Split (1)

train · 133k rows

text stringlengths 0 868k
Adrenal glands are a common site for metastatic spread, with autopsy studies documenting their presence in 27%-38% of all fatal malignancies . Various primary tumors can metastasize to the adrenal glands; approximately 50% of melanomas, 30%-40% of breast and lung cancers, and 10%-20% of renal and gastrointestinal tumors involve this site during their natural history . Adrenal gland metastases rank fourth, worldwide, after lung, liver, and bone metastases . Although clinically occult in most cases, their diagnosis is becoming more common with the technological improvement of diagnostic tools and the strict follow - up schedules for such cancer patients . Therefore, the diagnosis of adrenal metastases is often made at a very early stage, with most patients still in an oligometastatic state . The oligometastatic state is a disease state intermediate between loco - regionally confined and widely metastatic cancer . Increasing evidence from the literature suggests that selected patients with oligometastases may remain in a disease - free status for more than a decade if treated with an aggressive combined - modality therapy, including both systemic and local approach . Due to the absence of prospective trials and the paucity of retrospective series, the best evidence suggesting a survival advantage from local treatment of adrenal metastases can be derived from retrospective case - control studies comparing adrenalectomy plus systemic therapy versus systemic therapy alone . Each study found significantly prolonged median overall survival (os) in the adrenalectomy patient arm; however, patient selection likely played a pivotal role [6 - 8]. Adrenalectomy is currently the most frequent treatment approach . In a meta - analysis of 114 patients with non - small cell lung cancer undergoing resection of adrenal metastases, 5-year os was 25%-26%, confirming that there can be long - term survivors in a selected group of patients . Although the surgical approach can be considered as a gold standard, it is not free from severe complications, including infections (3.8%-12%), myocardial infarction (2%), ileus (7%), and even death (2%), and the contraindications to a surgical approach, including age or other comorbidities, remain a significant limitation . Several alternative approaches have been explored in recent years, including radiofrequency ablation (rfa) or trans - arterial chemoembolization . However, longer median survival and os times were demonstrated with resection of clinically isolated adrenal metastases when compared with non - surgical therapy, including rfa, external beam radiotherapy, arterial embolization, radio - embolization, bland embolization, chemical ablation, and cryo - ablation . The role of radiotherapy (rt) has historically been limited to a palliative intent . However, recent technological improvement with the introduction of stereotactic body radiation therapy (sbrt) increased the competitiveness of this local ablative treatment . Sbrt enables the delivery of very high doses of radiation to tumor cells in a few fractions, while sparing the surrounding healthy tissues . This feature is particularly important in an anatomical area like the abdomen, where the normal tissue dose - volume constraints limited the efficacy of rt for years . Dose escalation with sbrt is possible and results in outcome data comparable to that achieved with surgery . The aim of the current study is to report on the treatment outcome of patients treated with sbrt with volumetric modulated arc therapy (vmat) for adrenal gland metastases, with special focus on local control, toxicity, and survival . Between 2011 and 2015, 46 patients with adrenal gland metastases were treated with sbrt in our institute . Data collection and the analysis for an observational retrospective study were approved by the institutional review board based on an analysis of charts . The inclusion criteria for the sbrt treatment were as follows: age greater than 18 years, world health organization performance status 2, histologically - proven primary cancer disease, m1 stage with primary cancer radically treated with complete or stable response, a maximum of five metastases, a lesion diameter <5 cm, no previous radiation treatment or surgical intervention in the region . Free breathing 4d computed tomography (4dct) scans with 3-mm slice thickness were acquired for treatment planning in supine position, with the patient s arms above the head . Thermoplastic chest masks with abdominal compression (made with the insertion of styrofoam blocks under the mask in correspondence with the diaphragm) were constructed to improve the patient immobilization and reduce the motion of internal organs . The clinical target volume (ctv) included the metastases mass as identified on the computed tomography (ct) images . Set - up margins were added with an isotropic expansion of 5 mm from the envelope of the ctv volumes reconstructed in all phases of the 4dct . The organs at risk (oar) defined included the stomach and the duodenum, the small bowel, the liver, the spinal cord, and the kidneys . The dose prescription was 40.0 gy in four daily fractions of 10 gy (mean dose to ctv) for all patients . This prescription is a dose escalation from the earlier regimen of 45 gy in six fractions of 7.5 gy reported in the feasibility study . The planning objectives for the ctv were v98%> 98% and the minimization of the near - to - maximum dose (d1%). For ptv the coverage requirement was relaxed to v95%> 90% and possibly further reduced for individual challenging cases . For the oars, beside a general request for minimization of the mean and the near - to - maximum doses, the following explicit objectives were considered: (1) liver: total liver volume, v15gy> 700 cm; (2) spinal cord: d1% <18 gy; (3) kidneys (ipsilateral): v15gy <35%; and (4) duodenum: d1% <of vmat on a truebeam linear accelerator (varian medical systems, palo alto, ca) selecting the flattening filter free photon beams of 6 or 10 mv with a dose rate of 1,400 or 2,400 mu / min respectively to minimize the treatment time . The treatment plans were optimized using the eclipse system ver.11 (varian medical systems). The daily patient set - up was controlled using 3d cone beam ct images compared against the reconstructed image from the 4dct planning scans . Further details regarding the planning procedure and the dosimetric features of the treatment can be found in the feasibility investigation report published earlier . The clinical outcome was evaluated during the periodic follow - up visits; ct scans were acquired at 1 month after treatment and then every 3 months . For a group of 14 patients (30%), a positron emission tomography scan was performed using f - fluorodeoxyglucose 6 months after the end of treatment . The radiological response was defined according to the response evaluation criteria in solid tumors criteria and reported at the time of the maximal response . Descriptive statistics was used for characterization of the cohort data . The local control (lc) and os rates were computed using the kaplan - meier analysis and univariate analysis performed using log - rank tests . The variables tested were age, sex, performance status, laterality, primary tumour histology, solitary metastasis versus oligometastatic status . 22 (ibm corp ., armonk, ny) was used for the tests . The median follow - up period from sbrt was 7.6 months with a mean of 11.3 months . 1 shows the dose distribution (in color - wash) for one typical patient from the cohort in the axial, sagittal, and coronal planes . The analysis of the dose volume histograms (dvh) from the treatment plans reporting the dosimetric parameters subject to planning objectives for the various structures is summarized in table 2 . 2 shows the average dvh for the targets and the oar (solid line); the interpatient variability is represented at 1 standard deviation by the dashed lines . Each line in the table reports one dose - volume constraints used for the optimization of the treatment plans while each column reports the means observed for the various oar or target volumes for which the constraint was applied . For liver and kidneys, the data are reported only for the ipsilateral organ with respect to the treated lesion . The planning objectives were met for all patients . At the last follow - up, 42 patients (91.3%) were alive, four patients (8.7%) died because of the disease . The crude local response resulted in 15 patients (32.6%) with complete response, 21 patients (45.6%) with partial response or stable disease, and 10 patients (21.7%) with local progression of the disease . Considering only the subgroup of patients with primary lung tumor, an overall benefit rate of 86.6% the four patients (13.3%) experiencing progression of the disease during the follow - up period were affected by lung adenocarcinoma (n=2) and small cell lung cancer (n=2). While the first two were still alive at the time of the analysis, the latter died because of the disease . Progression of metastasis after treatment was also observed in one patient affected by neuroendocrine carcinoma of the prostate and urothelial carcinoma of the bladder . Accounting for the group of 20 patients with solitary single metastasis in the adrenal gland without other sites of disease, local progression of the disease was observed in five patients with a mean period of 6.7 months . On the contrary, new sites of distant metastasis appeared in 11 cases (55%) with a mean period of 5.2 months . Seven out of 20 patients (35%) were free from disease at the time of the analysis, two (10%) with only disease in the adrenal gland . Twenty - six patients (56.5%) had more than one metastasis at the time of treatment; all patients benefitted from sbrt but two showed local progression after 9.1 and 11.3 months . Distant progression was observed in 27 patients (58.7%) with new metastases identified in other organs after sbrt treatment for the adrenal localization . The sites of distant progression included the lungs in 13 patients (48%), the liver in five patients (19%), the bones in four patients (15%) plus other localizations (e.g., brain, pelvic nodes, and bladder) with lower incidence . All four patients who died presented distant progression but only one also presented with local progression . The actuarial mean os was 28.51.6 months (95% confidence interval [ci], 25.4 to 31.6), median was not reached . The actuarial mean lc was 14.61.8 months (95% ci, 11.0 to 18.2) and the median lc was 14.52.0 months (95% ci, 10.5 to 18.5). The 1-year and 2-year lc were 65.511.9% and 40.715.8%, respectively . In this case, no risk factors were distinguished among the subgroups of patients . Two patients reported asthenia, six patients (13.1%) reported either pain, nausea, or vomiting . Of these six patients, five (10.9%) were scored as grade 1 toxicity while one (2.2%) was scored as grade 2 . Although metastases to the adrenal glands are common, optimal management is still uncertain as clinical evidence is limited . A systematic review was recently published on the role of surgical and ablative therapies for oligometastatic patients with adrenal metastases . The analysis demonstrated 2-year os rates in favor of surgery compared to sbrt (44% vs. 19%); however, the authors stressed that this difference in survival might be limited by several factors . First, the patient s selection was biased by performance status, co - morbidities, and uncontrolled extra - adrenal disease . In fact, operated patients are commonly characterized by better condition and fewer comorbidities, while extra - adrenal disease was more common in the sbrt group compared to the surgery group (52% vs. 25%). In addition, the most common primary tumor in the sbrt series (68%) was in the lung and metastatic lung disease has a worse prognosis than other malignancies . So far, rt has been regarded as a palliative care or a last chance care . Another weak point against radiotherapy is the heterogeneity of the prescription doses and fractionation regimens . Indeed, even if high doses can be administered in a few fractions sparing the most relevant oars with sbrt, it is still unclear which one is the best schedule . To the best of our knowledge, the current report is the only one with consistent dose and fractionation . For all patients a total dose of 40 gy in four fractions of 10 gy each was delivered, representing a biological effective dose (bed10) of 80 gy . ; however, the schedules used by this group were quite heterogeneous, because single fraction and multi - fraction stereotactic radiotherapy were included . The dose range varied from 21 to 54 gy, reaching a median bed10 of 137.3 gy . The authors showed an actuarial lc rate of 90% at 2 years but an os of 14.5% . Treated a smaller sample; bed10 varied from 22.4 gy (16 gy in 4 fractions) to 75 gy (50 gy in 10 fractions) and the 1-year os and lc were 44% and 55%, respectively . Considering the results of these two studies with an acceptable number of cases, and comparing them with the current data, it is clear that bed10 influences the lc . In fact, a bed10 greater than 100 gy is an important parameter to obtaining good control of disease; a bed10 of 80 gy results in an interesting but still unsatisfactory lc . The os reported in our sample was the highest among the studies in the literature (87.6% at 1 and 2 years); however, this outcome can be influenced by the percentage of primaries included in the analysis . A summary of the most relevant studies reporting on sbrt treatment of the adrenal gland, including the current one, is shown in table 3 . In terms of toxicity the compliance with treatment was optimal and the most common side effects were mild asthenia, nausea, and vomiting (grade 1 or 2); no grade 3 or 4 toxicities were observed . Several studies on surgical approaches were also published . In a recent study by romero arenas et al . Analyzing the benefit of adrenalectomy in the management of adrenal metastases, the median os was 2.46 years and the 1- and 3-year survival were 70% and 40%, respectively . Complications were not infrequent in this group, both intraoperatively (e.g., bleeding, pneumothorax, and superior vena cava syndrome) and postoperatively (e.g., nerve injury, hematoma, and prolonged ileus). Even if the selection of the patients as candidates for surgery is not well established, this approach can preferably be reserved to smaller organ - confined lesions with no apparent involvement of the adrenal capsule or vascular pedicle . Modern techniques of radiotherapy, such as vmat, enable highly precise and rapid treatments respecting the dose constraints for all organs close to the affected gland . Although retrospective, our analysis on a homogeneous group of patients confirmed the promising local control rates achievable by means of sbrt with vmat for adrenal metastases . The dose escalation applied in this study, compared with the feasibility phase, enabled management of the entire treatment within one single week with good compliance from the patients and minimum distress induced by the small number of fractions . No endocrinology assessment was performed so far, this evaluation will be included in a prospective trial, which could also help to confirm the optimal dose in a larger number of patients . Treatment of adrenal gland metastases with vmat based sbrt is consolidating and the results in terms of control of disease, survival, and toxicity confirm the efficacy of the approach.
About 30 years ago, methyldopa and penicillin were the two medications most commonly associated with drug - induced autoimmune hemolytic anemia (diiha). Methyldopa and intravenous penicillin accounted for 67% and 25%, of all drug - induced immune hemolytic anemia, respectively . Currently, most cases of diiha are attributed to second- and third - generation cephalosporins, most commonly ceftriaxone, and this drug has become the most common cause of antibiotic - induced hemolysis . We present a case of diiha following ceftriaxone use, managed successfully with withdrawal of the drug and supportive measures . Since this antibiotic is widely used by clinicians across all specialties, it is important to be aware of this possibility to enable us to make an early diagnosis . A 60-years - old lady, with no past history of any drug allergies, presented with fever and productive cough of five days duration . Clinically, she had fever, tachycardia, tachypnea with crackles in the right mammary area . X - ray chest confirmed pneumonia in the right middle zone [figure 1]. On admission, her investigation were as in [table 1] x - ray chest of the patient showing consolidation in right middle zone laboratory parameters of the patient suffering from ceftrixone - induced hemolysis a diagnosis of community - acquired pneumonia was made, and patient was started on intravenous ceftriaxone one gram 12 hourly . Her hemoglobin dropped down to 7.5 g / dl within 24 hrs and further to 5.5 g / dl after 72 hrs, with peripheral blood smear showing marked polychromasia with three nucleated red cells per 100 white blood cells, schistocytes, a corrected reticulocyte count of 4.0% and ldh of 1221 units / l . Serum bilirubin rose to 2 mg / dl with indirect of 1.5 mg / dl . A diagnosis of ceftriaxone - induced aiha was made, and the drug was stopped immediately . Two units of packed red blood cells were transfused as she had symptomatic anemia, her hemoglobin increased to 8.6 g / dl and thereafter to 9.8 g / dl at discharge, after two weeks with no further deterioration . Ceftriaxone - induced urticaria, rash, exanthem, and pruritus are the most common adverse effects and occur in about three percent of patients . The first case of hemolysis induced by ceftriaxone was reported in 1991 by garratty et al . In a 52-year - old woman who was treated with ceftriaxone . This was the first case of immune hemolytic anemia associated with ceftriaxone, and also the first case of fatal cephalosporin - induced hemolytic anemia . Thereafter, in 1995, a case report of a 24-month - old boy with sickle cell disease who had cardiac arrest and died 36 hours later from multiple organ failure after starting ceftriaxone . Another case of a 16-year - old girl was reported in 1999 who had developed ceftriaxone - induced intravascular hemolysis leading to acute renal failure and death . Drug - dependent antibodies (antibodies react in vitro with rbc's, only in presence of drug) are produced by antibiotics like ceftriaxone and pipercillin . These drugs attach to rbc, but do not bind covalently to rbc membrane proteins . Combination of drug and antibody creates an immunogen, which activates complement and results in acute intravascular hemolysis . Drug - independent antibodies (drug not required to be present to detect antibodies in vitro) are produced by drugs as fludarabine, methyldopa, and penicillins . These drugs combine covalently with rbc membrane proteins, and the antibody - coated rbc are taken up by macrophages . Ceftriaxone - induced aiha, though rare, can be fatal if not thought of . It needs high index of clinical suspicion in patients treated with ceftriaxone who develop sudden drop in hemoglobin, hemoglobinuria, and evidence of hemolysis in peripheral blood smear . Beta lactam antibiotics should be used with caution in patients who have history of adverse effects to ceftriaxone because of cross reactivity . According to the world health organization (who) system of causality definitions, the adr (adverse drug reaction) in this reported case is categorized as probable with naranjp algorithm score of six, as the patient developed hemolysis after intravenous administration of ceftriaxone . There was no other possible cause of hemolysis as no other drug was used with ceftriaxone . Rechallenge was not done due to inherent risk involved, but the patient showed improvement after stopping the drug . Though drug - induced autoimmune hemolytic anemia is a rare adverse reaction, they may be fatal in some cases.
Kaposi s sarcoma (ks) is one of the malignancies that is most seen in hiv - positive or immunocompromised patients . The use of immunosuppressant drugs is also associated with the risk of developing ks, especially in kidney transplant patients.1 immunosuppressant drugs may also enhance the risk of ks in other patients . In 1981, leung et al . Described the first case of steroid induced ks in a temporal arteritis patient after 6 months of prednisolone therapy.2 a 65-year - old kashmiri male from a rural area presented with a 1-year history of multiple violaceous skin lesions and dependant edema of lower extremities . The patient s history included bilateral knee pain for which he had been receiving oral and injectable corticosteroid (in a dose varying from 540 mg / day) for the previous 8 years . The patient s history included 3 episodes of melena one year prior to presentation and mild hypertension for the previous year, possibly steroid - induced . There was no history of fever, cough, chest pain, breathlessness, hemoptysis, stiffness or swelling of joints or convulsions . Physical examination revealed multiple small, discrete, violaceous patches, plaques and nodules distributed bilaterally over the lower and upper extremities with scattered lesions over the shoulder and buttocks (figures 1, 2, 3). Some of the small papules and nodules had coalesced to form large plaques (figure 2). Most of the lesions were non - scaly and non - blanching, and they did not bleed on pinprick . Some of the lesions were tender . . Mucous membrane of the oral cavity showed characteristic patches on the hard and soft palate (figure 4). Penile mucosa showed purple plaques, and anal mucosa showed two small pink patches on the left lateral wall . Laboratory studies, including a complete blood cell count, urinalysis, liver function tests, kidney function tests, blood glucose, electrolytes and coagulogram, were within normal ranges . The serological tests for syphilis and human immunodeficiency virus (hiv) were negative or nonreactive . Chest radiography, ultrasonography of abdomen and computed tomography (ct) of chest and abdomen were normal . Proctoscopy and colonoscopy showed 1 hemorrhoid at 12 oclock position and two small pink patches at the lateral wall of anus . Histopathologic examination of skin biopsy from one of the patches (figure 5) showed neovascularization of the entire dermis with small irregular vascular channels intercommunicating and surrounding preexisting normal vascular channels . These neovascularised channels were of capillary nature with incomplete walls and showed extravasation of red blood cells . Section from a nodule (figure 6) showed fascicles of spindle cells with interweaving free red cells . On immunohistochemistry, the tumor cells were positive for cd31 (figure 7) and cd34 . Hhv-8 stain showed weak granular positivity . After confirming the diagnosis of ks by biopsy and immunohistochemistry, the patient was treated with 7 courses of systemic chemotherapy of pegylated liposomal doxorubicin, 40 mg / m, administered every 2 weeks over a 4-month period . There was a significant decrease in the edema of his legs and flattening of the ks lesions after the fourth course of chemotherapy . A 65-year - old kashmiri male from a rural area presented with a 1-year history of multiple violaceous skin lesions and dependant edema of lower extremities . The patient s history included bilateral knee pain for which he had been receiving oral and injectable corticosteroid (in a dose varying from 540 mg / day) for the previous 8 years . The patient s history included 3 episodes of melena one year prior to presentation and mild hypertension for the previous year, possibly steroid - induced . There was no history of fever, cough, chest pain, breathlessness, hemoptysis, stiffness or swelling of joints or convulsions . Physical examination revealed multiple small, discrete, violaceous patches, plaques and nodules distributed bilaterally over the lower and upper extremities with scattered lesions over the shoulder and buttocks (figures 1, 2, 3). Some of the small papules and nodules had coalesced to form large plaques (figure 2). Most of the lesions were non - scaly and non - blanching, and they did not bleed on pinprick . Mucous membrane of the oral cavity showed characteristic patches on the hard and soft palate (figure 4). Penile mucosa showed purple plaques, and anal mucosa showed two small pink patches on the left lateral wall . Laboratory studies, including a complete blood cell count, urinalysis, liver function tests, kidney function tests, blood glucose, electrolytes and coagulogram, were within normal ranges . The serological tests for syphilis and human immunodeficiency virus (hiv) were negative or nonreactive . Chest radiography, ultrasonography of abdomen and computed tomography (ct) of chest and abdomen were normal . Proctoscopy and colonoscopy showed 1 hemorrhoid at 12 oclock position and two small pink patches at the lateral wall of anus . Histopathologic examination of skin biopsy from one of the patches (figure 5) showed neovascularization of the entire dermis with small irregular vascular channels intercommunicating and surrounding preexisting normal vascular channels . These neovascularised channels were of capillary nature with incomplete walls and showed extravasation of red blood cells . Section from a nodule (figure 6) showed fascicles of spindle cells with interweaving free red cells . On immunohistochemistry, the tumor cells were positive for cd31 (figure 7) and cd34 . Hhv-8 stain showed weak granular positivity . After confirming the diagnosis of ks by biopsy and immunohistochemistry, the patient was treated with 7 courses of systemic chemotherapy of pegylated liposomal doxorubicin, 40 mg / m, administered every 2 weeks over a 4-month period . There was a significant decrease in the edema of his legs and flattening of the ks lesions after the fourth course of chemotherapy . Kaposi s sarcoma (ks) typically involves the skin and manifests as violaceous lesions that enlarge from patches to plaques and nodules . Four types of ks are recognized: classic ks, hiv - related ks, african endemic ks and iatrogenic ks.3 classic ks occurs in elderly men involving the skin of lower extremities and is indolent . Iatrogenic ks occurs in individuals who are immunosuppressed because of organ transplantation and tends to be aggressive.4,5 excess use of immunosuppressive drugs (including corticosteroids) has also been associated with high prevalence of iatrogenic ks.6,7 onset of the disease after administration of the triggering drug in previously reported studies ranged from less than one month to more than 20 years . There is no evident correlation between the development of ks and dose or duration of steroid therapy.7 in vitro evidence supports the hypothesis that glucocorticoids have a direct role in stimulating tumor development and growth . They cause upregulation of kaposi cell proliferation and the activation of hhv-8.8 chang et al . First reported a link between hhv-8 and ks in 1994.9 the virus was found in more than 90% of ks samples from hiv sero - positive patients, but it had low prevalence in healthy controls . Dna persists in endothelial cells and spindle cells of ks.10 furthermore, hhv-8 virus alone is not sufficient to cause ks, but it may be an important cofactor in the development of disease.11 hhv-8 has been isolated from all types of ks lesions, including corticosteroid induced ks.12 treatment modalities comprise local therapy for - example surgery, radiotherapy and local chemotherapy such as injections of vinca alkaloids or local immune therapy by interferon, 9 cis retinoic acid or imiquimod . Patients with extensive skin or mucosal lesions may need chemotherapeutic agents.13 positive results have been found for pegylated liposomal doxorubicin, danaurabucin, paclitaxel and interferon-.14 in patients with iatrogenic ks, immunosuppressive medication may be reduced or modified with the considerate possibility of grafts being rejected with insufficient immunosuppression.4 although corticosteroids act to induce or trigger the disease, it is only in the case of the autoimmune diseases that ks resolves after suspension of treatment with corticosteroids.7 our patient is an elderly male who had received oral steroids for the past 8 years in a dose varying from 540 mg per day . He developed typical ks lesions in the skin of lower extremities and other parts of his body . After stopping corticosteroids, our patient showed good response to the pegylated liposomal doxorubicin chemotherapy . To the best of our knowledge, this is the first case of steroid induced kaposi s sarcoma to be reported from kashmir valley and adds one more case to the rare entity, steroid - induced kaposi s sarcoma in non - hiv patients with significant mucous membrane involvement.
A variety of investigations are available for imaging the common bile ducts (cbd) before laparoscopic cholecystectomy (lc), and none has been accepted as gold standard . The guidelines were reasonably well established regarding the management of common bile duct stones in the era of open cholecystectomy . With the development of preoperative ercp, when many bile duct stones can be confirmed and treated, the situation has changed, and there is ongoing debate about a rational method of investigation of the bile ducts before laparoscopic cholecystectomy . There are arguments for and against each modality of investigations, eg, preoperative ercp, intravenous cholangiogram (ivc), ultrasonography (uss), and routine use of peroperative cholangiogram (poc). Routine poc has been advocated to demonstrate the biliary anatomy and to demonstrate unsuspected bile duct stones . We present a personal series of 700 laparoscopic cholecystectomies in the 7-year period between 1991 - 1998 where we have adopted a policy of not performing routine peroperative cholangiography . . Prospective analysis of all the patients was carried out with the help of meticulously filled proformas and clinical notes . Investigation of bile ducts was by combination of history of jaundice, cholangitis and gallstone pancreatitis, lfts and ultrasound evidence of dilated cbd . The first 215 patients underwent routine preoperative ivc in the initial period of the series . Preoperative ercp was performed in 78 patients based on clinical his - tory, abnormal lfts and/or dilatation of biliary tree on ultrasound . Selective peroperative cholangiogram (poc) was performed in 42 patients because of failed ercp or slightly abnormal lfts . We have presented our results with regard to conversion rate, morbidity, mortality, management of complications and incidence of retained stones . The total number of operative complications was 12 (1.71%), and the total number of laparoscopic cholecystectomy related complications was 15 (2.14%). Out of 13 patients who had bile leak, four needed laparotomy and drainage, and two were treated conservatively . The remaining seven patients who had localized bile collection were treated by ultrasound - guided insertion of a pigtail catheter . A single case of biliary stricture was referred to a hepatobiliary unit where roux - en - y hepaticojejunostomy was performed . One of them was after a bile leak, and the other two were due to associated severe cardiorespiratory diseases . Bile duct stones were demonstrated in four patients, and in two patients they were retrieved laparoscopically . Another two patients required open bile duct exploration, and four patients who had an operative cholangiogram developed bile leak (9.5%)., it was carried out to retrieve the stone from the cbd, and this was the only case in a series of 700 patients . In two patients, it was performed to place the stent in the cbd following bile leak . In the remaining one patient, an ercp was performed as there were abnormal lfts in the postoperative period, but the ercp did not demonstrate any abnormality . Standard method of investigation of bile ducts before laparoscopic cholecystectomy is still controversial . In the early days of our experience, it was a routine practice to perform intravenous cholangiogram in all the patients before laparoscopic cholecystectomy . This was mainly due to the fact that insufficient data was available about the investigation of bile ducts before laparoscopic cholecystectomy . It also seemed ivc was helpful in delineating the anatomy of the biliary tree and indicating the possibility of cbd stones . After initial experience, we found that a large majority of patients had normal ivc's if there was a negative clinical history and normal lft's and uss . This made us abandon the ivc as preoperative investigation of the biliary tree and adopt the policy of selective peroperative cholangiogram (poc) if there was minor alteration in the criteria of common bile duct stones . The other argument in favor of routine poc is that it provides a radiological picture of the anatomy of the biliary tree . But there are reports suggesting that the majority of biliary injuries occur due to the surgeon misidentifying the anatomy . With the policy of extremely careful dissection of calot's triangle and adherence to the rule not to ligate or divide any structures until the anatomy of calot's triangle is clearly defined, we believe that we can avoid relying on routine radiological imaging as a guide . The number of preoperative ercp's is 78 (11.14%), similar to other reported series, which is between 7 and 12% . This was based on the criteria of clinical history of jaundice, cholangitis and gallstone pancreatitis, abnormal lft's suggesting biliary obstruction and/or dilatation of the biliary tree on ultrasound . Selective peroperative cholangiography under fluoroscopy control was performed in 6% of patients, which is low compared to other series where an aggressive policy is adopted and routine poc is carried out in all laparoscopic cholecystectomies . We performed poc's only in those patients where ercp was unsuccessful or where there were minor abnormalities in the above - mentioned criteria . There was a 9.5% incidence of complications in this series, highlighting the risks involved in routine poc's . Routine poc does not appear to decrease the absolute incidence of biliary injuries but it reduces the sequelae . There are also reports that in comparison to selective poc's, routine poc did not increase the detection of common bile duct stones . If poc is not performed, the incidence of unsuspected cbd stones during cholecystectomy is 4% to 6% . With the selective use of preoperative ercp and poc, the majority of these patients are identifiable, and our series has shown that there was only one patient with retained stone . The other contributing factor for the very low incidence of retained stones in this series may be due to either spontaneous passage of cbd stones in the postoperative period or they have remained asymptomatic . In laparoscopic cholecystectomy, a policy of selective preoperative ercp and not routine peroperative cholangiogram has been found to be cost effective, reduce the time of operations and is associated with low morbidity, mortality and is not associated with a significant incidence of retained bile duct stones or bile duct injuries.
Since 1992, when the vasopressin v2 receptor gene (avpr2) sequence that codes for the v2 receptor (v2r) was first described, more than 200 mutations in the avpr2 have been found in patients presenting with x - linked congenital nephrogenic diabetes insipidus (cndi) [2, 3]. Functional studies of these mutant receptors have demonstrated a loss of function in the mutated protein that results in the insensitivity of the renal collecting duct to the action of the arginine vasopressin hormone (avp). This in turn leads to a defect in water reabsorption with polyuria, polydipsia, and hypernatremic dehydration . Recently, it was demonstrated that the v2r may be affected by gain of function mutations that cause a new syndrome: the nephrogenic syndrome of inappropriate antidiuresis (nsiad). This phenomenon has been observed for other g - protein - coupled receptors, for example, tsh (thyrotoxicosis), lh (familial male - limited precocious puberty), pth - rp (bloom syndrome), and the calcium sensing receptors (hypercalciuric hypocalcemia). Nsiad was subsequently described in two infant boys presenting with seizures due to severe hyponatremia and high urinary osmolality, but low plasma avp levels . Avpr2 sequencing demonstrated that these two children harbored the arginine-137-cysteine (r137c) and arginine-137-leucine (r137l) mutations in their respective v2 receptors . Since 2005, when the disease was first described, all the nsaid patients presented in the literature have had one of these two avpr2 mutations [410]. Functional studies have shown that both mutations are responsible for a constitutive activation of the mutant v2r, leading to inadequate water reabsorption in spite of low avp levels [4, 11]. Nevertheless, the clinical presentations of these nsiad patients have been highly variable, with one of them showing severe neurological consequences, while others were fully asymptomatic with only a urine dilution defect revealed during water - load testing [5, 6]. Thus, patients may be diagnosed early in life or in adulthood, or they may remain asymptomatic . The diagnosis of nsiad thus should be systematically considered in cases of childhood hyponatremia, especially when associated with high urine osmolality . Avp is synthesized in the supraoptic and paraventricular nuclei and acts through three types of avp receptors: the v1a receptor (vasopressive effects of avp), the v1b receptor found in the adenohypophysis (acth secretion), and the v2 receptor (v2r) localized in the distal renal collecting duct . At the cellular level, avp - v2r binding initiates a cascade of events, with adenosine 3: 5-cyclic phosphate (camp) production through stimulated v2r coupling with the gs protein and the activation of adenylyl cyclase . Intracytoplasmic protein phosphorylation by camp - dependent protein kinase a therefore occurs, which leads to the exocytic insertion of aquaporin 2 (aqp2), a specific water channel, into the luminal membrane of the principal cells of the renal collecting duct, thereby increasing its water permeability . Under normal conditions, avp activation of the v2r also leads to phosphorylation of serine residues located in the c - terminal receptor tail with, secondarily, -arrestin recruitment and v2r internalization . This negative regulation of the v2r after stimulation by avp prevents prolonged and excessive tubular reabsorption of water . In nsiad, the constitutively active mutant v2r appears to lose this important property, at least partly, but by a mechanism that remains not fully understood . Functional studies of the r137c- and r137l - v2r mutants have shown that both mutants have increased basal camp production compared with the wt - v2r, confirming their constitutive activity [4, 11]. It has also been shown that their relatively low amplitude constitutive activities are only weakly sensitive to the action of a v2r - inverse agonist like the sr121463 compound . These data suggest that these mutant receptors are mainly in an almost blocked conformation and are consistent with decaux's observation that nsiad patients are insensitive to nonpeptide v2r inverse agonists . Nevertheless, it has also been shown that the relatively low avp - induced stimulation of both mutants is completely inhibited by v2r inverse agonists . Therefore, this latter finding suggests that, although these mutant receptors are more often in a blocked conformation, they can also adopt a more flexible conformation capable of a desensitization / internalization process . All patients diagnosed with nsiad to date have been boys and most diagnoses were made during the first two years of life . Most patients appeared to have a relatively clear phenotype with biological features initially suggesting a syndrome of inappropriate antidiuretic hormone secretion (siadh) with hyponatremia, low serum osmolality, and unexpectedly high urine osmolality, but low plasma avp levels . The main clinical features, seizure or irritability, appeared to be linked to the severe hyponatremia . During the neonatal period, boys bearing the mutated receptor seem able to enough dilute their urine and therefore avoid the risk of severe hyponatremia . Indeed, unless peculiar clinical conditions such as neonatal asphyxia, the physiological limitation in concentration capacity during the first weeks of life may protect them from excessive water reabsorption during this period . Reported the first kindred and showed that the male patients in this family had been diagnosed in adulthood and were doing well, suggesting that nsiad conditions may sometimes remain unrecognized until advanced age . The late diagnosis in such patients may also be explained by the drop in water excretion naturally observed in the elderly . The female carriers of this x - linked disorder were also clinically asymptomatic, but some of them demonstrated an impaired ability to dilute urine during a water - load test performed with 20 ml / kg of water . More recently, we reported another four - generation family with nsiad bearing the r137c - v2r mutation . In this family, indeed, one of the children had two episodes of seizures related to hyponatremia with low plasma avp level, when he was 10 months and 34 months . Both episodes occurred during the summertime when large amounts of water were given to this young boy to prevent dehydration . His older brother, also bearing the mutated v2r, lived in the same city and, as far as we know, had the same diet but remained fully asymptomatic . Unfortunately, a first cousin, also having the same avpr2 mutation, experienced several seizure episodes due to recurrent hyponatremia between 27 months and 5 years of age and eventually developed permanent mental retardation . A water - load test was performed in the asymptomatic male carrier (10 ml / kg water load) and the heterozygous females (20 ml / kg water load). The results showed that water loading in the hemizygous male carrier was characterized by persistent aqp2 urine excretion independently of concomitant vasopressin excretion . The female carriers displayed variable biological findings after water loading that can be explained by random x inactivation . Among all the family members explored, only the symptomatic hemizygous male exhibited all the expected signs under basal conditions: persistent aqp2 urine excretion, low output of highly concentrated urine, and low plasma and urine avp levels . His asymptomatic brother, bearing the same mutation, had low aqp2 excretion and normal urine output under basal conditions but displayed a total absence of downregulation of aqp2 excretion after a cautious 10 ml / kg water load . Concerning the plasma avp levels measured in these nsiad patients, most levels appeared to be low or undetectable in spite of hyponatremia and high urine osmolality . Nevertheless, in at least one case, it was shown that avp production can persist despite low plasma sodium and plasma osmolality . Thus, of the four siadh categories described, nsiad most often belongs to the d group with a low plasma avp levels, although it can also be grouped in category b, which is characterized by a measurable plasma avp level [8, 15]. The explanation for this persistent avp secretion found in some patients despite low plasma osmolality is not clear . Nevertheless, this residual and relatively low avp secretion should have only a weak action on the v2r mutants given their low affinity for avp and, mainly, the reduced camp production level observed after stimulation by avp . . When nsiad is suspected, the plasma sodium level, plasma and urine osmolalities, and plasma avp level should all be measured at the same time during the hyponatremic episode . The association of hyponatremia with relatively high urine osmolality and a low or undetectable plasma avp level is an indication for sequencing the avpr2 . In siblings, a water - load test can be performed in an asymptomatic boy but cautiously: for example, with only 10 ml / kg of water . In girls, a 20 ml / kg water - load test can help to determine their ability to dilute their urine, as this is variable in heterozygous females due to random x inactivation and will help in providing them with recommendations for water intake . Assessment of the concentration of the plasma von willebrand factor (vwf) antigen, which is known to be increased by avp stimulation of the so - called in symptomatic nsiad patients with hyponatremia, rapid management with fluid restriction and, if necessary, administration of 3050% oral urea solution, is necessary to avoid persistent or increased hyponatremia, which carries the risk of brain damage [9, 16]. In addition, hemizygous boys have to avoid massive water intake, as shown by the results observed during water - load testing . In these patients, caution is particularly important when environmental factors may encourage sharp rises in water intake (sports activities, during heat waves, in the summertime, etc . ). However, boys bearing the mutation are mainly at risk of developing severe hyponatremia during infancy when their water intake is mostly under parental control . In heterozygous females, the advice will depend on the results of the water - load test and will range from normal to cautious water or fluid intake . The prevalence of this recently recognized disease is difficult to determine in children, and adults . Although nsiad does not seem to have an early neonatal expression, the diagnosis should systematically be considered in infants, children and adults presenting with hyponatremia associated with high urine osmolality . In males,, a water - load test can be helpful in studying and advising female carriers . The treatment of symptomatic patients is based on fluid restriction and, if necessary, administration of an oral urea solution.
The way the human organism responds to stress can be positive, such as fast decisions and reactions when facing potential danger (fight or flight)1, 2 . This hormone is an essential corticosteroid which is involved in the restoration of homeostasis,4 but it can be harmful when the organism is exposed to frequent stress . Humans responsed to stress results by an increasing expression of adrenocorticotropic hormone (acth) and cortisol5 . Temporomandibular disorder (tmd) can be triggered by stress and is characterized by a variety of symptoms involving the masticatory muscles, temporomandibular joint and adjacent structures6, 7 . The research diagnostic criteria for temporomandibular disorders (rdc / tmd) is considered the most complete assessment tool for the classification of tmd (muscle disorder, joint disc alteration, arthralgia, arthritis and osteoarthrosis)8 . Myogenous tmd is the most frequent type and is commonly caused by an increase in muscle activity triggered by emotional stress9, 10 . A number of tools are available for the evaluation of tmd, such as electromyography (emg)11, since as individuals with this disorder exhibit hyperactivity of the masticatory muscles12 . Moreover, several authors have proposed a biopsychosocial model for the characterization of the multifactorial nature of tmd based on the close relationship between physical alterations and emotional wellbeing13, 14 . Andrade et al.15 evaluated salivary cortisol in young adults with tmd, diagnosed using the rdc / tmd, and found the young adults had significantly higher levels in comparison to a control group . They concluded that cortisol evaluation can be used to complement the diagnosis of tmd, since there was demonstrating an association between cortisol and psychological factors . However, jasim et al.16 measured salivary cortisol in individuals with a diagnosis of orofacial pain and found they showed no difference from relation to asymptomatic individuals . These findings suggest that the relationship between pain and adrenocortical activity is complex and merits further investigation using specific diagnostic tools . To test on the hypothesis of positive correlations among tmd severity, emg activity of the masticatory muscles and cortisol level, the aim of the present study was investigated the correlation of salivary cortisol levels with the activities of the masseter and anterior temporal muscles of patients with different degrees of tmd . A cross - sectional study was conducted after receiving approval from the human research ethics committee of the piracicaba school of dentistry, state university of campinas (brazil) under process number 120/2008 . Recruitment was performed through flyers distributed around the university campus soliciting the participation of women with tmd . The individuals who expressed interest answered a questionnaire with close - ended responses and were a briefly evaluated for conformity with the administered for the determination of women who met the eligibility criteria . The inclusion criteria were: the female gender, age between 18 and 40 years, a diagnosis of myogenous tmd based on the rdc / tmd, angle class i occlusion, and body mass index between 18 and 25 kg / m . The exclusion criteria were currently undergoing physiotherapeutic, dental or medicinal (analgesic, anti - inflammatory agent, muscle relaxant or vasoactive drug) treatment, oral lesions, preexisting disease, missing teeth, a history of facial trauma, mouth breathing and current smoking habit . Fifty - one of the 200 women screened met the eligibility criteria and were selected for the study . However, two volunteers were excluded due to blood contamination in the saliva samples used for the determination of cortisol level . Thus, the final sample was made up of 49 females . The rdc / tmd allows the classification of individuals with tmd into three groups: i) muscle disorder; ii) joint displacement; and iii) other joint conditions8 . Axis i is used for the clinical examination, which is performed by a single examiner and allows the evaluation of muscle and joint pain, mouth opening pattern, mandibular range of motion, joint sounds and pain sensitivity during mandibular movements or palpation of the temporomandibular joint and masticatory muscles . The fonseca patient history index was used to diagnose the severity of tmd and is an adequately valid, reliable method for identifying individuals with tmd that has been widely used in recent studies17,18,19 . This portuguese - language measure has 10 items, each with three response options: yes (scored as 10 points), sometimes (5 points) and no (0 points). The sum of the points for all items gives the overall score which is classified as follow: absence of tmd (0 to 15 points), mild tmd (20 to 45 points), moderate tmd (50 to 65 points) and severe tmd (70 to 100 points)17 . Saliva was collected between 8 and 9 a.m. for the determination of cortisol, since the time of the day exerts and influences on the concentration of the hormone . The volunteers were instructed not to brush or floss their teeth two hours before the exam to avoid gingival bleeding, which would contaminate the sample, not to eat or drink anything one hour before the exam, to remain at rest 30 minutes before the exam, and to rinse their mouths with water and mild gargling ten minutes before the exam . During the collection of saliva, the volunteers remained seated and were instructed to remove the cap from the salivett tube and place the cotton pad under the tongue for two to three minutes20 . The cotton was then placed back into the tube and the cap was put on again . The samples were frozen, placed in a proper receptacle in a polystyrene cooler with recyclable ice and sent to the laboratory for analysis21, 22 . The quantification of salivary cortisol is a reliable index of free cortisol in the plasma23, 24 . Saliva samples are obtained using a simple, non - invasive, stress - free method that is easily performed by untrained individuals25 . Surface emg was used for the evaluation of the electrical activities of the masticatory muscles . For this, a portable, battery - powered, eight - channel signal conditioning module (emg system do brasil) was used with a bandpass filter (frequency: 20 to 500 hz), an amplifier with a gain of 1,000 x, and common - mode rejection ratio> 120 db, a 12-byte analog - digital converter, and active surface electrodes with a pre - amplified gain of 20 . Following cleaning of the sites with cotton soaked in 70% alcohol26, self - adhesive, disposable surface electrodes were attached over the masseter and anterior temporal muscles bilaterally, with placement guided by the point of greatest volume during contraction and the direction of the muscle fibers identification of these points . For such, the volunteers were instructed to clench the teeth and palpation of the muscles was performed . The signal was captured during non - habitual chewing (isotonic contraction) for 10 seconds, maximum voluntary clenching (isometric contraction) for five seconds, and with the mandible in the physiologic rest position for 10 seconds . M parafilm which reduces the variability of electromyographic readings was placed between the premolars and molars27 . Each contraction condition was performed three times with a three - minute rest period between readings . The volunteers remained seated in a wooden chair with the back supported by the back of the chair, frankfurt parallel to the floor, eyes open, their arms supported on the thighs, and their feet parallel and in contact with the floor . A sliding window was used to scan the emg signals and the mean of the three readings was used for the calculation of the root mean square (rms) values, which were used in the data analysis . The data were normalized to the peak of the emg signal, which had the lowest standard deviation . For the evaluation of the right and left masseter (rm and lm) and anterior temporal muscles (rt and lt), the following activity index was used: [(rm+lmrtlt)/(rm+lm+rt+lt)100]28 . The results of this equation allow identifying the muscles that are predominant during than proposed activity . Negative values indicate greater activity of the temporal muscles, positive values indicate greater activity of the masseter muscles and a value of 0 indicates balance among the muscles . Spearman s correlation coefficients (r) was calculated to determine the strength of correlations among the variables, and values of r were interpreted as follows: 0 = no correlation; 0 to 0.3 = weak correlation; 0.31 to 0.6 = moderate correlation; 0.61 to 0.9 = strong correlation; 0.91 to 0.99 = very strong correlation; and 1 = complete correlation . The kruskal - wallis test was employed to determine whether the activity index differed among the different degrees of tmd severity . All data analyses and processing were performed with the aid of the bioestat program, version 5.3 (belm, pa, brazil). Table 1table 1.spearmans correlation coefficients for the electromyographic activities of the in masticatory muscles and the degree of tmd severityrestisotonic contractionisometric contractionlmltrmrtlmltrmrtlmltrmrtmild 0.360.50.460.440.070.210.010.010.010.130.080.05moderate0.230.180.150.360.030.060.040.010.110.370.080.04severe0.70.540.650.210.430.81 * 0.050.81 * 0.320.650.320.76*statistically significant difference p <0.05 displays the correlation coefficients for degree of tmd severity and emg activity under the different contraction analyzed . Moderate to strong correlations were found between severe tmd and emg activity for all of the contraction . The strongest correlations were observed in the group of women with severe tmd regarded the temporal muscles during isotonic and isometric contractions of the temporal muscle . statistically significant difference p <0.05 moderate to strong correlations were found between salivary cortisol and emg activities of the women with severe tmd (table 2table 2.spearmans correlation coefficients for the electromyographic activities of the masticatory muscles and salivary cortisol according to degree of tmd severityrestisotonic contractionisometric contractionlmltrmrtlmltrmrtlmltrmrtmild 0.360.370.130.340.180.300.140.260.170.140.180.35moderate0.010.070.330.030.250.330.150.180.090.080.140.24severe 0.670.570.170.030.350.610.420.610.71 * 0.670.64 * 0.46statistically significant difference p <0.05). statistically significant difference p <0.05 table 3table 3.median and interquartile interval (25 and 75%) of cortisol according to three degrees of tmd severity determined using the fonseca index (p <0.008, kruskal - wallis test; * p <0.05; dunn s post hoc test)mildmoderateseverecortisol (g / dl)25.39 (16.2875.07)116.7 (47.75191.3)250.1 (35.05317.7)statistically significant difference p <0.05 shows the correlation between cortisol and tmd severity . The correlation was positive and strongest (r = 0.70) for subjects with the hormone and severe tmd . statistically significant difference p <0.05 the activity index results show that the data on the activity index, during non - habitual chewing (isotonic contraction), the activity of the anterior temporal muscles was predominantly independently of the degree of tmd severity . During maximum voluntary clenching (isometric contraction), activity in the masseter muscles was predominant in the groups with mild and severe tmd, and slightly predominant in the group with moderate tmd . However, no statistically significant differences were found among the different degrees of tmd (mild, moderate and severe) (p> 0.05, kruskal - wallis test). Pinheiro et al.29 suggested that gender and age differences exert an influence on the occurrence of tmd . To minimize these influences, only women aged 20 to 40 years were recruited for the present study, as tmd is more prevalent in this gender and age range30 . Although it was despite methodological differences, the study most similar to the present investigation was conducted by ardizone et al . 11, who evaluated emg patterns in patients with different degrees of tmd severity, but using the helkimo index rather than the fonseca index, and found lower muscle activity in the group with severe tmd during maximum voluntary contraction . In contrast, muscle activity was greatest among the women with severe tmd in the present investigation . This difference in these results may be attributable to the data collection time, since ardizone et al . Cited evaluated maximum contraction for 15 seconds, which may have caused pain during the reading and consequently lower muscle contraction potential . The occurrence of hyperactive muscles in the present investigation is in agreement with the study of bodr et al ., who also reported an increase in activity of the masseter and temporal muscles of individuals with tmd31 . The activity index demonstrated the predominance of activation of the temporal muscles over the masseter muscles . Takemura et al ., reported that bruxism is one of the main triggering factors of myogenous tmd, which is characterized by constant involuntary contractions that can lead to a reduction in the ability of the masseter muscle to generate force32 . Thus, the temporal muscles assume on additional functions to compensate for the loss of masseter muscle strength, positioning the head of the mandible in the mandibular fossa (its main function) and generating force during mandible elevation movements33 . According to nielsen et al.34, the inversion of the activity of the temporal and masseter muscles during chewing is a compensatory mechanism for minimizing pain in a motor response in individuals with tmd, which is believed to be an adaptation by the elevator muscles of the mandible following the onset of tmd35 . According to lipp and novaes36, stress plays an important triggering role in various adverse health conditions, but is often not the causal factor, as an individual must have a predisposition to the condition in question . The higher cortisol levels among women with more severe tmd indicates that stress may have triggered more symptoms and at a greater frequency, as demonstrated by the fonseca index . The amount of circulating cortisol varies throughout the day, with higher levels in the morning and lower levels at night37 . Moreover, changes in the cortisol secretion patterns are associated with depression, psychological stress, trauma, fear, pain and physical exercise . Castro and moreira5 described the influence of physical and emotional stress on the secretion of acth, concluding that the response to stress affects feedback mechanisms and the circadian rhythm, which resulting in an increase in both acth and cortisol . Jones et al.38 investigated the correlation of salivary cortisol with tmd in 36 women and found that the women group proved to be heterogeneous, as part of the group exhibited hypersecretion of the hormone, while no difference was found between the remaining volunteers and the control group . In contrast, a moderate correlation was found between cortisol level and tmd severity in the present investigation (r = 0.467). Korszun et al.39 measured the cortisol level in the blood of 15 women with tmd, and 15 controls and found an increase in the cortisol level of the group with tmd, which is in agreement with the present findings . The authors cited concluded that irregularity in the production of the cortisol hormone may be caused by the perception of facial pain, and may in turn stimulate pain throughout the entire body . Individuals with tmd exhibit pain characteristics that may activate the sympathetic nervous system and the hypothalamus - pituitary - supradrenal axis, which regulates the reactions to stress . It should be pointed out that psychological factors may trigger physical symptoms, such as muscle tension, which may result from a poorly adapted response to psychological stress40 . According to borini et al.41, anxiety can exert an influence on emg readings of the masseter and anterior temporal muscles in healthy individuals . Moreover, bakker et al.42 state that the temporal muscle is more susceptible to emotional stress than the masseter muscle . Tsai et al.43 conducted an experiment in which emg activity of the masticatory muscles was increased significantly under a condition of induced stress . While induced stress was not employed in the present investigation, muscle activity increased proportionally with the increase of cortisol . Ruf et al.44 report similar findings in a study addressing the effect of non - experimental stress on the function of the masseter and temporal muscles in young adults without tmd . Experimental studies have demonstrated that stress factors can increase emg activity45, 46, leading to the hypothesis that the change in muscle pattern is a powerful triggering factor of orofacial disorders, which may explain the correlation found for the volunteers analyzed in the present study . Rissn et al.46 also report that emotions tend to provoke different physiological responses, as demonstrated by the greater emg activity in the upper portion of the trapezius muscle associated with negative stress at a supermarket check - out . The increase in cortisol, which is a hormone released in situations of stress, was concomitant with to greater muscle activity and tmd severity . Further studies with a larger number of volunteers should be conducted to allow a better definition of this relationship in order to support to the treatment of individuals with tmd.
Wide range of rigid video laryngoscope (vl) are available in the indian market today like mcgrath 5, glidescope, airtraq, kingsvision, truview evo2, cmac, pentax, vt - a100 and so on . The rigid vls are expensive compared with traditional laryngoscopes . The higher price, coupled with the high economic recession is leading to slower adoption of the more expensive rigid vl across the globe . The use of vls may, however, be of benefit in a teaching situation where novice practitioners can visualise the technique of a supervisor and vice versa . However, as with conventional laryngoscopy and with other airway devices, successful use of the vl requires skill and multiple uses to become proficient . Each vl offers different features such as video and still recordings, disposable or reusable blades, different battery types, ruggedness, different sizes of scopes and monitors . For the students to get accustomed with various vls, it is necessary to get oriented to various types of vl blades and the images which are seen on either the monitor or through the eyepiece of the respective laryngoscope being used . The best way to determine which vl is preeminent for novice is to try in his own hands from the various available vls and start using it on manikins, and then move to the cadaver lab and patients . These devices are effective in providing visualisation of difficult airways, but they have a long and difficult learning curve, with desertion by many prospective operators before they acquire competence . Unfortunately, the use of vl is associated with longer time to tracheal intubation compared with the traditional techniques which can be explained with the variable learning curves of practitioners . It is a known fact that visualisation of larynx is easy with all vls but negotiating the endotracheal tube through it into the larynx is difficult . The foremost thing to remember about these new ranges of laryngoscopes is that there is a definite learning curve with each instrument before one can master the art of intubation with that particular instrument . Despite the growing number of practitioners attempting to use vl in their everyday practices, only few training tools exist . The biggest limitation to the day to day use for vl in operation theatre is their cost factor and the most affordable vl available in a developing country such as india, is airtraq . Single use airtraq with disposable blades has to be used after adequate training, otherwise it wo nt be cost effective . For the institutional teaching purpose airtraq however, to make all the novices and practitioners learn the technique of intubation and to reach plateau of their learning curve quickly in vl, we have developed a cheap model of vl which is both cost effective and can also mimic various available vls / optical stylets in market . The training kit is prepared as below: first of all, a sheath of airtraq avant (regular size) is separated out [figure 1]. (one can also remove the square plastic portion of distal tip to avoid glare from endoscope's light - emitting diode (led) as shown by arrow in figure 1). Next we need to purchase a simple cheap flexible borescope (industrial / snake endoscope, figure 2). The camera portion of borescope is introduced into the sheath of airtraq avant on the same side where its ideal fibreoptics rests [figure 3]. Borescope / snake endoscope may have a universal serial bus (usb) cable (available up to 20 feet in length) which is plugged into a laptop and that gives power to the led and the camera . The borescope is then switched on and this whole assembly is introduced into the airway of the manikin, and various intraoral images can be seen and appreciated on its monitor / laptop . As we advance the model and visualise the larynx we need to stabilize the image of larynx on monitor's centre and then try to intubate through the side channel of airtraq sheath as shown in figure 4 . Borescopes / snake endoscopes snake endoscope passed through airtraq avant sheath endotrachial tube negotiating through the vocal cords as seen on screen a borescope is an optical tool used to view areas that would otherwise not be visible . A videoscope or video borescope typically utilises a charge - coupled device or complementary metal oxide semiconductor camera sensor, located at the tip of the borescope, to produce an image that is relayed to an external viewing device such as a liquid crystal display monitor . Similarly all the vls available in market today utilise video camera technology to visualise airway structures and facilitate endotracheal intubation . Thus, we can use the video technology of a borescope / videoscope for making a cheap model of vl . The purpose of this report is to describe an inexpensive model, which is similar in some extent to but not inspired by vividtrac vt - a100 . Its use can further be extended to mimic not only various vls but also newer optical stylets and so on . This whole vl model will cost around 5000 - 10,000 inr and can be used multiple times . The borescope / usb endoscope can be tried in the sheath of glidoscope, copilotvl and pentax vl and used similarly . The flexible borescope alone can be used to mimic other simpler instruments like stylet view (vustik), trachview, ms201 video laryngoscope and disposcopes which could be tried upon the manikin directly without the aid of any laryngoscopes or their sheaths . This may prove to be of great benefit to the novice who would like to master their intubation skills in different types of vl and thereby attain plateau of learning curve for various available vls . This model of airtraq can be inexpensive, easily created and qualitatively consistent with the original airtraq avant . It utilises off the shelf, current materials and items . A word of caution - the usb endoscope / borescope is not medically licensed as a clinical device for endoscopy . What has been demonstrated is for experimental and research development only and not for clinical use . The author here describes this model only for practice purpose on manikin and in cadaver labs and does not support in any way the use of this model on patients . Nowadays various vl manufacturing companies have come up with the idea of replacing the bulb from the macintosh and miller blades with similar usb endoscopes . This type of video usb laryngoscopes will have the added advantage over the newer vl in that they would both be cheap and will require no extra learning curve . Different types of cheap flexible snake endoscopes, which can be attached to the usb port of our android smart phones are available as shown in figure 5 and can be used as vl model on manikin for training purposes . Airtraq has now come up with monitor supporting bluetooth connectivity whereby the image can be transferred to i - phones, i - pad and personal computers . Hope that in near future some of the vl manufacturing companies will come up with similar idea and manufacture optical blades with blue tooth connectivity and the smart phones in our pockets can be used as monitors for them - a concept that can be called wifi videolaryngoscopy! Cheap models of different types of vl or optical stylets can be designed from simple and easily available borescope or video endoscope and can be utilised for attaining basic training for use of actual vls or optical stylets.
The amide bond is widely prevalent in both naturally occurring and synthetic compounds . It is increasingly important in pharmaceutical chemistry, being present in 25% of available drugs, with amidation reactions being among the most commonly used reactions in medicinal chemistry . There is considerable interest in the development of new approaches to direct amidation, and organizations such as the acs green chemistry institute pharmaceutical roundtable have indicated that amide bond formation is one of the most important reactions used in industry for which better reagents are required . Although there are a large range of reagents and strategies for amide bond formation available, few can really be considered ideal . Currently there is a focus on the development of novel, atom - economical, benign methods for amidation, and there have been many recent developments in this field . An important consideration here is the ease with which the reagent or catalyst can be separated from the resulting product . Direct thermal amide formation from amines and carboxylic acids has been reported using toluene as the reaction solvent or using radiofrequency heating under neat conditions, and this reagent - free approach is practical in many cases, but the substrate scope is quite limited . Alternatively, a number of metal - based catalytic systems have also been reported, with recent examples including the use of ti(opr)4, cp2zrcl2, and zrcl4 under strictly anhydrous dehydrating conditions . Boron mediated amidation reactions have attracted considerable attention, and boronic acids have been shown to be effective catalysts for direct amide formation from carboxylic acids and amines . In general, boronic acid catalyzed amidation reactions require the removal of water from the reaction either by a dehydrating agent such as molecular sieves or by azeotropic reflux . Stoichiometric boron reagents for amidation often require anhydrous conditions and/or an excess of either the acid or the amine, however . While many of these boron - mediated processes are promising, to date the substrate scope is limited to relatively activated systems . We have recently reported that simple borate esters are effective reagents for the direct synthesis of amides from carboxylic acids or primary amides . Although commercially available b(ome)3 was useful for amidation in some cases, the 2,2,2-trifluoroethanol - derived ester b(och2cf3)3 gave consistently higher conversions and was applicable to a much wider range of substrates . The use of b(och2cf3)3 as an amidation reagent is operationally simple, as the reaction can be carried out open to the air with equimolar quantities of acid and amine in a solvent in which most amines and acids are readily soluble (mecn). In all of the examples examined, the thermal background yield of amide was found to be low in comparison to that obtained in the presence of the borate ester . Herein, we report a method for the large - scale preparation of b(och2cf3)3 from readily available b2o3 and a full study of the scope and limitations of b(och2cf3)3 as a direct amidation reagent . We also describe its application to the formylation of amines by transamidation of dmf . Importantly, a solid phase purification procedure has been developed that enables the amide products to be obtained without aqueous workup or chromatography . In our initial work, we prepared b(och2cf3)3 by reaction of 2,2,2-trifluoroethanol with bbr3 at low temperature (scheme 1). However, bbr3 is somewhat expensive and can be difficult to handle because of the fact that it readily hydrolyzes on contact with moisture . The synthesis of b(och2cf3)3 has been previously reported from boric acid and from b2o3 . We found the latter procedure to be particularly straightforward on multigram scale . Simply heating a suspension of b2o3 in 2,2,2-trifluoroethanol for 24 h, followed by distillation, gave the borate ester in 3348% yield on 2550 g scale, and up to 28% of the trifluoroethanol could be recovered and recycled . Although this procedure is lower yielding in comparison to our original approach, b2o3 is considerably cheaper than bbr3 and the reaction is not particularly moisture - sensitive . The b(och2cf3)3 reagent can be stored at room temperature under inert atmosphere for at least four months without any observable deterioration . In order to explore different workup procedures and reagents, the amidation of phenylacetic acid with benzylamine was selected as a test reaction (table 1). After the amidation reaction, the reaction mixture contains the amide product, borate - ester derived byproducts, and potentially some unreacted amine and/or carboxylic acid . In our preliminary report, the amidation reactions were purified by acid and base washes to remove these impurities . Under our original conditions (2 equiv of borate, 15 h, 80 c), the reaction time could be reduced from 15 to 5 h with only a small decrease in yield (entry 2). We explored an alternative solid phase workup for the amidation reactions involving treatment of the crude reaction mixture with three commercially available resins (amberlyst acidic, basic and amberlite boron scavenger resins), followed by mgso4, and then filtration / evaporation (figure 1). This provided the amide product in a comparable yield and purity to the aqueous workup (entry 3). This procedure is more convenient for general use and could potentially be used to enable automation of the reaction . Trimethyl borate was effective for amidation (entries 4 and 5), but a longer reaction time was required in order to obtain a good yield . B2o3 itself showed low reactivity in the amidation reaction with only 15% yield after a 5 h reaction time (entry 6). Commercially available trimethoxyboroxine 1 is reported to be a stronger lewis acid than both b(ome)3 and b(och2cf3)3 but did not offer any significant advantage in the amidation reaction (entry 7). Interestingly, the reaction with 1 did not lead to comparable conversions even after a 15 h reaction time (entry 8). This may be due to the fact that 1 can more readily form oligomeric species such as b2o3 upon heating, and such species are much less active in the amidation reaction . It should be noted that the thermal reaction in the absence of any reagent gave only an 18% yield of the amide . In our preliminary communicaton we determined the thermal reaction yield for the 15 other amidation reactions studied to be <9% . This clearly demonstrates the importance of the borate ester in mediating the amidation reaction . The full scope of the amidation reactions was explored with a wide range of amines and carboxylic acids . To evaluate the amine scope, the preparation of phenylactetamides (figure 2, 2a2x) from phenylacetic acid was explored using our standard reaction conditions (2 equiv of b(och2cf3)3, mecn, 80 c). Primary amines including benzylamines (2a2d), simple aliphatic amines (2e) and even functionalized examples (2f2h) could be coupled in good yield . A range of cyclic secondary amines also underwent amidation efficiently, including several medicinally relevant examples (2i2 m). The hydrochloride salt of dimethylamine underwent amidation in good yield when two or more equivalents of the hydrochloride salt were employed (2n) in combination with 2 equiv of hnig s base . The acyclic secondary amine dibenzylamine showed poor reactivity, however (2o), and a significant quantity of the secondary n - benzyl amide 2a was obtained, indicating that partial cleavage of one of the benzyl units had occurred . Less nucleophilic systems such as anilines (2p2u) and tert - butylamine (2v) could also be coupled, but higher reaction temperatures were needed in some cases in order to obtain reasonable yields . Extremely unreactive systems such as 2-pyridylamine (2u) gave only very low yields of the coupling product and adamantylamine (2w) and 2-mercaptoaniline (2x) did not undergo amidation at all . All reactions were carried out at 80 c for 5 h, and the solid phase workup procedure was used unless otherwise stated . (a) aqueous workup procedure; (b) 80 c for 15 h; (c) 100 c for 15 h in a sealed tube; (d) purified by column chromatography; (e) from 1 equiv of me2nhhcl, 1 equiv of dipea; (f) from 2 equiv of me2nhhcl, 2 equiv of dipea; (g) from 3 equiv of me2nhhcl, 3 equiv of dipea; (h) 6% of 2a was also isolated; (i) 100 c for 24 h in a sealed tube . The preparation of n - benzylamides (figure 3, 3a3v) was explored using our standard conditions in order to evaluate the carboxylic acid scope . A range of n - benzyl-2-arylacetamides (2a, 3a3i) were obtained in very good yield including -substituted (3b) and heteroaromatic acids (3h). A simple aliphatic acid (3j) and n - boc sarcosine (3k) also underwent amidation effectively . Carboxylic acids with conjugated alkyne (3l) and alkene groups (3m3o) could be coupled efficiently, but more hindered examples required a higher reaction temperature (3n). More hindered aliphatic systems including trifluoroacetic acid (3p) and pivalic acid (3q) could also be coupled effectively by using a higher reaction temperature . Benzoic acids (3r3v) were also relatively unreactive and required higher reaction temperatures in order for reasonable conversions to be obtained . All reactions were carried out at 80 c for 5 h, and the solid phase workup procedure was used unless otherwise stated . (a) aqueous workup procedure; (b) 80 c for 15 h; (c) 100 c for 15 h in a sealed tube . The coupling of a selection of other combinations of acids and amines (figure 4, 4a4 g) was explored, and yields were generally consistent with our observations of the relative reactivity of amines / acids outlined above . Thus, aliphatic amine / acid combinations (4a4d) generally gave reasonable yields of the amide, even with fairly volatile components (4a, 4b). Less reactive picolinic acid underwent amidation in relatively good yield with glycine methyl ester (4e). The reaction of a fairly nucleophilic aniline with an unsaturated acid also proceeded in good yield (4f). Pleasingly, we were also able to prepare paracetamol (4 g) in moderate yield by coupling acetic acid with 4-hydroxyaniline . Interestingly, monoamidation of a dicarboxylic acid could also be achieved in 53% yield (4h). In the majority of cases, the amides 24 could be purified by the solid phase workup procedure, with the exception of amides containing strongly basic (2i, 2j, 2 t, 2u, 4e) or acidic (4h) groups, which generally required chromatographic purification . All reactions were carried out at 80 c for 15 h and purified by solid phase workup unless otherwise stated . (a) aqueous workup procedure; (b) 80 c for 5 h; (c) purified by column chromatography . The background reaction for formation of six- (5a) and seven - membered (5b) lactams from simple thermal condensation was low in comparison to that observed in the presence of b(och2cf3)3 . Lactamization of boc - l - ornithine (5c) proceeded in 84% yield . All reactions were carried out at 80 c for 5 h unless otherwise stated and purified by solid phase workup . (a) yield without b(och2cf3)3; (b) 100 c for 5 h in a sealed tube; (c) 80 c for 15 h; (d) []d25 9.5 (c 1.22, meoh) [lit . []d20 10.6 (c 1.22, meoh)]. To evaluate the amidation reaction on larger scales, both a secondary (4c) and a tertiary amide (2k) were prepared using gram quantities of material (scheme 2). Although in both cases a slight reduction in yield was observed, more than 1 g of each amide could be synthesized in less than 15 ml of mecn . In each case, the product was purified using the solid phase workup, without the need for aqueous workup or column chromatography . For comparison, the same reaction to give 1 g of 4c using a boronic acid catalyst would require ca . The amidation of carboxylic acids bearing a chiral center at the -position is of high importance, and the coupling of -amino acids is of particular significance . While there are many methods for achieving such couplings, the fact that b(och2cf3)3-mediated amidation reactions can be easily purified by a solid phase workup might offer greater convenience . The successful amidation of amino acids using boronic acid catalysts or other boron - based amidation reagents has not been reported to date . We therefore wished to explore the application of b(och2cf3)3 to the coupling of a selection of amino acids bearing commonly used nitrogen protecting groups to determine whether the corresponding amides could be obtained without racemization (figure 6). The coupling of a range of protected amino acids with benzylamine proceeded in good yield (6a6e) including both boc (6a6d) and cbz (6e) protected examples . In most cases no significant racemization was observed (6a, 6b, 6d). Where small levels of racemization were observed, this could be reduced significantly by decreasing the reaction time, albeit at the expense of product yield (6b, 6c). The synthesis of prolinamide 6d is notable, as derivatives of this compound have been used as organocatalysts in a variety of reactions . Dipeptides (6f, 6 g) could also be obtained in moderate yield, by coupling of two suitably protected amino acids with no observable formation of diastereomeric products . Dipeptides 6f and 6 g have previously been synthesized via carbodiimide coupling, but purification by aqueous workup, recrystallization or chromatography was required . Pleasingly, amino acids could also be coupled with cyclic secondary amines (6h6l) in reasonable yield, and these couplings also proceeded with relatively low levels of racemization . The synthesis of amides 6h6j has been reported using a range of different coupling reagents, but the enantiomeric purity of the products was not directly determined in any of these cases . The preparation of n - benzylamide 6 m was achieved in excellent yield with negligible racemization . The coupling of amino acids with acyclic secondary amines was unsuccessful (6n, 6o). The above reactions serve to illustrate the scope of the b(och2cf3)3 reagent for the coupling of acids bearing adjacent chiral centers . Commonly used nitrogen protecting groups (boc, cbz) are tolerated under the reaction conditions, and very little racemization is observed in many cases despite the high temperatures employed . Where racemization does occur, notably, the coupling of amino acids with secondary amines using conventional coupling reagents is often a considerable challenge, and an aqueous work up and/or chromatographic purification is generally required . Our method therefore offers a potentially valuable approach to tertiary amino acid amides, as it furnishes pure products in reasonable yield with high enantiopurity, following a simple solid phase workup . All reactions were carried out at 80 c for 15 h unless otherwise stated and purified by solid phase workup . (a) 80 c for 8 h; (b) 100 c for 24 h in a sealed tube; (c) er measured after conversion to the n - benzoyl amide derivative; (d) 100 c for 8 h in a sealed tube; (e) 80 c for 5 h. in our preliminary communication, we reported the transamidation of a limited selection of primary amides using b(och2cf3)3 . Since this report, a number of alternative catalysts and reagents for transamidation reactions have been reported including hydroxylamine hydrochloride, cp2zrcl2, cu(oac)2, phi(oac)2, boric acid, ceo2 and l - proline . In many cases these reagents are cheap and readily available, and, it therefore seemed that the potential application of b(och2cf3)3 as a reagent for transamidation of primary amides is somewhat limited . However, during our initial solvent screen for the direct amidation of carboxylic acids, we observed that b(och2cf3)3 was highly effective for the transamidation of dmf . With this in mind, we opted to investigate the scope of this reaction . Recent literature methods for the n - formylation of amines include hconh2/naome, hconh2/nh2ohhcl, hconh2/cp2zrcl2, hco2h in the presence of protic ionic liquids, and hco2h / hco2na . All of these methods require high temperatures, anhydrous conditions and purification by column chromatography . The direct transamidation of dmf has recently been achieved with boric acid, phi(oac)2,l - proline, and imidazole, but at high temperatures, with extended reaction times, and/or with purification by column chromatography . We therefore anticipated that b(och2cf3)3-mediated transamidation of dmf may provide a useful formylation method, especially if the products could be readily purified by solid phase workup . The formylation of benzylamine was used as a model for optimization (table 2). First, we confirmed that the background reaction, observed when the amine was heated in dmf at 100 c in the absence of b(och2cf3)3, was negligible (entry 1). In neat dmf with 2 equiv of b(och2cf3)3, a 41% yield of formamide was obtained (entry 2). Surprisingly, the reaction was more effective with small quantities of dmf in acetonitrile as solvent (entries 39). Although reasonable yields were obtained with as little as 1 equiv of dmf (entry 3), the use of 10 equiv was found to be optimal (entry 8). The reaction temperature could be lowered to 80 c without a detrimental effect on yield, and the pure formamide could be obtained in good yield after solid phase workup and evaporation (entry 10). Formylation of benzylamine could also be achieved with similar efficiency using formamide (88% yield) and n - methylformamide (94%). However, dmf is considerably cheaper and easier to separate from the formamide product than these alternative formyl donors . 80 c, solid phase workup followed by evaporation of dmf, no column chromatography required . The scope of this reaction was evaluated on a range of amines (table 3). Aromatic and aliphatic amines underwent formylation in moderate to excellent yield (7a7f). Amines with -substituents such as -methylbenzylamine gave the corresponding formamide in excellent yield (7d). The volatile n - butylformamide (7 g) could be obtained in good yield as calculated by h nmr, but a significant loss of the product was observed during isolation . Less nucleophilic systems such as aniline and related derivatives (7h, 7i) were formylated in relatively low yield . Secondary amines (7i, 7j) could also be formylated, although higher temperatures were required to obtain better yields . A convenient synthesis of b(och2cf3)3 from readily available bulk chemicals has been reported, and the full scope of its application in direct amidation reactions has been explored . A wide range of acids and amines containing varying functionalities can be successfully used in b(och2cf3)3-mediated amidation reactions, and the pure amide products can be isolated following an operationally simple solid phase workup procedure using commercially available resins, avoiding the need for aqueous workup or chromatographic purification . The amidation of a series of n - protected amino acids with both primary and secondary amines has been successfully demonstrated, and the products were obtained with high enantiopurity . The formylation of a series of primary and secondary amines via transamidation of dmf was also successfully achieved . Reactions in mecn at 100 c were performed in a sealed (screw cap) carousel tube . All resins were washed with ch2cl2 and dried under a vacuum prior to use . Column chromatography was carried out using silica gel, and analytical thin layer chromatography was carried out using aluminum - backed silica plates . Components were visualized using combinations of uv (254 nm) and potassium permanganate . []d values are given in 10 deg cm g, concentration (c) in g per 100 ml . H nmr spectra were recorded at 300, 400, 500, or 600 mhz in the stated solvent using residual protic solvent cdcl3 (= 7.26 ppm, s), dmso (= 2.56 ppm, qn) or meod (= 4.87, s and 3.31, quintet) as the internal standard . Chemical shifts are quoted in ppm using the following abbreviations: s, singlet; d, doublet; t, triplet; q, quartet; qn, quintet; m, multiplet; br, broad or a combination of these . C nmr spectra were recorded at 75, 100, 125, or 150 mhz in the stated solvent using the central reference of cdcl3 (= 77.0 ppm, t), dmso (= 39.52 ppm, septet) or meod (= 49.15 ppm, septet) as the internal standard . The data for amides 2a, 2d, 2e, 2 g, 2h, 3j, 3l, 3o, 3q, 3r, 4a, 4b, 4d, 4f and 6b was reported in our preliminary communication . A suspension of b2o3 (25.6 g, 0.37 mol) in 2,2,2-trifluoroethanol (53 ml, 0.73 mol) was stirred at 80 c for 8 h. the reaction mixture was then filtered to remove excess boric anhydride . The filtrate was purified by distillation to give b(och2cf3)3 as a clear liquid (36.0 g, 117 mmol, 48%). A suspension of b2o3 (48.1 g, 0.69 mol) in 2,2,2-trifluoroethanol (100 ml, 1.37 mol) was stirred at 80 c for 24 h. the reaction mixture was then filtered to remove excess boric anhydride . The filtrate was purified by distillation to give b(och2cf3)3 as a clear liquid (46.3 g, 150 mmol, 33%). 2,2,2-trifluoroethanol (38.4 g, 28%) was recovered during the distillation: bp 122125 c (760 torr) [lit . (c h), 1441 (c f), 1376 (b o), 1156 (c o); h (300 mhz, cdcl3) 4.24 (q, j 8.3 6h); c (75 mhz, cdcl3) 61.8 (q, j 36.5), 123.2 (q, j 276); f (282 mhz, cdcl3) 77.06; found (ci) [m + h] 309.0334 c6h7o3f9b, requires 309.0344 . B(och2cf3)3 (2.0 mmol, 2 equiv) was added to a solution of acid (1.0 mmol, 1 equiv) and amine (1.0 mmol, 1 equiv) in mecn (2 ml, 0.5 m). The reaction mixture was stirred at the indicated temperature (80 c, or 100 c in a sealed tube) for the indicated time (524 h). After the indicated time, the reaction mixture was diluted with ch2cl2 or etoac (3 ml) and water (0.5 ml). Amberlyst a-26(oh) (150 mg), amberlyst 15 (150 mg) and amberlite ira743 (150 mg) were added to the reaction mixture, and it was stirred for 30 min . Mgso4 was added to the reaction mixture, which was then filtered, the solids were washed three times with ch2cl2 or etoac, and the filtrate was concentrated in vacuo to yield the amide product . For amides 2i, 2j, 2 t, 2u and 4e, amberlyst 15 was not used . In these cases, the residue was redissolved in ch2cl2 (15 ml) and washed with aqueous solutions of nahco3 (15 ml, 1 m) and hcl (15 ml, 1 m), dried over mgso4, filtered and concentrated under reduced pressure to give the amide product . All reactions were performed on a 1 mmol scale . B(och2cf3)3 (2.0 mmol, 2 equiv) was added to a solution of amine (1.0 mmol, 1 equiv) and dmf (10.0 mmol, 10 equiv) in mecn (2 ml, 0.5 m). The reaction mixture was stirred at 80 c for 5 h. after 5 h, the reaction mixture was diluted with ch2cl2 or etoac (3 ml) and water (0.5 ml). Amberlyst 15 (150 mg) and amberlite ira743 (150 mg) were added to the reaction mixture, and it was stirred for 30 min . The reaction mixture was dried over mgso4 and then filtered, the solids were washed three times with ch2cl2 or etoac, and the filtrate was diluted with toluene (10 ml) and then concentrated in vacuo repeatedly (5 times) to yield the clean product . Yellow solid (256 mg, 99%): mp 9495 c (ch2cl2); max (solid / cm) 3284 (n h), 3066, 3030, 2939, 2837 (c h), 1646 (c = o); h (600 mhz, cdcl3) 3.58 (s, 2h), 3.66 (s, 3h), 4.39 (d, j 5.8, 2h), 6.01 (br s, 1h), 6.80 (d, j 8.1, 1h), 6.87 (td, j 7.4, 0.9, 1h), 7.17 (dd, j 7.4, 1.6, 1h), 7.227.25 (m, 3h), 7.277.30 (m, 1h), 7.337.36 (m, 2h); c (150 mhz, cdcl3) 40.0, 44.0, 55.1, 110.2, 120.7, 126.1, 127.4, 128.9, 129.0, 129.6, 129.7, 135.1, 157.6, 170.7; found (ei) [m] 255.1251 c16h17o2n, requires 255.1254 . Yellow solid (252 mg, 99%): mp 139141 c (ch2cl2) [lit . 138139 c]; max (solid / cm) 3235 (n h), 3063, 3032, 2969, 2936 (c h), 1623 (c = o); h (600 mhz, cdcl3) 3.62 (s, 2h), 3.78 (s, 3h), 4.34 (d, j 5.8, 2h), 5.60 (br s, 1h), 6.816.83 (m, 2h), 7.097.12 (m, 2h), 7.257.26 (m, 1h), 7.267.30 (m, 2h), 7.327.36 (m, 2h); c (150 mhz, cdcl3) 43.2, 44.0, 55.4, 114.1, 127.5, 129.0, 129.2, 129.6, 130.3, 134.9, 159.1, 170.9; found (ei) yellow solid (158 mg, 57%): mp 145146 c (ch2cl2) [lit . 151153 c]; max (solid / cm) 3391 (n h), 3249 (n h), 3062, 3033, 2920, 2850 (c h), 1634 (c = o); h (500 mhz, cdcl3) 2.90 (t, j 6.7, 2h), 3.503.56 (m, 4h), 5.44 (br s, 1h), 6.77 (s, 1h), 7.087.15 (m, 3h), 7.187.22 (m, 1h), 7.237.28 (m, 1h), 7.267.30 (m, 2h), 7.35 (d, j 8.1, 1h), 7.54 (d, j 7.8, 1h), 8.00 (br s, 1h); c (125 mhz, cdcl3) 25.1, 39.8, 44.0, 111.3, 112.8, 118.7, 119.6, 122.0, 122.3, 127.3, 129.0 (2c), 129.5, 135.0, 136.4, 171.0; found (es) [m + na] 301.1305 c18h18on2na, requires 301.1317 . Yellow oil (170 mg, 96%): max (film / cm) 3029, 2940, 2853, 2795 (c h), 1627 (c = o); h (500 mhz, cdcl3) 2.20 (t, j 5.1, 2h), 2.25 (s, 3h), 2.34 (t, j 5.1, 2h), 3.45 (t, j 5.1, 2h), 3.66 (t, j 5.1, 2h), 3.72 (s, 2h), 7.217.25 (m, 3h), 7.297.33 (m, 2h); c (125 mhz, cdcl3) 41.0, 41.7, 46.0 (2c), 54.7, 55.0, 126.9, 128.7, 128.8, 135.1, 169.5 . Brown solid (209 mg, 76%): mp 9193 c (ch2cl2); max (solid / cm) 2919, 2827 (c h), 1632 (c = o); h (600 mhz, cdcl3) 2.952.98 (m, 2h), 3.103.13 (m, 2h), 3.563.59 (m, 2h), 3.783.82 (m, 4h), 6.876.93 (m, 3h), 7.257.31 (m, 5h), 7.337.37 (m, 2h); c (150 mhz, cdcl3) 41.2, 41.8, 46.1, 49.3, 49.6, 116.7, 120.6, 127.1, 128.8, 129.0, 129.4, 135.2, 151.0, 169.6; found (es) [m + h] 281.1656 c18h21on2, requires 281.1654 . White solid (182 mg, 89%): mp 6567 c (ch2cl2) [lit . 6264 c]; max (solid / cm) 3064, 3033, 2961, 2917, 2893, 2851 (c h), 1640 (c = o); h (400 mhz, cdcl3) 3.403.44 (m, 2h), 3.443.48 (m, 2h), 3.63 (s, 4h), 3.72 (s, 2h), 7.217.27 (m, 3h), 7.297.34 (m, 2h); c (100 mhz, cdcl3) 40.8, 42.1, 46.5, 66.4, 66.8, 126.9, 128.5, 128.8, 134.8, 169.6 . Clear oil (185 mg, 97%): max (film / cm) 3061, 3030, 2971, 2874 (c h), 1623 (c = o); h (500 mhz, cdcl3) 1.80 (quintet, j 6.7, 2h), 1.88 (quintet, j 6.7, 2h), 3.39 (t, j 6.7, 2h), 3.46 (t, j 6.7, 2h), 3.63 (s, 2h), 7.197.23 (m, 1h), 7.247.31 (m, 4h); c (125 mhz, cdcl3) 24.4, 26.2, 42.3, 46.0, 47.0, 126.7, 128.6, 129.0, 135.0, 169.6; found (es+) [m + h] 190.1226 c12h16on, requires 190.1232 . Yellow solid (194 mg, 89%): mp 7374 c (ch2cl2) [lit . 7375 c]; max (solid / cm) 3024, 2960, 2911 (c h), 1639 (c = o); h (400 mhz, cdcl3) 2.262.30 (m, 2h), 2.522.59 (m, 2h), 3.653.70 (m, 2h), 3.72 (s, 2h), 3.853.90 (m, 2h), 7.207.26 (m, 3h), 7.297.34 (m, 2h); c (100 mhz, cdcl3) 27.2, 27.4, 41.3, 44.4, 48.8, 126.9, 128.5, 128.9, 134.8, 169.4 . White solid (134 mg, 82 mg): mp 3739 c (ch2cl2) [lit . (c h), 1634 (c = o); h (600 mhz, cdcl3) 2.91 (s, 3h), 2.93 (s, 3h), 3.66 (s, 2h), 7.177.23 (m, 3h), 7.257.28 (m, 2h); c (150 mhz, cdcl3) 35.7, 37.8, 41.1, 126.8, 128.7, 128.9, 135.2, 171.1 . Colorless oil (37 mg, 12%): max (film / cm) 3062, 3029, 2925 (c h), 1639 (c = o); h (500 mhz, cdcl3, 35 c) 3.83 (s, 2h), 4.47 (s, 2h), 4.66 (s, 2h), 7.117.17 (m, 2h), 7.197.25 (m, 2h), 7.257.42 (m, 12h); c (125 mhz, cdcl3, 35 c) 41.0, 48.3, 50.3, 126.5, 126.9, 127.4, 127.6, 128.3, 128.5, 128.7, 128.8, 128.9, 135.0, 136.5, 137.3, 171.6 . Off white solid (125 mg, 60%): mp 116118 c (ch2cl2) [lit . 116117 c]; max (solid / cm) 3254 (n h), 3135, 3061, 3025 (c h), 1655 (c = o); h (600 mhz, cdcl3) 3.69 (s, 2h), 7.09 (t, j 7.4, 1h), 7.27 (t, j 7.8, 2h), 7.337.34 (m, 3h), 7.367.39 (m, 2h), 7.45 (d, j 8.0, 2h), 7.61 (br s, 1h); c (150 mhz, cdcl3) 44.8, 120.1, 124.6, 127.7, 129.1, 129.3, 129.6, 134.7, 137.9, 169.6 . Yellow solid (143 mg, 61%): mp 8283 c (ch2cl2) [lit . 8081 c]; max (solid / cm) 3284 (n h), 3028, 3011, 2959, 2939, 2918, 2837 (c h), 1648 (c = o), h (500 mhz, cdcl3) 3.72 (s, 3h), 3.76 (s, 2h), 6.80 (dd, j 8.1, 1.1, 1h), 6.93 (td, j 7.8, 1.1, 1h), 7.01 (td, j 7.8, 1.5, 1h), 7.317.37 (m, 3h), 7.377.42 (m, 2h), 7.79 (br s, 1h), 8.35 (dd, j 8.0, 1.4, 1h); c (125 mhz, cdcl3) 45.3, 55.7, 110.0, 119.6, 121.2, 123.8, 127.5, 127.7, 129.1, 129.7, 134.7, 147.9, 168.9 . White solid (105 mg, 53%): mp 132133 c (ch2cl2) [lit . 131132 c]; max (solid / cm) 3289 (n h), 3063, 3031, 2922 (c h), 1650 (c = o); h (500 mhz, cdcl3) 2.29 (s, 3h), 3.73 (s, 2h), 7.01 (br s, 1h), 7.08 (d, j 8.4, 2h), 7.28 (d, j 8.4, 2h), 7.317.36 (m, 3h), 7.387.42 (m, 2h); c (125 mhz, cdcl3) 23.6, 47.4, 122.9, 130.2, 131.8, 132.2, 133.3, 136.8, 137.5, 138.0, 172.1 . White solid (164 mg, 68%): mp 122123 c (ch2cl2) [lit . 124125 c]; max (solid / cm) 3315 (n h), 3084, 3026, 3009, 2943 (c h), 1650 (c = o); h (500 mhz, cdcl3) 3.73 (s, 2h), 3.77 (s, 3h), 6.806.83 (m, 2h), 6.97 (br s, 1h), 7.297.36 (m, 5h), 7.387.42 (m, 2h); c (125 mhz, cdcl3) 44.8, 55.5, 114.1, 121.9, 127.7, 129.3, 129.6, 130.7, 134.6, 156.6, 169.0 . White solid (114 mg, 53%): mp 107108 c (ch2cl2); max (solid / cm) 3170 (n h), 3032, 2971 (c h), 1686 (c = o); h (500 mhz, cdcl3) 3.68 (s, 2h), 7.20 (dd, j 8.3, 4.7, 1h), 7.237.33 (m, 5h), 8.068.10 (m, 1h), 8.27 (dd, j 4.7, 1.2, 1h), 8.57 (d, j 2.4, 1h), 9.05 (br s, 1h); c (125 mhz, cdcl3) 44.3, 123.9, 127.5, 127.6, 129.0, 129.3, 134.4, 135.4, 141.3, 144.9, 170.4; found (ei) [m] 212.0947 c13h12on2, requires 212.0944 . White solid (25 mg, 12%): mp 121122 c (ch2cl2) [lit . 122124 c]; max (solid / cm) 3230 (n h), 3046, 2959, 2921 (c h), 1656 (c = o); h (500 mhz, cdcl3) 3.74 (s, 2h), 6.987.03 (m, 1h), 7.277.33 (m, 3h), 7.337.38 (m, 2h), 7.667.71 (m, 1h), 8.198.27 (m, 2h), 8.52 (br s, 1h); c (125 mhz, cdcl3) 45.1, 114.1, 120.0, 127.8, 129.3, 129.6, 134.0, 138.5, 147.7, 151.3, 169.6; found (es) [m + h] 213.1035 c13h13on2, requires 213.1028 . White solid (116 mg, 60%): mp 104106 c (ch2cl2) [lit . 103 c]; max (solid / cm) 3303 (n h), 3063, 2962, 2872 (c h), 1638 (c = o); h (600 mhz, cdcl3) 1.28 (s, 9h), 3.48 (s, 2h), 5.17 (br s, 1h), 7.24 (d, j 7.2, 2h), 7.267.30 (m, 1h), 7.35 (t, j 7.4, 2h); c (150 mhz, cdcl3) 28.8, 45.0, 51.4, 127.3, 129.1, 129.4, 135.6, 170.4 . Yellow solid (225 mg, 81%): mp 168169 c (ch2cl2) [lit . 170174 c]; max (solid / cm) 3225 (n h), 3053, 3030, 2976, 2936 (c h), 1628 (c = o); h (500 mhz, cdcl3) 3.79 (s, 2h), 4.41 (d, j 5.8, 2h), 5.81 (br s, 1h), 7.18 (d, j 7.0, 2h), 7.217.30 (m, 3h), 7.39 (dd, j 8.3, 1.7, 1h), 7.467.52 (m, 2h), 7.72 (br s, 1h), 7.787.82 (m, 1h), 7.827.85 (m, 2h); c (125 mhz, cdcl3) 43.7, 44.1, 126.2, 126.5, 127.4, 127.5, 127.6, 127.7, 127.8, 128.4, 128.7, 129.0, 132.3, 132.6, 133.6, 138.2, 170.8 . Yellow solid (247 mg, 81%): mp 127128 c (ch2cl2) [lit . 126128 c]; max (solid / cm) 3311 (n h), 3060, 3030, 2930 (c h), 1634 (c = o); h (500 mhz, cdcl3) 4.48 (d, j 5.7, 2h), 4.96 (s, 1h), 5.94 (br s, 1h), 7.197.22 (m, 2h), 7.247.30 (m, 8h), 7.307.35 (m, 5h); c (125 mhz, cdcl3) 43.9, 59.3, 127.4, 127.6, 127.7, 128.8, 128.9, 129.0, 138.2, 139.4, 171.8 . Yellow solid (232 mg, 90%): mp 134135 c (ch2cl2) [lit . 136 c]; max (solid / cm) 3286 (n h), 3082, 3063, 3033, 2968, 2838 (c h), 1635 (c = o); h (600 mhz, cdcl3) 3.57 (s, 2h), 3.79 (s, 3h), 4.40 (d, j 5.8, 2h), 5.75 (br s, 1h), 6.866.89 (m, 2h), 7.167.19 (m, 4h), 7.237.26 (m, 1h), 7.287.31 (m, 2h); c (150 mhz, cdcl3) 43.0, 43.7, 55.4, 114.6, 126.8, 127.5, 127.6, 128.8, 130.7, 138.3, 159.0, 171.5 . Yellow solid (276 mg, 90%): mp 143144 c (ch2cl2) [lit . 144145 c]; max (solid / cm) 3272 (n h), 3055, 3030, 2920, 2871 (c h), 1642 (c = o); h (600 mhz, cdcl3) 3.77 (s, 2h), 4.44 (d, j 5.7, 2h), 5.75 (br s, 1h), 7.16 (td, j 7.7, 1.7, 1h), 7.217.27 (m, 3h), 7.30 (app t, j 7.6, 3h), 7.37 (dd, j 7.5, 1.6, 1h), 7.58 (dd, j 8.0, 1.0, 1h); c (150 mhz, cdcl3) 43.8, 44.2, 125.0, 127.6, 127.7, 128.2, 128.8, 129.4, 131.9, 133.3, 134.8, 138.1, 169.5 . Yellow solid (289 mg, 94%): mp 165166 c (ch2cl2); max (solid / cm) 3280 (n h), 3056, 3026, 2917, 2872 (c h), 1642 (c = o); h (600 mhz, cdcl3) 3.55 (s, 2h), 4.41 (d, j 5.6, 2h), 5.72 (br s, 1h), 7.15 (d, j 8.4, 2h), 7.19 (d, j 7.0, 2h), 7.257.28 (m, 1h), 7.297.33 (m, 2h), 7.457.48 (m, 2h); c (150 mhz, cdcl3) 43.2, 43.8, 121.6, 127.7, 127.8, 128.9, 131.2, 132.2, 133.8, 138.0, 170.2; found (ei) [m] 303.0256 c15h14onbr, requires 303.0253 . Brown solid (235 mg, 81%): mp 100101 c (ch2cl2) [lit . 98100 c]; max (solid / cm) 3297 (n h), 3065, 3033, 3000, 2936, 2835 (c h), 1634 (c = o); h (600 mhz, cdcl3) 3.58 (s, 2h), 3.85 (s, 3h), 3.86 (s, 3h), 4.41 (d, j 5.6, 2h), 5.74 (br s, 1h), 6.766.80 (m, 2h), 6.83 (d, j 8.0, 1h), 7.18 (d, j 7.0, 2h), 7.237.26 (m, 1h), 7.287.31 (m, 2h); c (150 mhz, cdcl3) 43.6, 43.7, 55.98, 56.02, 111.6, 112.4, 121.8, 127.2, 127.58, 127.61, 128.8, 138.3, 148.4, 149.4, 171.3; found (ei) [m] 285.1353 c17h19o3n, requires 285.1359 . Yellow solid (244 mg, 93%): mp 157158 c (ch2cl2) [lit . 151153 c]; max (solid / cm) 3277 (n h), 3056, 3027, 2918, 2874 (c h), 1642 (c = o), 690 (c cl); h (600 mhz, cdcl3) 3.56 (s, 2h), 4.41 (d, j 5.8, 2h), 5.76 (br s, 1h), 7.187.22 (m, 4h), 7.247.28 (m, 1h), 7.297.32 (m, 4h); c (150 mhz, cdcl3) 43.1, 43.8, 127.69, 127.74, 128.9, 129.2, 130.9, 133.3, 133.5, 138.1, 170.4 . Yellow solid (212 mg, 91%): mp 9698 c (ch2cl2); max (solid / cm) 3279 (n h), 3086, 3062, 3032, 2925 (c h), 1635 (c = o); h (600 mhz, cdcl3) 3.65 (s, 2h), 4.42 (d, j 5.8, 2h), 5.85 (br s, 1h), 7.01 (d, j 4.8, 1h), 7.147.15 (m, 1h), 7.19 (d, j 7.5, 2h), 7.237.34 (m, 4h); c (150 mhz, cdcl3) 38.3, 43.7, 123.7, 127.0, 127.61, 127.62, 128.6, 128.8, 134.8, 138.2, 170.5; found (es) [m + h] 232.0789 c13h14ons, requires 232.0796 . Yellow solid (298 mg, 95%): mp 125126 c (ch2cl2); max (solid / cm) 3285 (n h), 3085, 3064, 3033, 2921 (c h), 1636 (c = o); h (600 mhz, cdcl3) 3.60 (s, 2h), 4.43 (d, j 5.9, 2h), 5.71 (br s, 1h), 6.967.01 (m, 4h), 7.107.13 (m, 1h), 7.187.21 (m, 2h), 7.217.24 (m, 2h), 7.257.28 (m, 1h), 7.297.36 (m, 4h); c (150 mhz, cdcl3) 43.2, 43.8, 119.2, 119.3, 123.6, 127.6, 127.7, 128.8, 129.5, 129.9, 130.9, 138.2, 156.8, 157.0, 171.0; found (ei) [m] 317.1416 c21h19o2n, requires 317.1410 . Yellow solid (265 mg, 95%): mp 8284 c (ch2cl2) [lit . 8385 c]; max (solid / cm) 3310 (n h), 3067, 2978, 2931 (c h), 1664 (c = o), 1685 (c = o); h (400 mhz, cdcl3, 58 c) 1.40 (s, 9h), 2.90 (s, 3h), 3.83 (s, 2h), 4.41 (d, j 5.9, 2h), 6.52 (br s, 1h), 7.197.24 (m, 3h), 7.257.31 (m, 2h); c (100 mhz, cdcl3, 58 c) 28.2, 35.7, 43.3, 53.4, 80.6, 127.3, 127.5, 128.6, 138.2, 155.9, 169.1; found (ei) [m] 278.1629 c15h22o3n2, requires 278.1625 . Yellow solid (217 mg, 88%): mp 107110 c (ch2cl2); max (solid / cm) 3275 (n h), 3029, 2971 (c h), 1739 (c = o); h (600 mhz, cdcl3) 4.55 (d, j 5.7, 2h), 6.05 (br s, 1h), 6.26 (d, j 15.5, 1h), 7.227.24 (m, 1h), 7.267.36 (m, 6h), 7.42 (d, j 2.1, 1h), 7.65 (d, j 15.5, 1h); c (150 mhz, cdcl3) 44.0, 120.2, 125.1, 126.9, 127.4, 127.7, 128.0, 128.9, 135.2, 137.8, 138.3, 166.1; found (es+) white solid (229 mg, 90%): mp 120121 c (ch2cl2); max (solid / cm) 3332 (n h), 3079, 3059, 2921, 2852 (c h), 1531 (c = o); h (600 mhz, cdcl3) 2.11 (s, 3h), 4.56 (d, j 5.7, 2h), 6.69 (br s, 1h), 7.277.40 (m, 11h); c (150 mhz, cdcl3) 14.5, 44.2, 127.7, 127.98, 128.04, 128.5, 128.9, 129.5, 131.9, 134.3, 136.2, 138.5, 169.6; found (es) [m + h] 252.1394 c17h18on, requires 252.1388 . Yellow solid (183 mg, 89%): mp 7274 c (ch2cl2) [lit . 7071 c]; max (solid / cm) 3300 (n h), 3110, 3035, 2923 (c h), 1702 (c = o); h (500 mhz, cdcl3) 4.54 (d, j 5.8, 2h), 6.52 (br s, 1h), 7.287.32 (m, 2h), 7.327.41 (m, 3h); c (125 mhz, cdcl3) 43.9, 116.0 (q, j 285.4), 128.0, 128.2, 129.0, 136.1, 157.5 (q, j 36.9); f (282 mhz, cdcl3) 76.2 . Yellow solid (172 mg, 71%): mp 129130 c (ch2cl2) [lit . 129130 c]; max (solid / cm) 3256 (n h), 3058, 2957, 2930, 2834 (c h), 1631 (c = o); h (500 mhz, cdcl3) 3.85 (s, 3h), 4.64 (d, j 5.7, 2h), 6.28 (br s, 1h), 6.906.94 (m, 2h), 7.287.32 (m, 1h), 7.36 (m, 4h), 7.747.77 (m, 2h); c (125 mhz, cdcl3) 44.1, 55.5, 113.8, 126.7, 127.6, 128.0, 128.8, 128.9, 138.5, 162.3, 167.0 . Yellow solid (212 mg, 76%): mp 168170 c (ch2cl2) [lit . 149151 c]; max (solid / cm) 3326 (n h), 3091, 3071, 3036 (c h), 1643 (c = o); h (600 mhz, cdcl3) 4.65 (d, j 5.6, 2h), 6.53 (br s, 1h), 7.297.33 (m, 1h), 7.337.38 (m, 4h), 7.68 (d, j 8.2, 2h), 7.89 (d, j 8.2, 2h); c (150 mhz, cdcl3) 44.5, 123.7 (q, j 272.5), 125.8 (q, j 3.8), 127.6, 128.0, 128.1, 129.0, 133.4 (q, j 32.7), 137.7, 137.8, 166.2; f (282 mhz, cdcl3) 63.4 . Yellow solid (184 mg, 61%): mp 119120 c (ch2cl2); max (solid / cm) 3296 (n h), 3057, 3025, 3008, 2921, 2873 (c h), 1633 (c = o), h (600 mhz, cdcl3) 4.22 (s, 2h), 4.49 (d, j 5.6, 2h), 5.86 (br s, 1h), 7.13 (d, j 7.1, 2h), 7.167.19 (m, 3h), 7.217.25 (m, 4h), 7.267.32 (m, 3h), 7.337.37 (m, 1h), 7.397.42 (m, 1h); c (150 mhz, cdcl3) 39.0, 44.1, 126.2, 126.5, 127.3, 127.7, 128.0, 128.6, 128.9, 129.0, 130.3, 131.3, 136.5, 137.9, 139.0, 140.9, 169.9; found (es) [m + h] 302.1532 c21h20on, requires 302.1545 . White solid (124 mg, 37%): mp 167168 c (ch2cl2) [lit . 166167 c]; max (solid / cm) 3311 (n h), 3083, 3060, 3028 (c h), 1640 (c = o); h (600 mhz, dmso) 4.47 (d, j 6.0, 2h), 7.227.26 (m, 1h), 7.297.35 (m, 4h), 7.667.69 (m, 2h), 7.847.88 (m, 2h), 9.10 (br t, j 6.0, 1h); c (150 mhz, dmso) 42.7, 98.9, 126.8, 127.3, 128.3, 129.3, 133.8, 137.2, 139.5, 165.6; found (ei) [m + h] 337.9962 c14h13oni, requires 337.9958 . White solid (188 mg, 92%): mp 8283 c (ch2cl2) [lit . 7374 c]; max (solid / cm) 3301 (n h), 2959, 2931, 2866 (c h), 1649 (c = o); h (500 mhz, cdcl3) 0.86 (t, j 7.3, 3h), 1.24 (sextet, j 7.3, 2h), 1.39 (quintet, j 7.3, 2h), 2.34 (s, 3h), 3.18 (dt, j 7.3, 6.0, 2h), 3.52 (s, 2h), 5.43 (br s, 1h), 7.117.17 (m, 4h); c (125 mhz, cdcl3) 13.8, 20.0, 21.2, 31.6, 39.5, 43.6, 129.5, 129.8, 132.0, 137.1, 171.2; found (ei) [m] 205.1464 c13h19on, requires 205.1461 . White solid (132 mg, 72%): mp 8284 c (ch2cl2) [lit . 8182 c]; max (film / cm) 3375 (n h), 3059, 2954, 2852 (c h), 1746 (c = o), 1668 (c = o); h (600 mhz, cdcl3) 3.74 (s, 3h), 4.23 (d, j 5.7, 2h), 7.387.42 (m, 1h), 7.80 (t, j 7.6, 1h), 8.13 (d, j 7.6, 1h), 8.49 (br s, 1h), 8.53 (br d, j 4.5); c (150 mhz, cdcl3) 41.3, 52.5, 122.4, 126.6, 137.4, 148.4, 149.3, 164.7, 170.3 . White solid (97 mg, 69%): mp 169170 c (ch2cl2) [lit . 167168 c]; max (solid / cm) 3242 (n h / o h), 1632 (c = o); h (600 mhz, meod) 2.07 (s, 3h), 6.716.74 (m, 2h), 7.287.32 (m, 2h); c (150 mhz, meod) 23.5, 116.2, 123.4, 131.7, 155.4, 171.4 . B(och2cf3)3 (621.8 mg, 2.02 mmol, 2 equiv) was added to a solution of phenylene diacetic acid (192 mg, 0.99 mmol, 1 equiv) and benzylamine (0.11 ml, 1.01 mmol, 1 equiv) in mecn (2 ml, 0.5 m). The reaction mixture was stirred at 80 c for 5 h. after 5 h the solvent was removed in vacuo, and the residue was diluted in et2o (20 ml), washed with nahco3 (20 ml, 1 m), and extracted with et2o (3 20 ml). The aqueous layer was acidifed with hcl (1 m) and extracted with ch2cl2 (3 20 ml). The organic layer was dried over mgso4 and concentrated in vacuo to yield the product as a white solid (146 mg, 0.52 mmol, 52%): mp 163166 c (ch2cl2); max (solid / cm) 3284 (n h / o h), 3030, 3060 (c h), 1699 (c = o), 1632 (c = o); h (600 mhz, dmso - d6) 3.45 (s, 2h), 3.53 (s, 2h), 4.26 (d, j 6.0, 2h), 7.167.19 (m, 2h), 7.207.25 (m, 5h), 7.297.32 (m, 2h), 8.55 (br t, j 5.6, 1h), 12.31 (br s, 1h); c (150 mhz, dmso - d6) 40.3, 42.0, 42,2, 126.8, 127.3, 128.3, 128.9, 129.3, 133.1, 134.7, 139.5, 170.2, 172.8; found (ei) [m + h] 284.1279 c17h18o3n, requires 284.1287 . Colorless oil (95 mg, 99%): max (film / cm) 3245 (n h), 2945, 2870 (c h), 1637 (c = o); h (500 mhz, cdcl3) 1.691.82 (m, 4h), 2.30 (t, j 6.5, 2h), 3.263.32 (m, 2h), 7.03 (br s, 1h); c (125 mhz, cdcl3) 20.8, 22.2, 31.5, 42.1, 172.9 . White solid (100 mg, 86%): mp 6768 c (ch2cl2) [lit . 6668 c]; max (solid / cm) 3202 (n h), 2927, 2855 (c h), 1648 (c = o); h (500 mhz, cdcl3) 1.601.71 (m, 4h), 1.721.78 (m, 2h), 2.422.47 (m, 2h), 3.173.22 (m, 2h), 6.42 (br s, 1h); c (125 mhz, cdcl3) 23.3, 29.8, 30.6, 36.8, 42.8, 179.5; found (ei) [m] 113.0828 c6h11on, requires 113.0835 . White solid (180 mg, 84%): mp 100101 c (ch2cl2) [lit . 101103 c]; []d25 9.5 (c 1.22, meoh) [lit . []d20 10.6 (c 1.22, meoh)]; max (solid / cm) 3264 (n h), 2968 (c h), 1715 (c = o), 1652 (c = o); h (400 mhz, cdcl3, 58 c) 1.45 (s, 9h), 1.541.67 (m, 1h), 1.821.93 (m, 2h), 2.412.50 (m, 1h), 3.273.33 (m, 2h), 4.01 (dt, j 11.3, 5.6, 1h), 5.45 (br s, 1h), 6.33 (br s, 1h); c (100 mhz, cdcl3, 58 c) 21.1, 27.9, 28.3, 41.7, 51.6, 79.5, 155.8, 171.6 . Yellow solid (266 mg, 79%): mp 98100 c (ch2cl2); []d259.1 (c 1.1, ch2cl2) [lit . []d24 9.2 (c 1.1, ch2cl2)]; max (solid / cm) 3335 (n h), 3314 (n h), 3061, 3027, 2968, 2936 (c h), 1679 (c = o), 1655 (c = o); h (400 mhz, cdcl3, 58 c) 1.41 (s, 9h), 1.881.97 (m, 1h), 2.05 (s, 3h), 2.062.15 (m, 1h), 2.462.59 (m, 2h), 4.28 (app q, j 7.1, 1h), 4.36 (dd, j 14.8, 5.8, 1h), 4.43 (dd, j 14.8, 5.9, 1h), 5.42 (br d, j 8.1, 1h), 7.197.25 (m, 3h), 7.267.30 (m, 2h), 6.86 (br s, 1h); c (100 mhz, cdcl3, 58 c) 15.2, 28.3, 30.4, 32.0, 43.4, 54.1, 80.1, 127.3, 127.5, 128.5, 138.2, 155.7, 171.6; found (es) [m + na] 361.1567 c17h26o3n2sna, requires 361.1562; hplc (hexane / i - proh 92:8, 0.5 ml / min, chiralcel daicel od) tr (d) = 9.28 min (<1%), tr (l) = 12.48 min (> 99%). Yellow solid (287 mg, 81%): mp 128129 c (ch2cl2) [lit . 128 c]; []d25 + 5.2 (c 1.1, ch2cl2) [lit . []d22 + 4.9 (c 0.20, ch2cl2)]; max (solid / cm) 3343 (n h), 3312 (n h), 3024, 2927 (c h), 1678 (c = o), 1659 (c = o); h (400 mhz, cdcl3, 58 c) 1.43 (s, 9h), 3.09 (dd, j 13.8, 7.2, 1h), 3.13 (dd, j 13.8, 6.7, 1h), 4.324.40 (m, 3h), 5.00 (br s, 1h), 6.03 (br s, 1h), 7.127.16 (m, 2h), 7.207.25 (m, 3h), 7.257.32 (m, 5h); c (100 mhz, cdcl3, 58 c) 28.2, 38.6, 43.5, 56.4, 80.2, 126.8, 127.4, 127.6, 128.5, 128.6, 129.3, 136.8, 137.8, 155.3, 171.0; hplc (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 10.62 min (<1%), tr (l) = 13.24 min (> 99%). Yellow solid (186 mg, 61%): mp 124125 c (ch2cl2) [lit . 125126 c]; []d25 77.0 (c 1.0, ch2cl2) [lit . []d24 76.2 (c 1.0, ch2cl2)]; max (solid / cm) 3303 (n h), 2978, 2933, 2909, 2874 (c h), 1682 (c = o), 1653 (c = o); h (400 mhz, cdcl3, 58 c) 1.40 (s, 9h), 1.782.07 (m, 3h), 2.25 (br s, 1h), 3.373.42 (m, 2h), 4.244.30 (m, 1h), 4.37 (dd, j 14.8, 5.6, 1h), 4.46 (dd, j 14.8, 5.7, 1h), 6.82 (br s, 1h), 7.187.30 (m, 5h); c (100 mhz, cdcl3, 58 c) 24.1, 28.3 (2c), 43.3, 47.0, 60.6, 80.3, 127.2, 127.5, 128.5, 138.5, 155.2, 172.1; hplc (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 13.08 min (1%), tr (l) = 15.79 min (99%). Yellow solid (245 mg, 78%): mp 138139 c (ch2cl2) [lit . 140141 c]; []d25 8.0 (c 1.02, chcl3) [lit . []d228.1 (c 1.3, chcl3)]; max (solid / cm) 3286 (n h), 3059, 3035, 2975, 2930 (c h), 1682 (c = o), 1641 (c = o); h (500 mhz, cdcl3) 1.37 (d, j 6.9, 3h), 4.284.32 (m, 1h), 4.34 (dd, j 15.0, 5.7, 1h), 4.41 (dd, j 15.0, 5.6, 1h), 4.98 (d, j 12.1, 1h), 5.01 (d, j 12.1, 1h), 5.68 (br d, j 6.5, 1h), 6.88 (br s, 1h), 7.187.35 (m, 10h); c (125 mhz, cdcl3) 18.9, 43.5, 50.7, 67.0, 127.5, 127.7, 128.1, 128.3, 128.6, 128.7, 136.2, 138.1, 156.1, 172.5; hplc (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel ad) tr (l) = 5.13 min (95%), tr (d) = 7.88 min (5%). Yellow solid (136 mg, 42%): mp 9395 c (ch2cl2); []d25 58.9 (c 0.99, chcl3); max (solid / cm) 3283 (n h), 3254 (n h), 3134, 3060, 3024 (c h), 1655 (c = o), 1599 (c = o), 1544 (c = o); h (600 mhz, cdcl3) 1.27 (d, j 7.1, 3h), 1.42 (s, 9h), 3.06 (dd, j 13.8, 6.3, 1h), 3.13 (dd, j 13.8, 5.7, 1h), 3.70 (s, 3h), 4.18 (br t, j 7.1, 1h), 4.85 (m, 1h), 5.04 (br d, j 5.5, 1h), 6.70 (br s, 1h), 7.10 (d, j 7.1, 2h), 7.207.24 (m, 1h), 7.257.29 (m, 2h); c (150 mhz, cdcl3) 18.6, 28.4, 38.0, 50.0, 52.5, 53.2, 80.2, 127.2, 128.7, 129.4, 135.9, 155.5, 171.9, 172.4; found (es) [m + na] 373.1720 c18h26o5n2na, requires 373.1739 . Yellow solid (208 mg, 64%): mp 8284 c (ch2cl2) [lit . 8586 c]; []d25 + 23.2 (c 1.01, chcl3) [lit . []d + 23.0 (c 0.61, chcl3)]; max (solid / cm) 3285 (n h), 3061, 3030, 2926 (c h), 1636 (c = o), 1547 (c = o); h (400 mhz, cdcl3, 58 c) 1.27 (d, j 7.0, 3h), 1.41 (s, 9h), 3.04 (dd, j 13.9, 6.6, 1h), 3.12 (dd, j 13.9, 6.1, 1h), 3.64 (s, 3h), 4.13 (quintet, j 7.0, 1h), 4.81 (dt, j 7.6, 6.3, 1h), 5.16 (br d, j 7.6, 1h), 6.71 (br d, j 7.3, 1h), 7.087.12 (m, 2h), 7.157.26 (m, 3h); c (100 mhz, cdcl3, 58 c) 18.1, 28.2, 38.0, 50.4, 51.9, 53.3, 79.9, 126.9, 128.4, 129.2, 136.0, 155.3, 171.7, 172.4 . Colorless oil (135 mg, 59%): []d256.4 (c 1.1, chcl3) [lit . []d24 6.8 (c 1.1, chcl3)]; max (film / cm) 3300 (n h), 2976, 2936, 2879 (c h), 1705 (c = o), 1636 (c = o); h (400 mhz, cdcl3) 1.24 (d, j 6.8, 3h), 1.36 (s, 9h), 1.761.84 (m, 2h), 1.91 (app qn, j 6.8, 2h), 3.313.39 (m, 2h), 3.413.49 (m, 1h), 3.513.58 (m, 1h), 4.37 (app qn, j 6.8, 1h), 5.50 (br d, j 7.8, 1h); c (100 mhz, cdcl3) 18.6, 24.1, 26.0, 28.3, 45.9, 46.2, 47.8, 79.3, 155.1, 171.2; found (ei) [m + h] 243.1713 c12h23o3n2, requires 243.1709; hplc measured after conversion to the benzoyl derivative 6k (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 15.79 min (<1%), tr (l) = 23.58 min (> 99%). Yellow solid (113 mg, 41%): mp 6568 c (ch2cl2); []d25 3.8 (c 1.03, chcl3); max (solid / cm) 3317 (n h), 2980, 2927 (c h), 1699 (c = o), 1638 (c = o); h (400 mhz, cdcl3) 1.29 (d, j 6.8, 3h), 1.43 (s, 9h), 2.532.61 (m, 2h), 2.632.76 (m, 2h), 3.653.75 (m, 2h), 3.803.89 (m, 1h), 3.994.08 (m, 1h), 4.59 (app qn, j 7.2, 1h), 5.52 (br d, j 8.0, 1h); c (100 mhz, cdcl3) 19.3, 27.3, 27.9, 28.4, 44.8, 46.1, 48.1, 79.6, 155.0, 171.3; found (ei) [m] 274.1352 c12h22o3n2s, requires 274.1346; hplc measured after conversion to the benzoyl derivative 6l (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 22.20 min (8%), tr (l) = 31.86 min (92%). Colorless oil (115 mg, 37%): []d25 + 37.2 (c 1.0, chcl3) [lit . []d20 + 37.5 (c 1.0, chcl3)]; max (film / cm) 3432 (n h), 2979, 2880 (c h), 1702 (c = o), 1631 (c = o); h (400 mhz, cdcl3) 1.40 (s, 9h), 1.471.77 (m, 4h), 2.522.59 (m, 1h), 2.903.01 (m, 2h), 3.253.46 (m, 3h), 4.534.61 (m, 1h), 5.49 (br d, j 8.6, 1h), 7.167.28 (m, 5h); c (100 mhz, cdcl3) 24.0, 25.7, 28.3, 40.2, 45.7, 46.2, 53.6, 79.5, 126.8, 128.3, 129.4, 136.6, 155.1, 170.0; hplc (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 10.09 min (4%), tr (l) = 13.21 (96%). White solid (118 mg, 49%): mp 8991 c (pe / etoac); max (solid / cm) 3301 (n h), 3061, 2975, 2877 (c h), 1724 (c = o), 1629 (c = o); h (400 mhz, cdcl3) 1.42(d, j 6.8, 3h), 1.811.89 (m, 2h), 1.96 (quintet, j 6.7, 2h), 3.393.54 (m, 3h), 3.65 (dt, j 10.1, 6.7, 1h), 4.90 (quintet, j 7.0, 1h), 7.347.40 (m, 2h), 7.417.47 (m, 2h), 7.777.81 (m, 2h); c (100 mhz, cdcl3) 18.3, 24.1, 26.0, 46.1, 46.4, 47.3, 127.1, 128.4, 131.5, 134.1, 166.4, 171.0; found (es) [m h] 245.1290 c14h17n2o2, requires 245.1291; hplc (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 17.08 min (2%), tr (l) = 28.56 min (98%). White solid (120 mg, 45%): mp 137138 c (pe / etoac); max (solid / cm) 3310 (n h), 3059, 2981, 2918 (c h), 1631 (c = o); h (400 mhz, cdcl3) 1.42 (d, j 6.8, 3h), 2.522.77 (m, 4h), 3.693.80 (m, 2h), 3.89 (ddd, j 2.8, 6.6, 14.0, 1h), 4.04 (ddd, j 2.8, 6.6, 13.3, 1h), 5.07 (quintet, j 7.0, 1h), 7.377.51 (m, 4h), 7.787.83 (m, 2h); c (100 mhz, cdcl3)19.1, 27.4, 27.9, 44.9, 45.6, 48.2, 127.1, 128.5, 131.6, 134.0, 166.4, 171.1; found (es) [m h] 277.1011 c14h17n2o2s, requires 277.1011; hplc (hexane / i - proh 90:10, 0.5 ml / min, chiralcel daicel od) tr (d) = 24.26 min (4%), tr (l) = 34.28 min (96%). Yellow solid (294 mg, 98%): mp 7778 c (ch2cl2); []d25 + 7.2 (c 0.88, ch2cl2) [lit . []d20 + 7.1 (c 0.88, ch2cl2)]; max (solid / cm) 3304 (n h), 2949, 2866 (c h), 1638 (c = o); h (600 mhz, cdcl3) 0.90 (d, j 6.6, 6h), 1.55 (d, j 7.2, 3h), 1.85 (app nonet, j 6.8, 1h), 2.45 (d, j 7.0, 2h), 3.58 (q, j 7.2, 1h), 4.37 (dd, j 15.1, 5.7, 1h), 4.41 (dd, j 15.1, 5.8, 1h), 5.66 (br s, 1h), 7.107.14 (m, 4h), 7.197.29 (m, 5h); c (150 mhz, cdcl3) 18.6, 22.5, 30.3, 43.5, 45.1, 46.6, 127.3, 127.41, 127.43, 128.6, 129.6, 138.7, 138.8, 140.6, 174.7; hplc (hexane / i - proh 100:0, 0.5 ml / min, chiralcel daicel ad) tr (s) = 5.01 min (> 99%), tr (r) = 7.41 min (<1%) white solid (139 mg, 98%): mp 6364 c (ch2cl2) [lit . 6062 c]; max (solid / cm) 3269 (n h), 3089, 3056, 2925, 2886 (c h), 1637 (c = o); h (500 mhz, cdcl3) 4.41 (d, j 6.0, 2h), 6.41 (br s, 1h), 7.207.28 (m, 3h) 7.297.37 (m, 2h), 8.17 (s, 1h); c (125 mhz, cdcl3) 42.3, 127.8, 127.9, 128.9, 137.6, 161.1 . Colorless oil (152 mg, 99%): max (film / cm) 3273 (n h), 3061, 3028, 2934, 2866 (c h), 1656 (c = o); h (400 mhz, cdcl3, 58 c) 2.84 (t, j 7.1, 2h), 3.55 (app q, j 6.7, 2h), 5.96 (br s, 1h), 7.147.26 (m, 3h), 7.277.34 (m, 2h), 8.09 (s, 1h); c (100 mhz, cdcl3, 58 c) 35.5, 39.2, 126.5, 128.59, 128.63, 138.6, 161.1 . Yellow solid (101 mg, 61%): mp 8183 c (ch2cl2) [lit . 7980 c]; max (solid / cm) 3283 (n h), 3010, 2933, 2891 (c h), 1642 (c = o); h (600 mhz, cdcl3) 3.77 (s, 3h), 4.37 (d, j 5.9, 2h), 6.11 (br s, 1h), 6.836.86 (m, 2h), 7.177.20 (m, 2h), 8.18 (s, 1h); c (150 mhz, cdcl3) 41.7, 55.4, 114.2, 129.2, 129.9, 159.1, 161.3 . Pale yellow oil (129 mg, 85%): []d25 + 160.9 (c 0.52, chcl3) [lit . []d20 + 161.4 (c 0.50, chcl3)]; max (film / cm) 3270 (n h), 3032, 2977, 2931, 2829 (c h), 1653 (c = o); h (500 mhz, cdcl3) 1.45 (d, j 6.9, 3h), 5.13 (app quintet, j 7.2, 1h), 6.71 (br s, 1h), 7.217.35 (m, 5h), 8.04 (s, 1h); c (125 mhz, cdcl3) 22.0, 47.7, 126.2, 127.4, 128.7, 143.0, 160.7; found (ei) data for major rotamer reported . Colorless oil (135 mg, 96%): max (film / cm) 3280 (n h), 3060, 2922, 2851 (c h), 1657 (c = o); h (600 mhz, cdcl3) 0.770.88 (m, 2h), 1.001.18 (m, 3h), 1.341.42 (m, 1h), 1.531.68 (m, 5h) 3.01 (t, j 6.6, 2h), 6.71 (br s, 1h), 8.06 (s, 1h); c (150 mhz, cdcl3) 25.8, 26.4, 30.8, 37.8, 44.4, 161.8; found (ei) [m + h] 142.1227 c8h16no, requires 142.1226 . Brown oil (95 mg, 78%): max (film / cm) 3268 (n h), 3050, 2929, 2854 (c h), 1652 (c = o); h (500 mhz, cdcl3) 1.091.39 (m, 5h), 1.531.63 (m, 1h), 1.641.76 (m, 2h), 1.821.95 (m, 2h), 3.783.86 (m, 1h), 5.78 (br s, 1h), 8.07 (s, 1h); c (125 mhz, cdcl3) 24.8, 25.5, 33.1, 47.1, 160.5 . Yellow oil (31 mg, 30%): max (film / cm) 3280 (n h), 3058, 2959, 2933, 2868 (c h), 1655 (c = o); h (500 mhz, cdcl3) 0.90 (t, j 7.2, 3h), 1.33 (sext, j 7.2, 2h), 1.48 (quintet, j 7.2, 2h), 3.26 (q, j 6.7, 2h), 5.95 (br s, 1h), 8.12 (s, 1h); c (125 mhz, cdcl3) 13.7, 20.0, 31.5, 37.9, 161.5; found (ei) [m] 101.0827 c5h11on, requires 101.0835 yellow oil (25 mg, 21%): max (film / cm) 3273 (n h), 3066, 2923, 2854 (c h), 1682 (c = o); h (600 mhz, cdcl3) 7.087.11 (m, 1h), 7.19 (t, j 7.5, 1h), 7.317.38 (m, 2h), 7.537.56 (m, 1h), 8.41 (br s, 1h), 8.71 (d, j 11.3, 1h); c (150 mhz, cdcl3) 118.9, 125.4, 129.9, 136.8, 162.8 . Brown solid (55 mg, 38%): mp 5658 c (ch2cl2) [lit . 5861 c]; max (solid / cm) 3053, 2960, 2921, 2854 (c h), 1656 (c = o); h (600 mhz, cdcl3) 3.14 (2h, t, j 8.6), 4.05 (2h, app td, j 8.5, 0.9), 7.04 (1h, td, j 7.2, 1.5), 7.147.22 (2h, m), 7.24 (1h, d, j 7.2) 8.92 (1h, s); c (150 mhz, cdcl3) 27.3, 44.8, 109.5, 124.4, 126.2, 127.7, 132.1, 141.2, 157.7 . Pale yellow oil (119 mg, 71%): max (film / cm) 3056, 3026, 2929, 2886 (c h), 1646 (c = o); h (500 mhz, cdcl3) 2.87 (t, j 5.9, 2h), 3.60 (t, j 5.9, 2h), 4.65 (s, 2h), 7.057.19 (m, 4h), 8.16 (s, 1h); c (125 mhz, cdcl3) 29.8, 42.4, 43.3, 126.70, 126.71, 126.8, 129.0, 131.8, 133.7, 161.8.
To report a case of a young patient with retinitis pigmentosa (rp), essential iris atrophy, and glaucoma . This report presents a case of a 22-year - old female patient with unilateral glaucoma, increased intraocular pressure, increased cup disc ratio, iris atrophy, peripheral anterior synechiae, and bilateral rp . Essential iris atrophy is one of the subtypes of iridocorneal endothelial (ice) syndrome, which is a spectrum of disorders characterized by corneal proliferative endotheliopathy, associated with corneal edema, anterior chamber and iris stroma abnormalities, and glaucoma.1 other variants of ice syndrome are chandler s syndrome and cogan - reese syndrome . It is unilateral, and it is associated with iris holes, peripheral anterior synechiae, and corneal alterations.1 approximately 50% of the cases present glaucoma, and it is probably caused by peripheral anterior synechiae and by a cellular membrane that covers the trabecular surface . The treatment for glaucoma is clinical; however, there is frequent surgical indication of trabeculectomy . Retinitis pigmentosa (rp) is characterized by progressive decrease in night vision and progressive visual field loss due to cellular retinal dystrophy . The fundoscopy shows characteristic bone - spicules pigment.2 rp does not present a defined inheritance pattern, and it might occur in an autosomal dominant, recessive, or x - linked fashion.3 it can also be related to other systemic and ocular manifestations . A 22-year - old white female patient reported the diagnosis of rp that she had 7 years before . Having gone through many examinations along this period, 1 year ago, it was diagnosed increased intraocular pressure (iop) in the right eye (od). The patient had misused hypotensive eye drops: prostaglandin analogs, carbonic anhydrase inhibitors, and b - adrenergic antagonists . Patient consent was obtained before undergoing treatment . In the ophthalmic examination, the best - corrected visual acuity was od: 20/50 (1,00 cyl 115) and left eye (os): 20/25 (+ 2,00 sph 1,00 cyl 10). The slit lamp examination showed multiple iris holes and corectopia in od (figures 1 and 2), clear cornea in both eyes (ou), and no alterations in os . Iop by goldmann applanation tonometry was od: 34 mmhg and os: 16 mmhg at 3 pm . The gonioscopy revealed 360 isolated peripheral anterior synechiae in od (figure 3) and a visible open - angle up to ciliary body in os . Disc ratio 0.9 vertical (v) 0.9 horizontal (h), visible lamina cribrosa pores, preserved macula, and peripheral pigment mobilization in od . In os, disc ratio 0.3 v 0.3 h, preserved macula, and peripheral pigment mobilization . The automated perimetry (figures 6 and 7) and manual perimetry (figures 8 and 9) showed central island vision in od and ring scotoma in os . The ultrasound pachymetry was 524 m and 530 m in od and os, respectively . The specular microscopy revealed pleomorphism and polymegathism in ou (figures 10 and 11). After failure of the clinical treatment to diminish iop in od, trabeculectomy was performed in this eye and iop was controlled . We have reported the case of a young patient presenting with rp and ice syndrome with glaucoma . Although there are some reports of association of rp and glaucoma in the literature, we have not found any report of association between rp and ice syndrome at pubmed . The most frequent glaucoma associated with rp is angle - closure glaucoma.2,46 the prevalence of glaucoma in patients with rp can be up to 2.3%.4 however, a study of 40 patients with rp found a prevalence of 12.5% of primary glaucoma.7 in the literature, there are reports of glaucoma associated with rp in inherited isolated or secondary cases, such as sturge weber syndrome,8,9 retinal neovascularization,10 familial nephropathy,11 bilateral ectopia lentis,12 and fuchs heterochromic cyclitis.13 there are also case reports of patients with rp who mimic glaucomatous visual field defect14 and abnormal nerve fiber layer of the retina, similar to those found in patients with glaucoma.15 in this case, we believe that glaucoma is associated with ice syndrome because the patient has unilateral glaucoma and iris essential atrophy in the same eye . The patient also presents alterations in specular microscopy and in the anterior chamber in od, which might be related to essential iris atrophy . The perimetry examinations demonstrate a glaucoma typical defect in od and a rp typical defect in os.
Despite the advancement in targeted therapy, treatment of cancer still remains as a huge unmet medical need . Multiple factors, in addition to the complexity of cancer biology, contribute to this unsatisfactory state . Such close tumor - host interactions are vitally important in determining the sensitivity of tumor cells to cancer treatments . However, such complex tumor context is not replicated either in vitro or in vivo in transgenic or xenograft models . Genetically engineering mouse tumor models provide a potentially promising alternate to assess preclinical cancer drug efficacy . Near 30% of the 98 000 clinical trials listed on clinicaltrials.gov were related to cancer drugs . Such a large number not only reflects the huge unmet medical needs, but also stems from the low success rate of cancer medicine development . It is estimated that only 10% of the cancer drug candidates entering clinical stage ultimately gain market approval . New trial approaches are urgently needed especially for the development of targeted cancer therapies that will only benefit a subset of patients . Prospectively identifying sensitive or excluding resistant patient populations to achieve definitive clinical benefit led to successful development of several targeted therapies . Such successes include the use of her2 fluorescent in situ hybridization (fish) assay for selecting her2-positive breast cancer patients receiving herceptin treatment, egfr mutation assay for selecting non - small cell lung cancer patients to be treated with gefitinib / erlotinib, and applying kras mutation assay to avoid exposing colorectal cancer patients with kras mutations to anti - egfr mabs . Recently, such biomarker - based prospective patient selection strategy was applied to phase 1 studies to expedite clinical development of several new targeted agents . Overall response rates from 50% to near 80% were achieved in early phase trials of crizotinib (alk inhibitor), as well as plx-4032 (r7204) and gsk2118436 (braf v600e inhibitors). Such dramatic early efficacy data prompted sponsors launching phase 3 registration trials based on phase 1 and phase 2 results (table 2). For compounds lacking definitive biomarkers for identifying sensitive / resistant subpopulation, adaptive trial design to incorporate biomarker identification and validation into one single trial may represent an effective and efficient approach . Bla, biologic license application; cml, chronic myeloid leukemia; ctla4, cytotoxic t - lymphocyte protein 4; egfr, epidermal growth factor receptor; gist, gastrointestinal stromal tumor; her2, human epidermal growth factor receptor 2 (also known as erbb2); hsp90, heat - shock protein, 90 kda; igfr1, insulin - like growth factor receptor 1; mcl1, myeloid cell leukemia sequence 1; mtor, mammalian target of rapamycin; nda, new drug application; nsclc, non - small cell lung cancer; parp1, poly (adp - ribose) polymerase 1 . Sources: company reports, clinicaltrials.gov, american society of clinical oncology, american society of hematology . The redundancy in the signaling systems at the disposal of the cancer cells often render individual targeted agents inactive in treating most cancers . Even in rare exceptions, such as narrowly defined patient populations, single agent activities could be dramatic, but cancers still recur . Combinations of targeted agents represent a potentially effective approach to simultaneously inhibiting multiple pathways, suppressing feedback reactivation of compensatory signaling network, and therefore to prevent recurrence . The parallels between clinical development of combinations and understanding of cancer resistance will ultimately lead to personalized medicine, such as matching targeted therapy with cancer patients based on molecular events underlying their malignancies . Such close tumor - host interactions are vitally important in determining the sensitivity of tumor cells to cancer treatments . However, such complex tumor context is not replicated either in vitro or in vivo in transgenic or xenograft models . Genetically engineering mouse tumor models provide a potentially promising alternate to assess preclinical cancer drug efficacy . Near 30% of the 98 000 clinical trials listed on clinicaltrials.gov were related to cancer drugs . Such a large number not only reflects the huge unmet medical needs, but also stems from the low success rate of cancer medicine development . It is estimated that only 10% of the cancer drug candidates entering clinical stage ultimately gain market approval . New trial approaches are urgently needed especially for the development of targeted cancer therapies that will only benefit a subset of patients . Prospectively identifying sensitive or excluding resistant patient populations to achieve definitive clinical benefit led to successful development of several targeted therapies . Such successes include the use of her2 fluorescent in situ hybridization (fish) assay for selecting her2-positive breast cancer patients receiving herceptin treatment, egfr mutation assay for selecting non - small cell lung cancer patients to be treated with gefitinib / erlotinib, and applying kras mutation assay to avoid exposing colorectal cancer patients with kras mutations to anti - egfr mabs . Recently, such biomarker - based prospective patient selection strategy was applied to phase 1 studies to expedite clinical development of several new targeted agents . Overall response rates from 50% to near 80% were achieved in early phase trials of crizotinib (alk inhibitor), as well as plx-4032 (r7204) and gsk2118436 (braf v600e inhibitors). Such dramatic early efficacy data prompted sponsors launching phase 3 registration trials based on phase 1 and phase 2 results (table 2). For compounds lacking definitive biomarkers for identifying sensitive / resistant subpopulation, adaptive trial design to incorporate biomarker identification and validation into one single trial may represent an effective and efficient approach . Bla, biologic license application; cml, chronic myeloid leukemia; ctla4, cytotoxic t - lymphocyte protein 4; egfr, epidermal growth factor receptor; gist, gastrointestinal stromal tumor; her2, human epidermal growth factor receptor 2 (also known as erbb2); hsp90, heat - shock protein, 90 kda; igfr1, insulin - like growth factor receptor 1; mcl1, myeloid cell leukemia sequence 1; mtor, mammalian target of rapamycin; nda, new drug application; nsclc, non - small cell lung cancer; parp1, poly (adp - ribose) polymerase 1 . Sources: company reports, clinicaltrials.gov, american society of clinical oncology, american society of hematology . The redundancy in the signaling systems at the disposal of the cancer cells often render individual targeted agents inactive in treating most cancers . Even in rare exceptions, such as narrowly defined patient populations, single agent activities could be dramatic, but cancers still recur . Combinations of targeted agents represent a potentially effective approach to simultaneously inhibiting multiple pathways, suppressing feedback reactivation of compensatory signaling network, and therefore to prevent recurrence . The parallels between clinical development of combinations and understanding of cancer resistance will ultimately lead to personalized medicine, such as matching targeted therapy with cancer patients based on molecular events underlying their malignancies . The already saturated clinical trial density in well established oncology trial regions such as north america and western europe poses an impassable challenge to accruing patients with proper molecular characteristics to match targeted agents . For example, nearly 7 000 patients need to be screened to identify the 5% patients with tumors harboring the eml4-alk fusion event for the crizotinib phase 3 trial of 320 patients . The success in contributing patients to the i - pass trial is a beginning for china to play a more active role in global development of new anti - cancer agents . In preparation for this new era, it is vital for investigators in china to master the knowledge in new cancer biology, pharmacokinetics, pharmacodynamics, innovative trial design of both early and late phases, as well as to establish core capabilities in molecular testing of tumor samples in real time fashion to support prospective patient selection . In collaboration with us chinese anti - cancer association (uscaca), chinese journal of cancer has organized a series of review articles to cover a broad spectrum of topics in targeted cancer therapies . These articles will analyze each major pathway or target class with an emphasis on mechanism of action, translational medicine, and clinical development . This series of reviews will provide a basis for our readers, especially clinical investigators, to develop a comprehensive appreciation of these targets and pathways in cancer as well as relevant targeted therapies being developed.
Down syndrome (ds), caused by a trisomy of chromosome 21(hsa21), is the most common genetic developmental disorder, with an incidence of 1 in 800 live births . Some of its phenotypes (e.g., cognitive impairment) are consistently present in all ds individuals, while others show incomplete penetrance . A short interval near the distal tip of chromosome 21 contributes to congenital heart defects (chd), and indirect genetic evidence suggests that multiple candidate genes in this region may contribute to this phenotype . The relatively higher infant mortality rate in the ds population has been largely attributed to their having a higher incidence of chd . Extensive efforts to gain a better understanding of the genetic basis of chd in ds using rare cases of partial trisomy 21 have led to identification of genomic regions on chromosome 21 that, when triplicated, are consistently associated with chd . A study of rare partial trisomy 21 cases suggested that the chd candidate region on 21q22.3 was mapped to a larger telomeric genomic segment of 15.4 mb between markers d21s3 and pfkl region . Recent studies also suggest the contribution of vegfa, ciliome and hedgehog, and folate pathways to the pathogenicity of chd in ds . Also, engineered duplication of a 5.43-mb region of mmu16 from tiam1 to kcnj6 in the mouse model, dp(16)2yey, it was indicated that the genetic architecture of the chd risk of ds was complex and included trisomy 21 . The complete underlying genomic or gene expression variation that contributes to the presence of a chd in ds is still unknown . Protein complexes are key molecular entities that integrate multiple gene products to perform cellular functions . For the past few years, high - throughput experimental technologies and large amounts of protein - protein interaction (ppi) data have made it possible to study proteins systematically . A ppi network can be simulated for an undirected graph with proteins as nodes and protein interactions as undirected edges, so as to the prioritize disease - related genes or pathways and to understand the mechanism of disease . However, protein interaction data produced by high - throughput experiments are often associated with high false - positive and false - negative rates, which makes it difficult to predict complexes accurately . An iterative scoring method proposed by liu et al . Was used to assign weight to protein pairs, and the weight of a protein pair indicated the reliability of the interaction between the 2 proteins . A crucial distinguishing factor of disease genes was that they belonged to core mechanisms responsible for genome stability and cell proliferation (e.g., dna damage repair and cell cycle) and functioned as highly synergetic or coordinated groups . Therefore, a systematic method is required to track gene and module behavior across specific conditions in a controlled manner (e.g., between normal and disease type). Combined ppi and gene expression data to construct a cancer - perturbed ppi network in cervical carcinoma to study gain- and loss - of - function genes as potential drug targets . Masica and karchin correlated somatic mutations and gene expression to identify novel genes in glioblastoma multiforma . Proposed an iterative model to combine mutation and expression data and used it to identify mutated driver pathways in multiple cancer types . Combined ppi and gene expression data to construct tissue - specific ppi networks for 60 tissues and used them to prioritize disease genes . Zhang et al ., integrated dna methylation, gene expression, and microrna expression data in 385 ovarian cancer samples from tcga, and performed multi - dimensional analysis to identify disrupted pathways . In the present study, in order to further reveal the mechanism of chd in ds, we systematically tracked the disrupted modules of reweighted ppi networks to identify disturbed pathways between normal controls and chd in ds patients . To achieve this, normal and disease ppi networks were inferred based on pearson correlation coefficient (pcc); then, a clique - merging algorithm was formed to explore modules in the re - weighted ppi network, and these modules were compared with each other to identify altered modules . Finally, kyoto encyclopedia of genes and genomes (kegg) pathways enrichment analysis of genes in disrupted modules was carried out based on database for annotation, visualization, and integrated discovery (david). The gene expression profile of e - geod-1789 from arrayexpress database (http://www.ebi.ac.uk/arrayexpress/) was selected for chd in ds - related analysis . E - geod-1789 was existed in the affymetrix genechip human genome u133a platform, and the data were gained from cardiac tissue from fetuses at 1822 weeks of gestation after therapeutic abortion, consisting of 10 samples from fetuses trisomic for hsa21 and 5 from euploid control fetuses . The microarray data and annotation files of healthy human beings and chd in ds were downloaded for further analysis . The micro array suite 5.0 (mas 5.0) algorithm was used to revise perfect match and mismatch values . Robust multichip average (rma) method and quantile based algorithm were carried out background correction and normalization to eliminate the influence of nonspecific hybridization . A gene - filter package was used to discard probes that did not match any genes . The expression value averaged over probes was used as the gene expression value if the gene had multiple probes . The database search tool for the retrieval of interacting genes / proteins (string, http://string-db.org/) provides a comprehensive, yet quality - controlled, collection of protein it integrates and ranks 3 types associations derived from: 1) high - throughput experimental data, 2) mining of databases and the literature, and 3) predictions based on genomic context analysis . The data, comprising 1 048 576 interactions with combine - scores, were obtained from string database to build the ppi network . After removing self - loops and proteins without expression value, a ppi network including 9273 nodes and 58 617 highly correlated interactions (with combine - score 0.75) was constructed . Taking the intersection of the 12493 genes in e - geod-1789 and the nodes of the ppi network, we established a sub - network with 7390 nodes and 45 286 interactions . The weights of interactions reflect their reliabilities, and interactions with low scores are likely to be false - positives . Pcc is a measure of the correlation between 2 variables, whose values ranged from 1 to + 1 . In this experiment, the pcc of a pair of genes (a and b), which encoded the corresponding paired proteins (u and v) interacting in the ppi network, was defined as: where n was the number of samples in the gene expression data; g (a, k) or g (b, k) was the expression level of gene a or b in the sample k under a specific condition; (a) or (b) represented the mean expression level of gene a or b; and (a) or (b) represented the standard deviation of expression level of gene a or b. in this study, the pcc of a pair of proteins (u and v) was defined as equal to the pcc of their corresponding paired genes (a and b), that was pcc (u, v)=pcc(a, b). Furthermore, the pcc of each gene - gene interaction was defined as weight value of the interaction . The interactions with \|pcc(a, b)1 pcc(a, b)2\|>1 under 2 conditions were regarded as a significant difference . The module - identification algorithm was based on clique - merging, similar to that proposed for identifying complexes from ppi networks . The algorithm worked in 2 steps: firstly, all maximal cliques from the ppi networks of normal and disease were selected out, respectively; and secondly, the cliques were ranked according to their weighted density and merged or removed highly overlapped cliques . The score of a clique c was defined as its weighted density: where w (u, v) was the weight of the interaction between u and v calculated using fast depth - first method . There might be thousands of maximal cliques in a ppi network and many of them overlapped with one another . To reduce the result size, merging highly overlapped cliques to form bigger, yet still dense, subgraphs was also desirable since complexes were not necessarily fully connected and ppi data might be incomplete . The inter - connectivity between 2 cliques was used to determine whether 2 overlapped cliques should be merged together . The weighted inter - connectivity between the non - overlapping proteins of c1 and c2 was calculated as follows: given a set of cliques ranked in descending order of their score, denoted as {c1, c2,..., ck}, the clustering based on maximal cliques (cmc) algorithm removed and merged highly overlapped cliques as follows . For every clique ci, if there existed a clique cj such that cj had a lower score than ci and \|ci cj \|/\|cj \| overlap - threshold (to), where overlap - threshold was a predefined threshold for overlapping . Then, we calculated the weighted inter - connecting score of different nodes in the 2 cliques . If such cj existed, then the interconnectivity score between ci and cj was used to decide whether to remove cj or merge cj with ci . If inter - score (ci, cj) merge - threshold (tm), then cj was merged with ci to form a module; otherwise, cj was removed . In this study, the overlap - threshold was set to 0.5 and merge - threshold was set to 0.25 ., tm} be the sets of modules identified from the networks normal and disease, respectively . For each si s, the module correlation density was calculated as follows: the correlation densities for disease modules t were calculated similarly . We built a similarity graph m=(vm, em), where vm={s t}, and em={(si, tj): j(si, tj) tj, cc(si, tj)}, whereby j(si, tj)=\|si, tj\|/\|si tj\| was the jaccard similarity and cc(si, tj) = \|dcc(si) dcc(tj)\| was the differential correlation density between si and tj . Next, the disrupted module pairs t(si, tj) were identified by finding the maximum weight matching in m, and we ranked them in descending order according to their differential density cc . The module pairs (disrupted module pairs) of whose tj 2/3 and cc 0.05 were considered to be distinct modules . Kegg is an effort to link genomic information with higher - order functional information by computerizing current knowledge on cellular processes and by standardizing gene annotations . In this study, the david for kegg pathway enrichment analysis was carried out to further investigate the biological functions of genes in altered modules from normal controls and chd in ds patients . The threshold values of p - value <0.001 and gene count> 5 were used in this study . The gene expression profile of e - geod-1789 from arrayexpress database (http://www.ebi.ac.uk/arrayexpress/) was selected for chd in ds - related analysis . E - geod-1789 was existed in the affymetrix genechip human genome u133a platform, and the data were gained from cardiac tissue from fetuses at 1822 weeks of gestation after therapeutic abortion, consisting of 10 samples from fetuses trisomic for hsa21 and 5 from euploid control fetuses . The microarray data and annotation files of healthy human beings and chd in ds were downloaded for further analysis . The micro array suite 5.0 (mas 5.0) algorithm was used to revise perfect match and mismatch values . Robust multichip average (rma) method and quantile based algorithm were carried out background correction and normalization to eliminate the influence of nonspecific hybridization . A gene - filter package was used to discard probes that did not match any genes . The expression value averaged over probes was used as the gene expression value if the gene had multiple probes . The database search tool for the retrieval of interacting genes / proteins (string, http://string-db.org/) provides a comprehensive, yet quality - controlled, collection of protein it integrates and ranks 3 types associations derived from: 1) high - throughput experimental data, 2) mining of databases and the literature, and 3) predictions based on genomic context analysis . Thus, the interactions in string provided an integrated scoring scheme with higher confidence . The data, comprising 1 048 576 interactions with combine - scores, were obtained from string database to build the ppi network . After removing self - loops and proteins without expression value, a ppi network including 9273 nodes and 58 617 highly correlated interactions (with combine - score 0.75) was constructed . Taking the intersection of the 12493 genes in e - geod-1789 and the nodes of the ppi network, we established a sub - network with 7390 nodes and 45 286 interactions . The weights of interactions reflect their reliabilities, and interactions with low scores are likely to be false - positives . Pcc is a measure of the correlation between 2 variables, whose values ranged from 1 to + 1 . In this experiment, the pcc of a pair of genes (a and b), which encoded the corresponding paired proteins (u and v) interacting in the ppi network, was defined as: where n was the number of samples in the gene expression data; g (a, k) or g (b, k) was the expression level of gene a or b in the sample k under a specific condition; (a) or (b) represented the mean expression level of gene a or b; and (a) or (b) represented the standard deviation of expression level of gene a or b. in this study, the pcc of a pair of proteins (u and v) was defined as equal to the pcc of their corresponding paired genes (a and b), that was pcc (u, v)=pcc(a, b). Furthermore, the pcc of each gene - gene interaction was defined as weight value of the interaction . The interactions with \|pcc(a, b)1 pcc(a, b)2\|>1 under 2 conditions were regarded as a significant difference . The module - identification algorithm was based on clique - merging, similar to that proposed for identifying complexes from ppi networks . The algorithm worked in 2 steps: firstly, all maximal cliques from the ppi networks of normal and disease were selected out, respectively; and secondly, the cliques were ranked according to their weighted density and merged or removed highly overlapped cliques . The score of a clique c was defined as its weighted density: where w (u, v) was the weight of the interaction between u and v calculated using fast depth - first method . There might be thousands of maximal cliques in a ppi network and many of them overlapped with one another . To reduce the result size merging highly overlapped cliques to form bigger, yet still dense, subgraphs was also desirable since complexes were not necessarily fully connected and ppi data might be incomplete . The inter - connectivity between 2 cliques was used to determine whether 2 overlapped cliques should be merged together . The weighted inter - connectivity between the non - overlapping proteins of c1 and c2 was calculated as follows: given a set of cliques ranked in descending order of their score, denoted as {c1, c2,..., ck}, the clustering based on maximal cliques (cmc) algorithm removed and merged highly overlapped cliques as follows . For every clique ci, if there existed a clique cj such that cj had a lower score than ci and \|ci cj \|/\|cj \| overlap - threshold (to), where overlap - threshold was a predefined threshold for overlapping . Then, we calculated the weighted inter - connecting score of different nodes in the 2 cliques . If such cj existed, then the interconnectivity score between ci and cj was used to decide whether to remove cj or merge cj with ci . If inter - score (ci, cj) merge - threshold (tm), then cj was merged with ci to form a module; otherwise, cj was removed . In this study, the overlap - threshold was set to 0.5 and merge - threshold was set to 0.25 ., tm} be the sets of modules identified from the networks normal and disease, respectively . For each si s, the module correlation density was calculated as follows: the correlation densities for disease modules t were calculated similarly . We built a similarity graph m=(vm, em), where vm={s t}, and em={(si, tj): j(si, tj) tj, cc(si, tj)}, whereby j(si, tj)=\|si, tj\|/\|si tj\| was the jaccard similarity and cc(si, tj) = \|dcc(si) dcc(tj)\| was the differential correlation density between si and tj . Next, the disrupted module pairs t(si, tj) were identified by finding the maximum weight matching in m, and we ranked them in descending order according to their differential density cc . The module pairs (disrupted module pairs) of whose tj 2/3 and cc 0.05 were considered to be distinct modules . Kegg is an effort to link genomic information with higher - order functional information by computerizing current knowledge on cellular processes and by standardizing gene annotations . In this study, the david for kegg pathway enrichment analysis was carried out to further investigate the biological functions of genes in altered modules from normal controls and chd in ds patients . The threshold values of p - value <0.001 and gene count> 5 were used in this study . A total of 12 493 genes of normal and chd in ds were obtained after data preprocessing, then intersections between these genes and string ppi network were investigated, and re - weighted ppi networks of normal and disease were identified . It was clear that the numbers of interactions, as well as average scores (weights), were roughly equal in normal and disease ppi networks, both of them with 45 286 interactions and with average score of 0.776 . When the interaction correlation arranged 1.0~0.8, 0.5~0.5 and 0.9~1.0, the number of interactions in normal was higher than that in chd; however, in other conditions the number of interactions in normal was lower . Examining these interactions more carefully, we found that scores of 23 951 interactions in the disease network were lower than in the normal network, but 21 335 interactions were higher than these of normal . We extracted those with score changes> 1.0 in 2 conditions, which included 886 interactions . Based on david, when the threshold of p - value <0.001 was used, they mainly were enriched in 14 biological process terms . The pathways of oxidative phosphorylation (p=1.09e-14), alzheimer s disease (p=8.94e-12), huntington s disease (p=3.85e-11), parkinson s disease (p=5.34e-11), and focal adhesion (p=3.02e-10) showed the most significant enrichment . We used a clique - merging algorithm to identify disrupted or altered modules from normal and disease ppi networks . With the threshold of nodes> 5, a total of 8102 maximal cliques were identified for module analysis . As we performed comparative analysis on normal and disease modules to understand disruptions of the module level (table 1), we found that the total number of modules was the same under the 2 conditions, which both contained 674 modules . The average module sizes and module correlation density across the 2 conditions were roughly the same . It was obvious that there was no significant difference between the distribution of modules in normal and disease groups . Next, when the threshold was tj=2/3 and cc=0.05, we obtained 348 disrupted module pairs . In comparison of the module correlation density of the module pairs, we found that there were 188 modules showing higher correlation in normal than in disease groups, and 160 modules showing lower correlation in normal than in disease groups . There was a close correlation between the character of modules and combine - scores of the nodes . The intersection of the interactions contained in the disrupted modules with nodes whose difference values were significantly changed (> 1) was selected out . Pathway analysis based on these genes these genes were enriched in 33 terms (p<0.001), of which focal adhesion (p=1.10e-12), cell cycle (p=2.02e-09), pathways in cancer (p=1.16e-08), small cell lung cancer (p=3.91e-08), and renal cell carcinoma (p=8.77e-08) were the 5 most significant disrupted pathways . To further clarify the specific differences between disrupted modules, gene compositions of the modules were analyzed and compared . It was not difficult to find that in disease modules, there were 315 genes missed and 267 genes added compared with normal modules; a total of 137 genes were the intersection of the missed and added genes . Pathway analysis based on these genes was conducted separately . As missed genes, they mainly enriched in 22 terms (p<0.001), in which ecm - receptor interaction (p=3.27e-27), focal adhesion (p=3.86e-24), purine metabolism (p=3.98e-15), cell cycle (p=1.58e-14), oocyte meiosis (p=5.21e-11), and dilated cardiomyopathy (p=2.79e-10) were the most significant pathways . Added genes were mainly enriched in 16 terms (p<0.001), in which focal adhesion (p=1.06e-18), ecm - receptor interaction (p=5.30e-18), and purine metabolism (p=2.85e-08) were the most significant pathways . For the intersection of the missed and added genes, they mainly enriched in 14 terms (p<0.001), in which ecm - receptor interaction (p=1.10e-21), focal adhesion (p=2.38e-19), dilated cardiomyopathy (p=4.62e-11), and purine metabolism (p=2.68e-10) were the most significant pathways . In comprehensive analyses conducted on the results of the 3 kegg pathway analyses, we found that ecm - receptor interaction, purine metabolism, focal adhesion, and dilated cardiomyopathy were the most significant pathways . A venn diagram of 3 sets of pathway terms showed there were 10 common terms in the 3 conditions (figure 3). Furthermore, we performed analysis on the missed and added frequency of these genes in disrupted disease modules (table 3). We found that the missed and added frequency of several genes was more than 20 in both missed and added conditions, including nem5, nem7, polr2c, gucy1b3, npr2, gucy1a2, ctps2, npr1, ctps1, nem6, and polr2d . Pathway analysis showed that nem5, nem7, polr2c, gucy1b3, npr2, gucy1a2, npr1, and polr2d were all enriched in pathway of purine metabolism . The most frequent gene that appeared in the added disease modules was adcy8, was enriched in the pathway of dilated cardiomyopathy . A total of 12 493 genes of normal and chd in ds were obtained after data preprocessing, then intersections between these genes and string ppi network were investigated, and re - weighted ppi networks of normal and disease were identified . It was clear that the numbers of interactions, as well as average scores (weights), were roughly equal in normal and disease ppi networks, both of them with 45 286 interactions and with average score of 0.776 . When the interaction correlation arranged 1.0~0.8, 0.5~0.5 and 0.9~1.0, the number of interactions in normal was higher than that in chd; however, in other conditions the number of interactions in normal was lower . Examining these interactions more carefully, we found that scores of 23 951 interactions in the disease network were lower than in the normal network, but 21 335 interactions were higher than these of normal . We extracted those with score changes> 1.0 in 2 conditions, which included 886 interactions . Based on david, when the threshold of p - value <0.001 was used, they mainly were enriched in 14 biological process terms . The pathways of oxidative phosphorylation (p=1.09e-14), alzheimer s disease (p=8.94e-12), huntington s disease (p=3.85e-11), parkinson s disease (p=5.34e-11), and focal adhesion (p=3.02e-10) showed the most significant enrichment . We used a clique - merging algorithm to identify disrupted or altered modules from normal and disease ppi networks . With the threshold of nodes> 5, a total of 8102 maximal cliques were identified for module analysis . As we performed comparative analysis on normal and disease modules to understand disruptions of the module level (table 1), we found that the total number of modules was the same under the 2 conditions, which both contained 674 modules . The average module sizes and module correlation density across the 2 conditions were roughly the same . It was obvious that there was no significant difference between the distribution of modules in normal and disease groups . Next, when the threshold was tj=2/3 and cc=0.05, we obtained 348 disrupted module pairs . In comparison of the module correlation density of the module pairs, we found that there were 188 modules showing higher correlation in normal than in disease groups, and 160 modules showing lower correlation in normal than in disease groups . There was a close correlation between the character of modules and combine - scores of the nodes . The intersection of the interactions contained in the disrupted modules with nodes whose difference values were significantly changed (> 1) was selected out . Pathway analysis based on these genes these genes were enriched in 33 terms (p<0.001), of which focal adhesion (p=1.10e-12), cell cycle (p=2.02e-09), pathways in cancer (p=1.16e-08), small cell lung cancer (p=3.91e-08), and renal cell carcinoma (p=8.77e-08) were the 5 most significant disrupted pathways . To further clarify the specific differences between disrupted modules, gene compositions of the modules were analyzed and compared . It was not difficult to find that in disease modules, there were 315 genes missed and 267 genes added compared with normal modules; a total of 137 genes were the intersection of the missed and added genes . Pathway analysis based on these genes was conducted separately . As missed genes, they mainly enriched in 22 terms (p<0.001), in which ecm - receptor interaction (p=3.27e-27), focal adhesion (p=3.86e-24), purine metabolism (p=3.98e-15), cell cycle (p=1.58e-14), oocyte meiosis (p=5.21e-11), and dilated cardiomyopathy (p=2.79e-10) were the most significant pathways . Added genes were mainly enriched in 16 terms (p<0.001), in which focal adhesion (p=1.06e-18), ecm - receptor interaction (p=5.30e-18), and purine metabolism (p=2.85e-08) were the most significant pathways . For the intersection of the missed and added genes, they mainly enriched in 14 terms (p<0.001), in which ecm - receptor interaction (p=1.10e-21), focal adhesion (p=2.38e-19), dilated cardiomyopathy (p=4.62e-11), and purine metabolism (p=2.68e-10) were the most significant pathways . In comprehensive analyses conducted on the results of the 3 kegg pathway analyses, we found that ecm - receptor interaction, purine metabolism, focal adhesion, and dilated cardiomyopathy were the most significant pathways . A venn diagram of 3 sets of pathway terms showed there were 10 common terms in the 3 conditions (figure 3). Furthermore, we performed analysis on the missed and added frequency of these genes in disrupted disease modules (table 3). We found that the missed and added frequency of several genes was more than 20 in both missed and added conditions, including nem5, nem7, polr2c, gucy1b3, npr2, gucy1a2, ctps2, npr1, ctps1, nem6, and polr2d . Pathway analysis showed that nem5, nem7, polr2c, gucy1b3, npr2, gucy1a2, npr1, and polr2d were all enriched in pathway of purine metabolism . The most frequent gene that appeared in the added disease modules was adcy8, was enriched in the pathway of dilated cardiomyopathy . In the present study, by integrating ppi and gene - expression data, we performed a systematic identification and comparison of modules across normal and disease conditions, and identified 348 altered modules . It was not difficult to find that in disease modules, 315 genes were missed and 267 genes were added compared with normal modules and the intersection of the missed and added were 137 genes . In pathway analysis conducted based on these genes separately, we found that ecm - receptor interaction, purine metabolism, focal adhesion, and dilated cardiomyopathy were the most significant pathways . In cell biology, focal adhesions are large macromolecular assemblies through which mechanical force and regulatory signals are transmitted between the extracellular matrix (ecm) and an interacting cell . More precisely, focal adhesions are the sub - cellular structures that mediate the regulatory effects (i.e., signaling events) of a cell in response to ecm adhesion . The cytoplasmic side of focal adhesions consists of large molecular complexes that link transmembrane receptors, such as integrins, to the actin cytoskeleton and mediate signals modulating cell attachment, migration, proliferation, differentiation, and gene expression . At the molecular level, focal adhesions are formed around a transmembrane core of an integrin heterodimer, which binds to a component of the extracellular matrix (ecm) on its extracellular region, constitutes the site of anchorage of the actin cytoskeletons to the cytoplasmic side of the membrane, and mediates various intracellular signaling pathways . Gene function enrichment analysis indicated that dscam was enriched in ecm - receptor interaction and focal adhesion . Purine metabolism refers to the metabolic pathways that synthesize and break down purines, that are present in many organisms . Interestingly, individuals with ds have elevated purine levels in bodily fluids, hypothesized to be due to trisomy of gart and resultant increased synthesis of purines . Uric acid, hypoxanthine, and xanthine it was reported that the levels of hypoxanthine and xanthine in ds children were significantly lower than in healthy children, which increased conversion of hypoxanthine and xanthine to uric acid with subsequent free radical - dependent oxidation of uric acid to allantoin, and potentiated the mechanisms by the oxidative stress in ds . As we performed analysis on the frequency of genes appearing in the intersection of the missed and added genes, we found that the higher frequency of genes mainly enriched in the pathway of purine metabolism, and the most frequent gene that appeared in the added disease modules was adcy8, which is enriched in the pathway of dilated cardiomyopathy . Cardiomyopathy comprises a diverse group of heart - muscle disorders, which are further subdivided on the basis of their anatomic and hemodynamic findings . It was reported that gene mcip1, a direct association with the catalytic domain of calcineurin, was encoded by dscr, which resides within the ds critical region of human chromosome 21 . Forced expression of a constitutively active form of calcineurin in hearts of transgenic mice promotes cardiac hypertrophy that progresses to dilated cardiomyopathy, heart failure, and death, in a manner that recapitulates features of human disease . In recent years, a wide variety of methods to reverse - engineer transcriptional regulatory networks from microarray data have been developed . Module - based methods, such as weighted correlation network analysis, the context likelihood of relatedness algorithm and the learning module networks algorithm, assume a modular structure of the transcriptional regulatory network, with genes subject to the same regulatory input being organized in co - expression modules . However, none of the methods mentioned above can systematically track the disrupted modules . For example, the sample size was not large enough to affect the conclusions to some degree . Although disadvantages exist, we believe that this method and the predicted significant pathways offer investigators valuable resources for not only better understanding the mechanisms of chd in ds, but also detecting the novel underlying pathway biomarkers as well as drug targets for chd in ds therapy . Our analyses revealed that 348 altered modules were identified by comparing modules in normal and disease ppi network . Based on pathway functional enrichment analysis of disrupted module genes, we successfully identified the 4 most significantly altered pathways: ecm - receptor interaction, purine metabolism, focal adhesion, and dilated cardiomyopathy . Therefore, we predicted that these pathways might be good indicators for chd in ds.
Any variation in root canal morphology should be recognized before or during root canal treatment . An untreated canal, which a clinician fails to detect, may be a cause of failure . Various methods to assess the internal anatomy of root canal systems are: (i) conventional radiographs (ii) canal staining and tooth clearing (iii) plastic resin injection (iv) digital and contrast medium enhanced radiographic techniques (v) sectioning (vi) in vitro microscopic examination (vii) computed tomography (ct) techniques (vii) micro - ct and (viii) cone beam ct (cbct). Cbct was developed in the late 1990s by italian and japanese groups to produce undistorted three - dimensional images of the teeth and their surrounding tissues . It helps in visualizing the number of root canals and their convergence or divergence from each other . The principle goal of endodontic therapy is to retain every functional component of the dental arch, including third molars . When reviewing the literature regarding root and canal morphology using the pub med database (national library of medicine), there were no studies on the root canal morphology utilizing cbct images of permanent maxillary third molar in indian population . The aim of this study was to investigate the root canal morphology of maxillary third molars and to evaluate the number of roots and canals and classify them according to vertucci . 9000c 3d, 70 kvp, 10 ma, 36 s scan time, 10.8 s exposure time, 5 cm diameter5 cm height scan volume, france) images of 325 patients who presented at a private clinic for various dental problems in bhopal between june 2011 and march 2015 was done . All cbct image was observed and evaluated for the presence and absence of maxillary third molars . The scans were produced by a technician according to the manufacturer's recommended protocol using a minimum field of view of 40 mm 40 mm or 60 mm 60 mm and lowest dose radiation . The cbct images were analyzed with the inbuilt cs3d imaging software (nnt) in a hp workstation (hp compaq le 1911) with a 19 inch hp led screen with a resolution of 1280 1024 pixels on a dual monitor . The images were visually enhanced by adjusting contrast, brightness and grey scale using the image processing tool in the software to ensure better visualization . Three endodontists and a trained technician concurrently evaluated all the images to reach an agreement in the interpretation of the radiographic findings . Type of canal configuration, presence of extra root and numbers of canals were evaluated using the nnt toolbar by carefully rolling downward through the images from the pulp chamber to the root apex at the axial tomographic slices . The images were rotated in the entire axis, and slices were taken in all the three planes, coronal, sagittal, and axial planes to confirm the findings . (ii) third molars with no periapical lesions; (ii) no endodontic treatment performed (ii) no root canals with open apices, resorption or calcification; and (iii) the cbct images of good quality . The teeth with root canal fillings, restorations, posts, or crowns were excluded from the study . The final sample group included data from 116 patients (66 males and 50 females). Following information from the individual images was recorded (i) the number of roots and their morphology; (ii) the number of canals per tooth; (iii) the canal configuration in each root using vertucci's classification; and (iv) the frequency of additional roots and the frequency of c - shaped canals in the third molars . Frequency and percentage of variables were calculated using statistical package for social sciences (spss v.21.0, ibm, armonk, new york) version 21.0 and data was further analyzed by pearson chi - square test and fisher's exact test . 56.9% of the teeth belong to males, and 43.1% were of females, 43.1% were of right side, and 56.9% were of the left side . Maximum maxillary third molars (n = 116) had three root (55.2%) followed by one root (31.0%) and two roots (13.0%). Analysis of number of canals revealed that maximum number of maxillary third molars had 3 canals (37.9%) followed by 04 canals (24.1%) and 1 canal (19%), 3.4% of teeth had 5 canals . In single rooted maxillary third molar, vertucci type i (47.1%) was predominant . Most of the double - rooted teeth have vertucci type i (42.9%) and type iv (42.9%) in buccal root and type i in the palatal root (62.5%). Mesiobuccal root of three - rooted maxillary third molars had type i (43.8%) and type iv (40.6%), distobuccal root and palatal root had type i (87.5% and 100%), respectively [table 1]. Vertucci classification of canals in maxillary third molars comparison of vertucci classification revealed that type i was prevalent in both males and females in single rooted maxillary third molars, and the difference was statistically significant . The percentages of other vertucci types in males were type iv (14.3%), v (28.6%), and vi (14.3%) and in females were type ii (30.0%) and type iii (20.0%). In double - rooted teeth, buccal root had type i (75%) predominant in males as compared to females where type iv (66.7%) was predominant . In distobuccal root, vertucci type i was predominant in both males (85.7%) and females (90.9%) [table 2]. Vertucci classification of canals in maxillary third molars according to gender when vertucci classification of canals in maxillary third molars was compared between the right and left side of the oral cavity, it showed that in single rooted teeth type i was predominant in both the sides . Type v classification was observed in 28.6% of right side single rooted teeth whereas in left side 20% were type iii, 10% were and type iv . Chi - square test showed a significant difference between the right and left side of the oral cavity . In double - rooted maxillary third molar, vertucci type i and type iv was predominant in left side whereas on the right side type i, type ii, and type iv were equally present, and the difference was not statistically significant . In three - rooted maxillary third molars in mesiobuccal root, vertucci type iv (46.7%) was predominant on right side as compared to left side whereas type i (58.8%) were predominant, and the result was statistically significant (p = 0.013). In distobuccal root on both sides, these variations in the root canal morphology are thought to be racially and genetically determined . Therefore, it is necessary to investigate variations in tooth anatomy and their characteristic features in different racial groups . The multiplanar cbct scans obtained from axial sections of 116 maxillary third molars revealed that frequency of three - rooted maxillary third molars was maximum (55.2%) followed by one root (31.0%) [figure 1] and two roots (13.8%). Similar results were observed in burmese population by clearing technique where 51% of teeth had three separate roots, and 49% had fused roots . A study conducted by ng et al . In the same population using canal staining and tooth clearing technique showed 25% had three roots, and 31% had fused roots . Cone beam computed tomography image showing two canals in single rooted third molar in the present study, maximum maxillary third molars showed 3 canals (37.9%) followed by 4 canals (24.1%) [figures 2 and 3] and 1 canal (19%). The majority of palatal (100%) and distobuccal (96%) roots possessed one canal (type i). According to literature, vertucci type i was more common in distobuccal root (98.1%) and palatal root (100%). Cone beam computed tomography image of maxillary third molar showing vertucci v configuration cone beam computed tomography image showing maxillary third molar with mb2 mesiobuccal root shows considerable morphological variations in vertucci classification . A conventional radiograph can detect only 55% of mb2 due to the superimposition of anatomic structures in a buccolingual plane which fail to detect small structural density changes . Stropko found 20.0% of third molars had mb2, whereas it was 37% in a study done by green . The prevalence of mesiobuccal roots with two canals molars was 39% with vertucci type ii and type iv configurations . Study conducted on maxillary molars in south asian indian population using clearing technique showed that mesiobuccal roots of maxillary third molars exhibited 57.4% had type i, 32% had type ii, 2.1% had type iii, 8.5% had type iv, and 1% had type v canal anatomy . In this study, single rooted maxillary third molars, the palatal root of double - rooted maxillary third molars, and all three roots of a triple rooted maxillary third molars in buccal root of double - rooted maxillary teeth, the most common type was vertucci type i and type iv . A similar retrospective study in mandibular molars in a turkish population using cbct showed that majority of mandibular molars were two rooted with three canals . Mesial roots had more complex canal systems with more than one canal, whereas most distal roots had a type i configurations . Gender predilection for the prevalence of vertucci type showed that vertucci type i was predominant in single rooted teeth in both males and females . Topological predilection of vertucci classification revealed that three rooted maxillary third molars showed mesiobuccal root vertucci type iv (46.7%) predominant on right side in mesiobuccal root as compared to left side whereas type i (58.8%) were predominant and the result was statistically significant (p = 0.013). Prevalence of c - shaped canals in maxillary third molars was 3.4% in this study [figures 4 and 5]. According to sidow et al ., 4.67% were identified in maxillary third molars (all of them were double - rooted). Cone beam computed tomography image showing c - shaped canal in maxillary third molar cone beam computed tomography image of sagital view of c - shaped canal cbct offer high - resolution isotropic images which helps in identification of canals which is not possible in conventional radiograph if canal cortication is lost . It offers three - dimensional geometric accuracy compared with conventional radiographs without superimposition of anatomical structures where data can be reoriented in their true spatial relationships . However, consideration to use cbct should only be done when the conventional periapical radiographs fail to provide adequate information about the area of interest, as cbct views may also show some misleading findings . There was a high prevalence of three - rooted maxillary molars with three canals in central india population . Vertucci type i classification was most common in single rooted maxillary molars, distobuccal roots and palatal roots of three - rooted maxillary third molars.
Development of caries and wsls around orthodontic bands is a common occurrence following the use of fixed orthodontic appliances particularly in patients with poor oral hygiene . Demineralization occurs when specific bacterial species remain for a long time on the enamel surface . Bacterial metabolites such as organic acids dissolve the calcium phosphate mineral content of the tooth and initiate dental caries . Development of wsls as an early sign of demineralization under intact enamel is a common unfavorable occurrence in orthodontic treatment with fixed appliances and can occur within a few weeks after the treatment onset . A combination of fluoride therapy, oral health instruction and diet control has shown promising results for prevention of wsls; however, they all require patient cooperation and therefore are not reliable . Preventive strategies not requiring patient cooperation for instance, fluoride can be incorporated into cements used for banding; by doing so, the cement can act as a fluoride reservoir adjacent to teeth . Zinc phosphate cement used to be applied for cementation of orthodontic bands but, even zinc polycarboxylate caused demineralization . In the recent decades, gi cements have become increasingly popular due to favorable characteristics such as fluoride release and adhesion to tooth enamel [710]. Due to moisture susceptibility their conventional types used for molar banding have been clinically more effective for prevention of wsls compared to zinc phosphate cement [1,7, 11]. In the recent decades, addition of resin to gi cements for production of hybrid cements improved their moisture susceptibility and bond strength to tooth enamel . At present, the gold label (gc corporation, tokyo, japan) and fuji plus (gc corporation, tokyo, japan) gi cements are extensively used for cementation of orthodontic bands; however, clinical data regarding the anti - caries properties of these cements and prevention of wsls around orthodontic bands are scarce . Fuji plus is a resin reinforced, self - cure gi cement that does not cause post - operative hypersensitivity . Gold label is a gi cement modified with strontium . Due to the smaller size of particles kashani et al, in their in - vitro study in 2012 evaluated the efficacy of three cements of zinc polycarboxylate, gi and resin - modified gi (rmgi) for prevention of enamel demineralization around orthodontic bands . They showed that rmgi had the lowest microleakage and consequently caused the least demineralization among the three cements; whereas, zinc polycarboxylate caused the greatest demineralization . These results show that rmgi has a significantly greater preventive effect on enamel demineralization around orthodontic brackets . Shimazu et al, in an in - vitro study in 2013 compared retention, microleakage and fluoride release potential of three orthodontic cements (rmgi and two light - cure compomers) and showed that rmgi released significantly greater amounts of fluoride within 180 days . The tensile bond strength of this cement was significantly higher than that of the other two cements as well . Also, the microleakage of this cement was significantly lower than that of compomers . They concluded that rmgi had superior preventive effects compared to compomer cements and therefore, it is the cement of choice for orthodontic treatments requiring long - term banding of teeth . However, gillgrass et al, in a study in 2001 demonstrated that no significant difference existed between conventional gi cements and modified composites in terms of the occurrence of enamel wsls . Considering the limited number of studies available in this respect, this study aimed to compare the application of gc gold label (modified with strontium for moisture resistance) and gc fuji plus (resin reinforced) gi cements with regard to the occurrence of wsl around orthodontic bands . This randomized clinical trial was approved in the ethics committee of dental research center, shahid beheshti university of medical sciences tehran, iran and was in compliance with the ethical principles of the helsinki declaration . The study was registered in the iranian registry of clinical trials (irct201406141882n4) and written informed consent was obtained from patients . Based on previous studies (2,4,7,10,13), a total of 186 permanent first molars of 52 females and 20 males between 925 years old requiring orthodontic banding of at least two permanent upper or lower first molar teeth as part of fixed orthodontic treatment were selected . The teeth were thoroughly examined by two pediatric and orthodontic clinicians by visual inspection under dental unit light using a dental mirror and an explorer . If both examiners unanimously confirmed the absence of wsls the patient was included in the study . Then the mesial, middle and distal thirds of buccal and lingual surfaces of the teeth were examined again using diagnodent (diagnodent pen 2190, kavo, biberach, germany). The teeth with scores 013, 1420 and 2129 were considered as sound, with wsl and carious, respectively (according to diagnodent instructions). The teeth were randomly divided into three groups of six, nine and 12-month follow - ups . Orthodontic bands were placed according to renfroe . A band with the highest adaptation to tooth contour was selected and randomly cemented on the permanent right or left molar tooth using gc gold (cement a) or gc fuji plus (cement b). Patients were followed up monthly for their orthodontic treatment and were excluded from the study in case of loosening of bands or lack of cooperation at any time during the study period . All patients received the same oral hygiene instructions and the bands were removed at six, nine or 12 month follow - ups . After removal of bands, the teeth were thoroughly examined for caries or wsls by visual inspection and also by using diagnodent . The adhesive remnant index (ari) of artun and bergland was used to assess the amount of cement left on the internal band surface: 0 no adhesive remains on the internal band surface.1 less than half the adhesive remains on the internal band surface.2 more than half the adhesive remains on the internal band surface.3 the entire adhesive remains on the internal band surface . 0 one - way anova was applied for the comparison of the mean age of subjects and multivariate repeated measures anova was used for intragroup and inter - group comparisons of diagnodent scores . The kruskal wallis and the mann whitney tests were also applied for statistical analyses of the ari on the bands . Twelve teeth (four teeth in each group) were excluded from the study due to the lack of patient cooperation or not showing up for the follow up visits . The mean age of patients in the three groups of six-, nine-, and 12-months follow - ups one - way anova revealed that the three groups were not significantly different in terms of the mean age (p=0.69). Diagnodent scores before cementation of bands and after their removal are shown in tables 2 and 3 . Multivariate repeated measures anova with three intragroup and one intergroup factors showed that type of cement (p=0.56) and time of measurement (before and after cementation) (p=0.55) had no significant effect on diagnodent scores; whereas, the tooth surface (buccal and lingual) had a significant effect on diagnodent scores (p=0.03). Diagnodent scores were greater in the lingual surface in gc fuji plus in all groups . The three groups had no statistically significant difference with one another (p=0.87). Moreover, second order interaction (six months) effect of cement type and time (p=0.68), before and after cementation and time (p=0.33) and before and after cementation and cement type (p=0.95) and the third order interaction (12 months) effect of before and after cementation and time were not significant (p=0.59). Diagnodent scores (meanstandard deviation) before and after cementation (a: gold label, b: fuji plus) at the buccal surfaces in the three groups diagnodent scores (meanstandard deviation) before and after cementation (a: gold label, b: fuji plus) at the lingual surfaces in the three groups . The ari of artun and bergland was used to assess the amount of cement left on the internal band surface, which is shown in table 4 . The kruskal wallis test revealed that the ari of the bands for cements a and b was not significantly different among the three groups (p=0.38). The frequency distribution of ari of the bands for both cements in the three groups by artun and bergland a: gold label, b: fuji plus the mann whitney test revealed that the difference in ari of the bands at the three time points of six, nine and 12 months was not significant (p=0.34 for a and p=0.11 for b) between the two cements . However, the ari of the bands significantly decreased at the one - year follow up (p<0.001) for both cements . After removal of the bands, a few scattered white spots of variable sizes were detected during clinical examination by visual inspection under unit light . These lesions were observed in 21 out of 174 teeth in both groups of a and b and in both buccal and lingual surfaces (more commonly on the buccal surface and mandibular molars). Twelve teeth (four teeth in each group) were excluded from the study due to the lack of patient cooperation or not showing up for the follow up visits . The mean age of patients in the three groups of six-, nine-, and 12-months follow - ups one - way anova revealed that the three groups were not significantly different in terms of the mean age (p=0.69). Diagnodent scores before cementation of bands and after their removal are shown in tables 2 and 3 . Multivariate repeated measures anova with three intragroup and one intergroup factors showed that type of cement (p=0.56) and time of measurement (before and after cementation) (p=0.55) had no significant effect on diagnodent scores; whereas, the tooth surface (buccal and lingual) had a significant effect on diagnodent scores (p=0.03). Diagnodent scores were greater in the lingual surface in gc fuji plus in all groups . The three groups had no statistically significant difference with one another (p=0.87). Moreover, second order interaction (six months) effect of cement type and time (p=0.68), before and after cementation and time (p=0.33) and before and after cementation and cement type (p=0.95) and the third order interaction (12 months) effect of before and after cementation and time were not significant (p=0.59). Diagnodent scores (meanstandard deviation) before and after cementation (a: gold label, b: fuji plus) at the buccal surfaces in the three groups diagnodent scores (meanstandard deviation) before and after cementation (a: gold label, b: fuji plus) at the lingual surfaces in the three groups . The ari of artun and bergland was used to assess the amount of cement left on the internal band surface, which is shown in table 4 . The kruskal wallis test revealed that the ari of the bands for cements a and b was not significantly different among the three groups (p=0.38). The frequency distribution of ari of the bands for both cements in the three groups by artun and bergland a: gold label, b: fuji plus the mann whitney test revealed that the difference in ari of the bands at the three time points of six, nine and 12 months was not significant (p=0.34 for a and p=0.11 for b) between the two cements . However, the ari of the bands significantly decreased at the one - year follow up (p<0.001) for both cements . After removal of the bands, a few scattered white spots of variable sizes were detected during clinical examination by visual inspection under unit light . These lesions were observed in 21 out of 174 teeth in both groups of a and b and in both buccal and lingual surfaces (more commonly on the buccal surface and mandibular molars). These lesions were confirmed by the two pediatric and orthodontic clinicians . However, diagnodent scores were not indicative of caries . The ari of artun and bergland was used to assess the amount of cement left on the internal band surface, which is shown in table 4 . The kruskal wallis test revealed that the ari of the bands for cements a and b was not significantly different among the three groups (p=0.38). The frequency distribution of ari of the bands for both cements in the three groups by artun and bergland a: gold label, b: fuji plus the mann whitney test revealed that the difference in ari of the bands at the three time points of six, nine and 12 months was not significant (p=0.34 for a and p=0.11 for b) between the two cements . However, the ari of the bands significantly decreased at the one - year follow up (p<0.001) for both cements . After removal of the bands, a few scattered white spots of variable sizes were detected during clinical examination by visual inspection under unit light . These lesions were observed in 21 out of 174 teeth in both groups of a and b and in both buccal and lingual surfaces (more commonly on the buccal surface and mandibular molars). This study showed that no wsl detectable by diagnodent developed during the 12-month follow up with the use of cements a and b. clinical evidence shows that orthodontic bands make the teeth more susceptible to decalcification and subsequent caries . The band provides a suitable location for plaque accumulation and when the band does not properly adapt to tooth contour, the gap between the tooth and the band makes the tooth more susceptible to caries . In the present study, the bands were fitted thoroughly to the first molars and all the recommendations of renfroe were followed for banding . Moreover, after banding the fitness and retention of the bands were examined by placing a sickle probe in the band tube and exerting a tensile force to remove the band (a downward force for the upper band and an upward force for the lower band), by a clinician before cementation . Thus, use of fluoride - releasing cements in addition to topical fluoride application is effective for prevention of decalcification [5,17, 18]. In our study, fuji plus (resin - reinforced) and fuji gold label (higher moisture resistance due to smaller particle size) were used . Both of these cements are capable of releasing fluoride . In a study by shungin et al, number of white spots around gi cement kashani et al, in an in - vitro study reported that rmgi had significantly better preventive effects on enamel demineralization around orthodontic bands compared to zinc polycarboxylate and conventional gi . Shimazu et al, found that rmgi was the cement of choice for orthodontic treatments that required long - term banding of teeth due to the release of higher amounts of fluoride and higher tensile bond strength compared to compomers . In contrast, gillgrass et al . Demonstrated that no significant difference existed in the occurrence of enamel wsls between conventional gi and modified composites . Used diagnodent and scanning electron microscopy for evaluation of decalcification in teeth submitted to a simulated carious challenge by streptococcus mutans . They reported greater enamel decalcification in acid etched teeth and those received composite resin adhesive compared to the control group . Aljehani et al . Used diagnodent and quantitative light - induced fluorescence for histological quantification of enamel wsls and reported a similar diagnostic efficacy for the two methods . Our results revealed that type of cement and time of measurement (before and after cementation) had no significant effect on diagnodent scores; however, the difference between the buccal and lingual surfaces was statistically significant . Visual inspection with dental mirror and an explorer revealed wsls on 21 teeth but the diagnodent scores did not indicate caries or wsl . The observed wsls may indicate partial decalcification or a reversed demineralization cycle and its shift towards remineralization due to the release of fluoride from the understudy cements . Shungin et al . Compared gi cements and acrylic adhesives and reported that number of wsls was significantly lower in the gi cement group . In our study, the ari of the bands was not significantly different in the two groups but a significant difference was found in this respect at the 12-month follow - up . In other words, at one year, the degree of cement remnants on the bands significantly decreased . However, band loosening did not occur in any group (at each visit, the bands were examined by placing a sickle probe in the buccal tube while exerting a tensile force to ensure the band fitness and retention). In a study by dincer and erdinc, the degree of cement remnants on the bands in the gi group was greater than that in the zinc polycarboxylate group . Also, gillgrass et al . Compared modified composites and conventional gi and reported that band loosening occurred in both groups but its frequency was not significantly different between the two groups . The degree of cement remnants on the teeth was not significant and only in two cases adhesive remnants were observed on the buccal and lingual surfaces in very little amounts . Millett et al . Failed to find a significant difference between the two gi cement groups in terms of the degree of cement remnants on the teeth indicating that the cements used had a stronger bond to the band than to the tooth enamel . The teeth were carefully selected for this study and the patients who did not attend the appointments regularly were excluded from the study . Bands were selected precisely and the teeth surfaces were observed attentively . In the light of the criteria of this study and since a difference in the amount of residual cement between nine and 12 months and between six and 12 months was observed, future studies with longer follow - ups are recommended to evaluate the efficacy of such cements and their remnants on the teeth and the bands to ensure that molar teeth remain sound in longer orthodontic treatment periods . At the end of 12-month follow - up period, no significant wsls were detected by diagnodent following cementation of bands with two types of gi cements . Therefore, it seems that by using the two studied gi cements the teeth are at no risk of caries at least for 12 months.
Water deficit is responsible for the greatest crop losses worldwide and is expected to worsen, heightening international interest in drought tolerance in crops . Plant adaptation to water deficit is the result of many different physiological and molecular mechanisms that interact in a complex manner . Previous studies have shown that the plant response to water deficit stress involves numerous genes, which activate a series of physiological and biochemical processes to counteract the effects of the water - limited environment, including (1) the synthesis and accumulation of various osmoprotectants, (2) maintaining intracellular ion homeostasis via the expression of transporters, and (3) scavenging of reactive oxygen species (ros) generated as a secondary effect of water deficit by detoxification enzymes [2, 3]. In addition to these physiological and biochemical effects, regulatory systems that link the sensing and signaling of environmental stress in plants also play important roles in the response to water deficit [4, 5]. The components that control and modulate stress - adaptive pathways mainly include transcription factors and protein kinases [2, 6]. Many transcription factors belonging to different transcription factor families, such as bzip, ap2/erf, myb, nac, wrky, and zinc finger, are important regulators of the plant response to abiotic stress, and their activity can improve stress tolerance in transgenic plants [2, 3]. Moreover, these protein kinases, including calmodulin - dependent protein kinases (cdpks), mitogen - activated protein kinases (mapks), receptor protein kinases (rpks), and ribosomal protein kinases, participate in signal transduction processes in abiotic stress signaling and function as hubs in abiotic stress signaling . Lophopyrum elongatum or agropyron elongatum), a perennial species in the tribe triticeae and the genus elytrigia, shares an ancestor with common wheat [79]. This species is easily crossed with common wheat, which makes it a good source for genetic improvement of wheat . In the past several decades, a number of genes from th . Elongatum have been introduced into common wheat to improve yield and provide resistance to wheat streak mosaic virus, barley yellow dwarf virus, stripe rust [11, 12], leaf rust, fusarium head blight, and so on . Elongatum has also been used to improve tolerance to abiotic stresses, such as drought, waterlogging, and salinity, through the introduction of its chromosomes into wheat [7, 1517]. However, the genome of th . Elongatum has not yet been published, which seriously limits the identification, characterization, and development of valuable genes in this species . Recently, the development of next - generation sequencing (ngs) technologies and associated bioinformatics tools has provided a new method for transcriptomic research, that is, rna - seq . Rna - seq provides a precise way to measure transcript levels while simultaneously providing sequence information . Rna - seq is highly efficient, reliable, and cost - effective, which makes it widely used to characterize the transcriptomes of plants, particularly nonmodel plants without published reference genomes [1924]. In this study elongatum shoot and root tissues under control and water deficit stress conditions and identified a number of differentially expressed genes in response to water deficit stress . Elongatum to water deficit stress, which should greatly facilitate wheat improvement in the future . Thinopyrum elongatum (pi 531718, 2n = 14) seeds were kindly provided by grin (http://www.ars-grin.gov/), ars, us department of agriculture . The seeds were pregerminated on wet filter paper in the dark at 25c as described by placido et al . . When the coleoptiles were approximately 1 cm long, uniform seedlings were selected and transplanted to plastic pots filled with a mixture of surface soil collected from a field and washed sand . At 16 weeks after transplanting, each pot was supplied with 50 ml of water and 50 ml of half - strength hoagland solution twice weekly (irrigated four times per week). Then, 16 weeks later, the plants were randomly divided into two groups, including the control group (watered normally as described above) and the water deficit group (supplied with only 50 ml of half - strength hoagland solution twice weekly). After eight weeks of treatment, plant materials were collected from both the control and water deficit groups . All seedlings were grown in a greenhouse from march 2013 to september 2013 in harbin, china . The greenhouse temperature was between 26c and 30c, the humidity ranged from 40% to 80%, and the light period was 06:00 to 18:00, as supplied by metal halide lamp 1 kw bulbs (philips lighting). The root and shoot tissue samples were separated, cleaned quickly, frozen in liquid nitrogen, and stored at 80c for rna isolation . Frozen plant samples were ground in liquid nitrogen and total rna was extracted using one step rna reagent (bio basic inc ., canada) as per the manufacturer's protocol and purified using an rneasy plant mini kit (qiagen, valencia, ca). Total rna was quantified using a nanodrop nd-1000 spectrophotometer (thermo fisher scientific, wilmington, de, usa) and a bioanalyzer 2100 (agilent technologies, ca). Ribosomal rna depletion was carried out using a ribominus rna plant kit for rna - seq (life technologies, ca). The whole - transcriptome cdna library was prepared using an ion total rna - seq kit v2 (life technologies corporation, ca). Double - stranded cdna was ligated to barcoded adapters and sequenced by bgi - shenzhen ltd . (shenzhen, china) using an ion pi chip (ion torrent, life technologies, ca). Processing of raw data, removal of adapter sequences, base - calling, and quality value calculations were performed using torrent suite software 4.0 (ion torrent, life technologies, ca). Quality reads were obtained by trimming the raw reads at a minimum phred score of q = 20 . Rna - seq reads were first processed with fastx toolkit to remove low - quality sequences with parameters the resulting high - quality cleaned reads were assembled de novo into contigs using trinity with the parameters min_kmer_cov 2 . To remove the redundancy of trinity - generated contigs, the reads were further assembled de novo using iassembler with minimum percent identity (p) set to 97 . Blast searches of the resulting unique transcripts were performed against combined databases harboring arabidopsis, rice, maize, and brachypodium distachyon protein sequences with a cutoff e - value of 1e 5 . Gene ontology (go) terms were assigned to the assembled transcripts based on the go terms annotated to their corresponding homologs in the combined database, and the go annotation results were explored using wego . Plant transcription factors (tf) and protein kinases were identified and classified into different families (or groups) using the itak pipeline (http://bioinfo.bti.cornell.edu/tool/itak/). Elongatum transcripts using the bowtie program, allowing one mismatch . Following the alignments, raw counts for each transcript and in each sample were derived and normalized to reads per kilobase of exon model per million mapped reads (rpkm). Differentially expressed genes (fold changes 2 or fold changes 0.5 and adjusted p value 0.001) between normal and water deficit stress conditions were identified with the edger package . Go terms enriched in the set of differentially expressed genes affected by water deficit stress were identified using the topgo package . Elongatum at the transcriptome level, we performed whole genome transcriptome sequencing of shoots and roots collected from control and water deficit - stressed plants using the ion proton platform . After removing low - quality, adaptor, and barcode sequences, a total of 39,273,796 reads all raw and processed data were submitted to the ncbi database (accession numbers: srx729803 and srx729805 - 07). De novo assembly of these high - quality cleaned reads generated 169,990 unique transcripts with an average length of 550.5 bp; the longest transcript was 10,851 bp long . Elongatum unique transcripts were annotated by blast analysis against the combined databases, including arabidopsis, rice, maize, and brachypodium distachyon protein sequences, revealing a total of 81,061 (47.9%) unique transcripts with significant hits . Consistent with previous reports, the results show that the percentage of genes that could be annotated was positively correlated with the length of the genes, as shown in figure 1 . The short transcripts were annotated to fewer targets, and the longer transcripts generated more hits . Among these unique transcripts, 59,704 (35.1%) were assigned to at least one go term in three main categories, that is, biological process, molecular function, and cellular component . We further classified these unique transcripts into different functional categories, as shown in figure 2 . The result shows that metabolic process (go:0008152) was the most abundant group in the biological process category, followed by biological regulation (go:0065007), while response to stimulus (go:0050896) and response to stress (go:0006950) were also common, which is consistent with the transcriptome data collected from th . The most abundant groups included binding (go:0005488), catalytic activity (go:0003824), oxidoreductase activity (go:0016491), transferase activity (go:0016740), transporter activity (go:0005215), and transcription regulator activity (go:0030528). There were also transcripts classified into specific groups, such as antioxidant activity (go:0016209), indicating that antioxidants play an important role in trapping free radicals to protect th ., we used the itak pipeline to mine for transcription factors and protein kinases . In total, we identified 2,988 transcription factors classified into 77 different families and 3,154 protein kinases classified into 85 different families from among the th . These tfs belong to many families that play important roles in the plant response to abiotic stress, such as c2h2, c3h, wrky, myb, snf2, bzip, bhlh, nac, aux / iaa, ap2-erebp, ccaat, and mads . The protein kinases were classified into legume lectin domain kinase, leucine rich repeat kinase, duf26 kinase, s domain kinase, gmpk6/atmrk1 family, cdpk, snrk, mapk family, and so on . These protein kinases broadly participate in the regulation of gene expression, while protein kinases involved in the plant response to abiotic stress, especially the cdpk and mapk families [35, 36], were also highly abundant in our transcriptome dataset . To estimate possible differences in transcript sequences between th . Elongatum and wheat, a blastn search was performed against the wheat transcript sequences from iwgsc . Elongatum had significant matches with wheat transcripts, most with high identity percentages, as shown in figure 4 . Elongatum - specific genes, which could be beneficial for wheat improvement . Using the edger bioconductor package elongatum shoot and root tissue, respectively, while 122 transcripts were differentially expressed in both tissues, shown as figure 5 . Among these transcripts, 2,690 were induced by water deficit stress in root tissue, while 914 were repressed in roots . Go terms were assigned to all 4,782 differentially expressed transcripts, and enrichment analysis for go annotation was performed using the topgo package; the results are shown in table s1 in supplementary material available online at http://dx.doi.org/10.1155/2015/265791 . As expected, go terms in the biological process category were highly enriched, including go:0050896 (response to stimulus), go:0009628 (response to abiotic stimulus), go:0006950 (response to stress), go:0009651 (response to salt stress), and go:0006970 (response to osmotic stress), which is consistent with previous reports in other plants . Meanwhile, go terms in the molecular function category, such as go:0005507 (copper ion binding), go:0016491 (oxidoreductase), go:0016209 (antioxidant), go:0004784 (superoxide dismutase), go:0022857 (transmembrane transporter), and go:0005215 (transporter), were also highly enriched under water deficit stress in th . Elongatum, indicating that the antioxidant and transport systems play important role in protecting plants from damage due to environmental stress . The results show that shoots and roots have different ways of responding to water deficit stress, as shown in figure 6 . In shoots, however, compared to shoot tissue, some transcripts were more abundant in roots, including those in the categories across cell wall, lipids, antioxidant (including ascorbate, glutathione, and opp), and sucrose metabolism . Meanwhile, transcripts in the categories abiotic stress (20.2) and ascorbate and glutathione (21.2) were highly enriched, which is consistent with the go annotation results . We analyzed the expression of transcripts in these two categories based on transcriptome data, revealing that most of these transcripts were induced under water deficit stress, as shown in figure 7 . In plants, roots are often able to continue growing under water deficit stress in order to seek deeper water resources, while shoot elongation is completely inhibited due to a decline in photosynthesis . In this study, rna - seq technology was utilized to compare the shoot and root transcriptomes of th . We identified a total of 4,782 differentially expressed transcripts . Among these water deficit - responsive genes, 3,604 were detected in roots, while 1,300 were detected in shoots and only a few (122) were expressed in both roots and shoots, which is consistent with previous reports in maize and cotton [37, 38]. Placido et al . Examined the role of the brassinosteroid gene regulatory network in root development, finding that the drought tolerance of common wheat was improved through introgressing an alien chromosome segment from th . Elongatum . In the current study, we identified three differentially expressed transcripts involved in brassinosteroid metabolism and the brassinosteroid - mediated signaling pathway in th . Elongatum (thun007188, thun021506, and thun006380), which is consistent with the transcripts detected in wheat by placido et al . . We also found that go categories go:0044036 (cell wall macromolecule metabolic process, nine of 50 differentially expressed transcripts) and go:0048364 (root development, six of 45 differentially expressed transcripts) were enriched in root tissues, which is consistent with the fact that brassinosteroids promote cell wall loosening, root elongation, and root development to mitigate the effect of water deficit stress on plant growth . Elongatum to water deficit stress, since we identified 47 differentially expressed tf genes . In plants, the bhlh tf directly regulates the ga and ja signaling pathways to induce the initiation of trichomes, which act as barriers to protect plants from water loss . Indeed, in this study, we identified 12 differentially expressed bhlh tf genes, including 10 expressed in shoots and three expressed in roots (with one expressed in both tissues). Moreover, nine transcripts involved in ja and ga metabolism were also differentially expressed in shoots compared to two in roots . These results suggest that the modulation of the ga and ja signaling pathways by bhlh in shoots helps protect th . In addition to bhlh, other tfs reported to be involved in plant responses to abiotic stress, such as ap2/erbp (9) [40, 41], myb (8) [4244] (6), and wrky (6), were also differentially expressed under water deficit stress, confirming that they play crucial roles in regulating transcription processes under water deficit stress . Ros are produced in plant tissues due to the partial reduction of oxygen, for example, in the photosynthetic and respiratory electron chains, and their levels increase dramatically under environmental stress . However, as ros can cause cellular damage, they are scavenged (and generated) by oxidoreductases . Therefore, the homeostasis of ros is determined by interactions between the ros - producing and ros - scavenging pathways in plants . Ros play important roles as signaling molecules that modulate many pathways, for example, mapk cascades, and influence the activity of tfs under water deficit stress . Based on the transcriptome data, we identified 28 differentially expressed transcripts that are related to ros metabolism, most of which were induced by water deficit stress, as shown in figure 7 . These transcripts were mainly classified into two highly represented go categories, oxidoreductase activity and antioxidant activity, which were identified by topgo analysis . These genes encode enzymes including oxidoreductase, ascorbate, tocopherol, and glutathione, all of which scavenge harmful ros to protect th . Elongatum from cellular damage [20, 49]. However, the detailed mechanisms of ros metabolism are unknown . Additional studies are needed to fully elucidate the complex interactions of ros metabolism under water deficit stress . Elongatum shoots and roots that were differentially expressed in response to water deficit stress, with three times as many transcripts in roots as in shoots . These transcripts are mainly involved in the response to stress, signal transduction, transcriptional regulation, ros metabolism, and so on, especially the regulation of root development under water deficit . Elongatum adapt to water stress, and their introduction into cultivated wheat may improve the water deficit tolerance of this crop in the future.
Sudden hearing loss is a devastating disease for patients and represents a true otologic emergency . The etiologies of sudden hearing loss are many, but only about 1015% of cases have an identifiable cause . Oral steroids have been effective in many patients and currently represent the standard treatment for idiopathic sudden sensorineural hearing loss (issnhl) [24]. Intratympanic steroids (itss) may treat issnhl more effectively than oral steroids [512]. Data to support this hypothesis are limited almost exclusively to case series, which differ in the type of steroid used, the steroid dose, the dose frequency, the method of injection, the existence of previous treatment with oral steroids, and the outcome measurements . In addition, these studies do not specifically address the timing of the posttreatment audiogram in determining treatment success . We reviewed our experience with its, which included an analysis of the timing of post - treatment audiograms . In doing so we sought to determine if there is a different recovery rate depending on when audiograms are performed after completing its treatment . Most cases of sudden hearing loss are idiopathic not because they do not have a cause but because we are unable to identify it . We presumed that any group of idiopathic hearing loss patients is a heterogeneous one with variable response to steroids and a variable time course to recovery including both early and late responders . After obtaining institutional board approval, we performed a retrospective chart review of all patients undergoing its injection at our tertiary referral center from october 2001 to july 2008 . To be included in the study, patients had to have a sensorineural hearing loss of at least 30 db in 3 contiguous frequencies occurring in less than 72 hours . Serologic studies included an erythrocyte sedimentation rate, lyme titer, anti - nuclear antibody titer, rheumatoid factor, and a fluorescent treponemal antibody absorption (fta - abs) study . Patients were evaluated for pure - tone thresholds and speech intelligibility both before and after steroid injection . The pure - tone average (pta) was calculated as an average of thresholds measured at 0.5, 1.0, and 2.0 khz . Speech - discrimination scores (sdss) were calculated as the percent of phonetically balanced, monosyllabic words pronounced correctly . First, phenol was applied topically to anesthetize the posterior inferior quadrant of the tympanic membrane (the area overlying the round window niche). Approximately 0.3 to 0.5 ml of 40 mg / ml methylprednisolone mixed 9: 1 with 2% lidocaine was then delivered through the myringotomy via a 25 gauge spinal needle . The patients were then instructed to maintain their head turned 45 away from the injected ear in a reclined position for 30 minutes and were encouraged not to swallow if possible . Injections were repeated at approximately one - week intervals for a total of 3 injections (3 injections over approximately 15 days). Statistical analysis was performed using microsoft excel version 2002 (redmond, wa) and sas version 9.2 (sas institute inc, cary, north carolina). Improvement was defined as an improved pure - tone average 20 db or speech - discrimination score 20% . The variables evaluated included time to post - treatment audiogram, age, gender, sidedness of hearing loss, days from onset to its treatment (> 14 days), prior treatment with oral steroids, presence of vertigo, and presence of tinnitus . The primary covariate of interest was the time to post - treatment audiogram which was dichotomized at 5 weeks (35 days) after the first dose of its . Since expected cell counts were greater than five for all covariates, chi - square tests were used to determine the association between categorical patient characteristics and improvement and t - tests were used for continuous characteristics . Logistic regression was used to estimate adjusted odds ratios and 95% confidence intervals for variables which were found to be significant . Variable selection for the model was based on the significance (at 0.05 level) of univariate associations with improvement . During the study period, 172 series of injections were performed in 151 patients with 60 patients diagnosed with issnhl . Of those 60, 13 were excluded due to insufficient data, and 7 were excluded because they did not have at least a 30 db hearing loss in 3 contiguous frequencies; therefore, a total of 40 patients were included in the review . The average number of days from the onset of hearing loss to the initiation of its was 22.7, with a nearly equal distribution of patients starting treatment less than 2 weeks (15), between 2 to 4 weeks (12), and greater than 4 weeks (13) after the onset of hearing loss . Pta decreased an average of 17 db from pre- to post - treatment (95% ci: 24, 11; p <0.001) and sds increased an average of 12% (95% ci: 2, 21; p = 0.02; table 3). Patients with serviceable hearing (defined as a sds 50% and a pta 50 db) increased from 7/40 (17.5%) prior to its to 15/40 (37.5%) after its . The average number of days that an audiogram was performed was 33.2 days after the first steroid injection . Patients who had audiometric testing more than 35 days (5 weeks) after the first dose of its were more likely to demonstrate hearing improvement than those who received testing earlier (69% versus 33%; p = 0.03). The number of days from hearing loss to starting its was not significantly different between patients who had an audiogram at more than 5 weeks or less than 5 weeks after the first dose of its (p = 0.32). Regression analysis was performed to determine if either the days from hearing loss to the audiogram or the days from starting its to the audiogram were significant (figure 1). Neither the days from hearing loss to audiogram (r = 0.087, d.f . = 39, p = 0.06) nor the days from its to audiogram (r = 0.0005, d.f . = 39, p = 0.89) were significant, although the former demonstrated a trend toward a lesser likelihood of improvement with a longer duration of hearing loss to audiogram . Patients who received its 21 days after sudden hearing loss were more likely to improve than those who had a treatment delay of> 22 days (50% versus 38%, p = 0.02); see also figure 2 . Patients experiencing vertigo were more like to improve than patients who did not (65% versus 35%; p = 0.03). No other patient characteristics were significantly associated with improvement . After adjusting for vertigo, patients who had testing more than 5 weeks after the first dose of its were 6.7 times more likely to show improvment than patients who had earlier testing (95% ci: 1.3, 35; p = 0.02) and patients with vertigo were 6.2 times more likely to improve than patients who did not experience vertigo (95% ci: 1.3, 29; p = 0.02), as shown in table 5 . Patients with vertigo (12/40) started treatment an average of 18 days after the onset of hearing loss while patients who did not experience vertigo with their hearing loss started treatment an average of 32 days after the onset of hearing loss (p = 0.07, paired t - test). Our data are similar to other reviews of its with regard to demographics of issnhl and response rate to its; however, our review differs in that it specifically addresses the timing of post - treatment audiograms when assessing treatment response . Most other reviews report post - treatment audiograms as taking place during a certain range of weeks or months after treatment has concluded, with all patients falling within that stated range . A few studies have reported the use of serial audiograms during or immediately after the completion of treatment with its . The greatest response to treatment was 7 days after the first injection with a steadily decreasing steroid effect thereafter . There were significant differences between the pta after the first and third injection, corresponding to 7 and 21 days after treatment began . Also performed serial audiograms after intratympanic dexamethasone was administered twice a week for 2 weeks . Audiograms were performed after each injection and found a similar response early, with the greatest response in 35.8% of ears after the first injection, 14.7% after the second, and 11.8% after the third; however, choung also performed an audiogram 1 week after the final injection . There was an increased response rate from 11.8% on day 14 to 20.6% on day 21 . Whether or not this increased response represents a significant delayed response to treatment is uncertain . The studies of guan - min and choung provide valuable information regarding the early response to treatment with its but do not address the response to treatment that may occur several weeks after the completion of treatment . Reviewed their experience with oral steroids where audiograms were performed on average 44 days after hearing loss . A subset of those patients had an additional audiogram 4 months (average) after the onset of hearing loss for comparison . A statistically significant improvement in the pta was found between the 44-day audiogram to the second post - treatment audiogram . Battaglia et al . Performed a double - blinded, placebo - controlled, randomized study with patients receiving either intratympanic dexamethasone and an oral placebo, high - dose oral steroids and intratympanic saline, or intratympanic dexamethasone and high - dose oral steroids . Treatment was administered once a week for 3 weeks with serial audiograms and an additional audiogram performed 4 weeks after the initial injection . Although not discussed in their paper, the data suggest an increased probability of improvement in all 3 groups when comparing the audiograms from immediately after treatment with those performed at least 4 weeks after the initial injection . A statistical analysis was not performed on this particular aspect of the data . By definition, issnhl is from an unknown etiology and is a result of multiple unknown causes . Within this heterogeneous group, there may also be a number of patients who are recovering spontaneously, regardless of steroid therapy . This has been reported to be somewhere between 31% and 65% [2, 3, 15, 16]. Nevertheless, the timing of the audiogram will determine the observed response; therefore, when reporting results of idiopathic hearing loss, studies should, at the least, report when the audiograms were performed . Ideally, a series of audiograms should be administered during and after treatment to document the timing of treatment response . This will identify early versus late responders and may provide important clues to the etiology of hearing loss . It may also have implications with regard to the determination of the length of treatment . Another possibility to explain the late effect of its is how long it may affect inner ear cells . Intratympanic methylprednisolone has been detected in the perilymph and endolymph in guinea pigs for a fairly short duration; it achieves its highest concentration at 1 - 2 hours and is present for at least 6 hours, but it is no longer detectable at 24 hours . Despite the brief existence of steroids within the inner ear fluid, the effect may be more durable and has not yet been determined . Steroids effect gene expression in cochlear cells to alter both inflammatory processes and ion homeostasis [19, 20]. A delayed effect of treatment may well be via a mechanism that takes greater than 3 weeks to demonstrate a measurable response . Vertigo is often cited as a poor prognostic indicator for sudden hearing loss mostly due to large reviews performed prior to its in the 1970s and 1980s [15, 21, 22]. Most recent studies involving its have reported that vertigo is not a significant prognostic indicator [57, 13, 23] while reports of vertigo as a negative prognostic indicator are the minority . We found a significantly higher rate of response to its in patients who presented with vertigo . It has been our experience that when patients experience vertigo with their sudden hearing loss, they are much more likely to seek prompt medical evaluation and are more likely to be referred to a tertiary referral center . We believe that it is the shorter interval between hearing loss and the start of treatment in patients with vertigo (18 days to treatment) versus those who did not (32 days to treatment) that best explains this result in our series . Like other reviews, our data are limited by not having serial audiograms, which would better define when our patients responded to treatment . It is possible that the patients in our group who had audiograms> 5 weeks after the first dose of its responded sooner, which would have been detected if their audiograms had been performed earlier . However, our data differ from the currently reported data in that they show recovery occurring late, rather than early . In addition, our study highlights an area of its that is still yet to be defined: the timing of post - treatment audiograms in assessing treatment response . Our observed response of a significant number of patients showing improvement when audiograms were performed> 5 weeks after the first dose of its is contrary to the idea that response to treatment occurs early after starting treatment . To better define when to perform post treatment audiograms and to attempt to stratify patients with issnhl as early or late responders, studies should report when audiograms are administered and should ideally have multiple audiograms to monitor response.
Metabolic syndrome (ms) is a combined expression of the characteristics of metabolic disorders including hypertension, insulin resistance, obesity, dyslipidemia, which increase the risk of developing type 2 diabetes mellitus, renal diseases, and cardiovascular disease . Adult ms is prevalent, with an incidence rate of 20 - 30% in most countries . Among various biologic markers, the homeostatic model assessment insulin resistance index (homa - ir) and gamma - glutamyl transferase (ggt) levels are the most strongly related to ms; levels of high - sensitivity c - reactive protein, cystatin c, uric acid, and alanine aminotransferase (alt) have also been associated with ms . In addition, some studies have reported a relationship of unduly acidic urine (ph <5.5) with obesity, diabetes mellitus, and insulin resistance, which are components of ms . Another study reported an inverse correlation between urine ph and the number of ms components, and a recent cohort study proposed a low level of urine ph as both a causative factor and a predictive factor for the development of ms . However, in these studies, influential factors affecting metabolic disease, such as smoking, alcohol consumption, and exercise, were not considered . Therefore, the aim of this study was to identify the relation between a low urine ph and ms after controlled for other covariates including demographic and lifestyle factors in adult korean population using a nationally representative sample . The subjects and data were obtained from the fifth korea national health and nutrition examination surveys (knhanes v-1), a cross - sectional and nationally representative survey with a stratified, multistage, probability sampling design conducted by the korea centers for disease control and prevention in 2010 . The knhanes consisted of the health interview survey, health examination, and nutrition survey . Detailed information regarding the design of the survey has been reported previously . In brief, the fifth (2010 - 2012) knhanes were conducted annually using a rolling sampling design . The target population of the survey was noninstitutionalized civilians older than 1-year in south korea . Sampling units were defined based on geographic area, gender, and age group using the household registries from the national census registry . A total of 10,938 people from 3840 households in 192 national districts were randomly sampled and 8473 (77.5% of the target population) participated in the survey, respectively . Among adults aged> 19 years who fasted for> 8-h before undergoing a urine test, those with a known history of renal failure, those with a serum creatinine level 1.2 mg / dl, and those who were pregnant were excluded from the survey . A total of 4662 adults (1960 men and 2702 women) were included in this study . Sociodemographic characteristics, medical and surgical histories, medication history, anthropometric data, blood and urine tests and nutritional data were examined . Smoking status was subcategorized into never smoker, former smoker, and current smoker, and drinking status was subcategorized into drinking alcohol and not . Alcohol drinking was indicated as yes for participants who consumed at least one glass of alcohol every month over the last year . Regular exercise was defined as moderate occupational or physical activities (slow - paced swimming; playing doubles tennis, volleyball, badminton, or table tennis; and carrying light objects for> 30 min 5 times / week) or vigorous occupational or physical activities (jogging, climbing a mountain, fast - paced cycling or swimming, playing football or basketball, jumping rope, playing squash, playing singles tennis, and carrying heavy objects for> 20 min 3 times / week). Height and weight were measured down to the first decimal place, and body mass index (bmi) was calculated as body weight (kg) divided by the square of height (m). Using a tape measure waist circumference (wc) was measured from the half - way point between the lower line of the last rib and the upper line of the iliac crest when a subject exhaled and was measured down to the first decimal place . Blood pressure (bp) was measured 3 times with an interval of 30 s after resting for 5 min in a sitting position . The final bp was defined as the average bp of the second and third bp measurements . The samples were kept in a refrigerator once they were processed and delivered to the central laboratory in seoul . Measurement of fasting glucose, total cholesterol, triglyceride (tg), high - density lipoprotein cholesterol (hdl - c), low - density lipoprotein cholesterol (ldl - c), alt, and ggt levels was performed using an enzyme technique (hitachi automatic analyzer 7600, hitachi, japan). Blood urea nitrogen (bun) was measured with a kinetic ultraviolet method and creatinine was measured with a colorimetric method . Insulin level was measured with a radioimmunoassay using a 1470 wizard gamma - counter (perkinelmer, finland). Homa - ir was calculated as (fasting plasma insulin [u / ml] fasting plasma glucose [fpg] [mg / dl])/(22.5 18.182). The quantitative insulin - sensitivity check index (quicki) was calculated as 1/(log fasting insulin [u / ml] + log fasting blood sugar [mg / dl]). The early morning midstream urine was collected for urine chemistry following an 8-h fasting period and analyzed using an automated urine dipstick analyzer (urisys 2400, roche, germany). The analysis of nutritional values, including total calories, protein, fat, fiber, and sodium was performed by trained dietitians on the basis of the individuals 24-h dietary recall method . Metabolic syndrome was defined according to the 2005 american heart association / national heart, lung, and blood institute (aha / nhlbi) and international diabetes federation (idf) criteria . The wc thresholds for the definition of abdominal obesity in koreans taking into account the complex sampling design of the knhanes, to minimize selection errors, the results were estimated with consideration for the primary sampling unit and stratification variables and sampling weights . Descriptive data were expressed as the mean value (standard error) or number (%). The independent t - test was employed for analysis of continuous variables and the chi - square test for analysis of categorical variables . The differences in general characteristics, sociodemographic parameters, dietary parameters, anthropometric parameters, general characteristics of the group with urine ph <5.5 and the group with urine ph 5.5, biochemical results, and risk factors for ms were analyzed according to variables using the independent t - test and chi - square test . Multiple logistic regression was used for the analysis of relative risk factors of those with urine ph <5.5 compared with those with urine ph 5.5 . Age and sex were primarily adjusted, and bun, smoking status, drinking status, and regular exercise were secondarily adjusted for the analysis . Data were analyzed using spss version 18.0 for windows (spss inc ., chicago, il, usa). The subjects and data were obtained from the fifth korea national health and nutrition examination surveys (knhanes v-1), a cross - sectional and nationally representative survey with a stratified, multistage, probability sampling design conducted by the korea centers for disease control and prevention in 2010 . The knhanes consisted of the health interview survey, health examination, and nutrition survey . Detailed information regarding the design of the survey has been reported previously . In brief, the fifth (2010 - 2012) knhanes were conducted annually using a rolling sampling design . The target population of the survey was noninstitutionalized civilians older than 1-year in south korea . Sampling units were defined based on geographic area, gender, and age group using the household registries from the national census registry . A total of 10,938 people from 3840 households in 192 national districts were randomly sampled and 8473 (77.5% of the target population) participated in the survey, respectively . Among adults aged> 19 years who fasted for> 8-h before undergoing a urine test, those with a known history of renal failure, those with a serum creatinine level 1.2 mg / dl, and those who were pregnant were excluded from the survey . A total of 4662 adults (1960 men and 2702 women) were included in this study . Sociodemographic characteristics, medical and surgical histories, medication history, anthropometric data, blood and urine tests and nutritional data were examined . Smoking status was subcategorized into never smoker, former smoker, and current smoker, and drinking status was subcategorized into drinking alcohol and not . Alcohol drinking was indicated as yes for participants who consumed at least one glass of alcohol every month over the last year . Regular exercise was defined as moderate occupational or physical activities (slow - paced swimming; playing doubles tennis, volleyball, badminton, or table tennis; and carrying light objects for> 30 min 5 times / week) or vigorous occupational or physical activities (jogging, climbing a mountain, fast - paced cycling or swimming, playing football or basketball, jumping rope, playing squash, playing singles tennis, and carrying heavy objects for> 20 min 3 times / week). Height and weight were measured down to the first decimal place, and body mass index (bmi) was calculated as body weight (kg) divided by the square of height (m). Using a tape measure waist circumference (wc) was measured from the half - way point between the lower line of the last rib and the upper line of the iliac crest when a subject exhaled and was measured down to the first decimal place . Blood pressure (bp) was measured 3 times with an interval of 30 s after resting for 5 min in a sitting position . The final bp was defined as the average bp of the second and third bp measurements . The samples were kept in a refrigerator once they were processed and delivered to the central laboratory in seoul . Measurement of fasting glucose, total cholesterol, triglyceride (tg), high - density lipoprotein cholesterol (hdl - c), low - density lipoprotein cholesterol (ldl - c), alt, and ggt levels was performed using an enzyme technique (hitachi automatic analyzer 7600, hitachi, japan). Blood urea nitrogen (bun) was measured with a kinetic ultraviolet method and creatinine was measured with a colorimetric method . Insulin level was measured with a radioimmunoassay using a 1470 wizard gamma - counter (perkinelmer, finland). Homa - ir was calculated as (fasting plasma insulin [u / ml] fasting plasma glucose [fpg] [mg / dl])/(22.5 18.182). The quantitative insulin - sensitivity check index (quicki) was calculated as 1/(log fasting insulin [u / ml] + log fasting blood sugar [mg / dl]). The early morning midstream urine was collected for urine chemistry following an 8-h fasting period and analyzed using an automated urine dipstick analyzer (urisys 2400, roche, germany). The analysis of nutritional values, including total calories, protein, fat, fiber, and sodium was performed by trained dietitians on the basis of the individuals 24-h dietary recall method . Metabolic syndrome was defined according to the 2005 american heart association / national heart, lung, and blood institute (aha / nhlbi) and international diabetes federation (idf) criteria . The wc thresholds for the definition of abdominal obesity in koreans were determined as 90 cm for men and 85 cm for women . Taking into account the complex sampling design of the knhanes, to minimize selection errors, the results were estimated with consideration for the primary sampling unit and stratification variables and sampling weights . Descriptive data were expressed as the mean value (standard error) or number (%). The independent t - test was employed for analysis of continuous variables and the chi - square test for analysis of categorical variables . The differences in general characteristics, sociodemographic parameters, dietary parameters, anthropometric parameters, general characteristics of the group with urine ph <5.5 and the group with urine ph 5.5, biochemical results, and risk factors for ms were analyzed according to variables using the independent t - test and chi - square test . Multiple logistic regression was used for the analysis of relative risk factors of those with urine ph <5.5 compared with those with urine ph 5.5 . Age and sex were primarily adjusted, and bun, smoking status, drinking status, and regular exercise were secondarily adjusted for the analysis . Data were analyzed using spss version 18.0 for windows (spss inc ., chicago, il, usa). The general characteristics of the subjects are shown in table 1 . In total, 1960 the average age was 44.9 years and the mean bmi was 23.6 kg / m . The mean fpg was 96.3 mg / dl and the mean urine ph was 5.7 . Fasting insulin, total cholesterol, and ldl - c levels were not statistically different between men and women (p> 0.05). Baseline characteristics of study subjects the group with urine ph <5.5 and the group with urine ph 5.5 were compared for multiple parameters including sociodemographic, dietary, anthropometric, kidney function, and metabolic parameters [table 2]. No statistically significant difference in age and sex was observed between those with urine ph <5.5 and those with urine ph 5.5 . No differences in alcohol consumption, regular walking, as well as calories, protein, fat, fiber, and sodium consumption were observed between the groups . Conversely, significant differences in smoking and regular exercise were observed between the groups (p = 0.001 and p = 0.032, respectively). Characteristics of study variables by urine ph the bmi of those with urine ph <5.5 was higher than that of those with urine ph 5.5 (p = 0.038); however, no difference in abdominal circumference and bp was observed . Bun levels differed significantly between the groups; however, no significant difference in creatinine levels and creatinine clearance were observed between the groups . The fasting glucose level, insulin level, and homa - ir of subjects with urine ph <5.5 were higher than subjects with urine ph 5.5 (p <0.001, p = 0.005, and p <0.001, respectively), but the quicki was significantly lower (p <0.001). The group with urine ph <5.5 showed a high ggt level (p = 0.014). No significant difference in ldl - c level was observed between the groups; however, the hdl - c level was lower and the tg level was higher in the group with urine ph <5.5 (p <0.001 and p <0.001, respectively). Applying both aha / nhlbi and idf criteria, ms was more prevalent in subjects with urine ph <5.5 than subjects with urine ph 5.5 (p = 0.001 and p = 0.005, respectively) [table 3]. In the group with urine ph <5.5, 24.3% had abdominal obesity, which was more than the percentage of the group with urine ph 5.5 (21.3%; p = 0.036), and 26.3% of those with urine ph <5.5 had an abnormal fasting glucose level (fasting glucose 100 mg / dl or medication), which was more than the percentage of the group with urine ph 5.5 (22.8%; p = 0.016). The percentage with high tg levels was also significantly higher in the group with urine ph <5.5, with 33.9% having an abnormal value (p <0.001). No differences in metabolic components for elevated bp and low hdl - c were observed between the groups . Prevalence of ms and its components by urine ph the crude odds ratio (ors), age - and sex - adjusted ors (model 1), and multivariable - adjusted ors (model 2) for ms and the components of ms by urine ph status are shown in table 4 . After adjusting for age, sex, smoking status, drinking status, regular exercise, and bun level, the or for the presence of ms in the group with urine ph <5.5 was 1.350 (95% confidence interval [95% ci], 1.158 - 1.573, p <0.001) using aha / nhlbi criteria or 1.304 (95% ci, 1.082 - 1.572, p components, elevated fasting glucose (or = 1.231, 95% ci: 1.058 - 1.433, p = 0.007), reduced hdl - c (or = 1.195, 95% ci: 1.013 - 1.409, p = 0.035), and elevated tg level (or = 1.389, 95% ci: 1.189 - 1.623, p <0.001) showed significantly high ors . Or of ms and its components by urine ph the general characteristics of the subjects are shown in table 1 . In total, 1960 the average age was 44.9 years and the mean bmi was 23.6 kg / m . The mean fpg was 96.3 mg / dl and the mean urine ph was 5.7 . Fasting insulin, total cholesterol, and ldl - c levels were not statistically different between men and women (p> 0.05). Baseline characteristics of study subjects the group with urine ph <5.5 and the group with urine ph 5.5 were compared for multiple parameters including sociodemographic, dietary, anthropometric, kidney function, and metabolic parameters [table 2]. No statistically significant difference in age and sex was observed between those with urine ph <5.5 and those with urine ph 5.5 . No differences in alcohol consumption, regular walking, as well as calories, protein, fat, fiber, and sodium consumption were observed between the groups . Conversely, significant differences in smoking and regular exercise were observed between the groups (p = 0.001 and p = 0.032, respectively). Characteristics of study variables by urine ph the bmi of those with urine ph <5.5 was higher than that of those with urine ph 5.5 (p = 0.038); however, no difference in abdominal circumference and bp was observed . Bun levels differed significantly between the groups; however, no significant difference in creatinine levels and creatinine clearance were observed between the groups . The fasting glucose level, insulin level, and homa - ir of subjects with urine ph <5.5 were higher than subjects with urine ph 5.5 (p <0.001, p = 0.005, and p <0.001, respectively), but the quicki was significantly lower (p <0.001). The group with urine ph <5.5 showed a high ggt level (p = 0.014). No significant difference in ldl - c level was observed between the groups; however, the hdl - c level was lower and the tg level was higher in the group with urine ph <5.5 (p <0.001 and p <0.001, respectively). Applying both aha / nhlbi and idf criteria, ms was more prevalent in subjects with urine ph <5.5 than subjects with urine ph 5.5 (p = 0.001 and p = 0.005, respectively) [table 3]. In the group with urine ph <5.5, 24.3% had abdominal obesity, which was more than the percentage of the group with urine ph 5.5 (21.3%; p = 0.036), and 26.3% of those with urine ph <5.5 had an abnormal fasting glucose level (fasting glucose 100 mg / dl or medication), which was more than the percentage of the group with urine ph 5.5 (22.8%; p = 0.016). The percentage with high tg levels was also significantly higher in the group with urine ph <5.5, with 33.9% having an abnormal value (p <0.001). No differences in metabolic components for elevated bp and low hdl - c were observed between the groups . The crude odds ratio (ors), age - and sex - adjusted ors (model 1), and multivariable - adjusted ors (model 2) for ms and the components of ms by urine ph status are shown in table 4 . After adjusting for age, sex, smoking status, drinking status, regular exercise, and bun level, the or for the presence of ms in the group with urine ph <5.5 was 1.350 (95% confidence interval [95% ci], 1.158 - 1.573, p <0.001) using aha / nhlbi criteria or 1.304 (95% ci, 1.082 - 1.572, p = 0.005) using the idf criteria . Among ms components, elevated fasting glucose (or = 1.231, 95% ci: 1.058 - 1.433, p = 0.007), reduced hdl - c (or = 1.195, 95% ci: 1.013 - 1.409, p = 0.035), and elevated tg level (or = 1.389, 95% ci: 1.189 - 1.623, p <0.001) showed significantly high ors . Or of ms and its components by urine ph in this cross - sectional study, we suggested that urine ph <5.5 is associated with ms . Among ms components, elevated fasting glucose and elevated tg showed a significantly high or . It is known that urine ph decreases with aging, with a high protein diet and low fiber diet, and when renal function is deteriorated . In addition, another study showed that increased fatty acid provision associated with low urine ph . However, the results of this study show that age, protein intake, lipid intake, and fiber intake did not affect urine ph, although smoking status and the regular exercise did affect urine ph . Considering the difference of serum bun levels between the groups, we believed that our failure to present the influence of a high protein diet resulted from our failure to perform an accurate assessment of eating habits because we used a 24-h recollection survey for diet assessment . The acid - base balance of urine is regulated according to production and excretion of nh3, a urinary buffer . In patients with insulin resistance, production of nh3 from proximal tubules is reduced and ammonia excretion is also reduced accordingly, resulting in low urine ph . In addition, in patients with insulin resistance, sodium absorption is increased because of hyperinsulinemia, which also lowers urine ph . Insulin resistance in subjects with ms is believed to be associated with a lower urine ph; this is supported by the strong relation between hyperglycemia and urine ph presented in this study . The current findings are consistent with those from previous studies . In a study of 148 people who did not have urolithiasis or renal failure, using 24-h urine collection, a negative correlation was observed between blood glucose, systolic bp, triglyceridemia, and urine ph, and a positive correlation was observed between serum hdl - c level and urine ph . In another study conducted in 1503 male subjects, a low urine ph showed an association with greater wc; insulin resistance; and levels of fasting glucose, glycosylated hemoglobin, serum tg, and hdl - c . In the above - mentioned study, bp was not associated with a low urine ph value, and this result was reconfirmed in this study . In this study, this was believed to be due to various unmeasured confounding factors affecting urine ph that were modified before the results were deducted . A recent retrospective cohort study conducted in japan reported that a low urine ph is a causative factor for the development of ms . However, important confounding variables related to the prevalence of ms, such as smoking habit, alcohol intake, and dietary habit, were not investigated in this study . To the best of our knowledge, this is the only study examining the association between urine ph and ms after controlled for other covariates including demographic and lifestyle factors . The urine ph test, using a urine dipstick, is regarded as a relatively simple and noninvasive method, and risk factors for ms should be assessed if urine ph <5.5 . The first is that the nutritional assessment was performed using a 24-h dietary recall method . In this study, after review of the results of another study examining changes in urine ph according to diet, we believe that the relation between diet and urine ph should be examined using a more accurate nutritional assessment . The second limitation is the absence of information regarding urolithiasis . The third limitation is that spot urine samples were used instead of 24-h urine samples . However, it is known that spot urine ph was correlated with 24-h urine ph and fasting early morning samples were used in this study . We identified urinary ph using urine dipstick analyzers, and it is another limitation because this test method is limited to determine the exact level of urine ph . The final limitation is that this study was conducted as a cross - sectional study; therefore, the order of the incidence between a low urine ph and ms cannot be clearly identified . Despite these limitations, our findings are significant because this is a large - scale study including representative korean adults . This large scale cross - sectional study confirmed the association between low urine ph and ms in the korean population . All authors have assisted in preparation of the first draft of the manuscript or revising it critically for important intellectual content . All authors have read and approved the content of the manuscript and confirmed the accuracy or integrity of any part of the work.
A 14-year - old, spayed female domestic shorthair cat was evaluated because of a right adrenal mass . The referring veterinarian had started treatment for hypokalemia and systemic arterial hypertension . During the initial evaluation the cat was atrophy of the contralateral adrenal and an exaggerated response of cortisol to stimulation with adrenocorticotropic hormone suggested hypersecretion of cortisol . After surgery, clinical signs of hypercortisolism, hyperaldosteronism and hyperprogesteronism were no longer observed, and neither potassium supplementation nor antihypertensive treatment were needed . In cases with an adrenocortical tumor, clinicians should investigate whether the tumor hypersecretes glucocorticoids, mineralocorticoids, sex steroids or combinations of these . Hypersecretion of more than one adrenal hormone may occur in a cat with an adrenocortical tumor . A 14-year - old, 4.02 kg, spayed female domestic shorthair cat was referred to the oncology service at the university of florida small animal hospital with an 8 month history of increased vocalization, urination, food and water intake, and two episodes of hematuria . The referring veterinarian identified a right adrenal mass (3.57 cm 2.71 cm) on ultrasound (figure 1), and cytology of the mass was consistent with adrenocortical tumor . At the time of presentation, the cat was being medicated with amlodipine (1.5 mg po q24h) for hypertension and with a potassium supplement (tumil - k powder 4 meq po q24h) for hypokalemia . A sagittal ultrasonographic image of the right adrenal gland showing a mass (3.57 cm 2.71 cm) of mixed echogenigity at presentation the cat was alert and responsive . Physical examination revealed tachycardia (220 beats / min) with a gallop rhythm and synchronous femoral pulse . The cat had a cardiovascular consult, which revealed no abnormalities (including hypertrophy). Capillary refill time was <2 s and the respiratory rate was 35 breaths / min . A pendulous abdomen, prominent dermal blood vessels and muscle atrophy along the epaxial muscles were observed . A complete blood count showed mild neutrophilia (13 10/l; reference interval [ri] 2.39.8 10/l) and lymphopenia (0.43 10/l; ri 0.95.5 10/l). Serum biochemical abnormalities included hyperglycemia (171 mg / dl; ri 70140 mg / dl), mild decrease in alanine aminotransferase activity (27 u / l; ri 3283 u / l), and normal potassium (3.9 meq / l; ri 3.55.0 venous blood gas analysis was consistent with a metabolic alkalosis (ph 7.341, hco3 29.2 mmol / l) with respiratory compensation (partial pressure of carbon dioxide 53.4 mmhg). Subsequent venous blood gas analyses were in the normal range for cats . Computed tomography of the abdomen and thorax identified the left adrenal gland <5 mm and the right adrenal gland as a 3.8 3.2 2.8 cm mass, which caused ventromedial deviation of the vena cava, as well as caudal displacement of the right renal artery and vein (figure 2). (a) coronal, (b) axial and (c) sagittal planes an adrenocorticotropin hormone stimulation test (acth - st) was performed . The baseline cortisol concentration was 6.59 g / dl (ri 0.85.0 g / dl) and 1 h postcortisol concentration was 20.0 g / dl (ri 3.610.0 g / dl). A blood sample was submitted to the university of tennessee for measurement of adrenal sex hormone concentration . The endocrinology panel showed an increased concentration of aldosterone (> 1376 ng / ml; ri 11.3294.3 ng / ml) and progesterone (2.59 ng / ml; ri 0.030.40 ng / ml). Normal levels of 17 oh progesterone (0.12 ng / ml; ri 0.080.20 ng / ml), androstenedione (0.20 ng / ml; ri 0.10.3 ng / ml) and testosterone (0.02 ng / ml; ri 0.020.30 ng / ml) were observed; estradiol concentration was 27.3 pg / ml (ri 50.384.0 pg / ml) and cortisol was 2.1 ng / ml (reference range 5.254.4 ng / ml). A presumptive diagnosis of a cortisol, aldosterone and progesterone co - secreting tumor of the right adrenal gland was made . With no signs of macroscopic metastasis or vena cava invasion the calcium channel blocker (amlodipine) and the potassium supplement were discontinued immediately prior to surgery . General anesthesia was induced with propofol (6 mg / kg iv) and was maintained with isoflurane and fentanyl in 100% oxygen . Postoperative analgesia was maintained with methadone (0.3mg / kg iv q4h) and buprenorphine (0.1 mg / kg iv q6h). A dose of dexamethasone (1 mg / kg iv) was slowly administered during surgery . A right adrenalectomy was performed without complications; the adrenal mass seemed encapsulated and it was closely associated with the vena cava . The phrenicoabdominal vein was doubly clipped and transected; the tumor was excised with a combination of blunt dissection and electrocautery . No gross metastasis was observed to other abdominal organs and the left adrenal gland was considered grossly atrophied . Anisocytosis and anisokaryosis are mild to moderate, and one mitotic figure was observed in ten 400 fields . Postoperative therapy consisted of intravenous (iv) fluid therapy (lactated ringer s solution at 10 ml / h), methadone (0.3 mg / kg iv q36h), amoxicillin and clavulanic acid (15 mg / kg iv or po q12h) and one dose of desoxycorticosterone pivalate (docp; 2 mg / kg sc). Twenty - four hours after surgery, venous blood gas analysis (ph 7.411) and blood pressure (90 mmhg) were in the normal range . Serum biochemical was unremarkable (blood glucose 134 mg / dl [ri 70140 mg / dl]; potassium 3.54 meq / l [ri 3.55.0 meq / l]; sodium 154.9 meq / l [ri 148156 meq / l]; creatinine 1.6 mg / dl [ri 1.02.1 mg / dl]; blood urea nitrogen 37 mg / dl [ri 1740 mg / dl]). An acth - st was performed, which showed a baseline cortisol concentration of <0.1 g / dl (ri 0.85.0 g / dl), and 1 hour postcortisol concentration was 0.146 g / dl (ri 3.610.0 g / dl), indicating a need for corticosteroid supplementation . The cat received one dose of docp (2.2 mg / kg sc) and oral administration of prednisolone solution (0.2 mg / kg q12h) was started as the cat was eating and drinking . The cat was discharged 4 days after surgery, with an improved attitude and appetite . On the day of discharge serum meq / l), normal systolic blood pressure (115 mmhg) and normal venous blood gas analysis (ph 7.406). The owner was instructed to start oral potassium supplementation and to maintain oral prednisolone . Over the following 2 weeks, the cat showed progressive clinical improvement with normal food intake and a good activity level at home . Three weeks after surgery, potassium supplementation was discontinued as serum potassium concentration was consistently within the ri (between 4.1 and 4.5 mmol / l; ri 3.55.8 nmol / l) and aldosterone concentration was less than the ri (112 pmol / l; ri 194338 pmol / l), and prednisolone were gradually tapered down and it was discontinued . Eighteen months after surgical removal of a hormone - secreting adrenal cortical tumor the cat is doing well . All laboratory values in both us and international system of units are shown in table 1 . Laboratory results in both us and international units before and after adrenalectomy ri = reference interval; wbc = white blood cells; alt = alanine aminotransferase; usg = urine specific gravity; bun = blood urea nitrogen; acth - st = adrenocorticotropin hormone stimulation test the most common cause of hyperadrenocorticism in cats is a functional pituitary tumor that secrets acth . However, cortisol - secreting adrenocortical tumors are rare in cats, and a functional adrenal tumor that secretes cortisol can also cause hyperadrenocorticism . Adrenal adenomas and adenocarcinomas are rare in cats and represent 0.2% of all cancers in this species . Most primary adrenal tumors in cats secrete aldosterone, though there are a few reports that have documented secretion of sex hormones, cortisol and co - secretion of cortisol progesterone, cortisol this report describes an unusual case of a cat diagnosed with an adrenocortical tumor secreting more than one type of steroid hormones that was successfully treated with unilateral adrenalectomy . Unfortunately, the circulating thyroxine concentration was not measured prior to adrenalectomy . However, the complete disappearance of clinical signs after adrenalectomy argue against hyperthyroidism as the cause of the clinical signs prior to adrenalectomy . Unlike in dogs, consequently, hypercortisolism does not automatically result in polyuria and polydipsia in this species . However, most, but not all, cats with hypercortisolism develop secondary diabetes mellitus, which does result in polyuria, polydipsia and polyphagia . In the present case the cat did not have diabetes mellitus . The left adrenal hypotrophy may also be consistent with a cortisol - secreting adrenocortical tumor, resulting in low pituitary acth secretion . Hypercortisolism due to an adrenocortical tumor could not be proven unequivocally because the endogenous acth concentration was not measured . In the presence of an adrenocortical tumor, even when basal cortisol concentration is low, clinical signs of hyperadrenocorticism may be seen . Aldosterone is the main mineralocorticoid hormone produced by the zona glomerulosa of the adrenal cortex . The primary function of aldosterone is to regulate blood pressure through increasing reabsorption of water and sodium, and secretion of potassium in the distal renal tubules, colon and salivary glands . In primary hyperaldosteronism, aldosterone is autonomously secreted in the adrenal cortex leading to sodium retention and systemic hypertension . Primary hyperaldosteronism can be caused by unilateral or bilateral nodular hyperplasia, adenoma or adenocarcinoma of the zona glomerulosa . Secondary hyperaldosteronism may occur in cardiac or chronic renal disease owing to overactivity of the renin the suspicion of primary hyperaldosteronism was based on finding increased serum aldosterone prior to treatment and decrease in aldosterone concentration after surgical removal of the adrenal tumor, but plasma renin activity was not measured . Cats with an adrenocortical tumor may also hypersecrete sex steroids . In the cat in this report a high serum concentration of progesterone studies have shown that high serum progesterone concentration may increase free cortisol concentrations via displacing cortisol from cortisol binding protein, resulting in hypercortisolism . Furthermore, high adrenocortical progesterone production may cause hypersecretion of mineralocorticoids, glucocorticoids and androgens because the progesterone synthesized in the adrenal cortex can be converted into these hormones . Interestingly, adrenal tumors that secrete high concentrations of serum progesterone may cause mineralocorticoid excess syndrome, even in the absence of hyperaldosteronism . In the cat discussed herein, a high serum concentration of progesterone was observed, which could also explain the high serum aldosterone concentration . In general, adrenalectomy is the treatment of choice for a non - metastatic unilateral functional adrenal tumor . In cats, after a complete removal of a functional adrenal tumor, hypokalemia and hypertension are resolved in the immediate postoperative period and no continued medical treatment is necessary . Prognosis may not be favorable for medical management alone because cats became refractory to potassium supplementation and antihypertensive drugs . However, perioperative hemorrhage has been reported as a major and frequent complication in cats with aldosterone - secreting adrenal tumors . In this cat no surgical complications were detected and correction of clinical signs and long - term survival were achieved . As described herein, hypersecretion of glucocorticoids, mineralocorticoids, sex steroids or combination of these should be considered when an adrenocortical tumor is diagnosed.
We collected 456 fecal samples from diarrheic calves (mean age 9 days, median 8 days) from 415 farms in burgundy, france, during december 2005 through september 2008 to screen for these viruses: 1 sample each was collected for 377 outbreaks; 2 and 3 samples were collected for 35 and 3 outbreaks, respectively . Reverse transcription pcr, targeting the 3 end of the polymerase gene of novsgiii and neboviruses, was done with the qiagen one step rt - pcr kit (qiagen, hilden, germany), according to the manufacturer s instructions, by using the primer sets cbecu - f / cbecu - r and nbu - f / nbu - r (2). The complete capsid gene of a selection of neboviruses was amplified by using nbcap - f3/nbcap - r primers (3). The amplified products of 532 bp, 549 bp, and 1,692 bp were sequenced by using the same primers . In addition, we collected human stool samples in burgundy and other regions of france during june 2006 through september 2008 and analyzed them for the presence of novsgiii and neboviruses . Samples included 60 samples from 21 gastroenteritis outbreaks of unknown etiology and 50 samples from 13 gastroenteritis outbreaks related to the consumption of oysters or water contaminated by human noroviruses and other enteric viruses . Among the 456 samples from cattle, 114 (25%) were positive: 89 (20%) and 34 (7%) for novsgiii and neboviruses, respectively, with 9 (2%) samples infected by both viruses . These findings corresponded to 83 and 32 outbreaks positive for novsgiii and neboviruses, respectively, among which 9 presented co - infections in the same samples . The prevalence of novsgiii in similar studies range from 4% in the netherlands (4) to 80% in michigan, usa (5). The prevalence of neboviruses in our study was similar to that reported in other countries, e.g., 8% in the united kingdom (6) and 9% in south korea (7), but lower than in ohio, usa (29%) (2). Furthermore, similar to our results, smiley et al . (2) found a predominance of novsgiii compared to nebovirus, whereas in the united kingdom and south korea the prevalence of the 2 viruses was similar (69). Sequencing and phylogenetic analyses of 89 novsgiii strains enabled them to be classified into 2 groups: 25 strains, representing 5% of the 456 specimens analyzed, were homologous to each other . They clustered with the genotype 1 reference strain bo / jena/80/de on the gene fragment analyzed (table 1, phylogenetic analyses not shown). The other 64 strains, 14% of the 456 samples, clustered with the genotype 2 reference strain bo / newbury2/76/uk (newbury agent [na] 2). Partial polymerase sequences of a selection of these strains were submitted to the genbank database under the accession nos . The high number of sequences obtained in our study allowed us to highlight the existence of 2 distinct genotypes within novsgiii, as proposed by ando et al . Furthermore, the predominance of genotype 2 observed in our study is in keeping with numerous data (2,4,8,9). One study reported similar prevalence for the 2 genotypes, with a slight predominance of genotype 2 (5). All these results suggest that genotype 1 could be a minor circulating genotype and genotype 2 the main genotype worldwide . Molecular and phylogenetic analyses of the partial polymerase region of 34 detected neboviruses revealed that 33 strains were homologous to each other and to the reference strain bo / nebraska/80/us (nebraska strain [nb]) (11) (table 2; figure 1). No strain was related to the reference strain bo / newbury1/76/uk (na1) (1,6). The same observation was made in the united states and south korea, where only nb - like neboviruses were identified (2,7). A few studies have presented data about the epidemiology of neboviruses, but it seems that na1-like neboviruses have only been identified in uk cattle (1,6). The 34th strain of our study, bo / dijona216/06/fr, was not related to nb or na1 and appeared on a quite separate branch of the neboviruses . Nt, nucleotide; aa, amino acid . Nebovirus phylogenetic tree based on the deduced 167-aa length sequences covering the 3 end polymerase region . Possible novel strain is shown in boldface . Sequence alignments and clustering were performed by the unweighted - pair group method by using arithmetic average with bionumerics software (applied maths, sint - martens - latem, belgium). Bootstrap values calculated with 1,000 replicate trees are given at each node when> 70% . Collapsed branches are made up of the following nebovirus strains from france: * a042/06/fr, a051/05/fr, a058/05/fr, a1302/06/fr, a1432/06/fr, a3112/08/fr, a381/08/fr, a4452/08/fr, and a448/08/fr; a281/07/fr, a355/07/fr, a356/07/fr, a364/08/fr, and a365/08/fr . Partial polymerase sequences of the french nebovirus strains were submitted to the genbank database under accession nos . Gu259537gu259569 (a complete list is available from the authors .) Genbank accession nos . Of calicivirus reference strains used in this tree are the following: ay082890 (cv23-oh/00/us), ay082891 (nebraska/80/us), nc_007916 (newbury1/76/uk), af097917 (newbury2/76/uk), dq228162 (penrithc39/00/uk), dq228160 (penrith142/00/uk), dq228161 (penrith143/00/uk), dq228157 (penrith150/00/uk), dq228165 (starcross93/00/uk), and dq228164 (starcross117/00/uk). Scale bar indicates the percentage of similarities between strains . To gain more insight into the classification of neboviruses, we analyzed the complete capsid sequences of a selection of french neboviruses, including bo / dijona216/06/fr . While nb, na1, and all but 1 of the french strains were closely related (table 2; figure 2), bo / dijona216/06/fr again presented low levels of identity with reference strains and appeared on a different branch on the phylogenetic tree . To our knowledge, there is no clear definition of a nebovirus genotype based on nucleotide or amino acid sequence identities . (6) compared sequences of different nb - like and na1-like strains and showed that strains of the same polymerase genotype presented> 88% nt (> 95% aa) identity in the polymerase region, while nucleotide sequence identities among strains from distinct polymerase type were <78% (88% aa) in this region . In a study from korea, the minimum polymerase nucleotide identity between strains related to the nb - like viruses was 80.9% (84.5% aa), while these strains presented a maximum of 78.4% nt (82.8% aa) identity with na1-like strains (7). (6) showed that nucleotide sequence identities within 1 type ranged from 92% to 94% (96% to 99% aa), whereas in korea nucleotide sequence identities ranged from 85.7% to 87.7% (92.3 to 93.8% aa) (7). According to these data, bo / dijona216/06/fr appears to fall into a new genotype . This hypothesis is reinforced by the phylogenetic analysis of the amino acid sequences: bo / dijona216/06/fr clusters on a separate branch for both the polymerase and capsid regions, whereas the nb - like and na1-like viruses cluster on separate branches in the polymerase region, but together in the capsid region . Given the capsid analyses, the new nebovirus genus in the caliciviridae family should thus comprise 2 genotypes: one would include the reference strains bo / nebraska/80/us and bo / newbury1/76/uk and the second would include bo / dijona216/06/fr . This hypothesis awaits confirmation, and the complete genome of this strain is now being characterized in our laboratory . Nebovirus phylogenetic tree based on the deduced 549-aa length sequences of the complete capsid . Sequence alignments and clustering were performed by the unweighted - pair group method by using arithmetic average with bionumerics software (applied maths, sint - martens - latem, belgium). Bootstrap values calculated with 1000 replicate trees are given at each node when> 70% . Capsid sequences of the french nebovirus strains were submitted to the genbank database under the following accession nos . : gu259542 (dijona058/05/fr), fj687386 (dijona216/06/fr), gu259551 (dijona2902/07/fr), gu259553 (dijona3112/08/fr), gu259556 (dijona364/08/fr), gu259561 (dijona386/08/fr), and gu259569 (dijona448/08/fr). Genbank accession nos . Of calicivirus reference strains used in this tree are: ay082890 (cv23-oh/00/us), ay549169 (cv519-oh/02/us), ay549170 (cv526-oh/02/us), ay549171 (cv531-oh/02/us), ef528561 (ma274/04/kor), ef528564 (ma362/04/kor), ef528569 (ma729/05/kor), ay082891 (nebraska/80/us), nc_007916 (newbury1/76/uk), and af097917 (newbury2/76/uk). The existence of animal reservoirs for human novs has been suggested (4,8,12) but, to our knowledge, only mattison et al . (13) detected novsgii in fecal samples from pigs and cattle . In our study, we found no evidence of zoonotic transmission, since no novsgiii or neboviruses were detected in any samples from humans, which, for novsgiii, is consistent with the results of wolf et al . (14). 15) detected serum antibodies raised against novsgiii in humans, which suggests that novsgiii do infect humans . This study found that novsgiii are more frequent than neboviruses in diarrheic calves in france . Our results confirmed the predominance of genotype 2 novsgiii, as previously reported (2,4,8,9), and showed that nb - like viruses are the major circulating strains of neboviruses . In addition, substantial genetic diversity of neboviruses was demonstrated with the existence of a possible novel strain, which could represent a new genotype.
Aerobic exercise is consistently associated with favorable shifts in blood triglycerides and hdl - c; however, data from intervention studies [1, 2] and numerous meta - analyses [36] also support a less well - characterized and variable ldl - c lowering response to exercise training . Beyond ldl - c lowering, lipoprotein - profiling studies also suggest that high - intensity exercise training may modulate ldl particle number and size distribution patterns [7, 8]. Using a kinetic tracer approach, ficker et al . Recently shed light on the potential mechanism of ldl - c lowering in response to exercise training . They reported increased fractional ldl clearance in both hypercholesterolemic and normolipidemic individuals following a 4-month exercise program consisting of stretching, cycling, and strength training exercises . The degree of ldl - c lowering following exercise is likely dependent on multiple subject - specific factors (baseline lipid status, occurrence and extent of weight loss) and type and rigor of exercise training including schedule, frequency, and volume [3, 10]. Blood cholesterol concentrations are maintained within narrow range through complex and coordinated pathways that direct enterohepatic cholesterol absorption and synthesis, intravascular vldl remodeling, and plasma ldl clearance through the ldl receptor (ldlr) by receptor - mediated endocytosis . Transcriptional regulation of hepatic ldlr expression is classically regulated through sterol regulatory element binding protein 2 (srebp2), signaled through cellular cholesterol . Understanding of posttranscriptional ldlr regulation was significantly bolstered by the more recent discovery of proprotein convertase subtilisin / kexin type 9 (pcsk9) protein, a serine endoprotease that promotes degradation of the ldlr protein . Function / distribution studies suggest that pcks9 is synthesized and secreted predominately by the liver and initiates extracellular degradation of membrane - incorporated ldlr following direct binding, although intracellular mechanisms may also be involved . As pcsk9 is inversely related to ldl particle clearance, it is considered a potentially important biomarker of cardiovascular disease risk, intimately reflective of hepatic srebp2 expression and ldlr activity . Given the current understanding of the specific role of pcsk9 in regulating hepatic ldlr uptake and the recent report of increased fractional ldl clearance in response to exercise, there are emerging questions regarding the potential role of exercise training as a modulator of pcsk9 metabolism . Although plasma pcsk9 concentrations have been examined in response to diet [1821] and pharmaceutical [22, 23] lipid - lowering therapies, modulation of pcsk9 metabolism has yet to be examined as a potential contributing mechanism underscoring ldl - c reductions and hepatic ldl clearance in response to exercise . Therefore, the objective of this study was to examine the effects of aerobic exercise training in modulating pcsk9 abundance and hepatic sterol regulation in a high - fat - fed c57bl/6 mouse compared with untrained control animals . We hypothesized that aerobic exercise training would limit weight gain and reduce circulating pcsk9 and ldl - c, while consuming a high - fat diet . The animals used in this experiment were cared for in accordance with the guidelines established by the institutional animal care and use committee . All procedures were reviewed and approved by the animal care committee at the university at buffalo . Two - month old lean male c57bl/6 mice (taconic farms, inc .) Were randomly allocated to one of three groups for 8 weeks (table 1): (1) a low - fat - fed group (lf, 10% fat, research diets, inc . ; diet no . D12492i); a high - fat - fed group (hf, 60% fat, research diets, inc . ; diet no . D12450bi); or an hf - fed exercised group (hf + ex) that were trained 5 days / week on a treadmill (26 m / min; columbus instruments, inc . ; exer 3/6). On the first day, animals were placed in the treadmill chamber and allowed to acclimate for 20 min . Each day, animals were given a 35 min warm - up period with slow walking speeds . Training began with a pace of 10 m / min, a moderate walk - jog pace, for ~20 min . As mice became increasingly familiar with the treadmill, the velocity and duration were gradually increased until mice were able to run between 2528 m / min for 45 min . 2528 m / min is estimated to be 7580% of maximal oxygen consumption for mice . Generally, both pace and time were increased in an attempt to achieve a ~10% increase per week . Short bursts of compressed air were used to train the mice to continue their pace up to 45 minutes in duration . Mice were constantly monitored while they were on the treadmill . If a mouse required more than 4 bursts of compressed air to continue running within a minute period, the treadmill speed was reduced by ~10% . If a mouse appeared to be injured during the training, it was removed from the treadmill immediately . The hf + ex mice achieved a final grade of 5%, running 45 min / day at 26 m / min by the forty - third session . All blood and tissue samples were collected two days after the final exercise session to limit acute diet and hormonal influence . Twelve - hour fasting plasma samples were collected by cardiac puncture into heparinized tubes and separated from whole blood by centrifugation at 1,000 g for 10 min . Following the two - month treatment period, livers were removed under 3% isoflurane anesthesia and immediately frozen in liquid nitrogen for subsequent analysis . Following tissue removal plasma total cholesterol, non - hdl - c, and hdl - c were measured by enzymatic kit (bioassay systems, ehdl-100) according to the manufacturers' instructions . Commercial elisa kits were used to assess direct ldl - c (kamiya biomedical, kt-21019) and pcsk9 (r&d systems, mpc900) concentrations . Hepatic cholesterol was extracted and analyzed according to our previously published procedures [25, 26]. Approximately 500 mg of pulverized liver was spiked with -cholestane as internal standard and saponified in freshly prepared koh - methanol at 100c for 1 h. the nonsaponifiable sterol fraction was extracted with petroleum diethyl ether and dried under n2 gas . Sterol fractions were analyzed using a shimadzu gc-17a gas chromatograph fitted with a flame ionisation detector . A sac-5 capillary column (30 m 0.25 mm 0.25 mm, supelco, bellefonte, ca, usa) was used for cholesterol analyses . Nuclear and cytoplasmic enriched extracts for immunoblot analyses of srebp1c (novus biologicals, nb600 - 582), srebp2 (abcam, ab30682), pcsk9 (abcam, ab31762), and -actin (cell signaling, 8h10d10) were prepared according to our previously published procedures . Briefly, 200 mg of frozen, pulverized liver was homogenized in 10 volumes of chaps - containing buffer (40 mm hepes (ph 7.5), 120 mm nacl, 1 mm edta, 10 mm pyrophosphate, 10 mm -glycerophosphate, 40 mm naf, 1.5 mm sodium vanadate, 0.3% chaps, 0.1 mm pmsf, 1 mm benzamidine, and 1 mm dtt). Supernatant collected following centrifugation at 1,000 g for 3 min at 4c contained the cytoplasmic fraction . The pellet was washed three times with chaps buffer, centrifuged at 1,000 g for 3 min at 4c, and then resuspended in 50 l of lysis buffer and 8.3 l of 5 m nacl to lyse the nuclei . The mixture was rotated at 4c for 1 h and then centrifuged at 12,578 g for 15 min at 4c . Hepatic crude membrane for immunoblot analysis of ldlr (novus biologicals, nb110 - 57162) was prepared according to previous reported procedures . Briefly, 200 mg of pulverized, frozen liver was homogenized for 2 min with 1 ml of ice - cold homogenization buffer (10 mm tris - hcl, 250 mm sucrose, and 2 g / ml of pmsf; ph 7.5). The homogenate was then centrifuged at 1,000 g for 10 min at 4c to pellet undisrupted cells and nuclei . The collected supernatant was then centrifuged at 100,000 g for 1 hour at 4c . The resulting pellet (containing the crude membrane fraction) was resuspended in 500 l of resuspension buffer (80 mm nacl, 2 mm of cacl2, 50 mm tris - hcl, 1% triton - x-100, and 2 g / ml of pmsf; ph 7.5) and stored at 80c for future analysis . All blots were quantified using imagej (national institutes of health, bethesda, md, usa). Total rna was isolated from whole liver tissue using trizol reagent (ambion, am9738). Rna concentration and integrity were determined with spectrophotometry (260 nm) and agarose gel electrophoresis, respectively . Rna preparation and real - time rt - pcr were conducted using a one - step quantitect sybr green rt - pcr kit (qiagen, 204154) on a biorad myiq real - time pcr system according to previously established protocols . Sequences of sense and antisense primers for target and housekeeping genes were based on previously published sequences for pcsk9, ldlr, and -actin . Whole - body growth and blood lipid responses between lf, hf and hf + ex groups comparisons between hf, and hf + ex groups were conducted using a paired t - test . The association between plasma pcsk9 and non - hdl cholesterol was assessed with pearson's product moment correlation coefficients . Data were analyzed with spss 16 for mac (spss inc, chicago, il, usa). Mice that consumed an hf diet increased body weight (bw) gain (p <0.05) when compared with the lf or the hf + ex groups, expressed as endpoint bw (table 2), bw over time (figure 1(a)), and as a percent of absolute bw gain over time (figure 1(b)). Changes in bw were independent of feed intake as no difference (p> 0.05) was observed between the lf, hf, and hf + ex groups (table 2). The hf group also showed increased liver weight gain (p <0.05) when compared to the lf and the hf + ex groups (table 2). Although hf feeding increased (p <0.05) blood total, non - hdl, and ldl - c (25, 70, and 24%, resp .) Compared with the lf - fed animals, exercise training normalized hf - diet induced dyslipidemia to lf - control levels (figure 2(a)). Exercise training (hf + ex) also reduced (p <0.05) hepatic total cholesterol concentration (14%) compared with the lf group with no difference (p> 0.05) observed between the lf and hf animals (figure 2(b)). The lf feeding group was included to establish effects of high - fat feeding on body weight and blood and tissue lipid responses and as such was not included in the mechanistic gene and protein expression analysis . Compared with the hf animals, the hf + ex group demonstrated increased (p <0.05) hepatic pcsk9 mrna expression (1.9-fold of hf control) with no change observed (p> 0.05) in pcsk9 protein abundance (figures 3(a) and 3(b)). The hf + ex animals exhibited a 31% reduction (p <0.05) in plasma pcsk9 concentrations compared with the hf group (figure 3(c)). Plasma pcsk9 correlated positively with plasma ldl - c (p = 0.01, r = 0.82) and non - hdl - c (p = 0.01, r = 0.84, figure 3(d)). Although ldlr mrna expression was increased (p <0.05, 1.4-fold of hf control) in the hf + ex group compared with the hf animals (figure 4(a)), we observed no change (p> 0.05) in ldlr protein abundance in hepatic total tissue or membrane extracts between trained and untrained animals (figures 4(b), and 4(c)). Srebp1c protein abundance (cytosolic and nuclear) did not differ between the hf and hf + ex groups (figure 5(a)); however, the hf + ex group demonstrated an increase in nuclear srebp2 protein abundance (p <0.05, 1.8-fold of hf control) compared with the hf animals (figure 5(b)). Findings from this study suggest that exercise training protects against diet - induced dyslipidemia and differentially modulates the hepatic expression and circulating concentrations of pcsk9 . Hf + ex animals exhibited an increase (p <0.05) in hepatic pcsk9 mrna expression (1.9 fold of hf control) but a reduction in circulating plasma pcsk9 concentration (31%) compared with the hf - fed untrained group . Exercise training also reduced (p <0.05) hepatic cholesterol concentration (14%) and increased the expression of ldlr mrna (1.4-fold of hf control) and nuclear srebp2 protein (1.8-fold of hf control). Our results support previous reports of reductions in plasma cholesterol (total, non - hdl, and/or ldl - c) in response to aerobic exercise training in a variety of rodent models including ldlr [3437], db / db, mc4r mice, and male wistar rats . Alternatively, exercise training failed to increase hdl - c concentrations in our c57bl/6 mouse model, an effect, that is, most often associated with aerobic exercise training in humans but has been shown to be quite variable in rodents [40, 4244]. This nonresponse of hdl - c is likely model specific as c57bl/6 mice carry the majority (~70%) of plasma cholesterol in the hdl fraction and exhibit modified hdl metabolism characterized by an absence of cholesterol - ester transfer protein and a resistance to diet - induced atherosclerosis . Differences in hdl metabolism in wild - type mice have been suggested to mask the potential protective effects of exercise on hdl concentration . To our knowledge, this is the first study to demonstrate a reduction in plasma pcsk9 concentration in response to exercise training . Hf + ex mice also exhibited a coordinate upregulation of hepatic pcsk9 and ldlr mrna (figures 3(a) and 4(a), resp . ), likely the result of a reduction in hepatic cholesterol (figure 2(b)) and subsequent induction of nuclear srebp2 protein abundance (figure 5(b)). In response to reduced cellular cholesterol levels, both pcsk9 and the ldlr are transcriptionally upregulated following srebp2 cleavage at the endoplasmic reticulum and subsequent nuclear translocation [16, 31]. Although only a limited amount of work has examined hepatic cholesterol metabolism in trained animals, previous studies support our observed reduction in hepatic cholesterol and increased ldlr transcription [47, 48] in exercise - trained c57bl/6 mice . Exercise has been shown to increase srebp2 mrna expression in skeletal muscle, but we are not aware of any study examining hepatic srebp2 expression in response to an exercise intervention . The reduction in plasma pcsk9 was positively correlated with concurrent reductions in plasma ldl - c and non - hdl - c (figure 3(d)). This correlation may suggest that the reduction in ldl - c in the exercised animals is associated with a lower ldlr turnover and enhanced ldl - c clearance . Suggesting that circulating pcsk9 directly binds to ldl plasma particles, it is equally likely that our observed reductions in pcsk9 are merely reflective of lower ldl in the exercise - trained animals . This may also explain our observed differential response between liver and plasma pcsk9 protein abundance in the exercised animals . Even though ldlr mrna was elevated in response to exercise training, we failed to detect any difference in hepatic ldlr protein abundance in whole tissue or membrane extracts between trained and untrained animals . Although this finding is unexpected, the action of pcsk9 on ldlr expression and activity in extrahepatic tissues cannot be ruled out as contributing to the observed cholesterol reductions in the exercised animals . Furthermore, we did not examine hepatic vldl receptor expression, an additional target of pcsk9 that regulates plasma non - hdl cholesterol concentration . Though the precise molecular mechanism(s) underlying exercised - induced modulation of pcsk9 may not beclear, our data suggests that the reduction in blood pcsk9 involves a posttranscriptional and/or translational event(s), given that no change in hepatic pcsk9 protein was observed between the hf and hf + ex groups . While the intramolecular processing events that govern the maturation, secretion, and eventual proteolytic inactivation of pcsk9 have not been fully elucidated, it is clear that nutritional and hormonal signals tightly regulate hepatic expression and plasma concentrations [31, 53]. In this regard, it is interesting to speculate that the protective effects of exercise against weight gain in the present study were related to the observed reduction in pcsk9 concentrations . Resistin, an adipose tissue - derived adipokine, that is, increased in obese rodents, has recently been shown to inhibit hepatic ldl clearance by increasing pcsk9 expression . As weight loss through exercise intervention reduces circulating resistin concentrations [55, 56], reductions in fat mass and adipose - derived resistin secretion may underlie the observed reduction in pcsk9 concentration . First, it is not known whether the reduced plasma pcsk9 in the hf + ex mice was a cause or a consequence of changes in plasma ldl - c . Without the benefit of a pcsk9-deficient mouse, our results cannot demonstrate a direct link between pcsk9 and ldl - c reductions in response to exercise . Second, the mature pcsk9 protein is composed of a prodomain, a catalytic domain that binds to the egf - a domain of the ldlr and a c - terminal domain that interacts with cell - surface proteins . Previous work suggests that pcsk9 activity is regulated by specific autocatalytic processing events within the endoplasmic reticulum and is inactivated following cleavage by furin, another protein convertase . The commercial pcsk9 antibody used in these experiments was specific to the mature form of pcsk9; hence, we were not able to examine potential changes in pro - pcsk9 abundance in response to exercise training . Also, it is not clear if the total pcsk9 mass abundance in liver and blood is reflective of its activity . In summary, our results suggest that exercise training reduces blood non - hdl cholesterol and pcsk9 concentrations and enhances the hepatic mrna expression of srebp2, ldlr, and pcsk9 . Additional mechanistic studies are required to directly link exercise - induced lipid lowering with reduced pcsk9 activity.
The most effective treatment of end - stage renal disease is kidney transplantation, but a severe donor shortage has significantly limited this treatment . To overcome this profound donor shortage, immunologic barriers historically considered as absolute contraindications to transplantation are being reevaluated . Kidney transplantation across the abo blood group barrier has the potential to expand the pool of donors, increase the availability of transplantable organs, and decrease the prolonged time on the waiting list for a kidney [14]. In addition, through the help of a better understanding of related immunologic mechanisms and effective various regimens for controlling it, abo - incompatible kidney transplantation (aboi kt) is being performed with increasing frequency . To clarify the current status and uncertainties in this area, the present paper focuses on recently reported outcomes of aboi kt, preconditioning methods before transplantation, posttransplant monitoring and management, diagnosis and treatment of antibody - mediated rejection, and the basic elucidation of immune tolerance and accommodation . The use of an abo - incompatible (aboi) kidney is not a recent development . The first attempt at aboi kt was reported in 1955 by chung et al . . In their experience, eight of ten aboi kidney allografts did not work successfully within the first few postoperative days . Although further attempts at aboi kt have been sporadically reported, these series revealed similar poor outcomes with graft survival rates of approximately 4% at one year [710]. . Showed that 12 of 20 transplants from blood group a2 donors into o recipients maintained long - term allograft function . This procedure is based on the finding that the expression of the a antigen on the red blood cell in the a2 donor was much weaker than that in the a1 donor . Regrettably, this technique can be used only in a small minority of kt candidates . In 1987, alexandre et al . This protocol included pretransplant repeated plasmapheresis as a strategy not only to reduce the titers of anti - a or -b antibodies, but also to decrease the antilymphocyte globulin - based induction . This plasmapheresis also altered the triple maintenance immunosuppression of cyclosporine, azathioprine, and corticosteroids and concomitant splenectomy . A one - year graft survival of 75% and a recipient survival of 88% were achieved in the 23 recipients . While their results were impressive and became the basis of the next desensitization protocols for aboi kt, the aboi kt was still uncommon in the west . These efforts regarding aboi kt were significantly expanded in japan because of the near absence of deceased donors and the only 0.15% of living a2 donors . The largest number of aboi kt since 1989, more than 1000 cases, has been performed in japan . The percentage of aboi kt surgeries reached 14% of all living donor kts performed in japan . Following the remarkable results reported in the japanese center utilizing modern desensitization techniques, together with the development of new immunosuppressive therapies, aboi kt began receiving new interest in europe and the usa in the early 2000s . For instance, in the study of tydn et al ., recipients with a baseline anti - a or -b igg titer of up to 1: 128 were successfully transplanted with no episode of acute rejection . Montgomery reported one - year patient and graft survivals of 96.3% and 98.3%, respectively, in a cohort of 60 consecutive aboi kts using a variety of protocols . Oettl et al . Demonstrated a 100% survival rate of both patients and grafts at one - year after transplant . Moreover, long - term results of aboi kt reported by western and japanese transplant centers also have shown that aboi kt is equivalent to abo - compatible kt . Reported that aboi kt had no negative impact on long - term graft function compared to that of abo - compatible kt in terms of patient survival, graft survival, or incidence of acute rejection after a mean followup of three years . . Found that graft survival was 97% for the aboi kt compared with 95% for the abo - compatible kt in their three - center experience at their five - year followup . Patient survivals were 98% in both kt groups . In the analyzed unos data of gloor and stegall, they concluded that a long - term immunological response against abo incompatibility has little effect on graft survival with current immunosuppressive protocols and patient monitoring . Tanabe summarized the outcomes of 851 aboi kt performed in 82 institutions in japan between 1989 and 2005 . The five - year graft survival in their study was 79%, with patient survival at 90% . Montgomery obtained five - year patient and graft survivals of 89% following aboi kt at johns hopkins hospital . Report the five - year outcome of aboi kt as a graft survival rate of 100%, whereas ishida et al . Achieved a graft survival of 57% and patient survival of 89% at ten years postoperatively for more than 130 cases of aboi kt . For the successful performance of aboi kt, the antibody - mediated response must be understood and targeted . Over the past 20 years, several strategies have been developed to resolve and modulate this response . These strategies, or desensitizations, are all based on the same principles [5, 12, 22], including not only the removal of preexisting antibodies that are directed at the donor abo antigen, but also waiting to transplant until the anti - abo antibody titer is below a set target . Additionally, the prevention of further production of new recipient anti - abo antibodies before and after transplantation is another founding principle . Ordinarily, several pretransplant apheresis sessions are required for antibody removal . To prevent reformation of the antibody, apheresis is followed by intravenous immunoglobulin, a mixture of immunosuppressive therapies, and erasable splenectomy [11, 12]. This procedure usually occurs over a period of one to two weeks . In the field of aboi kt, currently used antibody depletion techniques include therapeutic plasma exchange, double - filtration plasmapheresis, and antigen - specific immunoadsorption . The simplest and most common method to remove antibody from plasma is therapeutic plasma exchange, in which large amounts of plasma are withdrawn and replaced with colloid solutions . However, this technique is not sufficiently selective to remove only protective antibodies and also removes coagulation factors, hormones, and antiviral and antibacterial immunoglobulin g (igg) and immunoglobulin m (igm). The selective techniques of double - filtration plasmapheresis or antigen - specific immunoadsorption are safe and more effective and are therefore usually the first choice . Because no coagulation factors are eliminated, large plasma volumes can be processed, and the resultant efficacy is increased compared to that of therapeutic plasma exchange . Using a second filter, double - filtration plasmapheresis is capable of eliminating the plasma fraction containing the immunoglobulins and decreases the amount of plasma discarded . Using the process of immunoadsorption, the plasma is processed through a glycosorb abo immunoadsorbent column and reinfused into the patient . There are no volume losses, and thus the number of adsorption cycles has no limit . Although the aboi kt is an american society for apheresis (asfa) category ii indication, there has been no clinical trial differentiating antibody reduction procedures or the standardized monitoring protocol . Intravenous immunoglobulin plays a role in the downregulation of the antibody - mediated immune response . The immunoglobulin blocks not only the fc receptor on the mononuclear phagocyte, but also the direct neutralization of the alloantibody . Further, it inhibits the cd19 expression on the activated b cell, as well as that of the complement and the alloreactive t cell . Although alloantibody rebounds within days of the discontinuation of plasmapheresis, the benefit of intravenous immunoglobulin may continue for many months after drug administration . Traditionally, concurrent splenectomy was an important prerequisite of the desensitization protocol for aboi kt, based on the idea that it contributed to the reduction of the antibody - producing b - cell pool . The early investigator of aboi kt, suggested that the splenectomized recipient had a much smaller risk of antibody - mediated rejection . . Found that the suppression of anti - abo antibody after splenectomy was not significantly different from that of nonsplenectomized patients . Sonnenday et al . Reported that splenectomized recipients had a 25% greater mortality at 84 months compared with that of non - splenectomized recipients . Gloor et al . Reported that splenectomy is not necessary even for patients with high - baseline anti - abo antibody titers . Takahashi et al . Demonstrated that splenectomy is not necessary to inhibit antibody production because significant numbers of memory cells exist in the bone marrow . The anti - cd20 monoclonal antibody, rituximab, directly inhibits b - cell proliferation and induces cellular apoptosis through the binding of complement . Complement, in turn, mediates antibody - dependent cell - mediated cytotoxicity and subsequent cell death . Several centers have established the use of rituximab as a chemical splenectomy due to its potent ablation of the b - cell compartment . The advantage of rituximab over splenectomy is that it ablates the b cell during the period of the greatest risk of antibody - mediated rejection and then allows the humoral immune system to heal with an intact spleen . Reported that patients who received rituximab induction had a lower incidence of acute antibody - mediated rejection and better outcome of five - year graft survival compared to those in abo - compatible or -incompatible kt recipients who were not treated with rituximab . Since cd20 antigen is not expressed on plasma cells, rituximab is effective against pre - b and b - cells but not against plasma cells, which contributes to antibody production . Some data suggest that rituximab has a much weaker impact on the memory b cell population, the progenitor of the igg - secreting plasma cell . . Indicated that a low - dose rituximab less than 375 mg / m has a potent impact on the depletion of b cells in the spleen and peripheral blood . . Demonstrated that a single dose of rituximab, even at 50 mg / m, depleted b cells from the peripheral blood as effectively as did the 375 mg / m dose . Revealed that there was no difference in serum creatinine at one year after transplant, irrespective of the dose of rituximab . As an extension of this idea, these have led to a modified protocol that consists of an antibody - depleting procedure and intravenous immunoglobulin with no long - term b - cell suppression from splenectomy or rituximab . Montgomery's results showed that the five - year graft survival rate was 88.7% with no instance of antibody - mediated rejection or graft loss . Immunosuppressive regimens are required for both t - cell - mediated immunity and b - cell - mediated immunity, which are similar to that used for abo - compatible kt . Calcineurin inhibitors (cyclosporine and tacrolimus) and antimetabolites (mycophenolate mofetil and azathioprine) are mainly used with low - dose steroids . In addition, monoclonal or polyclonal antibody agents (anti - cd25 antibody or antithymocyte globulin) are also often used during the induction period . Tanabe started to use tacrolimus in combination with mycophenolate mofetil as a basic immunosuppressant after aboi kt and reported a greatly improved graft survival compared with that of cyclosporine administration . Antimetabolites seem to take seven~ten days to be efficient as in vivo immunosuppressants . Therefore, immunosuppressive therapy as desensitization should be started before transplantation in order to adequately inhibit antibody production . In order to achieve a successful outcome with aboi kt, although there are slight differences in the preconditioning formalities depending on the transplant center, most include a combination of pretransplant plasmapheresis, intravenous immunoglobulin, and tacrolimus - mycophenolate - based immunosuppression with antibody induction . After transplant, very close monitoring of the anti - abo antibody titer is typically carried out for a minimum of two weeks . If necessary, plasmapheresis is added to eliminate the rebounding antibody level [5, 15]. If anti - abo antibodies are removed prior to transplantation, one of three types of immune response may occur: rejection, immune tolerance, or accommodation . (1) about 25% of patients produce antibodies to the incompatible abo antigen, which mediate allograft rejection . (2) some recipients seem to have immunologic tolerance to the incompatible abo antigen because they do not reject the allograft or produce anti - abo antibody against it . Theoretically, natural anti - abo antibody might be inducing antibody - mediated rejection in aboi kt and can manifest as a hyperacute rejection or as an acute or delayed humoral rejection . Antibody - mediated damage can result in rapid and irreversible graft thrombosis due to complement activation or contributes to long - term graft dysfunction . However, as the anti - abo antibody usually reaccumulates and persists after successful aboi kt, the recipient maintains satisfactory graft function . This resistance of allograft to antibody - mediated rejection despite the significant presence of anti - abo antibodies in the recipient serum is known as accommodation [1, 5, 35, 36]. . Defined the criteria of accommodation in aboi kt to include (1) detectable anti - abo antibody in the recipient serum, (2) normal graft histology according to light microscopy, (3) the presence of a or b antigen in the graft, and (4) renal function similar to that of abo compatible patients (gfr greater than 45 ml / min at one - year after transplant). In 2006, the american society of transplantation reached a consensus on accommodation, stating that it occurred when c4d deposition was detected with normal function and structure of the graft . How accommodation is induced and through what mechanism it is maintained are not well understood . Various hypotheses have been proposed to describe the mechanism responsible for accommodation [34, 37], including changes in the function of antidonor antibody, changes in the antigen, acquired resistance of the allograft through the expression of an antiapoptotic gene, or an expression of complement regulatory protein . The study of ishida et al . Presented the difference in quality between antibodies produced by accommodated and non - accommodated recipients . Suggested that accommodation is related to a shift from the igg isotype to the igg2 isotype that is less effective at activating complement and that competitively inhibits the binding of the more cytotoxic isotype . Chang and platt discovered that healthy organs could absorb antidonor antibody in large amounts, for which the accommodated functioning graft served as a sink . According to these results, accommodation may reflect a change in the properties of the antibody or antigen . Delikouras and dorling reported that the bcl-2 and bcl - xl, antiapoptotic molecules, were found in the accommodated abo incompatible kidney graft . These findings are consistent with the hypothesis that the endothelium of the kidney allograft will be initially exposed to low titers of anti - abo antibody, which will in turn instigate a series of protective changes that manifest as accommodation . . Suggest that a decrease in tumor necrosis factor- and alteration in smad (mothers against decapentaplegic homolog) gene expression may be important in long - term accommodated grafts . Introduced the concept that the upregulation of a complement regulatory protein such as cd59 seems to be involved in accommodation by preventing the formation of the membrane attack complex (mac) on the accommodated graft . The accommodated allograft kidney remains protected even though it is transplanted into a new recipient . However, an immunotolerant allograft preserves the potential to reject the tissue from the same donor . Immune tolerance is a state of immune unresponsiveness to the presence of specific non - self - antigens in the absence of long - term immunosuppression . . Postulated that the prolonged depletion of alloreactive b cells in tolerant mice is achieved through the dominant and active suppression of t helper cells . Ogawa et al . Suggested that prolonged t - cell suppression in the aboi kt recipient may result in a similar induction of tolerance to that of the incompatible abo antigen . The monitoring of anti - abo antibody titer is critical for determining the effectiveness of desensitization and the optimum time to permit graft implantation . After transplantation, the anti - abo antibody level must be monitored to detect its reaccumulation, which may indicate or induce antibody - mediated rejection . In patients with a higher rebound in serum antibody production after the incompatible transplant, desensitization therapy, especially antibody - depletion procedures, should be repeated . Most studies [3, 43] agree that posttransplant dfpp was ineffective at preventing the rebound of anti - abo antibody titers compared to the efficacy of therapeutic plasma exchange . The jones hopkins group of montgomery et al . [15, 28] determined the initiation of posttransplant plasmapheresis based on the pretransplant baseline antibody level before preconditioning . Others have granted that preemptive posttransplant plasmapheresis may be dispensable, favoring an on - demand strategy according to the post - transplant antibody titer elevation . However, there are conflicting opinions on which antibody titer is meaningful and how long antibody monitoring should continue . Kayler et al . Found that all patients whose posttransplant antibody titer remained below 1: 8 exhibited stable renal function . Those patients who had an increased titer above 1: 64 experienced allograft failure . Stegall et al . Recommended initiating plasmapheresis if the antibody titer increases to 1: 16 in the first two weeks after transplantation . Gloor et al . Showed that humoral rejection was rare when the antibody level was maintained less than 1: 8 in the first week and 1: 16 in the second week after transplantation . They then allowed antibody titers to rise if the graft function and surveillance biopsies were normal . Takahashi [46, 47] asserted that anti - abo antibody titers should be suppressed to the lowest level during the first week after transplant, when surface antigenicity is increasing in the vascular endothelial cells of the graft kidney . On the other hand, park et al . Demonstrated that anti - abo antibody titers return to detectable levels in all accommodated and nonaccommodated recipients, even in the absence of humoral rejection or chronic graft damage . . Also demonstrated that the clinical significance of an increased posttransplant anti - abo antibody level is variable, and that there was no dependable correlation for antibody - mediated rejection . These findings are supported by the fact that a high titer of antibody is generally necessary but is not sufficient for antibody - mediated rejection . Before the initiation of preconditioning, the baseline anti - abo antibody titer is well known as a significant predictor of the severity of antibody - mediated graft injury as well as graft survival [19, 42]. Although a few recent reports have shown that a high - baseline antibody titer is no longer predictive for poor graft outcome in patients that received tacrolimus- or mycophenolate mofetil - based immunosuppression [6, 19], antibody removal should be as complete as possible . Most centers performing aboi kt have adhered to the guideline that serum anti - abo antibody titers should be 1: 16 or lower before transplantation . However, the acceptable upper limit of anti - abo antibody titers is exclusively based on empirical evidence, not substantiated by deductive reasoning . Decreased the antibody titer to below 1: 4 before transplant, while chung et al . Some institutions use the antiglobulin igg antibody titer endpoint as the critical titer when assessing patients before and after transplantation . Which type of anti - abo antibody, igm or igg, causes antibody - mediated graft damage due to the unique characteristics of the antibody remains unclear . If anti - abo igg antibodies are believed to be responsible for worse graft outcomes, it is expected that blood group o recipients will be more likely to suffer graft damage than will a or b recipients . Antibody - mediated rejection (abmr) is known as the primary cause of graft loss in aboi kt . It is clear that abmr has a negative influence on short - term outcome following aboi kt . Recent studies have reported that abmr occurred in 17.9% up to 30% of abo - incompatible kidney transplants [22, 50, 51]. . Demonstrated that anti - abo igg antibody titers of 1: 32 at the time of transplantation and the presence of donor - specific anti - hla antibodies were independent risk factors for abmr . Although the development of desensitization protocols has improved graft survival, the outstanding results are largely due to aggressive surveillance, early detection, and an enhanced therapeutic approach for abmr . The hyperacute rejection due to anti - abo antibody does not occur within 24 hours, which is called the silent period . The greatest incidence of acute antibody - mediated rejection occurs two to seven days after transplant and does not typically occur after more than one month . Some researchers, therefore, have defined the first two weeks after transplantation as the critical period during which accommodation is usually induced and established . Once accommodation is established, acute antibody - mediated rejection does not occur, leading to the stable period . Abo antigen in the graft directly stimulates immunological responses, resulting in an explosive antibody production early in the critical period, typically, igg antibody . Type ii abmr is caused by primary sensitization due to an abo blood - group - associated antigen . In response to bacterial infection, an abo - antigen - like substance is found on the surfaces of bacterial cells, acting as a cross - reacting antigen to cause sensitization and antibody production, mainly igm . This type ii rejection usually progresses more slowly and is less severe than is type i rejection . Clinically, abmr was suspected when the serum creatinine level was increased relative to the previous value, together with a decrease in urine output . Acute abmr after aboi kt is diagnosed on the basis of morphologic, immunohistologic, and serologic features . Morphologic evidence includes (1) leukocyte (neutrophil, monocyte, and macrophage) infiltration into the peritubular capillary and/or glomeruli; (2) arterial fibrinoid necrosis; (3) glomerular and arterial thrombi; (4) acute tubular injury . Immunohistologic evidence involves (1) peritubular capillary c4d deposition and (2) immunoglobulin and/or complement in arterial fibrinoid necrosis . For serologic evidence, circulating specific antidonor antibodies at the time of biopsy should be found . Overall, at least one finding in each of the three categories must be present for a biopsy to be diagnosed as acute abmr [22, 25, 52]. These diagnostic criteria were established by the national institutes of health and the banff working group . The former group also requires clinical evidence of graft dysfunction, while the latter group accepts the possibility of subclinical acute abmr, defined as c4d staining and leukocyte margination in the peritubular capillary in a protocol biopsy of a well - functioning graft . Antibody - mediated rejection is thought to be caused by endothelial cell activation in the graft . Peritubular capillary c4d deposition has been considered to be an important histologic indicator of antibody - endothelial cell interaction and is a key element in the diagnosis of abmr . The presence of donor - specific antibody or the presence of c4d alone in the peritubular capillary is not diagnostic of acute abmr in the setting of aboi kt [5, 19]. Racusen and haas reported that c4d staining was associated with abmr and graft injury in the malfunctioning graft, whereas it reflected graft accommodation in the stably functioning graft . Setoguchi et al . Detected c4d staining in the peritubular capillary in 94% of their protocol biopsy specimens [54, 55] observed c4d deposition in 80% of protocol biopsies in the absence of allograft dysfunction or other histologic abnormalities suggestive of acute abmr . Meanwhile, they suggested that deposition of c3d, alone or in combination with c4d, may identify a more severe form of abmr associated with a high risk of graft loss . Basically, abmr was treated through the reinitiation of plasmapheresis to remove circulating antibodies [19, 53]. Standard treatment for abmr consists of repeated plasmapheresis - plasma exchange or immunoadsorption and intravenous immunoglobulin . Various combinations of these therapeutic modalities have been successfully used to treat abmr and improve outcomes . Most institutes [25, 58, 59] treated abmr with a series of plasma exchanges followed by low - dose ivig in addition to methylprednisolone until clinical improvement was achieved or until abmr was histologically determined to have been resolved . Racusen and haas reported that reversal rates for abmr were approximately 90% using such protocols, contrasted to reversal rates of less than 50% with traditional immunosuppression alone . Rituximab, an immunosuppressive agent which controls antidonor antibody production, and several complement inhibitors have also been reported to obtain significant efficacy . The use of rituximab is intended to deplete b cells and thereby suppress antibody production . Several doses of rituximab at 375 mg / m were intravenously administered to resolve abmr . Noted that allografts with cd20 cells in biopsy specimen were strongly associated with the clinical phenotype of glucocorticoid resistance and chose to treat abmr with rituximab . Together with tacrolimus - mycophenolate rescue, the majority of ambr cases have received antithymocyte globulin at the time of plasmapheresis . Administered okt3 at a dose of 5 mg / day for seven days in patients with persistent antibody - mediated rejection . Previously mentioned anti - abmr therapies including plasmapheresis, intravenous immunoglobulin, antithymocyte globulin, and rituximab have provided suboptimal results . One reason for this insufficient success is that they do not exert direct effects on the mature plasma cell . A proteasome inhibitor, such as bortezomib, depletes both transformed and nontransformed plasma cells in animal and human transplant recipients . Recent reports have also shown that eculizumab, a humanized monoclonal antibody against terminal complement protein c5, is an effective therapy to inhibit terminal complement activation and prevent antibody - induced injury . All of these modes are useful in the treatment of refractory abmr [24, 57]. Splenectomy may be a possible option as a rescue treatment for severe abmr resistance to standard treatment after aboi kt . Kaplan et al . Reported the first early experience with rescue splenectomy and suggested that the procedure may specifically and irreversibly deplete memory b cells, thus offering an additive effect to the standard treatment . Although successful strategies have been developed to treat acute abmr, humoral alloreactivity in the early posttransplant period adversely impacts long - term allograft survival and contributes to chronic rejection . . Revealed that a high panel - reactive antibody value was significantly associated with the development of chronic abmr characterized by transplant glomerulopathy . Recent studies [19, 50] have found that a prior history of abmr was significantly associated with the development of transplant glomerulopathy, with an incidence of 22% at one year after transplantation . Clarified sequential stages of chronic abmr using an animal model and determined that the first symptom was circulating alloantibody, c4d, or a combination of the two . Only rarely was transplant glomerulopathy observed in the absence of c4d or alloantibody . The national institutes of health suggested diagnostic criteria for chronic abmr in aboi kidney allograft . Their criteria require three of the following four lesions: (1) arterial intimal fibrosis, (2) interstitial fibrosis / tubular atrophy, (3) duplication of the glomerular basement membrane, or (4) lamination of the peritubular capillary basement membranes . Aboi kt is considered an increased immunologic risk; therefore, aggressive immunosuppressive protocols traditionally have been used . Most centers have adopted polyclonal antibody for the induction and chronic maintenance of immunosuppression based on tacrolimus and mycophenolate, starting two weeks before the transplantation . Nevertheless, chuang et al . Showed that maintenance - immunosuppressive therapy did not affect isoagglutinin titer in aboi kt . In addition, no significant difference in isoagglutinin titer was observed between tacrolimus and cyclosporine groups . Demonstrated that only standard immunosuppression could produce a successful aboi kt as long as an adequate desensitization protocol was employed . Far from high immunologic risk, avoidance of excessive immunosuppression potential is a benefit to aboi kt recipients . Magee avoided lymphocyte - depleting antibody because it is no more effective in preventing abmr and is adversely associated with a higher incidence of infective complications . Crew and ratner and galliford et al . Reported that aboi kt can be successfully accomplished using a steroid - sparing regimen without resulting steroid - resistant rejection . The idea that abo blood group incompatibility should be considered an absolute contraindication to kidney transplantation has been challenged in the past two decades . As the pretransplant and posttransplant desensitization protocols have developed and changed in many different fields, satisfactory results have been observed . As the body of immunologic knowledge including that regarding antibody - mediated rejection has grown, overall success rates are now comparable with those of abo - compatible kidney transplantation . Due to the surprising result, the pool of potential aboi kt candidates has increased . Because the long - term outcome of aboi kt has not yet been determined,
Adverse drug events result in hospital admissions, increased costs, and poor quality of health care.1 prevention of adverse treatment effects is essential for improving patient safety and quality of care.2 with $2.5 trillion in annual spending for healthcare in the us, adverse treatment effects contribute to unnecessary and preventable cost.2 hospital admissions due to adverse drug effects can be prevented with high quality care.3 aging patients are most vulnerable to multimorbid conditions and polypharmacy.4 however, hospital admissions for adverse drug events among elderly have not been evaluated in relation to quality of care . We aimed to examine frequency and hospital charges of adverse treatment effects among elderly using the national inpatient sample (nis) of the healthcare cost and utilization project.5 we analyzed total number of discharges with a principal diagnosis of adverse drug events in 20002007 . We defined elderly inpatients in two age categories: 6584 and 85 years of age . Principal diagnoses as the reasons for admission were identified using codes of the international classification of diseases, ninth revision, clinical modification (icd-9-cm), see appendix table 1).6,7 we defined adverse drug effects as poisoning due to inappropriate uses or medication errors (eg, wrong medication, wrong patient, overdose) and as an adverse drug reaction.8 we did not analyze clinical side effects including drug - induced psychoses (icd codes 10 292.0292.9) or dermatitis (icd codes 5 692.3, 692.9, 693.0, 693.8, 693.9).8 we identified all listed diagnoses of adverse treatment effects that coexisted at the time of admission, or that developed during the stay in 2007 using icd-9-cm codes6 (appendix table 2). We analyzed mean hospital charges5 as the amount the hospital charged for the entire hospital stay for each icd code . We multiplied the number of discharges by the mean hospital charge to calculate total hospital charges for each icd code for each year and for the total time period from 2000 to 2007 . We analyzed time trend in discharges and hospital charges with years as a continuous variable . We used restricted maximum likelihood (reml) estimation methods and 2 res log likelihood fit statistics with mixed procedure9 in sas . All calculations were performed at 95% confidence levels using a two - sided p value with sas software.10 during the period between 2000 and 2007, 321,057 hospital admissions among the elderly had principal diagnoses of adverse drug effects (table 1). Drug - induced gastritis with hemorrhage (87,807 discharges) and without mention of hemorrhage (57,786 discharges) constituted 31% and 21% of all drug - induced hospitalizations, respectively . Poisoning by benzodiazepine - based tranquilizers, insulins, antidiabetic agents, and anticoagulants contributed to 5% or more of drug - induced hospitalizations in the elderly . Hospital charges for gastritis with hemor rhage ($1,572,983,700 or 36% of all hospital charges), gastritis without mention of hemorrhage ($860,998,714 or 20% of all hospital charges), for poisoning by benzodiazepine - based tranquilizers ($328,528,129 or 8% of all hospital charges), and for poisoning by opiates ($217,660,115 or 5% of all hospital charges) were the largest drug - induced charges among elderly patients . Total number of hospital admissions due to adverse drug effects increased from 36,199 in 2000 to 42,057 in 2007 (figure 1). Total hospital charges increased from $393,618,776 in 2000 to $905,776,719 in 2007 (figure 2). Elderly patients constituted more than 50% of all admissions due to poisoning by anticoagulants and cardiotonics . Half of all hospital admissions with a principal diagnosis of poisoning by an anti - parkinsonism drug or drug - induced gastritis with hemorrhage occurred in elderly patients . The number of discharges and total hospital charges did not change over the examined years (p values for trend 0.61 and 0.11, respectively) while the mean charge per discharge increased on average by $1064 384 per year (p value for trend 0.006). Hospital admissions due to drug - induced gastritis and due to poisoning by glycosides decreased during 20002007 (table 2). Hospital admissions due to poisoning by opiates or insulin and antidiabetic agents increased in the examined time period (table 2). Hospital charges in elderly who were hospitalized for drug - induced gastritis with hemorrhage increased by $19,853,011 per year . Hospital charges for patients aged 6584 who were hospitalized for insulin poisoning and antidiabetic agents increased by $4,600,443 per year (table 2). All listed diagnoses related to adverse treatment effects in elderly in 2007 constituted 791,931 discharges and $937,795,690 hospital charges (table 3). Adverse effects of anticoagulants were experienced by 94,793 patients 6584 years (55.65% of all discharged with this diagnosis) and 31,807 inpatients older than 85 years (19% of all discharged with this diagnosis). Total hospital charges for adverse effects of anticoagulants in 2007 in elderly were $404,165,145 and $47,642,222 in the two age categories, respectively . Adverse effects of diuretics in 2007 afflicted 29,655 elderly patients, with total hospital charges of $46,906,127 . Adverse effects of corticosteroids afflicted 87,454 adults 6584 years of age (41% of all discharged with this diagnosis) with a total hospital charge of $317,339,123 . Much less expected was a large number of elderly with unspecified adverse drug effects . In 2007, 27,976 elderly experienced adverse drug effects with unknown definitive cause . While the rate of admissions remained the same during the study period, costs continued to increase . Several pharmacologic groups including antidiabetic drugs, anticoagulants, cardiotonics, saluretics, and anti - inflammatory medications are responsible for the most common adverse events in the elderly . Hospital charges are substantial when all listed diagnoses related to adverse drug effects in the elderly are analyzed . We did not analyze probable variability of adverse drug effects among geographical regions, types of hospitals, or patient income . Such variability may be associated with differences in hospital admission and charges but does not decrease the significance of the problem of very common and costly adverse drug events in the elderly . We could not judge the validity of hospital discharge codes in identifying drug - specific adverse effects.11 previous studies have demonstrated poor predictive value of hospital discharge codes in identifying drug adverse effects.11,12 hospital admissions due to adverse drug effects may reflect inadequate drug management in outpatient settings that cannot be analyzed using the national inpatient sample . Outpatient clinical pharmacology services may reduce adverse drug events in elderly,1315 but preventive effects on hospital admissions are not clear.
One of the three most commonly prescribed blood tests by physicians, urea is the major end product of protein nitrogen metabolism . It is synthesized by the urea cycle in the liver from ammonia which is produced by amino acid deamination . Rediffusion in the distal tubule depends on the urinary flow and is regulated by anti - diuretic hormone . During diuresis, there is minimal rediffusion and blood urea levels are low, whereas during anti - diuresis, the opposite happens . Thus blood urea levels depend on urea synthesis rate, renal perfusion and glomerular filtration rate (gfr). When used in conjunction with serum creatinine, determination of serum urea can aid in the differential diagnosis of three types of azotaemia: prerenal, renal and postrenal . Biological reference interval (bri) of urea is a critical component, and the validity of the entire renal function tests as a diagnostic tool depends on it . The bri should provide an acceptable degree of confidence for the decision - making process, which includes a consideration of the significant factors and variables introduced by the specific individual s reference sample or by the analytical process itself . Establishment of bri for urea is cumbersome as one has to exclude both hepatic and renal disorders, two of the commonest community afflictions, while selecting reference individuals . Secondly, protein metabolism differs in the two sexes, thereby accounting for the possibility of sex - wise segregation of reference values . Thirdly, protein anabolism takes the upper hand in children and adolescents vis - - vis the elderly individuals who predominantly catabolize proteins, compounded with the fact that renal function decreases with age; this adds a further dimension of age - wise compartmentalization of reference values . As a result, most of the literature supplied with the reagents refers to a broad classification of reference values . For example, the reagent kit used in this study refers to the expected values of <50 mg / dl for individuals <65 years and <71 mg / dl for indiviuals> 65 years . One is tempted to ask how often would you find a 10 year old healthy child with serum urea as high as, say, 45 mg / dl (which is normal as per the kit insert)! This article objectively describes the establishment of bri for urea measured on an urban indian ambulatory population by a kinetic uv urease / gldh method using dedicated reagents of cobas 6000 auto - analyzer on the basis of guidelines set by the clsi c28-a3 document . Inclusion of a graphical representation in the form of a biological reference curve (brc) adds interpretive value to the information, especially when partitioning of reference data is expected . This a priori non - interventional, cross - sectional unicentric observation was undertaken during the calendar year of 2012, in the department of biochemistry, drs . Subjects: the subjects were selected on the basis of a direct sampling technique, as practised in any a priori procedure . Age and sex matched individuals were selected according to pre - determined inclusion criteria (vide table 1). A total number of 3202 subjects (males = 1596, females = 1606), aged between 1 and 80 years were selected for the study, in each case, after the execution of an informed consent . Samples: venous blood samples were collected after allowing 10 to 15 minutes of rest in an office environment, observing standard aseptic procedures, within 30 seconds of tying tourniquet and transferred to standard gel separator tubes . Methods: the samples were measured on a cobas 6000 (roche diagnostics gmbh) platform using dedicated urease / gldh reagents8 . It is a kinetic method where urea is hydrolysed by urease to form ammonia and carbonate: in the second reaction, 2-oxoglutarate reacts with ammonium in the presence of glutamate dehydrogenase (gldh) and the coenzyme nadh to produce l - glutamate . In this reaction two moles of nadh are oxidized to nad+ for each mole of urea hydrolysed: the rate of decrease of nadh concentration is directly proportional to the urea concentration in the specimen and is measured photometrically at 340 nm . Performance specifications claimed by the instrument s manufacturer pertaining to the urea method are listed in table 2 . Certain components of the performance indicators e.g. Analytical measurement range, precision and accuracy verified by this laboratory matches the manufacturer s claims . Method calibrations were performed routinely once every week, on changes of lots of reagents and calibrators and as corrective measures for qc outliers . Two levels of commercial control materials were run on every working day (level 1 target value = 40 mg / dl, range = 35 to 45 mg / dl; level 2 target value = 140 mg / dl, range = 130 to 150 mg / dl) and standard westgard warning (12s,41s) and run rejection (13s,22s, r4s,10x) rules were applied . The study was spaced out into a whole calendar year deliberately to even out the variations brought in by changes in lots of reagents, calibrators and in instrument calibrations . In particular, two lots of calibrators and five statistical analyses: the data thus obtained were first analysed to establish the partitioning requirements of two covariates, namely age and sex . Then the data were subjected to tests for determining its suitability for parametric treatment . Finally non - parametric methods were applied for computation of bri and construction of brc . Partitioning requirement: to verify whether the distribution of the serum urea values is influenced by age of the subjects, the weighted residuals of the urea values were plotted as a function of age (vide figure 1), where weighted residual (), is defined as = (yi m)/, where yi is the individual urea value, m is the population mean and o is the population sd14 . If the weighted residuals are arranged in a band of constant width around the zero line, it may be assumed that the urea values do not change significantly with age . As is evident from figure 1, a constant bandwidth was not maintained, there was significant dispersion both above and below the zero line, and most importantly there was significant spiking above and below the zero line corresponding to the change of decades, e.g. 11 years, 21 years and so on . This signified that not only age - wise partitioning of the data was required but also a decade - wise partitioning would be appropriate . To determine if the sex of the subjects influenced the distribution of data, the data was segregated into two groups (male = 1596, female = 1606) and the non - parametric mann - whitney u test was run to compare the two groups, which returned a z - statistic of 12.157 with a p - value of <0.0001, implying that the two groups were significantly different (p<0.05). Fitness for parametric estimation: as it was determined that sex - specific partitioning was imperative, henceforth, the data would be segregated into two (males & females) and each group would be subjected to tests determining its fitness for parametric estimation . For parametric methods to be applicable, the following conditions must be met: for each value of covariate (e.g. Age) the distribution of data, either raw or transformed, is gaussian.the population mean of the analyte, here urea, is a linear function of age, i.e., eqn . 1 m = a + b x age the dispersion of urea values (i.e. Standard deviation) does not vary with age; in other words, the data is homoscedastic . For each value of covariate (e.g. Age) the distribution of data, the population mean of the analyte, here urea, is a linear function of age, i.e., eqn . 1 m = a + b x age the dispersion of urea values (i.e. Standard deviation) does not vary with age; in other words, the data is homoscedastic . When for each value of the covariate the data distribution is not gaussian, a data transformation can be used to normalize the distribution . Several families of transformations are used by statisticians among which, the box - cox transformation is likely the most famous . The box - cox transformation with parameter is given by (y 1)/. When = 1, this transformation is linear implying that there is no need to transform the data to normalize their distribution . When = 0, this transformation becomes the natural logarithm ln(y). Analysis of the current data returned a values of 0.498 and 0.801 for males and females respectively, which were different from 1 (p<0.001), hence box - cox transformation was required, and were different from 0 (again, p<0.001), hence logarithmic transformation would not be helpful . The data was statistically analysed to determine the values of the functions a and b in eqn . The values were obtained thus: males: a = 6.746, b = 0.066; females: a = 12.637, b = 0.142 . 2 males: (urea 1)/0.498 = 6.746 + 0.066 x age eqn . 3 females: (urea 1)/0.801 = 12.637 + 0.142 x age thereby, a parametric model was established for the urea data and eqns . 2 & 3 can be utilized for construction of brcs, but it was still necessary to determine whether this model appropriately describes the data . This can be suitably evaluated by inspecting a graph whereby the box - cox transformed data is plotted as a function of the best fit values . The fitted values are obtained by back - transformation thus: eqn . 4 males: urea = {1 + 0.498 x (6.746 + 0.066 x age)} eqn . 5 females: urea = {1 + 0.801 x (12.637 + 0.142 x age)} this is depicted in figure 2, where box - cox transformed data were plotted on y - axis and fitted values, as calculated by eqns . The magnitude of dispersion on the y - axis gives information on the actual dispersion of the data . The magnitude of dispersion on the x - axis gives information on what the model explains . As is evident from the figure, for males, the box - cox transformed data span 8 70 mg / dl, whereas the fitted values span 20 50 mg / dl; for females, the corresponding figures were 8 57 mg / dl and 20 42 mg / dl respectively . In other words, the proposed model explains only 58.8% and 49.7% of the male and female data respectively . This is evidence strong enough to reject the parametric model and move on to non - parametric models to obtain the objective of this study . Proposed non - parametric models: as guided by the age vs. weighted residuals plot, decade - wise bris of serum urea for males and females were computed by non - parametric method (vide table 3). Ninety percent confidence intervals for lower and upper reference limits were calculated using a non - parametric bootstrap method . It may be noted that bris for both males and females remain the same till the 2 decade, whereas values for males increase significantly from the 6 decade onwards . Reference curves were constructed using non - parametric quantile regression technique, where the relation between the independent variable (predictor) e.g. Age, and the independent variable (response) e.g. Urea value is not determined by a predetermined equation but according to the information derived from the data itself . Each reference curve consists of three lines corresponding to 2.5 percentile, 50 percentile and 97.5 percentile respectively . Each line represents the best fitted series of points but not a pre - determined equation . Four models of non - parametric regression were used: in the 1 model gaussian kernelsfor age were used to estimate the dispersion of urea values; in the 2 model, two kernels were used: a gaussian kernel for the x - axis and an uniform kernel for the y - axis; in the 3 model local constant theory was applied where the means for sets of data points are joined to form the regression line; in the 4 model local linear theory was applied where the best fitting lines for each point are joined together to form the regression line . Figure 3 represents these findings for male reference data and figure 4 depicts the same for female reference data . Choice for the candidate reference curve mainly depends on the smoothness of the regression lines thus derived . In this case, the local linear model (figure 3d, figure 4d) produces the desired level of smoothness and thus may be chosen as the candidate biological reference curve for serum urea by urease / gldh method . Bri established and brc constructed in this exercise can be used as a very powerful diagnostic tool . When used in conjunction with a similar data for serum creatinine, this model can make clinical decision making quite a cake - walk . One can easily diagnose or exclude azotaemia as a rule of the thumb, just by inspecting the brc . Furthermore, the mathematical models proposed in this study are valid for any other analyte and can be applied in any diagnostic specialty.
Malignant acrospiroma is which rarely reported, surgical resection is treatment of choice, with radiotherapy for unresectable and margin positive cases . Acrospiroma denotes a group of benign ductal tumors of the eccrine sweat glands that may or may not be connected to the skin, ranging from solitary plaques to exophytic papules to dermal nodules . Malignant acrospiroma comprises a group of rare epidermal, juxtaepidermal, and dermal ductal carcinomas that may coexist with their benign counterpart and have the potential for regional lymph node and, very rarely, distant metastases . We describe a case of a malignant acrospiroma involving wide areas of the chest and abdominal wall with metastases to bilateral axillary lymph nodes in a 47-year - old man, showing no clinical response to combination chemotherapy . Although various eccrine sweat gland tumors including benign acrospiroma are widely reviewed, malignant acrospiroma is rarely reported; also, literature on their response to chemotherapy is wanting . A 47-year - old man presented at our dermatology outpatient department with multiple painful reddish raised nodular lesions over the chest and upper abdomen for the last four months . A year and a half back, he first noted a small single nodular lesion in the middle of the chest, gradually increasing in size with a rough surface overlying it which later became painful, but was not associated with any discharge . The lesion was subsequently excised in a medical college in september 2008 . The site took a long time to heal . Within 3 - 4 months post surgery, he noticed multiple groups of raised lesions of skin close to the suture site and draining site in the abdomen . These lesions gradually increased in size within another 3 - 4 months, with no associated discharge or pain . Now for the past four months, he had noticed multiple crops of lesions on the chest and abdomen suddenly increasing in size and number . They were associated with pruritus, bleeds on scratch, and pain, associated with discharge . He complained of painful swelling in bilateral axilla and thickening of skin underneath and surrounding the existing lesion . Physical examination revealed multiple grouped nodular erythematous to skin - colored translucent papules and nodules, a few of them hyperkeratotic, brownish to black in color of varying sizes ranging from less than 1 cm to about 10 8 cm distributed over the anterior chest wall and upper abdomen [figure 1]. There were also ulceroproliferative lesions with pus discharge rising from the excision scar overlying the epigastric region . The lesions were painful and there was purulent yellowish discharge from the lesions . The skin around the nodular masses was infiltrated and tender . Examination of the axilla revealed bilateral hard, tender, and mobile lymphadenopathies (single, about 8 6 cm in the right axilla, and single, about 3 4 cm in the left axilla). The initial cytopathological report before the first excision was consistent with benign adnexal tumor and histopathology of the excised lesion revealed it to be eccrine poroma . Based on the clinical and pathological features of a repeat biopsy, done after two years, a provisional diagnosis of cutaneous malignancy / malignant adnexal tumor was made . The repeat histopathology revealed a tumor arising within the lower portion of the epidermis with extension downward into the dermis . Multiple noduloulcerative lesions, brownish to black in color over the chest wall and abdomen the tumor was predominantly solid [figure 2]; however, narrow ductal lumina could be seen focally . The cells were oval to cuboidal with a deeply basophilic nucleus and a clear - to - eosinophilic cytoplasm . The mitotic rate was very high (10 per 10 high power field) with atypical mitosis [figure 3]. The tumor displayed an infiltrative growth [figure 4] and reached up to the subcutaneous plane . Histochemically, the cells were pas - positive (pas; periodic acid - schiff) indicating the presence of glycogen . The cells were positive for pancytokeratin and negative for hmb-45 (hmb: human melanoma black) and s-100 . A final diagnosis of malignant eccrine acrospiroma or acrospirocarcinoma was made on histopathology, based on these findings . Low - power view showing islands of cells extending from the epidermis into the dermis . The surface shows hyperkeratosis (magnification lp 5, h and e staining) atypical mitosis is seen (arrow), hp 40, h and e staining the cells are seen streaming down from the epidermis with a clear zone of differentiation between the normal epidermis and the tumor cells a computed tomography (ct) evaluation of the abdomen and thorax revealed multiple heterogeneous, hyperdense nodular lesions of varying sizes with irregular margins rising from the skin of the anterior abdominal wall and anterior chest wall [figure 5]. Some were continuous and others rose as discrete exophytic nodules . The lesions could be grouped into three types, those rising from the skin and growing exophytically with little or no deeper component, some that were primarily rising deep to the epidermis in the subcutaneous fatty tissue as discrete nodules, and other bigger lesions extending from the surface of the skin across subcutaneous fatty tissue and invading into the underlying muscles of the anterior abdominal wall and thorax . The largest nodule measured around 6.2 6.0 cm rising from the epidermis . There was also the presence of bilateral multiple enlarged lymph nodes, of around 5 6 cm on the right and around 1.3 2.5 cm on the left [figure 6]. Malignant) with infiltration into the subcutaneous tissue and underlying muscle over the upper anterior abdominal wall and upper anterior chest wall with bilateral axillary nodal involvement was made . Ct scan showing all three subtypes of lesions in the same section, the ones rising from skin and growing exophytically and invading into deeper tissues (a), those rising mainly from the deep subcutaneous tissue as discrete nodules (b), and superficial lesions that have only exophytic component (c) ct scan showing enlarged bilateral axillary lymphadenopathy, more marked on the right side the patient was treated with systemic chemotherapy, as wide local excision was not deemed feasible by the surgeon citing widespread and disseminated nature of the lesions . He was initially treated with a combination chemotherapy regimen consisting of adriamycin 50 mg / m2 day 1, vincristine 1 mg / m2 day 1 and day 5, 5-fluorouracil (5fu) 500 mg d1d5, cisplatin 20 mg / m2 and bleomycin 5 iu / m2 from day15day19, a 28-day cycle for two cycles with no significant clinical response . Thereafter, the chemotherapy regimen was changed to paclitaxel 175 mg / m2 d1, a 21-day cycle which showed minimal clinical response with the appearance of new lesions . The patient subsequently received two more cycles of paclitaxel, with sustained pain relief but minimal or no regression of the lesions . He was planned for locoregional radiation using electron beam but defaulted and was lost to follow - up thereafter . Acrospiromas are distinct sweat gland tumors that present as solitary plaques, nodules, or exophytic papules . The term eccrine acrospiroma was first coined by johnson and hewig, in 1968, because on the histologic and histochemical studies, the cells of these tumors were believed to mimic those of the eccrine sweat gland . Histologically, these lesions are subclassified according to the location of the tumor in relation to the epidermis, with those confined primarily in the epidermis as epidermal acrospiroma and those involving both the epidermis and dermis as juxtaepidermal acrospiroma or just eccrine poroma . Those which are confined exclusively to the dermis or have minimal connection to the epidermis are termed as dermal acrospiroma or hidradenoma . Malignant acrospiroma comprises a group of rare epidermal, juxtaepidermal, and dermal ductal carcinoma occurring over the head and neck, anterior trunk, or extremities . One series described an incidence of only five cases in a group of 750,000 cases over an eight - year period . Another series from russia described malignant transformation in d six cases out of 105 cases of acrospiroma they follow a predictable pattern from the tumor site to regional lymph node and ultimately to systemic metastases . Malignant acrospiromas tend to be of moderate size; the largest reported malignant tumor was 4 cm . In the present case, the lesion was widespread with the largest nodule measuring about 11 cm and the full extent of the lesions on the thorax and abdomen were of about 30 cm . Reports in the literature describe acrospiroma to be a slowly growing tumor both for benign and malignant variants . However, in the present case, the history was quite short with lesions appearing in crops over seven to eight months . The histology of the first lesion was benign eccrine poroma and the subsequent local recurrence and its malignant histology and biological aggressive behavior point to the evidence of malignant transformation in a benign lesion . Malignant acrospiromas are treated by wide local excision, with a local recurrence rate of around 50% . Holden described the use of wide local excision with adjuvant radiotherapy for malignant eccrine acrospiroma of the scalp and left parotid, which eventually had local recurrence in the parotid region after two years . Headington, et al . Describes a more radical surgical approach of amputation of the leg and regional lymph node dissection that was required for clinical control of extremity acrospiroma . William, et al . Reported the case of a 66-year - old female with a recurrent malignant acrospiroma of the chest treated by wide radical resection, including chest wall excision, followed by reconstructive surgery and radiotherapy . Harari, et al . Described the role of radiotherapy in malignant eccrine acrospiroma, wherein three cases of malignant acrospiroma were treated with postoperative radiotherapy with doses of around 71 - 76 gy to the primary surgical bed and about 50 gy to the draining lymph node basin, with modest disease - free survival (27 and 35 months) in two of the three cases . They suggested that certain histological features like dermal lymphatic invasion, nerve sheath involvement, deep structure infiltration, positive resected margin, and extracapsular lymph node extension may identify a high risk of recurrence and merit postoperative radiotherapy . The role of chemotherapy in eccrine sweat gland carcinomas, and especially malignant acrospiromas is not clear . Various case reports and case series have reported the use of a multitude of drugs in various sweat gland carcinomas like cyclophosphamide and doxorubicin, bleomycin, cisplatin, mitomycin c, and so on, with partial response and a median duration of response of 4 to 16 months. [1416] isolated reports of response to taxanes (docetaxel and paclitaxel) are also present . Hence the option of chemotherapy to reduce the bulk of the lesions followed by a trial of definitive radiotherapy was planned for this patient . However, all of the chemotherapy regimens used including paclitaxel failed to show any significant clinical response . Analyzing all the available literature, we conclude that wide local excision is the treatment of choice for these rare skin appendage tumors, when localized, and adjuvant radiotherapy provides some additional benefit in local control . Multiagent chemotherapy thought of as an option for more extensive lesions, as in the present case, did not show much benefit, indicating a relative incurability of the tumor . However, paclitaxel as a single agent could provide a viable option for palliation, though more evidence in the form of case series and case reports is needed to establish the same.
A suitable administration is important to recreate and reproduce the structure, profile, form and function of uninjured status . Mandible is the main portable bone of the facial skeleton, and there has been a considerable upsurge in trauma and fracture in a majority of cases . In case if mandible fractures are not handles properly, that may prompt unfavorable outcome both cosmetically and functionally . The incidence of infection secondary to mandibular fractures ranges from 0% to 30%, resulting in significant sequelae . A 5 years study by gutta et al . Was conducted to assess the causes of the complications associated with the surgical treatment of mandibular fractures at an academic tertiary hospital . The outcomes of gutta study reported that the use of antibiotics did not decrease the incidence of infections . However, smokers and patients with systemic medical conditions had a greater risk of complications . Furthermore, a slight delay in surgical repair was not related to an increased complication rate . A study by czerwinski et al . Showed that the delay of mandibular fracture treatment> 3 days does not significantly increase infection risk . On the other hand, repair should occur promptly after the injury . A study by pham - dang et al . Stated that the most maxillofacial fractures involve the mandible, and there is an increasing trend in treating these fractures by osteosynthesis without intermaxillary fixation . Although treatment delays in the operative management of mandible fractures are often unavoidable, antibiotic prophylaxis associated with dental hygiene care can be indicated to prevent postoperative infections . However, there is an increasing trend in falls as a cause of fracture, especially in female patients, consistent with the increasing trend in presentation of older people . Fewer studies have investigated the effectiveness of waiting time from presentation to accident and emergency until surgical intervention for patients with mandible fractures on the rate of infection and postoperative complications . There is presently no strong evidence for either acute or delayed treatment of mandibular fractures in order to minimize healing complications; new studies including a substantial number of cases treated on an acute basis are very much needed . Primary aim of this study was to evaluate the effectiveness of early treatment of mandibular fractures upon healing and postoperative complications . The null hypothesis: early or delayed treatment of mandibular fractures has no effect in reducing or increasing the postoperative complications . This study has been conducted using clinical data of patients attending the newcastle general hospital, uk for the management of mandibular fractures . The retrospective clinical study lasted for 6 months included 91 patients (1460 years), who attended during weekdays 08.3017.00 (treated at maxillofacial operating theater) and evenings (after 17.00) and weekends (treated at trauma operating theater). Patients presented with various types of fracture (single fracture, bilateral fracture, condyle fracture only, or multiple) required open reduction and internal fixation of fractured mandibles were included . The data were recorded including: date of visit, hospital number, age and gender . The patient's relevant medical history was to be considered in relation to the patient's suitability for general anesthesia . Patients were classified into three groups according to the time utilized from admission to operative intervention (<24 [treated within 24 h], <72 [treated within 72 h] and 72 [treatment took longer than 72 h]). Different mechanisms of injury were also considered in relation to time consumed to treat patients . Common postoperative complications such as numbness, malocclusion and infection were recorded at 1 week and 4 weeks after patient's discharge date . A two group t - test with a 0.01 two - sided significance level was applied, and comparison between the groups was made using non parametric tests at a significance level of 0.01 . Patients needing urgent treatment should be treated within 72 h (maxillofacial surgery ward). The risk of infection has not been observed to increase by delaying the fracture treatment more than 72 h. so as to have the capacity to offer better treatment, administration and forethought to these patients it crucial to study the nature of trauma and its different perspectives and categories, sort and sort them appropriately . This study was based on collecting information from 93 patients notes who were attending the newcastle general hospital, uk (maxillofacial surgery department) for the management of mandibular fractures over the period of 6 months . The majority of patients (> 90%) were male patients [figure 1] and presented with four major types of mandibular fractures . The simple (single or line fracture) was the main type contributing 52.69% of total cases, followed by bilateral fractures (39.78%). Condylar and multiple fractures contributed only 7.53% whereas only one patient (1.08%) reported condylar fractures . Patient distribution on the basis of gender and type of mandibular fractures the average time the patient took from incident to admission to the hospital was 11.20 0.68 h and there was no significant difference for incidence happened during the weekend or weekdays [figure 2]. Time to treatment from the point of admission was 31.50 3.83 h during week days that has been significantly more than patients attending the hospital at weekends or nights . Similar trend was observed for total summative time from the incident to treatment analysis [figure 2]. The treatment procedure took a prolonged time (57.15 5.05 h) for patients attending during working hours compared to patients attending over the weekends [figure 2]. Considering the potential cause of injuries, alcohol abuse and related assault remain the most common cause (61% all reported within 3 days of injury) followed by interpersonal violence / assault that accounted for 22% [figure 3]. The fall and road traffic accidents (rtc) accounted for 11% and 7% respectively . Patients with mandible fractures related to rtc have higher median time to treatment from admission to operative intervention than other present complaints [p <0.05, figure 3]. A record of time to treatment for mandibular fracture patients attending the hospital during office hours and out of office hours relationships of fracture etiology and respective time to treatment for patient reporting mandibular fractures (road traffic cases) in terms of postoperative complications, a follow up of 4 weeks was recorded [figure 4]. About 45% patient did not report any post - operative complication in 4 weeks follow up time . Whereas 40% of patients with fractured mandible reported numbness after 1 week however it was reduced to 22% in 4 weeks follow up . The third main complication was malocclusion that was developed in 17% and reduced to just 9% in later follow up . The incidence of postoperative infections was reported in 5% patients and remains consistent for earlier and later follow ups . The review of literature suggests that there is uniform consent that the typical patient with a mandibular fracture is male and between 14 and 60 years of age . The results of this study have revealed that 38% of patients were treated <24 h, 52% treated between 24 h and 72 h however only 10% treated> 72 h. secondly, the mechanism of trauma is due to violence that is a major cause to sustain a mandibular fracture . In consistent to several studies, which report very high rates of interpersonal violence with almost epidemic proportions, all fractures were a consequence of the assault in the patient group . On the other hand, it must be pointed out that none of the cases involved a gunshot wound despite a very high percentage of privately owned small arms . Instinctively, it might cause the postponement for mandible fracture treatment might prompt a higher complication rate . For sure anderson and alpert showed a 16% general postoperative infection rate in the investigation of 75 mandible fractures; however, no contaminations happened in patients operated on inside 24 h of trauma . An alternate study by maloney et al . Reported 204 fractures in 131 patients with an in overall infection rate of 4.4% . In any case, consistent patients treated inside 72 h of injury and or trauma had no contaminations and infections . Of all the categories responsible for facial trauma in the present study, violence was the most prevalent, and when compared to the second most frequent category, automobile accidents, this association was statistically significant . There was a significant increase in the median time to treatment from admission to surgical intervention for patients who treated in maxillofacial operating theatre comparing with those treated in trauma operating theatre . Patients with mandible fracture following road traffic collision (rct) or association between alcohol intoxication and assault recorded higher median time to treatment as results of head injuries, chest injury (rib fractures, hemothorax and pneumothorax). Despite the fact that in the present study, in all trauma sort classifications there was a prevalence of men, women can likewise be casualties of trauma, particularly interpersonal roughness, on all its structures, and the majority of the times there are large amounts of alcoholic beverages included . The world health organization reports that violence is dependable for the high health insurance takes and for about 73,000 death / year in europe . Postoperative complications for the mandibular fractures management are fundamentally connected to the severity of the fracture instead of the treatment plan . Regarding the relationship of trauma mechanism and fracture site, our study confirms previous findings of a correlation between etiology and fracture pattern . Considering the comparable low number of traffic and occupational related injuries in our study, the safety measurements in these fields seem to have proven their effectiveness in the prevention of facial injuries . Patients conceded from the emergency department for prompt repair were frequently put off because of operating room intervals for absence of employees / work force or more intense cases requiring urgency . Elective repair takes into consideration a brief hospital admission and in addition utilization of surgical facilities, which might be better financially savvy than performing surgery at a tertiary care centers . Delay from admission to treatment the delay from admission to treatment may be because of elective theatre (maxillofacial theater weekdays 9 am to 5 pm). This investigation has demonstrated that the rate of infection and postoperative complications following surgical treatment of mandible fractures can be eased off by reducing the waiting time from presentation to the emergency and to the operating theatre . The risk of infection, malocclusion, mal - union and technical complications might rise with treatment delay, and therefore the surgical team must be alert of these consequences when reducing these fractures.
Chronic graft versus host disease (cgvhd) belongs to the most serious and frequent (3070%) complications in patients undergoing hemopoietic stem cells transplantation (hsct) for hematological malignancies . Musculoskeletal and skin cgvhd, by inducing fibrotic changes in tissues, may result in reduction of joints range of motion (rom), loss of muscular strength and, finally, in functional impairment, compromising the activities of daily living (adl). Supportive cares, such as physical rehabilitation and occupational therapy, although recommended as ancillary therapy, have been rarely experienced in such a condition ., recently presented, dealt with a single case of motor rehabilitation in a patient with cgvhd - related contractures . At the best of our knowledge, it represents the first reported case of extensive cgvhd with skin and musculoskeletal involvement treated with physical rehabilitation in an adult patient . Thereby, we described an additional case of a patient with similar cgvhd involvement recently treated with physical rehabilitation within our homecare program . A 39-year - old man affected by chronic myeloid leukemia (cml) in third relapse after allogeneic hsct and not eligible for further active therapy was referred to our homecare service as advanced / terminal patient in june 2008 . At diagnosis, in 1992, he had been submitted to hla identical sibling allogeneic hsct, obtaining complete remission (cr); in 1998, a disease relapse, as accelerate phase of cml, occurred . Therefore, a second hla identical sibling allogeneic hsct, from a different donor, was performed and both hematological and cytogenetic remission were achieved . In 2004, the patient developed a second hematological relapse (myeloid blast crisis) and he was given donor lymphocyte infusions (dli) and imatinib; after three dlis at escalating doses, a molecular cr was obtained . However, 8 months later, he developed extensive cgvhd (skin, mouth, eye) and, therefore, immunosuppressive therapy (steroids and extracorporeal photoferesis) was started, without improvement, such that cgvhd progressed with the addition of lung involvement . Therefore, the patient received multiple lines of immunosuppressive drugs (rituximab, cyclosporine, plaquenil and mycophenolate) with only a poor response . Meanwhile, in june 2007, he developed a third relapse (extramedullary lung and bone involvement) and was treated with imatinib and dasatinib without response and therefore he was considered not eligible for further causal therapy . At admission in the homecare service, the patient presented with an extensive skin and musculoskeletal cgvhd; barthel index (bi), as adl measure, was 40 (moderate severe reduction; normal = 100), as a result of diffuse contractures with severe reduction of joints rom [table 1]; secondary, legs muscles hypotrophy was increased due to spinal cord disease - related compression . The patient was assisted with a fully homecare program, with medical and nursing periodic examination, transfusions support and motor rehabilitation . Both physical and occupational therapy were promptly started, with particular attention to stretching exercises for joints; planned intensity was 3 sessions per week . After 4 weeks of treatment, planned intensity was respected and no rehabilitation - related complications were noted . Although bi did not improve, the rom of treated joints increased and the mean rom improvement (expressed as percentage of baseline value) was 52.5% [table 1]; both motor skills, psychological aspects and patient quality of life had significant amelioration . After 5 weeks, rehabilitation was discontinued because of infectious pneumonia and, 1 month later, an attempt to restart failed due to rapid deterioration . In november 2008, range of motion in major joints: normal value, baseline value (t0), after 1 month of treatment (t1) and improvement expressed as percentage of baseline value () musculoskeletal involvement, in the course of cgvhd, is a rare phenomenon; larger reported series describe cgvhd - related fasciitis or myositis in less than 1% of the patients undergoing allogeneic sct . Musculoskeletal cgvhd, expression of an immunological response toward recipient antigens, is considered an organ involvement in the course of a widespread disease, and systemic immunosuppressive therapy is the standard approach of treatment . However, local treatment should be used in order to improve response and to reduce toxicity, allowing a prompt and rapid escalation of systemic treatment . Although data derived from experiences in different immunologically mediated musculoskeletal contractures suggest an important role of physical rehabilitation, such a therapy remains a poorly explored issue in patients with cgvhd, with few data reported in adult patients . Although limited, confirm the possibility of almost temporary results, also in long - lasting cgvhd - related contractures . Monitoring for musculoskeletal involvement in patients at risk for or with initial features of cgvhd is required, both to prospectively evaluate cgvhd - related muscoloskeletal involvement and to enroll patients at an initial disease stage . Clinical trials have to be developed to adequately assess feasibility, safety and efficacy of motor rehabilitation in response to the need to prevent disease progression toward rom limitation and consequent disability.
Advances in minimally invasive technology and surgical techniques have allowed more complex procedures to be performed including laparoscopic anti - reflux surgery, laparoscopic myotomy for achalasia, laparoscopic and thoracoscopic staging for esophageal cancer, videoassisted thoracoscopic (vats) lobectomy, vats belsey fundoplication, vats lung reduction surgery for emphysema, and many others . Esophagectomy for benign and malignant disease is a complex and challenging surgical procedure that can be associated with significant morbidity and mortality . In an effort to decrease the morbidity associated with esophageal resection the aim of this report is to describe our initial experience using minimally invasive surgical approaches to esophagectomy . From june 1996 to may 1997, eight patients underwent esophagectomy at the university of pittsburgh medical center using minimally invasive techniques alone or in combination with mini - laparotomy or mini - thoracotomy . The decision to perform all or part of the procedure using minimally invasive techniques was based on body habitus, prior surgery, tumor size and location, and surgeon's preference . Addition of an open procedure was applied if there were technical difficulties precluding completion of the operation by minimally invasive techniques . Data were collected for demographics, operative time, complications, length of hospital stay and the number of conversions to an open procedure . The patient were placed in a supine position with the head turned slightly to the right . The surgeon stood on the patient's right side with the assistant on the left . Five abdominal ports were placed (figure 1) with the patient positioned in a steep reverse trendelenburg position . Esophageal hiatus was exposed by retracting the left lobe of the liver upward using the medi - flex (velmed, wexford, pa) self - retaining retractor system . The stomach was mobilized with division of short gastric vessels using the ultrasonic shears (u.s . The stomach was retracted superiorly and the left gastric vessels were identified and divided using the endo - gia stapler (u.s . Gastroduodenoscopy with insufflation was used in some cases to confirm the completion of the myotomy and absence of leaks . The periesophageal dissection was accomplished under direct visualization by retracting downward on the stomach and dividing the aortoesophageal branches . The entire dissection was performed using the ultrasonic shears (u. s. surgical corporation). The esophagus with a cuff of normal gastric cardia was divided from the remaining stomach using the 4.5 mm endoscopic stapler (ethicon, cincinnati, ohio). The distal esophagus was sutured to the gastric conduit using 2 - 0 surgitek endostitch (u.s . Surgical corporation). A 5 cm horizontal neck incision was used to mobilize the cervical esophagus . Mediastinoscope was inserted along the periesophageal plane to facilitate circumferential dissection of the upper esophagus . Once the entire esophagus was completely mobilized, it was removed through the neck incision by applying traction to the attached gastric conduit transhiatally up to the cervical incision . A nasogastric tube was directed through the anastomosis and placed down into the distal stomach . A laparoscopic feeding jejunostomy tube was performed by attaching a loop of proximal jejunum to the anterior abdominal wall . A seldinger technique was used to place the feeding tube into the efferent limb of the jejunum . The patient was intubated with a double lumen tube for single lung ventilation and was positioned in the left lateral decubitus position with the right lung collapsed . Four 10 mm ports were used initially, but currently we use two 10 mm and two 5 mm ports . The camera port was placed at the seventh intercostal space, mid - axillary line . Another 10 mm port was placed at the eighth or ninth intercostal space 2 cm behind the posterior axillary line for the ultrasonic shears . One 5 mm port was placed posterior to the tip of the scapula and one at the fourth intercostal space at the anterior axillary line for placement of retracting instruments . Surgical corporation) was placed on the central tendon area of the diaphragm and brought out of the thorax inferiorly to facilitate downward retraction of the diaphragm and promote exposure of the distal esophagus . The azygos vein was mobilized and divided using the endo - gia stapler with vascular cartridge (u.s . Periesophageal lymph nodes were sampled intraoperatively or mobilized to remain attached to the resected specimen . The patient were placed in a supine position with the head turned slightly to the right . The surgeon stood on the patient's right side with the assistant on the left . Five abdominal ports were placed (figure 1) with the patient positioned in a steep reverse trendelenburg position . Esophageal hiatus was exposed by retracting the left lobe of the liver upward using the medi - flex (velmed, wexford, pa) self - retaining retractor system . The stomach was mobilized with division of short gastric vessels using the ultrasonic shears (u.s . The stomach was retracted superiorly and the left gastric vessels were identified and divided using the endo - gia stapler (u.s . Gastroduodenoscopy with insufflation was used in some cases to confirm the completion of the myotomy and absence of leaks . The periesophageal dissection was accomplished under direct visualization by retracting downward on the stomach and dividing the aortoesophageal branches . The entire dissection was performed using the ultrasonic shears (u. s. surgical corporation). The esophagus with a cuff of normal gastric cardia was divided from the remaining stomach using the 4.5 mm endoscopic stapler (ethicon, cincinnati, ohio). The distal esophagus was sutured to the gastric conduit using 2 - 0 surgitek endostitch (u.s . Surgical corporation). A 5 cm horizontal neck incision was used to mobilize the cervical esophagus . Mediastinoscope was inserted along the periesophageal plane to facilitate circumferential dissection of the upper esophagus . Once the entire esophagus was completely mobilized, it was removed through the neck incision by applying traction to the attached gastric conduit transhiatally up to the cervical incision . A nasogastric tube was directed through the anastomosis and placed down into the distal stomach . A laparoscopic feeding jejunostomy tube was performed by attaching a loop of proximal jejunum to the anterior abdominal wall . A seldinger technique was used to place the feeding tube into the efferent limb of the jejunum . The patient was intubated with a double lumen tube for single lung ventilation and was positioned in the left lateral decubitus position with the right lung collapsed . Four 10 mm ports were used initially, but currently we use two 10 mm and two 5 mm ports . The camera port was placed at the seventh intercostal space, mid - axillary line . Another 10 mm port was placed at the eighth or ninth intercostal space 2 cm behind the posterior axillary line for the ultrasonic shears . One 5 mm port was placed posterior to the tip of the scapula and one at the fourth intercostal space at the anterior axillary line for placement of retracting instruments . Surgical corporation) was placed on the central tendon area of the diaphragm and brought out of the thorax inferiorly to facilitate downward retraction of the diaphragm and promote exposure of the distal esophagus . The azygos vein was mobilized and divided using the endo - gia stapler with vascular cartridge (u.s . Periesophageal lymph nodes were sampled intraoperatively or mobilized to remain attached to the resected specimen . Minimally invasive esophagectomy was performed on 8 patients (5 males, 3 females). Indications for esophagectomy included stage i carcinoma in 5 patients; palliative resection for dysphagia in 1 patient; barrett's esophagus with high grade dysplasia in 1 patient; and 1 patient with end stage achalasia . Patients with carcinoma did not receive prior chemotherapy or radiation therapy . The mean age was 68 years with a range of 54 - 82 years (table 1). Palliative resection was performed in one patient with good performance status and single metastatic lesion on the left lobe of the liver, which was resected by wedge excision at the time of esophagectomy . Two patients had prior esophageal surgery (hiatal hernia repair in one and a collis - nissen hiatal hernia repair in another). Approach to esophagectomy included total laparoscopic transhiatal esophagectomy in 4 patients; thoracoscopic combined with laparoscopic esophagectomy in 1; and laparoscopic gastric mobilization with right muscle - sparing mini - thoracotomy in 3 patients (table 2). Conversion to mini - laparotomy was necessary to complete esophageal dissection in 1 patient and to facilitate gastric pull - up in another . The mean operative time was 460 minutes (range of 267 - 570 minutes). The mean intensive care stay was 1.9 days (range of 0 - 7 days). The mean hospital stay was 13.8 days (range of 4 - 45 days). Minor complications included atrial fibrillation (n=1), pleural effusion (n=2) and persistent air leaks (n=1). Major complications included cervical anastomotic leak in 1 patient, and delayed gastric emptying requiring pyloroplasty in 1 patient without a pyloromyotomy at the original operation . The final pathology was stage i carcinoma in 3 patients (2 adenocarcinoma, 1 squamous cell); stage ii in 2 patients (2 adenocarcinoma); stage iv in 1 patient for palliative resection (adenocarcinoma); barrett's esophagus with high grade dysplasia in 1 patient; and 1 patient with benign end stage achalasia mega - esophagus . The incidence of esophagus carcinoma in the united states is increasing at an alarming rate . The prognosis remains poor, with an overall five - year survival rate of 5 - 10% . Surgical resection of the esophagus is associated with significant morbidity and a mortality rate ranging from 2% to 10% . In an effort to decrease the morbidity and mortality associated with esophagectomy most reports utilized a standard laparotomy with thoracoscopic esophageal mobilization or laparoscopy to facilitate gastric mobilization combined with a mini - laparotomy to bluntly complete the esophageal dissection . Depaula was the first to report a large series of 48 patients undergoing a total laparoscopic transhiatal esophagectomy . In 2 patients, one patient required a right thoracoscopy with intrathoracic anastomosis due to poor viability of the gastric tube . We have extensive experience in the management of benign esophageal disorders using laparoscopic and/or thoracoscopic techniques . In addition, we routinely perform laparoscopic and thoracoscopic staging in patients with esophageal carcinoma for placement into a neoadjuvant therapy protocol . This experience led to the application of these techniques to esophagectomy . The operative ports for laparoscopic transhiatal esophagectomy are similar to our port placement in performing a laparoscopic nissen fundoplication with the addition of a cervical incision . The laparoscopic transhiatal periesophageal dissection can be performed under direct visualization with the ability to biopsy surrounding mediastinal lymph nodes . Limitations for this approach include the small working space through the esophageal hiatus and difficulty in dissection of the mid and upper third esophagus due to the length of our instrumentation . In three cases, we performed laparoscopic gastric mobilization with a right mini - thoracotomy and intrathoracic anastomosis secondary to incomplete laparoscopic transhiatal esophageal mobilization . Therefore, we recently added thoracoscopic esophageal mobilization in one case as the first step followed by the laparoscopic gastric mobilization with transhiatal gastric pull - up . Thoracoscopic approach improves our ability to perform a wider lymph node dissection in these patients and improves our ability to mobilize the mid and proximal third of the esophagus following division of azygos vein . Appropriate instrumentations including the ultrasonic shears, endoscopic stapler and liver retractor are necessary to perform this procedure . This small series, similar to those of depaula and swanstrom, confirm that esophagectomy can be safely performed by the total laparoscopic or thoracoscopic approach in selected patients.
Type 2 diabetes or hyperglycemia, which is characterized by high blood glucose levels and glycosuria, is an endocrine disorder . It may occur for two main reasons: (1) deficient / insufficient secretion of insulin by the pancreatic beta cells; or (2) decreased or lost sensitivity of the insulin receptors . These two factors are preceded by stress, obesity, and a sedentary lifestyle.3, 4 at present, diabetes management is a prime concern in the medical community . As a result of various factors, diabetes management is a challenging problem.5, 6, 7, 8 however, many medicinal plants in ancient indian medicine (ayurveda) have been identified and used to reduce the hyperglycemic condition in the body . The herbs control the hyperglycemic condition and effectively maintain normal glucose levels from a long - term perspective . Many medicinal plants have recently been evaluated for their antihyperglycemic property and have been successfully proven for their effects.9, 10, 11 numerous polyherbal formulations are also being evaluated for effective diabetes management . Thus, a new formulation has been developed that combines six different herbs that are used in daily life as foods and have significant antidiabetic activity . We combined the six plants based on previously available literature, indigenous knowledge, and various preliminary studies . Our aim was to investigate the antidiabetic potential of the polyherbal formulation (i.e., adj6) and prove its synergistic effect against various aspects involved in diabetes management . Chemicals such as soluble starch and porcine pancreatic -amylase (ppa) were purchased from srl pvt . Ltd . -glucosidase, 3,5-dinitrosalicylicacid (dnsa), and 2,4-dinitrophenyl hydrazine (dnph) were obtained from himedia laboratories (mumbai, india). Para - nitrophenyl -d - glucopyranoside and standards such as gallic acid, quercetin, and ascorbic acid were purchased from sigma - aldrich co. (st . The herbs were collected from the medicinal farm frontier mediville (elavur, gummidipoondi, india) and were submitted to the plant anatomy research centre (tamil nadu, india) for authentication . The plant names, families, and parts used and their medicinal properties are listed in table 1 . The plant parts were minced individually using a mixer . The individual plants were then freeze - dried using a lyophilizer to minimize the loss of bioactive components . The freeze - dried powder was stored in an air - tight container at room temperature until further use . The traditional ayurvedic methods of preparing herbal formulations are primarily aqueous (it is likely that the peptides, proteins and glycans possessing antidiabetic activity would be denatured in organic solvents . ). The powders of each plant were mixed together in a specific proportion, soaked in water for 24 hours, and filtered . The assay mixture consisted of 500 l of 0.02 m sodium phosphate buffer [containing 6 mm sodium chloride (nacl), ph 6.9], 0.05 units of ppa solution, and adj6 at a concentration of 0.11.5 mg / ml (w / v). After incubation, 250 l of 0.5% (v / v) starch solution in the aforementioned buffer was added to the tubes and incubated for 15 minutes at 37c . The reaction was terminated by adding 1 ml of dinitrosalicylic acid reagent and then incubated in a boiling water bath for 10 minutes . The tubes were cooled and the absorbance was measured at 540 nm (shimadzu uv - vis 1800 spectrophotometer; shimadzu corporation, kyoto, japan). A tube with ppa but without adj6 served as the control with 100% enzyme activity . The assay mixture consisted of 150 l of 0.1 m sodium phosphate buffer (containing 6 mm nacl, ph 6.9), 0.1 unit of -glucosidase, and adj6 at a concentration of 0.11.5 mg / ml (w / v). The assay mixture was preincubated at 37c for 10 minutes . After incubation, 50 l of 2 mm para - nitrophenyl -d - glucopyranoside in 0.1 m sodium phosphate buffer was added to the mixture and incubated at 37c for 25 minutes . The reaction was terminated by adding 50 l of 0.1 m sodium carbonate (na2co3). The yellow color that developed was measured at 405 nm (bio - rad microplate reader; bio - rad laboratories, california, usa). The tube with -glucosidase but without adj6 served as the control with 100% enzyme activity, and acarbose served as the positive control.% inhibition = absorbance of controlabsorbance of extractabsorbance of control 100 the formulation adj6 was analyzed for the presence of amino acids, steroids, cardiac glycosides, phenols, tannins, terpenoids, alkaloids, flavonoids, saponins, carbohydrates, reducing sugar, and anthrones . One milliliter of sample (0.21 mg / ml) was added with 0.5 ml of folin ciocalteau reagent and incubated at room temperature for 10 minutes . Furthermore, 2.5 ml of saturated na2co3 solution was added and incubated at room temperature for 30 minutes . The resultant color was measured at 750 nm versus a blank containing distilled water and folin ciocalteau reagent . Total phenolic content was expressed in gallic acid equivalents using the equation t = cxv / m (t = total phenolic content (mg / g) of extract as gallic acid equivalents, c = concentration of gallic acid established from the calibration curve, v = volume of the extract solution in ml, m = weight of extract in grams). One milliliter of sample (0.21 mg / ml) was added with 0.5 ml of 1.2% aluminum chloride in 10% methanol, 0.5 ml of 1 m potassium acetate, and made up to 3 ml with distilled water . The mixture was incubated for 30 minutes in the dark, and the absorbance was read at 415 nm . Vitamin c was determined using the method described by roe, but with modification, using ascorbic acid as the reference compound . Fifty microliters of sample (0.21 mg / ml) was added with 150 l of 5% tca (trichloroacetic acid). The mixture was added with 500 l of 10 mm dnph and 500 l of 4% thiourea and incubated at room temperature for 3 hours . Postincubation 2.5 ml of 85% sulfuric acid was added and the absorbance was measured at 530 nm . The data are expressed as the mean the standard deviation (sd). -amylase (ec 3.2.1.1) randomly cleaves the -(14) glycosidic linkages of amylase to yield dextrin, maltose, or maltotriose, whereas -glucosidase (ec 3.2.1.20) hydrolyzes the terminal nonreducing 1 - 4 linked -glucose to release glucose molecules . Incubation of the -amylase with the substrate leads to the generation of maltose; however, the addition of the adj6 [inhibitory effect (ic50), 0.41 0.03 mg / ml) significantly inhibited the liberation of maltose in a dose - dependent manner, compared with acarbose (ic50, 0.2 0.01 mg / ml) (fig . 1). The ic50 of -glucosidase was 0.51 0.01 mg / ml, whereas that of acarbose was 0.39 0.02 mg / ml (fig . 2). The aqueous extract of the formulation also showed the presence of major phytochemical constituents such as phenols, flavonoids, steroids, cardiac glycosides, and saponins (table 2). The aqueous extract of the formulation was estimated for total phenol, flavonoids, and vitamin c content . The amount of phenols was 340 2.5 mg / g equivalents of gallic acid . The amount of flavonoids was 235.4 8.3 mg / g of quercetin equivalents, whereas the level of vitamin c was the highest at 470.8 16.6 mg / g of ascorbic acid equivalents (fig . The analyses suggested that the ic50 values of adj6 against -glucosidase and -amylase at various concentrations were less than those for the standard drug acarbose . Acarbose is a potent inhibitor of -amylase and -glucosidase, but adverse effects have occurred in the gastrointestinal tract because of excessive inhibition of the amylase enzyme that results in flatulence and diarrhea . Use of acarbose for the treatment of diabetes by dietary control has reportedly resulted in hepatitis.52, 53, 54 acarbose treatment also elevates liver enzyme levels, whereas its withdrawal normalizes levels . There has recently been a push to find an alternative source of treatment for type 2 diabetes, especially from medicinal plants that have high potency and fewer adverse effects than preexisting drugs.56, 57, 58, 59, 60, 61 excessive inhibition of pancreatic amylase can lead to abnormal bacterial fermentation of carbohydrate foods in the colon, which may lead to adverse digestive disorders.51, 62 plant - based compounds and products derived from natural sources have been reported for their potent inhibitory activities of the enzymes, but have fewer or no side effects.56, 57, 58, 59, 60, 61 the polyherbal formulation adj6, although it has slightly less inhibitory activity than acarbose, will likewise have fewer or no adverse effects because it is completely derived from plant sources . Because adj6 is rich in phytochemical constituents (i.e., phenols, flavonoids, and vitamin c), it will be helpful in the management of diabetes and will decrease the risk of other chronic disorders that are associated with diabetes . The present study elucidates that the polyherbal formulation adj6 can be used for effectively managing type 2 diabetes mellitus . The activities of the individual components of the plants are well known for their insulin mimetic role and for their role in reducing insulin resistance . The plants that are used in the formulation have been long used for food and medicinal purposes . Our results suggest that adj6 inhibits the enzymes -amylase and -glucosidase and contains a high amount of phytochemical constituents (i.e., total phenols, flavonoids, and vitamin c). Thus, adj6 may be used in the management of type 2 diabetes mellitus with few or no side effects . However, further studies of adj6 using in vitro and in vivo models need to be performed to elucidate its insulin mimetic activity and reduction of insulin resistance.
In many research institutions, we often do not appropriately support effective and dynamic undergraduate science education . Educators are held in high esteem as the agents of change for our youth, but they are unfortunately resistant to changing their teaching styles and practices (handelsman et al ., 2004). Over the past decade, undergraduate educators have recognized the need to shift the theoretical framework of their field, although changes are only slowly coming into practice (pfund et al ., 2009). Scientists gain respect and recognition in their field by attending conferences, presenting posters, and publishing primary literature . When expected to teach, however, scientists are often placed into classrooms without proper mentoring or training . Educational researchers have begun to recognize that an ability to educate in the sciences is not inherent and must be cultivated . In 2003, the national research council (nrc) published the report bio2010, transforming undergraduate education for future research biologists, identifying the need for a paradigm shift in undergraduate science education and highlighting the need for expanded teacher education training (nrc, 2003). Several institutes and training opportunities have been developed to assist faculty at research institutions in improving their teaching styles, including the national academies summer institute on undergraduate education (pfund et al . . The preparing future faculty program launched by the council of graduate schools and the association of american colleges and universities has similarly begun programs to train and mentor graduate students in the field of science teaching and education (pruitt - logan et al ., 2002). Despite these efforts, large gaps still exist in the training of traditional science students interested in teaching at the undergraduate level . Advances in effective teaching methodologies in undergraduate science, technology, engineering, and mathematics (stem) education have long been discussed . Recently, the nrc held workshops highlighting the best practices in stem education (reviewed in labov et al ., 2009). These best practices included topics such as concept - based teaching, the use of case studies, and the use of effective assessment strategies (alparslan, 2003; garvin - doxas, et al ., 2007). These practices should be emphasized and demonstrated effectively to future science teachers including those students currently serving as undergraduate teaching assistants (utas). Data demonstrate both the importance of a cohesive teacher student relationship to educator development and the deconstruction of that model to a nonhierarchical educator learner dynamic . Explicit instruction in the theory, practices, and behaviors of effective science educators is critical to achieving the objective of a progressing science educator workforce (gibbs and coffey, 2004). Emphasis on the mentorial role of faculty in the perpetuation of these theories and on a passion for education is a necessity in this changing environment . There is widespread support for a focused reformation in the classroom environment as a root intervention to promote more effective education . Pickering (2003) suggests that such change must take place through educator empowerment, providing teachers with the autonomy to be decision - makers, and to develop their own theory of practice . They teach for a variety of reasons, including but not limited to: solidification of knowledge, resume building, personal edification, or an interest in a career in education . We believe that the importance of this role is sevenfold: 1) peer - to - peer educational communication can facilitate increased communication between students and faculty (jabker and rives, 1974); 2) student - teachers are actively seeking a mentor mentee relationship and thus can be easily engaged and exposed to educational habits that foster optimal student learning (prawat, 1992); 3) the challenge of learning the basics of pedagogical theory and practice is eased by doing so in an area with which the young educator is previously well versed (e.g., a class that they have completed in the recent past); 4) creating a conduit for recruitment and proceeding development of young science teachers will increase the innovative capacity of science education; 5) student - teachers allow for increased personalization of education as shown in the case of supplemental instruction sessions (stone and jacobs, 2008); 6) by serving as advocates for students to faculty, utas increase cohesion in the classroom; and 7) to optimize young teacher educational programs, the novice must be engaged in authentic teaching tasks under the guidance of an expert practitioner; pseudoteaching practices such as role playing and artificial classrooms are insufficient (brown et al ., 1989; ball and cohen, 1999). Many teaching assistants (tas), however, lack sufficient training and supervision (prieto and altmaier, 1994). Very little research in ta training is aimed at defining a theoretical model, and few models of training or supervision exist (prieto et al ., 2001). In addition, it has been shown that student perception of learning is higher when more prepared and high - quality teaching students are involved in undergraduate biology courses (casem, 2006). Structured comprehensive ta training programs will enhance the learning experience for students enrolled in ta - facilitated courses and will increase the odds that student - teachers will move into the professoriate . We are particularly interested in targeting the undergraduate student cohort currently engaged as tas in the introductory biology laboratory course at brandeis university . Historically, these students have been asked to instruct their peers with minimal exposure to educational pedagogy and have not been provided training on how to present or explain material in the classroom . The educating young educators internship (ed92a) was designed to give undergraduate students teaching experience; provide an introduction to evidence - based practices, popular techniques and contemporary educational philosophies used to teach science and biology; and inspire them to think more critically about teaching and learning during their time as tas . It is our belief that by nurturing young educators, providing didactic exposure to pedagogy in parallel with structured and mentored teaching experience, we may impart useful educational theory and practice upon future generations of teachers at the college level . Through this case study, we intend to demonstrate the validity of such programs and to highlight their importance in a changing educational world . Undergraduate students at brandeis university are taught introductory biology laboratory skills over two semesters, usually in their second year of college . Cell and molecular biology (biol18b) is taught in the fall semester, and molecular genetics (biol18a) is taught in the spring . The majority of students enrolled in biol18 are life sciences majors or are fulfilling requirements necessary for pursuing advanced course work in health - related fields . Although this course is taught concurrently with traditional lecture courses in cell biology and genetics, biol18 is self - contained and has independent lecture and laboratory components . The laboratory sections are each run by two tas: a second - year graduate student (gta) most often in the life sciences ph.d . Program and a third- or fourth - year uta who has previously completed both semesters of the course, receiving at least a b+ in each respective term . Historically, the gta was responsible for teaching the laboratory section, reviewing course information, explaining misconceptions to students, holding office hours, and leading prelaboratory lectures and exercises . The uta's primary function was to assist the gta with technical support for the laboratory drawing upon the experience of having taken the course . Utas were present for the entirety of lab and were paid modest hourly wages . Over the past 4 yr, it became increasingly clear that our utas wanted a more significant role in the course . Many had specifically expressed interest in teaching and mentoring students and had volunteered to lead prelab discussions and postlab recaps . Although this seemed like a viable option to deepen the potential uta experience and to relieve a small fraction of the already heavy workload of the gtas, the utas did not have the pedagogical training to provide proper guidance or instruction to students . With this in mind, we have designed an internship experience to train utas in pedagogical theory and practice, in parallel with closely monitored teaching experience . This course focuses on developing the participants' ability to teach effectively, to recognize student misconceptions, and to foster student understanding and retention of key concepts . Students met once weekly to discuss topics and efforts under way in the biology education field and to put these ideas into practice as tas of the introductory biology laboratory course . The ed92a internship was designed to fulfill two primary perceived gaps in the education of undergraduate teachers . The purpose was defined as follows: to provide teaching experience in a closely structured and mentored environment with an emphasis on self- and peer - critique, with constructive feedback and critical integration provided by the course director, and to provide participants with an introduction to evidentiary analysis, popular techniques and practices, and contemporary pedagogical philosophies for science education . Specifically, the internship was designed with the following learning objectives in mind: to provide participants with an understanding of the importance of concept - based learning in the sciencesto teach participants the value of effective assessment including student self - assessment, instructor evaluation of student progress and learning, and assessment of course efficacyto demonstrate the importance of concept integration and of making scientific connections when teachingto expose participants to interactive strategies for teaching science in college classroomsto provide participants with experience reading, discussing, and critically evaluating articles in science educationto allow participants experience reading primary literature in biology education and to give them an opportunity to put teaching strategies into practice to provide participants with an understanding of the importance of concept - based learning in the sciences to teach participants the value of effective assessment including student self - assessment, instructor evaluation of student progress and learning, and assessment of course efficacy to demonstrate the importance of concept integration and of making scientific connections when teaching to expose participants to interactive strategies for teaching science in college classrooms to provide participants with experience reading, discussing, and critically evaluating articles in science education to allow participants experience reading primary literature in biology education and to give them an opportunity to put teaching strategies into practice it was our hope that students would emerge from the course with a more complete understanding of biological education research and that they would be able to apply these tools in a classroom setting . In its first iteration, ed92a had four primary components: reading of primary literature in science education, discussion of key concepts in select areas of biology, attendance at a weekly ta training session, and teaching a laboratory section of the introductory biology lab course (biol18a or biol18b). Students were encouraged to meet with a colleague from the education department at least once during the semester to discuss ideas and reflections on the course material . Once weekly, the ed92a participants met with the professor to discuss at least one original article of primary education literature . Our goal was to critically analyze these papers . In discussions, we focused on articulating the main points of the paper, identifying conditions under which the data were collected and assumptions used in interpreting the data . We also discussed how the results could be applied to the teaching environment at brandeis and in particular, biol18 . Starting the third week of the seminar series, course participants were asked to facilitate the literature discussions; each student did so on at least three occasions over the semester . Because students could enroll in ed92a multiple times, the reading list was changed each semester to provide a diverse array of topics for discussion, although the same overarching thematic topics were held constant . Fall 2008 ed92a topics covered in discussion sessions in choosing literature for the course, we adhered to the following rationale to guide our selections . For the first week of class, we assigned a reading or review that set the stage for educational reform in the sciences . This discussion section invariably led to candid debates between ed92a participants concerning undergraduate science education at brandeis and generalized opinions of science education across their diverse experiences . We encouraged frank commentary and criticism on the part of the students of their educational experiences and feel that this allowed the students to experience the interactive and open nature of the course . We emphasized the importance of comment and critique in teaching as a discipline during this session . Because the participants then began teaching in the classroom, we generally selected literature for the following week(s) discussing student learning and concept rather than fact - based teaching . These sessions helped the students recognize the difference between rote memorization and intrinsic understanding on the part of the introductory students, and we hoped it would frame the way in which our participants approached the presentation of information throughout the semester . Before and after the written classroom examinations were given to the biol18 students, we held a series of sessions concerning different types of assessment and how these strategies can be used both as evaluation tools for students and for course diagnostic purposes . Most of our participants had only experienced straightforward evaluation in their personal undergraduate experiences, and, after reading these papers, would offer suggestions as to how to incorporate ideas such as student self - assessment and reflection essays into the ongoing course . This also provided a timely opportunity for our participants to design a midterm teaching assessment for themselves that all administered to their students . For the remainder of the semester, we selected articles that reflected teaching strategies the professor had begun to implement in the course that particular semester, and those intended for future incorporation . The ed92a participants had sufficient teaching experience such that many positively contributed to dialogue concerning the value and implementation of these techniques . The final session focused on a topic of particular interest to that semester's cohort . The instructor selected an article concerning a specific topic that had been a focus of discussion throughout the semester . These topics have included such ideas as academic dishonesty, the teaching of evolution, and the medical school entrance criteria . All course readings are periodically discussed with colleagues involved in the master's of arts in teaching at brandeis in the departments of education and other sciences to ensure appropriateness and relevance of topic choice . In addition to our broad - based rationale and topic selection, the following issues were discussed contextually: constructive classroom dialogue, participatory lecturing, making teaching more dynamic while emphasizing productivity, effective evaluation, humor in the classroom, and the use of demonstrations as effective tools for student engagement . Students were partnered with a gta who was primarily responsible for giving prelab lectures, but the utas enrolled in the course had to independently give the prelaboratory lecture for their section at least three times during the semester . In addition, students enrolled in this course were periodically required to facilitate the postlaboratory discussions in their section, which included posing conceptual questions of biol18 students to encourage participatory learning . To prepare for the upcoming laboratory, participants were required to attend weekly training sessions, in which the course professor demonstrated lecturing techniques and strategies, and participants were given advice on how best to encourage student participation and inquiry - based learning in biol18 . On occasion, these sessions consisted of guided exam or lab report grading to help the participants understand the importance of proper assessment students specifically graded questions that they helped write to understand the entire process of exam writing, implementation, and evaluation . The ed92a utas were asked to keep an informal journal on effective and ineffective aspects of their internship course, as well as constructive critiques of the biol18 course . This list included notes on how well students performed certain procedures, what (if any) value the exercise added to students' understanding of biology, as well as suggestions for improvement of the laboratories . Students were asked to design a new laboratory exercise, a course evaluation, a learning assessment, or a course syllabus based upon classroom experiences and information garnered from the articles read throughout the semester . Participants designed their project independently and subsequently developed and carried out their plans with mentor input . Examples of past projects included the development an introductory biology survey course syllabus; the creation of several different laboratory exercises with potential application for use in biol18, including both invertebrate and reptilian dissection modules; the design, implementation, and assessment of using podcasts in biol18; and the formulation of final biology and chemistry course assessments including practical and theoretical exams . Most remain with the class for three or four semesters spanning their junior and senior years . With two exceptions, all of the 16 utas over the past 3 yr have majored in biology, biochemistry, or neuroscience, and none have enrolled in any formal education course during their undergraduate career other than ed92a . Most utas who have completed ed92a continue their postgraduate education in basic science research (m.s . Or ph.d . ), biomedical sciences, or in medical or veterinary school with the intention of incorporating education into their future career . B or better and must fill out a detailed application including two lengthy essays . Students are asked to explain why they want to teach and how being a part of the biol18 staff will be fulfilling, whereas the second essay requires students to respond to the scenario how will you teach and act in a position of authority over your peers? Utas are selected by the professor and course staff based upon their responses, qualitative observation of their performance as students, and their interest in studying science education . We have had a total of eight biol18a utas enroll in the course (all re - enrolled at least once). Enrollment has increased progressively from three students in fall 2007 to seven in spring 2009 . Students at brandeis are not allowed to receive credit for more than two semesters of internship classes and, because of this limit, four of the seven current students are enrolled for a third consecutive semester without possibility of receiving credit . Of the eight students, four have been male and four have been female suggesting no gender bias with regard to enrollment . Our current class has six students including two former utas of biol18 who voluntarily attend the weekly journal club meetings, contributing to the education of our enrollees . We have made significant efforts to monitor and evaluate the ed92a initiative . At present, most of our assessments have been qualitative, consisting mostly of open - ended response questions due to the relatively small size of the course (see supplemental material). To include all students from all iterations of the course, preassessments were not used in this evaluation, although questions reflecting participant self - assessment of confidence changes over the semester were used . Utas enjoyed their teaching role, especially directing prelab discussions, designing and implementing interactive exercises, as well as writing and marking exams . Students especially appreciated the integration of their teaching with the pedagogical study of science education . We see ta training, mentoring, and development as a core tenet of the educational success of biol18, and students have responded in - kind . We conducted a follow - up evaluation subsequent to the fall 2008 iteration of ed92a . All students were satisfied by the topics covered as assessed by the question what topic would you like to see removed from the syllabus? To which all students responded none . Participants reported an increased confidence in their ability to write and use a grading rubric (100%), to prepare lesson plans (71%), and to provide one - on - one tutoring to the biol18 students (85%) after taking the course . I think this course helped me realize how difficult it is to do these things effectively . Whereas the various aspects of teaching seemed straightforward before the class, learning about doing them effectively in ed92a in a way made me less confident simply because i became more aware of how much thought goes into each issue . Regarding the importance of concept - based learning, one commented, by being aware of how students perceive a complicated concept, you realize how to develop it from the foundation up, so that it becomes easy to understand . Before i learned about this, i would explain things as i understood them without realizing that what seems straightforward to me is not necessarily so for my audience . Students unanimously identified the discussion sections as the most helpful aspect of the course, and the predominant criticism was a request for more discussion sessions . All students rated themselves extremely likely to pursue additional education training, and although many entered the course with a strong interest in teaching (71%), this experience cemented that predilection . All students expressed interest in participating in teaching opportunities beyond biol18, and all students would take another semester of ed92a . In part, this course was created in response to a call from utas in the biol18 course who were seeking more responsibility in the classroom as well as the training necessary to support such a changing role . We saw this call as an opportunity to begin a paradigm shift in the recruitment, training, and retention of a committed and innovative undergraduate science professoriate . Given the overall number of utas used in undergraduate science courses nationwide, albeit in different capacities, we see the need for such training throughout the basic sciences (and indeed in other allied fields). Based upon qualitative and quantitative feedback from the instructors and the utas, ed92a is highly successful . The most helpful aspect of the course was the weekly discussion sessions, which students praised as a forum for integrating actual issues faced in their classrooms with issues of national education policy and pedagogy . In the four semesters in which we have taught ed92a, the utas have been better prepared than ever before, and mentor mentee relationships between students and faculty have improved . Ed92a was highly praised by the enrolled students, who sought more opportunities to integrate their pedagogical training with their teaching experiences . One student stated i would like to discuss concrete advice on how to incorporate some of the points we discussed into the scope of our own lectures or teaching styles some small specific things . So that when we reconvene every friday, we can say, this week i did this differently and this was the result . It is this, and other valuable student perspectives, that will continue to drive our improvement of ed92a . To increase cohesion between the pedagogical and the practical we are committed to the importance of uta training and will continue to refine the formula until we get it just right . Data from our exit - surveys suggest that enrollment figures will remain stable, if not increase . Enrollment for the iterations assessed in this paper was contingent upon teaching biol18 . To increase the size of the class and to determine whether our internship model is appropriate for other courses, we have begun to allow students who are utas for other brandeis science courses to enroll . During the 2009 spring semester, one student teaching an advanced biochemistry course and one student ta from a nonmajors science course were enrolled in ed92a . To maintain mentor mentee ratios, this required recruiting faculty from other courses, although the students were still primarily mentored by the professor of biol18 . We believe that in addition, scalability is realistic within the context of our syllabi as long as the faculty maintains programmatic interest . Over the coming years, we will continue to analyze the success of ed92a by tracking the professional development of course graduates . We are eager to demonstrate our strong belief that completing this course will strongly benefit our utas in their future careers, as members of the professoriate or otherwise . We have been privileged with the opportunity to enrich our work by harnessing the passion and innovation of the next generation of science teachers . We provide students the opportunity for empowerment in their teaching, the confidence to seek the limits of their knowledge, the ability to learn how to teach, and the access to life - long mentors in science education.
Hepatocellular carcinoma (hcc) is the third leading cause of cancer mortality worldwide with five - year relative survival rates less than 15% . Most of the risk factors for hcc, including chronic infection with hepatitis b virus (hbv) or hepatitis c virus (hcv), lead to the development of liver cirrhosis, which is present in 8090% of patients with hcc . The malignant conversion of cirrhosis to hcc is often fatal in part because adequate biomarkers are not available for diagnosis during the progression stages of hcc . Survival rates of patients with hcc can be significantly improved if the diagnosis is made at earlier stages, when treatment is more effective . Alpha - fetoprotein (afp), the serologic biomarker for hcc in current use, is not effective for early diagnosis due to its low sensitivity . Glycosylation is one of the most common post - translational modifications of proteins . Altered patterns of glycosylation have been associated with various diseases, and many currently used cancer biomarkers, including afp, are glycoproteins . The analysis of glycosylation is particularly relevant to liver pathology because of the major influence of this organ on the homeostasis of blood glycoproteins . Mass spectrometry is an essential tool for the analysis of glycosylation . As protein glycosylation can occur on multiple sites involving the attachment of different glycans to each site, analysis of glycoproteins this is further complicated by the different chemical properties between glycans and peptides, and analysis by mass spectrometry typically involves enrichment of glycoproteins or glycopeptides . An effective alternative is to analyze glycans released from proteins and associate the glycomic changes with pathological conditions of interest . N - glycans are of particular interest as their involvement in major biological processes, including cell cell interactions and intracellular signaling, has important implications in disease progression . Also, several enzymes that allow efficient release of this type of glycans have been made available . Through appropriate analytical methods that yield broad coverage of the glycome, characterizing glycomic patterns in serum / plasma of patients with cancer in particular, mass spectrometry is an enabling technology for analysis of glycans in cancer biomarker discovery . The use of matrix - assisted laser desorption / ionization mass spectrometry (maldi - ms) to identify n - glycan biomarkers for hcc has been widely applied and discussed . With recent advances in mass spectrometry and separation methods, liquid chromatography mass spectrometry (lc ms) is capable of profiling hundreds of glycans including isomeric glycoforms . Mass spectrometry using electrospray ionization (esi - ms) is especially well - suited to the lc higher sensitivity of lc esi - ms over maldi - ms and lc maldi - ms in detecting permethylated n - glycans derived from serum has been demonstrated in a recent study . However, to date glycomic profiling using lc esi - ms has not been fully exploited for large - scale biomarker discovery studies, and there is still a lack of appropriate computational tools . The present study applies lc esi - ms based serum glycomics for hcc biomarker discovery in patients with liver cirrhosis . We utilized two complementary platforms to perform global profiling and targeted quantitation of n - glycans and identified candidate biomarkers that distinguish hcc cases from cirrhotic controls . Global profiling was performed using a high - resolution mass spectrometer (ltq orbitrap velos), while targeted quantitation was performed using a triple quadrupole (qqq) mass spectrometer in multiple reaction monitoring (mrm) mode . The integrative workflow consisting of global profiling and targeted quantitation is widely applied in lc ms based proteomic studies but to our best knowledge has not yet been exploited in glycomics . This study revealed 26 n - glycans with statistically significant differences between hcc cases and cirrhotic controls through global profiling and 15 through targeted quantitation . Eleven of these candidate n - glycan biomarkers were identified by both quantitation approaches and match closely with the implications of important glycosyltransferases in cancer progression and metastasis . The results of this study illustrate the power of the integrative approach combining lc esi - ms based global profiling and targeted quantitation for a comprehensive serum glycomic analysis to investigate changes in n - glycan levels between hcc cases and patients with liver cirrhosis . Workflow for the lc esi - ms analysis of n - glycans in sera from patients in two study cohorts (tu and gu). The samples in this study were obtained from participants recruited in egypt and the u.s . The egyptian participants consisted of 89 adult patients (40 hcc cases and 49 patients with liver cirrhosis) recruited from the outpatient clinics and inpatient wards of the tanta university hospital, tanta, egypt (tu cohort). Participants comprised 94 adult patients (48 hcc cases and 46 patients with liver cirrhosis), recruited from the hepatology clinics at medstar georgetown university hospital, washington, dc, usa (gu cohort). The protocols were approved by the respective institutional review boards at tanta university and georgetown university . Detailed characteristics of the participants in both study cohorts are provided in supplemental tables s1 and s2 . Through peripheral venepuncture, a single blood sample was drawn into a 10 ml bd vacutainer sterile vacuum tube without the presence of anticoagulant . The blood was immediately centrifuged at 1000 g for 10 min at room temperature . The serum supernatant was carefully collected and centrifuged at 2500 g for 10 min at room temperature . After aliquoting, serum was kept frozen at 80 c until use . Primary tubes and serum aliquots were labeled using anonymous confidential code numbers with no personal identifiers . Identification codes were cross - referenced with clinical information in a pass code protected computer system we analyzed the collected sera in four batches for each cohort (designated as tu1, tu2, tu3, and tu4 in the tu cohort; gu1, gu2, gu3, and gu4 in the gu cohort). Each batch consisted of approximately 24 samples, balanced between hcc cases and cirrhotic controls in terms of age, race, gender, smoking, alcohol, and bmi . Samples within the same batch were prepared together, and lc esi - ms analysis was performed following a randomized order to avoid systematic biases (supplemental table s3). All of the samples were analyzed through global profiling and targeted quantitation except for three exhausted samples that were excluded from the latter . The samples that were excluded during the targeted quantitation were from batches tu1, tu3, and gu2 . Hplc - grade water and sodium hydroxide were obtained from mallinckrodt chemicals (phillipsburg, nj). Hplc - grade methanol, isopropyl alcohol, and acetic acid were procured from fisher scientific (pittsburgh, pa). Acetonitrile (acn) was acquired from jt baker (phillipsburg, nj). Borane - ammonia complex, sodium hydroxide beads, ammonium bicarbonate, iodomethane, trifluoroacetic acid (tfa), dimethyl sulfoxide (dmso), and formic acid (fa) were purchased from sigma - aldrich (st . Endoglycosidase purified from flavobacterium meningosepticum (pngase f, 500,000 units / ml) was obtained from new england biolabs (ipswich, ma). We applied the same procedure of sample preparation in both global profiling and targeted quantitation of n - glycans in serum . The procedure includes release, purification, reduction, and permethylation of n - glycans as we have recently described . Briefly, a 10-l aliquot of each serum sample was mixed with 10 l of digestion buffer (20 mm ammonium bicarbonate) and denatured in an 80 c water bath for 1 h. then, 1.2 l of pngase f (10 diluted) was added to the sample mixture . The enzymatic release was accomplished in a 37 c water bath for 18 h. after that, a dialysis purification step was performed for 18 h to remove impurities, using an in - house - made 12-well drop - dialysis and a cellulose ester dialysis membrane with molecular weight cut - offs of 500 and 1000 da (spectrum laboratories, rancho dominguez, ca). A 10-l aliquot of a borane - ammonium complex solution (10 g/l) was added to each sample vial and incubated at 60 c for 1 h. methanol was then added to the sample and dried under vacuum . Briefly, the dried sample was mixed with 30 l of dmso, 1.2 l of water, and 20 l of iodomethane and applied to a spin column filled with sodium hydroxide beads . After incubation for 30 min, the sample solution was centrifuged, and 20 l of iodomethane was added . The mixture was placed back in the columns packed with sodium hydroxide beads and incubated for 20 min . Permethylated glycans were eluted out with 50 l of acn and dried under vacuum . Permethylated n - glycans were separated by an ultimate 3000 nano - lc system (dionex, sunnyvale, ca) with an acclaim pepmap c18 column (75 m 15 cm, 2 m, 100) at 55 c to prompt efficient separation . Mobile phase a consisted of 2% acn and 98% water with 0.1% formic acid, while mobile phase b consisted of acn with 0.1% formic acid . The gradient program started at 20% mobile phase b over 10 min, which was ramped to 38% at 11 min and linearly increased to 60% in the following 32 min . Then, mobile phase b was increased to 90% in 3 min, and the percentage was maintained for 4 min . Finally, mobile phase b was decreased to 20% in 1 min, and the percentage was maintained for 9 min to equilibrate the column . The nano - lc system was interfaced to an ltq orbitrap velos (thermo scientific, san jose, ca) hybrid mass spectrometer . The mass spectrometer was operated in data - dependent acquisition (dda) mode, where each ms full scan (m / z range 5002000) was followed by five ms / ms scans of the most intense ions . The data were analyzed using a preprocessing pipeline consisting of in - house - developed algorithms and open - source software tools . The preprocessing steps include deisotoping of mass spectra, peak detection, peak alignment, and normalization . We performed the deisotoping of mass spectra using decontools (v1.0.4672, october 16, 2012), where the monoisotopic mass and charge state were deduced . Decontools allows us to specify an appropriate average residue composition for the calculation of isotopic distribution . The average composition for the monosaccharides (c10h18n0.43o5s0) was determined on the basis of the permethylated n - glycans commonly found in our previous studies . After the deisotoping step, peak detection was performed using an in - house - developed algorithm . Briefly, deisotoped ions with the same molecular weight (with 10 ppm tolerance) were linked along scans to generate a chromatographic trace . Low - quality traces were screened out according to user - defined criterions (i.e., minimum scans of 20 to define a peak, minimum summed intensity of 100,000, minimum density of 0.3 for valid scans in a trace, and allowable missing values of 35 between adjacent scans). Missing values in the remaining traces were interpolated using corresponding extracted ion chromatograms from raw data . The interpolated trace was further processed through successive convolution with a savitzky - golay smoothing filter (order of 5 and half of trace length as the window width) and a first - order derivative of a gaussian kernel (window width of 30 scans, standard deviation of 3) to identify the position and boundary of the chromatographic peak at zero - crossing and enclosing local extrema, respectively . A detected peak was characterized by the following properties: monoisotopic mass, charge state, intensity (area under curve within boundary), and retention time . A normalization step was then applied to ensure that the summed intensity of detected peaks was identical in all of the lc esi - ms runs from the same batch . Peaks detected in multiple runs were aligned and matched using the simultaneous multiple alignment (sima, version of 2010) model with the following parameters: -r 50 -m 0.1 . The resulting peak list of the lc esi - ms runs was further refined such that only the peaks detected in over half of the runs in either case or control group were retained . Finally, missing values owing to either peak detection or alignment were interpolated using their corresponding extracted ion chromatograms the preprocessing pipeline resulted in a consensus peak list of the lc esi - ms runs for subsequent analysis . Targeted quantitation of 117 n - glycans including isomers was performed by mrm using a qqq mass spectrometer . These targets include (i) n - glycans that were detected on the orbitrap or qqq instrument in our previous studies, (ii) n - glycans evaluated as potential hcc biomarkers in previous studies, and (iii) n - glycans involved in golgi apparatus retrieved from kegg glycan database . The 117 n - glycans were represented by 213 channels (three transitions in each) consisting of their different adduct forms and charge states . A complete list of the mrm transitions used in this study is provided in supplemental table s4 . The mrm quantitation was performed on a tsq vantage mass spectrometer (thermo scientific, santa clara, ca), with q1 and q3 operated at a unit resolution . The chromatographic condition was as described above in the analysis of global profiling utilizing an ultimate 3000 nano - lc system with identical gradient setup . Following data preprocessing, the most relevant peaks with differential abundance between hcc cases and cirrhotic controls were selected using a two - way analysis of variance (anova) model . Peaks from the four batches were matched upfront (m / z tolerance of 10 ppm and rt tolerance of 50 s), and peak intensity was modeled in terms of group effect (hcc versus cirrhosis), batch effect, interaction between group and batch, and random error associated with each sample . Specifically, the intensity for peak k from group i in batch j is modeled by yijk = + gi + bj + (g b)ij + ijk, where is the overall mean of the samples; gis are the group effects (igi = 0, i = 1, 2); bjs are the batch effects (jbj = 0, j = 1, 2, 3, 4); (g b)ijs are the interaction between group and batch (i(g b)ij = j(g b)ij = 0); and ijks are the random errors from a zero - mean normal distribution . We calculated p - values with the null hypothesis that the group means within each batch are the same . Peaks with a p - value <0.05 and having a consistent direction of fold change (fc) between groups in all four batches were selected as statistically significant . Lc esi - ms data were preprocessed in batch and peaks out of the expected rt range of glycans (1550 min) were excluded from subsequent analysis . In the tu cohort, 2609, 3130, 2903, and 2808 peaks were detected in batches tu1, tu2, tu3, and tu4, respectively . In the gu cohort, 2559, 2519, 2556, and 2922 peaks were detected in batches gu1, gu2, gu3, and gu4, respectively . This yielded 1628 and 1500 common peaks in the tu and gu cohorts, respectively, of which 262 and 254 peaks are associated with glycans . Prior to the statistical analysis, a logarithmic transformation was applied to ensure validity of the normal distribution assumption in the anova model . We evaluated the quantitation variability based on coefficient of variation (cv) of peak intensities across samples . The ranges of the cvs in the tu cohort and gu cohort are 2%40% (with median at 8%) and 3%58% (with median at 10%), respectively . Using the two - way anova model, we found 78 peaks in the tu cohort and 91 peaks in the gu cohort that are statistically significant (p - value <0.05) and have consistent fold change across the four batches within each cohort . Putative glycan structures were assigned to the selected peaks by matching experimentally measured mass values with theoretical values of human serum n - glycans (with tolerance of 2 ppm) that were previously characterized in consideration of different charge states and adduct forms (supplemental table s5). Matched glycans are represented by the number of five monosaccharides: n - acetylglucosamine (glcnac), mannose, galactose, fucose, and n - acetylneuraminic acid (neunac). This resulted in 18 significant n - glycans (11 up - regulated in hcc versus cirrhosis and 7 down - regulated) in the tu cohort and 11 significant n - glycans (6 up - regulated and 5 down - regulated) in the gu cohort (table 1). Three glycans were found significant in both cohorts . While [4 - 3 - 2 - 1 - 0] (up - regulated) and [5 - 3 - 0 - 0 - 0] (down - regulated) have the same fold change direction in both cohorts, [4 - 3 - 0 - 1 - 0] is up - regulated in the gu cohort and down - regulated in the tu cohort . Glycans are characterized by the number of five monosaccharides: glcnac, mannose, galactose, fucose, and neunac . The monosaccharide compositions were assigned through accurate mass matching (<2 ppm). Tandem ms spectra of the 11 glycans identified by both global profiling (lc esi - ms) and targeted quantitation (mrm) are provided in figure 3 . Adduct form is presented by charge state and number of protons replaced by ammonium: z (#[h] [nh4]). Fold change is based on the comparison of hcc versus cirrhosis, where and denote up - regulation down - regulation, respectively . Manual curation was performed to eliminate channels with unfavorable chromatographic profiles or significant noise and to determine appropriate rt windows for quantitation . Owing to the unit resolution in q1 and q3, interference may appear across channels with close m / z values in their transitions . The observed elution order of n - glycans on the orbitrap system was used to elucidate some ambiguous cases in the mrm analysis . Among the 213 transition channels, 65 channels representing 82 potential isomeric peaks of 52 n - glycans were detected consistently and quantitated for subsequent analysis (supplemental table s6). As in the global profiling analysis, peak intensities were log - transformed prior to the statistical analysis . A normalization step was also applied to ensure that the mean of the log - transformed peak intensities is identical in all the lc esi - mrm - ms runs from the same batch . The ranges of the cvs are 116% for both the tu and gu cohorts with median at 3% and 4%, respectively . Using the two - way anova model, we selected significant n - glycans (p - value <0.05) and those with consistent fold changes across the four batches in each cohort . We identified 11 significant glycans (7 up - regulated and 4 down - regulated) in the tu cohort and 5 significant glycans (4 up - regulated and 1 down - regulated) in the gu cohort (table 1). Consistent alteration (decreased level) was observed for the glycan [5 - 3 - 1 - 1 - 1] in both cohorts . Most of the significant glycans were also identified by the global profiling analysis, i.e., [4 - 3 - 1 - 0 - 0], [4 - 3 - 1 - 1 - 0], and [4 - 3 - 2 - 0 - 0] in the gu cohort and [5 - 3 - 0 - 0 - 0], [5 - 3 - 1 - 0 - 0], [5 - 3 - 1 - 0 - 1], [5 - 3 - 3 - 0 - 2], [5 - 3 - 3 - 0 - 3], [6 - 3 - 4 - 0 - 2], [6 - 3 - 4 - 0 - 3], and [6 - 3 - 4 - 0 - 4] in the tu cohort . Their mrm quantitation results and tandem ms spectra from global profiling analysis are shown in figures 2 and 3, respectively . Quantitation results of 11 candidate n - glycan biomarkers in sera of hcc cases and cirrhotic controls by the mrm analysis . (a c) up - regulated biantennary glycans in the gu cohort . (d f) down - regulated -1,6-glcnac branching glycans in the tu cohort . (g, h) up - regulated -1,6-glcnac branching glycans in the tu cohort . (i k) up - regulated tetra - antennary glycans in the tu cohort . Blue square = glcnac, green circle = mannose, yellow circle = galactose, red triangle = fucose, purple diamond = neunac . Annotated tandem ms spectra of 11 candidate n - glycan biomarkers: (a) [4 - 3 - 1 - 0 - 0], (b) [4 - 3 - 1 - 1 - 0], (c) [4 - 3 - 2 - 0 - 0], (d) [5 - 3 - 0 - 0 - 0], (e) [5 - 3 - 1 - 0 - 0], (f) [5 - 3 - 1 - 0 - 1], (g) [5 - 3 - 3 - 0 - 2], (h) [5 - 3 - 3 - 0 - 3], (i) [6 - 3 - 4 - 0 - 2], (j) [6 - 3 - 4 - 0 - 3], and (k) [6 - 3 - 4 - 0 - 4]. Fragment assignment was based on the criterion of signal - to - noise ratio> 3 . In summary, we analyzed over 1500 peaks, of which over 250 are associated with glycans in global profiling . In the targeted quantitation, we monitored 82 putative isomeric peaks of 52 glycans by mrm with improved sensitivity and accuracy compared to the global profiling . Smaller cvs for quantitated glycans in mrm analysis (median cv at 4%) compared to global profiling (median cv at 10%), we identified 26 and 15 significant n - glycans by global profiling and targeted quantitation, respectively . These represent 30 unique glycans, because 11 glycans overlapped between the two approaches, while the remaining 19 glycans were selected by only one of the two approaches . For example, manual curation was performed before targeted quantitation to eliminate channels with unfavorable chromatographic profiles or significant noise and to keep only the reliable information . Also, only those that displayed consistent fold change direction (either up- or down - regulation) across all batches were considered . In supplemental table s7, we present all characteristics observed for these glycans by using the two approaches . From the table, it is noted that among the 30 reported glycans, nine are either not detected in global profiling or eliminated after curation in targeted quantitation; 11 agree between two approaches on the basis of both significance and consistent fold changes in all batches; two ([4 - 3 - 2 - 0 - 2] and [5 - 3 - 2 - 1 - 0]) have consistent fold changes in all batches but are not reported as significant in one of the two approaches; two ([5 - 3 - 1 - 1 - 1] and [4 - 3 - 2 - 0 - 0]) have consistent statistical significance but are inconsistent in terms of fold change in one of the two approaches . The remaining six glycans among 30 are not consistent on the basis of either significance or fold changes . Most of the significant n - glycans discovered in this study are cohort - specific . This might be owing to the difference in etiologic factors between the two cohorts . Although the two cohorts involve hcc cases and cirrhotic controls, there are key differences in the characteristics of the two populations as illustrated in supplemental tables s1 and s2 . For example, the egyptian participants are all hcv positive and nearly all are hbv negative, whereas about half of the u.s . Participants are hcv positive and about a third are hbv positive . Also, while the egyptian participants are homogeneous middle eastern, the u.s . Participants are approximately 56% caucasian, 30% african american, 10% asian, and 5% hispanic . Moreover, about three - quarters of the egyptian hcc cases are stage i hcc, while stage i hcc accounts for about half of the u.s . However, it should be noted that the sample size in this study is not large enough to draw solid conclusion in terms of etiology factors . We analyzed n - glycans in sera from hcc cases and cirrhotic controls recruited in egypt and the u.s . Specifically, n - glycans were enzymatically removed from serum proteins and permethylated, allowing relative quantitation of hundreds of oligosaccharides . Candidate n - glycan biomarkers were identified through lc esi - ms based global profiling and targeted quantitation . The most relevant glycans in distinguishing hcc cases from cirrhotic controls were selected using a two - way anova model . We identified 26 and 15 statistically significant n - glycans through global profiling and targeted quantitation, respectively . <0.05 in consideration of multiple testing correction using the method by benjamini and hochberg, our integrative analysis revealed a good overlap of the significant glycans identified by both quantitation approaches . There are 11 candidate biomarkers overlapping between the two complementary platforms: [4 - 3 - 1 - 0 - 0], [4 - 3 - 1 - 1 - 0], [4 - 3 - 2 - 0 - 0], [5 - 3 - 0 - 0 - 0], [5 - 3 - 1 - 0 - 0], [5 - 3 - 1 - 0 - 1], [5 - 3 - 3 - 0 - 2], [5 - 3 - 3 - 0 - 3], [6 - 3 - 4 - 0 - 2], [6 - 3 - 4 - 0 - 3], and [6 - 3 - 4 - 0 - 4]. Eight of these glycans are up - regulated in hcc versus cirrhosis, while three are down - regulated . The up - regulation of the bigalactose biantennary glycan [4 - 3 - 2 - 0 - 0] is in agreement with a previously reported study . The overlap between our findings and previous glycomic studies is limited, because sialylated glycans were often excluded from the previous analysis . Biosynthesis of n - glycans in the golgi apparatus involves trimming of mannose residuals and stepwise addition of monosaccharides, resulting in three groups of n - glycans: high - mannose, complex, and hybrid types . Most of the candidate biomarkers identified in this study are complex type n - glycans with two hybrid - type glycans: [3 - 4 - 1 - 0 - 0] and [6 - 6 - 0 - 1 - 2]. Some biomarker discovery studies for other types of cancer have shown that structurally related glycans are likely to have correlated changes of levels due to the same biosynthesis process they are involved in . Our study exhibited a similar phenomenon, where many of the candidate biomarkers for hcc are closely related in their structures . These glycans can be grouped into four clusters: cluster 1, biantennary structure; cluster 2, -1,6-glcnac branching structure (down - regulated); cluster 3, -1,6-glcnac branching structure (up - regulated); and cluster 4, tetra - antennary structure as shown in figure 4 . Within each cluster four clusters of the identified n - glycan candidate biomarkers and their fc directions . Further elucidation of the relationship between the identified complex n - glycans can be obtained by referring to their biosynthesis process . Glycosyltransferases such as n - acetylglucosaminyltransferase v (gnt - v) have been known to play a key role in the formation of n - glycan branches . Gnt - v catalyzes the addition of -1,6-glcnac branching of n - glycans and has been considered as a promoter of metastasis . Their implications on hcc have also been discussed . In this study, increased levels in hcc were found in gnt - v s downstream products (clusters 3 and 4 in figure 4), matching the role of gnt - v in cancer metastasis . We note, however, that opposite alteration was observed in truncated branching glycans, i.e., cluster 2 where addition of galactose to antennary is not complete . In addition, increased levels of -galactoside -2,6-sialyltransferase (st6gali), which transfers sialic acid residue in -2,6 linkage to a terminal galactose, have been associated with progression and poor prognosis in hcc . Consistent findings were obtained in this study, where increased levels in hcc were found in a number of sialylated glcnac branching n - glycans (downstream products of st6gali). Enrichment analysis could potentially increase the statistical power to detect the glycomic changes on a systems level and yield biologically relevant results, as demonstrated in the genomic analysis . Esi - ms based workflow is expected to serve as a primary approach for this type of analysis . In order to allow a rigorous integration of changes in multiple glycans, defining appropriate categories of ontological / topological information this strategy may be further enhanced by integrating additional characteristics through other -omic analysis, such as proteomics and glycoproteomics . Our future studies will focus on investigating these candidate biomarkers on a larger population that allows stratification of the subjects on the basis of etiology and disease stage . We will also perform multivariate analysis or enrichment analysis to identify a panel of hcc biomarkers and to evaluate if the observed glycomic changes can be reliably used for early detection of hcc in high risk population of cirrhotic patients . Furthermore, we will investigate the underlying biochemical processes driving the glycomic changes and incorporate additional -omic measurements on the same subjects for a more comprehensive characterization.
The unroofed coronary sinus (cs) syndrome is a rare entity (1 - 5). Approximately, 75% of cases with the unroofed cs syndrome are associated with a persistent left superior vena cava (svc) (1). There is no reported case of an unroofed cs syndrome accompanied by the cs stenosis in the english literature . The clinical presentation of the unroofed cs is generally determined by the size of the defect between the cs and the left atrium (i.e. The degree of a left - to - right shunt) and associated abnormalities (2). We present a case of the complete unroofed cs syndrome with rare associated abnormalities (i.e. The cs stenosis and a collateral pathway through the small cardiac vein and thebesian vein, but the absence of a persistent left svc) incidentally identified on coronary computed tomography (ct) angiography . We also propose an explanation of the asymptomatic presentation in this case in spite of the large defect between the cs and the left atrium . A 43-year - old male presented with intermittent atypical chest pain of one month's duration . Coronary ct angiography from the tracheal bifurcation to the base of the heart (lightspeed vct, ge healthcare, milwaukee, wi, usa) to evaluate the underlying cause of the chest pain demonstrated normal coronary arteries . However, a large defect (approximately 2.8 cm in diameter) between the cs and the left atrium and stenosis of the cs orifice were identified (figure 1 a and 1b). The collateral flow from the cs to the right atrium through the small cardiac vein and thebesian vein there was no evidence of the enlargement of any cardiac chamber, and nor was there a persistent left svc identified (figure 1 a and 1b). No abnormality was identified at transthoracic echocardiography, although the ct reading was available to the cardiologist performing echocardiography . Transesophageal echocardiography was not performed because the patient was asymptomatic except for the chest pain . A diagnosis of the unroofed cs syndrome with the cs stenosis in the absence of a persistent left svc was made . The unroofed cs syndrome is a rare congenital anomaly that is often associated with a persistent left svc (1 - 5). The classification of the unroofed cs syndrome varies in the literature (1 - 5). It can be classified simply complete or partial depending on the size of the defect between the cs and the left atrium . No previous report exists of a complete unroofed cs syndrome and absence of a persistent left svc in combination with the cs stenosis leading to a collateral pathway through the small cardiac vein and thebesian vein identified on coronary ct angiography . This unusual combination of three congenital anomalies remained asymptomatic into adulthood, when the patient presented for unrelated reasons . The clinical presentation of the unroofed cs syndrome varies from the absence of symptoms to severe right heart failure, and is mainly determined by the size of the cs defect between the cs and the left atrium (i.e. The degree of left - to - right shunting) and associated anomalies such as a persistent left svc (i.e. Brain abscess or infarction caused by a right - to - left shunt) (1 - 5). The present case had no related symptoms in spite of a large defect between the cs and the left atrium . This was presumably due to the associated cs stenosis and the restriction of the flow by the formation of a collateral flow through the small cardiac and thebesian veins between the cs and the right atrium . Brain abscess or infarction may be a complication in patients with the unroofed cs syndrome due to paradoxical embolism caused by a right - to - left shunt (1). As there was no associated persistent left svc, the possibility of a right - to - left shunt was eliminated . Although the underlying cause of chest pain in the present case was not delineated clearly, the chest pain did not seem to be directly related to the unroofed cs syndrome as it had developed recently without accompanying symptoms . In this instance, multiple detector computed tomography (mdct) with its high spatial resolution provided not only precise anatomic detail of the unroofed cs syndrome and the associated anomalies, but also a possible explanation for the patient s clinical presentation . In conclusion, the presence of the cs stenosis and the absence of a persistent left svc in a patient with an unroofed cs syndrome may result in an asymptomatic presentation, even in the setting of a large cs defect.
We studied serum samples from 376 canadian patients with community - acquired pneumonia (121 ambulatory and 255 hospitalized) and from 511 healthy control subjects . All of these samples were previously tested for other pneumonia agents (4). To prepare antigen for microimmunofluorescence study, mimivirus was grown in acanthameba polyphaga strain linc ap-1 in 75-cm cell culture flasks with peptone yeast extract glucose medium as previously described (11). After amebal lysis occurred, unlysed amebas were removed by low speed centrifugation at 100 g for 15 min . Mimivirus particles present in supernatant were centrifuged at 4,000 g for 30 min and washed 3 times in phosphate - buffered saline (pbs). The pellet obtained after the last washing was then resuspended in pbs at 2 mg / ml concentration of protein and used as antigen in microimmunofluorescence assay under previously described conditions (5). Evidence of serologic reaction to mimivirus was defined as 1) seroconversion from <1:50 to> 1:100 between acute - phase and convalescent - phase serum samples or a 4-fold rise in antibody titer between acute - phase and convalescent - phase serum samples, or 2) a single or stable titer of> 1:400 . The cut - off titer for single serum was chosen to have <2.5% positive rate in control subjects . We also tested paired serum samples from 26 patients with intensive care unit (icu)-acquired pneumonia for a 1-year period and 50 paired serum samples from patients in our institution to determine antibodies to rickettsia spp . As controls . To verify that antibodies against mimivirus in patients with pneumonia recognize mimivirus particles specifically, a serum sample of 1 of these patients was used to detect mimivirus particles as previously described (12). Two serum samples of patients who did not have detectable antibodies against mimivirus were used as controls . Grids were incubated briefly twice in incubation buffer (pbs with 0.2% bovine serum albumin) for 5 min, then for 15 min in lysine buffer (pbs with 0.05 mol lysin). Grids were washed twice in incubation buffer for 5 min, then incubated for 3 h at 37c in patients diluted samples (diluted 1/1,000 in incubation buffer with 3% nonfat dry milk). Grids were washed 6 times for 5 min in incubation buffer, then incubated for 2 h at 37c in goat antihuman immunoglobulin (igg)-gold conjugate (aurion biovalley, marne la vallee, france) diluted 1/20 in incubation buffer with 3% nonfat dry milk . Grids were washed 6 times for 5 min in incubation buffer, then twice in pbs for 5 min . Grids were then immersed twice in gutaraldehyde (2% in pbs) for 5 min, rinsed 3 times in distilled water for 5 min, treated by r - gent se - em (aurion biovalley) for 25 min, then rinsed 3 times in distilled water for 5 min before being stained with uranyl acetate before examination . Genomic dna of mimivirus was found in bronchoalveolar lavage specimens from patients in the icu of the ste . Marguerite hospital, marseilles, france; serologic reaction was studied in serum samples of the patients for 1 year . The study was retrospective; samples were tested anonymously from 12 to 18 months after sampling . Mimivirus was found in bronchoalveolar lavage specimens from 32 patients with icu - acquired pneumonia and in specimens from 21 intubated control patients in icu who did not have pneumonia (5). We designed 4 primer pairs chosen from the genome sequence of mimivirus . To avoid any contamination, we used a nested polymerase chain reaction (pcr), previously described as suicide - pcr, that incorporates 2 primer pairs used only once without positive control, followed by sequencing and comparing to the targeted sequence (13). Dna from patient and control bal specimens, 3 water samples, and a suspension of a. polyphaga were extracted by using the qiamp tissue kit (qiagen gmbh, hilden, germany). Dna extracts from selected pathogens, including agents that are most commonly encountered in cases of hospital - acquired pneumonia (14), were tested: enterobacter aerogenes, proteus mirabilis, citrobacter freundii, escherichia coli, citrobacter koseri, klebsiella pneumoniae, enterobacter cloacae, serratia marscescens, haemophilus influenzae, moraxella catarrhalis, acinetobacter baumanii, stenotrophomonas maltophila, pseudomonas aeruginosa, bacteroides fragilis, prevotella intermedia, streptococcus pneumoniae, streptococcus oralis, staphylococcus aureus, staphylococcus epidermidis, candida albicans, cmv, hsv1, and adenovirus . Extracted dna was used as template with primers bcfe (5-ttattggtcccaatgctactc-3) and bcre (5-taattaccatacgcaattcctg-3) as external primers and bcfi (5-tgtcattccaaatgttaacgaaac-3) and bcri (5-gccatagcatttagtccgaaag-3) as internal primers . A minimum of 1 negative control was used for every 2 samples from patients with pneumonia; testing was conducted in a blinded manner . In the study of 511 healthy canadian controls, 12 (2.3%) exhibited a substantial titer of antibodies to mimivirus . Patients with community - acquired pneumonia were positive more frequently than controls, as 36 (9.66%) were found positive (chi - square test, p <0.01). Although the typical morphologic traits of mimivirus make its confusion with ameba organelles unlikely (figure), positive serum samples tested on noninfected intact amebas suspended in pbs by using the same migration inhibition factor protocol did not show any reactivity . Immunoelectron microscopic examination showed that antibodies of positive patients recognize mature mimivirus particles specifically (figure), whereas antibody fixation was not found in serum samples from 2 patients who were negative for mimivirus (data not shown). We compared selected features of 14 patients with community - acquired pneumonia who had serologic evidence of infection with mimivirus with those of 90 patients with community - acquired pneumonia who were seronegative for mimivirus (table). Only hospitalization from a nursing home (3/14 vs. 3/90) and rehospitalization after discharge (6/14 vs. 16/90) older age and diabetes mellitus were more common (both 6/14 versus 18/90) in patients with mimivirus antibodies but not significantly so (p = 0.07). In patients with community - acquired pneumonia, more frequent rehospitalization after discharge in patients with serologic evidence of mimivirus is likely explained by the poor efficacy of antimicrobial agents against viruses (15). Seropositive patients with community - acquired pneumonia were more likely to be admitted from a nursing home; this factor suggests that mimivirus is a particularly good candidate as an etiologic agent of pneumonia acquired in institutions, as is l. pneumophila (16). The seroprevalence of mimivirus was significantly higher than that of ameba associated bacteria tested on the same samples (4). As observed by scanning electronic microscopy, mimivirus antigen (a) is recognized by antibodies in our microimmunofluorescence assay using conventional fluorescence microscope (b) and confocal microscope (c). Mature particles within amebas are also recognized by antibodies seen with transmission electronic microscopy immunogold technique (d) (mimivirus particle size 400 nm). Serologic evidence of infection was observed in 5 (19.2%) of 26 icu patients . None of the 50 control patients was positive for mimivirus (p <0.01). Mimivirus dna was detected in bronchoalveolar lavage specimen from a 60-year - old comatose patient who had 2 episodes of hospital - acquired pneumonia during hospitalization in icu . The sequenced amplified fragment was 100% homologous to the target dna (genbank accession no . The finding of mimivirus dna in the bronchoalveolar lavage specimens from an icu patient with nosocomial pneumonia confirms that mimivirus may reach the respiratory tract of these patients . Because of the procedure used for suicide pcr amplification, contamination appears highly unlikely . In this patient, however, we cannot distinguish colonization and infection, but this feature is common to most microorganisms isolated from respiratory samples . This high rate of seroconversion observed in patients with pneumonia from our seroepidemiologic study suggests that community - acquired pneumonia and hospital - acquired pneumonia patients may have contact with mimivirus or a cross - reacting agent . As we do not report direct evidence of infection by mimivirus, these results have to be interpreted with caution . Viruses usually have a broad range of hosts, but the extraordinary size of the mimivirus genome (1.2 mb), comparable to that of small bacteria such as mycoplasma (17), suggests a possible adaptation to an extended range of hosts . We propose that mimivirus be tested as a possible novel human pathogen among ameba - resisting microorganisms . These results are preliminary, but raise the question of the pathogenic potential of the biggest identified virus to date . Mimivirus is an agent easy to cultivate and is freely available from our laboratory on request to researchers working on pneumonia who wish to introduce mimivirus antigen in serologic tests to confirm our results.
One of the key tools for the operating surgeon is the sense of touch . Through that, the surgeon is often able to determine inflammation and induration, create dissection planes, and identify vascular structures . The circumstances are wide ranging from the assessment of bowel viability in preparation for a bowel resection and reanastomosis to assessing patency after vascular reconstruction, from identifying arterial blood vessels to detecting stenoses or other abnormalities . Extension of this technology to laparoscopic surgery is a logical step, particularly in view of the lack of tactile sensation available during laparoscopy . Laparoscopic ultrasound has been used in the detection and staging of abdominal malignancies, identification of common bile duct stones, and in the prevention of injuries during laparoscopic cholecystectomy . Most reports, however, comment on the significant learning curve associated with the technique and use of the equipment . What is needed is a simple method to apply laparoscopically, what the general surgeon is comfortable performing during open surgery . Co. doppler probe (8.1 mhz) and a 15-inch section of thick - walled, 9.5-mm od stainless steel tubing, a laparoscopic doppler probe (ldp) was constructed . The parts were separately gas - sterilized, and a small segment of penrose drain was used to create an airtight seal (figure 1). The probe was constructed in the first few minutes of the operative cases by the first assistant, while the primary surgeons were scrubbing (figure 2). The ldp thus constructed was passed through a 10-mm port, allowing positive identification and assessment of vascular structures (figure 3). All the materials necessary for construction of the laparoscopic doppler probe . The constructed laparoscopic doppler probe . The probe was used to identify liver hemangiomas, iliac vessels during pelvic dissection, and mesenteric vessels during hemi - colectomies . Surgeons using the probe were surveyed, and all agreed that the probe was simple to use and added valuable information to their dissections . Its use in preventing complications during laparoscopic cholecystectomy has been extensively studied . Until just recently, however, its widespread application has been somewhat limited because of the size of the probe, the size of the ultrasound machinery, and the lack of, until recently, an end - on - probe . Similarly, the unfamiliarity of ultrasound to general surgeons has created a significant learning curve when ultrasound is being applied, not to mention being applied in a laparoscopic fashion . What is needed is a convenient, simple, cost - effective way to get some of the advantages that ultrasound offers at the disposal of the laparoscopic surgeon . The ldp described herein can be easily made during a laparoscopic procedure on a back table with low - cost materials just before the procedure begins, or any time during the procedure that a doppler may be of use . It provides useful information on the location of vascular structures as in during a laparoscopic colectomy where identification of the inferior mesenteric vessels is readily accomplished and eliminates any misunderstanding of the vascular anatomy . It has also been used by our surgeons in preperitoneal hernia dissection where both the femoral artery and vein are identified relatively simply by compressing the overlying soft tissues onto the vasculature . The ldp may also provide information on the patency and flow characteristics of vascular anastomoses as laparoscopic techniques evolve to include more vascular procedures . The ldp was originally constructed to identify a hemangioma on the surface of the liver during a routine laparoscopic cholecystectomy by using a penrose drain to create an airtight seal and the delivery portion of an endoscopic retrieval bag as the delivery tube . Since its inception, the ldp has been applied to a variety of general surgical procedures by a number of surgeons at our institution . During the 1-month trial period, it was used to positively identify the cystic artery during gallbladder dissection, the mesenteric blood vessels during laparoscopic colectomy, and the femoral vessels during laparoscopic hernia repair . It was found to be quick to construct, easy to use, and provided useful information to the operating surgeon . It is now available for routine use by any surgeon at our institution . To our knowledge, the first device, the endoscopic pulse detector, was designed to aid the surgeon in identifying the cystic artery during dissection in the triangle of calot . No erroneous assessments were made, and glavic et al found the device safe, reliable, and easy to use . We agree with their conclusions that an instrument to identify vascular structures during laparoscopic surgery should be part of the standard instrumentation of an advanced laparoscopic tray; however, we do not see the need to reinvent the wheel with an endoscopic pulse detector . The second report, concerns the use of a smart needle a doppler flow transducer used to identify the testicular artery during laparoscopic varicocelectomy . These authors sought to preserve the testicular artery and ligate only the testicular vein; they therefore used ultrasound assessment to achieve that goal . While we applaud their procedure, again, we do not feel that new equipment is necessary to be developed or purchased . The ldp is simply the extrapolation of a device used in open surgery, applied to laparoscopy, through an inexpensive delivery system . It can be placed through a 10-mm port and will likely become one of the cheapest instruments used during laparoscopic surgery . Further, the ldp can be utilized to identify vascular structures and provide valuable information to the laparoscopic surgeon . With experience,
Adaptive immunity is based on the recognition of specific molecular structures, named epitopes, by either antibodies / b cell receptors or t cell receptors . Antibodies and b cell receptors bind a wide variety of structures, including proteins and carbohydrates . In the case of protein ligands, antibodies can recognize either a series of contiguous residues (linear epitopes) or a set of residues encoded in disparate regions of the protein sequence and brought together in the three dimensional structure of the protein ligand (discontinuous epitopes). T cells recognize a complex between mhc molecules (named hla in humans and h-2 in mouse) and, in most cases, a peptidic epitope of 816 residues in length [1, 2]. T cell responses are a key component of adaptive immunity . In concert with antibody responses, cd8 t cells, recognizing class i binding epitopes, and cd4 t cells, recognizing their class ii counterparts, are key players in immunity to viruses and bacteria . In the case of allergic reactions, cd4 t cell responses play a key role in pathogenesis both directly and indirectly through the regulation of antibody responses of the ig e class . Accurate measurement of b and t cell responses is a valuable tool to study autoimmunity, allergies, immunity to pathogens, and host - pathogen interactions and assist in the design and evaluation of t cell - based vaccines and immunotherapies [58]. Accordingly, a large number of studies have been devoted to defining b and t cell epitopes, a process that has been facilitated by an ever - increasing expansion and refinement of experimental methods . As immune investigations proceed over time, alternatively, large - scale epitope identification can reveal hundreds of potential epitopes [912]. The immune epitope database (iedb) [13, 14] is a freely available resource that serves as a repository of experimentally derived immune epitope information available in the peer - reviewed published literature, as well as from direct submission from nih - niaid funded large - scale epitope identification studies . The iedb content covers a broad range of indications, to include infectious diseases (excluding hiv), allergies, transplantation, and autoimmune disease and a similarly broad range of hosts, including humans, nonhuman primates, mice, and livestock, amongst others . The database, as of october 2014, hosts experimental data related to 121,812 different peptidic epitope structures . This large amount of information might, in some cases, pose a challenge for the identification and selection of appropriate sets of epitopes for use in specific contexts . Thus, it is clearly desirable, given the ever - growing body of information contained in the iedb, to develop tools to enable the efficient generation of sets of validated reference epitopes for any antigenic source of interest . While an epitope, according to classic definitions, is any structure capable of interacting with t and b cell receptors, in practice the consensus in the scientific community is that certain types of assays identify the most relevant and validated epitopes . In the context of antibody reactivity, by way of example, epitopes identified on the basis of x - ray structures of ag / antibody complexes, biological activity, and in vivo assays or recognized by ige in the case of allergens are considered more biologically relevant than linear epitopes recognized in elisa assays and elicited by peptide immunization . In the case of t cell reactivity, again by way of example, multimer / tetramer staining assays or readouts based on ics or elispot assays, are preferred over older assay platforms such as thymidine incorporation following multiple in vitro restimulations with peptides . These high quality assays have been selected based on our experience and judgment; however, in the web tool developed, the user will be capable of customizing it by his / her needs, that is, select only epitopes derived from neutralization or elisa assays or any other desired selection . Indeed, for many applications, it is desirable to study t cells ex vivo, without manipulation . This is because manipulations, such as in vitro expansion, are known to profoundly change the phenotype and characteristic of the t cells [1517], thus questioning the physiological relevance of some of the experimental observations . However, direct ex vivo detection of human t cell responses is often difficult, largely because the immune response in any individual may target many different epitopes, and different individuals typically recognize unique epitope repertoires . Simultaneous use of many different epitopes as a pool might represent a powerful approach to detecting t cell responses, because even if the frequency of t cells recognizing each individual epitope may be below the limit of detection, a pool of a large number of epitopes (i.e., responses) might pass the limit of detection . An important consideration in the definition of reference sets of epitopes is how to factor the number of individual donors or experiments in which a given structure is reported to elicit a positive response, and particularly if this validation is provided in multiple independent studies . For example, different studies often report on essentially the same epitope but utilize different nested, truncated, or frame - shifted version of the same sequence, leaving uncertainty on how to combine the data or which particular version of the epitope to select for testing . Clarification of a general approach for combining data from such disparate studies would greatly facilitate the generation of nonredundant sets of epitopes . In the present study, we have attempted the definition of an automated process to generate reference sets of high quality epitopes for various disease indications . The resulting tool, made available to the scientific community, provides a standardized and reproducible platform to automatically extract and process relevant data from the iedb without the need of complex analysis and judgment calls from the user . At the same time, the tool also offers flexibility to enable the end user to design sets meeting specific user - defined criteria . We have also analyzed the data currently available in the iedb, to determine how many sets of pathogen or autoantigen specific epitopes could be identified on the basis of the data available to date . The web page application is written in php / html code with a mysql connection that allows communication between the database and the user interface . The first was based on the type of assays used to characterize the epitopes and the second on the frequency by which each epitope was recognized . Regarding the assay type scoring system for mhc class i or class ii epitopes, in our selection we included epitopes defined by multimer / tetramer staining, elispot, and ics assays . We arbitrarily associate a numerical parameter value of 3, 2, and 1 to these assay types, respectively . Each of these assay types can be used in either an ex vivo or in vitro configuration . To provide that ex vivo assays are always ranked higher, we assigned an ex vivo configuration a value of 4, and an in vitro configuration a value of 1, and calculated a final assay score by multiplying the assay type and configuration values . In the case of b cell epitopes, x - ray structure, biological activity, and in vivo assays were assigned a score of 1, as well as epitopes that present ige; for these epitopes, the effector origin was not taken in consideration . Since each epitope can be associated with multiple records, each describing different assays and thus with different assay scores, the highest assay score, reflecting the highest level of validation reached for that epitope, was selected and carried forward . In terms of scoring each epitope on the basis of the frequency by which it was recognized, we utilized a previously described response frequency (rf) score . The rf score is calculated as(1)rrn, where n is the total of subjects tested and r is the number of positive responses . The square root is a correction factor, approximating one standard deviation for the number of responding donors . There is no information of subjects tested, the epitope will be assigned r = 1, n = 1 if the assay outcome is positive and r = 0, n = 1 if it was negative . The rf score (rfs) also takes into account all data for a given epitope across all publications . We decided to use an older and simpler rf definition, as compared to the one used in, as it is more suitable to filter epitopes based on their rfs . As an example, consider an epitope 1 with positive responses (p) = 1 and total subjects (t) = 1; the new definition gives a rfs = 1 (0.041.00) whereas the older version gives an rfs = 0 . In contrast with epitope 2 with p = 8 and t = 11, the new version gives rfs = 0.73 (0.43: 0.92) and the older rfs = 0.47 . In order for the rfs to reflect the difference between epitopes 1 and 2 in terms of the total number of subjects, the latter should be assigned a higher score to be used for ranking and filtering the data, which at the end benefits the user giving simpler and useful results . Both the assay score and rf score are calculated for each epitope and provided in the results . For mhc class i epitopes, it is generally observed that a length of about 811 residues is optimal for t cell recognition and use in assays . Because of the structure of the class i binding groove, distinct class i sequences typically represent unique epitopes, even if they are nested within a longer sequence that is also recognized by t cells . Accordingly, for the present study, we have not subjected class i epitopes of nested or overlapping character to further processing . For mhc class ii epitopes, however, optimal epitopes are usually longer than the minimal t cell recognized 9-mer core . In general, peptides of varying length but that carry the same core may all be similarly active and/or recognized by the same t cell specificity . Thus, many of the epitope structures contained in the iedb for class ii epitopes are redundant, nested or largely overlapping . For this reason, it is desirable to devise strategies to reduce the complexity of class ii epitope sets . Here, we developed a clustering algorithm to generate consensus sequences or cluster of epitopes, an illustration of such a process can be found in table 1 . In order to solve this problem, then, taking the highest ranked peptide as starting sequence, we move down the ranked list aligning the sequences to find nested or overlapping epitopes by at least 9 residues . For this approach, we only consider identical matches over the region of overlap and identical nested peptides; given this definition, mismatches will be treated as separate epitopes . When a nested peptide is found, we will keep only the larger peptide and calculate a new rf score using the sum of all responded and tested subjects per epitope in the cluster . For overlapping epitopes, a consensus epitope or cluster will be generated combining the sequences, if the cluster length is up to 20 residues . In these cases, the rf score will be calculated as a new rf score as in the nested case . For the assay type scoring system, the highest ranked assay and application of all the assays associated with the set of nested epitopes will be considered . In the case of donors with latent tuberculosis infection (ltbi), leukapheresis or whole unit blood samples from 10 adults were obtained from the university of california, san diego, antiviral research center (avrc) clinic . Donors were classified as ltbi based on positive quantiferon - tb gold in - tube (cellestis), as well as a physical exam and/or chest x - ray that was not consistent with active tuberculosis . Because dengue virus (denv) prevalence is low in the san diego area, to obtain denv seropositive samples, anonymous blood donations from healthy adults were obtained by the national blood center, ministry of health, in the area of colombo, sri lanka . Plasma of the associated donation was tested for serology using the flow - based u937+dc - sign neutralization assay (conducted at the university of north carolina, chapel hill) as previously described [11, 20]. Because tb prevalence is low in the colombo area, all samples were collected and used following guidelines from the institutional review boards (irb) of lji and the medical faculty, university of colombo (serving as national institutes of health - approved irb for genetech research institute). 15-mer peptides were synthesized as crude material on a small (1 mg) scale by mimotopes (victoria, australia) and/or a and a (san diego). Pbmcs were purified by density gradient centrifugation (ficoll - hypaque, amersham biosciences) from 100 ml of leukapheresis sample or 450 ml of whole blood, according to manufacturer's instructions . Cells were cryopreserved in liquid nitrogen suspended in fetal bovine serum (gemini bio - products) containing 10% dimethyl sulfoxide . 10 cells / well) were incubated with peptide pools (1 g / ml) for 2 hrs . Brefeldin a (1 g / ml) (bd bioscience) was added to the mixture and incubated for another 4 hours (i.e., a total of 6 hrs with peptide). Cells were then washed and stained for cell surface markers using anti - cd3-alexa fluor 700 (ucht1), anti - cd8-v500 (rpa - t8) (both from bd biosciences), anti - cd4-apc efluor780 (rpa - t4), anti - cd45ra - efluor450 (hi100), and anti - ccr7(cd197)-percpcy5.5 (g043h7) (all three from affymetrix ebioscience) for 30 mins on ice . Cells were then washed, fixed with 4% paraformaldehyde, blocked with human sera, and stained for intracellular ifn using anti - ifn-fitc (4s.b3, affymetrix ebiosciences). The frequency of cells responding to the tb / denv - specific peptides was quantified by determining the total number of gated subset+ and cytokine+ cells and background values subtracted (as determined from the medium alone control) using flowjo software (tree star). As a preliminary step towards deriving sets of reference epitopes associated with preferred validated assays, we processed the data contained in the iedb relating to t cell epitopes . As of october 2014, a total of 28370 epitopes are associated with positive results in at least one t cell assay . As an example of filtering strategies, we first considered only peptidic epitopes associated with infectious agents and allergies (figure 1) and initially focused on bacteria, viruses, and nonhuman eukaryotes as epitope sources . Next, we only considered data in which humans were the host of the immune response and for which data was available to allow specifically characterizing responses as either class i or class ii restricted . In the case of class i, we further considered only epitopes of 811 residues, and in the case of class ii, only peptides of 1320 residues were considered . The next step in our process was to filter the results further by selecting epitopes that have been tested in high quality assays . This is possible because the iedb curates the specific assays that are used to define and characterize the specific epitopes reported in the literature or provided to the database by direct submission . While obviously any desired assay set could be used, here we selected for inclusion the multimer / tetramer staining, elispot and ics assays . This assay - based filtering resulted in a final total of 6345 epitopes, 2512 and 3833 for class i and class ii epitopes, respectively (figure 1), representing about 20% of the initial 28370 epitopes . We surveyed the epitope data in the iedb in terms of the species and antigens of provenance (epitope sources). The relative population of these categories in the iedb as of the 2009 date was discussed by davies et al . . In table 2, we list 43 categories for which at least ten class i or class ii epitopes were identified for viruses / bacteria (table 2(a)), nonhuman eukaryotes (table 2(b)), and autoantigens (table 2(c)). The table also lists b cell epitopes as identified and discussed further below . As a result of the processes described above, we generated sets of epitopes for the various categories . As an example, table 3 details the 21 epitopes defined for the parvoviridae human class i category . In addition to the epitope sequence, source organism and protein, and mhc restriction, the iedb epitope i d is provided to facilitate retrieval of additional information from the iedb pertaining to the epitope . Finally, the response frequency, assay score, the types of assay, and effector origin (ex vivo or in vitro), utilized to derive the assay score, are also given . All epitope tables from the categories shown in table 2 can be found in the supplemental file having established the conceptual framework for selection of epitope sets, we next expanded our applicability . Autoimmune epitopes are identified by the fact that both source antigen and host organism are the same (e.g., both the t cells and the epitope are originated from a human source). As listed in table 2(c), all autoimmunity epitope categories relevant to a given disease are condensed into a single category . A protein tree functionality available on the iedb and a list of the most common antigens associated with each disease were used to extract autoimmune epitopes . The identified categories for which at least ten class i or class ii epitopes were available are listed in table 2(c), along with the number of epitopes contained in each category . We considered expanding the scope of the study to also select epitopes recognized by species other than humans . In this case, the second most frequently represented host species is mouse . Accordingly, an option was created in the web application (next section) to allow selection of murine epitopes . The number of murine epitopes identified is listed as a separate column in table 2 . Finally, we also expanded our analysis to allow selection of b cell / antibody epitopes . In this case, we set a 5 to 20 residue size window and initially selected x - ray structure, biological activity, and in vivo assays as most biologically relevant . In addition, we included induction of ige subclass responses, as this type is most relevant in the context of allergic diseases . The number of b cell epitopes identified accordingly is also listed as a separate column in table 2 . Finally, we developed a tool, which will be hosted by the iedb as an additional link in the search results page and will be part of the next iedb update release in fall 2015 . This tool allows generation of specific epitope sets following the default criteria described above but also allows users to customize the generation of novel sets . The main interface automatically obtains query results from iedb searches and adds them to the query parameters of the tool . There, the user may choose to generate sets of class i, class ii, antibody linear, or antibody discontinuous epitopes, relating to either human or mouse as the host organism from which the epitopes are derived . Because of the flexibility of the design, additional host organisms may be included, provided sufficient data becomes available in the literature . An advanced options webpage can be accessed from the main page, and a sample screen shot of this option is shown in figure 2(b). In the advanced options, the user can set their custom rf score threshold and assay score threshold, rank the results using the rf score or assay score, include the clustering tool, filtering by determined alleles (known mhc allele), and set the minimum and maximum size if the epitopes . Also, a number of additional assays, generally considered as being less rigorous, are provided, allowing the user to set custom parameters . Every field in the advance options dynamically changes to fit the default values for a given query . For example, if the user selects mhc class ii epitopes, the web tool will set the clustering field to to experimentally validate the usefulness of the tool we decided to synthesize some of the actual peptide sets identified by the tool and experimentally test them for recognition by human t cell responses . One of the main challenges for testing large pools for t cell recognition is that ex vivo t cells assays require relatively substantial amounts of each epitope (in the 10.1 microgram / ml range), compounded by the fact that peptide solubility in solvents most widely applicable to preparing peptide stock solutions, such as dmso, is usually limited to about 2040 mg / ml . Since solvents like dmso are toxic in cellular assays at concentrations above 0.5%, this would seem to effectively limit the number of peptides that can be safely included in a pool to about 20 . However, in many cases the solubility of one peptide is not drastically influenced by the presence of other peptides (especially if the sequences, isolectric point, and general solubility are different). For this reason, we predicted that it might be possible to make pools of peptides already dissolved in a solvent like dmso, mix the solutions, and relyophilize the pool of pools . Indeed, we routinely find these sequentially lyophilized pools, once resuspended, to be much more soluble than the individual components . Accordingly, we synthetized a set of 207 ebv human cd8/class i epitopes, identified by the default setting described above (supplemental table 1a). In addition, we also synthetized a set of 92 cd8/class i epitopes derived from denv virus, obtained by selecting only peptides with rf> = 0.01 (supplemental table 1b), and a set of 86 epitopes cd4/class ii epitopes derived from mycobacterium tuberculosis, based on an rf score> = 0.1 and being recognized ex vivo (supplemental table 1c). Peptides corresponding to these three sets of epitopes were pooled and tested with human pbmc as a source of t cells . For these experiments we selected pbmc from 5 individuals infected with denv virus and likely uninfected with tb (see methods for details) and pbmc from 5 ltbi individuals and likely uninfected with denv . Because of the high incidence of ebv infection worldwide, we assumed that most if not all individuals tested would be latently infected with ebv . Pbmc were stimulated with the denv cd8 pool, mtb cd4 pool, and ebv cd8 pool . After ex vivo stimulation, the ifn response was measured by ics (figures 3(a)3(d)). The gating strategy for these experiments representative plots of the responses for both cd4 and cd8 t cells are shown for a ltbi donor (figure 3(b)) and a denv donor (figure 3(c)). The ifn responses induced by each epitope pool in the relevant cd4/cd8 compartments for all donors tested are summarized in figure 3(d). In the case of the mtb cd4 pool, ex vivo cd4 but not cd8 t cell responses were seen in the ltbi (p = 0.004) and denv donors . The reactivity was lower in the denv donors than in the ltbi donors (p = 0.03). This lower, but detectable, reactivity is explained by the fact that the denv seropositive individuals are vaccinated against mtb with m. bovis bcg and are likely exposed to nontuberculous mycobacteria . In the case of the denv cd8 pool, cd8 t cell responses, but not cd4, were detected in 3 out of 5 denv donors . This ex vivo reactivity in 3 out of 5 donors is in line with what was detected in previous studies . As expected, no cd4 responses were seen to the cd8 denv pool, as also low cd8 and cd4 t cell reactivity was noted in the mtb donors with the denv cd8 pool . Finally, as also expected, in both cohorts reactivity was detected against the ebv cd8 pool in cd8 but not in cd4 t cells (p = 0.004 for ltbi and p = 0.05 for denv). We devised a strategy that allows automatically filtering datasets to select epitopes of appropriate size, defined restriction, and assay type for use in characterizing responses to specific indications . While querying the iedb database can also generate these sets, a certain degree of complexity in the queries and the setting of multiple parameters would be necessary . In our application, the epitope sets are automatically generated, while the user is still enabled to change the default settings to generate validated epitope sets matching specific criteria . We further identified which epitope categories are supported by current iedb data, and found that reference epitope sets could be produced for 43 categories with data currently available in the iedb . The number of such categories, broadly based on previous epitope classification work, is undoubtedly destined to grow, allowing an ever more comprehensive study of immune responses in a broad variety of experimental systems . To further illustrate the broad applicability of the approach, we also extended our work to address autoimmune epitopes, b cell epitopes, and murine epitopes . While these actual epitope sets are provided as tables within the paper, we implemented a web application to automatically generate epitope sets, based on the fact that the iedb content is rapidly growing and new epitopes are added to the iedb in each of its biweekly updates . We plan to continuously gather feedback on this web application from the scientific community, and to implement changes and modifications through the main iedb website . Finally, to illustrate applicability in an actual experimental setting, we selected and synthesized peptide sets corresponding to ebv, denv, and mtb epitopes . The experimental testing of these epitope sets demonstrated the applicability of these sets as a valuable resource to allow detection of t cell responses ex vivo . As such, these sets of epitopes represent potentially valuable resources for diagnostic purposes, as well as for further detailed characterization of the immune response to specific targets of immunological interest.
Shock wave lithotripsy (swl) was invented in the early 1980s and since then has become a standard treatment for renal and ureteral calculi owing to its noninvasiveness . Swl is particularly recommended for the treatment of renal and ureteral stones smaller than 10 mm . Swl has been less successful in treating larger urinary calculi (> 20 mm) and staghorn calculi and thus is recommended for smaller, uncomplicated calculi . In our clinical practice, we develop individualized treatment plans after assessing stone size and location . However, the valuable information obtained from noncontrast computed tomography (ncct), including stone location, size, number, and obstructive grade, has an important role in treatment planning . Some reports have suggested that stone attenuation value on ncct is an independent predictor of clinical outcome after swl [3 - 7]. In the present study, we attempted to identify the radiographic parameters on ncct that best predicted swl success . From august 2005 to march 2009, we used the dornier compact s (dornier med tech, weling, germany) device to perform swl in 236 patients . Patients were excluded if maximum stone length was greater than 20 mm, if follow - up for the presence of unsatisfactory residual fragments was inadequate, or if the patient underwent an additional swl session within 2 weeks (because this was considered too short an interval to assess the effect of a single treatment). We retrospectively reviewed the records of 75 patients who met the inclusion criteria and underwent swl with a dornier compact s lithotripter for urinary calculi measuring 5 to 20 mm . Patients were treated with 3,000 shock waves at a maximum energy level of 6 (for renal calculi) or 7 (for ureteral calculi). Maximum stone length was measured by using plain abdominal film (kidney, ureter, bladder; kub) or intravenous pyelography (ivp). All scans were performed preoperatively by using a somatom plus 4 scanner (siemens, munich, germany) with 4 detector rows (2.5-mm collimation width, 5 helical pitch, 120 kv, and 150 effective mas). Using reconstructed 6-mm ncct images archived to a pop - net server (imageone co., tokyo, japan), a single urologist (m.t .) Traced the contour of the inner edge of the stone (not including the surrounding soft tissue) on the slice with the maximum stone cross - sectional area (fig . This illustration was then used to automatically calculate stone area and average, maximum, and minimum stone attenuation values on the pop - net server . Using the ncct images, we defined stone - to - skin distance (ssd) as the average of measurements taken at 0, 45, and 90 (fig . Kub was done on postoperative day 1 . In general, patients reported for follow - up evaluation by kub after 2 to 4 weeks . Patients underwent an additional session if substantial fragments remained . On follow - up imaging using kub or ncct, clinical outcome was classified as successful (patients who were stone - free or had fragments <4 mm in diameter) or failed (stone fragments measuring 4 mm). Outcomes were decided when patients were judged 1) to be stone - free or to have fragments less than 4 mm in diameter or 2) to be swl - resistant (e.g., an alternative treatment was selected for an unchanged stone or additional treatment was abandoned). The same urologist (m.t . 4.05j (sas institute, cary, nc, usa). In all analyses, we used the chi - square test and unpaired t - test to compare the preoperative parameters of successfully and unsuccessfully treated patients . The impact of preoperative parameters, i.e., stone length, location, average stone attenuation value, stone cross - sectional area, and ssd, were evaluated by univariate and multivariate analysis . In addition, these parameters were evaluated by using optimal cutoffs determined by receiver operating characteristic (roc) curve analysis and were reevaluated by univariate and multivariate analysis . Of the 75 patients (46 men and 29 women), 27 (36.0%) had a renal stone (calyx or renal pelvis) and 48 (64.0%) had a ureteral stone . The mean number of extracorporeal swl sessions was 1.10.4, and clinical outcomes were assessed after an average follow - up of 61.834.6 days . The overall success rate, i.e., stone - free or fragments less than 4 mm, was 73.3% . The mean duration of follow - up was 57.233.5 days for successfully treated patients and 74.335.5 days for unsuccessfully treated patients (p=0.059); the mean number of swl sessions was 1.10.3 and 1.30.6 (p=0.035), respectively . The respective average stone attenuation value, stone length, and stone cross - sectional area were 627.4166.5 vs. 788.1233.9 hu (hounsfield unit) (p=0.002), 11.73.8 vs. 14.23.6 cm (p=0.015), and 0.310.17 vs. 0.570.41 cm (p<0.001), respectively . The results of the univariate analysis showed that average stone attenuation value, stone length, and stone cross - sectional area were associated with swl success (p=0.004, p=0.019, and p=0.003, respectively), whereas stone location (i.e., kidney or ureter) was not associated with swl success . However, stone attenuation value was the only independent predictor of swl success in the multivariate analysis (p=0.023), although stone cross - sectional area had a tendency to be associated with swl success (p=0.053). The roc analysis revealed the optimal cutoff values for stone length, stone attenuation value, stone cross - sectional area, and ssd in relation to swl outcome . All variables were categorized by optimal cutoff values . Among these variables, average stone attenuation value, stone length, and stone cross - sectional area were significant predictors of swl outcome in the univariate analysis, and stone attenuation value was the only independent predictor in the multivariate analysis, as in the above - mentioned analysis (table 3). 2 shows the roc curves for stone attenuation value and stone cross - sectional area . On the basis of those values, patients were then classified into group 1 (attenuation 780 hu and cross - sectional area 0.4 cm), group 2 (780 hu and> 0.4 cm), group 3 (> 780 hu and 0.4 cm), and group 4 (> 780 hu and> 0.4 cm). Compared with the other groups combined, the odds ratio (or) in group 1 for a successful result on swl was 11.6 (95% confidence interval [ci], 3.9 to 54.7; p<0.001). The results of this study showed that stone attenuation value and stone cross - sectional area are good predictors of extracorporeal swl outcome . In the multivariate analysis, stone attenuation value was the only independent predictor of swl success (as a continuous and as a categorical variable; p=0.023, together), and stone cross - sectional area, as a continuous variable, had a tendency to be associated with swl success (p=0.053). Patients with a stone attenuation value of 780 hu or less and a stone cross - sectional area of 0.4 cm or less were 11.6 times as likely to have a successful result on swl as were the other groups combined (95% ci, 3.9 to 54.7; p<0.001). The combination of stone attenuation value and stone cross - sectional area provided information that was useful in determining the swl treatment for patients with urinary calculi . Bon et al . Examined the associations of the preoperative radiographic appearance of calculi (i.e., homogeneity, density, and morphologic features) with swl outcome and concluded that density and morphologic features were predictors of swl success . Ncct is clearly superior to conventional plain abdominal radiography and ivp both in its capacity to aid in diagnosis of urolithiasis and in cost - effectiveness . Several studies have identified stone attenuation as a predictor of swl success [3 - 7]. As mentioned above, lower stone attenuation values are predictive of swl success (fig . . Found that the stone - free rate for stones of 1,000 hu or greater was only 17% . Noted that to achieve a 60% stone - free rate, the density cutoff value for solitary 6- to 10-mm stones was 1,000 hu for stones in the proximal ureter and 640 hu for those in the renal pelvis . As compared with the stone radiographic pattern on kub, stone density on ncct is a much clearer criterion for stone assessment . Patient data and images can be easily stored and retrieved from a workstation system in almost all clinics, and stone attenuation values can be calculated in minutes . . Found that an ssd greater than 10 cm on ncct was a predictor of swl failure (or, 0.32; 95% ci, 0.29 to 0.35; p<0.01). Similarly, perks et al . Noted that the combination of an ssd less than 9.0 cm and a stone attenuation value less than 900 hu was a good predictor of swl success as compared with other groups (or, 7.1; 95% ci, 1.6 to 32; p<0.01). However, in the present study, ssd did not differ significantly between the success and failure groups . This discordance with regard to ssd may be due to differences between the physical characteristics of the present patients and those of western subjects . Dretler and polykoff demonstrated the possibility of determining stone composition by radiographic appearance, and prediction of stone composition by ncct has been reported in several studies . According to these reports, the density of uric acid stones is lower than that of calcium oxalate stones . However, calcium oxalate monohydrate and cystine, which are resistant to swl, could not be identified preoperatively . In the present study, stone composition analysis was performed in 51 patients: 50 had either calcium oxalate stones only or combined calcium oxalate / calcium phosphate stones and 1 had a cystine stone . Therefore, we were unable to assess the relation between stone composition and stone attenuation value . Several clinical studies have shown that swl failure is associated with greater stone attenuation value . Stone attenuation values in previous studies ranged from 578 to 837 among successfully treated patients and from 910 to 1,225 among unsuccessfully treated patients . We believe that the wide range of previously reported stone attenuation values is likely due to differences in ct collimation width, the method used to measure stone attenuation, and the lithotripter used . Stone attenuation values appear to be influenced by ct collimation, which affects the volume averaging of the surrounding soft tissue . Saw et al . Found that attenuation values were consistently lower at larger collimation widths perks et al . Investigated 2 methods elliptical region of interest (incorporating the largest cross - sectional area, excluding adjacent soft tissue) and mean attenuation calculated from three small, nonoverlapping regions of interest in each stone and found that these methods were significantly correlated (r=0.98, p<0.001). We modified the former method to calculate maximum stone cross - sectional area and contour the inner edge of the stone without including the surrounding soft tissue . Although we reconstructed 6-mm ncct images, measurement of the attenuation value for stones smaller than 6 mm might be affected by volume averaging . In the present study, stone attenuation values for stones smaller than 6 mm were significantly lower than those for stones larger than 6 mm (519.022110.566 vs. 690.882199.372 hu, p=0.014). We measured stone cross - sectional area by contouring the inner edge of the stone and took great care to exclude the surrounding soft tissue . However, this method, too, might have resulted in volume averaging, especially in smaller stones . Although several methods of determining stone surface area have been reported (graph paper, planimeter, computerized image analysis, and calculation as an ellipse), all of these measurements were collected by using kub . Tiselius calculated stone surface area from the longitudinal and transverse diameters as an ellipse with the formula lengthwidth0.25 and found a positive correlation between the number of swl sessions and stone surface area . Lam et al . Investigated 3 techniques use of graph paper, planimeter, and computerized image analysis and concluded that computerized image analysis was the most accurate, fastest, and easiest to perform . We assessed the effect of stone cross - sectional area calculated by contouring the inner edge of the stone on ct, not kub . In the multivariate analysis, stone cross - sectional area had a tendency to be associated with swl success (p=0.053). In addition, yoshida et al . Showed that stone volume was a good predictor of stone fragility . Lam et al . Reported an excellent correlation between stone volume and stone surface area (r=0.84, p=0.005). Stone length is one - dimensional, stone cross - sectional area is two - dimensional, and stone volume is three - dimensional . Ng et al . Maintained that treatment planning is aided by a scoring system that uses stone volume, stone attenuation, and ssd to determine swl outcome for upper ureteral stones . In the present study, we showed that classification by stone attenuation and cross - sectional area is a good predictor of swl success . The potential limitations of this study include the possible underestimation of stone attenuation values in stones smaller than 6 mm and the indefinite follow - up schedule . In addition, stone location (e.g., upper, middle, or lower pole of kidney or ureter) was not assessed . Nevertheless, our findings confirm that classification by stone attenuation value and cross - sectional area is a practical method for determining the potential effectiveness of swl . Data on stone attenuation value and cross - sectional area are easily stored and retrieved in imaging workstation systems . Ncct not only assists in diagnosing urolithiasis, it is also a predictor of swl success . Although stone attenuation and cross - sectional area, as determined by multidetector noncontrast ct, are good individual predictors of extracorporeal swl outcome, combined classification by stone attenuation and cross - sectional area is a strong predictor of extracorporeal swl outcome . In addition, because of the unique properties of swl devices, optimal stone attenuation cutoff values should be determined for each device type.
There is a period in brain development in which the euthyroid status is a prerequisite for normal development . The molecular basis of the thyroid dependent brain development is not yet clarified . Among other processes, defects in myelination, delays in the development of the dendritic tree, decreased number of glial cells, and axo - dendritic synapses have all been described in hypothyroid newborn rats . These injuries are very debilitating, commonly affecting the younger more productive portion of the population . Microsurgical techniques to restore nerve continuity have reached their limits, and further surgical advancements in the field of peripheral nerve surgery are unlikely to improve the prognosis . A different approach based on the cellular and molecular aspects of regeneration should be followed . This approach is justified by the fact that peripheral nerve injuries are in reality cellular, rather than tissue injuries . It is the long axon of the neuron that has been injured . In response, the cell body adapts in an effort to restore the cellular volume and function . Before adaptation these factors can be modulated both by surgical intervention and by altering biologically the microenvironment of the cell . These are important steps in the process of regeneration with cellular and molecular parameters influencing the final result . The process of nerve regeneration is actually a cellular response to injury . The nerve cell after the traumatic event loses a portion of its intracellular volume and initiates an effort to restore its shape and function . Appropriate target reinnervation and central nervous system adaptation are other equally important processes in restoration of function . Many studies have been undertaken to more efficiently define the biochemical and cellular processes of nerve regeneration . The proximal and distal nerve stumps are introduced and secured at the ends of the conduit material, leaving a predefined interstump distance . Veins, mesothelial tissues, collagen sheets, biosynthetic materials, biodegradable materials, and silicone have all been used . Silicone as a material has many important advantages as follows: availability in various sizes and diameters, ability to be sterilized, cheapness, sufficiently rigid to withstand compression, easily handled surgically for suture penetration, biologically inertness, not inducing inflammation or resorption and thus not affecting the process of regeneration.the introduction of the chamber model was made on the assumption that eliminating the influence of the external environment would be beneficial for the process of regeneration . Molecules and cells derived from the distal and proximal nerve stumps are concentrated inside the chamber undisturbed from exogenous factors . The results of those pilot studies were very encouraging as gaps 1 cm in length were successfully bridged in small animal models (rats) [5, 6]. Availability in various sizes and diameters, ability to be sterilized, sufficiently rigid to withstand compression, easily handled surgically for suture penetration, biologically inertness, not inducing inflammation or resorption and thus not affecting the process of regeneration . An advantage of a closed chamber model is the ability offered to alter the biochemical or cellular microenvironment within the gap . With this model the process of regeneration itself can also be studied efficiently in a timely manner, as the contents inside the chamber can be examined at various intervals from implantation . Biochemical, cellular, and histological methods can be used to delineate the various stages and processes of regeneration . These studies failed to detect any change in the rate of growth of sensory axons with t3 treatment, after a sciatic nerve crush . These earlier studies on peripheral nerve regeneration, in order to achieve higher concentrations of the hormone at the site of regeneration, used large quantities of t3 intraperitoneally . One possible explanation of these discouraging results is that these large quantities might had a detrimental role, acting systematically, masking any potential benefit . The introduction of the silicone chamber model in the study of peripheral nerve regeneration facilitated the application of small quantities of the hormone in a confined space thus eliminating adverse systemic effects . Thyroid hormones exert their function either through their extranuclear (nongenomic) or through their genomic action on the cell . The extranuclear action is mediated through the direct effect on membrane ion channels and pumps . Trs have been classified in two families according to the genes (tr, tr) that encode these receptors . Different processing of the tr gene transcript results in the formation of three isoforms (splice variants): tr1, tr2, and tr2v . Of all these isoforms, only tr1, tr1, and tr2 promote specific gene expression after their activation . The localization of trs in the peripheral nervous system is of great importance in the understanding of the mode of action of t3 in nerve development and regeneration in rats . In peripheral nerves, trs are expressed in schwann cells during a defined period, from the third week of embryonic life through the second postnatal week . The first schwann cells to lose the expression of trs are those in close proximity with the neuronal body . This elimination of trs expression is concomitant with the process of myelination and follows the temporospatial pattern of myelination from proximal to distal . Thus schwann cells distally retain their ability to express trs longer than the more proximally located cells . This loss of trs expression from schwann cells persists throughout adult life in intact peripheral nerves . After a nerve injury, this expression involves mainly the distal stump of the transected nerve and follows again the same temporospatial pattern but this time in reverse . The first schwann cells to reexpress trs are those in close proximity with the lesion with the more peripheral cells to follow . This process is concomitant with the process of degeneration and myelin degradation in the peripheral stump from proximal to distal . Thus it can be inferred that the loss of contact of axons with the schwann cells in the peripheral stump promotes trs expression . This loss of axon - cell contact leads to major physiological changes switching schwann cell to an embryonic state of proliferation and of expression of specific neurotrophic and neurotropic genes . Their action is not confined temporally on prenatal maturation and development . In the spinal cord, trs expression is constant at the large motor neurons and the other neurons of the grey matter . One difference from the peripheral glial cells is that the glial cells of the central nervous system, namely, the oligodendrocytes and the astrocytes, express trs constantly, irrespective of the axonal contact or the presence of myelin . Schwann cells express predominantly the tr1 splice variant and to a lesser degree the tr2 and tr1 . The predominant trs in sensory neurons of the dorsal root ganglia are tr1 and tr2 . From the above, it can be inferred that the postactivation cascade involves different mechanisms between schwann cells and sensory neurons . Furthermore it has been found that throughout the nervous system the population of nonfunctional trs isoforms is very large . This population may play a role in the regulation of the circulating levels of thyroid hormones . A proportion of sensory neurons in the dorsal root ganglia will undergo a process of apoptosis after a traumatic event as described previously . T3 is likely to have a direct effect on these neurons lessening the degree of apoptosis and rescuing a significant number of sensory neurons . By rescuing sensory neurons, t3 increases the number of new axons that enter the distal stump . This action is a direct effect and is not mediated through the action of t3 on peripheral glial cells . There are the results of two different types of experiments in support for the above . The first group of experiments uses the silicone chamber model to investigate the fate of the application of 125 i labeled t3 in the chamber . It has been documented that the neuronal bodies in the dorsal root ganglia show labeling after injection of the labeled t3 in the silicone chamber . It has been proposed that t3 is retrogradely transported through the proximal stump to the neuronal body . In the neuronal body, t3 binds to the nuclear receptors and exert its action rescuing the neuron from death . The second group of experiments uses cell cultures prepared from dorsal root ganglia (drg) of rat embryos . Three types of cultures were prepared: (a) mixed dissociated drg cultures, with neurons and nonneuronal cells including schwann cells, (b) primarily neuronal cell culture with diminished number of nonneuronal cells, and (c) explant drg culture where the physical relationship between neuronal and nonneuronal cells was preserved . The addition of t3 at physiological concentration resulted in the stimulation of neuron survival to the same extent for both mixed and neuron enriched cultures . This effect is not mediated by neurotrophic factors secreted by nonneuronal cells after their activation by t3 . This action is probably mediated through tr1 as this is the predominant receptor in sensory neurons . This effect was observed in explant drg cultures where the relationship of neuronal and nonneuronal cells was largely preserved . This increased outgrowth was not observed in neuron enriched cultures or when the proliferation of nonneuronal cells was inhibited by antimitotic agents . Thus it can be inferred that the promotion of neurite outgrowth is mediated by the action of t3 on nonneuronal cells . Nonneuronal cells under the influence of t3 may secrete neurotrophic factors that promote neurite outgrowth . These factors may include ngf (nerve growth factor), nt-3 (neurotrophin 3), and possibly others . Thus it can be inferred that t3 uses multiple different processes to promote neuronal survival and neurite outgrowth . The molecular basis of the cascade of events after the binding of t3 on its specific receptors is not yet clarified but the end result is the activation of specific target genes [13, 14]. Formation and transport of cytoskeletal proteins are another mode of possible t3 action promoting regeneration . Neurofilament subunits and tubulin isoforms levels have been found, by immunocytochemistry and western blot analysis, to increase in response to local t3 treatment . These necessary elements for neurite outgrowth have been found more rapidly in the distal segments of the regenerating nerve . Thus under the influence of local t3 new axons enter more rapidly and in greater numbers the distal stump . Another implication of the increased levels of neurofilaments in the regenerating distal stump is the actual increase of the axon diameter, as there is a direct relationship between the amount of neurofilaments subunits and the radial growth of the new axon . Microtubules which form the framework of the axons are primarily composed of tubulin and various microtubule - associated proteins which play an important structural and functional role . T3 through a synergistic action with ngf seems to regulate the formation, the transport, and the assembly of these proteins . Perhaps one of the most striking effects in peripheral nerve regeneration of local t3 is the increase in formation of the myelin sheath of new axons . Thus t3 treatment may improve the function of motor neurons with its effect on maturation and the increase in the diameter of the myelin sheath . May also act by increasing the proliferation of schwann cells as has been shown by the increased incorporation of [3h]thymidine in t3 stimulated cultures of schwann cells . Our study investigated potential functional effects of thyroid hormone on peripheral nerve regeneration in rats . After complete transection of the right sciatic nerve, the gap between the stumps was bridged with a silicone tube . In the first experimental group t3 solution was used to fill the tube, while a sterile buffer solution was used in nontreated rats . Additionally, sham operation with surgical incision and mobilization of the sciatic nerve without any other intervention was performed . In a few animals, a segment of the nerve was excised and the stumps were reversed to exclude the possibility of regeneration . The process of peripheral nerve regeneration was assessed by functional indices at three, six, nine, thirteen, and seventeen weeks postoperatively [1719]. Midstance angle, at the ankle, measured in degrees, was used as a kinematic index, and the withdrawal reflex (measured in grams of applied force) was used to evaluate the return of sensory function . Kinematic indexes were not different between groups a and b at all time points of the evaluation . Sensory function was significantly different in t3 treated animals compared to buffer treated control group (x versus y, p = 0.031) at nine weeks . In fact, phosphorylation of erk is induced by thyroid hormone at the microenvironment of nerve regeneration . Another mechanism may be through the upregulation of heat shock proteins, which can increase the rate of survival of motor and sensory neurons after injury and induce the process of nerve regeneration [24, 25]. However, although thyroid hormone has been shown to induce the expression and phosphorylation of heat shock protein 27 in heart tissues, it remains largely unknown whether similar effect can occur in nerve tissue . Local t3 acts rapidly and efficiently, enhancing a wide variety of different mechanisms which promote regeneration . Due to the short half - life of t3, it is probable that the concentration of the molecule inside the silicone tube rapidly decreases . Thus t3 should act rapidly in many targets which in turn produce a lasting effect to promote, through various mechanisms, peripheral nerve regeneration.
Retinoic acids, including vitamin a and its analogues, regulate the growth and differentiation . Retinoic acids suppress tumor formation in animals and have shown to be effective chemotherapeutic agents in many cancers . Predominantly all - trans retinoic acid (atra) and its stereoisomer 9-cis retinoic acid were found to be very potent metabolites of retinol exerting pleiotropic effects on many different biological processes . In contrast to all - trans and 13-cis, 9-cis retinoic acid has a greater effect on cell morphology . It has been reported that 13-cis retinoic acid decreases the development of primary tumors in patients with head and neck cancer, whereas atra provides a specific therapy for acute promyelocytic leukemia [1, 2]. The antitumor effect of retinoids is most often attributed to the induction of differentiation, but these compounds were also shown to stop the growth of tumor cells by inducing apoptosis or accelerated senescence . The ability of retinoic acid to induce differentiation in cancer cells suggests their potential role as a cancer chemotherapeutic agent . Retinoids exert their effects by modulation of gene expression by two distinct classes of nuclear receptors: retinoic acid receptors (rar,,) and rexinoid receptors (rxr,,). These receptors bear six domains: a / b for ligand - independent transactivation, c with two zinc fingers for dna binding, d is a hinge region and e is responsible for dimerization with rxr, ligand binding, ligand - dependent transactivation, and association with corepressor (cor) or coactivators (coa) complex . Binding, receptors bind to retinoic acid response elements (rares), specific dna sequence, as receptor dimer . Atra binds with high affinity (kd 0.20.4 nm) to rars, but not to rxrs, whereas 9-cis retinoic acid binds to rxr with high affinity . Rars may exist as homodimer and can form heterodimer with rxrs as well and interact with rare [6, 7]. Retinoid ligand binding to the receptor dimer complex induces a conformational change that removes the corepressors and recruits coactivators, thus, facilitating initiation of transcription . Two types of cellular retinoic acid binding protein crabp i and ii can act as transporter of retinoic acid to facilitate the transport of cytoplasmic retinoic acid into the nucleus leading to ligand - receptor interaction . For tumor invasion and migration, the tumor cells and host coordinately regulate matrix degradation, cell - cell attachments, and cell matrix attachment . Aberrant expression and activity of mmps the activation mechanism usually involves cleavage of the prodomain in the amino side of the conserved cystein residue followed by opening of the active site through the breakage of zinc - cystein bond . The gelatinases are distinguished by the presence of an fn - like region, inserted in the catalytic domain . Expression of integrin v3 on the cell surface supports maturation and activation of mmp-2 . The membrane bound mmps (mt - mmps) are characterized by a c - terminal transmembrane portion and a short furin - like sequence between the pro and the catalytic domain . Mmp activity can induce tumor growth or survival, invasion, angiogenesis, and cell migration . Tumor cells produce factors, such as chemokines, cytokines, and the extra - cellular matrix metalloproteinase inducer (emmprin), which in turn upregulate mmps . Mmps are the main group of proteolytic enzymes that facilitate tumor cell migration by degrading the basement membrane and other components of extra - cellular matrix (ecm). Beside degradation of ecm, tumor cell invasion and migration rely on the receptor - dependent attachment and release from the matrix and other cells . Mmp activity directly modulates the cell - cell and cell - matrix attachment and regulates the process of cell invasion and migration . Integrins play central role in anchorage - dependent growth, apoptosis, differentiation, and migration . Integrins differentially regulate the production of mmps . In human melanoma cell lines, 51 integrin and v3 integrin modulates release of mmp-2 and subsequent invasive behaviour . Reduction of cell adhesion is of major importance in tumor metastasis and can be achieved by a variety of mechanisms affecting the e - cadherin - catenin complex . These include reduction or loss of e - cadherin expression, mutation of the genes of constituent molecules, redistribution of e - cadherin within the cell and shedding of e - cadherin, and so forth, . In this communication, we report multifunctional effect of atra on (i) gelatinase - a expression and activity, (ii) various signaling molecules, and (iii) the integrin group of cell surface receptors in human breast cancer cells, mcf-7 . Minimal essential medium (mem), dulbecco's modified egal's medium (dmem), and foetal bovine serum (fbs) were purchased from invitrogen corporation, usa . Fibronectin (440 kda) and protein g agarose were purchased from roche, germany . Gelatin sepharose 4b beads was purchased from amersham biosciences, usa . All - trans retinoic acid (atra) was purchased from sigma . Anti - fak, anti - timp-2, anti - nf-b (p65), anti - emmprin, anti - mt1-mmp, anti - e - cadherin, anti - rar, anti - crabp, anti - erk, anti - phospho - erk, and anti - vegf antibodies were purchased from santa cruz, usa . Alkaline phosphatase coupled secondary antibodies (both monoclonal and polyclonal), hrp - coupled secondary antibody were purchased from calbiochem and nitro blue tetrazolium/5-bromo-4-chloro-3-indoyl phosphate (nbt / bcip, western blue stabilized substrate for alkaline phosphatase), and tetramethyl benzidine (tmb) was purchased from bangalore genei, india . Rnaqueous 4 pcr (total rna isolation kit) and retroscript (rt - pcr kit) were purchased from ambion, usa . Mmp-2, fak, 5, 1 primers were purchased from operon, usa . Gapdh primers and 100 base pair dna ladder were from genie, bangalore . A375 human melanoma cell line and mcf-7 human breast cancer cell line was obtained from national centre for cell sciences (nccs), pune, india . Mcf-7 cells were grown and maintained in mem containing 10% fbs and a375 cells were grown in dmem supplemented with 10% fbs in a co2 incubator at 37c . 7.5 mg retinoic acid (purchased from sigma, usa) was dissolved in 5 ml dmso to prepare 5 mm stock solution . Atra was added to the experimental dishes at concentrations of 10, 20, 30 m . A375 cells (300,000/ml) and mcf-7 cells (300,000/1.5 ml) were grown in serum free culture medium (sfcm) in absence (control) and in presence of 30 m atra for 24 (in case of mcf-7) and 48 (in case of a375) hours . 10 l of cell suspension (control and atra - treated) in pbs were taken and 10 l trypan blue was added into it . Mcf-7 cells (300,000/1.5 ml) were initially grown in mem supplemented with 10% fbs in petridishes, washed with serum - free culture medium (sfcm), and treated with increasing concentrations of atra (10 m, 20 m, 30 m) for 24 hours in sfcm . Control cells were grown without atra but in presence of 1% dmso (solvent for atra) for 24 hours and sfcm were collected . The matrix metalloproteinases were separated from sfcm using gelatin sepharose 4b beads and shaking for 2hours at 4c . The beads were washed x3 with tris - buffered saline with tween-20 (tbs - t) and suspended in 50 l of 1x sample buffer (0.075 gm tris, 0.2 gm sds in 10 ml water, ph 6.8). The suspension was incubated for 30 minutes at 37c and then centrifuged at 3000 r.p.m . For 3 minutes . The supernatant was then subjected to zymography on 7.5% sds - page copolymerized with 0.1% gelatin . Gel was washed in 2.5% triton - x-100 for 30 minutes to remove sds and was then incubated overnight in reaction buffer (50 mm tris - hcl ph 7, 4.5 mm cacl2, 0.2 m nacl). After incubation, the gel was stained with 0.5% coomassie blue in 30% methanol and 10% glacial acetic acid . Mcf-7 cells (300,000/1.5 ml) were grown in serum - free culture medium (sfcm) in absence (control) and in presence of 30 m atra (experimental) for 24 hours . The wells of microtitre plate were coated in triplicate with 50 l culture sfcm and with 50 g protein from both control and experimental set and kept at 4c overnight (plate was wrapped in wrap to prevent evaporation). Next day wells were washed with blocking buffer (1% bsa in pbs) to block nonspecific binding sites and incubated for 1 hour at 37c . Then the wells were washed thrice with washing buffer (0.5% np-40 & 0.5% bsa dissolved in pbs). Anti - timp-2, anti - e - cadherin, anti - rar, and anti - crabp primary antibody solution (1: 1000 dilution) was added to the wells and incubated at 37c for 1 hour . Respective second antibody solution (1: 1000 dilution buffer) was added to wells and incubated at 37c for 1 hour . Substrate (tmb) was added to the wells (in darkness) and kept as long as required (i.e., until color developed begins to become too intense). Then 1 m h2so4 stop solution was added and reading was taken in elisa reader at 450 nm . Rna was extracted from 1 10 mcf-7 cells grown in absence (control) presence and of 30 m atra for 24 hours . The sequence of the primers used for pcr was: hmmp-2: 5-gta ttt gat ggc atc gct ca-3 (forward) and 5-cat tcc ctg caa aga aca ca-3 (reverse), hfak: 5-gcg ctg gct gga aaa aga a-3 (forward) and 5-tcg gtg ggt gct ggc tgg tag g-3 (reverse), h5: 5-cat ttc cga gtc tgg gcc aa-3 (forward) and 5-caa aac agc cag tag caa caa-3 (reverse), h1: 5-tgt tca gtg cag agc ctt ca-3 (forward), and 5-cct cat act tcg gat tga cc-3 (reverse). Gapdh primers 5-cgg agt caa cgg att tgg tcg tat-3 (forward) and 5-agc ctt ctc cat ggt ggt gaa gac-3 (reverse) were used as control to normalize for mrna integrity and equal loading . Rt - pcr was carried out using two steps rt - pcr kit (ambion, usa). Components were incubated at 42c for 1 hour and at 92c for 10 minutes (to inactivate the reverse transcriptase) conditions used for pcr consisted of 24 cycles for mmp-2 at 94c for 30 seconds, 63c for 30 seconds, and 72c for 60 seconds, 25 cycles for fak at 94c for 30 seconds, 60c for 30 seconds and 72c for 1: 30 minutes and 28 cycles for 5 & 1 at 94c for 30 seconds, 58c for 30 seconds, and 72c for 1: 30 minutes with a final incubation at 72c for 7 minutes in dna thermal cycler . The predicted size of the pcr products were 198 base pairs (bp) for mmp-2, 476 bps for fak, 324 for 5, 452 for 1, and 454 for gapdh . Mcf-7 cells (300,000/1.5 ml) were grown in serum free culture medium (sfcm) in absence (control) and in presence of 30 m atra for 24 hours . Cell extraction was carried out using cell extraction buffer (37.5 mm tris, 75 mm nacl and 0.5% triton - x-100) and the protein content of the extracts were estimated by lowry's method . Equal amount of protein was taken and incubated with 1x sample buffer for 30 minutes followed by 58 minutes incubation with 0.1 volumes -mercaptoethanol at 8090c . The proteins were transferred on to nitrocellulose membranes by western blot at 300 ma for 3 hours . The membranes were blocked with 1% bsa and subsequently washed thrice with tbs - t . The immunoblots were reacted with anti - mt1-mmp, anti - emmprin, anti fak, anti - nf-b and anti - ig - g antibodies, respectively, (1: 1000 dilution) for 1.5 hours at 37c followed by incubation with respective alkaline phosphatase coupled second antibodies . Mcf-7 cells (300,000/1.5 ml) were grown in serum - free culture medium (sfcm) in absence (control) and in presence of 30 m atra for 24 hours . Cell extraction was carried out using the cell extraction buffer and the protein content of the extracts was estimated by lowry's method . Equal amount of protein was taken from each extract and erk, vegf was immunoprecipitated from the extracts using anti - erk, anti - vegf, and anti - ig - g antibodies and protein - g agarose beads and shaking overnight at 4c . The resultant immune - complex was washed thrice in pbs, suspended in 1x sample buffer and incubated at 37c for 30 minutes, followed by incubation with 0.1 volumes of -mercaptoethanol for 58 minutes at 8090c . The membranes were blocked with 1% bsa and subsequently washed thrice with tbs - t . The immunoblots were reacted with anti - erk antibody, anti - phospho - erk antibody, anti - vegf, and anti - ig - g antibodies, respectively, in 1: 1000 dilution, and kept at 37c for 1.5 hours . After washing with tbs - t, membranes were incubated with alkaline phosphatase coupled respective second antibodies (1: 1000 dilutions). The microtitre plate wells were coated with fibronectin (1.56 g, 3.125 g, 6.25 g, 12.5 g, and 25 g fibronectin / well). Wells were blocked with buffer c (1% bsa, 1 mm cacl2, and 1 mm mgcl2 in pbs) for 1 hour at 37c . Control and 30 m atra - treated (for 24 hours in complete medium) mcf-7 cells were trypsinised from culture dishes, washed, suspended in buffer c, added to microtitre plates (50,000 cells / well), and allowed to bind at 37c for 1.5 hours . The wells were washed 3 with buffer c. the bound cells were trypsinised, counted on haemocytometer, and expressed as% of adhesion . Statistical analyses were done with student's t - test comparing between the control and treated groups . Cell viability in mcf-7 (figure 1(a)) cells before and after atra treatment was checked using trypan blue stain (0.4%). In case of control 113 cells (average of 3 experiments) in 0.1 l (control) were counted as viable and in treated average of 3 experiments showed 110 cells/0.1 l (treated) were viable . However, t - test showed that there was no statistically significant difference (p = .085) between two groups . Therefore, no changes were observed in cell viability of control and atra - treated . Figure 1(b) showed the cell viability in a375 cells . In control, 138 cells/0.1 l (average of 3 experiments) and p = .113 indicates that there is no statistically significant difference in the cell viability of atra untreated (control) and atra - treated (treated) cells . The comparative zymogram (figure 1(c)) of control (lane c) mcf-7 cells and mcf-7 cells treated with 10 m (lane 1), 20 m (lane 2) and 30 m (lane 3) atra for 24 hours showed appreciable reduction in pro - mmp-2 activity in the sfcm of 30 m atra - treated mcf-7 cells as compared to that of the control . Pro - mmp-2 activity was not appreciably inhibited after 10 m and 20 m atra treatment for 24 hours . Pro - mmp-2 activity of control and 30 m atra - treated (for 12 hours) mcf-7 cells in sfcm showed no appreciable change in gelatinolytic activity . When the culture supernatant from both control and 30 m atra - treated mcf-7 cells were assayed for mmp-2 and tissue inhibitor of mmp-2 (timp-2) protein by elisa (figure 2), it was found that atra substantially increased timp-2 protein level . P = .000144 (p <.05) indicates data obtained are highly significant . To study the status of pro - mmp-2 activation complex, we studied the membrane type 1 mmp (mt1-mmp) expression by western blot using anti - mt1-mmp polyclonal antibody . The result (figure 3(a)) showed that 30 m atra - treated (lane e) mcf-7 cells exhibit much lower expression of mt1-mmp compared to the untreated mcf-7 cells (lane c). Treatment with 30 m atra for 24 hours (lane e) in mcf-7 cells showed appreciable downregulation in emmprin expression compared to the control (lane c) as analyzed by western blot (figure 3(b)). To analyze whether atra affects mmp-2 by regulating at transcription levels, we studied mrna expression for mmp-2 by rt - pcr . Figure 4 demonstrates a reduction in mmp-2 mrna expression after treating mcf-7 cells with 30 m atra for 24 hours (lane e) comparing the control (lane c). Figure 5(a) shows the effect of 30 m atra for 24 hours on adhesion of mcf-7 cells to ecm protein (fibronectin). Binding of cells to fibronectin decreased significantly upon atra treatment for 24 hours whereas binding of cells to fibronectin remained almost unaltered for 12 hours atra - treated cells (result not shown). Rt - pcr analysis (figure 5(b)) of control and atra - treated cells showed significant down regulation of 5 expression in atra - treated cells . Figure 5(c) represents the status of e - cadherin in control (c) and 30 m atra - treated (e) mcf-7 cells . When the expression level of e - cadherin protein in control and 30 m atra - treated (for 24 hours) were measured by elisa, result showed that e - cadherin expression increased significantly upon atra treatment . P = .01613 (p <.05) indicates statistically significant difference in e - cadherin expression between control and atra - treated cells . Focal adhesion kinase (fak) is located at the upstream of signaling cascade, especially the integrin signaling pathway involves fak . In order to determine if atra affect the fak pathway in mcf-7 cells, cells were cultured in absence (lane c) and presence of 30 m atra (lane e) for 24 hours and fak status was then determined by rt - pcr and western blot analysis . Result showed that fak (figures 6(a) and 6(b)) expression was reduced upon atra treatment . Nuclear factor kb (nf - kb) is one of the important signaling molecules affecting the activation of pro - mmp-2 . Therefore, the status of nf - kb in control (lane c) and 30 m atra (lane e) treated mcf-7 cells was assayed by western blot . Figre 7(a) is the representative of the western blot of nf - kb showed that the expression of nf - kb protein was appreciably reduced upon 30 m atra treatment for 24 hours in mcf-7 cells . Figures 7(b) and 7(c) show the comparative erk (figure 7(b)) and p - erk (figure 7(c)) expression by immunoprecipitation of erk and p - erk from whole cell extract with anti erk and anti p - erk antibodies followed by western blot . The results show that atra treatment downregulates the phosphorylation of erk, but the erk expression was not found to be altered significantly after atra treatment . The expression of p - erk is much less in the atra - treated (lane e) mcf-7 cell extract compared with untreated (lane c) mcf-7 cell extract . When the expression of vegf protein was assayed in atra - treated (lane e) and untreated (lane c) mcf-7 cells, western blot (figure 7(d)) demonstrated appreciable reduction in vegf protein expression in 30 m atra - treated mcf-7 cells, compared to that of the control cells . Elisa was performed to observe the status of rar (figure 8(a)) and crabp (figure 8(b)) upon atra treatment and it was found that rar and crabp expression increased appreciably in 30 m atra - treated (e) mcf-7 cells, compared to that of the control cells(c). P = .028 (p <.05) indicates that differences between control treated cells are statistically significant . In this communication we report the effect of all - trans retinoic acid (atra) on the expression and activity of matrix metalloproteinases and possible mechanism that may influence the drug to exert its effect . Treatment of mcf-7 cells with atra showed appreciable inhibition of pro - mmp-2 enzyme expression and activity . Treating cells with 30 the activity of mmps in extra cellular space is specifically inhibited by tissue inhibitors of metalloproteinases (timps). Timps bind to the highly conserved zinc binding site of active mmps at molar equivalence . Over expression of timp-2 can inhibit the activity of mmp-2 and it also inhibits the invasive and metastatic behaviors of cancer cells . Other studies also showed a pronounced induction of the timp-1 protein by vitamin a [23, 24]. Rt - pcr result demonstrates appreciable reduction of mmp-2 gene expression upon 30 m atra treatment for 24 hours . Pro - mmp-2 is activated at the cell surface through a unique multistep pathway that involves v3 integrin, mt1-mmp and timp-2 . Mt1-mmp acts as receptor and activator for pro mmp-2 . However, mt1-mmp cannot bind pro mmp-2 directly, and timp-2 acts as an adaptor molecule to mediate pro mmp-2 binding by forming ternary complex . The n - terminal domain of timp-2 binds the hemopexin like domain of pro mmp-2 . Cleavage of pro mmp-2 requires the presence of free mt1-mmp in addition to the complex [25, 26]. Our results demonstrate atra mediated reduction of mt1-mmp protein expression which may cause reduced activation of pro - mmp-2 in atra - treated mcf-7 cells . Extracellular matrix metalloproteinase inducer (emmprin), a 58 kd type - i trans membrane protein is known to play role in ecm remodeling through the activation of mmp production . Emmprin exhibits potential to induce mmp-2 expression . In this study downregulation of emmprin expression by atra may cause reduced pro - mmp-2 activity in the sfcm of atra - treated mcf-7 cells . The interaction of cells with adhesion protein in the ecm provides signals which affect the morphology, motility, gene expression and survival of adherent cells . The relationship that exists between integrin receptor, fibronectin, and mmp expression is of particular interest . It is present as a polymeric fibrillar network in the ecm and as soluble protomer in body fluids . Two regions in each fibronectin subunit possess cell binding activity: iii9 - 10 and iii14-v . The rgd motif in fibronectin is located in iii10 and is the most important recognition site for most of the known integrins . Integrins, a family of cell surface receptors, mediate attachment of the cells to ecm and initiate a series of signaling events that ultimately activates proteases like gelatinases . Integrins mediate both cell - cell and cell - substratum adhesion and signaling [29, 31]. Binding of integrin receptors to fibronectin can initiate organization of the cytoskeleton and focal contacts and signals which affect gene expression . Fibronectin through interaction with its corresponding 51 integrin receptor regulate the activity and expression of mmp-2 and mmp-9 [3234]. On binding to ecm molecules, integrins are thought to undergo a conformational change, which allows the intracellular domain of their subunit to interact with focal adhesion proteins . Fak combines with src and fak / src signaling pathway and promotes cell migration [35, 36]. Our study demonstrates that treatment of mcf-7 cells with atra downregulates the expression of 5 and 1 which reflects the result of cell adhesion assay, showing reduced tumor cell binding to ecm protein fibronectin after atra treatment in a time dependent manner . Our earlier study showed that atra treatment downregulates 5 and 1 subunit expressions of 51 receptor in siha cells . Focal adhesion kinase (fak) was first shown to be linked to integrin signaling when it was identified as a major substrate for tyrosine phosphorylation . It has been suggested that rho, a ras - like gtp binding protein that regulates the formation of focal adhesions and actin stress fibers, may be involved in the activation of fak . Thus, multiple cancer cell survival stimuli that signal through diverse pathways converge to induce the tyrosine phosphorylation of a common substrate, fak . Furthermore, fak induces mmp-2 secretion from cell interior to its medium [39, 40]. It may contribute to the cell motility and decreased gelatinase activity by regulating the secretion of mmp-2 in the sfcm . Alterations in the adhesion properties of neoplastic cells may play a pivotal role in the development and progression of the malignant phenotype in a range of tumor types . Adhesion molecules are intimately involved in the control of such processes as morphological differentiation, cellular proliferation, and invasion and colonization at distant organs . E - cadherin dependent cell - cell adhesion is important for the maintenance of epithelial structural integrity and the loss of e - cadherin expression has been shown to correlate with increased invasive potential of both carcinoma cell lines and human tumor samples . Recent data demonstrate that tumor - associated mmps can modulate cell - cell adhesion by cleaving e - cadherin . Evidence is emerging that there may be cross - talk between the cadherins and the integrins . Anticadherin antibodies have been shown to prevent the loss of 6 and 1 integrins in terminally differentiating keratinocytes . Positive expression of e - cadherin could decrease cell adhesion to fibronectin partially through transcriptional inhibition of 51 integrin gene . Our results showed that atra treatment up - regulated e - cadherin expression in mcf-7 cells which could downregulate the 5 and 1 expression and possibly attributed to inhibition of cell - matrix adhesion and therefore in turn inhibit pro - mmp-2 activity . Overexpression of e - cadherin decreased mmp-2 activity in prostate cancer cells and mt1-mmp in squamous cancer cells . Therefore, overexpression of e - cadherin in atra - treated mcf-7 cells may downregulate pro - mmp-2 activity in the sfcm of atra - treated cells . In our study, we found decreased expression of nf-b in atra - treated mcf7 cells . Nf-b is active in nucleus and is inhibited through its sequestration in the cytoplasm by inhibitor of b (ib). Ib kinase (ikk) can degrade ib and thus release nf-b from inhibition . Osteopontin, a membrane protein induces nf-b mediated pro - mmp-2 activation through ib/ikk phosphorylation . Therefore, by suppressing the nf-b protein expression atra may downregulate pro - mmp-2 activation . Furthermore, constitutive activation of nf-b may very well play an anti - apoptotic role in the breast and prostate carcinoma cells . The inhibition of constitutive nf-b activation by reducing nf-b expression in atra - treated mcf-7 cells may therefore enhance the basal apoptotic rate in these cells . Dual specificity phosphatase 6 (dusp6) dephosphorylates activated erk and blocks the growth stimulatory signals . Upregulation inhibits tumor cell proliferation and erk phosphorylation and serves as a negative regulatory mechanism to prevent further erk phosphorylation . Reduced erk phosphorylation may result due to atra induced transcriptional activation of dusp6 and rgs16 . Activation of erk plays an essential role in the expression of mt1-mmp [51, 52]. Reduced activation of erk may cause lesser expression of mt1-mmp in atra - treated cells . Angiogenesis is known to be one of the most important aggravating steps in the progression of cancer . Various angiogenic factors are known to be upregulated in cancer . Some of the proangiogenic factors such as thrombin, h2o2, hepatocyte growth factors, vascular endothelial growth factor (vegf) are known to have contribution to the activation and release of mmp-2 [53, 54]. Upon ligand (vegf) binding to its receptor vegfr-2 tyrosine kinase signaling cascade gets stimulated . As a result of this signaling cascade, proliferation / survival factors (bfgf), migration factors (icams / vcams / mmps), and vessel permeability factors (enos) are produced . Downregulation of vegf expression in atra - treated mcf-7 cells may contribute to the reduced pro - mmp-2 activity in treated cells . All - trans retinoic acid after entering into the cell, its entry from cytoplasm to nucleus is facilitated by crabp i / ii . In the nucleus it binds with its specific receptor rar / rxr and several studies suggested that rar / rxr and crabp expression got increased when cells received atra treatment [56, 57]. Our study also demonstrates up - regulation of rar and crabp expression upon atra treatment in mcf-7 cells . In conclusion, the present study demonstrates the inhibitory effect of atra on pro - mmp-2 activity and the possible molecular mechanisms . Our experimental findings strongly indicate that atra induced inhibition of pro - mmp-2 activity may result due to increased expression of timp-2, and downregulation of fak, mt1-mmp, emmprin, and nf - kb expression . Atra may interfere with the integrin down - stream signaling altering the expression and activity of pro - mmp-2.
Obesity - induced inflammation is considered to be a potential cause of metabolic disorders such as insulin resistance, type 2 diabetes, and cardiovascular diseases [13]. Adipose tissue actively participates in obesity - induced inflammation through recruitment of macrophages and t cells and release of inflammatory cytokines (monocyte chemotactic protein-1, mcp-1; tumor necrosis factor alpha, tnf-; interleukin-6, il-6) which modulate adipocyte differentiation, metabolism, and local / systemic inflammatory responses, causing undesirable metabolic imbalances [2, 4]. Interestingly, recent studies have shown that direct contact coculture of adipocytes and macrophages results in markedly elevated release of inflammatory cytokines [57], indicating that interaction between cell surface molecules on these cells is important for promoting their inflammatory responses . 4 - 1bb (also known as cd137 and tnfrsf9) is a classic example of a costimulatory molecule, and a well - known inflammatory receptor that is expressed by activated t cells at sites of inflammation . Stimulation of 4 - 1bb on t cells leads to cell expansion, cytokine production, and development of cytolytic effector functions . 4 - 1bb ligand (4 - 1bbl, also known as cd137l and tnfsf9) is highly expressed by most immune and many nonimmune cells and can receive and transmit reverse signals into cells such as macrophages . Accumulating evidence shows that bidirectional cell surface 4 - 1bb/4 - 1bbl interactions in immune cells are critical in initiating and modulating various inflammatory responses (e.g., rheumatoid arthritis, autoimmune myocarditis, and hematological malignancies) [1113]. Moreover, 4 - 1bb/4 - 1bbl - mediated interactions also occur between immune and nonimmune cells, again influencing inflammatory responses . For example, interaction between 4 - 1bb and 4 - 1bbl on endothelial cells and macrophages is involved in vascular inflammation [14, 15], and interaction between the two molecules on epithelial cells and natural killer cells is involved in renal ischemia - reperfusion injury . We previously showed that expression of 4 - 1bb and 4 - 1bbl was upregulated in adipose tissue that was inflamed due to obesity, and that ablation of 4 - 1bb reduced adipose inflammation . Hence, we hypothesized that interaction between 4 - 1bb and 4 - 1bbl on adipose cells and immune cells such as macrophages plays a role in adipose inflammation in obesity . In this study, we show for the first time that 4 - 1bb is expressed on adipocytes and is upregulated by obesity - related factors, and we demonstrate that 4 - 1bb/4 - 1bbl - mediated bidirectional signaling in adipocytes / macrophages plays a crucial role in initiating and promoting the obesity - induced adipose inflammatory cascade . Busan, korea) were fed a high - fat diet (hfd, 60% of calories from fat (research diets inc ., new brunswick, nj, usa); obese mice) or a low fat diet (lfd; 10% of calories from fat (research diets); nonobese mice) for 9 weeks . All animal experiments were approved by the animal ethics committee of the university of ulsan and conformed to national institutes of health guidelines . Nude mice were primed with pristane and injected intraperitoneally with a subcloned hybridoma producing an agonistic monoclonal antibody (ab) against 4 - 1bb (3e1) to induce ascite formation . The monoclonal ab was purified from the ascites fluid by affinity column chromatography with protein g - sepharose (sigma - aldrich). Recombinant 4 - 1bb fc (r4 - 1bb fc) was purchased from adipogen (seoul, korea). Antagonistic monoclonal ab against 4 - 1bbl (tks-1) was purchased from e - bioscience (san diego, ca, usa). Rat immunoglobulin g (rat igg) and human igg1 were purchased from sigma - aldrich (st . Louis, mo, usa) and used as control . The murine macrophage cell line raw264.7 was obtained from the korean cell line bank (kclb40071, seoul, korea). This cell line was maintained in rpmi1640 (gibco brl, ny, usa) containing 10% (vol / vol) fbs (fetal bovine serum) (gibco brl 3t3-l1 preadipocytes were maintained in dmem (dulbecco's modified eagle medium) high glucose (gibco brl, ny, usa) containing 10% fbs . Confluent 3t3-l1 preadipocytes (day 0) were incubated in dmem containing 10 g / ml insulin (sigma - aldrich), 0.25 m dex (dexamethasone, sigma - aldrich), 0.5 mm ibmx (3-isobutyl-1-methyl - xanthine, sigma - aldrich), and 10% fbs for 2 days . Briefly, 3t3-l1 cells were differentiated into mature adipocytes by incubation in dmem with 10% fbs and 5 g / ml insulin for 2 days . Mature adipocytes were maintained in this medium, and the culture medium was replaced with fresh medium every 2 days . Free fatty acid (ffa, palmitic acid mixture, sigma - aldrich) was dissolved in ethanol containing bovine serum albumin (bsa, 25 m) and conjugated with bsa at a 10: 1 molar ratio before use . 3t3-l1 adipocytes (3 10 cells / well) or raw264.7 macrophages (3 10 cells / well) in 24-well plates, were treated with obesity - related factors (palmitic acid: pal, lipopolysaccharide: lps) for 24 h or 4 h, respectively . To stimulate 4 - 1bb on adipocytes, 3t3-l1 adipocytes on 24-well plates were incubated with agonistic 4 - 1bb ab (3e1, 1 g / ml) or rat igg for 48 h in serum - free medium . To immobilize r4 - 1bb fc or human igg1 on culture plates, r4 - 1bb fc or human igg1 were incubated in 24-well plates at 37c for 1 h in a co2 incubator and the wells were rinsed with phosphate buffered saline (pbs). The plates were then incubated with rpmi (10% fbs) at 37c for 1 h in a co2 incubator and the wells were rinsed with pbs . Raw264.7 macrophages were incubated at 5 10 cells / well in 24-well flat - bottomed plates precoated with 100 ng / ml r4 - 1bb fc or human igg1 for 24 h. to isolate the stromal vascular fraction (svf) of adipose tissue, epididymial fat pads of c57bl/6 mice (male, 8 weeks old) were minced and digested for 30 minutes at 37c with type 2 collagenase (1 mg / ml; sigma - aldrich) in dmem (ph 7.4). The pellets were resuspended in erythrocyte lysis buffer, and the suspensions incubated at room temperature for 3 minutes, then centrifuged at 500 g for 5 minutes . After washing in dmem, the suspensions were passed through sterile 100 m nylon meshes (spl lifescience, pocheon, korea). The filtrated cells were transferred to 100 mm dishes contained dmem supplemented with 10% fbs and 0.4% fungizone and maintained in an incubator at 37c in 5% co2 . Cells were allowed to attach and floating cells were removed by aspiration and the culture media was replenished for every day . The svf cells were plated at 5 10 cell / well in 24-well plates . The confluent svf - derived preadipocytes were differentiated into adipocytes by treatment with dmem containing 10 g / ml insulin (sigma - aldrich), 0.25 m dex (sigma - aldrich), 0.5 mm ibmx (sigma - aldrich), and 10% fbs for 2 days . Mature adipocytes were maintained in the culture medium that was replaced with fresh medium every 2 days . To detect 4 - 1bb and 4 - 1bbl expression on svf - derived adipocytes exposed to obese factors, these cells incubated with palmitic acid 250 m, lps 100 ng / ml for 24 h. c57bl/6 mice (male, 8 weeks old) were intraperitoneally injected with 3 ml of 3% thioglycollate broth (difco, detroit, mi, usa) 4 days before being killed . Peritoneal macrophages were collected by centrifugation in mem media (minimum essential medium, gibco) and the resulting pellet was washed and resuspended in culture medium mem with 10% fbs . The peritoneal macrophages were purified by adherence to tissue culture plates for 2 hours . To detect 4 - 1bb and 4 - 1bbl expression on peritoneal macrophages exposed to obese factors, these cells incubated with palmitic acid 250 m, lps 100 ng / ml for 4 h. 3t3-l1 adipocytes were cultured and differentiated for 6 days . Coculture of adipocytes and macrophages was performed by two methods: direct contact coculture and transwell coculture . In the direct contact system, raw264.7 macrophages (3 10 cells: 50% macrophages, 3 10 cells: 10% macrophages) or peritoneal macrophages (3 10 cells) were placed in 24-well plates containing 3t3-l1 adipocytes (3 10 cells). The cells were cultured for 24 h in contact with each other and harvested . As a control, adipocytes and macrophages were also cultured separately, with cell numbers per well equal to those in the contact system and mixed after harvest . In the trans - well system, cells were cocultured using trans - well inserts with a 0.4 m porous membrane (corning, ny, usa) to separate adipocytes (3 10 cells, lower well) from macrophages (3 10 cells, upper well). After incubation for 4 h, 8 h, and 12 h, the supernatants were harvested . Cytokine levels in culture supernatants were measured using enzyme - linked immunosorbent assays (elisa). The assays were conducted using opteia mouse tnf, a mouse mcp-1 set (bd bioscience pharmingen, ca, usa) and a mouse il-6 and adiponectin set (r&d systems, minneapolis, mn, usa), and il-10 kit (r&d systems, minneapolis, mn, usa). Values for cytokine levels were derived from standard curves using the curve - fitting program softmax (molecular devices, sunnyvale, ca, usa). Total rna extracted from cultured cells was reverse transcribed to generate cdna using m - mlv reverse transcriptase (promega, madison, wi, usa). Real - time pcr amplification of the cdna was performed in duplicate with a sybr premix ex taq kit (takara bio inc ., foster, ca, usa) using a thermal cycler dice (takara bio inc ., all reactions were performed by the same procedure: initial denaturation at 95c for 10 s, followed by 45 cycles of 95c for 5 s and 60c for 30 s. all values for genes of interest were normalized to values for housekeeping genes (36b4 for adipocytes; -actin for macrophages and cocultures). Data were analyzed using thermal cycler dice real time system software (takara bio, inc . ). Base on the ct values obtained from each sample, the relative amounts of target genes were calculated using the standards curves with software provided by takara thermal cycler dice real time system . Cocultured 3t3-l1 adipocytes and raw264.7 macrophages in equal numbers (as described earlier) were separated following the manufacturer's protocol, using the cd11b microbeads system (macs; miltenyi biotec, sunnyvale, ca, usa). Briefly, cocultured cells were collected, washed twice with buffer (pbs supplemented with 2 mm edta and 0.5% bovine serum albumin - bsa), and incubated with cd11b microbeads for 15 min at 4c . Washed and resuspended cells were applied to macs column, which retained cd11b cells and allowed negative cells (adipocytes) to pass through . The column was then removed from the separator and placed on a suitable collection tube . Appropriate amounts of column buffer were pipetted onto the column to flush out positive cells (macrophages) using a plunger supplier with the column . This method resulted in 90% to 95% pure cd11b cells, as evaluated by flow cytometry . 3t3-l1 adipocytes and raw264.7 macrophages treated with obesity - related factors (as described earlier) were gently trypsinized, washed twice in pbs, and incubated with fc receptor - blocking antibodies (24g2) for 10 minutes on ice, then stained with phycoerythrin (pe) conjugated anti-4 - 1bb (ebioscience, san diego, ca, usa), anti-4 - 1bbl (ebioscience), or anti - rat igg2a, k (ebioscience), golden syrian hamster igg (ebioscience) and anti - cd11b (ebioscience) as a control to define the gate for adipocytes / macrophages . The cells were then washed with facs buffer and analyzed on a facscalibur (bd biosciences, san jose, ca, usa) with cellquest software (bd biosciences). 3t3-l1 adipocytes were plated at 1 10 cells / well in 6-well plates and incubated with 3e1 (1 g / ml) or rat igg for 3 h. raw264.7 macrophages were plated at 1 10 cells / well in 6-well plates coated with r4 - 1bb fc or human igg for 1 h. the 3e1-treated adipocytes and r4 - 1bb fc - treated macrophages were rinsed with pbs, resuspended by scraping in lysis buffer (10 mm tris - hcl, 10 mm nacl, 0.1 mm edta, 50 mm naf, 10 mm na4p2o7, 1 mm mgcl2, 0.5% deoxycholate, 1% igepal, and protease inhibitors cocktail), and centrifuged at 3000 rpm for 5 minutes . Samples containing 1030 g of total protein were subjected to western blot analysis using polyclonal antibodies to phosphorylated ikk (i kappa b kinase alpha / beta; p - ikk /, ser180/ser181), total ikk, p - p38 mapk (mitogen - activated - protein kinase), p - jnk (c - jun amino - terminal kinase), total jnk, p - akt (protein kinase b; ser473), total akt (cell signaling, danvers, ma, usa), and ib (inhibitor of nuclear factor-b alpha; santa cruz biotechnology, santa cruz, ca, usa), and -actin (sigma). Results are presented as means sem of three independent performed in duplicate . Statistical comparisons were performed using student's t - test or anova with duncan's multiple - range test . We first measured expression of 4 - 1bb during adipogenesis at the mrna level using qrt - pcr . We found that levels of 4 - 1bb transcripts were greater in svf - derived adipocytes after differentiation (figure 1(a)). Importantly, obesity - related substances such as palmitic acid and lps significantly upregulated levels of 4 - 1bb transcripts in svf - derived adipocytes and 4 - 1bbl transcripts in peritoneal macrophages (figure 1(b)). The upregulation of the transcripts is confirmed in 3t3-l1 adipocytes and/or raw264.7 macrophages (figure 1(c)). Facs analysis also revealed that 4 - 1bb protein on 3t3-l1 adipocytes and 4 - 1bbl protein on raw264.7 macrophages (figure 1(d)) were increased by these obesity - related factors . In addition, 4 - 1bb and 4 - 1bbl transcripts increased in cocultured adipocytes / macrophages (figure 1(e)), as well as in the epididymal adipose tissue of obese mice fed an hfd (figure 1(f)). To examine whether 4 - 1bb on adipocytes or 4 - 1bbl on macrophages provide an inflammatory signal, we treated each cell type with agonists that specifically stimulate these molecules; 3t3-l1 adipocytes were treated with an agonistic 4 - 1bb antibody (3e1) for 48 h, and raw264.7 macrophages with r4 - 1bb - fc for 24 h and we then measured levels of inflammatory cytokines in the respective cells . Both 4 - 1bb stimulation of adipocytes and 4 - 1bbl stimulation of macrophages markedly increased the production of proinflammatory cytokines such as mcp-1, tnf-, and il-6 at the mrna (figures 2(a), and 2(c)) and protein levels (figures 2(b) and 2(d)). Adiponectin secretion from adipocytes was not altered by 4 - 1bb stimulation (data not shown). 4 - 1bbl stimulation of macrophages decreased the transcripts of il-10 (figure 2(c)), but no change was observed in il-10 protein release (figure 2(d)). To understand the molecular mechanisms by which 4 - 1bb and/or 4 - 1bbl activate inflammatory signaling in adipocytes and/or macrophages, we examined the effects of 4 - 1bb/4 - 1bbl stimulation on intracellular signaling molecules . Stimulation of 4 - 1bb on adipocytes increased the phosphorylation of p38 mapk and jnk as well as the phosphorylation of ikk, the upstream molecule of nf-b, and induced ib degradation (figure 2(e)), while stimulation of 4 - 1bbl increased phosphorylation of akt and p38 mapk, and jnk (figure 2(f)), but had no effect on degradation of ib protein (figure 2(f)) and phosphorylation of ikk (data not shown). Consistent with previous reports [20, 21], 4 - 1bbl signaling not only activated p38 mapk but also induced akt activation in macrophages, leading increased inflammatory cytokines expression . Because 4 - 1bb/4 - 1bbl stimulation enhanced the release of inflammatory cytokines from adipocytes and/or macrophages, respectively, we investigated whether cell - cell interaction via surface molecules, presumably 4 - 1bb/4 - 1bbl, has a role in initiating and triggering inflammatory responses . We first cocultured 3t3-l1 adipocytes and raw264.7 macrophages in a direct contact system and found that the production of inflammatory cytokines il-6, mcp-1, and tnf- was correlated with the number of macrophages in the culture (figures 3(a)3(c)) and increased with time (figures 3(d)3(f)). To test whether the 4 - 1bb/4 - 1bbl - mediated interaction between adipocytes and macrophages participates in the inflammatory response in the contact cocultured 3t3-l1 adipocytes / raw264.7 macrophages, we blocked the interaction using a neutralizing antibody (tks-1). The neutralizing monoclonal antibody reacts specifically with mouse 4 - 1bbl, by which 4 - 1bbl cannot bind to 4 - 1bb receptor and can interrupt the interaction between 4 - 1bbl and 4 - 1bb . Hence, both 4 - 1bb - mediated signal in adipocytes and 4 - 1bbl - mediated signal in macrophages can be blunted by tks-1 treatment . We found that treatment with tks-1 significantly reduced levels of il-6, mcp-1, and tnf- mrna in the contact cocultured adipocytes / macrophages (figure 4(a)). The reduction in the expression of these inflammatory cytokines was confirmed at the protein level (figure 4(b)). Moreover, we also found that disruption of the interaction between 4 - 1bb and 4 - 1bbl reduced the release of inflammatory cytokines from peritoneal macrophages cocultured with adipocytes (figure 4(c)). To examine the relative contributions of 4 - 1bb and 4 - 1bb signaling to inflammatory gene expression in the cocultured adipocytes / macrophages, we separated the macrophages from the adipocytes and measured levels of inflammatory cytokine transcripts in the two types of cell (figure 4(d)). The neutralizing antibody significantly reduced the increase in levels of il-6, mcp-1, and tnf- mrnas in the adipocytes as well as in the macrophages (figures 4(e) and 4(f)). Obesity - induced adipose inflammation is characterized by recruitment of macrophages into adipose tissue, and the macrophages are an important source of inflammatory responses . Cell - cell contact between adipocytes and macrophages is considered to be important for triggering inflammatory pathways in adipose tissue [5, 6], although it is unclear which molecules are involved . Recent studies have shown that the engagement of co - stimulatory receptor 4 - 1bb with its ligand 4 - 1bbl through cell - cell contact modulates various inflammatory responses [13, 14, 16]. In previous work, we found that 4 - 1bb deficiency reduced adipose inflammation by decreasing macrophage recruitment and the release of inflammatory cytokines . Based on these findings, we hypothesized that 4 - 1bb/4 - 1bbl - mediated cell - cell interaction between adipose cells and macrophages might be important in the onset and/or maintenance of obesity - induced adipose inflammation . Interestingly, 4 - 1bb transcripts in adipocytes and 4 - 1bbl transcripts in macrophages were markedly upregulated by obesity - related factors (e.g., ffa and lps), and their expression was also strongly increased in contact cocultured adipocytes / macrophages . Moreover, the upregulation of these molecules was accompanied by enhanced release of inflammatory cytokines from the cells . These findings together with the upregulation in obese adipose tissue and the reduction of adipose inflammation in 4 - 1bb - deficient obese mice suggest that 4 - 1bb and 4 - 1bbl participate in the onset and/or promotion of adipocytes / macrophage - induced inflammatory responses . In order to see whether 4 - 1bb on adipocytes or 4 - 1bbl on macrophages was responsible for the inflammatory signals that triggered inflammatory responses, we stimulated the cells with agonists which bind specifically to either 4 - 1bb or 4 - 1bbl . We found, for the first time, that stimulation of 4 - 1bb on adipocytes markedly increased the release of inflammatory cytokines mcp-1, tnf-, and il-6 . Stimulation of 4 - 1bbl - mediated reverse signaling, which is known to activate macrophages, also increased levels of inflammatory cytokines . Recent evidence indicates that 4 - 1bb signaling results in activation of the mapk / nf-b pathway, which is tnf receptor - associated factor (traf)-2-dependent in lymphocytes . In adipocytes, we found that stimulation of 4 - 1bb activated p38 mapk, jnk, ikk and induced ib protein degradation . On the other hand, stimulation of 4 - 1bbl led to activation of inflammatory signaling molecules such as akt and p38 mapk in macrophages, which is consistent with previous studies [10, 20, 21]. More importantly, we found that treatment with a 4 - 1bbl neutralizing antibody reduced release of inflammatory cytokines in cocultures at both the mrna and protein level . These findings together suggest that the 4 - 1bb/4 - 1bbl - mediated interaction between adipocytes and macrophages triggers bidirectional inflammatory signaling and is a potent inducer of inflammatory responses in obese adipose tissue (figure 5). Interestingly, disruption of the 4 - 1bb/4 - 1bbl interaction did not completely suppress release of inflammatory cytokines from cocultured adipocytes and macrophages . This may be due to the presence of other cell surface molecules which participate in cell - cell interactions and mediate inflammatory responses . Indeed, adipocytes and macrophages express many inflammatory receptors and ligands on their surfaces [6, 25, 26]. For example, cd40 and herpes virus entry mediator (hvem), which are expressed on adipocytes, are considered to be mediators of contact - dependent signaling of macrophages, and ablation of these receptors reduces obesity - induced inflammatory responses [2630]. Thus it is conceivable that other receptors and ligands in addition to 4 - 1bb and 4 - 1bbl are also involved in the interaction between adipocytes and macrophages that leads to the initiation and maintenance of inflammatory responses . In conclusion, we have demonstrated for the first time that the contact - dependent interaction between adipocytes and macrophages mediated by 4 - 1bb and 4 - 1bbl, which generates bidirectional signals, plays a crucial role in the release of adipose inflammatory cytokines from these cells . 4 - 1bb and 4 - 1bbl, along with other molecules involved in cell - cell interaction between adipocytes and macrophages, may be valuable targets for preventing obesity - induced adipose inflammation.
Since the introduction of the implantable cardioverter defibrillators (icd) in 1980, they have been instrumental in the health and safety of patients who are at increased risk of sudden death by ventricular tachycardia or fibrillation [1, 2]. The purpose of an icd is to prevent such events from occurring by sensing the rhythm of the patient s heart and delivering a measured shock if aberrant rhythms occur . Consensus on the perioperative management of cardiovascular implantable electronic devices has suggested that certain surgical interventions (including transurethral resection of the prostate [turp]) may interfere with the sensing capability of the device, thereby resulting in unforeseen adverse outcomes . In addition, the american society of anesthesiologists (asa) has recommended deactivation of the icd to an asynchronous mode prior to most surgical interventions [3, 4]. The following presents the first case reports in which an icd was not deactivated prior to greenlight 180-w xps laser - guided turp . This study was approved by cleveland clinic institutional board . A 59-year - old man with a past medical history of hypertension, hyperlipidemia, and coronary artery disease (previous myocardial infarction 2008) presented for an elective greenlight laser xps (ams world headquarters 10700 bren road west, minnetonka, mn 55343, usa) prostatectomy in january 2012 due to obstructive benign prostatic hyperplasia (bph). Past surgical history was significant for five - vessel coronary artery bypass graft (2008) after the myocardial infarction, required temporary intra - aortic balloon pump post bypass and subsequent icd (guidant e102 teligen 100, boston scientific, 4100 hamline ave n st paul, mn, 55122, usa) implantation for low ejection fraction . Previous surgery also included coronary endarterectomy along with bilateral iliac artery stenting (2009) and right lower extremity stent placed (2011). Medications at the time included clopidogrel 75 mg (held for five days prior to surgery) and aspirin 325 mg (held for seven days prior to surgery). Preoperative electrocardiogram (ecg) showed complete left bundle branch block . Cardiac evaluation led to cardiac catheterization, which revealed mild diffuse disease in the left anterior descending and left main coronary arteries, severe diffuse disease in the circumflex coronary artery, and complex 100 percent proximal lesion in the right coronary artery . Saphenous vein graft to the 1 diagonal was totally occluded, but all other vein grafts were widely patent . After review of these findings and icd evaluation the patient was determined to be optimized and medically cleared for surgery . As per electrophysiology service (eps) recommendation, the icd was intentionally not deactivated prior to the laser turp procedure . Standard asa monitors, a bis monitor, and axillary temperature were utilized throughout the procedure . Anesthesia was induced with intravenous midazolam, lidocaine, fentanyl and propofol, followed by placement of a size 5 supreme laryngeal mask airway (lma) without difficulty . Sevoflurane was administered as the inhalational agent with a 2:1 air / oxygen mix throughout the case with no neuromuscular blockade . The patient was warmed with an air - warming blanket during the procedure, which lasted two hours and thirty - five minutes . The case was concluded without complication or any icd activity noted, 1700 cc lactated ringer was administered, and an estimated blood loss was less than 100 cc . The lma was removed from the patient without difficulty at the conclusion of the surgical procedure . The patient was then transported to the post - anesthesia care unit (pacu) awake and alert, and in stable condition . He was discharged on post - operative day one in stable condition with planned icd follow up . Although post operative contact was attempted it was not achieved and patient was lost to follow up . A 63 year old man with past medical history significant for hypertension, congestive heart failure, and atrial fibrillation presented for an elective greenlight laser xps (ams world headquarters 10700 bren road west, minnetonka, mn 55343, usa) prostatectomy in may 2012 due to obstructive benign prostatic hyperplasia (bph). Past surgical history included repair of an ascending aortic aneurysm with subsequent complete heart block requiring dual chamber pacing in 1990, as well as aortic valve and root replacement with an aortic homograft in 2008 . Hisold icd was replaced by a new icd [guidant n119 cognis 100, boston scientific, 4100 hamline ave n st paul, mn, 55122, usa] in january 2010 . Current medications included lisinopril 5 mg (held on the day of surgery), sotalol 80 mg, and aspirin 325 mg daily (held for five days prior to surgery). A preoperative transthoracic echocardiogram was performed and reported an ejection fraction of 55% with severe left atrial enlargement, moderate tricuspid valve regurgitation, and mild pulmonary hypertension (40 mmhg). After examination of these findings and icd evaluation the patient was deemed optimized and cleared for surgery . As per eps recommendation, a 20-gauge peripheral iv was placed prior to induction of general anesthesia with standard asa monitors . Anesthesia was induced after intravenous midazolam, fentanyl, and lidocaine, with propofol followed by rocuronium for muscle relaxation . Sevoflurane was used as the inhalational agent with a 1:1 air / oxygen mixture throughout the case . The patient was warmed with an air - warming blanket during the 104 minute procedure . The case was concluded without complication or any icd activity noted, 800 cc of lactated ringer administered, and with an estimated blood loss less than 50 cc . The patient was extubated without difficulty upon emergence and was transported to the pacu awake and alert in stable condition . Upon meeting criteria for pacu discharge, no episodes of ventricular arrhythmia were noted and three episodes of non - sustained ventricular tachycardia were reported . There were 10 total episodes of mode switch noted since last evaluation which was done about 2 months prior to the surgery . Many complications have been documented in various fields of surgery regarding adverse consequences of failing to set an icd to an asynchronous mode [5, 6]. With icd sensing, the pacemaker portion is generally set to sense the intrinsic rhythm of the patient s heart . If an icd senses any change in rhythm that may harm the patient, it analyzes the rhythm, and potentially delivers a direct cardioversion shock . However, the icd might mistake a stimulus from an outside electric source as an aberrant rhythm and cause unnecessary firing, which could lead to surgical delay or cancellation, extended hospitalization stay, re - admission for device management, and increased medical cost . Unipolar electrocautery is known to be the most common cause of electromagnetic interference (emi), and can cause events such as complete pulse generator failure or asystole in a patient completely reliant on the device [8, 9]. It is therefore important that anesthesiologists understand the rationale for, and the perioperative management of, an icd . Guidelines clearly state that anti - arrhythmia functions should be suspended prior to most surgical procedures . The pacemaker component of the icd should be switched to voo, doo, or vvi mode when a large amount of interference is expected . This mode switch re - programs the icd so that it no longer senses the electrical signal from the heart, but rather paces the heart at a set rate . The disadvantage of this approach is that it may lead to the loss of av synchrony . If not, pacemaker mediated tachycardia can happen in a cardiac dual chamber pacing device in atrial tracking mode . As with pacemakers, verification with the manufacturer is the only way to be certain what the response to magnet placement would be [4, 10, 11]. Turp is regarded as the gold standard for surgical treatment in patients with bladder outlet obstruction secondary to bph . However, despite its favorable short - term and long - term results, turp - associated side effects include severe bleeding necessitating blood transfusion, and the risk of bladder irrigating fluid absorption (turp syndrome). Moreover, the use of electrocautery in turp is often cited as a source of icd interference [3, 4]. Thus for a patient undergoing a turp procedure using electrocautery, failure to comply with icd guidelines may result in unintended complications [13, 14]. To reduce perioperative turp morbidity, numerous new laser techniques have been introduced into clinical practice . Potassium titanyl phosphate (ktp) laser (or greenlight laser, named for the wavelength of light it emits) is a laser technique with promising results and potentially decreased perioperative complications compared to classic monopolar turp . Greenlight laser is reported to provide results equivalent to those of standard monopolar turp while decreasing duration of urinary catheterization and hospital stay, to cite two of several adverse events [15, 16]. Laser turp has been suggested as a safer procedure to perform if there are cardiovascular concerns . This focuses on patients receiving anticoagulation to not need an interruption of anticoagulation for the surgical procedure, less potential of fluid absorption leading to turp syndrome, and it minimizes blood loss [17, 18]. A list of all the published medical literature of cardiovascular implantable electronic devices and emi interactions is available in the 2011 heart rhythm consensus statement on perioperative management of icds . A list of known procedures and devices which cause emi is shown in table 1 . A list of medical procedures and devices that can cause electromagnetic interference laser surgery has not been documented as, nor is it expected to be, a source of emi in patients with icds . A recent in - vitro study showed that emi emitted from widely used ophthalmic lasers does not lead to oversensing, inappropriate therapy, or change in the programming of certain icds . An extensive literature search by the authors showed no proven icd interference with lasers used in medicine due to the theoretical lack of interference with icd and after consultation with eps, the icd in these patients were left in the activated state for the laser turp . Although there were no complications with this particular surgery, it is important to note that the risk of adverse events would have remained if electrocautery had been needed during the procedure . Laser technology is not a documented source of emi in patients with icds . With no current evidence that links lasers to icd malfunction, we proceeded, the first reported cases of patients with an activated icd undergoing laser turp without cardiac arrhythmia incident . These cases are clinically significant in that the icd was not deactivated; on the contrary, it was allowed to detect and treat lethal arrhythmias by direct rather than extrinsic cardioversion . A secondary benefit of leaving an icd activated throughout the procedure is that it would likely prevent operating room delays that might result from alternately deactivating and reactivating the icd perioperatively with increasing numbers of patients with icds undergoing many different laser surgical procedures, further studies are warranted to analyze in depth the effects of laser therapy on icd function.
A 5-year - old male patient of 111 cm and 19 kg, who experienced an osteosarcoma in the left fibula was to go undergo insertion of a totally implantable central venous access device for chemotherapy . Hence, the patient was admitted for surgery for the removal of the infected catheter and for left totally implantable subclavian central venous catheterization . The patient underwent numerous chemotherapy treatments (cddp, adriamycin, methotrexate, ifofamide, vp-16). He had been on antibiotics for over 3 weeks due to an infection at the ticvad site . In the blood test before surgery, the platelet level had decreased to 64,000/mm . While the patient was on the or table, a very severe infectious ulcer and abscess of 5 cm in diameter was observable to the human eye on the skin and the tissue below the skin at the right ticvad site . On the operating table, the ekg, pulse oximeter, and a noninvasive blood pressure cuff were attached . The measured systolic / diastolic blood pressure was 100/50 mmhg, and heart rate was 90 . Glycopyrrolate (0.06 mg) and thiopental (100 mg) were administered to induce loss of consciousness . After adequate muscle relaxation, a noncuffed endotracheal tube (i.d . 5.0 mm) was inserted . After endotracheal intubation, n2o and oxygen were used to maintain the inspired oxygenconcentration at 0.5 . Sevoflurane 1.5 - 3 vol% was used for anesthesia during manual ventilation . For the end - tidal co2 concentration to be 35 mmhg, the tidal volume and the respiratory rate were controlled . The thoracic surgeon used a 21 g. introducer needle to puncture the left subclavian vein . For this procedure, we reduced the manual ventilation to prevent the occurrence of pneumothorax . When the left vessel was punctured, the beat of the arterial blood was not found in the small amount of aspired blood . So the blood was assumed to be venous . While inserting a guide wire and a 6.5 fr . Afterwards, puncture of the left subclavian vein was attempted again, but the introducer needle was removed after repeated arterial puncture, and pressure was applied for hemostasis . Venous puncture was attempted 2 or 3 times, but it failed . Then puncture of the left internal jugular vein, the puncture of the left femoral vein was attempted successfully . A 6 fr . Ticvad (x - port bard access systems, usa) was inserted . During the venous puncture so a plasma expander (hes - plazma6%, choongwae, korea) 200 ml was infused . During the central venous catheterization, curettage of the tissue near the infection was performed, and then the site was closed, ending the surgery . After the surgery, the patient was completely awake, could open his eyes, and move his arms and legs . A vasopressor, ephedrine 2.5 mg and packed rbc 1u were administered . Then the arterial hematocrit rose to 28% . Because of a continuous drop in blood pressure (60 - 90/30 - 40 mmhg) and acute acidemia, dopamine hcl (dopamine free mix 80 mg, cj, korea 10 - 20 g / kg / min) was continuously administered, and bicarbonate was intermittently administered . Then midazolam (1 mg)and rocuronium (5 mg) were administered . In the first chest x - ray (fig . Immediately, the thoracic surgeon inserted a chest tube and 500 ml of blood was drained . Packed rbc were continuously administered, which helped maintain the arterial hematocrit level at 33 - 35% . Continuous low blood pressure (60 - 90/30 - 40 mmhg) and tachycardia (140 - 150 bpm) were observed . Mmol / l) were found, so bicarbonate, calcium gluconate, and diuretics were intermittently administered . Midazolam and vecuronium were used for maintaining anesthesia . When 3u of packed rbc were administered, the airway pressure started to slowly increase . When 24 - 26 cm h2o was measured, the tidal volume was decreased and the respiratory rate was increased . In a retaken chest x - ray (fig . 2), a large amount of blood had not been drained from the right chest area, so a second tube was inserted in the chest . Afterwards, over 2,000 ml of blood was drained . Using a stethoscope, we found that the left pulmonary sound was reduced . 3), the right hemothorax was almost all gone, but a pneumothorax on the left - side was discovered . Thus, a third chest tube was inserted . However, the first and second chest tubes on the right - side continuously drained blood, and the blood pressure was not maintainable at 40 - 70 mmhg/20 - 40 mmhg . So, after discussions with the thoracic surgeon, a median sternotomy was done for hemostasis . A mid - surgery increase in hemorrhaging was predicted, so an 18 g intravenous catheter was inserted into the right external jugular vein . The drop in blood pressure could not be corrected, so a large amount of epinephrine 0.5 - 1.0 g / kg / min was continuously administered . Epinephrine (10 - 100 g), bicarbonate, calcium gluconate, and diuretics were intermittently administered . In the sternotomy, damage to the main blood vessels (the subclavian vein, the subclavian artery, and the pulmonary artery and vein) was not discovered . However, a severe bulging of the parietal pleura in the upper portion of the right chest, a dissection between the parietal pleura and visceral pleura, and a hematoma between the 2 pleurae were observed (fig ., there was an abscess pocket, which burst and leaked abscess in mid - surgery . The patient was assumed to be in a septic state, so the pediatrician administered dexamethazone 5 mg . However, the patient continued to have low blood pressure . The thoracic surgeon could not find the exact hemorrhage site on the right - side of the chest . Because of the progression of the disseminated coagulation disorder, it was deemed not viable to continue with the surgery, so the surgery was ended . While closing up the patient's chest, 900 cc of blood was drained from the chest tube . Packed rbc and fresh frozen plasma 3u were administered . A continuous high concentration of epinephrine and dopamine, intermittent epinephrine, calcium gluconate, and bicarbonate were administered . In the or, the administered amount of fluid and blood amounted to packed rbc 10 u, fresh frozen plasma 3 u, and fluid 3,000 ml . After surgery, the patient was moved to the icu and connected to an ekg when bradycardia was observed . Atropine and epinephrine were administered, and blood pressure was reduced (60/30 mmhg). In the icu, blood continued to drain from the chest tube . So packed rbc were continuously administered, but the hematocrit level was 24% . Within 20 minutes of arriving at the icu, the patient experienced cardiac arrest . Thus, cardiopulmonary resuscitation was immediately performed . A cardiac beat and a measurable blood pressure however, 15 minutes later, cardiac arrest was again observed, so cardiopulmonary resuscitation was attempted . The use of a totally implantable central venous access port provides long - term central venous access and thus simplifies the administration of chemotherapy, parenteral nutrition, and the repeated collection of blood samples . In contrast to the percutaneous central venous catheterization, dilators and peel - away sheaths are used to insert the catheter . Two small skin incisions are required: one at the guide wire exit site and a second for the implantation of the port reservoir (4 cm). In most cases, catheterization is done in the subclavian vein, but it can be done in the internal jugular vein, the external jugular vein, and the common femoral vein . During subclavian venous catheterization, . Hemorrhage usually occurs as a result of the puncture of the subclavian artery, the pulmonary artery and other adjacent vessels such as the intercostal artery and the internal mammary artery . Moreover, such hemorrhages are easily concealed due to blood tracking in the pleural cavity . The artery is in an anatomically non - compressible location, which means that local pressure is ineffectual . In the present case, the first time, a vessel dilator was also inserted, which may have caused damage to the left subclavian artery and hemorrhage and triggered the hemothorax . However, this cannot explain why repeated x - rays showed no hemorrhage at all in the left chest - area and only found that the opposite side had a massive hemothorax . Hemothorax occurring from a subclavian venous cannulation can cause an acute loss of blood and circulatory collapse . In such cases, with the use of an angiogram, stent implantation or surgical treatment but then it becomes difficult to reach the hemorrhage site of the thoracic apex . In the case of our pediatric patient, the first chest tube was inserted in the lower part of the right thorax . So, a chest tube was inserted into the upper portion of the thorax and 2,000 ml of blood was drained . The amount of hemorrhaging did not decrease, so a median sternotomy was considered for hemostasis . However, a large amount of hemorrhaging and transfusion had caused a disseminated coagulation dysfunction and a platelet reduction . A definite diagnosis of right - side hemorrhage could not be made, so both sides of the thorax were checked during the median sternotomy . The cause of the hemothorax in our patient could not be found without an autopsy . Nevertheless, the authors attempted to find the cause by considering the events before and after the occurrence of the hemothorax and by weighing the information from other reported cases . Hemothorax is a common sequela of chest trauma, an underlying malignancy, a ruptured aortic aneurysm, and inadvertent vessel injury in a central venous cannulation or a tube thoracostomy . When hemothorax is noted without any obvious trauma, it is called spontaneous hemothorax or non - traumatic hemothorax . Causes implicated in the etiology of the spontaneous hemothorax include neoplasms, coagulation disorders, av malformations, ruptured aneurysms, endometriosis, and pulmonary vasculature malformations . A few cases of pseudoaneurysm of the subclavian artery, the internal mammary artery, the intercostal artery, the brachiocephalic trunk, the thyrocervical trunk and the innominate artery following subclavian vein catheterization attempts have been reported as the cause of spontaneous hemothorax . Some have reported internal mammary artery pseudoaneurysms that complicated severe chest wall infection in children . Therefore, anterior chest wall abscesses should be treated aggressively to prevent the transthoracic spread of an infection leading to vascular complications . In the present case, our patient had the subclavian venous port removed . Within a few minutes, a severe drop in blood pressure was noted . An inflammatory ulcer and an abscess at the insertion point of the port may have caused the vascular abnormalities in the thorax . Or the catheter itself may have caused mechanical irritation causing vascular abnormalities in the area . Also, in the process of removing the catheter, the rupture of the vascular abnormalities may have caused the hemothorax . During the sternotomy pseudoaneurysms in adjacent nearby vessels, such as the intercostal artery, the intermammary artery, or the brachiocephalic trunk could have ruptured and caused the hemothorax . The formation of pseudoaneurysms can be diagnosed on contrast angiography, contrast computed tomography, and pulmonary arterial angiography . Methods of treatment are endoscopic coagulation, angiographic embolization, surgical resection, or repair [7 - 9]. Pseudoaneurysm cannot be discovered from a simple thoracic x - ray, so a definite diagnosis could not be made . The median sternotomy showed the right upper pleural apex drooping to the lower part, where the acute infection was seen . Kim et al . Reported that spontaneous hemothorax is caused by a small vascular rupture of adhesions between the visceral pleura and parietal pleura, which is caused by pulmonary collapse from damage to vascular pulmonary bullae or other factors . Bleeding adhesions are identified as the cause of hemothorax in up to 53% cases of spontaneous hemopneumothorax . The adhesions are commonly found near the apex and can also be found near the aorta, the subclavian vessels, and the pericardium . Explanations for the substantial bleeding from these torn adhesions include absence of a tamponade effect, lung movement impeding clot formation, and defective muscle components in the vessel wall . For hemostasis in a pediatric patient, median sternotomy was performed, which led to us finding a severe bulging of the parietal pleura in the upper portion of the right chest, dissection between the parietal pleura and visceral pleura, and a large hematoma between the 2 pleurae . Considering that pneumothorax occurred on the left side and hemothorax on the right, it cannot be diagnosed as spontaneous hemopneumothorax . The cause of the pneumothorax on the opposite side may be from pulmonary penetration by the introducer needle or dilator . Or it could be from barotrauma caused by continuous elevation of air pressure due to the hemothorax or the infusion of a large amount of blood and fluid . Many authors have reported on ipsilateral hemothorax from a central venous catheterization . However, hemothorax on the opposite side has rarely been reported (0.4 - 0.7%). One case was reported where, during placement, the subclavian vein, the pleura, and the pulmonary tissue were punctured and the result was contralateral tension pneumo- and hemo - thorax . One case of acute contralateral hemothorax due to the puncture of the superior vena cava during the left subclavian vein cannulation for hemodialysis was reported . In the present case, when the central venous catheter was inserted on the left, the deep insertion of the dilator could have caused damage to either the subclavian vein or other vessels and caused a large hemothorax . However, the thoracic surgeon discovered during the sternotomy that there was no significant damage to the vessels . The reports of complications after the removal of a central venous catheter are rare, and hemothorax after the removal of central venous catheter is also very rare . A case of massive hemothorax developing a few minutes after the removal of a central venous catheter was reported in a patient who had an arteriovenous fistula for hemodialysis on the same side as the arm arteriovenous fistula . The investigators recommended avoiding positioning the central catheter on the same side as an arm arteriovenous fistula . They emphasized that it was necessary to monitor patients after the removal of the subclavian vein catheter to detect this potentially fatal complication . Some postulated that it was likely that damage to the arterial adventitia had occurred during catheter insertion or use, which was not apparent as long as the catheter had remained in situ because of the " tamponading " effect by the catheter on the damaged artery . Only upon removal of the catheter and release of the " tamponade " does the integrity of the arterial wall fail, resulting in formation of an aneurysm . Such damage to the adventitia is not apparent at the time of the implantation because the arterial lumen is not entered . It can occur either from grazing of the artery by the implantation needle or guide wire, or from rubbing of the catheter on the arterial adventitia during its use . To date, reports on hemothorax are rare when a central venous catheter is removed from a child . We found just one precedent, a 2 year old male patient who had a serious hemothorax when the central venous catheter was removed from the right jugular vein . Complications with central venous cannulation must be looked for, and a routine chest x - ray must be performed . It is interesting that complications after the removal of central venous catheters are infrequently, if ever reported . When fusing medical knowledge of reported cases with the physical condition of our patient, we came up with the following list of possible causes of the hemothorax . (1) a complication from the left subclavian venous catheter puncture . In other words, when the left subclavian vein was punctured, the right subclavian vein or other blood vessels could have been damaged . However, there was no damage of the right vessels found in the sternotomy, so this possibility is not likely . (2) the hemothorax might have occurred from a torn vessel located in the dissection between the right parietal and visceral pleurae . (3) the hemothorax could have been caused after the removal of the infected right subclavian venous catheter . A great amount of blood may have flown from the subclavian vein where the subclavian venous catheter was removed . But we did not find serious hemorrhaging near the right subclavian vein during the sternotomy . (4) given that we found a lot of blood between right parietal pleura and viscerial pleura during the sternotomy, the parietal pleura drooped to a lower portion, and an abscess pocket developed in the right thorax, it is possible that a pseudoaneurysm near the blood vessels could have formed . In the process of removing the infected subclavian venous catheter, drainage near the pseudoaneurysm the most likely possibility of vascular findings are intercostal arterial- and internal mammary pseudoaneurysms . However, during the sternotomy, the pseudoaneurysm had already ruptured . Because the patient experienced septicemia and disseminated coagulation dysfunction, his thoracic region experienced hemorrhaging . Therefore, the exact location of the hemorrhage could not be found . Nevertheless, since a simple surgery such as a ticvad catheterization can lead to critical conditions or even death, we emphasize the dangers and complications of central venous catheterization in the field of anesthesia . Hence, we emphasize the great value patient observations . In both the insertion and the removal of the catheter, serious complications can occur . When an infected central venous catheter is removed, because the adjacent blood vessels can have complications, careful patient observation is always required.
One of the fundamental aims of surgery is to return postoperative patients to their home environment in a safe, timely fashion . Day surgery is the admission of select patients to hospital for a planned surgical procedure after which they return home the same day . The economic slowdown has had a major affect on healthcare, and budgetary constraints have been implemented internationally . Pressure from government bodies and insurance companies to attain an economic utilization of medical resources is forcing us to scrutinize the cost effectiveness of the services we are providing . Coupled with the fact that the patient population is aging, there is an urgency to reduce costs and continue to provide high - quality service to our patients . The transition of inpatient surgery towards day - case or ambulatory surgery is seen as an effective strategy to reduce costs . Day - case laparoscopic cholecystectomy has been shown to be safe in healthy patients with symptomatic gallstones and in those with minimal systemic disease, living within close proximity to the hospital . There is also evidence that laparoscopic inguinal hernia repair can be performed safely as a day - case procedure . Since the advent of day surgery, the definition of an acceptable day surgery patient has changed, and strictly held criteria for suitability have been relaxed . The question has now become, is there any reason why this patient should not be treated as a day case?, but for day - case laparoscopic surgery to be successful, patient selection is of the utmost importance . Factors that lead to overstay and readmission need to be identified at an early stage for day surgical units to be successful . This study aims to assess the feasibility of day - case laparoscopic nissen fundoplication and to identify factors that may lead to readmission and overstay . Readmission is defined as admission of a patient to the hospital due to a postoperative complication following discharge after day - case surgery, while overstay is defined as a patient having to stay longer than the planned duration in the hospital . This study was performed on a cohort of 72 patients who underwent day - case laparoscopic nissen fundoplication over 4 years (2006 to 2010). Surgery was performed after the patients were assessed, according to set protocols in a fully functional self - contained dedicated day ward that was introduced in 2005 in our institution . As a result, patients were seen in the outpatient clinic, and after making a decision about surgery, they were consented for the procedure by the team . Following this, patients were sent directly for preassessment at which time the suitability of the patient for day surgery was assessed . In the preassessment clinics, each patient was asked to fill out a standardized patient questionnaire to screen for medical and social problems . This questionnaire was aimed at highlighting factors that increase the risk of major anesthetic and operative complications, and concentrated on medical comorbidities, including obesity, and social circumstances . American society of anesthesiologists (asa) classification was relied on to quantify patients' anesthetic risk . Class i, ii, and iii patients were deemed to be suitable for day - case surgery . There were no absolute upper limits on age or body mass index (bmi) for safe delivery of anesthesia on a day - case basis, although each patient was judged on an individual basis . Social factors rarely had an impact on the decision to provide this procedure as a day case . Patient information leaflets were provided, which contained both general day surgery information and information specific to the proposed operation . On arrival at the day unit on the prearranged day of operation, all documentation was completed and available . Any change of circumstance, either social or medical, was noted from the time of preassessment, and the preoperative surgical team visit was brief, because the main task was to verify consent and answer any questions the patient may have had . Analgesia was delivered using 100-mg diclofenac sodium per rectum as a preemptive medication given 1 hour before induction of anesthesia, which was augmented by fentanyl (10 to 20mcg / kg) at induction (unless contraindicated). These criteria included hemodynamic stability, postoperative voiding of urine, adequate pain control, control of postoperative nausea or vomiting, and the ability to mobilize safely . Before returning home all day - case patients were required to have a responsible adult to facilitate postoperative recovery at home . They were further advised to contact the hospital or their general practitioner if they had any concerns . Patient age, social circumstances, and other demographics were recorded, as well as any comorbidities and american society of anesthesiologists (asa) score . Reasons documented for overstay and readmission were recorded as were durations of overstay and readmission . Initially 86 patients were identified from the laparoscopic nissen fundoplication database maintained in our institution . Fourteen (16.27%) patients were excluded, because they were converted to open, or deemed unsuitable for day - case surgery at preassessment (figure 1). Over the 4-year study period, 72 (83.72%) patients underwent day - case laparoscopic fundoplication . These were patients> 16 and <70 years of age, asa i- asa iii, who were deemed fit for elective day - case primary laparoscopic nissen fundoplication . The results show that the patients included in this study were between the ages of 20 and 63 years . According to asa scoring they were graded between asa i and asa iii with the maximum number of patients classified as asa ii (n=39, 54.16%). Only 5 patients (6.94%) following the procedure required admission to the hospital immediately or were readmitted within 30 days . Ci 95%), for readmission and 5.55% (n=4) (p=.05, ci 95%) for overstay . Postoperative pain (n=2), urinary retention (n=1), and technically difficult dissection (n=1) were the major causes for overstay . Persistent vomiting (n=1) in a young woman with a background history of psychiatric illness was the cause for readmission in the single case . When considering the impact of asa classification on readmission and overstay, we found that 4 patients who required admission following day - case laparoscopic surgery were classified as asa ii (1 patient) or asa iii (3 patients) preoperatively by an anesthetic registrar or consultant . Only 6 of 72 (8.33%) patients were classified as asa iii, and 50% (3/6) were readmitted or overstayed (figure 2). The maximum number of days spent in hospital as a result of readmission / overstay was 4 days . The impact of age on readmission and overstay is shown in figure 3 and shows a higher rate of readmission and overstay in older patients . Our readmission rate was 1.38%, and our overstay rate was 5.5%, which is in line with royal college of surgeons england guidelines . There has been a recent wave of enthusiasm amongst many general surgeons for laparoscopic surgical techniques to be utilized for a larger number of common surgical conditions following the success of cholecystectomy performed laparoscopically . The reported advantages of the laparoscopic approach over the conventional open method include reduced postoperative pain, shorter hospital stay, and rapid return to full activity with minimal discomfort . The conduct of surgical procedures on a day - stay basis has occurred for some time, and the approach has accelerated in the past few decades . Day surgery now comprises over 70% of all elective surgery in the united kingdom, over 80% in the united states, and is likely to become the default method of treating most surgical patients in the next 2 decades . Therefore, more needs to be done to establish safe, efficient day - surgery units so that ambulatory surgery can be exploited to its full potential . There are many potential benefits to providing surgical procedures as a day case and these include: patients receive treatment that is suited to their needs and allows them to recover in their own home;cancellation of surgery due to emergency pressures is unlikely in a dedicated day - case unit;risk of hospital - acquired infection is reduced;inpatient beds are released for major surgical cases;junior clinicians may be released if there is an effective, nurse - led preassessment service overseen by a clinical lead (ideally, an anesthetist);reduced waiting lists . Patients receive treatment that is suited to their needs and allows them to recover in their own home; cancellation of surgery due to emergency pressures is unlikely in a dedicated day - case unit; risk of hospital - acquired infection is reduced; inpatient beds are released for major surgical cases; junior clinicians may be released if there is an effective, nurse - led preassessment service overseen by a clinical lead (ideally, an anesthetist); reduced waiting lists . A multitude of studies have shown that certain surgical procedures, such as inguinal hernia repair, sfj ligation, varicose vein surgery, and laparoscopic cholecystectomy can be delivered safely on a day case basis . However, for day - case surgery to be successful and cost effective, the royal college of surgeons in england recommends a readmission rate not to exceed 2% to 3% for any surgical day case . Therefore, preassessment and identification of patient factors that may lead to overstay and readmission is an essential and fundamental component of providing day - case surgery . This process starts at the time of surgical consultation, where a decision is made for the surgical procedure to be undertaken, and it is the responsibility of the surgeon assessing the patient to highlight any potential problems at this stage . The preassessment clinic follows on from this and should be run by suitably trained nursing staff, with leadership provided by a clinical lead usually from the anesthesia department, because they must develop guidelines for patient screening that are accepted by their anesthesia colleagues . Availability of appropriate investigations as well as a system for dealing with problem identified by the nursing staff must be in place to ensure that problems are highlighted and dealt with quickly and efficiently . Preoperative assessment also provides an opportunity to educate patients and their caregivers regarding the procedure they will be undertaking and the expected postoperative course . Identification of patient factors that lead to overstay and readmission can be difficult, and one cannot say that day - case surgery is not suitable for a patient based on one variable alone such as age . One can suggest factors that may predispose a patient to overstay or to be readmitted so that practical recommendations can be developed . There are several studies that have looked at this area and have suggested general selection criteria for a specific procedure . An extensive, well - designed cochrane metaanalysis studied day - case laparoscopic cholecystectomy and suggested that normal healthy individuals or those with mild systemic disease, who lived in close proximity to the hospital, and had the availability of a responsible adult to take care of them after discharge were suitable for a day case . Patients who had previous upper abdominal surgeries, those suspected to have common bile duct stones, and presenting with acute cholecystitis were not deemed suitable . A retrospective study of 312 day - case nasal procedures over a 17-month period examined patient demographic factors including, age, sex and ethnicity, and their impact on readmission rates and overstay frequency and duration . The authors concluded that suitable candidates for day - case ent surgery included healthy individuals between the ages of 20 and 60 . In our study, we found that both increasing age and asa classification of ii or iii were the 2 factors that predisposed a patient to increased risk of readmission or overstay . With regards to asa classification it was also shown that increasing age correlated with increasing rates of overstay and readmission . Reasons for overstay were postoperative nausea and vomiting, difficult dissection, and urinary retention . Due to increasing age and comorbidities, one would expect that urinary retention would be more common and this is confirmed . It must be stressed that a consultant anesthetist with an interest in day - case anesthesia is of paramount importance . Good day - case anesthetic management is underpinned by fundamental principles including patient safety as the main priority (as for inpatient anaesthesia),optimal conditions for the surgeon, rapid patient recovery, good postoperative analgesia, minimal nausea and vomiting . Patient safety as the main priority (as for inpatient anaesthesia), optimal conditions for the surgeon, rapid patient recovery, good postoperative analgesia, minimal nausea and vomiting . A well - delivered general anesthetic with good postoperative analgesia and a low incidence of postoperative nausea and vomiting (ponv) is essential to reduce the incidence of overstay due to anesthetic complications . Pain management during anesthesia is based on a concept of multimodal analgesia, which is a combination of 2 or more analgesic agents or analgesic techniques to minimize side effects . A common strategy is to use an nsaid or short - acting opioid in combination with regional or local anesthesia . The administration of stronger opiates, such as morphine and pethidine, at this stage is to be avoided, because its longer - lasting effects may lead to unplanned overnight admission . Administration of analgesia in recovery and on the day ward before discharge should be given before breakthrough pain occurs and is based on the accurate measurement of pain by the patients themselves . Without social structure in place, even the healthiest patient undergoing surgery is not suitable for day - case surgery . Therefore organization of services into dedicated day units that are separate from acute / emergency surgical services and the use of integrated critical pathways is essential . This unit can be on a standalone site or can be integrated into an acute hospital as long as it is separate from the acute surgical services, because evidence shows that unplanned overnight admission rates dropped dramatically from 14% on an inpatient ward to 2.4% in a dedicated day unit . Ideally dedicated elective day case lists should be independent of inpatient surgery, but if this is not possible, day cases should be done first on the list to allow adequate time for postoperative monitoring and to allow adequate recovery time . Finally there are, of course, limitations to our study . Due to the nature of our study (cohort study), we cannot claim that care was standardized, even though there was a standard treatment plan in operation at our institution during this period . Surgical technique and use of local anesthetic was the same for all patients, unless there was a contraindication, but the operator was not always the same, because our institution is a teaching hospital and trainees would be involved in performing this procedure under supervision . Because anesthesia was delivered by different consultant anesthetists and anesthetic trainees, this is another aspect of care that was not standardized . It is also possible that a patient could have been readmitted to another hospital postoperatively, thus our readmission rate could be greater than reported . It would be extremely difficult to assess this, but there were no reports of admissions to other hospitals when the patients were followed up in clinic . As with any other retrospective study, missing charts and data will have some impact on our figures, but this was minimal as documentation was generally complete . Meticulous preassessment by using set protocols and guidelines to identify risk factors for overstay and readmission is a fundamental component of delivery of ambulatory day surgery accompanied by excellent day - case anesthetic management . The authors conclude that asa score of iii and increasing age correlate with an increasing incidence of overstay and readmission . Therefore, we would recommend the use of integrated pathways and advanced planning to reduce these rates.
Behavioral experiments show that elasmobranch fishes (sharks, skates, and rays) can detect changes in the geomagnetic field [13], and studies of migration [4, 5] give strong evidence that several species can navigate over long distances in environments where the geomagnetic field is the only plausible reference . Both direct magnetoreception and induction - based electroreception have been proposed as mechanisms for this ability to orient to the geomagnetic field or the direct magnetoreception mechanism assumes the existence of magnetite - based magnetoreceptors whose primary function is to measure the geomagnetic field for the purposes of navigation . The locus or mode of transduction for this magnetic sense is still the subject of some debate (see, e.g., johnsen and lohmann and others [79]). The electrosensory mechanism [10, 11] proposes that the orientation to the geomagnetic field is primarily achieved by magnetic induction; movement through the geomagnetic field induces currents in the electrosensory system, that are then used to achieve a compass sense . Behavioral experiments by hodson and others using attached magnets have cast doubt on the electrosensory mechanism . Bar magnets, inserted into the nasal cavity of the short - tailed stringray, dasyatis brevicaudata, impaired ability to detect magnetic field gradients . A magnetic field that is stationary with respect to the electrosensory system should have no effect on a mechanism based on magnetic induction . As the body of a ray is flexible, other authors have suggested that movement of the body with respect to the magnet might have impaired an induction - based system . In this paper we begin with an analysis of induction - based mechanisms for magnetoreception and show directly how the amplitudes of electrosensory signals at harmonics of the vestibular signals can be used to achieve a compass sense . An analysis of the magnitudes of these harmonics shows that the signals could be detected by the elasmobranch electrosensory system . We then show, using a simplified body - flexing model of a swimming fish, that relative movement of an attached magnet would impair an induction - based mechanism, unless strict criteria are met . Without ocean current, the only motion through the geomagnetic field is caused by the fish . Charged particles in the electrosensory system experience forces due to motion (vh) through the geomagnetic field (b) and any local electric fields (e) within the electrosensory system . These lorentz forces fl are described by (1)fl = q(e+vhwb), where q is the charge on each charge carrier in the ampullae, and is the usual vector cross - product . Charges will move as a result of this force and this leads to induced electric fields (even if none were present before). An equilibrium is reached when these forces add to zero, that is, we use an earth frame with the y - axis along magnetic north . The components of the geomagnetic field in the earth frame are if the fish is swimming with a heading, a simple model assumes that its swimming follows a sinusiodal path and that the angle between the mean fish path and the head oscillates as sin(t), where is the oscillation frequency of the head during swimming, and is the angular head oscillation amplitude during swimming . The frequency is the vestibular frequency for the swimming motion . The angle between the head and geomagnetic north is then (4)=+sin(t). In the fish frame, the geomagnetic field appears rotated by an angle about the z axis: (5)bf = rz()b=(bysin(sin(t))bycos (sin(t))bz). The equilibrium electric field due to induction will then be (7)ef=(bzvyf0byvyfsin(+sin(t))), and the z - component of the electric field can be expanded to (8)ez=byvyfcos ()sin(sin(t)) byvyfcos (sin(t))sin(). The jacobi - anger expansion for e allows us to expand sin(sin(t)) and cos (sin(t)) as series expansions: (9)sin(sin(t))=2n=0j2n+1()sin((2n+1)t),cos (sin(t))=j0()+2n=1j2n()cos (2nt), where jn() are the bessel functions of the first kind: (10)jn()l=0(1)l22l+nl! (n+l)!2l+n . Applying the jacobi - anger expansion ((9)) to the expressions for the x - and z - components of (8) allows us to express the receptor electric field as a sum of sinusoidal functions, that is, (11)ex=bzvyf, (12)ez=byvyf[j0()sin+2j1()cos sin(t) + 2j2()sincos (2t) + 2j3()cos sin(3t)]. The z - component can be expressed as a sum of oscillating terms that are at integer multiples (harmonics) of the vestibular frequency: (13)ez = az0+azsin(t)+az2cos (2t)+, where the dc term, az, is byvyj0()sin, the amplitude of the frequency component at the vestibular frequency, az, is (14)az=2byvyfj1()cos, the amplitude of the second harmonic of the vestibular frequency, az, is (15)az2=2byvyfj2()sin, and the amplitude of the third harmonic of the vestibular frequency, az, is (16)az3=2byvyfj3()cos . There is a considerable body of work on the sensitivity of elasmobranch electric senses (see peters et al . For an overview). When the stimulus is applied as a voltage gradient in the water overlying the ampullae, the threshold for the most sensitive units is 100 vm . The work of kalmijn showed that external fields as small as 2 vm could induce orienting behavior in the smooth dogfish, mustelus canis . More recently, kajiura and holland found a median behavioral - response threshold for scalloped hammerhead sharks, sphyrna lewini, of 2.5 vm, and sandbar sharks, carcharhinus plumbeus, of 3.5 vm, and a minimum behavioral - response of 0.05 vm in both species . Peters et al . Concluded that angular swimming movements can induce stimuli that have a detection threshold of 0.1 vm . Tricas and new measured the frequency response of the afferent neurons in the round stingray, urolophus halleri, and showed that these are sensitive to frequencies between approximately 0.1 hz and 10 hz . Applying the typical parameters shown in table 1 to (14), (15), and (16) gives the amplitude of the electric fields at the first three harmonics of the vestibular frequency: (17)az023.4sin vm1,az12.1cos vm1,az21.53sin vm1,az30.13cos vm1 . Both the amplitudes at the first harmonic, a, and the second harmonic amplitudes, a, exceed the detection thresholds described above . As the electroreceptors are not sensitive to dc stimuli, a compass sense should not use the constant az term . Using the other harmonics, a compass direction can be found by comparing the amplitudes of the z - component of the electric field at the fundamental, a, and second harmonic, a, of the vestibular frequency . Choosing the z - component, the ratio, z, of these two amplitudes can be expressed in terms of the heading as (18)zaz2az=j2()j1()tan(). In particular, it is independent of the swimming speed \|v\| and the strength of the geomagnetic field . The factor j2()/j1() /4 depends on the swimming modulation amplitude . Figure 3 shows how the bessel functions ratio changes for different swimming modulation amplitudes,, between 0.05 and 0.5 radians . Figure 4 shows the harmonic amplitudes as a function of heading angle (radians) for the typical parameters shown in table 1 . Equation (18) clarifies how the compass sense, first suggested by kalmijn and refined by paulin, could be achieved using electrosensory signals at harmonics of the vestibular frequency . An advantage of this model is that it provides a plausible cognitive mechanism for long - distance magnetic navigation . Various models for navigation have been proposed (see e.g., walker et al .) Including the following of magnetic anomalies in the ocean floor . The induction - based compass sense described here could enable an animal to travel long distances in the same direction by holding a constant ratio of az to az . In addition, the animal needs simply change the phase of one component by 180 degrees to travel on the return journey . This mechanism is relatively simple from a cognitive standpoint as it avoids the requirement for complex a permanent magnet attached to a swimming elasmobranch, if not moving relative to the electrosensory system, will not create any induced electric field and should not interfere with an induction - based mechanism for magnetoreception . However experiments have shown that placement of a permanent magnet in the nasal cavity of a short - tailed stringray, dasyatis brevicaudata, does interfere with the ray's ability to sense magnetic field gradients . Following the treatment in the previous sections, we can estimate the upper limits on relative movement between the magnet and the sensory system before the signals would exceed those from movement through the geomagnetic field . A simple model of a flexing swimming fish (see figure 5), has a distance r between the electoreceptor and the magnet that varies as r / r0 1 (/6) as the angle of the magnet changes during the swimming cycle . Here r0 is the distance when the body is straight, and is an angular modulation amplitude for the flexing body . If we assume that for regular swimming motion = sint, then the relative velocity along the y - axis between the electroreceptor at point p and the magnet is (19)v=(013r02cos(t)sin(t)0). The magnetic field from the attached magnet will have the form (20)b=(b0sin(sin(t))b0cos (sin(t))0), and the z - component of the resulting electric equilibrium field in the electroreceptor is (21)ez=13\|b0r02cos (t)sin(sin(t))sin(t)\| . For small values of, we can use the approximation sin(sin(t)) sin(t) to get an expression for the z - component of the electric field, ez, induced by relative motion of the attached magnet: (22)ez13b0r03sin2(t)cos (t). At typical swimming parameters (= 2, r0 = 0.05 m) and assuming a small magnetic field (b0 = 0.02 t), then relative angular movements with an amplitude greater than 0.107 radians (6.0 degrees) will cause an interfering signal at the vestibular frequency of 1 microvolt per meter . This corresponds to a distance change between the magnet and the electroreceptor of 96.0 m during the swimming cycle . We have presented, in sections 2 and 4, a mechanism of induction - based magnetoreception based on measurements of electrosensory signals at harmonics of the vestibular frequency during swimming . Maintaining a constant swimming direction relative to the geomagnetic field could be accomplished by simply maintaining a constant electrosensory chord, consisting of different amplitudes at the harmonics of the vestibular frequency . The analysis of signal amplitudes for some typical parameter values described in section 3 shows that a magnetoreception mechanism based on measurements of induced electric fields at the harmonics of the vestibular frequency is plausible given the known detection thresholds for electroreceptor organs . The signals that are at harmonics of the vestibular frequency could be sensed by synchronous detection we have also shown in section 5 that a magnet placed in a flexible swimming fish would introduce strong signals at the vestibular frequency . Unless rigid criteria are met, these signals would interfere with an induction - based magnetoreception mechanism, and the experiments could not distinguish between induction and direct magnetoreception mechanisms . A simplified analysis showed that the body would have to be rigid enough to have no relative motion between the magnet and the electrosensory system within 100 m for this effect not to be present . As this criterion is unlikely to have been met in the previous experiments described by hodson and others, new experiments are needed to elucidate the sensory mechanism underlying magnetoreception in elasmobranch fishes . The analysis of section 5 provides some guidance for further experiments that might differentiate between the induction - based and direct magnetoreception mechanisms . As the magnetic field of a magnet drops off rapidly with distance, an attached magnet with field strength a few times greater than the geomagnetic field would still interfere with a nearby direct magnetoreceptor but be weak enough that induced electrosensory signals are below sensitivity limits (due to both the weaker magnetic field and the reduced flexion of tissues over short distances). For example, if an upper limit for the strength of the interfering electric field is chosen to be 0.01 microvolts per meter (this value is indicative only; any value well below the accepted thresholds for electrosensory sensitivity could be chosen) and the distance over which the magnetic field exceeds the geomagnetic field is measured to be 0.02 m, then at typical swimming oscillation frequencies (= 2) and assuming a small magnetic field (b0 = 0.0001 t), (22) shows that the induced electric field amplitude will be smaller than 0.01 vm if the relative angular movements have an amplitude less than 0.184 radians or 11.0 degrees . Experimental measurement of movement during swimming is required to confirm that relative angular movements exceeding 11.0 degrees do not occur between the magnet and the neighbouring tissues . If orientation behaviour is not affected by such carefully chosen magnets, then the region surrounding the magnet would be excluded as a possible locus for a direct magnetoreceptive mechanism . Sufficient experimental coverage of plausible locations with fixed magnets would either exclude the direct magnetoreception mechanism entirely or provide good evidence for the location of a direct magnetoreceptor.
Heart failure (hf), a terminal stage of multiple heart diseases, is a leading cause of death all over the world . It is estimated that hf contributed to 1 out of 9 deaths in the united states during 2009, and approximately 284 000 people died of hf in united states in 2013 . It is estimated that chronic heart failure (chf) treatment costs about 35 billion us dollars or 2% of the total uk national budget, and is an extremely heavy economic burden on the whole society . Currently, about 20 million people worldwide have hf . The morbidity of hf is predicted to sharply increase in the next few decades due to various risk factors such as hypertension, hypercholesterolemia, and diabetes mellitus . Traditional markers like brain natriuretic peptide (bnp) and n - terminal pro - brain natriuretic peptide (nt - probnp) are widely applied to diagnose or exclude hf, and they are ideal markers to predict prognosis of hf . However, these 2 markers are also significantly increased in other conditions, such as kidney failure and hepatic cirrhosis . Although left ventricle ejection fraction (lvef) is often used to evaluate cardiac function in hf patients, many may have normal lvefs . A lncrna called urothelial carcinoma - associated 1 (uca1) has generated great interest because it is abundantly expressed in the heart and plays critical roles in many diseases . Uca1 is highly expressed in human bladder cancer, and exerts a role in regulating cancer cell proliferation . It can promote migration and invasion of tumor cells in prostate cancer, gastric cancer, lung cancer, and hepatocellular carcinoma [811]. Recent research indicates that circulating uca1 can be used as a biomarker for myocardial infarction, suggesting that uca1 can be detected in the plasma . The purpose of this study was to determine plasma levels of uca1 in chf patients and controls to determine whether uca1 can be applied as an ideal marker for chf . In this study, we recruited 67 chf patients and 67 age- and sex - matched controls without chf from our hospital . Before experiments, every participant was informed and required to sign informed consent . Diagnosis of chf was made according to the criteria listed in the 2013 accf / aha guideline for the management of heart failure and the 2016 esc guidelines for the diagnosis and treatment of acute and chronic heart failure . Hf was characterized by typical clinical symptoms, such as breathlessness, fatigue, and ankle swelling, and may be accompanied by clinical signs like elevated jugular venous pressure, peripheral edema, and pulmonary crackles, which are caused by a structural and/or functional cardiac abnormality, leading to reduced cardiac output and/or elevated intracardiac pressures at rest or during stress . Patients were clinically stable and ranged from class ii to iv according to nyha class . Participants were excluded if they had: (i) severe infection; (ii) surgery within 1 year; (iii) cancers; (iv) liver or renal failure; (v) cerebral vascular events in 6 months; or (vi) heart assist devices . Controls were defined as the population without chf and none of the diseases mentioned above . Our study was approved by our hospital ethics committee and all procedures conformed to the declaration of helsinki . The primary endpoint was death related to cardiac diseases, including cardiac death, or death associated with heart failure, cardiac infarction, severe arrhythmia, hypertension, stroke, or cardiac rupture . About 5 ml of fresh fasting blood was drawn intravenously into ethylene diamine tetra - acetic acid (edta)-anticoagulant tubes . Rna from plasma was extracted by mirneasy serum / plasma kit (qiagen, german) according to the manufacturer s recommendation . The total rna was eluted in 10 ul of pre - heated nuclease - free water . The quality and quantity were determined using a nanodrop 2000 spectrophotometer (thermo scientific, usa). Reverse transcription (rt) and qrt - pcr were performed by use of the goscript reverse transcription system (promega, usa) and gotaq qpcr master mix (promega, usa) following the manufacturer s protocols in order to determine the quantity of uca1 expression in the plasma . Rt procedures were: 25c for 5 min, 42c for 1 h, 72c for 15 min, followed by storage at 4c . During the qrt - pcr, 1 ul of cdna was added and blended with 10 ul of sybr green i dye premix (promega, usa), 1 ul of specific forward and reverse primers (10um), and 8 ul of nuclease - free water, with a following procedure: 95c for 2 min, 40 cycles of 95c for 15 s, and 60c for 30 s, followed by 55c for 30 min forward primer of uca1 was: acgctaactggcaccttgtt, reverse primer of was uca1: tggggattactggggtaggg . Forward primer of was u6: gcttcggcagcacatatactaaaat, and reverse primer of u6 was: cgcttcacgaatttgcgtgtcat . The independent samples t test was used to analyze differences in quantitative parameters between 2 groups . Receiver operating characteristic curves (roc) and the area under roc curves (auc) were used to evaluate prognostic power of uca1 and bnp for chf . Thresholds of these markers in roc curves were demonstrated by maximums of youden indexes (youden index = specificity+sensitivity1). Sensitivities and specificities to responding maximum youden indexes were listed to indicate the best diagnostic power . In addition, kaplan - meier survival curves were used to evaluate survival rates of chf and controls after 1-year observation . The median concentration of uca1 and bnp was used to divide the chf and controls into high- and low - concentration groups . In this study, we recruited 67 chf patients and 67 age- and sex - matched controls without chf from our hospital . Before experiments, every participant was informed and required to sign informed consent . Diagnosis of chf was made according to the criteria listed in the 2013 accf / aha guideline for the management of heart failure and the 2016 esc guidelines for the diagnosis and treatment of acute and chronic heart failure . Hf was characterized by typical clinical symptoms, such as breathlessness, fatigue, and ankle swelling, and may be accompanied by clinical signs like elevated jugular venous pressure, peripheral edema, and pulmonary crackles, which are caused by a structural and/or functional cardiac abnormality, leading to reduced cardiac output and/or elevated intracardiac pressures at rest or during stress . Patients were clinically stable and ranged from class ii to iv according to nyha class . Participants were excluded if they had: (i) severe infection; (ii) surgery within 1 year; (iii) cancers; (iv) liver or renal failure; (v) cerebral vascular events in 6 months; or (vi) heart assist devices . Controls were defined as the population without chf and none of the diseases mentioned above . Our study was approved by our hospital ethics committee and all procedures conformed to the declaration of helsinki . The primary endpoint was death related to cardiac diseases, including cardiac death, or death associated with heart failure, cardiac infarction, severe arrhythmia, hypertension, stroke, or cardiac rupture . About 5 ml of fresh fasting blood was drawn intravenously into ethylene diamine tetra - acetic acid (edta)-anticoagulant tubes . Rna from plasma was extracted by mirneasy serum / plasma kit (qiagen, german) according to the manufacturer s recommendation . The total rna was eluted in 10 ul of pre - heated nuclease - free water . The quality and quantity were determined using a nanodrop 2000 spectrophotometer (thermo scientific, usa). Reverse transcription (rt) and qrt - pcr were performed by use of the goscript reverse transcription system (promega, usa) and gotaq qpcr master mix (promega, usa) following the manufacturer s protocols in order to determine the quantity of uca1 expression in the plasma . Rt procedures were: 25c for 5 min, 42c for 1 h, 72c for 15 min, followed by storage at 4c . During the qrt - pcr, 1 ul of cdna was added and blended with 10 ul of sybr green i dye premix (promega, usa), 1 ul of specific forward and reverse primers (10um), and 8 ul of nuclease - free water, with a following procedure: 95c for 2 min, 40 cycles of 95c for 15 s, and 60c for 30 s, followed by 55c for 30 min . Forward primer of uca1 was: acgctaactggcaccttgtt, reverse primer of was uca1: tggggattactggggtaggg . Forward primer of was u6: gcttcggcagcacatatactaaaat, and reverse primer of u6 was: cgcttcacgaatttgcgtgtcat . The independent samples t test was used to analyze differences in quantitative parameters between 2 groups . Receiver operating characteristic curves (roc) and the area under roc curves (auc) were used to evaluate prognostic power of uca1 and bnp for chf . Thresholds of these markers in roc curves were demonstrated by maximums of youden indexes (youden index = specificity+sensitivity1). Sensitivities and specificities to responding maximum youden indexes were listed to indicate the best diagnostic power . In addition, kaplan - meier survival curves were used to evaluate survival rates of chf and controls after 1-year observation . The median concentration of uca1 and bnp was used to divide the chf and controls into high- and low - concentration groups . In this study, 67 chf patients and 67 matched controls were enrolled to test relative uca1 concentration in the plasma . We found that there was no significant difference in age, sex, body mass index (bmi), total cholesterol (tc), total triglyceride (tg), low - density lipoprotein cholesterol (ldl - c), high - density lipoprotein cholesterol (hdl - c), uric acid (ua), alcohol and cigarette consumption, or proportions of diabetes mellitus and hypertension between these 2 groups (p>0.05). However, bnp and lvef were significantly different in the chf group compared with those in controls (p<0.05). Plasma uca1 in the chf group was much higher than in controls (p<0.05) (figure 1). Thus, we speculated that uca1 plays important roles in chf, or it could be synthesized and released into circulation when cardiomyocytes are damaged, killed, or stretched by the accumulated volume of blood during chf . Uca1 and bnp were positively correlated, with a correlation coefficient r of 0.6119 (p<0.0001) (figure 2a). Plasma uca1 was negatively correlated with lvef, with a correlation coefficient r of 0.3061 (p=0.0003) (figure 2b). Moreover, bnp and lvef were negatively correlated with each other, with a correlation coefficient r of 0.6830 (p<0.0001) (figure 2c). Roc analysis illustrated that the auc of uca1 was 0.89, and the sensitivity and specificity of uca1 to diagnose chf were 100% [95% ci (0.94641)] and 76.12% [95%ci (0.64140.8569)] (p<0.05), respectively (figure 3). The auc of bnp was 0.98, and the sensitivity and specificity of bnp to diagnose chf were 95.52% [95% ci (0.8747 to 0.9907)] and 95.52% [95%ci (0.8747 to 0.9907)] (p<0.05), respectively . However, the auc of the combination of uca1 and bnp was 0.98, showing that this combination caused no significant increase in the diagnostic power compared with bnp (p>0.05), suggesting that uca1 might be a good indicator to diagnose chf, but is not superior to bnp . We discovered that survival rates of chf patients and controls were 88.06% and 98.507%, respectively (p=0.0154) (figure 4a). However, survival rate of high uca1 in chf patients was 84.615% compared with the low uca1 group in chf with a survival rate of 97.143% (p=0.011) (figure 4b), suggesting that a high concentration of circulating uca1 is associated with poor prognosis in chf patients . In addition, although uca1 had a similar survival tendency with bnp, there was no significant difference between these 2 markers in predicting prognosis in chf patients (p=0.2779) (figure 4c). In this study, 67 chf patients and 67 matched controls were enrolled to test relative uca1 concentration in the plasma . We found that there was no significant difference in age, sex, body mass index (bmi), total cholesterol (tc), total triglyceride (tg), low - density lipoprotein cholesterol (ldl - c), high - density lipoprotein cholesterol (hdl - c), uric acid (ua), alcohol and cigarette consumption, or proportions of diabetes mellitus and hypertension between these 2 groups (p>0.05). However, bnp and lvef were significantly different in the chf group compared with those in controls (p<0.05). Plasma uca1 in the chf group was much higher than in controls (p<0.05) (figure 1). Thus, we speculated that uca1 plays important roles in chf, or it could be synthesized and released into circulation when cardiomyocytes are damaged, killed, or stretched by the accumulated volume of blood during chf . Uca1 and bnp were positively correlated, with a correlation coefficient r of 0.6119 (p<0.0001) (figure 2a). Plasma uca1 was negatively correlated with lvef, with a correlation coefficient r of 0.3061 (p=0.0003) (figure 2b). Moreover, bnp and lvef were negatively correlated with each other, with a correlation coefficient r of 0.6830 (p<0.0001) (figure 2c). Roc analysis illustrated that the auc of uca1 was 0.89, and the sensitivity and specificity of uca1 to diagnose chf were 100% [95% ci (0.94641)] and 76.12% [95%ci (0.64140.8569)] (p<0.05), respectively (figure 3). The auc of bnp was 0.98, and the sensitivity and specificity of bnp to diagnose chf were 95.52% [95% ci (0.8747 to 0.9907)] and 95.52% [95%ci (0.8747 to 0.9907)] (p<0.05), respectively . However, the auc of the combination of uca1 and bnp was 0.98, showing that this combination caused no significant increase in the diagnostic power compared with bnp (p>0.05), suggesting that uca1 might be a good indicator to diagnose chf, but is not superior to bnp . We discovered that survival rates of chf patients and controls were 88.06% and 98.507%, respectively (p=0.0154) (figure 4a). However, survival rate of high uca1 in chf patients was 84.615% compared with the low uca1 group in chf with a survival rate of 97.143% (p=0.011) (figure 4b), suggesting that a high concentration of circulating uca1 is associated with poor prognosis in chf patients . In addition, although uca1 had a similar survival tendency with bnp, there was no significant difference between these 2 markers in predicting prognosis in chf patients (p=0.2779) (figure 4c). Heart failure (hf) is one of the most severe diseases, leading to death all over the world . Currently, there are 20 million people suffering from hf globally . A 2015 study demonstrated that the 5-year survival rate of hf patients in china is approximately 34%, which is much lower than that of many cancers, such as breast cancer, bladder cancer, prostate cancer, colon and rectum cancer, and cervical cancer, with 5-year survival rates of 73.1%, 67.3%, 53.8%, 47.2%, and 45.4%, respectively . Overexpression of uca1 leads to cell proliferation, and depletion of uca1 suppresses the growth and aggressiveness of tumor cells [1619]. It is reported that uca1 is abundantly expressed in the heart, suggesting uca1 might play roles in maintaining heart functions . A study in 2015 indicated that uca1 in the plasma can be a good biomarker for acute myocardial infarction . However, uca1 has never been investigated in hf patients before . In this study, uca1 was found to be significantly elevated in the plasma from chf patients but not in controls, indicating that uca1 must play important roles in chf . Uca1 is notably decreased in cardiomyocytes from rats with ischemia reperfusion injury due to the inducement of hypoxia and hydrogen peroxide . Moreover, uca1 inhibits the expression of p27 and plays an anti - apoptosis role in cardiomyocytes . Thus, we presumed that uca1 might exert its role of anti - apoptosis in chf . Correlation analysis illustrated that uca1 was positively correlated with bnp and negatively associated with lvef, suggesting that a high level of uca1 is closely associated with poor heart function . Although it was not superior to the traditional hf marker bnp, high plasma uca1 highly suggests a poor prognosis for chf patients, which was similarly observed in patients with cancers in previous studies . However, there was no significant difference in prediction of prognosis of chf between uca1 and bnp, although they had similar survival tendencies . The results demonstrated that uca1 might be used as an ideal biomarker to predict the outcome of chf . Firstly, our sample size was small and our conclusions need further validation in larger populations . Secondly, although uca1 had a high sensitivity and specificity to diagnose chf, many cancers, like bladder and prostate cancer, could also elevate uca1 expression . Thus, when uca1 was used as a diagnostic marker for chf, other related diseases must be excluded . Additionally, qrt - pcr is the quickest and most convenient method to detect the concentration of uca1, but this technology is time - consuming; therefore, there is a great need for new time - saving technologies, such as microarrays and probes for lncrna detection . Lastly, the underlying mechanisms of uca1 in chf were not fully explored in our study . Since the functions of uca1 in hf are still largely unknown, we plan to further investigate the roles of uca1 related with chf in cardiomyocytes and hf mouse models . Our study is the first to demonstrate that plasma uca1 is higher in chf patients, and it might be an ideal indicator for chf.
Over the past 10 years or so, numerous molecules that can promote and/or inhibit axonal growth have been identified, and an emerging theme is that these molecules function by activating a limited number of signal transduction cascades in growth cones (tessier - lavigne and goodman, 1996; doherty et al ., 2000). Ncam, n - cadherin, and l1 are cell adhesion molecules (cams) * that promote axonal growth during development, and have a function in synaptic plasticity in the adult (walsh and doherty, 1997). Their ability to activate an fgf receptor signaling cascade in growth cones is required for, and sufficient to explain, their positive effects on growth cone motility (williams et al ., 1994a; saffell et al ., 1997). The proximal steps in the fgf receptor signal transduction cascade involve activation of phospholipase c to generate dag (hall et al ., 1996), with the subsequent hydrolysis of dag by an as yet uncharacterized dag lipase coupling the pathway to an axonal growth response by stimulating calcium influx into the growth cone through n- and l - type calcium channels (doherty et al ., 1991a, 1995; williams et al ., interestingly, under normal conditions, the calcium changes are not global, but instead are highly localized to the submembranous region of the growth cone (archer et al ., 1999; chadborn et al ., this is likely to be a very important feature of the pathway, as this type of highly localized change in calcium in growth cones is sufficient to induce the formation of new filopodia in vivo (lau et al ., 1999), and can also induce growth cone turning responses in vitro (zheng, 2000). A key role for dag lipase activity in the control of axonal growth and guidance in vivo has also been established (brittis et al ., 1996; lom et al ., 1998) interestingly, the ability of n - cadherin to directly interact with the fgfr has also been implicated in tumor cell metastasis (suyama et al ., 2002), and n - cadherin stimulated increases in tumor cell migration are also dependent on dag lipase activity (nieman et al ., 1999). The mechanism that couples the hydrolysis of dag to the calcium response in neurons is not known . The initial hydrolysis of dag at the sn-1 position (by dag lipase) will generate 2-arachidonylglycerol (2-ag), with the subsequent hydrolysis of 2-ag generating arachidonic acid . At first sight, arachidonic acid appeared to be the best candidate for the instructive signal for axonal growth in the cam / fgf receptor pathway, as the direct application of arachidonic acid to primary neurons fully mimics the neurite outgrowth response stimulated by fgf2 and the aforementioned cams (williams et al ., 1994a, 1994c). However, arachidonic acid can stimulate the accumulation of 2-ag in cells (ueda et al ., 2000), and this raises the possibility that it might be 2-ag that normally couples the fgf receptor signaling cascade to the calcium response . Interestingly, 2-ag is a ligand for the cb1 and cb2 cannabinoid receptors (di marzo et al ., 1998), and in some instances cannabinoid receptors have been shown to positively couple with calcium channels (okada et al ., 1992; sugiura et al ., 1996; rubovitch et al ., 2002). Based on these observations, we tested for cross - talk between the fgf receptor and endocannabinoid signaling systems . Now, we provide compelling evidence that signaling via the cb1 receptor is not only required for, but can also mediate, the neurite outgrowth response stimulated by n - cadherin and fgf2, and that it does so by coupling dag hydrolysis to a signaling cascade that depends upon calcium influx into neurons via both n- and l - type calcium channels . In the adult brain, cannabinoid receptor agonists released from postsynaptic neurons act as retrograde messengers to suppress neurotransmitter release from the presynaptic axon . The effect is largely mediated by the cb1 receptor, and involves the coupling of a pertussis toxin sensitive g protein to inhibition of calcium influx through n - type calcium channels (for review see wilson and nicoll, 2002). However, the cb1 receptor is also expressed in the embryonic nervous system (buckley et al ., 1998; berrendero et al ., 1999), and this suggests additional functions for the cb1 receptor during development . When postnatal cerebellar neurons are cultured over monolayers of transfected 3t3 cells that express physiological levels of n - cadherin, n - cadherin promotes neurite outgrowth via a mechanism that requires activation of a neuronal fgf receptor signal transduction cascade (williams et al ., 2001). Given the requirement of dag lipase activity for the axonal growth response, and considering that the hydrolysis of dag will generate the cb1 agonist 2-ag, we decided to test whether cb1 function was required for the n - cadherin response . In this context, there is ample evidence that cultured cerebellar neurons express the cb1 receptor on cell bodies and neurites (for review see nogueron et al ., 2001), and we have extended this observation to cerebellar growth cones (fig . Our results show that two independent cb1 antagonists (am 251 and am 281) completely inhibit the n - cadherin component of the neurite outgrowth response (fig . 2 a). If the cb1 antagonists are acting at a step downstream from the fgf receptor, they should also inhibit the neurite outgrowth response stimulated by fgf2 . 2 b shows a representative example of an experiment where various doses of am 251 were tested for their ability to inhibit the response stimulated by 5 ng / ml fgf2 . A substantial inhibition (80%) of the response can be seen at an am 251 concentration of 0.2 m, with a complete inhibition found at 1 m . A series of pooled experiments show that at 1 m, both am 251 and am 281 completely inhibit the fgf2 response (fig . In contrast, a specific cb2 receptor antagonist (am 630) had no effect on the fgf2 response (fig . Bdnf stimulates axonal growth by activating the trkb receptor tyrosine kinase, and as this response does not depend on the hydrolysis of dag (lom et al ., 1998), there is no obvious basis for postulating a role for the endocannabinoid signaling in the response . In agreement, am 251 and am 281 did not inhibit the neurite outgrowth response stimulated by bdnf (fig . Cerebellar neurons were cultured overnight in media containing 5 ng / ml fgf2 before being fixed and stained for the cb1 receptor (see materials and methods). The bar is 10 m relative to the larger image, and 5 m relative to the inset . (a) cerebellar neurons were cultured on 3t3 monolayers or n - cadherin expressing monolayers in control media or media supplemented with 1 m am 251 or am 281 as indicated . (b) cerebellar neurons were cultured over 3t3 cell monolayers in control media or media supplemented with 5 ng / ml fgf2 in the presence of increasing concentrations of am 251 as indicated . (c and d) cerebellar neurons were cultured over 3t3 monolayers in control media or media supplemented with 5 ng / ml fgf2 or 5 ng / ml bdnf in the presence of 1 m am 251, am 281, or am 630 as indicated . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . Next, we determined whether activation of the cb1 receptor could mimic the fgf2 response, and whether this requires fgf receptor function . When neurons were treated with 5 ng / ml fgf2 or 0.2 m of the cb1 agonist win 55,2122, there was a clear increase in neurite outgrowth with no obvious difference in the nature of the neuronal response stimulated by these agents (fig ., we found that three cb1 receptor agonists (win 55,2122, acea, and noladin ether [na]) stimulated neurite outgrowth in a dose - dependent manner with maximal responses found in the low m range (fig ., neurons treated with the cb1 agonists were not obviously different from those treated with fgf2 or n - cadherin . The responses to all three cb1 agonists were fully inhibited by am 251 and am 281 (fig . 4 b), confirming that they reflect activation of the cb1 receptor . A specific fgf receptor inhibitor (pd 173074) that fully inhibits the fgf2 and n - cadherin responses (skaper et al ., 2000; williams et al ., 2001) had no effect on the responses stimulated by all three cb1 agonists (fig . 4 b) direct application of arachidonic acid to primary neurons can also fully mimic the neurite outgrowth response stimulated by cams and fgf2 at a site downstream from fgf receptor activation, but upstream from calcium influx into growth cones (williams et al . The arachidonic acid response is also fully inhibited by the two cb1 receptor antagonists, demonstrating that arachidonic acid also acts upstream of the cb1 receptor, possibly by stimulating 2-ag synthesis in cells (unpublished data). Cerebellar neurons were cultured overnight on 3t3 cell monolayers in control media (a d) containing 5 ng / ml fgf2 (e h) or media containing 0.2 m win 55,2122 (i l) before being fixed and stained for gap-43 . (a) cerebellar neurons were cultured on 3t3 monolayers in control media or media supplemented with the given concentrations of three cb1 receptor agonists (win 55,2122, acea, and na) as indicated . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . The results are from a single representative experiment, and each value shows the percent increase in mean neurite length relative to control media . (b) cerebellar neurons were cultured on 3t3 monolayers in control media or media supplemented with 0.2 m win 55,2122 (win), 1 m acea, or 1 m na, as indicated . The experiments were done in control media and media supplemented with 500 nm pd 173074, 1 m am 251, or 1 m am 281 . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . The results are pooled from three independent experiments and show the percent increase in mean neurite length relative to control media . Dag hydrolysis couples the fgf receptor pathway to an axonal growth response by stimulating calcium influx into the growth cone through n- and l - type calcium channels (williams et al ., 1994b, 1994c; archer et al ., 1999; for review see doherty et al ., 2000). If endocannabinoid signaling mediates this response, then l- and n - type calcium channel antagonists should inhibit the response to the cb1 agonists, as these agents inhibit the fgf2 response from all tested neurons, including rat cerebellar granule cells (williams et al ., 1994b). To test this, we cultured neurons with the various cb1 receptor agonists in media further supplemented with an l - type calcium channel antagonist (diltiazem at 10 m), an n - type calcium channel antagonist (-conotoxin, 250 nm), or a combination of both . The cb1 agonists failed to elicit a neurite outgrowth response when n- and l - type calcium channels were simultaneously inhibited, and they only elicited small responses when individual channels were blocked (fig . 5). Thus, we can conclude that the cb1 agonists promote neurite outgrowth via a mechanism that requires calcium influx into neurons through n- and l - type calcium channels . Interestingly, the neurite outgrowth response stimulated by bdnf was completely unaffected by the calcium channel antagonists (fig . 5), and this further demonstrates that two receptor tyrosine kinases (the fgf receptor and trkb receptor) use different signal transduction cascades to couple to an axonal growth response in cerebellar neurons . Cerebellar neurons were cultured on 3t3 monolayers in control media or media supplemented with 0.2 m win 55,2122 (win), 1 m acea, 1 m na, or 5 ng / ml bdnf as indicated . The experiments were done in control media (sato supplemented with 2% fcs) or media further supplemented with 250 nm -conotoxin, and/or 10 m diltiazem as indicated . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . The results are pooled from three independent experiments and show the percent increase in mean neurite length relative to control media . Calcium influx into neurons might seem an unlikely mechanism for the cb1 agonist driven neurite outgrowth response, given the paucity of data in the literature reporting positive effects of cannabinoid agonists on calcium levels in cells . However, it should be noted that under normal conditions, the calcium changes induced by cams and fgf2 are not detectable by conventional imaging, as they are highly localized to the submembranous region of the growth cone (archer et al . Furthermore, the notion that cannabinoid receptor activation can have positive effects on calcium influx is not without precedence, as it has been shown that the cb1 receptor can positively modulate l - type calcium channels in a neuronal cell line (sugiura et al ., 1996; rubovitch et al ., in addition, low concentrations of the natural cannabinoid receptor agonist -thc enhance k induced increases in calcium levels in cells (okada et al ., 1992). The stimulation of calcium influx into cells by cannabinoid receptor agonists is insensitive to pertussis toxin (sugiura et al ., 1996; rubovitch et al ., 2002), with the available evidence suggesting that it might be mediated by the now well - established stimulatory effects of cannabinoids on adenylate cyclase (glass and felder, 1997; felder et al ., 1998; calandra et al ., 1999; ishii and chun, 2002). Interestingly, we have found that pertussis toxin does not inhibit the cannabinoid agonist responses reported in this study (unpublished data). Biphasic responses to cannabinoids have been noted in biochemical, physiological, and behavioral studies (okada et al ., 1992; the data have been interpreted as evidence for the concomitant activation of two parallel pathways by the activated cb1 receptor, namely a stimulatory pertussis toxin an analogous situation might explain the biphasic nature of the neurite outgrowth response to fgf2 and arachidonic acid, and the fact that in some circumstances activation of the fgf receptor can inhibit axonal growth (williams et al ., 1994a, 1994c, 1995). In this scheme, the more classical cb1-mediated inhibition of calcium channels (caulfield and brown, 1992; mackie and hille, 1992) might account for the desensitization / inhibitory component of the response . In summary, to our knowledge, this is the first explicit demonstration of cross - talk between a neuronal receptor tyrosine kinase and the endocannabinoid system . This work also suggests that the emerging roles for adhesion molecules such as n - cadherin in synaptic plasticity in the adult (for review see goda, 2002; togashi et al ., 2002) in the adult brain, cannabinoid receptor agonists released from postsynaptic neurons act as retrograde messengers to suppress neurotransmitter release from the presynaptic axon . The effect is largely mediated by the cb1 receptor, and involves the coupling of a pertussis toxin sensitive g protein to inhibition of calcium influx through n - type calcium channels (for review see wilson and nicoll, 2002). However, the cb1 receptor is also expressed in the embryonic nervous system (buckley et al ., 1998; berrendero et al ., 1999), and this suggests additional functions for the cb1 receptor during development . When postnatal cerebellar neurons are cultured over monolayers of transfected 3t3 cells that express physiological levels of n - cadherin, n - cadherin promotes neurite outgrowth via a mechanism that requires activation of a neuronal fgf receptor signal transduction cascade (williams et al ., 2001). Given the requirement of dag lipase activity for the axonal growth response, and considering that the hydrolysis of dag will generate the cb1 agonist 2-ag, we decided to test whether cb1 function was required for the n - cadherin response . In this context, there is ample evidence that cultured cerebellar neurons express the cb1 receptor on cell bodies and neurites (for review see nogueron et al ., 2001), and we have extended this observation to cerebellar growth cones (fig . Our results show that two independent cb1 antagonists (am 251 and am 281) completely inhibit the n - cadherin component of the neurite outgrowth response (fig . 2 a). If the cb1 antagonists are acting at a step downstream from the fgf receptor, they should also inhibit the neurite outgrowth response stimulated by fgf2 . 2 b shows a representative example of an experiment where various doses of am 251 were tested for their ability to inhibit the response stimulated by 5 ng / ml fgf2 . A substantial inhibition (80%) of the response can be seen at an am 251 concentration of 0.2 m, with a complete inhibition found at 1 m . A series of pooled experiments show that at 1 m, both am 251 and am 281 completely inhibit the fgf2 response (fig . In contrast, a specific cb2 receptor antagonist (am 630) had no effect on the fgf2 response (fig . Bdnf stimulates axonal growth by activating the trkb receptor tyrosine kinase, and as this response does not depend on the hydrolysis of dag (lom et al ., 1998), there is no obvious basis for postulating a role for the endocannabinoid signaling in the response . In agreement, am 251 and am 281 did not inhibit the neurite outgrowth response stimulated by bdnf (fig . Cerebellar neurons were cultured overnight in media containing 5 ng / ml fgf2 before being fixed and stained for the cb1 receptor (see materials and methods). The bar is 10 m relative to the larger image, and 5 m relative to the inset . (a) cerebellar neurons were cultured on 3t3 monolayers or n - cadherin expressing monolayers in control media or media supplemented with 1 m am 251 or am 281 as indicated . (b) cerebellar neurons were cultured over 3t3 cell monolayers in control media or media supplemented with 5 ng / ml fgf2 in the presence of increasing concentrations of am 251 as indicated . (c and d) cerebellar neurons were cultured over 3t3 monolayers in control media or media supplemented with 5 ng / ml fgf2 or 5 ng / ml bdnf in the presence of 1 m am 251, am 281, or am 630 as indicated . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . Next, we determined whether activation of the cb1 receptor could mimic the fgf2 response, and whether this requires fgf receptor function . When neurons were treated with 5 ng / ml fgf2 or 0.2 m of the cb1 agonist win 55,2122, there was a clear increase in neurite outgrowth with no obvious difference in the nature of the neuronal response stimulated by these agents (fig ., we found that three cb1 receptor agonists (win 55,2122, acea, and noladin ether [na]) stimulated neurite outgrowth in a dose - dependent manner with maximal responses found in the low m range (fig . 4 a). Again, neurons treated with the cb1 agonists were not obviously different from those treated with fgf2 or n - cadherin . The responses to all three cb1 agonists were fully inhibited by am 251 and am 281 (fig . 4 b), confirming that they reflect activation of the cb1 receptor . A specific fgf receptor inhibitor (pd 173074) that fully inhibits the fgf2 and n - cadherin responses (skaper et al ., 2000; williams et al ., 2001) had no effect on the responses stimulated by all three cb1 agonists (fig . 4 b), and this demonstrates that cb1 function is downstream from fgf receptor activation . Direct application of arachidonic acid to primary neurons can also fully mimic the neurite outgrowth response stimulated by cams and fgf2 at a site downstream from fgf receptor activation, but upstream from calcium influx into growth cones (williams et al . The arachidonic acid response is also fully inhibited by the two cb1 receptor antagonists, demonstrating that arachidonic acid also acts upstream of the cb1 receptor, possibly by stimulating 2-ag synthesis in cells (unpublished data). Cerebellar neurons were cultured overnight on 3t3 cell monolayers in control media (a d) containing 5 ng / ml fgf2 (e h) or media containing 0.2 m win 55,2122 (i l) before being fixed and stained for gap-43 . (a) cerebellar neurons were cultured on 3t3 monolayers in control media or media supplemented with the given concentrations of three cb1 receptor agonists (win 55,2122, acea, and na) as indicated . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . The results are from a single representative experiment, and each value shows the percent increase in mean neurite length relative to control media . (b) cerebellar neurons were cultured on 3t3 monolayers in control media or media supplemented with 0.2 m win 55,2122 (win), 1 m acea, or 1 m na, as indicated . The experiments were done in control media and media supplemented with 500 nm pd 173074, 1 m am 251, or 1 m am 281 . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . The results are pooled from three independent experiments and show the percent increase in mean neurite length relative to control media . Dag hydrolysis couples the fgf receptor pathway to an axonal growth response by stimulating calcium influx into the growth cone through n- and l - type calcium channels (williams et al ., 1994b, 1994c; archer et al ., 1999; for review see doherty et al ., 2000). If endocannabinoid signaling mediates this response, then l- and n - type calcium channel antagonists should inhibit the response to the cb1 agonists, as these agents inhibit the fgf2 response from all tested neurons, including rat cerebellar granule cells (williams et al ., 1994b). To test this, we cultured neurons with the various cb1 receptor agonists in media further supplemented with an l - type calcium channel antagonist (diltiazem at 10 m), an n - type calcium channel antagonist (-conotoxin, 250 nm), or a combination of both . The cb1 agonists failed to elicit a neurite outgrowth response when n- and l - type calcium channels were simultaneously inhibited, and they only elicited small responses when individual channels were blocked (fig . 5). Thus, we can conclude that the cb1 agonists promote neurite outgrowth via a mechanism that requires calcium influx into neurons through n- and l - type calcium channels . Interestingly, the neurite outgrowth response stimulated by bdnf was completely unaffected by the calcium channel antagonists (fig . 5), and this further demonstrates that two receptor tyrosine kinases (the fgf receptor and trkb receptor) use different signal transduction cascades to couple to an axonal growth response in cerebellar neurons . Cerebellar neurons were cultured on 3t3 monolayers in control media or media supplemented with 0.2 m win 55,2122 (win), 1 m acea, 1 m na, or 5 ng / ml bdnf as indicated . The experiments were done in control media (sato supplemented with 2% fcs) or media further supplemented with 250 nm -conotoxin, and/or 10 m diltiazem as indicated . In each instance, the cultures were fixed after 18 h, and the length of the longest neurite per cell was determined from 120 neurons . The results are pooled from three independent experiments and show the percent increase in mean neurite length relative to control media . Calcium influx into neurons might seem an unlikely mechanism for the cb1 agonist driven neurite outgrowth response, given the paucity of data in the literature reporting positive effects of cannabinoid agonists on calcium levels in cells . However, it should be noted that under normal conditions, the calcium changes induced by cams and fgf2 are not detectable by conventional imaging, as they are highly localized to the submembranous region of the growth cone (archer et al ., 1999; chadborn et al ., furthermore, the notion that cannabinoid receptor activation can have positive effects on calcium influx is not without precedence, as it has been shown that the cb1 receptor can positively modulate l - type calcium channels in a neuronal cell line (sugiura et al ., 1996; rubovitch et al ., in addition, low concentrations of the natural cannabinoid receptor agonist -thc enhance k induced increases in calcium levels in cells (okada et al ., 1992). The stimulation of calcium influx into cells by cannabinoid receptor agonists is insensitive to pertussis toxin (sugiura et al ., 1996; rubovitch et al ., 2002), with the available evidence suggesting that it might be mediated by the now well - established stimulatory effects of cannabinoids on adenylate cyclase (glass and felder, 1997; felder et al ., 1998; calandra et al ., 1999; ishii and chun, 2002). Interestingly, we have found that pertussis toxin does not inhibit the cannabinoid agonist responses reported in this study (unpublished data). Biphasic responses to cannabinoids have been noted in biochemical, physiological, and behavioral studies (okada et al ., 1992; glass and felder, 1997; sulcova et al ., 1998). The data have been interpreted as evidence for the concomitant activation of two parallel pathways by the activated cb1 receptor, namely a stimulatory pertussis toxin insensitive pathway, and an inhibitory pertussis toxin sensitive pathway . An analogous situation might explain the biphasic nature of the neurite outgrowth response to fgf2 and arachidonic acid, and the fact that in some circumstances activation of the fgf receptor can inhibit axonal growth (williams et al ., 1994a, 1994c, 1995). In this scheme, the more classical cb1-mediated inhibition of calcium channels (caulfield and brown, 1992; mackie and hille, 1992) might account for the desensitization / inhibitory component of the response . In summary, to our knowledge, this is the first explicit demonstration of cross - talk between a neuronal receptor tyrosine kinase and the endocannabinoid system . This work also suggests that the emerging roles for adhesion molecules such as n - cadherin in synaptic plasticity in the adult (for review see goda, 2002; togashi et al ., 2002) might be considered alongside their ability to activate the endocannabinoid signaling system . Cerebellar neurons were cultured over monolayers of parental 3t3 cells or an established transfected 3t3 cell line that expresses physiological levels of chick n - cadherin (the lk8 cell line; for review see doherty et al ., for establishment of the co - cultures, 80,000 monolayer cells were plated into individual chambers of an eight - chamber tissue culture slide (precoated with poly - l - lysine and fibronectin) and maintained overnight in dme/10% fcs . The medium was removed, and 6,000 dissociated cerebellar neurons (taken from postnatal day 2 rats) were plated into each well in sato medium supplemented with 2% fcs . Test reagents were added as indicated in the text, and the co - cultures were maintained for 18 h. the co - cultures were then fixed and stained for gap-43 expression, and the mean length of the longest neurite per cell measured for 120150 neurons as described previously (williams et al ., 1994a). For cb1receptor expression, cerebellar neurons were cultured overnight in eight - chamber tissue culture slides precoated with poly - l - lysine (as above) and 10 g / ml laminin (in dme for 2 h at 37c). The cultures were fixed for 1 h with 4% pfa, and after blocking nonspecific binding sites with pbs/0.5% gelatin for 30 min at rt, were incubated with 20 g / ml of affinity - purified rabbit antibodies against the cb1 receptor (cb11-a; alpha diagnostic international, inc .) Overnight at 4c . All other steps in the staining procedure were as described previously for gap-43 (see above). Acea (arachidonyl-2-chloroethylamide n-[2-chloroethyl]-5z,8z,11z,14z - eicosatetraenamide), na (2-arachidonylglycerol ether; 2-[(5z,8z,11z,14z)-eicosatetraenyloxy]-1,3-propanediol), win 55,2122 mesylate ((r)-(+)-[2,3-dihydro-5-methyl-3-(4-morpholinylmethyl) pyrrolo-[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphthalenylmethanone mesylate), am 281 (1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl - n-4-morpholinyl-1h - pyrazole-3-carboxamide) and am 251 (n-[piperidin-1-yl]-5-[4-iodophenyl]-1-[2,4-dichlorophenyl]-4-methyl-1h - pyrazole-3-carboxamide), and am 630 (6-iodo-2-methyl-1-[2-(4-morpholinyl)ethyl]-1h - indol-3-yl](4-methoxyphenyl) methanone) were obtained from tocris cookson, ltd . Arachidonic acid was obtained from affinity bioreagents, inc ., and was used as described previously (williams et al ., 1994c). Diltiazem hydrochloride was obtained from calbiochem, and -conotoxin gvia was obtained from alomone labs; both were used as described previously (doherty et al ., 1991a). Cerebellar neurons were cultured over monolayers of parental 3t3 cells or an established transfected 3t3 cell line that expresses physiological levels of chick n - cadherin (the lk8 cell line; for review see doherty et al ., for establishment of the co - cultures, 80,000 monolayer cells were plated into individual chambers of an eight - chamber tissue culture slide (precoated with poly - l - lysine and fibronectin) and maintained overnight in dme/10% fcs . The medium was removed, and 6,000 dissociated cerebellar neurons (taken from postnatal day 2 rats) were plated into each well in sato medium supplemented with 2% fcs . Test reagents were added as indicated in the text, and the co - cultures were maintained for 18 h. the co - cultures were then fixed and stained for gap-43 expression, and the mean length of the longest neurite per cell measured for 120150 neurons as described previously (williams et al ., 1994a). For cb1receptor expression, cerebellar neurons were cultured overnight in eight - chamber tissue culture slides precoated with poly - l - lysine (as above) and 10 g / ml laminin (in dme for 2 h at 37c). The cultures were fixed for 1 h with 4% pfa, and after blocking nonspecific binding sites with pbs/0.5% gelatin for 30 min at rt, were incubated with 20 g / ml of affinity - purified rabbit antibodies against the cb1 receptor (cb11-a; alpha diagnostic international, inc .) Overnight at 4c . All other steps in the staining procedure were as described previously for gap-43 (see above). Acea (arachidonyl-2-chloroethylamide n-[2-chloroethyl]-5z,8z,11z,14z - eicosatetraenamide), na (2-arachidonylglycerol ether; 2-[(5z,8z,11z,14z)-eicosatetraenyloxy]-1,3-propanediol), win 55,2122 mesylate ((r)-(+)-[2,3-dihydro-5-methyl-3-(4-morpholinylmethyl) pyrrolo-[1,2,3-de]-1,4-benzoxazin-6-yl]-1-naphthalenylmethanone mesylate), am 281 (1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl - n-4-morpholinyl-1h - pyrazole-3-carboxamide) and am 251 (n-[piperidin-1-yl]-5-[4-iodophenyl]-1-[2,4-dichlorophenyl]-4-methyl-1h - pyrazole-3-carboxamide), and am 630 (6-iodo-2-methyl-1-[2-(4-morpholinyl)ethyl]-1h - indol-3-yl](4-methoxyphenyl) methanone) were obtained from tocris cookson, ltd ., and were used at concentrations recommended by the supplier . Arachidonic acid was obtained from affinity bioreagents, inc ., and was used as described previously (williams et al ., 1994c). Diltiazem hydrochloride was obtained from calbiochem, and -conotoxin gvia was obtained from alomone labs; both were used as described previously (doherty et al ., 1991a).
The coefficient of linear thermal expansion (cte), thermal conductivity and the nature and strength of the bond are all factors that influence the porcelain's capacity to resist fracture during clinical use of the restoration11,21 . In agreement with many authors, the difference in ctes of porcelain and metal has been recognized as a major parameter in predicting compatibility1,4,12,24 . The general consensus is that the alloy should have higher cte than the porcelain (a positive expansion coefficient mismatch) in order to produce compressive stress in the porcelain when cooling11,24 . Usually, a variation ranging from 0.5 to 1.0 10 c between the ctes of the alloy and ceramic is considered adequate when the metal coefficient is higher than that of the ceramic . Some authors reported that metal - ceramic specimens with a negative cte difference failed at significantly lower flexural loads than specimens did with positive cte difference2,10 . Various tests have been designed and selected by researchers to evaluate metal - ceramic bond strength and the minimal value recommended by the iso standard 969315 for metal - ceramic dental restorative systems is 25 mpa for 3-point bending test . However, it can be affirmed that this value is related more to the flexure strength of the metallic substrate than to the metal - ceramic bond strength12,13,18, causing difficulty when comparing different metallic substrates . Noble metal alloys had been widely used for porcelain veneering in dentistry . However, with the continuous price fluctuations of noble metals, more attention has been given to alternative alloys . Ni - cr alloys have good mechanical properties, such as high degree of hardness, low density and high tensile strength . Also, the low cost and easy fabrication of ni - cr alloys have caused them to be widely used in dental fixed prosthesis for quite some time14 . The addition of be in these ni - cr alloys promoted castability improvement of these alloys and enhanced bonding strength between porcelain and metal3,6,14,17,20,23 . However, in addition to beryllium, the presence of other potentially pathogenic metallic components in ni - cr alloys has contributed for reinsertion of pd - ag in the market5,8 . Porcelains suitable for pd - ag alloys were then developed, which avoid wearing of the ceramic coverage by ag diffusion in ceramics7,9 evidencing that this alloy system is safer than alloys with ni 7 . High palladium alloys were introduced in the early 1980s and are currently widely used in metal - ceramic restorations, even though they have not yet been scientifically investigated to the extent that their widespread use requires10,13,14,17,18 . This type of alloy presents characteristics that, in spite of not interfering with the porcelain - to - metal bond, must be observed . Moreover, there are elements in the alloy composition, such as silver and tin, which are susceptible to oxidation . Thus, previous oxidation is an important procedure that could increase the bond strength of such metal - ceramic interface1,16,19 . Furthermore, the pd - ag alloy (pors - on 4) presents much smaller grains than other pd - ag alloys that provide better mechanical qualities, besides promoting larger external contact surface14 . Another characteristic of the palladium alloy is its high sensitivity to the presence of carbon during casting procedures . The carbon promotes a formation of carbon monoxide during the ceramic baking, creating bubbles and porosities, which could be partly responsible for undesirable outcomes, such as cracks or fractures . The purpose of this study was to evaluate the metal - ceramic bond strength (mcbs) of 6 metal - ceramic pairs (2 ni - cr alloys with / without be and 1 pd - ag alloy with 2 dental ceramics) and correlate the mcbs values with the differences between the ctes of the metals and ceramics . Two ni - cr alloys - verabond (vb) with be and verabond ii (vb2) without be -and one pd - ag alloy - pors - on 4 (p4) - were fused to 2 ceramics - ips (i) and duceram (d) - (table 1) to form six metal - ceramic pairs (vbi, vbd, vb2i, vb2d, pi, and pd). Eight specimens of each metal - ceramic pair were used to test shear bond strength . The metal - ceramic bond strength test was established on previously published techniques1,6,22, which determine the shear strength needed to break the metal - ceramic bond of a ceramic ring constructed around cylinder - shaped metal rods . The ceramic rings were assembled with ips porcelain and duceram and manipulated according to the manufacturer's recommendations without any pre - heating treatment, since the verabond manufacturer does not suggest pre - heating for single crowns, only for three - element fixed partial dentures . Each specimen was calibrated with a handheld digital caliper (mitutoyo digimatic caliper, model 500 - 151, mitutoyo corp, tokyo, japan) as a function of the dimensional alterations inherent to the casting and ceramic firing processes . Eight individual specimens were cast for each alloy, being 1 for each casting ring . Metal rods were obtained to place brass rods, measuring 3.0 mm in diameter and 70.0 in length, inside a phosphate - bonded investment (termocast; polidental, sao paulo, brazil). After investment hardening, using pliers, the brass rods were removed from the cast by the exposed end at the base of the casting ring . After the rings cooled, the castings were manually divested and airbone - particle abraded (model microjet ii, edg, so carlos, sp, brazil) with 100m aluminum oxide abrasive (polidental, sao paulo, sp, brazil) under 2-bar pressure for 5 s, to remove residual investment . Silicone rubber cylinders measuring 7.0 mm in diameter and 6.0 mm high were fabricated, with a hole in the middle equal to the diameter of the rods in order to form a mold for the ceramic material . Each metal rod received a pair of these cylinders, each positioned by its free end to prevent any contamination from the construction site of the ceramic ring . One cylinder was positioned nearby the extremity of the metallic rod and the other one was inserted at the other end and moved until it encountered the spacer selected to standardize the thickness of the ceramic ring to 1.5 mm . Using a dental surveyor, the rings, assembled 6.0 mm from one end of the rods, were placed in the center of a plaster cylinder for load application . All steps of the metal - ceramic bond strength test are schematically illustrated in figures 1 to 4 . After plaster curing, the specimens were subjected to tensile loading in a universal testing machine (emic mem 2000, so jose dos pinhais, pr, brazil) by introducing opposite clamps, a self - locking one at the exposed end of the rod and another one projected to accommodate the plaster cylinders . The machine was set at a cross - head speed of 0.5 mm / min . The peak load was recorded and used to calculate the bond strength - indicating mcbs by the equation: t = f / s, where t = bond strength, f = critical rupture load, and s = area of the metal - ceramic bond . T, where s = metal - ceramic bonding area, d = rod diameter, and t = ring thickness . The data were recorded and submitted to a one - way anova and tukey's test (=0.01). Specimens measuring 12 mm in length and 2 mm in diameter were fabricated for the dilatometric test . Alloy specimens were obtained by machining the previously cast metallic stems from the studied alloys, in the mechanical vise . A capillary chromel - alumel thermocouple (0.8 mm in diameter) was welded to the specimen to check the temperature variation . Ceramic specimens were obtained by 2-mm - diameter built - in irrigation cannulas (model 22g1; sr produtos hospitalares, manaus, am, brazil) in refractory material (fortune, williams dent co, buffalo, ny, usa). The cannulas were removed after refractory setting, leaving the required space for further application of the ceramic . The investment was wet and the ceramic was applied in 2 steps . After the second firing of porcelain, finishing with low - speed diamond burs was done for final dimension adjustments . When the final dimensions were obtained, a groove was made in the center of the specimen for accommodation and building - in of the thermocouple, previously welded with porcelain gold flush . An additional porcelain layer was added, in order to retain the thermocouple inside it, which required a new firing for ceramic sintering . A dilatometer (adamel lhomargy, model dt 1000, ny, usa) was used for the dilatometric testing . Prior to the dilatometric tests, a complete heating / cooling cycle was performed in order to establish the temperature of each ceramic softening . The specimens were placed on the dilatometer and the cycle was performed, beginning at room temperature . The heating rate was 5c / min, up to the moment that an inversion on the heating curve was noted on the monitoring screen . At this point, the test was interrupted and each porcelain softening temperature was determined . Therefore a safe number for maximum temperature of the dilatometric test with ceramics was established at 620c . Regarding the dilatometric test for ceramic specimens, a heating / cooling cycle was programmed at a heating rate of 5c / min starting at room temperature and advancing to 620c . At this temperature, the specimen was cooled down at a cooling rate of 5c / min . And the determination of cte was made from 500c down to room temperature with air and helium gas injection . Metallic alloys were submitted to the entire cycle, which simulated the firing of ceramics . They were heated from room temperature up to 580c under vacuum at a heating rate of 150c / min and then up to 920c at heating rate of 5c / min . After reaching 920c, vacuum was eliminated; the specimen was kept for one minute at this temperature and then cooled down to 500c . From this temperature, the cte was determined to a cooling rate of 5c / min to room temperature . The data were recorded and submitted to one - way anova and tukey's test (=0.05). Additionally, linear regression was performed to determine the correlation of mcbs and cte differences . The anova and tukey's test indicated statistically significant differences among the groups (p<0.01) (tables 3 and 4). Groups with same superscript letter are not statistically different (p>.01) table 5 shows the single material cte values and also means and standard deviations of the evaluated materials . Table 6 shows the differences among cte values of ceramics and alloys, within the range of 100c to 500c, resulting from the mean of the five specimens for each evaluated material . For the correlation analysis of mcbs and cte differences, the anova and tukey's test indicated statistically significant differences among the groups (p<0.01) (tables 3 and 4). Table 5 shows the single material cte values and also means and standard deviations of the evaluated materials . Table 6 shows the differences among cte values of ceramics and alloys, within the range of 100c to 500c, resulting from the mean of the five specimens for each evaluated material . For the correlation analysis of mcbs and cte differences, the emergence of metal - ceramic restorations in the late 50's created the need to control cte of metal alloys in order to guarantee the success of restorations by preventing the rupture of metal - ceramic bond3 . Thermal compatibility of the metal - ceramic pair could play a significant role in mcbs because it constitutes the main physical requirement to avoid stress at the interface11,12,18,24 . The ctes of the metal and ceramics must be similar in order to avoid stress2,4,11,12,23 . The recommended mean difference between alloy and ceramics ctes (from room temperature to 600c) is from 0.5 to 1.0 10 c 3,23 . The cte differences between vb alloy and ips ceramic (0.54 10 c) and between vb2 and duceram (0.63 10 c) were found within the above mentioned range but did not guarantee high values of cmbs . The vbd pair difference was 1.33 10-c while the vb2i pair showed a negative difference (-0.14 10c). Although some authors3,10 recommend that the metal and porcelain should have similar coefficients of thermal contraction and metal must have a slightly higher value to avoid undesirable tensile loading at the interface, in this case the cte of ceramic was higher than the alloy one, without significant differences observed in the mcbs values . Two situations can be found when comparing the cte differences in this study . When there is a positive difference of ctes, the cte of alloy is higher than the cte of ceramic, where ceramic is compressed and metal is under tension . This is found to be the most common combination in dental metal - ceramic systems . When the difference is negative, the cte of ceramic is higher than the cte of alloy, where ceramic is under tension and metal is compressed4 . Differences much higher than the recommended average were found at the combination pors - on 4 alloy and both studied ceramics (pi= 1.8 10c; and pd= 2.6 10c). Differences of 1.7 10c between the coefficients of the metal - ceramic pair produce tension in the porcelain close to the metal - ceramic interface during the cooling of porcelain, possibly causing spontaneous bonding failure1 . It is also known that differences in cte between ceramic, metal and metallic oxide may induce stress on the metal - ceramic interface11,12,24 . There is no doubt that in order to guarantee esthetic results, the metal - ceramic bond strength is a basic factor because any failure with this bond may lead to an earlier removal of the restoration, regardless the success of initial results . However, there is no agreement regarding the adhesion mechanism between the metal and porcelain3,6,17,22 . There are questions regarding the testing methods for evaluation of the actual strength of metal - ceramic bond, since a method that can accurately measure this property is as of yet unknown . Some authors state that there is no methodology capable of measuring only shear forces along the metal / porcelain interface3,13 . In this study, the tensile load test with ceramic rings applied around metallic stems represents actual situations of metal - ceramic restorations with a larger esthetic covering of the process . No pre - heating was performed on the evaluated alloys, contradicting the respective manufacturer's indications of the pors - on 4 alloy . The purpose of this criterion was to minimize the effect of the chemical interaction among the evaluated materials, thus enabling greater physical interaction activity of the components20,24 . The manufacturer of the vb and vb2 alloys does not suggest pre - heating for single unit, only for multiple unit frameworks . However, according to a previous study14, the presence of al (as al2o3) and be (as beo) on the oxide layer of ni - cr alloy specimens submitted to pre - heating resulted to a better porcelain / metal bonding behavior . Therefore, it is possible that for each evaluated metallic substrate, the mcbs values could be improved if the pre - heating treatment was used . Therefore, it is possible that for each evaluated metallic substrate, the mcbs values could be improved if the manufacturer's recommendations were followed . By analyzing the loads involved in the metal - ceramic bond strength, there was no significant difference among five of the six evaluated metal - ceramic pairs . The association of alloy pors - on 4 with ceramic ips provided higher mcbs than the other combinations . On the other hand, however, this result is different those of a previous study14, which performed pre - heating treatment of the alloys and reported that the presence of the be reduced the oxide layer, hence promoting better metal - ceramic bonding . This fact might have occurred because in the present study the preheating treatment of the alloys was not performed, as previously explained, aiming at minimizing the effect of the chemical interaction among the evaluated materials . Although this higher difference is adverse for restoration longevity, the pors - on 4/ips pair presented the highest mcbs values (difference of 1.84 10c) while the pd pair (difference of 2.6 10 c) showed cmbs values without any significant difference in relation to the previously considered pairs, with cte differences considered as more adequate . Therefore, in this case, it was not possible to correlate the two evaluated parameters . When building metal - ceramic pairs at high temperatures of opaque or dentin layer firing (900 to 950c), porcelain is found in a softened state and it is adequately molded to the metallic substrate . From 600c, when porcelain hardening occurs, the differences of the metal - ceramic pair can generate the occurrence of complex tensions, which makes it difficult to perceive the consequences of the genuine characteristic of the metal - ceramic bond . If the highest difference of cte results in bonding failure was due to the occurrence of cracks11, it is possible that, in the case of pi, cracks did not occur and the porcelain maintained under tension presented the best results . However, it is possible that, if submitted to wear, a restoration made of this combination would undergo fracture due to the sum of chewing stress and the intrinsic stress of the metal - ceramic interface . In view of this possibility, the supposition that dynamic evaluations are perhaps better indicated to assess the actual quality and consequent longevity of metal - ceramic bond should be considered . It was difficult to compare the results of the present study to those obtained in other studies because different methods have been used to evaluated metal - ceramic bond strength . In the present study no pre - heating treatment was performed because it was not the aim of this study to add another variation factor, since not all of the manufacturers of studied alloys recommend pre - heating . Furthermore, the obtained results cannot be directly interpreted as clinically relevant, since factors such as the test geometry, the lack of a moist environment and lack of fatigue loading were not evaluated . Although the number of studied pairs was small, the goal of this work was not to generalize that there is not relation between mcbs and cte differences, but rather to show that the differences were not the main factor and to emphasize the importance of chemical relation between the evaluated pairs . Additionally, this study aimed to demonstrate the problem . Further research should determine the importance of the bonding mechanisms and the compatibility of various metal - ceramic combinations . The data from these new studies might provide criteria for the rational selection of ceramics and alloys that have adequate bond strength for clinical use . Considering the study methodology and limitations, it was concluded that: there was statistically significant difference only for the ips ceramic / pors - on 4 alloy pair, which showed the highest value of metal - ceramic bond strength . All other metal - ceramic pairs showed no significant differences.it was not possible to establish any correlation between the metal - ceramic bond strength values and cte differences of the evaluated metal - ceramic pairs . There was statistically significant difference only for the ips ceramic / pors - on 4 alloy pair, which showed the highest value of metal - ceramic bond strength . It was not possible to establish any correlation between the metal - ceramic bond strength values and cte differences of the evaluated metal - ceramic pairs.
Fahr's disease is a rare disorder that was first described by karl theodor fahr in 1930 . It usually presents with either slow progressive cognitive decline, psychiatric disturbance, or movement disorders . We describe a patient with an acute deterioration in the level of consciousness and a ct scan demonstrating both subarachnoid blood and idiopathic basal ganglia calcification (ibgc). Further investigations showed a right posterior communicating artery aneurysm to be the source of the hemorrhage . We postulate that the extensive calcification in fahr's disease negatively affects both brain parenchyma and intracranial vessels predisposing these individuals to such an acute presentation . A 54-year - old housewife without any significant previous medical history, or any neurological problem presented with a transient loss of consciousness followed by headache and confusion . Her blood investigation, which included coagulation profile, blood cell count and serum electrolytes, was normal . Brain computerized tomography (ct) showed two major findings: first, diffuse bilateral subarachnoid hemorrhage involving the basal cisterns and both sylvian fissures; and second, extensive calcification involving the basal ganglia, thalamus, corona radiata, and deep cerebellar nuclei [figure 1]. Axial noncontrast ct scan of the brain shows extensive symmetrical calcification at the level of the (a) cerebellum, (b) basal ganglia, (yellow arrow) (c) thalamus and (d) white matter . Formal cerebral angiography revealed a right posterior communicating artery aneurysm as the probable source of the sah . An attempt at coiling this aneurysm failed because of a tortuous internal carotid artery precluding safe access to the aneurysm [figure 2]. Right internal carotid angiogram showing a multilobulated right posterior communicating artery aneurysm measuring 7.8 5.7 4.2 mm with the neck of the aneurysm measuring 3.3 mm (white arrow). The patient was thereafter taken to the operating room where she underwent a right pterional craniotomy and clipping of the posterior communicating artery aneurysm . Her postoperative course was complicated by a right - sided upper extremity monoparesis due to a small middle cerebral artery territory ischemic infarct . However, over the following days she improved but experienced mild vasospasm that was treated medically with euvolemia and milrinone . She was also investigated for disorders that may cause abnormal calcium deposition which proved negative . The patient was eventually discharged from the hospital to a rehabilitation program where she showed significant improvement . The 6-month follow - up angiogram revealed no new aneurysms and no recanalization of the clipped aneurysm . Fahr's disease, or idiopathic basal ganglia calcification is a rare syndrome that is characterized by abnormal intracranial calcification in the absence of any systemic calcium disorder . Different names have been given to abnormally excessive calcification within the brain parenchyma and cerebral vessels, reflecting the confusion regarding what causes this disorder [table 1]. Names of ibcg with vascular predilections calcification has been described in the globus pallidus, caudate nucleus, putamen, thalamus, dentate nuclei, cerebellar lenticular nucleus, thalamus, the white matter of the cerebral cortex, as well as major intracranial vessels and those supplying the basal ganglia and the cerebellum . Typical presentation starts in the 4th to 5th decade of life with a slow cognitive decline, psychiatric abnormalities or movement disorders such as parkinson's tremor, dystonia or cerebellar ataxia . Microscopic and biochemical analysis of brain deposits in fahr's disease reveals that the stroma contains mainly calcium and protein without collagen or mucopolysaccharides . These deposits occur in vessel walls of arterioles, capillaries, veins, and in the perivascular spaces . The calcium deposits are generally symmetrical and may be seen in the walls of small and medium sized vessels that could have resulted from inflammatory processes in the vessels . An acute deterioration in the level of consciousness a potential cause may be a complex - partial seizure as reported in a patient who had had a mild psychiatric disturbanceprior to a seizure episode . In another case, simone et al ., described a 69- year - old patient who presented with recurrent episodes of deterioration in the level of consciousness and who was found to have classical radiological findings of fahr's disease, in addition to pseudo - hypoparathyroidism, the correction of which improved his clinical status . Subarachnoid hemorrhage from a ruptured intracranial aneurysm has a poor prognosis with mortality rate of 50%, with 20% of survivors remaining severely disabled . Histopathologically, aneurysms are associated with a loss of the media interna along with the elastic lamina as well as a thinning of the wall . There is also an associated intimal thickening in the parent artery . In larger aneurysms calcification may be seen either in the wall of the vessels or at the neck of the aneurysm . Earlier descriptions of fahr's disease postulate a vascular pathophysiological process with calcification in both small and large vessels . Our case represents ibgc presenting with an sah as a first presentation . Despite the heavy calcification seen on imaging she was asymptomatic before the event . We suggest that this could represent a subset of patients in whom there may be a predilection for intracerebral vessel symptomatology prior to the eventual onset of cognitive and psychiatric disturbances . The association of ibgc and an intracranial aneurysm has to date remained unreported in the literature . This case represents a first for fahr's disease presenting with an aneurysmal subarachnoid bleeding . Fahr's disease is a chronic slowly progressive neurodegenerative disorder that most commonly will present with acute deterioration in the level of consciousness, secondary to seizures . We report a case of fahr's disease in which this acute deterioration was secondary to an aneurysmal subarachnoid hemorrhage . This observation suggests that a brain cta should be performed in patients with unexplained recurrent episodes of loss of consciousness, to rule out an aneurysm, even if they are known to have ibgc, so as to not attribute it to an epilepsy disorder.
There is a common and diffuse false myth that aging is synonym of deterioration, pathology, and death . The increased life expectancy in developed and developing countries is parallel to the need to identify interventions able to preserve health and function even at older age, delaying the physical and cognitive declines . Aging is an extremely complex multifactorial process characterized by progressive physiological, genetic, and molecular changes, responsible for the increase risk of morbidity and death . Several hypotheses [2, 3] have been proposed to explain this inborn process common to all living beings, but one of the most plausible and better - accepted currently is the so - called free radical theory of aging . The age - associated loss of skeletal muscle mass and strength (i.e., sarcopenia) seems an unavoidable part of the aging process . After about the age of 50 years, there is a progressive decrease of muscle mass at the rate of 1 - 2% per year . Similarly but with different decline rate and timing, muscle strength also decreases by about 3% yearly after 60 years of age . Sarcopenia is a multidimensional phenomenon of aging (someone indicates it as a syndrome) and represents a powerful risk factor for the development of negative health - related events in the elderly . In fact, the relationships of sarcopenia with impaired physical performance, frailty, loss of functional independence, and increased risk of falls are all well established in the literature . Moreover, decreased muscle strength is also highly predictive of incident disability and all - cause mortality in older persons . Oxidative damage has been proposed as one of the major contributors of the skeletal muscle decline occurring with aging [7, 8]. The identification of free radicals as promoters of the aging process may imply that their inhibition might limit the detrimental modifications they exert on our organism (and, in particular, on skeletal muscle). In other words, if molecules with antioxidant capacities can counteract the oxidative damage, they may also play a key role in preventing the onset of age - related conditions, including the disabling process . It will come to be true that oxidative damage is at the basis of the pathophysiological mechanisms responsible for sarcopenia (and other geriatric conditions), and interventions aimed at enhancing the endogenous antioxidant defenses (e.g., dietary antioxidant supplementation) may gain special interest . The purpose of the present paper is to discuss current available evidence about the effects of antioxidant supplementation on sarcopenia . Special attention will be obviously given to studies focused on models of aging and involving older participants . He proposed that aging and the associated degenerative diseases were consequences of free radical - induced damages to cells and the inability of counterbalancing these changes by endogenous antioxidant defenses . Harman initially explained the production of free radicals through reactions involving molecular oxygen catalyzed in cells by oxidative enzymes and subsequently postulated that genetic and environmental factors might modify this process . In 1972, he then revised his theory identifying the mitochondria as primarily responsible for the physiological process of aging . Since oxidative damage is higher in cells and structures with higher consumption of oxygen, he suggested that mitochondria (consuming most of the intracellular oxygen) were particularly exposed to oxidative damage and potentially affected lifespan . Miquel and colleagues subsequently confirmed such theory by recognizing mitochondria as major actors of cellular aging . More recently and consistently with these concepts, the free radical theory of aging has been switched into a mitochondrial free radical theory of aging . Free radicals are a highly reactive chemical species with a single unpaired electron in its outer orbit seeking to pair with another free electron . In particular, reactive oxygen species (ros), deriving from oxidative metabolism, have higher reactivity than o2 . Ros are constantly generated in cells of aerobic organisms by the addition of a single electron to the oxygen molecule with subsequently damage of biological macromolecules (like lipids, proteins, and nucleic acids). The interaction of ros with normal cellular structures leads to potentially nonreversible modifications, with consequent cellular loss of function and death [3, 15, 16]. Mitochondrial electron transport, peroxisomal fatty acid, cytochrome p-450, and phagocytic cells (the respiratory burst) represent the most important ones . In particular, the main source of ros (estimated at approximately 90% of the generated total) is located at the inner mitochondrial membrane where oxidative phosphorylation takes place . Moreover, a variety of exogenous stimuli, such as exposure to infections, radiations, xenobiotics, environmental toxins, and ultraviolet light, may also increase the ros production in vivo . Interestingly, mitochondria are both producers as well as targets of ros . In all organisms living in an aerobic environment, recent studies [25, 26] have even shown that ros may function as an additional class of cellular messengers, being involved as physiological regulators of intracellular signaling pathways (e.g., response to growth factor stimulation or generation of the inflammatory response to bacterial defense). Therefore, since free radicals are necessary for correct functioning of the human organism, efficient mechanisms of antioxidant defense had to be developed (especially in cells highly exposed to oxidation processes) with the aim of protecting cellular constituents . Endogenous antioxidants are present under diverse and numerous forms, like enzymes (e.g., superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase), vitamins (e.g., vitamin c, vitamin e), and elements (e.g., selenium, zinc). All these substances are able to neutralize ros and protect cells from free radical damage . Nevertheless, in a normal scenario, about 1% of ros is still able to avoid the control of the antioxidant system, causing oxidation of surrounding tissues . Moreover, oxidative damage is obviously enhanced when the ros production increases and/or the antioxidant status decreases . According to the cellular constituents attacked by the oxidative stress, lipid peroxidation, protein oxidation, and dna damage will all promote abnormalities of the cell structures incompatible with proper cell function, leading to its death . Such cellular loss has been finally indicated as being responsible for the age - related degenerative diseases and conditions . In summary, according to the free radical theory of aging, oxidative damage is due to a redox imbalance between ros and the counteracting antioxidant forces generating a vicious cycle responsible for the progressive augmentation of damage . The equilibrium between ros production, antioxidant defenses, and the cellular structures determines whether a cell exposed to ros increase will be destined to survival or death . Antioxidants are substances able to inhibit the rate of oxidation [33, 34]. Mainly, antioxidant enzymes (e.g., catalase, superoxide dismutase (sod), glutathione peroxidase, glutathione reductase) work to maintain a state of balance preventing the transformation of ros and to convert them into more stable molecules (like water and molecular oxygen). Sod exists in two forms: cu / znsod is present in the cytoplasm of the eukaryotic cells whilst mnsod is located primarily in the mitochondria . Differently, endogenous nonenzymatic elements with antioxidant properties contribute to the maintenance of homeostasis by primarily acting as cofactors for the antioxidant enzymes . The most important (and also largely available as supplements) are vitamin c, vitamin e, and carotenoids . For example, ascorbic acid concentrations are inversely associated with isoprostanes, a marker of lipid peroxidation . In fact, vitamin c reduces the vitamin e radicals generated in cellular membranes and inhibits the propagation of -tocopheroxyl radical . It has been reported a significantly high correlation of -tocopherol (the most diffuse form of circulating vitamin e) with physical performance and of -tocopherol with skeletal muscle strength . Nunes and colleagues demonstrated that a vitamin - e - deficient diet may cause an increased caspase - like activation (a proapoptotic stimulus) in animal model . Consistently, vitamin e is inversely correlated with lipid peroxidation and positively correlated with in cytochrome oxidase activity (causing a mitochondrial respiratory chain dysfunction). The supplementation of different antioxidants will provide different effects on oxidation according to the hydrophobicity of the administered molecule . In fact, fat - soluble antioxidants (e.g., vitamin e) are particularly effective at inhibiting lipoprotein peroxidation, whereas water - soluble antioxidants (e.g., vitamin c) more efficiently protect the aqueous phase . However, these antioxidants do not only act individually, but also cooperatively and sometimes even synergistically . Moreover, their radical - scavenging effects depend on various factors, the site of generation of the oxidant and the localization of the antioxidant [41, 42]. Another important source of antioxidants is assured by dietary carotenoids (including -carotene, -carotene, -cryptoxanthin, lutein, zeaxanthin, and lycopene). They scavenge free radicals, quench singlet oxygen, inhibit lipid peroxidation, and modulate redox - sensitive transcription factors (e.g., the nuclear factor kappa - light - chain - enhancer of activated b cells or nf-b) that are involved in the upregulation of proinflammatory cytokines [44, 45]. Upritchard and colleagues have reported that the supplementation of carotenoids may significantly improve antioxidant status and reduce concentrations of isoprostanes . Numerous foods like fruits, nuts, vegetables, and spices are rich in antioxidants . Blueberries, cranberries, blackberries, plums, apples, cherries, and prunes are fruits particularly rich in antioxidants . Red and black beans, artichokes, and russet potatoes are the vegetables with highest content of antioxidants . Ground cloves, cinnamon, and oregano contain the greatest amount of antioxidants among spices . Finally, it is worth to be mentioned that the antioxidant system function is highly influenced by age [32, 48]. In fact, with aging, there is a progressive decline in mitochondrial function and increase in oxidative damage . Ros overwhelms the endogenous antioxidant defense system during the aging process, causing harmful modifications of myofiber cellular proteins, lipids, and dna . Moreover, the antioxidant dietary intake may easily decrease for multiple reasons (e.g., mobility disability leading to inadequate food supply; lack of social support; oral problems leading to repetitive and inadequate diets, etc . ). Thus, it is not surprising that poor antioxidant status is commonly found at the foundations of several conditions of older age . In 1989, rosenberg coined the term sarcopenia (from greek: or flesh and or loss) to describe the progressive and involuntary loss of skeletal muscle mass and function occurring with aging . Although it is difficult to provide an exact prevalence of sarcopenia due to the heterogeneity of older persons, the existing multiple operative definitions, and diverse (sometimes contradicting) assessment methodologies, common estimates indicate it as 513% in the 6070-year - old age group and 1150% in the 80-year and older age group . Such figures are expected to dramatically rise in the next future due to the progressive aging of western populations with a profound and negative impact on public health . In fact, sarcopenia (one of the most important geriatric syndromes) represents an important risk factor for functional impairment, physical disability [53, 54], falls, and frailty [56, 57]. Briefly, type i fibers are slow contracting and use an oxidative metabolism . Differently, type ii fibers are fast contracting and mainly glycolytic . Sarcopenic muscle mass reduction is primarily due to a loss of muscle fibers particularly characterized by a preferential atrophy of type ii fibers . At the same time, a conversion of fast type ii muscle fibers into slow type i fibers (with resulting loss in muscle power and decline in protein synthesis, especially of myosin heavy chains) has been described [5860]. Overall, these changes lead to a smaller, slower contracting muscle with resulting reduced capacity to adequately perform activities of daily living . These anatomical modifications have been (at least partly) attributed to the age - related increase of oxidative damage . In fact, the skeletal muscle is the largest consumer of oxygen in the body with muscle fibers continuously generating ros (especially during the contractile activity). Studies adopting muscle biopsies have confirmed that markers of oxidative damage are particularly and locally elevated in skeletal muscle of older adults [6164], promoting the above - mentioned inadequacy of the antioxidant system in preventing damages [32, 65]. Some components of the enzymatic scavenger system, such as catalase, glutathione transferase, and superoxide dismutase, are also significantly depressed in elderly muscle . The consequent prooxidant status results in the alteration of mitochondrial dna and abnormalities in the electron transport system, leading to reduced calcium uptake by the sarcoplasmic reticulum, irreversible damage of the cell, and its consequent death [6769]. In the healthy muscle, proteins and amino acids are ideally balanced between synthesis and breakdown . In the elderly, this equilibrium is disrupted because of a lower synthesis and an increased breakdown rate of myofibrillar and mitochondrial proteins . Several endogenous and exogenous factors may affect the organism capacity to maintain the protein homeostasis . For example, it has been hypothesized that muscle decline might be caused by the direct detrimental effects of the chronic low - grade inflammatory status of advanced age . In this context, it cannot be ignored the close relationship between inflammation and oxidative damage . Interestingly, both inflammation (in particular through the tnf- pathway) and oxidative damage are major regulator of cellular apoptosis and protein metabolism . At the same time, the age - related muscle protein loss may also macroscopically be caused by the frequent reduction of food intake in elders . Older persons are particularly exposed to the risk of (micro- and macronutrient) malnutrition that might also be related to endogenous (e.g., malabsorption, edentulism) or exogenous (e.g., lack of social support, disability) causes . Consequently, antioxidant supplementation represents a promising intervention potentially able to correct the inadequate diet of older persons and prevent the skeletal muscle decline by inhibiting the vicious cycle at the basis of protein catabolism . Antioxidant supplementation may not replace the age - related decline of the more complex antioxidant enzymatic system . Nevertheless, in theory, by reinforcing the antioxidant nonenzymatic defences, supplementation might still be helpful in preventing the onset of age - related conditions (including sarcopenia) by acting on the same cause (i.e., oxidation). However, further studies are needed to better understand the relationship between nonenzymatic and enzymatic antioxidant defenses . In particular, it could be that the two components are not parallel and independent, but indeed synergistically constitute the antioxidant system . Interestingly, selman and colleagues recently demonstrated that vitamin c supplementation in mice is associated with a downregulation of antioxidant protection genes (including mnsod). Despite the clinical relevance of sarcopenia and the large interest for antioxidant supplementation (both from a research and commercial standpoint of view), evidence in this field is extremely limited and controversial . Most of the studies available in the literature are from epidemiological data with most even coming from cross - sectional observations . The absence of a unique operative definition of sarcopenia represents a major issue limiting the conduction of research on the topic . In fact, most of the human studies analyze the relationship between dietary antioxidant supplementation and physical performance or muscle strength measures, without specifically focusing on the broader condition of sarcopenia . In fact, the quantitative (i.e., muscle mass) and qualitative (i.e., muscle strength, muscle function) declines follow separate and different trajectories with aging . The need of combining them into one single bidimensional definition of sarcopenia is critical from a theoretical and methodological perspective and has to be taken into account when specifically facing the topic sarcopenia . In other words, the separate evaluation of muscle mass or muscle strength may significantly affect the study of sarcopenia (limiting its exploration to only one of the two components) and likely result in biased findings . To our knowledge, there are currently no trials verifying the effects of antioxidant supplementation on sarcopenia (as identified by one of several the consensus definitions provided by international groups of experts). Interestingly, a recent statement from the society on sarcopenia, cachexia, and wasting disease does not even mention antioxidant supplementation as a possible tool to manage sarcopenia in older persons . Several studies have been conducted to evaluate the effects of antioxidant supplementation on antioxidant status [72, 73]. Overall, results consistently report significant improvements of antioxidant biomarkers after a period of specific supplementation . Differently, the effect of antioxidant supplementation on muscle performance is still and largely controversial . Here are just a few examples of positive studies (from both animal and human models) among the large body of literature suggesting a beneficial effect of antioxidant supplementation and sarcopenia . Jakeman and maxwell showed a protective effect of vitamin c supplementation against exercise - induced muscle damage . Similarly, shafat and colleagues reported a reduction of muscle damage by adopting a counteracting vitamin e and c supplementation . An antioxidant mixture containing vitamin e, vitamin a, rutin, zinc, selenium has shown to increase the anabolic response of old muscle to leucine and the leucine - induced inhibition of protein degradation in rats . Resveratrol, a natural polyphenol found in grapes, peanuts, and berries, has shown a protective effect against oxidative stress in skeletal muscle through the expression of antioxidant enzymes . At the same time, a similar (possibly larger) number of studies have reported negative results on the topic . For example, some trials have reported that antioxidant supplementation may even be unfavorable on physical performance and underlying biological mechanisms [79, 80]. A decrease of baseline levels of antioxidant mitochondrial enzymes was reported by strobel and colleagues after 14 weeks of vitamin e and -lipoic acid administration in rats . Data by ristow and colleagues suggested that oral administration of ascorbic acid and -tocopherol prevents exercise training - induced increases in insulin sensitivity and ros defense capacity . Consistently, the work by higashida and colleagues showed no inhibitory effect on the adaptive responses of muscle to exercise by antioxidant vitamin supplementation . Several studies [8486] showed no effects of antioxidants supplementation on muscle function after exercise - induced muscle damage . In a recent work, theodorou and colleagues found that a supplementation with ascorbic acid and tocopherol does not affect muscle performance . Kondratov and colleagues investigated possible improvements of signs of premature aging (e.g., cataracts, cornea inflammation, joint ossification, and muscle waste) in bmal1 knockout mice by supplementation of n - acetyl - l - cysteine (nac), a low - molecular - weight antioxidant . . Showed -tocopherol supplementation in older fit men did not suppress postexercise elevations in biomarkers of muscle damage and lipid peroxidation such as in younger men . More recently, vitamin e and c supplementation have shown to reduce muscular levels of oxidative stress in repetitively loaded muscles of old rats, but no increase in muscle mass and maximal force production (after more than 4 weeks of training) was found . Consistent results were obtained by barker and colleagues after administration of vitamin e and c in men undergoing anterior cruciate ligament surgical repair . It might seem that the biological effects of antioxidant supplementations are easily captured as increased levels of antioxidant biomarkers . Differently, the clinically relevant and beneficial effects of antioxidant supplementation are more difficult to be obtained (always if obtainable!). First of all, it is possible that sarcopenia is not related to oxidative damage, so that the obtained negative results are indeed true negative findings . Second, it is not automatic that the modification of a biomarker concentrations is able to parallely change clinical parameters . It is more likely that subclinical effects are more sensible to changes than clinically evident manifestations . And this is particularly true when testing interventions in an extremely complex field as geriatric syndromes, in which one sign / symptom is not necessarily indicative of a well - defined condition . Different types and doses of antioxidants administered, timing of supplementation, the adopted animal species, and the measured biomarkers may represent other important causes of the negative findings . As mentioned, the heterogeneity and methodological limitations affecting the study of sarcopenia may further explain the controversial findings . Finally, it is noteworthy the extreme scarcity of available clinical trials in humans on this topic . In fact, most of the positive results are obtained in animal models and still wait to be confirmed in humans . Furthermore, recent studies reporting possible negative effects (e.g., cardiovascular and all - cause mortality) of long - term, high - dosage antioxidant supplementation (in particular, for vitamin e) cannot be ignored . In the present paper, we chose not to go into many details about posologies of antioxidant supplementations . Current literature on the topic is extremely heterogeneous for methodological approaches, study designs (i.e., in vivo, in vitro, epidemiological evaluations, clinical trials, animal or human models), interventions (single antioxidant molecules or in combination, timing of administration, posologies), and outcome measures (i.e., biomarkers of muscle decline). After all, sarcopenia is a condition theoretically defined only about 20 years ago, but its operative definition is still debated . In summary, there is some evidence that oral antioxidant supplementation may reduce muscle damage, but experimental results are largely preliminary and far to be clinically relevant, at least, as suggestive of positive benefits . In fact, a large body of evidence may indicate extreme cautiousness in taking antioxidant supplementation as preventive measures against aging process and age - related conditions . Further studies are needed to support the widespread practice of oral antioxidant supplementation and to determine appropriate recommendations in elderly . Although antioxidant supplementation through diet is receiving growing attention, antioxidant supplementation could benefit muscle protein metabolism during aging, but further trials in humans and with adequate sample sizes are required to clearly establish the hypothesized relationship between antioxidants and sarcopenia . In this context, a better understanding of oxidation mechanisms, timing and doses of antioxidant supplementation, and appropriate methodological approaches to study this theme is needed to provide convincing evidence and justify the current widespread use of antioxidants supplementation.
Gaining invasiveness and overcoming the physical barriers imposed by the extracellular matrix (ecm) are the first, and arguably most critical, steps of tumor metastasis . In addition to facilitating dissemination, remodeling of the ecm invadopodia of malignant cancer cells are actin - rich, ecm - degrading membrane protrusions that are critical for tumor invasion and metastasis . In a recent study, we investigated the regulation of invadopodium formation and metastasis by ca signaling in melanoma . We unexpectedly discovered that hyperactive ca signaling in metastatic melanoma cells is organized in the form of oscillatory waves to orchestrate invadopodia assembly and melanoma invasion . In recent years, dysregulated ca signaling has been increasingly implicated in cancer invasion and metastasis, yet the underlying mechanism remained largely unclear . To gain mechanistic insight into ca - mediated invasion and metastasis, we examined the role of ca signaling in invadopodium formation in melanoma cells and discovered that blocking store - operated calcium (soc) channel signaling significantly decreased invadopodium number and activity . Accompanying the assembly of invadopodia was an oscillatory ca signal mediated by the soc channel proteins stim1 and orai1 . Interestingly, disruption of the ca oscillation by either blocking store operated calcium entry (soce; which decreased cytosolic ca concentration), or by inducing constitutive calcium entry with thapsigargin or the ionophore a-23187 (which increased cytosolic ca concentration) similarly inhibited invadopodium assembly and melanoma invasion, signifying the importance of temporal ca signal coding during metastatic dissemination . By screening a panel of protein kinases, we identified the non - receptor tyrosine kinase src as a downstream effector of soce . The notion that soce regulates invadopodium assembly through src is further supported by the rescue of defective invadopodium formation in stim1 knockdown melanoma cells by constitutively active v - src, and the abrogation of stim1-mediated invadopodium assembly by the src inhibitor dasatinib . The fact that constitutive ca influx induced by thapsigargin and a-23187 was a robust activator of src begs the question: why do melanoma cells use an oscillatory ca signal instead of a steady ca increase? It is estimated that hundreds of genes in the human genome contain ca binding ef - hand or c2 domains . The specificity and versatility of ca signaling relies on the intricate spatial and temporal coding of cytosolic ca concentration . By compartmentalizing ca signals into spatial - temporal patterns, cells are able to activate selective downstream signaling events at a defined time and subcellular location . It is believed that the frequency and amplitude of ca oscillations serve as digital signals that selectively activate threshold - dependent downstream events . The tight control of cytosolic ca is critical not only for signaling specificity but also for cell survival, since a prolonged and uncontrolled global increase in cytosolic ca is toxic to the cell and eventually leads to cell death . By organizing soce signals in the form of ca oscillation, melanoma cells are able to provide the ca signal necessary for invadopodium assembly and ecm remodeling over an extended period of time without causing cytotoxicity (fig . In contrast, although constitutive ca influx induced by thapsigargin and a23187 robustly increases src activity it might also indiscriminately activate hundreds of other ca - dependent signaling pathways, which eventually reduce melanoma cell fitness and inhibit melanoma invasion (fig . (a) hyperactive store - operated calcium entry (soce) increases ca oscillation frequency and amplitude, which selectively activates src to promote invadopodium assembly and extracellular matrix remodeling . (b) disruption of ca oscillation, either by a constitutive increase in cytosolic ca or by blockage of soce, inhibits invadopodium formation and melanoma invasion . (a) hyperactive store - operated calcium entry (soce) increases ca oscillation frequency and amplitude, which selectively activates src to promote invadopodium assembly and extracellular matrix remodeling . (b) disruption of ca oscillation, either by a constitutive increase in cytosolic ca or by blockage of soce, inhibits invadopodium formation and melanoma invasion . It is also possible that melanoma invasion and invadopodium assembly require a coordinated cycle of ca peaks and valleys, as recently demonstrated in mast cell exocytosis by wollman and meyer . Ca oscillation in antigen - activated mast cells drives the cyclic assembly and disassembly of cortical actin . Newly assembled cortex actin serves as a carrier to capture secretory vesicles, whereas disassembly of cortical actin allows the passage of vesicles to facilitate membrane fusion . Intriguingly, we discovered that recycling of membrane type 1 matrix metalloprotease (mt1-mmp, also known as mmp14) to the plasma membrane required soce, blockage of which resulted in entrapment of mt1-mmp in endosomes . It would be interesting to determine whether soce - mediated ca oscillation coordinates the recycling of endocytosed mt1-mmp to the plasma membrane . Of note, tumor - promoting ca oscillation has also recently been observed in esophageal squamous cell carcinoma and hepatocellular carcinoma (hcc). Overexpression of orai1 in esophageal carcinoma cells is responsible for hyperactive ca oscillation, which promotes cancer cell motility and proliferation in vitro and tumor growth in a xenograft model . In hcc the voltage - gated calcium channel subunit cacna2d1 was found to be a marker for recurrent disease . Recurrent hcc cells had higher expression of 21 and hyperactive ca oscillation, which could be inhibited by a blocking antibody targeting cacna2d1 . These observations, together with our recent finding, suggest that ca oscillation might be a signaling mechanism that is commonly hijacked by malignant cells to facilitate cancer progression . Future investigation in this area will likely significantly advance our understanding of how deregulated ca signaling promotes cancer malignancy.
The decade of the eighties produced a number of significant changes in the medicaid program . Increased numbers of recipients, rising costs, and many other health care issues have had a major impact on the program . As a result, an awareness has grown that increased control over the direction of the program is necessary . A key element of management control is the availability of information that allows the analysis of options for informed decisionmaking . Thus, it is no coincidence that establishment or enhancement of medicaid management information systems (mmiss) continues to be encouraged by the health care financing administration (hcfa). Many states have also established eligibility information management systems for more effective administration of the various public assistance programs . As a result, a great deal of information has become available to managers that can be used to shape program goals and to assess trends and progress . Third - party liability (tpl) has come to play a more prominent role in the drive to better control medical assistance costs . Historically, utilization of third - party payment sources has been shown to be a very cost - effective method of reducing medicaid costs . The relatively small administrative cost investment in the eligibility determination process and in efficient management of benefit recovery can help control program cost outlays and/or provide revenues to help fund program eligibility and/or benefit expansions . In new york, the emphasis on tpl began in the early eighties just as statewide implementation of mmis was being completed . The new york medicaid program is locally administered, with the state department of social services (dss) serving as the central administrative agency . Prior to mmis, medicaid claims payment was performed by each local district in new york (there are 58, including new york city). The transition to a centralized payment system allowed counties to reassign staff to other areas; one of the priorities recommended strongly by the state was the establishment or enhancement of the tpl function . Each county was encouraged to set up a third - party specialist unit, with the state providing training and other support services . There are now approximately 200 full - time equivalent staff assigned to this function at the local level throughout the state . One of the key problems affecting program managers is how to meet new demands using the resources at hand . Not many states have the luxury of sufficient staff and other resources to respond to the growth and complexity of public programs . Even when resources are available, there is always the challenge of using them effectively by selecting the most viable options for resource investment . Clearly, the power of information can guide productive decisionmaking, if existing information is used in new and innovative ways . Two good illustrations of this type of opportunity in new york are: first, the use of information to sensitize local social services officials to the importance and impact of third - party resources and, second, the innovative use of expenditure data to facilitate decisions as to whether it is cost effective for medicaid to pay for an applicant's health insurance policy or allow it to lapse . Because the new york medicaid program is locally administered, there is a significant problem in attempting to channel county priorities and resources to achieve statewide goals . In this case, the goal was to maximize medicaid program savings through the detection and use of other health insurance available to medicaid clients . The exchange of information between local districts and the establishment of specific performance goals was vitally important to this effort . A natural byproduct of this approach was the introduction of a sense of competition among local districts that served as an indirect incentive to increase the detection and use of health insurance . A recurring management report that utilizes key program information and ranks counties by their performance was established: the statistical tracking and reporting system (stars). An example of a recent report for a county in upstate new york can be seen in figure 1 . From the large amount of information available centrally, two indexes were chosen that could be calculated from existing data sources within the new york mmis . The first, insurance detection, presents the extent to which local eligibility workers identify other health insurance resources . The index chosen (the detection percentage) is the number of individuals with health insurance divided by all people on assistance . That is, the number of recipients with health insurance divided by caseload equals the detection percentage . Subsets of detection percentages that measure performance by the categorical eligibility status of a client in the cash assistance, medical assistance only, and supplemental security income (ssi) areas were also derived . This was done because the various assistance programs upon which medicaid eligibility is based usually fall under different managerial authorities (e.g., there are usually separate cash assistance and medical assistance directors) and thus may perform quite differently even within a common or shared administrative structure . The first is a production statistic that counts the number of third - party transactions generated by a county and then divides that by the number of workers . This allows the state to measure productivity per worker to determine the proper staffing level for that county's program . This is a measure of how well a local district is entering third - party information into the eligibility management information system . In new york, insurance coverage is indicated by the entry of a series of codes that define the scope of the policy . For example, the codes cover inpatient hospital, physician, emergency room, clinic, drugs, dental, major medical, etc . Although it is difficult to generalize about insurance policies, most people with health insurance would be expected to have coverage for at least three or four service types, even on a basic policy . As a result, the state would expect an average coverage index per entry of at least three or four . One interesting example of the use of this index occurred when one of the counties being monitored had a coverage index of exactly 1.0 . Investigation revealed that the county was entering inpatient hospital coverage only, in order to process the information in as little time as possible . The state was able to intervene and correct the situation, with the result that the county now has a coverage index of 3.2, allowing a much wider variety of medicaid claims to be edited for cost - avoidance purposes . In figure 1, one can see examples of a recent report for a county in upstate new york . The use of this performance - oriented management strategy produced some dramatic results . Using table 1, one can compare the detection percentage information for three counties from january 1984, when we initiated stars, to december 1989 . As can be seen, the use of local feedback provided a strong incentive to improve . New york has been in the forefront of paying health insurance premiums for medicaid recipients . The state has implemented a computer software program that is used by the local districts to assist them in arriving at the decision to buy health insurance coverage under certain circumstances . This program takes advantage of the fact that applicants for medicaid often have health insurance available through a current or former employer . In the latter case, there may be conversion rights available to provide coverage on an individual rather than group basis . Given the opportunity to continue the health insurance policy, it then becomes incumbent on the medicaid program to determine when it is cost beneficial to do so . Through the early years of developing this program, a consistent problem was that it was often difficult to determine the benefit side of the cost - benefit ratio . The cost side is quite easy, of course, because this can be determined by calculating the premium amount to be paid . Expected benefits have often been subjectively based on qualitative judgments concerning past and future utilization of medical services . Because new york's program is locally administered, these decisions are made on a case - by - case basis by eligibility workers or third - party specialists in the field, in conjunction with their normal job activities . As a result,, there may be a tendency not to continue the policy because this represents the path of least resistance . In 1987, a project was initiated within the new york state dss to try to bring new technology to this troublesome problem by developing a computer program that would accept a number of variables and produce a decision automatically . To make this available to the greatest number of people, a personal - computer - based concept was developed, although the ultimate application would make this capability available through use of the existing network of terminals in local districts that are connected to the central mainframe . It was determined that the key information necessary to make these decisions was: aid category (aid to families with dependent children, supplemental security income, or medical assistance only). Insurance coverage (inpatient, drugs, durable medical expenditures, major medical, etc . ). To calculate the cost - benefit ratio, the cost side of the equation is simply the net amount of the premium that would potentially be paid by the state . The benefit side is much more difficult, because with a new medicaid applicant, specific expenditure history is lacking . It was determined that the best substitute would be medicaid expenditure averages for individuals or cases with similar characteristics . Using data available from mmis, expenditure averages were calculated based on aid category, geographic area, age, and gender . Some of the results of this analysis are shown in table 2 . When data are entered into the program, the total medicaid expenditure expectation for each individual in the case is calculated . By comparing the amount of expected average expenditures and which of these services are covered by the insurance policy, the value of the policy can be estimated . By comparing this amount with premium cost the result of this process provides a highly automated way to evaluate some of the most routine aspects of premium purchases . If the future utilization pattern is less than average, then a decision to buy can be wrong . If high - cost medical utilization appears to be imminent, or it can be determined that there is a pre - medicaid history of high medical costs, then a decision not to buy may be wrong . In any case, the computer software has to be used in conjunction with human judgment to optimize the decision to purchase coverage . Recently, statewide data on the amount, type, and cost of health insurance purchases were made available . This information will be evaluated to determine how cost effective the program has been and where enhancements might be made . Hopefully, this will allow us to fine tune the computer software and further increase the efficiency of the process . Information about other health insurance resources obtained by caseworkers during the client eligibility intake process, if effectively collected and creatively used, can be a major source of tpl savings . Evaluation of tpl data collection performance can motivate local offices to maintain high quality and productivity in eliciting and reporting relevant, accurate tpl data . New york uses a results - oriented method of measuring the number of known third - party resources and the amount of savings that are attributable to the information received from each county . Because eligibility intake activities and tpl data collection universally rely on geographically dispersed local contacts with clients, the approach used by new york is potentially applicable in other states, whether local offices are under state or, like new york, county jurisdiction . More and more states are adopting the practice of paying health insurance premiums when it is cost effective to do so . The automated cost - benefit analysis approach used by new york to determine whether to pay health insurance premiums on behalf of medicaid clients is a particularly interesting application of data available in the state's information systems . Although this article focuses on two techniques used by new york for enhancing its tpl program through use of information, there are many other innovative practices utilized by other states . The health care financing administration has issued a publication entitled third party liability in the medicaid program, a guide to successful state agency practices . This guide provides information on the two new york practices as well as other exemplary practices that could assist states in improving their tpl efforts . The guide enables state agencies to identify and assess those practices that have proven to be successful and are transferable to their own state operations . Copies may be obtained by writing to: health care financing administration attention: alfred czerski, central office coordinator room 273 east high rise building 6325 security boulevard baltimore, maryland 21207
India is currently undergoing a demographic transition, with a shift to a higher proportion of elderly (increased from 5.6% in 1961 to 7.4% in 2001). (1) increasing numbers of people are at risk of age - related visual impairment as the elderly population increases. (2) blindness and hearing impairment contribute heavily to the overall burden of impairment . More than half of all the impaired persons in india have either visual or hearing impairment. (3) even as the elderly are at a higher risk of developing disabilities, it is also possible that the presence of single or multiple disabilities may increase the risk of death among them . The at - risk approach, used in maternal and child health care, can be adopted for the care of the elderly as well. (4) identification of groups among the elderly, who are at a greater risk of dying, will facilitate targeted interventions, with optimal utilization of the available resources . Among them, blindness and hearing impairment could be two possible predictors of mortality . Various researchers in industrialized countries have studied the association of blindness and/or hearing impairment with mortality in the elderly. (517) it was felt that it would be useful to study this association in india . The objective of the present community - based prospective study was to examine the association of blindness and hearing impairment with mortality in a cohort of elderly persons, aged 60 years or more, in a rural area . The study was conducted in villages that are covered under the intensive field practice area (ifpa) of the comprehensive rural health services project (crhsp), ballabgarh, district faridabad, haryana . It is a collaborative project between the all india institute of medical sciences, new delhi, and the state government of haryana . Health care services are provided by medical officers and their teams of health assistants and health workers, through a network of two primary health centers and twelve sub - centers . A health management information system (hmis) is in place, wherein, every person in these villages is allocated a unique 16-digit number and is under continuous demographic surveillance . Ethical approval for the study was obtained from the ethics committee of the all india institute of medical sciences, new delhi, india . The relative risks reported in previous similar studies ranged from 1.15 to 2.9. (911) the december 2007, census data of this area had reported a death rate of 4.45% in elderly persons . Considering a relative risk of 2.0, and 4.45% deaths among the non - blind elderly persons, with a 5% level of significance, and power of 80%, the estimated sample size was 1381 elderly persons . This sample size was calculated for an exposed: unexposed ratio of 1: 3 . The study population consisted of all elderly persons (age 60 years) living in the study villages at the time of baseline examination . The total population of the selected villages was 23979, including 1465 (6.1%) elderly persons (crhsp ballabgarh december 2007 census). Of these 1465 persons, 1422 (97%) were recruited and followed up for the outcome measurement, with no loss to follow - up . Of the remaining 43 persons, 17 refused to participate, 16 were excluded from the study, as it was not possible to administer the study tests to them, and 10 could not be contacted despite three visits to their homes . Baseline data collection was carried out from may 2008 to august 2008, and follow - up data collection was completed in the month of december 2009 . A questionnaire was administered to all the study participants, to collect information on the sociodemographic details, history of associated morbidities (hypertension, diabetes mellitus, coronary artery disease, stroke, and any orthopedic impairment), data on self - rated health, and feeding and dressing . It was developed in english, translated into hindi, and then back - translated into english to check for the correctness of the translation . The history of five of the above - mentioned specific morbidities was elicited by asking the question, are you suffering from any of these illnesses, or have you taken treatment for any of them? Orthopedic impairment was assessed by observation as well . The vision was recorded at a distance of 6 m separately for each eye; with distant glasses, if any . Blindness was defined as a visual acuity of less than 6/60 in the better eye, with available correction . For hearing assessment, all participants were administered the whisper test first, and subsequently examined with the rinne's test and weber's test, using a 512 hz tuning fork by the investigator . The initial calibration and fortnightly appraisals during the period of data collection were done under the supervision of a faculty from the department of the ear, nose, and throat (ent), all india institute of medical sciences, new delhi . All participants found blind or hearing impaired at the time of baseline examination were referred to ophthalmology and ent clinics at the comprehensive rural health services project (crhsp), ballabgarh hospital for management . They were asked about any improvement of visual / auditory status during the follow - up period . Data for the outcome variable, that is, all - cause mortality during the follow - up period, were collected from death registers maintained by health workers of the sub - centers covering the respective villages . Accredited social health activists (ashas) and anganwadi workers of the respective villages were also contacted to collect data on the deaths that occurred after the last visit of the health worker . Furthermore, the mortality data were cross - checked for deficiencies / discrepancies, if any, with the health management information system (hmis) at crhsp, ballabgarh . The association of the demographic variables and various self - reported morbidities, with mortality, was compared using the chi - square test . The cox proportional hazard models, both univariate and multivariate, were used to find the hazard of blinding and hearing impairment on mortality . Results of the 1422 participants 58.1% were in the age group of 60 to 69 years . About half (51.7%) of the participants were female and three - fourth of the participants (75.5%) had had no schooling . Sixty - two (4.4%) participants were dependent on others for dressing and 53 (3.9%) for feeding . Hypertension was reported by 10.7% and diabetes mellitus by 6.9% participants [table 1]. Their own health was reported as fair by 68.3%, poor by 14.9%, good by 13.5%, very poor by 1.8%, and excellent by 1.5% of the participants . Baseline characteristics of the participants there were no out - migrations among participants during the follow - up period . No participant reported improvement of vision or hearing impairment during the follow - up period . One hundred out of the 1422 (7%) participants died during the follow - up period . The follow - up period for participants ranged from a minimum of three days to a maximum of 567 days, with the median follow - up period being 518 days . Out of 134 blind participants, 15 (11.2%) died, as compared to 85 deaths (6.6%) out of 1288 participants with normal vision (p=0.048). The percentage of deaths was significantly (p=0.001) higher in participants with hearing impairment (13.3%), as compared to participants with no hearing impairment (5.9%). After adjustment for all the covariates (age, sex, literacy, hypertension, diabetes mellitus, coronary artery disease, stroke, orthopedic impairment, dressing, feeding, self - rated health), neither blindness nor hearing impairment was found to be significantly associated with mortality . Adjustment for only morbidities had no effect on the crude hazard ratios [table 2]. Association of blindness and hearing impairment with mortality on further exploratory analysis by age and sex, hearing impairment was found to be significantly associated with mortality in the age group 70 years with a hazard ratio of 2.13 (1.29 3.54; 95% ci). Hazard ratios for blindness in the age group 60 69 years could not be calculated, as there were no events in that group [table 3]. In this cohort study, we investigated the association of blindness and hearing impairment with mortality in the elderly age group in a rural area . A few studies conducted across the world have addressed the same study question, albeit in urban areas. (517) in the indian context, as more than two - thirds of the population is residing in rural areas, this is an important consideration . This corroborates the evidence generated from similar previous studies. (517) the male gender appeared to be protected for blindness as compared to the female gender in this univariate analysis . However, no association existed between blindness and mortality, after adjustment was made for sociodemographic factors (age, sex, and literacy). One of the possible reasons for the differing results could be the different sociodemographic factors for which the adjustments were made. (512) in the study by wang et al ., from australia, adjustments were made for height, weight, body mass index, and home ownership, apart from age and sex,(5) and in another study by lee et al . From usa, adjustments were made for age, sex, race, and marital status. (7) adjustments only for the selected morbidities, had no effect on the observed association between blindness and mortality . This was in support of the evidence generated by various similar previous studies. (5681012) however, in some studies, the observed association between blindness and mortality was no longer present, at least in some subgroups, once the adjustments were made for the identified confounders. (711) this could be due to a difference between various potential confounders adjusted for in the studies, and different methods used for their ascertainment . Hearing impairment remained associated with mortality; however, the results became insignificant once adjustments were made for the sociodemographic factors, especially age . This was in agreement with one study conducted in canada by ostbye et al. (15) hearing impairment was found to be significantly associated with mortality even after adjustment for all the potential confounders in the age group of 70 years or more . Similar significant associations were reported in the same age group in one previous study in italy. (16) it is possible that hearing impairment is a marker of accelerated aging, and hence, is indicative of a greater risk of death in those who are hearing impaired ., in the united states, significant association was found between hearing impairment and mortality among a group of women belonging to the non - white, non african american race (including asians, among others). (14) a couple of limitations need to be mentioned . First, the period of person - years of follow - up in the present study was smaller in comparison to other similar studies, mostly due to the lower duration of follow - up . Second, the method of ascertainment of the comorbid conditions was self - reported by the participants, which could have resulted in some diagnostic gap for the said morbidities . To conclude, the results of the present study showed that elderly persons aged 70 years, residing in the rural area, who suffered from hearing impairment, were at increased risk of mortality, as compared to persons without this impairment . Sociodemographic factors (age, sex, and literacy) had a strong confounding effect . However, the presence of various comorbid conditions (hypertension, diabetes mellitus, coronary artery disease, stroke, and orthopedic impairment) had no effect on this association . The presence of hearing impairment in the age group 70 years should be considered as a risk factor for mortality, and more efforts for mortality reduction should be directed toward this at - risk group through screening . With the increase in the elderly population in india, similar studies with longer follow - up periods
Gelastic seizures (gs) are an uncommon seizure type; they are characterized by sudden inappropriate attacks of uncontrolled and unmotivated laugh . One century later, the term gelastic epilepsy (from gelos: joy), was suggested by daly and mulder to define epileptic fits where laughter is the only or predominant symptom . The diagnosis criteria were given by gascon; these included stereotypical recurrence of laugh, which is unjustified by the context, associated signs compatible with seizure, and ictal or interictal abnormalities . Gs could be cryptogenic or symptomatic of a variety of cerebral lesions, most commonly hypothalamic hamartoma . However, gs associated with other types of cerebral lesions are exceedingly rare . The physiopathologic mechanisms of this type of seizure are still undefined . Two reports have described a non - lesional gs arising from a parietal focus . In this paper we report the first case of gs lesion associated to the parietal area of the brain in a child . A 5-year - old boy was referred to our department for recurrent fever and uncontrolled epilepsy . The patient was the youngest one in a family of five children born out of a consanguineous marriage, but without any other significant familial history . He was born at full - term without any perinatal problem, and weighed 3,400 g . He walked at the age of 13 months and acquired verbal language at the age of 18 months and his first seizures occurred by the age of 14 months . These attacks were characterized by generalized tonic clonic seizures with a frequency of 12 times per month . He was initially treated using phenobarbital then valproate without any significant improvement . By his 4 year, the patient started expressing daily laughing attacks that were occurring 23 times a day while each was lasting for about a minute . This stereotypical laugh was unrelated to the context; the patient was generally unconscious during attacks and experienced post - ictal amnesia . Most often, an undescribed feeling occurred prior to seizure associated with left hemi - corporeal paresthesia . These seizures were associated to episodes of fever up to 39.5c; these episodes occurred almost everyday and resolved spontaneously in less than 3 h. the fever rose with the start of gelastic attack and lasted 23 hours and sometimes occurred independently . He was 104 cm tall (50 percentiles), weighting 17 kg (50 percentiles) with 50 percentiles head circumference . Complete paraclinical investigations were performed, this included c - reactive protein, sedimentation rate, leukocyte count, urinalysis, lumbar puncture, thorax radiography, cardiac and abdominal ultrasound - and were not suggestive of infection . A cerebral magnetic resonance imaging (mri) revealed a lesion in the right parietal area, suggestive of cortical dysplasia . Functional mri was performed using sensory tasks which showed activation in the sensory cortical area as well as in the lesion [figure 1]. Interictal electroencephalography (eeg) showed sporadic active spiking in the right temporal region [figure 2]. Fluid attenuation inversion recovery magnetic resonance image showing a hyperintense lesion in the right parietal area interictal scalp electroencephalography indicating repetitive spikes in the parietal area they are mostly associated to hypothalamic hamartoma, drug resistance, precocious puberty, and mental decline. [59] secondary gs outside diencephalic lesion are very rare; they are most often attributed to a temporal focus . Rarely a frontal origin was usually reported,[1214] while parietal localization is exceptional . Among these localizations some differences in clinical profiles were noticed in reports of the literature according to the localization of the epileptic activity . It can appear sometimes natural and forced; and the seizure is not accompanied by a rupture of contact . The laughter may be natural or forced, unmotivated or in response to a pleasant sensation . The laughter is unnatural in frontal focus; and appears as if being forced, non - communicative without any affective connotation; and rupture of contact is frequently observed. [1214] a single patient was reported with parietal localization of the epilepsy, he was presenting veritable laughter attacks, described as inappropriate, involuntary and with contact rupture . Our case is probably the third one with parietal localization, and the only among the three, which is related to a cortical dysplasia . The physiopathologic mechanisms of this type of seizure are unclear and still need elucidation . Various anatomical regions have been reported to elicit laughing; this includes, hypothalamus, anterior cingulate gyrus, the orbito - frontal cortex, the baso - lateral temporal cortex, supplementary motor area and possibly parietal area . Several studies using electrical stimulation and ictal spect have demonstrated that joy feeling is dependent on the basal temporal cortex while motor aspect of laughter is organized in anterior cingulate area. [1720] in hypothalamic hamartoma, seizure is directly generated in hypothalamus and paroxysmal activity is spread in temporal area through hypothalamic - amygdala connections . Schematically, all anatomical areas mentioned above are organized in a large neuronal network, and activating one of these areas may activate a part or the whole network leading to gs . Fever has been rarely described in the literature as ictal or peri - ictal symptom and has never been associated to gs . Few cases of peri - ictal fever were reported, mainly related to non - convulsive seizure and rarely with a confusion state. [2225] the physiopathology of fever is not yet clear . First, the hypothalamus might be involved in the pathogenesis, ictal activity could spread to the hypothalamus via neuronal connections and would involve the pre - optic area including localized thermoregulation center leading to central thermoregulation disturbance during few hours . However, fever has never been reported in hypothalamic hamartoma, with the fact that ictal activity spreads from hamartoma towards the cortex, while the other way is not true . Regarding our patient, the ictal activity seems to be generated in the cortical area; both fever and gs probably resulted from hypothalamic involvement, which supports the major role of hypothalamus in the neuronal network described above . The two other hypotheses consist of pyrogenes production during the ictal activity and vagal nerve nuclei involvement that was demonstrated using vagal nerve stimulation treatment . Indeed, the role of the vagal nerve in temperature elevation is correlated to increased blood perfusion of the hypothalamus in - patients treated with vagal nerve stimulation . Fever might accompany the gs when it originates from cortical focus in temporal, frontal or parietal cortical areas; this could be misdiagnosed or most often underreported as a peri - ictal symptom since infection is usually thought of in such a patient . Fever should be investigated in epileptic patients in order to better assess the prevalence of this feature as a peri - ictal symptom . In the mean time, it is interesting to review all reported literature for better understanding the pathophysiological mechanisms involved in both gs and peri - ictal fever.
During november 2012june 2014, a total of 177 international travelers returning to ontario were considered persons under investigation (puis) for mers - cov, according to the guidelines of the ontario ministry of health and long - term care (6). Puis were recommended to be isolated and screened for mers - cov and other respiratory pathogens (6). Nasopharyngeal swab samples and, for persons on ventilators, bronchoalveolar lavage specimens were collected from patients and submitted to public health ontario laboratories (phol), the provincial reference laboratory for mers - cov testing (6). Fecal specimens were collected when patients had diarrhea, and urine was collected during early phases of the outbreak when appropriate specimen collection standards were ill - defined (6). Mers - cov real - time reverse transcription pcr (rrt - pcr) targeted regions upstream of the e gene and within open reading frame 1b, as recommended by who (8). Influenza rrt - pcrs targeted the influenza a matrix gene and influenza b nonstructural 1 gene using centers for disease control and prevention (cdc; atlanta, ga, usa) protocols . If the rrt - pcr was positive for influenza a virus, we conducted subtyping for seasonal influenza a(h3n2) virus hemagglutinin gene (cdc assay) and influenza a(h1n1)pdm09 virus neuraminidase gene (in - house assay) (9). Respiratory specimens were further tested by using seeplex rv15 ace multiplex respiratory viral assay (seegene inc ., targets included human rhinovirus, enterovirus, influenza a and b viruses, parainfluenza viruses 14, respiratory syncytial virus a and b, adenovirus, bocavirus, human metapneumovirus, human coronavirus oc43, and human coronavirus 229e / nl63 . Mycoplasma pneumoniae and chlamydophila pneumophila testing was conducted by using propneumo-1 multiplex assay (gen - probe inc ., san diego, ca, usa). Pcr was conducted for legionella species by using a protocol developed by cdc (10); binaxnow legionella urinary antigen test (binax inc ., portland, me, usa) was also conducted to test for l. pneumophila serogroup 1 . Of 177 puis (mean age 48.1 years, range <188 years; 56% male), 54.8% returned from saudi arabia or uae . Identification of puis peaked after the october 2013 hajj and after the first 2 mers - cov cases were imported into the united states in may 2014 (figure). All puis had ari; of the 85 puis for whom data were available, 47 (55%) and 74 (87%) had respiratory specimens collected within 5 and 14 days (median 4 days) from symptom onset, respectively . Specimens collected were as follows: 185 upper respiratory, 10 lower respiratory, 98 urine, 97 blood, 11 fecal, and 1 pleural fluid . Symptom onset varied from 17 days before return to 10 days after return (median <1 day after return) for the 20 puis for whom this information was supplied . One patient was excluded from the time - to - collection analysis because the specimen was collected under extenuating circumstances: testing was conducted because of worsening respiratory symptoms beginning 57 days before the patient returned from overseas . Puis and counts of major respiratory pathogens identified in travelers returning to ontario, canada, from countries affected with middle east respiratory virus coronavirus, december 2012june 2014 . Pui, persons under investigation . At least 1 respiratory pathogen (bacterial or viral) was detected in 89 (50.3%) puis; however, for most (87 [98%] of 89) patients, only viral pathogens were identified (table). Influenza was the most common virus identified: 27 (15.3%) persons tested positive for influenza a, 14 (7.9%) for a(h3n2) and 13 (7.3%) for a(h1n1)pdm09; 14 (7.9%) tested positive for influenza b. rhinovirus was also common, detected in 35 (19.8%) persons, with a peak in the fall, in keeping with its seasonality in canada (figure; table). Similarly, influenza a(h3n2) peaked in the fall, whereas influenza b and a(h1n1)pdm09 peaked in late spring . * cov, coronavirus; mers, middle east respiratory virus; na, not applicable . Among the 177 returned travelers, no respiratory pathogen was found for 88 (49.7%). Among the remaining 89 (50.3%) returned travelers, at least 1 respiratory pathogen was found; 12 (6.8%) of these persons had viral co - infections . Among the 12 co - infections were 8 rhinovirus co - infections (4 persons with influenza a and 1 each with influenza b, enterovirus, cov oc43, parainfluenza); 1 influenza a cov oc43 co - infection; 1 influenza b respiratory syncytial virus; 1 cov 229e / nl63adenovirus; and 1 cov 229e / nl63human metapneumovirus co - infection . Given the relatively low volume of travelers arriving to canada and ontario from mers - cov affected areas (0.6% of total global travel from mers - cov affected areas entered canada during june november, 2012, and <50,000 nonresident travelers entered ontario from affected countries in 2012) and lower rates of human - to - human transmission, risk of importation to ontario and subsequent local spread is likely low (1,13). Although the risk for mers - cov importation is low, respiratory virus infections acquired abroad or locally after returning to canada might be relatively high and consistent, occurring in 87 (49.2%) of 177 puis during the study period . Most influenza b cases were detected shortly after the 2014 ontario peak (phol, unpub . Furthermore, 75% of puis with influenza b reported symptom onset within 4 days after their return, possibly indicating local acquisition . Similarly, puis with enterovirus or rhinovirus detected probably acquired disease in canada, given the short incubation period (mean 1.9 days) of rhinovirus (14). Because limited information about clinical severity or outcomes was reported to phol, we were unable to report on the clinical spectrum of pui presentation . Furthermore, pathogens were not identified for all samples, possibly because of delays between symptom onset and specimen collection, sampling technique, or other factors . The number of puis with influenza (41 [23.2%]), whether acquired locally or abroad, is of particular concern . Influenza vaccination should be a priority for all persons and should be recommended by health care practitioners who advise travelers . In addition, surveillance should continue for other respiratory pathogens so that their effects on health systems, when they co - circulate with emerging pathogens with similar clinical presentation, can be better understood.
Nationwide surveillance of mrsa in finland, including notification for human cases and isolate characterization, was started in 1995 (6). From 1995 through april 2009, a total of 10,615 nonduplicate human isolates of mrsa were typed by using pulsed - field gel electrophoresis (pfge); 1 in 2007, 6 in 2008, and 3 in 2009 (n = 10, 0.09%) were nontypable, a typical feature of mrsa cc398 isolates (7). No systematic national mrsa surveillance for animals exists, but it is possible to send suspected isolates for confirmation . After the horse epidemic in 2007, some admission screening of animals started at the veterinary hospital where the epidemic occurred . From january 2007 through april 2009, a total of 35 animal mrsa isolates were typed by pfge; 20 (57%) were nontypable . For this study, all human and animal isolates of mrsa nontypable by smai pfge were further analyzed by testing antimicrobial drug susceptibility against 14 different antimicrobial drug groups, typing the ccr and mec complex regions within the staphylococcal cassette chromosome mec (sccmec) by pcr (8), detecting the presence of panton - valentine leukocidin (pvl) genes (9), spa typing, and pfge by using apai as the restriction endonuclease . Apai pfge was performed as described (10), except that the restriction digestion was performed with apai at 30c for 4 h, and initial and final switching times of 5 s and 15 s, respectively, were used for a 20-h pfge run . Multilocus sequence typing (mlst) (11) was performed on representative isolates of each different combination of origin (human vs. animal species), spa type, and sccmec . For persons whose mrsa isolate was nontypable by smai pfge, a structured questionnaire was used to inquire about the presence of commonly known healthcare - related risk factors for mrsa (technical appendix). These data were collected from infection control nurses at relevant healthcare districts or directly from patients by telephone interview . Pfge - nontypable isolates were found in samples from 10 humans, 13 horses, and 7 pigs . Based on combined results from spa typing, sccmec, and pvl pcr, 1 single t2922 isolate and 4 clusters of isolates were identified: 14 isolates (t011, sccmeciv) related to the horse epidemic; 3 human isolates (t011, sccmecv) from 2 hospital districts (a and b); 5 human isolates (t034, sccmecv, pvl positive) from 1 hospital district (c); and 7 isolates (t108, sccmecv) from pigs (table 1). The human t034 isolates from 1 hospital district (c) fell into 1 group . Although all but 1 of the human t011 isolates were clustered together with the pig t108 isolates, subtype - level differences were still detected within this group . Isolates from the horse epidemic formed the third group, showing subtype - level difference from the t2922 human isolate . Resistance patterns to erythromycin, gentamicin, tobramycin, and clindamycin (inducible or noninducible) varied but followed the same grouping as in apai pfge (table 1). * mrsa, methicillin - resistant staphylococcus aureus; cc, clonal complex; sccmec, staphylococcal cassette chromosome mec; mlst, multilocus sequence typing; tet, tetracycline; gen, gentamicin; tob, tobramycin; ery, erythromycin; cli, clindamycin . Dendrogram of apai pulsed - field gel electrophoresis of methicillin - resistant staphylococcus aureus clonal complex 398 . The human mrsa cases with cc398 isolates had no contact with each other . In 2 persons, the specimen was taken because of clinical symptoms, in 6 because of screening, and in 2 persons for unknown reasons (table 2). For others, no direct contacts with horses or pigs were identified, and none owned a pet (table 2). * our nationwide population - based surveillance for mrsa showed the emergence of mrsa cc398 in 2007, and in total 10 findings in humans through april 2009 . Molecular typing of both human and animal mrsa cc398 isolates identified 4 clusters; in only 1 was human carriage linked to occupation and related to the horse epidemic . Another cluster consisted of pig isolates, and 2 other clusters consisted of human isolates . The other patients with mrsa lacked or had negligible animal contacts; instead, most of them had previous healthcare contacts . According to the national guidelines for mrsa control, screening is indicated when a patient has previously carried mrsa, has been exposed to a mrsa carrier, has been recently cared for at a facility where mrsa is endemic, or during an outbreak . Although some persons were possibly screened because of recent exposure to another mrsa carrier, direct transmission in these instances was unlikely because these persons carried different strains . Connections to asia have previously been reported for persons with pvl - positive, t034 mrsa (4). Two cases of pvl - positive, spa type t034, mrsa infections in persons who had no contact with animals have also been reported from sweden (13). The proportion of cc398 of all mrsa in humans was far lower in finland (0.09%) than in the netherlands (30% in 2007) (14). Notably, the prevalence of mrsa in pigs is 40% in the netherlands (1), whereas in finland it is expected to be lower (15). The densities for pig and humans in the netherlands are 60 and 30 times higher than those in finland (http://epp.eurostat.ec.europa and www.stat.fi) respectively, and there are differences in screening policies . In the netherlands, it remains to be investigated whether the low occurrence of cc398 and lack of direct animal contacts among cc398 case - patients are related to lower occurrence of mrsa in animals, sparse pig and human populations, or screening policies in finland . Although questions about traveling abroad were included, these data were difficult to interpret in relation to mrsa acquisition because travel is common . Except for the isolates from the horse epidemic, human and animal isolates were distinguished from each other by using a combination of molecular typing techniques . Pfge method may help in resolving outbreaks . Despite closely related and typical livestock associated spa types, apai pfge distinguished the t108 pig isolates from the t011 human isolates at a possibly related level (45 band differences). In addition, the presence of 2 different sccmec types among t011 and nonexistent links in time and space between human cases may suggest unrecognized transmission chains in the community.
Anemia accompanies a variety of chronic illnesses including inflammatory disorders, neoplasia, and infection . In some infection diseases such as mycoplasma pneumoniae, correlative clinical reports, supported by in - vitro studies, suggest a significant role for the inflammatory cytokines interferon gamma (ifn) and tumor necrosis factor- (tnf-) in the onset of anemia . However, direct in - vivo studies of the causes of anemia during infectious disease have not been performed, and the underlying mechanisms remain poorly defined . Deficiencies in the production of ifn or the ifn receptor (ifn-r) result in impaired resistance to bacterial, viral, and parasitic infections . Ifn initiates protection from infection by inducing the expression of genes that enhance immunity and exert antimicrobial functions . In addition to its well - recognized protective effects, pathological effects have also been attributed to ifn production during viral, helminth, and parasitic infections . Specifically, production of ifn has been correlated to the onset of anemia during both autoimmune and infectious disease . In vitro evidence however, direct in - vivo mechanisms for ifn-induced anemia during infection remain to be fully elucidated . The binding of ifn to cellular receptors stimulates recruitment and activation of members of the janus kinase and signal transducer and activator of transcription (stat) family . Specifically, stat1 is involved in the transcriptional regulation of ifn-inducible genes phagocyte nadph oxidase (phox), inducible nitric oxide synthase (inos) and inducible protein 10 (ip-10), all of which are involved in host resistance to infection . These antimicrobial genes also are implicated in the induction of pathology during a variety of infections . Toxoplasma gondii is an obligate intracellular, protozoan parasite that causes significant disease in immunocompromised patients and upon transplacental transmission to the developing fetus . Host defense against t. gondii infection has been extensively studied in murine models, where it has been found that protection is mediated by a robust type 1 immune response characterized by the production of large quantities of ifn. In this setting, however, ifn also functions pathologically . Demonstrated that intestinal pathology accompanying acute t. gondii infection was abrogated by suppression of ifn. In addition, we demonstrated that mice infected with t. gondii exhibit anemia that is characterized by decreased hematocrits and is dependent upon production of ifn. Mice lacking hemostatic function (i.e., fibrin[ogen] or warfarin - treated mice) displayed exacerbated ifn-induced anemia, suggesting that hemorrhage is responsible for the anemia . Therefore, in this study, we further characterize the ifn-dependent anemia during t. gondii infection in mice . We demonstrate that ifn production during t. gondii infection both decreases red blood cell (rbc) production as evidenced by reduced numbers of circulating reticulocytes, and simultaneously increases the loss of circulating rbc . However, analyses of erythropoiesis and rbc loss in fibrin (ogen), ifn, ifn-r, and stat1 mice revealed that infection - stimulated anemia primarily results from ifn-dependent, stat1-independent rbc loss . These findings will lead to a better understanding of the pathways that result in ifn-mediated protection versus ifn-mediated pathology, and should thereby enable the development of therapies that alleviate pathology while maintaining protection . C57bl/6, 129s6, stat1, ifn, ifn-r, tnf, and nos2 mice were purchased from the jackson laboratory (bar harbor, me, usa). Phox / inos mice and fibrin(ogen) mice were generously provided by li chen (xinan hospital, chongqing). Animals were housed in a specific pathogen - free facility and cared for according to the general hospital of chinese people's liberation army and yuhuangding hospital animal care and use committee guidelines . Toxoplasma gondii strain me49 was originally provided by li chen (xinan hospital, chongqing) and maintained by serial passage in c57bl/6 mice . For experimental infections, mice were infected perorally with indicated numbers of cysts in 0.1 ml diluted brain suspension obtained from infected animals, as previously described . Sham - infected mice received similarly diluted brain suspensions from uninfected animals . At the indicated times, samples from each mouse were harvested, processed, and analyzed individually . Where indicated, mice were treated with polyclonal anti - ip-10 (100 g, i.p . Every other day) blood samples from anticoagulated mice (500 u heparin, intravenously) were obtained by cardiac puncture immediately following euthanasia by carbon dioxide narcosis . For the determination of hematocrits and total number of circulating rbcs, blood was diluted 20-fold in 5 mm edta and analyzed using a coulter counter (beckman coulter, usa). Ifn protein levels in sera were measured by sandwich elisa (bd biosciences, usa). To quantify numbers of circulating reticulocytes, 5 l of blood was stained with 500 l thiazole orange solution (retic - count, bd biosciences) for 1 h at room temperature, centrifuged at 800g for 5 min, and resuspended in 1% formaldehyde . The percentage of thiazole orange - stained rbc (i.e., reticulocytes) was determined by flow cytometry, using forward and side scatter to gate on rbc . The total number of reticulocytes was then calculated by multiplying the percentage of reticulocytes by the total number of rbc as determined by coulter counter . Red blood cell survival was measured by biotinylating all circulating cells in vivo, and then monitoring the loss of biotinylated rbc over time . In vivo biotinylation was performed the day prior to infection by retro - orbital injection of 1.2 mg biotin, dissolved in 10% dimethyl sulfoxide, given in a split dose 2 h apart . Mice were then euthanized on the indicated days, and 5 l blood was stained with streptavidin conjugated with phycoerythrin (bd pharmingen) and ter119 mab conjugated with fluorescein isothiocyanate . The percentage of streptavidin - positive ter119-positive cells in each sample was identified by flow cytometry and multiplied by the total number of rbc determined by coulter counter to obtain total numbers of biotinylated rbc . Levels of tnf-, inos, and ip-10 mrna in liver tissue were measured by real - time polymerase chain reaction (pcr) (perkinelmer). Real - time pcr primer and probe sequences for tnf- and inos primer combinations for ip-10 are as follows; ip-10-forward ctgccgtcattttctgcctc, ip-10-reverse cactggcccgtcatcgatat, ip-10-probe cgcaaggacggtccgctgc . The data about hematocrit drop, rbc production and rbc loss were analyzed by one - way analysis of variance (anova). Both student's t - test and one - way anova were performed using the computer program prism 5.0 (graphpad software inc . C57bl/6, 129s6, stat1, ifn, ifn-r, tnf, and nos2 mice were purchased from the jackson laboratory (bar harbor, me, usa). Phox / inos mice and fibrin(ogen) mice were generously provided by li chen (xinan hospital, chongqing). Animals were housed in a specific pathogen - free facility and cared for according to the general hospital of chinese people's liberation army and yuhuangding hospital animal care and use committee guidelines . Toxoplasma gondii strain me49 was originally provided by li chen (xinan hospital, chongqing) and maintained by serial passage in c57bl/6 mice . For experimental infections, mice were infected perorally with indicated numbers of cysts in 0.1 ml diluted brain suspension obtained from infected animals, as previously described . Sham - infected mice received similarly diluted brain suspensions from uninfected animals . At the indicated times, samples from each mouse were harvested, processed, and analyzed individually . Where indicated, mice were treated with polyclonal anti - ip-10 (100 g, i.p . Every other day) antibody . Blood samples from anticoagulated mice (500 u heparin, intravenously) were obtained by cardiac puncture immediately following euthanasia by carbon dioxide narcosis . For the determination of hematocrits and total number of circulating rbcs, blood was diluted 20-fold in 5 mm edta and analyzed using a coulter counter (beckman coulter, usa). Ifn protein levels in sera were measured by sandwich elisa (bd biosciences, usa). To quantify numbers of circulating reticulocytes, 5 l of blood was stained with 500 l thiazole orange solution (retic - count, bd biosciences) for 1 h at room temperature, centrifuged at 800g for 5 min, and resuspended in 1% formaldehyde . The percentage of thiazole orange - stained rbc (i.e., reticulocytes) was determined by flow cytometry, using forward and side scatter to gate on rbc . The total number of reticulocytes was then calculated by multiplying the percentage of reticulocytes by the total number of rbc as determined by coulter counter . Red blood cell survival was measured by biotinylating all circulating cells in vivo, and then monitoring the loss of biotinylated rbc over time . In vivo biotinylation was performed the day prior to infection by retro - orbital injection of 1.2 mg biotin, dissolved in 10% dimethyl sulfoxide, given in a split dose 2 h apart . Mice were then euthanized on the indicated days, and 5 l blood was stained with streptavidin conjugated with phycoerythrin (bd pharmingen) and ter119 mab conjugated with fluorescein isothiocyanate . The percentage of streptavidin - positive ter119-positive cells in each sample was identified by flow cytometry and multiplied by the total number of rbc determined by coulter counter to obtain total numbers of biotinylated rbc . Levels of tnf-, inos, and ip-10 mrna in liver tissue were measured by real - time polymerase chain reaction (pcr) (perkinelmer). Real - time pcr primer and probe sequences for tnf- and inos primer combinations for ip-10 are as follows; ip-10-forward ctgccgtcattttctgcctc, ip-10-reverse cactggcccgtcatcgatat, ip-10-probe cgcaaggacggtccgctgc . The data about hematocrit drop, rbc production and rbc loss were analyzed by one - way analysis of variance (anova). Both student's t - test and one - way anova were performed using the computer program prism 5.0 (graphpad software inc . Infection of c57bl/6 mice with t. gondii induced robust ifn production [figure 1a] that correlated kinetically with decreased hematocrits [figure 1b] and numbers of circulating rbc [figure 1c]. To further delineate the mechanisms underlying this anemia, we quantified rbc production throughout the course of t. gondii infection . After their release from bone marrow as erythroblasts, rbc retain rna for 2448 h. during this period, rbc was referred to as reticulocytes and can be enumerated using flow cytometric assays employing rna - binding dyes . Using such an assay, we found that numbers of reticulocytes in infected mice were comparable to those of sham - infected mice up through day 6 . At day 8, post infection reticulocyte numbers decreased significantly, but rebounded by day 10 and then remained elevated until the anemia resolved [figure 1d]. These results indicate that rbc production only briefly decreases during t. gondii infection, and fully recovers prior to the peak of anemia at day 10 . Interferon gamma (ifn-) dependent hematocrit drop during toxoplasma gondii infection is a result of decreased red blood cell (rbc) production and increased rbc loss . Wild type c57bl/6 mice were infected with 10 me49 cysts and injected with biotin as described in materials and methods . (a) serum ifn levels; (b) hematocrit; (c) rbc numbers; (d) total number of reticulocytes; (e) total number of biotinylated rbc and (f) occult blood were evaluated on days indicated . Significant differences between sham - infected controls and t. gondii - infected mice are depicted (* p <0.02). All data are represented as mean sd of four mice per group . Based on data in figure 1d, decreased production of rbc can only account for at most a deficit of 0.8 10 rbc . Since t. gondii - infected mice have approximately 3.55 10 fewer circulating rbc than sham control mice on day 10 of infection [figure 1c], an alternative mechanism to decreased erythropoiesis must account for the 2.75 10 decrease in total rbc in infected mice . Therefore, we investigated the possibility that anemia results also from rbc loss . To estimate the rate of rbc loss, we pulse - labeled rbc with biotin in vivo and measured the number of biotin - labeled rbc remaining at various time points throughout t. gondii infection . Figure 1e indicates that sham - infected mice lost circulating biotinylated rbc at an average rate of 2.1% per day . In contrast, t. gondii - infected mice lost circulating biotinylated rbc at an average of 11.4% per day between days 6 and 10 of infection accounting for a total of 2.4 10 rbc . After that time thus, t. gondii - infected mice display a significant increase in rbc loss during the same period at which they display anemia . To evaluate whether the loss of rbc resulted from t. gondii - induced hemorrhage, we obtained fecal samples from infected animals at various days of infection and analyzed for the presence of occult blood . We detected fecal occult blood on days 8 and 10 post infection [figure 1f] indicative of an intestinal hemorrhage in infected animals . Together, our findings of brief decline in erythropoiesis, increased rbc loss and the presence of fecal occult blood in infected mice strongly suggest that hemorrhage accounts for a majority of the rbc lost during t. gondii - infection . Fibrin is a product of the coagulation cascade that aids clotting thereby suppressing blood loss . To determine whether the exacerbated hematocrit drop in fibrin(ogen) mice results from decreased rbc production or increased rbc loss, both parameters were measured in fibrin(ogen) and littermate control mice on day 8 post infection [figure 2]. As previously reported, the hematocrits of fibrin(ogen) mice infected with t. gondii were significantly decreased as compared with infected littermate controls [figure 2a]. The number of reticulocytes in fibrin(ogen) animals did not differ significantly from controls [figure 2b], however; the loss of circulating biotinylated rbc was significantly greater in fibrin(ogen) mice compared with control mice [figure 2c]. Taken together, these data indicate an important role for rbc loss in the t. gondii - induced hematocrit reduction in fibrin(ogen) mice, supporting our conclusion that decreases in hematocrit primarily reflect hemorrhage caused by infection . Fibrin (ogen) heterozygous and knockout mice were biotinylated and infected with t. gondii on day 0 . (a) hematocrit levels; (b) total number of reticulocytes and (c) total number of biotinylated red blood cell are shown for fibrin (ogen) mice and heterozygous littermates . Mice lacking the capacity to produce ifn fail to exhibit the t. gondii - induced hematocrit reduction [figure 3a]. Consistent with those findings, mice unable to respond to ifn due to a genetic deficiency of ifn-r also do not demonstrate the t. gondii - induced hematocrit reduction [figure 3a]. While infection of wt mice caused a significant decrease in reticulocyte numbers, infection of ifn or ifn-r mice did not alter reticulocyte numbers as compared with sham controls [figure 3b]. Furthermore, there was no significant evidence of hemorrhage in infected ifn or ifn-r mice as measured through loss of biotinylated rbc or fecal occult blood [figure 3c and d]. These data demonstrate that both the decreased erythropoiesis and the increased rbc loss components of t. gondii - induced anemia are dependent upon the production of ifn and subsequent signaling through the ifn-r . Interferon gamma (ifn) and ifn receptor are required for toxoplasma gondii induce anemia . Indicated knockout mice were infected with 10 me49 cysts and blood and fecal samples collected on day 8 . (a) hematocrit levels; (b) total number of reticulocytes; (c) total number of biotinylated red blood cell and (d) percent positive hemoccults are shown for both infected and uninfected animals (nd: none detected). . All data are represented as mean sd of at least three mice per group . Interferon gamma has been implicated in the induction of the inflammatory cytokine tnf-, resulting in pathology during malaria infection . Also, previous literature has suggested a synergistic role for ifn and tnf- in eliciting an immune response to t. gondii and in the suppression of hematopoietic progenitor cell growth in vitro . Following confirmation of tnf- mrna induction during infection with t. gondii [figure 4a], we asked whether tnf- plays a role in t. gondii - induced anemia . Hematocrit levels and numbers of biotinylated rbc were significantly decreased in tnf- mice infected with t. gondii as compared with sham controls [figure 4b], indicating that t. gondii - induced anemia is tnf--independent . Toxoplasma gondii induces hemorrhage in a tumor necrosis factor (tnf), phagocyte nadph oxidase, inducible nitric oxide synthase (inos), and inducible protein 10 (ip-10) independent manner . Indicated knockout mice were infected with 10 me49 cysts and blood and fecal samples collected on day 8 . (a) levels of tnf mrna in c57bl/6 mice and (b) hematocrit levels in tnf knockout mice, are shown for both infected and uninfected animals . Similarly, induction of inos and ip-10 mrna (c) and decreased hematocrit for indicated ko mice (d) are shown for both infected and uninfected animals . Significant differences are shown (* p <0.02) (nd: none detected). All data are represented as mean sd of at least three mice per group . Having ruled out a role for tnf- in the reduction of hematocrit levels during t. gondii infection, we focused on ifn-dependent effector molecules upregulated during t. gondii infection . Both inos and phox are ifn inducible genes involved in the regulation of the immune response and intestinal pathology during infection with francisella tularensis . The products of these genes generate reactive nitrogen and oxygen species, which could be responsible for tissue and endothelial damage leading to vascular leakage and subsequent hemorrhage . Induction of inos mrna on d8 of infection was significantly abrogated in ifn mice compared with c57bl/6 infected mice [figure 4c], indicating that inos is inducible by ifn during t. gondii infection . To determine whether hemorrhage during t. gondii infection was a consequence of host cell damage due to reactive oxygen, we evaluated hematocrit levels in both inos and phox / inos double knock - out animals . Hematocrit levels decreased significantly in both inos and phox / inos mice on day 8 postinfection compared with sham - infected controls [figure 4d], and the extent of this decrease was comparable to that seen in wt mice . In addition to inos and phox, ifn stimulates production also of ip-10, which has been implicated in downstream effector functions resulting in immunopathology during crohn's disease . Similarly to inos mrna, induction of ip-10 mrna during t. gondii infection is reduced in ifn mice compared with wt controls [figure 4c]. Nevertheless, wild type b6 mice treated with anti - ip-10 displayed a significant hematocrit decrease on day 8 of infection [figure 4d]. Thus, while the t. gondii - induced anemia is ifn- and ifn-r - dependent [figure 3], these data demonstrate that anemia is independent of tnf-, inos, phox and ip-10 gene products [figure 4]. Identification of the signaling cascades involved in ifn-mediated anemia during t. gondii infection may provide critical insight into the downstream effector molecules regulating infection - associated hemorrhage . Ifn induces gene expression primarily through stat1-dependent pathways . To evaluate the role of stat1 in t. gondii - stimulated anemia, we infected stat1 mice and measured blood parameters on day 8 postinfection . Unexpectedly, hematocrit levels in stat1 mice were significantly lower than those of sham controls [figure 5a], and comparable to genetically matched 129s6 mice infected with t. gondii . Reticulocyte production did not decrease as a result of infection in stat1 mice or their 1296 controls [figure 5b], but there was a significant loss of biotinylated rbc in both strains compared with sham - infected mice [figure 5c]. Based on these results, we conclude that the ifn-induced hemorrhage in t. gondii infected animals is mediated through a stat1-independent mechanism . Stat1 ko mice and genetically matched 129s6 controls were injected with biotin and infected with 10 me49 cysts of toxoplasma gondii . On day 8 of infection, blood and fecal samples were collected and analyzed . (a) hematocrit levels in 129s6 and stat1 mice were significantly decreased as compared with sham controls; (b) reticulocyte numbers were not significantly different between toxoplasma gondii infected and sham control mice; (c) both 129s6 and stat1 mice lost a significant number of biotinylated red blood cell as a result of t. gondii infection . All data are represented as mean sd of at least four mice per group . Infection of c57bl/6 mice with t. gondii induced robust ifn production [figure 1a] that correlated kinetically with decreased hematocrits [figure 1b] and numbers of circulating rbc [figure 1c]. To further delineate the mechanisms underlying this anemia, we quantified rbc production throughout the course of t. gondii infection . After their release from bone marrow as erythroblasts, rbc retain rna for 2448 h. during this period, rbc was referred to as reticulocytes and can be enumerated using flow cytometric assays employing rna - binding dyes . Using such an assay, we found that numbers of reticulocytes in infected mice were comparable to those of sham - infected mice up through day 6 . At day 8, post infection reticulocyte numbers decreased significantly, but rebounded by day 10 and then remained elevated until the anemia resolved [figure 1d]. These results indicate that rbc production only briefly decreases during t. gondii infection, and fully recovers prior to the peak of anemia at day 10 . Interferon gamma (ifn-) dependent hematocrit drop during toxoplasma gondii infection is a result of decreased red blood cell (rbc) production and increased rbc loss . Wild type c57bl/6 mice were infected with 10 me49 cysts and injected with biotin as described in materials and methods . (a) serum ifn levels; (b) hematocrit; (c) rbc numbers; (d) total number of reticulocytes; (e) total number of biotinylated rbc and (f) occult blood were evaluated on days indicated . Significant differences between sham - infected controls and t. gondii - infected mice are depicted (* p <0.02) based on data in figure 1d, decreased production of rbc can only account for at most a deficit of 0.8 10 rbc . Since t. gondii - infected mice have approximately 3.55 10 fewer circulating rbc than sham control mice on day 10 of infection [figure 1c], an alternative mechanism to decreased erythropoiesis must account for the 2.75 10 decrease in total rbc in infected mice . Therefore, we investigated the possibility that anemia results also from rbc loss . To estimate the rate of rbc loss, we pulse - labeled rbc with biotin in vivo and measured the number of biotin - labeled rbc remaining at various time points throughout t. gondii infection . Figure 1e indicates that sham - infected mice lost circulating biotinylated rbc at an average rate of 2.1% per day . In contrast, t. gondii - infected mice lost circulating biotinylated rbc at an average of 11.4% per day between days 6 and 10 of infection accounting for a total of 2.4 10 rbc . After that time thus, t. gondii - infected mice display a significant increase in rbc loss during the same period at which they display anemia . To evaluate whether the loss of rbc resulted from t. gondii - induced hemorrhage, we obtained fecal samples from infected animals at various days of infection and analyzed for the presence of occult blood . We detected fecal occult blood on days 8 and 10 post infection [figure 1f] indicative of an intestinal hemorrhage in infected animals . Together, our findings of brief decline in erythropoiesis, increased rbc loss and the presence of fecal occult blood in infected mice strongly suggest that hemorrhage accounts for a majority of the rbc lost during t. gondii - infection . Fibrin is a product of the coagulation cascade that aids clotting thereby suppressing blood loss . To determine whether the exacerbated hematocrit drop in fibrin(ogen) mice results from decreased rbc production or increased rbc loss, both parameters were measured in fibrin(ogen) and littermate control mice on day 8 post infection [figure 2]. As previously reported, the hematocrits of fibrin(ogen) mice infected with t. gondii were significantly decreased as compared with infected littermate controls [figure 2a]. The number of reticulocytes in fibrin(ogen) animals did not differ significantly from controls [figure 2b], however; the loss of circulating biotinylated rbc was significantly greater in fibrin(ogen) mice compared with control mice [figure 2c]. Taken together, these data indicate an important role for rbc loss in the t. gondii - induced hematocrit reduction in fibrin(ogen) mice, supporting our conclusion that decreases in hematocrit primarily reflect hemorrhage caused by infection . Fibrin (ogen) heterozygous and knockout mice were biotinylated and infected with t. gondii on day 0 . (a) hematocrit levels; (b) total number of reticulocytes and (c) total number of biotinylated red blood cell are shown for fibrin (ogen) mice and heterozygous littermates . Mice lacking the capacity to produce ifn fail to exhibit the t. gondii - induced hematocrit reduction [figure 3a]. Consistent with those findings, mice unable to respond to ifn due to a genetic deficiency of ifn-r also do not demonstrate the t. gondii - induced hematocrit reduction [figure 3a]. While infection of wt mice caused a significant decrease in reticulocyte numbers, infection of ifn or ifn-r mice did not alter reticulocyte numbers as compared with sham controls [figure 3b]. Furthermore, there was no significant evidence of hemorrhage in infected ifn or ifn-r mice as measured through loss of biotinylated rbc or fecal occult blood [figure 3c and d]. These data demonstrate that both the decreased erythropoiesis and the increased rbc loss components of t. gondii - induced anemia are dependent upon the production of ifn and subsequent signaling through the ifn-r . Interferon gamma (ifn) and ifn receptor are required for toxoplasma gondii induce anemia . Indicated knockout mice were infected with 10 me49 cysts and blood and fecal samples collected on day 8 . (a) hematocrit levels; (b) total number of reticulocytes; (c) total number of biotinylated red blood cell and (d) percent positive hemoccults are shown for both infected and uninfected animals (nd: none detected). All data are represented as mean sd of at least three mice per group . Interferon gamma has been implicated in the induction of the inflammatory cytokine tnf-, resulting in pathology during malaria infection . Also, previous literature has suggested a synergistic role for ifn and tnf- in eliciting an immune response to t. gondii and in the suppression of hematopoietic progenitor cell growth in vitro . Following confirmation of tnf- mrna induction during infection with t. gondii [figure 4a], we asked whether tnf- plays a role in t. gondii - induced anemia . Hematocrit levels and numbers of biotinylated rbc were significantly decreased in tnf- mice infected with t. gondii as compared with sham controls [figure 4b], indicating that t. gondii - induced anemia is tnf--independent . Toxoplasma gondii induces hemorrhage in a tumor necrosis factor (tnf), phagocyte nadph oxidase, inducible nitric oxide synthase (inos), and inducible protein 10 (ip-10) independent manner . Indicated knockout mice were infected with 10 me49 cysts and blood and fecal samples collected on day 8 . (a) levels of tnf mrna in c57bl/6 mice and (b) hematocrit levels in tnf knockout mice, are shown for both infected and uninfected animals . Similarly, induction of inos and ip-10 mrna (c) and decreased hematocrit for indicated ko mice (d) are shown for both infected and uninfected animals . Significant differences are shown (* p <0.02) (nd: none detected). All data are represented as mean sd of at least three mice per group . Having ruled out a role for tnf- in the reduction of hematocrit levels during t. gondii infection, we focused on ifn-dependent effector molecules upregulated during t. gondii infection . Both inos and phox are ifn inducible genes involved in the regulation of the immune response and intestinal pathology during infection with francisella tularensis . The products of these genes generate reactive nitrogen and oxygen species, which could be responsible for tissue and endothelial damage leading to vascular leakage and subsequent hemorrhage . Induction of inos mrna on d8 of infection was significantly abrogated in ifn mice compared with c57bl/6 infected mice [figure 4c], indicating that inos is inducible by ifn during t. gondii infection . To determine whether hemorrhage during t. gondii infection was a consequence of host cell damage due to reactive oxygen, we evaluated hematocrit levels in both inos and phox / inos double knock - out animals . Hematocrit levels decreased significantly in both inos and phox / inos mice on day 8 postinfection compared with sham - infected controls [figure 4d], and the extent of this decrease was comparable to that seen in wt mice . In addition to inos and phox, ifn stimulates production also of ip-10, which has been implicated in downstream effector functions resulting in immunopathology during crohn's disease . Similarly to inos mrna, induction of ip-10 mrna during t. gondii infection is reduced in ifn mice compared with wt controls [figure 4c]. Nevertheless, wild type b6 mice treated with anti - ip-10 displayed a significant hematocrit decrease on day 8 of infection [figure 4d]. Thus, while the t. gondii - induced anemia is ifn- and ifn-r - dependent [figure 3], these data demonstrate that anemia is independent of tnf-, inos, phox and ip-10 gene products [figure 4]. Identification of the signaling cascades involved in ifn-mediated anemia during t. gondii infection may provide critical insight into the downstream effector molecules regulating infection - associated hemorrhage . Ifn induces gene expression primarily through stat1-dependent pathways . To evaluate the role of stat1 in t. gondii - stimulated anemia, we infected stat1 mice and measured blood parameters on day 8 postinfection . Unexpectedly, hematocrit levels in stat1 mice were significantly lower than those of sham controls [figure 5a], and comparable to genetically matched 129s6 mice infected with t. gondii . Reticulocyte production did not decrease as a result of infection in stat1 mice or their 1296 controls [figure 5b], but there was a significant loss of biotinylated rbc in both strains compared with sham - infected mice [figure 5c]. Based on these results, we conclude that the ifn-induced hemorrhage in t. gondii infected animals is mediated through a stat1-independent mechanism . Stat1 ko mice and genetically matched 129s6 controls were injected with biotin and infected with 10 me49 cysts of toxoplasma gondii . On day 8 of infection, blood and fecal samples were collected and analyzed . (a) hematocrit levels in 129s6 and stat1 mice were significantly decreased as compared with sham controls; (b) reticulocyte numbers were not significantly different between toxoplasma gondii infected and sham control mice; (c) both 129s6 and stat1 mice lost a significant number of biotinylated red blood cell as a result of t. gondii infection . All data are represented as mean sd of at least four mice per group . Anemia accompanies a variety of infectious diseases including malaria, trypanosomiasis, mononucleosis and secondary infections during hiv . Clinical studies have implicated important roles from inflammatory cytokines in the anemia's associated with infectious disease . In this study, an in vivo model was used to evaluate roles for the inflammatory cytokine, ifn, in the onset of anemia due to infectious disease . Specifically, this study identifies a stat1-independent ifn-induced pathology during infection with the protozoan parasite t. gondii . Infection - induced anemia could potentially result from decreased rbc production, rbc loss due to hemorrhage or destruction, as described in disseminated intravascular coagulation (dic), or pathogen - associated hemolysis . In the present study, we show that t. gondii - induced anemia results from both decreased erythropoiesis and increased loss of circulating rbc [figure 1]. We believe hypochromic microcytic anemia is the only morphological features for hemorrhagic anemia, and red cell loss caused by infection is the only reason during this process . Results of mean corpuscular volume mean corpuscular hemoglobin support our idea (data not shown). Anemia resulting from decreased erythropoiesis has been described in murine malaria, in part resulting from effects of increased tnf- levels on rbc precursor cells in the bone marrow of infected mice . Additionally, decrease numbers of erythroid progenitor cells have been previously observed in cba mice infected with the virulent rh strain of t. gondii . Together, these reports support our conclusion that a decrease in erythropoiesis during t. gondii infection is in part responsible for the induced anemia . Nevertheless, the decrease in rbc production accounts for only a small portion of the total number of rbc lost during t. gondii infection, indicating that an additional mechanism must contribute to this anemia . The possibility that anemia during t. gondii infection is not solely due to a reduction of erythropoiesis is supported by similar data during malaria infections . Another candidate for the cause of infection - induced anemia includes the destruction of rbc in circulation . During t. gondii infection, rbc destruction does not appear to be a mechanism for anemia, as there are no detectable spherocytes or schistocytes, hallmarks of such destruction, in peripheral blood smears from infected mice (data not shown). Alternatively, hemophagocytosis accompanies certain infections and can result in decreased erythrocyte numbers due to their phagocytosis by activated macrophages . However, it is unclear why loss of fibrin would predispose to increased hemophagocytosis or lysis, whereas it is obvious that it predisposes to hemorrhage [figure 2]. Indeed, hemorrhage, as measured through loss of biotinylated rbc and positive hemoccult, accounts for the majority of rbc loss during t. gondii - induced anemia [figure 1]. Hemorrhagic pathology, including bleeding from the respiratory and gastrointestinal organs, has been described during both bacterial and viral infections . During dengue hemorrhagic fever, hemorrhage is a result of vasculopathy and coagulopathy due to an imbalance between coagulation and fibrinolysis . Activation of the coagulation system can result in increased fibrin deposition in the vasculature causing dic and a subsequent depletion of rbc due to thrombosis and bleeding as described in viral hemorrhagic fevers . Dengue - virus induced hemorrhage is correlated to platelet abnormalities and dic . Though we have not formally ruled out dic as a possible cause of t. gondii induced anemia, exacerbation of anemia in fibrin (ogen) animals suggests that excessive coagulation is a not a primary cause of anemia . Nevertheless, our data indicated that rbc loss and hemorrhage are primary causes of ifn-dependent anemia in t. gondii - infected mice . Previous research has implicated several ifn-ips in pathology associated with inflammation . Treating mice with nitric oxide inhibitors prevented intestinal necrosis during t. gondii infection . Additionally, ip-10 has been implicated in the induction of liver, kidney, and intestinal pathology during crohn's disease . However, we were unable to identify a role for nitric oxide, or ip-10 in the induction of anemia during t. gondii infection . Additionally, no role for tnf- was identified in t. gondii induced anemia . Though anemia during trypanosoma cruzi is not accompanied by a decrease in reticulocyte numbers, similar to our findings, chemical inhibition of nitric oxide or treatment with anti - tnf did not rescue mice from anemia even though these treatments resulted in increased numbers of reticulocytes and suppressed decreases in bone marrow erythroblast numbers during infection . Our results suggest that divergent mechanisms may exist for ifn-induced protection compared with ifn-induced hemorrhagic immunopathology during t. gondii infection . Identification of the signaling cascades involved in ifn-mediated anemia during t. gondii infection may provide insight into the downstream effector molecules regulating hemorrhage . This led us to assess roles for stat1 as a downstream signaling molecule involved in ifn-induced hemorrhage during t. gondii infection . Based on previous literature describing the induction of pathological ifn effector mechanisms through stat1, we anticipated that this signaling mechanism also would be required in induction of ifn-dependent pathology during t. gondii infection . Surprisingly, in this setting, t. gondii infection stimulated anemia in a stat1-independent fashion . These data suggest that both the induction of ifn and the subsequent activation of an ifn-induced effector mechanism resulting in hemorrhage is a stat1-independent pathway . Recent in vitro studies with macrophages have identified mcp-1, mip-1 and, as stat1-independent, ifn-inducible genes ., however, infections of ccl2, ccr2 or ccr5 deficient mice did not indicate a role for these chemokines in t. gondii - induced anemia (data not shown). Future in vivo studies will continue to investigate potential ifn-dependent, stat1-independent effector molecules that are responsible for t. gondii induced hemorrhagic anemia . Understanding the pathways that result in ifn-mediated protection versus ifn-mediated pathology will provide valuable information to prevent immune pathology while, not compromising the protective effects of the immune response.
Cloacal and tracheal swab samples and serum were collected from 60 of 500 chickens on the patient s family farm and from 50 chickens in the backyards of 5 neighbors within 3 kilometers . In addition, 36 fecal samples from chickens on the patient s and neighboring farms were also collected . Each swab or fecal sample was placed in 2 ml of minimal essential medium supplemented with penicillin (2,000 u / ml) and streptomycin (2,000 u / ml). Virus was isolated by using 10-day - old specific pathogen free embryonated chicken eggs . Hemagglutinin (ha) and neuraminidase (na) subtypes were determined as described previously (14). Hemagglutination inhibition assay with 0.5% chicken erythrocytes was used to test for antibodies against h7 virus in the chicken serum samples . From the cloacal swab samples from the patient s farm, 3 viruses were isolated (a newcastle disease virus, an h9n2 influenza virus, and an h7n2 influenza virus); virus was not isolated from any sample collected from chickens on the neighboring farms . We designated the influenza viruses as a / chicken / jilin / sd001/2014(h9n2) and a / chicken / jilin / sd020/2014(h7n2). We then fully sequenced the genomes of a / chicken / jilin / sd020/2014(h7n2) and a / chicken / jilin / sd001/2014(h9n2) (genbank accession nos . Km054788km054803) and found that the na and nonstructural (ns) genes of a / chicken / jilin / sd020/2014(h7n2) are similar to those of a / chicken / jilin / sd001/2014(h9n2); identities were 99.1% and 100%, respectively . The other 6 genes were closely related to those of the h7n9 viruses that had been isolated from poultry or humans during 20132014 in china; identities were 99.5%99.9% (table). In the phylogenetic trees, the ha of a / chicken / jilin / sd020/2014(h7n2) clustered with that of the recently emerged h7n9 viruses (technical appendix, figure, panel a), whereas, the na, polymerase basic (pb) 2, pb1, polymerase acidic (pa), nucleocapsid protein (np), and ns genes of a / chicken / jilin / sd020/2014(h7n2) and a / chicken / jilin / sd001/2014(h9n2) clustered with those of the h9n2 viruses (technical appendix figure, panels b f, h). However, the matrix (m) gene of the 2 viruses remained on different forks; the m gene of a / chicken / jilin / sd020/2014(h7n2) clustered with the h7n9 or h9n2 viruses, and the m gene of a / chicken / jilin / sd001/2014(h9n2) clustered with the viruses from other subtypes (technical appendix figure, panel g). These results indicate that a / chicken / jilin / sd020/2014(h7n2) is a novel reassortant of h7n9 and h9n2 viruses . With the approval of the review board of harbin veterinary research institute, we tested the virulence of the a / chicken / jilin / sd020/2014(h7n2) in animals in biosafety level 3 laboratories . * ha, hemagglutinin; na, neuraminidase; np, nucleoprotein; m, matrix; ns, nonstructural; pa, polymerase basic; pb, polymerase basic . Similar to the h7n9 viruses (12,13), a / chicken / jilin / sd020/2014(h7n2) also has the single basic amino acid arginine in its ha cleavage site . We determined the intravenous pathogenicity index of a / chicken / jilin / sd020/2014(h7n2) as described previously (13). None of the chickens showed signs of disease or died during the 10-day observation period; the intravenous pathogenicity index was 0, indicating that this h7n2 virus in chickens is nonpathogenic . We inoculated groups of eight 6-week - old female balb / c mice with 10 50% egg infectious doses of a / chicken / jilin / sd020/2014(h7n2) and 2 h7n9 viruses, a / pigeon / shanghai / s1069/2013, and a / anhui/1/2013 . On day 3 postinfection, 3 mice in each group were killed and their organs (nasal turbinates, lungs, spleens, kidneys, and brains) were collected for virus titration . For 14 days, the remaining 5 mice were observed for body weight changes and survival . In the mice, replication of all 3 viruses was detected in the nasal turbinates and lungs but not in other organs (figure 1, panel a); the titers in lungs of mice infected with h7n2 virus were comparable to those in the lungs of mice infected with the human h7n9 virus a / anhui/1/2013 and were significantly higher than those in the lungs of mice infected with the avian h7n9 virus a / pigeon / shanghai / s1069/2013 (figure 1, panel a). The a / anhui/1/2013 virus infected mice showed up to a 30% loss of body weight, and 1 mouse died during the observation period (figure 1, panels b and c). Although none of the mice infected with the h7n2 virus or a / pigeon / shanghai / s1069/2013 virus died during the observation period, loss of body weight was slightly more for the h7n2-infected mice than for the a / pigeon / shanghai / s1069/2013-infected mice and the control mice (figure 1, panel b). The data shown are the mean sd for each group . Because virus was not detected from spleen, kidney, or brain of any mouse, data for these organs are not shown . A, p<0.01 compared with the corresponding value for the a / pigeon / shanghai / s1069/2013-inoculated group; b, p<0.01 compared with the corresponding value for the a / chicken / jilin / sd020/2014(h7n2)-inoculated and a / pigeon / shanghai / s1069/2013-inoculated groups; c, p<0.05 compared with the corresponding value for the a / pigeon / shanghai / s1069/2013-inoculated group . Ck / jl (h7n2), a / chicken / jilin / sd020/2014(h7n2); pg / s 1069, a / pigeon / shanghai / s1069/2013; ah/1, a / anhui/1/2013; eid50, 50% egg infectious dose . We also investigated antibody responses in serum samples from chickens in the patient s village . In 55 of the 60 serum samples collected from the chickens on the patient s family farm, hemagglutination inhibition assay indicated that antibody titers against h7n2 or h7n9 virus ranged from 2 to 1,024 . Only 5 of the 50 serum samples collected from the chickens on the patient s neighboring farms had hemagglutination inhibition antibody titers, which ranged from 2 to 128 (figure 2). The hemagglutination inhibition (hi) antibody titers of the serum against the h7n2 virus a / chicken / jilin / sd020/2014(h7n2) (a) and the h7n9 virus a / pigeon / shanghai / s1069/2013 (b) were determined with 0.5% (vol / vol) chicken erythrocytes . The h7n2 influenza virus isolated from a chicken in jilin province in northern china was a novel reassortant that derived its ha, pb2, pb1, pa, np, and m genes from the h7n9 virus that emerged in china in 2013 . Although we did not find any h7n9 viruses in chickens during this investigation, the fact that the owner of the chickens was infected with an h7n9 virus indicates that h7n9 viruses might have circulated among these chickens . The na and ns genes of the novel h7n2 virus are closely related to those of the h9n2 virus that was isolated from chickens on the same farm, providing direct evidence that h7n9 viruses continue to evolve and reassort with h9n2 viruses in poultry in china . H7n9 isolates from humans replicate much more efficiently and are more lethal in mice than are h7n9 isolates from birds (13). The mutation of glutamic acid to lysine at position 627(e627k) in pb2 contributes to this difference (15). The h7n2 virus does not have the pb2 627k mutation, but its replication in the lungs of mice is comparable to that of human h7n9 virus and significantly higher than that of avian h7n9 virus . These findings suggest that the continued circulation of h7 viruses in nature will enable them to acquire more mutations or new gene constellations that might increase their virulence in animals or humans . The nonpathogenic nature of h7 viruses in poultry enables them to replicate silently in birds . The high positive ratio of antibody against h7 viruses detected by hemagglutination assay and the huge diversity of antibody levels among chickens from the h7n9 patient s farm demonstrate that the h7 viruses might have been introduced and circulated in these birds for several weeks before they were detected . These findings highlight the challenges of trying to eradicate low pathogenicity influenza subtype h7 viruses from nature and the need for continued surveillance and monitoring of h7 viruses in poultry in china . The trees of h7 hemagglutinin (a), polymerase basic 2 (c), polymerase basic 1 (d), polymerase acidic (e), nucleocapsid (f), matrix (g), and nonstructural (h) were rooted to a / eq / prague/1/56 (h7n7), and the n2 neuraminidase tree (b) was rooted to a / duck / hokkaido/95/01(h2n2). Viruses characterized in the present study are shown in red (h7n2) and pink (h9n2); the recent h7n9 viruses are shown in blue . Bp, baer s pochard duck; bwt, blue - winged teal; ck, chicken; dk, duck; env, environment; eq, equine; ml, mallard; pg, pigeon; wb, wild bird; wd, wild duck.
In the big data era there is an increasing use of large healthcare administrative databases to conduct clinical and healthcare research, besides learning assessing delivery efficiency and effectiveness . Among many interesting healthcare research topics facilitated by big data another interesting topic is use of multiple hospital administrative datasets in performing meta - data analyses . Regardless of which applications are considered, one fundamental challenge is that administrative data are highly heterogeneous from hospital to hospital . Besides differences due to distributions of medical specialties and their delivery processes, the key source is that patient populations in hospitals are highly variable, and are not randomly distributed, which is a main source for heterogeneity between hospitals . The presence of such hospital heterogeneity creates a challenge to evaluating hospital performance or to pooling multiple hospital datasets in clinical studies, unless such heterogeneity is adjusted . One analytic strategy is to develop risk scores (rs), quantifying characteristics of patients within hospitals, and to adjust risk scores as a way of controlling heterogeneity between hospitals . There are many risk score calculation methods and risk scores developed for various medical conditions [68]. Among them, probably the most common is the charlson comorbidity index (cci). Being stimulated by chinese economic development, the chinese government increases the investment into the healthcare system while emphasizing evidence - based evaluation to improve healthcare delivery quality and compare performance across hospitals . Besides the evaluation of hospital - wide performance, there is also increasing interest in evaluating disease - specific performance across hospitals . A major disease attracting much attention in the chinese government is acute myocardial infarction (ami), because ami incidence has been rapidly increasing in recent years and is associated with high fatality . To the best of our knowledge, no ami study in china, using multiple hospital datasets, has considered the adjustment for hospital heterogeneity . Similarly, there is no commonly accepted method used to adjust heterogeneity between hospitals in evaluating and comparing hospital - wide performance . In this study, our objective was to develop a single numerical score for characterizing inpatient mortality associated with treating acute myocardial infarction (ami) patients based on comorbidity information generally recorded in the routinely collected administrative data in china . The first database (database a) is the discharge summary reports (dsrs) from 49 tertiary hospitals in beijing from 2006 to 2010 . The second database (database b) consists of dsrs from 65 tertiary hospitals from various cities and provinces in china in 2012, all of which are directly regulated by the national health and family planning commission (nhfpc) and are different from those 49 hospitals in the first database . In china, all hospitals are classified into 1 of 3 tiers primary, secondary, and tertiary hospitals in which tertiary hospitals are the best . Typically, most tertiary hospitals are owned and managed directly by local government agencies that are responsible for public health . Each hospital is required to submit dsrs on each hospitalization to their local health authority, forming local administrative databases . Health authority uses such an administrative database to assess the status of healthcare delivery through annual reports from local health authorities to the nhfpc . Early on, nhfpc has designed a dsr form, and has required all hospitals to use the same dsr form, so that dsr databases are interoperable throughout the country . In general, key clinical information in dsr includes, per hospitalization, the basic demographics of every patient, admission and discharge dates, primary and secondary diagnoses (up to 7 secondary diagnoses), surgical procedures, primary physicians, outcome of hospitalizations, and costs of each hospitalization . From 2006 to 2010, the basic structure of dsrs was stable, with minor modifications made by adding more information or by adopting international coding schemes . Among all 4 216 135 dsrs in database a, all dsrs with the primary diagnosis codes i21 and i22 in icd-10 were included as ami - related discharges . Excluding hospitals without cardiovascular patient admissions leads to 34 hospitals with 50 531 dsrs of ami patients, and all all dsrs were randomly divided into the training dataset (n=25 204) to develop the score, and the testing dataset (n=25 327) to conduct the internal validation test . For external validation, we used database b, with 3 110 566 total dsrs, and it includes 21 571 ami records from 35 hospitals . In the data analysis, we used a conservative strategy to remove all dsrs that appear to have unimportant and unclear disease codes, or possible coding errors (figure 1). The demographic variables include sex (male or female) and age in years at the time of admission . Other variables include the number of diagnoses, the number of procedures, cci, length of stay (within hospital), and total cost during the hospitalization . Inpatient mortality was defined as death at discharge (i.e., death during hospitalization). To ensure the robustness of risk score calculations with all diagnostic codes, we identified all primary diagnosis icd-10 codes on dsrs that reported death at discharge within each calendar year in database a. then, we included those diagnostic codes only if they appeared at least once in a calendar year from 2006 to 2010 . Applying the logistic regression model, we regress the discharge vital status on indicators of all diagnostic codes in addition to several demographic variables . After fitting, we use the logistic probability function to denote the predicted probability of death at discharge given the dichotomous independent variables to denote presence or absence of high - risk secondary diagnosis indicators . Those indicators are retained in the model only if it is statistically significant at the significance level of 0.05 . From logistic models, we estimate odds ratios (or) of all secondary diagnoses, and round them to their integers as resulting weights associated with corresponding secondary diagnoses . An individual s risk score is computed as the weighted sum of all secondary diagnoses at discharge present at the time of admission, with estimated ors . To compare across different risk scores, we computed the c - statistic as a measure of discrimination and compared these values to those obtained using cci and its common adaptions, including deyo, dhoore, gahli, and quan cci . All statistical analyses were performed using sas, version 9.13 (sas institute, cary, nc). The first database (database a) is the discharge summary reports (dsrs) from 49 tertiary hospitals in beijing from 2006 to 2010 . The second database (database b) consists of dsrs from 65 tertiary hospitals from various cities and provinces in china in 2012, all of which are directly regulated by the national health and family planning commission (nhfpc) and are different from those 49 hospitals in the first database . In china, all hospitals are classified into 1 of 3 tiers primary, secondary, and tertiary hospitals in which tertiary hospitals are the best . Typically, most tertiary hospitals are owned and managed directly by local government agencies that are responsible for public health . Each hospital is required to submit dsrs on each hospitalization to their local health authority, forming local administrative databases . Health authority uses such an administrative database to assess the status of healthcare delivery through annual reports from local health authorities to the nhfpc . Early on, nhfpc has designed a dsr form, and has required all hospitals to use the same dsr form, so that dsr databases are interoperable throughout the country . In general, key clinical information in dsr includes, per hospitalization, the basic demographics of every patient, admission and discharge dates, primary and secondary diagnoses (up to 7 secondary diagnoses), surgical procedures, primary physicians, outcome of hospitalizations, and costs of each hospitalization . From 2006 to 2010, the basic structure of dsrs was stable, with minor modifications made by adding more information or by adopting international coding schemes . Among all 4 216 135 dsrs in database a, all dsrs with the primary diagnosis codes i21 and i22 in icd-10 were included as ami - related discharges . Excluding hospitals without cardiovascular patient admissions leads to 34 hospitals with 50 531 dsrs of ami patients, and all all dsrs were randomly divided into the training dataset (n=25 204) to develop the score, and the testing dataset (n=25 327) to conduct the internal validation test . For external validation, we used database b, with 3 110 566 total dsrs, and it includes 21 571 ami records from 35 hospitals . In the data analysis, we used a conservative strategy to remove all dsrs that appear to have unimportant and unclear disease codes, or possible coding errors (figure 1). The demographic variables include sex (male or female) and age in years at the time of admission . Other variables include the number of diagnoses, the number of procedures, cci, length of stay (within hospital), and total cost during the hospitalization . Inpatient mortality was defined as death at discharge (i.e., death during hospitalization). To ensure the robustness of risk score calculations with all diagnostic codes, we identified all primary diagnosis icd-10 codes on dsrs that reported death at discharge within each calendar year in database a. then, we included those diagnostic codes only if they appeared at least once in a calendar year from 2006 to 2010 . Applying the logistic regression model, we regress the discharge vital status on indicators of all diagnostic codes in addition to several demographic variables . After fitting, we use the logistic probability function to denote the predicted probability of death at discharge given the dichotomous independent variables to denote presence or absence of high - risk secondary diagnosis indicators . Those indicators are retained in the model only if it is statistically significant at the significance level of 0.05 . From logistic models, we estimate odds ratios (or) of all secondary diagnoses, and round them to their integers as resulting weights associated with corresponding secondary diagnoses . An individual s risk score is computed as the weighted sum of all secondary diagnoses at discharge present at the time of admission, with estimated ors . To compare across different risk scores, we computed the c - statistic as a measure of discrimination and compared these values to those obtained using cci and its common adaptions, including deyo, dhoore, gahli, and quan cci . All statistical analyses were performed using sas, version 9.13 (sas institute, cary, nc). In the training set of 25 327 discharges, the mean age of the patients was 63.413.2 years, and 73.2% were male . Similarly, there were 25 204 discharges in the testing dataset, patients had a mean age of 63.313.2 years, and 73.6% were male . In validating dataset b, the discharge number was found to be 21 571, the mean age was 62.312.8 years, and 75.2% were male . Other patient characteristics, including number of diagnoses, number of procedures, cci, length of stay, total cost, and in - hospital mortality, are summarized in table 1 . Compared to the training and testing dataset, the external validating dataset had fewer procedures performed, shorter length of stay, and lower in - hospital mortality . Because the training and testing datasets were from 2006 through 2010 and the validating dataset was from 2012, such differences may be expected in light of continuous improvement of ami treatment and healthcare quality in china every year . This assumption was supported by the fact that from 2006 to 2010, the ami causes of in - hospital mortality decreased from 8.97% to 6.91% in the beijing hospitals in database a. after integrating the high - risk diagnosis codes for the 5 years, we removed 149 codes on the basis of coding because of relatively low occurrences in at least 1 year . Additionally, 67 codes were not selected because their associations with inpatient death was not statistically significant . A total of 22 diagnosis codes were eventually identified to associate with inpatient mortality of ami patients (figure 1). The high - risk secondary diagnoses were mainly composed of circulatory system diseases, such as cardiac arrhythmias, cerebral infarctions, and hemorrhaging . For each of the possible conditions that a given patient had, the combined risk score was calculated by summing the weights given above . We used c - statistics to evaluate the logistic regression models in this study (table 3) through 3 separate comparisons: using the testing dataset as an internal validation, an external validating dataset, and a technical comparison with the widely used cci . On computed risk score, the c - statistics in training, testing, and validating datasets were 0.829, 0.832, and 0.824, respectively . These estimates indicate that the risk scores were quite stable . When using the widely used cci as the comorbidity index, the c - statistics of the logistic regression model for predicting ami patient mortality were 0.775, the c - statistics for deyo were 0.782, 0.779, and 0.784; 0.783, 0.779, and 0.784 for dhoore; 0.780, 0.778, and 0.784 for gahli; and 0.781, 0.780, and 0.786 for quan cci . These results were similar to those of cci, but lower than our novel risk score, indicating our risk score model was more suitable for ami patients in china . We also computed the c - statistics of the logistic regression model with only the demographic variables . They were 0.768, 0.765, and 0.689 for training, testing, and validating datasets, respectively, indicating that high - risk secondary diagnosis and demographic characteristic - composed risk scores can improve the predictive ability of the model . As part of healthcare reform, there is growing interest in hospital evaluation . A government - endorsed criterion in evaluating hospital quality is via inpatient mortality . However, the major pushback to using inpatient mortality as an index to evaluate hospital quality is that hospitals are very different from each other because their patient populations are different (i.e., hospital - to - hospital heterogeneity). To correct this heterogeneity, we propose to use the risk score as a basis to compute the relative mortality ratio for each hospital computationally, we use the risk score to calculate the expected death probabilities of ami patients . Then, aggregating all of death probabilities within individual hospital leads to the estimated expected inpatient mortality for that hospital . In other words, if the average disease severity for patients in one hospital is much higher than that for patients in another hospital, the expected inpatient mortality is expected be higher . Correcting this source of heterogeneity, we compute the relative mortality ratios, defined as the observed inpatient mortality over the expected inpatient mortality, for each hospital . In the current application, we use the risk score established on the training set to compute the predicted death probabilities for all individuals in the external validation dataset . Averaging these computed risk scores within hospitals results in hospital - specific relative mortality ratios (table 4). Naively basing hospital ranking on observed inpatient mortality (column 4 of table 4), the hospitals are ordered from 1 to 35 as their ranks for these hospitals under considerations . However, based on relative mortality ratios, the hospital ranks are revised (column 5 of table 4). Since discussion of hospital ranks is not of primary interest, we selected 3 hospitals to examine why their ranks changed substantially . We took hospitals a, b, and c as examples . Without disclosing their identities, it suffices to state that all 3 are well - known tertiary hospitals in china . In particular, hospital c is known to be the best hospital in treating ami patients, while hospitals a and b are excellent in clinical areas other than ami . In this case, indeed, after accounting for disease severity across hospitals, the new ranks of hospitals are much more consistent with the actual clinical assessment . In the training set of 25 327 discharges, the mean age of the patients was 63.413.2 years, and 73.2% were male . Similarly, there were 25 204 discharges in the testing dataset, patients had a mean age of 63.313.2 years, and 73.6% were male . In validating dataset b, the discharge number was found to be 21 571, the mean age was 62.312.8 years, and 75.2% were male . Other patient characteristics, including number of diagnoses, number of procedures, cci, length of stay, total cost, and in - hospital mortality, are summarized in table 1 . Compared to the training and testing dataset, the external validating dataset had fewer procedures performed, shorter length of stay, and lower in - hospital mortality . Because the training and testing datasets were from 2006 through 2010 and the validating dataset was from 2012, such differences may be expected in light of continuous improvement of ami treatment and healthcare quality in china every year . This assumption was supported by the fact that from 2006 to 2010, the ami causes of in - hospital mortality decreased from 8.97% to 6.91% in the beijing hospitals in database a. after integrating the high - risk diagnosis codes for the 5 years, we removed 149 codes on the basis of coding because of relatively low occurrences in at least 1 year . Additionally, 67 codes were not selected because their associations with inpatient death was not statistically significant . A total of 22 diagnosis codes were eventually identified to associate with inpatient mortality of ami patients (figure 1). The high - risk secondary diagnoses were mainly composed of circulatory system diseases, such as cardiac arrhythmias, cerebral infarctions, and hemorrhaging . For each of the possible conditions that a given patient had, the combined risk score was calculated by summing the weights given above . We used c - statistics to evaluate the logistic regression models in this study (table 3) through 3 separate comparisons: using the testing dataset as an internal validation, an external validating dataset, and a technical comparison with the widely used cci . On computed risk score, the c - statistics in training, testing, and validating datasets were 0.829, 0.832, and 0.824, respectively . These estimates indicate that the risk scores were quite stable . When using the widely used cci as the comorbidity index, the c - statistics of the logistic regression model for predicting ami patient mortality were 0.775, 0.773, and 0.710 in training, testing, and validating datasets, respectively . The c - statistics for deyo were 0.782, 0.779, and 0.784; 0.783, 0.779, and 0.784 for dhoore; 0.780, 0.778, and 0.784 for gahli; and 0.781, 0.780, and 0.786 for quan cci . These results were similar to those of cci, but lower than our novel risk score, indicating our risk score model was more suitable for ami patients in china . We also computed the c - statistics of the logistic regression model with only the demographic variables . They were 0.768, 0.765, and 0.689 for training, testing, and validating datasets, respectively, indicating that high - risk secondary diagnosis and demographic characteristic - composed risk scores can improve the predictive ability of the model . As part of healthcare reform, there is growing interest in hospital evaluation . A government - endorsed criterion in evaluating hospital quality is via inpatient mortality . However, the major pushback to using inpatient mortality as an index to evaluate hospital quality is that hospitals are very different from each other because their patient populations are different (i.e., hospital - to - hospital heterogeneity). To correct this heterogeneity, we propose to use the risk score as a basis to compute the relative mortality ratio for each hospital . Computationally, we use the risk score to calculate the expected death probabilities of ami patients . Then, aggregating all of death probabilities within individual hospital leads to the estimated expected inpatient mortality for that hospital . In other words, if the average disease severity for patients in one hospital is much higher than that for patients in another hospital, the expected inpatient mortality is expected be higher . Correcting this source of heterogeneity, we compute the relative mortality ratios, defined as the observed inpatient mortality over the expected inpatient mortality, for each hospital . In the current application, we use the risk score established on the training set to compute the predicted death probabilities for all individuals in the external validation dataset . Averaging these computed risk scores within hospitals results in hospital - specific relative mortality ratios (table 4). Naively basing hospital ranking on observed inpatient mortality (column 4 of table 4), the hospitals are ordered from 1 to 35 as their ranks for these hospitals under considerations . However, based on relative mortality ratios, the hospital ranks are revised (column 5 of table 4). However, ranks for some other hospitals are changed substantially . Since discussion of hospital ranks is not of primary interest, we selected 3 hospitals to examine why their ranks changed substantially . We took hospitals a, b, and c as examples . Without disclosing their identities, it suffices to state that all 3 are well - known tertiary hospitals in china . In particular, hospital c is known to be the best hospital in treating ami patients, while hospitals a and b are excellent in clinical areas other than ami . In this case, indeed, after accounting for disease severity across hospitals, the new ranks of hospitals are much more consistent with the actual clinical assessment . Using over 4 million dsrs, we have developed a comorbidity risk score that characterizes inpatient mortality of treating acute myocardial infarction (ami) patients in these tertiary hospitals in china . Besides demographic variables, key predictors are multiple secondary diagnostic codes reported on dsr . After building a probability model for risk score calculation on a training dataset, we have checked their performance on an internal validation set . It appears that performance, measured by c - statistic, is satisfactory . Taking this predictive model to an external validation dataset, we were able to show again that the c - statistic remains quite impressively over 0.8 for predicting all inpatient morality of ami patients . In conclusion, the novel risk score can be used for predicting disease severity for patients, and can thus be used for adjusting heterogeneity between hospitals . Such an adjustment is necessary for many clinical studies on clinical data extracted from multiple hospitals, such as health service research or evaluation of healthcare quality . From the methodological point of view, the current risk score calculation synthesizes multiple variables for many different underlying diseases through using the logistic regression model, and becomes quite stable as a single index for application . For example, peduzzi and harrell reported that, when associated frequencies are less than 10, the regression coefficients in the logistic regression could be biased and estimated standard errors could be inflated . Through appropriate variable selections, our risk score can be readily used for applications with desired robustness . In comparison to cci and its adaption to using administrative data, however, the cci index is used to approximate the comorbidity burden, and is not designed for chinese administrative data . As we have shown, its performance is not as good as our risk score . Conceptually, the risk score is not just for ami . In fact, our risk score shares the same motivation as other risk scores such as grace, cadillac, timi, and pami . The key differentiator for our risk score is that it uses administrative data, as opposed to detailed information from clinics directly or electronic medical records . For developing countries like china, it is easier to develop risk scores for other clinical specialties risk scores have many applications . For example, clinicians can use our risk score to predict inpatient mortality based on baseline information collected when patients are admitted to hospitals . Such a risk score, once validated, can help clinicians design effective patient management . If a patient is at high risk of inpatient death, the clinician will pay much more attention and will institute more active treatment . The second example is that our risk score can be readily applied to hospital evaluations, which is the application used in the present study . The third application is to optimize use by healthcare delivery organizations, by estimating disease burdens across hospitals . It is also important to acknowledge the limitations in our development of risk scores . Because dsrs are the primary data sources for computing risk scores, distinguishing between pre - existing conditions and complications during hospitalization, we attempted to minimize the influence of complications through choosing an appropriate set of high - risk diagnosis codes . Further, it is estimated that 92% to 94% of secondary diagnoses were pre - existing conditions . The new risk score developed from dsrs outperform the existing administrative data - based indices when they are used in china . The primary use of this risk score is to adjust for heterogeneity between hospitals when clinical data from multiple hospitals are used . Another application is to predict inpatient mortality based on information at admission, and the predictive information may help clinicians to manage patients and treatments more efficiently.
The emphasis is now student - centered rather than teacher oriented and content - centered . This change in focus has necessitated other changes in curriculum design and delivery to meet this shift . Engagement of students in the learning process is, perhaps, the most important manifestation of the recent educational reform . In the era of quality assurance and requirements for accreditation, one - way of assessing students learning experience is to collect information about how students perceive their educational environment . The educational environment is also defined as the climate of the institution as experienced and perceived by students . It is believed by many educational authorities that the educational environment is the most significant reflection and the central component of the curriculum . Research studies have shown that a positive and supportive environment is essential for successful learning . Roff et al . Found that the educational environment makes an impact on students learning experiences and outcomes . It has also been reported that students who perceive their learning environment positively are more likely to develop effective learning strategies and adopt a deep learning approach . Many educationalists use students perception of the learning environment as a diagnostic tool to identify weaknesses and strengths of the curriculum . Pace and stern developed an assessment tool to study the educational environment of medical schools, namely medical environment index . Since then, a plethora of assessment tools have been developed to evaluate students perceptions of their educational climate . Among the assessment tools that gained popularity dreem was developed to assess the learning environment of medical and health - care related education programs . Other assessment tools for measuring the educational environment in postgraduate residency, surgery clerkship, and anesthesia have also become available . Respiratory care (rc) is a health - care profession concerned with the assessment and treatment of patients with cardiopulmonary disorders . It usually takes 4 - 5 years to graduate with a bachelor's degree in rc education is unique in that it comprises lectures and simulated laboratory teaching, interspersed with clinical rotations in hospitals . To assess the learning environment of such a curriculum model first, the nature of curriculum of rc programs that amalgamate theory, hands - on skills, and clinical practice requires a specially designed instrument to take into account features and specialty - specific components of the curriculum . Secondly, some research studies have reported that the original inventory was modified to suit the specific educational situation or the cultural setting of the institution . Although those studies that used seven inventories had been shown to be valid and reliable, it seems that the nature of the rc profession and cultural settings may require the use of a modified or even a new assessment tool to ensure a reflection of reality . Currently, to the best of our knowledge, there is no validated inventory dedicated to measuring the educational environment of rc educational programs . Therefore, we conducted a research project to develop an assessment tool to measure the educational environment of rc programs . In this publication, we present the process by which the instrument was developed and the preliminary evaluation of the psychometric properties of the new instrument . This project used the established principles of instrument design and evaluation proposed by streiner and norman: (1) item generation; (2) item reduction and preliminary assessment of the psychometric properties in the form of validity and reliability; (3) assessment of the factorial structure of the instrument . Overview of study main steps the study was conducted in the 3 rc programs in the kingdom of saudi arabia . The first program (program 1) was at the college of applied medical sciences, university of dammam . The baccalaureate program in rc started in 1999 has so far graduated approximately 400 respiratory therapists . The structures in all programs are similar consisting of 4 years of didactic, laboratory and clinical teaching followed by 1 year of internship training . All students from the three programs at all levels of the study were invited to participate in the questionnaire validation . The content of the questionnaire was developed by an interactive process conducted by the 5-lead research team of this project . Literature review was carried out by the research team to retrieve relevant published instruments, identify the common domains and explore issues relevant to the assessment tool under study . After the extensive review, the research team decided to make up the questionnaire to include five domains; perception of clinical rounds, perception of teaching and teaching environment, perception of laboratory teaching, and perception of the rc profession . The item generation stage led to the development of an initial pool of 165 items, which were then reduced to 105 items all in arabic . To assess the instrument's content validity,, 5 rc faculty members provided their comments on the clarity and completeness of the items and relevance to rc education . In a quantitative evaluation, 3 rc faculty members from our institution and six external rc educationalists were asked to rate the relevance of each item on the scale from one (not relevant) to four (very relevant). A content validity ratio (cvr) was then derived for each item by calculating the proportion of experts who rated the item relevant or very relevant and for the whole instrument by calculating the proportion of the total number items that were rated valid . The rc panel of experts was also asked if they felt there was any content area the questionnaire had failed to deal with . For this number of experts in the panel, values higher than 0.78 for cvr was considered satisfactory as suggested by lawshe . The instrument with the content valid items was then converted to a question format and calibrated on 5-point likert scale (from strongly disagree to strongly agree) and given to 10 students (five male and five female students from the five levels of the rc program) to complete although face - to - face cognitive interviews were being conducted . The interviews used a think - aloud process to reveal students thought processes although completing the questionnaire, and to discover the rationale for the choice of each answer . Each student also commented on simplicity and clarity of the questions on first reading, and the relevance of each question to the assigned domain . Similar items were either combined, vague ones left out or the more specific ones retained . The item review step resulted in 72-item preliminary questionnaire (71 items plus one global satisfaction item) based on the hypothesized structure of five domains: perception of clinical rounds (17 questions); perception of teaching and learning (26 questions); perception of program management (14 questions); perception of laboratory teaching (9 questions), and perception of rc profession (5 questions). Item design was based on a 5-point likert scale in which 0 corresponded to strongly disagree, 1 disagree, 2 not sure, 3 agree, and 4 strongly agree . A global scale was added as a proxy measure to assess students overall satisfaction with the program . The preliminary questionnaire (72 items) was distributed by the research team to all students in the 3 rc programs in the kingdom . The survey was distributed to students, who were then given a general overview of the survey . The questionnaire included instructions on the objectives of the questionnaire, guidelines for answering questions, and an assurance of anonymity . It also included questions on demographic characteristics, name of the program and the student's level in the program . The questionnaire was re - administered to a randomly selected 50 students one week after the first round to assess the test - retest reliability of the instrument . The response distribution was examined and items with endorsement rates (percentage of respondents who checked the same response category) of> 80% were considered for exclusion . The overall score of the questionnaire was obtained by adding scores from all items, and the score for each domain was obtained by adding the scores for the items in that scale . The proportion of items and domains that were missing were calculated with acceptable values below 20% . A high number of missing items or a high percentage of missing data throughout the questionnaire could indicate that the items were either confusing or that the questionnaire layout was problematic . The rates of floor and ceiling effects were calculated as the proportion of students who obtained the lowest and the highest possible scores respectively for any of the items or domains with expected values below 30% . The construct related validity was assessed by evaluating the item convergent and item discriminant validity . Item convergent validity refers to the extent to which items within a particular domain correlate with each other . Convergence was assessed by evaluating correlations between items within each domain, and also between each item and the overall sum - score for their domain when the item of interest is eliminated from the calculation of the sum - score (item total corrected for overlap). The correlation of each item with its own scale sum - score was considered satisfactory if it was> 0.30 . Item discriminant validity on the other hand studies the assumption that in an instrument with more than one domain, the correlation between an item and its own domain is expected to be significantly higher than the correlations of the item with other domains ., as the percentage of items within each domain that met item convergent and item discriminate validity criteria . Internal consistency reliability was tested by cronbach's alpha coefficient for each domain and for the entire questionnaire with an acceptable value of 0.70; however, a scale of 0.60 was regarded as acceptable in a newly developed scales . Items that reduced the cronbach's alpha value of their domain were considered for exclusion . To examine further whether the five domains measured different aspects of student satisfaction with the program, the cronbach's alpha of each domain was compared with the domain correlation coefficient of other domains . A cronbach's alpha of the domain that was higher than the domain's correlation with other domains, would indicate that the domain scores represented different aspects of students satisfaction . The study was conducted in the 3 rc programs in the kingdom of saudi arabia . The first program (program 1) was at the college of applied medical sciences, university of dammam . The baccalaureate program in rc started in 1999 has so far graduated approximately 400 respiratory therapists . The structures in all programs are similar consisting of 4 years of didactic, laboratory and clinical teaching followed by 1 year of internship training . All students from the three programs at all levels of the study were invited to participate in the questionnaire validation . The content of the questionnaire was developed by an interactive process conducted by the 5-lead research team of this project . Literature review was carried out by the research team to retrieve relevant published instruments, identify the common domains and explore issues relevant to the assessment tool under study . After the extensive review, the research team decided to make up the questionnaire to include five domains; perception of clinical rounds, perception of teaching and teaching environment, perception of laboratory teaching, and perception of the rc profession . The item generation stage led to the development of an initial pool of 165 items, which were then reduced to 105 items all in arabic . To assess the instrument's content validity,, 5 rc faculty members provided their comments on the clarity and completeness of the items and relevance to rc education . In a quantitative evaluation, 3 rc faculty members from our institution and six external rc educationalists were asked to rate the relevance of each item on the scale from one (not relevant) to four (very relevant). A content validity ratio (cvr) was then derived for each item by calculating the proportion of experts who rated the item relevant or very relevant and for the whole instrument by calculating the proportion of the total number items that were rated valid . The rc panel of experts was also asked if they felt there was any content area the questionnaire had failed to deal with . For this number of experts in the panel, values higher than 0.78 for cvr was considered satisfactory as suggested by lawshe . The instrument with the content valid items was then converted to a question format and calibrated on 5-point likert scale (from strongly disagree to strongly agree) and given to 10 students (five male and five female students from the five levels of the rc program) to complete although face - to - face cognitive interviews were being conducted . The interviews used a think - aloud process to reveal students thought processes although completing the questionnaire, and to discover the rationale for the choice of each answer . Each student also commented on simplicity and clarity of the questions on first reading, and the relevance of each question to the assigned domain . Similar items were either combined, vague ones left out or the more specific ones retained . The item review step resulted in 72-item preliminary questionnaire (71 items plus one global satisfaction item) based on the hypothesized structure of five domains: perception of clinical rounds (17 questions); perception of teaching and learning (26 questions); perception of program management (14 questions); perception of laboratory teaching (9 questions), and perception of rc profession (5 questions). 0 corresponded to strongly disagree, 1 disagree, 2 not sure, 3 agree, and 4 strongly agree . A global scale was added as a proxy measure to assess students overall satisfaction with the program . The preliminary questionnaire (72 items) was distributed by the research team to all students in the 3 rc programs in the kingdom . The survey was distributed to students, who were then given a general overview of the survey . The questionnaire included instructions on the objectives of the questionnaire, guidelines for answering questions, and an assurance of anonymity . It also included questions on demographic characteristics, name of the program and the student's level in the program . The questionnaire was re - administered to a randomly selected 50 students one week after the first round to assess the test - retest reliability of the instrument . The content of the questionnaire was developed by an interactive process conducted by the 5-lead research team of this project . Literature review was carried out by the research team to retrieve relevant published instruments, identify the common domains and explore issues relevant to the assessment tool under study . After the extensive review, the research team decided to make up the questionnaire to include five domains; perception of clinical rounds, perception of teaching and teaching environment, perception of laboratory teaching, and perception of the rc profession . The item generation stage led to the development of an initial pool of 165 items, which were then reduced to 105 items all in arabic . To assess the instrument's content validity, the item pool was reviewed by a panel of experts . Using three focus groups, 5 rc faculty members provided their comments on the clarity and completeness of the items and relevance to rc education . In a quantitative evaluation, 3 rc faculty members from our institution and six external rc educationalists were asked to rate the relevance of each item on the scale from one (not relevant) to four (very relevant). A content validity ratio (cvr) was then derived for each item by calculating the proportion of experts who rated the item relevant or very relevant and for the whole instrument by calculating the proportion of the total number items that were rated valid . The rc panel of experts was also asked if they felt there was any content area the questionnaire had failed to deal with . For this number of experts in the panel, values higher than 0.78 for cvr was considered satisfactory as suggested by lawshe . The instrument with the content valid items was then converted to a question format and calibrated on 5-point likert scale (from strongly disagree to strongly agree) and given to 10 students (five male and five female students from the five levels of the rc program) to complete although face - to - face cognitive interviews were being conducted . The interviews used a think - aloud process to reveal students thought processes although completing the questionnaire, and to discover the rationale for the choice of each answer . Each student also commented on simplicity and clarity of the questions on first reading, and the relevance of each question to the assigned domain . Similar items were either combined, vague ones left out or the more specific ones retained . The item review step resulted in 72-item preliminary questionnaire (71 items plus one global satisfaction item) based on the hypothesized structure of five domains: perception of clinical rounds (17 questions); perception of teaching and learning (26 questions); perception of program management (14 questions); perception of laboratory teaching (9 questions), and perception of rc profession (5 questions). 0 corresponded to strongly disagree, 1 disagree, 2 not sure, 3 agree, and 4 strongly agree . A global scale was added as a proxy measure to assess students overall satisfaction with the program . The preliminary questionnaire (72 items) was distributed by the research team to all students in the 3 rc programs in the kingdom . The survey was distributed to students, who were then given a general overview of the survey . The questionnaire included instructions on the objectives of the questionnaire, guidelines for answering questions, and an assurance of anonymity . It also included questions on demographic characteristics, name of the program and the student's level in the program . The questionnaire was re - administered to a randomly selected 50 students one week after the first round to assess the test - retest reliability of the instrument . Quality and completeness of item responses were assessed for all received questionnaires . The response distribution was examined and items with endorsement rates (percentage of respondents who checked the same response category) of> 80% were considered for exclusion . The overall score of the questionnaire was obtained by adding scores from all items, and the score for each domain was obtained by adding the scores for the items in that scale . The proportion of items and domains that were missing were calculated with acceptable values below 20% . A high number of missing items or a high percentage of missing data throughout the questionnaire could indicate that the items were either confusing or that the questionnaire layout was problematic . The rates of floor and ceiling effects were calculated as the proportion of students who obtained the lowest and the highest possible scores respectively for any of the items or domains with expected values below 30% . The construct related validity was assessed by evaluating the item convergent and item discriminant validity . Item convergent validity refers to the extent to which items within a particular domain correlate with each other . Convergence was assessed by evaluating correlations between items within each domain, and also between each item and the overall sum - score for their domain when the item of interest is eliminated from the calculation of the sum - score (item total corrected for overlap). The correlation of each item with its own scale sum - score was considered satisfactory if it was> 0.30 . Item discriminant validity on the other hand studies the assumption that in an instrument with more than one domain, the correlation between an item and its own domain is expected to be significantly higher than the correlations of the item with other domains ., as the percentage of items within each domain that met item convergent and item discriminate validity criteria . Internal consistency reliability was tested by cronbach's alpha coefficient for each domain and for the entire questionnaire with an acceptable value of 0.70; however, a scale of 0.60 was regarded as acceptable in a newly developed scales . Items that reduced the cronbach's alpha value of their domain were considered for exclusion . To examine further whether the five domains measured different aspects of student satisfaction with the program, the cronbach's alpha of each domain was compared with the domain correlation coefficient of other domains . A cronbach's alpha of the domain that was higher than the domain's correlation with other domains, would indicate that the domain scores represented different aspects of students satisfaction . Item response rate ranged from 97.6% to 100% . The majority of the students, 65.1% (n = 138) were from program 1 . The remaining students came from the two other programs, 21.2% (n = 45) and 13.7% (n = 29). The students included were equally distributed among the 3 years of the program (35.8%, 30.7%, and 33.4%). All students were surveyed at the same time in the academic year 2010 - 2011 [table 1]. Students characteristics the percentage of missing items by dimension was low (range 0.5 - 2.4%) and scale and total scale scores could be computed for 100% of the sample . Item means were roughly similar and item standard deviations were almost equivalent and around one . In contrast, none of the five domains had a floor or ceiling effect [table 3]. Item level statistical characteristics scale level statistical characteristics the correlation coefficients for item convergent validity ranged from 0.01 - 0.58 . Of the 71 items, of the remaining 63 items, 60 had a correlation of 0.4 [table 4]. Perception of laboratory training was found to have convergent validity success rate that was <80% . Furthermore, shows in table 4, a total of 28 items out of 428 item correlations failed to show a successful discriminant validity resulting in an overall success rate of 92% . Summary results of multi - trait / multi - item correlation matrix as shown in table 5, reliability of the scale internal consistency was adequate as determined by cronbach's alpha . Domain was at the margin of the acceptable level of internal consistency reliability (0.58). Table 5 also presents inter - scale correlations (range 0.28 - 0.64), which was lower than cronbach's alpha for each scale . Item response rate ranged from 97.6% to 100% . The majority of the students, 65.1% (n = 138) were from program 1 . The remaining students came from the two other programs, 21.2% (n = 45) and 13.7% (n = 29). The students included were equally distributed among the 3 years of the program (35.8%, 30.7%, and 33.4%). All students were surveyed at the same time in the academic year 2010 - 2011 [table 1]. The percentage of missing items by dimension was low (range 0.5 - 2.4%) and scale and total scale scores could be computed for 100% of the sample . Item means were roughly similar and item standard deviations were almost equivalent and around one . In contrast, none of the five domains had a floor or ceiling effect [table 3]. The correlation coefficients for item convergent validity ranged from 0.01 - 0.58 . Of the 71 items, 8 had a corrected item - total correlation of <0.30 . Of the remaining 63 items, 60 had a correlation of 0.4 [table 4]. Only one domain perception of laboratory training was found to have convergent validity success rate that was <80% . Furthermore, shows in table 4, a total of 28 items out of 428 item correlations failed to show a successful discriminant validity resulting in an overall success rate of 92% . As shown in table 5, reliability of the scale internal consistency was adequate as determined by cronbach's alpha . Domain was at the margin of the acceptable level of internal consistency reliability (0.58). Table 5 also presents inter - scale correlations (range 0.28 - 0.64), which was lower than cronbach's alpha for each scale . To the best of our knowledge, this is the first instrument for assessing educational environment of rc programs . In this paper, we focused on the first two phases of psychometric evaluation and scaling performance of the instrument under development . Future reports will focus on more refinement of the questionnaire factor structure and reliability of test - retest . The results of our preliminary analysis on the psychometric properties of the new instrument showed an overall satisfactory evidence of acceptability, reliability, and validity of the included questions . The high rate of completeness of the questionnaires reflects the practicality and feasibility of administering this survey to a group of students . Face validity was confirmed by asking students during the cognitive interviews whether the items looked reasonable at face value . Construct related validity was confirmed by the mostly successful item and scale validity . Of the 71 items, it is possible to explain the failure of the discriminant validity of some of these items; for example the item that asked about the organization between information provided in the laboratory teaching and class teaching made it difficult to separate the two domains perception of laboratory teaching and perception of teaching and learning . Answer to questions in one domain may be a coalescence of the effects of both domains . The same was true for items on utilization of clinical training in the information received in the laboratory teaching . It was probably difficult to differentiate between the two domains perception of lab teaching and perception of clinical training . In the process of item reduction, 6 items out of the 12 with unsatisfactory properties were excluded from the instrument . The other six were left after the research team decided on their high content validity and slight problems with their construct validity . For example, items such as faculty were partial to some students, which gave me a feeling of unfairness were considered to be important to keep in the questionnaire (corrected item - total correlation of 0.23 and floor effect of 17%). Scale reliability that was assessed by internal consistency reliability using cronbach's alpha was above the recommended value in four out of the five domains . The slightly lower internal consistency reliability of the perception of lab training dimension (cronbach's alpha 0.58) may suggest the need to add more items to this scale in future developments of this instrument . The high internal consistency reliability by the cronbach's alpha and moderate inter - scale correlations further supported the validity of the internal construct indicating that each of the five domains measured concepts that were related, but distinct . Some items obtained the highest score (ceiling effect) in a high proportion of the students, which may suggest that it is impossible to test sensitivity or verify improved perception of these items by students, over time or as a result of intervention programs . However, it is important to note that none of the dimension scales showed ceiling or floor effect suggesting that the instrument will continue to be effective in detecting the difference between groups and have good sensitivity to detect changes in student satisfaction using the dimensional and total scores . First, the sample size was relatively small; it was possible that with a larger sample size, there would be stronger evidence of reliability and validity and the performance of the instrument in various subgroups could be investigated . Secondly, the cross - sectional design of the study did not allow the assessment of the responsiveness of the instrument to change or intervention . Thirdly, without a similar published instrument to assess student perception of rc programs, no comparison of our validation results can be made . Despite these limitations, item generation and reduction of this study resulted in an instrument with 65 items and five domains . Overall scaling, validity, and reliability characteristics were very encouraging at this preliminary assessment of the questionnaire . Only a few items had difficulties and these were excluded except when the research team felt it was still desirable to retain them for content validity . The authors of this study are currently in the process of conducting more conclusive psychometric evaluation of this instrument including factor analysis, structural equation modeling, and test - retest reliability analysis . First, the sample size was relatively small; it was possible that with a larger sample size, there would be stronger evidence of reliability and validity and the performance of the instrument in various subgroups could be investigated . Secondly, the cross - sectional design of the study did not allow the assessment of the responsiveness of the instrument to change or intervention . Thirdly, without a similar published instrument to assess student perception of rc programs, no comparison of our validation results can be made . Despite these limitations, item generation and reduction of this study resulted in an instrument with 65 items and five domains . Overall scaling, validity, and reliability characteristics were very encouraging at this preliminary assessment of the questionnaire . Only a few items had difficulties and these were excluded except when the research team felt it was still desirable to retain them for content validity . The authors of this study are currently in the process of conducting more conclusive psychometric evaluation of this instrument including factor analysis, structural equation modeling, and test - retest reliability analysis . The instrument under study is being rigorously developed as the first validated instrument for measuring students perception and satisfaction in rc educational programs . This assessment tool is a potentially valid and reliable instrument for use in future studies to assess rc students perception and satisfaction with the educational environment . Future longitudinal studies are needed to assess the responsiveness and predictive validity of this instrument.
Patients with systemic rheumatic diseases, particularly rheumatoid arthritis (ra), systemic lupus erythematosus, systemic sclerosis, and idiopathic inflammatory myopathies, are at increased risk of developing malignancies . This risk is related to the pathobiology of the underlying rheumatic diseases including the inflammatory burden, immunological defects, and personal and environmental exposure such as smoking and some viral infections . However, the occurrence of cancer among patients with ra in a nonreferral community - based population has not been thoroughly examined, especially with respect to nonmelanoma skin cancer (nmsc). A number of studies have shown ra and ra diseases activity as pathogenic factors in the development of lymphoma [2, 3]. Some studies have shown an increased risk of lung cancer and decreased risk of colorectal cancer in patients with ra [4, 5]. The purpose of this study is to evaluate the occurrence of cancer both prior to and after diagnosis of ra in a population - based cohort of patients with ra and compare the occurrence to an age- and sex - matched comparison cohort without ra from the same geographical area, as well as to assess the risk factors for development of cancer among patients with ra . This retrospective, population - based study was conducted using the resources of the rochester epidemiology project, a medical records linkage system that allows ready access to the complete (inpatient and outpatient) medical records from all community medical providers . An inception cohort of all cases of ra diagnosed between january 1, 1980, and december 31, 2007, among olmsted county, minnesota, residents 18 years of age was previously assembled using the resources of the rochester epidemiology project . Incidence date was defined as the earliest date at which the patient fulfilled at least 4 of the 7 american college of rheumatology 1987 classification criteria for ra . A comparison cohort of olmsted county residents without ra with similar age, sex, and calendar year was also previously identified . The index date for each non - ra subject was defined as the ra incidence date of the corresponding patient with ra . The institutional review boards of the mayo clinic and the olmsted medical center approved this study . For both the ra and comparator cohorts, cancer diagnoses were retrieved from the mayo clinic cancer registry (all malignancies except nmsc) and nmsc were abstracted from the medical charts using a standardized abstraction form . Cancer categories included head / neck, gastric, pancreatic, liver, colon / rectal, other digestive, lung, other thorax, bone, soft tissue, skin (subdivided into melanoma and nmsc), breast, ductal carcinoma in situ, ovarian, other gynecologic, prostate, kidney, bladder, other genitourinary, ophthalmic, central nervous system, lymphoma, leukemia, multiple myeloma, myeloproliferative syndrome, myelodysplastic syndrome, and other . The information on ra characteristics included rf status, erythrocyte sedimentation rate (esr) at ra incidence, large joint swelling, joint erosions / destructive changes on radiographs, joint surgeries (i.e., arthroplasty and synovectomy), and extra - articular manifestations of ra (exra). Severe exra included pericarditis, pleuritis, felty's syndrome, glomerulonephritis, vasculitis, peripheral neuropathy, scleritis, and episcleritis . Data regarding start and stop dates for use of systemic glucocorticoids (e.g., oral / parental / intraarticular forms of prednisone, prednisolone, methylprednisolone, hydrocortisone, and dexamethasone), disease - modifying antirheumatic drugs (dmards) (methotrexate, other dmards), and biologic response modifiers (antitumor necrosis factor alpha [anti - tnf] agents, anakinra, abatacept, and rituximab) were collected in all patients . The cumulative incidence of malignancy adjusted for the competing risk of death was estimated for both cohorts . This method, although similar to the kaplan - meier method, better accounts for patients who die before experiencing malignancy . Cox proportional hazard models were used to examine the differences between cohorts, as well as the association between patient characteristics (age, time since ra diagnosis, etc .) And the rate of development of malignancy within the ra cohort, and to assess trends in malignancy over time . Analyses were performed using sas version 9.4 (sas institute, cary, nc, usa) and r 3.1.1 (r foundation for statistical computing, vienna, austria). The mean age of diagnosis was 55.9 (sd: 15.7) years with 42 (68.4%) females . The mean length of follow - up after diagnosis was 14.1 (sd: 7.7) years . The majority of the patients in this study were caucasian, 93.6% in the ra group and 94.8 in the non - ra group . In the non - ra comparator cohort the number of patients and mean age at index date were the same as for the ra cohort . The mean length of follow - up in the non - ra cohort was 14.9 (sd: 8.1) years . There were 21.9% and 17.7% current smokers in the ra and non - ra cohort, respectively . Prior to ra incidence / index date, 52 patients with ra and 66 non - ra subjects had malignancies excluding nmsc (p = 0.21). Including nmsc, there were 79 patients in the ra cohort and 108 in the non - ra cohort with malignancies (p = 0.024), as there were fewer nmsc in the ra cohort than in the non - ra cohort prior to ra incidence / index date (a total of 143 patients with malignancies excluding nmsc were detected in the ra cohort, compared with 118 patients experiencing malignancies in the general population comparator cohort . The hazard ratio (hr) of any malignancy excluding nmsc was 1.32 (95% confidence interval [ci]: 1.03, 1.68; table 1). The cumulative incidence of any malignancy excluding nmsc at 10 years after ra incidence / index date was 11.8% (standard error [se] 1.2%) among the ra compared to 9.3% (se: 1.1%) among the non - ra . There was no apparent difference in the cumulative incidence of any malignancy excluding nmsc during the first 5 years after ra incidence / index date (figure 1). Including cases of nmsc, the total number of patients with malignancies in the ra cohort was 194, compared with 179 in the general population group . The hr of any malignancy including nmsc for ra compared to non - ra did not reach statistical significance (hr: 1.13; 95% ci: 0.92, 1.38). The incidence of hematologic cancers in patients with ra was increased compared to the general population (hr 3.58; 95% ci: 1.69, 7.60). Of solid malignancies, lung cancer was diagnosed in 29 patients in the ra cohort; the incidence was increased compared to the non - ra cohort with hr 1.97 (95% ci: 1.08, 3.59). Characteristics associated with a high risk of any malignancy included smoking (hr: 1.60; ci: 1.09, 2.34) and erosions / destructive joint changes (hr: 1.47; 95% ci: 1.04, 2.09; table 2). Smoking was associated with increased risk of not only lung cancer but also risk for any malignancy . The hr for any malignancy comparing current smokers to never or former smokers was 1.60 (95% ci: 1.09, 2.34); that of lung cancer was also increased 3.59 (95% ci: 1.23, 10.48). The risk of lung cancer in ra compared to non - ra was attenuated by adjustment for smoking status (hr: 1.48; 95% ci: 0.81, 2.70). The risks for any malignancy (hr: 1.26; 95% ci: 0.99, 1.62) and hematologic cancers (hr: 3.48, 95% ci: 1.63, 7.41) were also somewhat smaller after adjustment for smoking status . There were no apparent calendar time trends in the occurrence of malignancies among the ra or non - ra cohorts . The use of glucocorticoids in patients with ra was associated with increased malignancy risk (hr 1.57; 95% ci: 1.04, 2.39). This association between glucocorticoid use and development of any malignancy persisted after additional adjustment for esr at ra incidence, rheumatoid factor positivity, and current smoking (hr: 3.59; 95% ci: 1.03, 2.40). Methotrexate use was not associated with overall increased malignancy risk in patients with ra (hr: 1.04; 95% ci: 0.72, 1.50). Other dmards as a group were not associated with an increased risk for malignancy, although the risk of lung cancer was numerically but not significantly increased (hr: 2.38; 95%; ci: 0.91, 6.22). As well, malignancy risk was not associated with use of biologics (primarily antitumor necrosis factor agents), glucocorticoids or anti - inflammatory analgesics (table 2). The risk of lung cancer was further attenuated by additional adjustment for erythrocyte sedimentation rate (esr) at ra incidence, rheumatoid factor positivity, and current smoking (hr: 1.50; 95% ci: 0.583.92). The malignancy risk was not increased in this ra cohort with the use of biologics (hr 0.69; ci: 0.36, 1.35). This retrospective population - based cohort study examined the incidence of malignancy in a nonreferral community - based population with ra and the risk for individual malignancies, including specific solid tumors, lymphomas, leukemias, and skin cancers (nmsc and melanoma). Excluding nmsc in the risk estimation revealed an increased risk of cancer in patients with ra; however, when nmsc were included, the overall cancer risk was not increased . In this study, the overall risk of malignancy in patients with ra was not associated with dmards or biologic response modifiers, principally tnf inhibitors . The use of glucocorticoids was associated with increased risk of any malignancy, but there was no apparent association between glucocorticoids and hematologic cancers or lung cancers . The association between glucocorticoid use and development of any malignancy persisted after additional adjustment for esr at ra incidence, rheumatoid factor positivity, and current smoking . However, given the observational nature of our study, glucocorticoid use may be confounded with more severe disease and increased inflammatory burden, which may be associated with malignancy risk . The overall increased risk of cancer was largely driven by the increased risk of hematologic cancers . A link between lymphoma and ra subsequently, a considerable body of evidence has emerged that supports ra and ra disease activity as pathogenic factors in the development of lymphoma [2, 3]. In a meta - analysis of 21 publications from 1990 to 2007 on the risk of malignancy in patients with ra, the risk of lymphoma was increased approximately twofold (sir 2.08, 95% ci 1.8, 2.39), with a greater risk of both hodgkin's and non - hodgkin's lymphoma . Lymphoproliferative malignancies are also increased in patients with extra - articular disease manifestations such as felty's syndrome and secondary sjgren's syndrome . Pooled data from 74 randomized controlled trials showed that tnf inhibitors were associated with an increase in risk of nmsc beyond the risk associated with ra alone . Several large observational studies have supported this finding [17, 18], but others have not [1921]. In a recent population - based cohort study conducted in sweden, the risk of squamous cell cancer (scc) and basal cell cancer (bcc) was evaluated in patients with ra nave to biologic drugs, in patients starting tnf inhibitors treatment, and in the general population . This study demonstrated a 20% increased risk of bcc and a near doubled risk of scc in patients with ra compared with the general population . For patients treated with tnf inhibitors compared with those nave to biologics, bcc risk was moderately increased, but the increase was not significant after adjustments for demographic and comorbidity variables . Limitations of that study include that the authors were unable to adjust for severity of disease . If severity of arthritis is related to risk of nmsc, then this outcome is confounded by indication . Patients were not randomly assigned to treatments in this observational study, so any excess risk could be due to increased severity of disease rather than treatment . One of the studies conducted among 13,001 patients using the us national cancer institute seer (surveillance, epidemiology, and end results) database revealed increased risk for skin cancers with biologic therapy, but not for solid tumors or lymphoproliferative malignancies . Another study from the south swedish arthritis treatment group register (ssatg) evaluated the risk of malignancy in patients who had undergone tnf inhibitor therapy . This study demonstrated that patients receiving conventional ra treatment had an increased overall tumor risk compared with the background population . Possible additional increased risk for lymphoma associated with tnf inhibitors was also reported in few cases . The risk for lung cancer was increased in the current study . An increased risk of lung cancer has been reported in individual studies, as well as in the meta - analyses . This may be related to an increased risk of ra in smokers described in population - based prospective cohort studies [24, 25]. Conversely, in a study of patients with ra in the us veterans' population, the risk of lung cancer was increased by 43% compared with the general population, even after adjustment for tobacco and asbestos exposure . Strengths of this study include its population - based design and complete medical record review . The rochester epidemiology project affords the ability to include both patients with ra and age- and sex - matched comparator subjects living within the same community, reducing biases of referral populations . The average follow - up of 14 years in this study is much longer than the majority of other retrospective studies . The length of follow - up in the current study permits assessment of long - term risk and secular trends in cancer development compared to most studies which are of shorter duration . Limitations may include the fact that the population of olmsted county is predominately caucasian; however results of rep studies are generally applicable to other population cohorts . In addition, there is some concern with the size of our cohort, 813 ra patients, ~7800 patient - years of follow - up . While our study was adequately sized to detect increased risk for any malignancy, it was under - powered to detect increased risks for cancer subtypes . There was a small to moderately increased risk of malignancies excluding nmsc in ra patients; the risk was highest for hematologic cancers . Risk for lung cancer was also increased . The overall risk of malignancy in patients with ra was not associated with dmards or biologic response modifiers, principally tnf inhibitors.
The interplay between gut microbiota and the immune system is a complex balance to maintain health and immunity, notably in chronic inflammatory diseases . Here, we review the changes in gut microbiota during hiv infection and the factors which modulate gut microbiota in relation to inflammation in hiv patients . We also discuss the local and systemic impact of the changes in gut microbiota and microbial translocation from the gut into the periphery in hiv infection . Finally, we discuss the potential immunotherapeutic interventions targeting gut mucosal immunity and microbiota to reduce hiv - induced inflammation . As humans, we tend to think of ourselves as independent entities; however we have coevolved with billions of microorganisms that have colonized our mucosal tissues and contribute to our host diversity . The interactions between host and microorganism have recently been identified as a two - way street, where host immune pressure and food intake impact the quality of mucosal - associated flora and in turn certain microbes tailor our local and systemic immune system . The oral - gastrointestinal (gi) tract which contains the largest population of microorganisms constitutes the digestive microbiota, better known as gut microbiota . The healthy gut microbiota is composed of a diverse and highly variable population of microbes that include bacteria, viruses, and over 50 genera of fungi [1, 2]. In physiological conditions, the gut microbiota exerts a predominantly positive effect on our immune defenses such as promoting immune cell maturation . In return for providing a niche rich in nutrients, the microbiota provides for us by means of carbohydrate digestion and fermentation, by vitamin production, and most notably by helping our bodies establish gut - associated lymphoid tissue (galts). One of the more common constituents of the gut microbiota is the multiple strains of lactobacilli, a lactic acid - producing bacterium which is capable of producing lactacin b, a bacteriocidal compound . Lactobacilli are commonly thought of as highly beneficial, so much so that strains tend to be added to different foods labeled as probiotic in hopes of positively affecting the gut microbiota composition . To look at a few examples, l. acidophilus interacts with dendritic cells (dcs) to induce production of interleukin-10 (il-10), an anti - inflammatory cytokine . In addition, l. paracasei works from the other end of the spectrum by means of a protease that it encodes which has the ability to degrade highly inflammatory interferon (ifn) -induced protein 10 (ip-10, cxcl10). Driver - passenger model for colorectal cancer whereby naturally occurring gut microbiota may act as a driver creating dna damage and driving genome instability leading to creation of tumors . Passenger or opportunistic bacteria may then take over leading to a dysbiosis of the gut . Despite potentially triggering colorectal cancer, another group showed that the gut microbiota may also be key in cancer treatment . Cyclophosphamide (ctx), a dna - alkylating chemotherapy agent, is dependent on a healthy gut microbiota to properly impact the polarization of splenocytes into th17 cells, which play a key role in maintaining the integrity of mucosal immunity by secretion of il-17 . Indeed, when ctx is used in germ - free mice, or mice on antibiotic treatments, a reduced elicitation of th17 cells was found . One of the more established functions of the gut microbiota is prevention of various diseases . By outcompeting pathogenic microorganisms for food and space, the gut microbiota is able to check pathogenic growth and prevent damage to the host [12, 13]. However, some viral infections have been known to use the microbiota to their advantage . Mouse mammary tumor virus (mmtv), a retrovirus, is capable of coating itself in lipopolysaccharides (lps) derived from the gut microbiota and interacting with pattern recognition receptor toll - like receptor 4 (tlr4) on myeloid cells . The subsequent production of il-10 contributes to successful mmtv infection via induction of immune tolerance . In addition, poliovirus uses the gut microbiota as well by binding to lps to promote infection resulting in a more severe clinical course . By using the gut microbiota to their own advantage, viruses such as poliovirus and mmtv are capable of circumventing immune detection and elimination in favour of enhanced replication . The galt, in particular cd4 + t cells residing in the galt, is one of the main sites in hiv infection which constitute a long - term reservoir site even in patients receiving successful antiretroviral therapy (art). Whatever the route of infection, mucosal regions house a rich microbiota which alters the infectivity of the target cells . Once infection has occurred, hiv rapidly depletes cd4 + t cells from the galt as a larger percentage of these cells express elevated level of ccr5, the coreceptor for cellular entry, compared to peripheral blood . Indeed, in an experimental infection of macaques by simian immunodeficiency virus (siv), a rapid decrease of 90% of cd4 + t cells in the galt was observed within 2 weeks of infection . The other hallmark of hiv infection is persistent immune activation which makes cd4 + t cells more susceptible to infection, thus creating a vicious cycle by increasing production of ifn-, il-6, ip-10, and indoleamine2,3-dioxygenase (ido). Cd4 + t cell destruction associated with immune activation in the gut leads to high levels of cd8 + t cell infiltration and epithelial cellular damage . In addition, hiv - infected cells are known to display an altered expression of micrornas (mirnas) in which multiple mirnas are downregulated . As mirnas in the gi can also be affected by the microbiota [24, 25], it is entirely likely that hiv creates changes to the gi mirna profile as well . In the gi tract, mucosal barrier damages disrupt the integrity of the epithelial tissue and favor microbial translocation into the circulating blood . This leaking galt in addition to hiv has been linked to the development of acquired immunodeficiency syndrome (aids). Art has the ability to partially reconstitute this loss of cd4 + t cells in the gut, but only to roughly 50% when compared to noninfected controls . One of the most significant consequences to the galt caused by hiv is the drastic decrease of th17 cells . There is also an increase in immunosuppressive regulatory t cell (treg) frequency in the galt which is influenced by the levels of ido . This shift in the balance of treg and th17 cells in favor of tregs leads to increased mucosal permeability and microbial translocation and therefore further fuels immune activation . Ido is an immunomodulatory enzyme found in dendritic cells (dc) and macrophages which breaks down tryptophan (trp) into kynurenine (kyn) [3032]. In addition, tryptophan 2,3-dioxygenase (tdo), a hepatic enzyme, is highly similar to ido, which also acts on the kyn pathway [34, 35]. Tdo may also be found in the placenta, testis, and brain after stimulation [3537]. Enhanced immunosuppressive kyn production by ido and/or tdo plays a harmful role in cancers and viral infections including hiv infection [22, 29, 38, 39]. Kyn inhibits t cell proliferation [40, 41] while another ido catabolite, quinolinic acid, is linked to neurodegenerative diseases including aids dementia complex . It is known that monocyte derived - dcs specifically expressing ido promote treg expansion and that the ido induction in these dcs can be achieved by the hiv transactivator protein tat [43, 44]. Furthermore, our team has recently shown that increased ido enzyme activity and kyn production are linked to the imbalance of th17/treg and microbial translocation in chronic hiv infection . In untreated hiv infection, ido levels were found to be elevated and were correlated with the high levels of immune activation . After several years of continuous successful art, these levels decreased, approaching what is seen in healthy subjects . Interestingly, an enrichment of a gut microbiota subset which has the capacity of catabolizing trp through the ido pathway was found in hiv - infected subjects . The alteration of th17/treg balance in the galt induced by hiv leads to microbial translocation of commensal and pathogenic bacterial products into the blood stream resulting in a generalized and persistent immune activation . However, there were also changes to the types and amounts of bacteria that comprise to microbiota . An in - depth analysis of the changes in microbiota of hiv - infected patients was assessed by vujkovic - cvijin et al . In their study, the total bacterial load and amount of diversity appeared to be similar across infected and uninfected groups; however hiv viremic patients had microbiota communities distinctly enriched in proteobacteria, most notably of the family enterobacteriaceae which includes known pathological microbes such as salmonella, escherichia, and shigella . In fact, these pathological microbes tend to be the cause of bacteremia in advanced hiv - infected patients . Viremic patients also displayed a decrease in bacteroides and alistipes, which are depleted in inflammatory bowel disease . The particular enrichments and depletions in viremic hiv patients were found to be linked to a decrease in th17 cells in gut biopsies as well as an increase in immune activation and correlation with ido activity and ip-10 plasma levels as a trustable marker of hiv disease progression . The link between ido activity and the microbiota appears to be a self - sustaining feedback loop, which encourages pathological microbe growth . Study have enzymatic homologs of ido, which are capable of producing kyn from trp . The initial assault from hiv to the gut causes inflammation, which may in turn create a microenvironment more suitable to pathologic bacteria . This bacterial community may be capable of outcompeting its beneficial counterpart by way of kyn production through ido, and, once established, they are capable of producing kyn which further fuels their growth . However, some art - treated patients exhibited microbial communities highly similar to viremic patients, while others were much more similar to healthy subjects . The diversity may be an indication of clinical outcome or could indicate that the microbiota recovery time is variable . In line with this hypothesis, a recent study by lozupone et al . Looked at bacterial variance during art . They examined hiv - infected patients who were untreated or had been on art for varying lengths of time . The study showed that genera of bacteria that are elevated in hiv - infected patients versus healthy subjects such as peptococcus decreased over time spent on art to levels approaching that of healthy subjects . Indeed, they demonstrated an association between enriched levels of lactobacillales and preserved immune function as indicated by decreased microbial translocation, lower t cell proliferation, and higher percentages of cd4 + t cells in the gut and periphery . Lactobacilli are clearly important for regulating and maintaining physiological gut immunity, a concept which was explored by zelante et al . In a mouse model . Indeed, lactobacilli, specifically l. reuteri, are capable of catabolizing trp into indole-3-aldehyde (iald) when there is an excess of nutritional trp and ido activity is low . Iald is then capable of stimulating natural killer (nk) cells via aryl hydrocarbon receptor (ahr) to produce il-22 which controls the gut microbiota, ensuring a diverse ecosystem . However, in cases where ido activity is elevated due to the migration of ido - expressing dcs to gut mucosa, trp is preferentially broken down into immunosuppressive kyn . Higher levels of kyn and the subsequent expansion of tregs create a tolerogenic environment where normal commensals like candida albicans can become pathogenic creating candidiasis . Interestingly, the same study showed that administration of oral iald to mice with mucosal candidiasis restored il-22 production by nk cells and decreased the candidiasis . This distinctive use of trp by lactobacilli may in part account for its association with better clinical outcomes in hiv by way of limiting kyn production and may represent an important strategy for future treatments . Recently, balmer et al . Helped elucidate the role of the liver in the control of microbial translocation using a mouse model . In their study however, once the gut epithelial cells were breached, microbes gained access to underlying vasculature, which drains directly into the hepatic portal vein . Mice challenged with e. coli alone did not have any detectable bacteria in the liver but after inducing experimental intestinal inflammation, e. coli was consistently found in the liver . Once microbial products reach the liver, kupffer cells, specialized hepatic macrophages, are capable of clearing the bacterial challenge . In the case of liver tissular insults, mice showed a drastic reduction in bacterial clearance . Since the initiation of art treatment, patients have shown increased survival and that survival has led to a rise in non - aids conditions all related to immune activation that affects kidney, cardiovascular organs, and liver . Lps in the portal vein system is capable of activating kuppfer cells, leading to a release of inflammatory cytokines and perpetuating the continued inflammation and therefore hepatic damages . Liver damage can further be exacerbated by alcohol abuse, obesity, metabolic syndrome, and art hepatotoxicity . Hiv is also capable of accelerating the development of liver cirrhosis in patients coinfected with hcv . Under viral infection conditions that increase immune system inflammation, the increased microbial translocation is linked to a decrease in the liver's ability to clear bacteria . Epidemiological evidence indicates that a cohort of patients displaying nonalcoholic fatty liver disease or steatohepatitis showed evidence of serum igg and iga against intestinal commensal microbes which signifies that compartmentalization of the gastrointestinal microbiota is compromised in liver disease due to the failure of the hepatic vascular firewall . Hiv infection is a major cause of microbial translocation where bacterial products egressing the gut by the portal vein cannot be fully cleared by the kupffer cells in the liver leading to microbes and their products being present in peripheral blood . Levels of microbial translocation can be measured by scd14, the soluble form of cd14, released into the circulation by monocytes upon microbial product stimulation . In hiv viremic patients, scd14 is elevated but, once patients are treated with art, these levels decrease to a level similar to healthy individuals . Another soluble inflammatory marker which is linked to ido activity is soluble cd40 ligand (scd40l) as cd40-cd40l signaling is known to be key in ido induction . Scd40l is mainly produced by activated t cells, platelets, and b cells and its plasma levels are increased in chronic hiv infection . As part of the tnf - receptor superfamily, engagement of cd40 and cd40l, in the presence the hiv envelope protein gp120 our group has recently reported that scd40l is able to stimulate treg expansion and differentiation, and, most notably, production of kyn through ido resulting in microbial translocation . Ido can also be used to predict disease outcomes independently of viral load and cd4 + t cell counts . In a ugandan cohort of hiv - infected patients, higher ido activity was strongly associated with higher hiv rna copies and low cd4 + t cell counts in absence of art . Following art initiation, ido produced at local gut mucosal sites and circulated in the peripheral blood affects multiple organs in multiple ways, including the brain . Activated monocytes are capable of trafficking the virus into the central nervous system where the infection is mainly perpetuated by infected macrophages . Blood - brain barrier endothelial cells can synthesize kyn after immune activation . In mice, this induction is mediated in part through the viral protein tat which synergizes with ifn- already present due to inflammation . Furthermore, high circulating levels of ido in hiv patients are associated with depression and are found in hiv - associated dementia . In line with this, it has been shown that scd40l is also involved in cerebral inflammation and dementia in hiv - infected patients [36, 37, 69, 70]. The human gut microbiota is complex and deeply intertwined with the immune system, which makes it one of the many factors involved in hiv infection . During hiv infection, the microbiota is affected on a local level in the gastrointestinal tract, which creates changes to our immune system . The alterations to immune system favoring inflammation lead to increased microbial translocation which is normally cleared in the liver, except in cases of liver damage or when this translocation persists for long periods of time . The systemic effects of the microbiota can be explained by the production of ido, which occurs at the level of the gut and also at multiple sites including the brain . Ido and its immunosuppressive catabolites are further capable of altering the immune system by enhancing treg populations and downregulating th17 populations, creating a vicious circle (figure 1). The topic of intervention in relation to the microbiota is not new and includes targeting the gi biological, immune, and mechanical barrier . All this makes ido, tdo, cd40l (an upstream inducer of ido), and the microbiota targets during hiv treatment to improve the immune system as summarized in table 1 . Such attempt used 1-methyl - tryptophan (1-mt) in the brain of cx3cl1/ mice after challenges of lps . Cx3cl1/ mice normally display persistent neural inflammation and depressive - like behavior upon lps challenge but with 1-mt, a competitive inhibitor of ido, these effects were abrogated only 72 h after challenge . Similar results were seen in another mouse model using 1-mt to promote clearance of hiv - infected macrophages in the brain, an environment simulating hiv encephalitis, where administration of the drug caused infected macrophages to decrease by almost 90% . Although kyn levels remained high, suggesting 1-mt was not fully effective against ido activity, macaques with unsuccessful art displayed reduced viral load . However, in a more recent study of 1-mt in rhesus macaques with siv on art treatment, there was no effect found on inflammation, viral rna in blood, or gastrointestinal tissue . Ido may be a potential target not only to treat hiv infection, but also in the prevention of infection . In hiv - exposed seronegative female commercial sex workers, cervical mononuclear cells one possible avenue in hiv prevention may lie in understanding the immune quiescent nature of seronegative sex workers immune system . Probiotics and prebiotics help support and grow the microbiota and have been used in different diseases with gastrointestinal inflammation . Probiotics consist of microorganisms, frequently lactobacilli, that are taken with the aim of positively influencing the host microbiota and therefore health . Prebiotics on the other hand are indigestible food ingredients such as inulin that aim to promote microbiota associated with good health . When used together, one study found that pro- and prebiotics increased cd4 + t cell reconstitution and functionality while a meta - analysis found that probiotics improved infant growth and protected against cd4 + t cell loss [78, 79]. New studies have also begun looking into sevelamer as a treatment for microbial translocation and subsequent inflammation . Sevelamer is a phosphate - binding drug already shown to decrease blood levels of lps in cases of chronic kidney disease . Indeed, in an siv model, sevelamer decreased microbial translocation while also decreasing inflammation and immune activation . However a study on nontreated hiv - infected patients showed a lack of any significant changes to microbial translocation, inflammation, or immune activation . Although not directly aimed at the microbiota, our group was instrumental in a study using il-7 as a treatment meant to restore gut immunity and integrity . Il-7 is known to induce gut epithelial cells to produce il-7, while an absence of gut microbiota is known to decrease il-7 . After il-7 administration, patients showed increased cd4 + and cd8 + t cells, as well as an increase in gut - homing lymphocytes (47 + t cells). Patients also displayed a decrease in scd14 indicating an improvement in the gut barrier integrity . Research has only begun to scratch the surface of how our microbiome fully influences hiv infection . However, it is clear that a complex interplay between gut microbiota and altered immune system mediated by the virus contributes to disease progression and immunodeficiency . Therefore, design and implementation of new and combinatory immunotherapeutic strategies which target both gut microbiota and host immunosuppressive mechanisms could represent novel additions to current art treatments to reduce generalized immune activation and inflammation as a consequence of hiv / microbiota partnership.
We used m. tuberculosis cdc1551, a clinical isolate, as the host strain to generate a transposon insertion mutant in mt2594 (ldtmt2::tn) as described 14 . This mutant carries a himar1 transposon insertion at + 872 base from the putative translation start site of the gene . This is a single copy integrating plasmid based on pmh94 backbone 25, which we modified into a gateway compatible destination vector (invitrogen). We cloned a wild - type copy of mt2594 along with its promoter into this destination vector pgs202 to generate pgs202_2594 . We used middlebrook 7h9 liquid medium supplemented with 0.2% glycerol, 0.05% tween80, 10% vol / vol oleic acid albumin dextrose catalase (oadc) and 50 ug ml cycloheximide for in vitro growth, and middlebrook 7h11 solid medium (becton - dickinson) for enumerating colony forming units (cfu) in in vitro and in vivo growth studies . We amplified a portion of ltdmt2 with primers 5-ttttcatgatcgccgatctgctggtgc-3 and 5-ttggatcccgccttggcgttaccggc-3, digested with bsphi bamhi (underlined) and cloned into pet2818 15 . The resulting plasmid, encodes a fusion protein consisting of a methionine specified by the atg initiation codon of pet2818, residues 55 to 408 of ldtmt2, and a c - terminal polyhistidine tag with the sequence gsh6 . We grew e. coli bl21(de3) harboring prep4groesl 26 and pet2818ldtmt2 at 37 c in 3 l of brain heart infusion broth containing 150 g ml ampicillin, induced expression using isopropyl we purified ldtmt2 from a clarified lysate by affinity chromatography on ni - nitrilotriacetate - agarose resin (qiagen gmbh, germany) followed by anion exchange chromatography (monoq hr5/5, amersham pharmacia) with a nacl gradient in 50 mm tris we performed an additional size exclusion chromatography on a superdex hr10/30 column equilibrated with 50 mm tris finally, we concentrated the protein by ultrafiltration (amicon ultra4 centrifugal filter devices, millipore) and stored at 20 c in the same buffer supplemented with 20% glycerol . We purified disaccharide - tetrapeptide containing amidated meso - diaminopimelic acid (glcnac murnac mesodapnh2d ala) from c. jeikeium strain cip103337 and determined the concentration after acid hydrolysis 27,28 . Next, we tested in vitro formation of muropeptide dimers in 10 l of 50 mm tris hcl (ph 7.5) containing 300 mm nacl, 5 m ldtmt2, and 280 m disaccharide tetrapeptide . We incubated he reaction mixture for two hours at 37 c and analyzed the resulting muropeptides by nanoelectrospray tandem mass spectrometry using n2 as the collision gas 28 . We used 45 week old, female balb / c mice (charles river laboratories) to study in vivo virulence of the strains and their susceptibility to drugs . We infected mice with a log phase culture of wild type m. tuberculosis, or ldtmt2::tn or the complemented strain in an aerosol chamber . For assessing in vivo growth of each strain, we sacrificed four mice per group at days 1, 7, 14, 28, 56 and 98 following infection, obtained lungs and spleen, homogenized and cultured appropriate dilutions on middlebrook 7h11 medium to determine cfu . We allocated 12 mice for each infection group to assess virulence of each strain, for which we determined median - survival - time that mice from each group survived following infection . Protocols for experiments involving mice were approved by johns hopkins university animal care and use committee . We determined minimum inhibitory concentrations for amoxicillin clavulanate, imipenem (merck), isoniazid (sigma) and cycloserine (sigma) using the broth dilution method 29 . We used augmentin (glaxosmithkline), a preparation containing amoxicillin and calvulanate as m. tuberculosis contains lactamases 17 . For this we inoculated 10 m. tuberculosis bacilli in 2.5 ml of 7h9 broth and added drugs at different concentrations . We incubated these cultures at 37 c and evaluated for growth by visual inspection at 7 and 14 days . For those samples with diminished growth compared to no - drug control, we determined cfu . We used four - five week old, female balb / c mice for in vivo assessment of susceptibility of m. tuberculosis lacking ldtmt2 to amoxicillin . We infected two groups of mice, 36 per group, with aerosolized cultures of either wild - type m. tuberculosis or ldtmt2::tn . We allocated 12 mice from each group into 3 sub groups and initiated daily treatment at 2 weeks following infection . We provided each sub group either 25 mg kg isoniazid, or 200 mg kg amoxicillin and 50 mg kg clavulanate, or no drug at all by oral gavage . For analysis, we sacrificed four mice from each treatment sub - group at 1, 2 and 4 weeks following initiation of therapy, obtained lungs, homogenized in 1 ml of pbs and determined cfu in each organ by plating appropriate dilutions of the homogenates on middlebrook 7h11 selective plates . We used m. tuberculosis cdc1551, a clinical isolate, as the host strain to generate a transposon insertion mutant in mt2594 (ldtmt2::tn) as described 14 . This mutant carries a himar1 transposon insertion at + 872 base from the putative translation start site of the gene . This is a single copy integrating plasmid based on pmh94 backbone 25, which we modified into a gateway compatible destination vector (invitrogen). We cloned a wild - type copy of mt2594 along with its promoter into this destination vector pgs202 to generate pgs202_2594 . We used middlebrook 7h9 liquid medium supplemented with 0.2% glycerol, 0.05% tween80, 10% vol / vol oleic acid albumin dextrose catalase (oadc) and 50 ug ml cycloheximide for in vitro growth, and middlebrook 7h11 solid medium (becton - dickinson) for enumerating colony forming units (cfu) in in vitro and in vivo growth studies . We amplified a portion of ltdmt2 with primers 5-ttttcatgatcgccgatctgctggtgc-3 and 5-ttggatcccgccttggcgttaccggc-3, digested with bsphi bamhi (underlined) and cloned into pet2818 15 . The resulting plasmid, encodes a fusion protein consisting of a methionine specified by the atg initiation codon of pet2818, residues 55 to 408 of ldtmt2, and a c - terminal polyhistidine tag with the sequence gsh6 . We grew e. coli bl21(de3) harboring prep4groesl 26 and pet2818ldtmt2 at 37 c in 3 l of brain heart infusion broth containing 150 g ml ampicillin, induced expression using isopropyl we purified ldtmt2 from a clarified lysate by affinity chromatography on ni - nitrilotriacetate - agarose resin (qiagen gmbh, germany) followed by anion exchange chromatography (monoq hr5/5, amersham pharmacia) with a nacl gradient in 50 mm tris we performed an additional size exclusion chromatography on a superdex hr10/30 column equilibrated with 50 mm tris finally, we concentrated the protein by ultrafiltration (amicon ultra4 centrifugal filter devices, millipore) and stored at 20 c in the same buffer supplemented with 20% glycerol . We purified disaccharide - tetrapeptide containing amidated meso - diaminopimelic acid (glcnac murnac mesodapnh2d ala) from c. jeikeium strain cip103337 and determined the concentration after acid hydrolysis 27,28 . Next, we tested in vitro formation of muropeptide dimers in 10 l of 50 mm tris hcl (ph 7.5) containing 300 mm nacl, 5 m ldtmt2, and 280 m disaccharide tetrapeptide . We incubated he reaction mixture for two hours at 37 c and analyzed the resulting muropeptides by nanoelectrospray tandem mass spectrometry using n2 as the collision gas 28 . We used 45 week old, female balb / c mice (charles river laboratories) to study in vivo virulence of the strains and their susceptibility to drugs . We infected mice with a log phase culture of wild type m. tuberculosis, or ldtmt2::tn or the complemented strain in an aerosol chamber . For assessing in vivo growth of each strain, we sacrificed four mice per group at days 1, 7, 14, 28, 56 and 98 following infection, obtained lungs and spleen, homogenized and cultured appropriate dilutions on middlebrook 7h11 medium to determine cfu . We allocated 12 mice for each infection group to assess virulence of each strain, for which we determined median - survival - time that mice from each group survived following infection . Protocols for experiments involving mice were approved by johns hopkins university animal care and use committee . We determined minimum inhibitory concentrations for amoxicillin clavulanate, imipenem (merck), isoniazid (sigma) and cycloserine (sigma) using the broth dilution method 29 . We used augmentin (glaxosmithkline), a preparation containing amoxicillin and calvulanate as m. tuberculosis contains lactamases 17 . For this we inoculated 10 m. tuberculosis bacilli in 2.5 ml of 7h9 broth and added drugs at different concentrations . We incubated these cultures at 37 c and evaluated for growth by visual inspection at 7 and 14 days . For those samples with diminished growth compared to no - drug control, we determined cfu . We used four - five week old, female balb / c mice for in vivo assessment of susceptibility of m. tuberculosis lacking ldtmt2 to amoxicillin . We infected two groups of mice, 36 per group, with aerosolized cultures of either wild - type m. tuberculosis or ldtmt2::tn . We allocated 12 mice from each group into 3 sub groups and initiated daily treatment at 2 weeks following infection . We provided each sub group either 25 mg kg isoniazid, or 200 mg kg amoxicillin and 50 mg kg clavulanate, or no drug at all by oral gavage . For analysis, we sacrificed four mice from each treatment sub - group at 1, 2 and 4 weeks following initiation of therapy, obtained lungs, homogenized in 1 ml of pbs and determined cfu in each organ by plating appropriate dilutions of the homogenates on middlebrook 7h11 selective plates.
Multiple sclerosis (ms) as one of the most frequent diseases of the central nervous system (cns) in young adults often entails persistent physical and mental disability . The prevalence is assumed to be 400,000 people in the united states and approximately 2,1 million people worldwide . Mostly, ms begins with a relapsing course (relapse remitting ms, rrms). After years, it leads to a progressive course (secondary progressive ms, spms) [3, 4]. Another form of ms, progressive - relapsing ms (prms), is defined as a progressive disease from onset with acute relapses and with periods of progression between relapses . Nearly 10% of ms patients develop primary progressive ms (ppms), which is defined as a progressive type from onset with temporary impairment . Ms is mainly characterized by multitopic inflammation and demyelination . As the disease proceeds, the role of axonal loss and gliosis increases ., one therapy with a single immune mechanism cannot fit such a complex pathogenic disease . At the present time, the anti - inflammatory, immunomodulatory, or immunosuppressive treatments are mainly effective in the early phase of the disease but are of less advantage in the progressive phase . Therefore, an axon - protective therapy will be essential to reduce disease progression . Current treating strategies of progressive ms are rare . There is general agreement that intravenous methylprednisolone (ivmp) administration (1000 mg daily for 35 days) is first - line therapy in the recovery from relapses [810]. Ivmp recovers the blood - brain barrier (bbb) by downregulating adhesion molecule expression . Furthermore, it induces different immunological changes as inhibition of proinflammatory cytokines, lymphocyte apoptosis, and remyelination . So, as of a result, their immunosuppressive and anti - inflammatory power glucocorticoids are established in the standard treatment for acute relapses . Although ivmp could reduce the duration of a relapse, no effect on the exacerbation rate or on the development of long - term disability was determined . The benefit of corticosteroids in the treatment of acute relapses has been examined in clinical trials . Another double - blind, placebo - controlled, randomized trial of high - dose methylprednisolone (1 g iv daily for 5 days) was arranged in 35 patients with ppms . A statistically significant amelioration of the expanded disability status scale (edss) score was observed . One phase ii randomized controlled trial (rct) in rrms compared the benefit of repeated pulsed ivmp with ivmp at the same dosage but administered only for relapses . It could be demonstrated that pulsed ivmp decreased the development of t1 black holes, brain atrophy progression, and associated development of permanent disability . On the other hand, pulsed application of intravenous corticosteroids is related to transient and dose - dependent side effects, such as temporary mood disorders, gastric ulcer, headache, and myalgia . Chronic administration may even result in more serious side effects, such as hypertension, hyperglycemia, decline of cardiac conditions, osteoporosis and an increased incidence of fractures, hepatic steatosis, infection, cataract, and transient memory impairment . Consequentially, one interesting alternative may be the intrathecal administration of triamcinolone acetonide (tca), which has been adopted for the treatment of many other diseases . This paper reviews data on the efficacy of intrathecal steroid application in the treatment of ms . Trials were classified according to the system established by the american academy of neurology (aan). A number of historical papers deal with advantages and disadvantages of intrathecal administration in ms . Since 1953, several mainly uncontrolled trials have been published . Different dosages and diverse conventional steroid compounds, that is, methylprednisolone acetate (mpa) or tca, are mentioned . Despite the controversial discussion especially in progressive ms patients with predominantly spinal symptomatology according to some trials, positive effects could be noticed [1820] (table 1). In 1953, kamen and erdman referred treating a patient with rrms with intrathecal hydrocortisone (hc) and intramuscular adrenocorticotropic hormone (acth). In a couple of open - label, uncontrolled trials between 1961 and 1963, boines [24, 25] reported 7580% recovery, particularly of spasticity with intrathecal mpa in 42 patients during a follow up of 1252 weeks . Goldstein et al . Reported that intrathecal mpa decreased csf -globulin in ms but without correlation to improvement of spasticity . In 1964, van buskirk et al . Performed an open - label, uncontrolled prospective study of intrathecal mpa in 20 patients . The treatment appears to decrease spasticity in 14 patients and consequently results in improved walking distance and bladder function . In 1970, again goldstein et al . Referred in an open - label, uncontrolled trial to 38 patients treated with 4 to 8 intrathecal mpa infusions and followed up for 2 to 8 years . Neurological examinations revealed an initial improvement in 30 patients that remained stable in only 6 patients . In 1973, again nelson et al . Reported in an open - label, uncontrolled prospective study on 23 patients with ms . All the above - mentioned studies have to be rated as class iv evidence, only . For the first time, rohrbach et al . Performed a double - blind, randomized, controlled trial (short report). One cohort was treated either with 3 or 4 intrathecal tca injections of 80 mg . The other cohort received oral triamcinolone starting with 48 mg / d in descending dosage . In the intrathecal cohort, a better and consistent improvement in the spinal score could be observed than the other treatment arm . This study corresponds to class ii evidence . In 1992, heun et al . Conducted an open - label, randomized, prospective, unblinded study on 50 ms patients with different ms forms (rrms, ppms, and spms). One group received 3 intrathecal tca injections of 40 mg on days 1, 8, and 15; the other cohort was treated with methylprednisolone 100 mg i.v . From day 1 to 5, then in descending dose . No significant difference in the examined frequency of improved neurological symptoms or in edss between the two cohorts was found ., the majority of the mentioned historical trials of intrathecal steroid for ms performed in the past were uncontrolled and have to be rated as class iv evidence . Despite their lacks, the trials of rohrbach et al . And heun et al . Are notable (class ii / iii evidence). Especially trials that conform to generally defined criteria of evidence - based medicine are missing . According to intrathecal tca applications repeated lumbar punctures under double - blind design including the agreement of patients and the ethical committee are nowadays not feasible . Intrathecal mpa therapy for ms caused transient urinary incontinence in two of 20 patients . In two other reports on 61 patients, constrictive arachnoiditis in thoracic or lumbar area, aseptic meningitis, subarachnoid haemorrhage, and neurogenic bladder were described [27, 28]. Other mentioned complications were brain damage, spinal cord lesions, and dense widespread pachymeningitis [3234]. In spite of these reports, the revival of intrathecal steroid treatment started with the positive results of a trial on intractable postherpetic neuralgia, in which 89 subjects received up to 4 intrathecal methylprednisolone administrations within 4 weeks without any serious side effects . In a rapid succession, a few further open - label uncontrolled trials were performed following a different treatment regime [3739] (table 2). Performed an open - label, uncontrolled, prospective trial on the short - term and long - term efficacy and tolerability of repeated intrathecal tca application . 36 patients with progressive ms (22 spss, 14 ppms, edss <7.5) were included . Patients did not receive steroids and were on a stable immunomodulatory drug treatment for at least 4 weeks before the start of the study . They had to show symptom progression of at least one point on the edss scale, in the last 2 years before study entry, but had to be stable for at least 4 weeks before inclusion . An atraumatic (sprotte) needle was used in order to minimize the risk of postlumbar puncture syndrome . Edss scores significantly decreased (p = .00065), and the walking distance (wd) significantly increased (p = .003). Patients with an improvement in their edss or wd were provided to receive further treatment with one tca application at an individual rate every 6 to 12 weeks . The follow - up treatment period amounted to 13.1 6.22, 323 (mean s.d ., the post hoc analysis demonstrated that a significant decline of edss and the improvement of wd occurred after first initial 6 tca applications and then remained stable . Neither a significant impact of covariates in statistical analysis nor relevant side effects were found . A temporary increase of csf protein above 500 mg / l and transitory increase of csf cells (maximum cell count was 38/l) was noticed . 5 patients developed a slight post - lumbar puncture syndrome, but they did not abandon further tca applications . This study illustrated efficacy and safety of repeated intrathecal tca administration in progressive ms patients with spinal symptoms . The application frequency (6 tca injections within 3 weeks and follow - up injection every 6 to 12 weeks) was markedly higher in contrast to other previous trials . Although long - term data did not prove any further improvement of neurological symptoms, the amelioration reached remained robust over the following treatment period with one tca application every 6 to 12 weeks . Hellwig et al . Performed another open - label, uncontrolled, prospective study on 161 ms patients (35 ppms, 122 spms, 4 rrms) with pronounced spinal symptoms on the impact of the administration of 40 mg of the sustained released steroid tca . Subjects did not suffer from an acute onset of exacerbation or recent pronounced increased progression of ms symptoms . Edss, barthel index, wd, and somatosensory evoked potentials (sseps) were analysed before start and at the end of the tca treatment . Atraumatic sprotte needles were used to avoid post - lumbar puncture syndrome [41, 43]. Edss and barthel indices were enhanced, wd increased, and latencies of ssep of the median and tibial nerves were reduced in all patients at serial evaluation (p <.0001 for all variables). 5 patients abandoned the study due to lumbar puncture headache . In this uncontrolled trial, an improvement of spinal symptoms, wd, and ssep latencies in progressive ms patients were documented, and the results from a previous trial were confirmed . The electrophysiological results may mirror a certain potential of intrathecal tca administration for demyelinating actions . Again steroids were suspected to induce a neuronal cell injury due to brain atrophy [10, 22, 44]. Another open - label, uncontrolled, prospectice trial on short - term efficacy of repeated intrathecal tca applications in progressive ms dealt with this aspect . In addition to the mentioned clinical parameters, csf was examined for the unspecific markers of cell injury neuron - specific enolase (nse), tau - protein, s 100b, and -amyloid [4549]. 6 tca injections, performed every third day, reduced edss (initial: 5.4 1.3, 37.5 (mean sd, range); end: 4.9 1.1; 2.56.5; p <.001) and significantly increased wd primarily after the fourth tca injection . These results indicated that the role of tca administrations is undercharged in those trials without any persuasive clinical output [18, 20]. This supported the statement that the sustained released steroid tca is not toxic and causes no relevant cell injury or deterioration of neuronal cells [10, 20, 44, 5053]. Previous studies showed that repeated intrathecal tca administrations generated a clear prolonged benefit in patients with progressive ms suffering from mainly spinal symptoms . Mitoxantrone (mix) application is performed similarly in progressive ms patients with a continuous, rapid worsening of symptoms . In contrast to tca administration, mix application is a worldwide accredited therapy to diminish or abandon progression . Hence, a cumulative maximal life - time dose should be respected [5456]. Based on this consideration, hellwig et al performed an open - label study over a 52-week - long interval and compared tca and mix therapy in two matched cohorts of subjects with progressive ms . Only patients with progressive the mix dose was minimized to 10 mg / m and 8 mg / m dependent on patients' stable condition . Edss significantly decreased and wd significantly increased (p <.001) after the initial 6 tca administrations and then remained relatively constant . Neither edss nor wd deteriorated in any of the tca patients . On the other hand, mix therapy did not significantly influence edss (p = .056) or wd (p = .12), even though no additional decline of edds or wd was measured . Two patients in the mix arm suffered from moderate nausea . An isolated and temporary increase in csf protein (> 500 mg / l) and a temporary rise of csf cells without development of neurological symptoms in all subject was observed . 8 patients in the tca arm suffered from post - lumbar puncture syndrome without termination of further tca treatment . Again, the efficacy and safety of repeated intrathecal tca administrations in progressive ms patients with predominantly spinal symptoms was approved [37, 38]. It has to be pointed out that a rate with 6 tca applications within 3 weeks was definitively higher compared to previous trials . Following this concept, especially ppms and spms patients appear to improve initially and then remain stable during tca treatment at least over one year . In contrast in this trial, mix therapy did not improve edss or wd, but no significant impairment was recognized . Other trials approved a positive impact of mix on ms symptoms especially in patients with progressive ms and superposed relapses [54, 57, 58]. The number of relapses in the year before mix treatment started is regarded to be a predictive parameter in mix efficacy in ms patients . In this trial therefore, the lack of edss improvement could be attributed to this . In conclusion, maybe a combination of both should be investigated in progressive ms patients as it has been performed with ivmp and mix . Despite the mentioned limitations, this study has to be rated as class iii evidence . Up to now, clinical trials on patients with progressive ms demonstrated no distinct proof of a potent symptomatic treatment intended to improve or at least stabilize disability, as soon as the progressive phase of the disease stage appears . Immunomodulatory treatment minimizes the rate of ms relapses noticeably but shows no evident positive effects in patients with progressive ms . Numerous papers dealt with the efficacy of intrathecal application of different dosages of various released steroid compounds, above all methylprednisolone acetate was used . This formerly used steroids were mainly short acting cortisone derivates . Further, these steroids were administrated intrathecally less frequently . So, these trials lacked of detailed selection and clinical characterization of ms patients, with small sample sizes, low steroid dosages, and only a few intrathecal administration of mostly short - acting cortisone derivates [19, 20, 36]. Beneficial but controversialy discussed effects were mentioned in progressive ms patients with predominantly spinal symptoms according to case reports, open - label trials, and one double - blind, controlled study (class of evidence ii) with the sustained released steroid tca [1820]. As is known, the anti - inflammatory impact of a steroid application depends not only on the dosage but also on the duration of exposure [9, 10, 61]. Hence, the frequency of application and the utilization of a delayed released steroid derivative as tca are recommendable . In a rapid succession, a few further open - label uncontrolled trials were performed following a different treatment regime [3739]. 6 injections of 40 mg of the sustained released steroid derivate tca were administered within 3 weeks . Patients with an improvement of edss or wd were provided to receive further treatment with one tca application in an individual rate every 6 to 12 weeks . All forecited more recent open label trials were performed in patients with progressive ms with mainly spinal symptoms . They documented a significant improvement of edss and wd, respectively . With additional administrations, a stable effect was achieved . However, the mechanism which these improvements are based on is unacquainted . One item debated was the decrease of spasticity by the long - acting steroid . But a significant decrease of antispastic scores was not essential to achieve the mentioned results in recent trials . Another point of discussion could be that intrathecal administration of a sustained released steroid circumvents the bbb and has a positive impact on the still continuing chronic inflammation process . The one thing common to all the recent examples we gave was that they had all been focused on progressive ms patients without signs of an acute exacerbation . The before - described great number of serious side effects could not be reproduced in the recent trials . There were some raised concerns about a possible neuronal cell injury promoting effect induced by the administered steroid, with inducing brain atrophy [10, 22, 44]. The additional serial assessment of potential unspecific cell injury markers, that is, nse or s-100, in csf of progressive ms patients treated with repeated intrathecal tca did not provide evidence of such a steroid associated risk . Particularly, the long half - life of the applied sustained released steroids appears to be the key of the missing proof of a toxic effect . Further detailed trials with examination of selected csf biomarkers in ms patients treated with intrathecal steroids are necessary to illuminate these interesting aspects . In general, all of the mentioned historical and recent studies have to be classified just as class ii the ideal trial design would be a randomized, placebo - controlled, double - blind one . In this case, repeated performance of intrathecal placebo application under double - blind conditions with the consent of patients and the ethical committee seems not to be realistic . Contrariwise, one could claim that due to the limited evidence for efficacy of intrathecal tca treatment, the only existing open - label, not placebo - controlled study with repeated lumbar punctures is unethical without level a evidence . From this point of view a multicenter clinical study has to be established to evaluate these items and to compare systemic and intrathecal steroid treatment, initially in progressive ms patients with predominantly spinal symptoms and afterwards in patients with an acute relapse . In addition to the investigation of the long- and short - term benefits, potential risks related to the intrathecal application have to be examined in a blinded analysis . Furthermore, the potential efficacy of intrathecal tca treatment combined with mix in progressive ms has to be explored . Anyhow, the intrathecal tca administration has to be taken into account as one therapy option in handpicked ms patients with a slow progressive clinical course with predominantly spinal symptom features . The intrathecal tca application should be offered by neurologists with a comprehensive experience in this special treatment . In fact, an individual risk - benefit analysis and the patient's approval are required.
Morbihan syndrome is a rare entity characterized clinically by chronic erythematous edema localized exclusively on the forehead, glabella, eyelids, and cheeks . Oral isotretinoin is considered the therapy of first choice, although not all patients improve . A 60-year - old caucasian man was admitted to our department because of a dermatitis on the face . The patient stated that he was in good general health, except for obesity (120 kg), and that he was not in therapy with systemic drugs . The patient also stated that the dermatitis appeared approximately 4 years before and that it was unsuccessfully treated with oral corticosteroids . Dermatological examination revealed a severe erythematous edema involving the forehead, glabella and both eyelids, because of which the patient was not able to open his eyes completely . Furthermore, erythema and telangiectasiae were visible on the nose and cheeks [figures 1 and 2]. Erythematous edema of the forehead, glabella, eyelids, and cheeks close up of same patient general physical examination did not reveal anything pathological . All laboratory and instrumental examinations (echography of periorbital area, carotids, and thyroid, chest x - rays, electrocardiogram, echocardiogram, and echography of the abdomen) were within normal ranges or negative . Histopathological examination showed dermal edema, perivascular and periadnexal lympho - histiocytic infiltrate, and sebaceous gland hyperplasia . The patient was treated with oral isotretinoin [starting daily dosage: 0.5 mg / kg (= 60 mg / day) for 4 weeks)]. Morbihan syndrome was possibly first described in 1956 by schimpf, who published four case reports on this subject from 1956 to 1960. [24] unfortunately, none of these articles had any clinical photographs . Furthermore, the histopathological picture of these patients was characterized by granulomas, that are rarely present in morbihan syndrome . In 1972, merklen, et al . Named this entity as infiltration massive persistante du front avec fort dme palpbral, i.e., massive persistent infiltration of the forehead with severe edema of the eyelids . In 1991, this name was due to the fact that the first french patient was observed in 1957 by degos in a farmer who came from the region of morbihan (north - western france). However, we do believe that the name of morbihan syndrome, in consideration of possible different etiopathogenetic factors, is more correct . Caucasian adults of both sexes are affected: to our knowledge, only one black and one indian patient were reported . Morbihan syndrome is characterized clinically by the slow appearance of erythematous edema localized exclusively on the forehead, glabella, eyelids, and cheeks ., it is a clinical variety or a complication of acne or rosacea . In our patient, the age, the clinical picture (erythema and telangiectasiae on the nose and cheeks), as well as the histopathological picture (sebaceous gland hyperplasia), support a correlation with rosacea . Furthermore, according to some authors, morbihan syndrome may be caused by lymph vessel abnormalities . Histopathological examination is nonspecific: it is characterized by dermal edema, perivascular and periadnexal lympho - histiocytic infiltrate, with more or less numerous mast cells, and dilated lymphatic vessels . Sebaceous gland hyperplasia may be observed in patients with previous or coexisting acne or rosacea . Biopsy for histopathological examination must be always performed because morbihan syndrome enters into differential clinical diagnosis with metastases to the periorbital area . Other differential diagnoses include congenital, infectious, inflammatory, neoplastic, and miscellaneous diseases [table 1]. Furthermore, barbiturates, chlorpromazine, diltiazem, and even isotretinoin can induce clinical manifestations similar to morbihan syndrome . Differential diagnoses of morbihan syndrome * several systemic drugs were used for the therapy of morbihan syndrome . . However, only isotretinoin, alone or associated with ketotifen, seems to be really effective . It has to be used at high doses and for long periods of time . As previously mentioned, in our patient, isotretinoin, despite the long duration of the therapy (26 weeks), was ineffective . Oral isotretinoin is ineffective: in these patients, the clinical course of morbihan syndrome is uncertain, the disease can become chronic or can relapse.
Hereditary spastic paraplegia (hsp) is a clinically and genetically heterogeneous group of neurodegenerative diseases that predominantly involves the lower extremities . The essential features are insidiously progressive spastic leg weakness associated with corticospinal tract and dorsal column degeneration . Hsp is classified according to the mode of inheritance (autosomal dominant, autosomal recessive, or x - linked), clinical symptoms (" pure " or " complicated "), and specific gene locus (" spg1 " through " spg17 "). Autosomal dominant hsp (ad - hsp) is the most prevalent mode and includes approximately 70% of cases . Approximately 40 - 45% of ad - hsp patients have pathogenic mutations in the spastin gene (spg4 or spast gene), which causes predominantly " pure " hsp . Pure hsp is characterized by severe progressive spasticity limited to both legs, which is eventually accompanied by urinary urgency (reported in up to 50% of cases in later disease stages) and mildly impaired vibration sense resulting from " dying back " degeneration affecting axonal transport of the longest fibers that innervate the lower extremities . Pure hsp can be confused with other diseases involving the corticospinal tract and dorsal column . Therefore, clinicians should consider this when they encounter patients who do not show improvement in gait disturbance, although they receive appropriate treatment . Here, we report the case of a patient who was initially misdiagnosed with subacute combined degeneration (scd), but in fact had hsp with a novel spast mutation . A 58-year - old man with gait disturbance came to our hospital on oct 30, 2011 . He was unable to regulate his steps by himself, and his acquaintances reported he walked with a slight limp . The impaired gait began 3 years after he had undergone subtotal gastrectomy and chemotherapy for 6 months . Thereafter, he felt tingling sensations in the hands and feet and acquired gait difficulties . He had quit smoking and drinking alcohol many years prior to his diagnosis . Upon neurological examination, however, there was a severely decreased response to vibration in both big toes, particularly in the left . The ankle jerk reflexes were bilaterally decreased, whereas the reflexes of other joints were normal . Thus, he had mixed neurological signs that involved the upper motor neuron and peripheral nerves . Considering his previous medical history, we investigated his brain, spinal cord, meninges, and peripheral nerve by using magnetic resonance imaging (mri), cerebrospinal fluid (csf) analysis, blood tests, and electrodiagnostic studies . Notable results included the lower - normal limit of serum vitamin b12 (363 pg / ml; reference range 200 - 1,000 pg / ml) and generalized sensory dominant polyneuropathy with axonal involvement . Blood tests, including those for syphilis, hiv, diabetes, connective tissue disease, vasculitis, and renal and liver function, were normal . Mild small vessel disease and a small amount of chronic subdural hematoma were observed in the left cerebral convexity . Whole - spine mri revealed normal signal intensity in the cord, except for disc extrusion with mild cord indentation, which did not seem relevant to the exhibited neurological symptoms . He was intramuscularly administered cyanocobalamin regularly for 6 months . However, there was no improvement in his condition . After reconsidering his abnormal neurological signs and laboratory tests, we examined hsp mutations in his genomic dna . As a result, the spast mutation was detected from the gene sample of the proband (fig . The mutation, a novel splicing mutation, is c.870 + 1delg (ivs5; heterozygote). We compared this result with the mutation database (http://hgmd.cf.ac.uk/ac/index.php), and there was no previous information of this polymorphism or mutation at this locus . His 32-year - old son complained of subjective gait difficulty, even though there was no abnormality in his walking . However, he showed hyper - reflexic knee jerks, ankle clonus, and bilateral extensor toe signs . His 29-year - old daughter with an intellectual disability of unknown origin did not have any abnormalities upon examination . The symptoms and signs of the patient and his son were different and are described in table 1 . As described, we misdiagnosed this patient with scd, which is distinct from hsp, because of atypical neurological signs and previous medical history . A genetic test revealed a novel splicing mutation in the spast gene that confirmed hsp . Genetically, hsp is classified according to the mode of inheritance and various gene loci . Among the several autosomal dominant hsp loci, since the first mutation in the spast gene was identified in 1999, at least 300 different pathogenic mutations have been detected . Spast is composed of 17 exons, encodes the spastin protein, and belongs to the atpases associated with various cellular activities (aaa) family . In the spast gene, the aaa domain in the c - terminal region (amino acids 342 to 599) and the microtubule interacting and trafficking (mit) domain in the n - terminal region play important roles . A large number of mutations are located in the aaa domain and are related with microtubule - severing and membrane - binding properties . Furthermore, the mit domain is involved in microtubule dynamics, such as intracellular organelle trafficking and endocytosis . In korea, there are 4 previous reports of novel spast mutations: one report involved a large genetic study of spast and atl1 mutations among several families . Most mutations are located between exons 7 - 17, in the aaa domain, and 1 mutation is located in intron 11 . Only one was a splicing mutation; the others were missense mutations, in - frame deletions, and frame - shift mutations . Unlike in our patient, the clinical manifestations in the patients in these reports typically corresponded to pure ad - hsp . It is to be remained whether our hsp patient should be classified as having a rare " complicated " ad - hsp with a spast gene mutation or " pure " ad - hsp, combined with nutritional - deficiency peripheral neuropathy . In conclusion, we report a novel splicing mutation, c.870 + 1delg (ivs5), in a korean family with autosomal dominant - inherited hsp . We confirmed the deletion of exon 5 by using rt - pcr and segregation of the spast gene among family members by direct sequencing.
The bacteriophage p1 cre recombinase, a 38-kda protein, recognizes specific 34-bp sequences called loxp sites and catalyzes site - specific recombination between two loxp sites [1, 2]. The cre - loxp system has been considered an important tool for manipulation of genomic sequences and gene expression including tissue - specific activation or inactivation of genes as well as cell - type - specific gene targeting . Araki et al . First utilized this system for manipulation of mouse preimplantation embryos . They constructed a cag - cat - z transgene, in which expression of the floxed chloramphenicol acetyltransferase (cat) gene occurs under control of the ubiquitously active cytomegalovirus enhancer / chicken -actin promoter (cag). Expression of the lacz gene coding for bacterial -galactosidase protein, which is located downstream of the floxed cat sequence in the cag - cat - z transgene, does not occur in the absence of cre recombinase protein . When cre - expression vector dna was injected into the pronuclei of fertilized eggs carrying the cag - cat - z transgene, expression of lacz protein was induced, indicating that expression of the lacz gene is induced after removal of the floxed cat sequence by cre recombinase . Once such recombination occurs, expression of the lacz gene in descendant cells will continue throughout embryogenesis . Using a strategy similar to that of araki et al ., we previously produced a double - reporter mouse line carrying a pcetz-17 transgene, which consists of cag, floxed dna sequence (containing enhanced green fluorescent protein (egfp) cdna), and the lacz gene . This cre - loxp - based system was useful for cell lineage analysis in mice . For example, when one blastomere of the 2-cell embryos derived from cetz-17 transgenic mice was microinjected with cre - expression vector (pcag / ncre-5), its descendant exhibited cre - mediated recombination in the integrated transgenes and also exhibited lacz activity . However, the offspring of the other blastomere, into which no injection was performed, remained silent for lacz activity . In this case, histochemical detection of lacz activity is always associated with fixation of tissues and subsequent staining with x - gal, a substrate for lacz, or by immunodetection using anti--galactosidase antibodies . This procedure often hampers serial microscopic observation of cells expressing newly activated gene products, and some tissues (i.e., adult ovaries, oviducts, and epididymides) are rich in endogenous activity for lacz (unpublished data). In this study, we constructed two new plasmids, pcrteil and pcetriz, as double - reporter transgenes . Pcrteil contains cag, floxed sequence (hcred1 cdna and cat gene), egfp cdna, internal ribosomal entry site (ires) from the encephalomyocarditis virus, and firefly luciferase (luc) cdna . Pcetriz contains cag, floxed egfp cdna and cat gene, hcred1 cdna, ires, and lacz gene . For example, cells carrying pcrteil exhibit hcred1 (red fluorescence) but neither egfp nor luc . However, upon transfection with a cre - expression vector, they will exhibit egfp (green fluorescence), because the loxp - flanked sequence in the integrated pcrteil transgenes is removed by transiently - expressed cre protein . Thus, the behavior of descendants of the cells exhibiting cre - mediated gene activation, which will exhibit egfp continuously, can be monitored in real - time in vivo and in vitro . The reporter plasmid pcrteil (figure 1(a)) was constructed through several cloning steps . First, pcrt-17, an intermediate product for pcrteil, was constructed by inserting an 8.8-kb fragment containing hcred1 cdna + poly(a) sites of the sv40 gene isolated from phcred1-n1 (clontech laboratories, inc ., palo alto, calif, usa) in front of the 5 end of cat in the pcag - cat - lacz from which the lacz gene had already been removed . A dna fragment containing egfp cdna, ires, and luc cdna was then placed immediately downstream of the loxp site located at the 3 end of the cat gene in pcrt-17 to obtain pcrteil-6 . The resulting pcrteil has a backbone of pbluescript sk(-) (stratagene, la jola, calif, usa). The reporter plasmid pcetriz (figure 1(a)) was constructed in a multistep process . - sce i - sfi i - xba i - spe i - sty i - nhe i - sfi i - i - sce i cassette, was generated by introducing linker oligo into a pbluescript ii - based vector . A fragment containing ires, lacz gene, and poly(a) sites was introduced into a sty i site (which had been blunt) of pacs to generate pacsiza . Next, pcetiz was generated by ligation of a 4.5-kb spe i fragment containing cag promoter, floxed egfp cdna and cat gene, and poly(a) sites into an xba i site of pacsiza . Finally, pcetriz was constructed by introducing pcr - amplified hcred1 cdna into a spe i site of pcetiz . For expression of cre, we used pcag / ncre plasmid (; see figure 1(b)). Pce-29 plasmid was also used as a positive control vector for expression of egfp in murine cells (figure 1(b)). Pcl was constructed by inserting luc cdna downstream of the cag promoter (figure 1(b)) and used as a positive control vector for expression of luc . Nih3t3 cells were first seeded onto gelatin - coated 6-well dishes (number 4810 - 020; iwaki glass co., tokyo, japan) at a density of 10 cells / well one day before transfection and grown in dulbecco's modified eagle's medium (dmem; invitrogen co., carlsbad, calif, usa) supplemented with 10% fetal bovine serum (fbs; invitrogen co.) at 37c in an atmosphere of 5% co2 in air at 37c . For transfection of a single plasmid, four g of plasmid dna was mixed with 8 l of lf2000 (number 11668 - 027; invitrogen co.) in dulbecco's modified phosphate - buffered saline without ca and mg, ph 7.4 (pbs(-)), and a total of 100 l solution was prepared according to the manufacturer's protocol . For cotransfection, two plasmids (3 g for each) were mixed with 12 l of lf2000 in pbs(-). These dna / liposome complexes were added to the cell culture and incubated for 1 day at 37c . After transfection, cells were observed for fluorescence, as described in what follows . Cells and tissue sections were observed using an olympus bx60 fluorescence microscope (olympus, tokyo, japan) with dm505 filters (bp460 - 490 and ba510if; olympus) and dm600 filters (bp545 - 580 and ba6101f; olympus), which were used for egfp and hcred1 monitoring, respectively . For detection of fluorescence in dissected oviducts, microphotographs were taken using a digital camera (fujix hc-300/ol; fujifilm, tokyo, japan) attached to the fluorescence microscope and printed out using a mitsubishi digital color printer (cp700dsa; mitsubishi, tokyo, japan). One l of solution containing plasmid dna and trypan blue (tb; 0.05% final concentration) was slowly injected with a glass micropipette, which had been attached to a mouthpiece, into the ampulla of an oviduct of b6c3f1 females (4- to 6-week - old; purchased from clea japan, inc ., the dna introduced per oviduct was pce-29 (0.2 g), pcrteil (0.2 g), pcag / ncre (0.2 g), pcrteil (0.2 g) + pcag / ncre (0.2 g), or pcl (0.2 g). In each transfection group, 0.02 g of phrl - sv (promega co., madison, wis, usa) was included as a control for normalization of luc activity as noted in what follows . Eight square - wave pulses with pulse duration of 50 milliseconds and electric field intensity of 50 v were administered from a square - wave pulse generator (t820; btx genetronics, inc ., one day after in vivo ep, the oviducts were subjected to observation for fluorescence and then to lysis for measurement of luc activity . Oviducts from the mice receiving plasmid dna were fixed in 4% paraformaldehyde (pfa) in pbs(-) for 2 days at 4c, then immersed in 30% sucrose in pbs(-) for more than 2 days at 4c, embedded in tissue - tek oct compound (sakura finetek co., tokyo, japan), and finally frozen before serial cryostat sectioning (1030 m in thickness). Sections were mounted in vectrashield mounting medium (vector laboratories, burlingame, calif, usa) and observed for fluorescence . To deliver dna - coated gold particles to the abdominal skin of adult icr females in vivo, we used the helios gene gun (bio - rad laboratories, hercules, calif, usa). Before the introduction of dna, transfection particles were made per helios gene gun protocol giving a microcarrier loading quantity of 0.5 mg per shot and a dna loading ratio of 2 or 4 g dna / mg gold particles (1.0 m). For single transfection with pcetriz (control), 1 g of dna was used . For cotransfection using pcetriz plus pcag / ncre (experiment), 1 g of each dna was used . Mouse abdominal skin was bombarded with the dna - coated gold particles using the gene gun pressurized by a helium tank at 300 psi . One bombardment was carried out per mouse using 6 mice . In total, 3 transfections were performed for each group . Mouse skin was excised and immediately subjected to observation for fluorescence under uv illumination . The samples were then fixed with 4% pfa in pbs(-) for 1 day at 4c . Subsequently, the skin was washed in pbs(-) twice and stained with x - gal staining solution (x - gal staining assay kit, genlantis, calif, usa) at 30c for 24 hours . The stained samples were then washed twice in pbs(-) and observed for lacz activity under light . Luc assay was performed using a kit (dual - luciferase reporter assay system (number e1910); promega co.). The oviducts isolated 1 day after in vivo ep were homogenized in 1 ml of 1 x reporter lysis buffer (promega co.). After centrifugation at 15 000 rpm for 10 minutes at 4c, the supernatant (200 l) was transferred to a fresh eppendorf tube . Cells 1 day after transfection were collected with a cell scraper and precipitated after brief centrifugation . Cell pellets were then lysed with 1 ml of 1 x reporter lysis buffer . Relative light units (rlus) obtained with luc were measured for 5 seconds following a 2-second delay after the addition of the lysate (10 l) to 50 l of luc assay substrate (promega co.) using a luminometer (number td-20/20; turner designs instrument, sunnyvale, calif, usa). Tissue protein determinations were performed using bradford reagent (bio - rad laboratories, inc ., hercules, calif, usa). At least four oviducts were tested in each transfection group, and values were presented as means standard deviation (sd). The rlu obtained from transfection into oviductal epithelium was analyzed using the spss 9.0/pc statistics package (spss inc . Results were compared using one - way analysis of variance (anova) following arcsin transformation of the proportions . The duncan new multiple range test or tukey test successful in vitro cre - mediated recombination results in switching of gene expressionin a preliminary test, we first examined what percentage of single cells can incorporate two constructs simultaneously; nih3t3 cells were cotransfected with pcrteil and pce-29 by the lipoplex method . Eight percent (12/142) and 10% (14/142) of cells exhibited egfp - derived green and hcred1-derived red fluorescence, respectively, (data not shown). Twenty - two percent (31/142) of cells expressed both types of fluorescence (data not shown). It was thus estimated that in approximately 20% of single cells, incorporation of two constructs into a single cell occurs at the same time . To test whether cre - mediated excision of the floxed hcred1/cat sequence in the pcrteil construct results in generation of egfp fluorescence (figure 1(a)), nih3t3 cells were cotransfected with pcrteil and pcag / ncre by the lipoplex method . One day after transfection, some (9% (10/112)) of these cells exhibited both red and green fluorescence (indicated by arrowheads in figures 2(d)2(f)), suggesting incomplete cre - mediated recombination in the introduced pcrteil construct (table 1). There were a few cells (4% [4/112]) preferentially expressing green fluorescence (indicated by arrows in figures 2(d)2(f)), suggesting the occurrence of complete cre - mediated recombination in the transfected cells (table 1). Twenty - four percent (27/112) of cells (table 1) expressed only red fluorescence, suggesting incorporation of two constructs at the same time in a single cell (though gene switching failed) or incorporation of pcrteil alone . Considering that 20% of cells can incorporate two constructs simultaneously, the rate of cre - mediated recombination in this system appears to be greater than 50% at a minimum . In the control experiment in which cells were transfected with pcrteil alone, some cells (35% (36/102); table 1) exhibited hcred1-derived red fluorescence but not egfp - derived green fluorescence (arrows in figures 2(b) versus 2(c)).similar results were also obtained when pcetriz was transfected singly or cotransfected with pcag / ncre (figures 2(g)2(n)). In this system, expression of lacz protein arises from the recombined form of pcetriz together with hcred1 after cre - mediated recombination . In fact, cells expressing hcred1 exhibited lacz, which could be visualized after fixation of cells and subsequent staining with x - gal (arrows in figures 2(k)2(n)). Transfection of cells with a single pcetriz resulted in expression of egfp but not of both hcred1 and lacz (arrows in figures 2(g)2(j)). These findings indicate that pcrteil and pcetriz as reporter plasmids work well with cultured murine cells . In a preliminary test, we first examined what percentage of single cells can incorporate two constructs simultaneously; nih3t3 cells were cotransfected with pcrteil and pce-29 by the lipoplex method . Eight percent (12/142) and 10% (14/142) of cells exhibited egfp - derived green and hcred1-derived red fluorescence, respectively, (data not shown). Twenty - two percent (31/142) of cells expressed both types of fluorescence (data not shown). It was thus estimated that in approximately 20% of single cells, incorporation of two constructs into a single cell occurs at the same time . To test whether cre - mediated excision of the floxed hcred1/cat sequence in the pcrteil construct results in generation of egfp fluorescence (figure 1(a)), nih3t3 cells were cotransfected with pcrteil and pcag / ncre by the lipoplex method . One day after transfection, some (9% (10/112)) of these cells exhibited both red and green fluorescence (indicated by arrowheads in figures 2(d)2(f)), suggesting incomplete cre - mediated recombination in the introduced pcrteil construct (table 1). There were a few cells (4% [4/112]) preferentially expressing green fluorescence (indicated by arrows in figures 2(d)2(f)), suggesting the occurrence of complete cre - mediated recombination in the transfected cells (table 1). Twenty - four percent (27/112) of cells (table 1) expressed only red fluorescence, suggesting incorporation of two constructs at the same time in a single cell (though gene switching failed) or incorporation of pcrteil alone . Considering that 20% of cells can incorporate two constructs simultaneously, the rate of cre - mediated recombination in this system appears to be greater than 50% at a minimum . In the control experiment in which cells were transfected with pcrteil alone, some cells (35% (36/102); table 1) exhibited hcred1-derived red fluorescence but not egfp - derived green fluorescence (arrows in figures 2(b) versus 2(c)). Similar results were also obtained when pcetriz was transfected singly or cotransfected with pcag / ncre (figures 2(g)2(n)). In this system, expression of lacz protein arises from the recombined form of pcetriz together with hcred1 after cre - mediated recombination . In fact, cells expressing hcred1 exhibited lacz, which could be visualized after fixation of cells and subsequent staining with x - gal (arrows in figures 2(k)2(n)). Transfection of cells with a single pcetriz resulted in expression of egfp but not of both hcred1 and lacz (arrows in figures 2(g)2(j)). These findings indicate that pcrteil and pcetriz as reporter plasmids work well with cultured murine cells . Successful in vivo cre - mediated recombination in pcrteil systemwe next examined whether this cre - loxp system using pcrteil as a reporter plasmid can also be used in vivo . For this purpose, gene delivery into oviductal epithelium was performed by dna injection into the lumen of oviducts and subsequent ep . Instillation of pce-29 plasmid yielded bright green fluorescence throughout the ampulla ((b) in figure 3(a)) but not red fluorescence ((c) in figure 3(a)). When pcrteil plasmid dna was singly introduced, no fluorescence for egfp was observed ((e) in figure 3(a)). Instead, red fluorescence was observed in some oviductal epithelial cells ((f) in figure 3(a)). Coinjection with pcrteil and pcag / ncre plasmids resulted in generation of both red and green fluorescence, although green fluorescence appeared to be weaker than red fluorescence (indicated by arrows in (h) and (i) in figure 3(a)).to examine the localized expression of egfp and hcred1 in the oviducts after cotransfection, cryostat sections were prepared and inspected for egfp and red fluorescence . Strong, but patchy, egfp fluorescence was observed in some oviductal epithelial cells (indicated by arrows in (k) in figure 3(a)), together with weak red fluorescence throughout the egfp - positive area (data not shown). These findings indicate that the cre - loxp system using pcrteil works well even in vivo, and as expected hcred1 exhibits a nonoverlapping spectral profile from egfp.the ires sequence is present between egfp and luc cdnas in the pcrteil plasmid (figure 1(a)). Therefore, the two proteins (egfp and luc) should be produced at the same time in a cell into which pcrteil and pcag / ncre have been cotransfected, since an ires sequence allows cap - independent translation initiation [10, 11] from the dicistronic mrna generated . In fact, we observed increase in luc activity repeatedly when oviductal epithelial cells were cotransfected with pcrteil and pcag / ncre (figure 3(b)). We next examined whether this cre - loxp system using pcrteil as a reporter plasmid can also be used in vivo . For this purpose, gene delivery into oviductal epithelium was performed by dna injection into the lumen of oviducts and subsequent ep . Instillation of pce-29 plasmid yielded bright green fluorescence throughout the ampulla ((b) in figure 3(a)) but not red fluorescence ((c) in figure 3(a)). When pcrteil plasmid dna was singly introduced, no fluorescence for egfp was observed ((e) in figure 3(a)). Instead, red fluorescence was observed in some oviductal epithelial cells ((f) in figure 3(a)). Coinjection with pcrteil and pcag / ncre plasmids resulted in generation of both red and green fluorescence, although green fluorescence appeared to be weaker than red fluorescence (indicated by arrows in (h) and (i) in figure 3(a)). To examine the localized expression of egfp and hcred1 in the oviducts after cotransfection strong, but patchy, egfp fluorescence was observed in some oviductal epithelial cells (indicated by arrows in (k) in figure 3(a)), together with weak red fluorescence throughout the egfp - positive area (data not shown). These findings indicate that the cre - loxp system using pcrteil works well even in vivo, and as expected hcred1 exhibits a nonoverlapping spectral profile from egfp . The ires sequence is present between egfp and luc cdnas in the pcrteil plasmid (figure 1(a)). Therefore, the two proteins (egfp and luc) should be produced at the same time in a cell into which pcrteil and pcag / ncre have been cotransfected, since an ires sequence allows cap - independent translation initiation [10, 11] from the dicistronic mrna generated . In fact, we observed increase in luc activity repeatedly when oviductal epithelial cells were cotransfected with pcrteil and pcag / ncre (figure 3(b)). Successful in vivo cre - mediated recombination in pcetriz systemcells carrying pcetriz are expected to exhibit hcred1 and lacz after cre - mediated excision . For testing the feasibility of pcetriz - based cre - loxp system in vivo, tissues that never exhibit endogenous -galactosidase activity, skin epidermis appeared to be suitable for this purpose, because it does not exhibit such kind of activity and has been considered as an attractive target to study gene delivery due to its easy accessibility and visualization . Since particle - mediated devices have been studied to deliver genes to skin efficiently [12, 14, 15], we introduced pcetriz (control) or pcetriz + pcag / ncre (experiment) into mouse skin using helios gene gun . Skin biopsies were taken after 48 hours for inspection of fluorescence and lacz staining . In the samples bombarded with single pcetriz, green fluorescence was detected over the area gene - transfected (figure 4(b)). However, neither red fluorescence nor lacz activity was noted in the area exhibiting green fluorescence (figures 4(c) and 4(d)). Samples bombarded with pcetriz + pcag / ncre showed coexpression of green and red fluorescence (arrows in figures 4(f) and 4(g)), suggesting successful cre - mediated excision of the introduced pcetriz . As expected, lacz staining revealed expression of lacz over the area cotransfected (figure 4(h)). These patterns of gene expression were also seen in the other 2 injected mice . Cells carrying pcetriz are expected to exhibit hcred1 and lacz after cre - mediated excision . For testing the feasibility of pcetriz - based cre - loxp system in vivo, tissues that never exhibit endogenous -galactosidase activity must be chosen . In this occasion, skin epidermis appeared to be suitable for this purpose, because it does not exhibit such kind of activity and has been considered as an attractive target to study gene delivery due to its easy accessibility and visualization . Since particle - mediated devices have been studied to deliver genes to skin efficiently [12, 14, 15], we introduced pcetriz (control) or pcetriz + pcag / ncre (experiment) into mouse skin using helios gene gun . Skin biopsies were taken after 48 hours for inspection of fluorescence and lacz staining . In the samples bombarded with single pcetriz, green fluorescence was detected over the area gene - transfected (figure 4(b)). However, neither red fluorescence nor lacz activity was noted in the area exhibiting green fluorescence (figures 4(c) and 4(d)). Samples bombarded with pcetriz + pcag / ncre showed coexpression of green and red fluorescence (arrows in figures 4(f) and 4(g)), suggesting successful cre - mediated excision of the introduced pcetriz . As expected, lacz staining revealed expression of lacz over the area cotransfected (figure 4(h)). These patterns of gene expression were also seen in the other 2 injected mice . The cre - loxp system permits the generation of mouse models, in which the fate of a cell can be followed through time . In such models, a cell - type - specific promoter that is turned on at a given stage of differentiation regulates cre - expression . When combined with a reporter system, regulated expression of cre may lead to specific expression of inductive reporter molecules and permanent tagging of those cells, which have completed a defined genetic program . An essential component of such strategy is the development of appropriate reporter strains of mice in which the inducible reporter molecule is ubiquitously expressed . Several reporter strains carrying different floxed transgenes and exhibiting switching of gene expression upon cre - mediated recombination have been reported in mice (i.e., cag - cat - z, rosa26r (r26r), z / ap, z / eg, rosa26flox, cmv - floxed stop - lacz, aczl, and cetz-17). Almost all have employed a single fluorescent marker gene, alkaline phosphatase, (alp) and/or lacz gene . The most commonly utilized strain appears to be rosa26r mice, which are generated by targeting a reporter construct to the proviral rosa26 locus that is constitutively expressed in all tissues . In these reporter strains carrying lacz or alp, detection of these reporters following cre - mediated recombination should always be performed for fixed samples, thus hampering continuous observation of activated gene products in living cells or embryos . There are only a few reports on reporter strains capable of exhibiting noninvasive fluorescent markers upon cre - mediated excision of a such strains carry a single fluorescent marker (egfp for schwenk et al ., mao et al ., motoike et al ., and kawamoto et al ., dsred - t3 for vintersten et al ., and ecfp or eyfp for srinivas et al . ), placed downstream of the floxed stop sequence . In our crteil system, the reporter plasmid contains two fluorescent markers (i.e., floxed hcred1 cdna and egfp placed downstream of the floxed gene) enabling monitoring of gene switching based on changes from red to green fluorescence (see figure 1(a)). This type of cre excision reporter construct was first reported by yang and hughes, who adopted two fluorescent markers (egfp and dsred1 in their reporter plasmid, called cre stoplight) and demonstrated that cells carrying cre stoplight as transgene can be converted from red to green by transient expression of cre . For these reasons, we used hcred, a dimeric far - red fluorescent protein variant isolated from the coral reef heteractis crispa, which exhibits a spectral profile (exc . 618 nm) that does not overlap with those of other existing fluorescent proteins . Hcred1 has already been used as a safe noninvasive protein marker in a transgenic system . Recently, muzumdar et al . Generated mt / mg; a double - fluorescent cre reporter mouse that expresses membrane - targeted tandem dimer tomato (mt) prior to cre - mediated excision and membrane - targeted green fluorescent protein (mg) after excision . The use of a double - fluorescent marker system by muzumdar et al . They observed that this strain works well in vivo after mating with the pre - existing cre expressor strains . These elements will be useful when tissue samples are after cre - mediated excision subjected to biochemical and histochemical analyses, since we can measure the level of luc or lacz quantitatively using commercially available kits (e.g., the luminescent -galactosidase detection kit ii (clontech laboratories, inc ., palo alto, calif, usa)) after observation for fluorescence . In this study, 630-bp ires placed between egfp and luc sequences was useful for simultaneous expression of the two proteins, though the level of luc placed downstream of the ires appeared to be greatly decreased (approximately 1/400 of luc activity in the oviducts transfected with pcl alone; see figure 3(b)). This appears to be due to the insertion of ires between egfp and luc, since the level of luc in the oviducts transfected with pctl (composed of cag promoter, loxp - flanked cat sequence, and luc gene) + ptc (carrying an ncre gene controlled by herpes simplex virus - derived thymidine kinase promoter) was only 1/4 of that in the oviducts transfected with pcl alone . In this sense, use of 81-bp 2a sequence, which is known to yield synthesis of two different proteins from a single mrna [34, 35], may be appropriate in our system, since similar levels of each of the proteins have been reported to be produced in cells transfected with the 2a - containing construct . In this study, we have described in vitro and in vivo switching of gene expression from red to green or green to red fluorescence by the cre - loxp system when pcrteil and pcetriz plasmids are used as tester plasmids . These events occurred when tester plasmid and cre - expression plasmid are cotransfected (see figures 24). In our lf2000-based transfection system, approximately 20% of nih3t3 cells could incorporate two constructs simultaneously, of which more than 50% exhibited cre - mediated gene switching . This rate appears to be too low, since in our previous experiments using f9 embryonal carcinoma cell line stably transfected with loxp - containing reporter plasmid pcetz-17, all clones exhibited gene switching within one day after transient expression of pcag / ncre . This means that 100% gene switching is possible if stable cell lines carrying a reporter construct are subjected to cre - mediated transfection . The low efficiency in cre - mediated recombination in the present study may be due solely to the cotransfection method itself, since we cannot strictly control the number of copies of exogenous gene introduced into cells . The present cre - loxp system based on two fluorescent markers appeared to have great advantages over the previous systems, since the process of change in gene expression can be easily monitored in noninvasive fashion . Furthermore, it is possible to trace the fate of the descendants that express fluorescence under physiological conditions . For finer analysis of the fate of cells transfected with exogenous cre - expression vector, it will be convenient to use transgenic mouse lines carrying the crteil or pcetriz transgene as generalized reporter strains.
Somalia, the easternmost nation in the horn of africa,1 is classified as a fragile state . The recurrent civil conflict for over 20 years has impeded progress toward improving health care in somalia.2 its capital mogadishu has been a haven for armed gangs, islamic militants, and pirates, and for more than two decades, the country has been characterized by insecurity and outbreaks of hunger and inadequate access to basic needs and services.3 according to a recent united nations population fund report, somalia s population stands at 12.3 million people with 45.6% of its people <15 years of age.4 it is a youthful population, with a growth rate of 2.8%, which is among the highest in the world.5 on average, every woman bears 6.6 children6 and each household in somalia has a mean of 5.9 persons.4 the current insecurity has undermined the impact of humanitarian assistance in somalia, a country where half of the population is dependent on health relief and food aid . The government has been unable to implement the rule of law, and external aid including medical supplies constantly faces the threat of diversion.7 the increase and continuous influx of injured people has created conflict of interest for health care resources and prioritization of allocating funds . Monitoring of progress in the public health arena has deteriorated, hence the need to provide progressive assessment of health outcomes . Since 2008, demographic surveillance and birth and death registration systems have come to a standstill, and this limits tracking of progress of health indicators . Through the multiple indicator cluster survey, the united nations international children s fund established a platform to monitor child and maternal indicators; however, this was only possible until 2006.8 there has been a census recently; however, there is no demographic and health surveillance data which are informative about the county s health indicators . It is mainly urban with a population of 1.6 million people, and it had the highest number of internally displaced persons in the country by 2014.4 banadir hospital,9 also known as the only national referral hospital in somalia, has since its establishment been the center of health care delivery in mogadishu . The hospital comprises both maternity and pediatric departments where mothers and children are treated, respectively; however its emergency department offers routine medical and surgical services . In this article, our primary objective was to explore morbidity and mortality patterns of the presenting conditions in the different units at the hospital such that an overview of somalia can be inferred . Sex is a multidimensional social construct10 and investigation of this precedent would provide an insight into health outcomes for males in a male - dominated community at war . The gender inequality index11 for somalia is 0.776 (with a maximum of 1, meaning complete inequality), which is the fourth highest position globally,12 and studies have shown that gender inequality index is positively associated with under-5 mortality rates.13 we also highlight the hospital s performance, gaps in management, and progress made during this study period . Banadir hospital is a teaching hospital located in the wadajir district of mogadishu in somalia . It consists of four main sections: a pediatric section, a maternity section, a laboratory, and a section for general medicine with a bed capacity of 700 . The hospital offers medical and surgical services and also voluntary counselling and testing (vct) for human immunodeficiency virus (hiv), prevention of mother - to - child transmission (pmtct),14 and the expanded program on immunization (epi) services.15 patients are usually admitted through the out - patient department; however, emergencies are received at the accident and emergency unit . Admission and medicines are free, but laboratory tests and x - ray services are priced . The hospital is mainly funded by nongovernmental organizations, and they equally provide training to staff including doctors, nurses, and nurses assistants . Data were collected between january 2008 and december 2012 . All patients that were diagnosed and attended to at the hospital were included in the study . Patient consent was not required as this was aggregated data that was anonymous and had no patient identifying information . For 5 years, aggregated data were obtained from patients records and it included age (dichotomized as <5 or> 5 years), sex, their presenting diagnosis, and outcomes . Diagnoses were made by the doctors who attended to the patients in each unit in accordance with somalia s clinical guidelines and also laboratory confirmation . Data completeness were not ascertained; however, data of all patients treated at the hospital were recorded . Annual data were compiled into a report and recorded on a morbidity and surveillance form . Total number of admissions, discharges, and deaths were also compiled for every month . Data obtained from the maternity ward included numbers of live births and stillbirths, deliveries, and cases of tetanus . Data from the pediatric section and the laboratory were also obtained . Patients that died before diagnosis were diagnosed through post mortem done at the hospital by hospital staff, and those that lacked a diagnosis were included in a category of others . This data were compiled weekly and monthly figures were compiled using the mortality and morbidity surveillance form by the data manager of the hospital . Proofreading to ascertain correct figures was done for the data collected from all the respective units for quality control . Ethical clearance for the study was obtained from the staff in charge of hospital since the hospital has no ethics review board . Data obtained during the 5 years were summarized according to the presented conditions with respect to age groups and stratified by sex . Univariate analyses were carried out to examine the association between sex and mortality . In these analyses, a two - tailed p - value of 0.1 or less was considered to be significant . Crude odds ratios (cors) were obtained for years in which outcomes were significantly associated with sex . Banadir hospital is a teaching hospital located in the wadajir district of mogadishu in somalia . It consists of four main sections: a pediatric section, a maternity section, a laboratory, and a section for general medicine with a bed capacity of 700 . The hospital offers medical and surgical services and also voluntary counselling and testing (vct) for human immunodeficiency virus (hiv), prevention of mother - to - child transmission (pmtct),14 and the expanded program on immunization (epi) services.15 patients are usually admitted through the out - patient department; however, emergencies are received at the accident and emergency unit . Admission and medicines are free, but laboratory tests and x - ray services are priced . The hospital is mainly funded by nongovernmental organizations, and they equally provide training to staff including doctors, nurses, and nurses assistants . All patients that were diagnosed and attended to at the hospital were included in the study . Patient consent was not required as this was aggregated data that was anonymous and had no patient identifying information . For 5 years, aggregated data were obtained from patients records and it included age (dichotomized as <5 or> 5 years), sex, their presenting diagnosis, and outcomes . Diagnoses were made by the doctors who attended to the patients in each unit in accordance with somalia s clinical guidelines and also laboratory confirmation . Data completeness were not ascertained; however, data of all patients treated at the hospital were recorded . Annual data were compiled into a report and recorded on a morbidity and surveillance form . Total number of admissions, discharges, and deaths were also compiled for every month . Data obtained from the maternity ward included numbers of live births and stillbirths, deliveries, and cases of tetanus . Data from the pediatric section and the laboratory were also obtained . Patients that died before diagnosis were diagnosed through post mortem done at the hospital by hospital staff, and those that lacked a diagnosis were included in a category of others . This data were compiled weekly and monthly figures were compiled using the mortality and morbidity surveillance form by the data manager of the hospital . Proofreading to ascertain correct figures was done for the data collected from all the respective units for quality control . Ethical clearance for the study was obtained from the staff in charge of hospital since the hospital has no ethics review board . Data obtained during the 5 years were summarized according to the presented conditions with respect to age groups and stratified by sex . Univariate analyses were carried out to examine the association between sex and mortality . In these analyses, a two - tailed p - value of 0.1 or less was considered to be significant . Crude odds ratios (cors) were obtained for years in which outcomes were significantly associated with sex . Major diagnoses across all age groups included uncomplicated malaria, acute watery diarrhea, anemia, presence of intestinal parasites, and urinary tract infection (table 1). The main diagnoses among children age <5 years were malaria, acute watery diarrhea, and respiratory tract infections . Meningitis, tetanus, whooping cough, and conjunctivitis presented the least cases during the study period . There was an exponential increase in measles cases every other year and a decrease in the year that followed, by 2012 . The reported number of patients with sexually transmitted diseases (stds) almost doubled each year making a sixfold increase by 2012 . These cases were, however, reported only among girls> 5 years of age . The percentage of complicated cases among the cases of malaria that presented reduced from 30% to 20% by 2012 . Trauma cases reported increased across the study period with a higher number of males than females across the study period . Between 2008 and 2010, the number of cases at the diarrhea treatment center declined (figure 1). There was an exponential increase from september 2010 to november 2011 and cases there after reduced gradually toward the end of 2012 . Monthly reporting of cases throughout the study period indicated that cases were higher between april and august each study year . Mortality due to diarrhea followed a similar pattern in both age groups (table 2). Between 2008 and 2009, mortality declined in both age groups and increased between 2009 and 2011 . The number of live births at banadir hospital increased between 2008 and 2012; however, the number of stillbirths remained constant . The ratio of stillbirths to live births therefore declined over the study period (figure 2). There was a consistent decline in the rate of stillbirths from 272 (per 1,000 live births) in 2008 to 102 in 2009 . This reduced further to 71, 85, and 48 in 2010, 2011, and 2012, respectively . Death from neonatal tetanus stagnated at a mean rate of 27% for all the cases of neonatal tetanus presented . The sum of total cases that were attended to at the hospital by the end of 2012 was four times the number at the baseline year of the study in 2008 (figure 3), an increase from 15,324 to 64,588 . The overall mortality rate among those admitted declined between 2008 and 2012 (table 3). At a significant level of 0.1, however, mortality in the age group> 5 years was consistently associated with sex across the study period (table 4). The odds of dying for males compared to females in the age group> 5 years were as follows: cor = 1.98 (95% confidence interval [ci]: 0.94.3, p<0.1) in 2008; cor = 1.85 (95% ci: 0.93.7, p<0.1) in 2009; cor = 1.80 (95% ci: 0.83.7, p<0.1) in 2010; cor = 1.77 (95% ci: 1.03.1, p<0.1) in 2011; and cor = 1.52 (95% ci: 1.12.1, p<0.1) in 2012 . Given the lack of data on a population level, this analysis aimed at understanding the patterns of conditions presented at banadir hospital in order to make inference and conclusions about the general health status of banadir region . It is evident from the results that malaria, acute watery diarrhea, and respiratory tract infections dominated the continuum of causes of admissions despite the integrated community case management, a result that is consistent with world health organization findings.16 although measles cases were on the rise, current data indicates that banadir region is a high endemic area and findings could not be generalized to the entire population.17 measles is one of the leading killers of young children particularly in the malnourished, a situation that is consistent with findings in somalia . Measles immunization coverage remains low with less than one - third of children under 1 year vaccinated against measles.17 according to the african union mission in somalia,18 cases of hiv are on the rise with low case detection due to the absence of diagnostics and stigma from the community.18 this could explain the annual doubling of std cases although the rate of stds was normal . Absence of std cases among boys age> 5 years, however, shows a gap in case detection since females are usually investigated at the maternity section . The reduction in the proportion of complicated cases of malaria indicates that there is improvement in early case detection and diagnosis for malaria within the catchment area for banadir hospital; however, data on case fatality were not available . At the beginning of 2008, the gradual increase in the number of patients at banadir hospital was consistent with the country s population increment.19 this trend; however, changed in mid-2010 (figure 4) with an increase in the rate of hospitalization in relation to the population . This can be explained by the famine and hunger associated illnesses that the country faced during that time . Between 2010 and 2012, the united nations reported the worst drought that ever hit somalia in the last 60 years.20 the increased rate of hospitalization also implies that the hospital provides much more care now than before . There was a clear relation between the annual rainfall pattern and that of diarrhea cases.21 in 2012, mdecins sans frontires documented the increased cases of acute watery diarrhea in southern somalia,22 in line with findings of this study . The increase in cases observed between 2011 and 2012 could also be attributed to the cholera outbreak in the region . This was essentially due to poor sanitation, shortage of safe water, and overcrowding, which were exacerbated by the seasonal flooding of the shebelle river . A recent report by world health organization shows that trauma cases are on the rise,17 which has been highlighted in findings at the hospital . Violence and conflict continue to take a heavy toll on civilians in somalia with escalating numbers of weapon - related injuries . Despite the conflict, the cause of trauma cases among children age <5 years needs to be investigated . The role of males in the civil strife has led to the increased numbers of trauma cases among males compared to the females . There was no consistent association between sex and under-5 mortality in this study in contrast to previous studies.13,23 these studies found that male sex was not an independent predictor of mortality among hospitalized children <5 years of age in the presence of risk factors like age, associated comorbidities, and severity of respective illnesses.24 for the age group> 5 years, sex was consistently associated with higher mortality among males . It was not possible to highlight possible risk factors because of the nature of the data . Although studies have shown that conflict overshadows the social and sex issues, rendering them secondary to the primary concern of safety and survival,25 further research in this area would yield better explanations . It is possible that males presented with more critical conditions than females; however, this could not be ascertained from the study data . The overall reduction in hospital mortality despite the increased number of patients attended to over the years is indicative of the improvement in performance of the hospital . Although the world bank reports an under-5 mortality rate of 146 in somalia,26 this study was not able to highlight changes in mortality rate over time . It is important to reflect on the fact that the overall hospital under-5 mortality among admitted cases has reduced and to highlight the progress that has been made . The increase in the number of patients can also be attributed to the observed number of live births that was much higher than the death rate . The increase in live births at the hospital with no significant increase in stillbirths could explain the increase in the region s population and also an increase in the number of patients attended to at the hospital during the study period . Somalia s birth rate stands at 41 births per 1,000 population and the death rate reduced from 15.9 to 13.9 deaths per 1,000 population despite the fact that the country is at war.27 owing to this, information from banadir hospital could be essential in evaluating health system performance and provide reliable facts on planning for this catchment area . According to the performance assessment tool for quality improvement in hospitals model, the increase in the number of patients attended to at the hospital with reduction in mortality is indicative of positive performance.28 the study involved a large data set for making good comparisons and detecting trends over time, for the first time in 2 decades of war; however, the data were aggregated making it hard to perform detailed analyses and making more concrete conclusions . Categories had been prefixed before the data were collected, which could not allow flexibility in the data analysis . Analyzing trends in this context disease - specific mortality was not possible in the study, which would have provided a better analysis of conditions . There may have been a selection of more serious cases being admitted to the hospital, which may also distort the results; however, sufficient information on the primary health care system in this war setting was not readily available to back up some of our arguments . Given the lack of data on a population level, this analysis aimed at understanding the patterns of conditions presented at banadir hospital in order to make inference and conclusions about the general health status of banadir region . It is evident from the results that malaria, acute watery diarrhea, and respiratory tract infections dominated the continuum of causes of admissions despite the integrated community case management, a result that is consistent with world health organization findings.16 although measles cases were on the rise, current data indicates that banadir region is a high endemic area and findings could not be generalized to the entire population.17 measles is one of the leading killers of young children particularly in the malnourished, a situation that is consistent with findings in somalia . Measles immunization coverage remains low with less than one - third of children under 1 year vaccinated against measles.17 according to the african union mission in somalia,18 cases of hiv are on the rise with low case detection due to the absence of diagnostics and stigma from the community.18 this could explain the annual doubling of std cases although the rate of stds was normal . Absence of std cases among boys age> 5 years, however, shows a gap in case detection since females are usually investigated at the maternity section . The reduction in the proportion of complicated cases of malaria indicates that there is improvement in early case detection and diagnosis for malaria within the catchment area for banadir hospital; however, data on case fatality were not available . At the beginning of 2008, the gradual increase in the number of patients at banadir hospital was consistent with the country s population increment.19 this trend; however, changed in mid-2010 (figure 4) with an increase in the rate of hospitalization in relation to the population . This can be explained by the famine and hunger associated illnesses that the country faced during that time . Between 2010 and 2012, the united nations reported the worst drought that ever hit somalia in the last 60 years.20 the increased rate of hospitalization also implies that the hospital provides much more care now than before . There was a clear relation between the annual rainfall pattern and that of diarrhea cases.21 in 2012, mdecins sans frontires documented the increased cases of acute watery diarrhea in southern somalia,22 in line with findings of this study . The increase in cases observed between 2011 and 2012 could also be attributed to the cholera outbreak in the region . This was essentially due to poor sanitation, shortage of safe water, and overcrowding, which were exacerbated by the seasonal flooding of the shebelle river . A recent report by world health organization shows that trauma cases are on the rise,17 which has been highlighted in findings at the hospital . Violence and conflict continue to take a heavy toll on civilians in somalia with escalating numbers of weapon - related injuries . Despite the conflict, the cause of trauma cases among children age <5 years needs to be investigated . The role of males in the civil strife has led to the increased numbers of trauma cases among males compared to the females . There was no consistent association between sex and under-5 mortality in this study in contrast to previous studies.13,23 these studies found that male sex was not an independent predictor of mortality among hospitalized children <5 years of age in the presence of risk factors like age, associated comorbidities, and severity of respective illnesses.24 for the age group> 5 years, sex was consistently associated with higher mortality among males . It was not possible to highlight possible risk factors because of the nature of the data . Although studies have shown that conflict overshadows the social and sex issues, rendering them secondary to the primary concern of safety and survival,25 further research in this area would yield better explanations . It is possible that males presented with more critical conditions than females; however, this could not be ascertained from the study data . The overall reduction in hospital mortality despite the increased number of patients attended to over the years is indicative of the improvement in performance of the hospital . Although the world bank reports an under-5 mortality rate of 146 in somalia,26 this study was not able to highlight changes in mortality rate over time . It is important to reflect on the fact that the overall hospital under-5 mortality among admitted cases has reduced and to highlight the progress that has been made . The increase in the number of patients can also be attributed to the observed number of live births that was much higher than the death rate . The increase in live births at the hospital with no significant increase in stillbirths could explain the increase in the region s population and also an increase in the number of patients attended to at the hospital during the study period . Somalia s birth rate stands at 41 births per 1,000 population and the death rate reduced from 15.9 to 13.9 deaths per 1,000 population despite the fact that the country is at war.27 owing to this, information from banadir hospital could be essential in evaluating health system performance and provide reliable facts on planning for this catchment area . According to the performance assessment tool for quality improvement in hospitals model, the increase in the number of patients attended to at the hospital with reduction in mortality is indicative of positive performance.28 the study involved a large data set for making good comparisons and detecting trends over time, for the first time in 2 decades of war; however, the data were aggregated making it hard to perform detailed analyses and making more concrete conclusions . Categories had been prefixed before the data were collected, which could not allow flexibility in the data analysis . Analyzing trends in this context disease - specific mortality was not possible in the study, which would have provided a better analysis of conditions . There may have been a selection of more serious cases being admitted to the hospital, which may also distort the results; however, sufficient information on the primary health care system in this war setting was not readily available to back up some of our arguments . Diseases of infectious origin dominated the continuum of cases attended to at the hospital, and hospital - based mortality reduced across the study period . Data from banadir hospital were consistent with findings from banadir region although figures from hospital - based studies are higher than those in the general population . This data can be used to describe the health status of the community in the absence of credible demographic surveillance in banadir region as earlier stated . Hospital - based studies would work as early surveillance tools in a sentinel site, since hospital cases may be observed to increase before the outbreak . There was an association between mortality in the age group> 5 years and sex with a protective advantage for females compared to males . Our results only reflect that there is a difference in outcome of patient admissions with respect to sex in the age group> 5 years but do not show that the female sex is positioned better than the male . The situation of war and increased risk of injury for males should be put into context in this study . There are better outcomes at the hospital with progressive improvement during the study period; however, these outcomes are still low in comparison to global standards.
Mitochondrial cytopathies (mc) are a rare and complex group of neuromuscular diseases due to a defect in the oxidative phosphorylation (oxphos) system . Symptomatic renal involvement in mc has been documented in the form of tubular defects (complete de toni - debr - fanconi syndrome in severe cases to incomplete proximal tubular defects in milder cases), chronic tubulointerstitial nephritis, cystic renal diseases, rare glomerular diseases such as focal segmental glomerulosclerosis due to 3243 a> g trnaleu mutations and coenzyme q10 biosynthesis defects, hypermagnesuria and myoglobinuria . Acute kidney injury (aki) as the sole presenting manifestation of clinically latent mc is extremely rare . We report a case of recurrent episodic aki caused by exercise induced rhabdomyolysis in a patient whose muscle biopsy revealed the diagnosis of mitochondrial myopathy (mm). A 53-year - old man presented with the complaints of oliguria, generalized bodyache and dark colored urine . He gave an unusual history of three previous episodes of similar symptoms in the past, at 25, 36 and 48 years of age . He had been treated with peritoneal dialysis during the first episode and hemodialysis in the next two, following which he made a complete recovery . All the four episodes had been preceded by a history of walking long distances prior to the onset of symptoms ., there was no peripheral edema and his blood pressure was 130/80 mmhg, pulse rate was 100/min and systemic examination did not reveal any abnormality . His laboratory parameters during the present episode were as follows: serum creatinine 10.2 mg / dl, blood urea 160 mg / dl, serum sodium 128 meq / l, serum potassium 6.1 meq / l and serum bicarbonate 17 meq / l . His packed cell volume was 36%, total white blood cell count was 5000 with normal distribution and no abnormalities detected on peripheral smear examination . His liver function tests showed serum glutamic oxaloacetic transaminase of 2005 iu / l and serum glutamic pyruvic transaminase 880 iu / l . The patient underwent three sessions of hemodialysis and attained complete recovery of his renal function . In view of his clinical history and laboratory data, a provisional clinical diagnosis of metabolic myopathy possibly mcardle's disease causing exercise induced rhabdomyolysis was considered and a muscle biopsy was performed . Histopathology revealed skeletal muscle fibers with preserved fascicular architecture and no evidence of necrosis or inflammation . Cryostat sections stained with modified gomorri trichrome stain revealed characteristic ragged red fibers (rrf) which on histochemical staining showed intense reaction in subsarcolemmal zone for succinic dehydrogenase and nicotinamide adenine dinucleotide tetrazolium reductase . Electron microscopy confirmed the presence of abnormal aggregates of mitochondria in the subsarcolemmal region corresponding to rrf . A final diagnosis of mm was established based on light microscopy, enzyme histochemistry, special stains, and electron microscopy findings . The patient was evaluated for other systemic manifestations of mitochondrial disease including progressive external ophthalmoplegia, cardiomyopathy, encephalopathy, hypogonadism, and motor neuron disease, which were negative . He was counseled regarding his disease condition and urged to refrain from strenuous physical exercises . He has been compliant and on regular follow - up for the last 10 years with no further recurrence of symptoms . Over the last decades, there has been immense development in the field of mitochondrial diseases with an ever expanding list of pathogenic mitochondrial and nuclear dna mutations causing a wide spectrum of clinically manifest diseases . Since the central nervous system and muscle are frequently involved in mitochondrial diseases, the term mitochondrial encephalomyopathy is commonly used . Acute renal failure is uncommon in mitochondrial diseases and it is extremely rare as a presenting manifestation of the disease . Among the various syndromes associated with mitochondrial diseases, isolated myopathy due to defects in oxphos, fits the clinical picture in this patient as he has no other systemic manifestations . The oxphos system, which is embedded in the inner membrane of the mitochondria, is constituted by five enzyme complexes, encoded by two separate genomes, viz ., mutations in the nuclear dna show mendelian inheritance whereas primary mitochondrial dna mutations are sporadic or show maternal inheritance as mitochondrial dna is only transmitted from mother to child . Mm may also be acquired, as in the case of antiretroviral therapy for human immunodeficiency virus infection . To the best of our knowledge, this is the first report from india of isolated mm in an adult patient presenting as recurrent episodic aki . Irrespective of cause of mitochondrial dysfunction, exercise induced adenosine triphosphate depletion results in intracellular calcium accumulation and myocyte death or rhabdomyolysis, which causes acute renal failure by release of muscle cell contents, especially myoglobin into circulation . Myoglobinuria occurs when myoglobin exceeds 250 ng / ml (normal 5 ng / ml) and causes cast formation and accumulation of iron in proximal tubules . Aki ensues due to direct nephrotoxicity of myoglobin as well as its conversion to ferrihemate at a ph <5.6 which is toxic to renal tubules . In addition, generation of oxygen free radicals and sequestration of fluids in injured muscles results in volume depletion, aciduria, nitric oxide depletion, and renal hypoperfusion further contributing to acute tubular necrosis . Aki induced by rhabdomyolysis can occur in varied clinical settings such as crush syndrome, trauma, drug overdose, hyperthermia, alcohol abuse, etc ., hence careful collation of history, clinical presentation and laboratory data are required to ascertain the etiology . Recurrent episodic aki is characteristic of rhabdomyolysis and heightened awareness of the possibility along with appropriate sensitivity to abnormal laboratory values is necessary to reach the diagnosis, which can be corroborated by muscle biopsy when indicated . The diagnostic workup of renal mc involves amalgamation of multiple modalities, viz ., enzymology and biochemistry analyses including measurement of urine organic acids by gas chromatography / mass spectrometry, molecular genetics, pathology (histology, histochemistry, and electron microscopy) and neuroradiology studies, possibly coupled with magnetic resonance spectroscopy . In infants, podocyte mitochondrial abnormalities demonstrated by electron microscopy are highly evocative of coq10 defects in early onset steroid resistant nephrotic syndrome, which is a treatable mc . Patients with recurrent rhabdomyolysis related aki should be further evaluated by means of muscle biopsy . A diagnosis of mm warrants counseling of the patient regarding avoidance of physical stresses which may provoke relapses of the disease . Conversely, screening for subclinical renal involvement and monitoring for renal disorders is required in all patients with mc . Screening of family members, keeping in mind possible maternal as well as mendelian pattern of inheritance is also important . This case is reported not only for its unusual presentation of a rare disorder, but also to highlight the value of reaching a correct etiological diagnosis of aki which can lead to prevention of further episodes of renal failure by counseling and institution of appropriate avoidance measures.
Acute upper gastrointestinal bleeding (ugib) is a common and potentially life - threatening emergency facing clinicians with an overall annual incidence of approximately 100 hospital admissions per 100,000 population . Peptic ulcer bleeding is a common medical emergency accounting for 50%70% of cases of acute nonvariceal ugib and is significantly associated with morbidity, mortality, and health costs . Initial hemostatic rates of 80% to 95% can be achieved with effective endoscopic therapies such as local injection, contact thermal coagulation, and hemoclips . Despite remarkable advances in diagnosis and treatment of peptic ulcer bleeding, bleeding recurs in 10%30% of patients . Therefore, recurrence of bleeding after initial endoscopic hemostasis has been described as the single most adverse independent prognostic factor for this group of patients . Endoscopic hemostasis including mechanical, thermal, and by injection of various agents, whether epinephrine, distilled water, cyanoacrylate, ethanol, or polidocanol, has been found to decrease the risk of rebleeding, need for surgery, and the mortality . Although vigorous efforts have been made to delineate the ideal endoscopic method for achieving hemostasis, there is still a great deal of uncertainty about a highly effective and simple hemostatic technique to reduce the risk of rebleeding in patients with nonvariceal ugib . Endoscopic injection of dilute epinephrine is considered a highly effective and popular endoscopic scheme for ugib, owing to its low cost, wide availability, lack of severe local or systemic injury, and easy to administer . However, epinephrine injection may induce cardiovascular complications and mild histologic changes such as hematoma and perforation . Because mechanical and chemical effects of epinephrine are short - lived, the addition of a second agent, such as polidocanol or ethanol, may be beneficial for preventing recurrent bleeding by prolonging hemostatic mechanisms of epinephrine . Therefore, wide variation in the rate of rebleeding can be explained by difference in the mechanisms of the action of the injected agents and differences in injection volume . However, clinical trials in patients with bleeding ulcers disclosed that no single solution is superior to another for hemostasis . Furthermore, results from several studies have revealed that injection of normal saline solution or distilled water has a primary role in hemostasis similar to those of epinephrine in the endoscopic therapy of patients with bleeding ulcers . In this regard, there has been no clinical study that evaluates the effects of fresh frozen plasma (ffp) in the endoscopic therapy of patients with ugib . Ffp, the most commonly prescribed hemostatic agent, is prepared either from a single whole blood donation or obtained by apheresis, frozen within a specific period and stored at a proper temperature up to 1 year that will maintain all of the coagulation factors, electrolytes, and plasma proteins . It has been shown that ffp is a good source of coagulation factors which can correct mild to moderate coagulopathy . Therefore, if the injection of ffp has similar effects epinephrine, it might be an alternative solution for the treatment of patients with bleeding ulcers because of its low cost, wide availability, rapidity, ease of application, and lack of severe complication . This study was designed to shed light on the possible role of ffp as a hemostatic agent in patients with high - risk bleeding peptic ulcers . A prospective, randomized, single - blind, parallel group trial was conducted at al - zahra hospital from august 23, 2015, to april 21, 2016 . All cases were informed about the procedure of the survey and written informed consent was obtained from all them . All patients with hematemesis, melena, or hematochezia underwent for emergency endoscopy within 24 h of admission . Only men and women over 18 years of age with ulcers indicative of a high - risk for spontaneous recurrent bleeding including bleeding visible vessel (spurting or oozing), adherent clot, and nonbleeding visible vessel were selected . Patients were excluded from the study if they had another possible bleeding site or an acute significant illness, were pregnant, had a severe bleeding tendency, and unable, or unwilling to give written consent . After an explanation of the nature of the study and patient consultation with their gastroenterologist, informed written consents were attained from all patients . The ethical institutional committee of isfahan university of medical sciences approved the protocol of study . Overall, a total of 100 patients with high - risk bleeding peptic ulcers were enrolled in the study, and completed interventions without interruption . After the enrollment, all patients were randomly divided into one of the two groups using random allocation method . Patients were stratified according to their forrest classification and then randomized 1:1 into two intervention groups: group a who received injection of epinephrine diluted 1:20,000 in saline solution alone in volumes of 8 ml aliquots by multiple punctures into and around the bleeding point and group b who received injection of epinephrine diluted 1:20,000 in saline solution plus thawed ffp in volumes of 8 ml around the ulcer base and beneath the bleeding source . During the period of endoscopic treatment,, endoscopic biopsy specimens from the gastric antrum and one from the gastric body were obtained for a rapid urease test for helicobacter pylori . In our study, initial hemostasis was defined as endoscopically verified cessation of hemorrhage for at least 5 min after the first endoscopic treatment and maximal water irrigation for 10 s. recurrent bleeding was suspected clinically as one or more signs of ongoing or new bleeding, including vomiting of fresh blood, melena or bloody stool, instability of vital signs or hemodynamic, and a reduction of hemoglobin concentration by more than 20 patients with rebleeding were confirmed by endoscopy immediately and retreated with endoscopic treatments such as epinephrine injection plus argon plasma coagulation (apc), transcatheter arterial embolization, and emergent surgery . After endoscopy treatment, all patients were closely monitored in an intensive care unit until the first follow - up and blood transfusion was given to maintain the hemoglobin level at> 10 the outcomes assessed in the study were the in - hospital recurrent bleeding, duration of hospitalization, surgery, and 30-day mortality . Analysis of the current study was performed using the spss for hardware (version 20.0; spss, chicago, il, usa). T - test, chi - square, and tests were applied to ensure homogeneity between the two groups in terms of age and gender . Results of endpoints parameter at baseline and 24 h after treatment were compared between the two groups using paired student's t - tests . For quantitative data, results of the analysis were summarized by mean standard deviation or number (percent). All tests were two - tailed, and p <0.05 was considered as a significant . A total of 108 patients with ugib were recruited during the study period . Of these, eight patients were excluded due to endoscopically uncontrollable bleeding, gastric malignancy, and multiple sites of bleeding at endoscopy . The two treatment groups well matched for demographic and clinical characteristics including age, gender, nsaid ingestion, comorbid disease, positive h. pylori, hemodynamic status at entrance, bleeding stigma, ulcer size, and transfusion requirements during the first 24 h [table 1]. There were one hundred patients who were included in the study, fifty in each group . Other clinical and endoscopic data for the patients at study entry are summarized in table 1 . Initial hemostasis was achieved in 47 of 50 patients (94%) in the group a and 49 of 50 patients (98%) in the group b. clinical and endoscopic characteristics of the patients at study entry we found no statistically significant differences in the rate of initial hemostasis between group a and group b (p = 0.61). There were no significant differences in the rate of recurrent bleeding between group a (14%) and group b (8%) (p = 0.52). Seven patients in group a had recurrent bleeding but were controlled in three patients with additional apc, and in three by surgical intervention . Recurrent bleeding was also controlled in three patients of group b. recurrent bleeding was controlled in one patient by apc, and in two patients by surgical intervention . The endoscopic findings indicated that duodenal ulcer was the source of bleeding in 54 patients . There were no significant differences between two groups in terms of ulcer type, ulcer size, volume of epinephrine used during endoscopic hemostasis, and forrest class . Major complications from endoscopic treatment including severe abdominal pain following hemostasis, perforation, and endoscopic therapy induced bleeding were observed more frequently in the group b than in the group a and the differences were not statistically significant . We did not find procedure - related cardiovascular or respiratory complication such as cardiac arrhythmia, considerable change in oxygen saturation, significant changes in systolic pressure, and abrupt change in pulse rates after endoscopic hemostasis in groups a and b. furthermore, there were no significant differences between group a and group b with respect to the surgery rate, bleeding death, procedure related death, and duration of hospitalization [table 2]. Bleeding peptic ulcer is a potentially life - threatening disease with a considerable mortality and morbidity . The effectiveness of endoscopic treatment for ugib is well established; endoscopic therapy is commonly used as the first - line treatment in patients with nonvariceal upper gi, and epinephrine alone is among the most widely used injection solutions . In an effort for more effective hemostasis and to reduce the risk of rebleeding in patients with high - risk of ugib, a number of endoscopic treatment modalities are firmly established including injection, thermal, and mechanical . Although the combination of epinephrine injection with a thermal method shows a consistent trend in favor of combined treatment, there is not yet strong evidence that any modality is superior to injection of epinephrine alone for treatment of patients with ugib . One of the reasons might be that combined therapy is not available in all hospitals, and it is more technically demanding . It has been shown that unsatisfactory visualization of the bleeding site, unsuccessful application of epinephrine injection, and recurrent bleeding in actively bleeding ulcers may be associated with the age, gender, comorbid disease, positive h. pylori, hemodynamic status at entrance, ulcer size, ulcer location, and transfusion requirements during the first 24 h, which were similar between two groups in our study, indicating that the outcomes of the study are unlikely influenced by these factors . A number of agents with different mechanisms of action such as vessel compression, vasoconstriction, and platelet aggregation have been investigated . Therefore, the addition of ffp, the most commonly prescribed hemostatic agent, would be advantageous in theory . Despite the theoretical advantages of ffp, previous studies revealed no significant differences between injection of epinephrine alone or in combination with other solutions such as distilled water and normal saline solution . Although it is difficult to sort out these inconsistent outcomes of previous studies, the difference may in part be clarified by a small number of patients, different subtype of peptic ulcer bleeding, combined with the fact that epinephrine injection is adequate in most cases with acute ugib . These possible reasons are explained in previous meta - analyses that compared efficacy of injection of epinephrine alone with epinephrine and a second injected solution in the patients with peptic ulcer bleeding . Meta - analysis of the recent controlled trials revealed that combined therapy seems to be more effective than epinephrine injection alone, but a particular form of treatment is not equal or superior to another . Although the absolute improvement in the outcomes of our study is relatively small, we failed to detect a significant reduction in the need for surgery, overall rate of mortality, duration of hospitalization, and rate of rebleeding . In a similar study, 140 patients with ulcers and endoscopic features indicative of a high - risk for spontaneous recurrent bleeding were assigned to endoscopic injection with epinephrine (group a) and epinephrine plus human thrombin (group b). They reported that endoscopic injection of epinephrine alone results in rebleeding rates of 20%, an overall mortality of 10%, and administration of 297 units of blood . The combination of endoscopic injection of epinephrine with an injection of human thrombin might be superior, resulting in rebleeding rates of 4.5%, an overall mortality of 0%, and administration of 219 units of blood . Our findings are inconsistent with the results of their study that highlighting advantages of the combination of epinephrine plus a second solution . A possible explanation for the discrepancy may lie in the fact that high - dose continuous intravenous ppis greatly lowers the rate of rebleeding, resulting in the conflicting findings but cannot serve as a specific explanation for the failure of ffp because the dose of ppis reported for both studies appears identical . In another study, 415 patients with high - risk bleeding ulcers were randomized to injection of epinephrine alone or epinephrine plus ethanolamine . They found no significant differences in the rate of mortality or in the proportions of the patients who required surgery . In addition, they showed a trend toward less recurrent bleeding after injection of the epinephrine plus ethanolamine . Therefore, the findings of their study suggested that adding ethanolamine to epinephrine can effectively prevent recurrent bleeding and might be some of the value in patients with peptic ulcer bleeding . However, pescatore et al . Found that injection of epinephrine alone and epinephrine plus fibrin glue does not have comparable recurrent bleeding rates, indicating that adding fibrin glue to epinephrine is not superior to epinephrine injection alone in the treatment of high - risk bleeding peptic ulcers . Due to increasing number of reports describing differential and conflicting results, more extensive studies in larger groups of patients should be undertaken to analyze the putative role of adding a second agent to epinephrine for injection treatment of patients with high - risk bleeding ulcers . In summary, this single - center, prospective, randomized, controlled trial of patients with ugib has shown that injection of epinephrine alone was equally effective as injection of epinephrine plus ffp to endoscopic hemostasis . Epinephrine alone and epinephrine plus ffp were not different in recurrent bleeding, surgery, blood transfusion, or mortality . Financial support of isfahan university of medical sciences, isfahan (research project number: 395100). Financial support of isfahan university of medical sciences, isfahan (research project number: 395100). Mkh contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, agreed for all aspect of the work . Mk contributed in the conception of the work, conducting the study, revising the draft, agreed for all aspects of work . Ash contributed in the conception of the work, conducting the study, agreed for all aspects of the work . Vs contributed in the conception of the work, revising the draft, agreed all aspects of the work.
The who estimates that there are over 1.5 million blind children in the world, of whom nearly 90% live in the developing nations (who factsheet 282, 2011 and). Poverty greatly compromises the children's quality of life; childhood mortality rates are greatly elevated (sightsavers estimates that fewer than 50% of blind children in india survive to adulthood) and the vast majority of blind children are unable to get an education . Notably, much of this blindness (over 70%) is preventable or treatable (figure 1 shows two common treatable conditions). Most children, however, never receive medical care because of financial hardship or lack of medical access . The left panel shows a child with bilateral corneal opacities and the right shows dense congenital cataracts . Both of these conditions are treatable with simple surgical procedures (grafting clear donor tissue for corneal opacities; lens extraction followed by intra - ocular lens implantation for cataracts). It might involve transcending the blindness through assistive devices such as technological aids (sonar equipped canes or audible gps, for instance) and improved social integration . These are certainly worthy goals to aim for, but they require significant investment in infrastructure and major changes in societal attitudes that might be slow in coming . A more direct way of helping blind children, of course, is to provide them sight restoring surgeries . To the extent that these surgeries are successful in bringing some modicum of functional vision to the children, they can be effective in immediately improving children's life prospects . As a bonus, this intervention also opens up an unprecedented scientific opportunity to study a fundamental open question: how does the brain learn to extract meaning from sensory information? As the newly - sighted children embark on the enterprise of learning to see, studying their visual development promises to yield insights into questions regarding object learning and brain plasticity . A particular strength of this approach is that it affords us an opportunity to continuously follow the development of visual skills and associated neural markers from before the sight restoration treatment to after . Furthermore, working with older children with newly initiated sight allows us to sidestep some of the operational difficulties that infant researchers have had to contend with, and that have limited the scope and complexity of developmental studies undertaken thus far . In popular imagination through the ages, the initiation of sight in a blind person is nothing less than a miracle . Indeed, an italian ophthalmologist named alberto valvo estimated that no more than 15 such cases had been described in any detail over the past millennium . Just a handful more have been added to the list in the following four decades . An english surgeon by the name of william cheselden presented the first account of delayed sight onset in a 13 year old boy born with bilateral cataracts . Cheselden noticed that the boy had severely impaired visual abilities even after the removal of cataracts, as illustrated in this passage: when he first saw, he was so far from making any judgment of distances, that he thought all object whatever touched his eyes (as he expressed it) as what he felt did his skin, and thought no object so agreeable as those which were smooth and regular, though he could form no judgment of their shape, or guess what it was in any object that was pleasing to him: he knew not the shape of anything, nor any one thing from another, however different in shape or magnitude; but upon being told what things were, whose form he knew before from feeling, he would carefully observe, that he might know them again . However, it is difficult to cleanly interpret cheselden's data since the child's struggles with acquiring visual proficiency could have been due either to central problems in learning or more peripheral issues of ocular healing, given the crude surgical techniques of that time, such as couching . Modern literature on sight recovery in adulthood, following prolonged visual deprivation, is rather sparse [2,5 - 11], (see also for a case of visual function recovery in adulthood, though not after blindness). Maurer and her colleagues have found that brief periods of early deprivation, lasting just a few months, can have long - lasting impact on perception later in life . For instance, children who were treated for congenital cataracts within the first six months of life show subtle differences in processing facial configurations relative to their normally developing counterparts even after reaching teenage years . As for instances of sight onset much later in life, the key findings from the few cases that have been reported thus far pertain to the difficulties the newly sighted experience in interpreting visual information as an ordered collection of meaningful entities . However, there is also evidence that these individuals over time are able to make effective use of visual information . For instance, gregory and wallace, in describing the patient denoted sb (who gained sight at the age of 52), write the following: sb had no difficulty in identifying the giraffe, elephant, monkey, lion, snakes or giant tortoises . He appeared to identify the tiger at once, though he was surprised to see that it was striped . Locals he cheered up considerably, and was clearly regarded as a character . He was able to recognise his friends at a distance of at least fifteen feet, from one bar to another, and he would now cross roads with some confidence . Similarly, kurson in his account of mike may, who gained sight at the age of 45, says the following: during lunch at the backyard patio table, may delighted in his ability to use vision alone to reach for the milk carton and find his napkin after it fell to the ground . He could easily distinguish between burgess and jennifer (may's wife and her friend) based on their hair lengths and the color of their clothes . Von senden reported that sight in adulthood was sometimes accompanied by emotional disturbances, perhaps in part due to the difficulties involved in accomplishing visual tasks that to others are so effortless . Carlson et al . Attribute some of the post - sight difficulties of their subject to motivational problems . As gregory and wallace write, in their account of sb: he certainly relied a great deal on vision, but we formed the impression that this very reliance cost him his self - respect, for he had been proud of his abilities when the handicap was obvious, but now his previous achievements seemed paltry and his present position almost foolish . Clearly, outcomes of sight - restoring surgeries late in life are complex, comprising both significant impairments as well as the development of important visual proficiencies . Given these complexities, a systematic research program with a larger subject population seems necessary . It is frustrating that most of the work thus far has been largely anecdotal in nature, a necessary consequence of the rarity of such cases . A new initiative has begun to change this state of affairs by adding many more cases of late sight onset to the corpus thus far . Named project prakash (sanskrit for light), this effort focuses on providing sight - restoring surgeries to congenitally blind children in rural india, the country with the largest population of blind children in the world . The project comprises an outreach program for identifying children with curable ocular pathologies, a medical treatment program for providing them surgical interventions and a schedule of post - operative follow - ups (www.projectprakash.org;). For each child, the prakash studies include a clinical ophthalmic evaluation as well as assessments of various aspects of visual function . Figure 2 summarizes some of the tests employed . Besides basic measurements of acuity, contrast sensitivity and motion coherence thresholds, the tests for examining visual function and its development following late sight - onset also assess children's performance on higher - order visual tasks such as image segmentation, shape matching and face localization . (image credits: landolt c chart from precision vision inc . And the worth four dot test from optimetrics inc .) The findings thus far suggest that, consistent with the notion of early sensitive periods for visual development, some key aspects of vision, such as acuity, spatial contrast sensitivity and precise oculomotor stability, are compromised by extended deprivation . The compromises appear to be permanent since the measures do not change significantly from soon after the surgery to even a year later . Some encouraging results emerge when we look beyond these basic measurements towards higher - order visual functions . Evidence thus far points to partial skill acquisition on tasks such as simple shape matching and face recognition . Performance of the newly sighted on several of these tasks is found to be well above chance, even though it might not be as good as that of controls . While some of the residual performance deficits can be attributed to the subpar acuity and lingering nystagmus following surgery, others are harder to explain . For instance, newly sighted children tend to exhibit perceptual overfragmentation (a tendency to break up images into many little pieces, rather than wholistic objects) for several months following sight onset . This pattern of proficiencies and limitations may help us better characterize the limits of neural plasticity late in childhood . In clarifying the prospects of visual function acquisition after many years of early blindness, these results hold significance for basic neuroscience as well as the practice of pediatric ophthalmology and the implementation of late stage blindness treatment programs . Moving beyond the mere demonstration of visual recovery, longitudinal studies in the prakash population, the elucidation of this arc of development opens up the possibility of mechanistically specifying how visual bootstrapping happens and how complex visual skills derive from simpler ones that precede them in developmental chronology . Along these lines, recent results have highlighted the profound significance of dynamic information processing as a building block for other visual skills . Another fundamental issue that these studies can help address is that of cross - modal mapping correlating visual information with those from other sensory modalities, such as touch and audition . This foundational question, which was framed over three centuries ago by philosophers such as john locke and william molyneux, is central to understanding the nature of internal representations and the nativism versus empiricism debate . Studies with the newly sighted have finally begun outlining an answer . After showing no evidence of cross - modal transfer immediately after surgery, this points to the existence of rapid learning processes for detecting relationships across sensory streams, a result that can help seed important theoretical work on learning algorithms in the brain . Taken together, these findings are beginning to suggest that the landscape of plasticity late in the developmental timeline is likely to be complex . Neither of the two extreme positions appear tenable; on the one hand, not all visual functions seem subject to strict early critical periods and, on the other hand, early visual experience is undeniably important for the normal development of key abilities like high - resolution vision . Individuals with late sight onset seem to possess the basic substrates for at least some aspects of visual learning, although the eventual extent of their proficiency might be limited by the deprivation they experienced early in their developmental trajectories . This pattern of results suggests a fascinating interplay of nature and nurture processes in visual development and points to a wealth of questions to be tackled in the years to come . Studies of newly sighted individuals promise many insights regarding visual learning . However, it is important that we do not over - interpret the data or misconstrue their relationships with other issues in neuroscience . We cannot assume a priori that the developmental trajectory following late sight onset will recapitulate in whole or in part the normal progression of visual development in a newborn . Even though the two children, one normally sighted and the other late - sighted, might reach similar levels of visual proficiency on a given task visual learning in a newly sighted adolescent, for instance, can ride atop the world model that has already been put in place by other modalities . The child already knows about the world as being made up of distinct objects, has linguistic labels for different categories and has in place concepts such as object permanence and solidity . These pre - existing notions might facilitate the development of visual object concepts in the late - sighted . An infant, by contrast, starts with a more rudimentary notion of the composition of the world . Additionally, an older child who is just beginning to see has much greater abilities for interacting with, and actively manipulating, the world relative to an infant . This richness of interaction may modify the rapidity and manner in which visual concepts are acquired . Finally, from a purely physiological perspective, the brain of an older child differs markedly from that of an infant . The processes of neuronal migration, axonal myelinization and dendritic pruning which are so extensive in the infant brain have largely run their course by adolescence . These physiological differences may impact developmental trajectories in complex ways and render visual learning in normally sighted infants to be quite different from that in older children with late sight onset . For these reasons and several others, studies of late sight onset should not be construed as replacements for investigations of normal visual development . This does not in any way diminish the significance of studies of late sight onset; they are still invaluable as indicators of a path towards visual proficiency . All we need to remember is that this path may not be the same as the one the brain follows in normal development . It is an interesting challenge to determine the extent to which the two kinds of trajectories actually share commonalities . It is tempting to think of instances of visual learning after late sight onset as counterpoints to classical notions of critical periods in vision . Even setting aside the fact that one body of literature arises from non - human animal studies, while the other is based on work with humans, there are several reasons why one has to exercise caution in relating these two lines of work . First, many, if not most, of the classical studies of visual critical periods have employed monocular deprivation protocols wherein one eye is sutured shut while the other eye has a normal visual experience [23 - 25]. Doing so sets up a strong competitive interaction between the two eyes with dramatic consequences on cortical organization . However, the cases of late sight onset in humans profiled above involve roughly equal bilateral deprivation . Given the reduced competitive effects in the latter case, it cannot be assumed that its cortical consequences (both in terms of their nature and permanence) will be comparable to those that arise from monocular deprivation regimens . Furthermore, several previous studies of binocular deprivation have typically used manipulations that are not precisely analogous to the deprivation experienced by humans prior to gaining sight . Specifically, dark - rearing and lid - suture lead to a more impoverished visual experience than do cataracts and corneal opacities (the two primary conditions treated in humans). The latter allow greater light perception and even some rudimentary sense of the movement of shadows of objects close to the face . Since traditional studies of critical periods were based on work with animal subjects, the complexity of the assessment techniques was necessarily limited; typically, the dependent variables were physiological, such as number of cells responding to one or the other eye . Behaviorally, while basic visual attributes like acuity and visuo - motor coordination can be measured (e.g. ), performance on high - level tasks such as object recognition and image segmentation is largely unknown . This makes it challenging to compare the two datasets, one from non - human subjects and the other from humans, that have employed non - identical sets of assessment tasks . Indeed, it appears that while visual deprivation in humans does permanently compromise acuity, consistent with classical studies with animals and the notion of critical periods, some higher - level visual skills can be acquired . Given all of these considerations, it is clear that the older animal studies of deprived rearing differ in some important ways from reports of late sight onset in humans . Therefore, evidence of some visual skill acquisition in the latter ought not to be seen as a counterpoint to the notion of critical periods developed in the former . More broadly, the notion of critical periods is worthy of a fresh look . Even within the body of animal deprivation studies, results of the consequences of early deprivation are not entirely homogenous; several studies have reported significant gains in visual abilities over time after deprivation's end [27 - 32]. We cannot assume a priori that the developmental trajectory following late sight onset will recapitulate in whole or in part the normal progression of visual development in a newborn . Even though the two children, one normally sighted and the other late - sighted, might reach similar levels of visual proficiency on a given task visual learning in a newly sighted adolescent, for instance, can ride atop the world model that has already been put in place by other modalities . The child already knows about the world as being made up of distinct objects, has linguistic labels for different categories and has in place concepts such as object permanence and solidity . These pre - existing notions might facilitate the development of visual object concepts in the late - sighted . An infant, by contrast, starts with a more rudimentary notion of the composition of the world . Additionally, an older child who is just beginning to see has much greater abilities for interacting with, and actively manipulating, the world relative to an infant . This richness of interaction may modify the rapidity and manner in which visual concepts are acquired . Finally, from a purely physiological perspective, the brain of an older child differs markedly from that of an infant . The processes of neuronal migration, axonal myelinization and dendritic pruning which are so extensive in the infant brain have largely run their course by adolescence . These physiological differences may impact developmental trajectories in complex ways and render visual learning in normally sighted infants to be quite different from that in older children with late sight onset . For these reasons and several others, studies of late sight onset should not be construed as replacements for investigations of normal visual development . This does not in any way diminish the significance of studies of late sight onset; they are still invaluable as indicators of a path towards visual proficiency . All we need to remember is that this path may not be the same as the one the brain follows in normal development . It is an interesting challenge to determine the extent to which the two kinds of trajectories actually share commonalities . It is tempting to think of instances of visual learning after late sight onset as counterpoints to classical notions of critical periods in vision . However, the linkage between the two bodies of work is not entirely straightforward . Even setting aside the fact that one body of literature arises from non - human animal studies, while the other is based on work with humans, there are several reasons why one has to exercise caution in relating these two lines of work . First, many, if not most, of the classical studies of visual critical periods have employed monocular deprivation protocols wherein one eye is sutured shut while the other eye has a normal visual experience [23 - 25]. Doing so sets up a strong competitive interaction between the two eyes with dramatic consequences on cortical organization . However, the cases of late sight onset in humans profiled above involve roughly equal bilateral deprivation . Given the reduced competitive effects in the latter case, it cannot be assumed that its cortical consequences (both in terms of their nature and permanence) will be comparable to those that arise from monocular deprivation regimens . Furthermore, several previous studies of binocular deprivation have typically used manipulations that are not precisely analogous to the deprivation experienced by humans prior to gaining sight . Specifically, dark - rearing and lid - suture lead to a more impoverished visual experience than do cataracts and corneal opacities (the two primary conditions treated in humans). The latter allow greater light perception and even some rudimentary sense of the movement of shadows of objects close to the face . Since traditional studies of critical periods were based on work with animal subjects, the complexity of the assessment techniques was necessarily limited; typically, the dependent variables were physiological, such as number of cells responding to one or the other eye . Behaviorally, while basic visual attributes like acuity and visuo - motor coordination can be measured (e.g. ), performance on high - level tasks such as object recognition and image segmentation is largely unknown . This makes it challenging to compare the two datasets, one from non - human subjects and the other from humans, that have employed non - identical sets of assessment tasks . Indeed, it appears that while visual deprivation in humans does permanently compromise acuity, consistent with classical studies with animals and the notion of critical periods, some higher - level visual skills can be acquired . Given all of these considerations, it is clear that the older animal studies of deprived rearing differ in some important ways from reports of late sight onset in humans . Therefore, evidence of some visual skill acquisition in the latter ought not to be seen as a counterpoint to the notion of critical periods developed in the former . More broadly, the notion of critical periods is worthy of a fresh look . Even within the body of animal deprivation studies, results of the consequences of early deprivation are not entirely homogenous; several studies have reported significant gains in visual abilities over time after deprivation's end [27 - 32]. Studies of sight - restoration in children and adults have already yielded some important insights regarding the possibility of visual learning late in life, and the mechanisms that might underlie such learning . Further development of this research program will enable us to address several additional major questions that have hitherto resisted systematic empirical investigation . A prominent open question ripe for inquiry relates to changes in cortical functional organization as assessed via non - invasive brain imaging techniques . How does the cortex reorganize after sight - onset? Specifically, is there cross - modal activation in the visual cortex prior to surgery (e.g.) That dissipates with sight - onset? To what extent can the influx of visual information late in life undo the oft - reported co - option of the visual cortex by other sensory modalities in the blind? Studying the behavioral changes, if any, in sensory sensitivities from before to after sight onset and correlating them with observed cortical changes can allow us to make inferences regarding the functional consequences of cortical reorganization . Classical animal studies of impoverished rearing have yielded evidence for sensitive periods in visual development . Yet, as we described in the foregoing section, there are several where caution needs to be exercised when extrapolating those results to cases of late sight onset in humans . We need to get empirical data from human subjects that can directly relate extent of deprivation to quality of post - operative vision . Such data will also enable us to build a taxonomy of visual skills according to their susceptibility to early deprivation . Critical periods is perhaps too broad to apply to the entire gamut of visual functions . For instance, while acuity might be highly sensitive to early deprivation, does binocular depth perception follow similar rules? Are some aspects of high - level vision, say face recognition and visual imagery, more sensitive to early visual histories than others? From this body of data, we will be able to begin constructing an understanding of the rules of visual plasticity and why some abilities might be permanently compromised due to an initial period of blindness while others might be spared . In this context, interesting connections wait to be drawn between behavioral findings of spared or compromised visual abilities on the one hand and recent work on molecular mechanisms related to neural plasticity, on the other . From an applied perspective too, studies of sight - restoration promise to yield rich dividends . The development of interventions and therapies for improving visual function in the newly sighted can have relevance for the broader domain of visual disorders including such conditions as amblyopia and even some neurological ones like autism which are reported to have strong visual correlates . The interactions might well be bi - directional; treatments developed for amblyopia might help improve low - level visual outcomes in the newly sighted children . The research program of providing sight to the blind and studying their subsequent visual progress is distinguished by its far - reaching implications from both fundamental and applied perspectives . It is an excellent example of a win - win partnership between the medical and scientific worlds and can be expected to yield many foundational clues about how the brain comes to extract meaning from sensory inputs.
Atherosclerosis or arteriosclerotic vascular disease is caused by deposited fat in blood vessels such as cholesterol and other types of plasma fat . When there is a high deposit of fat in blood vessels, the risk of atherosclerosis also increases, which has a direct connection with age, gender, exercising or not exercising, race, and diet (1). Research shows that the above - mentioned problems do not have a complete impact on causing cardiac - vascular diseases (2). Therefore, researchers are now paying closer attention to other possible patterns in order to predict cardiac - vascular diseases (3), some of which are il-1, il-6, crp and leptin (46). Crp is a plasma component which is made in liver and its increase is a sign of infectious disease or different tissue damage (7). It is assumed that secreted interleukin from fat tissues plays an important role in crp increase (8). It is also proved that crp has a high positive connection with tissue measurement indexes such as body index measurement, waistline, and the waistline - hipline ratio (9). Leptin peptide, which is secreted from white fat, plays a key role in controlling central metabolism of the body and its weight . High levels of leptin in obese subjects compared to thin ones can justify obesity issues and cardiac - vascular diseases with regard to leptin s role in regulating synthesis, secretion, and cytokines such as crp, il-6 and tnf - a . Higher levels of leptin in obese subjects compared with lean subjects could explain the inflammatory conditions associated with obesity and cardiovascular disease (10). There is lots of research on the effects of physical exercise and the significant decrease it brings about for cardiac - vascular patterns, showing that aerobic exercise results in significant decrease in infectious items such as those in il-6, hs - crp, tnf - a in healthy people (1112), cardiac - vascular patients (13), and diabetics (14). Having a two - year integrated aerobic - stamina exercise program for diabetic s results in a significant leptin decrease, and improving stamina has resulted in insulin production (15). A 16-week stamina program does not have a significant increase in leptin intensity and plasma adiponectin (16). Crp serum decreased within 12 days in young and elderly women who had completed 12 weeks of physical exercise (17). Hamedinia et al . Reported a significant decrease in crp level due to 12 weeks of aerobic exercise (18). The conducted research on the effects of physical exercise on crp level with limited leptin has conflicting results; moreover, there is little research on the effects of long aerobic physical exercise on the amount of serum gained from the above - mentioned agents leptin and crp; therefore, considering the importance of crp and leptin on the diagnosis of arteriosclerosis, we have decided to research the effects of six months of aerobic exercise on the intensity of infectious crp serum markers . This study was semi - experimental . Furthermore, it plan was confirmed by research assembly of physical education and sport sciences faculty of ferdowsi university of mashhad . During first stage, the subjects of this study were nineteen healthy and inactive female who randomly assigned into the experimental (n=11) and control (n=8) groups . Before starting the program, the levels of health and physical activity of the subjects were determined using general practice physical activity questionnaire, physical activity readiness questionnaire and medical survey (including electrocardiogram and blood pressure tests) by a specialist physician (19). The subjects were nonsmokers, received no drugs and had no metabolic disease and physical impairment affecting their performance . During the second stage, their height was measured in centimeters using a height determiner and their weight was calculated using a digital scale produced by a german company called beurer (ps07-ps06). The percent of body fat (pbf) was calculated using a body compound determiner (model in - body-720 made in korea) and based on a method called bioelectrical impedance . All of these measurements were carried out while the volunteers had stopped eating or drinking 4 hours prior to their test, and their bladder, stomach, and bowels were empty . The exercise protocol included aerobic exercise training lasted for 6 months and 3 sessions per week and every session lasted for 60 minutes and with intensity of 5565 percent of maximum heart rate reserve (mhrr). According to the mhrr for every single athlete was respectively calculated based on karvonen equation (1) and was also controlled during exercise by a heart rate monitor (made in finland blood samples in all related studies were collected by venepunction from forearm vein after at least 15 minutes of sitting at rest or in the supine position . Blood sample were poured into a tube containing k2edta and mixed for 15 min before analysis . Serum crp concentrations was determined using an auto - analyzer spectrophotometer and different kits in various wavelengths as follows below . Serum leptin concentration was determined by using bio vendor gmbh, human lif quantikine elisa kit, dlf00with elisa method . The average and standard deviation of data were calculated after checking the data distribution normalcy using kolmogorov - smirnov test and homogeneity of variance method . The comparison of between means groups and homogeneity of groups examined using independent t - test . Repeated measure for comparison of variance within the group, interaction (groups phases) and between group was used . This study was semi - experimental . Furthermore, it plan was confirmed by research assembly of physical education and sport sciences faculty of ferdowsi university of mashhad . During first stage, the subjects of this study were nineteen healthy and inactive female who randomly assigned into the experimental (n=11) and control (n=8) groups . Before starting the program, the levels of health and physical activity of the subjects were determined using general practice physical activity questionnaire, physical activity readiness questionnaire and medical survey (including electrocardiogram and blood pressure tests) by a specialist physician (19). The subjects were nonsmokers, received no drugs and had no metabolic disease and physical impairment affecting their performance . During the second stage, their height was measured in centimeters using a height determiner and their weight was calculated using a digital scale produced by a german company called beurer (ps07-ps06). The percent of body fat (pbf) was calculated using a body compound determiner (model in - body-720 made in korea) and based on a method called bioelectrical impedance . All of these measurements were carried out while the volunteers had stopped eating or drinking 4 hours prior to their test, and their bladder, stomach, and bowels were empty . The exercise protocol included aerobic exercise training lasted for 6 months and 3 sessions per week and every session lasted for 60 minutes and with intensity of 5565 percent of maximum heart rate reserve (mhrr). According to the mhrr for every single athlete was respectively calculated based on karvonen equation (1) and was also controlled during exercise by a heart rate monitor (made in finland blood samples in all related studies were collected by venepunction from forearm vein after at least 15 minutes of sitting at rest or in the supine position . Blood sample were poured into a tube containing k2edta and mixed for 15 min before analysis . Serum crp concentrations was determined using an auto - analyzer spectrophotometer and different kits in various wavelengths as follows below . Serum leptin concentration was determined by using bio vendor gmbh, human lif quantikine elisa kit, dlf00with elisa method . The average and standard deviation of data were calculated after checking the data distribution normalcy using kolmogorov - smirnov test and homogeneity of variance method . The comparison of between means groups and homogeneity of groups examined using independent t - test . Repeated measure for comparison of variance within the group, interaction (groups phases) and between group was used . According to the (table 1), before the onset of the exercise, there were no significant differences between groups in age, height and body composition variables including: weight, bmi, pbf and whr . Also, there were no significant differences between groups in the levels of crp and leptin . According to the (table 2), our results show decrease in weight, bmi, body far percent, whr, leptin in exercise group towards the end of period of the training, but this changes was not significantly . In addition, during the training, there was no significant change in serum crp levels in both groups . In the present study, no statistically significant difference was observed in the body mass index of exercise group subjects' body weight, body mass index and body fat presented . (21) did not find any significant changes in leptin levels by chronic and acute physical activity . Body weight and body mass index during the interval exercise were reduced (24). In this study, it appears that one of the main reasons for the decrease in body weight and body fat due to caloric restriction and exercise time has been changed . The results of the present study reveal that the level of leptin not changed significantly . The leptin levels decreased after 48 h rather than insulin after treadmill testing is done (25). Ldl - c and leptin levels were significantly in the exercise group after 12 weeks lower than the control group (26). The leptin concentration did not change immediately after exercising for 60 min at 70% vo2 max, but decreased by 18% and 40% at 24 and 48 h after exercise, respectively (27). Plasma leptin and cortisol levels did not changed significantly after eight weeks of combined endurance exercises - resistance in un - training subjects (28). Not only does high cortisol result in the increase of leptin serum in blood, but it also helps leptin to resist in some obese individuals (28). Regarding the positive connection between glucocorticoids and leptin, we may relate the stability of leptin level to the cotrizol consistency (29), it may be that the stability of the item in our research is the cause of internal cellular glucose metabolism productions which has neutralized leptin reduction by stimulating leptin mrna and small glucose injection (30). In this study, crp level did not significantly change after the exercise program . Murtagh et al (31) showed no significant response of crp following forty five minutes walking program with the intensity of sixty to seventy percents of heart rate maximum in overweight, healthy and inactive men . (32). Have reported different levels of exercise intensities (65%, 85% and 100% of vo2max) lead to no change in the levels of leptin and crp . They concluded that exercise (3 times / week) for 12 weeks, showed reduced body weight, body mass index (bmi), and crp level . It is important to note that the intensity, type, and the length of the exercise along with muscular vulnerability, and the number of the used muscles are influential on crp response to physical activities . In intense and short exercises, in which the use of different muscular tissues is almost rare, crp response happens late (34). After aerobic exercise, leptin showed differences when compared to resting values . Besides, there were no significant differences in crp levels after six months aerobic exercise . Furthermore, other cytokines and different types of subjects should be included in further studies . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.
Glyphosate is a non - selective herbicide, widely used in agriculture, forestry, industrial weed control and aquatic environments . Proposed mechanisms of glyphosate surfactant herbicide (glysh) toxicity to mammals include uncoupling of oxidative phosphorylation and glyphosate - or polyethoxethyleneamine (poea)-mediated direct cardiotoxicity . It can cause a wide range of clinical manifestations in human beings from skin and throat irritation to hypotension and death . This was a case report of a 35-year - old male patient who brought to our hospital with intentional ingestion of approximately 200 ml of glyphosate (herbicide) at around 10:15 am at home . Later (after 15 m) when the family members recognized the consumption, he was taken immediately to a local hospital where gastric lavage was done and subsequently shifted to our multispecialty hospital . In the casualty the patient was conscious and obeying commands . On examination the patient was afebrile, pulse rate: 110/m, blood pressure (bp): 94/60 mm hg, spo2 - 97%, glasgow coma scale 15/15, cardiovascular, respiratory and gastrointestinal systems were normal . The patient was initially stabilized with intravenous (iv) fluids in casualty and later shifted to the intensive care unit for further management . Routine blood investigations were as follows: hb%: 14.9 g / dl, total leucocyte count (tlc) 18,600 and platelet count: 2.9 lakh cells / cu mm . Serum creatinine: 2.1 mg / dl, blood urea: 44 mg / dl, serum sodium: 148 meq / l, potassium: 6.5 meq / l, chloride: 101 meq / l . Total bilirubin: 0.6 mg / dl, sgot-11 u / l, sgpt-67 u / l, serum albumin: 5.3 g / l . Arterial blood gas analysis: p: 7.2, pco2:31, po2: 171, hco3:12.2 . Sequential organ failure assessment score: 4 and acute physiology and chronic health evaluation score: 16 . He received calcium gluconate 1 g (10 ml) iv, dextrose - insulin infusion along with salbutamol nebulization for hyperkalemia . After 6 h of admission continuous veno - venous hemodiafiltration started in view of severe acidosis, hyperkalemia and raised creatinine levels . After 10 h of ingestion patient had sudden respiratory distress along with hypotension and was hence intubated and ventilated . For hypotension after adequate fluid resuscitation with central venous pressure of 9 - 10 mm hg (also using ultrasound guided - inferior venacaval collapsibility / distensibility), noradrenalin infusion started at 0.05 mcg / kg / min . After 24 h, the patient was febrile, heart rate (hr): 160 beats / min, bp: 90/60 mm hg (with high noradrenalin: 3 mcg / kg / min and vasopressin: 0.04 u / min) anuric, procalcitonin:> 10 and serum lactate: 37.5 mg / dl (reference value 4 - 20 mg / dl), serum creatinine 6.1 mg / dl and tlc-13,000 cells / cumm . Patient was started on empirical antibiotic meropenem . Iv lipid emulsion (20% intralipid 100 ml) once daily for three consecutive days (which started from 2 day). On 4 day patient improved hemodynamically with hr: 90 beats / min, bp: 120/78 mm hg with minimal inotropic support . Tlc: 7800, serum potassium: 3.5 meq / l, serum creatinine: 3.5 mg / dl, p: 7.42, pco2:35.6 and po2:145 . The hemodynamic parameters from admission to first 5 days has been shown in table 1 . Hemodynamic parameters for first 4 days after admission sustained low efficacy dialysis was done daily for first 4 days and later on alternate days for next four dialysis and stopped in view of adequate urine output from 14 day . Patient weaned from the ventilator on 4 day, later bi - level positive airway pressure support for few hours and oxygen mask for next 24 h. the inotrope and vasopressor tapered and stopped over next 24 h from day 4 . Glyphosate surfactant is a widely used herbicide in agriculture, forestry, industrial weed control, lawn, garden and aquatic environments . It is a non - selective herbicide . In plants, glyphosate disrupts the shikimic acid pathway resulting in a deficiency of 5-enolpyruvylshikimate-3-phosphate production which leads to reductions in protein synthesis and plant growth, death of the plant occurs in 4 - 20 days . The median half - life of glyphosate in soil is between 2 and 197 days . In humans the mechanism of toxicity of glyphosate in mammals is thought to be uncoupling of oxidative phosphorylation . The acute oral lethal dose (ld50) in rats is> 4320 mg / kg, dermal ld50 is> 2 g / kg and inhalation lethal concentration 50 is> 4.43 mg / l . After oral ingestion of glyphosate 30 - 36% is absorbed, peak concentrations occurs in tissues 6 h following dosing, undergoes little metabolism and is excreted mostly unchanged in the feces and secondarily in the urine . Inhalation of spray mist may cause oral / nasal discomfort, tingling and throat irritation . Severe poisoning causes dehydration, hypotension, pneumonitis, oliguria, altered level of consciousness, hepatic dysfunction, acidosis, hyperkalemia and dysrhythmias . It has not been determined whether these clinical features reflect primary (direct) or secondary (indirect) toxic effects of these herbicide formulations . Patients developing acute kidney injury, hyperkalemia, pulmonary edema and metabolic acidosis are more likely to die . Early renal replacement therapy may improve prognosis but there is no evidence to support this and requires identification of those at risk . There is no antidote for glysh and treatment is supportive . The mainstay of treatment for systemic toxicity is decontamination and aggressive supportive therapy . Gastric lavage or activated charcoal can be administered in patients who present <1 h after ingestion and who have no evidence of buccal irritation or burns . There is no evidence, however, that either of these reduce the systemic absorption of glysh . Intravenous fat emulsion (ife) has been used in the management of severe local anesthetic toxicity, calcium channel blockers, tricyclic antidepressants and beta blockers . Proposed mechanisms of glysh toxicity to mammals a study by han et al . Demonstrated the effectiveness of ife in severe poisoning patient who was refractory to inotropic support later showed recovery after administration of ife, surviving to hospital discharge without further sequelae . The mechanism of action of ife may be due to the lowering of serum concentration of the free surfactant poea component of glysh (which are more lipophilic) by dragging into the lipid sink formed by the ife, thereby blunting its cardiovascular toxicity . Glyphosate exposure can be measurement in blood or urine by gas chromatography and high - performance liquid chromatography.
Hyperparathyroidism (hpt) is one of the most important causes of calcium and phosphate metabolic disorders . It is a condition that occurs due to an increased activity of the parathyroid gland arising from either an intrinsic or extrinsic cause . An intrinsic change in the parathyroid gland culminating in the overproduction of the parathyroid hormone (pth) is termed as primary hyperparathyroidism (phpt), while an extrinsic cause leading to the lowering of serum calcium level with subsequent hyperfunctioning of the parathyroid glands results in secondary hyperparathyroidism (shpt). The most common cause of phpt and shpt is a parathyroid adenoma and chronic renal insufficiency, respectively . This endocrine abnormality produces vague and variable bony, renal, menstrual, nervous, and abdominal symptoms in the patients, which is often ignored, and hence results in a delayed diagnosis . The imaging studies to identify the abnormal parathyroid gland are ultrasonography (usg) of neck and technetium (99mtc) scan of neck . Nuclear imaging this study has been conducted to analyze the presentations of primary and secondary hpt and its associated complications . This was a retrospective study conducted at sri ramachandra medical college and research institute (srmc and ri) between january 2000 and january 2010 . In this period of ten years, among the patients with calcium and phosphate metabolic disorders, twenty - one patients were identified with hyperparathyroidism by perusal of the case files, operative notes, and histopathology reports . The patient details studied included serum levels of parathormone, calcium, and phosphate levels . Ultrasonography of the neck and a technetium (99mtc) scan of neck were performed to identify the abnormal parathyroid gland . No workup was performed on the osteoporotic profile, urine calcium or creatinine clearances of these patients . In sixteen patients with phpt and one patient with thpt the demographics in the present study highlight that about 76, 19, and 5% of the patients suffered from phpt, shpt, and thpt, respectively . The prevalence of this disease was 62% in females, which indicated that they were more prone to develop hpt . About 77% of the females belonged to the age group of 20 50 years [figure 1], and the maximum clustering was noted in the fourth decade, which accounted to about 62% . The neoplasm identified in all our patients with phpt was parathyroid adenoma [figure 2]. Details of the usg and technetium (99mtc) scans of the neck were not available for all cases, and hence, the details could not be analyzed . Distribution of patients with hyperparathyroidism according to age histopathology of a parathyroid adenoma on evaluating the clinical presentation, the patients mainly had renal, bony or menstrual abnormalities at presentation [table 1]. Symptoms in all of them included the involvement of two or more of these systems . A twenty - five - year - old, asymptomatic female patient was suspected to have an underlying silent parathyroid lesion causing hpt, when her eleven - month - old child, presenting with convulsions, was diagnosed with hypoparathyroidism . Profile of clinical presentations of patients in this study all four patients with shpt gave a 15 20 year history of chronic kidney disease (ckd) and had subsequently developed bone abnormalities like osteoporosis, recurrent fractures, and brown's tumor . A seventy - five - year - old, male patient with a 20-year history of ckd and shpt returned with elevated calcium and pth levels . He was subsequently diagnosed with thpt and usg of the neck revealed hypertrophied parathyroid glands, and the patient underwent parathyroidectomy . Only one patient developed features of hypocalcemia like tetany, carpopedal spasm, and paresthesia on the tenth postoperative day . Hyperparathyroidism is a disease characterized by an excessive secretion of pth, which is normally regulated by a negative feedback loop . The incidence of hpt is maximum in older women (> 40 years), which correlates with our study . Primary hpt occurs due to an adenoma or hyperplasia involving all the four glands that may be a part of syndromes such as type i and type ii of multiple endocrine neoplasia (men), familial hypocalciuric hypercalcemia, and hyperparathyroidism - jaw tumor syndrome . Secondary hpt is typically characterized by a low level of serum calcium that occurs due to an underlying renal pathology and elevated pth sets in to compensate for the hypocalcemia . It is a state in which the glands function autonomously producing high levels of pth and fail to normalize despite the serum calcium levels remaining within the reference range or even the elevated range . Hyperparathyroidism during pregnancy, as mentioned earlier, results in congenital hypoparathyroidism, as the calcium crosses the placental barrier and suppresses the parathyroid gland of the fetus . Painful bones, renal stones, abdominal groans, and psychic moans, and these features were also noted in our study . The differential diagnosis of hypercalcemia includes adverse reaction to lithium, thiazide diuretic, and parenteral nutrition, familial hypocalciuric hypercalcemia, berylliosis, histoplasmosis, coccidioidomycosis, leprosy, lytic bone metastasis, multiple endocrine neoplasms, pheochromocytoma, vasoactive intestinal polypeptide hormone producing tumor, ectopic hpt, exogenous calcium intake, and sarcoidosis . Investigation of hpt involves estimating pth, total serum calcium, and phosphate levels, which distinguish primary from secondary hpt . Serum albumin is estimated, as its correction becomes important in shpt and the associated ckd . The imaging modalities commonly used in patients with phpt include usg, magnetic resonance imaging (mri), computed tomography (ct), and the sestamibi scan, which aids in localization of the abnormal gland . The various methods of detection of pth are the novel immunoradiometric assay, for detection of the fully intact molecule of pth, and intraoperative venous sampling of pth following excision of the hyperactive parathyroid glands . Generally a fall in the pth concentration of more than 50% from the baseline level, 5 10 minutes postoperatively, suggests the absence of any residual hyperfunctioning tissue . This test has greatly reduced the postoperative failure rate of initial parathyroidectomy surgery from 6 to 1.5%, and has decreased the need for performing frozen sections . Ghandur - mnaymneh and kimura have clearly stated the criteria for histopathological diagnosis of the parathyroid adenoma and hyperplasia . Minimal access parathyroidectomy is more advantageous as it is easier and quicker to perform, causes less pain and gives better cosmetic results . Persistence of symptoms following an unsuccessful surgery is usually attributed to a missed parathyroid adenoma or due to inadequate resection of the unappreciated multigland disease . In our series patients with shpt were managed conservatively with calcium and vitamin d supplements, while thpt patients underwent parathyroidectomy . This study re - emphasizes the fact that phpt is more common and is often due to an adenoma . We need a high index of suspicion in patients who repeatedly seek consultation for obscure abdominal, bony, and renal ailments . An accurate diagnosis, timely investigations, and precise surgery helps to cure these patients, who would otherwise be labeled as hypochondriacs . Recent advances in pth sampling operatively have considerably reduced the missed glands at surgery.
In meiosis, reciprocal recombination, also known as crossing over or chiasma formation, plays the vital role of holding homologous chromosomes together until their proper segregation at the first meiotic division . In human females it has long been known that either the failure of a pair of homologs to recombine, or an unusual distribution of recombination events, is associated with meiotic nondisjunction . These observations have led to a two - step model of meiotic nondisjunction in which the creation of so - called vulnerable crossover configurations during meiotic prophase (a process that occurs during mid - to - late - fetal development in human beings) predisposes homologs to nondisjoin at either the first or second meiotic division events (events that occur one to five decades later) [2 - 4]. Given that crossovers function by virtue of using sister - chromatid cohesion on both sides of the crossover to link the homologs together, it makes sense that either the failure of crossing over per se or a crossover that occurred too distally between a pair of homologs might have insufficient cohesion to ensure proper homolog segregation . One prediction of this model is that these vulnerable crossover configurations do exist in fetal oocytes . This proposal has recently been directly tested and the results are described in a paper by cheng et al . Cheng et al . Studied the localization of the crossover associated protein mlh1 (for a review, see) in more than 1000 prophase oocytes derived from 31 fetal ovarian samples . Although their studies did indeed confirm the existence of the predicted vulnerable crossover configurations (i.e., either a pair of homologs with no detectable mlh1 foci or bivalents with only a very distal or proximal focus), there were several unexpected observations . First, their observations confirm those of others in suggesting that crossing over occurs over a wider temporal window in human females (from zygotene to pachytene) than it does in either human males or mouse females (where mlh1 foci appear to be tightly restricted to pachytene). Second, the number of mlh1 foci observed predicts a total genome genetic length of only 3465 cm, some 80% of the value of 4300 - 4600 cm obtained from direct measurement by linkage studies (for a review, see). As pointed out by the authors, the most reasonable explanation for this discrepancy is because crossover formation occurs over a wide temporal window, and some events may, therefore, be completed before others are initiated and it may thus not be possible to visualize all mlh1 foci that occur in a given oocyte at a single time . In addition, holloway et al . Have provided strong evidence in mouse oocytes for a set of mlh1-independent crossovers mediated via the mus81 pathway . Moreover, using high - resolution linkage analysis in humans, fledel - alon et al . Have demonstrated the existence of double crossovers that occur in surprisingly close proximity, and suggested that one or both of these crossovers might be mediated by an mlh1-independent second pathway . Thus, the deficit of mlh1 foci, with respect to the length of the genetic map, may well be explained both by the fact that not all mlh1 foci are seen at any one time and by the existence of a second mlh1-independent pathway for crossing over . However, there is a more serious discrepancy with respect to vulnerable crossover configurations . Have estimated that the frequency of oocytes lacking a crossover on chromosome 13 is close to 12% and oliver et al . Have determined that the frequency of oocytes that are non - exchange for chromosome 21 is approximately 20% . Similar data for chromosome 21 derived from high - resolution recombination mapping have been recently published by fledel - alon et al . . These values are substantially higher than the values of 1% (chromosome 13) and 4.9% thus, the frequency of non - crossover oocytes for both chromosome 21 and chromosome 13, as estimated by linkage analysis, significantly exceeds the fraction of nonexchange chromosomes as measured by the absence of mlh1 foci . As cheng et al . Point out, these discrepancies are extremely hard to understand . One component of the difference may be methodological it is standard practice in these types of cytological studies to ignore oocytes with obvious failures in pairing and synapsis . Perhaps some of these oocytes contribute to the pool of functional oocytes on which linkage studies are based . The authors best attempt to reconcile these disparate observations is to note that their estimates of non - exchange bivalents provide a better fit for the frequency of aneuploid embryos, assuming that all non - exchange bivalents segregate their homologs at random . Unfortunately, this assumption ignores the possibility that, like many other organisms [13 - 15], human females may indeed possess an exchange - independent back - up system for ensuring the segregation of those chromosomes that fail to recombine . The study by cheng et al . Offers intriguing insights into the distribution of mlh1 foci, and their temporal control in human fetal oocytes . Of even greater interest are the authors observations regarding the nature of interference in human oocytes and differences in the types of unusual (and presumably vulnerable) crossover distributions observed for different human chromosomes . One size fits all model for explaining the effects of abnormalities in recombination distribution on proper segregation . That said, the dilemma of just how many non - crossover bivalents there really are, and to what degree various classes of crossover and non - crossover bivalents might be selected for or against during oocyte development, remains open - as does the issue of whether or not human females may indeed have a system for ensuring the segregation of non - crossover bivalents (a possibility that would, quite honestly, not surprise this author). But perhaps most importantly, the observations of cheng et al . And those of others (for example, see) need to be viewed as a starting point - one in which prophase human oocytes become accessible to the types of analysis of crossover events, as defined by location of the proteins such as mlh1, which are routinely applied to human male meiotic cells and mouse oocytes . Surely, further study of the recombination process in human oocytes will address the questions asked above.
Mastitis is inflammation of mammary gland affecting all the species of domestic animals and is of great concern to dairy industry . Bovine mastitis can be classified into two types, namely, clinical mastitis and scm . Clinical mastitis is detected by the changes in physical appearance of milk, swelling, redness, and rise in temperature of udder whereas animals with scm do not exhibit any gross changes in milk or udder and can be detected only through laboratory tests . Early diagnosis of mastitis is vital because changes in the udder tissue take place much earlier before they become apparent . Various methods, based on physical and chemical changes of milk and isolation of organisms, are used for diagnosis of subclinical mastitis [2, 3]. However, the logistic and financial considerations involved with sampling all cows for bacteriological culture have precluded this technique from being widely adopted . Milk culture identifies the presence of mastitis pathogens but does not provide a measure of degree of inflammation associated with infection . The dairy industry is facing a great setback due to high prevalence and incidence of mastitis in milch animals . Scm affects milk quality and quantity causing great economic loss for producers [4, 5]. Annual losses in dairy industry due to mastitis was approximately 2 billion dollars in usa and 526 million dollars in india, in which subclinical mastitis is responsible for approximately 70% of economic losses as most dairymen and farmers are still unaware of impact of scm . Even though research work has been done on various aspects of bovine mastitis among dairy cattle in india, region to region variation on prevalence of both clinical mastitis and scm since india is a country of diverse agroclimatological conditions it is important to know the prevalence of bovine mastitis in a particular region for planning proper therapeutic, preventive, and control measure for bovine mastitis . Diagnosis of bovine mastitis depends on the use of various tests and comparative study of these tests in a particular region is very essential for epidemiological investigations . However, a systematic study involving the comparison of different tests for the diagnosis of scm in cows is not available in the literature even though they are used routinely as diagnostic tests either alone or in combination . Hence, the study aims to compare three mastitis diagnostic tests for their ability to determine the prevalence of mastitis in cows by considering different risk factors like age, lactation, breed, season, quarters, and herds . The milk samples of cows from four quarters were aseptically collected separately and tested for the presence of mastitis by using three different tests . The prevalence of clinical mastitis in cows was determined by examination of changes in the udder, namely, redness, rise in temperature, swelling, hardness of udder, changes in milk colour, and reduction in milk quality and quantity . The milk samples from each quarter of animal were tested by sfmt, sodium lauryl sulphate test (slst), and white side test (wst) to know type of mastitis . For the diagnoses of scm the positive reaction to these tests along with the absence of clinical signs was used . The prevalence was expressed in percent by using the following formula: (1)prevalence (%) = number of animals positivenumber of animals tested100 . The three simple and rapid chemical tests, namely, sfmt, slst and wst, were used for the diagnosis of bovine mastitis in cows . Cows aged 3 to 13 years were used to know the age - wise prevalence of mastitis . Cows in between 1st and 8th months of lactation period were tested to know the lactation - wise prevalence of mastitis . The breed - wise prevalence of mastitis was studied by using different breeds like holstein friesian, jersey, deoni, and nondescriptive (nd) breeds . Four seasons of the year, namely, winter (november, december, january, and february), summer (march, april, and may) monsoon (june, july, and august), and postmonsoon (september and october) seasons, were considered to know the season - wise prevalence of bovine mastitis . The milk samples from each quarter of animal were tested to know the quarter - wise prevalence of mastitis . Herds were categorized into two types, namely, organized and unorganized herds based on the housing facilities; herds with good ventilation, drainage system, adequate water, and bedding facilities were considered organized herds and herds with poor housing design that were maintained in the open field were considered the unorganized herds . The data was statistically analysed to know the age-, lactation-, breed-, season, and herd - wise prevalence of subclinical and clinical mastitis . Comparison of proportions and chi - square test were used to know if statistically significant association existed between the age groups, lactation period, different breeds, different season, and types of herd . The highest prevalence of scm in cows was recorded in sfmt followed by slst and the least was recorded in wst . Similarly the highest prevalence of clinical mastitis in cows was recorded by sfmt, followed by slst and wst (table 1). The highest prevalence of scm was recorded in the age group of 710 years followed by the group of cows with age greater than 10 years and the least was recorded in the age group of 36 years when tested with all three diagnostic tests . Similarly the highest prevalence of clinical mastitis was recorded in the group of cows with age greater than 10 years followed by group of 710 years and the least was recorded in the age group of 36 years when tested with all three diagnostic tests . The statistical analysis of data showed there was significant effect on age - wise prevalence of subclinical mastitis, whereas there was no significant effect on age - wise prevalence of clinical mastitis in the study area (table 2). The highest prevalence of scm in cows detected by sfmt was in the 5th lactation period followed by the 6th, 2nd, 3rd, 1th, 4th, and 7th and the least was in the 8th lactation period . Similarly slst diagnosis showed the highest prevalence was in the 5th lactation followed by the 2nd, 6th, 4th, 3rd, 1st, and 8th and least was in 7th lactation period . Wst also showed highest prevalence of scm was in the 5th lactation followed by the 6th, 4th, 2nd, 3rd, 1st, the 7th and no records were seen in the 8th lactation period . The highest prevalence of clinical mastitis in cows detected by sfmt was in the 5th lactation followed by the 6th, 3rd, 4th, 1th, 7th, and 8th and the least was recorded in the 2nd lactation period . Similarly detection of clinical mastitis was more in the 5th lactation followed by the 8th, 6th, 3rd, 7th, 2nd, and 1st and the least was in the 4th lactation with slst . The highest prevalence of clinical mastitis detected by wst was in the 5th lactation followed by the 7th, 3rd, 6th, 2nd, 1st, and no records were observed in the 4th, 7th, and 8th lactation . The statistical studies showed there was significant effect on lactation - wise prevalence of scm, whereas there was no significant effect on lactation - wise prevalence of clinical mastitis in the study area (table 3). The highest prevalence of scm and clinical mastitis in cows detected by all three different tests was in hf followed by jersey, nd, and deoni . The statistical studies showed that there was no significant effect on breed - wise prevalence of subclinical mastitis but there was significant effect on breed - wise prevalence of clinical mastitis when tested with slst and wst, whereas there was no significant effect on breed - wise prevalence of clinical mastitis when tested with sfmt (table 4). The season - wise prevalence of scm and clinical mastitis in cows detected by all three tests showed the highest prevalence was in monsoon followed by postmonsoon, winter, and summer seasons . The statistical analysis of data indicates there was significant effect on season - wise prevalence of subclinical mastitis, whereas there was no significant effect on season - wise prevalence of clinical mastitis in the study area (table 5). The prevalence of scm of cows detected by all three tests indicated that highest incidence of bovine mastitis was in single quarter followed by two and four and the least was recorded in the three quarters . The prevalence of clinical mastitis of cows detected by sfmt indicated that highest incidence of bovine mastitis was involved in two quarters followed by four and one and the least was recorded in the three quarters . The prevalence of clinical mastitis of cows detected by slst indicated that the highest incidence of clinical mastitis was involved in two quarters followed by four and one and no records were obtained from the three quarters and wst indicated that highest incidence of clinical mastitis was involved in two quarters followed by four and no records were obtained from the single and three quarters (table 6). The herd - wise prevalence of scm and clinical mastitis of cows detected by all three tests indicated that incidence of scm and clinical mastitis in unorganized herds was more when compared with that of organized herds . The statistical analysis of data showed there was significant effect on herd - wise prevalence of subclinical mastitis but there was no significant effect on herd - wise prevalence of clinical mastitis when tested with sfmt and slst, whereas there was a significant effect on clinical mastitis in herd - wise prevalence when tested with wst (table 7). The present study indicates that sfmt is the most sensitive test which diagnosed highest number of scm (46%) and clinical mastitis (8%), whereas said and abd - el - malik reported 38.07% cases in buffaloes on the basis of wst and california mastitis test . Hashmi and muneer have used cultural examination and reported a figure of 44.9% for buffaloes . Rahman et al . Reported a prevalence of 59.2 and 36.8% of scm in cows and buffaloes, respectively, on the basis of direct, indirect, and cultural examination . Shah used ciba - geigy mastitis test and found 34.48% buffaloes suffered from scm . Anwar and chaudhry reported a prevalence of 47.5% in buffaloes after using strip cup test, ph test, and wst . Recorded the prevalence of scm in buffaloes was 70.59%, 57.98%, and 32.77% by wst, cmt, and bromothymol blue test, respectively . Kumar and thakur detected slightly bigger number of clinical mastitis in buffaloes by using cmt (38) than bromothymol blue test (34). The variation in prevalence of scm observed in present and previous studies may be due to differences in the sensitivity of tests used for the detection of mastitis . The present study of age - wise prevalence showed that scm was more in second group (710), whereas clinical mastitis was found to be prominent in the age group> 10 years . Similar observations were made by naghmana, rasool et al ., and pluvinage et al ., [1921]. Rahman et al . Reported 57.5% prevalence of mastitis in the age group of higher than 9 years old and 40.1% in the age group of 7 and 8 years . The present findings are fairly similar to the findings of sharma, bhikane et al .,, and kumar and sharma and ameh et al . Recorded higher prevalence of mastitis in 49-year - old cows . Similarly biffa et al . Suggested older cows are at more risk (44.6%) for the incidence of mastitis than younger cows (23.6%). The high prevalence of scm and increase in milk production during the age group of 710 indicate that production of milk is directly proportional to prevalence of scm and high prevalence of clinical mastitis in the age group of> 10 years may be due to decreased immunity of cows and resistance of bacteria to antibiotics that were indiscriminately used for the treatment of mastitis during previous infections [2831]. A greater predisposition to infection could be the consequence of a number of characteristics associated with lactation period . In the present investigation lactation - wise prevalence of scm and clinical mastitis in cows showed that highest prevalence of mastitis was in the 5th lactation, which is in agreement with the findings of rahman et al . . . 's study on mastitis reports that incidence of 8.5% in first lactation is 26% greater than or equal to fifth lactation . The possible cause for high rate of mastitis in 5th lactation may be increased milk yield during this period showing direct correlation between milk yield and the prevalence of bovine mastitis . The present study of breed - wise prevalence indicated that highest incidence was in hf breed . Concluded the risk ratio of developing mastitis in jersey was approximately two times higher than indigenous breeds . Rahman et al . Have reported highest prevalence of mastitis in hf followed by jersey and the least in indigenous breed . Similarly biffa et al . Reported hf cows are affected at higher rate (56.5%) compared with local zebu (30.9%) and jersey cows (28.9%). The boran breed is shown to be more likely to be affected by clinical and scm when compared with that of short horn zebu breed . The difference in breed - wise prevalence of mastitis may be due to the inheritance characters, immunity of the individual breeds, and also habituation of cows to the climatic conditions . The season variation is an important factor that directly affects the occurrence of mastitis [36, 37]. The present study revealed that high incidence of mastitis was recorded during monsoon season which is in agreement with shinde et al ., jadhav et al ., and ameh et al .. in usa olde riekerink et al . The present and preceding studies indicate that the risk of developing mastitis in monsoon season is more as the conditions are favorable for the proliferation of pathogenic bacteria . Quarter - wise study of scm and clinical mastitis showed that highest prevalence was in single and two quarters, respectively, whereas iqbal and siddique reported that in most of the animals two quarters were affected (7.9%) followed by one quarter (6.7%). Kumar and sharma have reported that mastitis involvement was more in single quarter (52.75%). Similarly singh and shankar have recorded higher incidence of mastitis for single quarter (17.4%), as compared to two (2.6%), three (0.3%), and four quarters (2.7%). The difference in quarter - wise prevalence of mastitis is probably due to the fact that predisposing factors like injury, defective sphincters, and so forth could vary from quarter to quarter . Housing facilities contribute to the contamination and exposure of teats to environmental pathogens [42, 43]. In the present study rate of bovine mastitis similarly the percentage of mastitis was 59.5% in unorganized farm where floor was wet and soiled . Kivaria et al . Have showed scarcity of water as one of the potential risk factors for prevalence of mastitis . In the present study sfmt was found to be most sensitive for the diagnosis of bovine mastitis . The age- and lactation - wise prevalence study indicates older age and cows with later part of lactation stage were more susceptible to bovine mastitis . The breed - wise prevalence of bovine mastitis showed the exotic breeds like hf and jersey were more prone to bovine mastitis than indigenous cows . Season - wise study showed that cows are more sensitive to bovine mastitis during monsoon . The quarter - wise prevalence of bovine mastitis indicated that preparation of teats and udder for milking is poorly practiced in this region, hence, preventive measures like washing of teats with clean water and drying completely before milking, dipping the teats with any sanitizing solution after milking as to be followed which not only helps to reduce infection of individual cow but also controls the spread of pathogenic bacteria to other animals and humans . The study also indicated that cows in organized herds are less exposed to the bovine mastitis . The current analysis explored the fact that there exists a significant relationship between age of the cow and the subclinical mastitis but there is no significant association between age and clinical mastitis . Similarly significant association exists between lactation period of cow and subclinical mastitis but not showing in clinical mastitis . However there is no significant relationship between breed of the cow and subclinical mastitis but significant association exits between breed of cow and clinical mastitis diagnosed by slst and wst . Season - wise prevalence analysis indicates that there is a strong association between seasons and the subclinical mastitis but no such association exists between season and the clinical mastitis . The study also indicated that cow herds and subclinical mastitis have high significant association whereas no major association was recorded between herds and clinical mastitis except when diagnosing with wst . Considering the results of the current investigation it is concluded that subclinical mastitis is directly associated with age, lactation period, and environmental factors of the cow and clinical mastitis is more associated with the breed of the cow and environmental conditions . The present study specifies that environment factors play a major role in both subclinical and clinical mastitis; therefore it is recommended to maintain hygienic conditions in the herds for controlling the bovine mastitis.
Gastroesophageal reflux disease (gerd) is characterized by recurrent regurgitation into the esophagus, causing heartburn, chest pain, and dysphagia . Gerd is a highly prevalent (1020% of the population) condition having a significant impact on the quality of life leading to high healthcare expenditures . Gerd patients may be categorized according to their symptoms and endoscopic findings . From an endoscopic point of view, gerd patients are classified as those with no recognizable esophageal erosion (nonerosive reflux disease, nerd), those with visible distal esophageal erosions (erosive reflux disease, erd), and those with columnar metaplasia in the distal esophagus (barrett's esophagus, be). Though the etiopathogenesis of the disease is multifactorial, the main attributing factor is the dysfunction of the lower esophageal sphincter. [46] ensuring relief of symptoms in patients with gerd is an important treatment goal . The ideal treatment should improve patients quality of life by providing rapid relief of symptoms and reducing the severity and number of recurrent episodes . Proton pump inhibitors (ppis) are the most effective drugs to control gerd symptoms, and to cure esophagitis endoscopically . Ppis such as omeprazole, esomeprazole, lansoprazole, and rabeprazole effectively inhibit the duration and extent of gastric acid secretion and provide more complete remission of the symptoms of heartburn than other antisecretory drugs . However, the response to ppis in patients with nonerosive reflux disorder is less efficacious when compared to patients with erosive gerd . Two new ppis, rabeprazole and esomeprazole, have been already proved to be effective and safe in gerd . Rabeprazole is a ppi that effectively provides symptom relief and healing, and prevents relapse, in patients with erosive gerd . Esomeprazole, the s - enantiomer of omeprazole, has demonstrated superior efficacy over omeprazole in healing and symptom resolution in patients with erosive and nonerosive reflux disease . Currently, the market is flooded with me - too so our present study is an effort to determine the better agent between rabeprazole and esomeprazole in mild - to - moderate erosive gerd . The study was conducted on 60 patients of mild - to - moderate erosive gastroesophageal disease attending the outdoor department of general medicine, prathima institute of medical sciences, karimnagar, andhra pradesh, india . The study population included patients, irrespective of sex, aged 1865 years suffering from gerd symptoms for at least 3 months in the previous year . Subjects experienced at least one period of moderate - to - severe heartburn or regurgitation in the past 7 days prior to treatment and at endoscopy; they had grade a or grade b esophagitis according to the los angeles (la) classification . Patients were excluded for the following reasons: known history of gastroduodenal ulcer; infectious or inflammatory conditions of the intestine (including inflammatory bowel disease); malabsorption syndromes; obstruction; gastrointestinal malignancy; gastric or intestinal surgery including vagotomy; barrett's esophagus; esophageal stricture or pyloric stenosis; scleroderma; pregnancy; abnormal laboratory tests at the initial visit (including liver enzymes greater than twice the upper limit of normal); gerd treatment refractory to a 2-month course of h2-blocker or ppi therapy; ppis taken within 14 days of screening or h2-blocker or prokinetic agent taken within 7 days of screening; daily use of nsaids, oral steroids, aspirin (> 325 mg / day); being unable to discontinue the use of anticholinergics, cholinergics, spasmolytics, opiates, or sucralfate . The present study is a 4-week, randomized, single - blinded, parallel group comparative clinical study between rabeprazole and esomeprazole in patients with mild - to - moderate erosive gerd conducted in a single center . A written informed consent was taken from all the patients participating in the study after explaining the patient's diagnosis, the nature and purpose of a proposed treatment, the risks and benefits of a proposed treatment (rabeprazole / esomeprazole), alternative treatment, and the risks and benefits of the alternative treatment . A total of 30 patients were allocated in the rabeprazole group who received rabeprazole 40 mg daily and another 30 patients in the esomeprazole group who received esomeprazole 40 mg daily for 4 weeks . [figure 1] the patients received the drugs free of cost from our institute pharmacy . At the first visit, after a detailed history was taken on baseline symptomatology, clinical evaluation [including gerd symptom score and quality of life in reflux and dyspepsia (qolrad) scoring] and laboratory investigations (upper gi endoscopy, liver function test) were done . After 4 weeks, upper gi endoscopy was repeated and the clinical improvement was assessed in terms of the change in endoscopic findings, gerd symptom score, and qolrad scoring . The liver function test was done for all follow - up patients at the second visit to detect any hepatic dysfunction . Recruitment, allocation and follow - up of participants the efficacy variables were changes from baseline to day 28 in the severity of gerd symptoms based on gerd symptom scoring, endoscopic findings, and qolrad scoring . The improvement in the four most important gerd symptoms (heartburn, acid regurgitation, epigastric distress, and dysphagia) have been scored on a scale of 04 depending on severity to assess the efficacy of the candidate drugs . The symptom severity was defined as follows: 0 = no symptoms; 1 = mild (symptoms are present occasionally and patients can continue with daily activities); 2 = moderate (symptoms are present most of the time but patients can perform daily activities); 3 = severe (symptoms are present continuously . The symptoms are severe and affect daily activities or patient cannot do things that they normally can); 4 = very severe (symptoms are so severe that the patient has to stay in bed and cannot perform activities that one normally could). The qolrad questionnaire is a disease - specific instrument, including 25 items combined into five dimensions: emotional distress, sleep disturbance, vitality, food / drink problems, and physical / social functioning . Emotional distress: discouraged or distressed, frustrated or impatient, anxious or upset, worries or fears, irritable, and the exact cause is not known; sleep disturbance: tired due to the lack of sleep, waking at night, fresh and rested, and trouble getting to sleep; vitality: feeling tired or worn out, generally unwell, and lack of energy; food / drink problems: eat less than usual, unable to eat foods or snacks, food unappealing, not tolerating food or snacks, and avoiding certain food / drink; physical / social functioning: avoid bending over, doing things with family, difficulty in socializing, unable to carry out daily activities, and unable to carry out physical activities . All questions are rated on a seven - point likert scale according to the following response options: all of the time, most of the time, quite a lot of the time, some of the time, a little of the time, hardly any of the time, none of the time; for questions 3, 16, and 19, the responses were a great deal, a lot, a moderate amount, some, a little, hardly any, none at all . The lower was the value, the more severe the impact on daily function was . Qolrad scoring has been extensively documented in international studies in patients of heartburn with regard to reliability, validity, and responsiveness to change . One of the most commonly used classification systems for endoscopic gerd is the la classification . Developers of the la classification tried to avoid subjective interpretations and relied on objective criteria to make the diagnosis of endoscopic gerd . Finding a definite break in the mucosa called erosion is essential to diagnose endoscopic gerd in the la classification . Depending on the length of the erosion and its extension between esophageal folds, different grades are assigned . In this study, patients who were suffering from grade a (erosion, 5 mm or less, not extending between folds) or grade b (erosions more than 5 mm, not extending between the folds) oesophagitis were included . Tolerability was assessed in terms of reported adverse experiences and vital signs, which were measured at baseline and at the end of the study . All reported adverse drug reactions were graded according to the national cancer institute common toxicity criteria (ctc) and compared between the groups . Statistical analysis was carried out using the paired t - test, unpaired t - test, and fisher's exact test . Considering the gerd symptom score as the primary outcome, the sample size has been calculated taking the level of significance () as 0.05, power of the study (1) as 0.85, and expected mean difference as 1.25 . The study was conducted on 60 patients of mild - to - moderate erosive gastroesophageal disease attending the outdoor department of general medicine, prathima institute of medical sciences, karimnagar, andhra pradesh, india . The study population included patients, irrespective of sex, aged 1865 years suffering from gerd symptoms for at least 3 months in the previous year . Subjects experienced at least one period of moderate - to - severe heartburn or regurgitation in the past 7 days prior to treatment and at endoscopy; they had grade a or grade b esophagitis according to the los angeles (la) classification . Patients were excluded for the following reasons: known history of gastroduodenal ulcer; infectious or inflammatory conditions of the intestine (including inflammatory bowel disease); malabsorption syndromes; obstruction; gastrointestinal malignancy; gastric or intestinal surgery including vagotomy; barrett's esophagus; esophageal stricture or pyloric stenosis; scleroderma; pregnancy; abnormal laboratory tests at the initial visit (including liver enzymes greater than twice the upper limit of normal); gerd treatment refractory to a 2-month course of h2-blocker or ppi therapy; ppis taken within 14 days of screening or h2-blocker or prokinetic agent taken within 7 days of screening; daily use of nsaids, oral steroids, aspirin (> 325 mg / day); being unable to discontinue the use of anticholinergics, cholinergics, spasmolytics, opiates, or sucralfate . The present study is a 4-week, randomized, single - blinded, parallel group comparative clinical study between rabeprazole and esomeprazole in patients with mild - to - moderate erosive gerd conducted in a single center . A written informed consent was taken from all the patients participating in the study after explaining the patient's diagnosis, the nature and purpose of a proposed treatment, the risks and benefits of a proposed treatment (rabeprazole / esomeprazole), alternative treatment, and the risks and benefits of the alternative treatment . A total of 30 patients were allocated in the rabeprazole group who received rabeprazole 40 mg daily and another 30 patients in the esomeprazole group who received esomeprazole 40 mg daily for 4 weeks . [figure 1] the patients received the drugs free of cost from our institute pharmacy . At the first visit, after a detailed history was taken on baseline symptomatology, clinical evaluation [including gerd symptom score and quality of life in reflux and dyspepsia (qolrad) scoring] and laboratory investigations (upper gi endoscopy, liver function test) were done . After 4 weeks, upper gi endoscopy was repeated and the clinical improvement was assessed in terms of the change in endoscopic findings, gerd symptom score, and qolrad scoring . The liver function test was done for all follow - up patients at the second visit to detect any hepatic dysfunction . The efficacy variables were changes from baseline to day 28 in the severity of gerd symptoms based on gerd symptom scoring, endoscopic findings, and qolrad scoring . The improvement in the four most important gerd symptoms (heartburn, acid regurgitation, epigastric distress, and dysphagia) have been scored on a scale of 04 depending on severity to assess the efficacy of the candidate drugs . The symptom severity was defined as follows: 0 = no symptoms; 1 = mild (symptoms are present occasionally and patients can continue with daily activities); 2 = moderate (symptoms are present most of the time but patients can perform daily activities); 3 = severe (symptoms are present continuously . The symptoms are severe and affect daily activities or patient cannot do things that they normally can); 4 = very severe (symptoms are so severe that the patient has to stay in bed and cannot perform activities that one normally could). The qolrad questionnaire is a disease - specific instrument, including 25 items combined into five dimensions: emotional distress, sleep disturbance, vitality, food / drink problems, and physical / social functioning . Emotional distress: discouraged or distressed, frustrated or impatient, anxious or upset, worries or fears, irritable, and the exact cause is not known; sleep disturbance: tired due to the lack of sleep, waking at night, fresh and rested, and trouble getting to sleep; vitality: feeling tired or worn out, generally unwell, and lack of energy; food / drink problems: eat less than usual, unable to eat foods or snacks, food unappealing, not tolerating food or snacks, and avoiding certain food / drink; physical / social functioning: avoid bending over, doing things with family, difficulty in socializing, unable to carry out daily activities, and unable to carry out physical activities . All questions are rated on a seven - point likert scale according to the following response options: all of the time, most of the time, quite a lot of the time, some of the time, a little of the time, hardly any of the time, none of the time; for questions 3, 16, and 19, the responses were a great deal, a lot, a moderate amount, some, a little, hardly any, none at all . The lower was the value, the more severe the impact on daily function was . Qolrad scoring has been extensively documented in international studies in patients of heartburn with regard to reliability, validity, and responsiveness to change . One of the most commonly used classification systems for endoscopic gerd is the la classification . Developers of the la classification tried to avoid subjective interpretations and relied on objective criteria to make the diagnosis of endoscopic gerd . Finding a definite break in the mucosa called erosion is essential to diagnose endoscopic gerd in the la classification . Depending on the length of the erosion and its extension between esophageal folds, different grades are assigned . In this study, patients who were suffering from grade a (erosion, 5 mm or less, not extending between folds) or grade b (erosions more than 5 mm, not extending between the folds) oesophagitis were included . Tolerability was assessed in terms of reported adverse experiences and vital signs, which were measured at baseline and at the end of the study . All reported adverse drug reactions were graded according to the national cancer institute common toxicity criteria (ctc) and compared between the groups . Statistical analysis was carried out using the paired t - test, unpaired t - test, and fisher's exact test . Considering the gerd symptom score as the primary outcome, the sample size has been calculated taking the level of significance () as 0.05, power of the study (1) as 0.85, and expected mean difference as 1.25 . A total of 60 patients were randomized to two groups to receive either rabeprazole (n = 30) or esomeprazole (n = 30). Postbaseline values were missing in nine patients (five in the rabeprazole group and four in the esomeprazole group) because they were lost to follow - up due to noncompliance (n = 8) or adverse effect (n = 1). [figure 1] the treatment groups were comparable in demographic features and baseline clinical characteristics [table 1]. The age of the patients ranged from 18 to 65 years (mean age, 38 years in the rabeprazole group and 35 years in the esomeprazole group), and 38% were female and 62% male . The mean duration of gerd symptoms was 15 weeks in the rabeprazole group and 14 weeks in the esomeprazole group . Baseline demographic data and clinical characteristics of 60 patients of mild - to - moderate erosive gerd participated in the study in the fi rst visit the improvement in the four most important gerd symptoms (heartburn, acid regurgitation, epigastric distress, and dysphagia) has been scored on a scale of 04 depending on severity to assess the efficacy of the candidate drugs . Rabeprazole and esomeprazole have been found to decrease heartburn and acid regurgitation significantly in their respective groups and when the percentage changes have been compared, rabeprazole has been found to be superior to esomeprazole in controlling those symptoms . Epigastric distress and dysphagia were found to decrease significantly in both groups but the change in the rabeprazole group was not statistically significant when compared to the esomeprazole group . The improvement in the overall symptom score was significantly lower in both groups, and rabeprazole (p = 0.01) was found to be superior over esomeprazole when compared by the t - test [table 2]. Change in gerd symptom scoring and qolrad questionnaire scoring in follow - up patients (n = 51) after 4 weeks in this study, improvement has been seen in all five domains with both the drugs . But the improvement with rabeprazole was found to be more in comparison to esomeprazole over 1 month . In the rabeprazole group, the percentage change in emotional distress (37.2%), sleep disturbance (46.4%), food / drink problems (43.7%), and vitality (40.5%) questionnaire scoring was found to be significantly different when compared to esomeprazole group . But the change in the physical / social function questionnaire scoring in the rabeprazole group (39%) was not significant in the esomeprazole group (17.6%). An increase in the overall score of qolrad was also found to be statistically significant in the rabeprazole group (p <0.0001). [table 2] at endoscopy, the patients having grade a or grade b gerd according to the la classification were recruited . Endoscopy was done both at the first and second visit . In the rabeprazole group, 22 patients were diagnosed to have grade a gerd and in the esomeprazole group, 18 patients had grade a gerd . After 1-month treatment, in the rabeprazole group, 21 patients showed improvement whereas in the esomeprazole group, 14 patients showed endoscopic improvement . The endoscopic findings have also been presented in 2 2 contingency table and statistical significance has been tested by fisher's exact test (p = 0.03). A p - value <0.05 indicates that the change in the rabeprazole group is statistically significant and not by random occurrence . Endoscopy showed that the incidence of residual esophagitis after 4 weeks was higher in the esomeprazole group compared to the rabeprazole group [table 3]. Similarly, the incidence of healing was significantly higher (p = 0.03) in the rabeprazole group compared to the esomeprazole group . This represents an absolute improvement of 30% and relative improvement of 55% over esomeprazole, yielding an nnt (number of patients needed to treat to benefit at least one patient) of only 3 patients . In our study groups, there was no significant baseline difference in the helicobacter pylori status [table 1]. The postdrug h. pylori status was also not significantly affected by either rabeprazole or esomeprazole [table 3]. Both the drugs were well tolerated . In the rabeprazole group, out of four patients who experienced adverse effects, two complained of headache, one had dizziness, and one patient showed a borderline increase in serum ast / alt . In the esomeprazole group, two patients complained of headache, one patient had nausea, one patient had diarrhea, and in two patients there was a borderline increase in ast / alt . According to the ctc grading of adverse drug reactions, all the reported side effects were of grade 1 (mild) except in one patient . One patient of the esomeprazole group, who complained of moderate, persistent headache, discontinued the treatment and was excluded from the study . The overall incidence of adverse effects was 16% and 23.1% in the rabeprazole and esomeprazole group, respectively . To compare the incidence of adverse effects of two groups, fisher's exact test was done and it was found to be statistically nonsignificant (p = 0.72). A total of 60 patients were randomized to two groups to receive either rabeprazole (n = 30) or esomeprazole (n = 30). Postbaseline values were missing in nine patients (five in the rabeprazole group and four in the esomeprazole group) because they were lost to follow - up due to noncompliance (n = 8) or adverse effect (n = 1). [figure 1] the treatment groups were comparable in demographic features and baseline clinical characteristics [table 1]. The age of the patients ranged from 18 to 65 years (mean age, 38 years in the rabeprazole group and 35 years in the esomeprazole group), and 38% were female and 62% male . The mean duration of gerd symptoms was 15 weeks in the rabeprazole group and 14 weeks in the esomeprazole group . Baseline demographic data and clinical characteristics of 60 patients of mild - to - moderate erosive gerd participated in the study in the fi rst visit the improvement in the four most important gerd symptoms (heartburn, acid regurgitation, epigastric distress, and dysphagia) has been scored on a scale of 04 depending on severity to assess the efficacy of the candidate drugs . Rabeprazole and esomeprazole have been found to decrease heartburn and acid regurgitation significantly in their respective groups and when the percentage changes have been compared, rabeprazole has been found to be superior to esomeprazole in controlling those symptoms . Epigastric distress and dysphagia were found to decrease significantly in both groups but the change in the rabeprazole group was not statistically significant when compared to the esomeprazole group . The improvement in the overall symptom score was significantly lower in both groups, and rabeprazole (p = 0.01) was found to be superior over esomeprazole when compared by the t - test [table 2]. Change in gerd symptom scoring and qolrad questionnaire scoring in follow - up patients (n = 51) after 4 weeks in this study, improvement has been seen in all five domains with both the drugs . But the improvement with rabeprazole was found to be more in comparison to esomeprazole over 1 month . In the rabeprazole group, the percentage change in emotional distress (37.2%), sleep disturbance (46.4%), food / drink problems (43.7%), and vitality (40.5%) questionnaire scoring was found to be significantly different when compared to esomeprazole group . But the change in the physical / social function questionnaire scoring in the rabeprazole group (39%) was not significant in the esomeprazole group (17.6%). An increase in the overall score of qolrad was also found to be statistically significant in the rabeprazole group (p <0.0001). [table 2] at endoscopy, the patients having grade a or grade b gerd according to the la classification were recruited . Endoscopy was done both at the first and second visit . In the rabeprazole group, 22 patients were diagnosed to have grade a gerd and in the esomeprazole group, 18 patients had grade a gerd . After 1-month treatment, in the rabeprazole group, 21 patients showed improvement whereas in the esomeprazole group, 14 patients showed endoscopic improvement . The endoscopic findings have also been presented in 2 2 contingency table and statistical significance has been tested by fisher's exact test (p = 0.03). A p - value <0.05 indicates that the change in the rabeprazole group is statistically significant and not by random occurrence . Endoscopy showed that the incidence of residual esophagitis after 4 weeks was higher in the esomeprazole group compared to the rabeprazole group [table 3]. Similarly, the incidence of healing was significantly higher (p = 0.03) in the rabeprazole group compared to the esomeprazole group . This represents an absolute improvement of 30% and relative improvement of 55% over esomeprazole, yielding an nnt (number of patients needed to treat to benefit at least one patient) of only 3 patients . In our study groups, there was no significant baseline difference in the helicobacter pylori status [table 1]. The postdrug h. pylori status was also not significantly affected by either rabeprazole or esomeprazole [table 3]. The improvement in the four most important gerd symptoms (heartburn, acid regurgitation, epigastric distress, and dysphagia) has been scored on a scale of 04 depending on severity to assess the efficacy of the candidate drugs . Rabeprazole and esomeprazole have been found to decrease heartburn and acid regurgitation significantly in their respective groups and when the percentage changes have been compared, rabeprazole has been found to be superior to esomeprazole in controlling those symptoms . Epigastric distress and dysphagia were found to decrease significantly in both groups but the change in the rabeprazole group was not statistically significant when compared to the esomeprazole group . The improvement in the overall symptom score was significantly lower in both groups, and rabeprazole (p = 0.01) was found to be superior over esomeprazole when compared by the t - test [table 2]. Change in gerd symptom scoring and qolrad questionnaire scoring in follow - up patients (n = 51) after 4 weeks in this study, improvement has been seen in all five domains with both the drugs . But the improvement with rabeprazole was found to be more in comparison to esomeprazole over 1 month . In the rabeprazole group, the percentage change in emotional distress (37.2%), sleep disturbance (46.4%), food / drink problems (43.7%), and vitality (40.5%) questionnaire scoring was found to be significantly different when compared to esomeprazole group . But the change in the physical / social function questionnaire scoring in the rabeprazole group (39%) was not significant in the esomeprazole group (17.6%). An increase in the overall score of qolrad was also found to be statistically significant in the rabeprazole group (p <0.0001). At endoscopy, the patients having grade a or grade b gerd according to the la classification were recruited . Endoscopy was done both at the first and second visit . In the rabeprazole group, 22 patients were diagnosed to have grade a gerd and in the esomeprazole group, 18 patients had grade a gerd . After 1-month treatment, in the rabeprazole group, 21 patients showed improvement whereas in the esomeprazole group, 14 patients showed endoscopic improvement . The endoscopic findings have also been presented in 2 2 contingency table and statistical significance has been tested by fisher's exact test (p = 0.03). A p - value <0.05 indicates that the change in the rabeprazole group is statistically significant and not by random occurrence . Endoscopy showed that the incidence of residual esophagitis after 4 weeks was higher in the esomeprazole group compared to the rabeprazole group [table 3]. Similarly, the incidence of healing was significantly higher (p = 0.03) in the rabeprazole group compared to the esomeprazole group . This represents an absolute improvement of 30% and relative improvement of 55% over esomeprazole, yielding an nnt (number of patients needed to treat to benefit at least one patient) of only 3 patients . In our study groups, there was no significant baseline difference in the helicobacter pylori status [table 1]. The postdrug h. pylori status was also not significantly affected by either rabeprazole or esomeprazole [table 3]. Both the drugs were well tolerated . In the rabeprazole group, out of four patients who experienced adverse effects, two complained of headache, one had dizziness, and one patient showed a borderline increase in serum ast / alt . In the esomeprazole group, two patients complained of headache, one patient had nausea, one patient had diarrhea, and in two patients there was a borderline increase in ast / alt . According to the ctc grading of adverse drug reactions, all the reported side effects were of grade 1 (mild) except in one patient . One patient of the esomeprazole group, who complained of moderate, persistent headache, discontinued the treatment and was excluded from the study . The overall incidence of adverse effects was 16% and 23.1% in the rabeprazole and esomeprazole group, respectively . To compare the incidence of adverse effects of two groups, fisher's exact test was done and it was found to be statistically nonsignificant (p = 0.72). The goal of treatment of gerd is to improve patients quality of life by providing rapid relief of symptoms and reducing the severity and number of recurrent episodes and this is measured as improvement of gerd symptoms scores, especially of heartburn or acid regurgitation . In this study, rabeprazole and esomeprazole have been found to decrease heartburn and acid regurgitation significantly in their respective groups and when the percentage changes were compared, rabeprazole has been found to be superior to esomeprazole in controlling those symptoms . The improvement in the overall symptom score was significantly lowered in both groups and rabeprazole was found to be superior over esomeprazole when compared by the t - test . The present study supports the findings of a previous study by warrington et al . Where rabeprazole was found to be a better antisecretory agent than esomeprazole . In this study, but the improvement with rabeprazole was found to be more than esomeprazole over 1 month . So in all five domains, rabeprazole was found to be superior to esomeprazole in reducing the impact on daily functioning and improving quality of life . An increase in the overall score of qolrad was also found to be statistically significant in the rabeprazole group . The changes in the esomeprazole group of our study are close to those of the previous studies done by gunasekaran et al . And th attwood et al . Endoscopic findings showed that the incidence of residual esophagitis after 4 weeks was higher in the esomeprazole group compared to the rabeprazole group . Similarly, the incidence of healing and percentage risk reduction was significantly higher in the rabeprazole group compared to the esomeprazole group . Like other ppis, both rabeprazole and esomeprazole were well tolerated without any severe side effects . The superiority of rabeprazole over esomeprazole found in our study has been supported by a comparative study where rabeprazole 20 mg daily was found to be more effective than esomeprazole 20 mg daily in increasing intragastric ph and maintaining ph> 3 and> 4 . On day 5, mean ph auc was higher after esomeprazole than rabeprazole . A previous study by caos et al demonstrated the safety and efficacy of 20 and 10 mg rabeprazole in maintaining gerd healing for up to 5 years compared to placebo . Both doses were effective in preventing the relapse of gerd, heartburn frequency, and daytime heartburn severity, with the 20-mg dose also effective in preventing night time heartburn severity . Both rabeprazole doses were well tolerated and equally safe . In providing rapid, sustained acid control, rabeprazole effectively relieves the symptoms of gerd and has been shown to be effective for acute healing of erosive esophagitis and 1-year maintenance of healing . In another study, rabeprazole increased intragastric ph with a rapid onset of action (within hours) and maintained an elevated ph through and between meals . This effect was seen on the first day and maintained throughout 8 days of rabeprazole treatment . Rabeprazole was demonstrated to be superior to omeprazole on the first treatment day, by maintaining a higher diurnal and nocturnal gastric ph at half dosage and decreasing more deeply the gastric acidity at full dosage (rabeprazole: 66%, omeprazole: 35%). [2628] several mechanisms may explain the superior efficacy of rabeprazole in increasing the intragastric ph and decreasing the acid output . Rabeprazole, which has the highest pka of all ppis and is therefore least stable at neutral ph, is more rapidly converted to inhibit the proton pump as compared to omeprazole, lansoprazole, or pantoprazole . This may be critical given the known short half - lives of ppis that limit time available to accumulate in the parietal canaliculus, to form the activated sulphenamide form, and to bind to inactivate proton pumps . In addition, rabeprazole may have more prolonged and potent acid inhibitory effects due to continued binding to proton pump transmembrane domains even after achieving 100% inhibition of the atpase activity . While the majority of available parietal cells typically maintain an intracellular ph near 1, a proportion of these target cells may have a ph as high as 3 depending largely on the age of that cell . However, in less acidic environments, rabeprazole, given its rapid activation over a wide ph range, actually targets a greater population of parietal cells to give a more rapid and pronounced degree of acid inhibition . In older parietal cells, rabeprazole can be as much as 10 times more potent than other ppis . Its metabolism is largely nonenzymatic and therefore less dependent on cyp2c19, giving a greater consistency of pharmacokinetics across all patients, regardless of the cyp2c19 genotype . From the results of the present comparative clinical analysis of rabeprazole and esomeprazole, we conclude that rabeprazole (40 mg) is a better choice in mild - to - moderate erosive gerd compared with esomeprazole (40 mg) owing to its better efficacy and safety profile . This study has limitations because of being a single - blinded and single - center study, and hence the findings of this exploratory study should be confirmed by multicentric, randomized, double - blind, large population studies.
Osteoarthritis (oa) is a slowly progressive degenerative disease characterized by escalated loss of articular cartilage . It is one of the most common causes of pain and disability in middle - aged and older people . The major pathological changes during the progression of oa are articular cartilage breakdown, osteophyte formation, subchondral sclerosis, and other alterations . Local inflammation and synovitis are present in many patients with oa and have also been observed in animal models of oa . In addition to mechanical factors such as obesity induced weight bearing, a lot of research has concentrated on biochemical and genetic factors that contribute to alterations of chondrocytes and synoviocytes . Since the secretory functions of adipose tissue have been uncovered, adipokines have been linked to many diseases, such as cardiovascular disease, metabolic complications, atherosclerosis, and inflammatory and immune - related disorders [35]. Evidence suggests that adipokines including leptin, adiponectin, resistin and visfatin exert proinflammatory and catabolic / anabolic roles during the pathophysiology of oa [68]. No study has demonstrated the precise relation of the newly discovered adipokine nesfatin-1 with articular cartilage metabolism . It has been reported that high sensitivity c - reactive protein (hscrp) associates with local inflammatory in patients with oa and may reflect the progression [9, 10]. But some study demonstrated there was no significant relationship between crp and incidence of knee or hip oa . In patients with coronary artery disease, type iia collagen n propeptide (piianp), a major collagen in cartilage, was found decreased in knee oa patients and associated with decrease severity [13, 14]. Interleukin-18 (il-18) is a member of the il-1 superfamily; as an inflammatory cytokine, il-18 has the function of promoting cartilage loss . As the typical adipokine, leptin could enhance the synthesis of proinflammatory mediators in human osteoarthritic cartilage . For this background, we speculate whether nesfatin-1 has some relation with inflammatory mediators or collagen in cartilage . Nesfatin-1 is an 82-amino - acid peptide that was first described in 2006 by oh is and colleagues from maebashi, japan . They found a new anorexigenic protein derived from nucleobindin 2 (nucb2) and named it nucb2-encoded satiety and fat - influencing protein (nesfatin). It produces three major peptide products: nesfatin-1 (spanning residues 182), nesfatin-2 (residues 85163), and nesfatin-3 (residues 166396). It is worth mentioning that nesfatin-1 is the only biologically active peptide known to be involved in food restriction . The appetite regulation of nesfatin-1 was first described: the intracerebroventricular injection of nesfatin-1 decreases food intake in a dose - dependent manner . For example, gunay et al . Found decreased plasma nesfatin-1 levels in patients with anxiety . In addition to the cardiovascular system, nesfatin-1 modulates blood pressure through effects on peripheral arterial resistance . Zhang et al . Discovered that nesfatin-1/nucb2 ir cells are widespread in the rodent digestive organs such as the pancreas, stomach, and duodenum . Recent evidence suggests that central nesfatin - expressing neurons are sensitive to peripheral inflammatory stimuli and could account for the reduction in food intake . Furthermore, nesfatin-1 plays an anti - inflammatory and antiapoptotic role in subarachnoid hemorrhage - induced oxidative brain damage in rats . Nesfatin-1 may inhibit the inflammatory response via nf-b signaling . In light of the aforementioned studies, it is logical to hypothesize that nesfatin-1 could have a protective or harmful role in oa . The aim of this study was to investigate the expression profile of nesfatin-1 in synovial fluid (sf) and serum obtained from patients with oa and to compare with the serum levels of nesfatin-1 in healthy controls . In addition, we compared nesfatin-1 gene expression in articular cartilage in patients with oa and controls . We also measured the levels of hscrp, piianp in serum and il-18 in synovial, comparing the correlations with nesfatin-1 levels . Furthermore, with the aid of immunohistochemistry (ihc) we examined nesfatin-1 levels in five oa articular tissues (cartilage, osteophytes, synovium, meniscus, and the infrapatellar fat pad). Sf and serum were obtained from 40 patients with oa who underwent total knee replacement (tkr) (26 females and 14 males; mean age 66.17 5.82 years; mean bmi 25.34 2.81 patients were diagnosed as having primary oa by both clinical and radiography . Based on bmi, patients were divided into three stratifications, bmi25 (22 patients), 25 <bmi30 (15 patients), bmi30 (3 patients). Normal serum samples were obtained from 25 healthy age - matched individuals without oa and other diseases (16 females and 9 males with mean age 61.52 6.45 years, mean bmi 25.06 1.71 kg / m). All patients with clinical, intraoperative, or pathologic evidence of previous trauma, avascular necrosis, or inflammatory arthropathy were excluded . Patients with diabetes mellitus, coronary artery disease, and history of myocardial infarction, history of tobacco use within the last 5 years, history of recent trauma or recent infection were also excluded . Collected serum was centrifuged at 2000 g for 15 min and sf was centrifuged at 8000 g for 15 min . The personal and clinical characteristics of the patients and control individuals are summarized in table 1 . Oa - affected articular tissues were obtained from six patients who underwent tkr . Under aseptic conditions, samples were washed in ice - cold phosphate - buffered saline and five tissues (cartilage, osteophyte, synovium, meniscus, and infrapatellar fat pad) were separated and stored at 80c for polymerase chain reaction (pcr) analysis . Other specimens of oa cartilage were collected from the femoral heads of eighteen patients with hip arthritis during total hip arthroplasty (tha) surgery . Normal femoral head cartilage was obtained from eighteen patients with femoral neck fractures without oa who underwent tha . All patients were treated at the second affiliated hospital of zhejiang university college of medicine . This study was approved by the local ethics committee, and written informed consent was obtained from each volunteer . Five types of oa knee articular samples (cartilage, osteophyte, synovium, meniscus, infrapatellar fat pad) were pulverized in liquid nitrogen, and total rna was extracted using trizol reagent (sigma - aldrich, st . First strand cdna was synthesized from 1 g of total rna using a moloney murine leukemia virus reverse transcriptase cdna synthesis kit (promega, madison, wi, usa). Quantitative real - time pcr was carried out using an iqtm sybr green premix ikpcr kit (takara, japan) and an icycler system (bio - rad). The primers used are shown in table 2 . 18s rna transcript (nr 003286) primers (forward, 5-gactcaacacgggaaacctcac-3; and reverse, 5-ccagacaaatcgctccaccaac-3) were used for parallel amplification of murine to normalize the expression data of the target transcripts . The relative expression levels of targeted genes were calculated for 100 copies of the 18s housekeeping gene using the formula: n=1002-(ct targeted gene - ct 18s rna). Samples were obtained from 18 patients with hip arthritis and eighteen age / bmi - matched patients with femoral neck fractures but without oa at the time of tha surgery . Nesfatin-1 concentrations in serum and sf were measured using a commercially available enzyme - linked immunoassay (elisa) kit (phoenix peptides, burlingame, ca, usa), according to the manufacturer's instructions . The elisa kit is designed to measure the concentration of human nesfatin-1 (182) in human serum / plasma and conditioned medium . It can be used as long as the level of nesfatin-1 in the sample is above the sensitivity limit of the kit . Before assaying, serum samples were diluted with 1 assay buffer at room temperature (2023c)., columbia, md) was utilized with a lower limit of detection of 0.5 this elisa is based on a polyclonal antiserum raised against the recombinant human glutathione s transferase- (gst-)exon 2 fusion protein and uses recombinant human gst - exon 2 as a standard . The specificity of the antibody against piianp was previously demonstrated by western blot analyses against the recombinant exon 2 protein (prior to and after cleavage with thrombin) and against type iia procollagen isolated from the culture medium of human fetal ribs . Il-18 in synovial was also measured using an elisa according to the manufacturer's instructions . Postsurgical knee cartilage specimens obtained from three patients were fixed in 4% buffered paraformaldehyde for 2 days and decalcified with buffered 20% edta (ph 7.4). After dehydration and embedding in paraffin, 5 m thick sections were prepared, deparaffinized in xylene, and rehydrated in a graded ethanol series . Serial sections from each specimen were stained with hematoxylin and eosin and a rabbit antibody against human nesfatin-1 . The following steps were performed automatically at 37c using the benchmark xt slide staining system (ventana medical systems, tucson, az, usa). Antigen retrieval was performed by immersing slides in citrate buffer (ph 6.0) for 15 minutes, and endogenous peroxidase activity was blocked through incubation with 1% h2o2 for 4 minutes . The sections were incubated with an anti - human nesfatin-1 receptor antibody at (dilution 1: 100) for 60 minutes at room temperature . An ultravision lp kit (lab vision, fremont, ca, usa) was used to visualize the immunostaining . The slides were stained using a diaminobenzidine (dab) detection kit and counterstained with hematoxylin . Statistically significant differences between matched sf and serum samples, oa serum and normal serum nesfatin-1 levels, nesfatin-1, hscrp, and piianp levels in serum, nesfatin-1 and il-18 levels in synovial, and nesfatin-1 gene expression in oa cartilage and cartilage from patients with femoral neck fractures were identified by paired student's t - test and nonparametric test . Spearman's rank order correlation coefficient was used to examine the relationship between the above - mentioned index levels . To assess the gene expression of nesfatin-1 in oa - affected articular tissues, we examined cartilage, osteophytes, synovium, meniscus, and fat pad samples from six patients with oa who underwent tkr surgery by real - time quantitative pcr . We compared nesfatin-1 mrna expression in oa cartilage and femoral neck fracture, non - oa cartilage by quantitative real - time pcr . Nesfatin-1 mrna was detected in both types of cartilage; however, oa articular cartilage exhibited significantly higher nesfatin-1 expression compared with femoral neck fracture, non - oa cartilage (p <0.05) (figure 2). Pg / ml, n = 40), as compared with serum from healthy controls (352.05 137.51 the nesfatin-1 level in serum was significantly higher than that in paired sf samples (p <0.001) (figure 3). In the oa group, there were no sex differences in serum and sf nesfatin-1 levels . Pg / ml in females (n = 26) and 414.23 132.13 pg / ml in males (n = 14) (p> 0.05), while the sf nesfatin-1 concentration was 94.59 49.50 pg / ml in females and 107.05 45.61 pg / ml in males (p> 0.05). On different bmi stratifications, the nesfatin-1 levels in serum, respectively, were 391.34 115.81 (bmi25), 520.87 192.41 (25 <kruskal - wallis test showed = 13.59, p = 0.001, which means nesfatin-1 in serum has asymptotic significance with bmi variation (figure 4). Meanwhile, the nesfatin-1 levels in synovial, respectively, were 88.65 42.7 (bmi25), 116.10 55.71 (25 <kruskal - wallis test showed = 2.749, p = 0.253, which means no statistical correlation of nesfatin-1 level exists between different bmi . A strong and statistically significant correlation was found between serum nesfatin-1 and hscrp levels in these 40 oa patients [r = 0.593, p = 0.00005, table 1 and figure 5(a)]. However, there was no statistical correlation between serum nesfatin-1 and piianp levels (r = 0.226, p = 0.16) (figure 5(b)). Statistically significant correlation was found between synovial nesfatin-1 and il-18 levels [r = 0.560, p = 0.0017, table 1 and figure 5(c)]. Staining of representative slides demonstrated that all oa cartilage, osteophyte, and synovium samples contained nesfatin-1 . Nesfatin-1 staining was stronger in the lesional cartilage area than in the nonlesional area (b> a). Nesfatin-1 was also present in the synovium and osteophytes, notably in the superficial layer (figure 6). It is increasingly apparent that oa is not just a weight - loading disease but is also a multifactorial degenerative joint disease involving metabolic and biochemical factors . Previous studies indicated that adipose tissue, as a metabolic and endocrine organ, secretes many factors, including adipokines leptin, adiponectin, resistin, chemerin, visfatin, and other cytokines . It has been reported that adipokines may be of relevance to pathophysiologic inflammation in oa . For example, adiponectin has been demonstrated to play a protective or deleterious role in oa [28, 29], while serum adiponectin levels were found to be at increased levels in patients with erosive compared with nonerosive oa . Leptin was found to be secreted by osteophytes, synovium, cartilage, and the infrapatellar fat pad . Leptin was the first adipokine to be described (in 1994), and its biological function has been researched relatively thoroughly . The newly identified anorexigenic protein nesfatin-1 is reported to be ubiquitously expressed in the body [19, 21, 22, 32, 33]. Nevertheless, there are no data regarding the expression and effects of nesfatin-1 in chondrocytes . This study demonstrated (1) nesfatin-1 gene expression in five oa - affected knee articular tissues; (2) increased nesfatin-1 gene expression in patients with hip arthritis compared with individuals with femoral neck fractures; (3) the presence of nesfatin-1 in sf obtained from patients with oa; (4) increased serum levels of nesfatin-1 in patients with oa, as compared to healthy, non - oa individuals; (5) serum nesfatin-1 levels varied with bmi in oa patients; (6) serum nesfatin-1 levels had statistically significant correlation with serum hscrp, but without piianp; and (7) synovial nesfatin-1 levels had statistically significant correlation with il-18 in synovial fluid . In the present study, nesfatin-1 was detected in sf from patients with oa, but the levels of nesfatin-1 in serum in patients with oa exceeded those in paired sf samples (p <0.001). This finding demonstrated that circulating levels of nesfatin-1 did not accurately represent the situation in the joint . This is in line with previous observations that serum levels of adipokines such as adiponectin, leptin, and apelin were increased [6, 34]. Nesfatin-1 was secreted by white adipose tissue (wat), which is widely distributed in the body . However, the joint cavity is a physically isolated space with relatively low wat levels compared with the body as a whole . Thus, abundant peripheral fat stores may be one of the reasons that nesfatin-1 levels were higher in the bloodstream . Osteophytes, synovium, cartilage, and the infrapatellar fat pad can secrete adipokines [31, 35]. All five oa - affected knee articular tissues we studied (cartilage, osteophytes, synovium, meniscus, and the infrapatellar fat pad) expressed the nesfatin-1 gene . Yosten and samson found that nesfatin-1 acts through the central oxytocin system and that its effects can be reversed by pretreatment with an oxytocin receptor antagonist . Because nesfatin-1 was detected in sf from patients with oa and the nesfatin-1 gene was expressed in oa - affected articular tissues, we can speculate that some nesfatin-1 receptor may exist on human chondrocytes, synoviocytes, fat pad adipocytes, or even osteocytes and that nesfatin-1 may penetrate into these tissues, binding to this receptor . Nesfatin-1 gene expression was higher in oa cartilage, as compared to cartilage from healthy individuals (p <0.05), indicating that nesfatin-1 may be involved in the pathogenesis of oa . Furthermore, serum levels of nesfatin-1 were distinctly higher in in patients with oa than in non - oa individuals (p <0.05). Excessive secretion of adipokines was described as being associated with proinflammatory effects [16, 27, 37] and rheumatoid arthritis . Local inflammation and synovitis have been observed in the pathological course of many patients with oa and animal models of oa . In view of the aforementioned evidence, nesfatin-1 appears to exert a proinflammatory effect in the progress of oa . However, additional studies are required to clarify the contribution of nesfatin-1 to the pathogenesis of oa to determine whether nesfatin-1 has a protective or aggressive role in oa . Synovial nesfatin-1 levels had no linear relation with bmi . However, serum nesfatin-1 levels correlated positively with bmi in oa patients (= 13.59, p = 0.001), demonstrating that systemic nesfatin-1 levels may be influenced by the body fat . As inflammatory index, we explored the relation between hscrp and nesfatin-1, which prompts significant positive relation in patients with oa (r = 0.593, p = 0.00005). A study on peritoneal dialysis patients showed there was a close relationship between proinflammatory cytokines and adipokines, including il-18 and adiponectin . Above on, the relationships of nesfatin-1, hscrp, and il-18 are of relevance in the inflammatory component of oa . There was no statistically significant correlation to be found in serum nesfatin-1 and serum piianp in our results . However, more deep research is needed in detecting the role in oa progression of these two new molecular markers . In this study, we detected nesfatin-1 expression in oa knee cartilage, osteophytes, and synovium by ihc staining . In synovium, the number of synoviocytes secreting nesfatin-1 was high, corresponding with the rich wat in the synovium . This is in accordance with a previous study showing that synovium and the infrapatellar fat pad are major sources of adipokines . Additionally, nesfatin-1 expression was mainly detected in the superficial and border of cartilage and subchondral bone . This indicates that nesfatin-1 may play a protective role or respond to the oa pathological process . It has been reported that the leptin expression levels were related to the grade of cartilage destruction . In our study, we did not compare the relation between nesfatin-1 levels and oa severity . Previous studies of sex differences in patients with oa showed that serum leptin levels were higher in females than in males and that adipokine expression differed between males and females . In conclusion, in the first study of nesfatin-1 in oa, we discovered that human chondrocytes express nesfatin-1, which was also detected in sf from patients with oa . We also confirmed that the serum nesfatin-1 concentration was higher in patients with oa than in healthy, non - oa controls . Furthermore, oa cartilage, osteophytes, synovium, meniscus, and infrapatellar fat pads express the nesfatin-1 gene, consistent with the results of ihc of cartilage, osteophytes, and synovium . Taken together, the results of this study highlight a potentially pivotal role of nesfatin-1 in the pathophysiology of oa.
About 382 million people in the world have diabetes, and this number is expected to rise to 592 million by 2035 . The prevalence of diagnosed diabetes in korea has increased from 2% in the 1970s to 9.8% in 2011, and in 2012 the rate for patients with poor glycemic control was reportedly as high as 71.5% . These findings suggest the presence of a substantial financial burden on the korean health - care system . Diabetes can be substantially improved by performing tasks such as taking prescribed medications, monitoring blood glucose levels, eating an appropriate diet, and exercising regularly . These are all day - to - day behaviors that patients must carry out to control their disease, a process that is termed self - management . The traditional approach to diabetes self - management has been to educate patients about the disease and provide them with the skills necessary to control it . According to one systematic review, although such self - management education appears to be successful, it exerts only small - to - moderate effects on the diabetes . Diabetes researchers insist that providing patients with knowledge and skills is crucial, but these approaches appear to be insufficient for including the required behavioral changes among patients with diabetes [6, 7]. Therefore, further factors that contribute to more effective diabetes self - management need to be considered . Self - efficacy, a term that is derived from the social cognitive theory, refers to belief in one's capability to organize and execute the course of action required to produce given levels of attainments . Self - efficacy influences the individual's choice of behaviors; people tend to engage in tasks when they feel competent to perform them and to avoid them when they feel that they exceed their capabilities . Self - efficacy also influences how people motivate themselves in the tasks that they undertake . That is, people with a strong sense of self - efficacy view their tasks or behaviors as challenges to be mastered, even if they are difficult . In addition, self - efficacy beliefs influence emotional states; people with higher self - efficacy are likely to have reduced stress levels and lower risks of depression than those with low self - efficacy . Thus, self - efficacy has emerged as a crucial factor in diabetes self - management behaviors [1012]. Instruments that measure self - efficacy are broadly categorized into general and specific types of scales . Some researchers view self - efficacy as a more trait - like general construct, referring to one's overall competence to perform across a variety of different situations [13, 14]. Others state that self - efficacy judgments are specific to behaviors and the situations in which those behaviors occur [15, 16]; that is, people perceive different levels of capability of performing in particular domains or situations of functioning . Patients with diabetes must perform particular tasks to control their blood glucose in order to prevent complications . They may possess a high self - efficacy with respect to taking medication, but a low self - efficacy regarding physical exercise . Scales that are specifically designed for patients with diabetes are therefore more appropriate for measuring their self - efficacy [10, 17, 18]. There have been previous attempts in korea to develop a specific scale measuring the perceived self - efficacy of diabetes self - management [19, 20], but they have produced only a primitive stage of scale development; the items were derived from the literature without verifying their psychometric properties . Applying such instruments in the studies for clinical interventions may threaten the reliability of their outcomes . The diabetes management self - efficacy scale (dmses) is a specific - type instrument that was developed by the members of the international partnership in self - management and empowerment . Its psychometric properties were found to be acceptable for populations with type 2 diabetes in several countries: netherlands, united kingdom, australia, turkey, and taiwan . However, these psychometric studies had methodological and statistical problems related to factors such as sample size, item redundancy, and the underlying constructs . With these issues in mind, the aims of the present study were to perform a culture - sensitive translation of the dmses and then evaluate the psychometric properties of the translated scale in a korean population with type 2 diabetes . The english - language version of the dmses was translated into korean using a forward and backward translation technique, based on the guidelines of brislin . A bilingual health professional and an expert panel of three bilinguals checked the two potential korean versions and achieved a consensus on a korean version . Any discrepancies between the translated and original english versions were either confirmed by one of the original developers or else a consensus was reached by the panel . The preliminary korean version was thus produced, and the korean version was finalized after one professor majored in korean literature had reviewed its grammar . Five experts (one physician, one professor in nursing, and three diabetes educators) were involved in assessing the content validity of the final korean version of the dmses (k - dmses). These experts were asked to rate each item of the preliminary k - dmses whether they considered it essential, useful, but not essential, or not essential . In addition, they were asked to answer open questions regarding whether or not there were any ambiguous words, jargon, or value - laden words and whether or not there were items that needed to be modified . This was a methodological study to assess the psychometric properties of the k - dmses . A convenience sample of 440 patients with type 2 diabetes was recruited from two university hospitals in south korea . This sample size satisfied the requirement that at least 7 times the total number of items is needed for psychometric tests . The inclusion criteria for the participants were being aged at least 20 years, being diagnosed with diabetes type 2, and being articulate in the korean language . The participants were asked to sign a consent form and complete a package of questionnaires . Of these, 70 were given an envelope containing the k - dmses questionnaire for the assessment of test - retest reliability . They were asked to take it home and complete it 10 days later; a time interval of 1 - 2 weeks between repeated measures is often recommended . Each participant was asked to post the return envelope containing the completed questionnaire near home . Prior to data collection, this study was approved by the institutional review boards at the participating institutions . The dmses is a self - reported questionnaire that comprises 20 items with 4 subscales: nutrition specific and weight, nutrition general and medical treatment, physical exercise, and blood sugar . Originally, each item was scored on a 5-point scale, but this was later revised to an 11-point scale on the uk english - language version . Possible scores range from 0 to 200, with higher scores reflecting higher self - efficacy . The dmses satisfied the content validity, factorial construct validity, internal consistency reliability, and test - retest reliability when it was developed . The english - language version of the dmses, which was obtained from the developer, was translated into korean and used in this study . Based on previous studies [12, 25], it was hypothesized in this study that the dmses was positively and moderately correlated with the summary of diabetes self - care activities scale (sdsca). Therefore, the korean version of the sdsca was administered to test hypothesis testing construct validity . The sdsca assesses the frequency of behavioral tasks in five aspects of the diabetes regimen: diet, exercise, self - monitoring of blood glucose, foot care, and smoking for the previous 7 days . The reliability and validity of the sdsca, which comprises 11 items, were culturally adapted for korean patients with type 2 diabetes [30, 31]. The zero - order correlation matrix among the k - dmses items was computed using pearson's analysis . A cross - validation approach involving both exploratory factor analysis (efa) and confirmatory factor analysis (cfa) was used for the factorial construct analysis, and for the cross - validation, 440 patients were split into 2 subsamples using a random - sampling function of the computer program (table 1). The homogeneity of the subsamples with regard to general characteristics was computed using or fisher's exact test . With subsample 1, bartlett's test of sphericity and the kaiser - meyer - olkin (kmo) measure of sampling adequacy were screened to justify undertaking efa . Factors with an eigenvalue higher than 1 were retained, and the factor loading criterion was set at 0.4 . For the cfa with subsample 2, a maximum - likelihood estimation procedure was performed . Multiple criteria were used to evaluate the model fit: the ratio of the value to the degrees of freedom (cmin / df), goodness - of - fit index (gfi), standardized root - mean - square residual (srmr), root - mean - square error of approximation (rmsea), comparative fit index (cfi), and normed fit index (nfi). The following criteria were used to confirm that a model was an acceptable fit: relative cmin / df <3, gfi> 0.9, srmr <0.08, rmsea <0.08, cfi> 0.9, and nfi> 0.9 [3336]. Construct validity by means of the hypothesis testing approach was examined for the entire sample using pearson's correlation analysis . Internal consistency reliability and test - retest reliability were evaluated using cronbach's alpha and the intraclass correlation coefficient (icc), respectively . In korean culture, workers often go out after work to socialize, either formally or informally, as a release from their job - related stresses, and this socializing often involves eating grilled meats or rice and drinking alcohol . It is difficult for a worker at a group dinner to refuse to eat or drink or to order other foods for only himself / herself . Thus, the term company dinner was added in the translation process to item 16: able to follow a healthy eating pattern when i am eating out, at a party, or at a company dinner . Clinicians in korea usually recommend that patients with diabetes visit their physicians every 3 months, based on the guidelines of the korean diabetes association . Therefore, item 18 (able to visit my doctor once a year to monitor my diabetes) was changed to able to visit a clinic or a public health center four times a year to monitor my diabetes . With respect to the content validity, all of the experts considered all of the items to be essential . However, item 11 (able to exercise more if the doctor advises me to) was refined by replacing the term doctor in this item with health professional, since patients with diabetes in korea receive advice not only from physicians but also from diabetes educators (e.g., nurses or nutritionists). Three experts commented that there were content similarities between items 4 and 5 and between items 13 and 14; however, no deletions were performed at this stage . The rate of missing values was 0.23% for each of items 3, 11, and 15; these missing values were replaced by the mean value for each item . In the 20 20 zero - order correlation matrix, items 4/5, 14/13, and 16/15 were strongly correlated (r = 0.800.90), as expected from the results for content validity . These strong correlations indicate the presence of redundancy, and hence only one item of each pair was retained . Items 4 and 14 were retained because their contents are more specific to diabetes than those of items 5 and 13 . Furthermore, item 16 (eat out, at a party, or at a company dinner) occurs more frequently in daily life than the content of item 15 (eat on holiday), and so item 16 was retained . Thus, items 5, 13, and 15 were deleted in order to remove content redundancy . The general characteristics did not differ between subsamples, as assessed by or fisher's exact test (table 1). With the randomly split subsample 1, the kmo statistic (0.89) and bartlett's sphericity (= 2602.62, p <0.001) indicated that the correlation matrix was suitable for factor analysis . The initial efa extracted a four - factor solution (eigenvalue> 1, table 2), which accounted for 65.81% of the total variance . Item 7 was not significantly loaded on any factors at a criterion of> 0.40 . Efa was conducted after deleting that item (table 2), again yielding a four - factor solution that explained 67.28% of the total variance in all items . (items 4, 9, 10, 14, 16, and 17), physical exercise / body weight (items 6, 8, 11, and 12), medical treatment (items 18, 19, and 20), and blood sugar (items 1, 2, and 3). To cross - validate the 16-item, 4-factor construct, cfa was conducted with the randomly split subsample 2 . The srmr value indicated an acceptable model fit, where the values of the other indexes indicated a poor - fitting model (model 1, table 3). Thus, the possibility of model modification was explored using modification indices (mis), which revealed that the mi value of pairing of error terms between items 14 and 16 was the largest, at 57.38 . After modifying the covariance between the error terms of items 14 and 16 (model 2), the model fit was significantly improved ((1) = 66.51, p <0.05). However, the values of some model - fit indexes (cmin / df, gfi, and rmsea) were unsatisfactory, and there was still a large mi value (36.63) between the error terms of items 16 and 17 . With this modification, cfa produced a significantly improved model 3 ((1) = 40.56, p <0.05). After the final modification of the covariance between the error terms of items 9 and 10 (mi = 17.06), model 4 was significantly improved compared with model 3 ((1) = 31.39, p <0.05), and the values of all goodness - of - fit indexes, except gfi, were satisfactory . All items loaded meaningfully onto factors with standardized values ranged from 0.59 to 0.93 (figure 1). The k - dmses score was moderately correlated with the sdsca score (r = 0.50, p <0.001), as hypothesized for the construct validity . Overall cronbach's alpha of the k - dmses was 0.92, which indicates excellent internal consistency reliability . Cronbach's alpha values for the subscales of nutrition, physical exercise / body weight, medical treatment, and blood sugar were 0.89, 0.87, 0.86, and 0.84, respectively, which were all above the acceptability criterion of 0.70 . Of the 70 patients who were asked to complete the k - dmses twice, the icc for the overall k - dmses score was 0.85 (p <0.001; 95% confidence interval = 0.750.91), reflecting a satisfactory test - retest reliability . Iccs for the nutrition, physical exercise / body weight, medical treatment, and blood sugar subscales were 0.87, 0.78, 0.62, and 0.88, respectively . This study translated the dmses into korean and evaluated its psychometric properties in korean type 2 diabetes patients . The total number of items in the k - dmses was 16, which is fewer than in all other language versions of the dmses except for the uk - english version, which comprises 15 items . A shorter k - dmses may represent a smaller burden for patients with type 2 diabetes, rendering it more feasible to use in practice . Translation and back - translation of a questionnaire requires not only literal translation but also social / cultural adaptation . In this study, item 18 of the k - dmses was changed to four times a year to monitor my diabetes, based on the guidelines of the korean diabetes association . A similar change was also made in the taiwanese / chinese version, in accordance with taiwanese regulations of the bureau of national health insurance . In the uk version, the item was deleted based on the national health service (such as gp care system in the uk). The inclusion or wording of item 18 may depend upon the prevailing health system or health policy in the country in which the questionnaire will be used . Mcdowell et al . Reported strongly correlated items (items 2/3, 8/11, 13/14, 13/15, and 14/15) in the australian - english version . Also noted duplicated items (items 4/5, 5/10, 13/14, and 13/15) in the content validity of the uk - english version . Similarly, redundancy of items 4/5, 13/14, and 15/16 was found in the k - dmses for the content validity and the zero - order correlation matrix of items . If items of a scale are strongly correlated, it is recommended that the redundant ones should be dropped . Factorial construct validity in this study demonstrated that the k - dmses comprises four subscales . The items clustered into each subscale were similar to those of the taiwanese / chinese version . The dutch version also comprises four subscales, wherein the clustered items on the physical exercise and blood sugar subscales were similar to those of the two aforementioned versions, but the items on the other two subscales (nutrition specific and weight and nutrition general and medical treatment) were clustered differently . This finding in the study of the dutch version may be attributable to the use of an insufficient sample size (n = 94) for a principal component analysis . An inadequate sample size was also a weakness in the psychometric study of the turkish version of the dmses (n = 101), which revealed three subscales . In addition, a single subscale was reported for the uk - english version, which accounted for only 41% of total variance of all items . This unidimensionality is not congruent with the assertion that diabetes management of self - efficacy is multifaceted . Moreover, the total amount of variance accounted for by that unidimensionality did not meet the criterion of> 50% . Item 7 (i am able to examine my feet for cuts) has been inconsistent in its loading on factor analyses: it loaded onto the general nutrition and medical treatment subscale of the dutch version, the diet / feet control subscale of the turkish version, and the blood sugar / feet check subscale of the taiwanese / chinese version . Furthermore, the item was statistically deleted in the present study . This lack of consistency may be due to there being only one item related to the confidence of foot care in the dmses, with this item possibly being treated as relatively heterogeneous, resulting in it being statistically clustered onto various subscales, or even deleted from the scale . If there were more items related to item 7, its own subscale might have been constructed . Given that at least three items are required for a latent construct, it is recommended that two items should be added in future studies, for example, confident of protecting my feet from hot and cold and confident of putting on shoes and socks at all times . Only efa has been performed to evaluate the factorial construct validity of the dmses cfa has never been performed . This is the first study in which both efa and cfa have been performed to validate the dmses, applying a cross - validation approach . This approach has the merit of exploring the underlying construct of the items and simultaneously confirming the stability of those underlying constructs . In the present study the four - subscale construct extracted from the efa was empirically supported by cfa . However, the cfa revealed that there was covariance between the error terms of three pairs of items, items 9/10, 14/16, and 16/17, implying the presence of an unknown systematic error . Byrne reported that a systematic error may occur due to an overlap in the content of items . The contents of the three pairs of items all related to eating - related confidence . Construct validation by means of the hypothesis testing approach refers to the correlation with one or more well - established instruments, based on a prior hypothesis . The present study has demonstrated the construct validity of the k - dmses, with a moderate correlation with the sdsca . The taiwanese / chinese version of the dmses exhibited a similar correlation (r = 0.58) to the sdsca . A cronbach's alpha value of between 0.70 and 0.95 indicates sufficient item correlations and a low redundancy of items . Overall cronbach's alpha was a little higher for the k - dmses (0.92) than for the dutch version (0.81), the uk - english version (0.89), and the turkish version (0.88) and was similar to that of the australian - english version (0.91) and the chinese version (0.93). Test - retest reliability refers to the temporal stability of a scale between two time points, and the most commonly used criteria for evaluating this parameter are pearson's r or icc> 0.70 . Pearson's r for the test - retest reliability ranged from 0.76 to 0.86 for the dutch, australian - english, and chinese versions . It does not consider systematic differences as a part of measurement error, so pearson's r value is usually higher than the icc . The icc is considered a more reliable parameter for continuous variables and so was calculated in the present study, yielding a value of 0.85, which is higher than that of the uk - english version (0.77) and lower than that of the turkish version (0.91). These findings suggest that the overall test - retest reliability of the dmses is stable over time across languages . However, the medical treatment subscale in this study was characterized by a relatively low icc (0.62). Similarly, the temporal stability of that subscale was unsatisfactory in the taiwanese / chinese version (r = 0.69). Other studies have determined only overall values, not values for the subscales, so it is currently difficult to determine why the medical treatment subscale lacks stability . A limitation of this study is the lack of a responsiveness test to detect changes when patients improve or deteriorate . A longitudinal study should therefore be conducted which assesses the k - dmses scores of patients in whom changes are expected to occur . Regarding test - retest reliability, the time interval between repeated measures should be justified . In general, it is preferable for the time interval to be sufficiently long to prevent recall, but short enough so as to ensure that a clinical change has not occurred . Diverse time intervals have been applied in reliability testing of the dmses: 10 days (present study), 2 weeks, 3 weeks, 4 weeks [22, 24], and 5 weeks . One empirical study found no significant differences in the test - retest reliability of health - status instruments when time intervals of 2 days and 2 weeks were applied . More studies of the optimal time interval for the test - retest reliability of the dmses are required . The k - dmses was subjected to culture - sensitive translation and its psychometric properties were validated in korean type 2 diabetes patients . The underlying construct of the k - dmses comprises four subscales: nutrition (items 4, 9, 10, 14, 16, and 17), physical exercise / body weight (items 6, 8, 11, and 12), medical treatment (items 18, 19, and 20), and blood sugar (items 1, 2, and 3). The k - dmses demonstrated good content validity, factorial construct validity, hypothesis testing construct validity, internal consistency reliability, and test - retest reliability.
To report a case of bilateral acute angle - closure glaucoma after oral administration of cabergoline for the treatment of galactorrhea . A diagnosis of secondary drug - induced angle - closure glaucoma was made in a patient with elevated intraocular pressure (iop) and myopic refractive shift, which was confirmed by ultrasound biomicroscopy (ubm) of the ciliary body and anterior segment, sonography, and optical coherence tomography . The treatment included the discontinuation of the culprit drug and the administration of topical anti - glaucoma drops . The treatment course was followed with serial measurements of the iop and refraction, and with performing ubm . Five hours after he received a single 0.5-mg oral cabergoline tablet, the patient suffered from acute secondary angle - closure glaucoma and myopic refractive error . Ubm demonstrated both effusion of the ciliary body and an anterior rotation of the iris - ciliary body . Iop was reduced 8 h after cessation of the causative agent and administration of anti - glaucoma drops . Secondary acute angle - closure glaucoma has been reported to occur after the administration of some drugs . In this report, an attempt has been made to describe this adverse reaction after oral cabergoline intake . Several types of drugs, such as adrenergic agonists, cholinergics, anti - cholinergics, sulfa - based drugs (e.g. Topiramate), selective serotonin reuptake inhibitors, tricyclic and tetracyclic anti - depressants, anticoagulants, and antihistamines, have been reported to induce secondary acute angle - closure glaucoma [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12]. Cabergoline (brand names dostinex and cabaser), an ergot derivative, is a potent dopamine d2 receptor agonist . The drug is prescribed in parkinson's disease, prolactin - producing pituitary gland tumors, ablactation and dysfunctions associated with hyperprolactinemia . It stimulates dopamine receptors in lactophilic hypothalamic cells to suppress prolactin secretion in the pituitary gland [13, 14]. To the best of our knowledge, she was prescribed 0.5-mg oral cabergoline tablets by her gynecologist (one tablet per week); however, she did not receive any other medication . Five hours after ingestion of the first single dose of cabergoline, the patient was referred to our hospital suffering from bilateral painful red eyes, blurred vision, headache, nausea, and vomiting . Initially, the symptoms occured in her left eye, but, consequently, they also developed in her right eye . The patient had no past medical and familial history of glaucoma, other ophthalmologic diseases or refractive errors . Ocular examination revealed an uncorrected visual acuity of 20/200 in the right and 20/400 in the left eye, normal external ocular motion in both eyes, 5-mm pupils in both eyes that were nonreactive to light, a conjunctival hyperemia and a perilimbal injection . In addition, the examination showed a microcystic corneal edema, a shallow anterior chamber, a closed angle in gonioscopy as well as a clear lens . The fundus demonstrated normal disc and vessels, a normal foveal light reflex as well as some perifoveal retinal wrinkling secondary to choroidal thickening . The intraocular pressure (iop), measured using goldmann applanation tonometry, was 40 mm hg in the right and 42 mm hg in the left eye . Refractive errors were 7.75 dpt sph and 1.00 94 cyl in the right eye, and 9.00 dpt sph and 0.50 56 cyl in the left eye . Ultrasound biomicroscopy with a 40-mhz probe showed ciliochoroidal thickening, effusion underneath the ciliary body, narrowing of the angle and anterior rotation of the iris - ciliary body in both eyes (fig . Measured axial lengths were 23.22 and 23.24 mm in the right and left eye, respectively . The anterior chamber depth was 1.33 mm in the right and 1.34 in left eye . Treatment of the patient was immediately started with the discontinuation of cabergoline as the suspicious causal drug . The elevated iop was treated with topical timolol maleate 0.5% every 12 h, brimonidine tartrate 0.1% every 8 h, and latanoprost 0.005% every 24 h. glaucoma was controlled 8 h after medical treatment, iop was reduced to 25 mm hg in both eyes, conjunctival hyperemia was reduced, and ocular pain was alleviated; however, the patient still had a myopic shift in refraction . Finally, by 8 days after cessation of cabergoline, the refraction returned to normal levels . Cabergoline is absorbed from the gastrointestinal tract within 0.5 to 4 h, with an average elimination half - life of 80 h. seventy - nine percent of the patients taking this drug report at least one side effect . These side effects are chiefly mild or moderate, including nausea, constipation, dry mouth, gastric irritation, dyspepsia, sleep disturbances, vertigo, depression, dyskinesia, hallucinations, systemic hypotension, peripheral edema, arrhythmia, and angina pectoris [15, 16, 17, 18, 19, 20]. We were not able to find any previous report of glaucoma symptoms and signs in the literature . Acute drug - induced bilateral glaucoma is a relatively uncommon but serious adverse reaction which, if not recognized in a timely manner, may result in severe morbidity and even permanent visual damage . Its treatment differs from that of primary acute angle - closure glaucoma, i.e. It is necessary to discontinue the drug for controlling glaucoma [1, 2, 3, 4, 5].
The common malignancies in this age group involve the breast, cervix, blood and brain . The long - term survival of all cancer patients has improved with the therapeutic advances in the oncology . Many of these patients will eventually show interest in childbearing, putting the burden of fertility preservation on the managing team . The options available for fertility preservation include retrieval and cryopreservation of oocytes, ovarian tissue or embryo and ovarian suppression by the use of gonadotropin releasing hormone analogs (gnrha). Primordial follicles at birth consistently reduce in life from closer to two million follicles at birth to 200,000 in reproductive age group . Female germ cells are incapable of regeneration after injury and hence it is important to preserve the available cells for future fertility . Initial studies revealed that the gonadotoxic chemotherapy had less damaging effects on ovarian function in prepubertal females . The gnrha act by suppressing the pituitary ovarian axis decreased ovarian perfusion and prevents germ cell apoptosis . Other collateral benefits include suppression of menses and resulting prevention of anemia and bleeding in hematological malignancy . Parenting biologic children is dependent on factors like age of the patient, type of gonadotoxic therapy used (radiation vs. chemotherapy), available time, specific disease and the fertility potential of the partner . Gnrha treatment is of doubtful efficacy for fertility . In women who have their normal menses and suffer from menorrhagia due to hematologic malignancies and in one of the largest meta - analysis and systematic reviews, use of gnrha, was associated with spontaneous resumption of menses and ovulation, but no improvement in the rates of pregnancy . Since these receptors mediate functions like induction of cell cycle arrest, apoptosis inhibition and proliferation inhibition, it is possible that they may interfere with the action of chemotherapeutic drugs and thus reduce the efficacy of cancer treatment . In addition, the efficacy of the use of gnrh agonist is not well established in clinical trials . Presently data is available for only resumption of menses and not for fertility so large data is required before prescribing this drug as adjuvant therapy for fertility preservation . Fertility rates are low with the use of gnrh treatment compared to other methods of ovarian function preservation . This was due to small sample size, shorter study period, inadequate analyzable data and methodological weakness and also varied injection protocols in different studies.
Compounds containing boron groups have attracted considerable interest recently owing to their extensive use as synthons in organic synthesis, particularly in suzuki cross coupling reactions . Organoboronic acids [rb(oh)2] and boronate esters [rb(or)2] are exceptionally attractive for these carbon - carbon bond forming reactions as they are generally readily prepared, are air- and water - stable, and have relatively low toxicities . Interest in boron compounds also arises, however, from the discovery that these simple compounds can display a wide range of biological properties . For instance, 2-aminoethoxydiphenyl borate (figure 1(a)) is a common activator of the transient receptor potential cation channel subfamily v members (trpv1, trpv2, and trpv3); and while chemical activators for trpv1 are common, only a few examples are known to activate trpv2 and trpv3 . The first example of a boron compound approved for clinical trials is velcade (figure 1(b)) used for the treatment of multiple myeloma . Another example of a simple bioactive boron - containing compound is the benzoxaborole compound an2690 (figure 1(c)), which displays potent antifungal properties . Likewise, more relevant to this work is the observation that arylspiroborates also display antifungal properties and are used for the treatment of wood against parasites such as termites . We have begun to investigate the synthesis and bioactivity of arylspiroborate salts derived from substituted catechols . Indeed, we have found that boron salts derived from 4-tert - butylcatechol and 3,5-di - tert - butylcatechol had moderate antimicrobial activities . As part of our study, we generated the corresponding arylspiroborate salts from caffeic acid phenethyl ester (cape). Caffeic acid (figure 2) is the major component in hydroxycinnamic and phenolic acids and is naturally found in plants in a variety of forms, including the corresponding esters . The chemistry and medicinal potential of cape derivatives have been well - documented, displaying potent antioxidant, anticancer, and antifungal properties [9, 10]. Cape was also reported as an interesting 5-lipoxygenase (5-lo) inhibitor compared to zileuton [11, 12]. The latter is an antiasthmatic drug and the only 5-lo inhibitor available for use in clinical or commercial settings although severe side effects have limited its use . 5-lo is the main enzyme regulating the synthesis of leukotrienes (lts) from arachidonic acid (aa). Lts are key lipid mediators of various inflammatory processes such as atherosclerosis, asthma, and rheumatoid arthritis . In this study we report the synthesis of boron derivatives of cape along with initial bioactivity testing, where it was hoped that the salt form would aid in delivery and enhance activities . As described previously for the cape related propionic, acetic, and benzoic acid analogues, ester 2 was synthesized from 2-phenylethanol with acetylated caffeic acid 1 . The conversion of 1 into the corresponding carboxylic chloride was achieved by the vilsmeier - haack adduct derived from thionyl chloride and n, n - dimethylformamide (dmf) as catalyst . Deacetylation of compound 2 to afford cape (3) was performed with guanidine hydrochloride and triethylamine in meoh / ch2cl2 . Addition of two equivalents of 3 to solutions of commercially available borohydride salts in methanol afforded the corresponding arylspiroborates in good yields along with the formation of dihydrogen (scheme 1). The boron salts were characterized by a number of physical methods, including multinuclear nmr spectroscopy . The b nmr spectra for these compounds show a sharp singlet at approximately 14 ppm, signifying that the boron atom remains in a four - coordinate environment . Little change is observed by either h or c nmr spectroscopy upon chelation of the organic cape group to the boron atom . Although this methodology could be used to generate a number of salts, we decided to focus on sodium salt 4 and the tetrabutylammonium analogue 5 but, unfortunately, the lipophilic butyl groups had only a negligible effect on improving the solubility of this salt in organic solvents . With these new arylspiroborates elementally pure and owing to the wealth of bioactivities associated with simple boron compounds, we then decided to examine these new cape derivatives for their potential to act as antioxidant and antimicrobial agents . Radical scavenging activities of cape (3) and compounds 4 and 5 were assayed using 2,2-diphenyl-1-picrylhydrazyl (dpph) as a stable radical and are expressed as ic50 concentrations in table 1 . As was expected of catechol - containing molecules all compounds possessed radical scavenging ability with most having ic50 values in the range of 9.515 m . As shown in table 1, sodium salt 4 is more active than ammonium salt 5 and surpasses the radical scavenging ability of cape (3) and of zileuton which is almost nonactive . As mentioned previously, arylspiroborates are known to display significant antimicrobial properties . With this in mind, we examined the inhibitory activity of cape (3) and compounds 4 and 5 against candida albicans, pseudomonas aeruginosa, staphylococcus aureus, and methicillin - resistant s. aureus (mrsa) using boric acid as a control to see what role, if any, the boron atom has on bioactivity . Although the new salts did not display any significant activity against the gram - negative bacterium p. aeruginosa in our initial screening (growth inhibition ranged from 5 to 25% at 100 g / ml), these compounds did show some weak antifungal activity against c. albicans and modest activity against the gram - positive bacterium s. aureus and mrsa (see table 2). Studies with the ammonium salt 5 were complicated by the poor solubility of this salt in physiological media and the data obtained for this complex should therefore be interpreted with caution . It is, however, interesting to note that although 5 was not significantly active against s. aureus (causing only 31% inhibition when screened at 100 g / ml), the activity of 4 was comparable to that of cape (3). In contrast, cape (3) was considerably more active against the methicillin - resistant s. aureus than both 4 and 5, which exhibited similar activity against mrsa . The inhibitory capacities of synthesized sodium and ammonium salts were at first analyzed in double stable transfectants of intact hek 293 cells expressing both 5-lo and 5-lo activating protein (flap), thereby possessing all the necessary cellular machinery required for lts biosynthesis . As shown in figure 3, compounds 4 and 5 have similar 5-lo products biosynthesis inhibitory activity in intact hek293 cells as zileuton and cape (3) at concentrations of 1 m . This result clearly shows the effectiveness of the synthesized boron salts as transporter of cape, where a total or even partial hydrolysis occurs for the release of cape (3). Indeed, the formation of cape (3) under these biological conditions was confirmed using hplc and uv - vis spectroscopy (see section 3.4). Likewise, a peak in the b nmr spectrum for salt 4 was observed in dmso - d6 after one hour along with significant amounts of a peak at 19 ppm for degradation product boric acid, b(oh)3 . The stability of these salts was examined using representative salt 5, but compound 4 showed similar reactivity (see section 3.4). In order to further probe inhibitory capacity of our sodium 4 and ammonium salts 5, tests were undertaken to investigate inhibition of 5-lo in stimulated human polymorphonuclear leukocytes (pmnl) cells in the presence of 1 m of the test compounds . 5-lo is highly expressed in pmnl which are important producers of ltb4 [22, 23]. As seen in figure 3, sodium salt 4 is the more active of the compounds tested and more potent than the only known inhibitor for commercial and clinical uses, zileuton . The more efficacious inhibitory effect of 4 may be due to its more effective uptake into pmnl . Concentration - response studies in thapsigargin - stimulated human pmnl were investigated to allow a better insight into the potency of the compounds . Compounds 4 and 5 inhibited 5-lo products synthesis in a concentration - dependent manner in human pmnl and showed prominent inhibitory activities with ic50 values ranging from 0.6 to 0.8 m . Sodium salt 4 was clearly the more potent being more active than both zileuton and cape (3) (5 and 1.8 times, resp . ). Ammonium salt 5 was also more active than zileuton and cape (3) (3.8 and 1.3 times, resp . ). Nmr spectra for 13 were recorded on a bruker avance iii 400 mhz spectrometer and mass spectrometric measurements were performed on a microtof instrument from bruker doltonics in positive electrospray . Nmr spectra for 4 and 5 were recorded on a jeol jnm - gsx400 ft nmr (h: 400 mhz; b: 128 mhz; c: 100 mhz) spectrometer . The ppm scale was calibrated using the residual solvent signal peaks (h and c) and external bf3oet2(b). Multiplicities are reported as singlet (s), doublet (d), triplet (t), sextet (sext), multiplet (m), broad (br), and overlapping (ov). Ft - ir spectra were obtained with a thermo fisher scientific nicolet is5 ft - ir spectrometer in atr mode and are reported in cm . Elemental analyses for carbon, hydrogen, and nitrogen were carried out at laboratoire d'analyse lmentaire de l'universit de montral (montral, qc). Detection was carried out under uv light (254 nm) or by molybdate solution (235 ml of distilled water, 12 g of ammonium molybdate, 0.5 g of ceric ammonium molybdate, and 15 ml of concentrated sulfuric acid) followed by heating . Separations were carried out on silica gel (7749 merck) using circular chromatography (chromatotron, model 7924, harrison research). Melting points of the arylspiroborate salts were obtained using a mel - temp (model 1001d) melting point apparatus . Either protonated ions (m + h) or sodium adducts (m + na) were used for empirical formula confirmation . A mixture of diacetylcaffeic acid (250 mg, 0.94 mmol), 10 ml of thionyl chloride, and two drops of dmf was heated at reflux for 4 h. the excess thionyl chloride was removed on a rotovap, and the residue is dissolved in 4 ml of dry dichloromethane . To this solution is slowly added 1 ml of pyridine and 2-phenylethanol (127.2 mg, 125 l, 1.04 mmol, 1.1 eq). After removal of solvents, the residue was dissolved in ethyl acetate (25 ml); the organic extract was washed with water (2 20 ml) and brine (2 20 ml) and then dried over mgso4 . Hexane) gave acetylated cape 2 (272 mg, 78%) as a white solid (mp 8082c). Rf = 0.45 (30% etoac - hex); ir (, cm): 3037, 2930, 1774, 1713, 1642, 1504, 1204 . Spectroscopic nmr data: h (cdcl3); (ppm) d 7.51 (d, 1h, j = 15.9 hz, chcar), 7.427.23 (m, 8h, har), 6.38 (d, 1h, j = 15.9 hz, chco), 4.44 (t, 2h, j = 7 hz, ch2o), 3.04 (t, 2h, j = 7 hz, ch2o), 2.33 (s, 6h, 2 oac). C (cdcl3); (ppm) 168.08, 167.98, 166.49, 143.50, 142.90, 142.44, 137.81, 133.30, 128.93, 128.55, 126.61, 126.43, 123.93, 122.71, 119.25, 65.16, 35.18, 20.66, 20.62; hrms m / z calcd for c21h20o6(na): 391.1152; found: 391.1151 . The acetylated cape (2) (200 mg, 0.54 mmol) was dissolved in 2 ml of anhydrous ch2cl2 under n2, to which 4 ml of meoh was added . Guanidinium hydrochloride (168.5 mg, 1.76 mmol, and 3.25 eq) and triethylamine (631.7 mg, 738 l, 5.26 mmol, and 9.75 eq) were added to the stirred solution . After consumption of the diacetylated precursor (about 2 h), the reaction mixture was concentrated and partitioned between 60 ml of acoet and 30 ml of water . The organic phase was washed sequentially with water (50 ml), saturated ammonium chloride (2 20 ml), and brine (2 20 ml), treated with charcoal, dried over mgso4, and concentrated to give pure cape (3) (150 mg, 79%) of a white solid (mp 126128c); rf = 0.37 (50% etoac - hexane); ir (, cm): 3330, 3058, 2986, 1678, 1596, 1265 . Spectroscopic nmr data: h (cdcl3); (ppm) 9.60 (s, 1h, oh), 9.13 (s, 1h, oh), d 7.45 (d, 1h, j = 15.8 hz, chcar), 7.337.21 (m, 5h, har), 7.04 (s, 1h, har), 6.99 (d, 1h, j = 8.2 hz, har), 6.76 (d, 1h, j = 8.1 hz, har), 6.23 (d, 1h, j = 15.8 hz, chco), 4.32 (t, 2h, j = 6.8 hz, ch2o), 2.95 (t, 2h, j = 6.8 hz, ch2o); c (cdcl3); (ppm) 166.93, 148.90, 146.03, 145.68, 138.57, 129.35, 128.83, 126.83, 125.91, 121.85, 116.20, 115.31, 114.29, 64.77, 34.96; hrms m / z calcd for c17h16o4(na): 307.0941; found: 307.0934 . Sodium borohydride (14 mg, 0.37 mmol) was added in small portions as a solid to a stirred thf (5 ml) solution of cape (3) (210 mg, 0.74 mmol). The reaction mixture was heated at reflux for 6 h at which point hexane (5 ml) was added to the clear yellow solution to afford a white precipitate . The precipitate was collected by suction filtration and washed with hexane (3 1 ml) to afford 4 as a white solid . Yield: 188 mg (85%); mp: 300303c; ir (, cm): 3056, 3027, 1697, 1682, 1628, 1607, 1593, 1489, 1450, 1316, 1252, 1238, 1183, 1146, 1099, 1052, 971, 921, 850, 808, 749, 696, 607 . Spectroscopic nmr data: h (dmso - d6); (ppm) 7.45 (d, j = 16.0 hz, 2h, ch = ch), 7.307.25 (ov m, 8h, ar), 7.19 (m, 2h, ar), 6.91 (d, j = 1.4 hz, 2h, ar), 6.84 (dd, j = 7.8, 1.4 hz, 2h, ar), 6.51 (d, j = 7.8 hz, 2h, ar), 6.21 (d, j = 16.0 hz, 2h, ch = ch), 4.27 (t, j = 6.8 hz, 4h, ch2ch2), 2.91 (t, j = 6.8 hz, 4h, ch2ch2); b (thf): (ppm) 13.5 (sharp); c (dmso - d6): (ppm) 167.4 (o c = o), 155.3, 152.5, 147.2, 138.7, 129.4, 128.9, 126.9, 124.9, 123.2, 112.6, 108.3, 106.2, 64.7 (och2ch2), 35.1 (och2ch2). Tetrabutylammonium borohydride (91 mg, 0.35 mmol) was added in small portions as a solid to a stirred et2o (5 ml) solution of cape (3) (200 mg, 0.70 mmol). The reaction was allowed to proceed for 1 h at which point a white precipitate was collected by suction filtration . The precipitate was washed with et2o (3 1 ml) to afford 5 as a white solid . Ir (, cm): 2961, 2874, 1696, 1625, 1588, 1487, 1453, 1382, 1311, 1237, 1167, 1148, 1117, 1089, 1043, 980, 897, 846, 806, 749, 698, 609 . Spectroscopic nmr data: h (dmso - d6): (ppm) 7.45 (d, j = 16.0 hz, 2h, ch = ch), 7.307.25 (ov m, 8h, ar), 7.207.17 (ov m, 2h, ar), 6.91 (d, j = 1.4 hz, 2h, ar), 6.84 (dd, j = 7.8, 1.4 hz, 2h, ar), 6.51 (d, j = 7.8 hz, 2h, ar), 6.21 (d, j = 16.0 hz, 2h, ch = ch), 4.27 (t, j = 6.9 hz, 4h, och2ch2), 3.09 (br m, 8h, nch2), 2.91 (t, j = 6.8 hz, 4h, och2ch2), 1.50 (br m, 8h, ch2), 1.25 (sext, j = 6.8 hz, 8h, ch2ch3), 0.87 (t, j = 6.8 hz, 12h, ch3). C (dmso - d6): (ppm) 167.4 (o c = o), 155.3, 152.4, 147.2, 138.7, 129.4, 128.9, 126.9, 124.9, 123.2, 112.6, 108.3, 106.2, 64.7 (och2ch2), 58.0 (nch2), 35.1 (och2ch2), 23.7 (nch2ch2), 19.6 (ch2ch3), 13.7 (ch3). Anal . Calcd . For c50h64nbo8 (817.86): c, 73.43; h, 7.89; n, 1.71 . Found: c, 73.98; h, 7.97; n, 1.67 . Testing compounds to scavenge radicals was evaluated by the dpph assay . To avoid discrepancies in ic50 calculation, meticulous care was applied in the preparation of the control solution (dpph reagent + ethanol as a diluent without test compounds). Only controls showing an optical density (od) of 0.3500.360 were used . 1 ml of the dpph reagent diluted in methanol (60 mm) was added to 1 ml of the test compound at various concentrations . Radical scavenging was termed as% inhibition of dpph absorbance:% inhibition = [(acontrol atest)/acontrol] 100, where acontrol is the od of the control (dpph solution in absence of test compound) and atest is the absorbance of the test sample (dpph solution in presence of test compound). Graphpad prism 5 software (graphpad software, san diego, ca, usa) was used to calculate ic50 values by fitting experimental values to a sigmoidal concentration - response curve - fitting model with a variable slope . Antibacterial activity against staphylococcus aureus (atcc 29213), mrsa (atcc 33591), and pseudomonas aeruginosa (atcc 10145) and antifungal activity against candida albicans (atcc 14053) were evaluated using a microbroth dilution antibiotic susceptibility assay modified from webb et al . Stock solutions of the test compounds (1.25 mg / ml) were prepared with sterile - filtered dmso, stored at 4c, and used within one week of preparation . Immediately prior to use, stock solutions (40 l) were diluted with the appropriate nutrient broth (960 l) and the resulting test solutions (100 l) were transferred to nonperipheral wells of a 96-well microtitre plate in triplicate . Wells were then inoculated with suspensions of the appropriate microbial strain (100 l) of cell density 5 10 colony forming units / ml and to reduce evaporation from the plates, sterile water (200 l) was added to perimeter wells . Positive controls consisted of a triplicate twofold serial dilution of antibiotic (1.250.313 g / ml, gentamicin for s. aureus; 51.25 g / ml, gentamicin for p. aeruginosa; 102.5 g / ml, nystatin for c. albicans; 0.20.05 g / ml, ciprofloxacin for mrsa; 100 l per well) as 4% dmso solutions in the appropriate nutrient broth inoculated with suspensions of the appropriate pathogen (100 l). In addition to test and positive control wells, each plate contained three untreated controls [4% dmso in the appropriate nutrient broth (100 l) inoculated with suspensions of the appropriate pathogen (100 l)] and three uninoculated blanks (200 l of 2% dmso in the appropriate nutrient broth). The optical densities of the wells were measured before and after a 24-hour incubation period (37c), and the change in optical density (od) was calculated by subtracting the initial optical density from the final optical density of corresponding wells . Od values were corrected for background absorbance of the media by subtracting the mean od readings of the blanks from the mean od readings of the control and test compound wells . The percentage inhibition of bacterial or fungal growth was then defined as follows: [1 (mean test or positive control od / mean negative control od)] 100 . Mic and ic50 values were determined for test compounds that exhibited> 50% growth inhibition at a concentration of 100 g / ml in the initial screening assays, which were performed as described above on twofold serial dilutions of active compounds in triplicate . All compounds tested against c. albicans were tested at 10 concentrations obtained from two dilution series (200.012.5 g / ml and 150.09.38 g / ml). All compounds tested against s. aureus and mrsa were tested at 15 concentrations obtained from two dilution series (200.00.39 g / ml and 150.09.38 g / ml). The mic of a compound was considered to be the lowest assay concentration at which it inhibited mycobacterial growth by more than a mean value of 90% . Absolute ic50s were estimated by fitting a four - parameter logistic curve to the microbial growth data (in relative fluorescence or od units) using masterplex 2010 readerfit (hitachi). In cases when the data were insufficient to obtain reliable estimates by four - parameter logistic regression, absolute ic50s were obtained by probit analysis [22, 23] performed by fitting mean percentage inhibition values calculated from the growth data to the probit model by the maximum likelihood method using spss statistics 19 (ibm). Cotransfection of hek293 cells was performed using a pcdna 3.1 vector expressing 5-lo and a pbudce4.1 vector expressing flap in presence of the polyfect reagent (qiagen, mississauga, on, canada) according to the manufacturer's protocol . Cell culture in presence of geneticin and zeocin (invitrogen, burlington, on, canada) generated stable double transfectants hek 293 cells . The resulting stable double transfectants were propagated in culture and aliquots were frozen . Once thawed for a series of experiments, each aliquot of cells is cultured for a maximum of 6 weeks before being discarded . To stimulate the synthesis of 5-lo products, the transfected hek 293 cells were collected and then trypsinized and washed and hank's balanced salt solution (hbss) containing 1.6 mm cacl2 was used to resuspend the cell pellet at a concentration of 5 10 cells ml . Each compound was preincubated at the indicated concentration with the cells for 5 min at 37c and was followed by cell stimulation for 15 minutes at 37c with the addition of 10 m calcium ionophore a23187 (sigma - aldrich, oakville, on, canada) and 10 m arachidonic acid (cayman chemical, ann arbor, mi). Then, as described in a previous publication, stimulations were stopped and processed by rp - hplc . Data are the means sem of 3 independent experiments, each performed in duplicate . Human pmnl were prepared from peripheral blood as described elsewhere and were suspended in hbss at 1.6 mm cacl2 (10 cells / ml) and prior to stimulation they were incubated with the test compounds for 5 min at 37c in presence of 1 m thapsigargin . Addition of 0.5 volume of cold meoh: ch3cn (1: 1) was used to stop the reactions and 50 ng of pgb2 was added as an internal standard . Samples were stored at 20c until being analyzed by rp - hplc (c18) column as indicated above . Data are means sem of 3 independent experiments, each performed in duplicate (figure 3). It is possible to track an inhibitor used in our 5-lo products biosynthesis bioassays if the inhibitor absorbs at the wavelengths set in the detection parameters of the diode array detector of the hplc . The hplc method used for tests with hek293 and pmnl cells in the presence of our compounds was set for detection at 270 nm and 236 nm (as well as scanning peaks from 200 to 400 nm). To determine the release of cape (3) by sodium salt 4 and ammonium salt 5, cape (3) was injected onto the hplc system with the usual internal standards, without incubation in the presence of cells . The chromatograms obtained are shown in figure 4 . The uv spectrum associated with peak c (cape (3)) chromatographic analysis of hek293 cells incubated with the sodium salt 4 and ammonium salt 5 shows the same peak as in figure 4 (peak c). Figures 5 and 6 show the hplc chromatograms obtained for extracts of hek293 cells incubated with sodium salt 4 and ammonium salt 5, respectively . Peak c was absent in hek293 cells incubated with the vehicle (dmso) only . Peak c is also observed when cape (3) is used as the inhibitor in hek293 cells and the same results are obtained when using pmnl cells (data not shown). To demonstrate the release of cape (3) by our salts, stability tests of 5 in the presence of dmso - d6 using nmr were performed . H and b nmr spectra are included in the supplementary material (see supplementary material available online at http://dx.doi.org/10.1155/2015/418362). Compound 5 (50 mg, 0.06 mmol) was dissolved in 1 ml of dmso - d6 and the solution was analysed by multinuclear nmr spectroscopy after a period of 24 h. spectroscopic nmr data: h (dmso - d6); (ppm) 7.42 (d, j = 16.0 hz, chcar, 5), 7.36 (d, j = 15.8 hz, chcar, 3), 7.317.14 (ov m, ar, 3 and 5), 6.98 (d, j = 1.4 hz, ar, 3), 6.896.85 (ov m, har, 3 and 5), 6.82 (dd, j = 7.8, 1.4 hz, ar, 5), 6.70 (d, j = 8.1 hz, har, 3), 6.51 (d, j = 7.8 hz, ar, 5), 6.16 (d, j = 16.0 hz, chco, 3), 6.15 (d, j = 15.8 hz, chco, 5), 4.24 (t, j = 6.8 hz, ch2o, 5), 4.10 (t, j = 6.8 hz, ch2o, 3), 3.03 (br m, nch2, 5), 2.91 (t, j = 6.8 hz, och2ch2, 5), 2.90 (t, j = 6.8 hz, och2ch2, 3), 1.45 (br m, ch2, 5), 1.20 (sext, j = 6.8 hz, ch2ch3, 5), 0.82 (t, j = 6.8 hz, ch3, 5). B (dmso - d6): (ppm) 17.2 (b(oh)3), 12.5 (5). Stability tests for 5 were performed using a varian mercury 200 plus ft nmr spectrometer (h: 200 mhz). In summary, we have prepared new arylspiroborate salts from caffeic acid phenethyl ester and examined their antioxidant, 5-lo inhibition, and antimicrobial properties . Our results indicate that the prepared salts are indeed efficient carriers of cape whereby the antioxidant effects and the effects of inhibition of 5-lo were both increased compared to cape . There is also evidence that the sodium salt is more active than its corresponding ammonium salt, and this difference is probably due to the low solubility of the ammonium salt . The preliminary nature of this work meant that only a small library of analogues was tested; however, the observed biological activities of these compounds, especially their promising anti - inflammatory and antibacterial abilities, warrant further in - depth investigations into derivatives with enhanced solubility in aqueous media.
The incidence of differentiated thyroid cancers (dtcs), including papillary thyroid cancer (ptc) and follicular thyroid cancer variants, is rising significantly globally over the past decades, with a wide geographic variation.1 in saudi arabia, dtc is the second - most common malignancy, accounting for more than 10% of all cancers among middle - aged women.2 generally, age above 45 years is regarded as a poor prognostic marker in dtc, using the american joint cancer committee / union internationale contre le cancer tumor nodes metastasis staging system; the mortality rate climbs gradually starting at age 45 years and above.3,4 dtc in older patients (> 60 years) has some distinctive clinicopathological features: 1) large size of primary tumors at the time of diagnosis; 2) high risk of distant metastases at the time of presentation; 3) more aggressive histopathological variants of dtc; and 4) higher recurrence rates.5,6 the management of dtc in older patients remains controversial as there has been conflicting literature in regard to approach.7 dtc in older patients is treated in a similar way as that in young adults, primarily because of scarcity of clinical and outcome data.8 in the present study, we aimed to evaluate the difference between different clinicopathological characteristics, and treatment outcomes of dtc in saudi patients aged <60 years and> 60 years . After a formal approval from the institutional ethical committee of king fahad medical city and formal written consent from patients, medical records of 1,192 patients with confirmed dtc, who were managed in our institute during the period of 2000 and 2012, were retrieved using computer - based database system . As 45 years of age has been used as a cutoff in the staging of dtc in most of studies, the patients aged below 45 years were excluded.9 patients with incomplete information and those lost at follow - up were also excluded . All patients were divided in two groups: 1) group a: patients aged above 45 years but below 60 years, and 2) group b: patients aged above 60 years . Descriptive data (age, sex, and symptoms, histology, size of primary tumor, variants, multifocality, lymphovascular invasion, staging, surgery types, neck dissection, adjuvant treatment and doses in millicurie [mci], radiation therapy) were collected for each patient . Radiological data were collected from different imaging modalities (neck ultrasonography, whole body scan, computed tomography, fluoro - deoxyglucose positron emission tomography computed tomography). The primary objective of this study was the disease - free survival (dfs) in elderly population, while secondary objectives were locoregional control (lrc), distant metastasis control (dmc), and overall survival (os) rates . Locoregional recurrence (lr) was defined as the gap between the surgery date and the date of radiologically detectable disease in the thyroid bed or in cervical lymph nodes on imaging in the presence of elevated thyroglobulin levels . Distant metastasis (dm) was defined as the gap between the surgery date and the date of documented disease outside the neck on imaging . Dfs was described as the gap between the surgery date and the date of documented all - site relapse (lr and dm) or last follow - up (censored). Os was defined as the gap between the surgery date and the date of death or last follow - up (censored). To determine the differences in various clinical variables, all graphs were drawn with the kaplan meier method, and the comparisons for various survival curves were performed with the log - rank test . All data analyses were done using spss version 16.0 (spss inc ., chicago, il, usa). All patients were divided in two groups: 1) group a: patients aged above 45 years but below 60 years, and 2) group b: patients aged above 60 years . Descriptive data (age, sex, and symptoms, histology, size of primary tumor, variants, multifocality, lymphovascular invasion, staging, surgery types, neck dissection, adjuvant treatment and doses in millicurie [mci], radiation therapy) were collected for each patient . Radiological data were collected from different imaging modalities (neck ultrasonography, whole body scan, computed tomography, fluoro - deoxyglucose positron emission tomography computed tomography). The primary objective of this study was the disease - free survival (dfs) in elderly population, while secondary objectives were locoregional control (lrc), distant metastasis control (dmc), and overall survival (os) rates . Locoregional recurrence (lr) was defined as the gap between the surgery date and the date of radiologically detectable disease in the thyroid bed or in cervical lymph nodes on imaging in the presence of elevated thyroglobulin levels . Distant metastasis (dm) was defined as the gap between the surgery date and the date of documented disease outside the neck on imaging . Dfs was described as the gap between the surgery date and the date of documented all - site relapse (lr and dm) or last follow - up (censored). Os was defined as the gap between the surgery date and the date of death or last follow - up (censored). To determine the differences in various clinical variables, all graphs were drawn with the kaplan meier method, and the comparisons for various survival curves were performed with the log - rank test . All data analyses were done using spss version 16.0 (spss inc ., chicago, il, usa). Among the 1,192 registered dtc patients in our department, 252 adults (21.2%) aged below 60 years (group a) and 118 (9.9%) aged above 60 years (group b) were found to have dtc . The clinical, diagnostic, and therapeutic characteristics of both groups are described in table 1 . The mean age of study cohort at diagnosis was 57.2 years (range: 4697). The study cohort (n=370) consisted of 292 (78.9%) females and 78 (21.1%) males . Classic variant ptc was more frequent in group a (63.4%), whereas follicular variant ptc was more common 40.2% in group b (p=0.002). The mean size of the primary tumor was 2.8 cm (range: 0.311), with no significant difference between groups a and b (p=0.653). Pathologically involved cervical lymph nodes were seen more in elderly patients (51%, p=0.002). In group b, distant metastases at the time of diagnosis were nearly three times more than that in group a (p=0.010). Other features (extrathyroidal extension, multifocality, and lymphovascular space invasion) were significantly high in group b (p=0.018, p=0.006, and p=0.003, respectively). However, the frequency of neck dissection was seen more in group a than in group b (p=0.027). A total of 326 patients (88.1%) were treated with adjuvant radioactive iodine-131 (rai) ablation with a median gap of 8.2 weeks (6.816.6 weeks) from the date of surgery . Postsurgical complication rates including permanent hypocalcemia, postoperative bleeding, and wound infection were much higher in group b as compared to group a (table 2). Rai were significantly higher in group b than in group a. the median follow - up period was 5.5 years (range: 0.710.4). For all patients, the estimated 10-year lrc and dmc rates were 91.8% and 89.6%, respectively . Group b was associated with inferior 10-year lrc and dmc rates (86.0% and 82.2%, respectively) than those in group a (94.3% and 93.1%, respectively). A total of 25 lrs (6.8%) were observed: 12/252 in group a and 13/118 in group b (p=0.025) (table 3). The lrs were managed by surgery (lateral neck exploration, 13 patients; completion thyroidectomy, five patients; excision, two patients), neck irradiation (three patients), and rai ablation (16 patients). A total of 32 patients developed dm (8.7%): 14/252 in group a and 18/118 in group b (p=0.003). Dms were treated with rai ablation (28 patients) and palliative radiotherapy (three patients). The projected 10-year dfs rates were 87.6% in group a and 70.8% in group b (p<0.0001; figure 1). Furthermore, in a multivariate analysis of group b patients, positive lymph nodes (p<0.0001) and partial response after first rai ablation (p<0.002) were found to be important independent prognostic factors predicting dfs . Among the 1,192 registered dtc patients in our department, 252 adults (21.2%) aged below 60 years (group a) and 118 (9.9%) aged above 60 years (group b) were found to have dtc . The clinical, diagnostic, and therapeutic characteristics of both groups are described in table 1 . The mean age of study cohort at diagnosis was 57.2 years (range: 4697). The study cohort (n=370) consisted of 292 (78.9%) females and 78 (21.1%) males . Classic variant ptc was more frequent in group a (63.4%), whereas follicular variant ptc was more common 40.2% in group b (p=0.002). The mean size of the primary tumor was 2.8 cm (range: 0.311), with no significant difference between groups a and b (p=0.653). Pathologically involved cervical lymph nodes were seen more in elderly patients (51%, p=0.002). In group b, distant metastases at the time of diagnosis were nearly three times more than that in group a (p=0.010). Other features (extrathyroidal extension, multifocality, and lymphovascular space invasion) were significantly high in group b (p=0.018, p=0.006, and p=0.003, respectively). However, the frequency of neck dissection was seen more in group a than in group b (p=0.027). A total of 326 patients (88.1%) were treated with adjuvant radioactive iodine-131 (rai) ablation with a median gap of 8.2 weeks (6.816.6 weeks) from the date of surgery . Postsurgical complication rates including permanent hypocalcemia, postoperative bleeding, and wound infection were much higher in group b as compared to group a (table 2). Similarly, acute and delayed (any grade) toxicities of adjuvant rai were significantly higher in group b than in group a. the median follow - up period was 5.5 years (range: 0.710.4). For all patients, the estimated 10-year group b was associated with inferior 10-year lrc and dmc rates (86.0% and 82.2%, respectively) than those in group a (94.3% and 93.1%, respectively). A total of 25 lrs (6.8%) were observed: 12/252 in group a and 13/118 in group b (p=0.025) (table 3). The lrs were managed by surgery (lateral neck exploration, 13 patients; completion thyroidectomy, five patients; excision, two patients), neck irradiation (three patients), and rai ablation (16 patients). A total of 32 patients developed dm (8.7%): 14/252 in group a and 18/118 in group b (p=0.003). Dms were treated with rai ablation (28 patients) and palliative radiotherapy (three patients). The projected 10-year dfs rates were 87.6% in group a and 70.8% in group b (p<0.0001; figure 1). Furthermore, in a multivariate analysis of group b patients, positive lymph nodes (p<0.0001) and partial response after first rai ablation (p<0.002) were found to be important independent prognostic factors predicting dfs . Recent data have shown that the dfs rate in dtc declines gradually with each 5-year increment in age above 45 years.3 however, the literature regarding clinicopathological features and treatment outcomes in elderly patients remains scarce and controversial, which is likely attributed to the definition of elderly itself.58 because of the lack of definition for elderly, different studies have used different age limits for elderly patients; few of them have reported it around 80 years.7,10,11 for the purpose of the present study, we defined elderly as patients aged above 60 years for threefold reasons; 1) according to the saudi arabia population census 2004, only 3.5% of population is above 65 years;12 2) thus by decreasing the age limit to 60 years, we achieved a large sample size; 3) which was also in agreement with other previously published data.13 in the present study, no significant difference was observed in primary tumor volumes between the two age groups, which is consistent with the reported literature.14 in contrast to patients aged below 60 years, the pathological positive neck nodes were significantly higher in patients aged above 60 years, owing to the presence of lymphovascular space invasion, multifocality, and aggressive histopathological variants in elderly patients, which supports the routine use of lateral neck dissection in this age group.15,16 in contrast to the study by tartaglia et al,17 patients aged above 60 years experienced significant postoperative hypoparathyroidism, hemorrhage, and wound infections . This observation favors the hypothesis of lobectomy / hemithyroidectomy for primary tumor in this age group, especially in patients with more than one associated comorbidity.7,9,18,19 similarly, patients aged above 60 years experienced more rai - induced acute and late (any grade) complications including a rare side effect of nasolacrimal duct obstruction, which we have previously reported.20 a possible explanation could be the use of a fixed empiric dosing strategy (100200 mci) for rai in our department . For the elderly age group, dosimetry - guided rai therapy may be helpful . However, further studies are warranted.21 in contrast to previously published studies, our elderly patients experienced more all - site recurrences and had lower 10-year dfs rate (70.8%) even after extensive treatment that warrants more molecular - level studies.4,5 large sample size of study population and comparison of different clinicopathological characteristics and outcomes of elderly patients aged between 46 and 60 years were primary strengths of our study . However, the study might be criticized for 1) not evaluating thyroid - stimulating hormone (tsh) suppression therapy - related complications (including osteoporosis), as tsh suppression therapy can theoretically increase the risk of osteoporosis,22 and 2) not having molecular - level data on elderly dtc . In conclusion, the frequency and clinicopathological features of dtc in saudi elderly patients are similar to published data; however, some discrepancies (no difference in regard to tumor size between patients aged below 60 years and 60 years) were seen . Furthermore, elderly patients experienced more treatment - related complications when compared to patients aged <60 years . Despite extensive treatment by thyroidectomy, neck dissection, rai ablation, and tsh suppression therapy, a large proportion of elderly patients developed all - site recurrences . Large multi - institutional studies are warranted to suggest optimal treatment approaches for dtc in elderly patients . Furthermore, interdisciplinary tumor board meetings and competent follow - up of patients can minimize the disease- or treatment - related morbidities.
Adnexa refer to the anatomical area adjacent to the uterus, and contains the fallopian tube, ovary, and associated vessels, ligaments, and connective tissue . The reported incidence of adnexal masses in pregnancy ranges from 1 in 81 to 1 in 8000 pregnancies . These cysts may be asymptomatic and may be coincidently found or until their size increases the abdominal girth . Pain due to rupture, hemorrhage into the cyst, infection, venous congestion, or torsion may be of sudden onset or of a more chronic nature . Most of these adnexal masses are diagnosed incidentally at the time of dating or first trimester screening ultrasound (uss). An adnexal mass in pregnancy can be complicated by torsion, rupture, or bleeding / infection, or labor obstruction . It is particularly important when the mass is not well defined or when pelvic examination is limited by discomfort . Both transabdominal scan and transvaginal scan (tvs) should be used together as complimentary techniques, though more detailed morphological assessment of the mass is better with tvs, especially in early pregnancy . In addition, color doppler imaging has been shown to significantly improve the ability to distinguish benign from malignant masses . Prior to the widespread use of uss, adnexal masses in pregnancy were documented with less frequency on physical examination, especially if they were small and asymptomatic . Management can be conservative or surgical depending on the size, gestational age, available resources, and possibly patient preference following careful evaluation . This article will review the diagnosis of adnexal masses in pregnancy, evaluate the appropriate investigations to determine whether intervention is necessary, and recommend the most appropriate management . We searched medline and pubmed using the terms ovarian masses, adnexal masses, tumor markers, ultrasound, pregnancy, laparoscopy, and laparotomy for including articles by all authors . The bibliography of each article was reviewed in an effort to determine any further articles that could be included in this review . Original research articles were included if they dealt with diagnosis, evaluation, or treatment of adnexal masses in pregnancy . Using uss, adnexal masses are classified into the following categories: simple, solid, or complex . Functional cyst is the most common adnexal mass in pregnancy, similar to the nonpregnant state . A corpus luteum persisting into the second trimester accounts for 13 - 17% of all cystic adnexal masses . However, the differential diagnosis throughout pregnancy also includes the following: benign masses such as dermoid cyst (7 - 37% incidence), serous cystadenoma (5 - 28% incidence), mucinous cystadenoma, ovarian malignancy accounting for approximately 1 - 8% of adnexal masses in pregnancy, endometrioma, classification of adnexal masses table 2 shows the studies comparing surgical versus conservative approaches in the management of adnexal masses . Uss screening during the first trimester has led to the discovery of many adnexal masses in pregnancy . If an adnexal mass is palpated during examination, uss is the preferred radiological method of confirmation because of its ability to differentiate morphology and categorize the mass . The aim of an uss evaluation is to aid the physician in determining those masses in which conservative management with observation is possible versus those requiring surgical intervention . Uss has been found to be accurate in determining the malignant potential of an adnexal mass; the more complex a tumor (i.e. The more septa and solid components it contains), the higher the risk of malignancy . Found the frequency of malignancy in the unilocular cyst to be 0.3%, while in multilocular cyst it was 73% . In a study by whitecar et al ., 89 of 91 masses diagnosed as simple cyst on uss were confirmed to be benign cysts on pathology . Color flow doppler has been shown to be a useful adjunct in assessing the possibility of malignancy in ovarian tumor . The doppler criteria show that malignant tumors will generally have lower blood flow impedance and higher blood flow velocity; these findings can also be seen in inflammatory lesions . A similar study by bromley and benacerraf found that uss alone was accurate in the diagnosis of dermoid tumors 97% of the time, endometrioma 80% of the time, and the diagnosis of simple cysts 71% of the time . Endometriomas have features in common with neoplasia, such as clonal proliferation, which is consistent with the endometriosis disease theory, and are associated with subtypes of ovarian malignancy, such as endometroid and clear cell carcinoma . Each of these studies uses their own form of risk assessment based on complexity of features seen on uss . All demonstrated that uss characterization of an ovarian mass complexity and size can assist with the prediction of malignancy . Characteristic features suggestive of malignancy were masses with septations, solid component nodules, papillary components, or an average diameter of greater than 5 cm . Recent studies have evaluated the utility of adding doppler flow evaluation to gray scale uss in an effort to improve the sensitivity of antenatal diagnosis of malignancy . Wheeler and fleischer studied 34 pregnant patients with complex adnexal masses in the second trimester and found considerable overlap of doppler blood flow pattern between benign and malignant processes with a positive predictive value of 42% and a false - positive rate of 48% . In a review article by de priest and desimone, they concluded that doppler did not further aid in diagnosis compared with gray scale sonography alone, with a similar false - positive rate of 49% for the prediction of malignancy . However, three - dimensional doppler studies may aid gray scale examination in the stratification of adnexal masses . Computerized tomography (ct) and magnetic resonance imaging (mri) can be useful adjuncts when uss imaging is inconclusive . Ct imaging provides better resolution for identifying non - obstetric causes of abdominal pain . Although ct imaging is relatively safe in pregnancy, it does expose the mother and fetus to 2 - 4 rads in a single examination . Contrast material can pass the placental barrier and should be used with caution because its effect is not clearly known . Mri is generally considered safe in pregnancy and is the procedure of choice in certain conditions . It is better at distinguishing paraovarian cystic lesions, which can then be managed conservatively, and also can provide better tissue characterization, allowing for more accurate evaluation of the large masses that are difficult to completely visualize by uss . Mri can also determine the possible extent of malignancy and aid in the diagnosis of acute bowel processes such as appendicitis and inflammatory bowel disease . However, use of mri in pregnancy should be judicious and solely for the clarification of an inconclusive uss result . Leiomyosarcomas are the malignant counterpart of benign fibroids and uss cannot reliably be used to determine sarcomatous change, although a change within the vascular pattern may be detected using doppler . Similarly, torsion in an ovarian cyst has no specific uss features and the diagnosis relies on comparison with the opposite ovary . The ovary may appear congested and edematous, and multiple small cysts may be seen at the periphery of the markedly enlarged ovary . However, doppler may show the absence of blood flow in case of torsion, though this is not universal as torsion may be complete or intermittent . The level of ca125, a glycoprotein in serum, may also be elevated with other benign disease processes such as menses, uterine fibroid, and endometriomas . Ca125 is typically elevated during the first trimester, but may be useful during later assessment or follow - up . Other tumor markers helpful in stratifying germ cell malignancy, such as alpha - feto prtien (afp), beta humanchorionic gonadotrophin (bhcg), and lactate dehydrogenase (ldh), are of limited value because they may be significantly altered by pregnancy alone . In general, tumor markers should be used with caution during pregnancy, particularly in the first trimester, because of the wide variation in results and interpretation . A pyosalpinx is an unlikely presentation in pregnancy where there is problem with differentiating this mass a pyosalpinx on uss has a very typical appearance of a thick wall cystic sausage-shaped structure with the an incomplete septum . We should not forget the clinical features of different presentation of the adnexal masses in pregnancy where they can present with features of torsion, rupture, or bleeding into the cyst [table 3]. The major questions to be answered once an adnexal mass is discovered during pregnancy are: what is the nature of the mass? What is the likelihood that it is malignant? Secondly, is there a possibility that the mass may regress? And finally, will the mass undergo torsion, possible rupture, or will it cause obstruction during delivery? Early in pregnancy, ovarian enlargement less than 6 cm diameter is usually due to corpus luteum formation . Cysts measuring 10 cm in diameter should be resected due to increased risk of cancer in the large cysts, while cysts less than 5 cm could be left alone, and indeed, most undergo spontaneous resolution . Others believe that if they contain septae, nodules, papillary excrescences, or solid component, resection is recommended [table 2]. [1423] in certain cases, intervention can be delayed until the second trimester, usually 14 - 16 weeks, when access to the mass is much easier . Where oophorectomy is done for an adnexal mass prior to this time generally, there is disagreement among authors concerning the best management of adnexal masses in pregnancy, with some recommending observation and others favoring surgical management . Most ovarian masses identified in pregnancy will spontaneously resolve and aggressive surgical management is not required . Characteristic features favorable for resolution are: masses that are simple in nature by uss, less than 5 cm in diameter, and diagnosed before 16 weeks . Larger masses or those with more complex morphology are less likely to spontaneously resolve and may represent a neoplastic process . Similarly persistent adnexal masses into pregnancy are more likely to be malignant or may result in complications in pregnancy, like torsion, rupture, or obstruction of labor . Surgical management is encouraged when there is concern that the persistent or larger ovarian mass will place the patient at higher risk for an acute abdomen, ovarian torsion, or rupture . Up to 10% of persistent complex ovarian masses will ultimately be diagnosed as malignancy, implying that observation may not be appropriate . Where cancer of the ovary is found, treatment should be individualized and consideration should be given to the type and stage of the cancer, women desire to continue with the pregnancy, and the risk of modifying or delaying treatment . These studies demonstrate good maternal and fetal outcomes comparable to those seen in older studies . Conservative management is also supported by the fact that up to 71% of benign ovarian masses will either decrease in size or resolve spontaneously . The royal college of obstetricians and gynaecologists (rcog) in one of its guidelines stated, simple, unilateral, unilocular, ovarian cysts less than 5 cm in diameter have a low risk of malignancy . It is recommended that in the presence of a normal serum ca125, they can be managed conservatively . The american society of radiologists issued guidance for management of incidental adnexal masses noted on imaging nonpregnant, asymptomatic women . The intent was to determine which masses do not require follow - up imaging, which ones require follow - up imaging, and which ones require surgical intervention . Using sonographic assessment, stratification for further evaluation was done . Simple cysts (anechoic, smooth, thin wall, no septations) of 5 - 7 cm size in a premenopausal woman should be reimaged yearly . Hemorrhagic cyst of size greater than 5 cm in premenopausal women should be reimaged in 6 - 12 weeks . A hemorrhagic cyst of any size in early menopause (within 1 - 5 years since last menses) should be reimaged in 6 - 12 weeks; however, a hemorrhagic cyst of any size in late menopause (> 5 years since last menses) warrants surgical evaluation . Endometriomas or dermoid cysts should be followed up yearly, if not surgically removed at any age . Cysts with thin - walled septations should be reimaged in 6 - 12 weeks or, if stable, can be followed up yearly premenopausal . Cysts containing nodules with blood flow or thick septations (> 3 mm) should warrant surgical management at any age . These recommendations are intended for the non - pregnant women with an incidental finding on uss and are reserved for those cysts that are truly worrisome for malignancy . Several studies are available supporting that similar management would be reasonable for masses found in pregnant patients . Schmeler et al . Reviewed 59 pregnant patients from 1999 to 2003, who underwent either surgical or observational management for an adnexal mass of 5 cm or greater . In the study, 17 patients underwent antepartum surgery (15 laparotomies, 2 laparoscopies) and 42 patients were observed during pregnancy with their surgery performed intrapartum at the time of cesarean section or postpartum . All five malignancies (four malignant, one borderline) were in the antepartum surgery group (5/17 or 29%). One of the surgical management patients experienced preterm premature rupture of membranes at 23 weeks and delivered prematurely at 28 weeks . No other adverse fetal outcomes were noted in either group of patients . In an earlier observational trial by zanetta et al ., complete or near - complete resolution was observed in 69% of simple cysts, 77% of endometrioid - appearing cysts, and 57% of simple cyst with minimal complex components . No resolution occurred in masses with features of mature teratoma or in borderline - appearing mass . In the 31 masses that persisted after pregnancy, these observations certainly make conservative management a viable option for those masses of low complexity noted on uss . Ovarian malignancies are rare during pregnancy, and when they do occur are likely to be of early stage and have favorable outcome . A small retrospective study by kumari et al . Malignancies in all of these observational studies suggest that with the use of tvs for risk stratification and due to the low likelihood of malignancy in the pregnant population, one may choose to advocate postponing surgery of even complex masses found in the asymptomatic pregnant patient until postpartum . These studies demonstrate good maternal and fetal outcomes comparable to those seen in older studies . Conservative management is also supported by the fact that up to 71% of benign ovarian masses will either decrease in size or resolve spontaneously . The royal college of obstetricians and gynaecologists (rcog) in one of its guidelines stated, simple, unilateral, unilocular, ovarian cysts less than 5 cm in diameter have a low risk of malignancy . It is recommended that in the presence of a normal serum ca125, they can be managed conservatively . The american society of radiologists issued guidance for management of incidental adnexal masses noted on imaging nonpregnant, asymptomatic women . The intent was to determine which masses do not require follow - up imaging, which ones require follow - up imaging, and which ones require surgical intervention . Using sonographic assessment, stratification for further evaluation was done . Simple cysts (anechoic, smooth, thin wall, no septations) of 5 - 7 cm size in a premenopausal woman should be reimaged yearly . Hemorrhagic cyst of size greater than 5 cm in premenopausal women should be reimaged in 6 - 12 weeks . A hemorrhagic cyst of any size in early menopause (within 1 - 5 years since last menses) should be reimaged in 6 - 12 weeks; however, a hemorrhagic cyst of any size in late menopause (> 5 years since last menses) warrants surgical evaluation . Endometriomas or dermoid cysts should be followed up yearly, if not surgically removed at any age . Cysts with thin - walled septations should be reimaged in 6 - 12 weeks or, if stable, can be followed up yearly premenopausal . Cysts containing nodules with blood flow or thick septations (> 3 mm) should warrant surgical management at any age . These recommendations are intended for the non - pregnant women with an incidental finding on uss and are reserved for those cysts that are truly worrisome for malignancy . Several studies are available supporting that similar management would be reasonable for masses found in pregnant patients . Schmeler et al . Reviewed 59 pregnant patients from 1999 to 2003, who underwent either surgical or observational management for an adnexal mass of 5 cm or greater . In the study, 17 patients underwent antepartum surgery (15 laparotomies, 2 laparoscopies) and 42 patients were observed during pregnancy with their surgery performed intrapartum at the time of cesarean section or postpartum . All five malignancies (four malignant, one borderline) were in the antepartum surgery group (5/17 or 29%). No malignancies were diagnosed on final pathology in the observational group . Of note, one of the surgical management patients experienced preterm premature rupture of membranes at 23 weeks and delivered prematurely at 28 weeks . No other adverse fetal outcomes were noted in either group of patients . In an earlier observational trial by zanetta et al ., complete or near - complete resolution was observed in 69% of simple cysts, 77% of endometrioid - appearing cysts, and 57% of simple cyst with minimal complex components . No resolution occurred in masses with features of mature teratoma or in borderline - appearing mass . In the 31 masses that persisted after pregnancy, these observations certainly make conservative management a viable option for those masses of low complexity noted on uss . Ovarian malignancies are rare during pregnancy, and when they do occur are likely to be of early stage and have favorable outcome . A small retrospective study by kumari et al . Did, however, malignancies in all of these observational studies suggest that with the use of tvs for risk stratification and due to the low likelihood of malignancy in the pregnant population, one may choose to advocate postponing surgery of even complex masses found in the asymptomatic pregnant patient until postpartum . Surgery is indicated when physical examination or imaging of a pregnant woman reveals an adnexal mass that is suspicious of malignancy, but the physician must weigh the benefit of prompt surgery against the risk to the pregnancy . Traditionally, surgery for adnexal masses in pregnancy has been performed by laparotomy to provide the best exposure to the pelvis as well as upper abdomen, should surgical staging be indicated . Disadvantages to laparotomy include increased postoperative recovery time, and increased incisional pain and discomfort that may limit a patient's mobility, thereby potentiating the risk of postoperative thromboembolism in a patient population that is already at high risk . These factors raise the question as to the feasibility and safety of laparoscopy in pregnancy . In a retrospective comparative review of 88 pregnant women undergoing surgical intervention for adnexal pathology, 39 patients underwent laparoscopy in the first trimester compared to 54 patients undergoing laparotomy (25 in the first trimester and 29 in the second trimester). No operative or postoperative maternal complications occurred in either group, with five women having first trimester miscarriages and two newborns having congenital malformations in the laparoscopy group compared to two first trimester miscarriages and one congenital malformation in the laparotomy group, illustrating that laparoscopy is safe and should be considered if technically feasible . The advantages of laparoscopy are evident in a randomized comparison of laparoscopy versus laparotomy for benign adnexal masses, in which laparoscopy was associated with significantly lesser operative time, lesser perioperative morbidity, reduced length of hospital stay, and decreased postoperative pain resulting in faster postoperative ambulation and return to regular activity, which is very important in pregnancy because of the increased thrombotic events . Laparoscopy is now widely used in most gynecological malignancies including staging of ovarian cancer . Currently, there are no prospective studies comparing laparotomy and laparoscopy to determine which approach is superior . Studies comparing techniques are unlikely because of the limited number of pregnant patients requiring surgery for such a mass . However, multiple observational studies have demonstrated that laparoscopic management of adnexal masses in pregnancy is technically feasible and should no longer be considered contraindicated in pregnancy . Yuen et al . Reported a series of 67 women undergoing laparoscopic surgery for an adnexal mass in pregnancy . In this series, 2 of 67 (3%) given the delayed timing of the miscarriage, it is unlikely that it was secondary to her laparoscopic procedure . Lenglet et al . Reported that 26 of 26 patients had no complications related to surgery . Ko et al . Reported 11 patients with no complications from laparoscopy and have shown favorable outcomes for laparoscopy, even in the first trimester . Soriano et al . Performed a retrospective review comparing 454 patients undergoing laparotomy with 34 patients having laparoscopy . The miscarriage rate was similar between the two groups, but was higher when surgery was performed by either route in the first trimester . However, reedy et al . Published an observational study of patients in swedish health registry, comparing the outcomes of laparotomy and laparoscopy for the management of adnexal masses in pregnancy . During the 20-year span from 1973 to 1993 this study did not identify any difference in birth weight, gestational age, intrauterine growth restriction, infant survival, or fetal malformation . These reports and observations demonstrate that the benefits of laparoscopic surgery with respect to lesser pain, reduced length of hospital stay, earlier ambulation, decreased blood loss, and the lower rate of infection may outweigh those of open traditional laparotomy . In spite of the availability of these facts, there is still controversy over the effect of pneumoperitoneum on the fetus . The literature includes reports of more than 500 laparoscopic procedures on pregnant women; only one publication includes reports of adverse fetal events over the rate anticipated with laparotomy . Amos et al . Observed four fetal deaths in seven women undergoing laparoscopic surgery, as compared to no fetal death in concurrent laparotomy group . The authors postulated that fetal demise might have been related to acidosis despite the fact that maternal co2 levels were maintained within the standard physiological range . Laparoscopy for an adnexal mass during pregnancy should be undertaken by those well - trained in the art . Certain guidelines and recommendations must be adhered to, such as non - urgent cases should optimally be scheduled at 16 - 20 weeks, open hassan technique is the preferred route of initial entry, and trocars should be placed at least 6 cm above the fundus or left upper quadrant . A guideline from the society of american gastrointestinal and endoscopic surgeons, published in 2011, makes the following recommendation: laparoscopy is safe and effective treatment in gravid patients with symptomatic ovarian cystic masses . Observation is acceptable for all other cystic lesions provided uss is not concerning for malignancy and tumor markers are normal . Initial observation is warranted for more cystic lesions less than 6 cm in size . When considering surgery for an adnexal mass in pregnancy, the surgeon must optimize both maternal outcome and fetal well - being while performing an expeditious removal of the mass . Pregnant women undergoing surgery are at overall risk of prematurity (up to 22%) compared with pregnant women not undergoing surgery, regardless of the route of the procedure . The main disadvantage of delaying surgery during pregnancy is the risk of the mass undergoing torsion, rupture, or infarction, acute abdomen, and most importantly the risk of malignant change in case of ovarian mass . If the mass turns out to be ovarian cancer, the treatment of the pregnant woman is similar to that of the non - pregnant women depending on the stage, gestational age, as well as staging and grade of the tumor . In certain circumstances, it may be justified to remove the tumor only and await fetal maturation, while in some cases chemotherapy may even be given while awaiting pulmonary maturation . Widespread use of antenatal uss has made the diagnosis of adnexal masses in pregnancy more common . It seems reasonable to remove all ovarian masses over 10 cm in diameter because of the substantial risk of malignancy . Tumors 6 - 10 cm in diameter should be carefully evaluated for the possibility of neoplastic disease by the use of uss or mri or both . Consequently, in the absence of symptoms or sonographic findings concerning malignancy, patients should be managed expectantly . If the evaluation suggests neoplasm, then surgery is indicated, either by laparotomy or laparoscopy . If corpus luteum is removed before 8 weeks, then progesterone supplement should be given.
A cross - sectional design was employed . For this study 73 patients with diagnosis of schizophrenia patients were required to be aged between 20 - 60 years, of either gender with diagnosis of schizophrenia (as per mini). Patients with comorbid axis - i psychiatric disorders (except nicotine dependence), personality disorders, mental retardation and comorbid physical disorder were excluded . A 17 item hindi questionnaire was designed specifically to study individual's beliefs in various types of magico - religious beliefs, the role of magico - religious beliefs in causation of mental illness / behavioural abnormalities and the role of treatment based on such beliefs . Additionally, the questionnaire also had the provision to assess the role of stress (which is understood more as tension in our community) and changes in neuro - chemicals in causation of schizophrenia . The questions were developed in the line of supernatural attitude questionnaire, an instrument which was developed about a decade ago by one of the authors (pk). Various items of the questionnaire were based on commonly prevalent magico - religious beliefs in our society . One item in the questionnaire covered the role of stress in development of mental illness and another item evaluated the understanding of patients with respect to the role of change in neuro - chemicals in the brain as the aetiology of mental illness . Regarding treatment, the questionnaire covered areas like seeking treatment from faith healers and performing religious rituals . The last question asked about the prevalence of magico - religious beliefs in the locality to which the patient belongs . The language of the questionnaire was simple and the responders were instructed to answer the questions in yes or no . They were explained the nature of the study and written informed consent was obtained from the patients . Patients were first assessed on mini to confirm the diagnosis of schizophrenia and to rule out other comorbid psychiatric disorders . Physical comorbidity was ruled on the basis of available history . Only those patients who fulfilled the inclusion and exclusion criteria were recruited . They were explained the nature of the study and written informed consent was obtained from the patients . Patients were first assessed on mini to confirm the diagnosis of schizophrenia and to rule out other comorbid psychiatric disorders . As shown in table 1, the mean age of the study sample was 31.65 (sd 8.76) years and mean number of years of education was 12.75 (sd 4.43). Majority of the patients were males, unemployed, hindu, from non - nuclear family and came from rural background . Sociodemographic and clinical profile of the patients the mean age of onset of schizophrenia was 24.76 (sd 6.89) years and the mean duration of illness was 6.80 (sd 4.27) years . About half of the sample was diagnosed to have paranoid schizophrenia (47.9%) and another 43.8% were diagnosed to have undifferentiated schizophrenia and the rest (8.2%) had other subtypes of schizophrenia . Of the 73 patients, 40 (58%) had personal convictions in magico - religious beliefs . Nearly similar percentage of patients (61.6%) admitted that people in their community also held these beliefs . As shown in table 2, the most common among the various magico - religious beliefs were those of sorcery / witchcraft (jaadu tona) followed by spirit intrusion (opari kasar). Of the patients who had personal magico - religious beliefs, 75% (30 out of the 40 patients) had more than one magico - religious belief . Beliefs of patients about magicoreligious beliefs on questions of causation of mental illness, as shown in table 2, about one - third of the patients attributed their illness to sorcery / witchcraft (jaadu tona) and this was the most commonly attributed supernatural cause . This was followed by planetary / celestial influences (grah nakchatra), bad deeds in previous life (karma), spirit intrusion (opari kasar), evil spirits (buri atma), ghosts (bhoot - pret) and divine wrath (devi devta prakop). Overall, about two - third of the sample attributed their symptoms to one of the above stated causes and about 40% attributed their symptoms to more than one of the above causes . Additionally, 63% of patients also accepted that stress can lead to the development of mental illness and 70% also agreed that change in neuro - chemical balance can lead to symptoms of mental illness . When both these factors were taken together, 60 (82.2%) patients attributed the symptoms of mental illness to either of these causes, with majority 37 (51%) attributing the same to both . Of the 60 patients who attributed their symptoms to stress or change in neuro - chemical balance, 42 also attributed their symptoms to magico - religious causes . Only 6 patients attributed their symptoms exclusively to stress or change in neuro - chemical balance, and these 6 patients did not have any conviction in magico - religious beliefs . Of the total 73 patients, only 7 (10%) did not attribute their mental illness to either magico - religious belief, or stress / change in neurochemicals in the brain . Offering prayers only was considered sufficient for treatment of mental illnesses by 46% of the patients . A minority of the patients (10%) considered that performing magico - religious rituals only may be sufficient for the management of symptoms of mental illness . In terms of actual practice, about two - third (63.1%) actually performed prayers during the most recent episode to get rid of their symptoms and about one - fourth (24.7%) admitted that magico - religious rituals were performed during their most recent episode of symptoms . Relationship between supernatural beliefs and sociodemographic and clinical variables compared to females, males more frequently believed in spirit intrusion (opari kasar) (chi - square test with yate's correction - 4.12; p=0.04). Significantly higher percentage of married patients believed in sorcery / witchcraft (jaadu - tona) (chi - square test - 3.94; p=0.04). Older patients (spearman rank correlation coefficient - 0.266; p=0.023) and those who were less educated (spearman rank correlation coefficient - 0.290; p=0.013) more frequently believed in sorcery / witchcraft (jaadu - tona). None of the other sociodemographic and clinical variables had any association with personal belief system . There was no significant difference between the genders with respect to attribution of symptoms to various magico - religious beliefs, stress or change in neuro - chemical balance . Compared to patients who were single at the time of assessment, significantly higher percentage of married patients attributed their symptoms to ghosts (bhoot - pret) (chi - square test - 4.35; p=0.037). Significantly lower percentage of patients from rural background attributed their symptoms to stress (chi - square test - 6.30; p=0.012). Additionally, patients with lower level of education believed that mental illness can be caused by sorcery / witchcraft (jaadu - tona) (spearman rank correlation coefficient - 0.231; p=0.049) and ghosts (bhoot - pret) (spearman rank correlation coefficient - 0.236; p=0.044). None of the other sociodemographic variables and clinical variables had any significant association with aetiological models . None of the sociodemographic variable had significant association when the patients with one or more supernatural etiological model were compared with those without any super - natural causation . Similarly, none of the sociodemographic variable had significant association when the patients with social and biological aetiological model were compared with those without any social and biological aetiological model except for education level of patients . There was no significant difference between the genders with respect to performing prayers, magico religious rituals, or beliefs about the usefulness of prayers and magico - religious rituals in symptoms removal . Patient with lower level of education more frequently resorted to magico - religious treatment (spearman rank correlation coefficient - 0.275; p=0.019), whereas patients from higher income indulged in prayers (spearman rank correlation coefficient - 0.290; p=0.013). None of the other sociodemographic variables and clinical variables had any significant association with beliefs about treatment and help seeking behaviour . On questions of causation of mental illness, as shown in table 2, about one - third of the patients attributed their illness to sorcery / witchcraft (jaadu tona) and this was the most commonly attributed supernatural cause . This was followed by planetary / celestial influences (grah nakchatra), bad deeds in previous life (karma), spirit intrusion (opari kasar), evil spirits (buri atma), ghosts (bhoot - pret) and divine wrath (devi devta prakop). Overall, about two - third of the sample attributed their symptoms to one of the above stated causes and about 40% attributed their symptoms to more than one of the above causes . Additionally, 63% of patients also accepted that stress can lead to the development of mental illness and 70% also agreed that change in neuro - chemical balance can lead to symptoms of mental illness . When both these factors were taken together, 60 (82.2%) patients attributed the symptoms of mental illness to either of these causes, with majority 37 (51%) attributing the same to both . Of the 60 patients who attributed their symptoms to stress or change in neuro - chemical balance, 42 also attributed their symptoms to magico - religious causes . Only 6 patients attributed their symptoms exclusively to stress or change in neuro - chemical balance, and these 6 patients did not have any conviction in magico - religious beliefs . Of the total 73 patients, only 7 (10%) did not attribute their mental illness to either magico - religious belief, or stress / change in neurochemicals in the brain . Offering prayers only was considered sufficient for treatment of mental illnesses by 46% of the patients . A minority of the patients (10%) considered that performing magico - religious rituals only may be sufficient for the management of symptoms of mental illness . In terms of actual practice, about two - third (63.1%) actually performed prayers during the most recent episode to get rid of their symptoms and about one - fourth (24.7%) admitted that magico - religious rituals were performed during their most recent episode of symptoms . Relationship between supernatural beliefs and sociodemographic and clinical variables compared to females, males more frequently believed in spirit intrusion (opari kasar) (chi - square test with yate's correction - 4.12; p=0.04). Significantly higher percentage of married patients believed in sorcery / witchcraft (jaadu - tona) (chi - square test - 3.94; p=0.04). Older patients (spearman rank correlation coefficient - 0.266; p=0.023) and those who were less educated (spearman rank correlation coefficient - 0.290; p=0.013) more frequently believed in sorcery / witchcraft (jaadu - tona). None of the other sociodemographic and clinical variables had any association with personal belief system . There was no significant difference between the genders with respect to attribution of symptoms to various magico - religious beliefs, stress or change in neuro - chemical balance . Compared to patients who were single at the time of assessment, significantly higher percentage of married patients attributed their symptoms to ghosts (bhoot - pret) (chi - square test - 4.35; p=0.037). Significantly lower percentage of patients from rural background attributed their symptoms to stress (chi - square test - 6.30; p=0.012). Additionally, patients with lower level of education believed that mental illness can be caused by sorcery / witchcraft (jaadu - tona) (spearman rank correlation coefficient - 0.231; p=0.049) and ghosts (bhoot - pret) (spearman rank correlation coefficient - 0.236; p=0.044). None of the other sociodemographic variables and clinical variables had any significant association with aetiological models . None of the sociodemographic variable had significant association when the patients with one or more supernatural etiological model were compared with those without any super - natural causation . Similarly, none of the sociodemographic variable had significant association when the patients with social and biological aetiological model were compared with those without any social and biological aetiological model except for education level of patients . There was no significant difference between the genders with respect to performing prayers, magico religious rituals, or beliefs about the usefulness of prayers and magico - religious rituals in symptoms removal . Patient with lower level of education more frequently resorted to magico - religious treatment (spearman rank correlation coefficient - 0.275; p=0.019), whereas patients from higher income indulged in prayers (spearman rank correlation coefficient - 0.290; p=0.013). None of the other sociodemographic variables and clinical variables had any significant association with beliefs about treatment and help seeking behaviour . Hence, the traditional beliefs about mental illnesses are being challenged by the western biomedical models . In contrast to traditional indian model, where family members take most of the treatment decisions, the western biomedical model emphasizes the concept of autonomy and patient's / caregiver's active participation in treatment decisions . Hence, understanding personal beliefs and explanatory models about mental illness as understood by the patients may be useful in planning management strategies . In this era of flux, from social anthropology point of view the present study evaluated personal magico - religious beliefs, role of magico - religious beliefs in causation of symptoms, role of biological and social factors in causation of symptoms and help seeking behaviour of patients with schizophrenia attending psychiatry outpatient clinic of a general hospital psychiatric unit . . Further, some of the studies had used qualitative methods and then presented the data in the quantitative form . It is quite possible that some of the patients gave socially desirable answers to some of these questions when asked directly . Hence, the present study evaluated the personal supernatural beliefs and etiological models using a self - rated questionnaire in which the patients had the option of rating each question as yes or no. The study sample comprised of patients of schizophrenia of fairly long duration of illness, with a comparatively high degree of education (mean number of years of education - 12.75), primarily from rural background . With increase in literacy rates in the country and availability of treatment for this study demonstrates that magico - religious beliefs are quite common in north indian community and majority of patients have personal magico - religious beliefs . In their study on key relatives from our centre, kulhara et al . Had enquired about the patients supernatural beliefs from the relatives and reported that 35% patients had belief in sorcery during the course of the illness, 25% each believed in ghost / evil spirit and spirit intrusion . The findings of the present study are more or less similar, suggesting that over the years there is no appreciable change in the prevalence of super - natural beliefs in patients with schizophrenia . Findings of etiological attribution to magico - religious causes in about two - third of the patients in the present study is in concurrence with one of the earlier studies from india, which reported that a vast majority of the patients attributed the symptoms of schizophrenia to magico - religious and mystical factors . This possibly suggests that the magico - religious beliefs are quite prevalent in various parts of the country and further indicate that patients hold aetiological models which necessarily are not in line with professionals understanding of the genesis of mental disorders . The finding of the present study with respect to supernatural causes is also supported by findings from other developing countries . The findings of the present study are also supported by some of the studies conducted on the key relative of patients with schizophrenia, but are in contradiction to some . Further, comparison of the findings of the present study with respect to aetiological attribution with the findings of kulhara et al, reveals that despite the passage of more than a decade during which awareness of various psychiatric disorders and knowledge available pertaining to treatment have presumably increased, the prevalence of magico - religious attribution continues to be same . In the present study, this finding is in contrast to study from south india, in which social and biological causes were reported less frequently . The possible reasons for this disparity could be the type of patients included . The study from south india had drug naive first episode psychosis patients, in contrast to the present study's sample which comprised of patients in various phases of the illness . It is quite possible that many of our patients might have received some kind of psychoeducation about their illness during the long contact with psychiatric services and hence had some understanding about biological and social underpinning of their illness . Further, intake of psychotropics and change in symptomatology may also have facilitated believe in biological and social causation of their illness . However, from social anthropology view point, attribution of symptoms to biological causes by two - third of the patients may be a reflection of the changing cultural values . In an earlier study from our centre, in which key relatives of patients with schizophrenia were evaluated, 46% of them had admitted that supernatural beliefs are generally accepted in the community . In the present study about two - third of the patients admitted that supernatural beliefs are prevalent in their locality . This increase in reporting in the present study could be due to use of self - report measure . In the present work, the number of patients who sought magico - religious remedial measures during their most recent episode is less than that reported in some of the studies from other parts of india and a study from our centre . This could be a possible reflection of the change in the attitude of the patients towards mental illnesses . It is also possible that patients are under - reporting such practices . Taken together, from social anthropology view point, more patients now attribute their symptoms to biological causes and fewer patients seek magico - religious measures . This suggests that over the years, it is possible that more and more patients would accept biological causes for their symptoms and seek help from mental health professional . The data pertaining to association between various illness models and help seeking behaviour are rather limited . The present study shows that patient with lower level of education are more likely to believe that mental illness can be caused by sorcery / witchcraft (jaadu - tona) and ghosts (bhoot - pret). Additionally, present study suggests that significantly lower percentage of patients from rural background attributed their symptoms to stress and patient with lower level of education more frequently sought magico - religious treatment . Taken together, it can be hypothesized that supernatural illness models are more common in less educated rural population and seeking intervention from faith - healers is in conformity with their belief and explanatory systems . The present study is limited by small sample size, purposive sampling and cross - sectional design . The study included patients attending psychiatry outpatient of a general hospital unit, hence the findings cannot be generalized to patients in primary care or a mental hospital settings . Since the study included patients in psychiatry out - patient care, it is quite possible that the findings of the present study may actually be an underestimate of the true prevalence of the supernatural beliefs and aetiological models based on them . Further, we used a self rated instrument to asses the supernatural beliefs and aetiological models . It is quite possible that many participants would have interpreted questions according to the cultural background and would have responded accordingly . To conclude, the present study demonstrates that super - natural beliefs are quite common in north indian community and majority of the patients attribute their symptoms to one of the supernatural cause . However, majority of the patient's additionally have a biological model of causation of their symptoms . This possibly also explains dual nature of seeking treatment i.e., seeking psychiatric treatment and at the same time simultaneously participating in religious and magico - religious rituals for possible amelioration of psychiatric distress . From the perspective service planning and health delivery systems, educating the sufferers and their caregivers as well as traditional healers about the virtues of proper medical treatment of such ailments may be a beneficial effort.
It includes behaviors such as slapping, hitting, rape, recklessness, driving and shooting in school, truancy, road rage and other high - risk behaviors . Nearly 18.6% of females aged 12 - 17 got into a serious fight at school or work . 14.1% participated in a group - against - group fight and 5.7% attacked another person with an intent to seriously harm him / her . In india, researchers have focused on factors such as perceived popularity among the peer group, romantic relations, the risk factors such as family system, environment, aggressive parents and academic performance, peer aggression, victimization and social relationships, prevalence and gender difference . The increasing crime rates and violent activities of youth in india have made the researchers to focus on aggression among youth . There is a need for the proper assessment of youth for aggression and development of prevention and intervention modules for youth in indian context . The present study aims to understand the factors (prevalence, risk factors and protective factors associated with aggression in six cities of india (bangalore, uttar pradesh, madhya pradesh, rajasthan, jammu and kashmir, kerala and sikkim) the sample consisted of 6500 subjects, from which 1024 incomplete protocols were not considered for analysis . Total of 5476 data's (2785 males and 2691 females) in the age range of 15 - 26 years were taken for the study . The data collected (individual administration of protocols) from the communities (college, residential, apartments and workplace) of bangalore, jammu, indore, kerala, rajasthan, sikkim and delhi using english / hindi / kannada version of the questionnaire . Anger data sheet: developed by the investigator, provides information about the subject socio - demographic variable, situations associated with anger, type of anger style of expression of anger, control over aggressive ideation and protective factors for controlling the aggression and risk factors such as substance abuse, mood disturbance, childhood experience, academic effects, family influence, peer influence, media influence etc ., were involved . Clinical anger scale was used to measure the psychological symptoms presumed to have relevance in understanding and treatment of clinical anger . It has 21 items and it has reliability coefficient of 94 (male and female together). Test reliability was 71 for anger and 90 for physical aggression and total scale resilience . It has eight dimensions, which are self - assurance, personal vision, flexible and adaptable, organized, problem solver, interpersonal competence, socially connected and active . There are 32 items each item has five point rating from strongly disagree to strongly agree . Subgroup analysis, analysis of variance and chi - square were also used to analyze the data . Subgroup analysis, analysis of variance and chi - square were also used to analyze the data . A total of 5476 participants, 2785 males and 2691 females protocol were taken for the study . The data was collected from different communities (college, residential, apartments and workplace) of bangalore, jammu, indore, kerala, rajasthan, sikkim and delhi . The maximum percentage of the sample was in the age range of 18 - 20 years, in this 47% of them were females and 53% of them were males and 94.7% were single, 4.3% were married . Nearly, 17.7% of them experience of anger and 17% of them had physical aggression . The youth in the age group of 16 - 19 years had frequent experience of aggression in comparison to the age group of 20 - 26 years . There was a significant difference between males and females in the experience and expression of aggression . The subjects reported that work pressure (28.3%), alcohol (15.1%), violent activities (14.8%), exposure to family violence / violence in media (9.2%) had been associated with experience / expression of aggression / road rage . In this survey, about 20.4% involved themselves in physical violence, 12.3% also used weapons during expression of aggression . In the family context, 37% of the participants got hurts from their parents physically or emotionally, 14.8% of the parents had hurts each other emotionally or physically, 36.6% reported their parents had used physical means to discipline them . The mean score on the total of buss - perry aggression scale is 80.24, standard deviation is 19.59 f value is 63.71 and p value 0.00 (significance level 0.001) indicates significant difference among the mean scores of the group . The mean score of indore (91.67) and jammu (83.08) showed a high score on the total of buss - perry aggression scale, which indicates that jammu and indore groups have high - level of aggression compared with other regions . For management of aggression, the following themes emerged includes discussing with others (29%), solving problems individually (24.9%) and exploring the reasons for anger (18.1%); 37.1% perceives managing the anger with proper guidelines; 32.8% perceived explaining positives and negative effects of anger expression by encouraging healthy expression of anger; 23.9% perceives strict implementation of law such rules and regulation was the role of law and order in managing the anger in the society; 47.7% perceived encouraging healthy and positive programs in the media; 22.7% perceives promoting healthy expression of anger and positive role models and 20.7% perceives promoting the information about counseling and its centers was the role of media in managing anger in the society . Among them, 7% use substance occasionally in the form of tobacco but none of them met the clinical criteria of dependence . There was a significant relation in the subjects who consume substance and the level of aggression in them . The chi - square value was 14.016, p value is 0.001, which is significant at 0.01 levels . The subjects who consumed substance abuse had a high score (21.7) on aggression when compared with the non - substance abuser [table 1a]. Comparison of substance abuse and aggression nearly, 49.2% of the group reported experience of frequent mood disturbance . Around 5.2% of them felt most of the time there was a strong relation between aggression and mood disturbance [table 1b]. Comparison of mood disturbance with aggression the chi - square value of 16.919 and p value of 0.000, which was significant at 0.001 levels, which indicates there, was a significant relation with mood disturbance and aggression . On examination, 5% of the sample always experienced loneliness, 4.9% always experienced lack of concentration . Psychological problems such as sadness of mood, disturbed sleep, irrational fear, anxious, suspicious were experienced rarely or some of the times by the subjects . The chi - square value was 169.59 and p value was 0.000, which was significant at 0.001 levels, which indicated a significant relation between attention deficit - hyperactivity disorder (adhd) and aggression [table 1c]. Psychological problems (adhd and aggression) the correlation analysis indicates that there was a significant positive relationship between aggression and failures in academics, verbal or physical fights in schools or colleges, anger expressed in their educational institutes punishment received from the educational institutes . It showed that failure in academics and anger expression in educational institutions are directly related to level of aggression in the youth [table 1d]. Frequency and correlation of academic experience and anger expression in college nearly, 44.2% of the subject's peer group had frequent mood disturbance . 17.3% of peer group were involved in the physical violence, 13.1% of peer involved in the legal constraints 19.2% peer involved in the gang attacks . 21.5% of subjects were provoked to involve for aggression by the peer group, 20.7% of the subjects had received a threat from other gang and 11.8% of the subjects reported that their friends use weapons in violence . There was a significant positive relationship with peer influence and youth [table 1e]. Peer group violence reported by the subjects it indicated that peer violence had a direct influence on youth aggression . The chi - square value of gender difference of anger management by peer group is 66.78 and p value was 0.000, which was significant . It indicates there was a significant gender difference in the management of anger in the peer group [table 2]. Anger management ways by peer group correlation analysis relieves that resilience and risk factors such as substance use, mood disturbance, physical abuse, sexual abuse, failure in academics, missed college regularly; anger expressed in school or college, childhood experience, adhd, family influence, peer influence, media influence and psychological problems in participants has a negative relationship [table 3]. Correlation values of risk factors of aggression with resilience the model has proposed based on the risk factors assessed from the current study [figure 1]. It indicates that there is influence of all these factors for youth aggression . In the current study, all these factors has individual positive relationship to aggression, substance abuse (0.001), mood disturbance (0.000), family influence (0.000), peer influence (0.000), psychological problems such adhd, sadness of mood, loneliness, anxious, irrational fear, suspicious etc ., (0.000), academic influence (0.001), childhood experience (0.01), physical and sexual abuse (0.000), tv and media (0.000). Among them, 7% use substance occasionally in the form of tobacco but none of them met the clinical criteria of dependence . There was a significant relation in the subjects who consume substance and the level of aggression in them . The chi - square value was 14.016, p value is 0.001, which is significant at 0.01 levels . The subjects who consumed substance abuse had a high score (21.7) on aggression when compared with the non - substance abuser [table 1a]. Nearly, 49.2% of the group reported experience of frequent mood disturbance . Around 5.2% of them felt most of the time there was a strong relation between aggression and mood disturbance [table 1b]. Comparison of mood disturbance with aggression the chi - square value of 16.919 and p value of 0.000, which was significant at 0.001 levels, which indicates there, was a significant relation with mood disturbance and aggression . On examination, 5% of the sample always experienced loneliness, 4.9% always experienced lack of concentration . Psychological problems such as sadness of mood, disturbed sleep, irrational fear, anxious, suspicious were experienced rarely or some of the times by the subjects . The chi - square value was 169.59 and p value was 0.000, which was significant at 0.001 levels, which indicated a significant relation between attention deficit - hyperactivity disorder (adhd) and aggression [table 1c]. The correlation analysis indicates that there was a significant positive relationship between aggression and failures in academics, verbal or physical fights in schools or colleges, anger expressed in their educational institutes punishment received from the educational institutes . It showed that failure in academics and anger expression in educational institutions are directly related to level of aggression in the youth [table 1d]. 17.3% of peer group were involved in the physical violence, 13.1% of peer involved in the legal constraints 19.2% peer involved in the gang attacks . 21.5% of subjects were provoked to involve for aggression by the peer group, 20.7% of the subjects had received a threat from other gang and 11.8% of the subjects reported that their friends use weapons in violence . There was a significant positive relationship with peer influence and youth [table 1e]. Peer group violence reported by the subjects the chi - square value of gender difference of anger management by peer group is 66.78 and p value was 0.000, which was significant . It indicates there was a significant gender difference in the management of anger in the peer group [table 2]. Correlation analysis relieves that resilience and risk factors such as substance use, mood disturbance, physical abuse, sexual abuse, failure in academics, missed college regularly; anger expressed in school or college, childhood experience, adhd, family influence, peer influence, media influence and psychological problems in participants has a negative relationship [table 3]. The model has proposed based on the risk factors assessed from the current study [figure 1]. It indicates that there is influence of all these factors for youth aggression . In the current study, all these factors has individual positive relationship to aggression, substance abuse (0.001), mood disturbance (0.000), family influence (0.000), peer influence (0.000), psychological problems such adhd, sadness of mood, loneliness, anxious, irrational fear, suspicious etc ., (0.000), academic influence (0.001), childhood experience (0.01), physical and sexual abuse (0.000), tv and media (0.000). Its association with reported that work pressure, substance use, violent activities, family disturbance, road rage, mood disturbance, psychological problems and peer relationships . Resilience had a negative relationship with substance use, mood disturbance, physical abuse, sexual abuse, failure in academics, missed college regularly, anger expressed in school or college, childhood experience, adhd, family influence, peer influence, media influence and psychological problems . That jammu and indore groups have high - level of aggression compared to other regions . It management has been highlighted in the form of discussing with others, solving problems individually, exploring the reasons for anger; educating themselves about the positives and negative effects of anger expression by encouraging healthy expression of anger; strict implementation of law such rules and regulation in managing the anger in the society; healthy and positive programs in the media and healthy expression of aggression; sensitization about the availability of counseling and its management . The presence of abnormal scores of aggression among children in the age range of 14 - 19 years in the indian context and students (mean age of 28.7 years . Boys were found to be more physically and verbally aggressive than girls, but girls used more indirect aggression at the higher year levels.- higher percentage of women engaged in verbal aggression (95.3% vs. 92.8%), whereas the males engaged in more severe physical aggression (4.6% vs. 2.0%) and produced worse consequences for their female partners health (especially slight cuts / slight bruises, broken nose, black eye, broken bone and requiring medical treatment / hospitalization). Women reportedly attacked their partners while under the influence of emotional states of intense anger (22.4% vs. 13.9%), whereas males did so in response to aggression received (13.0% vs. 6.6%). Physical aggression decreased significantly across the age groups, but health consequences became more severe with age (e.g., broken nose, black eye, broken bone, went from 1% at 16 years to 4.5% at 20 years of age). Risk factors strongly related to later violence were distributed among the five domains of hyperactivity (parent rating), low academic performance, peer delinquency and availability of drugs in the neighborhood predicted violence from ages 10, 14 and 16 years . Youths exposed to multiple risks were notably more likely than others to engage in later violence . A dependent group had high mean scores for state anger, trait anger and expression / experience of anger . Alcohol dependent persons have high expression and experience of anger leading to low quality - of - life . A history of abuse, failing a grade and dealing drugs was also independently associated with violence while having a regular partner was protective . Delinquent peer influences, antisocial personality traits, depression and parents / guardians who used psychological abuse in intimate relationships were consistent risk factors for youth violence and aggression poor academic performance, peer rejection and psychosomatic complaints with high - levels of anger . The present model of risk factor for aggression among youth has also been corroborated by the presence of risk factors available in the review of literature in the form of developmental stages (e.g., maternal substance abuse, community disorganization, residential mobility, exposure to violence, family socio - economic status); executive dysfunction (e.g., difficulty connecting actions and consequences, adapting to new circumstances, processing information to set and realize goals), chronic under arousal and abnormal biochemical activity; psychological factors, such as cognitive delays / disorders (e.g., adhd), certain personality traits (e.g., conduct disorder), poor coping ability and poor school functioning; parental antisocial practices and attitudes and externalizing behaviors, such as early deviant behaviors, violence, aggression and substance use . It has limitation in the form of survey design, even though the researchers were trained for data collection, investigators did not had any control on the quality of the data collections . It has implications in the form of screening of risk factors / vulnerabilities for emotional dyscontrol among youth, teachers should pay attention to aggression related behavior (verbal / non - verbal) and help children / youth to handle them in a better way and psychoeducation for the parents; need for interaction of academic institute, policy makers and parents: reducing academies distress, ability to handle pressure or frustration or failure; development of intervention module for management of aggression.
A major goal of genomic studies is to understand the regulatory architecture of the genome; how, for example, powerful regulatory elements, such as enhancers and silencers, which have the ability to act over large genomic distances, are constrained to act only on appropriate transcription units . There is considerable evidence for a domain model of genomic regulatory architecture where the actions of long - range regulatory elements are confined within chromosomal domains [1 - 3]. The promiscuity of enhancers is restricted to regulation of transcription units within the same domain . In this model of genome organisation, insulator elements are proposed to play a key role as domain gate - keepers, shielding genes within the domain from the influence of outside regulatory elements . How insulators function is still unclear but they have been proposed to associate together to form chromosomal loops providing a physical basis for chromosomal domains . Insulator elements have been shown to have appropriate activities for such a role; they are defined by their ability to block enhancer - promoter interaction and/or to provide boundaries between different chromatin states and have been demonstrated to be involved in chromosome looping . But does the segregation of the genome into domains through the formation of chromosomal loops really represent the endogenous function of insulator elements? Although this question has been asked in the past, recent results in drosophila emphasising links between insulators and the regulation of transcription have once again brought it into focus . A number of proteins have been associated with insulator function in drosophila, including the suppressor of hairy - wing [su(hw)] protein, ccctc - binding factor (ctcf), centrosomal protein 190 (cp190), boundary element - associated factor (beaf), gaga factor (gaf) and zeste - white-5 (zw5), and over the past few years, genomic binding sites for several insulator components have been mapped [12 - 18]. In support of the domain model, these studies reveal associations between particular insulator components and boundaries of chromatin state domains; for example, bartkuhn et al . Document that cp190 and ctcf binding correlates strikingly with the boundaries of repressive chromatin domains marked by the h3k27me3 modification . This accords with genomic studies in vertebrates demonstrating that ctcf binding sites mark chromatin state boundaries . However, the drosophila genomic mapping experiments also reveal a strong association between particular insulator components and transcription start sites . This is especially true for some components, cp190, gaf and beaf, but not for su(hw), suggesting that there may be distinct types of insulator complexes . Beaf 32a and b were initially identified as factors binding to an insulator element (scs') associated with the 87a hsp70 heat shock locus . Insulator activity is dependent on beaf binding sites and beaf is involved in the formation of a chromosomal loop through interaction with zw5 bound to a second element (scs). Domain boundary credentials, more than 85% of the 1820 beaf binding sites in the genome are less than 300 bp from transcription start sites . Many (50%) of these beaf peaks are associated with head - to - head gene pairs, although these beaf sites do not appear to function to insulate these adjacent promoter regions from each other . Sharing of components between insulators and promoters may fit with shared structural features of these elements (for example, both ctcf - binding sites and active transcription start sites are marked by the presence of specific histone variants and are associated with nucleosomes containing both the h3.3 and h2a.z variants). While this may be interpreted as indicating a link between insulators and transcriptional regulation insulator components may serve a variety of functions and not all their binding sites are necessarily associated with insulator function . However, other experimental approaches provide support for a fundamental role for insulator - promoter interaction . It has been known for some time that some promoters can behave as insulators in enhancer - blocking assays . However, it was never clear whether the mechanism of enhancer - block was the same in both cases . Recently, chopra et al . Have uncovered a connection between promoters with enhancer - blocking activity and the presence of stalled rna polymerase ii (pol ii). Testing the ability of several hox gene promoters to exhibit enhancer - blocking, promoters associated with stalled pol ii showed blocking function whereas several unstalled promoters did not . The enhancer - blocking activity was dependent on the function of the elongation factors negative elongation factor (nelf) and drb sensitivity - inducing factor (dsif), which are thought to stabilise pol ii at the pause site . However, the key observation that draws together insulators and promoters is that the enhancer - blocking activity of two bithorax - complex insulators, fab7 and fab8, is also dependent on the elongation factors nelf and dsif . As fab7 and fab8 do not seem to contain stalled polymerase, the implication is that the insulators interact with promoters to inhibit elongation . This fits with observations, using damid (dna adenine methyltransferase identification) or chromosomal conformation capture, that the fab7 and fab8 insulators can form loops that bring them into contact with promoter regions of the abd - b hox gene and that this configuration is associated with repression of abd - b transcription . In support of the generality of interaction between insulators and the regulation of transcription elongation, jiang et al . Found considerable overlap between beaf and nelf binding sites . In addition, vertebrate studies using chromatin topology assays have identified insulator - promoter associations at several loci, including igf2-h19 and cftr . Overall, the above combination of genomic binding site location and functional analysis currently indicates a more intimate relationship between insulators and the regulation of gene transcription than is suggested by the domain boundary / chromosome loop model . Insulators may serve a diverse range of functions; as classical boundaries, as boundaries of regulatory regions, and as regulators of transcription . Even the regulatory effects of insulators can apparently be diverse; beaf appears to be predominantly required to facilitate transcription whereas the above interactions between the fab insulators and abd - b promoters occur in a repressive context . It is feasible that insulator elements in general are involved in the specification of chromosomal topology; this could provide a common function but, depending on the context, could have diverse consequences for chromatin state and transcriptional regulation.
Influenza throat swab specimens were collected in accordance with the case criteria outlined in canas et al . The criteria included patients with a fever> 37.8c accompanied by cough or sore throat . Throat swabs were taken within 72 hours of the onset of symptoms, placed in viral transport media (microtest, m4) (vtm), and delivered via commercial carrier to the clinical laboratory at the epidemiological surveillance division, brooks air force base . The two influenza isolates used in this study were randomly selected from 13 positive patient samples isolated from february to april 1999 from a department of defense sentinel site in lima, peru . All influenza viruses examined in this study were passaged one time through primary rhesus monkey kidney (pmk) tissue culture (viro - med, minneapolis, mn; biowhittaker, walkersville, md). A total of 500 l of vtm was injected onto a shell vial containing a coverslip with pmk tissue culture . Cultures were tested for viral infection using the centrifugation - enhanced shell - vial technique that includes a cell monolayer grown on a coverslip contained in a shell vial . Specimens are inoculated onto the cell monolayer, subjected to a low speed centrifugation for 60 minutes, incubated at 35c for 48 hours to 72 hours and then screened with monoclonal antibodies (chemicon, inc ., temecula, ca) to detect the presence of influenza a or b viruses . Aliquots of all specimens used in this study for the purposes of genetic analysis were stored at -80c until use . For antigenic analysis, aliquots of each isolate were sent to cdc for characterization in hemagglutiniation inhibition (hi) tests with postinfection ferret antisera as previously described (11). For genetic typing, approximately 1 ml of vtm was used to infect pmk tissue culture (viro - med, minneapolis, mn; biowhittaker, walkersville, md)and incubated at 37c for 3 to 5 days . Rna from was extracted from a 300 l aliquot of tissue culture fluid using the high pure viral rna kit (boehringer - mannheim, indianapolis, in). Influenza rna was amplified into double stranded dna by reverse transcription and polymerase chain reaction (rt - pcr) using the titan one step rt - pcr kit (boehringer - mannheim). An 1,187 bp cdna fragment consisting of the ha1 coding region of influenza a hemagglutinin was amplified using forward primer f6-(5-aagcaggggaaaataaaa-3, mrna) and reverse primer r1193-(5-gtaatcccgttaatggca-3, vrna sense). The rt - pcr reaction was performed by using a perkin elmer 2400 thermocycler (forest city, ca). The pcr product was purified using the qiaquick spin column purification (qiagen, valencia, ca). Amplicon was cycle sequenced by using the big dye terminator cycle sequencing kit (pe biosystems) run on a 377-xl automated dna sequencer according to manufacturer recommendations (pe biosystems). Four internal oligonucleotide sequencing primers (table 1) were used to sequence the entire ha1 amplicon in both the forward and reverse directions . Multiple sequence alignments, protein translation, and phylogenetic analysis were performed by using the software package lasergene (version 3.18) (dnastar, madison, wi). The nucleotide and amino acid sequences for a / peru/1621/99 and a / peru/1798/99 are available from genbank under the accession numbers af268313 and af268312, respectively . Additional nucleotide and amino acid sequences characterized by brooks air force base and depicted in phylogenetic analysis are available from genbank under the accession numbers ay029287-ay029292 . Gc= (guanosine (g) + cytidine (c))/ (adenosine (a)+ thymidine (t)+ guanosine (g) + cytidine (c)) x 100 tm= 81.5 + 16.6 * log [na+] + 41 * (#g + #c)/length 500/length where [na+]= 0.1 m . Influenza throat swab specimens were collected in accordance with the case criteria outlined in canas et al . The criteria included patients with a fever> 37.8c accompanied by cough or sore throat . Throat swabs were taken within 72 hours of the onset of symptoms, placed in viral transport media (microtest, m4) (vtm), and delivered via commercial carrier to the clinical laboratory at the epidemiological surveillance division, brooks air force base . The two influenza isolates used in this study were randomly selected from 13 positive patient samples isolated from february to april 1999 from a department of defense sentinel site in lima, peru . All influenza viruses examined in this study were passaged one time through primary rhesus monkey kidney (pmk) tissue culture (viro - med, minneapolis, mn; biowhittaker, walkersville, md). A total of 500 l of vtm was injected onto a shell vial containing a coverslip with pmk tissue culture . Cultures were tested for viral infection using the centrifugation - enhanced shell - vial technique that includes a cell monolayer grown on a coverslip contained in a shell vial . Specimens are inoculated onto the cell monolayer, subjected to a low speed centrifugation for 60 minutes, incubated at 35c for 48 hours to 72 hours and then screened with monoclonal antibodies (chemicon, inc ., temecula, ca) to detect the presence of influenza a or b viruses . Aliquots of all specimens used in this study for the purposes of genetic analysis were stored at -80c until use . For antigenic analysis, aliquots of each isolate were sent to cdc for characterization in hemagglutiniation inhibition (hi) tests with postinfection ferret antisera as previously described (11). For genetic typing, approximately 1 ml of vtm was used to infect pmk tissue culture (viro - med, minneapolis, mn; biowhittaker, walkersville, md)and incubated at 37c for 3 to 5 days . Rna from was extracted from a 300 l aliquot of tissue culture fluid using the high pure viral rna kit (boehringer - mannheim, indianapolis, in). Influenza rna was amplified into double stranded dna by reverse transcription and polymerase chain reaction (rt - pcr) using the titan one step rt - pcr kit (boehringer - mannheim). An 1,187 bp cdna fragment consisting of the ha1 coding region of influenza a hemagglutinin was amplified using forward primer f6-(5-aagcaggggaaaataaaa-3, mrna) and reverse primer r1193-(5-gtaatcccgttaatggca-3, vrna sense). The rt - pcr reaction was performed by using a perkin elmer 2400 thermocycler (forest city, ca). The pcr product was purified using the qiaquick spin column purification (qiagen, valencia, ca). Amplicon was cycle sequenced by using the big dye terminator cycle sequencing kit (pe biosystems) run on a 377-xl automated dna sequencer according to manufacturer recommendations (pe biosystems). Four internal oligonucleotide sequencing primers (table 1) were used to sequence the entire ha1 amplicon in both the forward and reverse directions . Multiple sequence alignments, protein translation, and phylogenetic analysis were performed by using the software package lasergene (version 3.18) (dnastar, madison, wi). The nucleotide and amino acid sequences for a / peru/1621/99 and a / peru/1798/99 are available from genbank under the accession numbers af268313 and af268312, respectively . Additional nucleotide and amino acid sequences characterized by brooks air force base and depicted in phylogenetic analysis are available from genbank under the accession numbers ay029287-ay029292 . Gc= (guanosine (g) + cytidine (c))/ (adenosine (a)+ thymidine (t)+ guanosine (g) + cytidine (c)) x 100 tm= 81.5 + 16.6 * log [na+] + 41 * (#g + #c)/length 500/length where [na+]= 0.1 m . Antigenic characterization by hi, using postinfection ferret antisera, was performed with reference antigens representing two globally cocirculating influenza a virus, type h1n1 antigenic / genetic lineages (a / beijing/262/95, which includes the variant a / new caledonia/20/99; and a / bayern/07/95, which includes a / johannesburg/82/96). Both peru isolates were antigenically related to the a / beijing/262/95 rather than to the a / bayern/07/95 lineage (table 2). Both peru isolates were antigenically close to the new variant, a / new caledonia/20/99, that recently evolved from the a / beijing/262/95 virus . Titers of the peru isolates were within a two - fold difference from the homologous titer demonstrated by a / new caledonia/20/99 (160 vs. 320), while they were fourfold lower than the a / beijing/262/95 homologous titer (160 vs. 640). Test viruses are considered antigenically similar to the reference strain if the h1 titer is equal or two times lower than the homologous titer of the reference virus . If the difference in h1 titers is 4-fold or higher, the test viruses are considered to be antigenically different from the reference strain . The complete nucleotide and deduced amino acid sequences of the ha1 of the two peru isolates were compared with those of the previous vaccine strain, a / beijing/262/95, and the current vaccine strain, a / new caledonia/20/99 . Based on nucleotide alignments, a / peru/1621/99 and a / peru/1798/99 share identical ha1 sequences and are genetically closer (97.9%) to a / new caledonia/20/99 (97.9%) than they are to the a / bayern/07/95 (94.8%) or a / beijing/262/95 (96.8%) reference strains . A comparison of the amino acid residues of the peru isolates with a / new caledonia/20/99 and a / beijing/262/95 is shown in figure 1 . The peru isolates contained only 8 amino acid differences compared with a / new caledonia/20/99 and 11 amino acid differences compared with a / beijing/262/95 . A substitution at residue 156(g156e) shows a neutral to acidic amino acid change similar to those observed in some other beijing/262-like viruses . Amino acid substitutions at positions 190(n190d) and 194(l194i) are also characteristic of the beijing/262/95 lineage . Substitutions at position -1 (signal sequence), 9, 82, 186, and 218 represent novel changes not present in a / new caledonia/20/99 or the majority of characterized beijing/262-like viruses . The amino acid sequence of the ha1 region of the hemagglutinin of the peru isolates and a / beijing/262/95 compared with the 2000/01 and 2001/02 vaccine strain, a / new caledonia/20/99 . Amino acid numbering corresponds to h3 subtype (19), with additional amino acids residues present in the h1 subtype sequence indicated by an asterisk . A phylogenetic analysis (figure 2) comparing the ha1 nucleotide sequence of the peru isolates with h1n1 viruses isolated after 1990 was performed with the software package megalign (1993 - 1998) 0(dnastar, madison, wi), using the jotun - hein method (12). Based on the topography, the peru isolates and other a / new caledonia/20/99-like viruses isolated by dod - gies during the 1999 - 2000 influenza season appear to have evolved from beijing/262/95-like viruses into a distinct a / new caledonia/20/99 sublineage . An unrooted phylogenetic analysis of the ha1 gene nucleotide sequence of influenza a h1n1 viruses isolated since 1990 . Peru isolates 1621 and 1798 are within the beijing/262/95 lineage but are more similar to a / new caledonia/20/99 . A number of isolates characterized by brooks air force base from 1999 to 2001 were also a / nc/20/99-like . The tree was generated by using the jotun - hein algorithm (6) in megalign software (version 3.18). Are proportional to the number of substitutions between branch points . Asterisk () denotes 2000/01 vaccine strain; () denotes isolates characterized by brooks air force base . Brooks air force base isolates are available from genbank under accession numbers af268312, af268313 and ay029287-ay029292 . Antigenic characterization by hi, using postinfection ferret antisera, was performed with reference antigens representing two globally cocirculating influenza a virus, type h1n1 antigenic / genetic lineages (a / beijing/262/95, which includes the variant a / new caledonia/20/99; and a / bayern/07/95, which includes a / johannesburg/82/96). Both peru isolates were antigenically related to the a / beijing/262/95 rather than to the a / bayern/07/95 lineage (table 2). Both peru isolates were antigenically close to the new variant, a / new caledonia/20/99, that recently evolved from the a / beijing/262/95 virus . Titers of the peru isolates were within a two - fold difference from the homologous titer demonstrated by a / new caledonia/20/99 (160 vs. 320), while they were fourfold lower than the a / beijing/262/95 homologous titer (160 vs. 640). Test viruses are considered antigenically similar to the reference strain if the h1 titer is equal or two times lower than the homologous titer of the reference virus . If the difference in h1 titers is 4-fold or higher, the test viruses are considered to be antigenically different from the reference strain . The complete nucleotide and deduced amino acid sequences of the ha1 of the two peru isolates were compared with those of the previous vaccine strain, a / beijing/262/95, and the current vaccine strain, a / new caledonia/20/99 . Based on nucleotide alignments, a / peru/1621/99 and a / peru/1798/99 share identical ha1 sequences and are genetically closer (97.9%) to a / new caledonia/20/99 (97.9%) than they are to the a / bayern/07/95 (94.8%) or a / beijing/262/95 (96.8%) reference strains . A comparison of the amino acid residues of the peru isolates with a / new caledonia/20/99 and a / beijing/262/95 is shown in figure 1 . The peru isolates contained only 8 amino acid differences compared with a / new caledonia/20/99 and 11 amino acid differences compared with a / beijing/262/95 . A substitution at residue 156(g156e) shows a neutral to acidic amino acid change similar to those observed in some other beijing/262-like viruses . Amino acid substitutions at positions 190(n190d) and 194(l194i) are also characteristic of the beijing/262/95 lineage . Substitutions at position -1 (signal sequence), 9, 82, 186, and 218 represent novel changes not present in a / new caledonia/20/99 or the majority of characterized beijing/262-like viruses . The amino acid sequence of the ha1 region of the hemagglutinin of the peru isolates and a / beijing/262/95 compared with the 2000/01 and 2001/02 vaccine strain, a / new caledonia/20/99 . Amino acid numbering corresponds to h3 subtype (19), with additional amino acids residues present in the h1 subtype sequence indicated by an asterisk . A phylogenetic analysis (figure 2) comparing the ha1 nucleotide sequence of the peru isolates with h1n1 viruses isolated after 1990 was performed with the software package megalign (1993 - 1998) 0(dnastar, madison, wi), using the jotun - hein method (12). Based on the topography, the peru isolates and other a / new caledonia/20/99-like viruses isolated by dod - gies during the 1999 - 2000 influenza season appear to have evolved from beijing/262/95-like viruses into a distinct a / new caledonia/20/99 sublineage . An unrooted phylogenetic analysis of the ha1 gene nucleotide sequence of influenza a h1n1 viruses isolated since 1990 . Peru isolates 1621 and 1798 are within the beijing/262/95 lineage but are more similar to a / new caledonia/20/99 . A number of isolates characterized by brooks air force base from 1999 to 2001 were also a / nc/20/99-like . The tree was generated by using the jotun - hein algorithm (6) in megalign software (version 3.18). Horizontal lines are proportional to the number of substitutions between branch points . Asterisk () denotes 2000/01 vaccine strain; () denotes isolates characterized by brooks air force base . Brooks air force base isolates are available from genbank under accession numbers af268312, af268313 and ay029287-ay029292 . A / beijing/262/95-like viruses first appeared in china during the 1994 - 95 influenza season and then spread throughout asia over the next 5 years (810). These viruses have a characteristic deletion mutation in the ha molecule at residue 134 . In geographic areas outside asia, bayern/7/95-like viruses have predominated during the 1996 - 97, 1997 - 98, and 1998 - 99 seasons (810). In may and june 1999, a / new caledonia/20/99, an antigenic variant of beijing/262/95, was first reported in new caledonia in the southern pacific (13). Shortly thereafter, these isolates were important because they were the first beijing/262/95-like viruses in the americas with the signature ha1 deletion mutation at residue 134 . However, the peru isolates were antigenically distinct from beijing/262-like viruses and antigenically similar to a / new caledonia/20/99 (table 2). Eleven amino acid differences in the ha1 protein were observed between the peru isolates and a / beijing/262/95, the vaccine strain for the 1998 - 99 and 1999 - 2000 influenza seasons . Four of these 11 substitutions were located in 3 antigenic sites and could potentially alter antibody - binding properties of the viruses . Wilson and cox proposed that a drift variant of epidemiologic importance usually contains four or more amino acid substitutions located in two or more of the antigenic sites on the ha1 protein (14). Substitutions at residues 218(a218 t) and 225(g225d) were present in the ca antigenic site located approximately halfway down the side of the ha1 globular head (3,15). Two other substitutions, 82(e82d) and 166(n166k), were observed within antigenic sites cb and sa, located at the base and tip of the ha1 globular head, respectively (3,15). Genetic comparisons between peru isolates and a / new caledonia/20/99 show a difference of only eight amino acids (figure 1). Three of these eight residues, 156(e), 186(s), and 194(i), are present in the a / beijing/262/95 vaccine strain . The substitution at residue 190(d) is also typical for many beijing/262/95-like viruses, although not a / beijing/262/95 itself (16). The remaining four substitutions, at residues -1(l), 9(s), 82(d), and 218(t), are unique compared with most recently characterized new caledonia/20/99 or a / beijing/262/95-like viruses . The phylogenetic analysis of influenza a viruses from 1990 to 2001 confirmed the coexistence of the two major h1n1 lineages (figure 2). The beijing/262/95-like lineage is easily distinguished from the bayern/07/95-like viruses by a characteristic deletion at residue 134 . With the exception of one bayern/07/95-like isolate, all the viruses genetically characterized by dod - geis since these peru isolates were detected contain the residue 134-deletion mutation and appear to be evolving from a / beijing/262/95 into a distinct sublineage (figure 2). The a / peru/1621/99 and a / peru/1798/99 isolates are depicted as a distinct branch in the phylogeny of new caledonia - like viruses . Since these peru strains were first identified in 1999, dod - geis and cdc have characterized similar new caledonia/20/99-like viruses isolated from throughout north and south america during the 1999/2000 influenza season . The sudden widespread appearance of these viruses prompted who to recommend the change to a / new caledonia/20/99 as the 2000/01 h1n1 influenza vaccine component (13). This recommendation was timely because the 1999/2000 vaccine containing the a / beijing/262/95 h1n1 component induced a cross - reactive response to a / bayern/7/95-like viruses but induced lower titers of antibodies to a / new caledonia/20/99-like strains (17). Therefore, a change in the h1n1 component was necessary to ensure that the vaccine would provide effective immunization against emerging a / new caledonia/20/99-like viruses . During the 2000/01-influenza season, new caledonia - like viruses continued to predominate over the h1n1 bayern - like lineage and were associated with outbreaks in many countries (13,18). During this season, 80 (96%) were antigenically related to a / new caledonia/20/99; three (4%) were bayern/7/95-like . Our antigenic data are consistent with findings that approximately 84% of h1n1 viruses characterized by cdc during the 2000/2001 influenza season were similar to a / new caledonia/20/99 (13,18). The continued persistence of new caledonia - like viruses in the global population encouraged who to maintain a / new caledonia/20/99 as the h1n1 component for the current 2001/2002 influenza season (20). Studies based on amino acid analyses of viruses from previous years to predict the evolution of future h1n1 epidemic strains would be advantageous as a surveillance tool and could contribute to the vaccine selection process . Using a retrospective approach, bush et al . Determined that specific codons in the ha1 domain of the hemagglutinin gene of human influenza subtype h3 are under positive selection to mutate (21,22). Certain amino acids in the ha1 of human h1n1 viruses mutate at positively selected codons, giving rise to new viral lineages . The characterization of these peru variants emphasizes the need to be vigilant in examining sublineage amino acid changes that may be indicators for the emergence of future strains . The effectiveness of an annually determined trivalent influenza vaccine depends on choosing component strains that offer optimal immunity from the numerous variants in global circulation . In addition, timing is critical because the vaccine strains are selected months before the onset of influenza season to ensure the production of adequate amounts of vaccine by drug manufacturers.
Sudden changes in coronary plaque luminal surface morphology consisting of plaque rupture or fissure have been recognized as important mechanisms of acute coronary syndrome (acs). Plaque disruption is a reflection of enhanced inflammatory activity within the plaque, and the risk of plaque rupture has been shown to be associated with plaque composition, which includes a large lipid core, a thin fibrous cap, and a high count of macrophages.1)2) the ability to visualize and quantify the different components of atherosclerotic lesions provides important information not only on the mechanism of coronary artery disease (cad) but also on potential future therapeutic interventions to alter the disease process.3) recently, virtual histology intravascular ultrasonography (vh - ivus) using spectral analysis of radiofrequency ultrasound backscatter signals was introduced to clinical practice to characterize plaque composition.4) the low density lipoprotein - cholesterol (ldl - c)/high density lipoprotein - cholesterol (hdl - c) ratio is a predictor of cad risk and a surrogate marker of lipid - lowering therapies.5) meta - analysis data from 4 studies using conventional ivus has indicated a positive linear correlation between achieved ldl - c / hdl - c ratio and percent volume changes of coronary plaque burden.6) moreover, kimura et al.7) reported that an elevated ldl - c / hdl - c ratio may be a positive predictor for coronary lipid - rich plaques and plaque vulnerability in patients with chronic cad . However, few reports have evaluated any link between the types of cad, coronary plaque vulnerability, and blood lipid profiles . Therefore, the purpose of this study was to determine the characteristics of coronary plaque tissue and to examine the relationship between coronary plaque tissue according to lipid profile characteristics visualized with vh - ivus and lipid profiles in patients with stable angina pectoris (sap). This study was a retrospective, single - center study . From august 2007 to december 2010, we identified 266 consecutive patients (61.79.2 years, 174 males) with sap who underwent coronary angiography (cag) and vh - ivus for target lesions before percutaneous coronary intervention (pci). The presence of sap was determined by typical effort - induced chest pain which was relieved by resting . Patients were divided into an unstable plaque (up) group (61.69.2 years, 24 males, n=34) and a stable plaque (sp) group (61.79.2 years, 150 males, n=232). Ups are characterized by thin - cap fibroatheroma (tcfa), ruptured plaque, or remaining thrombus on vh - ivus . The inclusion criterion was elective pci in a de novo lesion due to symptomatic cad without any prior history of pci . In patients with single - vessel disease, the most severe lesion was considered the target lesion . In patients with multivessel disease and angina, the selection was determined by the combination of left ventricular wall motion abnormalities, electrocardiographic findings, single - photon emission computed tomography, and the closest corresponding coronary vessel containing the most severe lesion . We excluded patients with restenosis after pci, coronary artery bypass grafting, total occlusions, bifurcation lesions, lesions with severe angulations, and heavily calcified lesions . Fasting blood sampling was obtained for measuring lipid profiles, high sensitivity c - reactive protein (hs - crp), and creatinine before cag . The serum levels of total cholesterol, ldl - c, hdl - c, and triglyceride were measured by standard enzymatic methods . Hs - crp was analyzed turbidimetrically using sheep antibodies against human crp; this has been validated against the dade - behring method.8) lipoprotein a {lp(a)} was measured by an immunonephelometric assay using a latex lp(a) reagent composed of polystyrene particles coated with a rabbit anti - human lp(a) -globulin fraction . Apolipoprotein a1, apolipoprotein b, and lp(a) were measured using a behring nephelometer ii (dade behring inc ., coronary angiogram was analyzed with a validated quantitative coronary angiography (qca) system (philips h5000 or allura dci program, philips medical system, eindhoven, the netherlands). With the outer diameter of the contrast - filled catheter as the calibration standard, the minimal lumen diameter, reference diameter, and diameter stenosis were measured in diastolic frames from orthogonal projections . Virtual histology intravascular ultrasonography examination was performed before any intervention and after intracoronary administration of nitroglycerin 200 g using a motorized transducer pullback system (0.5 mm / s). A 2.9 fr ivus imaging catheter (eagle eye; volcano corporation, rancho cordova, ca, usa) incorporated a 20 mhz phased - array transducer . Conventional gray - scale quantitative ivus analyses were performed according to the american college of cardiology clinical expert consensus document on standards for acquisition, measurement, and reporting of intravascular ultrasound studies.9) percent plaque area of the minimum luminal area (mla) was defined as the plaque and media area divided by the external elastic membrane (eem) area . A remodeling index (ri) the ivus sign of plaque rupture was a cavity that communicated with the lumen with an overlying residual fibrous cap fragment.10)11) thrombus was an intraluminal mass having a layered or lobulated appearance, evidence of blood flow (microchannels) within the mass, and speckling or scintillation.9)12) vh - ivus analysis classified tissue into four major color - coded components: green (fibrotic), yellow - green (fibro - fatty), white (dense calcium), and red {necrotic core (nc)}. Vh - ivus analysis was reported in absolute amounts and as a percentage of plaque area . Vh - ivus - derived tcfa was defined as a nc 10% of plaque area at the mla site in 3 consecutive frames without evident overlying fibrous tissue in the presence of 40% plaque burden.13) the statistical package for social sciences for windows, version 15.0 (chicago, il, usa) was used for all analyses . Continuous variables were presented as meanstandard deviations, and differences between the 2 groups were evaluated by the student's t - test . Categorical variables were presented as numbers (percentages), and comparisons across the 2 groups were performed by the chi - square test or fisher's exact test . Patient baseline variables were entered into the regression model if they were statistically significant (p<0.2) by univariate analysis . This study was a retrospective, single - center study . From august 2007 to december 2010, we identified 266 consecutive patients (61.79.2 years, 174 males) with sap who underwent coronary angiography (cag) and vh - ivus for target lesions before percutaneous coronary intervention (pci). The presence of sap was determined by typical effort - induced chest pain which was relieved by resting . Patients were divided into an unstable plaque (up) group (61.69.2 years, 24 males, n=34) and a stable plaque (sp) group (61.79.2 years, 150 males, n=232). Ups are characterized by thin - cap fibroatheroma (tcfa), ruptured plaque, or remaining thrombus on vh - ivus . The inclusion criterion was elective pci in a de novo lesion due to symptomatic cad without any prior history of pci . In patients with single - vessel disease, the most severe lesion was considered the target lesion . In patients with multivessel disease and angina, the selection was determined by the combination of left ventricular wall motion abnormalities, electrocardiographic findings, single - photon emission computed tomography, and the closest corresponding coronary vessel containing the most severe lesion . We excluded patients with restenosis after pci, coronary artery bypass grafting, total occlusions, bifurcation lesions, lesions with severe angulations, and heavily calcified lesions . Fasting blood sampling was obtained for measuring lipid profiles, high sensitivity c - reactive protein (hs - crp), and creatinine before cag . The serum levels of total cholesterol, ldl - c, hdl - c, and triglyceride were measured by standard enzymatic methods . Hs - crp was analyzed turbidimetrically using sheep antibodies against human crp; this has been validated against the dade - behring method.8) lipoprotein a {lp(a)} was measured by an immunonephelometric assay using a latex lp(a) reagent composed of polystyrene particles coated with a rabbit anti - human lp(a) -globulin fraction . Apolipoprotein a1, apolipoprotein b, and lp(a) were measured using a behring nephelometer ii (dade behring inc ., coronary angiogram was analyzed with a validated quantitative coronary angiography (qca) system (philips h5000 or allura dci program, philips medical system, eindhoven, the netherlands). With the outer diameter of the contrast - filled catheter as the calibration standard, the minimal lumen diameter, reference diameter, and diameter stenosis were measured in diastolic frames from orthogonal projections . Virtual histology intravascular ultrasonography examination was performed before any intervention and after intracoronary administration of nitroglycerin 200 g using a motorized transducer pullback system (0.5 mm / s). A 2.9 fr ivus imaging catheter (eagle eye; volcano corporation, rancho cordova, ca, usa) incorporated a 20 mhz phased - array transducer . Conventional gray - scale quantitative ivus analyses were performed according to the american college of cardiology clinical expert consensus document on standards for acquisition, measurement, and reporting of intravascular ultrasound studies.9) percent plaque area of the minimum luminal area (mla) was defined as the plaque and media area divided by the external elastic membrane (eem) area . A remodeling index (ri) the ivus sign of plaque rupture was a cavity that communicated with the lumen with an overlying residual fibrous cap fragment.10)11) thrombus was an intraluminal mass having a layered or lobulated appearance, evidence of blood flow (microchannels) within the mass, and speckling or scintillation.9)12) vh - ivus analysis classified tissue into four major color - coded components: green (fibrotic), yellow - green (fibro - fatty), white (dense calcium), and red {necrotic core (nc)}. Vh - ivus analysis was reported in absolute amounts and as a percentage of plaque area . Vh - ivus - derived tcfa was defined as a nc 10% of plaque area at the mla site in 3 consecutive frames without evident overlying fibrous tissue in the presence of 40% plaque burden.13) the statistical package for social sciences for windows, version 15.0 (chicago, il, usa) was used for all analyses . Continuous variables were presented as meanstandard deviations, and differences between the 2 groups were evaluated by the student's t - test . Categorical variables were presented as numbers (percentages), and comparisons across the 2 groups were performed by the chi - square test or fisher's exact test . Patient baseline variables were entered into the regression model if they were statistically significant (p<0.2) by univariate analysis . Hdl - c, ldl - c / hdl - c ratio> 2.0 and apolipoprotein a1 were significantly lower in the up group than in the sp group, whereas other variables in the 2 groups were similar (table 1). Quantitative coronary angiography showed that the target artery of the left main was more common in the up group than in the sp group (20.6% vs. 7.3%, p=0.012), the minimal luminal diameter (mld) was significantly smaller in the up group than in the sp group (0.70.4 mm vs. 1.00.4 mm, p=0.004), and the stenosis diameter (sd) was significantly higher in the up group than in the sp group (79.011.0% vs. 70.313.0%, p=0.001) (table 2). Gray - scale ivus showed that the eem cross - sectional area (csa) of the lesion segment (18.06.7 mm vs. 13.13.9 mm, p=0.001), percent plaque area of the mla (77.77.0% vs. 71.19.6%, p=0.001), and the eem csa of the distal reference segment (13.76.6 mm vs. 11.04.0 mm, p=0.037) were significantly larger in the up group than in the sp group . Ri was significantly higher in the up group than in the sp group (1.130.18 vs. 0.970.20, p=0.001), and target lesions in all patients contained 4 thrombi (1.5%) and 22 ruptured plaques (8.3%). Vh - ivus showed that the nc area was significantly greater (2.21.6 mm vs. 1.41.0 mm, p=0.024), and a tendency toward greater percentages of nc (27.9% vs. 21.6%, p=0.356) was present in the up group . Target lesions in all patients contained 12 tcfas (4.5%) (table 3). Multiple logistic regression analysis was performed using ldl - c / hdl - c ratio> 2.0, body mass index, homocysteine, apolipoprotein a1, and hdl - c . In patients with sap, ldl - c / hdl - c ratio> 2.0 was the only independent predictor for up (odds ratio 5.252, 95% confidence interval 1.132 - 24.372, p=0.034) (table 4). Hdl - c, ldl - c / hdl - c ratio> 2.0 and apolipoprotein a1 were significantly lower in the up group than in the sp group, whereas other variables in the 2 groups were similar (table 1). Quantitative coronary angiography showed that the target artery of the left main was more common in the up group than in the sp group (20.6% vs. 7.3%, p=0.012), the minimal luminal diameter (mld) was significantly smaller in the up group than in the sp group (0.70.4 mm vs. 1.00.4 mm, p=0.004), and the stenosis diameter (sd) was significantly higher in the up group than in the sp group (79.011.0% vs. 70.313.0%, p=0.001) (table 2). Gray - scale ivus showed that the eem cross - sectional area (csa) of the lesion segment (18.06.7 mm vs. 13.13.9 mm, p=0.001), percent plaque area of the mla (77.77.0% vs. 71.19.6%, p=0.001), and the eem csa of the distal reference segment (13.76.6 mm vs. 11.04.0 mm, p=0.037) were significantly larger in the up group than in the sp group . Ri was significantly higher in the up group than in the sp group (1.130.18 vs. 0.970.20, p=0.001), and target lesions in all patients contained 4 thrombi (1.5%) and 22 ruptured plaques (8.3%). Vh - ivus showed that the nc area was significantly greater (2.21.6 mm vs. 1.41.0 mm, p=0.024), and a tendency toward greater percentages of nc (27.9% vs. 21.6%, p=0.356) was present in the up group . Target lesions in all patients contained 12 tcfas (4.5%) (table 3). Multiple logistic regression analysis was performed using ldl - c / hdl - c ratio> 2.0, body mass index, homocysteine, apolipoprotein a1, and hdl - c . In patients with sap, ldl - c / hdl - c ratio> 2.0 was the only independent predictor for up (odds ratio 5.252, 95% confidence interval 1.132 - 24.372, p=0.034) (table 4). We evaluated the relationship between plaque vulnerability and lipid profiles using ivus in patients with sap . The present study showed that a high ldl - c / hdl - c ratio was a useful marker for up in patients with sap . Coronary luminal stenosis as assessed by angiography has been considered a surrogate marker of atherosclerotic severity . However, cag, a luminogram, has low predictive value to assess atherosclerotic plaque burden or to predict acs events.14)15) nevertheless, sap patients have flow - limiting culprit lesions in their coronary arteries, and such lesions may be closely related to plaque vulnerability and plaque composition as a result of lower shear stress and endothelial dysfunction.16) it is also well known that a vulnerable plaque rarely develops in <40% plaque volume . Therefore, a culprit lesion with a coronary blood flow limiting site may have a considerable relation to plaque vulnerability compared to a non - flow limiting lesion . Although identification of mild / moderate vulnerable stenosis has the most relevant clinical implications, clinical validation and confirmation of vh data on culprit lesions, which are the lesion subset best studied, are required . Virtual histology intravascular ultrasonography has the potential to provide detailed qualitative and quantitative information; the identification of 4 specific plaque components has been validated in explanted human coronary segments, as well as in retrieved directional coronary atherectomy specimens.17) the rupture of a vulnerable plaque and subsequent thrombus formation are the most important mechanisms leading to acs.2)18) one angioscopic study reported that plaque rupture and subsequent thrombus formation were observed in 17% of sap patients.19) a study which investigated the relationship between clinical and angiographic observations with plaque rupture detected by ivus has demonstrated that 22% of coronary plaques ruptured even in patients with stable angina or asymptomatic patients.20) ivus studies have reported varying frequencies of plaque rupture in sap patients: 15% by hong et al.,21) 18.5% by hur22) and 10.7% by bae et al.23) in the present study, 12.8% of sap patients had plaques with vulnerable characteristics . It is well established that high serum levels of ldl - c constitute a strong predictor of cad and that ldl - c - lowering therapy reduces cad.24) the ldl - c / hdl - c ratio was found to be more accurate in determining cad risk compared to ldl - c or hdl - c alone.5)25) based on data from clinical trials using conventional ivus (reversal, camerot, activate, and asteroid),6)26 - 28) a high ldl - c / hdl - c ratio is associated with coronary plaque progression, while a low ldl - c / hdl - c ratio achieved by pharmacological intervention is associated with coronary plaque regression . According to a subanalysis of the mega study, which focused on primary prevention of cardiovascular events in a japanese population, the incidence of cardiovascular events was significantly lower in those with an ldl - c / hdl - c ratio of 2.0 or lower than in those with an ldl - c / hdl - c ratio exceeding 2.0 regardless of the hdl - c level.29) nicholls et al.6) performed pooled analysis by integrating the data of 4 prospective, randomized trials using ivus to assess plaque regression as a result of ldl - c lowering therapy for secondary prevention of cad and demonstrated that plaques were regressed by controlling the ldl - c / hdl - c ratio at 1.5 or lower . In the present study, an ldl - c / hdl - c ratio> 2.0 in patients with sap was the independent predictor of plaques with vulnerable characteristics . In addition, the present study showed that the percent plaque area of mla in high ldl - c / hdl - c ratio patients was significantly higher than in the low ldl - c / hdl - c ratio patients . In the present study, characteristics of plaques detected using ivus were associated with the ldl - c / hdl - c ratio . Therefore, increased ldl - c / hdl - c ratio represented by an increase in ldl - c and/or decrease in hdl - c might increase the percent plaque area of mla and may be a useful predictor for plaque vulnerability, which is a potent predictor of future cardiovascular events . However, further investigations are needed to clarify this relationship . First, the present study was retrospective and consisted of a relatively small number of patients from a single center . Third, the ivus image was only a single slice at the mld site of the target lesion . We believe, however, that flow - limiting lesions might be related to low shear stress and endothelial dysfunction in patients with cad . Blood ldl - c / hdl - c ratio is related to up, especially in patients with sap . An ldl - c / hdl - c ratio over 2.0 may be a positive predictor for coronary plaque vulnerability . First, the present study was retrospective and consisted of a relatively small number of patients from a single center . Therefore, a larger scale, well - organized prospective study is needed . Third, the ivus image was only a single slice at the mld site of the target lesion . We believe, however, that flow - limiting lesions might be related to low shear stress and endothelial dysfunction in patients with cad . Blood ldl - c / hdl - c ratio is related to up, especially in patients with sap . An ldl - c / hdl - c ratio over 2.0 may be a positive predictor for coronary plaque vulnerability.
All species have to perform a balancing act with their genome: cram it into the cell (in the case of eukaryotes, a small part of that cell: for example, about 2 m of human dna in a nucleus of about 5 m diameter) yet make the appropriate regions readily available for replication and expression (and repair if something goes wrong). Eukaryotes achieve this feat by wrapping their dna into chromatin, a highly ordered complex with a simple repeating unit of about 146 bp dna plus eight histone proteins, termed the nucleosome . This beads - on - a - string array is further assembled into a variety of higher - order structures all the way up to the metaphase chromosome . The chromatin field exploded with the discovery that the monotonous - looking nucleosomes are actually hugely variable, with post - translational modifications of numerous residues on the major histones, their substitution for histone variants, and even post - translational modifications of the variants . Furthermore, the highly of dna (such as promoters, centromeres or damaged dna) to the appropriate enzymatic machineries . Histone variants are non - allelic isoforms of the canonical histones that can be assembled into nucleosomes in their place, and are thought thereby to provide the basis for regulation of biological processes that require local access to dna . In contrast to the s - phase - coupled synthesis of the major histones (timing availability to the peak demand of genome replication) histone h2a has one of the largest variant families, and includes h2a.z, a protein that is highly conserved across eukaryotes but differs considerably from the major h2a in each species (figure 1). H2a.z has been ascribed a large number of roles, including most recently suppressing antisense rnas and stabilizing the association of condensin with mitotic chromosomes . Although we still have a poor understanding of how the variant mediates any specific function, it is likely that differential enrichment at specific locations and distinct post - translational modifications contribute . Is monoubiquitinated, that in budding yeast (saccharomyces cerevisiae) is sumoylated, and in all tested species it is subject to multiple amino - terminal acetylations (figure 1), primarily by the kat5 family of acetyltransferases . Mutation of the s. cerevisiae sumoylation sites impairs movement of dna double - strand breaks to the nuclear periphery, whereas an unacetylatable allele in fission yeast (schizosaccharomyces pombe) recapitulates many of the phenotypes of a complete deletion . However, it is still unknown whether the effect of any of these modifications is direct (such as steric hindrance or charge modulation influencing the formation of higher - order structures) or indirect (such as generating sites for the recruitment of regulatory proteins). A simplified view of h2a.z structure and post - translational modifications . Bars indicate the major regions of divergence between h2a.z proteins across species (green) and between h2a.z and h2a (blue). The relative location of the nuclear localization signal (nls) and regions of s. cerevisiae (sc) h2a.z (called htz1) that mediate contact with the nap1 chaperone and the swr - complex (swr - c) atpase complex are also shown . All h2a.z post - translational modifications identified so far are on the relatively divergent amino and carboxyl termini, so it is unclear whether each specific modification is invariably used to regulate variant function across species . Addition of post - translational modifications generally depends on the swr complex, indicating that each modification occurs after the variant is assembled into chromatin . A major region of difference between h2a and h2a.z is in the loop 1 domain, which regulates interaction between the two h2a molecules in a nucleosome . This has led to the suggestion that nucleosome core particles can only be homotypic, containing either h2a or h2a.z . However, hybrid nucleosomes containing h2a: h2b and h2a.z: h2b dimers have been observed . The sequence of human h2a.z-1, including the three residues that differ in h2a.z-2, is also indicated . The major route for h2a.z into chromatin is via swr1, the snf2-family atpase at the catalytic center of the swr chromatin remodeling complex . This is certainly the case in s. cerevisiae (swr1), s. pombe (swr1), humans (srcap), drosophila (domino) and arabidopsis (pie1) [2,3,6 - 8]. The presence of h2a.z in a nucleosome facilitates intramolecular folding to higher - order arrays, particularly 30 nm chromatin fibers, although these resist the formation of more highly condensed structures resulting from intermolecular association . H2a.z has also been reported to have a subtle destabilizing effect on the nucleosome in which it is incorporated, although this has been disputed . The apparent contradictions in the data can however be reconciled if the total histone composition of a nucleosome octamer is considered: variants seem to subtly alter nucleosome stability, so the order of stability is h3/h2a.z = h3/h2a> h3.3/h2a> h3.3/h2a.z . Furthermore, although it was originally predicted that h2a.z was unlikely to form hybrid nucleosomes (figure 1), both homotypic (containing two h2a.z: h2b dimers) and heterotypic (containing h2a: h2b and h2a.z: h2b dimers) forms have been observed, adding yet another level of structural (and possibly functional) heterogeneity . High density maps of h2a.z across genomes as diverse as s. cerevisiae, s. pombe, arabidopsis thaliana and caenorhabditis elegans show the variant to be widely but non - randomly distributed . In budding yeast h2a.z occupancy peaks in the single nucleosomes directly flanking (-1/+1) a nucleosome - free region over promoters, a pattern apparently induced by the nucleosome - free region itself . Fission yeast, in contrast, shows enrichment in the + 1 but not the -1 nucleosome around the nucleosome - free region . The reason for (or outcome of) this difference is unknown, although in each organism enrichment depends on the swr complex and is inversely correlated with transcriptional activity . H2a.z has been linked to both transcriptional activation and repression at various genes, although consensus seems to be building towards a role in marking and/or poising promoters for expression . The presence of h2a.z might commit local chromatin to a state competent for activation by other factors or, in higher eukaryotes, it might protect the region from inactivating dna methylation . Or it might be that the cell uses the inherent instability of h2a.z - containing nucleosomes to regulate promoter accessibility . Studies on the dynamics of replication - independent histone turnover in budding yeast suggest that h2a.z - containing nucleosomes have significantly higher turnover rates . This' hotness' of the nucleosomes around transcription start sites could aid promoter function by making it easier to expose these dna elements to the transcriptional machinery . Such rapid flux might also abrogate the spread of a propagating domain (such as that of the budding yeast sir2 deacetylase complex), which could explain how h2a.z mediates a heterochromatin - euchromatin boundary function in this organism . H2a.z enrichment at the regions between euchromatin and heterochromatin is a feature also found in other organisms, despite the dramatic biochemical differences between the heterochromatin of budding yeast and that of many other species . In this manner the mammalian variant is a component of pericentric heterochromatin and flanks sites occupied by the insulator binding protein ctcf . As if the complexity described above wasn't enough, recent mass spectrometry analyses of chicken erythrocytes identified two forms of h2a.z that differ by just three amino acids: h2a.z-1 (previously h2a.z) and h2a.z-2 (previously h2a.f / z or h2a.v) (figure 1). These proteins are encoded by two non - allelic genes, which phylogenetic analyses indicate are present in all vertebrates and have a common origin early in chordate evolution . Both isoforms are incorporated into chromatin, and both seem to be acetylated on the same three lysine residues within the amino terminus (lys4, lys7 and lys11) to a similar degree (figure 1). Why would vertebrates need two copies of a protein that differ by just three amino acids, whereas invertebrates do just fine with just one? Mouse studies ostensibly showing that h2a.z is indispensable deleted only h2a.z-1, indicating non - redundancy: that is, h2a.z-2 cannot compensate . At this stage the three - amino - acid difference is not expected to have any major structural implication for nucleosomes . The h2a.z isoforms could have a differential affinity for various chaperones and/or deposition machineries, which could explain their subtly different chromatin occupancy patterns . Although this might sound unlikely, there is a comparable precedent: three of the four amino acids that differ between histones h3.1 and h3.3 regulate the usage of the respective proteins in the replication - dependent and -independent deposition pathways . However, the most important difference between h2a.z-1 and h2a.z-2 may be their highly divergent promoter sequences . This opens up the possibility of dramatically different temporal and/or spatial expression patterns for the two isoforms . Indeed, preliminary studies suggest some differences in mrna expression levels depending on the developmental stage of a variety of tissues . Plants also have multiple h2a.z isoforms . Three have been reported in a. thaliana - hta8, hta9 and hta11 - which share about 90% identity but have distinct expression patterns, with hta9 alone being cell - cycle - independent . Pie1 (the plant homolog of swr1) interacts with all three variants, but not with h2a . It remains to be seen whether these variants of the variant have any tissue or developmental function . However, the parallel with vertebrates is striking and may suggest that more complex organisms need more finely tuned chromatin than one h2a.z can provide.
Members of the kinesin-5 family are homo - tetramers with two motor domains at each end of a central four - stranded stalk . Kinesin-5 motors play a crucial role in cell division (kashina et al . 1996; sawin et al . 1992). We have recently shown that eg5 drives relative sliding of two microtubules, suggesting that each dimeric end walks on one microtubule (kapitein et al . 2005). A recent study using single - molecule fluorescence has furthermore revealed that single eg5 motors can run processively on microtubules and on axonemes (microtubule bundles) (kwok et al . 2006), in contrast to earlier reports of non - processivity also of a dimeric construct in kinetic experiments (crevel et al ., eg5 is believed to drive the poleward sliding of microtubules during spindle morphogenesis (miyamoto et al . Eg5 thus works in a large organized machinery which resembles muscle in its function if not in its microstructure (sharp et al . In contrast to muscle, the structural elements in the spindle are microtubule bundles which are rigid enough to withstand compressive forces . Since motors of opposite directionalities are active in the spindle, the whole assembly works like a push pull muscle (hildebrandt and hoyt 2000; sharp et al . The competition between opposing motors might serve as one regulatory element in this highly complex system . During spindle morphogenesis, the spindle poles move apart to a well defined distance which is then maintained in a dynamic equilibrium while the poleward flux of microtubules continues (miyamoto et al . This equilibrium could be controlled by a length measurement (e.g. Via chemical gradients). It is tempting, however, to speculate that this equilibrium, just as the positioning of the chromosomes in the cell midplane in metaphase, is maintained through a balance of forces . In that case it is necessary for the cell to sense force in some way, possibly using the motors themselves which could act as force sensors via load - dependent steps in their chemical cycles . Such a mechanism has been proposed to explain spindle oscillations in asymmetric cell division in c. elegans (grill et al . 2005). Understanding the exact role of eg5 in the mitotic spindle thus requires a measurement of the force generated by the full - length motor beyond just observing its unloaded motion on the microtubule lattice . Full - length xenopus laevis eg5 with an amino - terminal poly - histidine tag was expressed in insect cells, purified as described with an additional purification step using gel filtration on a superose 6 column (kapoor and mitchison 2001) and stored at 80c . We used an amino - terminal tag in order to avoid a possible perturbation of the interaction of the strongly conserved bimc box at the c - terminus of the motor with a head of the opposing dimer . In addition we wanted to provide an easily accessible poly - histidine epitope for antibody immobilization of the motor . His - tagged eg5 for functionality in a rescue assay in xenopus egg extract and no difference to untagged motors was found (kwok et al . 2004). Axonemes were purified from sea urchin sperm following a published protocol (gibbons and fronk 1979). C - terminal his - tagged drosophila melanogaster kinesin heavy chain (dmkhc) truncated at amino acid 685 was purified by using immobilized metal affinity chromatography (imac). E. coli strain bl21(de3) was used to overexpress kinesin and the cells were lysed by a freeze / thaw method . The cell lysate was then mixed with ni - nta resin, the column was washed with wash buffer, and kinesin was eluted from the column and stored at 80c . Assays were performed at 21c using a single - beam optical trap setup built on a custom - designed inverted microscope as described elsewhere (allersma et al . 1998). Infrared laser light (1,064 nm, cw, nd: yvo4, compass, coherent, santa clara, ca, usa) was focused into the flow chamber using an objective lens (neofluar 100, 1.3 na, oil immersion, zeiss) to trap the particle . The trap stiffness was varied in the range of 15 10 n m. the back - focal plane of the condenser (1.4 na, oil immersion, zeiss) was imaged onto a quadrant photodiode, which was operated at a reverse bias voltage of 100 v (yag444 - 4a, perkin elmer, vaudreuil, canada) for position detection of the trapped particle (gittes and schmidt 1998a). Photodiode signals, reflecting the displacement fluctuations of the trapped particle in the plane normal to the optical axis, were processed by custom - built analog electronics (allersma et al . 1998) and read into a pc using labview (national instruments, austin, tx, usa) for digital processing . Motility assays were carried out in sample chambers that were assembled from a cover slip and microscope slide, separated by a double - stick tape with a thickness of 70 m . Streptavidin - coated silica particles 0.5 m in diameter (kisker biotech, germany) were incubated first with 0.09 mg ml casein (sigma - aldrich) in pem80 buffer (80 mm pipes, 1 mm mgcl2, 1 mm egta, ph 6.8) for 10 min prior to mixing with biotinylated antibodies against the poly - histidine tag (penta - his biotin conjugate, qiagen) and then incubated further for at least 0.5 h. in order to eliminate unbound antibodies the beads were washed three times in pem80 buffer containing 90 g ml casein by centrifugation (10 min, 6,000 rpm, centrifuge 5415d, eppendorf) and resuspension, before motors were added . Then eg5 was added in the presence of 1 mm atp in pem80, and the mixture was incubated for 30 min on ice . Axonemes in pem80 were injected into a flow chamber and incubated for 10 min to let the filaments bind to the surface . To prevent non - specific bead binding, the flow chamber was then treated with 0.09 mg ml casein for another 10 min . In order to remove unbound axonemes, the flow chamber was washed with several volumes of motility buffer consisting of pem80, 10 mm dithiothreitol, 1 mm atp, 2 mm mgcl2, 10 mm glucose, 100 g ml glucose oxidase, 80 g ml catalase, 90 g ml casein . Finally, the mixture of motility buffer, which contained motor - coated beads with antibodies at a concentration of 0.060.13 g ml and eg5 at a concentration of 14 g ml, was added . Axonemes were chosen with their long axis oriented parallel to one of the quadrant photodiode detector axes . Using a piezo - actuated xyz substage (nano - lp-100, mad city labs, madison, usa), the laser - trapped motor - coated bead was positioned on top of a surface - immobilized filament to allow the motors on the surface of the trapped bead to interact with the microtubule lattice . The position of the bead in the trap was monitored using a quadrant photodiode detector . Position measurements were calibrated using the power spectrum method (gittes and schmidt 1998b). We estimate an error of 20% in this calibration, which is taken into account in calculating the error of the motor velocity . Full - length xenopus laevis eg5 with an amino - terminal poly - histidine tag was expressed in insect cells, purified as described with an additional purification step using gel filtration on a superose 6 column (kapoor and mitchison 2001) and stored at 80c . We used an amino - terminal tag in order to avoid a possible perturbation of the interaction of the strongly conserved bimc box at the c - terminus of the motor with a head of the opposing dimer . In addition we wanted to provide an easily accessible poly - histidine epitope for antibody immobilization of the motor . His - tagged eg5 for functionality in a rescue assay in xenopus egg extract and no difference to untagged motors was found (kwok et al . 2004). Axonemes were purified from sea urchin sperm following a published protocol (gibbons and fronk 1979). C - terminal his - tagged drosophila melanogaster kinesin heavy chain (dmkhc) truncated at amino acid 685 was purified by using immobilized metal affinity chromatography (imac). E. coli strain bl21(de3) was used to overexpress kinesin and the cells were lysed by a freeze / thaw method . The cell lysate was then mixed with ni - nta resin, the column was washed with wash buffer, and kinesin was eluted from the column and stored at 80c . Assays were performed at 21c using a single - beam optical trap setup built on a custom - designed inverted microscope as described elsewhere (allersma et al . Infrared laser light (1,064 nm, cw, nd: yvo4, compass, coherent, santa clara, ca, usa) was focused into the flow chamber using an objective lens (neofluar 100, 1.3 na, oil immersion, zeiss) to trap the particle . The trap stiffness was varied in the range of 15 10 n m. the back - focal plane of the condenser (1.4 na, oil immersion, zeiss) was imaged onto a quadrant photodiode, which was operated at a reverse bias voltage of 100 v (yag444 - 4a, perkin elmer, vaudreuil, canada) for position detection of the trapped particle (gittes and schmidt 1998a). Photodiode signals, reflecting the displacement fluctuations of the trapped particle in the plane normal to the optical axis, were processed by custom - built analog electronics (allersma et al . 1998) and read into a pc using labview (national instruments, austin, tx, usa) for digital processing . Motility assays were carried out in sample chambers that were assembled from a cover slip and microscope slide, separated by a double - stick tape with a thickness of 70 m . Streptavidin - coated silica particles 0.5 m in diameter (kisker biotech, germany) were incubated first with 0.09 mg ml casein (sigma - aldrich) in pem80 buffer (80 mm pipes, 1 mm mgcl2, 1 mm egta, ph 6.8) for 10 min prior to mixing with biotinylated antibodies against the poly - histidine tag (penta - his biotin conjugate, qiagen) and then incubated further for at least 0.5 h. in order to eliminate unbound antibodies the beads were washed three times in pem80 buffer containing 90 g ml casein by centrifugation (10 min, 6,000 rpm, centrifuge 5415d, eppendorf) and resuspension, before motors were added . Then eg5 was added in the presence of 1 mm atp in pem80, and the mixture was incubated for 30 min on ice . Axonemes in pem80 were injected into a flow chamber and incubated for 10 min to let the filaments bind to the surface . To prevent non - specific bead binding, the flow chamber was then treated with 0.09 mg ml casein for another 10 min . In order to remove unbound axonemes, the flow chamber was washed with several volumes of motility buffer consisting of pem80, 10 mm dithiothreitol, 1 mm atp, 2 mm mgcl2, 10 mm glucose, 100 g ml glucose oxidase, 80 g ml catalase, 90 g ml casein . Finally, the mixture of motility buffer, which contained motor - coated beads with antibodies at a concentration of 0.060.13 g ml and eg5 at a concentration of 14 g ml, was added . Axonemes were chosen with their long axis oriented parallel to one of the quadrant photodiode detector axes . Using a piezo - actuated xyz substage (nano - lp-100, mad city labs, madison, usa), the laser - trapped motor - coated bead was positioned on top of a surface - immobilized filament to allow the motors on the surface of the trapped bead to interact with the microtubule lattice . The position of the bead in the trap was monitored using a quadrant photodiode detector . Position measurements were calibrated using the power spectrum method (gittes and schmidt 1998b). We estimate an error of 20% in this calibration, which is taken into account in calculating the error of the motor velocity . To explore eg5 s motility with high spatial and temporal resolution and under load, we have used a single - bead optical trapping motility assay . We have used biotinylated antibodies to the his - tags at the n - termini of full - length eg5 to attach the motors to streptavidin - coated silica spheres . For a tetrameric double - ended motor, attachment to the bead can occur in different geometries, and the probability of binding in a particular geometry depends on stoichiometry, namely on the ratio of motors to beads and that of motors to antibodies . . Only two of these binding configurations (d and f) are expected to allow unperturbed microtubule interactions by two motor domains at one end of the tetramer . To achieve binding in these configurations, we optimized the relative concentrations of motors to antibodies and beads by determining the fractions of beads binding and moving on surface - attached axonemes (fig . 2a, b). At a high antibody density on the beads (fig . 2a), less beads moved than were stuck or bound only briefly, even when the motor concentration was increased . This might have been caused by mutual inhibition of tightly packed motors . At the lowest motor density no binding or motility was observed, most likely because all motor - domains were sequestered by the excess of antibody binding sites . At a constant motor concentration in solution (fig . 2b), the fraction of interacting and motile beads first increased with increasing antibody concentration, reached a maximum at a ratio of about 2:1 (motors: antibodies) and then decreased again . This again clearly demonstrates that an excess of antibodies is likely to bind the motors in a non - functional geometry . D, f possible eg5-motor attachments to beads (silica, 0.5 m diameter) via the genetically encoded n - terminal his - tag of eg5 . A all four motor domains are bound, preventing motility . C two motor domains are free, one at each end, likely allowing only non - processive motility . D one motor domain is bound, leaving a dimeric motor end free to interact with the microtubule . E traces of bead motility generated by individual eg5 (green) and kinesin-1 (grey) motors . The averaged (15-point) and median - filtered (0.3 s (eg5) and 0.05 s (kinesin-1) sliding windows; rank 10) signal is overlaid in red over both traces . The trap stiffnesses were 0.03 pn / nm (kinesin-1) and 0.013 pn / nm (eg5). F one dimer is bound, one dimer is free; sketch of a silica - sphere with motor held in the laser - trap, such that it interacts with a surface - attached microtubule trackfig . 2motor - bead attachment . Fractions of beads not interacting with a microtubule over 2 min (grey), moving (red), attached for less than 2 min (without motion) (purple), irreversibly stuck (blue). A constant high average number of antibodies per bead (6,950), variation of motor concentration . B constant concentration of motors in solution (corresponding to 2,410 per bead), variation of antibody density in order to obtain optimal motor / antibody - ratio (r - value) to favor species d and f (fig . 1). C systematic reduction of the absolute number of motor / antibody - complexes at constant r - values between 1 and 2 revealed a clear concentration dependence of motile events . The number of beads that was used at each concentration is shown under the histograms motor attachment, experimental setup and bead traces . D, f possible eg5-motor attachments to beads (silica, 0.5 m diameter) via the genetically encoded n - terminal his - tag of eg5 . A all four motor domains are bound, preventing motility . C two motor domains are free, one at each end, likely allowing only non - processive motility . D one motor domain is bound, leaving a dimeric motor end free to interact with the microtubule . E traces of bead motility generated by individual eg5 (green) and kinesin-1 (grey) motors . The averaged (15-point) and median - filtered (0.3 s (eg5) and 0.05 s (kinesin-1) sliding windows; rank 10) signal is overlaid in red over both traces . The trap stiffnesses were 0.03 pn / nm (kinesin-1) and 0.013 pn / nm (eg5). F one dimer is bound, one dimer is free; sketch of a silica - sphere with motor held in the laser - trap, such that it interacts with a surface - attached microtubule track motor - bead attachment . Fractions of beads not interacting with a microtubule over 2 min (grey), moving (red), attached for less than 2 min (without motion) (purple), irreversibly stuck (blue). A constant high average number of antibodies per bead (6,950), variation of motor concentration . B constant concentration of motors in solution (corresponding to 2,410 per bead), variation of antibody density in order to obtain optimal motor / antibody - ratio (r - value) to favor species d and f (fig . 1). C systematic reduction of the absolute number of motor / antibody - complexes at constant r - values between 1 and 2 revealed a clear concentration dependence of motile events . The number of beads that was used at each concentration is shown under the histograms at the optimal motor - to - antibody ratio (between 1:1 and 2:1) we then reduced the absolute concentrations of both (fig . As expected, the fraction of beads moving on microtubules decreased . Assuming poisson binding statistics (svoboda and block 1994; svoboda et al . 1993), the likelihood is large that the observed bead - microtubule - interactions are driven by just one motor if the fraction of moving beads is below 50% . For all our subsequent single - motor experiments, a motor / antibody ratio of 2 and absolute densities of nominally 200 motors / bead were used . This is an upper limit for the motor density on the beads, assuming that all motors were functional and did bind to beads . Since in reality this will not be the case, this nominal density is reasonable . We recorded the movement of eg5-bead complexes along axonemes with high - resolution back - focal - plane interferometry (gittes and schmidt 1998a). Beads moved processively at an average rate of 35 8 nm / s (fig . 1e), consistent with velocities observed in multiple - motor surface - gliding assays (data not shown). As a control, we used kinesin-1 (dmkhc685, the plasmid was a kind gift from r.j . Stewart, university of utah) with a c - terminal his - tag which allowed us to attach it to the same kind of beads in the same way . Kinesin-1-coated beads moved with initial speeds of about 400600 nm / s and typically stalled in the optical trap at loads of 67 pn (fig . 1e) consistent with what has generally been found for kinesin-1 s (svoboda and block 1994; svoboda et al . 1e, the traces of eg5-driven beads reveal a very distinct behavior . Apart from the fact that the velocity was much lower than that of kinesin, motor - driven excursions from the center of the trap appeared less regular . The thermal motion of the beads clearly decreased with increasing load, reflecting the non - linearity of the attachment compliance (svoboda et al . = 0.013 pn / nm, the average displacement from the trap center reached only about 100 nm and the load at which motors detached was typically below 2 pn . The repeated excursions observed, even at low motor concentrations, make it unlikely that the release events were caused by the breakage of the antibody - poly - his bond . Moreover, motor beads bound to axonemes in the presence of the non - hydrolyzable atp analog amp - pnp withstood much higher forces (data not shown). To examine the motility mechanism more closely, we first analyzed the motility records of kinesin-1 for evidence of regular stepping . At limiting motor concentrations, beads moved in the stereotypical kinesin pattern (fig . The overall stiffness of the system was increased sufficiently to readily observe stepwise displacements . Kinesin-1 motility using the same attachment chemistry to immobilize individual motors on 0.5 m silica spheres . Stepwise displacement (uncalibrated axis) is evident before (grey) and after filtering the data (red, 4,096 hz sampling rate, 15-point averaging and median - filtering: 0.05 s sliding window, rank 10) steps of kinesin-1/control . Kinesin-1 motility using the same attachment chemistry to immobilize individual motors on 0.5 m silica spheres . Stepwise displacement (uncalibrated axis) is evident before (grey) and after filtering the data (red, 4,096 hz sampling rate, 15-point averaging and median - filtering: 0.05 s sliding window, rank 10) we then analyzed eg5 motility in the same way . Figure 4a shows a collection of eg5-microtubule interaction events in which stepwise motion was visible . Due to the low load levels eg5 can sustain, the stiffness of the axoneme - bead - linkage was not in all traces high enough to show steps . 1993) of the plotted interactions, however, that were selected for more rigid attachment, revealed step - wise motion driven by individual eg5-motors (fig . Note that the initial variance shown in the traces does not strictly scale with trap stiffness because from track to track varying linkage stiffness dominated in most cases . The measured step - size bead = 6.5 0.2 nm (mean sem) was attenuated by the compliance of the axoneme - surface- and motor - bead linkages and is thus smaller than 8 nm . It is possible to roughly determine the magnitude of this attenuation factor . From the displacement variance in the tracks shown in fig . 4a we estimate an average linkage stiffness of link = 0.062 pn / nm . To estimate the motor displacement mot we use the correction mot = bead(trap + link)/link . This results in a step size of 9.3 1.5 nm, which is consistent with the 8 nm periodicity of the tubulin lattice . The linkage stiffness found for eg5 is comparable to what has been reported for similar experiments with kinesin-1 (svoboda and block 1994; svoboda et al . 1993). Processive stepping behavior similar to what we see has also recently been found with truncated dimeric human eg5 constructs (valentine et al . 2006), although only in high ionic strength buffer (200 mm kcl) and for short runs, comprising only a few steps . Our finding of stepping behavior (typically tens of steps) for the full - length tetrameric motor at standard motility assay conditions (80 mm pipes) supports the hypothesis that the motor can function in vivo in a processive manner and that each dimeric end of the motor can exert force on a microtubule . A example traces selected from independent experiments displaying stepwise displacements of the beads in the laser - trap driven by individual eg5 motors [grey, unfiltered data; red, averaged (15-point) and median - filtered data (0.3 s sliding window, rank 10)]. The trap stiffnesses were: trace i: 0.014; ii: 0.021; iii, iv: 0.029; v: 0.042 pn / nm . Double gaussian fit to this distribution yields a mean step size of 6.5 0.2 nm (mean sem). C histogram analysis of detachment forces observed for single kinesin-1- (black) and eg5-motors (red). D histograms of relative motor speeds directly preceding detachment: we scored the speeds of beads driven by kinesin-1 (black) and eg5 (red) in time interval before detachment (between arrows in a and fig . 3 corresponding to about 10 motor steps in both cases) relative to the unloaded motors speeds . E systematic variation of the trap stiffness revealed a hyperbolic relation to the obtained displacement (green circles). Error bars denote sem, the number of evaluated events varied between 5 <n <73 . The resulting detachment forces (product of displacement and trap stiffness) are nearly constant (purple triangles) single - step analysis and quantification of release force . A example traces selected from independent experiments displaying stepwise displacements of the beads in the laser - trap driven by individual eg5 motors [grey, unfiltered data; red, averaged (15-point) and median - filtered data (0.3 s sliding window, rank 10)]. The trap stiffnesses were: trace i: 0.014; ii: 0.021; iii, iv: 0.029; v: 0.042 pn / nm . Double gaussian fit to this distribution yields a mean step size of 6.5 0.2 nm (mean sem). C histogram analysis of detachment forces observed for single kinesin-1- (black) and eg5-motors (red). D histograms of relative motor speeds directly preceding detachment: we scored the speeds of beads driven by kinesin-1 (black) and eg5 (red) in time interval before detachment (between arrows in a and fig . 3 corresponding to about 10 motor steps in both cases) relative to the unloaded motors speeds . E systematic variation of the trap stiffness revealed a hyperbolic relation to the obtained displacement (green circles). Error bars denote sem, the number of evaluated events varied between 5 <n <73 . The resulting detachment forces (product of displacement and trap stiffness) are nearly constant (purple triangles) the distinctive feature of full - length eg5 motility was that the maximal force was on average rather low and that the motor tended to release at higher forces (fig . 1e). In the light of the stepping data this is unlikely to stem from the alternative attachment geometries (fig . 1a c). To quantify the phenomenon, we measured the eg5 release forces in comparison to kinesin-1 (fig . While kinesin-1 reached on average 5 pn, eg5 only reached an average force of 1.6 pn . The shapes of the distributions of detachment - forces were also clearly different between the two motors . Kinesin-1 was most likely to release at about 5 pn, with a tail in the distribution towards lower forces, while eg5 mostly released at low force with a tail towards higher forces . 4c) could be due to the finite probability of having more than one motor interacting with the microtubule on some beads or of having the two dimers of one tetramer somehow interacting at the same time with the microtubule, thereby producing higher force . We tested whether detachment occurred before or during stalling by plotting a distribution of speeds immediately preceding detachment, normalized by the average initial speeds (fig . While kinesin-1 predominantly detached at very low relative speed (i.e. During stalling), eg5-motors dissociated more frequently at near - maximal speeds and rarely stalled completely . To further test for a load - dependent release mechanism a motor with a load independent run length would not be affected by varying trap stiffness, while a motor with a characteristic release force should release at decreasing displacements with increasing trap stiffnesses . 4e, triangles) while displacements scaled as the inverse of trap stiffness (fig . Note that the first point, both in displacement and force, at low trap stiffness values does not fit on the model curves . This can be explained by another run length - limiting factor taking over from load - triggered release . Our findings suggest that eg5 might employ a so far un - described mechanism to limit force - production of individual motors a sort of slip - clutch - mechanism which might have a role in regulating spindle dynamics . It is interesting to note that, in contrast to skeletal muscle, regulation of the spindle dynamics is not effected from the outside, but cell - internally . In the most widely accepted model for spindle formation and maintenance, the push pull muscle model, opposing motors balance each other in a carefully regulated fashion (compton 2000; hildebrandt and hoyt 2000; sharp et al . Since eg5 is believed to be involved in this force balance, the effect we observed would give eg5 the role of a force sensor that would act such that force can be kept constant at a non - zero velocity . It is unclear if the load - dependent detachment is a property of the motor domain itself or if it depends on the structural organization of the tetrameric motor (neck and/or the coiled - coil). Since a dimeric truncated construct has been shown to stall at higher force (valentine et al . 2006), it is possible that the tails of the opposing motor dimer and in particular the highly conserved bimc box (drummond and hagan 1998) are necessary for this regulation . To clarify this, future studies will have to be done with engineered chimeric and truncated eg5-constructs . Our study provides insight into the native tetramer and will provide essential input for a quantitative model for mitotic spindle assembly and function.
Anemia is widely prevalent in developing countries like india and the most common affected group is pregnant women with an estimate of nearly two - thirds of all pregnant women . The main cause of anemia in pregnancy is found out to be iron deficiency, i.e. About 95% . Because of that, iron deficiency anemia remains a major public health problem today in developing countries like india . In pregnancy, iron deficiency is exaggerated because of the ability of foetus to extract its requirement in obligatory direction, from a mother whose body iron levels are already depleted however, it is far below the iron requirement of an iron depleted or deficient pregnant women . Therefore, more amount of iron, exceeding the daily requirement, is to be supplemented . This is aggravated by the adverse effect of pregnancy on the gastrointestinal tract which includes nausea and vomiting, motility disorder with reflux esophagitis, indigestion, constipation, and tendency to develop hemorrhoids . Therefore, anemia is a major contributory factor for maternal and fetal morbidity as well as mortality in developing countries like india . The first choice in the treatment of iron deficiency anemia for the majority of patients is the oral iron replacement therapy which is easily available at all peripheral health centers and subcenters . Situations like failure of oral iron therapy or increased demands in spite of regular oral iron therapy often necessitate parenteral iron therapy in anemic pregnant women . Iron dextran and iron sorbitol citric acid however, threat of unpredictable anaphylactic reaction by these conventional parenteral iron preparations prevented their wide use . Some of the studies show that new parenteral iron preparation, iron sucrose, is safe and effective for the management of anemia and can administer without a test dose. [810] it suggests that it can be given at most peripheral health centers even with minimum facilities . For that, multiple injections of iron sorbitol citric acid are required in a month, which is a common factor of decrease in compliance of recipients . Iron sucrose can be given as a single large dose infusion without any side effect . These are the main reasons which are the hurdles of parenteral iron therapy in developing countries . To overcome this, current practice is to give parenteral iron in a predefined fixed dose followed by oral or parenteral iron therapy according to the severity of anemia . This has shown to increase the compliance as well as decrease the economic burden on the pregnant women in rural areas . Therefore, this study was aimed at comparing the efficacy and safety with a fixed dose of two parenteral iron preparations, iron sucrose complex (intravenous route) and iron sorbitol citric acid (intramuscular route), as per the current practice in this area . This was a prospective, randomized, open label study undertaken from august 2009 to october 2010 . The study was carried out in h m patel research centre at shree krishna hospital and its attached peripheral centers: rural subcenter, ardi; primary health center, bakrol; and primary health center, karamsad . The ethical approval was obtained from human research ethics committee of the institute before starting of the study . Pregnant women with gestational age between 12 and 32 weeks, diagnosed as iron deficiency anemia with hemoglobin <8.5 g / dl, and specific indications for parenteral iron were selected for the study . Patients with other causes of anemia, infection, inflammation, liver or renal disease, recent administration of parenteral iron preparation and intolerance to iron derivatives were excluded from the study . One group received 200 mg of elemental iron in the form of iron sucrose complex, administered as short intravenous infusion (in 100 ml of 0.9% normal saline) over half an hour . Another group received 300 mg of elemental iron in the form of iron sorbitol citric acid, which was administered intramuscularly in divided doses over 4 days (i.e. 75 mg daily). Because the iron sorbitol citric acid is highly dialyzable, 3035% of elemental iron is excreted directly just after its administration . However, the whole dose was calculated according to hemoglobin deficit by the following formula and the remaining doses were continued orally after 1 month . The brand selected for iron sucrose complex was imax - s (brook laboratories ltd .) And for iron sorbitol citric acid was jectocos (cfl pharmaceuticals pvt . Ltd . ). If the patient did not show any reaction within 1 h, the remaining drug was administered . Whole therapy was monitored and each recipient was kept in observation in the hospital for at least 2 h after administration of parenteral iron . Baseline investigations such as hemoglobin concentration, hematocrit level, mcv, mch, and serum ferritin were performed before administering the iron therapy . After the therapy, each patient was followed twice, first follow - up after 14 days (i.e. 2 weeks) and second follow - up after 28 days (i.e. 1 month) of the parenteral iron therapy . On the day of first follow - up clinical examination and hemoglobin estimation while on the day of second follow - up, i.e. After 28 days, all laboratory investigations were done as before administering the therapy . At the time of follow - up visits, patients were also inquired for any adverse drug reaction noted during this period . Statistical analysis was done by using medcalc (version 9.2.0.1) and statistica software (trial version). Data were analysed by using various statistical tests such as paired t - test for laboratory parameters of all patients before and after the therapy, independent t - test to compare both the groups, and repeated measure anova test to compare the rise in the hemoglobin level in both the groups . Between august 2009 and october 2010, from 893 pregnant women, 643 were detected as iron deficient anemia at various rural centers . Among them sixty pregnant women were included in the study according to selection criteria and randomly assigned in the one of the two groups, i.e. Iron sucrose group (n = 30) or iron sorbitol citric acid group (n = 30). Eight pregnant women were lost to follow - up on the second follow - up visit, i.e. At 4 weeks . At 4 weeks, 29 pregnant women from the iron sucrose group and 23 pregnant women from the iron sorbitol citric acid group one woman developed pregnancy - induced hypertension, one delivered prematurely, two withdrew the consent because of pain at the site of injection and others did not come for follow - up . The initial demographic and laboratory characteristics were similar in both the groups [table 1]. Age, weight, and gestational weeks were almost similar in both the groups with p> 0.05 . Most women were multigravida while only 9 (30%) in iron sucrose and 8 (26.67%) in iron sorbitol citric acid groups were primigravida . According to the modified prasad classification, most of the pregnant women belonged to upper lower socioeconomic class . Hemoglobin concentration, haematocrit value, mcv, mch and serum ferritin level of both the groups were also similar before the therapy (p> 0.05). Baseline comparison of demographic and laboratory parameters between the iron sucrose group and iron sorbitol citric acid group as seen in figure 1 and tables 2 and 3, the increase in hemoglobin in both the treatment groups was significant as compared to pre - treatment . Before the therapy, the mean hemoglobin level in the iron sucrose therapy group was 7.59 g/ dl (sd, 1.38), which was increased significantly up to 8.33 g / dl after 14 days and 9.25 g / dl (sd 1.91) after 28 days (p <0.001). Similarly in the iron sorbitol citric acid therapy group hemoglobin was increased from 8.32 g / dl (sd 1.34) before therapy to 9.21 g / dl after 14 days and 9.77 g / dl (sd 1.64) after 28 days of the therapy . Tables 4 and 5 show that there was no significant difference in increase in the hemoglobin level in both the groups after 2 and 4 weeks . However, increment in the hemoglobin level from 2 to 4 weeks in the iron sucrose group was significantly more than the iron sorbitol citric acid group . Mean increase in the hemoglobin concentration after iron sucrose and iron sorbitol citric acid therapy . Comparison of the differences in laboratory parameters at the baseline and 28 days after iron sucrose therapy (n = 29) comparison of the difference in laboratory parameters at the baseline and 28 days after iron sorbitol citric acid therapy (n = 23) comparison laboratory parameters of the iron sucrose group and the iron sorbitol citric acid group 28 days after the therapy hemoglobin differences during repeated measurement during different therapy the ferritin level was found to be increased significantly across the time within both, iron sucrose (p <0.001) and iron sorbitol citric acid (p <0.001) groups . Before therapy, the serum ferritin level was 6.59 ng / ml in the iron sucrose therapy group and 9.32 ng / dl in the iron sorbitol citric acid therapy group, which was increased to 20.33 ng / dl and 20.12 ng / dl in iron sucrose and iron sorbitol citric acid therapy groups, respectively [tables 2 and 3]. Ferritin value remained higher in the iron sorbitol citric acid group as seen in figure 2 . However, there was no significance difference in the serum ferritin level at day 28 after iron sucrose and iron sorbitol citric acid therapy (p> 0.05). Serum ferritin level before and after iron sucrose and iron sorbitol citric acid therapy . Other parameters such as mcv, mchc and hematocrit value were also increased significantly (p> 0.001) in both the groups as seen in tables 2 and 3 . However, there was no difference in increase in values of all laboratory parameters between two different iron therapies after 28 days (p> 0.05). Sixty ampoules of iron sucrose injections (100 mg elemental iron each) and 116 ampoules of iron sorbitol citric acid injection (75 mg elemental iron each) were administered to 60 pregnant women . There was no serious adverse drug reactions, no episode of serious anaphylaxis or hypotensive attack was noted during the study period . As seen in table 6, out of total 33 adverse events, only two events occurred in the iron sucrose group where one pregnant woman in the iron sucrose group complained of burning and swelling at the site of infusion . Iron deficiency anemia during pregnancy is common and deserves special attention because of its potential consequences . However, the compliance of pregnant women is much less because of its untoward effects such as gastritis, constipation and blackening of stool . However because of cost and compliance to injectable iron, the current practice in this area is to give one fixed dose of parenteral iron then switch over to oral iron or continuations of parenteral iron according to severity of anemia . For the efficacy of parenteral iron therapy, laboratory parameters such as hemoglobin concentration, serum ferritin, mcv, mch and haematocrit value were chosen, because they are commonly preferred by clinicians in their clinical practice and gives better idea for diagnosis, prognosis and also evaluation of the therapy . As seen in table 5 and figure 1, the rise in hemoglobin was significant in both the groups after 14 days and after 28 days . The normal rise in the hemoglobin level usually starts after three days of the starting of iron therapy, and the rate in rise of the hemoglobin level in pregnant women is 0.8 g / dl per week as compared to non - pregnant women of 1.0 - 1.2 g / dl per week . Although not up to the expectation, the rate of increase in the hemoglobin concentration was found to be significant in this study . The reason for less rise in the hemoglobin level is unidentified, as the dose of iron was sufficient according to requirement for 1 month . The daily iron requirement in pregnancy is 4 mg / day (2.5 mg / day in early pregnancy, increasing up to 6 mg / day after 32 weeks) and so for 1 month 120 mg to maximum of 150 mg iron is required . Also during the antenatal visit, almost all the pregnant women were dewormed by a single dose of 400 mg albendazole . Showed a mean rise in the hemoglobin level was 1.7 g / dl, 25 days after the iron sucrose therapy . Also a study by wali et al . Showed the hemoglobin level rise of 2.6 g / dl after 3.6 weeks . Therefore, the rise in the hemoglobin level in this study was almost similar to both these studies . However, in this study with the limited dose of 200 mg of elemental iron, the initial rate of rise in the hemoglobin level is almost similar like in other studies with the full calculated dose . The rise in the hemoglobin concentration in the iron sorbitol citric acid group was not similar to that of the iron sucrose group after the 14 days of the parenteral therapy . The reason might be that nearly 33 - 35% of iron sorbitol citric acid is excreted just after the injection and also its release from the reticuloendothelial system is much slower as compared to iron sucrose release from liver parenchymal cells . As seen in tables 2 and 3 and figure 2, the increase in the serum ferritin level was almost similar in both iron sucrose and iron sorbitol citric acid therapy groups . However, a study by breymann c et al . And breymann c et al . Showed the rise in serum ferritin from 7 ng / ml to 342 ng / ml and from 8 ng / ml to 180 ng / ml, respectively . The reason for such a high increase in the ferritin level in these studies might be due to administration of the whole calculated therapeutic dose of parenteral iron as that of the conventional pattern . The dose in this study was sufficient for the production of adequate amount of red blood cells but for the store it is not sufficient . Even though, similar efficacy as compared to laboratory parameters after the two different parenteral iron preparations, the main problem with the iron sorbitol citric acid was its side effects . Because iron sorbitol is much low molecular weight and has high transferrin saturation capacity, it cannot be given as high intravenous bolus or infusion however, the most common complaint in this study was pain at the site of injection, specifically with intramuscular injection of iron sorbitol citric acid, which was found to be similar to the study by wali et al . Similarly, other side effects such as swelling and blackening of skin were major complaints in the iron sorbitol citric acid therapy group . Also, the patient dropout rate was higher in the iron sorbitol citric acid therapy group, similar to the study by wali et al . Therefore, all these side effects of the iron sorbitol citric acid might be the main reason for decreasing the compliance of the pregnant women and increase in drop rates . These adverse events were not seen with the iron sucrose complex therapy . However, the main problem with iron sucrose therapy was its cost . A total dose of therapy with the iron sucrose complex (inclusive of storage) costs between rs . The majority of the pregnant women suffering from iron deficiency anemia belong to middle to lower socioeconomic status and to purchase a complete dose of parenteral iron therapy is an economic burden for them . However, our study showed that the increases in all laboratory parameters are significant after the fixed single dose iron sucrose therapy . In this study, all laboratory parameter levels increased significantly after both the iron sucrose and iron sorbitol citric acid therapy . The rise in hemoglobin was found to be slightly more in the iron sucrose group as compared to the iron sorbitol citric acid therapy after the second week . There was no other significant difference in the efficacy of both the groups in anemia therapy in pregnant women . However, in this study almost all adverse events such as pain, swelling and blackening at the site of injection were seen and because of the adrs the dropout rate was much more in the iron sorbitol citric acid group . Giving iron sucrose in monthly divided doses decreases the economic burden to the patients and increases the compliance.
Congenital coronary arteriovenous fistulas are rare anomalies.1)2) however, patients may sometimes present the disease with bacterial endocarditis.3) we report a patient with congenital coronary arteriovenous fistula along with bacterial endocarditis of the mitral valve and embolism in the spleen and kidney . A 27-year - old man was referred to our hospital due to mitral valve repair for severe mitral insufficiency secondary to streptococcus viridians infective endocarditis which was diagnosed 2 months ago ., he had tachycardia of 120 beats / minute and blood pressure of 110/70 mm hg . Laboratory investigations revealed mild anemia (hemoglobin level, 10.4 g / dl) and the erythrocyte sedimentation rate of 34 mm / h . A standard two - dimensional doppler echocardiography was performed using acuson sequia c256 (siemens, pa, usa), which showed dilation of the left ventricle (left ventricular dimension in enddiastole / end - systole: 62/43 mm) and left atrium (left atrial diameter: 43 mm). It also revealed an echo free space beneath the posterior mitral annulus and aneurysmal dilatation of the proximal right coronary artery in the parasternal long axis view of the left ventricular inflow tract (fig . 1). The large mid and distal right coronary artery with a tortuous course, a defect in the posterior mitral leaflet, and the site of drainage of the fistulous tract into the left ventricle were visualized in parasternal short axis view, respectively (fig . Color - doppler examination showed high velocity turbulent flow striking the posterior mitral leaflet, and mitral regurgitant flow directing anteriorly into the left atrium through the defect of the posterior mitral leaflet, during isovolumetric ventricular contraction and diastole (fig . 4) confirmed the presence of dilated and tortuous right coronary arteriovenous fistula drainage into the left ventricle . During the operation, the patient was found to have dilated and tortuous right coronary artery with a fistula tract of approximately 0.8 cm arising from the distal to posterior descending artery origin and opening into the left ventricle immediately inferior to the posterior mitral annulus . The defect (0.6 cm diameter) in the posterior leaflet was seen between the middle and medial scallops . No vegetation of fibrinoid materials was seen on the posterior leaflet surrounding the terminal portion of the fistula . The defect in the posterior leaflet was closed with a woven dacron patch, and the fistula was sutured and closed inside the dilated distal right coronary artery . Coronary arteriovenous fistula is an asymptomatic and infrequent congenital anomaly.4) however, a significant number of patients present complications including bacterial endocarditis, congestive heart failure, and angina . Bacterial endocarditis has been reported in 4% to 10% of patients with coronary arteriovenous fistula.1)2) mitral valve perforation is an uncommon lesion that occurs in association with infective endocarditis of the aortic and mitral valves.5) in our patient, the perforation of the posterior leaflet secondary to bacterial endocarditis was clearly identified near the drainage site of the coronary arteriovenous fistula . Turbulence over the posterior leaflet caused by the abnormal flow of coronary arteriovenous fistula could account for the site of perforation on the posterior leaflet . Thus, it seems clear that coronary arteriovenous fistula can cause endocarditis on the left side of the heart and must be considered in the differential diagnosis of patients with unusual perforation of the posterior mitral leaflet . The absence of vegetation at the time of referral was probably due to bacteriological cure or distal embolization . Two dimensional echocardiography has its limitations in diagnosing coronary arteriovenous fistula but has been an important procedure in establishing the diagnosis in most cases.6)7) in our case, the proximal portion, the drainage site of coronary arteriovenous fistula, and the perforation of the posterior mitral leaflet were clearly demonstrated by two dimensional echocardiography . Coronary arteriovenous fistula could be considered in the differential diagnosis of patients with unusual perforation of the posterior mitral leaflet secondary to infective endocarditis . The ideal time for elective surgical closure would be prior to the development of fistula - related complications.
The heptavalent pneumococcal conjugate vaccine (pcv7) schedule in the pediatric population has significantly reduced the incidence of pneumococcal diseases in both vaccinated children and unvaccinated individuals of all ages . This led to the conclusion that pcv7 not only was highly effective in vaccinated children but also could induce herd immunity, which limited the spread of pneumococcal diseases in the population living in the same geographic areas as the vaccinated children . For example, the us cdc has reported up to about 90% reduction of the incidence of invasive pneumococcal diseases (ipds) caused by streptococcus pneumoniae in young children with the introduction of pcv7 . After the applications of pcv7, a significant decline in pneumococcal mucosal diseases such as acute otitis media (aom) and nonbacteremic pneumonia has also been reported worldwide in children and in adults, especially in the elderly [3, 4]. While the incidence of pneumococcal diseases caused by pcv7 serotypes continued to decline with the introduction of pcv7, increased incidence of infections caused by non - pcv7 serotypes, mainly serotypes 19a, 7f, 6a, and 6c, has been reported by several groups, which reduced the global efficacy of pcv7 against pneumococcal diseases [57]. To overcome this problem, a new vaccine covering more serotypes, especially the emerging serotypes, has been developed . The 13-valent pneumococcal conjugate vaccine (pcv13) currently covers the most serotypes, including 7 pcv7 serotypes (4, 6b, 9v, 14, 18c, 19f, and 23f) and six additional serotypes 1, 3, 5, 6a, 7f, and 19a . Thus, all the capsular polysaccharides of the 13 serotypes included in pcv13 were conjugated with the nontoxic mutant of diphtheria toxin crm 197 . Pcv13 was licensed to replace pcv7 in 2010 for children between 6 weeks and 5 years of age in the united states of america and the european union [8, 9]. Pcv13 was licensed on the basis of immunogenicity data alone through a putative protection correlate derived from pooled immunogenicity data and results of pediatric efficacy trials on pcv7 . Therefore, assessments of the protection effectiveness of pcv13 have drawn great interest immediately after it was licensed . Given the limitations of immunogenicity data in predicting protective efficacy conferred by vaccines, postmarket surveillance and effectiveness studies are highlighted for evaluating newly developed vaccines, particularly those with additional serotypes such as pcv13 . Therefore, a number of studies have monitored the incidence of pneumococcal diseases in pcv13-vaccinated and pcv13-unvaccinated population and the circulation of pneumococcal serotypes in both patients and healthy subjects . In this review, we evaluated the impacts of pcv13 in younger children based on previous studies on the effects of pcv13 on the incidence of invasive pneumococcal diseases, pneumonia, acute otitis media (aom), and nasopharyngeal carriage . We searched pubmed for eligible studies published from january 2010 to august 2014 using the key words, pcv13 or 13-valent pneumococcal conjugate vaccine and children or pediatric . Most studies on the effectiveness of pcv13 against ipd have demonstrated that pcv13 introduction has significantly reduced the incidence of ipd in both vaccinated children and unvaccinated population compared to the previous pcv7 applications, and the results were independent of countries, the scheme of pcv13 administration [1218]. However, different effectiveness regarding the 6 additional serotypes has been reported . The traditional 3 + 1 scheme of administration at 2, 4, 6, and 12 months was used in the usa . Recently, the us centers for disease control and prevention (cdc) have evaluated the impacts of pcv13 on ipd incidence through an active population - based surveillance in 10 regions around the country . Continuous reduction of ipd cases due to new serotypes included in pcv13 has been observed in all groups of different ages during the first three months after the introduction of pcv13 in 2010 . Particularly, 93%, 75%, 72%, 62%, and 58% reductions of the incidence of ipd caused by serotypes 1, 3, 5, 7f, and 19a were observed for subjects of <5, 517, 1849, 5064, and> 65 years of age, respectively, in 2012 and 2013 . However, analysis of the incidence of ipd caused by non - pcv13 serotypes revealed a possible early evidence of serotype replacement among adults of 1849 and 5064 years . In these two groups, incidence of ipd caused by non - pcv13 serotypes in 2012 - 2013 was 13% and 26% that were higher than expected when pcv13 was not available . This had only a marginal impact on the global effectiveness of pcv13 because of a significant reduction (about 30,000 cases) in overall ipd incidence and mortality (3,000 deaths) in all groups of different ages . The most significant reduction of ipd incidence was observed in the group of children aged <5 years for whom the ipd incidence was reduced by 64% in 2012 - 2013 compared to the time when pcv13 is not available . On the contrary, reduction in mortality was more important in adults, particularly in those older than 50 years . It has been reported that the protective effectiveness of each serotype included in pcv13 was different . For example, it was 100% for serotype 7f, 7696% for serotype 19a, and 1393% for serotype 3 . In addition, pcv13 administration was significantly effective in a special population, the alaska native people who are under higher risk of ipd than the general population of the usa . Have followed a total of 3,714 alaska native children (<5 years of age) who received the pcv13 vaccination between january 2009 and august 2011 according to the us recommendations . They found only 9 cases of ipd including 7 cases caused by pcv13 serotypes between 2009 and 2011 (106.7/100,000/year), whereas 52 ipd cases including 31 cases caused by pcv13 serotypes were diagnosed between 2005 and 2008 (399.0/100,000/year; p <0.001). The 3 + 1 schedule was also applied in canada and led to highly protective effectiveness . After the introduction of pcv13 in canada, the incidence of ipd in children <5 years of age declined from 18.0 to 14.2 cases per 100,000 population in the period of 20102012 . Specifically, pcv13 serotypes declined significantly from 66% (224/339) to 41% (101/244; p <0.001) in children <5 years of age and from 54% (1,262/2,360) to 43% (1,006/2,353; p <0.001) in children 5 years of age . Serotypes 19a, 7f, 3, and 22f were the most common serotypes in ipd cases reported in 2012 . The ipd caused by serotypes 19a and 7f declined from 19% to 14% (p <0.001) and 7f from 14% to 12% (p = 0.04), respectively, during 20102012 . Ipd caused by serotypes 22f and 3 increased from 7% to 11% (p <0.001) and 7% to 10% in children of <5 years of age (p = 0.22), respectively, during 20102012 . The 2 + 1 schedule (pcv13 administration at 2, 4, and 12 - 13 months) was started in england, wales, and northern ireland on april 1, 2010, to replace the previous pcv7 schedule . According to the epidemiological data in the public health of england, 706 ipd cases were reported during april 2010 and october 2013, including 30 caused by pcv7 serotypes, 292 caused by the additional 6 serotypes of pcv13 or serotype 6c, and 414 caused by non - pcv13 serotypes . Regarding the vaccination status of the studied children, it was reported that the pcv13 effectiveness after 2 doses in the first year or one dose after 12 months was 75% (95% confidence interval [ci], 58%84%). The effectiveness was 90% (95% ci, 34%98%) for the pcv7 serotypes and 73% (95% ci, 55%84%) for 4 of the 6 additional serotypes of pcv13 . In addition, the vaccine effectiveness of serotype 3 was not significantly different and the vaccine effectiveness of serotype 5 could not be analyzed because no case of infection due to this serotype was observed during the studying period . In denmark, a nationwide population - based cohort study was conducted to evaluate the dynamic changes of ipd incidence during three periods, the baseline (20002007), the pcv7 period (20082010), and the pcv13 period (20112013). In the study, a 21% reduction (95% ci, 17%25%) of ipd incidence in the whole population and a 71% reduction (95% ci, 62%79%) of ipd incidence in children aged <2 years were reported after pcv13 introduction . In addition, a 28% reduction (95% ci, 18%37%) of the 30-day mortality due to ipd was observed, decreasing from 3.4 deaths (95% ci, 3.2%3.6%) to 2.4 (95% ci, 2.2%2.7%) per 100,000 population after pcv13 introduction . The decline of mortality was observed in all groups of different ages and mainly in the nonvaccinated population, which is consistent with the report from the usa . However, for serotypes 1 and 3, there were no significant changes in incidence beyond what would be expected from the natural cyclical patterns . On the contrary, for serotype 19a for which a significant increase in disease incidence following pcv7 has been reported, the introduction of pcv13 was followed by a significant decline in the number of the cases towards baseline pre - pcv7 levels . The high effectiveness of pcv13 (the scheme 2 + 1) was also reported in israel by ben - shimol et al . The incidence of ipd caused by pcv7 6a serotype during the pcv13 application period decreased by 95% (incidence rate ratio [irr] = 0.05; 95% ci, 0.03%0.09%) including 90% in the pcv7 period and further 5% in the pcv13 period among the 2,670 ipd cases compared to the pre - pcv13 period . The incidence of ipd caused by the 5 additional pcv13 serotypes 1, 3, 5, 7f, and 19a increased initially by 47% but subsequently decreased by 79%, resulting in an overall 70% reduction during the entire study period (irr = 0.30; 95% ci, 0.21%0.44%). In total, a 63% reduction of ipd caused by all serotypes was observed in children aged <5 years (69% and 48% in children <2 and 24 years of age, resp . ). However, a certain degree of replacement was evidenced because a twofold increase of ipd caused by non - pcv13 serotypes was found (irr = 2.43; 95% ci, 1.73%3.66%). The most commonly increased serotypes were 12f, 15 b / c, and 33f . On the contrary, negative replacement phenomenon was reported in a study conducted by levy et al ., three years after the pcv13 administration, the number of pneumococcal meningitis cases significantly decreased by 27.4% (p = 0.041). Specifically, a 28.2% (p = 0.039) reduction was reported for children <2 years of age . Pneumococcal meningitis caused by the 6 additional pcv13 types decreased by 66.7%, but the number of cases due to nonvaccine serotypes remained stable . In 2012, 67.6% of cases were caused by the non - pcv13 serotypes including 12f (15%), 24f (15%), 22f (7%), and 15b / c (7%). A marked reduction of incidence of community acquired pneumonia (cap) mainly in vaccinated children <2 years after the implementation of pcv7 has been reported in a number of countries [19, 20]. However, a number of worldwide studies have reported a significant increase of the incidence of severe cap cases (i.e., empyema) caused by pcv13 serotypes 1, 3, 5, 7f, and 19a during the large scale administration of pcv7 . Therefore, it was hypothesized that pcv13 could reduce the incidence of cap in both vaccinated children and unvaccinated subjects . This hypothesis was confirmed with the implementation of pcv13 in a number of countries . In uruguay, pcv7 (schedule 2 + 1) was applied in 2008 and replaced by pcv13 (schedule 2 + 1) in 2010, and a catch - up immunization with a single dose of pcv13 was offered to children born between 2005 and 2009 . It has been shown that pcv7 and the pcv13 schedules have significantly reduced the incidence of cap in children 014 years of age compared to the cap incidence prior to the vaccination in 20032007 and the introduction of pcv13 had further reduced cap compared to the cap incidence during the pcv7 administration period . Particularly, the global cap hospitalization rate was reduced by 78.1% by pcv7 compared to prior vaccination period and increased to 92.4% after pcv13 . In addition, pcv13 introduction was accompanied by a relevant reduction of the incidence of cap due to serotypes 1 and 5, which, on the contrary, increased in the years of pcv7 administration . However, a significant increase of the total number of caps caused by non - pcv13 serotypes was observed during the period of 20092012 . A pcv13 schedule 3 + 0 (i.e., 3 doses at 2, 4, and 6 months without any booster) was introduced in nicaragua in 2010 . Becker - dreps et al . Compared the rates of pneumonia hospitalizations and ambulatory visits of cap between the prevaccine (20082010) and vaccine (2011 - 2012) periods . They found that the adjusted incidence ratio for all - cause cap hospitalization between the vaccine and prevaccine periods was 0.67 (0.590.75) and 0.74 (0.670.81) among infants and 1-year - old children, respectively . The adjusted incidence ratio for ambulatory visits of cap was 0.87 (0.751.01) and 0.84 (0.740.95) among infants and 1-year - old children, respectively . The low rates of health facility visits due to cap among children of 24 years of age and 514 years of age were also observed, suggesting a significant herd immunity effect . The pneumococcal serotypes 1, 3, 5, 7f, and 19a were the most frequently causes of cap after the implementation of pcv7 and the switch from pcv7 to pcv13 in june 2010 in france, where an observational prospective study was conducted in 8 pediatric emergency departments between june 2009 and may 2012 cap . Children between 1 month and 15 years of age were included in this study and the cap was confirmed through chest radiography examination . The incidence of cap was compared among three periods (1 year for each period) including a pre - pcv13 (2009 - 2010), a transitional (2010 - 2011), and a post - pcv13 period (2011 - 2012). A total of 5,645 children with cap including 365 and 136 cases of pleural effusion and pneumococcal laboratory - confirmed cap, respectively, were analyzed . While no catch - up program was performed for children aged 25 years, all - cause cap and pneumococcal cases decreased by 16% and 63%, respectively (p <0.001), in the post - pcv13 periods compared to the pre - pcv13 period . Although the highest reduction was seen in vaccinated children, a significant decrease of cap incidence was also observed in older unvaccinated children, confirming the herd effect induced by pneumococcal conjugate vaccines . In addition, the number of pleural effusion cases decreased by 53% (p <0.001) and the number of caps caused by the additional pcv13 serotypes decreased by 74% in the post - pcv13 period . The introduction of pcv7 immediately reduced the office visits of aom by 6%7.8% and antibiotic prescriptions by 5.7% . Pcv7 vaccination had an even more significant impact on recurrent aom by reducing tympanostomy tube placements by 20%24% . From the point of view of microbiologists, pcv7 initially induced a significant reduction of the incidence of pneumococcal aom caused by the pcv7 serotypes . However, the incidence of aom, caused by non - pcv7 serotypes, particularly serotypes 6a, 6c, and 19a, increased with the reduction of aom cases caused by pcv7 serotypes [27, 28]. In addition, pcv13 could significantly reduce the nasopharyngeal colonization by emerging serotypes causing aom . Therefore, it has been concluded that pcv13 provided better protective effects against aom than pcv7 . This conclusion was confirmed by the prospective study conducted in southern israel by ben - shimol et al . In this study, the effects of pcv7/pcv13 sequential introduction on pneumococcal and overall aom necessitating middle ear fluid (mef) culture in children <2 years of age were evaluated based on 6,122 aom cases including 1,893 pneumococcal cases . Compared to the prevaccination period, the incidence of aom caused by serotypes pcv7 + 6a and the 5 additional pcv13 serotypes 1, 3, 5, 7f, and 19a decreased by 96% and 85%, respectively (irr and 95% ci = 0.04, 0.020.08 and 0.15, 0.070.30, resp . ). Specifically, in the pcv7 vaccination period, only the incidence of aom caused by pcv7 + 6a serotypes decreased and in the pcv13 vaccination period the incidence of aom caused by serotypes 1, 3, 5, 7f, and 19a decreased along with a further pcv7 + 6a aom reduction . A nonsignificant increase of aopm caused by non - pcv13 serotypes was observed (irr = 1.07; 95% ci, 0.721.58). In total, the incidence of all - pneumococcal and all - cause aom decreased by 77% and 60% reductions, respectively . Have evaluated the microbiological characteristics of middle ear effusions of 118 pediatric patients (6 months to 12 years of age) undergoing pressure equalization tube (pet) placement between august 2012 and april 2013 . A total of 39 middle ear cultures from 29 patients led to the growth of at least one bacterial pathogen . Among these patients, 7 only received pcv7, 18 only received pcv13, and 4 received a combination of pcv7 and pcv13 . Only one culture from a child who has received pcv7 was positive of s. pneumoniae serotype 16 . On the contrary, haemophilus influenzae and moraxella catarrhalis were isolated from 7 and 3 cases, respectively . The limited number of s. pneumoniae strains isolated from mef in this study suggests that pcv13 was effective for preventing aom caused by serotypes covered by the vaccine . One of the limitations of this study was that the studied population has previously received antibiotics treatment repeatedly; therefore, the bacterial strains isolated from the patients were not fully associated with the effectiveness of vaccination of pcv7 and pcv13 . Nasopharyngeal pneumococcal carriage is considered as a prerequisite for the development of pneumococcal disease; therefore, reduction of nasopharyngeal carriage through pcv7 is also useful for reducing the incidence of pneumococcal infections among vaccinated children, their families, and the community . In addition, monitoring the changes of nasopharyngeal carriage induced by pcv13 vaccination is important for the evaluation of vaccine effectiveness and monitoring the development of replacement allows us to predict possible emergence of new serotypes causing pneumococcal diseases . Have analyzed 943 nasopharyngeal swabs from children (6 to 24 months of age) with aom between october 2010 and march 2011 . Among the 943 children with aom, 651 received at least 1 dose of pcv13 and 285 received only pcv7 . The overall pneumococcal carriage and carriage of non - pcv7 serotypes in the pcv13-vaccinated children were significantly lower than those in children exclusively vaccinated with pcv7 (53.9% versus 64.6%, p = 0.002, and 9.5% versus 20.7%, p <0.0001, resp . ). For serotypes 19a, 7f, and 6c, the pneumococcal carriage rates were also significantly lower in pcv13-vaccinated patients than in patients vaccinated only with pcv7 (7.5% versus 15.4%, p <0.001, 0.5% versus 2.8%, p = 0.002, and 3.7% versus 8.4%, p = 0.003, resp . ). Analyses of the other new serotypes included in pcv13 were not available due to the low number of cases identified in the study . A study on the surveillance of pneumococcal carriage in children <60 months was conducted in july 2010 at a pediatric center in boston, usa . Eighty - nine isolates (8.5%) were identified as one of the 6 additional serotypes included in pcv13 . A fall / winter peak of pneumococcal carriage of pcv13 serotypes was observed in nonvaccinated children but was blunted in vaccinated children . The authors reported a 74% reduction of pcv13 serotype colonization in the vaccinated children compared to nonvaccinated children . Approximately> 75% community children received pcv13 vaccination, and a> 50% decline of pcv13 serotype carriage was observed in nonimmune children in the same community . Consequently, the differences of the pcv13 serotype colonization between nonvaccinated and vaccinated children became not significant . In addition, no evidence of replacement has been observed to date . In england, the pneumococcal carriage of a group of children and their families in 2012 and 2013 after the pcv13 implementation was studied and compared with that in two previous periods, 2001 - 2002 before the pcv7 introduction and 2008 - 2009 after the pcv7 introduction . The prevalence of pneumococcal carriage in children <5 years was similar among these three periods, 47.7% (95% ci, 41.853.5), 51.0% (95% ci, 44.058.0), and 48.4% (95% ci, 44.152.7) in 2012 - 2013, 2008 - 2009, and 2001/2002, respectively . The prevalence of pneumococcal carriage in children of 520-years of age was 22.3% (95% ci, 15.630.9) in 2012 - 2013 and most strains (22/25, 88.0%) were of non - pcv13 serotypes . Only 3.4% (95% ci, 1.96.1) children 20 years of age were positive of pneumococcal carriage in the period of 2012 - 2 - 013, which was lower than that of the last two periods . Compared to the pneumococcal carriage in 2001 - 2002 before the pcv7 introduction, the odds of pcv7 serotype carriage significantly decreased in both 2008 - 2009 and 2012/2013, while the odds of carriage of the additional six pcv13 serotypes increased after the pcv7 introduction but significantly declined after the pcv13 introduction . The case / carrier ratio (ccr) for the serotypes of the highest carriage was relatively low . The highest ccr was observed for serotypes 7f, 19a, 3, 8, and 33f . Across the three carriage studies, despite the difficulties deriving from the differences in immunization programs, vaccination coverage, the timing of pcv13 introduction since previous pcv7 implementation, and the presence / absence of catch - up campaigns, global evaluation and comparison of the incidence of pneumococcal diseases in young children who received pcv13 and/or pcv7 suggest that pcv13 provides a wider and more optimal coverage against pneumococcal disease than pcv7 . It has been reported that pcv13 vaccination resulted in significantly higher effectiveness against ipd, mucosal pneumococcal diseases, and pneumococcal carriage than pcv7 . Given the high safety and tolerance however, pcv13 has been implemented for a relatively short time and long - term surveillance should be conducted in the future to further evaluate the safety and effectiveness of this novel vaccine . First of all, effectiveness against the additional 6 serotypes covered by pcv13 should be better defined . If the effectiveness against serotypes 6a, 7f, and 19a is indisputable, the effectiveness against serotypes 1, 3, and 5 needs further evaluation . Due to the relatively low number of cases caused by serotypes 1 and 5, no conclusion was drawn on the effectiveness against these two serotypes between pre- and post - pcv13 implementation periods . However, the reduction of the incidence of cap with empyema, a condition frequently caused by the most invasive serotypes, suggests that pcv13 was highly effective in preventing these pathogens . It has been reported that the effectiveness of pcv13 against serotype 3 was not satisfactory.
The advanced glycation endproduct (age) n - carboxy - methyllysine (cml), as recently investigated by kneyber and colleagues, can be formed either from glucose via ketoamine or glyoxal or from lipids by oxidation via glyoxal . This may explain why the pathophysiological role of ages is not restricted to diabetes, in which condition they have been primarily studied ., renal - insufficient patients have been associated with cml values several times higher than in healthy controls . Accumulating ages can be observed histologically as endothelial depositions in atherosclerotic plaques and tubular cells [3 - 5]. Their deposition initiates increased nadph oxidase and nuclear factor b activity as well as a reduction in endothelial nitric oxide synthase activity . The new and interesting idea of kneyber and colleagues was to investigate the association of cml with myocardial inflammation during sepsis and the clinically relevant state of mechanical ventilation, which by itself is known to induce age accumulation in the lungs . This is of relevance as sepsis - induced cardiac dysfunction is a frequent complication associated with increased mortality . Therefore, they focused on a situation where age accumulation is increased by systemic inflammation and exacerbated by mechanical ventilation . The association of cml with myocardial inflammation in sepsis and mechanical ventilation is intriguing . Indeed, sepsis enhances cml deposition, which is further aggravated by mechanical ventilation . Thus, the myocardial deposition of ages is associated with the disease and the therapeutic approach of mechanical ventilation perpetuates age formation . These results raise the question, however, whether the association reflects a relevant pathophysiological mechanism or' only' reflects the critical disease state . In the former case, interfering with the production or accumulation of ages could provide possible treatments . The extracellular ligand - binding domain of rage, the age receptor which binds ages and thereby limits the deleterious effects of ages . In animal experiments, treatment with soluble rage ameliorated inflammation and significantly reduced the atherosclerotic lesion area in a glycemia- and lipid - independent manner . Another pharmacological option is blockade of age formation by substances such as aminoguanidine or pyridoxamine . These have also been proven to prevent age - related cardiac hypertrophy in the absence of changes in collagen and elastin content and diabetic complications in animal models . These different approaches to treat age accumulation and the pathophysiological relevance of age formation in sepsis and mechanical ventilation need to be addressed in future studies using either soluble rage or blockers of age formation . Several cross - sectional studies have documented that age - induced inflammation is also present in human diseases with chronic low - grade inflammation and has also been associated with diabetic microangiopathy, endothelial dysfunction, atherosclerosis and chronic heart failure . However, in a prospective substudy of the irbesartan type 2 diabetic nephropathy trial (idnt) cohort including 450 patients with nephropathy caused by type 2 diabetes, cml was not predictive for cardiovascular events . Kneyber and colleagues present an interesting association between a major non - cross - linking age and sepsis combined with mechanical ventilation . Whether this association reflects a pathophysiologically relevant characteristic needs to be investigated in future studies . However, if interventional studies demonstrate positive effects in animal models, the availability of safe and cheap agents may offer an opportunity to target myocardial inflammation in sepsis and mechanical ventilation.
Emergence of resistant strains and human immunodeficiency virus infection has made the situation even more complicated . In addition to above, paradoxical reactions to anti - tuberculous therapy have created difficulties in the diagnosis and management of extrapulmonary tuberculosis, particularly central nervous system tuberculosis . We present a case of a child with tuberculous meningitis who developed optic neuritis as a paradoxical reaction to anti - tuberculous therapy (att). A 5 year - old - boy presented with complaints of loss of vision in both eyes since 4 days . It started as blurring of vision with an inability to recognize faces which gradually progressed to complete blindness . On examination, there was no perception of light and the pupillary response was sluggish, ill - sustained to light in both eyes . Three months ago the patient was diagnosed as tuberculous meningitis in a private hospital on the basis of prolonged fever, convulsion, positive tuberculin test, history of tuberculous contact and cerebrospinal fluid analysis . Computed tomography (ct) scan of the brain showed mild dilatation of all ventricles with periventricular ooze and exudates along tentorium cerebelli . He was started on four - drug att, consisting of isoniazid (5 mg / kg / day), rifampicin (10 mg / kg / day), pyrazinamide (25 mg / kg / day), and ethambutol (20 mg / kg / day), all taken once daily per orally . Prednisolone (2 mg / kg / day) and oral phenytoin (10 mg / kg / day) were also given in divided doses . After 4 weeks of stopping ethambutol and pyrazinamide, he developed visual complaints and presented to our hospital . Although the patient had visual loss, there was no worsening of his systemic condition . Also, he developed bilateral optic neuritis despite being off ethambutol . Due to the above factors, isoniazid and rifampicin were continued and oral prednisolone was re - started at a dose of 2 mg / kg / day in divided doses . On follow up after 2 weeks the patient showed gradual improvement in his vision . Steroids were continued for four weeks and then gradually tapered . On follow up after six months the child's vision had improved and fundoscopy was normal . Recurrence or appearance of fresh symptoms, physical and radiological signs in a patient who had previously shown improvement with appropriate att is called as paradoxical reaction . Various cases of neurotuberculosis showing expansion of previous tuberculoma or development of multiple new brain lesions during att have been reported . Clinicians may experience difficulty in differentiating between paradoxical deterioration, relapse of the disease or development of secondary resistance to att . Paradoxical reactions has been reported as early as 2 weeks and as late as 18 months after the initiation of att . In our case, the interval between the institution of therapy and appearance of paradoxical response was 3 months . Paradoxical reaction to att, side - effects of att, tuberculous neuritis, and secondary resistance to att were the different possibilities considered in our patient . It is unlikely that he had tuberculous optic neuritis, as this rare condition is usually associated with chorioretinitis, uveitis, or military tuberculosis . Further, when the patient developed visual loss, there was no worsening of the systemic condition . Thus, secondary resistance to att is also less likely . The anti - tuberculous drugs causing optic neuritis include isoniazid, ethambutol, and streptomycin . Our patient did not receive streptomycin and was off ethambutol at the time of visual loss . The fact that he improved with steroids despite continuing isoniazid suggests that optic neuritis was possibly an immunological - mediated response to att . Paradoxical reactions occur due to complex interplay between host's immune response and the direct effect of mycobacterial antigens . Activation and accumulation of lymphocytes and macrophages at the site of bacterial deposition or toxin production occurs when bacilli die . In patients with paradoxical reaction to att the rationale behind the use of adjuvant steroids lies in reducing the harmful effects of inflammation as the att kill the organisms . In conclusion, there is a need for clinicians to be aware of the occurrence of paradoxical reactions to att.
Septoplasty in adults is a well - established surgery, but in children it is still a matter of controversy . Some authors contraindicate surgery before 17 to 18 years of age, because they think that early surgical intervention would influence the normal growth of the nose; others indicate surgery based on the explanation that the sooner septal deviation of a child is corrected, the greater chance of developing normal breath and therefore a suitable facial growth.1 2 the surgery has undergone technical changes since its introduction to minimize trauma to the nasal structure, thus reducing the possible postoperative complications.1 this study aims to present the experience of the department of otolaryngology, university hospital, in the surgical treatment of children with nasal septum deviation and debunk the concept that septoplasty should only be performed after 17 to 18 years of age . This longitudinal cohort study had a sample of 40 patients, 24 (60%) boys and 16 (40%) girls, aged 4 to 12 years, with a mean age of 9 years, in the period from january 2005 to march 2012 (table 1). Patients underwent septoplasty and associated procedures such as adenoidectomy, tonsillectomy, and cauterization of inferior turbinate, when indicated, in the same surgery . These were assessed clinically and through nasal endoscopy in the postoperative period at 10, 30, and 60 days, and annually thereafter, with the longest follow - up of 7 years . With the patient under general anesthesia, asepsis and initially, a topically sterile cotton ball soaked in adrenaline concentration of 1:2,000 is placed in both nostrils with the aim of promoting vasoconstriction . After this, epinephrine solution is infiltrated at a concentration of 1:80,000 in the septal mucosa of both nostrils . A septal incision is performed on the left side, held at the mucocutaneous transition at nasal vestibule . The septal mucosa is detached in subperichondrial and subperiosteal bilaterally after transfixation of the quadrangular cartilage . Detachment is extended to the nasal floor bilaterally to facilitate the removal of possible cartilaginous and bony deviations . Cartilaginous and bony deviations are excised conservatively to preserve the growth of the septal cartilage, thereby avoiding abnormalities in nasal growth . Initially, a topically sterile cotton ball soaked in adrenaline concentration of 1:2,000 is placed in both nostrils with the aim of promoting vasoconstriction . After this, epinephrine solution is infiltrated at a concentration of 1:80,000 in the septal mucosa of both nostrils . A septal incision is performed on the left side, held at the mucocutaneous transition at nasal vestibule . The septal mucosa is detached in subperichondrial and subperiosteal bilaterally after transfixation of the quadrangular cartilage . Detachment is extended to the nasal floor bilaterally to facilitate the removal of possible cartilaginous and bony deviations . Cartilaginous and bony deviations are excised conservatively to preserve the growth of the septal cartilage, thereby avoiding abnormalities in nasal growth . Forty patients underwent septoplasty; 39 (97.5%) of them had associated inferior turbinate cauterization procedure, 20 (50%) patients had adenotonsillectomy, and 17 (42.5%) adenoidectomy (table 2). All patients were evaluated by performing nasal dressings in 10, 30, and 60 days, observing possible adhesions and recurrence of the deviation, septal perforation, infection, and nasal deformity . After this period, annual follow - up was done with the maximum of 7 years . There is controversy in the literature about the consequences of septoplasty for septal deviation in children, and some studies have shown that when done early the procedure brought benefits in the short and long term.2 a study conducted with 80 patients aged between 4 and 14 years old who underwent septoplasty (65 patients), rhinoplasty (11 patients), and rhinoplasty (4 patients) showed postoperative complications in only 13 of these patients (not specifying the surgery performed); the authors concluded that the benefits brought by these surgeries outweigh the occurrence of these minimal complications.2 dispenza et al3 stated that more important than the age of indication for the procedure is the degree of nasal obstruction, placing it as an absolute indication, because nasal obstruction during infancy disrupts the normal development of the angle of the skull base and consequently the maxillofacial growth and may cause malocclusion and jaw protrusion with bone deformities, confirmed even with anthropometric measurements . Others4 5 6 7 also claimed that delay defect correction can bring negative effect on organ systems that play a role in somatic and psychic development of the child including voice changes and sleep disturbances, but speculated that in some situations monitoring should be done for real indication for surgical treatment . A study performed with 44 patients aged between 8 and 12 years old who underwent septal surgery (reconstructive rhinoplasty) showed efficacy in relation to nasal obstruction and demonstrated that surgery when performed conservatively does not harm the facial growth or promote nasal deformities.8 in our study, all 40 patients were younger than 12 years old and underwent septoplasty surgery early, avoiding development of deformities resulting from mouth breathing . None of our patients had facial deformity at the first visit and none had nasal deformity after surgery (maximum follow - up of 7 years). Septoplasty can be performed safely without affecting the nasal and facial development in appropriately selected patients, and delaying the procedure may cause asymmetry and craniofacial anomalies.9 10 there are caveats, however, that surgery can negatively influence the growth of the nasal dorsum when done by an external approach and that before considering pediatric nasal septum surgery, a thorough clinical examination should be performed for a correct diagnosis and appropriate surgical indication.9 research that showed convincingly that septoplasty in children causes nasal deformity could not be found in the literature . Some studies even questioned the possibility of the occurrence of these deformities; however, most studies, like ours, showed that early surgery when indicated is beneficial . Thus, the studies found in the literature,1 2 3 4 5 6 7 8 9 10 whether anthropometric or clinical trials, corroborated our findings that septoplasty in children allows appropriate craniofacial growth and development, prevents abnormalities in somatic and psychic component of the patient, as well as demystifies the concept that septoplasty should only be performed after the age of 17 to 18 years old . The nasal septum deviation should be corrected early to provide a harmonious craniofacial growth and appropriate child development, without the occurrence of nasal deformity.
This study was approved by the sheba medical center and maccabi healthcare services (mhs) institutional review board committees . This study consists of elderly (65 years of age) type 2 diabetic subjects who are engaged in the idcd, a longitudinal investigation assessing the relationship of long - term type 2 diabetes characteristics and cognitive decline . Longitudinal follow - up began recently, so the present results are based on baseline data only . Subjects were randomly selected from the 11,000 type 2 diabetic individuals that are in the diabetes registry of mhs . The mhs diabetes registry is an integral part of the mhs electronic patient record system and was established in 1999 to facilitate disease management and to improve treatment . Entry criteria to the registry are any of the following: 1) hba1c> 7.25%, 2) glucose> 200 mg / dl on two exams> 3 months apart, 3) purchase of diabetic medication twice within 3 months supported by an hba1c> 6.5% or glucose> 125 mg / dl within half a year, or 4) diagnosis of type 2 diabetes (icd-9 code) by a general practitioner, internist, endocrinologist, ophthalmologist, or type 2 diabetes advisor, supported by a hba1c> 6.5% or glucose> 125 mg / dl within half a year . These criteria have been validated by 20 physicians in mhs against their own practice records (20). Additionally, age - specific prevalence rates were similar to those of a diabetes registry of another large hmo in israel (21). The diabetes registry has collected detailed laboratory, medication, and diagnosis information since 1998 (20). Subjects are eligible for the study if they are listed in the mhs diabetes registry, live in the central area of israel, are diagnosed as suffering from type 2 diabetes, are 65 years of age or above, are diagnosed as cognitively normal at baseline (based on a multidisciplinary weekly consensus conference), do not suffer from major medical, psychiatric, or neurological conditions that affect cognitive performance, have three or more hba1c measurements in the diabetes registry, and speak hebrew fluently and have contact with an informant for at least 10 h per week . The latter criterion was implemented to ensure obtaining of data regarding the existence of functional impairments secondary to cognitive changes as well as information on changes in behavior, both of which are important for diagnosis of cognitive status, especially in cases that are on the border between normal cognition and mci or early dementia . The mhs team performs a thorough screening of the diabetes registry and the mhs electronic patient record in order to identify potential subjects, excluding anyone with an icd code for dementia or its subtypes, treated with prescribed cholinesterase inhibitors, or with a major psychiatric or neurological condition (such as schizophrenia or parkinson disease) that could affect cognitive performance (fig . Letters are sent by mhs to the primary care physicians, asking for permission to contact each patient regarding the study . If the doctors agree, letters are sent to the subjects briefly describing the study and saying that they will be contacted by phone in the following 2-week period . Then the mhs team calls the subjects and asks for their participation after determining that they are fluent in hebrew and have a family member or caregiver whom they see at least 10 h per week who is willing to be an informant for the study . Subjects who are willing to participate in the study are assessed at their residence (or they come to the sheba medical center memory clinic, according to their preference) in two phases . First, the subject is visited by a study physician who, after the subject signs the informed consent form, performs medical, neurological, geriatric, and nutritional assessments (food frequency questionnaire) and draws blood for inflammatory markers (il-6 and crp) and hp and apolipoprotein e (apoe) genotypes . In the second phase (optimally 2 weeks after the physician visit), the subject is visited by a neuropsychologist who administers a cognitive battery (described below) and questionnaires to the subject and informant for cognitive and functional impairment and for depression and behavioral disturbances characteristic of dementia . All subject cognitive data are discussed by a multidisciplinary consensus conference team in order to define the subject s cognitive status (as cognitively normal, mci, or dementia and their subtypes). If the subject is cognitively normal at baseline, the idcd has follow - up interviews at 18-month intervals . Subjects who are diagnosed as mci at baseline are not included in the study; however, subjects who convert from cognitive normal status to mci during follow - up continue their participation in the study until conversion to dementia . The clinical dementia rating scale assesses, through an interview with the subject and an informant, the severity of cognitive and functional impairment in six domains: memory, orientation, judgment and problem solving, community affairs, home and hobbies, and personal care (22). The mini - mental state exam (mmse) is a 30-item questionnaire assessing orientation, concentration, memory, and language (23). Factor analysis revealed four cognitive domains, which were then scored as totals of z scores: episodic memory factor (included word list immediate and delayed recall and recognition from the consortium to establish a registry for alzheimer's disease [cerad] neuropsychological battery) (24), semantic categorization factor (25) (included the letter and category fluency and similarities), attention / working memory factor (included the diamond cancellation and digit span forward and backward tests) (28), and an executive factor (included the trail making test, parts a and b and the digit symbol test). Finally, we computed an overall measure summing the scores of all four domains (overall cognitive score). Immediately after the bloods were drawn into an edta - containing vacutainer tube, the tubes were placed in an ice box until handling at sheba medical center . Within up to 6 h from phlebotomy (as recommended), the bloods were centrifuged and serum was stored at 70c until determination . Hp typing was performed on stored plasma samples by polyacrylamide gel electrophoresis as previously described (30). In brief, 10 l of hb - enriched plasma was subjected to electrophoresis in a nondenaturing gel, and the gel was subsequently immersed in solution containing a congener of benzidine with a precipitate forming in the gel corresponding to the location of hb - hp complexes . The hp type of the sample was determined by the banding pattern of the hp - hb complexes with each of the three hp types having a characteristic banding fingerprint . Previous work established a 1:1 correspondence between this method and a pcr - based method for hp genotyping (30). The sociodemographic covariates were age at the time of cognitive assessment, years of education, sex, and number of follow - up years in the registry . The cardiovascular covariates were bmi, creatinine, total cholesterol, triglycerides, diastolic and systolic blood pressure, and hba1c . For the cardiovascular covariates, we used the average of all the subject s measurements available in the mhs diabetes registry . Microalbumin levels in the urine were used to reflect microvascular disease, whereas diagnosis of mi was used to reflect macrovascular disease . Our a priori hypothesis was that hp 1 - 1 would have lower cognitive performance; we therefore compared this group to each of the other two genotypes (hp 1 - 2 and hp 2 - 2). For each of the five cognitive measures separately, ancova compared hp 1 - 1 to hp 1 - 2 and hp 1 - 1 to hp 2 - 2, controlling for demographic factors (age, years of education, sex, and number of follow - up years in the registry) and cardiovascular factors (bmi, creatinine, total cholesterol, triglycerides, diastolic and systolic blood pressure, and hba1c). This study consists of elderly (65 years of age) type 2 diabetic subjects who are engaged in the idcd, a longitudinal investigation assessing the relationship of long - term type 2 diabetes characteristics and cognitive decline . Longitudinal follow - up began recently, so the present results are based on baseline data only . Subjects were randomly selected from the 11,000 type 2 diabetic individuals that are in the diabetes registry of mhs . The mhs diabetes registry is an integral part of the mhs electronic patient record system and was established in 1999 to facilitate disease management and to improve treatment . Entry criteria to the registry are any of the following: 1) hba1c> 7.25%, 2) glucose> 200 mg / dl on two exams> 3 months apart, 3) purchase of diabetic medication twice within 3 months supported by an hba1c> 6.5% or glucose> 125 mg / dl within half a year, or 4) diagnosis of type 2 diabetes (icd-9 code) by a general practitioner, internist, endocrinologist, ophthalmologist, or type 2 diabetes advisor, supported by a hba1c> 6.5% or glucose> 125 mg / dl within half a year . These criteria have been validated by 20 physicians in mhs against their own practice records (20). Additionally, age - specific prevalence rates were similar to those of a diabetes registry of another large hmo in israel (21). The diabetes registry has collected detailed laboratory, medication, and diagnosis information since 1998 (20). Subjects are eligible for the study if they are listed in the mhs diabetes registry, live in the central area of israel, are diagnosed as suffering from type 2 diabetes, are 65 years of age or above, are diagnosed as cognitively normal at baseline (based on a multidisciplinary weekly consensus conference), do not suffer from major medical, psychiatric, or neurological conditions that affect cognitive performance, have three or more hba1c measurements in the diabetes registry, and speak hebrew fluently and have contact with an informant for at least 10 h per week . The latter criterion was implemented to ensure obtaining of data regarding the existence of functional impairments secondary to cognitive changes as well as information on changes in behavior, both of which are important for diagnosis of cognitive status, especially in cases that are on the border between normal cognition and mci or early dementia . The mhs team performs a thorough screening of the diabetes registry and the mhs electronic patient record in order to identify potential subjects, excluding anyone with an icd code for dementia or its subtypes, treated with prescribed cholinesterase inhibitors, or with a major psychiatric or neurological condition (such as schizophrenia or parkinson disease) that could affect cognitive performance (fig . Letters are sent by mhs to the primary care physicians, asking for permission to contact each patient regarding the study . If the doctors agree, letters are sent to the subjects briefly describing the study and saying that they will be contacted by phone in the following 2-week period . Then the mhs team calls the subjects and asks for their participation after determining that they are fluent in hebrew and have a family member or caregiver whom they see at least 10 h per week who is willing to be an informant for the study . Subjects who are willing to participate in the study are assessed at their residence (or they come to the sheba medical center memory clinic, according to their preference) in two phases . First, the subject is visited by a study physician who, after the subject signs the informed consent form, performs medical, neurological, geriatric, and nutritional assessments (food frequency questionnaire) and draws blood for inflammatory markers (il-6 and crp) and hp and apolipoprotein e (apoe) genotypes . In the second phase (optimally 2 weeks after the physician visit), the subject is visited by a neuropsychologist who administers a cognitive battery (described below) and questionnaires to the subject and informant for cognitive and functional impairment and for depression and behavioral disturbances characteristic of dementia . All subject cognitive data are discussed by a multidisciplinary consensus conference team in order to define the subject s cognitive status (as cognitively normal, mci, or dementia and their subtypes). If the subject is cognitively normal at baseline, the idcd has follow - up interviews at 18-month intervals . Subjects who are diagnosed as mci at baseline are not included in the study; however, subjects who convert from cognitive normal status to mci during follow - up continue their participation in the study until conversion to dementia . The clinical dementia rating scale assesses, through an interview with the subject and an informant, the severity of cognitive and functional impairment in six domains: memory, orientation, judgment and problem solving, community affairs, home and hobbies, and personal care (22). The mini - mental state exam (mmse) is a 30-item questionnaire assessing orientation, concentration, memory, and language (23). Factor analysis revealed four cognitive domains, which were then scored as totals of z scores: episodic memory factor (included word list immediate and delayed recall and recognition from the consortium to establish a registry for alzheimer's disease [cerad] neuropsychological battery) (24), semantic categorization factor (25) (included the letter and category fluency and similarities), attention / working memory factor (included the diamond cancellation and digit span forward and backward tests) (28), and an executive factor (included the trail making test, parts a and b and the digit symbol test). Finally, we computed an overall measure summing the scores of all four domains (overall cognitive score). The clinical dementia rating scale assesses, through an interview with the subject and an informant, the severity of cognitive and functional impairment in six domains: memory, orientation, judgment and problem solving, community affairs, home and hobbies, and personal care (22). The mini - mental state exam (mmse) is a 30-item questionnaire assessing orientation, concentration, memory, and language (23). Factor analysis revealed four cognitive domains, which were then scored as totals of z scores: episodic memory factor (included word list immediate and delayed recall and recognition from the consortium to establish a registry for alzheimer's disease [cerad] neuropsychological battery) (24), semantic categorization factor (25) (included the letter and category fluency and similarities), attention / working memory factor (included the diamond cancellation and digit span forward and backward tests) (28), and an executive factor (included the trail making test, parts a and b and the digit symbol test). Finally, we computed an overall measure summing the scores of all four domains (overall cognitive score). Blood samples for hp typing were taken during the physician assessment . Immediately after the bloods were drawn into an edta - containing vacutainer tube, the tubes were placed in an ice box until handling at sheba medical center . Within up to 6 h from phlebotomy (as recommended), the bloods were centrifuged and serum was stored at 70c until determination . Hp typing was performed on stored plasma samples by polyacrylamide gel electrophoresis as previously described (30). In brief, 10 l of hb - enriched plasma was subjected to electrophoresis in a nondenaturing gel, and the gel was subsequently immersed in solution containing a congener of benzidine with a precipitate forming in the gel corresponding to the location of hb - hp complexes . The hp type of the sample was determined by the banding pattern of the hp - hb complexes with each of the three hp types having a characteristic banding fingerprint . Previous work established a 1:1 correspondence between this method and a pcr - based method for hp genotyping (30). The sociodemographic covariates were age at the time of cognitive assessment, years of education, sex, and number of follow - up years in the registry . The cardiovascular covariates were bmi, creatinine, total cholesterol, triglycerides, diastolic and systolic blood pressure, and hba1c . For the cardiovascular covariates, we used the average of all the subject s measurements available in the mhs diabetes registry . Microalbumin levels in the urine were used to reflect microvascular disease, whereas diagnosis of mi was used to reflect macrovascular disease . Our a priori hypothesis was that hp 1 - 1 would have lower cognitive performance; we therefore compared this group to each of the other two genotypes (hp 1 - 2 and hp 2 - 2). For each of the five cognitive measures separately, ancova compared hp 1 - 1 to hp 1 - 2 and hp 1 - 1 to hp 2 - 2, controlling for demographic factors (age, years of education, sex, and number of follow - up years in the registry) and cardiovascular factors (bmi, creatinine, total cholesterol, triglycerides, diastolic and systolic blood pressure, and hba1c). One thousand two hundred and eighty - eight subjects passed the preliminary screening, expressed consent to participate, were approached by a study physician, and signed informed consent . Of these 1,288 subjects, 282 (21.1%) were excluded from the study due to incompatibility with eligibility criteria (based on physician assessment), 109 (8.5%) refused to continue their participation in the study, and 897 remained active participants . The present analysis consists of 850 subjects who had an hp genotype available, 87 with hp 1 - 1, 350 with hp 1 - 2, and 413 with hp 2 - 2 . Of these, 84, 335, and 393, respectively, had full data on demographic, cardiovascular, and cognitive data to allow comparisons . The entire sample's average was 72.9 years of age (sd 4.7) and 39% were women . Subjects were in the diabetes registry for 10.5 years (sd 1.4) on average, and their mmse score was 28.0 (sd 1.8), consistent with a cognitively normal status in a sample with a broad education range . The mean hba1c was 6.8% (sd 0.8), consistent with good diabetes control . The three groups of hp genotypes did not differ significantly in any characteristic except for the mmse, for which the hp 1 - 1 had poorer performance (p = 0.02). Sample characteristics as depicted in table 2, compared with hp 1 - 2 and hp 2 - 2, cognitive function (presented as z scores) of hp 1 - 1 genotype was lower in all categories . Compared with subjects with the hp 1 - 2 genotype, hp 1 - 1 subjects performed significantly worse in semantic categorization (f = 7.03; p = 0.008) and overall cognition (f = 5.57; p = 0.02) (table 3). Similarly, compared with subjects with hp 2 - 2 genotype, hp 1 - 1 subjects performed significantly worse in semantic categorization (f = 4.18; p = 0.04) and overall cognition (f = 4.70; p = 0.03) (table 3). Means and sds of z scores of cognitive performance by cognitive domain and by hp genotype comparison of cognitive function in hp genotypes since the results of the comparisons of hp 1 - 1 with each of the hp 2 carriers on cognitive functions were substantially similar (tables 2 and 3), and in order to minimize multiple comparisons, in a secondary analysis, examining the relationship of cardiovascular risk factors and cognition by hp genotype, we compared hp 1 - 1 to hp 2 carriers (hp 1 - 2 and hp 2 - 2). For each of the cognitive domains and overall cognition, for hp 1 - 1 and hp 2 carrier groups separately, stepwise multiple regressions evaluated the collective association with the seven cardiovascular risk factors, controlling for the demographic predictors . Since the sample sizes of hp 1 - 2 and hp 2 - 2 were at least eight times as large as the sample size for the hp 1 - 1 group, the difference in power makes p values inappropriate when comparing the usefulness of cardiovascular predictors to cognition in the two hp groups . A conditional r showed the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors . The distribution of each conditional r was approximately normal (31), so a student t test (for normal distributions with different sds) was used to compare them . For descriptive purposes, anova and were used to compare the three hp groups to describe demographic and cardiovascular characteristics . Table 4 shows the conditional r (the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors) in the two groups . In the hp 1 - 1 group, the association of cardiovascular risk factors with cognition was significant for semantic categorization (p = 0.008), attention / working memory (p = 0.002), executive function (p = 0.05), and overall cognitive score (p = 0.05). In the hp 2 carrier group, the association of cardiovascular risk factors with cognition was significant for semantic categorization (p = 0.03), executive function (p <0.0005), and the overall cognitive score (p = 0.001). Compared with hp 2 carriers, the conditional r was significantly higher in subjects with hp 1 - 1 genotype for the semantic categorization (p = 0.009), attention / working memory (p = 0.002), and overall cognitive score (0.05). As depicted in table 2, compared with hp 1 - 2 and hp 2 - 2, cognitive function (presented as z scores) of hp 1 - 1 genotype was lower in all categories . Compared with subjects with the hp 1 - 2 genotype, hp 1 - 1 subjects performed significantly worse in semantic categorization (f = 7.03; p = 0.008) and overall cognition (f = 5.57; p = 0.02) (table 3). Similarly, compared with subjects with hp 2 - 2 genotype, hp 1 - 1 subjects performed significantly worse in semantic categorization (f = 4.18; p = 0.04) and overall cognition (f = 4.70; p = 0.03) (table 3). Means and sds of z scores of cognitive performance by cognitive domain and by hp genotype comparison of cognitive function in hp genotypes since the results of the comparisons of hp 1 - 1 with each of the hp 2 carriers on cognitive functions were substantially similar (tables 2 and 3), and in order to minimize multiple comparisons, in a secondary analysis, examining the relationship of cardiovascular risk factors and cognition by hp genotype, we compared hp 1 - 1 to hp 2 carriers (hp 1 - 2 and hp 2 - 2). For each of the cognitive domains and overall cognition, for hp 1 - 1 and hp 2 carrier groups separately, stepwise multiple regressions evaluated the collective association with the seven cardiovascular risk factors, controlling for the demographic predictors . Since the sample sizes of hp 1 - 2 and hp 2 - 2 were at least eight times as large as the sample size for the hp 1 - 1 group, the difference in power makes p values inappropriate when comparing the usefulness of cardiovascular predictors to cognition in the two hp groups . A conditional r showed the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors . The distribution of each conditional r was approximately normal (31), so a student t test (for normal distributions with different sds) was used to compare them . For descriptive purposes, anova and were used to compare the three hp groups to describe demographic and cardiovascular characteristics . Table 4 shows the conditional r (the proportion of variation not explained by the demographic predictors that was explained by the cardiovascular predictors) in the two groups . In the hp 1 - 1 group, the association of cardiovascular risk factors with cognition was significant for semantic categorization (p = 0.008), attention / working memory (p = 0.002), executive function (p = 0.05), and overall cognitive score (p = 0.05). In the hp 2 carrier group, the association of cardiovascular risk factors with cognition was significant for semantic categorization (p = 0.03), executive function (p <0.0005), and the overall cognitive score (p = 0.001). Compared with hp 2 carriers, the conditional r was significantly higher in subjects with hp 1 - 1 genotype for the semantic categorization (p = 0.009), attention / working memory (p = 0.002), and overall cognitive score (0.05). First, compared with hp 2 carriers (both hp 1 - 2 and hp 2 - 2), subjects with hp 1 - 1 genotype performed significantly worse in the semantic categorization domain and the overall cognitive score (reflecting lower performance in the summary of all cognitive domains). Second, in both hp 1 - 1 and the hp 2 carriers, cardiovascular risk factors were associated with cognition with significantly stronger associations in the hp 1 - 1 group for semantic categorization, attention / working memory, and overall cognition . Cardiovascular risk factors were not associated with the episodic memory domain in either group . To the best of our knowledge, this is the first study to report an association between hp type and cognition in type 2 diabetic subjects . In subjects with post - traumatic brain injury, a similar association was demonstrated, such that subjects with hp 1 - 1 genotype had lower scores on verbal iq and motor tests at 1 and 12 months after injury (32). Previous studies have shown that hp 2 - 2 genotype is associated with a less favorable cardiovascular profile . Since the latter is associated with cognitive function (33), hp 2 allele could be expected to be associated with lower cognitive performance . However, the role of hp in vascular pathology may differ according to the vascular bed (brain vs. periphery); the frequency of hp 1 - 1 genotype was significantly higher and frequency of hp 2 allele was significantly lower in a cohort of subjects with first symptomatic lacunar stroke due to small vessel disease compared with their frequency in healthy controls (18). Consistent with this finding, in hypertensive subjects with asymptomatic small vessel disease, hp 1 - 1 was associated with larger volumes of deep wmls when adjusting for age, sex, brain volume, 24-h mean arterial pressure, duration of hypertension, and previous antihypertensive treatment (19). Lacunar strokes and wml have been consistently associated with compromised cognitive functioning (34). These studies are consistent with the present neuropsychological findings and may explain the different role of hp genotype in the brain compared with its role in the periphery . Several mechanisms have been suggested to underlie the pathogenesis of small vessel disease (which includes wml and lacunar infarcts) (35) in the brain of hp 1 - 1 carriers . Among these are endothelial damage, compromised ability to form new blood vessels, and ineffective functioning of the blood - brain barrier (18). These hypotheses are based on findings pointing to the association of hp 1 - 1 with decreased activity of epithelial progenitor cells, which are involved in endothelial repair (35), a process that may attenuate the trajectories of damaged epithelium (35). In contrast, hp 2 - 2 has been demonstrated in vitro to be superior in the promotion of new blood vessel formation compared with other hp phenotypes (36). An alternative explanation for our findings is a possible interaction of hp genotype with hypertension, a risk factor for dementia by itself (37). Though groups stratified by hp genotype did not differ in mean systolic or diastolic blood pressure values, the negative association between cardiovascular risk factors (including blood pressure) and cognition was consistently stronger in hp 1 - 1 compared with hp 2 carriers . In line with our findings, higher levels of hp in hypertensive men were associated in a previous study with higher risk for stroke (38) and other sequelae of cardiovascular risk factors (39). These levels vary by genotype, with hp 1 - 1 values being highest (39). The interaction of hp genotype and cardiovascular risk factors was associated with lower cognitive performance in semantic categorization, attention / working memory, and overall cognitive score, with a similar trend for the executive function but not episodic memory domains . These findings may suggest that in type 2 diabetic subjects, a vascular mechanism (34) is involved in cognition rather than a hippocampal - related mechanism, which manifests typically in episodic memory impairment (40). Accordingly, the association of diabetes with performance for executive functions and overall cognition, but not episodic memory, has been demonstrated by some (41,42), but not all (43), previous studies . This report is based on cross - sectional data; thus, we cannot rule out that the present results reflect an artifact of the selection of subjects . Hp 2 carriers, who tend to have more cvd (8,44), might have had higher mortality, morbidity, or cognitive impairment that precluded their participation in the study . Some previous cross - sectional studies have also demonstrated higher prevalence of cvd in hp 1 - 1 carriers, but in longitudinal follow - up, hp 2 - 2 was consistently associated with more incident events (44). The longitudinal follow - up of this sample is essential to shed light on this potential limitation and the interpretation of the current results . Strengths of this study include the large sample, validated diabetes diagnosis for each subject, strong validity for risk factor levels and medical diagnosis, and thorough cognitive evaluation . The main limitation of this study is lack of brain imaging, thus limiting our ability to distinguish the vascular contribution to the association of hp with cognition . The hp phenotype is not available for subjects from the mhs diabetes registry who were excluded from the study, and the results reported here are cross - sectional (44). An additional limitation is lack of measurement of crystallized intelligence, preventing the evaluation of the contribution of this factor to our results . Nevertheless, we did control for education, which is a major contributor to crystallized intelligence . Israel has a strong family - oriented culture, so a major role in grandparenting has been the primary reason of refusal of women to participate in the study . Subjects who do not have contact with a caregiver for 10 weekly hours were excluded to optimize diagnosis of cognitive status . In summary, in our sample of subjects with type 2 diabetes, cognitive function is associated with hp genotype, being worse for hp 1 - 1 compared with hp 2 - 2 and hp 1 - 2 genotypes . Furthermore, cardiovascular risk factors are associated with cognitive function in different domains (but not episodic memory) in all genotypes, but more strongly in the hp 1 - 1.
A 40-year - old multiparous woman (164 cm, 74 kg) at 38 weeks gestation was admitted for a repeat cesarean section . She had experienced dyspnea on exertion for 10 years, and ild had been diagnosed with a lung biopsy one year previously . The pulse oximetry (spo2) was 95% with the patient breathing room air in the antenatal care unit, and pulmonary function tests showed decreased forced vital capacity (fvc)% predicted (60%), diffusing capacity of the lungs for carbon monoxide (dlco)% (64%), and forced expiratory volume in 1 second (fev1) (57%). Arterial blood gas analysis results were as follows: fraction of inspired oxygen 0.21, ph 7.44, pao2 89.9 mmhg, paco2 32.2 mmhg, hco3 21.6 mmol / l, sao2 96.7% . The patient was receiving prednisolone 5 mg / day due to migrating joint pain during pregnancy, and she was taking an antacid for gastroesophageal reflux . On preoperative examination, the patient had no limitation of mouth opening and was given a mallampati score of class 2 . Following admission, the patient was administered oxygen 3 liters per minute via nasal catheter . Consultation from the pulmonology department estimated that the risk of postoperative pulmonary complications is five times higher in patients with ild compared to the general population, associated with the possibility of acute deterioration of interstitial fibrosis . After discussion with the patient, the obstetric surgeon and the anesthesiologist, the decision was made to perform the procedure with combined spinal epidural (cse) anesthesia . The patient received 100 mg of hydrocortisone before arrival in the operating room . Upon arrival in the operating room, the noninvasive blood pressure (nbp) was 107/56 mmhg and the heart rate was 60 beats / min . Standard monitoring was used throughout the operation, including electrocardiography, nbp monitoring, and pulse oximetry . With the patient in the right lateral recumbent position, an 18 g tuohy and 27 g pencil point spinal needle were inserted via the needle - through - needle technique at the l3 - 4 interspace . A free - flow of cerebrospinal fluid was observed before 1.3 ml heavy bupivacaine 0.5% was injected . There was a failure of advancement of the epidural catheter with two attempts at another interspace . Fifteen minutes after the spinal injection of heavy bupivacaine, the sensory block (pinprick test) obtained to t5 with complete motor block of the lower extremities . The blood pressure decreased to 72/48 mmhg 25 minutes after the spinal injection and remained stable after intravenous ephedrine 10 mg and the infusion of additional fluids . A male baby (2.63 kg) was born with apgar scores of 9 and 10 at 1 and 5 minutes respectively . The sensory level was regressed to t8 and t10 after 90 minutes (at the end of the operation) and 140 minutes (discharge from the postanesthesia care unit), respectively . The motor block level regressed to bromage 0 (left leg) and 1 (right leg) at discharge from the postanesthesia care unit . Pregnant women with ssc are considered high risk patients, and they pose a potential anesthetic challenge during labor analgesia and operative delivery . If a cesarean section is planned, a series of preoperative laboratory tests, including a complete blood cell count, urinalysis and creatinine levels, electrolytes, albumin levels, coagulation screen, electrocardiogram, chest radiograph, arterial blood gas analysis, and pulmonary function test, should be performed . Echocardiography is now more frequently employed as it is useful in the assessment of ventricular dysfunction, pericardial and pleural effusions, and pulmonary hypertension . Our patient had dyspnea for 10 years, and was diagnosed with ild via a lung biopsy . Pulmonary function tests showed a moderate pulmonary insufficiency of mixed type and mildly decreased diffusing capacity of the lungs for carbon monoxide . Ild is common and a leading cause of morbidity and mortality in patients with ssc . Patients with mild interstitial involvement are asymptomatic during the early stages, and clinically significant ild is observed in approximately 40% of patients with ssc . Pulmonary function tests are a principal component in the diagnosis and prognosis of ssc - ild . Arterial hypoxemia resulting from reduced diffusing capacity is common in these patients . If a patient's vital capacity is lower than 1 l, weaning and extubation are difficult due to an inadequate ventilator effort during the postoperative period following general anesthesia . Moreover, such patients require increased positive airway pressure and a higher than normal oxygen concentration for adequate ventilation and diffusion . If general anesthesia is required, the patient should be prepared for difficult intubation and aspiration of gastric contents . Furthermore, a thorough preoperative physical examination should be performed to screen for skin tightening in the face and neck and limitation of mouth opening, as these can affect intubation . Selection of anesthetic agents should be determined on an individualized basis, according to the level of organ involvement . Regional anesthesia is a preferable alternative to general anesthesia and is also useful for postoperative analgesia . Moreover, the vasodilatory effects of sympathetic blockade can improve tissue perfusion and prevent raynaud's phenomenon . However, several case studies have reported problems of prolonged sensory block as a result of abnormal responses to local anesthetics in patients with ssc . Since 1964, patients in seven out of 21 cases of local and regional anesthesia in individuals with ssc have shown a prolonged sensory block . Six of these seven patients had prolonged peripheral nerve block and only one had a labor epidural block using chloroprocaine . Thompson and conklin reported that t6-s5 anesthesia was maintained for 5 hours and 55 minutes after the injection of 320 mg of chloroprocaine . However, a prolonged block has not been reported since 1999, when spinal, epidural, cse anesthesia, and continuous intrathecal catheter techniques were performed using bupivacaine, ropivacaine, and prilocaine . Bailey et al . Reported that when a patient with pre - eclampsia with limited mouth opening and a class 4 mallampati score underwent subarachnoid injection of 4.75 ml of 0.25% plain bupivacaine with 0.25 mg diamorphine, the sensory block reached the t2 level and full sensation was recovered 3.5 hours later . However, the patient experienced severe hypotension (160/90 mmhg to systolic pressure 90 mmhg) shortly after establishment of the block and was administered a total of 42 mg of ephedrine . The authors suggested that the precipitate hypotension was induced by chronic vasoconstriction and relative hypovolemia due to ssc and pre - eclampsia . In the present case, the cse technique was chosen in consideration of a risk of postoperative pulmonary complications and a possibility of acute deterioration of interstitial fibrosis . However, only a single shot spinal anesthesia was used to maintain the block after the failure to insert the catheter into the epidural space . The patient in the present case showed similar patterns of sensory and motor block recovery to those of normal parturients until discharge from the postanesthesia care unit, and she was able to perform activities such as breast - feeding without any particular differences compared to normal parturients . A limitation of this case study may be the fact that we did not record the accurate times of full sensory and motor block recovery after the patient was discharged from the postanesthesia care unit . In conclusion, our patient demonstrates an example of uneventful management of spinal anesthesia during a cesarean section . However, due to the rarity of reports of anesthesia in pregnant women with ssc, we recommend that anesthesiologists should keep in mind the possibility of abnormal responses to local anesthetics.
Gastroenterologists and surgeons who specialize in the treatment of crohn disease (cd) and chronic ulcerative colitis (cuc) have become increasingly aware of the implications of different forms of medical therapy on surgical outcomes . This is especially important in the era of top - down and multi - agent therapy for inflammatory bowel disease (ibd). Although relatively little literature exists regarding the relationship between pre - operative corticosteroid use and post - operative complications, several authors have found that increasingly higher doses of such immunosuppressive medications may result in an increased rate of post - operative septic complications . Similarly, there is increasing concern that combination immunomodulatory therapy with multiple agents may also be associated with an increase in post - operative infectious complications . Given reports of the association of monoclonal anti - tumor necrosis factor - alpha (anti - tnf-) antibody therapy with pulmonary infections, this concern has specifically been focused on infliximab (ifx), which until recently has been the only fda - approved biologic agent for ibd [7 - 11]. A recent meta - analysis of the association between immunomodulatory therapy and post - operative complications after surgery for ibd, which included studies of azathioprine, cyclosporine a, and three studies of ifx, found that the available evidence did not support this association . Since then, several studies have been published suggesting that ifx is indeed associated with an increased risk of post - operative complications . Thus, the potential association between ifx and surgical complications is controversial; studies both support and refute this potential relationship [5,13 - 19]. In a study of 270 patients by colombel et al ., 52 patients experienced intra - abdominal septic complications (iascs) after bowel resection for cd . Analysis did not reveal any increased risk in the ifx - treated subgroup, the moderate - to - high - dose corticosteroid subgroup, or the immunomodulator subgroup . Likewise, a matched case - control study from belgium of 31 cd patients also concluded that pre - operative ifx use did not result in a significantly increased rate of post - operative complications, or increased hospital length of stay, as compared to a control group of ifx - nave patients . That study did note, however, a trend towards increased early post - operative infections in the ifx group . More recently, a study of 413 ibd patients (156 with cd), of which 101 had received ifx within 12 weeks of surgery, also did not find any relationship between pre - operative ifx therapy and post - operative complications . That study, similar to others, was relatively limited by the absolute number of complications . In contrast, a more recent study from appau et al . Found an association between pre - operative ifx therapy for cd and post - operative complications . They concluded that ifx therapy within 3 months of surgery was associated with an increased rate of iascs, and of hospital re - admissions . They also found that patients who received a diverting stoma had a lower risk of iascs, thus prompting the observation that a diverting stoma may be prudent when surgeons are faced with cd patients who have recently received ifx . In light of this study, the risks associated with stoma reversal surgery must be weighted against the potential increase in complications associated with ifx for cd . In a study of 151 patients with cuc, 17 (10%) of whom failed ifx therapy and went to surgery and 134 of whom were ifx - nave, no association between ifx and complications was observed . However, the authors observed that ifx patients who had concurrent cyclosporine a treatment were at increased risk for overall and infectious complications . In a larger study by selvasekar et al . In which 47 cuc patients received pre - operative [ileal pouch - anal anastomosis (ipaa)] ifx therapy and 254 did not, those who received ifx were more likely to have anastomotic leak, and after multivariate adjustment for both disease severity and other medication use, ifx remained independently associated with an increased risk of ileal pouch - related and infectious complications . Finally, a recent study of 85 patients with cuc who received ifx pre - operatively also found that patients who receive pre - operative ifx were at increased risk of post - operative septic complications as well as late complications . Importantly, the authors also noted that patients who received ifx were more likely to have undergone a 3-stage ipaa, likely due to surgeon reluctance to perform an anastomosis in the setting of pre - operative ifx administration . Disease severity determined retrospectively is often inaccurate and surrogate covariates may be inadequate substitutions for validated methods of assessing disease activity . However, it is interesting to note that in the studies of cuc, those that adjusted for disease activity showed a relationship between ifx and complications, while the converse was true for those studies that did not . Another major limitation of several of these studies is the relatively long pre - operative ifx window, often 12 weeks or more (table 1). Recent studies of the pharmacokinetics of ifx in ibd suggest that the elimination half - life is between 7 and 18.5 days . By 12 weeks (84 days, or 4.5 half - lives) a window of 12 weeks used by several of the studies published to date may theoretically produce negative results regarding the occurrence of post - operative outcomes if a significant proportion of patients had an interval this long between ifx administration and surgery . Ideally, the duration between last infusion and surgery should be included as a continuous variable, but outpatient infusion often makes these data unavailable retrospectively . Referral practice patterns may too account in part for the heterogenous findings of these studies, as these may differ substantially in various regions of the world, as demonstrated by at least a 10% variation in the proportion of surgical ibd patients who received ifx . Thus, as is usually true of most retrospective studies, results from a single institution may not be broadly generalizable; the institutions themselves may be considered as a potential confounding factor when comparing results of different studies to each other . In one of the largest studies of the association of ifx and serious infections and mortality, the treat registry study of 6290 patients found that after adjustment for corticosteroid use and disease severity, ifx was not independently associated with increased risk, although both corticosteroids and disease severity were associated with those adverse outcomes . Although this study did not include surgical endpoints, the implications are nonetheless important, especially given the lack of large - scale surgical data . In a study of 270 patients by colombel et al ., 52 patients experienced intra - abdominal septic complications (iascs) after bowel resection for cd . Analysis did not reveal any increased risk in the ifx - treated subgroup, the moderate - to - high - dose corticosteroid subgroup, or the immunomodulator subgroup . Likewise, a matched case - control study from belgium of 31 cd patients also concluded that pre - operative ifx use did not result in a significantly increased rate of post - operative complications, or increased hospital length of stay, as compared to a control group of ifx - nave patients . That study did note, however, a trend towards increased early post - operative infections in the ifx group . More recently, a study of 413 ibd patients (156 with cd), of which 101 had received ifx within 12 weeks of surgery, also did not find any relationship between pre - operative ifx therapy and post - operative complications . That study, similar to others, was relatively limited by the absolute number of complications . In contrast, a more recent study from appau et al . Found an association between pre - operative ifx therapy for cd and post - operative complications . They concluded that ifx therapy within 3 months of surgery was associated with an increased rate of iascs, and of hospital re - admissions . They also found that patients who received a diverting stoma had a lower risk of iascs, thus prompting the observation that a diverting stoma may be prudent when surgeons are faced with cd patients who have recently received ifx . In light of this study, the risks associated with stoma reversal surgery must be weighted against the potential increase in complications associated with ifx for cd . In a study of 151 patients with cuc, 17 (10%) of whom failed ifx therapy and went to surgery and 134 of whom were ifx - nave, no association between ifx and complications was observed . However, the authors observed that ifx patients who had concurrent cyclosporine a treatment were at increased risk for overall and infectious complications . In a larger study by selvasekar et al . In which 47 cuc patients received pre - operative [ileal pouch - anal anastomosis (ipaa)] ifx therapy and 254 did not, those who received ifx were more likely to have anastomotic leak, and after multivariate adjustment for both disease severity and other medication use, ifx remained independently associated with an increased risk of ileal pouch - related and infectious complications . Finally, a recent study of 85 patients with cuc who received ifx pre - operatively also found that patients who receive pre - operative ifx were at increased risk of post - operative septic complications as well as late complications . Importantly, the authors also noted that patients who received ifx were more likely to have undergone a 3-stage ipaa, likely due to surgeon reluctance to perform an anastomosis in the setting of pre - operative ifx administration . Many of these retrospective studies suffer from common limitations . First is lack of adjustment for disease severity (table 1). Disease severity determined retrospectively is often inaccurate and surrogate covariates may be inadequate substitutions for validated methods of assessing disease activity . However, it is interesting to note that in the studies of cuc, those that adjusted for disease activity showed a relationship between ifx and complications, while the converse was true for those studies that did not . Another major limitation of several of these studies is the relatively long pre - operative ifx window, often 12 weeks or more (table 1). Recent studies of the pharmacokinetics of ifx in ibd suggest that the elimination half - life is between 7 and 18.5 days . By 12 weeks (84 days, or 4.5 half - lives) a window of 12 weeks used by several of the studies published to date may theoretically produce negative results regarding the occurrence of post - operative outcomes if a significant proportion of patients had an interval this long between ifx administration and surgery . Ideally, the duration between last infusion and surgery should be included as a continuous variable, but outpatient infusion often makes these data unavailable retrospectively . Referral practice patterns may too account in part for the heterogenous findings of these studies, as these may differ substantially in various regions of the world, as demonstrated by at least a 10% variation in the proportion of surgical ibd patients who received ifx . Thus, as is usually true of most retrospective studies, results from a single institution may not be broadly generalizable; the institutions themselves may be considered as a potential confounding factor when comparing results of different studies to each other . In one of the largest studies of the association of ifx and serious infections and mortality, the treat registry study of 6290 patients found that after adjustment for corticosteroid use and disease severity, ifx was not independently associated with increased risk, although both corticosteroids and disease severity were associated with those adverse outcomes . Although this study did not include surgical endpoints, the implications are nonetheless important, especially given the lack of large - scale surgical data . Whether pre - operative ifx use is associated with post - operative complications after surgery for ibd remains controversial; current evidence favors this association after surgery for cuc but does not favor an increased risk after surgery for cd . The potentially practice - changing implications of this debate are occurring now; increasingly some surgeons are waiting until anti - tnf- agents are washed out before operating or, if that is not possible, performing resections for cd with temporary diverting stomas or advising 3- rather than 2-staged ipaa . Larger studies and/or formal meta - analysis of the relationship between ifx and post - operative complications after surgery for ibd are needed before definitive treatment recommendations can be made . The decision of whether or not to perform staged surgery for ibd patients on ifx needs to be made on an individual basis, based on the clinical context and other known risk factors, such as hypoalbuminemia and high - dose corticosteroid treatment.
Evidence has been accumulated over the last decades supporting the idea that reactive oxygen species (ros) play a principal role in pathogen elimination by the microbicidal activity of phagocytes . Ros have also been described to induce modifications of nucleic acids, proteins, and lipids, resulting in a crucial effect on the cell functions that may be related to the process of aging or age - related diseases.2, 3, 4, 5 the main sources of ros are mitochondria, where their production is a consequence of the electron transport process . Moreover, the ros family consists of free radicals, such as superoxide anion (o2) and hydroxyl radical (oh), and non - radical molecules, such as hydrogen peroxide (h2o2) and singlet oxygen (o2). The free radicals can be produced by oxidative reactions, leading to chain reactions causing cell damage . These chain reactions can be terminated by antioxidants via interception of the ros, thereby limiting their toxic effects . Several antioxidants are used in vitro, in vivo, and in clinical trials, such as glutathione (gsh), vitamin e, ascorbic acid (vitamin c), and beta - carotene.7, 8, 9 gsh, catalase, superoxide dismutase, and other enzymes are part of a complex antioxidant system used by plants and animals to balance their oxidative state . These molecules are produced internally or introduced by the diet, such as vitamin a, vitamin c, and vitamin e. it has been shown that, in some cases, the combination of two antioxidants is more effective compared with either one alone . Showed that the dietary supplementation using a combination of vitamin c and e in alzheimer s disease (ad) patients is a more effective treatment compared with ad patients treated with only one of them . Several recent studies have also shown controversial outcomes where dietary supplements have been suggested or found to improve health and efficiency in preventing and/or slowing the progression of different diseases.12, 13, 14, 15, 16, 17, 18 the reduced intake and/or absorption of antioxidants from the diet and the reduced activity of endogenous antioxidative enzymes are some of the causes of decreased antioxidant defenses . There are also other endogenous and exogenous factors, like inflammation, elevation in o2 concentration, increased mitochondrial leakage, chronic inflammation, psychological and emotional stress, environmental pollution, strenuous exercise, smoking, and nutrition, that are considered causes of increased ros production . Cell membranes are usually resistant to the penetration of larger molecules, restricting intracellular delivery of potential therapeutics . Cell - penetrating peptides (cpps) have the potential to overcome this limitation and are a promising tool to transport molecules across cellular membranes . The ultimate goal is to specifically target organelles to selectively deliver the cargo molecule to the site of action in the cells, either by covalent attachment of the cargo to the cpp or by formation of stable complexes via electrostatic or hydrophobic interactions . Frankel and pabo and green and loewenstein were the first to discover the ability of peptides to penetrate cell membranes in experiments with the hiv-1 trans - activator protein (tat). Since then, thousands of cpps have been discovered and studied . Generally, cpps are composed of 430 amino acid residues either net positively charged or with alternating cationic and hydrophobic regions . The main accepted mechanism of cpp uptake is via endocytosis; however, other uptake mechanisms have also been suggested . The mechanism of action has shown strong dependence on the type of cpp, the peptide concentrations, the cargo molecule, and the charge or molar ratio used . Previously, we have designed a mitochondrial targeting cpp (mtcpp1) composed of d - arginine, 2,6-dimethyl - l - tyrosine, l - ornithine, and l - phenylalanine, described in the n - to - c direction (figure 1a). The inspiration came from the ss31 peptide, which is a tetrapeptide with alternating aromatic residues and basic amino acids, and we could demonstrate a 2-fold better superoxide anion scavenging ability for mtcpp1 compared with ss31 . We have also designed the gsh analog peptide 25 (upf25) by adding the non - coded amino acid o - methyl - l - tyrosine (tyr(me)) to the n terminus, changing the -glutamate to -glutamate, and amidation of the c terminus to gsh (figure 1b). We have shown that upf25 has a much higher hydroxyl radical scavenging ability compared with gsh, with a half maximal effective concentration (ec50), respectively, of 0.032 0.006 m and 1231.0 311.8 m.figure 1general structure of mtcpp1, upf25, and mtgcpp(a) mtcpp1, (b) upf25, and (c) mtgcpp . General structure of mtcpp1, upf25, and mtgcpp (a) mtcpp1, (b) upf25, and (c) mtgcpp . In this study, an investigation of the potential synergistic effect combining the aforementioned peptides, mtcpp1 and upf25, is presented . The dual antioxidant peptide was developed by fusion of the mitochondrial peptide and the glutathione analog using a covalent strategy, generating a novel peptide, mtcpp1-upf25 (mtgcpp) (figure 1c). Our aim was to explore the potential to synergistically increase the treatment efficacy of the novel peptide acting in different compartments at the same time . This was achieved by using delivery of the fused peptide into cells, thereby increasing the therapeutic antioxidant properties and, potentially, more effectively scavenging cytoplasmic and mitochondrial ros than either peptide alone . All synthesized peptides included in table 1 were readily soluble in milliq water at 1 mm stock solutions . 5-(6)-carboxyfluorescein (fam)-mtcpp1, fam - upf25, and fam - mtgcpp were designed to study the intracellular uptake of peptides . The carboxyfluorescein moiety did not decrease the solubility of fam - mtcpp1 and fam - mtgcpp but was slightly decreased for fam - upf25 in milliq water, requiring a longer time on the vortex to have a homogeneous solution.table 1library of synthesized cpps used in this studynamesequencemwmtgcppd - arg - dmt - orn - phe - tyr(me)-glu - cys - gly - nh21091.2mtcpp1d - arg - dmt - orn - phe - nh2625.4upf25tyr(me)-glu - cys - gly - nh2484.5fam - mtgcppfam - d - arg - dmt - orn - phe - tyr(me)-glu - cys - gly - nh21449.5fam - mtcpp1fam - d - arg - dmt - orn - phe - nh2983.01fam - upf25fam - tyr(me)-glu - cys - gly - nh2842.5mw, molecular weight; dmt, 2,6-dimethyl - l - tyrosine; (me), o - methoxy group; d-, d - form amino acid; arg, tyr, glu, cys, gly, phe, three letter codes for standard l- form amino acids; orn, l - ornithine . Library of synthesized cpps used in this study mw, molecular weight; dmt, 2,6-dimethyl - l - tyrosine; (me), o - methoxy group; d-, d - form amino acid; arg, tyr, glu, cys, gly, phe, three letter codes for standard l- form amino acids; orn, l - ornithine . We have previously shown that mtcpp1 and upf25 did not affect the viability of different cell lines even at high concentration (100 m).27, 28 we compared the effects of mtgcpp at different concentrations on the viability of hela 705 cells after 24 hr (figure 2). A solution of 20% dmso in complete cell growth medium was used to treat cells as a positive control . Mtgcpp did not show any significant toxic effects on the viability of hela 705 cells, nor did the other peptides at any of the tested concentrations (1, 5, 10, 20, 50, and 100 m). Furthermore, we studied the effects of the same set of peptides and concentrations on the viability of chinese hamster ovary (cho), bend.3 (mouse brain endothelial), and u87 (human brain glioblastoma) cells (figure s1). However, the peptides seemed to affect the metabolism of bend.3 cells, where a higher proliferation rate was observed (figure s1b).figure 2effect of treatment with peptides at different concentrations on hela 705 viabilityhela 705 cells were treated with mtcpp1, upf25, and mtgcpp for 24 hr . H2o2 (200 m and 400 m) were chosen as positive controls as well as dmso (20%). P values obtained from one - way anova multiple comparisons showed no significant difference between each group and untreated cells (complete medium only). Data represent the mean of a minimum of three individual experiments; sd for each data point is shown . Effect of treatment with peptides at different concentrations on hela 705 viability hela 705 cells were treated with mtcpp1, upf25, and mtgcpp for 24 hr . H2o2 (200 m and 400 m) were chosen as positive controls as well as dmso (20%). P values obtained from one - way anova multiple comparisons showed no significant difference between each group and untreated cells (complete medium only). Data represent the mean of a minimum of three individual experiments; sd for each data point is shown . Cell viability was quantified by conventional wst-1 assay . The superoxide anion scavenging assay was used as an estimation criterion for the antioxidative activity of the designed peptide . Mitochondrial superoxide was generated as a byproduct of oxidative phosphorylation and detected with a fluorescence method using the mitosox red mitochondrial superoxide indicator as a probe . Analysis of the scavenging ability of peptides showed that the fusion peptide had a remarkably stronger superoxide anion scavenger ability than mtcpp1 and upf25 alone (figure 3). The dual antioxidant peptide mtgcpp had an improved superoxide anion scavenging abilities by 2- and 3-fold compared with mtcpp1 and upf25, respectively . Antimycin a (ama) was used as positive control because of the ability of the chemical compound to induce an oxidative state in cells . Surprisingly, the covalent conjugation of the mitochondrial peptide to the gsh analog resulted in a more efficient antioxidant cpp, suggesting that both the oh and sh groups are involved in radical depletion reactions ., where the cys residue in the sequence was replaced with a ser residue in the upf26 sequence, and reduction of the hydroxyl radical scavenging ability was not observed . These analogs showed ec50 values of the scavenging reaction in the submicromolar range (the ec50 for upf25 was approximately 30 nm).figure 3the superoxide anion scavenging ability of peptides(a and b) superoxide anion levels decreased after treatment with any of the peptides in hela 705 cells . Shown are spectrofluorometry data expressing the fluorescence intensity (f.i .) Of mitosox after 24 hr treatment with peptides at 5 m concentrations and normalized versus cells treated with ama as a positive control (a) or versus mtcpp1 superoxide anion scavenging ability (b). Data represent the mean of three individual experiments sd . * * p <0.005 versus mtcpp1 . The superoxide anion scavenging ability of peptides (a and b) superoxide anion levels decreased after treatment with any of the peptides in hela 705 cells . Shown are spectrofluorometry data expressing the fluorescence intensity (f.i .) Of mitosox after 24 hr treatment with peptides at 5 m concentrations and normalized versus cells treated with ama as a positive control (a) or versus mtcpp1 superoxide anion scavenging ability (b). The chemiosmotic hypothesis postulated by mitchell describes the process of atp formation, where the respiratory chain converts redox energy into an electrochemical gradient of protons called proton - motive force (p). The two parameters of p are the membrane potential () and the transmembrane proton gradient (ph), which are thermodynamically equivalent:p=+2.3rt / fph, where r is the gas constant, t is absolute temperature, and f is faraday s constant . The contribution of either parameter to the proton - motive force varies widely in different organisms . In mitochondria, the component significantly exceeds the ph component and is therefore regarded as the main driving force for atp production.33, 34, 35 with the aim of assessing how these antioxidant peptides influence mitochondrial energy provision, m, and atp production were studied . Spectrofluorometry analysis using tetramethylrhodamine methyl ester (tmre) as a fluorescent probe showed that upf25 influenced the m . Treatment with upf25 decreased the m in hela 705 cells either with or without h2o2 addition . The gsh analog was able to partially rescue the m when the cells were under oxidative stress; however, not to the same extent as mtcpp1 and mtgcpp, where results close to the healthy situation were shown . No significant difference was observed between mtcpp1 and mtgcpp, whereas there were significant differences when comparing any of the peptides with untreated cells with addition of h2o2 (figure 4). The luminescence intensity (l.i .) From hela 705 cells after lysis was normalized based on the l.i . Of untreated cells . Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (fccp), a potent mitochondrial oxidative phosphorylation uncoupler able to depolarized m, was used as a negative control for the m measurements . This inhibition causes a collapse of the proton gradient across the mitochondrial inner membrane, leading to loss of the m and a reduction in the levels of atp.36, 37, 38 ama was used as a negative control for the measurement of atp levels . One - way anova multiple comparisons showed that atp levels after treatment with mtgcpp and mtcpp1 were similar to the atp levels of untreated cells (figure 5). The same analysis showed that atp levels after 24-hr treatment with upf25 were significantly decreased.figure 4mitochondrial membrane potentialhela 705 cells with (+) and without () addition of h2o2 at 200-m concentration for 2 hr were treated for 24 hr with peptides at 5 m concentrations . P values obtained from two - way anova multiple comparisons showed significant differences between mtcpp1 and upf25 and mtgcpp and upf25 . * p <0.05, * * p <0.005, * * * * p <0.0005.figure 5atp levels after treatment with peptidesatp levels in hela 705 were measured 24 hr after treatment with peptides and controls . The luminescence intensity (l.i .) Was normalized to the untreated cells level in each individual well . P values were obtained from ordinary one - way anova multiple comparisons (* p <0.0001). Mitochondrial membrane potential hela 705 cells with (+) and without () addition of h2o2 at 200-m concentration for 2 hr were treated for 24 hr with peptides at 5 m concentrations . P values obtained from two - way anova multiple comparisons showed significant differences between mtcpp1 and upf25 and mtgcpp and upf25 . Data represent the mean sd (n = 3). * p <0.05, * * p <0.005, * * * * p <0.0005 . Atp levels after treatment with peptides atp levels in hela 705 were measured 24 hr after treatment with peptides and controls . The luminescence intensity (l.i .) Was normalized to the untreated cells level in each individual well . P values were obtained from ordinary one - way anova multiple comparisons (* p <0.0001). We proposed a mechanism of superoxide anion scavenging activity (figure 6) and for the reduction of h2o2 (figure 7) of mtgcpp based on gsh . According to winterbourn free radical sink, gsh works together with superoxide dismutase to prevent oxidative damage:2o2+2h+superoxidedismutaseh2o2+o2r+gshrh+gsgs+gsgssggssg+o2gssg+o2.in the same manner, mtgcpp would have a role in protecting cells by catching and neutralizing potentially harmful molecules (figure 6).figure 6proposed mechanism of superoxide anion scavenging activity of mtgcppfigure 7proposed interconversion of mtgcpp in its reduced form and oxidized form by the action of glutathione oxidase, glutathione reductase, and glutathione peroxidase enzymes proposed mechanism of superoxide anion scavenging activity of mtgcpp proposed interconversion of mtgcpp in its reduced form and oxidized form by the action of glutathione oxidase, glutathione reductase, and glutathione peroxidase enzymes gsh is also used as a substrate for glutathione peroxidase (gshpx) for the reduction of h2o2:h2o2 + 2gshglutathioneperoxideh2o+gssg.gsh disulfide (gssg) is reduced to gsh by nicotinamide adenine dinucleotide phosphate (nadph) through the gsh reductase reaction: gssg+nadph+h+glutathionereductasenadp++2gsh.this exchange reaction provides an important mechanism for the action of gsh . Based on these data, we hypothesized and proposed an interconversion mechanism for mtgcpp in its reduced and oxidized form by the action of gsh oxidase, gsh reductase, and gsh peroxidase enzymes (figure 7). Gsh and molecular oxygen are used as substrates by gsh oxidase in the following reaction:2gsh+o2glutathioneoxidasegssg+h2o2.we hypothesized that mtgcpp is capable of preventing damage to cellular compartments caused by ros acting as gsh in the gsh metabolism . We have previously shown that mtcpp1 is internalized into cells and is targeting mitochondria . It has also been reported that treatment with gsh or upfs as well as other gsh analogs does not increase serum gsh levels, mainly because of its rapid degradation and the difficulties with direct uptake into different cell types . It has been shown that the uptake of gsh in cells after 1-hr treatment with 1 mm of gsh was in the low micromolar range (1.5 m). To investigate whether mtgcpp follows similar localization as mtcpp1 or whether we could increase the cellular uptake, we attempted to trace the subcellular localization of the internalized peptide by epifluorescence microscopy using organelle - specific fluorescent staining reagents . As shown in figure 8, mtgcpp as well as mtcpp1 (stained with carboxyfluorescein, green pseudocolor) were found inside cells but not in the nuclei (stained with a hoechst dye, blue pseudocolor). The mitochondria were stained with a tmre dye (red pseudocolor), and the orange / yellow pseudocolor resulting from the merged pictures indicated that the peptide partially targets the mitochondria . These results, as confirmed during spectrofluorometric analysis, showed that fam - upf25 was not internalized . Instead, the fusion peptide was shown to be a cpp entering the cell and accumulating in mitochondria . Similar results were observed when bend.3 cells were treated with the peptides at the same concentrations (figure s2). Spectrofluorometry was used to measure and quantify the subcellular uptake of the fluorescently labeled peptides . Using the procedure to isolate the mitochondria according to the manufacturer s protocol, three different subcellular fractions were obtained: membranes (plasma membrane and nuclear membrane), cytosol, and mitochondria . We determined the carboxyfluorescein fluorescence intensities in the three fractions after treatment with peptides for 24 hr in hela 705 cells . Fam - mtgcpp was presented in the membranes to the same extent as fam - mtcpp1, whereas fam - upf25 was registered to accumulate in the membranes four times higher than the other two peptides (figure 9a). Interestingly, the fluorescence signal from fam - mtgcpp was found to be 8- and 19-fold higher than that of fam - mtcpp1 and fam - upf25, respectively, in the cytosol fraction (figure 9b). Moreover, the data showed that fam - mtgcpp is mainly accumulated in the mitochondria . The uptake of fam - mtgcpp was 10- and 33-fold higher than that of fam - mtcpp1 and fam - upf25, respectively (figure 9c).figure 8cellular uptake and localization of fam - mtcpp1, fam - upf25, and fam - mtgcpp in hela 705 cellscells were incubated with peptides at 5 m concentration for 4 hr before imaging . Hoechst 33342 was added at 1 g / ml for 10 min before images were acquired . Untreated cells were kept under the same condition as treated cells without any peptide treatment . Fresh complete growth medium was added when the peptides were added to the other samples . Scale bars, 10 m.figure 9uptake of fluorescein - conjugated peptides in different cellular compartments(a c) uptake of fam - mtcpp1, fam - upf25, and fam - mtgcpp after 24 hr treatment with peptides at 5 m concentration in (a) membranes, (b) cytosol, and (c) isolated mitochondria fractions from hela 705 cells . Of fam - mtcpp1 and fam - mtgcpp . In the cytosol and in mitochondria, fam - mtgcpp accumulates to a higher extent than fam - mtcpp1 and fam - upf25; 8- and 19-fold and 10- and 33-fold, respectively . Data represent the mean of three individual experiments sd for each data point . * * * * p <0.0001 . Cellular uptake and localization of fam - mtcpp1, fam - upf25, and fam - mtgcpp in hela 705 cells cells were incubated with peptides at 5 m concentration for 4 hr before imaging . Hoechst 33342 was added at 1 g / ml for 10 min before images were acquired . Untreated cells were kept under the same condition as treated cells without any peptide treatment . Fresh complete growth medium was added when the peptides were added to the other samples . Uptake of fluorescein - conjugated peptides in different cellular compartments (a c) uptake of fam - mtcpp1, fam - upf25, and fam - mtgcpp after 24 hr treatment with peptides at 5 m concentration in (a) membranes, (b) cytosol, and (c) isolated mitochondria fractions from hela 705 cells . 4-fold higher than the f.i . Of fam - mtcpp1 and fam - mtgcpp . In the cytosol and in mitochondria, fam - mtgcpp accumulates to a higher extent than fam - mtcpp1 and fam - upf25; 8- and 19-fold and 10- and 33-fold, respectively . Data represent the mean of three individual experiments sd for each data point . P values were obtained from ordinary one - way anova multiple comparisons . * * * * p <0.0001 . The peptide exhibited a size of 150 and 400 nm in diameter when dissolved in milliq h2o or in cell culture media at 5 m final concentration, respectively (table s1). This means that the peptide is forming aggregates because an eight amino acid - long peptide would not have a similar size . The zeta potentials of mtgcpp were mainly electropositive at all of the different tested concentrations, as expected from the nature of a peptide consisting of an excess of positively charged amino acids (table s1). Here we studied the toxicity of the designed peptide and found that mtgcpp did not affect the viability of several different cell lines even at 100 m concentration . The non - toxic influence of the peptide was also confirmed by studying the functionality of the mitochondria after treatment . A depolarization of the m was recorded after treatment with h2o2 at 200 m concentration to induce the oxidative stress . Treatment with mtgcpp was able to rescue the m at the same level as the untreated cells without addition of h2o2 . Measurements of atp production showed that the atp levels of cells treated with any of the peptides were similar to the atp levels of untreated cells . We have shown that the fused peptide, mtgcpp, prevented ros formation with lower mitochondrial superoxide levels in cells compared with treatment with one of the peptides alone . A significant 2- and 3-fold decrease of ros levels were recorded for mtgcpp compared to mtcpp1 and upf25, respectively . These data suggest that part of the synergistic antioxidative activity might be a result of the ability of mtcpp1 fragments to carry into cells upf25 fragments at a higher concentration . The spectrofluorometric analysis of different cellular compartments using fluorescein - conjugated peptides gave unexpected results . We did not expect to find a better targeting ability of the new cpp compared with the parent mitochondrial peptide because a mitochondrial targeting ability of the gsh analog peptide has not been shown . There were 10- and 33-fold increases in fam - mtgcpp uptake in the mitochondria and 8- and 19-fold increases in uptake in the cytosol compared with fam - mtcpp1 and fam - upf25, respectively . Even though mtgcpp accumulated to such a higher extent compared with the other peptides, antioxidant activity our data suggest an additive synergistic effect of mtgcpp on scavenging of free radicals in live cells . The compounds discussed in this study may also act by regulating other pathways along with antioxidative mechanisms, which may result in synergistic antioxidative effects . In addition, combinatorial therapy with antioxidants should be considered, where they are combined with existing drugs . This might be a way to enhance the efficacy of standard therapy in the treatment of different diseases, like cardiovascular and neurodegenerative diseases . To achieve this result, a complete understanding of the molecular mechanisms of the ros specificities in each disease and in each state of the disease as well as animal studies and clinical trials all peptides were designed based on our previously published peptides, mtcpp1 and upf25.27, 28 peptides were synthesized in stepwise manner in a 0.1 mmol scale on a biotage alstra plus peptide synthesizer (biotage) using a fluorenylmethyloxycarbonyl (fmoc) solid - phase peptide synthesis (spps) strategy with chemmatrix rink amide resin (0.45 mmol / g) as a solid support to obtain c - terminally amidated peptides . The resin was swollen in n, n - dimethylformamide (dmf) for 20 min at 70c with an oscillating mixer . At each coupling step, fmoc - protected d- or l - amino acids were used and dissolved in dmf, and ethyl 2-cyano-2-(hydroxyimino)acetate (oxymapure) and carbodiiamide (dic) were used as coupling reagents for 5 min at 75c (table s1). The fmoc group was removed by treatment with piperidine (20% v / v) in dmf (first reaction at 45c for 2 min and the second reaction at room temperature for 12 min). The final cleavage was performed using a standard protocol (95% trifluoroacetic acid [tfa], 2.5% triisopropylsilane [tis], and 2.5% h2o) for 4 hr at room temperature . Peptides were precipitated in cold diethyl ether and purified by reverse - phase high - performance liquid chromatography (rp - hplc) using a biobasic c-8 column (thermo scientific) and a 20%80% acetonitrile (in water with addition of 0.1% tfa to both solvents) gradient . The purified peptides were lyophilized, and the molecular masses of the peptides were analyzed by ultra - performance liquid chromatography - mass spectrometer (uhplc - ms; agilent 1260 infinity, agilent technologies). Hela 705 cells (a human cervical carcinoma cell line) were grown in dmem with glutamax supplemented with 0.1 mm non - essential amino acid solution, 100 u / ml penicillin, 100 g / ml streptomycin, and 10% fetal bovine serum (fbs). Bend.3 cells (a mouse brain endothelial cell line) and cho cells were grown in dmem with glutamax supplemented with 3 mm l - glutamine, 100 u / ml penicillin, 100 g / ml streptomycin, and 10% fbs . U87 cells (a human primary glioblastoma cell line) were grown in dmem with glutamax supplemented with 100 u / ml penicillin, 100 g / ml streptomycin, and 10% fbs . Cell proliferation was determined by using the wst-1 cell proliferation assay (roche diagnostics) according to the manufacturer s instructions . Briefly, hela 705, bend.3, u87, and cho cells were seeded at 7 10 cells / well into 96-well plates 24 hr prior to experiments . The cells were treated with peptides at different concentrations and incubated for 24 hr in complete growth medium according to the cell line . Wst-1 cell proliferation reagent was added after 20 hr of peptide treatment to each well at a final dilution of 1:10 . After 4 hr incubation, the plate was placed on a sunrise microplate absorbance reader (tecan) and shaken for 1 min before the reading, and absorbance of the formazan product was then measured at 450 nm . Cells incubated for 24 hr with 20% dmso in complete media (v / v) were used as positive control as well as cells treated with h2o2 200 m and 400 m concentration . M was evaluated using the fluorescent probe tmre (mitochondrial potential membrane assay kit, abcam). The positively charged cell - permeant dye tmre readily accumulates in active mitochondria because of their relative negative charge . The dye fails to be sequestered into depolarized and/or non - functional mitochondria because of a decrease in m . Briefly, hela 705 cells were seeded into 96-well plates 24 hr before the treatments . Cells were treated with peptides for 24 hr at different concentrations as previously described . Tmre (400 nm) was added to the complete medium, and cells were incubated for 30 min at 37c, 5% co2 and protected from light . The medium was removed, and cells were washed once with pbs to remove background fluorescence from the cell culture medium . The plate was read on a fluorescence reader (peak excitation = 549 nm, peak emission = 575 nm). The same assay was performed to evaluate the ability of peptides to restore a physiological m after insult with h2o2 . Briefly, cells were plated and treated with peptides at different concentrations as previously described . After 2 hr of exposure to 200 m h2o2, cells were incubated for 24 hr at 37c and 5% co2 . Medium containing tmre was prepared and added to each well at 400 nm final concentration . Cell medium was removed after 30 min, and cells were washed once with pbs and replaced with 100 l / well of 0.2% bsa in pbs . The m was measured by spectrofluorescence reader (flex station ii, molecular devices; peak excitation = 549 nm, peak emission = 575 nm). The m of treated cells was expressed as the percentage of m of untreated cells or of untreated cells with addiction of h2o2 at 200 m concentration . Ros production was determined by using the fluorescent probe mitosox red mitochondrial superoxide indicator (invitrogen detection technologies). When in mitochondria, mitosox red reagent is oxidized by superoxide and exhibits red fluorescence (life technologies, molecular probes). According to the manufacturer s protocol, a vial of mitosox reagent was dissolved in 13 l of dmso to make a 5 mm mitosox reagent stock solution . The 5 mm stock solution was diluted in hank s balanced salt solution (hbss)/ca / mg to obtain a 5 m mitosox reagent working solution . Briefly, hela 705 and bend.3 cells were seeded in 96-well plates at a concentration of 7 10 cells / well containing 100 l of complete medium and allowed to recover for 24 hr . Mitosox reagent 5 m was added to the cells, and they were incubated for 10 min at 37c and 5% co2, protected from light . After staining with mitosox, the medium was aspired, and the cells were washed once with 0.2% bsa in pbs to remove background fluorescence, and finally 100 l / well of 0.2% bsa in pbs was added . The plate was read with a fluorescence reader (flex station ii, molecular devices) with settings suitable for mitosox (peak excitation = 510 nm, peak emission = 580 nm). The compartmentalization of the peptides inside the cells was determined using the thermo scientific mitochondrial isolation kit for cultured cells . The protocol relies on a reagent - based method and differential centrifugation to separate the mitochondrial and cytosolic fractions . Briefly, hela 705 cells were grown in 225 cm flasks and allowed to recover for 24 hr . Cells were treated with fluorescein - conjugated peptides at 5-m concentration for 24 hr . Cells reached 90% confluence with an average cell yield of 2.25 10 and were harvested using a cell scraper (sarstedt). The flask was washed with 10 ml fresh complete medium, transferred to a 15-ml falcon tube, and centrifuged at 850 g for 2 min . The pellet was suspended in 1.5 ml medium and centrifuged at 850 g for 2 min . 800 l of mitochondrion isolation reagent a was added and vortexed at medium speed for 5 s, and the tube was incubated on ice for exactly 2 min . 10 l of mitochondrion isolation reagent b was added and vortexed at maximum speed for 5 s. the tube was incubated on ice for 5 min, vortexing at maximum speed every minute . 800 l of mitochondrion isolation reagent c was added, and the tube was inverted several times to mix . The tube was centrifuged at 700 g for 10 min at 4c . The supernatant was transferred to a new 2.0-ml tube and centrifuged at 12,000 g for 15 min at 4c . 500 l of mitochondrion isolation reagent c was added to the pellet and centrifuged at 12,000 g for 5 min . After the isolation, the mitochondria were resuspended in complete medium, and 100 l / well were transferred in a black clear - bottom 96-well plate . The plate was immediately read with a fluorescence reader (flex station ii, molecular devices) with settings suitable for fluorescein (excitation, 510 nm; emission, 580 nm). The digital images were obtained with an inverted fluorescence microscope lsm pascal (zeiss) at 2,048 2,048 pixels . Images were taken using 10 and 40 dry objective lenses and a 63 oil immersion objective lens, and the optical section was <1 m . Fluorescence was excited for hoechst 33342 and fam by the 346- and 494-nm line of an argon laser, and emission at 497 and 519 nm was recorded, respectively, for the nuclear and peptide stains . To localize mitochondria, cells were loaded with 200 nm tmre, which distributes into negatively charged cellular compartments, for 20 min at 37c . Tmre fluorescence was excited by laser at 535 nm and recorded at 575 nm . Green and red pseudocolors were applied to visualize the localization of peptide into cells and mitochondria . The quantitative determination of atp was assessed using recombinant firefly luciferase and its substrate d - luciferin . All other reagents, magnesium sulfate (mgso4), tricine, dtt, coenzyme a (coa), edta, sodium azide, and atp were bought from sigma - aldrich . For the luciferase assay, a standard reaction solution was prepared containing distilled water (dh2o), 20 reaction buffer (500 mm tricine buffer [ph 7.8], 100 mm mgso4, 2 mm edta, and 2 mm sodium azide), 0.1 m dtt, 10 mm d - luciferin, and firefly luciferase (5 mg / ml) stock solution . Atp was diluted serially in the standard reaction solution, and a standard curve was generated . To assess the intracellular atp, hela 705 cells were seeded 24 hr before treatment with the peptide in white - walled 96-well plates . Then, 20 l of cell lysis buffer was added and incubated for 10 min at room temperature . Standard reaction solution was added, and, immediately, light emissions were acquired for approximately 30 s using a glomax 96 microplate luminometer (promega). Dynamic light scattering (dls) was used to determine the hydrodynamic mean diameter and the zeta potential of mtgcpp . The peptide was dissolved in dmem (invitrogen) supplemented with 10% fbs or milliq water with ph adjusted to 7.4 . Statistical significance of data was assessed by one - way or two - way anova as appropriate, performed using graphpad prism software v. 6.0h (graphpad). ; methodology, c.p.c . ; investigation, c.p.c . ; writing, c.p.c . ; funding acquisition, .l . ; supervision, .l.
The generation of global enh, global cypher, cyphers, and cypherl knockout mouse models has been described previously.14,21,22 genotyping of isolated embryos, neonates, and mice was performed using previously described primer sets.14,21,22 all experiments described in this study were completed using mice of a mixed 129/svj and black swiss background . All procedures were performed in accordance with the nih guide for the care and use of laboratory animals and approved by the institutional animal care and use committee at the university of california, san diego . Whole - mount in situ hybridization was performed as previously described.23 briefly, embryos isolated at different stages were fixed in pre - chilled 4% paraformaldehyde in phosphate - buffered saline at 4c overnight, and subsequently subjected to rna in situ analyses . The enh rna in situ probe was generated using the following primer set: enh - forward: cacatacccactcacagtgatg and enh - reverse: gaatagatgtaaatacattgaagg . For histological analyses, following whole - mount in situ hybridization, fixed embryos were embedded in oct tissue - tek (thermo fisher scientific, waltham, ma), and sectioned (8 m) using a leica cm 3050s cryostat (leica microsystems, bannockburn, il). Sections were blocked in a solution containing 2% horse serum, 0.2% triton x-100, and 5% bovine serum albumin in phosphate - buffered saline, followed by incubation with primary antibody overnight at 4c . The following primary antibodies were used: cypher24 (1:300), cd31 (1:300; bd biosciences), sarcomeric alpha()-actinin (1:300; sigma - aldrich), myomesin (1:300; santa cruz biotechnology), cleaved caspase 3 (1:300; cell signaling technology), and phospho - histone h3 s10 (1:300; millipore). Confocal microscopy was performed using a zeiss axioplan 2 upright confocal microscope (carl zeiss inc, thornwood, ny). Female mice with copulation plugs were considered to be at embryonic day 0.5 (e0.5). Timed pregnant mice were sacrificed at various stages of gestation . Embryos were harvested, examined, imaged, and fixed for 1 to 24 hours in 4% paraformaldehyde in phosphate - buffered saline . Genotyping of isolated embryos was performed using individual embryo yolk sac extracts . Following fixation, embryos were embedded in paraffin, transversely sectioned, and analyzed by staining with hematoxylin and eosin as previously described.13,25,26 embryos isolated at e9.5 were immediately immersed in fixative (2% paraformaldehyde, 2% glutaraldehyde in phosphate buffered saline) and incubated overnight . Embryos were then washed in 0.15 mol / l sodium cacodylate buffer and postfixed in 2% osmium tetroxide and 0.8% potassium ferrocyanide in 0.15 mol / l sodium cacodylate buffer for 1 hour . Subsequently, embryos were stained overnight in 2% uranyl acetate, dehydrated, and embedded in durcupan resin (emd, gibbstown, nj) according to standard procedures . Ultrathin sections (60 to 70 nm) were stained with a solution of 2% uranyl acetate and lead citrate . Electron micrographs were recorded using a jeol-1200ex transmission electron microscope operated at an accelerating voltage of 80 kv . Transmission electron microscopy was performed at the national center for microscopy and imaging research, university of california, san diego . The generation of global enh, global cypher, cyphers, and cypherl knockout mouse models has been described previously.14,21,22 genotyping of isolated embryos, neonates, and mice was performed using previously described primer sets.14,21,22 all experiments described in this study were completed using mice of a mixed 129/svj and black swiss background . All procedures were performed in accordance with the nih guide for the care and use of laboratory animals and approved by the institutional animal care and use committee at the university of california, san diego . Whole - mount in situ hybridization was performed as previously described.23 briefly, embryos isolated at different stages were fixed in pre - chilled 4% paraformaldehyde in phosphate - buffered saline at 4c overnight, and subsequently subjected to rna in situ analyses . The enh rna in situ probe was generated using the following primer set: enh - forward: cacatacccactcacagtgatg and enh - reverse: gaatagatgtaaatacattgaagg . For histological analyses, following whole - mount in situ hybridization, fixed embryos were embedded in oct tissue - tek (thermo fisher scientific, waltham, ma), and sectioned (8 m) using a leica cm 3050s cryostat (leica microsystems, bannockburn, il). Sections were blocked in a solution containing 2% horse serum, 0.2% triton x-100, and 5% bovine serum albumin in phosphate - buffered saline, followed by incubation with primary antibody overnight at 4c . The following primary antibodies were used: cypher24 (1:300), cd31 (1:300; bd biosciences), sarcomeric alpha()-actinin (1:300; sigma - aldrich), myomesin (1:300; santa cruz biotechnology), cleaved caspase 3 (1:300; cell signaling technology), and phospho - histone h3 s10 (1:300; millipore). Confocal microscopy was performed using a zeiss axioplan 2 upright confocal microscope (carl zeiss inc, thornwood, ny). Female mice with copulation plugs were considered to be at embryonic day 0.5 (e0.5). Timed pregnant mice were sacrificed at various stages of gestation . Embryos were harvested, examined, imaged, and fixed for 1 to 24 hours in 4% paraformaldehyde in phosphate - buffered saline . Genotyping of isolated embryos was performed using individual embryo yolk sac extracts . Following fixation, embryos were embedded in paraffin, transversely sectioned, and analyzed by staining with hematoxylin and eosin as previously described.13,25,26 embryos isolated at e9.5 were immediately immersed in fixative (2% paraformaldehyde, 2% glutaraldehyde in phosphate buffered saline) and incubated overnight . Embryos were then washed in 0.15 mol / l sodium cacodylate buffer and postfixed in 2% osmium tetroxide and 0.8% potassium ferrocyanide in 0.15 mol / l sodium cacodylate buffer for 1 hour . Subsequently, embryos were stained overnight in 2% uranyl acetate, dehydrated, and embedded in durcupan resin (emd, gibbstown, nj) according to standard procedures . Ultrathin sections (60 to 70 nm) were stained with a solution of 2% uranyl acetate and lead citrate . Electron micrographs were recorded using a jeol-1200ex transmission electron microscope operated at an accelerating voltage of 80 kv . Transmission electron microscopy was performed at the national center for microscopy and imaging research, university of california, san diego . In previous studies, we have demonstrated that cypher is highly expressed in the early developing heart.11,14 to investigate specific cell types expressing cypher in embryonic heart, we performed immunostaining analysis of e9.5 embryos using antibodies to cypher, and cd31, a marker of endothelium (figure 1a through 1d). Cypher expression was only detected in myocardium, not in endocardium . To determine the expression pattern of enh during murine development, embryos staged between e8.5 and e10.5 were analyzed . Owing to lack of antibodies specific to enh for immunofluorescence studies, we performed whole - mount rna in situ hybridization utilizing a probe specific for enh transcripts . At e8.5 to e9.5, enh was highly expressed and detected exclusively in the heart (figure 1e and 1f, and s1a and s1b), extending to the head region by e10.5 (figure s1c and s1d). Histological analysis of e9.5 transverse sections following whole - mount rna in situ hybridization for enh further revealed that expression of enh was restricted to myocardium, and was not detected in endocardium (figure 1 g and 1h). Cypher and enh are specifically expressed in the myocardium at e9.5 . A through d, immunofluorescence analysis of a transverse section of the heart of a wild - type embryo at e9.5, staining for (a) dapi, (b) cypher, and (c) cd31 . D, color - merged image of dapi (blue), cypher (green), and cd31 (red). E and f, whole - mount rna in situ hybridization analysis of enh expression in a wild - type embryo (right and left lateral views) at e9.5 using an enh - specific probe . G, histological analysis of a transverse section of the heart from the embryo depicted in (e and f). Arrow indicates myocardium; arrowhead, endocardium; dapi, 4,6-diamidino-2-phenylindole; enh, enigma homolog protein; la, left atrium; lv, left ventricle; ra, right atrium; rv, right ventricle . Both cypher and enh knockout mice develop postnatal dilated cardiomyopathy,13,14,21 with differences in severity, suggesting a unique role for cypher and enh in the adult heart . Since there is no obvious heart developmental defect in either cypher or enh global knockout mice, yet cypher and enh are specifically expressed in the early developing heart11,14 (figure 1), we speculated that there is a possible functional overlap between these 2 enigma family members during embryonic heart development . To address this question, we generated enh / cypher double knockout (dko) mice by crossing enh with cypher mice . No viable enh / cypher mutants were obtained in litters from enh / cypher intercrosses at weaning, indicating that dko of cypher and enh results in embryonic lethality . To determine the stage of embryonic lethality, genotyping revealed the presence of enh / cypher embryos up until e10.5, but not beyond . The genotype distribution fit the expected mendelian ratios at e8.5 to e9.5; however, at e10.5 fewer live dko embryos than predicted were recovered (table1). Collectively these data reveal that dko of cypher and enh leads to lethality of embryos between e9.5 and e11.5 . Genotypes of offspring from enh / cypher intercrosses at developmental stages embryonic day (e)8.5 to 21 dpn, show embryonic lethality of enh / cypher double knockout mice between e9.5 and e11.5 dpn indicates days postnatal; enh, enigma homolog protein . We observed no difference in the gross morphology of enh / cypher and enh / cypher embryos during embryonic development or in the postnatal phenotype (data not shown). Thus, enh / cypher or enh / cypher embryos were used interchangeably as controls for all experiments . In the absence of both enh and cypher, embryonic development appeared normal at e9.0, as dko embryos were comparable to control embryos in size and morphology (figure 2a through 2f). However, by e9.5, although variability in the severity of the phenotype was observed, almost all dko embryos displayed dilation of the heart with an abnormally thin myocardium transparent in appearance (figure 2 g through 2l). By e10.5, enh and cypher dko embryos were severely growth retarded and heart defects were evident (figure 2 m through 2r). Many of the enh / cypher hearts failed to beat and all the dko embryos at this stage displayed severe pericardial effusion indicative of heart failure . Previously, we have shown that cypher mice develop dilated cardiomyopathy as early as postnatal day 1 (p1).14 thus, to exclude the possibility that the morphological abnormalities observed in dko embryos at e9.5 and e10.5 were due to the ablation of cypher alone, we investigated the morphology of cypher embryos at the same stages of embryonic development (figure s2). Consistent with our hypothesis that a functional overlap exists between cypher and enh during embryonic development, we did not observe any phenotypic abnormalities in cypher knockout embryos when compared to their wild - type littermates at e9.5 to e10.5 . Enh / cypher embryos display aberrant embryonic development and cardiac morphogenesis at e9.5 to e10.5 . Whole - mount microscopic assessment of control and enh / cypher dko embryos (right lateral, anterior, and left lateral views) at different developmental stages . A through c, control embryo and (d through f), somite - matched enh / cypher dko embryo at e9.0 . G through i, control embryo and (j through l), somite - matched dko embryo at e9.5 . M through o, control embryo and (p through r), dko embryo at e10.5 . Dko indicates double knockout; enh, enigma homolog protein . To further investigate the phenotype of enh and cypher dko embryos, heart sections of embryos at e9.5 were analyzed by hematoxylin and eosin staining (figure 3). Consistent with the observed whole - mount morphological changes, histological analysis demonstrated severe dilation of the heart chambers . The compact zone in the enh / cypher embryos was considerably thinner and appeared to lack well - defined trabeculations in comparison to control embryos at the same stage of development . There were also marked changes in the development of the outflow tract and the atrioventricular canal in the dko embryos . Whole - mount (anterior view) and histological h&e staining analysis of consecutive (1 to 4) transverse sections of the heart of a (a) control embryo, and (b) a somite - matched enh / cypher dko embryo at e9.5 . A indicates atrium; avc, atrioventricular canal; bc, bulbus - cordis; bt, bulbus - truncus; dko, double knockout; enh, enigma homolog protein; h&e, hematoxylin and eosin; ot, outflow tract; v, ventricle . To determine whether the aberrant thinning of the myocardium observed in dko embryos was a result of increased cardiomyocyte apoptosis or decreased cardiomyocyte proliferation, confocal immunofluorescence microscopy using antibodies to cleaved caspase 3 (ccasp3), an apoptotic marker, and a marker of mitosis, phospho - histone h3 (phh3) was performed (figure s3). No abnormalities or differences in cardiomyocyte apoptosis or proliferation were detected between mutant and control embryos . Cypher13,14 and enh21,27 have both been shown to localize to the z - line . Moreover, cypher and enh mutant mouse hearts display disorganized z - lines, although this phenotype is not directly linked to their lethality.13,14,21 since deletion of several sarcomeric proteins has been shown to cause aberrant sarcomere structure leading to embryonic lethality,2830 we speculated that double ablation of cypher and enh would result in sarcomere abnormalities . To investigate, we performed immunostaining analyses of e9.0 to e9.5 cardiac muscle for sarcomeric -actinin, and myomesin, an m - line protein that is associated with thick filaments (figure 4a through 4d). Enh / cypher mice showed severely disorganized and fragmented z - lines in cardiac muscle, illustrated by the absence of -actinin striations (figure 4a and 4b). However, no detectable defects in m - line structure were observed in dko hearts when compared with control littermate hearts (figure 4c and 4d). To further examine the structure of the z - line in the hearts of dko mice at e9.5, transmission electron microscopy was performed (figure 4e and 4f). Consistently, z - lines in enh / cypher cardiac muscle were poorly organized with loosely arranged myofibrils between the 2 z - lines when compared with controls . These data showed that deletion of enh and cypher together impaired the compact and ordered features of the z - line structure . Disorganized z - lines in enh / cypher mouse cardiac muscle . Immunofluorescence analysis of a transverse section of the heart of (a and c) control and (b and d) somite - matched enh / cypher dko embryos at e9.0 to e9.5 . Z- and m - lines were stained using antibodies against (a and b) -actinin, and (c and d) myomesin, respectively . Dna is stained with dapi (blue). E and f, representative tem images of a transverse section of the heart of (e) control and (f) somite - matched dko embryos at e9.5 . Dko indicates double knockout; dapi, 4,6-diamidino-2-phenylindole; enh, enigma homolog protein; tem, transmission electron microscopy . We have previously shown that cypher s long (cypherl) and short (cyphers) isoforms have distinct roles in the regulation of cardiac structure and function.22 selective ablation of cypherl resulted in partial neonatal lethality . Surviving cypherl knockout (cypherl) mice displayed defects in z - line ultrastructure, cardiac fibrosis, calcification, and developed late - onset dilated cardiomyopathy leading to premature adult mortality . In contrast, mice deficient in cyphers (cyphers) were viable and had no phenotypic abnormalities.22 to investigate potential unique and redundant roles of cypher isoforms and enh in cardiac development, we crossed cypherl or cyphers mice with enh mice . Enh / cyphers mutants displayed no embryonic lethality and survived to adulthood (table2), while enh / cypherl mutants were embryonic lethal, with no enh / cypherl embryos surviving past e12.5 (table3). The observed phenotypes suggest that while cypher s short isoforms are dispensable, in the absence of enh, the long isoforms of cypher are indispensable for normal cardiac function . Thus, enh and cypherl have redundant roles in heart development . Genotypes of offspring from enh / cyphers intercrosses at developmental stages embryonic day (e)8.5 to 21 dpn, show expected mendelian ratios dpn indicates days postnatal; enh, enigma homolog protein . Genotypes of offspring from enh / cypherl intercrosses at developmental stages embryonic day (e)8.5 to 21 dpn, show embryonic lethality of enh / cypherl double knockout mice at e12.5 dpn indicates days postnatal; enh, enigma homolog protein . In previous studies, we have demonstrated that cypher is highly expressed in the early developing heart.11,14 to investigate specific cell types expressing cypher in embryonic heart, we performed immunostaining analysis of e9.5 embryos using antibodies to cypher, and cd31, a marker of endothelium (figure 1a through 1d). Cypher expression was only detected in myocardium, not in endocardium . To determine the expression pattern of enh during murine development, embryos staged between e8.5 and e10.5 were analyzed . Owing to lack of antibodies specific to enh for immunofluorescence studies, we performed whole - mount rna in situ hybridization utilizing a probe specific for enh transcripts . At e8.5 to e9.5, enh was highly expressed and detected exclusively in the heart (figure 1e and 1f, and s1a and s1b), extending to the head region by e10.5 (figure s1c and s1d). Histological analysis of e9.5 transverse sections following whole - mount rna in situ hybridization for enh further revealed that expression of enh was restricted to myocardium, and was not detected in endocardium (figure 1 g and 1h). Cypher and enh are specifically expressed in the myocardium at e9.5 . A through d, immunofluorescence analysis of a transverse section of the heart of a wild - type embryo at e9.5, staining for (a) dapi, (b) cypher, and (c) cd31 . D, color - merged image of dapi (blue), cypher (green), and cd31 (red). E and f, whole - mount rna in situ hybridization analysis of enh expression in a wild - type embryo (right and left lateral views) at e9.5 using an enh - specific probe . G, histological analysis of a transverse section of the heart from the embryo depicted in (e and f). Arrow indicates myocardium; arrowhead, endocardium; dapi, 4,6-diamidino-2-phenylindole; enh, enigma homolog protein; la, left atrium; lv, left ventricle; ra, right atrium; rv, right ventricle . Both cypher and enh knockout mice develop postnatal dilated cardiomyopathy,13,14,21 with differences in severity, suggesting a unique role for cypher and enh in the adult heart . Since there is no obvious heart developmental defect in either cypher or enh global knockout mice, yet cypher and enh are specifically expressed in the early developing heart11,14 (figure 1), we speculated that there is a possible functional overlap between these 2 enigma family members during embryonic heart development . To address this question, we generated enh / cypher double knockout (dko) mice by crossing enh with cypher mice . No viable enh / cypher mutants were obtained in litters from enh / cypher intercrosses at weaning, indicating that dko of cypher and enh results in embryonic lethality . To determine the stage of embryonic lethality, timed pregnancies were performed, and embryos were isolated at various stages of gestation . Genotyping revealed the presence of enh / cypher embryos up until e10.5, but not beyond . The genotype distribution fit the expected mendelian ratios at e8.5 to e9.5; however, at e10.5 fewer live dko embryos than predicted were recovered (table1). Collectively these data reveal that dko of cypher and enh leads to lethality of embryos between e9.5 and e11.5 . Genotypes of offspring from enh / cypher intercrosses at developmental stages embryonic day (e)8.5 to 21 dpn, show embryonic lethality of enh / cypher double knockout mice between e9.5 and e11.5 dpn indicates days postnatal; enh, enigma homolog protein . We observed no difference in the gross morphology of enh / cypher and enh / cypher embryos during embryonic development or in the postnatal phenotype (data not shown). Thus, enh / cypher or enh / cypher embryos were used interchangeably as controls for all experiments . In the absence of both enh and cypher, embryonic development appeared normal at e9.0, as dko embryos were comparable to control embryos in size and morphology (figure 2a through 2f). However, by e9.5, although variability in the severity of the phenotype was observed, almost all dko embryos displayed dilation of the heart with an abnormally thin myocardium transparent in appearance (figure 2 g through 2l). By e10.5, enh and cypher dko embryos were severely growth retarded and heart defects were evident (figure 2 m through 2r). Many of the enh / cypher hearts failed to beat and all the dko embryos at this stage displayed severe pericardial effusion indicative of heart failure . Previously, we have shown that cypher mice develop dilated cardiomyopathy as early as postnatal day 1 (p1).14 thus, to exclude the possibility that the morphological abnormalities observed in dko embryos at e9.5 and e10.5 were due to the ablation of cypher alone, we investigated the morphology of cypher embryos at the same stages of embryonic development (figure s2). Consistent with our hypothesis that a functional overlap exists between cypher and enh during embryonic development, we did not observe any phenotypic abnormalities in cypher knockout embryos when compared to their wild - type littermates at e9.5 to e10.5 . Enh / cypher embryos display aberrant embryonic development and cardiac morphogenesis at e9.5 to e10.5 . Whole - mount microscopic assessment of control and enh / cypher dko embryos (right lateral, anterior, and left lateral views) at different developmental stages . A through c, control embryo and (d through f), somite - matched enh / cypher dko embryo at e9.0 . G through i, control embryo and (j through l), somite - matched dko embryo at e9.5 . M through o, control embryo and (p through r), dko embryo at e10.5 . Dko indicates double knockout; enh, enigma homolog protein . To further investigate the phenotype of enh and cypher dko embryos, heart sections of embryos at e9.5 were analyzed by hematoxylin and eosin staining (figure 3). Consistent with the observed whole - mount morphological changes, histological analysis demonstrated severe dilation of the heart chambers . The compact zone in the enh / cypher embryos was considerably thinner and appeared to lack well - defined trabeculations in comparison to control embryos at the same stage of development . There were also marked changes in the development of the outflow tract and the atrioventricular canal in the dko embryos . Whole - mount (anterior view) and histological h&e staining analysis of consecutive (1 to 4) transverse sections of the heart of a (a) control embryo, and (b) a somite - matched enh / cypher dko embryo at e9.5 . A indicates atrium; avc, atrioventricular canal; bc, bulbus - cordis; bt, bulbus - truncus; dko, double knockout; enh, enigma homolog protein; h&e, hematoxylin and eosin; ot, outflow tract; v, ventricle . To determine whether the aberrant thinning of the myocardium observed in dko embryos was a result of increased cardiomyocyte apoptosis or decreased cardiomyocyte proliferation, confocal immunofluorescence microscopy using antibodies to cleaved caspase 3 (ccasp3), an apoptotic marker, and a marker of mitosis, phospho - histone h3 (phh3) was performed (figure s3). No abnormalities or differences in cardiomyocyte apoptosis or proliferation were detected between mutant and control embryos . Moreover, cypher and enh mutant mouse hearts display disorganized z - lines, although this phenotype is not directly linked to their lethality.13,14,21 since deletion of several sarcomeric proteins has been shown to cause aberrant sarcomere structure leading to embryonic lethality,2830 we speculated that double ablation of cypher and enh would result in sarcomere abnormalities . To investigate, we performed immunostaining analyses of e9.0 to e9.5 cardiac muscle for sarcomeric -actinin, and myomesin, an m - line protein that is associated with thick filaments (figure 4a through 4d). Enh / cypher mice showed severely disorganized and fragmented z - lines in cardiac muscle, illustrated by the absence of -actinin striations (figure 4a and 4b). However, no detectable defects in m - line structure were observed in dko hearts when compared with control littermate hearts (figure 4c and 4d). To further examine the structure of the z - line in the hearts of dko mice at e9.5, transmission electron microscopy was performed (figure 4e and 4f). Consistently, z - lines in enh / cypher cardiac muscle were poorly organized with loosely arranged myofibrils between the 2 z - lines when compared with controls . These data showed that deletion of enh and cypher together impaired the compact and ordered features of the z - line structure . Disorganized z - lines in enh / cypher mouse cardiac muscle . Immunofluorescence analysis of a transverse section of the heart of (a and c) control and (b and d) somite - matched enh / cypher dko embryos at e9.0 to e9.5 . Z- and m - lines were stained using antibodies against (a and b) -actinin, and (c and d) myomesin, respectively . E and f, representative tem images of a transverse section of the heart of (e) control and (f) somite - matched dko embryos at e9.5 . Dko indicates double knockout; dapi, 4,6-diamidino-2-phenylindole; enh, enigma homolog protein; tem, transmission electron microscopy . We have previously shown that cypher s long (cypherl) and short (cyphers) isoforms have distinct roles in the regulation of cardiac structure and function.22 selective ablation of cypherl resulted in partial neonatal lethality . Surviving cypherl knockout (cypherl) mice displayed defects in z - line ultrastructure, cardiac fibrosis, calcification, and developed late - onset dilated cardiomyopathy leading to premature adult mortality . In contrast, mice deficient in cyphers (cyphers) were viable and had no phenotypic abnormalities.22 to investigate potential unique and redundant roles of cypher isoforms and enh in cardiac development, we crossed cypherl or cyphers mice with enh mice . Enh / cyphers mutants displayed no embryonic lethality and survived to adulthood (table2), while enh / cypherl mutants were embryonic lethal, with no enh / cypherl embryos surviving past e12.5 (table3). The observed phenotypes suggest that while cypher s short isoforms are dispensable, in the absence of enh, the long isoforms of cypher are indispensable for normal cardiac function . Genotypes of offspring from enh / cyphers intercrosses at developmental stages embryonic day (e)8.5 to 21 dpn, show expected mendelian ratios dpn indicates days postnatal; enh, enigma homolog protein . Genotypes of offspring from enh / cypherl intercrosses at developmental stages embryonic day (e)8.5 to 21 dpn, show embryonic lethality of enh / cypherl double knockout mice at e12.5 dpn indicates days postnatal; enh, enigma homolog protein . The dramatically dilated heart at e9.5, and severe pericardial effusion at e10.5 indicated that enh / cypher embryos died of heart failure . Since cypher and enh are highly, and almost exclusively, expressed in myocardium at and before dko embryos displayed abnormal cardiac morphogenesis phenotypes, we concluded that lethality in dko embryos resulted from loss of both cypher and enh in cardiomyocytes . We have shown previously that neither cypher nor enh mice display obvious cardiac developmental defects . Data presented in this report clearly demonstrated that deletion of both cypher and enh leads to embryonic lethality with severe cardiac defects, demonstrating that cypher and enh play redundant roles in mouse heart development . Our data also demonstrated that only cypher long isoforms, but not short isoforms, are redundant with enh to effect normal cardiac development . However, cypher short isoforms can partially compensate for the loss of the long isoforms, as enh / cypherl embryos die 1 to 2 days later than enh / cypher embryos . We have shown previously, by analyzing cypher mice, that cypher does not play a role in recruiting -actinin to the z - line, or striated muscle sarcomerogenesis, but is required for maintaining z - line structure during muscle contraction.14 it has been reported by 1 group that dzasp, the only member of alp / enigma family in drosophila, is required for recruitment of -actinin to the z - line and sarcomere assembly.31 however, 2 other groups reported that dzasp is not essential for recruiting -actinin to the z - line, or for sarcomere assembly.32,33 consistent with the latter observations, our immunostaining data from e9.0 to 9.5 dko embryos clearly demonstrated normal m - line structure in dko hearts when compared with control littermate hearts and that -actinin was still present at the z - line, albeit not as well organized as in controls . Collectively, our data demonstrated that cypher and enh are not required for murine sarcomerogenesis . Cypher and enh, however, redundantly play an essential role in sustaining z - line structure from the earliest stages of cardiac function, and are redundantly required to maintain normal embryonic heart function and embryonic viability . Chen is funded by grants from the national institute of arthritis and musculoskeletal and skin (r01ar059334) and the national heart, lung, and blood institute . Peter is funded by the national institutes of health training in cardio - vascular physiology and pharmacology training grant (5t32hl007444 - 27). Lange is funded by a national institutes of health grant (k99hl107744 - 01). Ouyang is supported by the national key basic research program of china (2013cb531200), and the national science foundation of china (31370823, 91439130). Whole - mount rna in situ hybridization analysis of enh expression in a wild - type embryo (right and left lateral views) at (a and b) e8.5 and (c and d) e10.5 using an enh - specific probe . Whole - mount microscopic assessment of wild - type and cypher - null (cypher) embryos (left lateral view) at different developmental stages . A, wild - type embryo and (b) somite - matched cypher embryo at e9.5 . C, wild - type embryo and (d) somite - matched cypher embryo at e10.5 . Immunofluorescence analysis of a transverse cryosection of the heart of (a and c) control and (b and d) somite - matched enh / cypher double knockout (dko) embryos at e9.0 to e9.5 . Apoptosis and proliferation were stained using antibodies against (a and b) cleaved caspase 3, ccasp3 (green), and (c and d) phospho - histone h3, phh3 (green), respectively . Sarcomeres were stained with anti--actinin (red); dna is stained with dapi (blue). Note: due to thinning of the myocardium and severe dilation of the heart chamber, dko hearts shrank during sucrose processing.
Porcine reproductive and respiratory syndrome (prrs) was first described in 1987 in united states and subsequently discovered in 1990 in europe . Despite ofchronicle proximity of the discovery, presumably derived from common ancestor and structural similarity of the viruses, these isolates from two different continents showed very distinct genotypes . The prrs virus (prrsv) prrsv is a single - stranded, positive - sense rna virus belongs to family arteriviridae of the order of nidovirales . The virus has genome of ~15 kb which encode around 10 open reading frames, orf1a, orf1b, orf2a, orf2b, orf3, orf4, orf5, orf6, and orf7 . Viral protease process translated polyproteins of orf1a and orf1b into 14 different non - structural proteins (nsps). These nsps have been identified to have function in viral replication and transcription machinery, and some of them involved in regulation of the viral pathogenesis through their involvement in host innate immune response modulation . The major clinical features of the disease are late term reproductive failure in pregnant sows and respiratory problems in piglets and growing pigs resulting in enormous economic loses . A tremendous effort has been made to protect pigs from this economically devastating disease by developing such as killed, modified live, recombinant protein based, and dna vaccines . But, only cell culture attenuated virus vaccine is practiced in the field with arguably limited efficacy . The prrsv vaccine did not clear virus from infected pigs nor prevent re - infection of the virus (fig . 1). The vaccine showed no adequate innate immune reaction, low anamnestic immune response and negligible cell mediated immunity . Despite of the current developed scientific technology, there still remain many questions to solve a most important pig disease worldwide . Therefore, no vaccines providing solid protective immunity with excellent safety for the prrsv have been developed yet . Infectious diseases in modern animal production exert an enormous economic burden in the industry, instability of the meat market, animal welfare and may threaten human health depending on the infectious agents.to protect animals from infectious disease, vaccinology is considered a most effective solution in animal health . Series of good animals vaccines such as modified live vaccine (mlv) of classical swine fever and canine distemper known to be very effective in vaccinated animals to protect respective virus infection after proper vaccination . Influenza vaccines in animals and human have difficulties to formulate precise antigen make up to expect seasonal epidemics of the serotype and/or subtypes within the serotypes . Genetic heterogeneity of the field virus dampens efficacy of the vaccine and protection of the disease in vaccinated herd but still antigens in the vaccine formulation elicit good immune response . Despite the current scientific achievement in immunology and vaccinology, vaccines against human immunodeficiency virus (hiv) in human and african swine fever in pigs efficacy of the animal vaccines currently available varies depending on immunogens in vaccine formula such as modified live, killed or recombinant proteins . Pprsv persist long term in the infected host due to the delayed and lack of both innate and adaptive immunity . As well huge discrepancies were observed between experimentally infected groups in isolated facilities and observations made in the farm animals . The early stage of a virus infection in animals is a critical race between the infected virus and host's immune system, in which host try to halt virus replication and defend invaders . There are various physico - chemical barriers to defend against virus infection such as acidic ph, proteolytic enzymes, and layers of mucus . The innate immune system plays very important role in control of the early stage of virus replication and delay spread of the virus to other parts of the body . Especially, the innate immunity differs from specific immunity, which elicit broad - spectrum of the anti - viral effect . Innate immunity is triggered by recognition of the microbial patterns characteristic of virus but not host cellular components . Type i interferons (ifns) exert direct anti - viral activity as well activate other innate and adaptive immune responses . Measuring type i ifn response in virus infected animals is often used as a reliable good tool to evaluate innate immunity of the host . The type i ifn is a major player of the host innate immune response in viral infection . During a virus infection and replication process, viral intermediates trigger the expression of the ifn gene in cells and infected host . In this events, the rig-1 like helicase and tlr-3 trigger signaling cascade and activate irf3, nuclear factor kb and atf-2 that drives ifn gene expression . Nsp1 (nsp1 subunits) of the prrsv partly blocks type i ifn production in the virus infected cells . The prrsv infected host either does not produce ifn or showed significantly reduced production of the ifn, which is an important host defense mechanism in virus infected cells that eventually provide virus spread to the adjacent cells . Not only nsp1 but other prrsv nsp are also modulate innate immune signaling pathways (table 1). Specific antibodies to the antigen provide major barrier against virus spread between susceptible cells and tissues are particularly important in limiting virus spread through vascular system . Classical immunology claims that neutralizing antibody is the first line of the defense against free virus particles . Virus neutralization test provides an important indicator for the humoral protection index in virus - infected host . Pigs either infected or vaccinated pigs respond to the prrsv proteins and produce virus specific antibodies but early antibodies did not show virus - neutralizing activities . As shown in fig . 2, viremia last long time in the infected pigs and gradually diminished and total antibody response was similar to that of the other viral infection but appearance of the serum neutralizing antibody was independent to viral clearance (fig . This indicates that virus clearance is not directly responsible for the protection even neutralization antibody is an important factor for the humoral protection mechanism . Research data obtained in late 90s thought prrsv is persistent in the infected animals, which is reliable reason that memory responses would be difficult to demonstrate in vivo due to the continual presence of antigen that could simply be eliciting active immunity . During the course of acute with prolonged viremia, lymphoid tissue infection, prrsv - specific memory b - cells peak in number at 40 - 100 days of infection then declined . But, re - challenge with genetically similar or unrelated viruses at about 200 days of infection did not show any noticeable anemnestic response (murtaugh, unpublished data). Rather, the parameters of infection and host immunity need to be determined and immunological effector responses evaluated for usefulness as surrogate measures of protection against future infectious challenge . Another key feature of the adaptive immunity are the establishment of the immunological memory, which is very common in animals vaccinated and/or naturally infected . However, the prrsv vaccinated and/or infected pigs did not show booster effect by the second exposures of the antigen . Measuring total antibodies by an enzyme - linked immunosorbent assay or neutralization antibodies by virus the research finding from the previous study that antibody avidity correlates with virus clearance from the circulating blood indicates that maturation of the antibody plays an important role in free virus control in the virus infected host animals . Groups of pigs with high avidity to prrsv showed low mortality and low avidity groups showed relatively higher mortality (figs . 1, 3). T cells exhibit multiple functions in antiviral immunity such as restricting establishment of virus infections, immunoglobulin isotype switching and maturation, activation of macrophages and protecting re - infections of the virus to other tissues . To promote virus survival in the infected host evasion strategies of the virus can be categorized according to mechanisms such as impairing host response, avoiding recognition by the host immune system and restricting control by immune effector mechanism . In the course of the either european or north american type virus infection showed very little if any prrsv - specific ifn- releases response from whole blood, whereas non - specific responses were consistently observed . 2 viral clearance in the blood and viral load in the lymphoid tissue does not co - relate with cell - mediated immunity . Ifn- assay is neither absolute nor only indicator for the evaluation of the cell - mediated immunity but this assay is common method for the cell - mediated immune (cmi) response . Highly variable number of the t cell in either acutely or persistently animals were detected and showed no close correlation to the level of the virus in the lymphoid tissues . There are no significant changes in cd4 + and cd8 + t - cell frequencies after prrsv infection were observed, though a decrease number of gamma and delta t cells were recorded . This result support that there is no or very little contribution of the cmi to the prrsv infection and suggest prrsv suppresses t - cell recognition of the infected macrophages . Even weak cmi response in prrsv infection, 9 antigenic regions on the 5 of the viral proteins determined by ifn- elispot assay indicate that there are t - cell specific epitopes on the viral proteins . Despite the current scientific achievement in immunology and vaccinology, vaccines against hiv in human and african swine fever in pigs are not available at the moment . Efficacy of the animal vaccines currently available varies depending on immunogens in vaccine formula such as modified live, killed or recombinant proteins . To protect animals from infectious diseases, series of good animal vaccines has been developed and practiced such as mlv of classical swine fever and canine distemper . These vaccines are known to be very effective in protection against the respective disease agents for the properly vaccinated animals . Despite the good success of various types of vaccines, influenza vaccines in animals and human have been experienced difficulties in formulating precise antigen make - up through expecting in - coming seasonal epidemics of the serotype and/or subtypes within the serotypes . Often genetic heterogeneity of the field virus dampens efficacy of the vaccine and protection of the disease in vaccinated herd but still antigens in the vaccine formulation elicit good immune response . Several viral agents efficiently evade host immune system and survive prolonged time in the host tissues . Infectious diseases in modern animal production exert an enormous economic burden in the industry, instability of the meat market, animal welfare and may threaten human health depending on the infectious agents . Pprsv persist long term in the infected host due to the delayed and lack of both innate and adaptive immunity . As well huge discrepancies were observed between experimentally infected groups in isolated facilities and observations made in the farm animals . Prrsv have at least several evasion tools to survive prolonged time in the infected host . Non - structural proteins of the prrsv plays very important role to inhibit innate immunity and several mechanisms were investigated . Since there is no close correlation between viral clearance and neutralization antibody, we need to find a mechanism behind viral elimination from the blood and tissues . Viruses evolved and earned various evasion strategies to host immune system . Prrsv have at least several evasion tools to survive prolonged time in the infected host based on the known fact such as poor innate immunity, low anamnestic humoral immune response and negligible cellular immunity in early infection . Pprsv persist long term in the infected host due to the delayed and lack of both innate and adaptive immunity . As well huge discrepancies were observed between experimentally infected groups in isolated facilities and observations made in the farm animals . Current understandings on the prrsv vaccinology is a tip of icebergs and further studies to develop measures against prrsv infection in the pigs are seemed to be needed.
Arsenic compounds are ubiquitous in nature and are released into the environment via industrial or agricultural processes as well as some medical applications . Consumption of arsenicals such as sodium arsenite through contaminated water is prevalent in many areas of the world . Sodium arsenite is a clastogen causing chromosomal breakage, which interacts with other substances like metals to potentiate its effects . Its administration has been reported to compromise the integrity of the liver of mouse, rat, fish, and goat [57]. However, administration of sodium arsenite induces oxidative stress with severe demyelination and other morphological alterations in axons of peripheral nerves which may potentially induce changes in the generation and distribution of action potentials in peripheral nerves, thereby causing an impediment in transmission of nerve impulses . It has been reported that arsenic can act as comutagen because of its ability to bind and inhibit the activities of thiol containing enzymes, such as dna ligase causing defects during dna replication / repair, recombination, and joining of single- and double - stranded dna breaks . Alzheimer's disease is a progressive dementing neurodegenerative disorder in elderly, which is pathologically characterized by the presence of senile plaques and neurofibrillary changes in the brains of affected individuals . High activities of acetylcholinesterase (ec 3.1.1.7) (ache) in the brain have been implicated in the pathogenesis of the disease and its inhibition is considered as a viable therapeutic strategy in the management of the disease . The main biochemical role of ache is the termination of impulse transmission at cholinergic synapses by rapid hydrolysis of the neurotransmitter, acetylcholine (ach). Ache exhibits a high specific activity similar to that of a diffusion - controlled reaction . Millions of people around the world get exposed to high levels of arsenic compounds in drinking - water which often largely affect rural dwellers . Considering the adverse effects of these arsenic compounds on the nervous system and the high prevalence of alzheimer's disease among such rural dwellers, it is worthwhile to investigate the effects of the arsenic compounds on the pathophysiology of alzheimer's disease . Unfortunately, however, such an important relationship has not been previously investigated either in humans or experimental animals . On the other hand, most of the arsenics - exposed individuals as well as the alzheimer's patients are frequently exposed to a number of functional foods . Honey is basically a supersaturated solution of sugars, produced by honeybees via a regurgitation mechanism of plant parts [1518] with fructose and glucose as the most abundant sugars present in it . Variety of constituents such as phenolic acids, flavonoids, enzymes, carotenoids, organic acids, and proteins have been reported to be present in honey [1921]. In addition to the above - mentioned constituents, other bioactive compounds such as vitamins, antioxidants, and hydrogen peroxide are also reported to be present in honey . Thus, honey as a natural source of antioxidant might reduce the risk of alzheimer's disease because of the crucial role of oxidative stress in the pathogenesis of the disease . It has also been documented that honey exhibits several medicinal properties which include antitumor, antimetastatic, and antiangiogenic effects . Others are antibacterial, anti - inflammatory, immune - stimulant, antiulcer, and wound / burn healing properties . Acacia honey is a type of honey produced by bees from the acacia flowers, hence, the name . Earlier report from our laboratory demonstrated that daily administrations of acacia honey to wistar rats have some biological effects on the clinical and biochemical parameters . We have also demonstrated its antiproliferative effects against prostate cancer cell line and lung cancer cell line in vitro . Furthermore, we have evidently demonstrated the fact that fractionation of acacia honey negatively affected its antioxidant potentials by making it a radical generating agent in contrast to the unfractionated sample . In fact, the antioxidant potential of the whole acacia honey was comparable to -tocopherol; a well - known standard antioxidant . However, the effects of honey on alzheimer's disease have not been fully investigated especially with respect to the possible modulation of heavy - metals (arsenics) associated toxicity during the disease . Hence, this study was conducted to investigate the possible effects of arsenic compounds (sodium arsenite) on the pathology of alzheimer's disease as well as the modulatory role of acacia honey on the heavy - metals (arsenics) associated toxicity during the disease . In the in vitro study, acacia honey and sodium arsenite demonstrated potent inhibition of ache in a concentration - dependent pattern (figures 1 and 2) with an exceptional ic50s of 0.26% (v / v) and 0.0885 mm, respectively . Interestingly, sodium arsenite also significantly (p <0.05) inhibited ache in the brain of the experimental animals but acacia honey had a more significant inhibition of the brain ache than sodium arsenite (table 1). However, among all the treatments, the combined administration of acacia honey and sodium arsenite demonstrated the most potent inhibition of the brain ache (table 1). There was no significant difference (p <0.05) in the serum levels of ache among the treatment groups (table 1). A significant (p <0.05) decrease in the brain ca and na levels was observed in the sodium arsenite and acacia honey treated groups and the reduction in the brain levels of these electrolytes was more significant (p <0.05) in the coadministered group (table 2). There was no significant (p> 0.05) difference across all the groups in the brain k levels . All the treatments significantly (p <0.05) decreased the brain levels of cl but there was no significant (p> 0.05) difference among the treated groups compared to the control (table 2). There was no significant (p> 0.05) difference across all the groups in the electrolyte levels in serum except when compared with control (p <0.05) (table 3). Bearing in mind the role of ions in the release of acetylcholine and vice versa, the correlation between ache activity and electrolyte levels in brain and serum was calculated with a strong correlation between ca and na levels and ache activity in the brain (r = 0.962 and 0.838) with no correlation in terms of k and cl levels . However, no strong correlations were observed between ache activity and electrolyte level in serum . The gc - ms chromatogram of the acacia honey is presented in figure 3 and the list of proposed bioactive components was presented in table 4 . Figure 4 shows the vitamin contents of acacia honey with vitamin a being highest in content followed by vitamin c. some important mineral elements (figure 4) of physiological importance like calcium, iron, magnesium, potassium and zinc . The concentration of these elements in acacia honey is in the order: iron> magnesium> potassium> calcium> zinc . Acetylcholine (ach) is a neurotransmitter that functions in conveying nerve impulses across synaptic clefts within the central nervous system (cns). Following the transmission of an impulse across the synapse by the release of ach this enzyme hydrolyzes ach to choline and acetate, and transmission of the nerve impulse is terminated . In this study, we report the effects of sodium arsenite and acacia honey on acetylcholinesterase activity as well as the relationship with electrolyte levels . Arsenic compounds are known to exert toxicity by binding and inactivating thiol groups in proteins and this phenomenon could account for the observed in vitro inhibition of the ache by the sodium arsenite . Interestingly, the sodium arsenite was also able to inhibit the ache in the brain which might suggest that this compound possesses the ability to cross the blood - brain barrier and modulate the function of the enzyme via binding to the thiol groups of the protein . Also, the observed inhibitory effects of sodium arsenite on the brain ache were potentiated by acacia honey, which could be linked to the active ingredients in honey that are perhaps lipophilic in nature and, therefore, could increase the effective concentration of the sodium arsenite entering the brain . It is also possible that the potentiation of sodium arsenite inhibitory activity was due to the identified phenolic compounds such as p - hydroxybenzoic acid, cinnamic acid, and chrysin present in the acacia honey which could also inhibit the ache . Indeed, phenolics such as anacardic acids, cardols, cardanols, and methylcardols have been reported to inhibit ache . Overall, the foregoing observations suggest that sodium arsenite and/or acacia honey could be beneficial in the management of alzheimer's disease in this regard . Inhibition of ache implies more of ach in circulation, which has been reported to bind to angiotensin ii, thereby preventing angiotensin ii induced oxidative stress . Serum cholinesterases presumably originate in liver cells but other organs also contribute to the pool of these enzymes in the plasma . Activity of serum ache could be an index of liver function and low activity of the enzyme has been reported in so many liver dysfunctions like jaundice and cirrhosis [3, 32]. Our findings indicated that the sodium arsenite and/or acacia honey could lower the serum levels of ache, though insignificantly, which seemingly indicate hepatotoxicity . Some identified components of acacia honey such as pyrazol-3-one and 9-octadecanoic acid-2-hydroxy-1-(hydroxymethyl) ethyl ester as well as the sodium arsenite have been reported to be hepatotoxic [33, 34]. However, it is plausible to suggest that sodium arsenite and/or acacia honey have some beneficial effects on hepatic cells but the inhibitory effects of the sodium arsenite as well as the identified components of the honey on thiol containing proteins led to a decline in the activity of the serum enzyme . Overall, information derived from the serum tends to suggest that these agents have some level of hepatotoxicity . Balance in the levels of ca and na in the brain and blood is a prerequisite for neurotransmission . Our results showed that the activity of ache positively correlates with the levels of these ions . The role of ca and na in neurotransmission in regulating the release of neurotransmitters and in the pathogenesis of neurological diseases has been investigated . When presynaptic cell releases a brief pulse of ach, both sites on the postsynaptic cell receptor are occupied briefly and the channel opens, which allow the passage of either ca or na . The inward flux of these ions depolarizes the plasma membrane, initiating subsequent events that vary with the type of tissue . High concentration of ca and low concentration of na are required for ache release but the consistent decrease in ache activity in this study means that there is more ach than ache present to facilitate the synaptic nerve transfer . Interestingly, sodium channels play a central role in action potential generation and are uniquely poised to influence the efficacy of transmitter release . Oxidative processes have been implicated in the onset and development of degenerative diseases and foods rich in polyphenols, vitamins, and minerals may have a nutritional and health beneficial effects based on our findings . Data from this study suggest that exposure to sodium arsenite could be beneficial in the management of alzheimer's disease; however, it seems toxic to hepatic tissues . Furthermore, acacia honey could potentiate the action of sodium arsenite in both cases and therefore may be explored in the management of alzheimer's disease . Sodium arsenite (5 mg / kg body weight) equivalent to two - tenth of the oral ld50 was used in all experiments . Acacia honey was dissolved in distilled water to prepare a 20% (v / v) honey solution and 5 ml / kg body weight (b.w .) Honey produced by apis mellifera was collected from the north - west frontier of pakistan during spring season of 2012 from acacia modesta flower, identified, and maintained at 4c until analysis, at the industrial analytical centre, international center for chemical and biological sciences, university of karachi, karachi, pakistan . The activity of ache (sigma - aldrich) was determined spectrophotometrically by the modified method of ellman's et al . Using acetylthiocholine iodide as substrate and 5 - 5- dithiobis (2-nitrobenzoic) acid [dtnb] as a chromogen . Varying concentrations of sodium arsenite (0.2, 0.1, 0.05, 0.025, 0.0125, and 0.00625 mm) and honey (0.125, 0.25, 0.5, 1.0, 2.0, and 4.0% v / v) were used for inhibition studies, respectively . The reaction of dtnb with thiocholine released by the enzymatic hydrolysis of acetylthiocholine iodide was monitored at a wavelength of 412 nm . Twenty - four (24) male wistar rats (150195 g) were used in the present study . They were allowed to adapt for one week under standard laboratory conditions of 12 hr light - dark cycle before commencement of all experiments . The rats were maintained in the animal house of international centre of chemical and biological sciences, university of karachi, pakistan, with protocol for the study approved by the institutional animal right review committee . During acclimatization, in addition, all rats were catered in accordance with the national institute of health (nih) guide for the care and use of laboratory animals . They were randomly grouped into four (4) groups of six (6) rats each . The animals were treated daily for seven days as shown in the experimental design below: group 1: distilled water only; group 2: 5 mg / kg b.w . Sodium arsenite equivalent to 20% of oral ld50; group 3: 20% v / v acacia honey + 5 mg / kg b.w . Sodium arsenite; group 4: 20% v / v acacia honey at 5 ml / kg b.w . Group 1: distilled water only; group 2: 5 mg / kg b.w . Sodium arsenite equivalent to 20% of oral ld50; group 3: 20% v / v acacia honey + 5 mg / kg b.w . Sodium arsenite; group 4: 20% v / v acacia honey at 5 ml / kg b.w . Twenty - four (24) hrs after the last treatment, the rats were humanely sacrificed with sodium pentothal (60 mg / kg b.w .) After an overnight fast . The clotted blood samples were centrifuged at 3500 g at 4c for 10 minutes to obtain the serum which was kept at 80c until further analysis . The brain (cerebrum and cerebellum) and blood serum were also collected and the brain was homogenized in 1: 5 of phosphate buffer (ph 7.4), centrifuged at 3500 g at 4c for 10 minutes, and kept at 80c until further analysis . Each time the supernatant / serum was outside the freezer, it was kept in ice bags . Using auto analyzer the total protein contents of the serum and tissues were determined using the standard manufacturer's protocol . The activities of ache in the blood serum and brain were determined spectrophotometrically by the method of ellman's et al . As modified by srikumar et al . Using acetylthiocholine iodide as appropriate substrate and 5 - 5- dithiobis (2-nitrobenzoic) acid [dtnb] as a chromogen . The reaction of dtnb with thiocholine released by the enzymatic hydrolysis of acetylthiocholine iodide was monitored at 412 nm . The specific activity of ache was expressed as mole / gram of tissue / minute / mg protein for brain and mole / minute / mg protein for serum . Electrolytes levels were quantified in serum and brain tissues by using auto analyzer hitachi roche 7020 (902) according to manufacturer's protocols for calcium ion, whereas the levels of potassium, sodium, and chloride ions were determined by electrolyte analyzer (ion selective electrode, china) according to manufacturer's protocol . Gas chromatography / mass spectrometry (gc - ms) was carried out by shimadzu gcms - qp2010 plus japan according to manufacturer's protocol . The mineral elements: calcium, iron, potassium, magnesium, and zinc, were determined using atomic absorption spectrometry (aas) machine according to manufacturer's protocol . Vitamins a, c, and e were determined in the honey after adopting the methods of rutkowski and grzegorczyk and dahot et al . . To address the biological variability and stability of the samples, each and every experiment was repeated at least three times and the results were expressed as mean standard deviation . Differences between the groups were analyzed by one - way analysis of variance (anova) with the aid of statistical package for social sciences (spss) software, spss inc . P values <0.05 were considered significant for differences in mean using the least of significance difference (lsd).

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.