text
stringlengths 0
868k
|
|---|
Amongst various techniques available for solubility enhancement of poorly soluble drugs, powdered liquid technology is comparatively less explored . Liquisolid technology, as described by spireas and bolton, can be used to transform a liquid into a free flowing, easily compressible, and apparently dry powder by simple physical mixing with selected excipients named the carrier material . Liquisolid technology has been applied to improve dissolution of various poorly water soluble drugs [25]. Drugs with poor water solubility and high first pass metabolism are difficult to deliver effectively, because gastrointestinal route must be avoided to avoid first pass metabolism . Although not as permeable as sublingual mucosa, the buccal mucosa can still be considered an effective route of drug delivery . Since the drug is poorly soluble, it is less likely to be released effectively at the buccal mucosal membrane . In such case, a solubility enhancing technique such as the liquisolid approach can be helpful to improve absorption efficiency . In this study, a bcs class ii drug was formulated as a buccoadhesive tablet, utilizing a liquisolid approach to achieve modified release . Although sustained release formulations of nifedipine are available on the market, they were easily succeeded by new generations of antihypertensive agents which provide better control over the condition . Formulating nifedipine as a buccoadhesive tablet allows reduction in its dose and offers better control over the plasma levels . Liquisolid system containing the drug was incorporated into a matrix containing buccoadhesive polymers to formulate a buccoadhesive tablet . Nifedipine (amneal pharmaceuticals, ahmedabad), polyethylene glycol 400 (peg 400) and glycerine (sulab reagent, baroda), polysorbate 80 (tween 80), carboxymethylcellulose sodium, propylene glycol and magnesium stearate (burgoyne burbidges & co., mumbai), microcrystalline cellulose (avicel ph 102, 112, bombay tablets, gandhinagar), magnesium aluminium silicate (neusilin, gangwal chemicals pvt . Ltd . Mumbai), carbomer (acrypol 934p, corel pharma, ahmedabad, india), and chitosan (mahtani chitosan, veraval, india) were used as materials . Excess nifedipine was dispersed and stirred in different solvents for 48 h at 21 1c . Accurately weighed quantities of the filtered supernatants were further diluted with methanol and analyzed spectrophotometrically (uv-1800, shimadzu, japan) at 237 nm for their drug content . From these results, the solubility of nifedipine in the respective liquid vehicle was calculated . The experiment was designed to measure the flowable liquid retention potential ((-value) for avicel ph 101, avicel ph 112, and neusilin). To 10 g of carrier material (neusilin), increasing amounts of nonvolatile solvent were added and mixed well . At each concentration of nonvolatile solvent added, the angle of repose for carrier was determined . The corresponding -value was calculated from the following equation:(1)-value = weight of liquidweight of carrier or coat, where is flowable liquid retention potential of a carrier material . The -value corresponding to an angle of repose of 33 represented the flowable liquid retention potential of carrier . Various powder materials, namely, avicel ph 101, avicel ph 112, and neusilin, were screened based on their flowable liquid retention potential value . Calculated quantities of drug and nonvolatile solvent were taken in 10 ml glass beaker and stirred using a magnetic stirrer to dissolve the drug in the solvent . Was carried out in three steps as described by spireas and bolton . During the first stage, mumbai) at an approximate mixing rate of 60 rpm for approximately 1 min in order to evenly distribute the liquid mixture in the powder . In the second stage, the liquid / powder admixture was evenly spread as a uniform layer on the surfaces of a mortar and left standing for approximately 5 min to allow drug solution to be absorbed by the powder particles . In the third stage, the powder was scraped off the mortar surfaces by means of spatula and then blended at a higher rate of rpm for another 30 sec . The success of liquisolid system with an acceptable flow rate and compressibility depends on liquid load factor (lo) and excipient ratio (r). The liquid load factor (lo) is a characteristic of amount of vehicle used in the formulation that is defined as the weight ratio of the liquid medication (w) and carrier . The excipient ratio (r) of a powder is defined as the ratio between the weights of carrier (q) and coating material (q) present in the formulation, hence, the powder excipients ratio and liquid load factor of the formulations . From the drug concentration, the dose of the drug, and carrier - coat ratio (r - value), weight of liquid medication (w) can be calculated . For sustained release purpose, (w), weight of liquid medication, is to be calculated from% w / w, thereby multiplying dose with 100 and dividing with weight of solvent (30): lo is optimum liquid load factor . Q is quantity of coating material:(2)weight of liquid medication w = dose100drug solubility.then using equation lo = w / q, quantity of carrier (q) can be determined(3)q = wlo.then using equation r = q / q, quantity (q) can be calculated:(4)q = qr . Q is quantity of coating material:(2)weight of liquid medication w = dose100drug solubility . Three bioadhesive polymers, namely, carbomer, cmc, and chitosan, were mixed to prepare a 49% w / w liquisolid system that was compressed into tablets (cadmach machinery, ahmedabad, india). These buccoadhesive tablets were tested for mucoadhesive strength and drug release . Based on these results, suitable bioadhesive polymer(s) based on above screening, two bioadhesive polymers, carbomer and cmc (mixture described in table 2 replaced the individual 50 mg of mucoadhesive polymer found in f1f3), were evaluated further to optimize the polymer ratio (table 2). Flat, 200 mg tablets were prepared by direct compression method using multistation rotary punch tablet compression machine . All tablets contained 49% liquisolid system, 50% of bioadhesive polymer (or ratio of polymers with different mixing ratios), and 1% of magnesium stearate (as lubricant). All liquisolid preparations were compacted into tablets using a sixteen - station rotary compression machine (cadmach machinery, ahmedabad, india) using flat - faced punch with a compression force that provides acceptable tablet hardness . Sample of 25 gm weight (m), which was previously passed through 20 #sieve, was transferred in 100 ml graduated cylinder . The powder was levelled carefully without compacting, and the unsettled apparent volume was read . Apparent bulk density in gm / ml was calculated by the following formula: (5)bulk density = weight of powderbulk volume . Sample of 25 gm weight (m), which was previously passed through 20 #sieve, was transferred in 100 ml graduated cylinder . Then cylinder containing sample was tapped mechanically by raising the cylinder and allowing it to drop under its own weight using mechanical tapped density tester . Cylinder was tapped for 100 times and tapped volume was measured . Tapped density in gm / ml was calculated by the following formula:(6)tapped density = weight of powdertapped volume . The formula for carr's index is as below:(8)carr's index%=tapped densitybulk density100tapped density . Hausner's ratio was calculated from the equation:(9)hausner's ratio = tapped densitybulk density . The ratio of the drug's solubility in the liquid vehicle (cl) to the drug concentration (cd) in the liquisolid system denotes the fraction (fm) of the dissolved, or molecularly dispersed, drug in the liquid medication of the prepared liquisolid tablets . Therefore(10)fm = clcd.it should be noted here that the fraction of the molecularly dispersed drug in any system cannot exceed unity and, thus, in the cases where cl is greater than cd, the value of fm should be set equal to 1 . Liquisolid system was subjected to x - ray diffraction analysis to determine the crystalline state of nifedipine in the system . Analysis was carried out at diffraction angle range (2) of 10 to 70. fourier transform infrared spectroscopy (ftir). Ftir spectroscopy helps to determine any chemical interaction between drug and excipients used in formulation . The ftir spectra for nifedipine and optimized powder mixture for liquisolid preparations were obtained using ftir-8400s spectrophotometer (shimadzu, japan). The pure drug and physical mixtures (nifedipine, carboxymethylcellulose sodium, neusilin, carbomer, and magnesium stearate were added to physical mixture) these kbr discs were then scanned over a wave number range of 4000400 cm pressure . Content uniformity of prepared tablets was assessed by crushing a single tablet and extracting the drug from the powder using 100 ml of methanol . Samples were analyzed by uv 1800 spectrophotometer (shimadzu, japan) at 235 nm; dilutions were made with methanol . Buccal tablets were weighed individually (w1), placed separately in petri dishes containing 4 ml of phosphate buffer (ph 6.8) solution . At regular intervals (1, 2, 3, 4, 5, 6, 7, and 8 h), the tablets were removed from the petri dishes and excess surface water was removed carefully using filter paper . The swollen tablets were then reweighed (w2), and swelling index (si) was calculated using the following formula: (11)swelling index = w2w1w1 . The ex vivo bioadhesive strength of the prepared tablets was measured using a modified two - armed physical balance as shown in figure 1 . Freshly excised bovine buccal mucosa (obtained from a local slaughterhouse and stored in normal saline at 4c upon collection) was used as a model tissue (e). The bovine buccal mucosa (b) was fixed on the glass stage (c) using cyanoacrylate adhesive . The prepared tablet (d) was attached to the balance pan and then the glass stage (c) was raised slowly until the tablet surface came in contact with the buccal mucosa . A preload of 5 g (at e) was applied over the balance pan above the tablet for 5 min and then removed . Distilled water from a burette was added dropwise to the opposite side arm (f). Amount of water required was noted from the burette and required weight was calculated(12)bioadhesion strength = w,where w is the weight of water required for detachment and is the density of water:(13)force of adhesion n = bioadhesive strength9.811000 . A freshly cut bovine buccal mucosa was fixed on the internal side of a beaker with cyanoacrylate adhesive . A side of each tablet was wetted with 50 l of phosphate buffer ph 6.8 and was attached to the buccal tissue by applying a light force with a fingertip for 20 s. the beaker was filled with 80 ml of phosphate buffer ph 6.8 and kept at 37 1c . After 2 min, a stirring rate of 110 rpm was applied to simulate the buccal cavity . Dissolution studies were performed for each formulation using the usp ii apparatus at 50 rpm . The dissolution medium consisted of 900 ml phosphate buffer (ph 6.8) and 0.1% w / v sodium lauryl sulphate (sls) at 37 0.58c . At appropriate time intervals, 5 ml samples were taken and filtered through a 0.45 m millipore filter, and the absorbance of each sample was measured spectrophotometrically at 235 nm . Ex vivo permeation study through the buccal mucosa was performed using a franz diffusion cell at 37 0.2c and 50 rpm, using a magnetic stirrer . Buccal mucosa was obtained from a local slaughterhouse and used within 2 h of slaughter . The epithelium was separated from underlying connective tissues with surgical scissors and clamped between donor and receiver chambers 0.05 m of the franz diffusion cell . After the buccal membrane was equilibrated for 30 min with phosphate buffer at ph 6.8 in both chambers, the receiver chamber was filled with fresh ph 6.8 buffer . The hydrodynamics in the receptor compartment was maintained by stirring with a magnetic bead at 50 rpm . The buccal tablet was placed in the donor chamber and 1 ml of buffer solution (ph 6.8) will be added . Aliquots (1 ml) were collected at predetermined time intervals and were replaced with the same quantity of fresh solution . The collected aliquots were filtered through a filter paper, and the amount of drug permeated through the buccal mucosa was determined by measuring the absorbance at 236 nm using a uv spectrophotometer . Five kinetic models were used for controlled drug release curve fitting to select the most appropriate model . The dissolution data for optimized batch was fitted to the zero - order, first - order, higuchi, korsmeyer - peppas, and hixson - crowell models . The best fit model was selected on the basis of highest correlation coefficient and lowest f value . Ftir and spectra of nifedipine and physical mixture of drug and optimized formulation are shown in figure 1 . Ir spectrum (figure 1) of nifedipine exhibits characteristic peaks at absorption bands in the region of 3330 cm due to stretching vibration of n - h and aromatic c - h stretching that appears at 3000 cm . Several bands in the region of 2962 cm2872 cm show methyl group having asymmetric and symmetric peaks, respectively . Appearance of all these peaks and absence of any new peaks in the physical mixture and liquisolid formulation indicated no chemical interaction between the drug and excipients . Individual sample of drug, liquisolid system, and precompression powder (figure 2) containing all excipients were analyzed by ftir . The x - ray diffraction pattern of pure nifedipine showed characteristic high intensity diffraction peaks indicating that the drug is crystalline (figure 3) whereas reduced intensity peaks were observed for liquisolid compact (figure 3) that might be due to the lower level of drug in the sample . This can be tested for xrd by comparison of a physical mixture of the same composition not treated to form the compact (at a diffraction angle (2) of 15, 18, 19, 24, and 26). However, the peak at 24 can be seen clearly in liquisolid system (figure 3). Solubility data of drug nifedipine in various liquid vehicles is shown in table 3 which showed that the drug is more soluble in peg 400 than other vehicles . The solubility is an important factor in liquisolid systems, as higher solubility of drug in liquid vehicle can lead to higher dissolution rates since the drug will be more molecularly dispersed and more surface of drug will be exposed to the dissolution media . The relationships of angle of repose with corresponding -value avicel ph 102, avicel ph 112, and neusilin are shown in table 4 . Lf was then used to decide the optimum amount of carrier and coating materials required to ensure dry, free flowing, and compactible powdered systems . The lowest liquid factor was obtained for avicel ph 102 and accordingly the amount of carrier was higher than other formulations . The highest liquid factor was obtained for neusilin and avicel ph 112 and accordingly the amount of carrier was lower than other formulations . L o for selected carrier - coat system (avicel ph 112 and neusilin) can be calculated as follows: lf = + (1/r). Dose of nifedipine = 10 mg . R value = 20 . Therefore, weight of medication w = (dose 100)/concentration . W = (10 100)/30 = 33.33 mg . The quantity of carrier material can be calculated as q = w / lo = 33.33/0.78 = 42.74 mg . The quantity of coating material can be calculated as q = q / r = 42.74/20 = 2.13 mg . The quantity of carrier material can be calculated as q = w / lo = 33.33/0.78 = 42.74 mg . The quantity of coating material can be calculated as q = q / r = 42.74/20 = 2.13 mg . Powder flowability is crucial in the industrial production of tablet dosage forms, as a uniform powder stream through hopper confirms uniformity of both tablet weight and drug content . Carr's index, hauser's ratio, and angle of repose were found from 11 to 15, 1.12 to 1.18, and 20 to 30, respectively . Consider(14)fm = clcd, fm=3.3045000,fm=7.33105.a low fm value indicates that drug is largely present in undissolved form, a requisite for sustained release . The tablets containing liquisolid system were evaluated for friability, hardness, thickness, drug content, bioadhesive strength, and ex vivo permeation study, and so forth . All the prepared tablets complied with the pharmacopoeial standards and specifications for the weight variation and content uniformity tests . Results of hardness, friability, thickness, bioadhesive strength, and ex vivo residence time are represented in table 6 . Hardness test showed an average hardness of liquisolid tablets ranging from 6.0 0.35 to 8.0 1.24 kg / cm . Conventional compressed tablets that lose less than 1% w / w of their weight are generally considered acceptable . The percentage friability for all formulations was below 1% w / w, indicating that the friability is within the prescribed limits . Bioadhesive strengths of all the formulations are found within the range of 30 1.5 g to 39 1.5 g that indicated good bioadhesive strength . Moreover, ex vivo residence time found to be 4.0 0.2 h to 8 0.4 h was due to good bioadhesive strength and hardness of the formulations . However, swelling rate slowed down after 2 h. results are shown in table 7 . Batches f2 and f4 showed least swelling . In vitro drug release of the prepared formulation batches . Batch f2 containing only cmc showed incomplete release even at 8 hrs (figure 4). Batch f5 was subsequently selected for permeation study because it showed higher bioadhesive strength and sufficient ex vivo residence time . Flux (jss) and permeability coefficients (pc) were calculated on the basis of drug permeation(15)flux jss=3.89 g cm2 h1,pc=0.3 cm / h . Model fitting results of the drug release data of the optimized batch revealed that korsmeyer - peppas model was best fitted model as r is 0.9981, n (diffusion exponent) is 1.1732 which is> 0.85 indicating dissolution controlled release mechanism, and kinetic constant is 0.065 . The new technique of liquisolid system appears to be a promising alternative for the formulation of water - insoluble drugs . The higher dissolution rate displayed by liquisolid system is due to the increased wetting properties and surface of the drug available for dissolution . Estimation of fraction of drug dissolved and xrd studies suggest that only a fraction of the drug is present in dissolved form . Nifedipine is compatible with excipients used in formulation and stability study indicated that formulation is stable . Among the bioadhesive polymers screened, carbomer showed excellent bioadhesion but provided poor control over drug release . Reason for this poor drug release might be the formation of nonpermeative, erodible matrix by carbomer . Addition of carboxymethylcellulose sodium in the formulation led to improvement in dissolution because of matrix formation by combination of these two bioadhesive polymers . The use of liquisolid system while formulating buccoadhesive dosage form for low dose, poorly soluble drugs enables better control over release . From the results of different batches prepared by neusilin as carrier it was found that neusilin proved to be the superior carrier than others . A lesser amount of neusilin was required to adsorb the same amount of liquid vehicle compared to avicel which lowered the weight of tablet . Avicel ph 112, when used as carrier material, gives lower unit dosage form size due to its high surface area . The flow property obtained by neusilin was good and remains unaffected at such low amount . The flowability improvement can be attributed to the high porosity and high specific surface area of these excipients, which allows penetration of liquid into the particle pores resulting in a weight gain of individual particle accompanied by better flow properties . High flux observed with liquisolid bioadhesive tablet indicated that presence of drug in dissolved form significantly affects permeation across buccal mucosa . Liquisolid system containing the drug was incorporated into a matrix containing buccoadhesive polymers to formulate a buccoadhesive tablet . Nifedipine liquisolid tablets formulated from bioadhesive polymers containing 49% liquisolid system, 17.5% carbomer, and 7.5% carboxymethylcellulose sodium provided the best results in terms of dissolution properties . Neusilin was found more suitable as carrier materials instead of avicel, as the liquid adsorption capacity increases manyfold and thus tablet weights are reduced in case of neusilin as compared to avicel.
|
Myofascial pain syndrome (mps) is a common dysfunction affecting up to 85% of general population . It affects the muscles of mastication and neck and covers sensory, motor, and autonomic symptoms . Mps was originally described by janet travell (john f. kennedy's physician) and david simons . Kellgren published seminal papers in this area introducing the concept of trigger points . In 1952, travell and rinzler explained the genesis of pain with illustrations depicting pain patterns of over thirty muscles . Mps is characterized by the presence of tender zones called trigger points and each trigger point is composed of hypercontracted muscle fibers . Some research suggests mps as a reflex disorder caused by a reverberating circuit of sustained neural activity . Chronic myofascial pain is usually a result of, and sometimes a product of, both emotional influences and physical factors . According to fricton et al ., mps is a regional muscle disorder that is associated with several behavioral, psychosocial, and cognitive contributing factors . Mps is usually managed by stretch and massage, thermotherapy, electrotherapy, laser therapy, dry needling, acupuncture, shockwave therapy, botulinum toxin type a injection, trigger point injections, pharmacological methods, and according to a recent report even hyperbaric oxygen therapy can be used . Pharmacological treatment methods include diclofenac patch, tramadol, tropisetron, opioids, lidocaine patch, tizanidine, benzodiazepines, cyclobenzaprine, thiocolchicoside, gabapentin, pregabalin, amitriptyline, duloxetine, sumatriptan, botulinum type a toxin, ketamine, l - tryptophan, and memantine . Although medications provide improvement in acute cases, they carry a risk of adverse effects and offer only symptomatic relief . Patients with myofascial pain commonly experience depression, sleep disturbance, anger, fatigue, and altered mental function . Although medications are frequently advised, it is necessary to think of alternative therapies such as meditation . Meditation operates on a wide range of pain categories and can alleviate chronic pain in patients who do not respond to traditional medical care . However, the role of meditation has long been underestimated in the scientific community and has never tried in mps . Therefore, i examined this potential arena while taking into account two important considerations: various precipitating factors are known to maintain mpsmeditation alleviates all known precipitating factors of mps . Various precipitating factors are known to maintain mps meditation alleviates all known precipitating factors of mps . As meditation has substantial effect on pain perception, sleep patterns, psychological morbidity, and sympathetic nervous system, it seems reasonable to hypothesize that it can control the progression of mps [figure 1 and table 1]. In the subsequent sections later, it has spread out to china and western world . In the recent years, it emerged as a new field that challenges even modern science in treatment and palliative care capable of improving health and well - being . The word meditation is from the latin word meditation meaning to contemplate . The essence of meditation is mindfulness or awareness or simply being in the moment . Mindfulness is essentially a buddhist concept - the word itself is an english translation of the pali term sati . A good meditator witnesses all experiences regardless of their nature or valency (pleasant, unpleasant). They can range from mantra chanting (transcendental meditation [tm]) to more powerful mindfulness and insight meditations as taught in zen . Despite the technique used, awareness (of breath, mantras, thoughts, and emotions) liberates the hidden inner tendencies that lie dormant in the mind and results in emotional well - being . In mindfulness the hidden tendencies lead to thoughts, and thoughts lead to emotions . A causal relationship exists between thoughts and emotions, one leading to the other . Meditators do not engage with the content of thoughts but experience them as they are, without judgment or analysis . At the biological plane, meditation decreases sympathetic activity, lowers cortisol (marker of stress), causes cortical thickening, and also brings specific changes in the electroencephalogram (eeg) that correspond to mental relaxation . Mindfulness - based treatment programs were applied in the management of chronic pain, anxiety, emotional disorders, and mainly fibromyalgia (fm), a similar but a more generalized form of mps . The role of meditation in muscular pain disorders was identified early, but surprisingly no studies are available on its role in mps . Many studies identified mps and fm as similar conditions with overlapping biology and pathogenesis . Both are frequently associated with local tenderness, taut muscle bands, and active trigger points . In fm multiple, generalized trigger points, generalized fatigue and musculoskeletal pain, poor sleep, headache, gastrointestinal disturbance, numbness, sensation of swelling occur more often compared to mps . Symptoms only vary in severity . In mps, referred pain and taut bands are more common . Coexistence of fm and mps can also occur, and pain and tenderness in masticatory muscles may be an important component of fm . The stomatognathic system is frequently involved in fm . Fm and mps hence represent two ends of the same clinical entity . In recent literature, mindfulness - based stress reduction reduced majority of fm symptoms including sleep quality and fatigue, and home practice reduced general symptom severity . The positive impact of meditation on fm existed even after long observation period and was shown as a potential intervention in a quasi - randomized trial . Sufficient data are available on mps, fm, meditation, and on the impact of meditation in fm . Owing to the similarities and overlap between fm and mps, i have attempted to apply some of these findings to identify potential mechanisms involved in the alleviation of myofascial pain through meditation . Literature reported significant changes in gray matter and white matter anatomy . To investigate central nervous system (cns) changes in mps, high - resolution structural brain and brainstem scans the first report of cns changes in mps was in 2011, by younger et al . Significant change (both decrease and increase) was noted in the gray matter volume as compared to controls mainly in the trigemino - thalamocortical pathway (trigeminal sensory nuclei, thalamus, and primary sensory cortex) and a decrease in gray matter volume was noted in the limbic system (posterior putamen, globus pallidus, and anterior insula). In another similar study, a regional decrease was found in white matter volume in the medial prefrontal cortex (pfc) bilaterally . Furthermore, a decrease in gray matter volume occurred in the cingulate gyrus, insular cortex, frontal gyrus, and superior temporal gyrus bilaterally in the temporomandibular disorder patients . When myofascial trigger points were stimulated, enhanced activity was found in somatosensory (si, sii, inferior parietal, mid - insula) and limbic regions (anterior insula) and suppressed activity was found in the hippocampal area . In a positron emission tomographic study, it was shown that induced jaw - muscle pain (a chronic pain model that mimics mps) was associated with a significant increase in regional cerebral blood flow in the posterior insula, anterior cingulate, prefrontal cortices, right posterior parietal cortex, brainstem, cavernous sinus, and cerebellum indicating them as potential areas involved in assimilating jaw pain . It has a direct effect on all brain regions responsible for pain modulation [figure 2]. Mindfulness meditation acts on the same brain regions that are responsible for the assimilation of myofascial pain . Meditation increases cerebral blood flow in the anterior cingulate cortex (acc), pfc, insula (region involved in emotion regulation). Regular mindfulness practice causes a greater activation of acc and less utilization of pfc . With constant practice, the utilization of the pfc - acc regions and their connectivity with the amygdala and insula is enhanced . The primary somatosensory cortex shows high activity during pain and meditation reduces its activity significantly . A block diagram connecting areas of the brain that participate in pain, emotion, and autonomic regulation . The acc is a center that consists of brodmann area 24, 32, and 33 . This brain region participates in pain, autonomic functions, impulse regulation, and emotion . Brodmann area 24 in acc registers physical pain and its activity can be correlated with pain intensity . It is involved in the emotional reaction to pain rather than to the perception of pain itself . Hence, there are two things, the sensation of pain and the emotional reaction to pain . The insula, mainly the anterior region controls the autonomic nervous system (both sympathetic and parasympathetic limbs). Anatomically, the insular cortex is divided into a larger anterior region and the smaller posterior region . The anterior insula receives projections from the basal thalamus and has reciprocal connections with the amygdaloid complex . The posterior insula connects reciprocally with the secondary somatosensory cortex and receives input from thalamic nuclei . This region receives inputs from the posterior part of the thalamus specialized to convey pain information . Thalamus acts as a gateway that determines the flow of sensory (pain) information . Thalamic communication with higher centers is deactivated by mindfulness meditation and the pain signals simply fade away . Mindfulness meditation also reduces pain by activating the orbitofrontal cortex (brodmann area 10, 11, and 47) [figure 2]. The orbitofrontal cortex is a part of the pfc and an important area for cognitive processing . Connectivity of the orbitofrontal cortex with limbic areas includes reciprocal projections to insular cortex, parahippocampal regions, and hippocampus . The orbitofrontal cortex shares connections with limbic system, amygdala (extensive reciprocal connections), and direct and indirect connections with the hypothalamus . The experience of pain is associated with relatively lower amplitudes of slower wave (delta, theta, and alpha) activity and relatively higher amplitudes of faster wave (beta) activity . Electroencephalographic studies on (insight) zen meditation found increased alpha and theta activity in the frontal cortex, generally related to relaxation . Theta activity, in particular, is a marker of deeper relaxation and is directly related to the degree of experience, being greater in more senior practitioners . Eeg pattern changes in response to neuromodulatory approaches such as meditation which indicates pain modulation at cortical level . Recently, the brain wave pattern in fm and fatigue syndrome revealed an alpha rhythm disturbance (7.511 hz) and alpha - delta sleep (alpha intrusions in nonrapid eye movement sleep) as meditation increases alpha, theta, and delta activity and corrects disturbed cortical activity, it can be considered . Several researchers point sleep deprivation as a contributory for pain syndromes in general and in myofascial pain . In an internet survey conducted on 2500 fm patients, insomnia was the most frequent aggravating factor . Although many studies have shown a connection between pain syndromes and sleep disturbance, the direction of cause and effect is still a gray area moldofsky and scarisbrick reported that sleep - deprived individuals have more musculoskeletal symptoms and a significant increase in muscle tenderness . A close relationship was also found between increase in pain sensitivity and sleep debt in hours . It reduces the need for sleep and improves the quality of sleep . In this way shortage of sleep is also important cause of stress and anxiety, both contribute to mps . Travell and simon emphasized in their book titled, myofascial pain and dysfunction: upper half of body that an inquiry into the nature of sleep is important in mps patients . Painful muscles in mps interrupt sleep and disrupted sleep can make the muscles even more painful . Smythe considered sleep disturbances as one of the four important criteria in the diagnosis of fm . Most of the fm patients demonstrate an overnight increase in the tenderness of the muscles . Improving sleep quality can reduce pain and fatigue, further supporting the hypothesis that sleep dysfunction is a pathogenic stimulus . Sleep deprivation in healthy individuals can cause symptoms of myalgia, tenderness, and fatigue suggesting the possible role of sleep dysfunction in the origin of chronic muscle pain . Epidemiological studies also indicate poor sleep quality as a risk factor for the development of chronic muscle pain . Sleep deprivation impairs descending pain - inhibition pathways that are important in coping with pain . Stress and anxiety are the body's response to perceived physical and mental stress . Although anxiety is a short - lived in general population, in a few, it is almost a permanent state . In a meta - analysis, it was concluded that clinicians should discuss with their patients the role of meditation programs for psychological stress . In various studies, stress was identified as a contributor for mps . Hence, the role of stress in the progression of mps cannot be underestimated . As meditation reduces stress, mindfulness meditation has promising potential as a nonpharmacologic treatment of chronic pain for patients with mps . The common benefits with mindfulness meditation include pain reduction, acceptance of pain, better sleep, and enhanced well - being [figure 3]. Based on available data, mps seems closely related to chronic anxiety, depression, and other psychological states . Meditation is a neuromodulatory practice capable of neutralizing the effect of perpetuating factors on myofascial pain syndrome . Autonomic nervous system is pivotal in muscle contractility, genesis of muscle spasm, and mps [figure 1]. When sufficient amount is reached, the postsynaptic receptors are activated to initiate muscle action potential . The amount of acetylcholine is proportional to degree of sympathetic activity, which is further controlled by mental and psychosocial factors through inhibitory and excitatory pathways ., mindfulness meditation can significantly lower the muscle sympathetic nerve activity . In another study, physiological indices of stress were found to be lower in people who regularly practiced tm than nonmeditating control participants . A noxious loud tone (100 db, 0.5 s, 3000 hz) was presented to participants during normal waking and stress reaction to each tone as indicated by the galvanic skin response (gsr) was compared between the two groups . Gsr is a marker of autonomic arousal and its measures reflect sympathetic load or output . Habituation of the gsr to tones was faster for meditators than for controls, and meditators made fewer multiple responses during habituation indicating greater autonomic stability in response to stress . In many experiments, meditators were found to make fewer spontaneous gsr's than control participants . Thus, meditators were found to be more stable than controls on three autonomic indices: rate of gsr habituation, multiple responses, and spontaneous gsr . In myofascial pain individuals, the autonomic responses are less stable, but in meditators responses are more steady . The acc is a center that consists of brodmann area 24, 32, and 33 . This brain region participates in pain, autonomic functions, impulse regulation, and emotion . Brodmann area 24 in acc registers physical pain and its activity can be correlated with pain intensity . It is involved in the emotional reaction to pain rather than to the perception of pain itself . Hence, there are two things, the sensation of pain and the emotional reaction to pain . The insula, mainly the anterior region controls the autonomic nervous system (both sympathetic and parasympathetic limbs). Anatomically, the insular cortex is divided into a larger anterior region and the smaller posterior region . The anterior insula receives projections from the basal thalamus and has reciprocal connections with the amygdaloid complex . The posterior insula connects reciprocally with the secondary somatosensory cortex and receives input from thalamic nuclei . This region receives inputs from the posterior part of the thalamus specialized to convey pain information . Thalamus acts as a gateway that determines the flow of sensory (pain) information . Thalamic communication with higher centers is deactivated by mindfulness meditation and the pain signals simply fade away . Mindfulness meditation also reduces pain by activating the orbitofrontal cortex (brodmann area 10, 11, and 47) [figure 2]. The orbitofrontal cortex is a part of the pfc and an important area for cognitive processing . Connectivity of the orbitofrontal cortex with limbic areas includes reciprocal projections to insular cortex, parahippocampal regions, and hippocampus . The orbitofrontal cortex shares connections with limbic system, amygdala (extensive reciprocal connections), and direct and indirect connections with the hypothalamus . The experience of pain is associated with relatively lower amplitudes of slower wave (delta, theta, and alpha) activity and relatively higher amplitudes of faster wave (beta) activity . Electroencephalographic studies on (insight) zen meditation found increased alpha and theta activity in the frontal cortex, generally related to relaxation . Theta activity, in particular, is a marker of deeper relaxation and is directly related to the degree of experience, being greater in more senior practitioners . Eeg pattern changes in response to neuromodulatory approaches such as meditation which indicates pain modulation at cortical level . Recently, the brain wave pattern in fm and fatigue syndrome revealed an alpha rhythm disturbance (7.511 hz) and alpha - delta sleep (alpha intrusions in nonrapid eye movement sleep). A similar phenomenon may occur in mps . As meditation increases alpha, theta, and delta activity and corrects disturbed cortical activity, several researchers point sleep deprivation as a contributory for pain syndromes in general and in myofascial pain . In an internet survey conducted on 2500 fm patients, insomnia was the most frequent aggravating factor . Although many studies have shown a connection between pain syndromes and sleep disturbance, the direction of cause and effect is still a gray area . Moldofsky and scarisbrick reported that sleep - deprived individuals have more musculoskeletal symptoms and a significant increase in muscle tenderness . Furthermore, musculoskeletal pain threshold decreases significantly in sleep - deprived individuals . A close relationship was also found between increase in pain sensitivity and sleep debt in hours . It reduces the need for sleep and improves the quality of sleep . In this way shortage of sleep is also important cause of stress and anxiety, both contribute to mps . Travell and simon emphasized in their book titled, myofascial pain and dysfunction: upper half of body that an inquiry into the nature of sleep is important in mps patients . Painful muscles in mps interrupt sleep and disrupted sleep can make the muscles even more painful . Smythe considered sleep disturbances as one of the four important criteria in the diagnosis of fm . Most of the fm patients demonstrate an overnight increase in the tenderness of the muscles . Improving sleep quality can reduce pain and fatigue, further supporting the hypothesis that sleep dysfunction is a pathogenic stimulus . Sleep deprivation in healthy individuals can cause symptoms of myalgia, tenderness, and fatigue suggesting the possible role of sleep dysfunction in the origin of chronic muscle pain . Epidemiological studies also indicate poor sleep quality as a risk factor for the development of chronic muscle pain . Sleep deprivation impairs descending pain - inhibition pathways that are important in coping with pain . Stress and anxiety are the body's response to perceived physical and mental stress . Although anxiety is a short - lived in general population, in a few, it is almost a permanent state . In a meta - analysis, it was concluded that clinicians should discuss with their patients the role of meditation programs for psychological stress . In various studies, hence, the role of stress in the progression of mps cannot be underestimated . As meditation reduces stress, mindfulness meditation has promising potential as a nonpharmacologic treatment of chronic pain for patients with mps . The common benefits with mindfulness meditation include pain reduction, acceptance of pain, better sleep, and enhanced well - being [figure 3]. Based on available data, mps seems closely related to chronic anxiety, depression, and other psychological states . Meditation is a neuromodulatory practice capable of neutralizing the effect of perpetuating factors on myofascial pain syndrome . Autonomic nervous system is pivotal in muscle contractility, genesis of muscle spasm, and mps [figure 1]. When sufficient amount is reached, the postsynaptic receptors are activated to initiate muscle action potential . The amount of acetylcholine is proportional to degree of sympathetic activity, which is further controlled by mental and psychosocial factors through inhibitory and excitatory pathways . Meditation is a wakeful state accompanied by a lowering of cortical and autonomic arousal . According to park et al ., mindfulness meditation can significantly lower the muscle sympathetic nerve activity . In another study, physiological indices of stress were found to be lower in people who regularly practiced tm than nonmeditating control participants . A noxious loud tone (100 db, 0.5 s, 3000 hz) was presented to participants during normal waking and stress reaction to each tone as indicated by the galvanic skin response (gsr) gsr is a marker of autonomic arousal and its measures reflect sympathetic load or output . Habituation of the gsr to tones was faster for meditators than for controls, and meditators made fewer multiple responses during habituation indicating greater autonomic stability in response to stress . In many experiments, meditators were found to make fewer spontaneous gsr's than control participants . Thus, meditators were found to be more stable than controls on three autonomic indices: rate of gsr habituation, multiple responses, and spontaneous gsr . In myofascial pain individuals, the autonomic responses are less stable, but in meditators responses are more steady . According to recent reports, mps involves the formation of oxygen free radicals . In the striated muscle, the accumulation of reactive oxygen species (mainly nitric oxide and superoxide radicals) contributes to contractile dysfunction and myopathy (both are components of mps). Superoxide radicals are normally acted upon by superoxide dismutases (sods) and converted to hydrogen peroxide, which is later cleaved by either catalase or glutathione peroxidase . They include xanthine oxidase, phospholipase a2, and nicotinamide adenine dinucleotide phosphate oxidase 2-mediated pathways . During sustained vigorous contractile activity (seen in mps), reactive oxygen species generated in mitochondria and other nearby sites cause damage to mitochondrial components to initiate a chronic degenerative processes . At subcellular level, mitochondria was highlighted in a variety of clinical conditions ranging from neuropathic pain to chronic fatigue syndrome . Meditation, both transcendental and insight type (zen), was showed to diminish oxidative stress . The activity of antioxidant enzymes such as sod, catalase, glutathione peroxidase, and glutathione reductase is enhanced in meditators . Meditation preferentially upregulates sod activity, reduces lipid peroxidation, and is therefore an antioxidant therapy at cellular scale . Lower oxidative stress, can improve mitochondrial performance, which is critical for effective calcium transport during muscle contraction . Chronic pain syndromes such as fm are also associated with chromosomal aberrations such as telomere shortening . Telomere length is a metric of biological aging and cellular morbidity, and its assessment is an active research focus in pain syndromes . Patients with higher levels of pain within fm population were associated with shorter telomere length as compared to controls . Furthermore, depression had a significant role . When both pain and depression were combined, patients categorized as high - pain and high - depression had shorter telomeres than those with telomere length also correlated with pain threshold, pain sensitivity, and also gray matter volume . Patients with shorter telomeres were more sensitive to evoked pain and had less gray matter in the primary somatosensory cortex, the area associated with pain processing . Elizabeth blackburn (nobel laureate - physiology, 2012), who identified telomeres also conducted many studies on the effect of meditation on telomerase, an enzyme that maintains the size of telomeres . In one of her preliminary investigations, telomerase activity was found to be significantly elevated in the 3-month meditation retreat participants than controls . Chronic pain, anger, anxiety, stress, and depression have a significant impact on certain areas of the brain and also on muscle fibers at a subcellular level leading to the progression of mps . We can expect clinical improvement with meditation, as it reduces stress and psychological morbidity, which may be its triggers at the root level . Sympathetic burden is common to individuals with this condition, and meditation reduces sympathetic tone stabilizing autonomic function . Due to the effect on the sympathetic limb, mps is a central sensitization syndrome, and it is reasonable to consider meditation as a palliative intervention . Functional neuroimaging studies have revealed a network of brain regions in the limbic system, insula, pfc, and thalamus to be involved in the processing of pain information in general and especially myofascial nociceptive information . Meditation increases the activity in the same regions in the brain that participate in mps . Meditation reduces the experience of pain (suffering) by uncoupling sensory dimension (pain sensation) from the intrinsic alarm response (emotional reaction to pain). The brain is highly plastic and responds promptly to changes in the degree of mindfulness.
|
Renal cell carcinomas (rcc) represent 2 - 3% of all non - cutaneous malignant neoplasms in adults of both genders . Rcc is not a single entity, but encompasses a group of histologically distinct tumors including clear cell rcc (ccrcc), papillary rcc (prcc) and chromophobe rcc (crcc). The world health organization classification of renal tumors established in 2004 recognizes clear cell, papillary, chromophobe, collecting duct and unclassified rcc as the main subtypes of renal tumors . Since clinical outcomes are closely related to tumor stage, diagnostic methods that help to achieve early detection as well as new therapeutic modalities are critical . Cancers and epigenetics are closely associated, with deoxyribonucleic acid (dna) hypermethylation being widely accepted as a feature of many cancers . Alterations in dna methylation have been described in human cancer for more than thirty years now and its importance in cancer research has increased over the last decade . Additional epigenetic mechanisms including histone modifications and microrna (mirna) regulation have also been reported . In this review, we discuss the role of epigenetics in the prognosis, diagnosis and treatment of kidney malignancies . Epigenetics can be defined as inherited modifications in gene expression that are not encoded in the dna sequence itself . Aberrant dna methylation usually occurs in cytosine, guanine (cpg) rich regions and is associated with gene silencing . Histone lysine acetylation at the n - terminal leads to gene activation, whereas histone lysine methylation causes transcriptional activation or repression depending on the position of the methylated lysine rest . De - regulation of mirna expression (a class of small non - coding rna) resulting from epigenetic modifications occurring in transformed cells may lead to tumorigenesis . Previous studies were able to demonstrate that the detection of dna hypermethylation allows for normal tissue to be distinguished from malignant renal tissue . Some examples of tumor suppressor genes affected by epigenetic changes are listed in table 1 . Tumor suppressor genes and associated renal tumor histological type [4447] pbrm1 protein polybromo-1 gene; ccrcc clear cell renal cell carcinoma; smarcb1 swi / snf related matrix - associated actin - dependant regulator of chromatin subfamily b member 1 gene; rt rhabdoid tumor; setd2 set domain containing 2 gene; vhl von hippel - lindau gene; apaf-1 apoptosis protease activating factor-1; rassf1a ras association domain family 1 isoform a; apc adenomatous polyposis coli; p14 p14 (alternate reading frame) dna methylation consists of an addition of a methyl group (ch3) to the carbon 5 position of the cytosine ring forming a covalent bond . Although most cytosine methylation takes place in the cpg dinucleotide sequence, dinucleotide sequences containing adenine and thymine (cpa, cpt) can also be involved . Dna methylation alterations are one of the most consistent epigenetic modifications occurring during carcinogenesis involving various organ sites . Hypermethylation inactivates transcription of cpg dinucleotides in promoter regions of tumor suppressor genes leading to gene silencing . Earlier studies have shown that aberrant dna hypermethylation is involved in the pathogenesis of rcc . One study demonstrated a 100% correlation between dna hypermethylation of the promoter gene rassf1a and papillary rcc (prcc). The important role of promoter hypermethylation with subsequent transcriptional silencing of tumor suppressor genes in the development of rcc was noted by ricketts et al . In their report, they found that in patients with clear cell rcc (ccrcc), the von hippel - lindau (vhl) tumor suppressor gene is inactivated by promoter hypermethylation in 15% of cases . Several enzymes called dna methyltransferases (dnmt) are required to accomplish the process of hypermethylation (figure 1). Hypermethylation may be analyzed by using the sensitive methylation - specific pcr (msp) technique, which allows for the identification of a single methylated allele among hundreds of unmethylated alleles . Msp - based detection of hypermethylation has been successfully used when obtaining samples from body fluids that surround or drain the organ of interest in patients with solid malignancies . A) transcription factor attachment to dna strand induces rna polymerase to initiate transcription and gene expression . B) methylation of cpg island prevents transcription factor attachment and subsequent dna transcription and gene expression . Dna hypomethylation involves removal of a methyl group from methylated dna strands in a process conducted by several enzymes called demethylases . Dna hypomethylation occurs early in human carcinogenesis and is associated with genetic instability in cancer cells . It has been proposed that global dna hypomethylation promotes malignancy through reactivation of transposable elements and loss of imprinting (loi). Ludgate et al . Demonstrated a proportional hypomethylation of satellites genes (sat and sat 2 dna) in loi - subtype of wilms tumor . Histones are proteins around which the double stranded dna is coiled, giving rise to a structure known as a nucleosome . A histone octamer is a group of four pairs of histone molecules (h2a, h2b, h3 and h4). Heterochromatin is highly condensed and is thus difficult to transcribe, whereas euchromatin is loosely packed and therefore easily transcribed . Dna and histones can be modified in order to silence or activate genes . As a result, the translated or untranslated protein can cause the activation or silencing of other genes in a process that resembles a chain effect . A number of studies have found that loss or gain - of - function of histone - modifying enzymes, including histone lysine methyltransferases, is pathogenic in several types of cancer . Aberrant activity of histone - modifying enzymes might result in altered chromatin configuration and the subsequent disruption of normal transcriptional programs, pushing the cell towards malignant activity . A recent review identified that histone modifications at h3k4me2 and h3k18ac (associated with active transcription) and h3k9me2 (associated with gene repression) were able to predict disease outcome . However, only h3k9me2 was found to be a prognostic indicator of poorer outcome in metastatic rcc patients . Regulation of post - transcriptional gene expression takes place through the epigenetic mechanism of rna interference . Mirnas are a class of small noncoding rnas that regulate this process . Within tumor cells, the overexpression of mirna in tumor cells has been termed oncogenic, whereas mirna that shows reduced expression is referred to as a tumor suppressor . Down - regulation of mirna expression has been identified as a feature in ccrcc in previous studies . Similarly, dysregulated mirnas in rcc, such as mir-210, mir-141 and 200c, have been found to give rise to renal carcinogenesis . Huang et al . Reported that the down - regulation of mir-30c promotes epithelial mesenchymal transition (emt) in human renal cell carcinoma . Emt is a transient process in which epithelial cells acquire a mesenchymal phenotype, that is, the loss of intercellular adhesions maintained by a group of proteins called cadherins and the subsequent increase in cell motility . As malignant cells initially proliferate at a higher rate than angiogenesis, a microenvironment of hypoxia is generated . As a result of this, huang et al . Found that the down - regulation of mir-30c could be induced by hypoxia via hif . The subsequent repression of mir-30c expression results in the reduction of e - cadherin production and promotion of emt . Conversely, overexpression of mir-30c was found to inhibit emt in rcc . In order to characterize mirnas, two approaches are used: studying expression of known mirnas by hybridization - based techniques or discovery of novel mirnas molecules by cloning and sequencing . Tumor markers have become a useful tool in diagnosis of malignancy, as they are typically simple to utilize, readily measured in blood and urine samples and do not require invasive procedures . Ideally, a tumor marker should have the following features: be repeatedly present only in cancer patients, correlate with disease stage and response to treatment, and be easily measured . Several proteins have been investigated as potential tumor markers for rcc including carbonic anhydrase 9 (caix), hypoxia - inducible factor 1- (hif1), vascular endothelial growth factor (vegf) and c - reactive protein (crp). Tumor markers are not routinely used in clinical practice; however they can be helpful in aiding the diagnosis of problematic cases . Recently reported on the association between tumor marker levels of ca 15 - 3, ca 125 and -2 microglobulin in 332 patients who underwent nephrectomy for rcc . They found that these markers were increased preoperatively in many patients and that serum levels of ca 15 - 3 correlated with tumor grade and stage . They found that high grade tumors showed lower expression of nkiras1 compared to low grade tumors . One study reported the use of hypermethylated in cancer 1 (hic1) as a possible marker to enhance individualized therapy and risk stratification in rcc patients . They found that (hic1) hypermethylation was associated with reduced recurrence - free survival . Patricio et al . Reported that the transcription factor paired - box 2 (pax-2), which is intensely expressed during early stages of kidney development, might be useful as a tool to discriminate chromophobe rcc (crcc) from oncocytoma . They also found that pax-2 expression was significantly lower in crcc compared to ccrcc and prcc . Specific dna alterations and molecules in intracellular pathways might be used as potential biomarkers for rcc prognostication . Reported the association between fibulin-1 (an extracellular matrix glycoprotein) down - regulation and the progression of rcc . They suggest that down - regulation of fibulin-1 through promoter hypermethylation correlated with rcc progression and that by restoring fibulin-1 expression, rcc cell growth was significantly inhibited . Therefore, fibulin-1 functions as a novel candidate tumor suppressor gene in rcc . Cell adhesion molecules (cadms) comprise a protein family that participates in cell polarity maintenance and tumor suppression . Reported in their study that cadm2 is a tumor suppressor gene that prevents progression, invasion and metastasis of renal cancer, and that its expression is silenced at least in part through promoter hypermethylation . A recent study indicates that epigenetic silencing of nak-- gene (atp1b1) through promoter hypermethylation contributes to rcc initiation and disease progression . They also showed that knockdown of the (vhl) tumor suppressor gene in rcc cell lines resulted in atp1b1 promoter hypermethylation . (aqp1) and perlipin-2 (plin2), correlate with tumor size and stage . Their results showed that urine aqp1 concentrations can distinguish ccrcc and prcc from controls with a sensitivity and specificity of 100% and 100%, respectively . Methylation of the microrna (mir)-124 - 3 cpg island was suggested as an independent prognosticator for ccrcc by gebauer et al . Their analysis demonstrated that increased methylation of a sub - region of mir-124 - 3 was associated with adverse clinicopathologic parameters including metastasis, higher grade, greater tumor size and risk of recurrence . Recent studies have suggested that circulating mirnas could be used as biomarkers for diagnosis and prognosis in cancer patients . Reported that up - regulation of serum mir-210 may occur in the early stage of ccrcc and can therefore be used as a biomarker for early ccrcc in humans . Indicated that mir-187 was down - regulated in both tumor tissue and plasma of ccrcc patients . Interestingly, they found that all patients with high mir-187 expression were alive after 5 years whereas among those with low mir-187 expression, 5 year survival was only 42% . Immunotherapy for advanced rccs, including the administration of interferon - alpha and interleukin-2 (il-2), has been used as a standard treatment for over 20 years . In addition to immunotherapy and traditional surgical approaches, several molecular targeted therapies have been adapted into clinical practice, including the use of mammalian target such as rapamycin (mtor) inhibitors and tyrosine kinase inhibitors (tki), both of which target the vegf receptor . Since epigenetic changes are heritable and potentially reversible, it is reasonable to use them as potential therapeutic targets . Several molecules have been developed to target epigenetic changes that involve dna methylation (dna methyl transferases (dnmt) inhibitors) and histone modification (histone deacetylase (hdac) inhibitors). Some clinical and preclinical trials of these molecules are showed in tables 2 and 3 . Clinical and * preclinical trials: hdac inhibitors clinical and * preclinical trials: dmnt inhibitors the use of chemically modified antisense - oligonucleotides has been explored in the past as a method of mirna knockdown; however, the biodistribution, biostability and mode of delivery have been an important challenge . The development of alternative and non - conventional methods to target mirna is therefore necessary . Currently, mirna inhibitors are offered as vector - based expression clones or synthetic oligonucleotides . Transient and stable suppression of the target gene is achieved when the mirna inhibitor clones bind specifically to the target mirnas . Humans contain three catalytically - active dna methyltransferases enzymes (dnmt1, dnmt3a, and dnmt3b) which regulate dna methylation, in addition to an associated regulatory protein (dnmt3l). As indicated previously, methylation of cpg dinucleotides has been linked to the development of rcc . Therefore, molecules that target dnmts would appear to be excellent therapeutic agents against rcc . It binds to dnmt1 messenger rna (mrna) preventing further processing of the mrna and reducing cellular levels of dnmt1 . One signaling pathway that has been implicated in the pathogenesis of rcc in recent studies is the wnt/-catenin pathway . Studies have shown that promoter hypermethylation of wnt antagonists results in carcinogenesis through dysregulation of cell proliferation and differentiation . Secreted - frizzled - related protein 2 (sfrp2) is a wnt antagonist that functions as a tumor suppressor gene . A recent study suggested that the use of 5-aza-2-deoxycyti - dine (dac), a dnmt inhibitor that restores sfrp2 expression, induces apoptosis in rcc cells . Histone modifications include acetylation (transcriptional activation), methylation (activation or repression) and phosphorylation (chromatin structure and function alteration). Aberrant activity of the enzymes implicated in these changes could lead to abnormal chromatin configuration and subsequent development of cancer . Histone deacetylase inhibitors are categorized based on their structure into hydroxamates (vorinostat), cyclic peptides (romidepsin), aliphatic acids (phenylbutyrate) and benzamides (entinostat). Several new agents are currently under development . A novel hdac inhibitor called obp-801, also known as ym753, was reported to induce apoptosis and inhibit cell growth of rcc cells when combined synergistically with the phosphatidylinositol 3-kinase (p13k) inhibitor ly294002, rendering this combination to be a promising treatment for rcc . Several therapeutic benefits of hdac inhibitors have been described in pre - clinical trials, but unfortunately, this has not translated into clinical trials to date . One reason could be the development of acquired resistance due to long - term drug treatment . A recent study showed how the prolonged use (12 weeks) of a hdac inhibitor (valproic acid) was associated with drug resistance when compared with a short 2 weeks treatment . They found that the chronic use of valproic acid enables the reactivation of akt, also known as protein kinase b, which may be involved in resistance development . Epigenetics can be defined as inherited modifications in gene expression that are not encoded in the dna sequence itself . Aberrant dna methylation usually occurs in cytosine, guanine (cpg) rich regions and is associated with gene silencing . Histone lysine acetylation at the n - terminal leads to gene activation, whereas histone lysine methylation causes transcriptional activation or repression depending on the position of the methylated lysine rest . De - regulation of mirna expression (a class of small non - coding rna) resulting from epigenetic modifications occurring in transformed cells may lead to tumorigenesis . Previous studies were able to demonstrate that the detection of dna hypermethylation allows for normal tissue to be distinguished from malignant renal tissue . Some examples of tumor suppressor genes affected by epigenetic changes are listed in table 1 . Tumor suppressor genes and associated renal tumor histological type [4447] pbrm1 protein polybromo-1 gene; ccrcc clear cell renal cell carcinoma; smarcb1 swi / snf related matrix - associated actin - dependant regulator of chromatin subfamily b member 1 gene; rt rhabdoid tumor; setd2 set domain containing 2 gene; vhl von hippel - lindau gene; apaf-1 apoptosis protease activating factor-1; rassf1a ras association domain family 1 isoform a; apc adenomatous polyposis coli; p14 p14 (alternate reading frame) dna methylation consists of an addition of a methyl group (ch3) to the carbon 5 position of the cytosine ring forming a covalent bond . Although most cytosine methylation takes place in the cpg dinucleotide sequence, dinucleotide sequences containing adenine and thymine (cpa, cpt) can also be involved . Dna methylation alterations are one of the most consistent epigenetic modifications occurring during carcinogenesis involving various organ sites . Hypermethylation inactivates transcription of cpg dinucleotides in promoter regions of tumor suppressor genes leading to gene silencing . Earlier studies have shown that aberrant dna hypermethylation is involved in the pathogenesis of rcc . One study demonstrated a 100% correlation between dna hypermethylation of the promoter gene rassf1a and papillary rcc (prcc). The important role of promoter hypermethylation with subsequent transcriptional silencing of tumor suppressor genes in the development of rcc was noted by ricketts et al . In their report, they found that in patients with clear cell rcc (ccrcc), the von hippel - lindau (vhl) tumor suppressor gene is inactivated by promoter hypermethylation in 15% of cases . Several enzymes called dna methyltransferases (dnmt) are required to accomplish the process of hypermethylation (figure 1). Hypermethylation may be analyzed by using the sensitive methylation - specific pcr (msp) technique, which allows for the identification of a single methylated allele among hundreds of unmethylated alleles . Msp - based detection of hypermethylation has been successfully used when obtaining samples from body fluids that surround or drain the organ of interest in patients with solid malignancies . A) transcription factor attachment to dna strand induces rna polymerase to initiate transcription and gene expression . B) methylation of cpg island prevents transcription factor attachment and subsequent dna transcription and gene expression . Dna hypomethylation involves removal of a methyl group from methylated dna strands in a process conducted by several enzymes called demethylases . Dna hypomethylation occurs early in human carcinogenesis and is associated with genetic instability in cancer cells . It has been proposed that global dna hypomethylation promotes malignancy through reactivation of transposable elements and loss of imprinting (loi). Ludgate et al . Demonstrated a proportional hypomethylation of satellites genes (sat and sat 2 dna) in loi - subtype of wilms tumor . Histones are proteins around which the double stranded dna is coiled, giving rise to a structure known as a nucleosome . A histone octamer is a group of four pairs of histone molecules (h2a, h2b, h3 and h4). Heterochromatin is highly condensed and is thus difficult to transcribe, whereas euchromatin is loosely packed and therefore easily transcribed . Dna and histones can be modified in order to silence or activate genes . As a result, the translated or untranslated protein can cause the activation or silencing of other genes in a process that resembles a chain effect . A number of studies have found that loss or gain - of - function of histone - modifying enzymes, including histone lysine methyltransferases, is pathogenic in several types of cancer . Aberrant activity of histone - modifying enzymes might result in altered chromatin configuration and the subsequent disruption of normal transcriptional programs, pushing the cell towards malignant activity . A recent review identified that histone modifications at h3k4me2 and h3k18ac (associated with active transcription) and h3k9me2 (associated with gene repression) were able to predict disease outcome . However, only h3k9me2 was found to be a prognostic indicator of poorer outcome in metastatic rcc patients . Regulation of post - transcriptional gene expression takes place through the epigenetic mechanism of rna interference . Mirnas are a class of small noncoding rnas that regulate this process . Within tumor cells, the overexpression of mirna in tumor cells has been termed oncogenic, whereas mirna that shows reduced expression is referred to as a tumor suppressor . Down - regulation of mirna expression has been identified as a feature in ccrcc in previous studies . Similarly, dysregulated mirnas in rcc, such as mir-210, mir-141 and 200c, have been found to give rise to renal carcinogenesis . Huang et al . Reported that the down - regulation of mir-30c promotes epithelial mesenchymal transition (emt) in human renal cell carcinoma . Emt is a transient process in which epithelial cells acquire a mesenchymal phenotype, that is, the loss of intercellular adhesions maintained by a group of proteins called cadherins and the subsequent increase in cell motility . As malignant cells initially proliferate at a higher rate than angiogenesis, a microenvironment of hypoxia is generated . As a result of this, hypoxia - inducible factors (hif) are released . Huang et al . Found that the down - regulation of mir-30c could be induced by hypoxia via hif . The subsequent repression of mir-30c expression results in the reduction of e - cadherin production and promotion of emt . Conversely, overexpression of mir-30c was found to inhibit emt in rcc . In order to characterize mirnas, two approaches are used: studying expression of known mirnas by hybridization - based techniques or discovery of novel mirnas molecules by cloning and sequencing . Tumor markers have become a useful tool in diagnosis of malignancy, as they are typically simple to utilize, readily measured in blood and urine samples and do not require invasive procedures . Ideally, a tumor marker should have the following features: be repeatedly present only in cancer patients, correlate with disease stage and response to treatment, and be easily measured . Several proteins have been investigated as potential tumor markers for rcc including carbonic anhydrase 9 (caix), hypoxia - inducible factor 1- (hif1), vascular endothelial growth factor (vegf) and c - reactive protein (crp). Tumor markers are not routinely used in clinical practice; however they can be helpful in aiding the diagnosis of problematic cases . Recently reported on the association between tumor marker levels of ca 15 - 3, ca 125 and -2 microglobulin in 332 patients who underwent nephrectomy for rcc . They found that these markers were increased preoperatively in many patients and that serum levels of ca 15 - 3 correlated with tumor grade and stage . They found that high grade tumors showed lower expression of nkiras1 compared to low grade tumors . One study reported the use of hypermethylated in cancer 1 (hic1) as a possible marker to enhance individualized therapy and risk stratification in rcc patients . They found that (hic1) hypermethylation was associated with reduced recurrence - free survival . Patricio et al . Reported that the transcription factor paired - box 2 (pax-2), which is intensely expressed during early stages of kidney development, might be useful as a tool to discriminate chromophobe rcc (crcc) from oncocytoma . They also found that pax-2 expression was significantly lower in crcc compared to ccrcc and prcc . Specific dna alterations and molecules in intracellular pathways might be used as potential biomarkers for rcc prognostication . Reported the association between fibulin-1 (an extracellular matrix glycoprotein) down - regulation and the progression of rcc . They suggest that down - regulation of fibulin-1 through promoter hypermethylation correlated with rcc progression and that by restoring fibulin-1 expression, rcc cell growth was significantly inhibited . Therefore, fibulin-1 functions as a novel candidate tumor suppressor gene in rcc . Cell adhesion molecules (cadms) comprise a protein family that participates in cell polarity maintenance and tumor suppression . Reported in their study that cadm2 is a tumor suppressor gene that prevents progression, invasion and metastasis of renal cancer, and that its expression is silenced at least in part through promoter hypermethylation . A recent study indicates that epigenetic silencing of nak-- gene (atp1b1) through promoter hypermethylation contributes to rcc initiation and disease progression . They also showed that knockdown of the (vhl) tumor suppressor gene in rcc cell lines resulted in atp1b1 promoter hypermethylation . (aqp1) and perlipin-2 (plin2), correlate with tumor size and stage . Their results showed that urine aqp1 concentrations can distinguish ccrcc and prcc from controls with a sensitivity and specificity of 100% and 100%, respectively . Methylation of the microrna (mir)-124 - 3 cpg island was suggested as an independent prognosticator for ccrcc by gebauer et al . Their analysis demonstrated that increased methylation of a sub - region of mir-124 - 3 was associated with adverse clinicopathologic parameters including metastasis, higher grade, greater tumor size and risk of recurrence . Recent studies have suggested that circulating mirnas could be used as biomarkers for diagnosis and prognosis in cancer patients . Reported that up - regulation of serum mir-210 may occur in the early stage of ccrcc and can therefore be used as a biomarker for early ccrcc in humans . Indicated that mir-187 was down - regulated in both tumor tissue and plasma of ccrcc patients . Interestingly, they found that all patients with high mir-187 expression were alive after 5 years whereas among those with low mir-187 expression, 5 year survival was only 42% . Immunotherapy for advanced rccs, including the administration of interferon - alpha and interleukin-2 (il-2), has been used as a standard treatment for over 20 years . In addition to immunotherapy and traditional surgical approaches, several molecular targeted therapies have been adapted into clinical practice, including the use of mammalian target such as rapamycin (mtor) inhibitors and tyrosine kinase inhibitors (tki), both of which target the vegf receptor . Since epigenetic changes are heritable and potentially reversible, it is reasonable to use them as potential therapeutic targets . Several molecules have been developed to target epigenetic changes that involve dna methylation (dna methyl transferases (dnmt) inhibitors) and histone modification (histone deacetylase (hdac) inhibitors). Some clinical and preclinical trials of these molecules are showed in tables 2 and 3 . Clinical and * preclinical trials: hdac inhibitors clinical and * preclinical trials: dmnt inhibitors the use of chemically modified antisense - oligonucleotides has been explored in the past as a method of mirna knockdown; however, the biodistribution, biostability and mode of delivery have been an important challenge . The development of alternative and non - conventional methods to target mirna is therefore necessary . Currently, mirna inhibitors are offered as vector - based expression clones or synthetic oligonucleotides . Transient and stable suppression of the target gene is achieved when the mirna inhibitor clones bind specifically to the target mirnas . Humans contain three catalytically - active dna methyltransferases enzymes (dnmt1, dnmt3a, and dnmt3b) which regulate dna methylation, in addition to an associated regulatory protein (dnmt3l). As indicated previously, methylation of cpg dinucleotides has been linked to the development of rcc . Therefore, molecules that target dnmts would appear to be excellent therapeutic agents against rcc . It binds to dnmt1 messenger rna (mrna) preventing further processing of the mrna and reducing cellular levels of dnmt1 . One signaling pathway that has been implicated in the pathogenesis of rcc in recent studies is the wnt/-catenin pathway . Studies have shown that promoter hypermethylation of wnt antagonists results in carcinogenesis through dysregulation of cell proliferation and differentiation . Secreted - frizzled - related protein 2 (sfrp2) is a wnt antagonist that functions as a tumor suppressor gene . A recent study suggested that the use of 5-aza-2-deoxycyti - dine (dac), a dnmt inhibitor that restores sfrp2 expression, induces apoptosis in rcc cells . Histone modifications include acetylation (transcriptional activation), methylation (activation or repression) and phosphorylation (chromatin structure and function alteration). Aberrant activity of the enzymes implicated in these changes could lead to abnormal chromatin configuration and subsequent development of cancer . Histone deacetylase inhibitors are categorized based on their structure into hydroxamates (vorinostat), cyclic peptides (romidepsin), aliphatic acids (phenylbutyrate) and benzamides (entinostat). Several new agents are currently under development . A novel hdac inhibitor called obp-801, also known as ym753, was reported to induce apoptosis and inhibit cell growth of rcc cells when combined synergistically with the phosphatidylinositol 3-kinase (p13k) inhibitor ly294002, rendering this combination to be a promising treatment for rcc . Several therapeutic benefits of hdac inhibitors have been described in pre - clinical trials, but unfortunately, this has not translated into clinical trials to date . One reason could be the development of acquired resistance due to long - term drug treatment . A recent study showed how the prolonged use (12 weeks) of a hdac inhibitor (valproic acid) was associated with drug resistance when compared with a short 2 weeks treatment . They found that the chronic use of valproic acid enables the reactivation of akt, also known as protein kinase b, which may be involved in resistance development . The three main epigenetic mechanisms implicated in carcinogenesis include dna methylation, histone modifications and mirna regulations . Epigenetics has become an important topic in cancer research during the last decade, and its role in the diagnosis, prognosis and treatment of kidney malignancies appears to be a promising field . The clinical application of epigenetics has shown to have the potential to allow for early detection and prognostication in kidney cancer, as well as to provide tools for the introduction of newer therapeutic agents . The feasibility of epigenetic changes to be potentially reversed motivates researchers to continue pursuing these targets as treatment options for rcc and other malignancies.
|
Dystonia is a hyperkinetic movement disorder characterized by involuntary sustained muscle spasms causing in twisting movements and abnormal posturing of one or multiple body parts . With respect to the latter, dystonic syndromes can be divided into primary and secondary forms, dystonia - plus syndromes and heredodegenerative forms . While numerous authors have reviewed the primary dystonias1 in recent years, highlighting the proceedings into genetics and other aspects of the primary dystonias, less emphasis has been given to the secondary forms, albeit exigent . In this article we chose to focus on secondary dystonias, in particular, because their diagnosis can be challenging . Causes are multifold and include brain lesions of various nature, previous exposure to drugs (in particular dopamine antagonists) or toxins, metabolic conditions and neurodegeneration . Fortunately, combination of clinical features (syndromic associations) may serve as red flag towards certain syndromes and investigations may demonstrate characteristic findings which may confirm the diagnosis or be directive in the diagnostic process and facilitate making the correct diagnosis and thus allow initiating the ideal treatment . In this article we point out some clinical clues and syndromic associations which may be helpful in the approach to a patient . Prevalence data on secondary dystonia are limited . A brazilian study of 122 patients with a dystonic syndrome, 46 (38%) were found to have a symptomatic form.2 among these, the most frequent causes were tardive dystonia (35%) and perinatal cerebral injury (30%). Other causes included stroke (13%), encephalitis (6.5%) and wilson s disease (4%). Causes were more common in certain age groups: younger patients tended to have had perinatal cerebral injury or encephalitis preceeding their dystonia . In older patients stroke and exposure to drugs (tardive dystonia) were more common . In a recent study by wenning et al.3 of 16 elderly patients with dystonia, ten (62.5%) this is in line with a large study of more than 3,000 dystonia patients, 29% of which had a secondary form: tardive dystonia was the leading cause.4,5 however, in addition to tardive dystonia, there are a number of other secondary and heredodegenerative disorders which can cause dystonia as a predominant feature or as part of a syndrome . Certain clinical clues may help to narrow down the list of differential diagnoses and focus the investigations accordingly (table 1). Some primary dystonias there may have laryngeal involvement, for example dyt4 (whispering dystonia, the underlying gene remains unkown), dyt6 (due to mutations in the thap1 gene, as very recently identified), dyt12 (rapid - onset dystonia parkinsonism) and dyt17 (recessively inherited, linked to the chromosome 20, gene not yet identified) dystonia.68 however, overall, prominent oro - lingual - buccal dystonia is uncommon in primary dystonia and a secondary or heredodegenerative form should be considered,9 particularly, when severe (table 1). In particular pervious neuroleptic intake, but also certain genetic disorders such as pkan (pantothenate kinase associated neurodegeneration, previously known as hallervorden - spatz disease) due to mutations of the pank2 gene, neuroacanthocytosis, neuroferritinopathy and lesch - nyhan syndrome are high on the list of differentials.10 with the exception of neuroferritinopathy (autosomal dominant inheritance) they follow autosomal recessive inheritance and family history may thus be negative for a similar disorder, but there may be a history of consanguinity . Patients with primary dystonia have normal eye movements . In fact, presence of an eye movement disorder hints towards a secondary form of dystonia . Patients with a supranuclear gaze palsy may complain of difficulties going downstairs because of limited downward gaze which is usually more affected than upward gaze . Presence is limited to a few dystonic conditions, most importantly progressive supranuclear palsy (psp), where parkinsonism is the prominent and patients are elderly . Furthermore, supranuclear palsy may be present in niemann - pick type c and pkan, both inherited autosomal recessively . In niemann - pick type c, a neurovisceral lipid storage disorder, supranuclear gaze palsy is present in 75% of adult - onset cases and a presenting sign in 8% of cases.10 the presence of retinitis pigmentosa in the context of dystonia narrows down the list of differential diagnoses . Most important differential diagnoses in this context are pkan (or the allelic disorder referred to as harp syndrome characterized by hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration), gm2 gangliosidosis and metachromatic leukodystrophy . The combination of dystonia and deafness is characteristic of the mohr - tranebjaerg syndrome due to a new mutations in the ddp1 gene.11 other mitochondrial disorders may produce a complex phenotype which may involve additional visual problems (blindness) or heart problems.12 another complex disorder with phenotypic similarities to mitochondrial disease is the woodhouse - sakati syndrome . For this, only recently the underlying cause was identified and effects the c2orf37 gene, encoding a nucleolar protein.13 this rare autosomal recessive disorder presents with hypogonadism, alopecia, diabetes mellitus, mental retardation, and extrapyramidal features.14 as for other genetic disorders, there is phenotypic and genetic variability . Presence of neuropathy is not a feature of primary dystonia, although subclinical impairment of sensory discrimination is discussed as possible endophenotype of dystonia.15 if ataxia is additionally present, there are, however, a number of differentials to consider . This includes the common recessive forms of ataxia, such as friedreich s ataxia16 and ataxia telangiectasia17,18 and their differential diagnoses,19 where ataxia, dystonia and peripheral neuropathy may be present . For example, in a study of 70 ataxia telangiectasia patients, dystonia was present in 55 and peripheral neuropathy 50 of them.20 a less common cause is the young - onset variant of niemann - pick type c disease, while the adult form presents with peripheral nervous system involvement.11 because presence of vertical gaze palsy is also characteristic (see above) in niemann - pick type c, which is present in 7580% of patients, this can be a helpful clue towards the diagnosis . A further clue may be enlargement of the liver and spleen (present in about one 3090% of cases)11,21 and, in children, neonatal jaundice (present in half of the patients). Notably, the combination of dystonia with neuropathy and ataxia can also be seen in some of the autosomal dominant spinocerebellar ataxias,22 e.g. Sca 3.23 finally, the combination of peripheral neuropathy, progressive dystonia and ataxia, as well as cognitive decline is seen in metachromatic leukodystrophy caused by mutations in the arylsulfatase a gene cause.24 in addition to pure dystonic and pure parkinsonian syndromes, there are overlap syndromes . On one hand dystonic conditions may have superimposed parkinsonism as seen in dopa - responsive dystonia or wilson s disease . On the other hand, dystonia may be a seen in (or even be the presenting feature of) various parkinsonian disorders . While dystonia is uncommon in drug - naive patients with idiopathic parkinson s disease, its presence may be a red flag towards an atypical parkinsonian syndrome like psp, multiple system atrophy (msa) or corticobasal degeneration (cbd).25 dystonia may then present as axial dystonia and blepharospasm (levator inhibition) causing the starring expression associated with psp; antecollis and facial dystonia in msa; or the dystonic arm posture seen in cbd . Parkinsonism associated with dystonia is furthermore characteristic of genetic forms of parkinsonism which often have young - onset and recessive inheritance (for review see).26,27 one example is parkinsonism related to mutations in the parkin gene where dystonia may be present intermittently, as so - called exercise - induced paroxysmal foot dystonia, and this may precede signs of parkinsonism by some years.28 the combination of young - onset dystonia and parkinsonism is also seen in other neurodegenerative diseases like the rare autosomal recessive disorders of nigro - striatal - pallidal - pyramidal syndrome referred to as kufor - rakeb disease and pla2g6-associated neurodegeneration (park14).29 (also see review by schneider, et al.26) most frequent, however, is dystonia in the context of parkinsonism as complication of dopaminergic treatment, for example as peak - dose dystonia, diphasic dystonia and offdystonia.28 progressive dementia is not a feature of the primary dystonias like the young - onset dyt1-related dystonia or the adult - onset sporadic forms . Progressive dementia is, however, one of the core features of huntington s disease and the huntington disease - look like syndromes (including hdl4/sca17), as well as neuroacanthocytosis and pkan . Indeed, chorea is the main movement disorder, however, prominent dystonia can occur . A further condition to consider is creutzfeldt - jakob disease, a rare neurodegenerative disease characterized by rapidly progressive dementia, mutism, ataxia and extrapyramidal and pyramidal involvement.30 the movement disorder is typically characterized by focal or generalized myoclonus (present in 80100% of cases), but dystonia occurs and may rarely be a presenting sign.3032 dystonia in creutzfeldt - jakob disease is then usually unilateral and distally but may become generalized in later disease stages.30 over all, disease course is rather progressive and this should alert the clinician to this diagnosis . Furthermore, hiv encephalopathy is a cause of dementia; and dystonia has also been observed.33 finally, dementia may also be a symptom in the complex autosomal recessive dystonia parkinsonian syndromes mentioned above.26 neuroimaging can reveal patterns characteristic of certain conditions . Strategic lesions in the basal ganglia, brainstem, cerebellum or cortical areas (parietal and frontal) may result in dystonia3441 and there may be a relationship between the distribution of dystonia and the localization of the lesion . For example, it has been proposed that thalamic lesions are more likely to result in hand dystonia . However, not all basal ganglia lesions necessarily result in neurological symptoms or signs . Brainstem lesions on the other hand have been associated with cranial dystonias such as blepharospasm, and putaminal lesions were found in patients with hemidystonia or limb dystonia . In hemidystonia, lesions are often unilateral, contralaterally to the dystonia . Of course, the list of causes underlying the lesion is long and includes tumors, trauma, bleeding, inflammation, atrophic changes in the context of neurodegeneration or accumulation of metals (such as iron, copper, manganese etc . ). How imaging can facilitate the diagnostic work - up we will be discussed in more detail as an example for basal ganglia disorders with metal deposition . The basal ganglia host high concentrations of metals which act as cofactors for metabolic activity including iron, copper and manganese . In the case of excessive metal accumulation, metal deposition can be detected by neuroimaging on ct (e.g. Copper) or mri (e.g. Iron). In recent years, in particular, iron deposition has received growing attention and a new term referring to these disorders, syndromes of neurodegeneration with brain iron accumulation (nbia), has been coined . This group entails the condition of pkan (nbia type 1, also known as hallervorden - spatz disease), pla2g6-associated neurodegeneration (nbia type 2),29 neuroferritinopathy, and aceruloplasminemia.42,43 of these, in pkan iron accumulates within the globus pallidus interna . T2-weighted mri demonstrates a signal hypointensity representing iron with a central hyperintensity (probably representing fluid accumulation or edema) and this pattern resembles an eye of the tiger on axial slides.42 it has been proposed that this eye - of - the - tiger sign highly correlates with the genoptype, thus with presence of pank2 gene mutations,42,44 and that it is usually present from early in the disease course,45 although this is still matter of debate . Nbia type 2 is associated with mutations in the pla2g6 gene on chromosome 22q13, a calcium - independent phospholipase . The clinical phenotype is heterogenous and includes infantile neuroaxonal dystrophy and adolesecence-/adult - onset dystonia parkinsonism, and it is a key differential diagnosis of pkan . As in pkan there is iron deposition on mri imaging, however there is no classical eye - of - the - tiger sign, but there is only a hypointensity in the globus pallidus, whereas the central hyperintensity is lacking . Notably, though, normal mri imaging has also been reported in a gene - proven case of pla2g6-associated neurodegeneration and the disorder should thus also be considered when iron is absent.29 copper deposition also shows as hyperintense signal on t2-weighted scans . Copper deposition in the putamen and globus pallidus, liver and cornea are characteristic of wilson s disease, an important differential diagnosis of secondary dystonia, particularly in young patients.46,47 this is known as face of the giant panda sign (referring to the combination of high signal intensity in the tegmentum except for the red nucleus with preservation of signal intensity of the lateral portion of the pars reticulata of the substantia nigra and hypointensity of the superior colliculus).48 manganese accumulation has been associated with secondary parkinsonism in welders chronically exposed . In the basal ganglia manganese accumulates symmetrically within the globus pallidum and is depicted as hyperintensity on t1 sequences . Dystonia may also be prominent.4952 calcium deposition can be easily detected by ct imaging as high - intense lesions and incidental calcifications are relatively frequent (up to 1.5% of ct scans). Within the basal ganglia, calcium mostly commonly affects the globus pallidus and is usually benign, in most cases idiopathic or age - related.53 in view of this, it has been proposed that presence of globus pallidus calcifications only requires further elaboration when the patient is younger than 40 years of age . In addition all patients, no matter of age, where other basal ganglia or brain areas are affected should be further investigated . The differential diagnosis is wide and includes metabolic, infectious, toxin - induced and degenerative causes.53 among the metabolic disorders, idiopathic or surgical hypoparathyroidism is probably the most common cause of symmetric basal ganglia calcification, and dystonia as presenting feature may occur.54 infections (including congenital forms) by toxplasmosis, rubella, cytmomegaly, herpes and hiv may result in basal ganglia damage with calcifications and secondary dystonia.55,56 following carbon monoxide poisoning movement disorders including dystonia may develop as a part of delayed encephalopathy57 and imaging may reveal basal ganglia calcifications.58 neurodegenerative causes include wilson s disease.59 last but not least, familial causes of basal ganglia calcifications have been recognized, also referred to as striopallidodentate calcinosis or fahr s disease and dystonia has been observed.59 prevalence data on secondary dystonia are limited . A brazilian study of 122 patients with a dystonic syndrome, 46 (38%) were found to have a symptomatic form.2 among these, the most frequent causes were tardive dystonia (35%) and perinatal cerebral injury (30%). Other causes included stroke (13%), encephalitis (6.5%) and wilson s disease (4%). Causes were more common in certain age groups: younger patients tended to have had perinatal cerebral injury or encephalitis preceeding their dystonia . In older patients stroke and exposure to drugs (tardive dystonia) were more common . In a recent study by wenning et al.3 of 16 elderly patients with dystonia, ten (62.5%) this is in line with a large study of more than 3,000 dystonia patients, 29% of which had a secondary form: tardive dystonia was the leading cause.4,5 however, in addition to tardive dystonia, there are a number of other secondary and heredodegenerative disorders which can cause dystonia as a predominant feature or as part of a syndrome . Certain clinical clues may help to narrow down the list of differential diagnoses and focus the investigations accordingly (table 1). Some primary dystonias there may have laryngeal involvement, for example dyt4 (whispering dystonia, the underlying gene remains unkown), dyt6 (due to mutations in the thap1 gene, as very recently identified), dyt12 (rapid - onset dystonia parkinsonism) and dyt17 (recessively inherited, linked to the chromosome 20, gene not yet identified) dystonia.68 however, overall, prominent oro - lingual - buccal dystonia is uncommon in primary dystonia and a secondary or heredodegenerative form should be considered,9 particularly, when severe (table 1). In particular pervious neuroleptic intake, but also certain genetic disorders such as pkan (pantothenate kinase associated neurodegeneration, previously known as hallervorden - spatz disease) due to mutations of the pank2 gene, neuroacanthocytosis, neuroferritinopathy and lesch - nyhan syndrome are high on the list of differentials.10 with the exception of neuroferritinopathy (autosomal dominant inheritance) they follow autosomal recessive inheritance and family history may thus be negative for a similar disorder, but there may be a history of consanguinity . In fact, presence of an eye movement disorder hints towards a secondary form of dystonia . Eye movement dysfunction may be in the form of supra - nuclear gaze palsy . Patients with a supranuclear gaze palsy may complain of difficulties going downstairs because of limited downward gaze which is usually more affected than upward gaze . Presence is limited to a few dystonic conditions, most importantly progressive supranuclear palsy (psp), where parkinsonism is the prominent and patients are elderly . Furthermore, supranuclear palsy may be present in niemann - pick type c and pkan, both inherited autosomal recessively . In niemann - pick type c, a neurovisceral lipid storage disorder, supranuclear gaze palsy is present in 75% of adult - onset cases and a presenting sign in 8% of cases.10 the presence of retinitis pigmentosa in the context of dystonia narrows down the list of differential diagnoses . Most important differential diagnoses in this context are pkan (or the allelic disorder referred to as harp syndrome characterized by hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration), gm2 gangliosidosis and metachromatic leukodystrophy . The combination of dystonia and deafness is characteristic of the mohr - tranebjaerg syndrome due to a new mutations in the ddp1 gene.11 other mitochondrial disorders may produce a complex phenotype which may involve additional visual problems (blindness) or heart problems.12 another complex disorder with phenotypic similarities to mitochondrial disease is the woodhouse - sakati syndrome . For this, only recently the underlying cause was identified and effects the c2orf37 gene, encoding a nucleolar protein.13 this rare autosomal recessive disorder presents with hypogonadism, alopecia, diabetes mellitus, mental retardation, and extrapyramidal features.14 as for other genetic disorders, there is phenotypic and genetic variability . Presence of neuropathy is not a feature of primary dystonia, although subclinical impairment of sensory discrimination is discussed as possible endophenotype of dystonia.15 if ataxia is additionally present, there are, however, a number of differentials to consider . This includes the common recessive forms of ataxia, such as friedreich s ataxia16 and ataxia telangiectasia17,18 and their differential diagnoses,19 where ataxia, dystonia and peripheral neuropathy may be present . For example, in a study of 70 ataxia telangiectasia patients, dystonia was present in 55 and peripheral neuropathy 50 of them.20 a less common cause is the young - onset variant of niemann - pick type c disease, while the adult form presents with peripheral nervous system involvement.11 because presence of vertical gaze palsy is also characteristic (see above) in niemann - pick type c, which is present in 7580% of patients, this can be a helpful clue towards the diagnosis . A further clue may be enlargement of the liver and spleen (present in about one 3090% of cases)11,21 and, in children, neonatal jaundice (present in half of the patients). Notably, the combination of dystonia with neuropathy and ataxia can also be seen in some of the autosomal dominant spinocerebellar ataxias,22 e.g. Sca 3.23 finally, the combination of peripheral neuropathy, progressive dystonia and ataxia, as well as cognitive decline is seen in metachromatic leukodystrophy caused by mutations in the arylsulfatase a gene cause.24 in addition to pure dystonic and pure parkinsonian syndromes, there are overlap syndromes . On one hand dystonic conditions may have superimposed parkinsonism as seen in dopa - responsive dystonia or wilson s disease . On the other hand, dystonia may be a seen in (or even be the presenting feature of) various parkinsonian disorders . While dystonia is uncommon in drug - naive patients with idiopathic parkinson s disease, its presence may be a red flag towards an atypical parkinsonian syndrome like psp, multiple system atrophy (msa) or corticobasal degeneration (cbd).25 dystonia may then present as axial dystonia and blepharospasm (levator inhibition) causing the starring expression associated with psp; antecollis and facial dystonia in msa; or the dystonic arm posture seen in cbd . Parkinsonism associated with dystonia is furthermore characteristic of genetic forms of parkinsonism which often have young - onset and recessive inheritance (for review see).26,27 one example is parkinsonism related to mutations in the parkin gene where dystonia may be present intermittently, as so - called exercise - induced paroxysmal foot dystonia, and this may precede signs of parkinsonism by some years.28 the combination of young - onset dystonia and parkinsonism is also seen in other neurodegenerative diseases like the rare autosomal recessive disorders of nigro - striatal - pallidal - pyramidal syndrome referred to as kufor - rakeb disease and pla2g6-associated neurodegeneration (park14).29 (also see review by schneider, et al.26) most frequent, however, is dystonia in the context of parkinsonism as complication of dopaminergic treatment, for example as peak - dose dystonia, diphasic dystonia and offdystonia.28 progressive dementia is not a feature of the primary dystonias like the young - onset dyt1-related dystonia or the adult - onset sporadic forms . Progressive dementia is, however, one of the core features of huntington s disease and the huntington disease - look like syndromes (including hdl4/sca17), as well as neuroacanthocytosis and pkan . Indeed, chorea is the main movement disorder, however, prominent dystonia can occur . A further condition to consider is creutzfeldt - jakob disease, a rare neurodegenerative disease characterized by rapidly progressive dementia, mutism, ataxia and extrapyramidal and pyramidal involvement.30 the movement disorder is typically characterized by focal or generalized myoclonus (present in 80100% of cases), but dystonia occurs and may rarely be a presenting sign.3032 dystonia in creutzfeldt - jakob disease is then usually unilateral and distally but may become generalized in later disease stages.30 over all, disease course is rather progressive and this should alert the clinician to this diagnosis . Furthermore, hiv encephalopathy is a cause of dementia; and dystonia has also been observed.33 finally, dementia may also be a symptom in the complex autosomal recessive dystonia parkinsonian syndromes mentioned above.26 some primary dystonias there may have laryngeal involvement, for example dyt4 (whispering dystonia, the underlying gene remains unkown), dyt6 (due to mutations in the thap1 gene, as very recently identified), dyt12 (rapid - onset dystonia parkinsonism) and dyt17 (recessively inherited, linked to the chromosome 20, gene not yet identified) dystonia.68 however, overall, prominent oro - lingual - buccal dystonia is uncommon in primary dystonia and a secondary or heredodegenerative form should be considered,9 particularly, when severe (table 1). In particular pervious neuroleptic intake, but also certain genetic disorders such as pkan (pantothenate kinase associated neurodegeneration, previously known as hallervorden - spatz disease) due to mutations of the pank2 gene, neuroacanthocytosis, neuroferritinopathy and lesch - nyhan syndrome are high on the list of differentials.10 with the exception of neuroferritinopathy (autosomal dominant inheritance) they follow autosomal recessive inheritance and family history may thus be negative for a similar disorder, but there may be a history of consanguinity . In fact, presence of an eye movement disorder hints towards a secondary form of dystonia . Patients with a supranuclear gaze palsy may complain of difficulties going downstairs because of limited downward gaze which is usually more affected than upward gaze . Presence is limited to a few dystonic conditions, most importantly progressive supranuclear palsy (psp), where parkinsonism is the prominent and patients are elderly . Furthermore, supranuclear palsy may be present in niemann - pick type c and pkan, both inherited autosomal recessively . In niemann - pick type c, a neurovisceral lipid storage disorder, supranuclear gaze palsy is present in 75% of adult - onset cases and a presenting sign in 8% of cases.10 the presence of retinitis pigmentosa in the context of dystonia narrows down the list of differential diagnoses . Most important differential diagnoses in this context are pkan (or the allelic disorder referred to as harp syndrome characterized by hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration), gm2 gangliosidosis and metachromatic leukodystrophy . The combination of dystonia and deafness is characteristic of the mohr - tranebjaerg syndrome due to a new mutations in the ddp1 gene.11 other mitochondrial disorders may produce a complex phenotype which may involve additional visual problems (blindness) or heart problems.12 another complex disorder with phenotypic similarities to mitochondrial disease is the woodhouse - sakati syndrome . For this, only recently the underlying cause was identified and effects the c2orf37 gene, encoding a nucleolar protein.13 this rare autosomal recessive disorder presents with hypogonadism, alopecia, diabetes mellitus, mental retardation, and extrapyramidal features.14 as for other genetic disorders, there is phenotypic and genetic variability . Presence of neuropathy is not a feature of primary dystonia, although subclinical impairment of sensory discrimination is discussed as possible endophenotype of dystonia.15 if ataxia is additionally present, there are, however, a number of differentials to consider . This includes the common recessive forms of ataxia, such as friedreich s ataxia16 and ataxia telangiectasia17,18 and their differential diagnoses,19 where ataxia, dystonia and peripheral neuropathy may be present . For example, in a study of 70 ataxia telangiectasia patients, dystonia was present in 55 and peripheral neuropathy 50 of them.20 a less common cause is the young - onset variant of niemann - pick type c disease, while the adult form presents with peripheral nervous system involvement.11 because presence of vertical gaze palsy is also characteristic (see above) in niemann - pick type c, which is present in 7580% of patients, this can be a helpful clue towards the diagnosis . A further clue may be enlargement of the liver and spleen (present in about one 3090% of cases)11,21 and, in children, neonatal jaundice (present in half of the patients). Notably, the combination of dystonia with neuropathy and ataxia can also be seen in some of the autosomal dominant spinocerebellar ataxias,22 e.g. Sca 3.23 finally, the combination of peripheral neuropathy, progressive dystonia and ataxia, as well as cognitive decline is seen in metachromatic leukodystrophy caused by mutations in the arylsulfatase a gene cause.24 in addition to pure dystonic and pure parkinsonian syndromes, there are overlap syndromes . On one hand dystonic conditions may have superimposed parkinsonism as seen in dopa - responsive dystonia or wilson s disease . On the other hand, dystonia may be a seen in (or even be the presenting feature of) various parkinsonian disorders . While dystonia is uncommon in drug - naive patients with idiopathic parkinson s disease, its presence may be a red flag towards an atypical parkinsonian syndrome like psp, multiple system atrophy (msa) or corticobasal degeneration (cbd).25 dystonia may then present as axial dystonia and blepharospasm (levator inhibition) causing the starring expression associated with psp; antecollis and facial dystonia in msa; or the dystonic arm posture seen in cbd . Parkinsonism associated with dystonia is furthermore characteristic of genetic forms of parkinsonism which often have young - onset and recessive inheritance (for review see).26,27 one example is parkinsonism related to mutations in the parkin gene where dystonia may be present intermittently, as so - called exercise - induced paroxysmal foot dystonia, and this may precede signs of parkinsonism by some years.28 the combination of young - onset dystonia and parkinsonism is also seen in other neurodegenerative diseases like the rare autosomal recessive disorders of nigro - striatal - pallidal - pyramidal syndrome referred to as kufor - rakeb disease and pla2g6-associated neurodegeneration (park14).29 (also see review by schneider, et al.26) most frequent, however, is dystonia in the context of parkinsonism as complication of dopaminergic treatment, for example as peak - dose dystonia, diphasic dystonia and offdystonia.28 progressive dementia is not a feature of the primary dystonias like the young - onset dyt1-related dystonia or the adult - onset sporadic forms . Progressive dementia is, however, one of the core features of huntington s disease and the huntington disease - look like syndromes (including hdl4/sca17), as well as neuroacanthocytosis and pkan . Indeed, chorea is the main movement disorder, however, prominent dystonia can occur . A further condition to consider is creutzfeldt - jakob disease, a rare neurodegenerative disease characterized by rapidly progressive dementia, mutism, ataxia and extrapyramidal and pyramidal involvement.30 the movement disorder is typically characterized by focal or generalized myoclonus (present in 80100% of cases), but dystonia occurs and may rarely be a presenting sign.3032 dystonia in creutzfeldt - jakob disease is then usually unilateral and distally but may become generalized in later disease stages.30 over all, disease course is rather progressive and this should alert the clinician to this diagnosis . Furthermore, hiv encephalopathy is a cause of dementia; and dystonia has also been observed.33 finally, dementia may also be a symptom in the complex autosomal recessive dystonia parkinsonian syndromes mentioned above.26 strategic lesions in the basal ganglia, brainstem, cerebellum or cortical areas (parietal and frontal) may result in dystonia3441 and there may be a relationship between the distribution of dystonia and the localization of the lesion . For example, it has been proposed that thalamic lesions are more likely to result in hand dystonia . However, not all basal ganglia lesions necessarily result in neurological symptoms or signs . Brainstem lesions on the other hand have been associated with cranial dystonias such as blepharospasm, and putaminal lesions were found in patients with hemidystonia or limb dystonia . In hemidystonia, lesions are often unilateral, contralaterally to the dystonia . Of course, the list of causes underlying the lesion is long and includes tumors, trauma, bleeding, inflammation, atrophic changes in the context of neurodegeneration or accumulation of metals (such as iron, copper, manganese etc . ). How imaging can facilitate the diagnostic work - up we will be discussed in more detail as an example for basal ganglia disorders with metal deposition . The basal ganglia host high concentrations of metals which act as cofactors for metabolic activity including iron, copper and manganese . In the case of excessive metal accumulation, metal deposition can be detected by neuroimaging on ct (e.g. Copper) or mri (e.g. Iron). In recent years, in particular, iron deposition has received growing attention and a new term referring to these disorders, syndromes of neurodegeneration with brain iron accumulation (nbia), has been coined . This group entails the condition of pkan (nbia type 1, also known as hallervorden - spatz disease), pla2g6-associated neurodegeneration (nbia type 2),29 neuroferritinopathy, and aceruloplasminemia.42,43 of these, in pkan iron accumulates within the globus pallidus interna . T2-weighted mri demonstrates a signal hypointensity representing iron with a central hyperintensity (probably representing fluid accumulation or edema) and this pattern resembles an eye of the tiger on axial slides.42 it has been proposed that this eye - of - the - tiger sign highly correlates with the genoptype, thus with presence of pank2 gene mutations,42,44 and that it is usually present from early in the disease course,45 although this is still matter of debate . Nbia type 2 is associated with mutations in the pla2g6 gene on chromosome 22q13, a calcium - independent phospholipase . The clinical phenotype is heterogenous and includes infantile neuroaxonal dystrophy and adolesecence-/adult - onset dystonia parkinsonism, and it is a key differential diagnosis of pkan . As in pkan there is iron deposition on mri imaging, however there is no classical eye - of - the - tiger sign, but there is only a hypointensity in the globus pallidus, whereas the central hyperintensity is lacking . Notably, though, normal mri imaging has also been reported in a gene - proven case of pla2g6-associated neurodegeneration and the disorder should thus also be considered when iron is absent.29 copper deposition also shows as hyperintense signal on t2-weighted scans . Copper deposition in the putamen and globus pallidus, liver and cornea are characteristic of wilson s disease, an important differential diagnosis of secondary dystonia, particularly in young patients.46,47 this is known as face of the giant panda sign (referring to the combination of high signal intensity in the tegmentum except for the red nucleus with preservation of signal intensity of the lateral portion of the pars reticulata of the substantia nigra and hypointensity of the superior colliculus).48 manganese accumulation has been associated with secondary parkinsonism in welders chronically exposed . In the basal ganglia manganese dystonia may also be prominent.4952 calcium deposition can be easily detected by ct imaging as high - intense lesions and incidental calcifications are relatively frequent (up to 1.5% of ct scans). Within the basal ganglia, calcium mostly commonly affects the globus pallidus and is usually benign, in most cases idiopathic or age - related.53 in view of this, it has been proposed that presence of globus pallidus calcifications only requires further elaboration when the patient is younger than 40 years of age . In addition all patients, no matter of age, where other basal ganglia or brain areas are affected should be further investigated . The differential diagnosis is wide and includes metabolic, infectious, toxin - induced and degenerative causes.53 among the metabolic disorders, idiopathic or surgical hypoparathyroidism is probably the most common cause of symmetric basal ganglia calcification, and dystonia as presenting feature may occur.54 infections (including congenital forms) by toxplasmosis, rubella, cytmomegaly, herpes and hiv may result in basal ganglia damage with calcifications and secondary dystonia.55,56 following carbon monoxide poisoning movement disorders including dystonia may develop as a part of delayed encephalopathy57 and imaging may reveal basal ganglia calcifications.58 neurodegenerative causes include wilson s disease.59 last but not least, familial causes of basal ganglia calcifications have been recognized, also referred to as striopallidodentate calcinosis or fahr s disease and dystonia has been observed.59 while presence of tremor is compatible with a diagnosis of primary dystonia, there are other clinical features which point away from this diagnosis, including eye movement disorders, retinitis pigmentosa or peripheral neuropathy, to name a few . In these cases syndromic associations, some of which have been outlined in this article, can be useful and help the clinician to narrow down the list of differential diagnosis . Investigations such as a peripheral blood smear to screen for neuroacathocytosis or neuroimaging may help to reach at the correct diagnosis.
|
Dna single strands can hybridize to form higher - order functional structures, which include hairpins, triplexes, and quadruplexes [14]. The existence and physiological relevance of these secondary structures in vivo have been the subject of much controversy . However, several in vivo techniques have confirmed the presence of dna secondary structures in telomeres and regulatory regions of specific genes (e.g., bcl-2, c - myc) [58]. Secondary structures may also serve as specific targets recognized by drugs, such as actinomycin d and piper, as well as transcription factors, such as sp1, because of their topological variance from duplex watson - crick dna [9, 10]. On account of their occurrence in regulatory regions and their structural peculiarity, functional dna structures may serve as biological microswitches for altering transcription by silencing or enhancing gene expression [11, 12]. Exercising control over gene expression by controlling the activation of these switches and/or introducing new switches in biological circuits could revolutionize medical research and offer new avenues of treating genetic disorders . For exercising such control, it is imperative to understand the factors affecting the mechanism of formation and maintenance of functional structures at a fundamental level . Numerous fluorescent analogs of dna bases have been evaluated for examining the subtleties of dna transitions [1315]. Locating an appropriate probe that could map the mechanistic aspects of transition of double stranded (ds) dna to single stranded (ss) secondary structure is a first step toward monitoring the formation of complex, higher - order structures since ssdna is an intermediate in the pathway to functional structures . In the following report, we present a comparative study of two deoxycytidine analogs, pdc and tc (figure 1), to evaluate their suitability as fluorescent reporter probes for dna transitions . The properties of pyrrolocytosine and the effects of base stacking and hydrogen bonding on its quantum yield in nucleic acids have been previously evaluated . Based on this prior work, we reported the use of pdc to determine hairpin formation in short oligos (16 nucleotides). This result implied that pdc might be a useful probe for investigating more complex dna functional structures in detail . However, to overcome certain limitations of pdc, we also explored another recently characterized fluorescent base analog, tc. The tc has a quantum yield five - times greater than pdc (qf = 0.30 for tc) and a molar absorptivity maximum of 9000 m cm at 360 nm . The absorbance wavelength of tc is similar to pdc, which allows both to be easily distinguishable from dna . Both of these fluorophores have been reported to be quenched, relative to the single strand, when base - paired with guanine, making it easy to determine when the dna is in the duplex form [17, 19]. In addition, unlike pdc, tc has only minor variations in fluorescent properties caused by surrounding bases . However, like pdc, tc induces little or no changes in stability upon incorporation into dsdna . High quantum yield, retention of the original configuration of dna, and quenching when base - paired suggested that tc would be a useful fluorescent probe for mapping the transition of duplex dna to a functional dna structure spectroscopically . In this paper, we compare spectral properties of tc and pdc for use as reporters of dna conformation . The dna sequence used (table 1) is known to form a cruciform structure in the cloning vector pbr322 under superhelical duress [21, 22]. This sequence was chosen since the results from the work described here will provide a context for interpreting data in future studies of the pdc and tc incorporated into this supercoiled plasmid . Hence the effect of supercoiling on functional structure formation and conformation can be potentially probed with these fluorescent bases . All dna oligonucleotides (sequences shown in table 1), including those incorporating pdc and tc, were obtained from midland certified reagent co. (midland, tx, usa). All oligos were dissolved in te buffer (10 mm tris, 1 mm edta, ph 8) made from spectroscopic - grade reagents obtained from fisher scientific . Purity of each oligo was assessed using agarose gels, which showed no other higher or lower molecular weight contaminations . Cd and fdcd experiments were performed using a circular dichroism instrument (model 202sf, aviv biomedical inc . Lakewood, nj, usa) and fluorescence lifetime measurements were conducted on a multifrequency cross - correlation phase and modulation fluorometer (model k2, iss inc ., champaign, il, usa). After ensuring the purity of the single - strand pdc, tc, and wildtype (sspdc, sstc, and sswt; the wt contains no fluorophore) oligos, each was mixed with a slight molar excess of their complementary strand . This was heated to 80c for 20 minutes, and then cooled to room temperature to anneal strands . The double - strand oligo formation was confirmed by observing the difference in migration of ds- and ss - oligos on agarose gels and compared to a dna ladder of the known length . In addition, duplex was the only strand observed after staining with the sybr gold, which stains both ss- and dsdna . Cd spectra were recorded using a quartz cuvette having an optical path length of 1 cm . All oligos analyzed were in 700 l volume at concentration of 0.35 m . Wild - type oligos were analyzed to ensure that the signals were not modified by the fluorophores . Each data point was averaged over an integration time of 1 s per nm . Cd signals were collected from 25c to 90c over the range of 220 nm to 420 nm to check for any change in the global conformation of the single - stranded and double - stranded wt, pdc, and tc oligos . While performing cd scans, the total uv absorbance of each oligo was also collected . Oligos analyzed were in a total volume of 70 l and at the concentration of 8.5 m . Each fdcd scan was averaged over 15 seconds per nm in order to increase signal - to - noise ratio . The excitation wavelengths were from 300 nm to 420 nm at temperatures ranging from 25c to 90c . Steady - state fluorescence spectra were analyzed for ss- and ds- (wt, pdc, and tc) oligos . All the oligos had concentration of 0.35 m in te buffer (10 mm tris, 1 mm edta, ph 8). Excitation scans were collected over the wavelength range of 220400 nm, with the emission wavelength fixed at 450 nm . Emission spectra were taken over the wavelength ranging from 400 nm to 580 nm with the excitation wavelength fixed at 350 nm . The ss- and dswt oligos were used as a baseline signal and subtracted from the steady - state fluorescence data . Fluorescence lifetime was measured for both ss- and ds - oligos using a frequency domain lifetime instrument . Excitation wavelengths were 350 nm and 368 nm for pdc and tc, respectively . Data were collected from 10240 mhz frequencies with 100 iterations at each frequency and 40 total frequencies from which the lifetimes were calculated . Both the individual decays (fitted to 2 components) and average lifetimes are reported . In order to assure that no structural perturbations were introduced by insertion of the fluorophores in the oligos, changes in absorbance at 260 nm were monitored at varying temperatures to determine duplex melting temperatures as well as any transitions occurring in ssdna (data not shown). The data indicated that the sswt, sspdc, and sstc undergo similar spectral changes with temperature, indicating no perturbations to the ss - structures after replacement of cytidine with pdc or tc. The absorbance for all ssdna increases by ~10% from 25c to 40c, signifying reorientation of the strands during melting . Thus, introduction of either pdc or tc did not lead to the formation of any additional secondary conformation in ss - oligos as predicted based on the previous literature [17, 19]. Hence, pdc and/or tc could be used to investigate single- and double - stranded regions of dna functional structures . Circular dichroism (cd) spectroscopy was also used to investigate whether the overall helical structural conformation of the dna might have been affected by the fluorophores (figure 2). Our results, in agreement with melting data from absorbance and the literature, indicated that the fluorophores did not affect the structure of the duplexes or the manner in which they melted [17, 23, 24]. There were only negligibly small changes in the cd spectrum with temperature for ss - oligos, which indicated little structure at any temperature as compared to dsdna . The dsdna oligos showed considerable cd, consistent with the common global spectral features typical of b - dna . Major changes in the cd signal of dsdna with respect to the temperature were observed at 245 nm, with relatively smaller changes that occurred at 280 nm . These cd spectra and their temperature dependence illustrated that the dna is not affected by replacing cytidine with pdc or tc. Circular dichroism has been used for detecting the local environmental changes around pdc integrated into dna . However, the direct detection of cd by pdc or other base analogs is restricted to analogs that either have an absorbance far enough removed from the dna max of 260 nm to prevent spectral overlap or are incorporated into short dna sequences . In both cases, an alternative approach to direct cd observation is to use fdcd to study the local environment of the fluorescent base analog . Since our previous data has sufficiently demonstrated that the replacement of deoxycytidine with either pdc or tc does not affect the original dna structure, we analyzed the fluorophores by fdcd to explore the local structural changes occurring around the base . In our studies, pdc - containing dna at concentrations up to 8.5 m did not show any fdcd signal over the temperature range of 25c to 90c, suggesting that pdc's low quantum yield is insufficient for fdcd measurements at reasonable dna concentrations with our instrument . However, tc showed a strong fdcd signal for both ss- and dsdna between 300 nm and 420 nm even at submicromolar concentrations (0.5 m; figure 3). The fdcd signal for duplex dna was significantly larger than that for the ss oligo . In addition it had a positive value throughout, indicating the base was stacked parallel to the bases in the vicinity . The lower intensity of the peak in ss - oligos is attributed to the residual structure at room temperature . Thus, tc is a very effective probe for monitoring the localized changes occurring in dna structure in response to variations in structural parameters . Fdcd data obtained can be used for predicting the molecular details of higher - order secondary structures . For example, in case of loop regions of i - motif and cruciform structures, tc will exhibit lower fdcd signal since these regions are less structured . However, tc substituting for dc in the regions where base - pairing occurs should show higher fdcd signals . These structural details could then be used to assess the stabilities of functional dna structures after binding of transcription factors or drugs . Fluorescence intensities of pdc and tc depend on their hydrogen bonding state, and decrease if the fluorophores are base - paired [17, 19]. Figure 4 clearly demonstrate this quenching of fluorescence for both pdc and tc in duplex dsdna versus unpaired ssdna . Fluorescence intensities from ssdna to dsdna are lowered by approximately 60% and 40% for pdc and tc, respectively . Figure 4 also shows the difference in the quantum yield of pdc and tc, with pdc exhibiting significantly lower fluorescence . Both the fluorophores had an excitation maximum at 350 nm and an emission maximum of 450 nm that did not change in ssdna versus dsdna . These decreases in the fluorescence and the location of the maxima are consistent with the known literature [8, 19]. Like steady - state intensities, fluorescence lifetimes of pdc and tc decrease when they are paired to their complementary base [17, 19]. Since fluorescence lifetimes are independent of concentration, their decrease has the potential to be used for differentiating paired bases from unpaired, thus they can be used for deductively mapping functional dna structures . Two lifetimes (1, 2) were fit to the phase - modulation data . The weighted average of the two lifetimes, 1 and 2, were calculated and reported as in table 2 . These weighted averages indicate that the lifetimes for tc decreased slightly (0.3 ns) with respect to the strandedness . In contrast, pdc showed appreciable difference (1.9 ns) between single and duplex oligos . These lifetime values are similar to those previously reported [17, 19]. To unambiguously differentiate between the ss- and ds regions of the secondary structures, thus, the lifetime data indicates that pdc is a better choice than tc for assessing the strand base - pairing in dna via this methodology . Similar to fdcd, lifetime measurements can facilitate the studies to observe differences between ss loop regions and ds regions in functional dna structures like i - motif and cruciforms, and hence aid the studies to investigate formation and stability of secondary structures . In this report, spectroscopic techniques were used to determine the appropriate fluorescent deoxycytidine analog for probing the transition of duplex dna into topologically distinct functional nucleic acid structures . Rather, we suggest the two should be used in conjunction to obtain an overall description of changes to nucleic acid structure . While tc has a very good quantum yield that allows for fdcd analysis, it exhibits only minor changes in fluorescence lifetime between ss- or dsdna . Pdc, on the other hand, undergoes a substantial decrease in the fluorescence lifetime when base - paired, but shows no fdcd signal at concentrations appropriate for most biochemical studies . Hence, we conclude that to map the transition of duplex dna to other functional forms, both pdc and tc at concentrations up to 8.5 m can be used, depending on the structural information desired . We are now investigating spectral changes incurred by these probes, when they are contained within well - known functional dna structures, such as quadruplex and i - motif dna.
|
The regulation of gene expression is mainly conferred by transcription factors (tfs) that bind to cis - regulatory sequences . These sequences can be used to generate hypothesis about tf that may be involved in the regulation of nearby genes (1,2). In arabidopsis thaliana, more than 1500 tfs corresponding to 5% of the total genes have been identified (3). The largest families are myb and myb - related (190 members), ap2/erebp (144), bhlh (139), nac (109), c2h2(zn) (105), hd (89), mads (82), bzip (81) and wrky (72). Since the complete sequence of the a.thaliana genome has been published (4), it was desirable to have a map of transcription factor binding sites (tfbss) for the whole genome . The non - restrictive nature of such a map permits the identification of regulatory sequences within transcribed and coding regions as well . To accomplish such a map, the pattern search program patser (5) and publicly available alignment matrices were used to generate the athamap database, the first tfbs map for the whole a.thaliana genome (6). The second release of the athamap database presented here has increased the data content from 2.4 10 to> 7.4 10 putative sites . Specific care has been taken in the annotation of cat- and tata - boxes, which were predicted using alignment matrices from the plantprom database (7) together with the positional information relative to transcription start sites (tsss) or translation start sites . Because each tfbs is associated with a particular score that represents the similarity of the site to the underlying alignment matrix, a new functionality was implemented that allows the identification of highly conserved binding sites . It is well known that the composition of binding sites in the regulatory region of a gene confers its specific expression profile (8). For example, two g - box like sequences constitute the as-1 element that is bound by bzip tfs (9). Another example is the ocs element that occurs in certain glutathione s - transferase genes of arabidopsis, which harbour a bzip and dof factor binding site in close vicinity (1012). A wide variety of expression specificity is associated with the co - localization of myb- and myc - binding sites (1316). Other examples are mads / mads tfbss and those tfs that harbour two dna - binding domains, such as ap2 (17,18). For the identification of such co - localizing elements, a new web tool was implemented that permits a user - defined identification of pairs of tfbss in the genome of arabidopsis by providing distance and quality parameters . This web tool was used to identify the co - localizing sites for known interacting factors . Such combinatorial elements were annotated to the athamap database and can also be used for the identification of more complex elements consisting of, for example, two combinatorial elements harbouring four tfbss . As summarized in table 1, the genomic positions of more than 7.4 10 putative tfbss were determined in the a.thaliana genome . These positions were identified with 42 alignment matrices for 36 tfs . For the factors bzip910, bzip911, pif3, abi4, rav1 and myb.ph3, two different alignment matrices were employed and they are identified by numbers in brackets behind the factor name (table 1). The binding sites were taken directly from the published literature, which is regularly screened in the process of updating the transfac database with plant transcription factor data (2). The screens were performed on the most recent version of the a.thaliana genome sequence (tigr release 5.0, january 21, 2004). The pattern search program patser (5) was used for the identification of binding sites as described previously (6). The following command line was used to run patser: patser - v3d -a a: t 0.320 c: g 0.180 -m matrixfile -f sequencefile -c -li -d2. For all screens, the default threshold calculated by patser from the adjusted information content of the matrix was employed . This criterion was chosen as an objective cut - off threshold value applicable for all the matrices as it represents a measure of how far the nucleotide frequency distribution in the alignment matrix diverges from the a priori probability for the occurrence of the nucleotides in the genome (5). In the case of cat- and tata - boxes (cbf and tbp), only those elements that occur upstream of known tsss or predicted translation start sites were imported into the athamap database . Tsss and translation start sites were annotated to the athamap database as provided by the tigr . The athamap database is based on the in silico determination of binding sites and does not distinguish between experimentally verified and predicted sites . A criterion for the conservation of a site is the individual score of a tfbs determined by using patser (5). In general, only tfbss with a specific score above a threshold score determined for each matrix were imported into the athamap database and are displayed as putative binding sites . A high score close to the possible maximum score represents a highly conserved binding site whereas a low score close to the threshold stands for a less conserved site . Maximum score, threshold score and specific score of a site are identified in a tool tip box in the athamap database to evaluate individual tfbss (6). To permit the exclusive display of higher conserved tfbss, a new function was implemented in the athamap database that allows the user to restrict the number of sites shown by the quality of their scores . With the new search page of athamap, the user is able to restrict the sites displayed to those that are closer to the maximum score . This requires an input value as a percentage, which is then applied to the difference between maximum score and threshold score . For example, if the restrictive value is set to 20% then only sites with a score of at least 6 will be displayed for a matrix with a maximum score of 10 and a threshold score of 5, while normally all sites with a score of at least 5 would be shown . A user - defined increase in the threshold score of tfbss displayed in the athamap database may eliminate putative false positive tfbss . Gene expression specificity is often mediated by the interaction between tfs that recognize closely spaced binding sites (8). The importance of combinatorial control for gene expression makes it desirable to identify co - localizing tfbss in the genome based on user provided parameters . For this, a new co - localization web tool was implemented on the athamap website that permits the selection of two tfs and the designation of a specific minimum and maximum spacer of up to 50 bp between two tfbss . Furthermore, one can increase the threshold score of the tfbss individually to obtain combinatorial elements that show a higher conservation of underlying binding sites . The result of the co - localization analysis is shown on the same page and gives the total number of co - localizing tfbss detected, the chosen parameters for the co - localization analysis and the number of sites used in the analysis . The spacer between two binding sites is defined by the distance between the most 5 positions of both tfbss . This permits the identification of overlapping sites that may be relevant for longer matrices with non - overlapping core sequences . To avoid identical hits at the same chromosomal position when using tfs of the same family, it is suggested to select a minimum spacer length that is as long as the matrix of one of the two factors . In addition, even known tsss can be selected to identify tfbss in close vicinity to the tsss . Owing to the large number of putative binding sites for some factors, the co - localization analysis had to be limited to 200 000 tfbss for each factor to permit a co - localization analysis in a reasonable time . The number of tfbss of 10 matrices was limited to higher conserved sites by increasing their threshold scores in the co - localization analysis . This applies to the matrices of factors agl15, alfin1, dof2, gamyb, hvh21, p, rav1, teil and gt1 . Figure 1 shows a modified screenshot of a result page for a co - localization analysis with atmyb15 and tga1, which are both factors from a.thaliana (table 1). As user - defined parameters, a minimum spacer of 0 nt and a maximum spacer of 20 nt between the binding sites and the default threshold of the alignment matrices (11.85 and 5.81, respectively) were selected . The total number of co - localizing sites detected is nine (figure 1, combinatorial elements). A result table shows the positions of the co - localizing binding sites, the chromosome and the orientation of the respective site with an arrow . Each position is linked to an athamap sequence window that opens and shows the co - localizing sites highlighted within their genomic context (data not shown). On the result page, when selected, a feature show overview displays a table with a summary of the co - localization analysis (figure 1, arrow). The inserted table displays the total number of sites that were obtained with all spacer lengths between the selected minimum and the maximum spacer . Here, the user can readily see if a preferred spacer length is detected for binding sites of two tfs . This new tool will be very helpful to identify co - localizing binding sites for tfs that were shown experimentally to interact with each other . Furthermore, genes harbouring a similar architecture of cis - regulatory elements may be identified . The well - known examples for combinatorial elements in plants are the as-1 element that is bound by two dimers of bzip transcription factors, the endosperm or ocs element that is recognized by a member of the bzip and dof tf family, and promoters that harbour myc / myb or mads / mads tf binding sites (9,12,16,17). Based on the approximate spacing between these elements, co - localizing sites were determined with the above described web tool and annotated as bzip / bzip, bzip / dof, myc / myb and mads / mads combinatorial elements . A second class of co - localizing tfbss consists of sites for factors that harbour two dna - binding domains, such as rav1 (18). Rav1 belongs to the ap2/erebp superfamily of tfs that comprises the subfamilies ap2, erebp and rav - like (3). Rav1 has two different dna - binding domains and for each of them the binding specificity was identified (18) and annotated as rav1 and rav1 in the athamap database . All the putative rav combinatorial elements were derived from a co - localization of rav1 and rav1 . Table 2 lists the total number of combinatorial elements identified in the a.thaliana genome and annotated in the athamap database . The factors used for the determination of combinatorial sites and the distances between putative binding sites are shown . These elements are identified in the athamap database by the factor family names and are displayed with a double line in the sequence window . For the ap2/erebp member myc (bhlh) tfs apparently recognize binding sites that are identical or are very closely related to bzip - binding sites (1921). Hence, annotated bzip sites were employed for the identification of myc - binding sites in combinatorial elements . The identification of functional myc / myb - binding sites by employing bzip sites can be shown for the gene encoding banyuls that is induced by the interacting tfs tt8 (myc) and tt2 (myb) (16,22,23). When the arabidopsis genome identification number of the banyuls gene (at1g61720.1) is used for a search in the athamap database, a putative myc / myb combinatorial element is detected upstream of the tata - box (data not shown). This combinatorial element corresponds to the previously determined myc and myb regulatory sites in the banyuls promoter (24). Table 3 summarizes several known or experimentally predicted combinatorial elements detected in the athamap database . As a further asset of the athamap database, these annotated combinatorial elements can be included in the user - defined identification of co - localizing tfbss as well . Therefore, more complex arrangements of regulatory elements consisting of up to four individual binding sites can be detected . Modified screenshots of the web tool for the identification of co - localizing tfbss in the a.thaliana genome . The results for a co - localization analysis between tfbss for tga1 and atmyb15 using the default parameters are shown . The number of putative binding sites detected with alignment matrices for tfs from different factor families in the a.thaliana genome and annotated in the athamap database combinatorial tfbs in the a.thaliana genome annotated in the athamap database owing to the palindromic nature of the tga1a and mads box matrices, tfbss frequently occur in sense and antisense at the same position . This leads to redundant combinatorial elements for which only one was annotated in the database and is displayed . Examples of known and experimentally predicted combinatorial elements identified by co - localization analysis and annotated in the athamap database the element can be displayed when entering the arabidopsis genome identifier (agi) in the search window of the athamap database.
|
Epilepsy is one of the chronic illnesses with the greatest negative impact on quality of life especially for children . Studies have reported that compared to healthy controls, children with epilepsy exhibit more behavioral problems, depressive symptoms, social withdrawal, aggression etc . Factors such as comorbidity, number of medications and frequency of seizures are also highly related to diminished quality of life in children with epilepsy . In this context several studies have examined quality of life as related to the specific health / illness status and have focused on the health - related quality of life construct (hrqol); either general or specific models of hrqol have been used, which have defined this construct as a multidimensional indicator of physical, social and psychological functioning of the individual in the context of the specific disease . Cross country research has provided evidence that 80% of all children with epilepsy live in developing countries, such as albania, where they might also lack medical treatment and psychological support . However, the issue of medical treatment is not as problematic, as the indifference towards the quality of life of children suffering from this disease . Although evidence from albania shows increasing rates of several neurological disorders (including epilepsy) the corresponding efforts to provide psychosocial support are practically non - existent . Indeed, the traditional medical model still focuses mainly on controlling the disease symptoms, without considering the psychosocial aspects of the illness and without engaging the parents in decision - making regarding their children s illness . The importance of parental involvement in decision - making regarding medical treatment is crucial, since they can provide health professionals with valuable information about their children . Parents is believed to play an equally important role in providing useful information about their children s hrqol, which is why many studies use proxy parental reports . Evidence indicates that parental and child self reports are significantly correlated, although the former tend to report lower hrqol as compared to their children . However, parental reports are especially useful in cases when children are too young or their involvement in the study poses ethical issues . Research has shown that mothers and fathers actually provide similar reports of their children s hrqol (epilepsy and other chronic childhood illnesses). Nonetheless, these findings might not apply to different cultural contexts (e.g., albania), where gender roles in the family are especially well - defined; for instance, evidence from albania suggests that the mother still is the primary (and sometimes the only caregiver), while the father figure is still the main or only breadwinner . In this context, it is important to examine whether the findings from other countries, referring to a high correspondence of maternal and paternal reports also apply to albania . Therefore, the aim of the present study was to assess whether albanian mothers and fathers hold similar perceptions of the hrqol of their children with epilepsy . Ethical approval for the study was granted by the ethics committee of city college, international faculty of the university of sheffield . Additionally, formal written permission was obtained by the state hospital director of korca, where the study was conducted . Participants were parents of children diagnosed with epilepsy, who were contacted by the researchers during routine clinical visits at the hospital (the pediatric neurologist office). All children were diagnosed with epilepsy by the pediatric neurologist and were taking medication for this specific disorder . The researchers explained the study to the parents who were asked to sign the informed consent form if they agreed to participate . The researcher also obtained the parents permission to get chart information by the neurologist regarding their children s age, gender and frequency of seizures . Parents were led to a quiet room, where they were given the data sheet and the questionnaire . The data sheet asked information about the age, gender, and education of the parent . Participants were encouraged to ask any questions during the completion of the questionnaire . In cases when only one of the parents was present and the other could not come to the clinic even at a later date, the researchers asked the person present to take a copy (consent form, data sheet and questionnaire) home and return it completed . This was due to the personal relationship that was built in time between the researchers and the parents, as well as to the fact that the doctors encouraged the parents to participate in the study . The final sample consisted of 102 parents (51 mothers and 51 fathers) of 51 children diagnosed with epilepsy . The mean age for mothers was 34.8 years (sd=3.21) and for fathers 41.1 years (sd=6.37). Only 20% of the parents had higher education (12 years), while the remaining 80% had only the obligatory 8-year education . Out of the 51 children, 23 were boys and 28 were girls, aged between 6 and 12 years old (mage=8.75, sd=1.97). In terms of seizure frequency the neurologist (based on the chart records) reported a range from zero to five seizures during the last year (mseizures=1.74, sd=1.40). This questionnaire is a disease specific questionnaire, i.e. It could be used only in studies on epilepsy . It is a proxy report measuring hrqol of children with epilepsy as perceived by their parents . Thus, parents are asked to answer the way they think their child would answer . The parent proxy report scale consists of 5 subscales assessing the following domains: interpersonal, future worries, present worries, intrapersonal and secrecy . The interpersonal subscale assesses the social consequences of epilepsy; it includes items asking on how peers treat these children, whether they have friends etc . Examples include: some kids with epilepsy think that other kids treat them differently . Future and present worries scales include present and future limitations (e.g. Not being able to drive when grown - up) and risks (e.g. Getting hurt) associated to epilepsy . The intrapersonal subscale includes difficulties in handling emotions, problems with attention, memory etc . Finally, the secrecy subscale assesses the willingness of children to discuss about the disease or to disclose to others the fact of being sick . Each of the five domains is assessed by five items, adding up to a total of 25 items . The test is structured in the following way: there are two options for each item and the participant is asked to choose one and then check on the same side whether it is true or sort of true . This double - checking offers the opportunity to think well of the response given and not just choose the first option coming to mind . The overall score ranged from a minimum of 25 to a maximum of 100, while the score for each subscale ranged from a minimum of 5 to a maximum of 20 . The cronbach s coefficient alpha values varied from 0.60 to 0.80; more specifically, the interpersonal and intrapersonal sub - scales had the highest alpha values, approximately 0.8 . The secrecy and worries scales (present and future worries) on the other hand had alpha values in the range 0.6 to 0.68, which though not high, are still acceptable values for reliability . Moreover, these results are comparable to the authors original reports (e.g., chronbach s alpha of 0.64 for present worries). The questionnaire was translated into albanian; the back - translation into english as well as the simplicity of the items (the wording was the same as that of the child version of the questionnaire) ensured the correctness of translation . A pilot study was conducted with four participants in order to check the accuracy of the translation and to ensure that the items were comprehensible and no revisions were required . However, a point that should be taken into consideration when interpreting the results is that this questionnaire has not been standardized in albanian . Descriptive analyses (means, standard deviations, skewness and kurtosis values) were run for all variables of interest (the five sub - scales and total scores). Skewness and kurtosis values were within the acceptable range for all of the variables (from 1.35 to 2.9), suggesting there were no major violations of normality assumptions . In order to examine the extent to which parents agreed on their reports of the several hrqol dimensions, intra - class correlations (icc) maternal and paternal reports of hrqol were also compared by using paired - samples t - tests . Also to examine the effects of demographic variables (age, gender of children) and seizure frequency two multivariate regression analyses were conducted with age, gender, and seizure frequency as independent variables and hrqol total scores (for mothers and fathers separately) as the dependent variables . Also the univariate effects of these variables on parental perceptions of hrqol (both mothers and fathers) were examined . Ethical approval for the study was granted by the ethics committee of city college, international faculty of the university of sheffield . Additionally, formal written permission was obtained by the state hospital director of korca, where the study was conducted . Participants were parents of children diagnosed with epilepsy, who were contacted by the researchers during routine clinical visits at the hospital (the pediatric neurologist office). All children were diagnosed with epilepsy by the pediatric neurologist and were taking medication for this specific disorder . The researchers explained the study to the parents who were asked to sign the informed consent form if they agreed to participate . The researcher also obtained the parents permission to get chart information by the neurologist regarding their children s age, gender and frequency of seizures . Parents were led to a quiet room, where they were given the data sheet and the questionnaire . The data sheet asked information about the age, gender, and education of the parent . Participants were encouraged to ask any questions during the completion of the questionnaire . In cases when only one of the parents was present and the other could not come to the clinic even at a later date, the researchers asked the person present to take a copy (consent form, data sheet and questionnaire) home and return it completed . This was due to the personal relationship that was built in time between the researchers and the parents, as well as to the fact that the doctors encouraged the parents to participate in the study . The final sample consisted of 102 parents (51 mothers and 51 fathers) of 51 children diagnosed with epilepsy . The mean age for mothers was 34.8 years (sd=3.21) and for fathers 41.1 years (sd=6.37). Only 20% of the parents had higher education (12 years), while the remaining 80% had only the obligatory 8-year education . Out of the 51 children, 23 were boys and 28 were girls, aged between 6 and 12 years old (mage=8.75, sd=1.97). In terms of seizure frequency the neurologist (based on the chart records) reported a range from zero to five seizures during the last year (mseizures=1.74, sd=1.40). The present study used the hrqol questionnaire . This questionnaire is a disease specific questionnaire, i.e. It could be used only in studies on epilepsy . It is a proxy report measuring hrqol of children with epilepsy as perceived by their parents . Thus, parents are asked to answer the way they think their child would answer . The parent proxy report scale consists of 5 subscales assessing the following domains: interpersonal, future worries, present worries, intrapersonal and secrecy . The interpersonal subscale assesses the social consequences of epilepsy; it includes items asking on how peers treat these children, whether they have friends etc . Future and present worries scales include present and future limitations (e.g. Not being able to drive when grown - up) and risks (e.g. Getting hurt) associated to epilepsy . The intrapersonal subscale includes difficulties in handling emotions, problems with attention, memory etc . Finally, the secrecy subscale assesses the willingness of children to discuss about the disease or to disclose to others the fact of being sick . Each of the five domains is assessed by five items, adding up to a total of 25 items . The test is structured in the following way: there are two options for each item and the participant is asked to choose one and then check on the same side whether it is true or sort of true . This double - checking offers the opportunity to think well of the response given and not just choose the first option coming to mind . The overall score ranged from a minimum of 25 to a maximum of 100, while the score for each subscale ranged from a minimum of 5 to a maximum of 20 . The cronbach s coefficient alpha values varied from 0.60 to 0.80; more specifically, the interpersonal and intrapersonal sub - scales had the highest alpha values, approximately 0.8 . The secrecy and worries scales (present and future worries) on the other hand had alpha values in the range 0.6 to 0.68, which though not high, are still acceptable values for reliability . Moreover, these results are comparable to the authors original reports (e.g., chronbach s alpha of 0.64 for present worries). The questionnaire was translated into albanian; the back - translation into english as well as the simplicity of the items (the wording was the same as that of the child version of the questionnaire) ensured the correctness of translation . A pilot study was conducted with four participants in order to check the accuracy of the translation and to ensure that the items were comprehensible and no revisions were required . However, a point that should be taken into consideration when interpreting the results is that this questionnaire has not been standardized in albanian . Descriptive analyses (means, standard deviations, skewness and kurtosis values) were run for all variables of interest (the five sub - scales and total scores). Skewness and kurtosis values were within the acceptable range for all of the variables (from 1.35 to 2.9), suggesting there were no major violations of normality assumptions . In order to examine the extent to which parents agreed on their reports of the several hrqol dimensions, intra - class correlations (icc) maternal and paternal reports of hrqol were also compared by using paired - samples t - tests . Also to examine the effects of demographic variables (age, gender of children) and seizure frequency two multivariate regression analyses were conducted with age, gender, and seizure frequency as independent variables and hrqol total scores (for mothers and fathers separately) as the dependent variables . Also the univariate effects of these variables on parental perceptions of hrqol (both mothers and fathers) were examined . Intraclass correlation analyses revealed that mothers and fathers held similar perceptions about the hrqol of their children with epilepsy as evident both from the significant positive correlations (ranging from icc=0.75 to icc=0.84, p<0.001) and from the lack of statistically significant differences between mothers and fathers reports across all dimensions of hrqol (table 1). In terms of the specific dimensions, the highest scores (and hence higher hrqol were reported in the interpersonal dimension m=14.69 (sd=4.78) and the lowest scores in the intrapersonal dimension m=9.49 (sd=3.73), but there were no statistically significant differences between the reports of mothers and fathers in all subscales as is evident in table 1 . The regression models with age, gender and seizure frequency as independent variables and hrqol as dependent variable were insignificant . Also the univariate effects of these three variables on parental perceptions of hrqol were not significant . The purpose of the present study was to assess parental perceptions of health - related quality of life of their children with epilepsy . The study compared mothers and fathers reports on quality of life to examine both relationships and differences on hrqol . Results showed no significant differences between maternal and paternal reports of hrqol; also the reports were moderately to highly correlated across all dimensions . Additionally results showed that both parents reported the highest levels of hrqol in the interpersonal domain and the lowest scores in the intrapersonal one . These findings were in accordance with studies from developed countries, which have found no gender differences in parental reports of hqol of their children . Therefore, albanian mothers and fathers of children with epilepsy tend to have similar perceptions of hrqol of their children across all dimensions . However, parental reports showed the highest correspondence in the interpersonal dimension of hrqol and the lowest correspondence in the future worries dimension . The interpersonal dimension refers mainly to behaviors that are observable, such as relationships with peers, ability to form friendships, as well as aggressive behavior . Therefore a high correspondence on this dimension is not surprising . On the other hand, the future worries dimension is not as accessible or directly observable, since it refers to worries expressed by the child over the future (e.g., not being able to drive a car when they grow up). Thus, reports on this particular dimension might grossly depend on the kind of relationship they have built with the child, e.g., how much they talk to each other over these issues . Hence, in this dimension mothers and fathers might display perspectives that do not correspond as highly as the reports in the interpersonal dimension . Even so, in terms of overall evaluations mothers and fathers reports do not differ significantly, a finding which is quite important both in the context of research and practice . Nonetheless, this finding does not imply that maternal and paternal reports might be used interchangeably, since there is no evidence of the correspondence of these reports with the child s self - reports . Indeed, several authors draw attention to the extra source of variance due to differing concordance of maternal and paternal reports with the child s self - report . Unfortunately the present study could not test the concordance of parental reports with the child s own reports but future studies should consider the use of child self - reports in order to get more solid conclusions . In the context of reports on the several dimensions of quality of life, a secondary finding (which is nonetheless worth mentioning) refers to the low hrqol scores reported by both parents on the intrapersonal domain . Hence according to parental perceptions, there are important impairments of their children as regards both cognitive abilities (memory and attention) and ability to control emotions (anger, anxiety, irritability). Studies have repeatedly demonstrated that indeed children with epilepsy have cognitive and emotional problems, which might also be related to the side effects of the medication they are taking . Nonetheless, the lowest scores reported on this dimension might also be indicative of the fact that these children are not getting the appropriate psychological support or cognitive training to help them overcome these difficulties . This aspect should be explored in further research because it goes beyond the scope of the present study . Considering that only two - parent families participated, the findings of this study could not be representative of other more nontraditional families, e.g., one parent families . The stressors in this kind of families might be quantitatively as well as qualitatively different, considering that only one parent has to hold the entire burden . Reports from mothers and fathers could also largely differ in one - parent families, depending on who is looking after the child . Another limitation applying to the findings in general, is that no control was undertaken on social desirability effects . This suggestion derives from the fact that the study was conducted in a medical clinic . Parents would probably be refrained from expressing negative attitudes that might indirectly involve the doctor; it would be rather more acceptable for them to report as if things are generally going moderately well . Despite the several limitations, the findings of the present study are important in the context of providing information on the parents perspectives on hrqol of albanian children with epilepsy . Results showed that contrary to the expectation, albanian mothers and fathers reports corresponded to each other; nonetheless these reports might not be interchangeably used unless the correspondence with child self reports is first examined.
|
Cross - sectional imaging strongly influences the diagnosis and management of several pathologic entities including liver lesions, pulmonary nodules, and gastrointestinal (gi) hemorrhage . Often, patients will have pre procedure cross - sectional imaging that guides the management plan . While high - quality computed tomography (ct) and magnetic resonance imaging (mri) offer excellent sensitivity and specificity for detecting lesions and characterizing vascular anatomy, accuracy depends on the quality of images obtained, and the accuracy with which they are interpreted . Conventional angiography can provide additional diagnostic and anatomic vascular information that may not have been apparent on pre procedure imaging . Characteristic angiography findings of liver lesions include vascular proliferation, tumor staining, mass effect, and arteriovenous shunting; the distribution and magnitude of vascular changes can aid in diagnosis and prognosis . Conventional angiography also serves to define the vascular anatomy, evaluate the extent of disease, and help assess the viability of surgical resection in candidates . Unexpected angiographic findings prompt the interventionalist to alter or abort the management plan during the procedure . Examples of possible unexpected findings include previously undetected lesions, unanticipated or aberrant vascular supply to lesions, and additional diagnostic information . In these situations, the interventionalist may have to expand the region of embolization, alter the approach, perform additional procedures at a later date, attempt alternative routes or abort the procedure, and change the management plan to surgical or medical treatment modalities . Liver - directed therapy with transarterial chemoembolization (tace) and radioembolization (tare) is a mainstay of primary and secondary liver cancer treatment . Pre procedure imaging with ct and mri is standard and aids in the detection of tumors and in planning for transarterial intervention . The reported sensitivity and specificity of ct and mri for detection of hepatocellular carcinoma (hcc) are 80100% and 9095%, respectively, when including all sizes of tumors but decrease significantly for tumors 12 cm and decrease even further for tumors <1 cm . In the evaluation of liver metastases, cross - sectional imaging has been shown to be 90100% sensitive when including all sizes of tumors, but this again decreases significantly for tumors <1 cm . Despite reported accuracy of cross - sectional imaging, unanticipated tumors are frequently encountered during arteriography preceding therapy [figures 13]. Not only this information is diagnostic and useful in altering the therapeutic plan by detecting additional lesions, but also it aids in prognostication . (a) computed tomography demonstrated a 5.1-cm right liver mass, presumed hepatocellular carcinoma (black asterisk) in a 55-year - old male with hepatitis b virus cirrhosis . (b) no tumors were identified on computed tomography in the inferior right hepatic lobe . (c) angiography performed within 1 month of the computed tomography revealed a great number of small amorphous hypervascular nodules scattered in the inferior half of the right liver (black arrowheads). Only the dominant 5.1-cm right liver mass (black asterisk) was treated with transarterial chemoembolization . (d) computed tomography 4 weeks later showed no tumors beyond the lipiodol - staining (arrow) of the dominant, embolized tumor (black asterisk). (e) however, magnetic resonance imaging 1 year later showed extensive multifocal and infiltrative hepatocellular carcinoma in the right liver with osseous metastases . No further liver therapy was performed, and the bone metastases (not shown) were treated with palliative radiation therapy . (a) magnetic resonance imaging of a 59-year - old female with hepatitis c virus cirrhosis demonstrated a 5 cm hepatocellular carcinoma in liver segment 5 (black asterisk) with possible satellite nodules . (b) left hepatic angiography within 2 weeks of the magnetic resonance imaging showed two subcentimeter hypervascular nodules in segment 2 (black arrowheads) and a hypervascular focus in segment 7/8 that required a second transarterial chemoembolization procedure . (a) magnetic resonance imaging of a 62-year - old female with hepatitis b virus disease and prior transarterial chemoembolization of hepatocellular carcinoma in segments 4a and 7 showed no new tumors and an embolization cavity (white asterisk) without evidence of residual disease . (b) on angiography performed within 1 month of the magnetic resonance imaging, abnormal hypervascularity was identified near hepatic dome, in the region of the previously treated segment 7 tumor, supplied by subsegmental hepatic arterial branches and right inferior phrenic artery (black arrow) branches . The ability of such tumors to develops new, abnormal vascular supply may confound efforts to treat them . Aberrant vascular supply can be from extrahepatic vessels such as the inferior phrenic artery or intercostal arteries and branches of the internal mammary artery [figure 4]. (a) magnetic resonance imaging showed a new segment eight hepatocellular carcinoma (arrowhead) in a 70-year - old male with a history of chronic hepatitis b virus cirrhosis and hepatocellular carcinoma and prior transarterial chemoembolization and ablation procedures . (b) angiography revealed much more extensive disease than seen on magnetic resonance imaging showing that the arterial supply arose not only from the right hepatic branches but also a variant right lateral branch of the dorsal pancreatic artery (black arrowhead) arising from the common hepatic artery, branches of the gastroduodenal artery (black arrow) and (c) the right inferior phrenic artery (black arrow) with shunting to the pulmonary circulation . (d) during yttrium-90 mapping, embolization of the right inferior phrenic, gastroduodenal, and right gastric artery was performed, to allow for redistribution solely via the right hepatic where transarterial radioembolization was then performed . (e) magnetic resonance imaging 3 months later showed no residual disease . In certain cases, tumors may not have a vascular supply conducive to intra - arterial therapy [figures 5 and 6]. This can be due to several factors: multiple prior tace procedures that disrupt the vascular supply in such a way that a vascular approach is unfeasible; inability to traverse stenosis or occlusion of the main vascular supply; or vasculature distribution that involves other organ systems such as the bowel . In these cases, (a) magnetic resonance imaging showed multifocal bilobar hepatocellular carcinoma (white asterisk) in a 71-year - old male . (b) superior mesenteric artery occlusion (arrowhead) was also noted on computed tomography . (c) angiography demonstrated that the bowel was supplied by the celiac artery via the gastroduodenal artery, via the pancreaticoduodenal arcade, precluding gastroduodenal artery embolization . However, the right and left hepatic arteries and gastroduodenal artery originated from the common hepatic artery in a trifurcation (black arrow), raising concern for nontarget embolization to the bowel from yttrium-90 embolization of either hepatic artery since the gastroduodenal artery (black arrowhead) supplied the superior mesenteric artery distribution due to superior mesenteric artery occlusion (black asterisk). Westminster, co, usa; black arrow) was used to prevent retrograde flow of the yttrium-90 embolic agent during embolization . (e) single - photon emission computed tomography imaging showed delivery to the liver parenchyma without activity in the bowel . (a) magnetic resonance imaging demonstrated hepatocellular carcinoma (white asterisk) in a 59-year - old male with a transplanted liver, performed 17 years earlier, for hepatitis c virus cirrhosis . (b) celiac axis (white asterisk) appeared widely patent, and the original plan was for transarterial radioembolization . (c) however, angiography demonstrated chronic obstruction of the proper hepatic artery (arrow) precluding transarterial therapy that had not been appreciated on the pre procedure magnetic resonance imaging . The liver was supplied by extensive but fine collateral vessels from the left gastric and gastroduodenal artery branches (black arrowhead), as well as branches (black asterisk) from the remaining proper hepatic arterial stump (black arrow). It is important to identify anatomic variation as it may alter the treatment plan . For liver - directed therapy, replaced and accessory hepatic arteries will alter treatment strategies [figure 7]. Replaced right hepatic artery . (a) computed tomography showed tumors in both hepatic lobes in a 49-year - old male with metastatic colon cancer . (b) during mapping, angiography showed a left gastrohepatic trunk (black arrow) with multiple gastric branches (black arrowheads) arising before the left hepatic artery (black asterisk). There are a marked enlargement and inferior deviation of the left hepatic lobe due to large masses . (c) a replaced right hepatic artery (black arrowhead) from the superior mesenteric artery was not appreciated on pre procedure imaging but identified angiographically . The gastroduodenal artery (black arrow) originated from the right hepatic artery (black arrowhead). Yttrium-90 mapping of the left and right lobes was therefore performed by macroaggregated albumin infusion via two separate catheter placements . For uterine fibroid embolization, the ovarian artery can often supply the fibroid(s), especially in patients with large fundal fibroids, tubo - ovarian pathology, or prior pelvic surgery [figure 8]. At times, the supply may not be visible until after the embolization is performed, with a resultant change in flow dynamics and redistribution of flow to the ovarian artery . (a) contrast - enhanced t1-weighted magnetic resonance imaging demonstrates a fibroid uterus in a 48-year - old female with pelvic pain and menorrhagia . (b) abdominopelvic aortogram demonstrates supply to the enlarged fibroid uterus from branches from the right and left uterine arteries (black arrowheads). In addition, the enlarged right ovarian artery (black arrow) supplies a portion of the superior uterus . While ct and mri are helpful in differential diagnostic considerations, angiography provides dynamic information that, by showing the evolution of blood flow over time, can help to sort through the differential diagnosis . Ct and mri are helpful in the diagnosis of hepatic tumors, and in differentiating among the diagnostic considerations . Angiography provides dynamic information that, by showing the propagation of blood flow over time, can help to sort through the differential diagnosis . In the liver, arterioportal and arteriovenous shunts can be revealed that are only suggested or not demonstrated on cross - sectional imaging . Such shunting can suggest particular tumors such as hcc or certain metastases . From a procedural standpoint, parenchymal lesions on ct tend to enhance, without focal detail in regard to vascular anatomy . Pulmonary arteriovenous malformations (avms), the majority associated with osler weber rendu syndrome, often displays tortuous feeding arteries, aneurysms, and dilated draining veins which may be seen on ct . However, other pulmonary arterial or venous diseases such as pseudoaneurysms and mass lesions can be difficult to distinguish at times [figures 9 and 10]. Sensitivity and specificity of ct for detecting avms are 83% and 78% for the whole lung and 72% and 93% for lobar evaluations, respectively, whereas pulmonary arteriography has a sensitivity and specificity of 70% and 100% for the whole lung and 68% and 100% for lobar evaluation, respectively . Beyond providing higher specificity, transcatheter pulmonary arteriography allows for simultaneous diagnosis and management . (a) a 64-year - old female with chronic obstructive pulmonary disease was found to have hypervascular right lower lobe lung nodules, with imaging features suggestive of arteriovenous malformations (black arrow). Contrast - enhanced computed tomography findings were considered suspicious enough to warrant a conventional angiogram and possible embolization . (b) right pulmonary angiography demonstrated no evidence of dilated artery or early draining vein, excluding arteriovenous malformations . (c) computed tomography - guided biopsy of a dominant nodule was then performed and revealed a diagnosis of nonsmall cell carcinoma . (a) chest computed tomography in a 70-year - old male demonstrates a right lower lobe pulmonary nodule (black asterisk) thought to represent an arteriovenous malformation . Computed tomography pulmonary angiogram was not performed, as the findings were considered suspicious enough to warrant conventional angiography . (b) right lower lobe segmental pulmonary arteriogram demonstrated a pseudoaneurysm (white asterisk) of the vessel perfusing the medial portion of the base of the right lower lobe, without a draining vein to suggest an arteriovenous malformation . For gi bleeds, endoscopic evaluation is generally performed first . However, if endoscopy is unable to identify the source of bleeding, either because no bleeding is found or excess bleeding prevents localization, angiography can play diagnostic and therapeutic roles . The location of active gi bleeding is identified by extravasation of contrast into the bowel lumen and can be seen at bleeding rates as low as 0.5 ml / h . Angiodysplasias, virtually invisible by axial computerized imaging, can be identified by the tortuous network of vessels and dilated, rapidly draining vein (s). Vasculopathies, such as fibromuscular dysplasia (fmd) and segmental arterial mediolysis (sam), can be identified as well . Fmd, most commonly affecting the renal and cerebral arteries, but occasionally the mesenteric vessels, has three major subtypes affecting different layers of the arterial wall; the most common type, which involves the medial layer, gives a classic string - of - beads sam, classically affecting the splanchnic vessels, is due to the lysis of the outer media of the arteries and characterized by segmental, scattered aneurysms, stenosis, and occlusions with the main distinguishing feature being the high prevalence of dissecting aneurysms [figure 11]. Sam and fmd have some overlapping histological and radiographic appearances and may be a spectrum of one disease . A 62 year old man with spinal cord compression from a thoracic tumor developed massive hemorrhage following surgical decompression . Celiac and superior mesenteric arteriography unexpectedly demonstrated scattered stenoses (black arrowheads), aneurysms (black arrows), and arterial dissections, in a pattern consistent with segmental arterial mediolysis . The procedure was stopped, as it was now recognized that the patient was not amenable to endovascular intervention.
|
In spite of the early reluctance of the plastic surgery community to accept regular use of perforator based propeller flaps in clinical practice, these flaps are gradually looked upon as a safe and reliable option in reconstructive plastic surgery . A propeller flap is an island flap that moves around a stationary vascular axis, and reorients itself from one axis to the other . Early description of propeller flaps mentioned of a thick subcutaneous pedicle which restricted the arc of rotation of these flaps . With increasing knowledge and awareness of the location and the vascular territory perfused by cutaneous perforators, it is now possible to design propeller flaps based on a single perforator, so - called perforator based propeller flaps . These flaps permit flap rotation up to 180. the concept of free styling of perforator flaps offers greater degree of freedom and intra operative maneuverability in flap planning since flap harvest can be carried out in any anatomical area where a sizable perforator can be detected . Although there are a large number of reports of using perforator based propeller flaps in lower limb reconstruction, the application of this technique in the upper extremity is infrequently reported . We present our experience of free style perforator - based propeller flaps for upper limb soft tissue reconstruction . We present a retrospective series of 63 free style perforator flaps used for soft tissue reconstruction of the upper extremity from november 2008 to march 2013 . All the flaps were performed by the first author for various locations and indications over the upper extremity . Patient demographics, surgical indication, defect features, complications and clinical outcomes are evaluated and presented as an uncontrolled case series . 60 flaps were islanded on a single perforator, and three flaps were islanded on two perforators . All flaps were rotated around the axis of the perforator through various degrees ranging from 90 degrees to 180 degrees . The three perforator flaps which were islanded on two perforators were rotated up to 90 degrees . It was done after ascertaining intra operatively that the two perforators do not impinge on each other . Generally most of the perforators in the upper extremity follow the intermuscular septum distally, but proximally they often pierce the muscle bellies . In the upper arm, they arise from the lateral septum between triceps and brachialis muscles and from medial intermuscular septum between triceps and biceps . Perforators of radial artery are generally found between the septum between brachioradialis and flexor carpi radialis . The ulnar artery perforator arises in the septum between flexor carpi ulnaris and flexor digitorum superficialis . The perforators from the posterior interosseus artery emerge between extensor carpi ulnaris and extensor digitiminimi . The perforators of the anterior interosseus artery emerge between extensor digitorum communis and extensor digiti minimi to reach the skin . Patient selection: small to moderate sized defects, post electric burn defects and resurfacing after post burn contracture release can be effectively managed by perforator based propeller flaps . We generally tend to avoid performing perforator flaps for those extremities, where in there is extensive trauma zone, associated multiple fractures of the extremity above the level of the defect . We consider preoperative doppler as desirable and not mandatory prerequisite for performing a free style perforator flap . The doppler study is made with a hand held doppler with an 8 hz frequency probe around the axis of the major vessel adjoining the defect . The perforator with a consistent, audibly loud and high pitched doppler signal is marked . In our clinical practice, we have noticed that it is a bit more difficult to differentiate a perforator from the main vessel in the upper extremity than in the lower extremity, probably because the shorter length and proximity of the perforators to the main vessel in the upper extremity . Incision is made in such a fashion that if need arises, tissue on both sides of the incision could be used for harvesting a flap . Due care is taken to make maximum use of the available tissue on both sides of the incision . Due care must also be taken while making the incision so that, if appropriate perforator is not identified or if found to be in trauma zone, the same incision can be used to delay a fasciocutaneoous flap or harvest a regional axial flap or as a gateway to dissect the recipient vessel for micoanastomosis . Although there are no fixed rules, our choice of using a suprafascial or a subfascial perforator flap depends on the defect . For defects like amputation stumps, or defects where secondary procedures are not anticipated, we generally prefer subfascial incision to identify the perforator and raise the flap [figure 1]. This is helpful as we have noticed that, if the skin part of the flap is lost, the fascia may still be intact and graftable in due course of time . The subfascial distal radial artery perforator flap: (a) crush hand, (b) defect identified after debridement and fixation, (c) flap islanded on distal radial artery perforato, (d) well settled flap we have realized that; in those cases with associated nerve injuries or tendon injuries, which might need tendon transfers or tendon grafts at a later date, it is better to go for a suprafascial flap harvest . This ensures a smooth subfascial tract for tendon transfer / tendon graft if need arises [figure 2]. The suprafascial distal radial artery perforator flap: (a) distal ulnar defect, (b) flap islanded on distal radial artery perforator, (c, d) flap in situ with donor area skin grafted in a free style concept, the planning of the flap dimensions is intraoperative . After a non - committal exploratory incision is made, the perforators are identified . In general we tend to avoid any perforator which is excessively close to the edge of the wound as the perforator might be fragile because of post traumatic vascular disease . We also prefer not to choose a perforator which is too far from the defect as it increases the length of the flap unnecessarily . After an appropriate, reliable perforator is identified, the distance of the perforator to the distal edge of the defect is measured . Planning is made in reverse, considering the degree of rotation involved, and distal edge of the flap is marked along the long axis of the upper extremity . Due care is taken to add 1 - 1.5 cms to the long axis of the flap . The width of the defect is noted and marked on either side of the perforator . All fibrous strands are dissected to prevent compression on the perforator after rotation . Throughout the procedure, the perforator / guaze is irrigated by lignocaine solution to prevent drying and spasm of the perforator . Once the flap is islanded, tourniquet is released and flap is permitted to perfuse for a while before rotation . It is possible to anastomose this vein to a local vein to augment the venous outflow if a venous compromise is anticipated . Cautery is used judiciously as and when needed away from the perforator to achieve absolute hemostasis . The flap is then propelled as necessary to cover the defect . In case where 180 degrees rotation is needed, it is advisable to turn the flap from the side which causes the least degree of torsion on the perforator . The initial sutures are taken along the sides of the perforator to prevent traction to the perforator . The flaps appear a bit congested in the initial few days, but gradually settle down with time . Few clinical images demonstrating the distal ulnar atery perforator flap, recurrent radial artery perforator flap, proximal ulnar artery perforator flap and proximal radial artery perforator flap are shown [figures 35]. (a) defect on dorsum of hand, (b) flap islanded, (c, d) well settled flap and graft recurrent radial artery perforator flap & proximal ulnar artery perforator flap . (a) elbow defect, (b) recurrent radial artery perforator flap harvested, (c) proximal ulnar defect & proximal ulnar artery perforator flap harvested, (d, e) well settled flaps proximal radial artery perforator flap . (a, b) elbow contractures; (c) harvested proximal radial artery perforator flap, (d) flap islanded on perforator, (e) well settled flap splintage and strict limb elevation is maintained for a period of 10 days . If they are applied, they are applied in a fashion that does not cause compression over the perforator . Sutures are removed on 10 - 12th day, and physiotherapy as and where necessary is initiated . Generally most of the perforators in the upper extremity follow the intermuscular septum distally, but proximally they often pierce the muscle bellies . In the upper arm, they arise from the lateral septum between triceps and brachialis muscles and from medial intermuscular septum between triceps and biceps . Perforators of radial artery are generally found between the septum between brachioradialis and flexor carpi radialis . The ulnar artery perforator arises in the septum between flexor carpi ulnaris and flexor digitorum superficialis . The perforators from the posterior interosseus artery emerge between extensor carpi ulnaris and extensor digitiminimi . The perforators of the anterior interosseus artery emerge between extensor digitorum communis and extensor digiti minimi to reach the skin . Patient selection: small to moderate sized defects, post electric burn defects and resurfacing after post burn contracture release can be effectively managed by perforator based propeller flaps . We generally tend to avoid performing perforator flaps for those extremities, where in there is extensive trauma zone, associated multiple fractures of the extremity above the level of the defect . We consider preoperative doppler as desirable and not mandatory prerequisite for performing a free style perforator flap . The doppler study is made with a hand held doppler with an 8 hz frequency probe around the axis of the major vessel adjoining the defect . The perforator with a consistent, audibly loud and high pitched doppler signal is marked . In our clinical practice, we have noticed that it is a bit more difficult to differentiate a perforator from the main vessel in the upper extremity than in the lower extremity, probably because the shorter length and proximity of the perforators to the main vessel in the upper extremity . Incision is made in such a fashion that if need arises, tissue on both sides of the incision could be used for harvesting a flap . Due care is taken to make maximum use of the available tissue on both sides of the incision . Due care must also be taken while making the incision so that, if appropriate perforator is not identified or if found to be in trauma zone, the same incision can be used to delay a fasciocutaneoous flap or harvest a regional axial flap or as a gateway to dissect the recipient vessel for micoanastomosis . Although there are no fixed rules, our choice of using a suprafascial or a subfascial perforator flap depends on the defect . For defects like amputation stumps, or defects where secondary procedures are not anticipated, we generally prefer subfascial incision to identify the perforator and raise the flap [figure 1]. This is helpful as we have noticed that, if the skin part of the flap is lost, the fascia may still be intact and graftable in due course of time . The subfascial distal radial artery perforator flap: (a) crush hand, (b) defect identified after debridement and fixation, (c) flap islanded on distal radial artery perforato, (d) well settled flap we have realized that; in those cases with associated nerve injuries or tendon injuries, which might need tendon transfers or tendon grafts at a later date, it is better to go for a suprafascial flap harvest . This ensures a smooth subfascial tract for tendon transfer / tendon graft if need arises [figure 2]. The suprafascial distal radial artery perforator flap: (a) distal ulnar defect, (b) flap islanded on distal radial artery perforator, (c, d) flap in situ with donor area skin grafted after a non - committal exploratory incision is made, the perforators are identified . In general we tend to avoid any perforator which is excessively close to the edge of the wound as the perforator might be fragile because of post traumatic vascular disease . We also prefer not to choose a perforator which is too far from the defect as it increases the length of the flap unnecessarily . After an appropriate, reliable perforator is identified, the distance of the perforator to the distal edge of the defect is measured . Planning is made in reverse, considering the degree of rotation involved, and distal edge of the flap is marked along the long axis of the upper extremity . Due care is taken to add 1 - 1.5 cms to the long axis of the flap . The width of the defect is noted and marked on either side of the perforator . The flap is then harvested, and islanded on the perforator . All fibrous strands are dissected to prevent compression on the perforator after rotation . Throughout the procedure, the perforator / guaze is irrigated by lignocaine solution to prevent drying and spasm of the perforator . Once the flap is islanded, tourniquet is released and flap is permitted to perfuse for a while before rotation . Whenever possible, a subcutaneous vein is kept at the base of the flap . It is possible to anastomose this vein to a local vein to augment the venous outflow if a venous compromise is anticipated . Cautery is used judiciously as and when needed away from the perforator to achieve absolute hemostasis . The flap is then propelled as necessary to cover the defect . In case where 180 degrees rotation is needed, it is advisable to turn the flap from the side which causes the least degree of torsion on the perforator . The initial sutures are taken along the sides of the perforator to prevent traction to the perforator . The flaps appear a bit congested in the initial few days, but gradually settle down with time . Few clinical images demonstrating the distal ulnar atery perforator flap, recurrent radial artery perforator flap, proximal ulnar artery perforator flap and proximal radial artery perforator flap are shown [figures 35]. (a) defect on dorsum of hand, (b) flap islanded, (c, d) well settled flap and graft recurrent radial artery perforator flap & proximal ulnar artery perforator flap . (a) elbow defect, (b) recurrent radial artery perforator flap harvested, (c) proximal ulnar defect & proximal ulnar artery perforator flap harvested, (d, e) well settled flaps proximal radial artery perforator flap . (a, b) elbow contractures; (c) harvested proximal radial artery perforator flap, (d) flap islanded on perforator, (e) well settled flap if they are applied, they are applied in a fashion that does not cause compression over the perforator . Sutures are removed on 10 - 12th day, and physiotherapy as and where necessary is initiated . 63 free style perforator flaps were used for soft tissue reconstruction of 62 patients for the upper extremity from november 2008 to june 2013 . Of the 63 flaps, 31 flaps were performed for trauma, 30 for post burn reconstruction including electric burns, and two for post snake bite defects [figure 6]. The age group varied from 9 years to 51 years with the average age of 34 years . Most of the patients of trauma injury were male, and most of the patients with burn injuries were females . In case of use of free style perforator based propeller flaps for post burn resurfacing, the flaps were used in 7 cases of little finger contracture, 6 in case of wrist contracture, 4 in electrical burns, 8 in elbow contractures, 4 for axillary contractures, and one for adduction contracture of the thumb . Both post snake bite defects were on the dorsum of the hand and forearm respectively . Of the trauma cases, two defects were on the arm region, six were in the elbow and proximal forearm region, and 23 defects were in the distal wrist, palm and dorsum of hand . Two flaps were performed in one patient of post traumatic defect over the elbow, and the proximal forearm . The largest defect in our series was a 6 10 defect on the palm involving almost the entire palmar surface, which was resurfaced by the distal ulnar artery perforator flap . Brachial artery perforator flaps were performed in 3 patients, of which 2 were post traumatic defects, and one was post burn elbow contracture . Proximal radial artery perforator flaps were done for 4 cases of post burn elbow contractures . Distal radial artery perforator flaps were performed in 16 patients, of which 9 were for post traumatic defects, 7 were for post burn resurfacing . Proximal ulnar artery perforator flap was performed for one case of trauma, and two cases of post burn contractures . Distal ulnar artery perforator flap was performed in 8 cases of trauma and 3 cases of post burn resurfacing and one case of snake bite . Posterior interosseus artery perforator flap was done for one case of post snake bite defect . Anterior interosseus artery perforator flap was done in 6 cases of trauma, and two cases of post - burn resurfacing . Ulnar digital artery perforator flap was performed in 7 cases of post - burn little finger contractures [figure 7]. Distribution of flaps we were able to achieve primary closure in all the seven cases of ulnar digital artery perforator flaps . Apart from that, we were able to achieve primary closure in three cases only . However, the graft requirement was significantly reduced due to the propeller design of the flap . Of the 63 flaps the other three were post traumatic defects, which were managed by a second flap cover by either an abdominal or groin flap . One of them was managed by another perforator plus flap for the distal forearm [figure 8]. (a) distal radial defect, (b, c) distal radial artery perforator flap harvested, (d) necrosed flap, (e, f, g) defect covered by perforator plus flap one flap of brachial artery perforator flap for mid - humeral defect had settled well, but the fixator was loosened, and the proximal fracture fragment penetrated through the flap, puncturing the flap [figure 9]. (a) humerus exposed, (b) flap islanded on perforator, (c) identification of perforator, (d) well settled flap, (e) proximal fracture segment piercing through the flap all the flaps were lost because of congestion; as is commonly encountered with perforator flaps . Amongst the four flaps which were completely lost, 3 had hematoma formation and one had compression of overlying muscle over the perforator . Failure of 8 flaps out of 63 flaps almost amounts to a 12 - 13% failure rate . Of these 8 flaps, 7 needed a secondary procedure, and one healed secondarily . Although we have a significant failure rate, most of our failures were in the early part of the series indicative of a learning curve associated with the flap . Pedicle local flaps, regional flaps, distant flaps and free flaps can be used to resurface defects over the upper extremity . Pedicle local flaps (transposition or rotation) are simple and rapid to execute and bring local skin with a good color and texture match . However, their arc of rotation is generally restricted to 90, and their utility is limited to areas of skin laxity . Pedicle regional flaps (radial and ulnar artery forearm flaps and posterior interosseus artery flaps) have all the advantages of local flaps and also have a greater arc of rotation . Radial and ulnar artery flaps necessitate division of a major vessel of the upper extremity . The posterior interosseus artery flap needs considerable dissection, and at times may be complicated because of aberrant anatomy . Free flaps are a good option for medium to large defects with a variety of donor options to suit the requirements of the particular patient . However they are infrastructure dependent, have a significant learning curve and have a potential for total flap loss . A perforator - based propeller flap for the upper limb combines the advantages of pedicled local flaps (good tissue match), pedicled regional flap (180 arc of rotation), pedicled distant flap (reliable), and free flap (tissue away from zone of injury). In addition, literature review suggests that it allows linear closure of the donor defect in smaller defects . This is made possible by the propeller design of the flap, which on rotation brings the bridge segment of the flap into the donor defect, making closure easier . In our series however, we were able to achieve primary closure of the donor defect in only three cases . The requirement of skin graft was definitely reduced due to the propeller design of the flap . The upper extremity is generally exposed, and therefore skin graft over the exposed upper extremity is not an aesthetically pleasing sight . This might be one of the reasons why the perforator based propeller flaps are not so popular in the upper extremity reconstruction . However, most of the patients coming to our unit are from the poor socioeconomic strata and daily wages workers . Their main concern is going back to work as early as possible and aesthetic outcomes are the least of their concerns . Free style perforator based propeller flaps offer a safe, reliable and single stage option for these patients with minimal functional morbidity and without sacrifice of a major vessel . They have a significant disadvantage of poor donor site aesthetics . In a resource poor country like india; these flaps have a definite role to play in soft tissue reconstruction of the upper extremity . The major drawback of a perforator - based propeller flap is that the perforator must be intentionally twisted to allow the flap to rotate . The perforators of the upper extremity are generally shorter in length as compared to those of the lower extremity . Tc teo feels that one of the potential limitations to the wider application of the propeller flaps, especially in the distal forearm is the relatively short pedicle, which does not tend to withstand extreme (180) rotation so well . Even though the pedicle length and diameter of the upper extremity perforators is less as compared to those of the lower extremity, so is the thickness of the skin and fascia which is transferred on the perforator . Few previous experimental studies have studied the effect of pedicle twisting on flap survival . Based on these studies and reports in the literature, perforator - based propeller flaps with a rotation up to 180 have shown to be viable and versatile . More often, it is obvious as to rotation in which direction will cause less pedicle twisting . In those cases, which need 180 twist, flap rotation is attempted from both sides, and rotation resulting in minimal twist is selected . Shimpei ono et al . Feel that an empty vessel is more susceptible to kinking as compared to a vessel with flow, and they attempt clockwise and counterclockwise rotation of flap to select the direction of rotation before release of the tourniquet . When a rotation has been selected, they put the flap back in its native position . We, however feel that when a rotation is performed, one of the veins accompanying the perforator gets kinked, and the other one opens up; and unless the veins are filled it is difficult to determine the proper direction of rotation ., after the flap is harvested, we release the tourniquet and flap is allowed to perfuse . To select the actual rotation, we rotate the flap clockwise and counterclockwise after the release of tourniquet with a couple of minute's interval between the two rotations to prevent spasm to the perforator . The direction causing the least torsional effects it is also important to isolate the pedicle and obtain as much length as is safely possible when a 180 rotation is planned . Saint - cyr et al . Have mapped out the territory perfused by a single perforator by carrying out static and dynamic dye injection studies in fresh cadavers . They studied the radial artery, ulnar artery, and dorsal metacarpal artery perforator flaps in the upper limb . They introduced the concept of a perforasome (unique vascular territory supplied by a single perforator) and determined that the vascular axis of perforator flaps should follow the axial alignment of the linking vessels, which in turn follows the axial anatomy of the limb . When a flap includes two perforasomes, the link vessels open up to perfuse the flap from a single perforator . This is analogous to the choke vessel concept proposed by taylor et al . To the best of our knowledge, how much flap can be safely harvested on a single perforator in upper limbs is unknown . It has been suggested that flaps up to one - third of limb length can be safely harvested in lower limb . Until the exact territories can be determined, it is best to raise flaps that fall within the static territories . To the best of our knowledge and literature search, ours is the largest series of free style perforator based propeller flaps used for upper extremity reconstruction, wherein we have included various flaps for varied indications in the upper extremity . We used past clinical and anatomical studies of upper limb perforator flaps and our clinical experience to determine the size of our perforator - based propeller flaps . Although we have rarely used these flaps to resurface defects as large as the entire palm, we suggest these flaps are ideal for defects where the donor sites can be closed primarily or with minimal amount of skin graft over the donor site . The upper limb has more than 100 cutaneous perforators (_ 0.5 mm diameter). Divided the skin of the upper extremity into 16 vascular territories based on the deep trunk vessels from which these perforators arise . The axilla, elbow, forearm, wrist, and hand represent the major anatomical areas that usually require flap reconstruction . In our series perforators from the medial aspect of the arm are generally selected for resurfacing the axilla, and midhumeral defects . This is mainly because of hidden donor site, and greater laxity of the tissues there . Recurrent radial or ulnar artery flaps are decided depending on the location of the defects . Generally radial sided wrist and hand defects are covered by radial artery perforator flaps, ulnar defects are covered by ulnar artery perforator flaps . Defects over dorsum are managed by anterior interosseus artery perforator flaps or the posterior interosseus artery flaps . A perforator - based propeller flap is designed in the long axis of the limb because there is greater skin laxity in the long axis when compared to the transverse axis . In addition; flaps designed along the long axis include the linking vessels (that follow the axis of the limb). The availability of free style perforator flaps in our armamentarium for management upper extremity soft tissue reconstruction has increased our choices greatly . It has often given simple options to complex reconstructions . This technique provides us with a rapid and reliable reconstruction with acceptable aesthetic outcomes, especially when donor site is closed primarily . Proper patient selection, atraumatic handling of the perforator during flap harvest, complete isolation of the perforator to minimize the tortional effects, absolute hemostasis will give us good outcomes in free style perforator based propeller flaps for upper extremity reconstruction . They can be the first choice option in selected group of patients for upper extremity soft tissue reconstruction.
|
Transurethral resection of the prostate (turp) is an effective treatment modality for lower urinary tract symptoms (luts) secondary to a benign obstruction of the prostate (bop). However, in some patients, the improvement of symptoms after turp is insufficient [2, 3]. Therefore, studies have been conducted to detect parameters that can predict outcomes after the intervention . According to several studies, one of such parameters could be resected tissue weight or the ratio of the resected tissue weight with prostate volume [2, 4, 5]. Currently, the standard turp technique recommends a complete resection of all adenomatous tissue; however, the duration of the operation and the amount of the tissue removed are directly associated with intraoperative and early postoperative complications . A few studies have found no significant correlation between the resected tissue weight and symptom improvement, and the authors postulated that a complete resection might not be essential [5, 7]. Other techniques for the treatment of luts caused by bop such as transurethral needle ablation, interstitial laser coagulation or vaporization do not aim to completely remove the adenoma, but instead rely on tissue sloughing or shrinkage at varying degrees . The outcomes of these treatment modalities are acceptable for the patients . For these reasons, the hypothesis of a limited resection has recently gained popularity . Despite the generally accepted principles of the surgical technique, there is no consensus on how much tissue should be resected or how complete the turp should be . The aim of this study was to evaluate the impact of the resected tissue weight and the resected tissue ratio with transition and total prostate volume on the improvement of symptoms, the quality of life, and voiding function after transurethral resection of the prostate (turp). This prospective case series study included 89 patients with luts and histologically confirmed bph, who underwent turp . The inclusion criteria were age 4585 years, ipss 13, qmax 15 ml / s, post voiding residual volume (pvr) of 300 ml, and a prostate biopsy to confirm benign disease, when prostate specific antigen (psa) was> 4 ng / ml, as well as a signed consent form . The exclusion criteria were a previous operation of the bladder, prostate, or urethra; urethral stricture; qmax of> 15 ml / s; ipss of <13; prostate or bladder cancer; bladder stones, and chronic urinary tract infection . Examinations of the patients before their operations included psa, ipss, qol, qmax, pvr, total prostate volume (tpv), and transition zone volume (tzv). Transrectal ultrasound (trus) was used for the total estimation of the prostate and its zones . Turp was performed using standard 24 or 26 french resectoscopes with either an intermittent or a continued flow according to the technique of a complete adenoma resection, down to the surgical capsule . Up was arranged six months after turp, and included ipss, qol, qmax, trus and pvr investigations . The endpoint of the study was an evaluation of the treatment efficacy using pre / postoperative changes to ipss, qol, and qmax . The cut off of the efficacy of the operation was defined as 50% improvement of each evaluated parameter or decrease in ipss (10 points), increase in qmax (10 ml / s), and improvement of qol (3 points). Treatment was considered effective when the postoperative results were excellent (all three parameters improved more than the defined cut off), good (improvement in two of the three parameters), and ineffective when the results were fair (improvement in one of the three parameters), or none (all three parameters did not reach the cut off level). The weight of the resected prostate tissue (rptw), rptw / tzv ratio, and rptw / tpv ratio were analyzed with regard to the endpoint of the study, i.e. Effective or ineffective treatment results . The statistical analysis was performed using the t test and the chi squared test . The roc curves were used to analyze the impact of intra operative parameters on treatment efficacy . Survival analysis (life tables) was performed to detect the cut off and prognostic values of each parameter for predicting postoperative results . Spss 21.0 for windows (statistical package for social sciences, chicago, illinois, usa) was used to perform the statistical analysis . In total, 89 patients were involved in this prospective case report study . The patients moderate symptoms (up to 18 ipss points) were observed in 30.2% and severe (19 and more ipss points) symptoms in 69.8% of the patients . All the evaluated parameters (qmax, qol, pvr, and ipss) changed significantly at 6 months after turp (table 1). The difference between pre and postoperative data varied from 75% (ipss and pvr) to 120% (qmax). The treatment was effective according to qmax (improvement> 50% or 10 ml / s) in 74.2% of the patients, according to ipss (improvement> 50% or 10 points) in 91%, and according to qol (improvement> 50% or 3 points) in 74.2% of the patients . According to our definition of efficacy, the treatment was effective in 74.2% (excellent 71.9% and good 2.2%) of the patients, while in 25.8% (fair 6.7% and ineffective the mean rptw / tpv ratio was 0.48 (sd 0.17, range 0.130.89), and the mean rptw / tzv ratio was 0.91 (sd 0.29, range 0.421.98). Up was 25.8 ml (sd 15.44). A very strong correlation between rptw and the difference of tpv before and after turp was found (r = 0.869, p <0.001). The decrease in pvr was similar between the groups, and therefore, an increase in qmax and qol, as well as the reduction in the ipss score, were significantly higher when turp was effective (table 2). There was no difference in rptw, but the resected tissue ratio with tzv and tpv was higher when the treatment was effective (table 2). The roc curve analysis was performed for each of the intraoperative parameters to evaluate their influence on treatment outcomes . The most significant predictors for obtaining favorable results were rptw / tzv and rptw / tpv ratios . The data is shown in table 3 and figure 1 . Survival analysis (life tables) shows that in order to achieve 50% improvement in qmax, qol, and ipss (table 4), more than 3035% of all prostate tissue (the cut off value of the rptw / tpv ratio was 0.300.35) and more than 60% of the transition zone tissue (the cut off value of rptw / tzv ratio was 0.60) should be removed . Roc curve analysis for the influence of intra operative parameters on the evaluated parameters and the overall effectiveness . Resected prostate tissue weight: area under the curve 0.572, p = 0.303, rptw / tzv ratio of the resected prostate tissue weight and the transition zone volume: area under the curve 0.691, p = 0.007; rptw / tpv ratio of the resected prostate tissue weight and the total prostate volume: area under the curve 0.699, p = 0.005 preoperative objective parameters and their difference at six months after transurethral resection of the prostate tpv total prostate volume, tzv transition zone volume, ipss international prostate symptoms score, qol quality of life, pvr post void residual volume, qmax maximal urinary flow rate differences between parameters according to the effectiveness of the treatment tpv total prostate volume, tzv transition zone volume, ipss international prostate symptoms score, qol quality of life, pvr post void residual volume, qmax maximal urinary flow rate, tzv transition zone volume, tpv total prostate volume, rptw resected prostate tissue weight, rptw / tzv ratio of the resected prostate tissue weight and transition zone volume, rptw / tpv ratio of the resected prostate tissue weight and total prostate volume roc curve analysis for the influence of intra operative parameters on the evaluated parameters and overall effectiveness ipss international prostate symptoms score, qol quality of life, qmax maximal urinary flow rate, rptw resected prostate tissue weight, rptw / tzv ratio of the resected prostate tissue weight and the transition zone volume, rptw / tpv ratio of the resected prostate tissue weight and the total prostate volume, area area under the curve significance of the completeness of the resection on changes in the evaluated parameters difference between pre and post operative values, ipss international prostate symptoms score, qol quality of life, qmax maximal urinary flow rate, rptw / tzv ratio of the resected prostate tissue weight and the transition zone volume, rptw / tpv ratio of the resected prostate tissue weight and the total prostate volume turp aims to resect tissue from the transition zone of the prostate to treat luts secondary to bpo . Turp is still regarded as a standard surgical procedure for the treatment of luts secondary to bpo in prostates 80 ml . Despite the growing popularity of pharmacotherapy during the last decades, surgical management of luts is still recommended in certain conditions, including the presence of refractory urinary retention, bladder stones, persistent gross hematuria, recurrent urinary tract infection, renal failure secondary to bpo, or ineffective conservative treatment [8, 9], and provides good results . In a recent analysis of 20 contemporary rcts published between 2005 and 2009 and a maximum follow up of 5 years, turp resulted in an improvement of the mean qmax (162%), a reduction of the mean ipss (70%), and a reduction of the mean qol score (69%) and mean pvr (77%). A study with long term follow up also reported a significant decrease in most symptoms and an improvement in the urodynamic parameters after the mean period of 13 years, which demonstrated the efficacy of turp in long term settings . Generally, the outcome of turp performed for luts is favorable in 7893% of patients . However, the description of the effectiveness of turp was not standardized, and thus, the data could be evaluated critically . According to literature, the best results for the treatment of luts were demonstrated after open prostatectomy [12, 13] when up to 97% of the transition zone can be enucleated during the operation . The logical conclusion is that during the turp, as much tissue as possible should be resected, but data supporting this is insufficient and controversial . The impact of preoperative parameters on treatment related functional results or treatment efficacy has been investigated in various prospective randomized studies . Symptom differentiation between overactive bladder and bop is one of the essential points that can affect postoperative results . In our study, obstructive symptoms were only slightly more expressed than irrigative symptoms (3.3 vs. 3.1 point per ipss question) which could account for the high ineffective results rate . Using more extended questionnaires before the procedure could be helpful with better selection of patients . The investigation of operative parameters is mostly confined to the detection of the removed tissue weight, the duration of the operation, and the values of complications, but they do not estimate the impact on treatment effectiveness . There are only a few studies that have quantified the effect of the amount of the resected tissue or the completeness of the turp on the outcomes in individuals with luts secondary to bop . Suggest that early symptom improvement after turp will depend on the amount of the tissue removed, but symptomatic improvement after turp is not primarily dependent on the relative completeness of the resection . Patients with larger prostates and larger rtw tend to gain more symptomatic benefit from turp than do patients with smaller prostates . Our results showed that rptw as a single parameter had no impact on the effectiveness of turp . Indeed, rtpw directly correlates with the transition zone or total prostate volume, but only completeness of the resection (rptw ratio with tzv> 60%, hr 1.91, or rptw ratio with tpv> 35%, hr 1.6) is a significant predictor of the outcome . A more recent study published by park et al . Did not find any relation between the resected tissue ratio with tzv and clinical improvement after turp . Patients were stratified into 2 subgroups according to the resection ratio (volume of the resected tissue / tzv) <50% and 50% . The authors did not find any significant difference in the improvement of ipss, qmax, or qol scores and pvr after turp when comparing the investigated groups . The conclusion of this study was that the resection ratio had no effect on post turp clinical improvement and that a complete resection of prostate adenoma may not be essential . The interpretation of the data of this study is difficult because in our study, 95% of the patients underwent resection of more than 50% of tzv . Also, attention should be paid to the retrospective study design and the low overall improvement of qmax, qol, and ipss (40%, 46%, and 59%, respectively) comparing our findings or data to other studies . . Found that the resection of less than 30% of the prostatic tissue seems to be sufficient to alleviate luts related to bph . The presented study data raises some important unanswered questions, such as how correct the transabdominal measurement of prostate volume is or what was the increase in qmax and the decrease in pvr we think that the author's final message may be misleading, and the results have to be critically analyzed, as the study suffers from some major methodological flaws . We believe that a resection of less than 30% of tpv can be sufficient in selected cases when tzv accounts for the same percentage as tpv . Study prospectively assessed the results of total and minimal turp in 167 patients with obstructive symptoms caused by bph, and found that a significant relief in symptoms of obstruction and irritation was observed in both groups . Qmax and pvr improvement was also similar between the groups . However, there are no more studies to confirm such long term results . Why is the discussion about the completeness of turp interesting in the urological community? In comparison, there is no data indicating that incomplete open prostatectomy might be suggested . We think that the principle of these operations should be the same to remove all obstructive tissue . It is generally accepted that the duration of the operation and the amount (weight) of the resected tissue are directly associated with an increasing rate of complications . However, recent results on turp complications reported in the analysis of the contemporary rcts are not significantly higher in comparison to those observed with other techniques: bleeding requiring blood transfusion 2%, the duration of the surgery is currently much shorter (mean 38.5 min), compared with an average of 57 and 62.5 min, respectively, in the past cohort reference studies [15, 18]. On the other hand, there are no randomized studies to compare complication rates after incomplete and complete turp . We think that if there are limitations related to the duration of the surgery, or an increase in risk because of high co morbidity, it is better to choose other minimally invasive procedures than to perform an incomplete turp . The first one is that the resection will not be effective if less than 30% of the tpv and 60% of tzv is removed . The second one is that turp could be safely stopped if some unexpected difficulties occur and 30% of tpv and 60% of tzv has been resected . The efficacy of transurethral resection of the prostate during short term follow up depends on the completeness of the resection . An improvement in symptoms, quality of life, and voiding function could be expected when at least 3035% of the total prostate or 60% of the transitional zone has been removed.
|
With an aging population, the prevalence of aortic stenosis (as) is on the rise . As presents as a continuum and patients are typically asymptomatic for a period of time, with onset of symptoms marking a key point in the natural history significantly impacting survival.1 current guidelines recommend aortic valve replacement (avr) for severe as once symptoms occur or when there is ventricular systolic dysfunction.2 the presence of significant as in the absence of symptoms and normal left ventricular ejection fraction (lvef) presents a clinical dilemma . Increasingly, therefore, cardiologists are recognizing that various subtypes of as with preserved lvef have varying outcomes, when separated based on lv stroke volume index (lvsvi).3, 4, 5, 6 the clinician must balance the risk of avr with risk of waiting for symptoms to develop . Waiting too long may have detrimental effects, as prior studies have linked severity of preoperative symptom status with worse postoperative outcome.7 it is increasingly being recognized that structural lv changes, in the setting of significant as, may not always be reversible even after successful valve intervention and may impact longterm survival, even in those with a normal lvef . Additionally, many patients are relatively poor at identifying their symptomatic status due to functional limitation from aging or medical comorbidities . Thus, there is increasing interest in using sensitive markers of lv function, other than parameters derived from contractile function (lvef or lvsvi), to determine outcomes in this population.8, 9, 10, 11, 12, 13, 14 previous studies have established the usefulness of brain natriuretic peptide (bnp) in patients with as.12, 14, 15, 16, 17, 18 these studies have found that bnp levels correlate with symptomfree survival, new york heart association class, and survival.12, 16, 19, 20, 21 left ventricular global longitudinal strain (lvgls), measured using speckle tracking echocardiography, is a quantitative measure of early lv dysfunction, enabling assessment of longitudinally oriented subendocardial myocardial fibers, which are sensitive to ischemia and wall stress in as patients . We sought to determine the incremental prognostic utility of bnp levels and lvgls in a contemporary population of patients with significant as and preserved lvef . This was a retrospective observational cohort study of 531 patients who had an echocardiogram at our tertiary center between january 2007 and january 2008 documenting an aortic valve area (ava) 1.3 cm, lvef 50%, without severe tricuspid / mitral valvular disease and serum bnp measured obtained close to the incident echocardiogram (> 90% on the same day, all within 90 days) and without significant interval change in clinical status . We excluded patients with a limited life expectancy due to noncardiac causes (ie, terminal malignancy, stroke, and advanced lung disease) or death from noncardiac causes within 90 days of incident echocardiogram without having undergone av surgery (n=15), lvef <50% (n=94), and those with poor image quality for strain assessment (n=31). Clinical data were assembled from electronic medical records after appropriate institutional review board approval . For bnp assay, plasma bnp (pg / ml) was determined by chemiluminescence immunoassay on site (biosite diagnostics, san diego, ca). Cardiac procedures were as follows: (1) isolated avr, (2) avr and coronary artery bypass grafting, (3) avr and ascending aorta repair or replacement + / coronary artery bypass grafting, and (4) transcatheter avr . Based on available preoperative data, society of thoracic surgeons (sts) score was calculated . The decision for surgery was made by the individual treating cardiologists and cardiac surgeons at the time of clinical evaluation . Death notification was confirmed by inspection of the death certificate or verified with a family member . In addition, we further categorized death as cardiac, noncardiac (eg, malignancy, cirrhosis of liver, primary pulmonary / neurologic etiology), or unknown . We also performed survival analysis for a secondary outcome of deaths, categorized as cardiac or unknown, but excluding documented noncardiac deaths (censoring these patients at the time of death). All patients underwent a comprehensive echocardiogram with commercially available instruments (philips medical systems, general electric, and siemens medical solutions). Measurements were obtained according to recommendations and indexed to body surface area.22, 23, 24 for quantification of as, lv outflow tract (lvot) diameter was measured on parasternal longaxis views . Pulsedwave and continuouswave doppler was used to record velocities across lvot and aortic valve (av), respectively . A cutoff 35 ml / m was considered as preserved lvsvi.4, 23, 25, 26 ava was calculated using the continuity equation and severe as was defined as ava 1 cm or mean av gradient 40 mm hg . Finally, valvuloarterial impedance (mm hgmlm), a measure of global lv afterload, was calculated as follows27: mean av gradient+systolic blood pressure / lvsvi). In all patients, lvgls measurements were obtained from grayscale images recorded in apical 2, 3, and 4chamber views, using offline velocity vector imaging (syngo vvi; siemens medical solutions, mountain view, ca). The details of our protocol have been described previously.28 measurements were made by an investigator blinded to all clinical information . Continuous variables are expressed as mean (sd) and/or median and compared using analysis of variance (normal distribution) or mann whitney test (nonnormal distribution). Categorical data are expressed as a percentage and compared using . Association between continuous variables was tested using spearman's correlation coefficient . To assess outcomes, relevant clinical and echocardiographic variables, known to be associated with outcomes in as patients, were considered . For each patient undergoing avr, the analysis time was modeled so that only the persontime after avr was included in the surgical group . Hazard ratios with 95% ci were calculated . To ensure that proportional hazards assumption was not violated, graphical inspection of schoenfield residuals plotted against time was performed . Additionally, survival curves for cumulative events as a function over time were obtained using cox proportional hazards model and adjusted for relevant variables described above . In addition, discriminative ability of various survival models was compared using the cstatistic.29 statistical analysis was performed using spss version 11.5 (spss inc, chicago, il), stata version 10.0 (statacorp, college station, tx), and r 3.0.3 (r foundation for statistical computing, vienna, austria). This was a retrospective observational cohort study of 531 patients who had an echocardiogram at our tertiary center between january 2007 and january 2008 documenting an aortic valve area (ava) 1.3 cm, lvef 50%, without severe tricuspid / mitral valvular disease and serum bnp measured obtained close to the incident echocardiogram (> 90% on the same day, all within 90 days) and without significant interval change in clinical status . We excluded patients with a limited life expectancy due to noncardiac causes (ie, terminal malignancy, stroke, and advanced lung disease) or death from noncardiac causes within 90 days of incident echocardiogram without having undergone av surgery (n=15), lvef <50% (n=94), and those with poor image quality for strain assessment (n=31). Clinical data were assembled from electronic medical records after appropriate institutional review board approval . For bnp assay, plasma bnp (pg / ml) was determined by chemiluminescence immunoassay on site (biosite diagnostics, san diego, ca). Cardiac procedures were as follows: (1) isolated avr, (2) avr and coronary artery bypass grafting, (3) avr and ascending aorta repair or replacement + / coronary artery bypass grafting, and (4) transcatheter avr . Based on available preoperative data, society of thoracic surgeons (sts) score was calculated . The decision for surgery was made by the individual treating cardiologists and cardiac surgeons at the time of clinical evaluation . Death notification was confirmed by inspection of the death certificate or verified with a family member . In addition, we further categorized death as cardiac, noncardiac (eg, malignancy, cirrhosis of liver, primary pulmonary / neurologic etiology), or unknown . We also performed survival analysis for a secondary outcome of deaths, categorized as cardiac or unknown, but excluding documented noncardiac deaths (censoring these patients at the time of death). All patients underwent a comprehensive echocardiogram with commercially available instruments (philips medical systems, general electric, and siemens medical solutions). Measurements were obtained according to recommendations and indexed to body surface area.22, 23, 24 for quantification of as, lv outflow tract (lvot) diameter was measured on parasternal longaxis views . Pulsedwave and continuouswave doppler was used to record velocities across lvot and aortic valve (av), respectively . A cutoff 35 ml / m was considered as preserved lvsvi.4, 23, 25, 26 ava was calculated using the continuity equation and severe as was defined as ava 1 cm or mean av gradient 40 mm hg . Finally, valvuloarterial impedance (mm hgmlm), a measure of global lv afterload, was calculated as follows27: mean av gradient+systolic blood pressure / lvsvi). In all patients, lvgls measurements were obtained from grayscale images recorded in apical 2, 3, and 4chamber views, using offline velocity vector imaging (syngo vvi; siemens medical solutions, mountain view, ca). The details of our protocol have been described previously.28 measurements were made by an investigator blinded to all clinical information . Continuous variables are expressed as mean (sd) and/or median and compared using analysis of variance (normal distribution) or mann whitney test (nonnormal distribution). Categorical data are expressed as a percentage and compared using . Association between continuous variables was tested using spearman's correlation coefficient . To assess outcomes, relevant clinical and echocardiographic variables, known to be associated with outcomes in as patients, were considered . For each patient undergoing avr, the analysis time was modeled so that only the persontime after avr was included in the surgical group . Hazard ratios with 95% ci were calculated . To ensure that proportional hazards assumption was not violated, graphical inspection of schoenfield residuals plotted against time was performed . Additionally, survival curves for cumulative events as a function over time were obtained using cox proportional hazards model and adjusted for relevant variables described above . In addition, discriminative ability of various survival models was compared using the cstatistic.29 statistical analysis was performed using spss version 11.5 (spss inc, chicago, il), stata version 10.0 (statacorp, college station, tx), and r 3.0.3 (r foundation for statistical computing, vienna, austria). A pvalue of <0.05 was considered significant . The baseline data are shown in tables 1 and 2 . In the study, the vast majority (n=459, 86%) of the patients had ava 1 cm, while 72 (16%) had moderate as (ava [11.3 cm]). There were no major clinical differences between these subgroups, except for higher age (7212 versus 6516 years), higher proportion of symptoms (87% versus 65%), higher sts score (11.55% versus 8.54%), and higher median bnp (145 versus 92 pg / ml) in those with severe versus moderate as (all p<0.05). Similarly, indexed lv mass (11945 versus 9332 g / m), mean aortic valve gradient (4516 versus 2210 mm hg), and ava (0.70.2 versus 1.20.1 cm) were significantly worse in severe as versus moderate as (all p<0.01). Median lvgls was 13.9% (interquartile range 16.3% to 11.5%), and slightly worse in severe versus moderate as (13.6% versus 14.2%, p=0.04). Lvgls had a statistically significant but weak association with lvef (0.3, p<0.001) and lvsvi (0.20, p<0.001), indexed lv mass (0.19, p<0.001), and bnp (0.24, p<0.001). Similarly, there was a significant but weak association between bnp and lvef (0.14, p=0.002) and indexed lv mass (0.20, p<0.001), but no association with lvsvi (0.04, p=0.3). Baseline characteristics of the study population all continuous variables reported as mean (sd). Ace indicates angiotensinconverting enzyme; bnp, brain natriuretic peptide; bsa, body surface area; cad, coronary artery disease; gfr, glomerular filtration rate; hdl, highdensity lipoprotein; icd, internal cardioverter defibrillator; iql, interquartile range; ldl, lowdensity lipoprotein; nyha, new york heart association; ohs, open heart surgery . Echocardiographic characteristics of the study population all continuous variables reported as mean (sd). Av indicates aortic valve; edd, enddiastolic dimension; esd, endsystolic dimension; la, left atrium; lv, left ventricle; lvgls, left ventricular global longitudinal strain; lvot, left ventricular outflow tract; lvsvi, left ventricular stroke volume index; rvsp, right ventricular systolic pressure . Mean lvgls values (%) for each bnp quartile were as follows: quartile 1 (15.23), quartile 2 (14.33), quartile 3 (13.43), and quartile 4 (12.64), p<0.001 . (ml / m) for each lvgls quartile were as follows: quartile 1 (4110), quartile 2 (3910), quartile 3 (3910), and quartile 4 (359), p<0.001 . The median bnp values (pg / ml) for lvgls quartiles were as follows: quartile 1 (95 [41212]), quartile 2 (109 [44204]), quartile 3 (154 [60307]), and quartile 4 (228 [97429]), p<0.001 . Finally, the mean lvsvi values for each bnp quartile were as follows: quartile 1 (4011), quartile 2 (3810), quartile 3 (3810), and quartile 4 (389), p=0.4 . Overall, 405 patients (76%) underwent avr and 126 (24%) were treated medically . Of the avr patients, 179 (44%) underwent isolated surgical avr, 18 (4%) underwent transcatheter avr, and the rest underwent a combination procedure (avr+ coronary artery bypass grafting + / there was no difference in lvgls in patients requiring concomitant coronary artery bypass grafting (13.63% versus 13.94%, respectively, p=0.1). The relevant parameters of the study sample, divided on whether they underwent avr versus medical therapy, are shown in table 3 . Relevant characteristics of the study population, separated on basis of aortic valve replacement versus medical therapy ace indicates angiotensinconverting enzyme; avr, aortic valve replacement; bnp, brain natriuretic peptide; cad, coronary artery disease; gfr, glomerular filtration rate; iql, interquartile range; lvgls, left ventricular global longitudinal strain; nyha, new york heart association; ohs, open heart surgery; rvsp, right ventricular systolic pressure . During 4.72 years of followup, mortality was observed in 161 (30%) patients (6 [1%] deaths within 30 days postavr). The breakdown of deaths was as follows: 94 (58%) cardiac, 17 (11%) documented noncardiac, and 49 (31%) unknown (however, none of them had a clearly documented noncardiac etiology to account for death). The proportion of deaths was similar between severe and moderate as (137 [30%] versus 24 [33%]), with no difference in survival during followup (p=0.1). Results of multivariable cox proportional hazard survival analysis (for allcause mortality) are shown in table 4a and 4b . The for allcause mortality incrementally increased as follows: sts score 31, sts+bnp 77, sts+bnp+lvgls 120, and sts+bnp+lvgls+avr 140, all p<0.001 . Using the integrated discrimination index, the ability of various models to predict mortality incrementally increased as follows: cstatistic for sts score was 0.60 (0.580.64), for sts score+bnp was 0.67 (0.620.70), and sts score+ bnp+lvgls was 0.74 (0.680.78). The cstatistic for sts score+bnp+lvgls+avr further increased to 0.79 (0.720.84), all p<0.01 . Multivariable cox proportional hazard analysis for allcause mortality in the study population in part (a), the following variables were considered for analysis: age, sex, symptoms, comorbidities, pacemaker, defibrillator, medications, indexed left ventricular mass and systolic dimension, left atrial volume index, ejection fraction, diastolic function, stroke volume index, aortic valve area, aortic valve mean gradient, aortic and mitral regurgitation, global longitudinal strain, brain natriuretic peptide (bnp), aortic valve surgery, and type and time of surgery . Nyha indicates new york heart association . In part (b), variables that constitute sts score were not considered for analysis . Because of collinearity, only stroke volume index (and not valvuloarterial impedance) was considered for the model . Bnp indicates brain natriuretic peptide; gls, global longitudinal strain; idi, integrated discrimination index; lvsvi, left ventricular stroke volume index; nyha, new york heart association; sts, society of thoracic surgeons . The proportion of allcause deaths, separated on the basis of bnp quartiles was as follows: quartile 1 (14 [11%]), quartile 2 (34 [25%]), quartile 3 (42 [32%]), and quartile 4 (71 [54%]). Figure 2a illustrates the adjusted survival curves stratified according to increasing bnp quartiles (p<0.001). The proportion of deaths, separated on the basis of lvgls quartiles was as follows: quartile 1 (22 [17%]), quartile 2 (33 [25%]), quartile 3 (39 [31%]), and quartile 4 (67 [47%]). Figure 2b illustrates the adjusted survival curves stratified according to worsening lvgls quartiles (p<0.001). Adjusted survival curves demonstrating outcomes based on various quartiles of (a) brain natriuretic peptide (bnp) and (b) left ventricular global longitudinal strain (lvgls). Subsequently, in order to understand the interplay between lvgls and bnp, we created 4 subgroups, based on medians . The proportion of deaths, based on these 4 subgroups, were as follows: (1) lvglsmedian (ie, better value) and bnp <median (21/161 [13%]); (2) lvgls median, bnpmedian (33/102 [32%]); (3) lvgls <median, bnp <median (27/106 [26%]); and (4) lvgls <median (ie, worse value) and bnp median (80/162 [49%]). Figure 3 illustrates the survival curves according to lvgls and bnp medians (p<0.001). Adjusted survival curves demonstrating outcomes based on 4 subgroups derived based on brain natriuretic peptide (bnp) and left ventricular global longitudinal strain (lvgls) levels better or worse than median . The breakdown of deaths, according to symptoms and lvgls / bnp was as follows: asymptomatic and both, lvgls and bnp better than median (5/51 or 10%), asymptomatic and 1 or both, lvgls and bnp worse than median (20/64 or 31%), symptomatic and both, lvgls and bnp better than median (16/110 or 15%) and symptomatic, and 1 or both, figure 4 illustrates the survival curves according to symptom status and whether bnp / lvgls were better or worse than median (p<0.001). Even in asymptomatic patients, the mortality was significantly high in the setting of 1 or both, lvgls and bnp worse than median . Adjusted survival curves demonstrating outcomes of 4 subgroups, based on whether both brain natriuretic peptide (bnp) and left ventricular global longitudinal strain (lvgls) were better than median or 1/both were worse than median and symptoms . The breakdown of allcause deaths, according to median sts score (median 7.3 [3.912.9]) and lvgls / bnp was as follows: sts score <median and both, lvgls and bnp better than median (8/79 or 10%), sts score <median and 1 or both, lvgls and bnp worse than median (52/184 or 28%), sts score median and both, lvgls and bnp better than median (13/81 or 16%) and sts score median, and 1 or both, lvgls and bnp worse than median (88/187 or 47%). Figure 5 illustrates the survival curves of patients stratified according to sts score and whether bnp / lvgls were better or worse than median (p<0.001). Even in patients with sts scores lower than median, the mortality was significantly high in the setting of 1 or both, lvgls and bnp worse than median . Adjusted survival curves demonstrating outcomes of 4 subgroups, based on whether both brain natriuretic peptide (bnp) and left ventricular global longitudinal strain (lvgls) were better than median or 1/both were worse than median, and sts score better or worse than median . Multivariable cox proportional hazard survival analysis, for the secondary outcome (cardiac mortality and death due to unknown causes, excluding noncardiac deaths, n=143) demonstrated that increasing sts score (hazard ratio 1.05 [1.011.09]), every 10 pg / ml increase in bnp (1.08 [1.061.11]), every unit worsening of lvgls (hazard ratio 1.12 [1.061.18]), and av surgery (0.36 [0.240.52]) were independent predictors (for the model 104, p<0001). During 4.72 years of followup, mortality was observed in 161 (30%) patients (6 [1%] deaths within 30 days postavr). The breakdown of deaths was as follows: 94 (58%) cardiac, 17 (11%) documented noncardiac, and 49 (31%) unknown (however, none of them had a clearly documented noncardiac etiology to account for death). The proportion of deaths was similar between severe and moderate as (137 [30%] versus 24 [33%]), with no difference in survival during followup (p=0.1). Results of multivariable cox proportional hazard survival analysis (for allcause mortality) are shown in table 4a and 4b . The for allcause mortality incrementally increased as follows: sts score 31, sts+bnp 77, sts+bnp+lvgls 120, and sts+bnp+lvgls+avr 140, all p<0.001 . Using the integrated discrimination index, the ability of various models to predict mortality incrementally increased as follows: cstatistic for sts score was 0.60 (0.580.64), for sts score+bnp was 0.67 (0.620.70), and sts score+ bnp+lvgls was 0.74 (0.680.78). The cstatistic for sts score+bnp+lvgls+avr further increased to 0.79 (0.720.84), all p<0.01 . Multivariable cox proportional hazard analysis for allcause mortality in the study population in part (a), the following variables were considered for analysis: age, sex, symptoms, comorbidities, pacemaker, defibrillator, medications, indexed left ventricular mass and systolic dimension, left atrial volume index, ejection fraction, diastolic function, stroke volume index, aortic valve area, aortic valve mean gradient, aortic and mitral regurgitation, global longitudinal strain, brain natriuretic peptide (bnp), aortic valve surgery, and type and time of surgery . Nyha indicates new york heart association . In part (b), variables that constitute sts score were not considered for analysis . Because of collinearity, only stroke volume index (and not valvuloarterial impedance) was considered for the model . Bnp indicates brain natriuretic peptide; gls, global longitudinal strain; idi, integrated discrimination index; lvsvi, left ventricular stroke volume index; nyha, new york heart association; sts, society of thoracic surgeons . The proportion of allcause deaths, separated on the basis of bnp quartiles was as follows: quartile 1 (14 [11%]), quartile 2 (34 [25%]), quartile 3 (42 [32%]), and quartile 4 (71 [54%]). Figure 2a illustrates the adjusted survival curves stratified according to increasing bnp quartiles (p<0.001). The proportion of deaths, separated on the basis of lvgls quartiles was as follows: quartile 1 (22 [17%]), quartile 2 (33 [25%]), quartile 3 (39 [31%]), and quartile 4 (67 [47%]). Figure 2b illustrates the adjusted survival curves stratified according to worsening lvgls quartiles (p<0.001). Adjusted survival curves demonstrating outcomes based on various quartiles of (a) brain natriuretic peptide (bnp) and (b) left ventricular global longitudinal strain (lvgls). Subsequently, in order to understand the interplay between lvgls and bnp, we created 4 subgroups, based on medians . The proportion of deaths, based on these 4 subgroups, were as follows: (1) lvglsmedian (ie, better value) and bnp <median (21/161 [13%]); (2) lvgls median, bnpmedian (33/102 [32%]); (3) lvgls <median, bnp <median (27/106 [26%]); and (4) lvgls <median (ie, worse value) and bnp median (80/162 [49%]). Figure 3 illustrates the survival curves according to lvgls and bnp medians (p<0.001). Adjusted survival curves demonstrating outcomes based on 4 subgroups derived based on brain natriuretic peptide (bnp) and left ventricular global longitudinal strain (lvgls) levels better or worse than median . The breakdown of deaths, according to symptoms and lvgls / bnp was as follows: asymptomatic and both, lvgls and bnp better than median (5/51 or 10%), asymptomatic and 1 or both, lvgls and bnp worse than median (20/64 or 31%), symptomatic and both, lvgls and bnp better than median (16/110 or 15%) and symptomatic, and 1 or both, lvgls and bnp worse than median (120/306 or 39%). Figure 4 illustrates the survival curves according to symptom status and whether bnp / lvgls were better or worse than median (p<0.001). Even in asymptomatic patients, the mortality was significantly high in the setting of 1 or both, lvgls and bnp worse than median . Adjusted survival curves demonstrating outcomes of 4 subgroups, based on whether both brain natriuretic peptide (bnp) and left ventricular global longitudinal strain (lvgls) were better than median or 1/both were worse than median and symptoms . The breakdown of allcause deaths, according to median sts score (median 7.3 [3.912.9]) and lvgls / bnp was as follows: sts score <median and both, lvgls and bnp better than median (8/79 or 10%), sts score <median and 1 or both, lvgls and bnp worse than median (52/184 or 28%), sts score median and both, lvgls and bnp better than median (13/81 or 16%) and sts score median, and 1 or both, lvgls and bnp worse than median (88/187 or 47%). Figure 5 illustrates the survival curves of patients stratified according to sts score and whether bnp / lvgls were better or worse than median (p<0.001). Even in patients with sts scores lower than median, the mortality was significantly high in the setting of 1 or both, lvgls and bnp worse than median . Adjusted survival curves demonstrating outcomes of 4 subgroups, based on whether both brain natriuretic peptide (bnp) and left ventricular global longitudinal strain (lvgls) were better than median or 1/both were worse than median, and sts score better or worse than median . Multivariable cox proportional hazard survival analysis, for the secondary outcome (cardiac mortality and death due to unknown causes, excluding noncardiac deaths, n=143) demonstrated that increasing sts score (hazard ratio 1.05 [1.011.09]), every 10 pg / ml increase in bnp (1.08 [1.061.11]), every unit worsening of lvgls (hazard ratio 1.12 [1.061.18]), and av surgery (0.36 [0.240.52]) were independent predictors (for the model 104, p<0001). In our observational study of contemporary patients with significant as and preserved lvef, we demonstrate that increasing bnp levels and worsening lvgls were independent predictors of mortality, providing additive (rather than duplicative) prognostic utility . Furthermore, using integrated discrimination improvement, we demonstrate that addition of bnp and lvgls further improved our ability to reclassify mortality risk in as patients . It appears that lvgls and bnp could potentially help us identify patients who could benefit from earlier avr . We included patients with patients with ava 1.0 to 1.3 cm because as is a continuum and we wanted to evaluate survival of these patients visavis current therapeutic techniques . Asymptomatic patients had significantly worse survival, in the setting of abnormal lvgls and/or bnp . This impact on survival was also seen in the subgroup with low sts scores, where patients with lvgls and/or bnp worse than median had significantly worse outcomes versus those with normal lvgls and bnp . However, the study is potentially underpowered to make conclusive assertions about subgroup analyses; and a larger, prospective study is needed to be conclusively assertive . In the current study, when bnp and lvgls were considered for survival analysis, known predictor such as lvsvi did not maintain statistical significance . This is likely because sensitive markers such as lvgls and bnp become abnormal earlier in the disease cascade, as compared to flowdependent markers such as lvsvi . Additionally, there are known inherent technical limitations in measuring lvsvi, which takes lvot area into account . As previously described, lvot area can be potentially inaccurate on 2dimensional echocardiography when compared to gated computed tomographic techniques.30 this potentially generates erroneous lvsvi values, which results in misclassifying as patients into different strata with varying risk profiles . In patients with as, in order to compensate for increased wall stress and preserve lvef, there is progression of lv hypertrophy . However, lvef eventually drops and in this setting, if avr is not performed, there is a significant reduction in survival . Therefore, objective and sensitive parameters that identify early lv dysfunction, prior to a drop in lvef could potentially have a big impact on appropriate timing of surgery and in turn, potential survival . Bnp is released in response to increased ventricular wall stress, and our data are in agreement with previous studies that have shown that bnp levels correlate with survival.8, 10, 11, 12, 13, 14 however, bnp is nonspecific, with multiple clinical situations resulting in elevated values . Also, as demonstrated in the current study, bnp levels appear to be lower in as patients in particular (and valvular heart disease in general) than in other etiologies of heart failure . Hence, different bnp thresholds may be needed in valvular heart disease to adequately predict outcomes . A previous report has suggested the use of different thresholds, based on age and sex.31 a recent report utilized bnp ratios generated based on these thresholds and demonstrated incremental prognostic utility of bnp in the setting of significant as.16 lvgls is much more sensitive in detecting subtle abnormalities in myocardial mechanics and may indicate pathology before evident on conventional indices of lv function . Previous studies have indeed demonstrated that impairment in lvgls can occur even in the setting of a preserved lvef, due to subendocardial ischemia and fibrosis.32, 33 additionally, reduced lvgls is associated with poorer outcomes in patients with significant as,28, 34 with preoperative lvgls an independent predictor of postoperative outcomes.11 using these markers provides synergistic risk stratification in patients with significant as prior to onset of overt lv systolic dysfunction or symptoms . In patients with significant as and preserved lvef, a combination of bnp and lvgls provides synergistic risk stratification, independent of symptoms, risk factors, and echocardiographic variables . Prospective studies are needed to determine whether onset of changes in these parameters rather than waiting for symptoms or onset of abnormal lvef may be more appropriate to determine valve intervention timing . Additionally, a risk score, incorporating these markers alongside other clinical and echocardiographic markers, could be developed and prospectively validated in asymptomatic patients with significant as . This was an observational retrospective study conducted at a large tertiary care center and is likely not free from referral bias . Not all patients with severe as seen at our institution had bnp levels obtained in close proximity to the echocardiogram . However, the baseline characteristics of the current study population were similar to those that did not have bnp levels measured . During followup, only a small proportion of patients underwent isolated avr, making this a heterogeneous population, where other factors such as coronary artery disease and aortic disease could have affected outcomes . However, as patients tend to be typically older with many comorbidities, and our study reflects the current state of practice in most valve centers . The biggest utility of these newer markers would potentially be in asymptomatic patients with significant as to determine appropriate timing of surgery, and not in those with symptoms who already would meet criteria for surgery . However, the study is potentially underpowered to make conclusive assertions about this specific subgroup . We report allcause mortality as the primary end point, as opposed to cardiac mortality . However, on secondary outcomes analysis, where documented noncardiac deaths were excluded, the basic results were similar . In patients with significant as and preserved lvef, a combination of bnp and lvgls provides synergistic risk stratification, independent of symptoms, risk factors, and echocardiographic variables . Prospective studies are needed to determine whether onset of changes in these parameters rather than waiting for symptoms or onset of abnormal lvef may be more appropriate to determine valve intervention timing . Additionally, a risk score, incorporating these markers alongside other clinical and echocardiographic markers, could be developed and prospectively validated in asymptomatic patients with significant as . This was an observational retrospective study conducted at a large tertiary care center and is likely not free from referral bias . Not all patients with severe as seen at our institution had bnp levels obtained in close proximity to the echocardiogram . However, the baseline characteristics of the current study population were similar to those that did not have bnp levels measured . During followup, only a small proportion of patients underwent isolated avr, making this a heterogeneous population, where other factors such as coronary artery disease and aortic disease could have affected outcomes . However, as patients tend to be typically older with many comorbidities, and our study reflects the current state of practice in most valve centers . The biggest utility of these newer markers would potentially be in asymptomatic patients with significant as to determine appropriate timing of surgery, and not in those with symptoms who already would meet criteria for surgery . However, the study is potentially underpowered to make conclusive assertions about this specific subgroup . We report allcause mortality as the primary end point, as opposed to cardiac mortality . However, on secondary outcomes analysis, where documented noncardiac deaths were excluded, the basic results were similar . In patients with significant as and preserved lvef, a combination of bnp and lvgls predicts mortality . Assessment of lvgls and bnp could have a potential role in synergistic improvement in risk stratification of as patients with a preserved lvef, especially those perceived to be without symptoms and/or deemed at a low risk.
|
Portal annular pancreas (pap) is a rare variant in which the uncinate process of the pancreas extends to the dorsal surface of the pancreas body and surrounds the portal vein or superior mesenteric vein (smv). Recent progress has made it possible to diagnose pap preoperatively with contrast - enhanced multidetector computed tomography (mdct) or magnetic resonance imaging . Nevertheless, pap is still not recognized as an important finding in cases of pancreas cut surface reconstruction . Most cases of pap have been reported during pancreaticoduodenectomy (pd) [1, 2, 3, 4, 5]. Upon pd, when the pancreas is cut at the neck, which is located at the left side of the portal vein, two cut surfaces of the pancreas are created . Thus, the cut surface of the pancreas becomes larger than usual and the dorsal cut surface is behind the portal vein, therefore pancreatic fistula after pd has been reported frequently [2, 5]. Here, we report a patient with pap who underwent subtotal stomach - preserving pd (ssppd) and additional pancreas resection 1 cm distal to the pancreas tail to the left side of the original resection line . This allowed us to perform safe pancreatic jejunal anastomosis . Her unconsciousness was due to hypoglycemia and she recovered quickly after intravenous administration of glucose . For about 2 years, she had been aware of palpitations, cold sweat and nausea that improved after consuming sweets during exercise . She was admitted to the department of surgery and science, kyushu university with suspicion of insulinoma of the pancreas head . Complete blood cell count was normal; immunoreactive insulin level was 178 u / ml and fasting blood sugar 56 mg / dl . Serum levels of glucagon, gastrin, growth hormone, adrenocorticotropic hormone, thyroid - stimulating hormone and free t4 were within normal limits . The tumor markers pro - gastrin - releasing peptide, neuron - specific enolase, carcinoembryonic antigen and carbohydrate antigen 19.9 were also within normal limits . On contrast - enhanced mdct, an enhanced 2-cm nodule was detected in the pancreas head . When the pancreas head was dissected at the usual level, which was to the left of the portal vein, the uncinate process was extended and fused to the dorsal surface of the pancreas body . Pancreatic duct - like structures were observed in the usual place and the extended uncinate process . Reconstruction of the pancreas cut surface seemed to be difficult, and additional resection of the pancreas body 1 cm distal to the pancreas tail to the left side of the original resection line was performed . On the new cut surface, there was only one pancreatic duct in the usual place and pancreaticojejunostomy was performed as usual . After the operation, mdct revealed an extended uncinate process of the pancreas that was fused to the dorsal surface of the pancreas body by surrounding the portal vein (fig . No postoperative complications such as pancreatic fistula occurred, and the patient was discharged from hospital on day 22 after the operation . Pap is an anatomical variant in which the uncinate process extends and joins the dorsal area of the pancreas body . The portal vein and/or the smv are surrounded by the uncinate process of the pancreas . Reviewed 700 abdominal contrast - enhanced mdct scans, irrespective of the patients' disease and sex, and diagnosed 8 cases (1.14%) of pap . There are no clinical symptoms related to pap, and it emerges only when operative intervention is required . Proposed another pap classification that categorizes cases according to the location of the main pancreatic duct . The main pancreatic duct is posterior to the portal vein because the ventral bud of the pancreas fuses with the dorsal area of the pancreas body in type i pap . Type ii pap is associated with pancreas divisum and the main pancreatic duct is posterior to the portal vein . Type iii pap is when the uncinate process alone is involved in encasement of the portal vein and/or smv . Sugiura et al . Reported the first case of pap in 1987 . To the best of our knowledge, 5 cases of pap in patients who have undergone pd have been reported to date [1, 2, 3, 4, 5]. Reconstruction of the pancreas cut surface in pd is difficult and crucial in pap for the following reasons: (1) the cut surface of the pancreas is larger than usual, (2) the dorsal cut surface of the pancreas is located in the dorsal portal vein, and (3) a pancreatic duct can be observed in the uncinate process . The standard operative procedure for reconstruction of the pancreatic cut surface in pap has not been determined to date . Sugiura et al . Closed the pancreas cut surface by suture when it was dorsal to the smv . Divided the fused region of the uncinate process and dorsal area of the pancreas body . Pancreatic fistula occurred in 2 of 4 cases with pd that had information about postoperative complications . Closure of the dorsal cut surface by suture should be avoided in patients with type i and ii pap according to the classification of joseph et al ., because the main pancreatic duct is located at the dorsal cut surface . Even when the main pancreatic duct is found at the dorsal pancreas cut surface in patients with type i and ii pap, anastomosis of the pancreatic duct and jejunum is technically difficult because fine anastomosis has to be done behind the portal vein . Additional resection of the pancreas body to the left of the original resection line seems to be reasonable and can make the cutting surface the same as usual anatomically, although this method has not been reported previously . By adding further resection, only one pancreatic duct according to karasaki et al ., the mean length of the fusion between the lingual projection and the body of the pancreas was 9.4 mm, therefore an additional 1-cm resection of the pancreas body may be sufficient for safe anastomosis (fig ., additional resection of the pancreas body may be a standardized procedure in patients with pap who are undergoing reconstruction of the pancreas cut surface.
|
Osas is one of the most significant health problems in middle - aged people and leads to daytime sleepiness and cognitive deficiencies as well as many systemic diseases . It is a highly prevalent disorder, and at least 4% of middle - aged males and 2% of middle - aged females are estimated to be affected . Diagnosis of osas is essentially performed via patient history, clinical examination, and some anthropometric measurements . Overnight in - laboratory psg is used most widely to confirm or to refute a suspected osas . However, in - lab psg's limited availability, its high cost, and time- and labor - consuming nature are its disadvantages . The waiting lists of sleep clinics for psg are quite long, and it is difficult to perform psg on all patients suspected of osas . Thus, many studies that aim to diagnose osas via clinical findings and easily applicable tests have been carried out . To this aim, multivariate clinical prediction formulas have been developed using mathematical modeling to assess ambulatory psg, nap or half night psg, morphometric analysis, self - reported symptoms, and questionnaires . While declared prediction models using logistic regression have high sensitivity (more than 85%), their specificity is low (less than 55%). Because a low cost and less time - consuming diagnostic method is needed, this study aims to evaluate the predictive values of symptoms and anthropometric, laboratory, and physical examination findings in order to determine a formula to detect osas in patients earlier and to reduce the constantly increasing psg density in our sleep centers . In this observational study, we retrospectively evaluated 390 consecutive, unselected subjects who were referred to the sleep laboratory of a university hospital to evaluate presumed sleep - disordered breathing and who had undergone psg . Each individual included in this study was referred to sleep laboratory by otolaryngology department after detailed ear, nose, and throat examination which was performed by the same specialist . Demographic data (age, gender, smoking history, and alcohol and psychotropic drug use), anthropometric measurements (height, weight, body mass index, and circumferences of neck, waist, and hip), and medical history were evaluated . Bmi, the most commonly used method to measure obesity, was calculated by dividing weight in kilograms by the square of height in meters (kg / m). Hip circumference was measured in centimeters while patients were standing still and their feet were fairly close and at the level of the point where the maximum circumference over the buttocks was measured . After asking patients about their complaints, the following parameters emerged: snoring, witnessed apnea, the existence of nasal obstruction, smoking, and alcohol use . Subjective daytime sleepiness was assessed by using the turkish version of the epworth sleepiness scale (ess). Pulmonary function tests (including spirometry and flow volume curves), chest x - rays, pulse oximeters in polyclinics to evaluate peripheral oxygen saturation (plus med - pulse oximeter, plus 50-dl, contec medical systems), arterial blood gas analysis, and a full - night in - laboratory psg were performed on all subjects . Parameters obtained in these examinations were included in statistical evaluations and included the following: protrusion and retrusion of the mandibles, tonsil sizes, the relationship between the soft palate and the neutral position of the tongue, the tongue - base size, nasal septum deviation, the inferior turbinate size, the endoscopic nasal cavity, and nasopharynx examinations using a 0 rigid endoscope, endoscopic larynx, and hypopharynx examinations using a 70 rigid endoscope (4 mm, 18 cm, korl storz hopkins, tuttlingen, germany). Mandibular retrognathism was evaluated in accordance with the position of the pogonion when the virtual imaginary line between the vermilion line and the chin on a patient sitting in a frankfort horizontal position is taken into consideration . The examinations of the oral cavity started with an inspection of the relative position of the hard and of the soft palate to the tongue inside the mouth, without protrusion using the modified mallampati index (mmi), ranging from class i to class iv, with class i representing the highest visibility (the tonsils, the pillars, and the soft palate being visible) and class iv representing the lowest level of visibility (only the hard palate being visible) of the posterior oropharynx . The tonsils were classified by degree in accordance with hypertrophy, from degree i to degree iv as follows: tonsils in the tonsillary fossa and they are barely seen behind the anterior pillars were grade i, tonsils that occupied 25% of the oropharynx were grade ii, tonsils that occupied 50% of the oropharynx were grade iii, and tonsils that occupied at least 75% of the oropharynx were grade iv, if they meet in the midline . The tongue was classified as grade 1 when the vallecula was partially visible in an examination using a 70 rigid endoscope, while the tongue was in an easy position within the mouth; it was classified as grade 2 when the vallecula was invisible and the tongue base touched the epiglottis; and when the tongue base pushed the epiglottis, it was classified as grade 3 . Nasal examinations were performed via anterior rhinoscopy and a 0 rigid endoscope, and internal nasal pathways were evaluated following research on pathology, such as septum deviation, turbinate hypertrophy, and intranasal obstructive lesions, such as polypus . The movement of obstructive lesions and the vocal cords in the larynx and in the hypopharynx was evaluated following a larynx examination via a 70 rigid endoscope . All subjects underwent a full overnight in - laboratory diagnostic psg (compumedics e series, australia or alice 5 diagnostic sleep system, philips, respironics, usa). Psg consisted of monitoring of sleep by electroencephalography, electrooculography, electromyography, airflow, and respiratory muscle effort and included measures of electrocardiographic rhythm and blood oxygen saturation . Thoracoabdominal plethysmograph, oronasal temperature thermistor, and nasal - cannula pressure transducer system were used to identify apneas and hypopneas . Ahi was the sum of the number of apneas and hypopneas per hour of sleep . Osas was defined as an ahi of 5 events / h and the presence of clinical symptoms, for example, excessive daytime sleepiness, loud snoring, witnessed apneas, and nocturnal choking, or ahi of 15 events / h without any osas symptoms . Besides, an ahi of <5 events / h was considered within normal limits . First, the correlation between the ahi and all of the variables included in the study was analyzed in order to identify variables to be used to predict the ahi . Mann - whitney u test was performed to evaluate the statistical difference between ahi values of men and women . Following this test it was not a statistically significant difference between men and women according to ahi values (p = 0.190) we found in the results of the kolmogorov - smirnov test that variables did not demonstrate normal distribution . Spearman's rank order correlation analysis was performed because variables did not provide normal distribution as required . Following this analysis, variables that were identified to have had a correlation with the ahi were integrated into the regression analysis . Each variable was integrated into the regression in order to identify how these variables as a whole affected the ahi via a step - by - step, multiple linear regression analysis . The demographic data (age, gender, smoking history, and alcohol and psychotropic drug use), anthropometric measurements (height, weight, body mass index, and circumferences of the neck, waist, and hips), and medical history variables are shown in table 1 . Variables that were integrated into the regression analysis after we found that they were correlated with the ahi in spearman's rho test were the bmi, nc, wc, hip circumference (hc), smoking rate in packages / year, force vital capacity (fvc), forced expiratory volume ratio in one second (fev1%), fev1/fvc ratio, pao2, paco2, ess score, oxygen saturation level via a pulse oximeter, the epworth scale score, and tonsil size . Correlation coefficients of these variables in nonparametric spearman's rank order correlation analysis are shown in table 2 . Thereafter, each variable was integrated into the regression analysis in order to identify how these variables as a whole affected the ahi via a step - by - step multiple linear regression analysis . In the seventh phase, therefore, the following model was developed to predict the ahi: ahi prediction = (0.797 bmi) + (2.286 nc) (1.272 spo2) + (5.114 ts) + (0.314 wc). The most significant variables in the regression model developed to the ahi prediction via a step - by - step multilinear regression analysis are shown in table 3 . We found this model to be statistically significant (f = 155.348, p <0.05). According to this formula, 68.2% of the variation in the ahi could be explained via these variables, while 32.8% could be attributed to other variables . Bland altman plot comparing real ahi values obtained from psg and the predicted ahi values obtained from the prediction formula is shown in figure 1 . Some studies have shown that data based on medical history and the findings of the physical examination may be useful to detect osas in patients . Hoffstein and szalai obtained a sensitivity of 60% and a specificity of 63% in the detection of osas in patients in a study that included 594 patients and aimed to analyze the statistical relevance of data related to medical history and physical examinations . In our study to predict the ahi, a clinical formula with 0.682 explanatory power was found including these parameters: body mass index, neck circumference, waist circumference, peripheral oxygen saturation, and tonsil size . Sleep apnea, despite being the most common reason for eds, was not considered to be a useful clinical feature for detecting osas in patients because 30 to 50% of the society claim moderate to sleepiness [1, 2]. Bausmer et al . Did not find a significant correlation between the ess score and the ahi . In a study analyzing the relation between clinical parameters and osas on a group of 80 people, similar to our present study, no significant correlation was found between subjective sleepiness measured via the ess and the ahi . Obesity is an important risk factor for osas, and 70% of osas patients suffer from it . The most commonly used measurements in the diagnosis of obesity are bmi, wc, and hc . Bouloukaki et al . Stated that bmi was a better indicator than other obesity indicators, such as waist - to - hip ratio, in osas predictability . In many studies, nc, which is related to fat deposition around the upper airway, was defined as an important predictor factor for osas . The value of nc in predicting osas is still controversial . In a study of 2,690 patients, bouloukaki et al . Reported that nc was the most significant correlate with the ahi . In this study, similar to the findings in previous studies, nc and bmi were found to be significant parameters for the ahi prediction . It is a challenging issue for otolaryngologists to identify and to improve the location of obstruction level(s) in the upper airway (uaw) in patients suspected of osas . The uaw is assumed to be narrower and/or more prone to collapse multilevelly in osas patients . The relationship between anatomic abnormalities and the severity of osas has not been well established in previous studies because uaw abnormalities are not the only causative factors . In this study just ts was found significant in predicting the ahi among the physical examination findings of uaw, we only found ts to be significant in predicting the ahi . Friedman revealed a relation between the increase in ts and the ahi through grading tonsil sizes in osas patients . Enlarged tonsils are associated with osas, and surgical removal is thought to be an important part of the treatment . Reported that the tonsil grade has a strong correlation with the ahi in osas patients . There is no consensus regarding the effect of nasal airway blockage on osas pathogenesis and the severity of the disease . While some authors argued that the nasal passage affects osas development and is related to ahi, other authors claimed the converse . In this study, the mallampati index, which was defined by anesthesiologists in 1985 to identify difficult intubation, was later suggested as an mmi to be used in predicting osas . 's findings, we found no significant relationship between tongue - base hypertrophy, mmi, and the ahi . In many studies, pulmonary function tests evaluated 102 obese patients by clinical features, pulmonary function tests, arterial blood gas tensions, and oximetry for prediction of osas prior to psg and stated that none of these data is sufficient to prove the existence of osas . In a study which attempted to develop a predictive index for osas based on pulmonary function parameters, conducted with obese snorers suspected of osas, it is found out that daytime oxygen saturation contributed to the model significantly it was argued that this model could help decrease redundant psg applications by 38% . In our study, among spirometric parameters, the fvc, fev1%, and fev1/fvc ratios were found to be correlated with the ahi, but these parameters were eliminated in the regression analysis and did not come out in the ahi predictive model as independent variables . The relationship between the levels of ahi and desaturation were also argued, and no strong significance was identified about this issue . Since it is easier to apply and it is more cost - effective, transcutaneous pulse oximetry has become more and more widely used in initial screenings of osas . Stated that psg applied to patients suspected of osas is by no means superior to ambulatory methods based on oximeter readings combined with clinical data . In their study of 275 patients, chiner et al . Found that a preliminary pulse oximeter may decrease redundant pgs ratios by 38% in a group of patients where the ahi is more than 15 . On the other hand, no desaturation can be seen among hypopnea period and in cases where upper airway resistance has increased even when oxygen desaturation is prevalent in obstructive apnea . Therefore, an oximeter may be useful on its own, particularly as far as higher average levels of osas are concerned and where they cannot rule out the diagnosis . Because putting all patients through overnight oximeters conflicts with the practicability of our study, we analyzed the pulse oximeters and oxygen saturations in peripheral blood in policlinic environment and found that evaluation was one of the most significant parameters in the ahi prediction model . However, such formulas include different variables within different populations, whose differences may be a significant limitation of this study . Therefore, this method may not be sufficient since a screening technique and its validity need to be further tested in other series and would need to include more patients . It is our next aim to design a prospective study to evaluate the predictability of the formula obtained from this study . As a result, a mathematical model created via data obtained through simple office procedures to predict osas may reduce redundant psg and result in more rapid diagnoses and treatment processes . The potential advantage of this approach is its ease of use, its cost effectiveness, its applicable nature in office environments, and its contribution to more rapid decisions . Validated prediction models, which will be created via collective studies by more sleep centers and with more groups of patients, are needed because no single, sufficient model has yet been described.
|
The centers for disease control and prevention (cdc) estimates that the peak h1n1 season (april 2009 to april 2010) in the united states resulted in 4389 million cases, 195403 thousand hospitalizations, and 8,87018,300 deaths.1 in addition to morbidity and mortality, keech and beardsworth concluded in their review that each episode of influenza resulted in a loss of 1.55.9 working days.2 the global emergence of the h1n1 virus in april 2009 resurrected the significance of and urgency for continual influenza surveillance and epidemiologic data.3 during an infectious disease outbreak, there is a massive increase in the demand for services in a healthcare facility such as a hospital emergency department . The available resources in such a facility needed to respond to this increased demand for healthcare services can be greatly enhanced with a more accurate estimate of the expected demand.4 influenza surveillance methodologies use laboratory - confirmed cases as the method for estimating total cases . However, not all cases go to a healthcare provider, nor are all cases tested for influenza . Therefore, the numbers reported are likely to be an undercount of the actual cases . Because of this, and in order to improve the timeliness of their reporting in the united states, the cdc monitors the occurrence of influenza - like illness (ili), defined as fever> 100 f, and cough, and/or sore throat (in the absence of a known cause other than influenza).5 symptomatic surveillance for influenza infections has limitations . A substantial proportion of patients infected with influenza virus may not develop clinical symptoms, even though they may shed their virus and transmit infection to others.6,7 in addition, several symptoms associated with influenza, such as fever, cough, headache, chills, fatigue, nausea, vomiting, and diarrhea, are also associated with other illnesses, which makes the clinical diagnosis of influenza difficult.8 babcock and associates, in a case series study,9 and van den dool and colleagues, in a prospective cohort study,10 concluded that the sensitivity and positive predictive value of symptoms, such as fever and cough, for the diagnosis of influenza were low among hospitalized patients . Govaert and colleagues also reported a lower positive predictive value of the same combination of symptoms in elderly persons.11 hoeven and associates demonstrated that the influenza virus was present over twice as often as the clinically diagnosed influenza, indicating that clinical diagnosis alone should not be the basis for interventions designed to control the spread of the virus.12 despite these drawbacks, symptomatic surveillance is rapid and avoids the use of potentially scarce laboratory resources . Thus, symptomatic surveillance can be a critical tool for the prompt diagnosis of influenza needed to prevent the spread of virus and treat the disease in a timely fashion . In a retrospective, pooled analysis of 3,744 patients with ili symptoms, monto and colleagues concluded that clinical symptoms had a high positive predictive value of 60%80%.13 the overall purpose of this study was to assess the numbers and age distribution of patients presenting with symptoms of ili to the two healthcare centers in a small appalachian city between january 1, 2009, and december 31, 2010 . The study also aimed to examine the associations between their symptoms and temporal patterns of presentation (month, day of week, and time of day). The results of this work can aid in public health planning and interventions for future influenza epidemics . Using electronic health records, we conducted a retrospective cross - sectional study of all patients who presented with ili symptoms at the well wvu the students center of health (shs) and the emergency department (ed) of ruby memorial hospital between january 1, 2009, and december 31, 2010 . Both facilities are part of the west virginia university (wvu) healthcare system and are located in morgantown, a city in the metropolitan area of north central west virginia, with a population of approximately 30,000 . Shs operates from 8:30 am6:00 pm during weekdays, and 8:30 am4:30 pm during summer months . Ruby memorial hospital is the largest in the city and its ed provides round - the - clock emergency care to sick and injured individuals from west virginia and neighboring states . A non - probability purposive sampling technique was used for this study that included all patients who presented with symptoms of ili at either of the two participating healthcare centers in morgantown, west virginia, between january 1, 2009, and december 31, 2010 . Information obtained from the electronic health records included age, sex, symptoms, diagnoses of the disease, and the date and time when they presented at the healthcare facility during the 20092010 h1n1 pandemic . The west virginia university institutional review board (irb) and the national institute for occupational safety and health irb determined that this study was exempt from full review, and waived the requirement to obtain informed consent . We analyzed electronic health records by age, sex, month, weekday, and time for those patients who presented themselves with ili at the shs and ed in 2009 and 2010 . For shs, there were a total of 647 patient visits in 2009, of which 14 were repeat visits . In 2010, there were a total of 60 patient visits, of which 2 were repeat visits . Since the visits were on different days and times, check - in times at shs were categorized as morning (8:00 am11:59 am) and afternoon (noon5:59 pm). The hours at the ed were grouped into four time periods: midnight5:59 am; 6:00 am11:59 am; noon5:59 pm; and 6:00 pm11:59 pm . Information on patient symptoms was not available from the shs, but the records contained the ili diagnoses for all the patients in this study . For the ed, we had information on the following symptoms recorded in the patient charts: fever, cough, chills, diarrhea, vomiting / nausea, body ache, congestion, sore throat, headache, weakness / dizziness, ear pain, shortness of breath, and chest pain . Symptoms, such as tiredness, passing out, lethargy, and lightheadedness, were included under the symptom symptoms such as sinus drainage, runny nose / nasal drainage, stuffy nose, cold symptoms, sneezing, and lung pain were all combined with the main symptom congestion . Aches and back pain were combined with shortness of breath, throat pain was combined with sore throat, feeling flushed was included under fever, and rib pain was combined with chest pain . A separate category each of these symptoms was dummy - coded as 1 if the symptom was present and 0 if it was absent . The following symptoms rarely occurred (between one and two cases) and were not included in the analysis: upper respiratory infection, abdominal pain, kidney pain, bladder infection, right flank pain, lymph node discomfort, tingling, rash, constant sleeping, bleeding, hearing problems, and dehydration . Descriptive analyses were conducted to assess the temporal pattern (day of the week and time of the day), age distribution, and frequencies of ili symptoms during the 20092010 h1n1 pandemic . Chi - square test was performed to assess whether ili patients with fever were distributed differently across the days of the week . The likelihood of ili patients with fever presenting at the ed and experiencing other symptoms was calculated by estimating the odds ratios (or) and 95% confidence intervals using binary logistic regression analyses . Using electronic health records, we conducted a retrospective cross - sectional study of all patients who presented with ili symptoms at the well wvu the students center of health (shs) and the emergency department (ed) of ruby memorial hospital between january 1, 2009, and december 31, 2010 . Both facilities are part of the west virginia university (wvu) healthcare system and are located in morgantown, a city in the metropolitan area of north central west virginia, with a population of approximately 30,000 . Shs operates from 8:30 am6:00 pm during weekdays, and 8:30 am4:30 pm during summer months . Ruby memorial hospital is the largest in the city and its ed provides round - the - clock emergency care to sick and injured individuals from west virginia and neighboring states . A non - probability purposive sampling technique was used for this study that included all patients who presented with symptoms of ili at either of the two participating healthcare centers in morgantown, west virginia, between january 1, 2009, and december 31, 2010 . Information obtained from the electronic health records included age, sex, symptoms, diagnoses of the disease, and the date and time when they presented at the healthcare facility during the 20092010 h1n1 pandemic . The west virginia university institutional review board (irb) and the national institute for occupational safety and health irb determined that this study was exempt from full review, and waived the requirement to obtain informed consent . We analyzed electronic health records by age, sex, month, weekday, and time for those patients who presented themselves with ili at the shs and ed in 2009 and 2010 . For shs, there were a total of 647 patient visits in 2009, of which 14 were repeat visits . In 2010, there were a total of 60 patient visits, of which 2 were repeat visits . Since the visits were on different days and times, check - in times at shs were categorized as morning (8:00 am11:59 am) and afternoon (noon5:59 pm). The hours at the ed were grouped into four time periods: midnight5:59 am; 6:00 am11:59 am; noon5:59 pm; and 6:00 pm11:59 pm . Information on patient symptoms was not available from the shs, but the records contained the ili diagnoses for all the patients in this study . For the ed, we had information on the following symptoms recorded in the patient charts: fever, cough, chills, diarrhea, vomiting / nausea, body ache, congestion, sore throat, headache, weakness / dizziness, ear pain, shortness of breath, and chest pain . Symptoms, such as tiredness, passing out, lethargy, and lightheadedness, were included under the symptom symptoms such as sinus drainage, runny nose / nasal drainage, stuffy nose, cold symptoms, sneezing, and lung pain were all combined with the main symptom congestion . Shortness of breath, throat pain was combined with sore throat, feeling flushed was included under fever, and rib pain was combined with chest pain . A separate category each of these symptoms was dummy - coded as 1 if the symptom was present and 0 if it was absent . The following symptoms rarely occurred (between one and two cases) and were not included in the analysis: upper respiratory infection, abdominal pain, kidney pain, bladder infection, right flank pain, lymph node discomfort, tingling, rash, constant sleeping, bleeding, hearing problems, and dehydration . Descriptive analyses were conducted to assess the temporal pattern (day of the week and time of the day), age distribution, and frequencies of ili symptoms during the 20092010 h1n1 pandemic . Chi - square test was performed to assess whether ili patients with fever were distributed differently across the days of the week . The likelihood of ili patients with fever presenting at the ed and experiencing other symptoms was calculated by estimating the odds ratios (or) and 95% confidence intervals using binary logistic regression analyses . Out of 707 patients identified in the patient records as presenting with ili at the shs in 2009 and 2010, nearly all (91.5%) were patients in 2009 . Thus, there was a 91% decline in 2010 over 2009 in the number of patients with ili presenting at shs . For this reason, the demographic and other information of patients at shs are only provided for 2009 . The age of ili patients ranged from 17 to 39 years, and the mean age of ili patients was 21.1 years (sd: 3.0). Over 54% of the ili patients were between 17 and 20 years old, and another 39% were between 21 and 25 years old . At the shs in 2009, october was the busiest month, with 52% of the patients presenting; another 18% presented in november (fig . 1). There was a significant difference between the number of patients presenting during different days of the week (p <0.05) with friday having the fewest number of patients (fig . 2). During the day, about 39% of patients presented in the morning between 8:0011:59 am and the rest (61%) presented in the afternoon between 12:005:15 pm . Patients presenting at the ed with ili had a different profile from those who presented at shs . The ed had 41,330 total patient visits in 2009 and 41,412 patient visits in 2010 . A total of 348 patients with ili were seen in 2009 (52% females), and 209 ili patients (57% females) in 2010 . There was a broad range in the ages of ili patients at ed, from 2 months to 85 years . In 2009, 86% of the patients were under 40 years old, and 42% were between 20 and 40 years old . The trend was similar in 2010 . Over three quarters (78%) of the ili patients were under 40 years old, with 52% between 20 and 40 years old . The mean age of ili patients was 23.63 years (sd: 15.36) in 2009 and 29.13 years (sd: 14.77) in 2010 . There was a significant difference between the number of ili patients presenting at the ed by month in 2009 (p <0.05). November was the busiest month, with almost 60% of the patients presenting at ed, followed by 21% in october and 12% in december (fig . 1). This trend changed in 2010 with a greater spread of patients throughout the year . There was a significant difference between the number of patients presenting at ed during different months in 2010 (p <0.05). In 2009, differences among the numbers of ili patients at ed by day of the week were statistically significant (p <0.05), with the highest percentage of ili patients (17.8%) seen on saturday (fig . The distribution of ili patients at ed during the week was rather balanced (p> 0.05). Tuesdays and thursdays were equally busy, with 18.2% patients each day, closely followed by friday with 15.8% . In 2009, a third of ili patients visited the ed between 6:00 pm and midnight, and slightly more patients (37%) visited during the same time in 2010 (fig . About 50% of the ili patients presented between 6:00 pm and 6:00 am . At the ed, the most common symptoms of ili patients in 2009 were fever (25.6%), cough (17.8%), and vomiting / nausea (9.5%) (fig . 4). In 2010, fever was still the most common symptom (19.1%), followed by body ache (14.8%), sore throat (14.4%), and cough (13.4%). Among the ili patients at the ed in 2009, those with fever, when compared to those without, were more likely to also experience cough (or: 10.89; ci: 5.8820.16), sore throat (or: 4.19; ci: 1.779.93), congestion (or: 4.14; ci: 1.809.49), chills (or: 3.98; ci: 1.4411.04), headache (or: 2.62; ci: 1.136.09), body ache (or: 2.61; ci: 1.235.54), and vomiting or nausea (or: 2.19; ci: 1.064.55) (table 1). These patients were also more likely to have a flu test ordered at the ed (or: 1.73; ci: 1.062.81). There were no significant differences in patients with fever either by sex or by day or time of presentation . Patients with median age (20.78 years) or younger were over three times more likely to have fever (or: 3.27; ci: 1.915.61) than older patients . Among the ili patients at the ed in 2010, those with fever were more likely to also experience vomiting or nausea (or: 2.98; ci: 1.207.42) and body aches (or: 2.83; ci: 1.226.52). Those with fever were also more likely to have a flu test ordered at the ed (or: 2.84; ci: 1.405.78). The odds of having any other symptoms were not statistically significant and there was no association by age, sex, or day or time of presentation at the ed . Compared to the expected frequency of patients with fever on different days of the week in the peak months (october december) of the h1n1 influenza season in 2009, the observed presentation of patients was much higher on tuesday and sunday, as shown in table 2 . This study examines the temporal patterns of ili patients presenting at a student health service (shs) and a hospital emergency department (ed) during the 20092010 h1n1 pandemic in a city with a large college student population . Such an assessment can aid in public health planning and interventions for future influenza pandemics . Educational institutions such as schools, colleges, and universities, are places of high social contact, which can be prime sites of influenza transmission and outbreak.14 upper respiratory tract infections are a significant cause of morbidity among college and university students, adversely affecting their school and work performance.15 in this study, we found that the number of ili patients presenting at the shs and ed in 2009 increased sharply at the beginning of the academic year, which is not the normal peak season for regular influenza.16,17 most of the ili patients presenting at the ed in 2009 and 2010 were younger than 60 years . This finding is consistent with what was seen nationally and is in contrast to the regular seasonal influenza pattern.18 in this study, 86% of the 2009 patients and 79% of the 2010 patients were less than 40 years old; the highest proportion of patients in both years (42% in 2009 and 52% in 2010) were between 20 and 40 years old . This is an interesting finding because persons in the age group 20 to 40 years are considered to be the least vulnerable for all diseases . Yet, nationally, the h1n1 pandemic had a significant impact on this age group, with the elderly being less affected . These results concur with shiley et al ., who concluded that the median age of h1n1 patients was significantly lower than that of the seasonal influenza patients.19 another notable finding was that october was the month with the greatest number of patients presenting at the shs in 2009; in turn, inflow of patients at the ed peaked in november in 2009 and 2010 . One reason for this difference could be that the population seen at the ed has a different demographic than the population at shs and influenza might have arrived sooner in the student population or spread faster because of higher population densities and greater mixing among the student population . Alternatively, it is possible that the ili cases among the shs patients in october had worsened in severity resulting in an ed visit in november . Nationally, the peaks in positive influenza cases in 2009 occurred in june and october.20 locally, data provided by west virginia sentinel providers to the cdc indicate that a peak in visits for influenza cases in 20092010 occurred in october 2009, but not june 2009.21 these data are corroborated by the positive test results that also peaked in october 2009, as reported by hospital and referral laboratories;21 this suggests that patients in the ed and shs followed a similar pattern to other areas of west virginia . Additionally, the shs did not experience the surge in june 2009 as many students were home for the summer . Less than 1% of the students who were ili patients in 2009 presented themselves at shs between the months of june and august . The results also indicate that the distribution of patients both at the ed and shs varied over the week during the 20092010 h1n1 pandemic . In 2009, the observed presentation of patients in the ed was much higher on tuesday and sunday compared to the expected frequency of patients with fever on different days of the week in the peak months (october december) of the h1n1 influenza season . The ed had about half the number of patients in the late evening and early morning hours between 6:00 pm and 6:00 am . This suggests that there is a significant workload during the late evening and early morning hours; staff and healthcare services at ed are required equally during the day and nighttime periods . Consistent with the cdc definition of ili symptoms, the most common symptoms of ili patients presenting at ed in 2009 were fever, cough, and vomiting / nausea . Our results are consistent with other studies that indicate a higher frequency of these symptoms among ili patients . Among the 2009 ed patients, those with fever, compared to those patients without, were over ten times more likely to also have cough, four times more likely to experience sore throat and chills, over three times more likely to have congestion, and over two times more likely to report symptoms of headache, body ache, and vomiting or nausea . However, in 2010, while fever was still the most common symptom, it was closely followed by other symptoms, such as body ache, sore throat, and cough . A cross - sectional study by shiley and colleagues compared the differences between epidemiological characteristics of pandemic h1n1 influenza and seasonal influenza . They concluded there were more complaints of cough, myalgia, and chest pain among the pandemic h1n1 influenza patients than among the seasonal influenza patients.19 tang et al . Found that, compared with the seasonal influenza patients, those with h1n1 were at higher odds of experiencing cough (or: 2.04; ci: 1.273.26) and sore throat (or: 1.39; ci: 0.962.02).22 monto and colleagues conducted a retrospective, pooled analysis of eight double - blind, placebo - controlled studies in north america, europe, and the southern hemisphere . 13 they analyzed baseline signs and symptoms from phase two and three clinical trial participants and concluded that fever and cough together were the two best predictors of influenza among patients with ili . Several other studies also corroborate these findings.23,24 a systematic review of randomized control trials and cohort studies identified three symptoms fever, rigors, and sweating to diagnose influenza.25 another systematic review of clinical and epidemiological features of the pandemic influenza a (h1n1) in 2009 concluded with cough (84.9%), fever (84.7%), headache (66.5%), runny nose (60.1%), and muscle pain (58.1%) as the most common symptoms of confirmed cases.26 consistent with the literature, the results of this study indicate fever as the most common symptom among patients with ili presenting at the ed . Finally, this study has several limitations that need to be acknowledged . However, these healthcare facilities represent two different populations: the general population seeking care at the ed, and college age students seeking care through the university shs . Many of the patients at the ed and shs were not tested for influenza, so it is unclear how many cases of ili were actually influenza . It is also possible that some of the actual influenza cases did not present with the symptoms of ili . However, as indicated earlier, there is a strong correlation between ili symptoms and laboratory - confirmed influenza . In conclusion, we have demonstrated the temporal and demographic characteristics of patients presenting with ili at two healthcare facilities in a small appalachian city during the 20092010 h1n1 pandemic; for one facility we have examined the likelihood of other symptoms occurring along with fever in patients with ili . There is a critical need to assess the magnitude of the burden of influenza cases and the healthcare resources needed to bear that burden . This study can assist health professionals in preparing for a better and more rapid response to an influenza epidemic.
|
Bone metastases are exceedingly common among advanced cancer patients, especially in those with breast, prostate, and lung carcinomas, . They are a cause of great morbidity and result in significant pain in 5075% of patients at some point throughout the course of their illness,, . Bone metastases can also lead to hypercalcemia, skeletal complications including pathological fractures and spinal cord compression, and have a negative impact on quality of life (qol),, . External beam radiation therapy (ebrt) studies have proven it to be both cost - effective and efficacious, with up to 80% of treated patients experiencing at least some pain relief, . Moreover, it has few associated toxicities, many of which are temporary and minor in nature . Recent technological developments have led to an increased use of stereotactic body radiation therapy (sbrt) for the treatment of select tumors, most commonly to the liver, lung, or bone, . This technique is employed with a locally curative intent and delivers more radical doses of radiation with great accuracy . For spinal metastases, sbrt allows for locally ablative doses of radiation to the target and limits the spinal cord or cauda to thresholds below the dose of myelopathy . Sbrt to the spine delays tumor progression and provides long - term pain control and maintenance or even improvement in qol . Long term complications of spine sbrt, unique from conventional ebrt, include vertebral compression fractures and, much less likely, radiation myelopathy . Acute adverse events are similar to conventional radiotherapy and are usually self - limiting . Pain flare, defined as a temporary worsening of bone pain in the treated metastatic site, has been previously documented as a side effect of radiopharmaceutical and hormonal therapy,, . Although it is a recognized side - effect of radiation treatment as well, only recent studies have attempted to accurately document its incidence in patients treated with ebrt or sbrt,,,,,,,, . These studies report incidences reaching as high as 68% for sbrt and 44% for ebrt . A qualitative study published by hird et al . Discusses patient perspectives and the impact of pain flare on qol . Overall, patients describe interference with daily activities and general functioning, as well as anxiety and worry regarding the success of the treatment . Typical pain flare management entails an increase in analgesic use, leaving the patient at risk of associated adverse events including dry mouth, drowsiness, and constipation . Moreover, the majority of patients felt that their pain was not adequately relieved by increased analgesics . Rather, 85% of patients stated that the optimal management of pain flare requires prophylaxis . Dexamethasone is an anti - inflammatory steroid medication that has been shown to be effective as a prophylactic agent against pain flare,, . It is hypothesized that the dexamethasone reduces edema within the periosteum of the treated bone . With a half life of 3654 h, it may be administered to patients throughout the duration of treatment and for a few days post treatment in order to curb the debilitating effects of pain flare . The objective of this report is to present the currently available literature documenting the incidence of pain flare in both conventional and stereotactic radiation therapy techniques . Furthermore, it will summarize the use of dexamethasone in early clinical trials as a prophylactic measure against the occurrence of pain flare . It was limited to english articles only, but was not restricted to any time period . The american society for therapeutic radiology and oncology (astro) 2014 book of published abstracts keywords and subject headings for searches included radiation therapy, stereotactic radiation therapy, bone metastases, pain flare, and abstracts and articles generated by the search were screened based on title first, then abstract or full text, independently by rm and lr . If there was a disagreement for inclusion or exclusion of an article, a discussion ensued until a consensus was reached . This includes nine full text articles and two abstract publications extracted from the astro 2014 . Seven studies investigated ebrt with two additionally investigating prophylactic treatment of pain flare with dexamethasone and one investigating prophylaxis with a methylprednisolone infusion . Four studies investigated pain flare resulting from stereotactic radiation therapy, only one of which included dexamethasone as a prophylactic agent . The incidence of pain flare, duration of pain flare, and possible use of dexamethasone, if applicable, is reported in table 2 . A total of seven studies have documented the incidence of pain flare in patients treated with ebrt to symptomatic bone metastases, three of which included an investigation of pain flare prophylaxis with a steroid medication,,,,,, . All studies collected data such as pain score and analgesic intake prospectively using questionnaires at baseline, daily during, and daily after treatment completion for a set duration of time . Pain flare was defined in their study as either a 2-point increase in worst pain on a scale of 010 with no decrease in analgesic intake, or as a 25% increase in analgesic intake with no decrease in worst pain score . Between june 2000 and february 2001, 88 patients were accrued to the study . The incidence of pain flare was 14% on day one for patients who received 8 gy in 1 fraction, and 15% on day one for patients who received 20 gy in 5 fractions . Following up with this study in 2007, the authors published a study investigating the use of dexamethasone for the prophylaxis of pain flare . All 33 patients accrued to the study were prescribed two tablets of 4 mg dexamethasone by mouth one hour before treatment . Using the brief pain inventory (bpi) to collect analgesic information and worst pain score, pain flare incidence in this population was reported to be 24% . In contrast to the previous two studies, loblaw et al . Collected pain scores using the present pain intensity (ppi) questionnaire and developed two working definitions of pain flare: (1) a 2-point increase in the ppi with no decrease in analgesic score, or a 50% increase in analgesic score with no decrease in ppi on at least two consecutive days; and (2) a 2-point increase in ppi with no decrease in analgesic score or a 25% increase in analgesic score with no decrease in ppi on at least two consecutive days . The authors collected pain scores prospectively using the ppi at baseline, in a daily diary for the first week following treatment, and then at 14, 30, and 60 days post treatment . Published a comprehensive study in 2009 with results on pain flare incidence from three canadian centres . A total of 111 patients were included in the study, of which 41% documented pain flare . Eighty percent of those who experienced pain flare also reported it to be within the first five days following treatment . In which 8 mg of dexamethasone was prescribed to all patients and taken at least one hour before daily radiotherapy and for three consecutive days following completion . Twenty - two percent of the 41 accrued patients reported pain flare with a median duration of one day . A recent study published in abstract form only reported the incidence of pain flare in patients treated with ebrt to bone metastases . This study collected worst pain scores and analgesic consumption prospectively before, daily during, and for ten days post - treatment . Of a total patient population of 94, 42 (44.7%) were documented to have pain flare . The median duration of pain flare was two days and the majority (88%) occurred between days one to five post - treatment . In a double - blind randomized study, one hundred twenty patients with vertebral metastases during the two week short - course ebrt were randomized to methylprednisolone versus placebo resulting in pain flare incidence of 6.6% versus 20% respectively . Four studies investigated the incidence of pain flare in patients treated with sbrt,,, . Three of the four studies defined pain flare as (1) at least a 2-point increase in worst pain score, (2) at least a 25% increase in opioid intake, or (3) the initiation of steroids,, . The fourth study measured pain flare according to the common terminology criteria for adverse events (ctcae) version 4.03 . Published the first study in march 2013 and focused specifically on sbrt for patients with spinal metastases . Data was collected prospectively using the bpi at baseline, during treatment, and ten days post follow - up . The authors found that 28 of 41 (68.3%) accrued patients experienced pain flare and the most common occurrence was before day 3 following completion of treatment (71%). In contrast, owen et al . Investigated sbrt for non - spine bone metastases . Data collection in this study was completed retrospectively; incidence of pain flare was determined from clinical notes based on follow - up visits typically one to three months after treatment completion . A total of 74 patients were evaluable, and the reported incidence of pain flare was much lower at 10% . A similar study design was used by pan et al . Who completed a secondary analysis of phase i and ii trials on spine sbrt . Pain scores were collected in a retrospective manner through completion of the bpi at baseline and one and two weeks after completion of single fraction sbrt, or two and four weeks after completion of multiple fraction sbrt . The overall median time to pain flare was five days according to survey, however this decreased to 2.5 days when based solely on clinical evaluation . The only study to investigate the use of prophylactic dexamethasone for pain flare for sbrt patients was published in an abstract by khan et al . . Dexamethasone was taken a day prior to treatment, daily during treatment, and for four days post treatment . Group one consisted of 24 patients prescribed 4 mg dexamethasone, of which 25% experienced pain flare . Group two consisted of 23 patients who were prescribed 8 mg of dexamethasone and the incidence of pain flare was considerably less, at only 13% . Pain flare occurred most often during treatment and up to day one following completion (66% of patients). Data was collected prospectively through the completion of the bpi daily during treatment and for 10 days following completion . A total of seven studies have documented the incidence of pain flare in patients treated with ebrt to symptomatic bone metastases, three of which included an investigation of pain flare prophylaxis with a steroid medication,,,,,, . All studies collected data such as pain score and analgesic intake prospectively using questionnaires at baseline, daily during, and daily after treatment completion for a set duration of time . Pain flare was defined in their study as either a 2-point increase in worst pain on a scale of 010 with no decrease in analgesic intake, or as a 25% increase in analgesic intake with no decrease in worst pain score . Between june 2000 and february 2001, 88 patients were accrued to the study . The incidence of pain flare was 14% on day one for patients who received 8 gy in 1 fraction, and 15% on day one for patients who received 20 gy in 5 fractions . Following up with this study in 2007, the authors published a study investigating the use of dexamethasone for the prophylaxis of pain flare . All 33 patients accrued to the study were prescribed two tablets of 4 mg dexamethasone by mouth one hour before treatment . Using the brief pain inventory (bpi) to collect analgesic information and worst pain score, pain flare incidence in this population in contrast to the previous two studies, loblaw et al . Collected pain scores using the present pain intensity (ppi) questionnaire and developed two working definitions of pain flare: (1) a 2-point increase in the ppi with no decrease in analgesic score, or a 50% increase in analgesic score with no decrease in ppi on at least two consecutive days; and (2) a 2-point increase in ppi with no decrease in analgesic score or a 25% increase in analgesic score with no decrease in ppi on at least two consecutive days . The authors collected pain scores prospectively using the ppi at baseline, in a daily diary for the first week following treatment, and then at 14, 30, and 60 days post treatment . Published a comprehensive study in 2009 with results on pain flare incidence from three canadian centres . A total of 111 patients were included in the study, of which 41% documented pain flare . Eighty percent of those who experienced pain flare also reported it to be within the first five days following treatment . In which 8 mg of dexamethasone was prescribed to all patients and taken at least one hour before daily radiotherapy and for three consecutive days following completion . Twenty - two percent of the 41 accrued patients reported pain flare with a median duration of one day . A recent study published in abstract form only reported the incidence of pain flare in patients treated with ebrt to bone metastases . This study collected worst pain scores and analgesic consumption prospectively before, daily during, and for ten days post - treatment . Of a total patient population of 94, 42 (44.7%) were documented to have pain flare . The median duration of pain flare was two days and the majority (88%) occurred between days one to five post - treatment . In a double - blind randomized study, one hundred twenty patients with vertebral metastases during the two week short - course ebrt were randomized to methylprednisolone versus placebo resulting in pain flare incidence of 6.6% versus 20% respectively . Four studies investigated the incidence of pain flare in patients treated with sbrt,,, . Three of the four studies defined pain flare as (1) at least a 2-point increase in worst pain score, (2) at least a 25% increase in opioid intake, or (3) the initiation of steroids,, . The fourth study measured pain flare according to the common terminology criteria for adverse events (ctcae) version 4.03 . Chiang et al . Published the first study in march 2013 and focused specifically on sbrt for patients with spinal metastases . Data was collected prospectively using the bpi at baseline, during treatment, and ten days post follow - up . The authors found that 28 of 41 (68.3%) accrued patients experienced pain flare and the most common occurrence was before day 3 following completion of treatment (71%). In contrast, owen et al . Investigated sbrt for non - spine bone metastases . Data collection in this study was completed retrospectively; incidence of pain flare was determined from clinical notes based on follow - up visits typically one to three months after treatment completion . A total of 74 patients were evaluable, and the reported incidence of pain flare was much lower at 10% . A similar study design was used by pan et al . Who completed a secondary analysis of phase i and ii trials on spine sbrt . Pain scores were collected in a retrospective manner through completion of the bpi at baseline and one and two weeks after completion of single fraction sbrt, or two and four weeks after completion of multiple fraction sbrt . The overall median time to pain flare was five days according to survey, however this decreased to 2.5 days when based solely on clinical evaluation . The only study to investigate the use of prophylactic dexamethasone for pain flare for sbrt patients was published in an abstract by khan et al . . Dexamethasone was taken a day prior to treatment, daily during treatment, and for four days post treatment . Group one consisted of 24 patients prescribed 4 mg dexamethasone, of which 25% experienced pain flare . Group two consisted of 23 patients who were prescribed 8 mg of dexamethasone and the incidence of pain flare was considerably less, at only 13% . Pain flare occurred most often during treatment and up to day one following completion (66% of patients). Data was collected prospectively through the completion of the bpi daily during treatment and for 10 days following completion . Bone pain as a result of bone metastases is a well documented occurrence in advanced cancer patients,, . Palliative external beam radiation therapy, and more recently stereotactic body radiation therapy, are effective and well - tolerated treatments for the relief of cancer related bone pain,, . Pain flare, a temporary exacerbation of pain closely following completion of treatment, is a recognized acute toxicity of both treatment techniques . We completed a comprehensive review of the currently available literature documenting the incidence of pain flare and the prophylactic use of dexamethasone to decrease the incidence . The method of data collection is an inherently critical factor in study design and can greatly influence study results and their interpretation . It is particularly relevant to this current review when examining the widespread discrepancies in pain flare incidence, particularly among sbrt studies . These incidences are considerably less than the 68% reported by chiang et al . In 2013, in a study that employed prospective collection methods . Retrospective studies in general may be subject to recall bias, where patients do not accurately recall the events that they have experienced . Especially when the goal of treatment is to provide pain relief, these patients may be more focused on the improvement of their symptoms rather than the transient exacerbation of them . Noteworthy are that conventional ebrt studies obtained data prospectively and the collective incidence of pain flare was consistently around 40% . Dexamethasone, with its anti - inflammatory properties, has been shown to be an effective medication in the treatment of pain flare and is hypothesized to prevent the phenomenon as well . Despite a lack of literature investigating this hypothesis, currently published phase i and ii trials have provided compelling preliminary evidence for its use as a prophylactic agent in both ebrt and sbrt treatment settings . Khan et al . Conducted the first and only study where patients receiving sbrt to the spine were prescribed either 4 mg or 8 mg dexamethasone once daily during treatment and four days post - treatment . This is significantly less than the previously reported 68% of patients at the same institution with similar patients who experienced pain flare without any prophylaxis ., dexamethasone prophylaxis of varying regimens was used by chow et al . And hird et al . In patients treated with ebrt . Incidence of pain flare in these studies decreased from an average of 40% to 2224% . Despite the apparent benefit of prophylactic dexamethasone in decreasing the incidence of pain flare, there is a lack of consensus on dosage, frequency, and duration of intake . The majority of pain flare incidence occurs within days one to five following completion of radiation treatment,, . With a half life of 3654 h, theoretically dexamethasone prescribed for four days post - treatment confirm this hypothesis, as patients prescribed 8 mg of dexamethasone during and four days post treatment had pain flare incidence of only 13% . The incidence of pain flare in ebrt studies after prophylactic dexamethasone use remains higher at approximately 2224%, however, these studies prescribed dexamethasone only on the day of treatment, or on the day of treatment with three additional subsequent days, . The greater incidence of pain flare in these studies as compared to the study by khan et al . May be related to the shorter duration of dexamethasone . In determining the best possible dose of dexamethasone, it is equally important to consider optimal prophylaxis as well as adverse events and contraindications related to the medication itself . For instance, dexamethasone has a role in immune - suppression, which may lead to increased susceptibility for infection . In already vulnerable populations such as those with advanced cancer dexamethasone may also increase blood sugar levels putting those with diabetes at risk, or activate and further complicate ulcers and other digestive problems . Other common side effects of dexamethasone include an increased appetite, trouble sleeping, and excess fluid retention or swelling in the face, hands or feet . Especially in palliative cancer patients, where the goal of treatment often focuses on maintenance or improvement of qol, the dosage and duration of dexamethasone must be optimally suited to maximize the prevention of pain flare while minimizing further side effects from the medication itself . Although the use of dexamethasone appears to be protective against pain flare, some patients still endure the painful side effect . This occurs in approximately 13% of patients receiving spine sbrt, as reported by khan et al ., and 22% of patients receiving ebrt, as reported by hird et al . . Why is it that these patients do not benefit from the anti - inflammatory properties of dexamethasone as the majority of patients seem to? The answer to this question may be found in the analysis of biomarkers or dna of the patient . Determining what these markers are and developing methods of prophylaxis for these patients should be objectives of future studies in order to provide the best possible care to all patients . Two studies are ongoing that promise to be paramount in the prescription of dexamethasone in the prophylaxis of pain flare . Ncic ctg is currently investigating the use of 8 mg dexamethasone daily on the day of treatment and four days post - treatment versus placebo of the same duration (nct01248585). The primary outcome of this study is the incidence of pain flare, with secondary outcomes including changes in pain scores, analgesic use, and qol . The results of this study may be able to help identify those patients who will not benefit from prophylactic dexamethasone . Similarly, westhoff et al . Are collaborating with twelve radiotherapy departments in the netherlands to investigate placebo for four days versus 8 mg dexamethasone for one day with placebo for three days, versus 8 mg dexamethasone for four days (nct01669499). Again, the primary outcome is the incidence of pain flare, with secondary outcomes including pain scores, qol, and side effects . Similar studies should be undertaken in a stereotactic body radiation therapy setting, in order to confirm the findings by khan et al . . Bone metastases are very prevalent in advanced cancer patients and often lead to significantly debilitating pain . Radiation therapy is an effective treatment of painful bone metastases and is often well tolerated with little toxicity . However, acute pain flare has been previously recognized and is reported to have an incidence as high as 68% in sbrt and ~40% in patients treated ebrt . Ongoing clinical trials will confirm the utility of dexamethasone and shed some light on the optimal duration, dose and frequency required to prevent pain flare.
|
Rna molecules lacking 5 and 3 ends and shaped as covalently closed circular rnas (circrnas) were described decades ago in a variety of model systems, but they were considered rare events (sanger et al ., 1976, capel et al ., 1993). However, recent studies report that these molecules are commonly produced by thousands of genes (salzman et al ., 2012,, 2013, memczak et al ., 2013) and are usually generated by the joining of a 5 splice site with the 3 splice site of an upstream intron, in a so - called back - splicing reaction (hansen et al . It has been shown that circrna expression is often highly conserved across species and particularly abundant in mammalian neuronal tissues (rybak - wolf et al ., 2015). Moreover, the dna that encodes circrnas is more conserved than the dna of flanking exons (rybak - wolf et al ., 2015). Very little is known about their mechanism of action; some may be sponges for micrornas (mirnas), as shown for cdr1as and sry in vertebrate neuronal tissues (memczak et al ., 2013, hansen et al ., 2013) and for circ - hipk3 in human cancers (zheng et al ., 2016). Nevertheless, genome - wide studies have demonstrated that mirna sponging activity cannot be generally applied (memczak et al . Jeck and sharpless, 2014), and other mechanisms have also been proposed, such as acting as platforms for protein interaction (hentze and preiss, 2013). This specifically pertains to circ - mbl, which competes for the splicing of its linear counterpart by binding to mbl (ashwal - fluss et al ., 2014), and to circ - foxo3, which blocks cell - cycle progression by interacting with cdk (du et al ., 2016 emerging evidence also suggests a potential role of circrnas in different human diseases (chen et al ., 2016), with data indicating tumor - promoting properties in in vivo models (guarnerio et al ., 2016). Despite these data in favor of circrnas relevant functional roles, we have identified conserved circrnas that are regulated during murine and human muscle differentiation and whose expression is altered in duchenne muscular dystrophy (dmd) myoblasts . A dedicated knockdown strategy followed by a high - content phenotypic screening identified circrnas participation in the control of myogenesis; circ - znf609, selected on the basis of its ability to regulate myoblast proliferation, provided an interesting example of translation occurring on a circrna . Total rna was collected from two replicates of human and mouse (c2c12) myoblasts cultured in growth medium (gm) or induced to differentiate into myotubes (differentiation medium, dm). Paired - end ribominus rna sequencing (rna - seq) was performed, and the findcirc computational pipeline (memczak et al ., 2013) was applied in order to detect circrnas . Rna - seq data were first processed for gene expression analysis: reads were mapped with tophat and the transcriptome was reconstituted with cufflinks (data summarized in figure s1a). Differential gene expression analysis was performed in order to check the quality of the in vitro differentiation experiments . While fragments per kilobase of transcript per million mapped reads (fpkms) of genes in technical replicates were almost perfectly correlated (> 98% correlation; figure s1b, upper panels), gene expression in myotubes compared to myoblasts was highly diverse, with> 3,000 genes significantly upregulated or downregulated in one of the two conditions, in both human and mouse systems (figure s1b, lower panels). When looking at the enrichment of gene products upregulated in myotubes versus myoblasts in terms of gene ontology (go) biological process keywords, we found a consistent and significant enrichment for genes related to muscle differentiation and function (figure s1c). Moreover, the expression of well - known specific markers of muscle differentiation was assessed by qrt - pcr, which confirmed the data obtained by rna - seq (figure s1d). Rna - seq reads were then realigned to the reference genomes, the ones contiguously aligned were discarded, and the remaining reads were used as input for findcirc (figure 1a) to detect head - to - tail splicing sites . As described in figure 1b, thousands of circular splicing events were found in both human and mouse samples, with almost 90% deriving from internal exons of protein - coding genes (figure 1c). Almost 10% of circrnas was expressed at similar or higher levels with respect to the linear counterpart (by comparing the number of reads mapping on circular versus linear splice junctions). Interestingly, almost 600 of these circrnas were conserved between species of the 2,100 and 1,600 circrnas identified in human and mouse, respectively (figure 1d, full list in table s1). Our criterion for conservation was any circrna in which the genomic location in human overlapped with the syntenic region in mouse . Considering that low - abundance species might have been missed by this analysis, the actual species overlap may be even higher . Indeed, when filtering human circrnas for high expression level (more than five reads), the overlap with mouse circrnas increased from 25% to 40% . To perform quantitative analyses on circrna expression and regulation, we took human samples and reduced further our list to a set of highly expressed molecules by requiring at least five unique reads mapping to the head - to - tail junction . With this threshold, while the technical replicates had an overall very good correlation (figure 2a), the comparison between myoblasts and myotubes revealed a global change in circrna expression (45% circrnas having 2-fold variation in one of the two conditions, figure 2b), meaning that these molecules were modulated in response to cell differentiation . Hierarchical clustering analysis of normal and dystrophic myoblasts and myotubes revealed that indeed dmd cells have a unique signature in terms of circrna expression levels (figure 2b): specific subsets of transcripts were differently abundant in dmd with respect to controls both in gm and in dm conditions . This is in agreement with the notion that duchenne cultures have a much slower progression into the differentiation process (cazzella et al ., 2012). Notably, circrna abundance tends in general to increase during differentiation (figure 1b), as described for neuronal differentiation (rybak - wolf et al ., the circular / linear ratio also followed this trend (figures 2c and 2d). This is possibly related to the high stability of these molecules: during differentiation, induction of circrnas at the transcriptional level, combined with a slow turnover, could lead to their accumulation over time . Then we addressed the question of whether modulation of circrna expression in myogenesis was due to transcriptional regulation of the host gene or to post - transcriptional control, such as competitive biogenesis between the linear and the circular isoforms within the same gene (ashwal - fluss et al ., 2014). Therefore, we analyzed the relationship between the fold change ratio of circular versus linear expression level in the two conditions tested (gm versus dm), and we found a positive correlation (figure 2e). Additionally, according to fpkms calculated with cuffdiff, the abundance of circrnas produced from upregulated, stable, or downregulated genes indicated that the induction of circrnas coming from upregulated genes was significantly higher than that of stable and downregulated genes (figure 2f). However, exceptions were detected, such as the bnc2 gene that produces mainly the linear mrna in human and mouse myoblasts in growth conditions but predominantly the circrna in differentiated cells . Figure 2 g shows circ - bnc2 in comparison with circ - cdyl, which is an example of a concomitant increase in both circular and linear isoforms during myogenesis, probably because of transcriptional activation of the locus . Specific criteria were applied in order to restrict the number of candidates for further characterization: (1) conservation, (2) expression level, (3) modulation during differentiation, and (4) circular / linear ratio (see the star methods). The selected species were initially validated by rt - pcr (summarized in table 1, full results in figures s2a and s2b, list of primers in table s2). Of 31 candidates, only one, circ - myl4, circ - ttty16 was instead not detected in mouse samples, because it is located in the y chromosome, which is not present in c2c12 cells . For almost every circrna, rt - pcr produced a band of the expected size and one or more larger products, possibly corresponding to concatemers generated by rolling circle retro - transcription . For a few circrnas (cdyl, qki, and znf609), we gel - extracted and sequenced those bands, confirming that they contained the head - to - tail junction and that they were concatemers (figure s2c). The qrt - pcr analysis of a subset of six human circrnas did not reveal a major second pcr product for any of them (figure s2d), possibly because of the different enzyme and cycling conditions used with respect to non - quantitative pcr and opening to the possibility of using such technique for accurate measurement of relative circrna expression (figure s2e). Indeed, in all cases, the normalized rna quantities measured by qrt - pcr reflected the levels observed by rna - seq and rt - pcr (figure s2e). For the same candidates, purification of total rna with oligo dt revealed that they were preferentially recovered in the non - polyadenylated fraction with respect to their linear counterparts (figure s2f). Similarly, comparison of dt- versus random examer - primed cdna synthesis shows that circrnas were retro - transcribed more efficiently with random examers than with dt with respect to linear rnas (figure s2 g). Resistance to the rnase r exonuclease was used to test whether the selected molecules were circular (suzuki et al ., 2006). Of 30 putative circrnas, 29 were confirmed as non - accessible to the exonuclease . Only one, circ - neb, was digested by rnase r as efficiently as its linear counterpart (summarized in table 1, full results in figures s2h and s2i). Moreover, nuclear / cytoplasmic fractionation indicated that all circular species were almost exclusively located in the cytoplasm, both in mouse and human cells (figures s2j and s2k). We then designed an image - based functional genetic screen to further characterize these molecules (summarized in figure 3a). We tried to design at least two small interfering rnas (sirnas) targeting each of the 29 circrnas, according to the following features: (1) binding site at the head - to - tail junction; (2) 7-mer seed not present in the linear host gene; and (3) chemical modifications within the seed region, in order to reduce the chance of an mirna - like effect and passenger strand inactivation to direct strand - specific ago loading . These modifications and their applications have been the objective of extensive studies (jackson et al ., 2006, chen et al ., 2008), and they have been here designed for customized targets (on - target - plus by dharmacon). Following these rules, it was possible to design two sirnas for 20 circrnas, one for five circrnas, and none for the four remaining ones (figure s3a; sirnas listed in table s3). Due to the poor transfectability of human primary myoblasts, we developed a reverse transfection protocol that allowed high - efficiency transfection of sirnas in these cells (see the star methods). The 45 sirnas plus a negative control were applied in triplicate to myoblast cultures in a 96-well format, and, 24 hr post - transfection, cells were switched to dm for 48 and 96 hr . The relative abundance of the circular versus linear forms was tested in order to confirm the specific downregulation of the circrna . This revealed that at least one sirna for 17 different genes specifically downregulated the circular form without affecting the linear mrna (figure s3b). Immunofluorescence analysis was performed for two common myogenic markers, myogenin (myog) and myosin heavy chain (mhc), together with dapi staining (figure s3c). Several readouts were analyzed in order to obtain a detailed picture of how knockdown of each circrna affected cell differentiation and morphology . We included in this analysis 11 different phenotypes, including total cell number, the fraction of myog- or mhc - positive cells, and additional morphological parameters, such as the fusion index . From this screening, two strong and opposite phenotypes associated with sirnas targeting circ - qki and bnc2 emerged . The two sirnas designed for circ - qki (sirna #1 and sirna #2) both inhibited myoblast differentiation (figure 3b). While sirna #1 had a specific effect on circ - qki and none on qki mrna, sirna #2 did not alter circ - qki levels but downregulated qki mrna (figure s3b). This supports the hypothesis that both circ - qki and qki mrna participate in the same process . To confirm that hypothesis, we raised a third sirna specifically targeting qki mrna (si - qki - l; figure s3d). Si - qki - l, and additional experimental replicates with si - qki #1 (figures 3c, s3b, s3d, and s3e), had again a specific anti - myogenic effect, thus confirming that both the circrna and the mrna could be involved in promoting differentiation (figure s3e, as in li et al ., 2003). In the case of circ - bnc2, si - bnc2 #1 efficiently downregulated circ - bnc2 but had also a small effect on bnc2 mrna, while si - bnc2 #2 targeted specifically circ - bnc2 and had no effect on the phenotype (figure s3b). We confirmed this by using a third sirna, designed specifically for bnc2 mrna (si - bnc2-l; figures s3d and s3e), and we observed the same effect as with additional replicates of si - bnc2 #1 (figures 3c, s3d, and s3e). Notably, during differentiation, a strong increase of the circular rna paralleled the decrease of the linear bnc2 mrna (figures 2 g, s2a, and s2b). Therefore, it is likely that biogenesis of circ - bnc2 is a mechanism for competing with the production of the anti - myogenic bnc2 mrna when differentiation starts . Interestingly, both circrnas, upregulated during in vitro differentiation of control myoblasts, were downregulated in dmd conditions (figure 3d), well correlating with the notion that dystrophic cells have altered progression into the differentiation process (cazzella et al ., 2012). For a different set of circrnas highly expressed in myoblasts, we investigated the relationship between their abundance and proliferation capacity through a bromodeoxyuridine (brdu)-labeling assay (figure s3c). Among the circrnas tested, we found that the knockdown of circ - znf609 (successfully accomplished with sirna #1) reduced brdu incorporation by 80% (figure 4a). In line with this, also markers of proliferation, such as cdk1 and cyclin a2, were significantly reduced after circrna knockdown (figure 4e), indicating a specific role of circ - znf609 in myoblast proliferation . Similar effects, even if at lower extents, were observed in murine cells (figures s4a and s4b). The initial screening was subsequently validated by comparing the activity of three distinct sirnas: si - circ (corresponding to sirna #1 used in the screening), which targets the circ - znf609 head - to - tail junction; si - ex2, targeting both the circrna and its linear counterpart; and si - mrna targeting only the linear mrna (figure 4b). Both si - circ and si - ex2 reduced myoblast growth rate by 80% while si - mrna, targeting only the linear mrna, did not affect proliferation (figures 4c and 4d). These results allowed us to exclude that the observed phenotype was due to an off - target effect, and they indicated that the decrease in proliferation was solely due to the circrna activity . Both circular and linear znf609 rna levels were measured after treatments by qrt - pcr, confirming the specificity of the three sirnas (figure 4e). Moreover, northern blot analysis confirmed that circ - znf609 was susceptible to si - circ treatment and resistant to rnase r (figure 4f), while the linear znf609 mrna was resistant to si - circ and susceptible to rnase r (figure 4f). Notably, the circular form co - migrated with the product derived from an artificial construct, p - circ (see next paragraph), overexpressing circ - znf609 rna (figure 4f). Also interestingly, circ - znf609, which is downregulated during myogenesis in control myoblasts, was instead found at elevated levels in dmd conditions (figure 4 g). This is consistent with the delayed differentiation phenotype of dystrophic primary myoblasts and with the persistence of a high proportion of proliferating, non - fusing myoblasts (cazzella et al ., 2012). Circ - znf609 originates from the circularization of the second exon of its host gene . A 753-nt open reading frame (orf) is present in circ - znf609, spanning from the putative aug of the host gene to a stop codon created 3 nt after the splice junction (figure 5a). To determine whether this orf (circorf) is functional, we first used sucrose gradient fractionation to test circ - znf609 loading onto polysomes . Figure 5b shows that a small but significant proportion of circ - znf609 sedimented with heavy polysome fractions while the rest remained in the non - bound fraction . The circular conformation of the polysome - bound circ - znf609 rna was confirmed by rnase r resistance (figures s5a and s5b). Moreover, we excluded the presence of possible linear concatemers by northern blot (figure 4f; see also rt - pcr with primers in exons 1 and 3 of the znf609 gene in figure s5c). In puromycin - treated myoblasts, circ - znf609 shifted to lighter polysomes, similarly to the behavior of the linear znf609 and hprt mrnas, suggesting that its sedimentation pattern was due to active translation . As a control, a circrna with no orf, circ - pms1, remained on free rna fractions . The association of circ - znf609 with heavy polysomes was also confirmed in mouse (figure s5d). To test the protein - coding ability of circ - znf609, we took advantage of an expression vector that was able to produce circular transcripts (kramer et al ., 2015). P - circ contains the second exon of the znf609 gene and is able to express circ - znf609 rna at high levels (figure 4f). Sequencing of the rna produced from this construct revealed its perfect correspondence with the endogenous circ - znf609 rna (data not shown). A construct was derived from p - circ that contained a 3flag - coding sequence immediately upstream of the stop codon, such that a flagged protein could be produced only upon formation of a circular template (p - circ3xf; figure 6a). Due to the poor transfection efficiency of plasmid dna in human and murine myoblasts, the results indicate that in both cell types, in comparison to mock - treated cells, p - circ3xf gave rise to two flagged proteins (figure 6b). Inspection of the sequence indicated that a second atg codon was present 150 nt downstream of the first one and in the same frame . Mutants lacking either one of the two initiation codons (p - circ1 and p - circ2) showed that two bands observed by western blot corresponded to two isoforms: the upper band (atg1) derived from translation from the first atg, while the lower one (atg2) originated from the second start codon (figure 6b). Deletion of both atgs (p - circ1 - 2) abolished both products . An additional mutant, with a tga stop codon replacing atg2 (figure 6a; stop2), confirmed that translation of the flagged proteins required initiation at those precise sites (figure s6c). An additional construct, p - lin3xf, was raised carrying the same orf present in circ - znf609 in a linear conformation . When transfected in hela and n2a cells, this plasmid induced the expression of the same two proteins observed with the circular substrate, even if with a much higher efficiency (figures s6a and s6b). Titration of the proteins produced by the linear versus the circrnas, normalized for the amount of rna produced, indicated that circrna was translated at almost two orders of magnitude lower efficiency than the linear form (figure s6b). These results are in line with previous observations showing that re - initiation and internal initiation of translation can be as low as 1%10% the efficiency of cap - dependent initiation (merrick, 2004). Moreover, while the circular template yielded approximately the same amount of the two isoforms, translation of the linear one was strongly biased in favor of the first atg, indicating a substantial difference in the translation initiation mechanism between the circular and linear transcripts . In cells expressing p - circ3xf and the different atg mutant derivatives, we confirmed the production of circular transcripts by northern analysis (figure s6d), with a specific control of rnase r resistance (figure s6e). We also verified the integrity of the orf by sanger sequencing of the rt - pcr products (data not shown), and we further excluded the production of linear concatemers through rt - pcr (figures s6f and s6 g). To further prove the protein - coding ability of the circ - znf609 rna derived from the chromosomal gene, we designed a genome - editing approach for inserting the 3flag - coding sequence in the endogenous znf609 locus . We used the crispr / cas9 system in mouse embryonic stem cells in combination with a dna donor designed for inserting the 3flag - coding sequence in the same position as in p - circ3xf, so that a flagged protein could be produced only upon circularization of the second exon of znf609 (figure 6d). After transfection, clonal selection, and genotypization (figures s6h s6j), we obtained one positive clone carrying two modified alleles: the first one contained the expected flagged allele, while the second carried a small deletion across the 3 splice site of the first intron, which prevented circularization of the second exon (figure s6j; f / d clone). Therefore, from this cell line only the flagged allele would be able to produce the circ - znf609 rna, and the amount of circrna produced would be half of that produced by a wild - type (wt) line . Since circ - znf609 is highly expressed in neural tissues (rybak - wolf et al ., 2015), we applied an established neuronal differentiation protocol (wichterle and peljto, 2008), and we checked for the expression of the flag - tagged circ - znf609 rna by northern blot in wt cells and in the f / d clone . As expected for their genomic context, f / d cells produced roughly half the circrna of wt cells (figure s6k); moreover, the circrna was slightly larger than in the wt because of the inserted tag . Rt - pcr and sanger sequencing confirmed that the circ - znf609 rna produced by f / d cells was identical to that made by the p - circ3xf construct . Due to the low translation efficiency and the high background in western analysis, we performed immunoprecipitation of f / d cells lysates with an anti - flag antibody, and then we subjected proteins (size selected between 30 and 40 kda) to mass spectrometry on a polyacrylamide gel . As positive controls, we immunoprecipitated proteins from cells transfected with the constructs overexpressing either the linear or the circular flagged orf . Figure 6e shows that numerous peptides, mapping to the circorf, were present in overexpression conditions with the linear construct (p - lin3xf), fewer with overexpression of the p - circ3xf construct, and one in the f / d sample . This is in agreement with the lower levels of rna produced by the chromosomal gene, with respect to those obtained with the overexpression of both p - circ3xf (figure 4f) and p - lin3xf, and to the lower translational efficiency from circular templates (figures s6a and s6b). No znf609 peptides were instead detected in control wt cells . As low initiation efficiency is commonly associated with cap - independent translation, which instead serves as a regulatory mechanism responding to various external stimuli, such as heat shock stress (holcik and sonenberg, 2005), we tested protein production in such condition . As shown in figure 6f, heat shock induces a strong and significant increase in translation of the flagged circ - znf609 transcript . Since circrnas are devoid of cap structure, translation should occur through sequences able to act as internal ribosome entry sites (iress). Notably, phylogenetic analysis of the 5 and 3 utrs of znf609 in vertebrates indicated that the portion of the 5 utr present in circ - znf609 was significantly more conserved than the other utr sequences situated in the linear znf609 mrna (figure s6l). To test whether it possessed ires - like activity, the circ - znf609 utr was inserted between the firefly and renilla luciferases of a bicistronic construct (utr; figure 6 g). With respect to a vector containing a viral ires sequence (emcv), utr displayed very little luciferase activity (figure 6h). Remarkably, renilla luciferase raised to levels even higher than those of emcv when introns from znf609 (utr - inznf), hprt (utr - inhprt), and -globin (utr - inglob) genes were inserted into the utr construct, reconstituting the original splice junction of circ - znf609 . Furthermore, deletion of the 5 splice site in utr - inglob (utr-ss) completely abolished luciferase levels (figure 6h), indicating that renilla luciferase (rluc) activity did not originate from cryptic splice sites and ultimately proving the relevance of splicing in the induction of ires activity . Finally, the circ - znf609 utr was replaced with an unrelated sequence of similar length (mcs - inglob). Notably, this construct was not able to trigger rluc activity (figures 6 g and 6h), thus pointing out that ires activity also relies on specific features of the utr sequence . Rt - pcr analysis indicated that correct splicing, where applicable, was obtained for all constructs (figure s6 m). Altogether, these data show that the utr of circ - znf609 is able to work as an ires in a splicing - dependent manner . Moreover, synthetic flag - tagged circ - znf609 made by in vitro ligation (figure s6n) was not translated upon transfection in comparison to the same molecule produced through back - splicing from plasmid p - circ3xf, further demonstrating the requirement of a splicing - dependent process for efficient circrna translation (figures s6n and s6o). Due to several unique features, circrnas are increasingly recognized as promising candidates for the identification of additional layers of gene expression control . For instance, circrnas can pleiotropically modulate gene expression by competing for mirna or protein binding (hansen et al ., 2013, hentze and preiss, 2013, du et al ., 2016), or they can compete with linear rna production regulating the accumulation of full - length mrna (ashwal - fluss et al ., 2014). They have been shown to have differential tissue - specific expression (memczak et al ., 2013, rybak - wolf et al ., 2015) and specific subcellular localization (rybak - wolf et al ., 2015, you et al ., 2015). Despite the large number of circrnas identified in many different organisms, tissues, and developmental conditions, only a few examples are available that indicate a crucial role on cellular functions (guarnerio et al . In part this is due to the difficulty in selective targeting of circrnas, because their nature limits the choice of target region for selectivity and further constrains the parameters normally used for designing mrna - targeting sirnas . Here, with a combination of bioinformatic tools, we obtained selective circrna downregulation using modified sirnas . These reagents were used in an image - based functional genetic screen of 25 circrna species, conserved between mouse and human, which were differentially expressed during myogenesis . Such analysis provided one interesting case, circ - znf609, whose phenotype could be specifically attributed to the circular form and not to the linear counterpart . Notably, analysis of the circ - znf609 sequence revealed the presence of an orf . We found that a fraction of circ - znf609 rna is loaded onto polysomes and that, upon puromycin treatment, it shifted to lighter fractions, similar to canonical mrnas . The coding ability of this circrna was proved through the use of artificial constructs expressing circular tagged transcripts and by crispr / cas9 tagging of the endogenous znf609 gene . Proteins derived from the translation of circrnas were described a long time ago in archaea, where homing endonucleases were produced by stable circularized introns (kjems and garrett, 1988, dalgaard et al ., 1993). Although there are reports of circrna in vitro translation (chen and sarnow, 1995) and of proteins derived from artificial circrna constructs (wang and wang, 2015, abe et al ., 2015), our data demonstrate that an eukaryotic endogenous circrna may encode for a protein . Generation of protein isoforms via back - splicing and circularization of selected exons from primary mrna transcripts is an intriguing mechanistic alternate to conventional alternative splicing . Interestingly, termination codons present upstream of the aug initiation codon in linear mrnas can be converted into in - frame stop codons upon circularization . Moreover, depending on the distance of the stop codon from the newly formed junction, peptides with additional amino acids that are absent from the linear form can be produced . Therefore, these mechanisms enlarge the repertoire of protein domains that can be derived from a primary transcriptional unit, and they increase further the complexity of the genome output . This is particularly interesting in consideration of the fact that many circrnas contain the canonical start codon of their host gene (735 circrnas of 2,175 in our human dataset, well above the number expected by chance). So far, we have no hints on the molecular activity of the proteins derived from circ - znf609 and as to whether they contribute to modulate or control the activity of the counterpart deriving from the linear mrna . The zinc - finger protein 609 has been described as a transcriptional factor characterized by two zinc - finger domains . It was detected as part of a protein interaction network dedicated to control embryonic stem cell (esc) pluripotency in nanog - associated complexes (gagliardi et al ., 2013) and as a direct interactor of dax1 (wang et al ., 2006). Znf609 was also shown to be required for rag1 and rag2 expression in developing thymocytes (reed et al ., 2013). The fact that the circ - znf609-encoded protein lacks the zinc - finger domains would suggest different hypotheses on how it could interfere or cope with the activity of the full - length isoform: it could act as a dominant - negative competitor or as a modulator of alternative znf609 complex formation . However, since the use of plasmids and other expression vectors as well as naked rna produced a non - specific block of myoblast proliferation, we were unable to perform rescue experiments and univocally link the circ - znf609 phenotype to its protein - coding capacity . Another relevant aspect about circrnas, lacking the cap structure and the polya tail, relates to the machinery and factors required for the assembly into translationally competent complexes . Cap - independent translation, driven by the so - called ires, was initially described in viral rnas (pelletier and sonenberg, 1988) and subsequently identified also in cellular rnas (weingarten - gabbay et al ., iress can act by various mechanisms, including the formation of rna structures, watson - crick base pairing with the 18s ribosomal rna, and often in cooperation with ires - transacting factors (itafs) (komar and hatzoglou, 2011); moreover, putative cellular iress have been suggested to play crucial roles in different developmental conditions and in response to different types of stress (holcik and sonenberg, 2005). In this work, we showed that the utr element of circ - znf609, spanning from the termination to the initiation codons, can drive ires - dependent translation but only if produced through a splicing event, suggesting that factors loaded on the transcript upon splicing might play a crucial role in ribosome recognition and translation initiation . In this study, we have also observed that the circular template had a much lower translation activity when compared to the linear counterpart, a feature exhibited also when analyzing the cell line carrying an endogenous flagged allele obtained through crispr / cas9 genome editing . It is well known that cap - independent initiation is less efficient than the cap - dependent one (merrick, 2004) and that regulation of cap - independent translation is often used to respond to several cellular stresses in order to allow immediate and selective changes in protein levels (holcik and sonenberg, 2005). Along this line, cis - acting elements have been also shown to respond to different cellular stresses and to contribute in the promotion of translation initiation through a cap - independent mechanism . This is the case of n6-methyladenosine (m6a) residues whose levels in 5 utrs are increased upon different cellular stresses (zhou et al . Notably, reanalysis of m6a cross - linking and immunoprecipitation (clip) data (zhao et al ., 2014) and m6a immunoprecipitation (ip) in myoblasts (figures s6p and s6q) revealed that circ - znf609 is highly methylated, suggesting a possible regulatory role of this modification in circ - znf609 translational activity . In conclusion, circ - znf609 provides relevant material to identify the factors required for the translation of this class of transcripts devoid of cap and polyadenylated tails . Further work will be required in order to understand whether circrna translation responds to specific stimuli or signals different from those regulating protein synthesis conducted by linear mrnas . Reagent or resourcesourceidentifierantibodiesanti - flag m2sigma - aldrichcat #f1804 - 1mganti - actinin (h-300)santa cruz biotechnologycat #sc-15335; rrid: ab_2223809anti - gapdh (6c5)santa cruz biotechnologycat #sc-32233; rrid: ab_627679anti - myogeninsanta cruz biotechnologycat #sc12732; rrid: ab_627980anti - myosinthis papern / aanti - mouse cy3/alexafluor488jackson immunoresearchcat #115 - 165 - 003anti - m6asysycat #202 003; rrid: ab_2279214chemicals, peptides, and recombinant proteinsdmemsigma - aldrichcat #d6546fbssigma - aldrichcat #f7524l - glutaminesigma - aldrichcat #g7513egfcorningcat #354052penicillin / streptomycinsigma - aldrichcat #p0781fgfbmilliporecat #01 - 106human skeletal muscle dmpromocellcat #c-23061insulinsigma - aldrichcat #11376497001collagen type icorningcat #354236optimemgibcocat #31985 - 047rnase repicentercat #mrna092vilo superscriptthermo fisher scientificcat #11754050sybr mastermixqiagencat #208052bis - tris - acrylamide gelthermo fisher scientificcat #wg1402boxembryonic stem mediummerck milliporecat #slm-220-bglutamaxthermo fisher scientificcat #35050 - 061lifmerck milliporecat #esg1107advanced d - mem / f12thermo fisher scientificcat #12634010neurobasalthermo fisher scientificcat #211030049knockout serum replacementthermo fisher scientificcat #10828028b-27thermo fisher scientificcat #17504 - 044ne aminoacidsmerck milliporecat #tms-001-cretinoic acidsigma - aldrichcat #r2625glyoxal loading dyeambioncat #am8551mytaq dna polymerasebiolinecat #bio-21105cycloheximidesigma - aldrichcat #01810rnase guardthermo fischer scientificcat #n8080119qiazol reagentqiagencat #79306hybond n+ membranege healthcarecat #rpn303bt7 rna polymerasepromegacat #p2077proteinase kthermo fischer scientificcat #25530049puromycinservacat #33835.02paraformaldehydeelectron microscopy sciencecat #157 - 8goat serumthermo fischer scientificcat #16210072prolong diamond reagentthermo fischer scientificcat #p36930dapisigma - aldrich - aldrichcat #d9542fastdigest ecorithermo fischer scientificcat #fd0274fastdigest nheithermo fischer scientificcat #fd0973bbsinebcat #r0539sfastdigest xbaithermo fischer scientificcat #fd0684northernmax bufferambioncat #am8671pbssigma - aldrichn / alds sample bufferinvitrogencat #np0007dnasethermo fischer scientificcat #en0525alkaline phosphatasesigma - aldrichcat #000000010713023001rnase inhibitorsthermo fischer scientificcat #eo0384t4 polynucleotide kinasebiolabscat #m0236sdmsosigma - aldrichcat #d4540t4 rna ligase 1biolabscat #m0204slipofectamine 2000thermo fischer scientificcat #11668019dharmafect lipid reagentdharmaconcat #t-2001 - 01critical commercial assaysribominus technologythermo fisher scientificcat #a1083708real genomics genomic dna extraction kitrbc biosciencecat #ygb300mirneasy spin columnsqiagencat #217004dig - luminescence detection kitsigma - aldrichcat #11363514910dig - rna labeling mixsigma - aldrichcat #000000011277073910in - fusion hd cloning kitclontechcat #639649dynabeads protein g immunoprecipitation kitinvitrogencat #10007d5-bromo-2-deoxy - uridine labeling and detection kit isigma - aldrichcat #11296736001dual glo luciferase assaypromegacat #e2920deposited datarna sequencing raw datathis papergeo: gse70389experimental models: cell linesmouse myoblasts c2c12atcccat #crl-1772human male myoblasts (wt)telethon biobankn / ahuman male myoblasts (dmd)telethon biobankn / ahelaatcccat #ccl-2n2aatcccat #ccl-131mouse embryonic stem cellsthis papern / amouse embryonic fibroblastsmilliporecat #92590oligonucleotidesdna oligonucleotides used in this work are listed in table s2sirnas used in this work are listed in table s3recombinant dnapcdna3.1(-)thermo fisher scientificn / ap - circ (name used in this work)hung ho xuan, gunter meister labn / ap - circ-3xf (name used in this work)hung ho xuan, gunter meister labn / acircrna mini vector zkscan1addgene#60649p - circ-3xf 1this papern / ap - circ-3xf 2this papern / ap - circ-3xf 1 - 2this papern / ap - stop2this papern / ap - lin-3xfthis papern / apx330 vectoraddgene#42230pgl3-control vectorpromegan / aprl - tk vectorpromegan / ap - luc empty vectorthis papern / autr+in. Glob.d5ssthis papern / autr vectorthis papern / apires2-egfp plasmidclontechn / apluc - emcv - iresthis papern / autr+in . Papern / autr+in .- znf vectorthis papern / autr+in.hprt vectorthis papern / amcs+in. Glob vectorthis papern / asoftware and algorithmstrimmomaticbolger et al . (2013)n / ahttp://crispr.mit.edun / an / aacapella software development / run - time environmentperkin elmern / acustom image analysis scriptsthis papern / acircrna annotation and data parsing scriptsthis papern / a further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, irene bozzoni (irene.bozzoni@uniroma1.it). Mouse myoblasts (c2c12, atcc) were cultured in growth medium (gm, dmem with 20% fbs, l - glutamine 2 mm and penicillin / streptomycin) and induced to differentiate in dm (fbs reduced to 0.5%). Human myoblasts (wt and dmd) were cultured in growth medium (gm, dmem with 10% fbs, l- glutamine 2 mm, insulin 50 mg / ml, fgfb 25 ng / ml, eggf 1 ng / ml, penicillin / streptomycin) and induced to differentiate with human skeletal muscle dm (promocell). Reverse transfection of human myoblasts with sirnas was performed as follows: 96-well optical plates (corning) were treated overnight with 350 mg of collagen type i in water and 0.5% acetic acid, washed with pbs and uv - sterilized . Twenty microliters of sirna transfection mix (150 nm sirna, 0.2 l dharmafect lipid reagent from dharmacon, 20ml transfection medium: dmem with l - glutamine 2 mm and insulin 50 mg /ml) was seeded in each well, left at rt for 20 min and then diluted with 30 l of transfection medium . Cells (12000 per well) were added after resuspension in double complete medium (gm with 2x concentration of serum, antibiotics, fgfb and egf). Cells were switched to dm after 24h and fixed or collected for analysis at 48 hr and 96 hr . Hela and n2a cells were cultured in dmem with 10% fbs, l - glutamine 2 mm and penicillin / streptomycin 1x . Hela and n2a cells were transfected with 2 g of plasmid dna with lipofectamine 2000 . Two l of lipofectamine were added to 300 l of optimem with dna, mixed and pipetted in a 35-mm plate with 200000 cells . Medium was replaced 4 hr later and cells harvested for protein and rna analyses after 48 hr . For heat shock experiments, p - circ3xf - tranfected hela cells were cultured at 44c for three hours . Total rna in this study was extracted with qiazol reagent according to the manufacturer s protocol (qiagen). Rna from 96-well plates and nuclear / cytoplasmic fractions was purified with mirneasy spin columns according to the manufacturer s specifications (qiagen). Rnase r treatment was performed as follows: 1 - 10 g of total rna was diluted in 20 l of water with 4u rnase r/g unless differently stated and 2 l of enzyme buffer (epicenter), then incubated 15 min at 37c and purified by phenol chloroform extraction . One pg of a dna spike- in molecule was added to each reaction for qpcr normalization . Dna spike - in was produced from the multiple cloning site in pcdna3.1(-) (life technologies). Retrotranscription of rna in this study was performed with vilo superscript (life technologies): up to 2 g of rna were retrotranscribed in a 10 l reaction mix with 1 l of enzyme and 2 l of buffer, incubated 10 min at 25c, 60 min at 42c and 5 min at 85c . Qrt - pcr analyses in this study were performed as follows: cdna (2 - 10 ng equivalent) was added to a reaction composed of 7.5 l 2x sybr mastermix (qiagen), 1.5 l of 5 mm primers and water to a final volume of 15 l . Dna amplification (40 cycles of 95c for 30 s, 55c for 30 s and 72c for 30 s, followed by melting curve analysis) was monitored with an abi 7500 fast qpcr instrument . Rt - pcr for circrna detection was performed with 0.2 l of mytaq dna polymerase (bioline) in 25 l water with 5 l reaction buffer, 15 ng of cdna, 2.5 l 5 mm primers . Reaction was carried out for 28 cycles at 95c for 25 s, 55c for 25 s, 72c for 25 s. five microliters of pcr were run on 2% agarose gels . Rt - pcr for circular and linear rna from the same locus was carried out for the same number of cycles . Rna (10 - 20 g for detection of endogenous circrna and 1 - 2 g for detection of overexpressed circrna) was denatured with one volume of glyoxal loading dye (ambion) for 30 at 50c and loaded on 1.2% agarose gel . Electrophoresis was carried out for 2 - 3 hr at 60 v. rna was transferred on hybond n+ membrane (ge healthcare) by capillarity overnight in 10x ssc . Transferred rna was cross - linked with uv at 1200 100 j / cm2 and the membrane was washed in 50 mm tris ph 8.0 for 20 min at 45c . Prehybridization and hybridization were performed in northernmax buffer (ambion) at 68c (30 min and overnight respectively). 500 ng of dig - labeled probe in 10 ml were used for hybridization . The membrane was then washed with 2x ssc 0.1% sds twice 30 min, then once 30 min and once 1 hr with 0.2x ssc 0.1% sds at hybridization temperature . The membrane was the processed for dig detection (hybridization with anti - dig antibody, washing and luminescence detection) with the dig luminescence detection kit (roche), according to the manufacturer instructions . Dig - labeled probes were produced by in vitro transcription with dig - rna labeling mix (roche) of pcr templates produced with the oligonucleotides znf609_c_l_fw, znf609_c_l_t7_rv used with both human and mouse cdnas . Transcription with t7 rna polymerase (promega) was carried out overnight and the rna was then loaded on 6% denaturing polyacrylamide gel, run for 1 hr in tb 1x at 100 v. the gel was stained with etbr 1:10000 for 10 min, washed in ddh2o for 10 min and the bands were cut and resuspended in 500 l of na acetate 0.3 m, 0.1 mm edta, 0.2% sds ph 5.5 . Elution was carried out overnight on a rotating wheel and the eluted rna was purified by pca and precipitated with 1 l glycogen in 1 ml 100% ethanol . Illumina truseq library preparation was performed by istituto di genomica applicata (udine, italy) from 1 g of total rna, depleted of ribosomal rna with ribominus technology (life technologies). For each sample, 20 - 40 million 100bp long paired - end reads were collected for each sample (geo: gse70389), then trimmed and analyzed as reported in quantification and statistical analysis, section rnaseq analyses . Nuclear / cytoplasmic fractionation of human and mouse cells was performed according to legnini et al . (2014) as follows: cells (1 106) were washed with pbs and immediately lysed on ice with 500 l of cytoplasmic lysis buffer (140 mm nacl, 1.5 mm mgcl2, 10 mm tris ph 7.5, 0.5% np40) for 5 min . After scraping the cells and placing them in a 2 ml collection tube, 500 l of a sucrose cushion (same as lysis buffer with 12% sucrose) was gently pipetted to the bottom of the tube . Sample was centrifuged 10 min at 12000 x g. supernatant and pellet were then separately resuspended in 1 ml of qiazol, while sucrose was discarded . Cytoplasm fractionations on sucrose gradients were performed as follows: 5x106 cells were lysed 5 min on ice with 500 l of tnm (10 mm tris ph 7.5, 10 mm nacl, 10 mm mgcl2) lysis buffer supplemented with 10 mg / ml cycloheximide, 1x pic (complete, edta free, roche) and 1x rnase guard (thermo scientific), then spinned 2 min at 15000 x g for discarding nuclear pellets . Samples were centrifuged on 9 ml 15%45% sucrose gradient at 38000 rpm with a sw41 rotor (beckman) for 1 hr 30 min at 4c . Fractions were collected with a bio - logic lp (biorad), 1 pg of a spike - in dna as internal control was added to each fraction, together with 10 g of glycogen, 100 g of proteinase k (roche) and 40 l of sds . Samples were left 1 hr at 37c and rna was purified by pca extraction and precipitated with isopropanol . Dna spike - in was produced amplifying the multiple cloning site from pcdna3.1(-) (life technologies). For puromycin treatments, medium was replaced 3 hr before lysis with 1 mm puromycin containing- medium . Cells were harvested with 50 - 100 l of protein extraction buffer (100 mm tris ph 7.5, edta 1 mm, sds 2%, pic 1x (complete, edta free, roche) and incubated 20 min on ice, centrifuged at 15000 x g for 15 min at 4c . Proteins (15 - 30 g) were loaded on 4%12% bis - tris - acrylamide gel (life technologies) and transferred to a nitrocellulose membrane . The membrane was blocked in 5% milk and hybridized with the following antibodies, depending on the experiment . Flag protein sequence was detected by wb through f1804 - 1 mg monoclonal anti - flag m2 (sigma - aldrich). Actinin and gapdh were detected by wb through polyclonal anti - actinin (h-300) sc-15335 (santa cruz biotechnology) and monoclonal anti - gapdh (6c5) sc-32233 (santa cruz biotechnology), respectively . Cells were washed twice in 100 ml pbs, fixed with 100 l of 4% paraformaldehyde for 15 min at room temperature, washed twice with 100 l of pbs, permeabilized and blocked with 100 l of pbs with 0.2% triton x-100 and 1% goat serum, incubated with 50 l of in - house made anti - myogenin / anti - myosin antibody (available upon request), washed twice in pbs, incubated with 50 l anti - mouse cy3/alexafluor488 secondary antibody diluted 1:300 in pbs - dapi and finally washed twice in pbs . Acquisition for image - based phenotypic analysis was performed with a widefield nikon tie microscope equipped with a lumencor spectrax led light source and perfectfocus 3; 4 and 10 objectives were used (nikon instruments). For image analysis labeling reagent was added to the cell culture medium (diluted 1:1000) 3 hr before fixation (human primary myoblasts) or 15 before fixation (c2c12), then cells were fixed with a solution made of 7 parts of ethanol and 3 parts of 50 mm glycine at ph 2.0 for 20 min at 20c . Cells were then washed twice with pbs and incubated for 1 hr at room temperature with 30 l of antibody anti - brdu diluted 1:10 in pbs . Cells were again washed twice and incubated for 30 min with anti - mouse cy3/alexafluor488 secondary antibody diluted 1:300 in pbs - dapi and finally washed twice in pbs . We took 4 pictures of each well with a zeiss axio observer a.1 with a 10x objective, both in the dapi and cy3 channels . For brdu image analysis see quantification and statistical analysis, section image analysis . For immunofluorescence of p - lin3xf - transfected cells, they were fixed in 4% paraformaldehyde (electron microscopy sciences, hatfield, pa) in pbs for 20 min at 4c . Cells were then washed in pbs and permeabilized and blocked with 0.2%triton x-100 /0,2% bsa in pbs for 20 min at room temperature . Subsequently, cells were processed for immunostaining with anti - flag m2 primary antibody (sigma aldrich) diluted 1:1000 in 0,2% bsa/1% goat serum / pbs for 16h at 4c . Cells were then incubated with secondary antibody (goat anti - mouse igg cy3-conjugated, jackson immunoresearch, west grove, pa) diluted 1:500 in 1% goat serum / pbs for 45 min at room temperature . Finally, after extensive washing, dapi (sigma - aldrich) was used to label nuclei and the coverlips samples were imaged on an olympus ix73 inverted microscope equipped with confocal imager crest x - light spinning disk, a coolsnap myo ccd camera (photometrics) and a lumencor spectra x led illumination . The images were acquired using a lucplanfln 20x objective (na 0,45) and a uplansapo 60 x oil objective (na 1.35) and collected with metamorph software (molecular devices). Cells were trypsinized and pelleted at 500 g for 5 min, washed in pbs and lysed in an equal volume to the cell pellet of lysis buffer (250 mm nacl, 50 mm tris ph 8, 5 mm edta, 0.8% np40, 1 mm dtt, 5% glycerol, 50 mm naf) with 20 strokes in a dounce homogenizer . Lysates were left on ice for 5 min and centrifuged at 15000 g for 10 min . Protein concentration of the supernatant was then measured by bradford assay and a volume containing 5 - 10 mg of proteins was diluted 1:2 in dilution buffer (50 mm tris ph 8, 5% glycerol). Fifty l of protein g - coupled dynabeads (immunoprecipitation kit, invitrogen) were washed in binding buffer (form the kit), resuspended in 200 l of binding buffer containing 10 g of anti- flag m2 antibody (sigma - aldrich aldrich) and left rotating on a wheel for 1 hr at 4c . Beads were then washed in binding buffer and incubated with the diluted lysates in a final volume of 600 - 800 l . The binding was carried out at 4c with the samples rotating on a wheel . Beads were then washed 3 times with low salt wash buffer (50 mm tris ph 7.5, 150 mm nacl, 1 mm edta, 0.25% np40, 5% glycerol), 2 times in high salt wash buffer (same as low salt with 300 mm nacl) and once in pbs . Samples were eluted with 20 l elution buffer (from the kit) and 10 l lds sample buffer (invitrogen). Proteins were run on a 4%12% polyacrylamide gel for 1 hr at 160 v and bands were cut according to the protein marker between 30 and 40 kda . Bands were stored at 4c in 300 l h2o and sent for mass spectrometry analysis to the proteomic platform at igbmc - strasbourg, where they were digested with trypsin and analyzed according to their standard mass spectrometry pipeline . (2012) as follow: a volume containing 100 g of rna was diluted in a final volume of 300 ml with ipp buffer (10 mm tris ph 7.4,150 mm nacl, 0.1% np-40) containing 10 g of anti - m6a antibody and incubated for 2 hr at 4c . The mixture was then immunoprecipitated by incubation with 50 l of g - coupled dynabeads (immunoprecipitation kit, invitrogen) at 4c for an additional 2 hr . Beads were then washed 5 times with ipp buffer and resuspended in 500 l of qiazol . Beads - only and isotypic igg - coupled - beads were used as negative controls . The insertion of a 3xflag coding sequence at position 3 of the zfp 609 exon 2, immediately before the stop codon, was obtained in mouse embryonic stem cells by homology - directed repair of a crispr / cas9-induced dna break . A guide rna targeting the beginning of zfp 609 exon 2 was designed with crispr design (http://crispr.mit.edu) and cloned in a px330 vector (see plasmid construction section). As a dna donor, both a ssdna oligo (ssdna donor) and a plasmid donor carrying the same sequence plus 800 nt of homology upstream and downstream were used . Transfection of 500 ng of donor dna plus 500 ng of px330 was performed in mes cells with 2 l of lipofectamine 2000 . After 48 hr, cells were split and a half was used for gdna extraction and genotyping . Oligos crispr - a, b and c were used for amplifying the wt and recombinant alleles (figure s6d) on control cells and transfected cells . Pcr products were sanger sequenced and the plasmid donor - transfected cells resulted positive for the insertion . We diluted trypsinized cells at 0.5 cells / well in two 96 wells, and recovered a total of 20 colonies with the plasmid donor - transfected cells . Colonies were split after 10 days and half of each was grouped producing 3 pools, which were separately genotyped . Pool #2 appeared positive, therefore the single colonies were further scrutinized and only one positive clone was identified (named f / d, p - circ and p - circ-3xf were kindly provided by hung ho xuan and gunter meister . Briefly, p - circ was produced by cloning the circznf609 sequence in the circrna mini vector zkscan1 (kramer et al ., 2015), addgene #60649) and p - circ-3xf was derived by inserting a 3xflag - coding sequence (gactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatga caag) immediately upstream of the taa codon present at position 3 in the circrna sequence . We obtained the 1 derivative through inverse pcr on the p - circ-3xf vector with noatg1-znf609_fw and noatg1-znf609_rv oligonucleotides, while the 2 with noatg2-znf609_fw and noatg2- znf609_rv, the p - stop2 with stop2_fw and noatg2-znf609_rv on the p - circ-3xf template . The 1 - 2 was produced with an inverse pcr with noatg1-znf609_fw and noatg1- znf609_rv on the 2 template . The p - lin-3xf vector was produced by inserting an amplicon obtained with pznf_fw and pznf_rv oligonucleotides from c2c12 gdna using the in - fusion hd cloning kit (clontech) into pcdna3.1- (invitrogen), digested with ecori and nhei . The 3xflag tag was then inserted into the resulting vector through inverse pcr with 3xflag_1/2fw and 3xflag_1/2rv oligonucleotides . The oligonucleotides (flag_zfp_guide2_fw and flag_zfp_guide2_rv) encoding the cas9 guide rna were annealed and ligated in a bbsi - digested px330 vector (addgene #42230, (cong et al ., 2013)). Luciferase bicistronic reporter constructs were obtained from pgl3-control vector (promega) and prl - tk vector (promega). In order to get p - luc empty vector, fluc gene was isolated from pgl3-control vector through the digestion with the restriction enzymes nhei and xbai . 5utr was amplified with fw_5utr - circznf609 and rev_5utr - circznf609 oligonucleotides and cloned between the two luciferase genes in p - luc empty vector, linearized by inverse pcr using fw_inversepcr-1 and rv_inversepcr-1 oligonucleotides . In order to obtain the utr vector, eighty - four nucleotides upstream the 5 splice junction of znf609 s exon were amplified with fw_84ntznf609 and rev_84ntznf609 - 2 oligonucleotides . The fragment was then inserted in the vector containing the znf609 5utr, linearized by inverse pcr with fw_inversepcr-2 and rv_inversepcr-1 oligonucleotides . In order to get utr+in. Glob vector, eighty- four nucleotides upstream the 5 splice junction of znf609 s exon were amplified with fw_84ntznf609 and rev_84ntznf609 oligonucleotides and the second intron of hbb - bs gene was amplified with fw_b - globin - intr2 and rev_b - globin - intr2 oligonucleotides . The vector containing only znf609 5utr was linearized as previously described, then the amplicons were cloned upstream znf609 5utr to obtain utr+in. Glob vector . Znf609 utr, 84-nucleotide fragment and hbb - bs second intron were amplified from c2c12 gdna by pcr . Utr+in.glob.d5ss vector was obtained by inverse pcr from utr+in.glob vector, using luc_deltasplicing_fw and luc_deltasplicing_rv oligonucleotides . In order to obtain utr+in .- znf vector, 485 nucleotides from znf609 fw_pluc_in.znf contains forty nucleotides from the 5 of znf609 intron 2 - 3 right upstream the intron 1 - 2 annealing sequence . This amplicon was inserted into utr vector, which was previously linearized by inverse pcr, using fw_inversepcr-2 and rv_inversepcr-3 oligonucleotides . Utr+in.hprt vector was obtained inserting hprt intron 8 - 9 into utr vector, which was linearized by inverse pcr as previously described . Hprt intron was amplified from mouse gdna, using fw_pluc_in.hprt and rv_pluc_in.hprt oligonucleotides . In order to get mcs+in.glob vector, the second intron of hbb - bs gene was amplified from utr+in.glob vector, using fw_pluc_in.bglob_noutr and rv_pluc_in.bglob_noutr oligonucleotides . Then, this construct was linearized by inverse pcr, using fw_inversepcr-1 and rv_inversepcr-4 oligonucleotides . Mcs sequence from pcdna3.1(+) (thermo fisher scientific) was amplified using fw_pluc_mcs_noutr and rv_pluc_mcs_noutr oligonucleotides . This amplicon was then cloned in the previous construct, in order to obtain mcs sequence downstream the globin intron . Emcv ires was amplified from pires2-egfp plasmid (clontech) with fw_ires and rv_ires oligonucleotides and cloned between luciferase genes (pluc - emcv - ires) in p - luc empty vector, linearized as previously described . Utr vector, utr+in.glob vector, utr+in .- znf vector, utr+in.hprt vector, mcs+in.glob vector and emcv - ires vector were realized with in - fusion hd cloning kit (clontech). The linear version of the flagged circznf609 transcript was obtained by in vitro transcription from a pcr - generated template (using p - circ-3xf as template and primers t7_znf_flag_fw and znf_flag_rv listed in table s2) in presence of t7 polymerase (promega) following the manufacturer s instructions . Upon dnase treatment, the rna was purified through polyacrylamide gel electrophoresis and the 5-terminal triphosphate removed by treatment with alkaline phosphatase (roche) in presence of rnase inhibitors . The rna was then subjected to ethanol precipitation upon the addition of 10 g of glycogen (roche). A phosphate group was then attached to the 5-oh using atp and t4 polynucleotide kinase (biolabs); the linear transcript carrying now 5-phosphate and 3-oh ends was subjected to ethanol precipitation in presence of 10 g of glycogen (roche). Ligase reaction was carried out in a final volume of 100 l, incubating the linear transcript at 95c for 2 min followed by 5 min at 75c in presence of 10% dmso and equimolar amount of splint dna (oligo in table s2). T4 rna ligase 1 (biolabs), 1x t4 rna ligase buffer, 10 mm atp and rnase inhibitor will be then added and the reaction was carried out at 16c for 16 hr . The circularized rna product was separated and purified from the linear transcript by polyacrylamide gel electrophoresis . Thirty nanograms of both circular and linear znf609 transcripts were subjected to rnase r treatment followed by qrt - pcr to assess the circularity of the gel - purified rna molecules . Pluc empty vector, pluc - utr vector, pluc - intr .- utr vector, pluc - emcv - ires vector and pluc - intr .- utr - d - spl . Vector were transfected in c2c12 cells as follows: 1 l of lipofectamine 2000 was added to 100 l of optimem together with 500 ng of dna, mixed and pipetted onto 50,000 pre - seeded cells in a 12 well plate . Medium was replaced 4 hr later and cells harvested for subsequent analyses after 48 hr . Cells were harvested with plb lysis buffer (promega) and rluc and fluc activities were measured by dual glo luciferase assay (promega) according to the manufacturer s protocol . A part of cell lysate was kept for rna extraction and checked by rt - pcr with fluc - pgl3control_fw and rluc - prltk_rv oligonucleotides . For standard gene expression analysis, reads were mapped with tophat, transcriptomes defined by cufflinks and differential expression analyzed with cuffdiff . For circrna detection, paired - end reads were split and used separately as input to the following pipeline: reads were aligned to rrna with bowtie2, the remaining ones were mapped to hg19 or mm10 genome assemblies with bowtie2 . Reads that were left after these alignments were used by findcirc, memczak et al ., 2013) for finding circrnas . For quantitative analyses of circrna regulation in human muscle differentiation, the total number of reads mapping to the head - to - tail splice junction was used for measuring circrna expression level, while the mean of total reads mapping linearly to the same splice junction was used for measuring the abundance of the linear isoform . For comparing wt and dmd samples, circrna expression level was normalized by dividing the reads mapping to the head - to - tail junctions by the total number of spliced reads identified for each sample by findcirc . After the circrna detection process, all human circrna events were annotated using bedtools to the ensembl grch37 gene set . Annotation for gene structure features (cds, utr, intron etc .) Was performed with the r package circus . For experimental validation, a subset of circrnas were selected according to the following criteria: human circrnas were first filtered for expression (at least 5 unique reads in one sample, at least 2 unique reads in its biological replicate), then sorted by the average fold change ratio between myotubes and myoblasts, then filtered for conservation (at least two unique reads in one sample in mouse of an overlapping circrna). The ones with an absolute fold change ratio> 2 were then sub - divided in 6 classes, according to the expression pattern of their cognate mrna: (circrna upregulated> 2, downregulated <0.5) x (mrna upregulated> 2, downregulated <0.5, non regulated). Two or 3 of the top candidates were picked among each class, yelding a list of 16 circrnas (acvr2a, ankib1, ash1l, asph1, bnc2, dcbld2, mef2a, myl4, neb, pms1, ptp4a2, rtn4, runx1, sept9, slc8a1, tmeff1, ttn). Additional candidates were added according to their high expression level (hipk3, znf292, bach1, specc1, rtn4bis) and their high circular / linear ratio (adamts6, camsap1, cdyl, med13l, zfhx3, znf609, ttty16). To such list, we added crkl and qki for the known role of their host genes in muscle differentiation . For each circrna selection after sorting for fold change, expression level, circular / linear ratio, we manually inspected the rnaseq coverage and isoforms expression, and we manually excluded those situations that seemed too complicated for a validation experiment (too many isoforms, unexpected coverage, apparent trans - splicing events etc . ). More details about bioinformatics analyses, all files and all scripts are available upon request . The acquired images were analyzed using two custom image analysis algorithms (available upon request), developed and executed in the acapella software development / run - time environment (perkin elmer). Both algorithms used a perkin elmer proprietary algorithm on the dapi staining for nuclei detection . Dapi and myog staining at 48 hr were used to extract (for each sirna treatment) the total cell number, the percentage of myog+ cells, and the average myog signal intensity . The dapi&myog algorithm workflow can be summarized as follows: 1) nuclei detection (on dapi channel); 2) myog signal intensity estimation (from cy3 channel) and 3) myog nuclei classification . In the absence of a cytoplasmic marker, following the segmentation on dapi thus, foreground and background masks were defined to represent the nuclear area and its local background . These masks were further used to extract average dapi and myog intensities for every nucleus . The dapi / myog signal intensity of every nucleus was defined as the difference between the dapi / myog intensities of its local foreground and background . This local approach compensates for both intra- and inter - image spatial variability of illumination and minimizes possible errors in estimating dapi / myog signal intensities over different wells (and fields). Following a similar local approach, and this time compensating for different inter - image noise level / content, the myog - positive and -negative classification was developed to use a local image adaptive threshold to apply on the myog signal intensity . For each analyzed image, the threshold was defined as 1.5median of all standard deviations of myog signal intensities of the local backgrounds of all nuclei detected in the current image . Then, each nucleus was classified as myog+ or myog- based on the comparison of its myog signal intensity and the current local image threshold (see the example figure showing the myog - positive classification). Dapi and mhc staining at 96 hr were used to extract (for each sirna treatment) the total number of cells, the percentage of mhc - positive nuclei, and additional morphological parameters such as the fusion index and the number of nuclei per fiber . The algorithm workflow can be summarized as follows: 1) nuclei detection (on dapi channel); 2) nuclei count correction procedure; 3) cytoplasm segmentation (on red channel); 4) mhc signal intensity estimation (from the red channel); 5) mhc - positive and -negative nuclei classification; 6) red cell / fiber mhc+ nuclei classification . Prior to all analyses, a circular mask was applied on the images of all channels in order to remove vignetting . This was required to overcome the issue of contiguous, syncytial - like nuclei that were present in myotubes . The nuclei count correction procedure was developed based on a combination of some morphological features of the detected nuclei: the normalized nuclear area (with respect to the median of all nuclei area of the current image) and the nuclear axial length ratio (nucleus width / length). First, all nuclei having a normalized area smaller than 1, which count as 1 nucleus each . A second class was defined by taking the integer of values derived after applying the floor function to nuclei with a normalized area greater than 1 (for example, nuclei with values between 2.0 and 2.99 were scored as 2, while those between 3.0 and 3.99 were scored as 3). Third, we defined a subclass with all nuclei having a normalized area between 1.5 and 2 and with an axial length <0.5 were counting as 2 nuclei each . We used a perkin elmer proprietary algorithm to define the cytoplasmic area for each nucleus . The cytoplasmic area is assigned to the nuclei based on the signal in the red channel . First, because of the peculiar morphology of cells and fibers (cells have elongated shape, fibers appear stitched / clumpy and are multinucleated), individual cells / fibers were erroneously subdivided . Second, in some cases, the method attempted to assign cytoplasm to cells that, on visual inspection, had no signal in the red channel . Cell objects including a nuclear region (with one or more nuclei) and a cytoplasmic region . Cell objects that had a cytoplasmic / nuclear area smaller than one were removed from the cytoplasmic segmentation result, since they were potentially mhc - negative . From the remaining population of cells, we defined a cellular mask (cytoplasm and nuclear areas) on which mhc - positive / negative nuclei classification was performed . All nuclei with at least one quarter of their area overlapping the cellular mask were classified as mhc - positive . The red cell / fiber classification was implemented using a work - around of the cytoplasm segmentation . The definition of a fiber was as follows: stitched / clumpy cells with multiple and short distanced nuclei (clusters). Specifically, nuclei that were within 100 m of each other were defined as being part of the same cluster . Thus, we used the morphological dilation operator (circular structuring element of 30 pixels diameter) on the nuclear mask given by all mhc - positive nuclei . The resulting dilated mask was then intersected (and operator) with the cellular mask to separate nuclei of neighboring red cells . This resulting binary image was used to define nuclei clusters by using connected component labeling (ballard and brown, 1982) and selecting only those components containing more than one mhc - positive nucleus . Finally, all mhc - positive nuclei belonging to nuclei clusters were labeled as fiber nuclei. Similarly, all those mhc - positive nuclei that were not part of a nuclear cluster are labeled as red cell nuclei . The result of this classification was transferred to the nuclei - associated cell objects, and thus labeled as fibers and red cells . The first four parameters are based on nuclei, namely, total number of (detected) nuclei, percentage of mhc - positive nuclei, percentage of mhc - positive red - cell nuclei, average number of nuclei per fiber (estimated by the average number of nuclei per nuclei cluster). The following two parameters are cell area descriptors: the fraction of red cell area and the fraction of fibers area . These fractions were estimated as the total area of red cells / fibers with respect to the entire area of the analyzed image . The fusion index was defined as the fraction of total number of fiber nuclei to the total number of detected nuclei . The maturation index was defined as the fraction of the total number of fiber nuclei to the total number of mhc - positive nuclei . Brdu images were analyzed manually by using imagej: tiff files were converted into binary images by setting a fixed threshold for both dapi and brdu signal intensity, merged edged of close nuclei were split through the watershed plug - in and nuclei count was performed with the built - in particle analysis plug - in . Accepted nuclei dimension were set in a range corresponding to the second and third quartiles of all particles detected . All experiments were repeated for at least 3 times unless differently stated in the legend; arithmetic means together with standard error are reported in all plots shown in this study unless differently stated in the legend . Statistical significance for comparisons of means was assessed by student s t test for qrt - pcrs, luciferase assays and immunofluorescence - based screenings . P values below 0.05 were marked by 1 asterisk, while 2 asterisks indicate a p value <0.02 and 3 asterisks a p value <0.01 . When multiple comparisons were performed, p values were scaled according to the bonferroni correction and then filtered for corrected p value <0.1 . All software used in this manuscript; formal analysis, i.l . ; investigation, i.l ., g.d.t ., f.r .,; visualization, i.l . ; supervision, i.b . And n.r . ; project administration and funding acquisition, i.b.
|
A 92-year old male resident in a nursing home was admitted to our tertiary care center in riyadh, saudi arabia, with a general deterioration . He had a past history of diabetes mellitus, systemic hypertension and stroke . The physical examination revealed a temperature of 34c, blood pressure of 70/30 mmhg, pulse rate of 115 per minute, respiratory rate of 22 per minute and a glasgow coma scale of 8 out of 15 . A temporary diagnosis of urinary tract infection and septic shock was made and he was transferred to the intensive care unit, where he received intravenous fluids, vasopressors and mechanical ventilation . The initial empiric antimicrobial therapy included imipenem - cilastatin four times daily and ciprofloxacin 400 mg twice daily, both given intravenously . The blood, urine and sputum cultures showed an extended - spectrum beta - lactamase (esbl)-producing escherichia coli . The isolates were resistant to ciprofloxacin, but susceptible to imipenem and gentamicin (table 1). The clinical conditions of the patient improved and gentamicin and imipen - em - cilastatin were discontinued after a total of 10 days and 14 days respectively . Ten days after the antibiotic therapy was discontinued, i.e. On the 24 day in the intensive care unit, the patient had fever up to 38.6c, hypotension and peripheral blood leukocytosis (white blood cell count 1810/l, 80% neutrophils). Chest x - ray showed left lung consolidation with a large pleural effusion (figure 1a). A pigtail catheter was inserted taking strict aseptic precautions to drain the effusion (figure 1b). The fluid analysis revealed protein at 52.0 g / l, lactate dehydrogenase at 1477 iu / l, ph at 7.0 and white blood cells at 8450, 96% of which were neutrophils . A diagnosis of ventilator - associated pneumonia and pleurisy was made and colistin methanesulfonate was started with a loading dose of 9 million units followed 24 hours later by 3 million units three times daily in combination with imipenem - cilastatin 500 mg four times daily . The patient developed a pneumothorax because of the pigtail catheter which was therefore replaced with an intercostal chest drain (figure 1c). The pleural fluid taken via the pigtail drain showed the growth of esbl - producing e. coli and carbapenem - resistant acinetobacter baumannii . On day 28, the patient was still febrile and continued to require high dose vasopressor infusions to maintain his blood pressure . The lack of clinical improvement prompted us to add intra - pleural colistin methanesulfonate at a dose of 0.5 million units in 50 ml of a 0.9% sodium chloride solution . The medication was administered at 12-hour intervals via the intercostal drain . In between the drain a remarkable improvement in the patient s condition was noted with a drop of the peripheral white blood cell count to 8.810/l (normal range: 4 - 1110/l), reduced need for ventilation and successful discontinuation of the vasopressor support . It showed the growth of proteus mirabilis (table 1), but neither a. baumannii nor e. coli were isolated, indicating a successful microbiological clearance of both microorganisms . The minimum inhibitory concentrations of imipenem and meropenem for the isolated proteus mirabilis strain were 4 mg / l and 1 mg / l respectively, thus suggesting a switch from imipenem - cilastatin to meropenem 1 g three times daily intravenously . The intra - pleural and intravenous colistin methanesulfonate therapies were discontinued after a total of 10 days and 14 days, respectively, while meropenem was continued for a total of 7 days . Culture of pleural fluid obtained on day 37 was again negative for a. baumannii and e. coli (table 1). The intercostal drain was removed on day 42 and a follow - up chest x - ray showed the resolution of the previously identified signs of infection and effusion (figure 1d). Despite the patient remained clinically stable with no further episodes of sepsis, our attempts to wean him off mechanical ventilation were unsuccessful . He developed an acute myocardial ischemia and passed away after a total stay of 67 days in the intensive care unit . To the best of our knowledge, this is the first report of successful intra - pleural colistin methanesulfonate therapy, in combination with intravenous antibiotics, for a pleural infection caused by multidrug - resistant gram - negative bacteria . Indeed, the patient had clinical, radiological and microbiological evidence of ventilator - associated pneumonia and pleural infection caused by multi - drug resistant strains of e. coli and a. baumannii . He remained critically ill with refractory hypotension, fever and leukocytosis despite 4 days of appropriately dosed intravenous imipenem - cilastatin and colistin methanesulfonate therapy . The addition of intra - pleural colistin methanesulfonate was associated with a prompt clinical and microbiological response . Intra - pleural antimicrobial therapy is not generally recommended in the treatment of bacterial pleural infections . However, favorable results were reported from small comparative studies when intra - pleural antimicrobial therapy was added to an adequate pleural drainage and systemic antimicrobial therapy . Many articles published in the literature described a poor colistin penetration in the pleural space, but none indicated a reference to corroborate this statement . We searched the english language literature using pubmed, medline plus and google scholar and were not able to identify any primary studies upon which these statements could be based . Colistin was originally introduced in the clinical practice in the 1950 s and hence was not submitted to the modern requirements for rigorous pre - licensing assessments . As a result, there are considerable gaps in the understanding of its clinical efficacy in various types of infections . Its clinical use has increased over the last two decades in parallel with the development and the spread of infections caused by carbapenem - resistant gram - negative bacteria . It has become evident that the results of earlier colistin pharmacokinetic studies, which relied upon biological assays, are unreliable . Modern pharmacokinetic studies have demonstrated that previously recommended parenteral regimens lead to sub - therapeutic serum colistin levels, especially in critically - ill patients . The colistin methanesulfonate regimen received by our patient is consistent with the current evidence and recommendations . The intra - pleural colistin methanesulfonate dose used for our patient was extrapolated from pharmacokinetic studies and case series with intra - thecal and intra - ventricular use of colistin methanesulfonate . Notwithstanding the potentially significant differences between cerebrospinal and pleural spaces in terms of drug penetration, distribution and excretion, we felt that in the presence of an intercostal drain, a twice daily administration might result in a better average exposure over time, thereby optimizing bacterial killing . Interestingly, the summary of product characteristics for at least one commercially available colistin methanesulfonate preparation, colimicina (ucb pharma, pianezza, italy), includes recommendation for intra - pleural and intra - peritoneal treatments with a dose of 0.5 - 1.0 million units per day mixed in 20 - 50 ml of ordinary saline . These routes of administration are not recommended in the product summary characteristics of the locally available brand of colistin methanesulfonate (colomycin, forest laboratories, bextley, united kingdom). Despite the successful outcome in our case report, it is important to emphasize that the safety of the intra - pleural colistin therapy remains still to be established . Respiratory depression has previously been reported in association with the intra - pleural administration of neomycin and bacitracin therapy . Therefore, this adverse event should be taken into consideration for this route of administration . Moreover, it is not known whether this topical treatment could result in the development of bacterial resistance to colistin, as was the case with the inhalational colistin therapy in patients with cystic fibrosis . Finally, even though the patient improved during the intravenous treatment and the pleural draining, we believe that the addition of the topical intra - pleural medication had a key role in the clinical and microbiological improvement, as it emerged in connection with its introduction . The use of the intra - pleural colistin therapy should be considered in carefully selected patients with pleural infections caused by multi - resistant gram - negative bacteria . However appropriately designed trials and further studies are needed to better clarify the efficacy, the safety, and the pharmacokinetics of this route of colistin administration.
|
Familial mediterranean fever (fmf) is an autosomal recessive hereditary autoinflammatory disease, which primarily affects several ethnic groups originating in the mediterranean basin including jews (mainly non - ashkenazi), armenians, turks, arabs, and less commonly greeks and italians . However, in recent years, more and more cases have been reported in countries out of this area, such as the usa and japan . Caused by mutations in mefv gene, fmf is a disorder characterized by lifelong recurrent and self - limited episodes of paroxysmal attacks of fever and serosal inflammation, resulting in pain in the abdomen, chest, joints and muscles . Most patients with fmf experience their first attack in early childhood . In 65 percent of cases, the initial attack occurs before the age of 10, and in 90 percent before the age of 20; while it rarely occurs beyond the age of 40 years . In each case, the disease may present differently or may change its course over the patient s lifetime . Similarly, different manifestations of fmf have been observed among populations of various ethnic origins . Each attack lasts 1 - 4 days on average and resolves spontaneously . In almost all patients the attack is preceded by a prodromal period with symptoms mostly including myalgia, arthralgia, headache, nausea, vomiting, constipation, diarrhea, dyspnea, low back pain, asthenia and anxiety . The typical manifestations of fmf include fever, peritonitis, pleuritis, arthritis, and erysipelas - like erythema . One of the devastating complications of fmf is the development of amyloidosis, which mainly affects the kidneys but may involve other organs as well . It is reported that late onset fmf (over 40 years of age) may have a milder clinical presentation . Although accompanied with some side effects, long - term daily colchicine is the mainstay of therapy for the disease . Treatment results in complete remission or marked reduction in the frequency, duration, and severity of attacks in most patients and prevents amyloidosis . The 15 to 20 million azeri turks living in northwestern of iran are ethnically closely related to turkish people living in turkey . There are a few reports of fmf in iran and based on our knowledge there are no report about the adult - onset type . The purpose of this study was to review clinical presentation, demographic characteristics and treatment outcome of adult patients with fmf in northwest of iran . In this cross - sectional study, adult patients (first attack at the age of> 20 years) with a diagnosis of fmf who referred to gastroenterology and rheumatology clinics of ardebil university of medical science (situated in north west of iran) over the period of 2004 - 2009 were enrolled . All patients were of azeri turk origin and diagnosis was based on clinical criteria for fmf (table 1). The study was approved by the research and ethical committee of ardebil university of medical science and an informed consent was obtained from all patients . Main demographic and clinical data including age, sex, age at onset of disease, age at diagnosis, duration of the attacks, frequency of the attacks, attack symptoms and family history of fmf were recorded . Colchicine (1 mg per day) was started for all patients at the time of diagnosis . All patients were followed during the study for drug adherence, adverse drug reactions and the course of the disease . Laboratory tests (cbc, bun, creatinin and urine analysis) were checked at the beginning and during the follow - up period . Response to colchicine was defined as complete (no attack) or partial (> 50% decrease in frequency of attacks) and unresponsive according to clinical condition . Good compliance with treatment was defined by adherence to colchicine more than 95% of the time . Mean sd were calculated for quantitative variables, and frequencies and percentages were reported to describe qualitative variables . Main demographic and clinical data including age, sex, age at onset of disease, age at diagnosis, duration of the attacks, frequency of the attacks, attack symptoms and family history of fmf were recorded . Colchicine (1 mg per day) was started for all patients at the time of diagnosis . All patients were followed during the study for drug adherence, adverse drug reactions and the course of the disease . Laboratory tests (cbc, bun, creatinin and urine analysis) were checked at the beginning and during the follow - up period . Response to colchicine was defined as complete (no attack) or partial (> 50% decrease in frequency of attacks) and unresponsive according to clinical condition . Good compliance with treatment was defined by adherence to colchicine more than 95% of the time . Data were analyzed by spss v.15 software (chicago, il, usa). Mean sd were calculated for quantitative variables, and frequencies and percentages were reported to describe qualitative variables . Forty - four patients (30 males and 14 females) with a clinical diagnosis of fmf were included . Sd, standard deviation; yr, year; mo, month eleven patients (25%) had positive family history for fmf . Five patients (11.5%) reported their first attack after the age of 40, 10 (23.0%) between 30 - 40 years of age and 29 (65.5%) cases between 20 - 29 years of age . All 43 patients continuing treatment responded to treatment even though low - dose colchicine (1 mg per day) was administered . Response to treatment was complete in 33 (76.7%) and partial in 10 (23.3%) patients . Moreover, 53.5% of patients had good compliance with treatment, while other 46.5% had irregular usage of the administered drug . All of irregular users developed recurrence of attack after a mean duration of 1.20 0.95 months . The most common symptoms were abdominal pain and fever which occurred in 42 (95.5%), and 40 (91%) of the patients, respectively . Abdominal pain was generalized in 88% and localized in one or two quadrants in 12% of patients . The most common misdiagnosis was acute appendicitis in 6 (13.6%) patients, all of whom had undergone appendectomy . Other misdiagnoses were diverticulitis, pulmonary embolism, pancreatitis, ischemic heart disease and palindromic rheumatism, each in 1 (2.3%) patient . There was no clinical or laboratory evidence of amyloidosis at the time of diagnosis or during the follow - up period in our patients . In one patient colchicine fmf usually occurs in young age; most patients (90%) begin to suffer from their first attack before 20 years of age . Onset of the disease at an older age may occur but is uncommon after the age 40 . The date of onset of fmf is usually determined by history, although misinterpretation and misdiagnosis can occur . Previous studies revealed a subgroup of late or adult - onset patients with different demographic, clinical and probably genetic features . In our patients the mean age of first attack was 29.0 7.8 years and it occurred after the age of 40 in five patients (11.5%). This finding is similar to the study by sayarlioglu et al . Who reported that 5 patients (8.8%) had their first attack after the age of 40 . This difference is probably due to the study population, as we included only adult patients . The mean age at diagnosis in our study was 34.59.7 years that is comparable with other studies reporting a mean age of 34.2 9.5 years . Male / female ratio in our patients was about 2/1 . Similarly in a turkish study, 80% of fmf patients with late onset disease were male . In another report from the northwest of iran, by contrast, ureten et al . Declared that the majority of fmf patients were female (female / male: 1.85). The erratic nature of disease and short period of attack make it difficult to make the correct diagnosis early in the course of disease . Mean delay in diagnosis in our patients was 5.0 5.9 years, which was similar to reports by tamir et al (4.9 5.8 years) and sayarlioglu et al . (6.0 6.6 years) and different from the study done by ureten et al . Which estimated a mean duration between disease onset and diagnosis of 9.39 8.92 years . The diagnostic delay in patients with adult onset disease seems to be significantly less than those with early onset, nonetheless, tunca et al . Showed no significant difference in the diagnostic delay among patients with early (before the age of 18 years) versus late onset disease . We considered that this differnce may be attributed to more attention of adults to new manifestations and more attention to receive a final diagnosis . A significant proportion of patients with fmf have positive family history . In our study, only 25% of patients had positive family history of fmf which is mostly similar to the prevalence rate of 23% reported in one turkish study . This may be due to occurrence of new mutations in some populations which needs to be further evaluated . The hallmark of fmf is recurrent acute febrile attack and involvement of abdomen, chest, joints, muscles, scrotum and skin . Abdominal pain is present in about 95% of patients, and the clinical picture is that of acute peritonitis . Likewise, in our patients abdominal pain (95.5%) and fever (91%) were the most common clinical findings which are in accordance with most other studies . However, tsuchiya - suzuki et al . Reported that only 55% of patients suffered from abdominal symptoms . Our study depicted that 26.7% of male fmf cases had scrotal pain 50% of females had pelvic pain which is not previously mentioned by other studies . Arthritis and erysipelas - like erythema were seen in 4.5% and 2.3% of our patients respectively, which is less frequent than reports in younger patients . In agreement with our findings, tunca et al . Concluded that arthritis, arthralgia, myalgia, and erysipelas - like erythema were significantly less frequent among the adult - onset patients . Amyloidosis is the most significant complication of fmf, usually affecting the kidneys and resulting in renal insufficiency . On the other hand, there are unexplained ethnic differences in the prevalence of amyloidosis . In untreated north - african jews, armenians, and turks, its prevalence reaches as high as 60% or more, whereas in ashkenazi and iraqi jews, american- armenians, and arabs, it is less common . None of our patients had clinical or laboratory evidence of amyloidosis during follow - up period, similar to a study in japan that amyloidosis was seen in only 1 of 80 patients . This implies that late onset fmf may have a less aggressive behavior probably due to different mutation as compared to early onset disease . Earlier diagnosis and therapy with higher compliance to treatment in this group are the other probable contributing factors . Misdiagnosis is common in fmf patients because the disease involves different organs and may have different clinical presentations . Consequently, diseases mistaken for fmf may be different in adults than in children, probably due to the lower prevalence or even lack of a number of diseases such as diverticulitis, pulmonary embolism and pancreatitis during childhood . Six patients (13.6%) had abdominal operation with impression of acute appendicitis . In the study done by ureten 20% of patients underwent appendectomy; most of the patients were operated before the diagnosis of fmf was made . Other misdiagnoses in our patients were diverticulitis, pulmonary embolism, pancreatitis, ischemic heart disease and palindromic rheumatism . This is similar to other studiesand indicates that response to colchicine in adult onset fmf is excellent and lower doses of colchicine may be adequate (1 mg per day). This is the first study to describe the characteristics of iranian fmf patients whose disease started after the age of 20 years . The most important one is the absence of genetic analysis as well as mutation studies . Lack of a reliable and complete family history to form genealogy trees of the patients is one limitation which inhibits the precise genetic analysis . In conclusion, our findings demonstrated that adult - onset fmf in iran is more common in males, arthritis and erysipelas - like erythema are seen less commonly, and there is a shorter delay before diagnosis, and a better treatment outcome (favorable response even to low - dose colchicines). Moreover, a better tolerance of drug with a lower risk of amyloidosis is seen in adult - onset fmf patients . However, the role of genetic or environmental factors should be evaluated and determined in future studies.
|
Subjects with type 1 diabetes were from the australian type 1 diabetes dna repository (11,12). They had been diagnosed by a specialist physician on the basis of hyperglycemia requiring immediate and ongoing insulin therapy . All subjects were of european descent and lived in metropolitan melbourne or the wider state of victoria . They were recruited in an unselected manner from diabetes clinics, including the royal children's hospital, which until recently followed up the majority of children and teenagers with type 1 diabetes in victoria . Virtually all individuals with type 1 diabetes in victoria attend diabetes clinics or are seen by specialists with attachments to these clinics . Subjects (n = 462) diagnosed before 18 years of age between 1950 and 2005 (91% after 1975) were typed for hla - drb1 alleles . Hla - drb1 genotyping was performed by pcr - based sequence - specific oligonucleotide hybridization, modified from the 11th international histocompatibility workshop protocol to accommodate subsequently described sequence polymorphisms (13). Briefly, pcr primers were designed to provide either generic or allele - specific amplification of exon 2 of the drb1 allele . The pcr - amplified dna was rendered single stranded by exposure to sodium hydroxide, immobilized onto nylon membranes, and hybridized with biotinylated oligonucleotide probes designed to detect sequence polymorphisms between drb1 alleles . Stringent washing was performed in the presence of 3 mol / l tetramethylammonium chloride and the hybridized product detected using a streptavidin / alkaline phosphatase conjugate and chemiluminescent substrate cdp - star (roche diagnostics, castle hill, nsw, australia). Allele assignments were made by comparing patterns of hybridization to those predicted from published sequences . Subjects were grouped by decade of birth or diagnosis (19501969, combined due to small numbers; 19701979; 19801989; 19901999; and 20002005) and from the highest (dr3,4) to intermediate (dr3,3 or dr4,4; dr4,x or dr3,x) to the lowest (drx, x, where x denotes a non-3 or non-4 allele) hla genotypes for type 1 diabetes risk . Statistics were performed with graphpad prism version 3.0 software (la jolla, ca). Hla - drb1 genotyping was performed by pcr - based sequence - specific oligonucleotide hybridization, modified from the 11th international histocompatibility workshop protocol to accommodate subsequently described sequence polymorphisms (13). Briefly, pcr primers were designed to provide either generic or allele - specific amplification of exon 2 of the drb1 allele . The pcr - amplified dna was rendered single stranded by exposure to sodium hydroxide, immobilized onto nylon membranes, and hybridized with biotinylated oligonucleotide probes designed to detect sequence polymorphisms between drb1 alleles . Stringent washing was performed in the presence of 3 mol / l tetramethylammonium chloride and the hybridized product detected using a streptavidin / alkaline phosphatase conjugate and chemiluminescent substrate cdp - star (roche diagnostics, castle hill, nsw, australia). Allele assignments were made by comparing patterns of hybridization to those predicted from published sequences . Subjects were grouped by decade of birth or diagnosis (19501969, combined due to small numbers; 19701979; 19801989; 19901999; and 20002005) and from the highest (dr3,4) to intermediate (dr3,3 or dr4,4; dr4,x or dr3,x) to the lowest (drx, x, where x denotes a non-3 or non-4 allele) hla genotypes for type 1 diabetes risk . Statistics were performed with graphpad prism version 3.0 software (la jolla, ca). The mean age at diagnosis of the total cohort of type 1 diabetes subjects was (means sd) 8.5 4.5 years, and this did not differ across decades of diagnosis (p = 0.54, anova). The proportion of the highest - risk genotype, dr3,4, decreased significantly over time from 79% in 19501969 to 28% in 20002005 (p <0.0001) (table 1) (fig . On the other hand, the proportion of the heterozygous intermediate - risk genotypes, dr4,x and dr3,x, increased significantly over this period (table 1); taken together, they increased from 20 to 48% (p = 0.0002) (fig . Homozygosity for dr4, but not dr3, increased over time, and the lowest - risk genotype, drx, x, was consistently low (3%) (table 1). Matched for drb1 genotype and decade of birth, there was no change across time in age at diagnosis for the high - risk dr3,4 genotype, but for the intermediate risk genotypes (dr4,4; dr3,3; dr4,x; and dr3,x) age at diagnosis decreased over time (fig . The incidence of childhood - onset type 1 diabetes in australia has doubled in the last 20 years, from 11.3 cases per 100,000 person - years in 1985 to 23.2 in 2002 (14). On the assumption that the drb1 genotype frequencies were representative of the total population of individuals with type 1 diabetes, the contribution of drb1 genotypes to the increasing incidence of type 1 diabetes was examined . The numbers of incident cases (rev . In 14) were related to specific drb1 genotype proportions . As shown in table 2, the population incidence of type 1 diabetes in subjects with the highest - risk genotype (dr3,4) has remained unchanged . In contrast, the number of cases with intermediate - risk genotypes (dr3,3 or dr4,4 and dr3,x or dr4,x) has increased, accounting for the increase in disease incidence . Hla class ii profiling demonstrates that the genetic contribution in individuals diagnosed with type 1 diabetes has changed over the last five decades . The contemporary increase in disease incidence is accounted for by individuals with lower - risk hla class ii genotypes who, in previous eras, would not have developed diabetes in childhood . It would appear, therefore, that changing environmental conditions have increased the penetrance of these lower - risk genotypes . Our findings are similar to those reported in the northern hemisphere (6,7) but are more likely to be free of selection bias based on survival, as 91% of our subjects were diagnosed after 1975 . Subjects were unselected and predominantly of european anglo - celtic origin, with no change over the decades to suggest dilution by immigrants of other ethnic backgrounds . Nevertheless, the possibility that they were not entirely representative of the total population of individuals with type 1 diabetes across the decades remains a potential limitation . With this caveat, environmental conditions operating in both hemispheres therefore appear to be permissive for the increasing incidence of type 1 diabetes among individuals without the classic high - risk dr3,4 genotype . Furthermore, the mean age at diagnosis has decreased in children with lower - risk genotypes, representing further evidence for the impact of environment . The temporal change in the genetic contribution to type 1 diabetes raises several points for discussion . First, studies of type 1 diabetes may need to consider stratification by year of birth and diagnosis to dissect the relative influences of genes and environment . This concept is also more broadly relevant to other human diseases in which polygenetic susceptibility and environment interact . Second, the hla profile of classic, childhood - onset type 1 diabetes has shifted and is now similar to that of adults with autoimmune diabetes, who are characterized as having lower - risk hla genes (15,16). However, adults diagnosed today with autoimmune diabetes were born> 30 years ago when the contribution of environment was presumably much less . Third, it appears that the shift in the distribution of hla genotypes began in the 1980s . A variety of environmental factors including infectious exposure in early life, the quantity and composition of food intake, and the amount of exercise and sleep (with concomitant obesity) have been implicated in promoting the rising incidence of type 1 diabetes . Since the 1980s, the incidence of type 1 diabetes in australia has more then doubled (14). A change in individuals diagnosed in the 1980s could reflect the impact of environmental factors acting in early life in the 1970s . Two candidate factors may be worthy of comment . First, up until the mid-1970s newborns in victorian hospitals were housed together in nurseries for up to a week, but this practice ceased when the high prevalence of diarrhea associated with rotavirus infection was found to be significantly reduced by rooming - in with the mother (17). The possibility that rotavirus infection in the neonate could protect against type 1 diabetes is supported by findings in the nonobese diabetic (nod) mouse model of the disease (18); interestingly, though, rotavirus infection postweaning in the nod mouse did not protect but rather increased disease incidence (18). The latter result is consistent with our finding in children followed longitudinally in whom rotavirus infection was positively associated with evidence of islet autoimmunity (19). Second, the prevalence of obesity, and presumably insulin resistance, in australian children began to accelerate in the 1970s (20). We have shown that insulin resistance is an independent risk factor for development of type 1 diabetes in children with islet autoimmunity (21). Therefore, insulin resistance promoted by changing environmental conditions may contribute to the pathogenesis and rising incidence of type 1, as well as type 2, diabetes . The stable incidence of dr3,4 across time suggests that this genotype is resistant to the influence of environment . One interpretation is that adaptive t - cell mediated immunity responsible for -cell destruction is optimal with dr3,4 but not with lower - risk genotypes . However, the latter can be complemented by innate immunity promoted (together with insulin resistance) by a proinflammatory environment (22). Our findings illustrate that the contribution of hla genes to type 1 diabetes has changed but not lessened over time . Indeed, genetic susceptibility to type 1 diabetes is no less relevant as more individuals fall under the shadow of a
|
In the previous issue of critical care, eslami and coworkers review the various outcome measures used to evaluate the quality of blood glucose (bg) control (level of' tight glycaemic control' [tgc]) in critically ill patients; the review considers studies published prior to 2008 . They subdivided 30 different indicators into four nonorthogonal categories: bg zones (adverse zones versus in - range zones), bg levels (for example, mean bg), time intervals (for example, time within a predefined bg range), and protocol features (for example, bg sampling frequency). In recent years, the definition of tgc had appeared to be well established, based on the findings of two randomized controlled clinical trials that clearly demonstrated the relation between strictly regulated bg (80 to 110 mg / dl) and reduction in mortality / morbidity . More recently, however, the level of tgc has emerged as a controversial issue, following publication of the findings of two other (under - powered) clinical trials that were unsuccessful in implementing tgc into daily practice . Control of bg to achieve a clinically and ethically approved target remains a crucial element in the treatment of intensive care unit (icu) patients and necessitates the design and assessment of measures that reflect this level of control . The paper by eslami and coworkers presents an overview of existing indicators, but rigorous assessment to identify the optimal indicator(s) is now required . Two important facts (already partly discussed by eslami and coworkers) must be emphasized . First, there is no consensual definition of some methodologies that are currently used as an indicator . Eslami and coworkers identified 15 different thresholds for bg, varying from <40 mg / dl to <72 mg / dl . In some studies any measurement below the threshold is regarded' hypoglycaemia', whereas other studies take the time dimension into account in order to ensure that multiple hypoglycaemic events occurring over a short interval (for example, 30 minutes) are evaluated as a single event . In still other studies, definitions second, the availability of a near - continuous glucose sensor is a prerequisite for reliable tgc assessment, but no near - continuous glucose sensor has yet been found to be sufficiently reliable and accurate for use in critically ill patients . Accordingly, only time - discrete measurements of glycaemia (for instance, a time interval of 1 hour or more) are available, which can be dealt with in two ways . On the one hand, the time dimension can be neglected such that only the effectively measured values are considered in the analysis (for example, mean bg, glycaemic penalty index (gpi), and so on). As eslami and coworkers correctly point out, this type of analysis may be sensitive to sampling . On the other hand, nonmeasured values can be estimated, leading to a (non - measured) continuous glucose signal, allowing application of area under the curve indicators (for example, hyperglycaemic index [hgi]). Here, however, a typically linear relation between observations is assumed (in order to achieve an approximation to the true, nonlinear dynamics of bg fluctuation), which explains why this second technique can lead to incorrect assessment of bg signals . Ideally, adequate assessment of a bg signal and comparison with other bg signals require the fulfilment of three conditions . The first of these is consensus concerning the desired target bg range (and definitions of hypoglycaemia / hyperglycemia). The two landmark studies and a new clinical trial have shown that achieving age - adjusted strict normoglycaemia throughout the icu stay leads to lower icu mortality and morbidity, in both adult and paediatric icu patients . Second, the use of future reliable near - continuous glucose sensors will permit appropriate consideration of the time dimension in the indicator . Accordingly, duration and magnitude of hypoglycaemic / hyperglycemic events are represented more precisely, as compared with time - discrete bg signals . Third, clinicians must be aware that traditional measures (for instance, mean bg) potentially can confound evaluation, as previously discussed . More advanced indicators such as hgi and gpi (note that gpi, introduced in 2008, was not evaluated by eslami and coworkers) are indispensable for adequate assessment of the overall level of bg control and are less complex than is sometimes claimed . Indeed, the hgi (and, analogously, the hypoglycaemic index) and gpi combine the first three categories mentioned by eslami and coworkers: bg zones, bg levels and time intervals . While we await the availability of near - continuous glucose monitoring devices, we advise clinicians to compute both hgi and gpi (per patient), because these indicators compensate for each other's weaknesses . Next, population hgi and gpi values can be obtained by computing the median and 25% to 75% interquartile range, because most bg distributions are non - normal . Finally, it is important to note (particularly when comparing different bg signals) the impact that study design (bg sampling frequency and duration of algorithm application) has on the level of bg control . Bg: blood glucose; gpi: glycaemic penalty index; hgi: hyperglycaemic index; icu: intensive care unit; tgc: tight glycaemic control . Bdm and gvdb are both supported by the flemish government (fwo: g.0557.08). Bdm is supported by the following: research council kul (goa ambiorics, coe ef/05/006, iofscores4chem, several phd / postdoc and fellow grants), the flemish government (fwo: phd / postdoc grants, projects g.0452.04, g.0499.04, g.0211.05, g.0226.06, g.0321.06, g.0302.07, g.0320.08, g.0558.08, research communities; iwt: phd grants, mcknow - e, eureka - flite+), the belgian federal science policy office (iuap p6/04), eu (ernsi; fp7-hd - mpc), contract research (aminal) and helmholtz (vicerp). Gvdb is supported by the following: research council kul (goa/2007/14, ot/03/56), the flemish government (fwo: g.0533.06) and the methusalem program, funded by the flemish government.
|
Malignant myelomatous pleural effusions (mpes) are very rare and occur in <1% of cases of mm . Since this condition is associated with poor prognosis, an accurate diagnosis of this condition is necessary . In this article, we report a rare case of a patient who initially presented with pleural effusion, which was subsequently found to be secondary to mm . A 63-year - old female presented to the outpatient department of our hospital in december 2014, with a complaint of feeling increasingly breathless and fatigued over a period of 2 months . She also complained of right sided chest pain and nonradiating pain in the lower back since a month . On evaluation, the chest x - ray revealed a homogenous opacity in the right mid and lower zones [figure 1]. Biochemical analysis of the pleural fluid confirmed that it was exudative in nature (protein 9.8 g / dl, glucose 4.9 mg / dl, lactate dehydrogenase 1020 iu / l, adenosine deaminase 69.6 u / l [ref: 33 u / l]). The pleural fluid sent for culture, and cytology showed no acid - fast bacilli . A computed tomography (ct) scan thorax was done and showed an ill - defined nodular heterogeneously enhancing lesion in right posterior hemithorax with right sided gross pleural effusion, collapse of right lung, and involvement of the right 4 rib [figure 2]. Fine - needle aspiration cytology (fnac) done from the right pleural lesion showed numerous plasma cells, binucleate forms, and few atypical plasma cells [figure 3]. A cell block was prepared after centrifuging the pleural fluid and immunohistochemistry done on the cell block showed tumor cells positive for cd20, cd138, and lambda and negative for leukocyte common antigen, cd3, cytokeratin, and kappa [figure 4]. Serum electrophoresis showed an m - spike in beta region with elevated serum igg levels (3586 mg / dl, ref range 7001600 mg / dl). Beta 2 microglobulin level was elevated (3.23 mg / l ref: 0.82.2 mg / l). Magnetic resonance imaging whole spine was done, and confirmed the presence of a lobulated enhancing soft tissue lesion in the right paravertebral region, measuring 6 cm 8.6 cm, with involvement of the adjacent rib and also intraspinal extension . Ct - guided fnac done from this paravertebral mass showed multiple plasma cells, contributing to the diagnosis of mm . Bone marrow aspiration and biopsy showed scattered and <2% infiltration with plasma cells . She received palliative radiotherapy of 30 gray in 10 fractions to the t12l2 spine and paravertebral mass . She was started on vtd regimen with bortezomib, thalidomide, and dexamethasone chemotherapy along with monthly bisphosphonates . After 6 cycles of chemotherapy, she was symptomatically better, and her chest x - ray showed resolution of the pleural effusion . Computed tomography image plasma cells on cytology low- and high - power view cd20 (top low- and high - power), cd138 (middle- low- and high - power), lambda (bottom low- and high - power) in history, mm was first described in egyptian mummies . The word mm was first coined by rustizky in 1873 . The median age of presentation is 69 years and is more common in men, and increases with advancing age . Patients with mm may be asymptomatic or can usually present with hematologic manifestations such as anemia, bleeding disorders, or bone related problems, infections and other end organ damage like renal failure . In mm, the development of pleural effusion pleural effusion occurs in around 6% of patients with mm during the course of the disease, while mpe is even rarer presenting in <1% of patients as reported by kintzer et al . It is associated with poor prognosis, and there are previous studies with the survival of <4 months . Mpes may arise from either extension of plasmacytomas of the chest wall, invasion from adjacent skeletal lesions, direct pleural involvement by myeloma (pleural plasmacytoma) or also following lymphatic obstruction secondary to lymph node infiltration . Pleural effusions are rarely a direct consequence of the myeloma itself and usually occur due to the concurrent disease process or coexisting illness such as cardiac failure, amyloidosis, pulmonary embolism, pneumonia, or a second malignancy . Reported that about 50% of mm patients accompanied with pleural effusion were due to congestive heart failure . The other possible mechanisms are a pulmonary embolism, chronic renal failure accompanying mm, and second malignancy . Mpes are most commonly associated with the presence of an iga paraprotein (in up to 80% of cases). Sasser et al . Reported 56 cases of mm with the involvement of the serous cavities . The sites of involvement were mostly the pleural cavity (thirty cases) and among them, 50% of the cases with cavitary involvement were of the iga type . In this case, this is an important contributory factor for the development of mpes and explains the apparent aggressive nature of myelomatous disease . This case is distinctive in regards to the direct involvement of the pleural cavity by malignant plasma cells, which was confirmed with the fnac and ihc . Only 11 cases have been described previously, including the present case (to the best of our knowledge). Chemotherapy with various newer drugs such as bortezomib, thalidomide, lenalidomide along with dexamethasone or 2 generation proteasome inhibitors like carfilzomib remains the first - line treatment for mm . In practice, pleural involvement with myeloma cells is associated with an aggressive course which is poorly responsive to first or second - line therapies used in conventional myeloma treatment . In this case, the patient was doing better with vtd chemotherapy and palliative radiotherapy . This patient was started on treatment early and had igg paraprotein mpe probably indicating better response in these cases . The occurrence of mpes in mm is rare . It indicates a poor prognosis because of an aggressive natural course . Early consideration of mpes helps in rapid diagnosis and early initiation of treatment which may help in improving prognosis as seen in the present case.
|
Despite the increase in the incidence of abdominal trauma caused by traffic accidents, traumatic pancreatic injury is relatively uncommon . Pancreatic injuries occur in only 0.2% to 4% of all abdominal injuries (1 - 5). However, morbidity and mortality rates associated with injuries to the pancreas approach 40% and 19%, respectively (2), and these high rates are attributed to difficulties with initial assessment, establishment of diagnosis, and occasionally treatment . The spectrum of pancreatic injury is broad and ranges from simple contusion, fracture, and laceration to complete disruption of the pancreatic duct and parenchyma . Moreover, the diagnosis of blunt abdominal injuries, especially in cases of isolated pancreatic injury, can be extremely difficult, because retroperitoneal lesions do not have any specific symptoms . Another cause of elevated morbidity and mortality is the missing or underestimation of pancreatic lesions during exploration of the abdomen . The purpose of this study was to identify predictors of morbidity and mortality in patients with traumatic pancreatic injuries . This was a retrospective study of the medical records of 75 consecutive patients with a pancreatic injury who underwent laparotomy at the emergency medical center, masan samsung hospital from january 2000 to december 2005 . Medical records were reviewed for the following parameters: demographic data, mechanism of injury, accident to surgical operation time, initial systolic blood pressure (sbp), initial heart rate, initial base deficit, initial amylase, initial glasgow coma scale (gcs), revised trauma score (rts), number of abbreviated injury scales (ais), injury severity score (iss), number of associated injuries (head, colon, stomach, small bowel, abdominal vessel, etc . ), grade of pancreatic injury, method of surgical operation, amount of blood transfusion, mortality, morbidity, and others . Pancreatic injuries were graded according to the pancreatic organ injury scale proposed by the organ injury scaling committee of the american association for the surgery of trauma (aast), as shown in table 1 (6). For the purpose of data analysis, postoperative morbidity was subdivided into three groups, i.e., pancreatic complications, non - pancreatic abdominal complications, and intensive care unit (icu) complications . Icu complications included acute respiratory distress syndrome, pneumonia, renal failure, and multiple organ failure ., chicago, il, u.s.a .) And medcalc (medcalc 7.2 version, medcalc inc ., a univariate analysis was performed using the student's t test or by one - way analysis of variance for continuous variables, or by using the test for categorical variables . Using receiver operating characteristic curve analysis, the cut - off point that best divided each significant continuous or polychotomous variable into two subgroups this variable was transformed into a dichotomous variable based on the cut - off point . All variables found to be significant by the univariate analysis were then analyzed by a multivariate logistic regression analysis . The demographic data revealed a male predominance (72.0%) and a young age (37.915.8). Traffic accident wounds were the most common injuries and accounted for 65.3%, fall - down wounds accounted for 14.7%, and compression wounds for 4.0% . The remaining patients (8.0%) suffered from stab injury . Mechanisms of injury were not associated with mortality or morbidity by univariate analysis (table 2). The most frequent site of pancreatic injury was the head (including neck) in 21 patients (28.0%). Sites of pancreatic injury were not found to be associated with mortality or morbidity by univariate analysis . Grade 3 accounted for 36.0%, grade 4 for 10.7%, grade 1 for 8.0%, and grade 5 for 2.7% of patients, and higher grades of pancreatic injury were associated with poorer outcomes (p<0.05, table 3). Based on only main pancreatic duct status, grades of pancreatic injury were divided into two groups: injury grades 1 and 2 were allocated to group 1, and grades 3 to 5 to group 2 . The mortality rates of these two groups were 7.9% and 18.9%, respectively, which were not significantly different, but morbidity rates in these two groups were 34.2% and 64.9%, respectively, and these were significantly different (p=0.008). One of these groups included injury grades 1 to 3, and the other grades 4 and 5 . Mortality rates in these two groups were 9.2% and 40.0%, respectively, and these were significantly different (p=0.008). However, morbidity rates in these two groups were 46.2% and 70.0%, respectively, which were not significantly different . Simple surgical operations such as drainage and primary repair were performed more often for pancreatic injuries than more complex surgical operations, such as pancreatectomy, resection with internal drainage, pyloric exclusion, and pancreaticoduodenectomy . Forty - eight patients (64.0%) underwent drainage and primary repair, and 20 patients (26.7%) underwent distal pancreatectomy . Of the remaining seven patients, resection with internal drainage or pyloric exclusion pancreaticoduodenectomy was performed only in one patient, and this patient survived . The majority (72.9%) of patients who had undergone simple surgical operations had a low grade (1 or 2) pancreatic injury, and 88.9% of patients who had undergone complex surgical operations had a high grade (3 to 5). The method of initial surgical management was found to be associated with the grade of pancreatic injury (p<0.001), but the correlation was not strong (r=0.566, p <0.001). There was no association between the surgical method and mortality, but there was an association with morbidity (p<0.01, table 3). Associated injuries were common, with a mean of 3.72.1 organs injured, ranging from isolated pancreatic wounds to nine organs injured . Other commonly injured organs included spleen (33.3%), bone (32.0%), genitourinary organ (30.7%), small bowel (24.0%), and duodenum (21.3%). Associated major abdominal venous injuries were observed in 16% of patients (table 4). The superior mesenteric veins, portal vein, and inferior vena cava accounted for most of these injuries . Thirty - six patients (48.0%) required five or less units of packed red blood cells, and the others (34.7%) required six or more units of packed red blood cells; sixteen or more units of packed red blood cells were required in 8% of patients (table 2). Mm / l in all patients, and mean base deficits in patients who survived or succumbed were -5.84.3 mm / l and -15.34.4 mm / l, respectively, and the mean base deficits of patients with or without a complication were -8.45.3 mm / l or -5.75.2 mm / l, respectively . Mean base deficits of patients who survived or did not have a complication were higher than those who died or had a complication, respectively (p<0.05). Mean iss in all patients was 27.215.1, and mean iss in patients who succumbed (50.815.7) was higher than in patients who survived (23.611.3, p<0.001), and mean iss in patients with one or more complications (31.813.3) was higher than in patients without a complication (22.7 15.5, p<0.01). Of these, twelve were revealed to be significantly associated with mortality by univariate analysis (table 5). These factors were a blood transfusion of> 12 units, a base deficit of -11.0 mm / l, gcs <13, rts 6.2, four or more number with high ais (4 or 5), an initial sbp of <90 mmhg, an iss of> 26, four or more associated injuries, abdominal venous injury, high grade pancreatic injury, old age, and thoracic injury . Multivariate analysis revealed that a blood transfusion of> 12 units and a base deficit of -11.0 mm / fourteen patients (18.7%) had a pancreatic complication, and intra - abdominal and icu complications both accounted for 18 patients (24.0%). Univariate analysis revealed that eight factors were significantly associated with morbidity, namely, an iss of> 26, a base deficit of -5.8 mm / l, four or more number with high ais (4 or 5), surgical complexity, high - grade pancreatic injury, four or more associated injuries, colon injury, and stomach injury (table 7). However, multivariate analysis revealed that a base deficit of -5.8 mm / l and surgical complexity were most significantly correlated with morbidity (table 8). Although the pancreas remains one of the least frequently injured organs in cases of abdominal trauma, its location and the fact that it is surrounded by vital structures means that pancreatic injuries often present complicated diagnostic and treatment problems . Frequencies of pancreatic injuries are related to the geographic settings of the traumatic incidents (i.e., urban or rural). In the u.s.a ., penetrating trauma accounts for 70% of all pancreatic injuries, and blunt trauma accounts for the remaining 30% (3, 7, 8). However, in our series, 92% of all pancreatic injuries were caused by blunt trauma and the remaining 8% by penetrating trauma . The mechanism of wounding in cases of penetrating trauma is simple violation by a sharp object (i.e., a knife blade). The pancreas has a relatively fixed retroperitoneal position anterior to the spine, and thus, forcible compression of the pancreas against the vertebral column resulting from blunt trauma is the most common mechanism of blunt pancreatic injury . By multivariate analysis, the grade of pancreatic injury was not associated with morbidity or mortality in our patient population . Generally, the status of the main pancreatic duct is an important predictor of outcome, and knowledge of its status is essential for establishing a basis for treatment decisions in cases of pancreatic injury (1 - 3, 8 - 10). (9) reported a significant association between main pancreatic ductal injury and an increased incidence of pancreas - related complications, particularly, with an increased incidence of pancreatic fistula . (1) reported that the grade of pancreatic injury was an independent predictor of both pancreatic complications and mortality . However, their study did not include the important factors of the patients' outcome, such as, amount of blood transfusion, base deficit, gcs, and rts . In this study, in the present study, grade 1 and 2 pancreatic injuries (no ductal injuries) were usually treated by closed drainage with or without local debridement and pancreatorrhaphy, which is the most commonly adopted procedure, and this approach proved to be safe and effective (11, 12). Fabian et al . (11) reported on the superiority of closed - suction drainage for the treatment of pancreatic trauma in a randomized prospective study, and we also prefer and widely use this modality . The integrity of the pancreatic duct has been suggested to be an important factor for determining the method of treatment (13), whereas for grade 4 injuries, multiple procedures, such as closed suction drainage and distal resection, could be selected, depending on the clinical condition . Moreover, when resecting more than 80% of pancreatic parenchyma with associated diabetes mellitus, one should consider preservation of the distal pancreas and internal drainage by roux - en - y jejunal anastomosis . Pyloric exclusion has been suggested as a valuable means of treating severe duodenal injuries, and of reducing the postoperative leakage rate, and pyloric exclusion has also been considered as a viable option for grade 4 - 5 pancreatic injuries associated with duodenal injuries (14). Grade 5 injuries characterized by massive devascularization of the pancreatic head and adjacent duodenum are infrequent and usually require pancreaticoduodenectomy . As mentioned above, the selection of the surgical method depends primarily on the grade of pancreatic injury . However, other clinical conditions such as the site of the pancreatic injury, the characteristics and severity of the associated injuries, and the physiological status of the patient can also affect the decision . Therefore, the surgical method appears to better reflect the general pathophysiological condition of the patient than the grade of pancreatic injury . This explains why univariate analysis revealed both the grade of pancreatic injury and the surgical complexity were associated with morbidity . However, multivariate analysis revealed only the surgical complexity was a better predictor for morbidity . In the present study, associated injuries were very common, with a mean of 3.72.1 organs injured per patient . The liver was most frequently injured, and this was observed in 36% of our patients, which is consistent with the findings of other authors (2 - 5). Moreover, associated major abdominal venous injuries were found to correlate with mortality by univariate analysis, but were not found to significantly predict mortality by multivariate analysis . Likewise, associated colon and stomach injuries were found to correlate with increased morbidity by univariate analysis, but this relation was not substantiated by multivariate analysis . Base deficit has been shown to be an excellent predictor of transfusion requirement, shock - related complications, and mortality (15, 16). As base deficit reduced, both mortality and morbidity increased in our study, whereas transfusion requirement was associated with mortality only . The present report is the first to show that base deficit and transfusion requirement are predictors of mortality in patients with a traumatic pancreatic injury . This finding demonstrates that not only is the physiologic presentation of a patient important, but that efforts to rapidly control ongoing hemorrhage may also significantly improve the patient outcome . Although the small number of subjects limits our conclusions, the data suggest that early efforts to prevent shock and rapidly control of bleeding are most likely to reduce the mortality rates in patients with a traumatic pancreatic injury.
|
Primary hyperparathyroidism (phpt) is a disease characterized by elevated or inappropriately normal parathyroid hormone (pth) levels due to excessive secretion by one or more parathyroid glands . The classical form of the disease is characterized by hypercalcemia, kidney stones, and severe bone disease . The routine measurement of serum calcium as a screening tool has led to a sharp increase in the incidence of a new presentation of the disease, namely, asymptomatic phpt, whose demonstration of bone involvement depends exclusively on the bone densitometry data [24]. The association with kidney disease, nephrocalcinosis, and nephrolithiasis is well established in the hptp and has been reported in several studies . Found a prevalence of 7% in 271 individuals with the disorder and 1.6% in 500 healthy patients evaluated by sonography . The risk of hospitalization due to urolithiasis is increased for patients with hptp even ten years after parathyroidectomy [5, 6]. Currently a new phenotype has arisen, in which normocalcemia is observed, despite persistently high levels of pth . In this situation, a thorough search for causes of secondary hyperparathyroidism, particularly vitamin d deficiency, is imperative [79]. The demonstration of normocalcemic phpt is even more difficult as there are no guidelines for routine pth measurement, as hptp is most frequently identified during the investigation of reduced bone density [9, 10]. We retrospectively reviewed the medical records of 70 patients with phpt from our institution, who were divided into two groups: 33 patients with normal serum calcium levels and 37 with hypercalcemia (serum calcium 10.2 mg / dl). The following clinical data were obtained: gender, age, weight, height, and bmi . The diagnostic criteria for nphpt were as follows: apart from normal serum calcium and high pth levels, serum 25ohd levels above 30 ng / ml, absence of bisphosphonates, thiazide diuretics, anticonvulsants or lithium use, glomerular filtration rate greater than 60 ml / min, using the formula modification of diet in renal disease (mdrd), and the absence of other metabolic bone diseases or gastrointestinal diseases associated with malabsorption or liver disease . All patients had a urinary ca / cr ratio of less than 240 mg / g cr, demonstrating the absence of hypercalciuria . Serum calcium was determined using the johnson and johnson vitros 950 system (rochester, ny, usa) with reference value 8.4 to 10.2 mg / dl, serum 25-hydroxyvitamin d using the diasorin liaison competitive chemiluminescent immunoassay (stillwater, mn, usa) 10% coefficient of variation, with the following reference values: normal: 30 to 60 ng / ml), serum pth using the chemiluminescence method, immulite 2000 (siemens, llanberis, gwynedd, uk), with intra- and interassay coefficients of variation of 4.2 to 5.7% and 6.3 to 6.8%, respectively, and serum c - telopeptide when using the electrochemiluminescence assay, elecsys systems, roche diagnostics, mannheim, germany, reference value 50450 pg / ml . Bone mineral density (bmd) and t - score were evaluated at the lumbar spine (l1l4), femoral neck, and distal radius (lunar corporation madison, wisconsin, usa). The correction of serum calcium levels in relation to albumin was performed using the following formula: corrected calcium = calcium found + (4-serum albumin) 0.8 . Patients who had clinical manifestations of nephrolithiasis were evaluated by ultrasound, and the results of the examinations were obtained from the medical records . Pearson's chi - square test or fisher's exact test and the student's t - test with equal or unequal variances were used for comparisons . Verification of the hypothesis of equal variances was performed using levene's f test, and the level of significance used in interpreting the statistical test was 5% . The prevalence of nephrolithiasis in the normocalcemic group was 18.2% and 18.9% in the hypercalcemic group (p = 0.937). Fifteen percent of normocalcemic patients had a previous history of fractures compared to 10.8% of hypercalcemic patients, although there was no statistically significant difference (p = 0.726) table 2 . In both groups, the bone mineral density in the lumbar spine was 0.95 0.24 g / cm (t score: 1.3), femoral neck 0.76 0.15 g / cm (t score: 1.75), and distal radius 0.54 0.15 g / cm ls bmd was normocalcemic 0.95 0.22 g / cm versus hypercalcemic 0.95 0.26 g / cm, p = 0.885 and fn bmd: normocalcemic 0.73 0.15 g / cm versus hypercalcemic 0.79 0.19 g / cm, p = 0.123 . Patients with normocalcemia had bmd values in the distal radius significantly higher than the hypercalcemic patients (p = 0.046), as shown in table 3 . In the present study we found a high prevalence of kidney stones in nphpt, suggesting that the normocalcemia condition does not mean that the patient is without clinical manifestations . In relation to a history of fractures, we found a similar occurrence in the two groups with 15.2% in the normocalcemic and 10.8% in the hypercalcemic . We also observed that the bone mineral density in the distal radius was more preserved in the normocalcemic group than in the hypercalcemic group, although there were no significant differences in the lumbar spine and femoral neck . Lundgren et al ., in a sample of 109 patients, found that 17 (16%) had normal levels of calcium with elevated pth characterizing nphpt . In our institution, marques et al . Found a prevalence of nphpt of 8.9% in a population of 156 postmenopausal women with osteoporosis . These data suggest that it is not a rare condition and therefore needs to be investigated in all patients with reduced bone mineral density . In contrast, in a population - based survey conducted in sweden, the prevalence of nphpt, in postmenopausal women was 0.6% . Lowe et al ., in a series of 37 normocalcemic patients, found a frequency of nephrolithiasis of 14%, which is comparable with our findings, and a history of fracture of 11% . Marques et al . Showed an occurrence of kidney stones of 28.6% in osteoporotic women with nphpt in contrast to 0.7% in noncarriers . For clinical fractures they found a 21.4% prevalence in nphpt compared with 16.2% in those not affected . Our study showed a preservation of cortical bone in patients with the normocalcemic form of the disease, and this is in agreement with the findings of lowe et al ., who showed a deterioration, particularly in ls bmd . One study showed that after an oral calcium load, normocalcemic subjects had an inadequate suppression of pth compared with hypercalcemic subjects . The high frequency of kidney stones and fractures in normocalcemic primary hyperparathyroidism could be explained by the possible lower renal and bone sensitivity to the biological effects of pth, although this hypothesis needs further investigation . Gomes et al . Stated that another possibility could be the presence of non-184 pth circulating molecules, such as a 784 pth fragment, blocking the calcemic effect of 184 pth and preventing hypercalcemia . Our data suggests that nphpt may not be an idle condition as it may progress to complication regardless of the development of hypercalcemia . Controversies regarding the suggestion that nphpt should be treated, since the disease can lead to a deterioration in bone mineral density, fractures, and kidney stones . Thus, the routine determination of pth could detect these individuals early on in an attempt to prevent an unfavorable clinical course . There is no consensus about when to treat patients with hptpn, but if there is progression to clinical complications such as urolithiasis, bone mass loss, or fractures, surgery is indicated . Finally, a new phenotype of nphpt was recently described in a population - based survey mros (osteoporosis fractures in men). Using less rigid criteria for the diagnosis of nphpt (gfr> 40 ml / min and serum 25ohd <20 mg / ml), the authors found a 0.7% prevalence of the disease that was associated with a significantly higher ls bmd in comparison with the elderly men without nphpt . Our findings revealed a high prevalence of urolithiasis in normocalcemic primary hyperparathyroidism, but with preservation of the cortical bone, corroborating the belief that the disease is not an indolent condition and needs to be not only investigated but also treated when complications are diagnosed.
|
Amitani is widely credited to be the first to have described a pattern of idiopathic upper lobe fibrosis in the japanese literature in 1992, and subsequently this pattern of pulmonary fibrosis has frequently been referred to as amitani disease. However, in their case series in 2004, frankel et al . From the interstitial lung disease program at the national jewish medical and research center in denver defined a similar pulmonary fibrotic syndrome as a unique idiopathic pleuroparenchymal lung disease that is characterized by upper lobe radiographic predominance and pathologic findings that do not fit with any of the currently defined interstitial pneumonias, and they believed this to be akin to a pattern of fibrosis seen in earlier case reports in the english and non - english (esp . Japanese) literature, the first of which appeared as early as the 1960s [3 - 8]. Thus, in a less eponymous fashion, the disease has also become known as idiopathic upper lobe fibrosis (ipuf; esp . In the the japanese literature [9 - 3]), or (idiopathic) pleuroparen - chymal fibroelastosis ((i)ppfe), which is currently the preferred term in the english - language literature, most likely due to its concise yet highly descriptive nature . Since the early reports, a series of corroborative reports have been published, which have sought to uncover possible causative factors, and have established this rare pattern of fibrosis as a separate entity with definable, reproducible radiological and histopathological criteria that allow its recognition as a disease which is distinct from the other currently recognised patterns of idiopathic interstitial pneumonias . While several possible associations have become apparent, including previous lung and bone marrow transplantation as well as chemotherapy, the aetiology of this disease remains largely enigmatic . In this paper, we havetherefore systematically reviewed the histopathology and the clinical characteristics of known cases of ppfe in the english - language literature (69 in total), to aid in the generation of a unifying hypothesis regarding its pathogenesis and underlying mechanisms, and to provide a framework for the classification and specific diagnosis of this disease within the spectrum of known (idiopathic) interstitial pneumonias . The initial case series of ppfe in the english literature by frankel et al . Included five cases (4 female, 1 male, aged 32 - 65 years), 2 of whom had undergone cmf (cyclo - phosphamide, methotrexate, fluorouracil) chemotherapy, and all non - smokers, who presented with a range of symptoms, most consistent of which were dyspnoea on exertion and cough . For 4 patients, high - resolution ct (hrct) data were available, which showed intense pleural thickening with evidence of fibrosis, primarily affecting the upper lobes, sometimes accompanied by centrilobular nodularity . Histo - logically, this corresponded to marked fibrosis of the pleura and the subpleural parenchyma, with a homogeneous mix - ture of elastic tissue and dense collagen . There was a relatively abrupt border between the areas of fibrosis and the surrounding unaffected parenchyma with rare fibroblastic foci observed at the interface, accompanied by a varying amount of lymphocytic inflammation . More recently, becker et al . Presented two cases (both female, 51 and 59 years old) of idiopathic biapical, pleural and subpleural fibrotic change, characterised histologically by predominantly elastic fibrosis of the visceral pleura with extension into the adjacent alveolar walls . Again, the demarcation to normal parenchyma was sharp, with a few questionable fibroblastic foci at the interface, and some mild interstitial lymphocytic infiltrates . One of these women had undergone extensive chemotherapy (fludarabine, chop, rituximab and ibritumomab tiuxetan) in addition to autologous stem cell transplantation for follicular centre cell lymphoma . A further 2 cases (male, 28 and 60 years old), with subpleural fibrosis of the upper lobes reminiscent of ppfe on both hrct and histology . They also noted a sharp demarcation with the surrounding parenchyma, with some fibroblastic foci being present at the interface in both cases . More recently, our group published a study of 12 patients, all of whom had pleuroparenchymal thickening with subjacent fibrosis on ct imaging . Consistent with ppfe by both histopathology and radiology, taken from a series of 30 patients with lung biopsy material in the archives of the royal brompton and harefield nhs foundation trust (london, uk) which had been characterised by the terms intra - alveolar fibrosis, pleuroparenchymal and fibroelastosis in the original histopathology report . These patients had no significant drug history (except 1 case of immunosuppression following a renal transplant for anca - positive glomerunephritis), history of radiotherapy or bone marrow transplantation . Interestingly, 2 patients had first - degree relatives with interstitial lung disease (1 case of usual interstitial pneumonia (uip) and 1 of non - specific interstitial pneumonia (nsip)), and 4 of seven patients who reported recurrent infections had auto - antibodies in their serum . 5/12 had interstitial fibrosis in regions remote from the pleuroparenchymal changes, on hrct being most reminiscent of nsip / possible uip (3), nsip (1) and unclassifiable interstitial pneumonia (1) in the middle en lower zones . Histologically, all patients had intra - alveolar fibrosis with septal elastosis (iafe), with 11 out of 12 also showing fibrosis of the pleura . Other upper lobe changes included perilobular (6/12) and bronchocentric (10/12) iafe . Also of note was partial stenosis of the pulmonary vasculature in 8/12 patients in the fibrotic areas . Have identified a further 5 archival cases of histologically proven ppfe . In line with previous studies, these patients showed progressive functional deterioration even in a relatively short time of follow - up . These patients were aged 67 to 74, and included 4 men and 1 woman . The histology showed a markedly thickened visceral pleura and prominent subpleural fibrosis characterised by both elastic tissue and dense collagen, with an abrupt transition to adjacent normal lung parenchyma . They observed rare fibroblastic foci and a variable amount of inflammation, consisting mainly of small aggregates of lymphocytes . There were no known associated disorders or presumed causes in this group and the cases were therefore classified as idiopathic ppfe, or ippfe. Watanabe et al . Described a series of 9 patients (aged 43 - 81 years, 4 males and 5 females) with a pattern of upper lobe fibrosis on hrct . In all patients, this corresponded to subpleural fibroelastosis on histology with a preserved alveolar structure and intra - alveolar collagen deposition, which in most patients was also accompanied by pleural thickening and fibrosis to a varying degree . Interestingly, while these findings were upper - lobe predominant in all patients, two of the cases developed bilateral reticular or honeycomb opacities during follow - up . The patients had a poor prognosis, with two - thirds having died during follow - up, 1.8 to 12.2 years after initial presentation . The authors defined this pattern as ipuf, but recognised it as part of a spectrum of upper - lobe subpleural fibrosis that encompasses both ppfe and ipuf . In addition, there have been reports of changes remini - scent of ppfe in pulmonary disease following both lung and bone marrow transplantation . Have reported upper lobe fibrosis on ct imaging in 7 and 13 lung transplant recipients, respectively, which was corroborated in four patients by open lung biopsy in the latter series . The histological findings were of variably dense interstitial fibrosis, sometimes accompanied by obliterative bronchiolitis, organising pneumonia, and aspiration, although the typical pattern of fibroelastosis was not mentioned in their series . More recently, hirota et al . Described a single case of a 30-year - old female who had undergone living - donor lung transplantation for idiopathic pulmonary arterial hypertension, who developed ppfe - like changes 20 months after transplantation, with on biopsy pleural fibrosis and subpleural elastosis . In addition, there was evidence of constrictive bronchiolitis with surrounding peribronchiolar intra - alveolar fibrosis . They suggested ppfe as a possible pathological phenotype of restrictive allograft dysfunction (ras), and as a manifestation of chronic lung allograft dysfunction ., who identified 47 patients with ras, 16 of whom had a lung biopsy . In 15 of these, a pattern of subpleural parenchymal fibroelastosis was noted, characterised by intra - alveolar deposition of hypocellular collagen with preservation and thickening of the alveolar elastic network . Again, there was a sharp transition to unaffected surrounding parenchyma, with fibroblastic foci found at the interface . This was accompanied by obliterative bronchiolitis in 14, and diffuse alveolar damage (dad) in 13 patients . This led the authors to propose that dad may precede and be causally related to the development of ppfe in ras . Our group has reported a series of 4 patients who had undergone bone marrow transplantation and subsequently developed pulmonary fibrosis with a classical pattern of ppfe, both on ct and histopathology . The spectrum included pleural fibrosis, sharply demarcated subpleural and paraseptal intra - alveolar fibroelastosis and obliterative bronchiolitis . Of note were ct findings of pneumothoraces with or without a history of recurrent pneumothorax in all of these patients . A possible familial propensity for the development of otherwise idiopathic ppfe was suggested by an earlier french report of three sisters with bilateral isolated apical pleural fibrosis, leading to death in two cases and bilateral lung transplantation in the third patient . The women (all non - smokers) were aged 23 - 29 at time of presentation, with no evidence of auto - immune disease or relevant exposure history except drug treatment for previous pulmonary tuberculosis in one patient . Imaging revealed pleural and subpleural fibrosis, predominantly in the upper lobes in all three cases, which was confirmed by surgical lung biopsy in two, with a sharp demarcation towards normal more central lung parenchyma and a lack of significant inflammation . Salient demographic, clinical, and histological findings of the various case series have been collated in tabular format in table 1 . The age range over the studies was 13 - 85 years with an average age of 49, with almost total parity of sex (m: f ratio 46:54). There was a bimodal distribution of presentation, with an early peak in the third, and a later peak in the sixth decade (fig . 1a), with a striking predominance of female cases in the earlier peak, especially after exclusion of post - transplantation cases (fig . 1b). As far as is apparent from these publications, there were no active smokers and few ex - smokers amongst the patients . The most common presenting complaints were dyspnoea and cough (79% and 52% resp . ), with weight loss and pneumothorax also common (20% and 30% resp . ). The relevant history included cases of lung transplantation (47%), bone marrow transplantation (6%), chemotherapy (10%, many of whom had also undergone bone marrow transplant), known exposure to allergens (4%), previously detected auto - antibodies (8%) and recurrent pulmonary infective episodes (14%). There was a family history of lung fibrosis in 9% of cases, which were virtually exclusively female (just 1 male patient), with an average age of just 38 and all represented in the earlier peak of presentation (fig . The accrual of data through the radiological findings and histological description of surgical lung biopsies obtained from the cases in the series discussed in the previous section, has enabled the delineation of criteria for the diagnosis of ppfe . Definite ppfe or consistent with ppfe diagnosis (table 2). In their paper, kusagaya et al . Used previous studies to define the histological criteria of typical idiopathic ppfe as (1) intense fibrosis of the visceral pleura; (2) prominent, homogenous, subpleural fibroelastosis; (3) sparing of the parenchyma distant from the pleura; (4) mild, patchy lymphoplasmocytic infiltrates; and (5) small numbers of fibroblastic foci present . A typical focus of pleural fibrosis and subpleural fibroelastosis in ppfe is shown in fig . Our group has defined additional criteria to establish a diagnosis of a pattern of fibrosis which is consistent with ppfe, being intra - alveolar fibrosis as above, but (1) not associated with significant pleural fibrosis, or (2) not predominantly beneath the pleura, or (3) not in a upper lobe biopsy (table 2). While tightening the histological definition, this method obviously still allows for a possible overlap in the histological characteristics of ppfe with other known patterns of (idiopathic) pulmonary fibrosis . The two most prominent patterns of diffuse parenchymal lung disease in clinical practice today, are non - specific interstitial pneumonia (nsip) and usual interstitial pneumonia (uip). Nsip will not easily be confused with ppfe due to its more diffuse involvement of the lung parenchyma with generally little pleural change (with the exception of connective tissue - related nsip) and, on histology, an interstitial rather than intra - alveolar pattern of inflammation (as in cellular nsip) and/or fibrosis (in fibrotic nsip). In view of the subpleural predominance of the fibrosis of ppfe, however, the main radiological and histological differential diagnosis constitutes a pattern of uip, be it in an idiopathic setting (i.e. Idiopathic pulmonary fibrosis (ipf)) or secondary to known causes (e.g. Drug effects, or chronic extrinsic allergic alveolitis (eaa)). Ipf and a subset of ppfe patients also have a similarly poor prognosis, and familial cases have been described for both diseases [25, 26]. In contrast to the uip pattern, however, ppfe has a typical upper zone predominance, while uip, especially in the initial stages, primarily affects the lower lobes . Moreover, uip leads to extensive remodelling of the lung parenchyma, eventually resulting in end - stage fibrosis with effacement of the original parenchymal architecture . These features are not characteristic of ppfe, as the pattern is of homogeneous intra - alveolar fibrosis with preserved alveolar structure and even accentuation of septal structures through elastosis, and a lack of cystic change with bronchiolisation; the latter equating to the radiological finding of honeycombing in uip . Connective tissue stains which highlight elastic fibre deposition (such as an elastica van gieson stain) can therefore be highly valuable in solving this differential diagnosis . Also, the most important histological hallmark of uip, which is temporal heterogeneity of fibrosis with the presence fibroblastic foci adjacent to areas of established fibrosis, is not a feature of ppfe . Fibroblastic foci may be seen, but these should not exceed low numbers to permit a confident diagnosis of ppfe . The combination of both pleural and parenchymal fibrosis can also be seen in asbestosis, advanced fibrosing sarcoidosis, and radiation or drug - induced lung disease . A lack of a relevant history would obviously exclude the latter two, and histologically, none of these are characterized by the combination of intra - alveolar fibrosis and septal elastosis seen in ppfe . Thus, the archetypcal histological pattern of asbestos - related parenchymal fibrosis tends to display more advanced remodeling and architectural distortion than the intra - alveolar fibrosis seen in ppfe . Furthermore, in the case series included in this review, in only 3 patients [16, 17] exposure to potential (avian and fungal) allergens was noted, and only 1 patient was deemed to have significant asbestos exposure . Several of the other studies specifically mention the absence of a history of inhalational exposure, and this therefore would not appear to support a major role in ppfe . Potentially, however, not all clinical assessments of the patients included were rigorous enough to completely exclude this as a possibility . In clinical practice, a confident diagnosis of ppfe should nonetheless only be made in the absence of (1) a relevant exposure history, and (2) significant numbers of asbestos bodies and sarcoid - type granulomas on histology if a surgical lung biopsy is performed . Histomorphologically, the so - called apical cap, which is a localised lesion of subpleural fibrosis that predominantly occurs in the apices of the upper lobes, also enters the differential diagnosis of ppfe . Several criteria can be used in combination, however, to prise these two entities apart . Firstly, apical caps tend to occur in older cigarette smokers and are typically asymptomatic and non - progressive (average age 65.6 years, age range 51 - 91 years), while ppfe also affects younger, non - smoking patients, who present with symptoms and often have a poor clinical outcome . Secondly, apical caps (as the name suggests) tend to be localised mass lesions in the upper lobe apices, and as such, they are often resected for a presumed diagnosis of carcinoma . Ppfe, on the other hand, while displaying an upper lobe predominance, has a more diffuse subpleural distribution which can also affect basal portions and other lobes . Thirdly, histologically, apical caps are often associated with sclerotic pleural plaques and extensive alveolar collapse, which are not typically present in ppfe . Akin to ppfe, (cryptogenic) organizing pneumonia ((c)op) [28, 29] can lead to intra - alveolar fibrosis . Op is characterized by an initial phase, and a varying amount, of intra - alveolar fibrin deposition and inflammatory cell infiltration, followed by buds of intra - alveolar (myo) fibroblastic organization, the so - called masson bodies . These foci of organization can be cleared with often complete resolution and restoration of normal lung structure . Alternatively, a progression to chronic fibrosis can occur, with incorporation of the foci into alveolar septa and irregular interstitial fibrosis . This does not result in the diffuse, homogeneous intra - alveolar fibrosis and alveolar septal elastosis typical of ppfe, however, and both radiologically and histologically, op has a patchier, haphazard and frequently more peribronchial distribution than the predominant subpleural and paraseptal contiguous areas of fibrosis seen in ppfe . Prominent intra - alveolar presence of fibrin on a background of op is typical of acute fibrinous and organizing pneumonia (afop) [30, 31]. Again, afop tends to be a more patchy process than typical ppfe, with an average of 50% airspace involvement but less peribronchiolar accentuation than classical op . It is generally more pronounced in the lung bases, in contrast to ppfe which has a predominant upper zone distribution . Based on the clinical characteristics, there is a potential aetiologic overlap with ppfe patients, as recently cases of afop in lung and bone marrow transplant patients have been described [32, 33]. Afop can also occur as a non - specific secondary phenomenon, e.g. In the vicinity of tumours, foci of granulomatous disease, infarction of abscesses and in its primary form it has the same aetiologic differential as diffuse alveolar damage (dad) (incl . It has indeed been speculated to be a possible variant of dad, although intra - alveolar fibrin in afop is generally organized in afop often resolves completely, and although it can run a fulminant course with rapid progression to death in as many as half of the patients, long - term sequelae with dense intra - alveolar or septal collagen deposition have not been described . In some of the ppfe patients elements suggestive of dad have been observed . Thus, as mentioned above, in the series of transplant - related ppfe in the context of restrictive allograft syndrome published by ofek et al . Specimens obtained less than 1 year after onset of ras typically showed features of dad, with those obtained at a later date having less evidence of dad . The authors thus suggested that there may be a temporal sequence of dad preceding ppfe, especially as in some patients areas of dad appeared to merge into areas of ppfe . This is also a phenomenon sometimes seen in our case series of bone marrow transplant - related ppfe, with foci of dad - like fibrin deposition underlying areas of subpleural fibro - elastosis, pleural fibrosis and hypocellular pleural exudates (fig ., this may represent changes consistent with the previously described post - bone marrow transplant idiopathic pneumonia syndrome in the context of graft - versus - host disease, which has a high mortality rate (approx . 74%) and radiological and histological features of organizing pneumonia as well as dad [34, 35]. Classically, dad leads to a more interstitial pattern of initially myxoid - type, and later collagenous fibrosis, in contrast to the constantly denser, hypocellular intra - alveolar fibrosis in ppfe . Interestingly, however, when more central areas of intra - alveolar fibrosis are seen in ppfe patients, these often have an appearance reminiscent of the end - stage alveolar duct fibrosis with adjacent blood vessel dilatation first described in dad by pratt (fig . As the entity of ppfe is becoming more widely accepted, the number of cases reported in the literature is beginning to reach levels that allow for hypotheses of its aetiology and pathogenesis on the basis of the accumulated demographic data, clinical characteristics and histological features of these patients . By far the strongest association appears to be preceding lung or bone marrow transplantation, with just over half of the patients included in this review having undergone either of these . The aetiology of ppfe in bone marrow transplantation patients remains elusive, although possible causes may include drugs (e.g. Induction or chemotherapy regimens), radiation - induced effects or graft - versus host disease . Inflammation does not appear to be a dominant feature at the time of biopsy in these patients; however, an inflammatory component in earlier stages of the disease cannot be excluded . And although it is certainly conceivable that graft - versus host disease - related obliterative bronchio - litis could lead to a degree of subpleural atelectasis and collapse fibrosis, the pattern of fibrosis seen in ppfe is characterised more by alveolar filling with collagenous fibrosis with retention and accentuation of alveolar septal elastin . In the context of bone marrow transplantation, ppfe could also be a sequela of other known acute graft - versus host disease - related changes, such as the idiopathic pneumonia syndrome, with its characteristic histopatho - logical appearances of diffuse alveolar damage, organising or acute pneumonia and interstitial lymphocytosis . This syndrome tends to occur early after transplant (in the range of 1 to several weeks), as opposed to pleuroparen - chymal fibroelastosis, which appears to be of relatively late onset in post - bone marrow transplant patients . It is conceiv - able that the intra - alveolar fibrosis in ppfe constitutes the result of an imbalance in the rate of deposition and clearance of fibrinoid material in these frequent dad - like changes in the earlier stages after bone marrow transplantation, and/or an aberrant, relatively hypocellular and homogeneous fibrotic response to the presence of this material and its break - down products . Alternatively, ppfe could represent a consolidation of the intra - alveolar mixture of fibrin and fibroblastic plugs typical of (acute and fibrinous) organizing pneumonia, rather than the more common resolution or septal incorporation of these aggregates . Similarly, in lung transplantation patients who developed upper lobe fibrosis, this was in many cases accompanied by features of dad, or (af) op, in addition to constrictive obliterative bronchiolitis [21, 23]. It is as yet unclear, whether a possible confirmation of the hypothesis of dad/(af)op progressing to ppfe should be sought in disordered fibrin deposition, fibrinolysis, macrophage activity, fibroblastic response or pneumocyte homeostasis, or in a combination of these . If this is a common final pathway shared by other, non - transplant related forms of ppfe, it is conceivable that any form of lung injury leading to an intra - alveolar fibrinous response could lead to fibrosis with a ppfe pattern . This could thus also serve as a mechanism for the ppfe cases with a history of recurrent infection, allergen exposure, previous chemotherapy, and positive autoimmune serology in the studies discussed in this paper, all of which have previously been shown to have the potential to lead to dad / afop . Any such derangement in the balance of deposition and clearance of intra - alveolar fibrin / organisation could be due to environmental factors, or have a genetic basis, or be due to a combination of these . This theory of post - dad/(af)op ppfe is seemingly contradicted by the fact that the idiosyncratic pleural and subpleural localisation of fibrosis in ppfe does not conform to the typical radiological and histological pattern of changes in other bone marrow or lung transplant related lung pathology, which tends to have a more central and/or peribronchial distribution, especially when airway - related, such as is the case in constrictive or obliterative bronchiolitis . In transplant patients, and in some idiopathic cases, however, there also appears to be an additional (microscopic) bronchocentric component to the fibroelastosis, and it would therefore appear that this may be a self - limiting process in this location, whereas the fibrosis in the subpleural location is progressive and can continue unchecked . It is therefore likely that while fibrinous exudates and/or foci of intra - alveolar fibroblastic organisation may form the substrate for ppfe, other factors determine its eventual distribution . Thus, the correlation of idiopathic pneumonia syndrome with serositis, fibrosis and pneumothorax may be of particular interest, as the latter two are certainly also present in non - transplant cases of ppfe, and chronic serositis may have preceded the extensive pleuroparenchymal changes seen . Pleuritis in the context of systemic lupus erythematosus is known to have a potential to lead to pleural fibrosis in a minority of patients, as can drug - induced and rheumatoid pleuritis . This could potentially also serve as a mechanism for the occurrence of ppfe in patients with known positive autoimmune serology in the various case reports, but (chronic) pleuritis does not appear to be a feature of ppfe once the patients reach the stage of clinical presentation . Scarring of a visceral pleural defect following pneumothorax could also lead to the occurrence of subpleural fibrosis, and pneumothoraces are a recognized association of transplant - related lung fibrosis as well as of idiopathic ppfe . However, in both instances foci of subpleural fibroelastosis are more likely to contribute to the development of pneumothoraces rather than being a result thereof, as pleural and subpleural scarring following a pneumothorax is generally characterized by more localised collagenous fibrosis and remodeling of the parenchyma in contrast to the diffuse intra - alveolar fibroelastosis of ppfe . The predilection for the upper lobes of ppfe could also be another intriguing pointer towards its potential pathogenesis . In analogy with the apical cap, which is by some be presumed to be the end result of upper lobe subpleural infarction, ppfe can be accompanied by marked vascular changes, as shown in our recent case series, in which 8 out of 12 patients showed venous and arterial intimal fibrosis, which in 2 cases was sufficiently present to suggest vasculo - occlusive disease in the original reports . The peripheral localisation of ppfe with upper zone predominance may thus correlate with the relative hypoperfusion and ischaemia of these areas, although a mechanism for ischaemia leading to disordered fibrin and connective tissue homeostasis in these patients still needs to be established . Pleural effusions could act as a marker of active pleural disease, and could potentially play a pathogenetic role in ppfe, for instance mediated by fibrin and its degradation products contained within the fluid . At the time of presentation of ppfe, however, pleural effusion appears to be an extremely rare imaging finding . In fact, in the case series included in this review, only 1 case of unilateral pleural effusion was described, in the context of adjuvant chemotherapy following mastectomy for breast adenocarcinoma . This pleural fluid was found to be negative for malignancy, and the paper is not informative as to whether the patient had undergone radiotherapy for breast carcinoma on the same side . Obviously, this does not exclude selective underreporting of pleural effusion in the other case series, and retrospective information regarding pleural effusion in earlier (subclinical) stages of ppfe is generally not available . Nonetheless, the lack of effusion as a consistent finding in the sizeable group of patients presented in this review, implies that its role as a feature in (the development of) this disease is probably negligible . While there is a wide age range of presentation, the observed bimodal distribution, especially in the non - transplant cases, could be taken to suggest different aetiologies in the younger and the older age group . It is also of note that females are rather overrepresented in the first peak of presentation, with a relatively large number of these women having a family history of fibrosis, and also a generally poor prognosis . The publication of a set of 2 and 3 sisters, resp . By frankel et al . And, who all developed a pattern of fibrosis consistent with ppfe, provides strong support for the supposition that genetic variability may be an important, and at least contributory factor in its development and/or progression . Additional possible familial cases have been reviewed in the more extensive japanese literature [9, 10]. As yet, however, it remains unclear as to what the underlying genetic aberration(s) and its / their mechanism could be . In summary, ppfe is to be regarded as a distinct pattern of pulmonary fibrosis which is likely to be introduced as a separate entity in the new classification scheme of idiopathic interstitial pneumonias . It often runs a rapidly progressive course with a poor prognosis, and can constitute a rare but reproducible response to a range of pulmonary insults . These are presumed to include factors related to lung and bone marrow transplantation, and possibly drugs, autoimmunity, and recurrent infective episodes . While the acute changes caused by these insults are likely to vary in distribution and morphology, the end result in ppfe patients is an upper zone predominant pattern of pleural fibrosis and subjacent diffuse intra - alveolar fibroelastosis, possibly due to a disorder of fibrinolytic and/or fibrogenic homeostasis following dad or afop . Much remains to be understood about the potential triggers for ppfe (especially outside the setting of lung and bone marrow transplantation), however, and about the factors influencing an individual s predisposition to react to these insults with ppfe . Larger (and in view of the rarity of the disease, international) studies are therefore required to provide a clearer picture of possible clinical associations, delineate the natural history of the disease, and identify specific risk factors in patient characteristics . Genetic linkage in combination with exposure studies involving familial cases of ppfe may prove indispensable not only for unravelling potential familial genetic defects leading to the development of ppfe, but after their identification also those of possible sporadic genetic cases, and even of environmental factors which could influence the processes controlled by the genes involved . In due course, animal studies could be employed to test theories of aetiology and pathogenesis, and eventually of candidate therapies for ppfe . Thus, while models which faithfully reproduce all of the characteristics of ppfe are not yet available, a transgenic mouse model has been developed which expresses transforming growth factor- (tgf-) in the distal lung under control of the surfactant protein c (sp - c) promoter which recapitulates some of the features of ppfe with pleural and subpleural fibrosis [41, 42]. Notwithstanding ongoing research into the causes and potential treatments for ppfe, it will continue to be important to raise awareness ppfe as a separate entity in the spectrum of rare fibrotic lung diseases amongst clinicians, radiologists and pathologists involved in the management of lung fibrosis patients, as specific radiological and histological features have now been identified which enable its diagnosis with some confidence . This holds particular poignancy for those patients with symptoms and signs of lung fibrosis following lung and bone marrow transplantation, and for cases of otherwise idiopathic fibrosis in young women, especially in those with a positive family history . = acute fibrinous and organizing pneumonia = cryptogenic organizing pneumonia = computed tomography = diffuse alveolar damage = extrinsic allergic alveolitis = high - resolution computed tomography = intra - alveolar fibroelastosis = idiopathic pulmonary fibrosis = idiopathic pleuroparenchymal fibroelastosis = idiopathic upper lobe fibrosis = non - specific interstitial pneumonia = organizing pneumonia = pleuroparenchymal fibroelastosis = restrictive allograft syndrome = usual interstitial pneumonia
|
Phosphorylation is an important post - translational modification performed by kinases that catalyze the addition of phosphate groups onto the target amino acids, such as serines, threonines, and tyrosines . In prokaryotes phosphorylation is a reversible process, and under appropriate conditions, phosphorylated residues can be dephosphorylated by phosphatases . In the process of phosphorylation, a phosphate group is attached to an amino acid via a covalent bond . As a result, the local polarity, charge, and even the local structure of the target protein are changed . Following these local changes in the physicochemical properties and in the local structure, the interaction of a target protein with other molecules is influenced, giving raise to the controlled and reversible modulation of the specific protein function, and therefore, providing a way to control corresponding pathways . The importance of this posttranslational modification cannot be overestimated, and the reversible phosphorylation of the phosphorylated proteins was shown to play key roles in various processes of molecular signaling and regulation where the reversible phosphorylation acts frequently as a switch controlling various signaling processes . Phosphorylation is one of the most abundant posttranslational modifications and about 30% of proteins in eukaryotic proteomes can be phosphorylated . In arabidopsis thaliana, the number of coding genes is ~25,000 and the number of ser / thr protein kinases is around 1,000 . Assuming eukaryote - averaged level of phosphorylation, it is expected that ~7,500 a. thaliana proteins are phosphorylated by the 1,000 kinases . In other words, curiously, a large scale phosphorylation mapping study revealed that among the 1,346 phosphorylatable proteins of arabidopsis thaliana, more than 10% have membrane (either plasma membrane or vacuolar membrane) in annotation of their cellular localization . Since phosphorylation is a catalytic process that in principle should follow the classical lock - and - key model, it is a puzzle how one kinase can modify multiple often unrelated proteins . It has long been recognized that the efficiency of phosphorylation is determined by the primary structure of the target proteins . It was found recently that the structural flexibility is also a key factor that allows one kinase to phosphorylate multiple targets . Most eukaryotic protein kinases share very similar structural fold, being often composed of a smaller n - terminal -structure - enriched lobe and a larger c - terminal -helix - dominated lobe . Atp is bound to a loop (p - loop) connecting 2 -strands in the cleft formed by the n- and c - lobes . Near this atp - binding p - loop, there is another loop called activation loop through which the kinase activity can be regulated by either being phosphorylated / dephosphorylated or interacting with other regulatory proteins . There is a third loop known as catalytic loop that contains conserved asp and asn residues to interact with the substrate and to make the phosphorylation happen . All these loops, being flexible, are critical for the phosphorylation process, since kinases use these flexible regions to interact with their multiple partners . It was also emphasized that the local disorder in proteins targeted to phosphorylation represents another level of utilization of conformational flexibility in this catalytic process . In fact, phosphorylation relies on the interaction between the kinase and the substrate, and the flexible residues flanking the phosphorylation site (p - site) of the substrate are often involved in the substrate - kinase recognition . Therefore, besides the flexibility of the kinase itself, the structural flexibility of the substrate protein, especially the residues sequentially close to the p - site(s), represents an important prerequisite for phosphorylation to occur . One should also keep in mind that in many proteomes, the number of protein phosphatases is typically far smaller than the number of protein kinases, e.g., there are ~500 human protein kinases and only ~200 protein phosphatases . This indicates that in their function, phosphatases also rely on protein flexibility and intrinsic disorder . Therefore, structural flexibility of the kinases and the phosphatases and their substrates represent key factors defining the efficiency of the reversible phosphorylation process . It has been shown that phosphorylation occurs normally within the intrinsically disordered protein regions (idprs). The term idpr refers to a segment of a polypeptide chain that due to weak interaction with other parts of the same protein does not have stable structure under physiological conditions and exist as a dynamic conformational ensemble . The length of an idpr may vary from several residues to hundreds and even thousands of residues . Proteins that contain ordered domains and idprs are named hybrid proteins . For many proteins, known as intrinsically disordered proteins (idps), idpr runs over the entire protein length . Structurally, idps and idprs may exist in multiple forms, such as extended or compact disordered species that contain smaller or larger amount of flexible secondary structures . Although the structural flexibility of the substrates seems to represent an important structural factor defining the efficiency of protein phosphorylation, the peculiarities of the correlation between phosphorylation and the extent of the flexibility has not been completely understood . Besides, it is also not clear whether other structural factors might affect the phosphorylation process . In our previous study on the structural prerequisites for the efficient methionine oxidation, it was found that the methionine oxidation sites are characterized by some unique features, such as local structural flexibility, high solvent accessibility, and peculiar local secondary structure . Therefore, we undertook this study to examine the patterns of structural features defining the efficiency of protein phosphorylation . To this end, we focused on the peculiarities of phosphorylation of trans - membrane proteins from arabidopsis thaliana . The primary reason for this choice of these proteins is in the fact that the majority of the signaling receptors that detect and respond to various environmental stimuli are membrane proteins located within the cell membrane . Therefore, the analysis of the effects of phosphorylation on structural properties of membrane proteins is extremely important for better understanding the regulating roles of phosphorylation in various signaling pathways . While the accuracy of predictions of protein secondary structure and relative accessible surface area have been validated by their developers and by our previous study, the peculiarities of protein intrinsic disorder predictions needs to be further analyzed since two quite different disorder predictors (pondr - vlxt and pondr - fit) were applied in this study . This predictor is extremely sensitive to the peculiarities of the local amino acid compositions, and therefore, it is a very useful tool to measure the local structure flexibility . Pondr - fit, being a newer computational tool, is one of the more accurate disorder predictors . It is a meta - predictor that combines the outputs of 6 individual predictors and has high per - residue prediction accuracy . The comparison of pondr - vlxt and pondr - fit scores for all 75 phosphorylated residues in 52 transmembrane proteins is shown in figure 1a . This analysis revealed that: (1) sites with high pondr - vlxt disorder scores are very likely to have high pondr - fit disorder scores; (2) for structured site, the pondr - vlxt and pondr - fit disorder scores have larger discrepancy; (3) for exposed residues, the pondr - vlxt disorder score is usually lower than the pondr - fit disorder score; (4) for semi - exposed sites, pondr - fit scores are often higher than pondr - vlxt scores . (a) comparison of disorder score predicted by pondr - fit and pondr - vlxt . All the phosphorylation sites are organized into 3 different groups: buried (black, rsa 0.25), semi - exposed (green, 0.25 <rsa 0.5), and exposed (pink, rsa> 0.5). The solid diagonal line is where the disorder scores from both predictors match exactly to each other . The region between 2 dashed off - diagonal lines indicates confidence region where the disorder scores from 2 predictors are equivalent to each other . Y - axis is the averaged disorder score for a segment centered at the residue and flanked by 20 amino acids at both sides . Dark crosses (group i) are residues that are consistently predicted by both pondr - vlxt and pondr - fit as shown in (a). Blue circles (group ii) have larger pondr - vlxt scores in (a). Red squares (group iii) show residues with larger pondr - fit scores in (a). As shown by the confident region between the 2 dashed lines, the predictions of 2 predictors match each other for most of the residues . There are 54 residues within the area limited by these 2 dashed lines, which accounts for 72% of all the phosphorylated residues analyzed in this study . Out of 21 residues (28%) located outside of this area, only 11 (15%) are extreme outliers . The above described analysis was performed for individual residues with known phosphorylation status . However, in reality, the flexibility of an amino acid is influenced by its neighboring residues . Therefore, at the next step we analyzed the disorder score of a region flanking a sp.ecific residue, and figure 1b represents results of this analysis . Here, x - axis represents the disorder score predicted by pondr - vlxt for a phosphorylated residue, whereas y - axis shows the averaged disorder score for a segment centered at the phosphorylated residue and flanked by 20 amino acids at both sides . This analysis provides description of the local environment of the residue / region of the interest . If a structured target site (i.e., site with the disorder score below 0.5) is flanked by disordered regions, the averaged disorder score of this region will be higher than the score of the target site . In the curve representing the per - residue disorder score distribution if a disordered target site (i.e., site with the disorder score above 0.5) is flanked by structure - prone regions, the averaged disorder score of this segment will be smaller than the score of the target site, and this segment would correspond to a figure 1b suggests that almost all flexible phosphorylatable residues (disorder score> 0.5) have decreased averaged disorder score for the entire region, whereas the majority of structured phosphorylatable residues have increased averaged disorder score over the entire region . Therefore, this analysis suggests that almost all phosphorylatable residues are located either in the dips or the spikes of the corresponding per - residue disorder score curves . In figure 1b, we further considered 3 groups of residues based on the result of their disorder status evaluated by pondr - vlxt and pondr - fit (see fig . Here, group i includes residues with the disorder status consistently evaluated by both pondr - vlxt and pondr - fit (i.e., residues located within the area separated by two dashed lines in fig . 1a); group ii contained residues that had larger pondr - vlxt scores (i.e., residues located below the bottom dashed line in fig . 1a), and group iii corresponds to residues with larger pondr - fit scores (i.e., residues located above the upper dashed line in fig . Since group i represent residues whose disordered status is consistently predicted by both predictors, the subsequent analysis was focused on residues from groups ii and iii . The pondr - vlxt scores for residues in group ii are larger than their pondr - fit scores . Since pondr - vlxt is more sensitive to the peculiarities of local amino acid compositions, and since pondr - fit is more accurate in the general evaluation of disorder status, the higher pondr - vlxt score for these residues is an indication that the residues are locally flexible . Dips and another half is contained in spikes of the corresponding per - residue disorder score curves . Residues in the group iii that were characterized by higher pondr - fit scores also systematically had higher averaged scores of their extended segments . This means that these residues are predominantly located in dips, and their flanking regions are more flexible . This is also the reason of why pondr - fit scores for them are higher than the corresponding pondr - vlxt scores . Figure 2a represents the predicted disorder score and predicted relative surface area (rsa) for all phosphorylatable amino acids categorized by their secondary structures and clearly shows that only a small fraction of phosphorylatable residues are located within -helices or -strands, whereas the greatest majority of these residues can be found within the regions with irregular structure (coils). The peculiarities of numerical distributions are further illustrated by table 1, where positioning of all thr, ser, and tyr residues in secondary structure elements of analyzed proteins are compared with localization of phosphorylatable residues . Here, 2276 (35.9%), 521 (8.2%), and 3540 (55.9%) of all the thr, ser, and tyr residues the fractions of phosphorylatable residues within the three different secondary structure elements changed to 7 (9.3%), 2 (2.7%), and 66 (88.0%). By using the student t - test and assuming the null hypothesis that these 2 distributions are the same, the p - value of this test is 0.067, which does not indicate that the peculiarities of secondary structures have significant influence on the phosphorylation the total numbers of thr, ser, and tyr in the data set are 1902, 3391, and 1044, respectively . The numbers of phosphorylatable thr, ser, and tyr are 17, 56, and 2, accordingly . Again, applying the student t - test on the null hypothesis that 2 sets of data have same distribution, the p - value is calculated as 0.045 suggesting that phosphorylation has variable preference for the different types of phosphorylatable amino acid, in the order from ser, to thr, to tyr . Figure 2 . The sites were classified by different secondary structures, which are helix (blue square), -sheet (green circle), and coil (pink star). It can be seen that: (1) near 90% of phosphorylation sites are located in coil regions (as shown by pink stars); (2) more than 70% of phosphorylation sites are within disordered regions (disorder score> 0.5); (3) in the other 30% of structured phosphorylation sites, about 80% are exposed to solvent (rsa> 0.25); (4) only 5 out of 75 phosphorylation sites are structured and buried; (5) by taking consideration that residues with disorder score less than 0.5 but bigger than 0.3 are in twilight zone, only one out of 75 phosphorylation site is structured and buried . The range of possible disorder score from 0 to 1 was divided into 10 bins with each bin corresponding to a range of 0.1 . The bar height on each bin represents fraction of phosphorylation sites whose disorder score are within the bin . The bars are composed of 3 segments indicating buried site (brown), semi - exposed (orange), and exposed (green). Figure 2b shows the correlation between fraction of amino acids with specific values of relative surface area and structural flexibility as indicated by the disordered score for all phosphorylatable amino acids . In this analysis, the rsa was divided into three ranges: <25%, between 25% and 50%, and> 50% . The correlation coefficients for these 3 groups of residues with their disordered score are 0.02, 0.71, and 0.84, respectively . This demonstrates that when phosphorylatable residues are more exposed, their exposure probability is more positively correlated with their disorder score . This is also an indication that highly flexible residues are more often associated with larger surface exposure . Actually in figure 1b, the blue circles can be further split into 2 groups since despite the similarity of the overall disorder scores averaged on extended regions the pondr - vlxt scores of individual phosphorylatable residues clearly form 2 groups . This suggests that some residues in this group are located within spikes, whereas other residues are found in, the residues can gain additional flexibility from the neighboring regions . In the real process of phosphorylation, phosphorylatable residue has to be accessible to the catalytic domain of the kinase to form a covalent bond with phosphate . Therefore, it is intuitive to expect that the phosphorylatable residue has to be exposed and flexible . As shown in figure 2a, in line with our previous study on methionine oxidation, residues with rsa above 0.25 are exposed and residues with i d score higher than 0.3 are flexible . By using these 2 thresholds, all the phosphorylatable residues can be divided into 4 groups: (i) exposed and flexible; (ii) exposed but not flexible; (iii) not exposed but flexible; (iv) not exposed and not flexible . These residues are exposed and therefore they can be approached by the catalytic domain of the kinases . Since these residues are also flexible, they can adjust their conformations and/or spatial locations to facilitate the efficient catalytic process . The structural information related to residues in the group as shown by figure 3a, the averaged disorder score of an extended region centered at the phosphorylation site usually increases very fast when the length of the extended region is increasing . In other words, although these residues have lower disorder score, the entire segments where the phosphorylation sites are located are rather flexible . Meanwhile, as it can be seen from figure 3b, these residues have large rsa values indicating that they are exposed . Therefore, in terms of the easiness of their phosphorylation, the group ii residues are essentially the same as the group i residues . The only noticeable exception from this rule in figure 3a is tyr31 in q42438 . Even when the length of region surrounding this residue was increased to 40, the averaged disorder score was still below 0.1 suggesting that this residue is located within a pretty long rigid region . To analyze the reason for this peculiar behavior, figure 3c represents the detailed structural information of q42438 . The total length of this protein is 532 residues, including kinase domain at n - terminal half (the dark - red horizontal bar in the plot), an autoinhibitory domain in the middle, and the four tandem ef - hand motifs at the c - terminal half . The atp binding site is located right before the kinase domain and after the phosphorylation site . The region flanking the phosphorylatable tyr31 is actually enriched in charged and polar residues . In pondr - fit plot, the entire region before the kinase domain is expected to be highly flexible, as shown in figure 3c . Therefore, the phosphorylation of all the group ii residues is still under the control of the local structural flexibility and surface exposure . Figure 3 . Structural analysis for residues with low disorder score and high rsa . (a) the averaged disorder score for the segment extended toward both sides on the phosphorylation site . X - axis is the length of the extension and y - axis is the averaged disorder score calculated from pondr - vlxt prediction . X - axis is the extended length and y - axis is the averaged rsa predicted by netsurfp . Since the segment is extended on both sides, the total length of the segment with extension n is 2n+1 . The curves in both (aandb) stand for: (a) f4kd71-t556; (b) q9flv9-s601; (c) q9sb58-s343; (d) q42438-y31; (e) q8rye2-s69; (f) q9lh89-s167; and (g) q38890-t20 . (c) structural information, disorder prediction, and rsa prediction for q42438 (at5g19450). Pink stars are phosphorylated tyrosine (y31) labeled on pondr - vlxt and rsa prediction, respectively . The residues in group iii are also similar to the group i and ii residues . In fact, figure 4a shows that all the group iii residues have larger disorder score by themselves . Although the values calculated for phosphorylatable residues by themselves are all small, the averaged rsa for the regions surrounding these residues increases very fast . Therefore, vast majority of the group iii residues still follow the phosphorylation mechanisms that rely on both structural flexibility and surface exposure . Therefore, the details of the disorder and rsa prediction were further analyzed as shown in figure 4c . It has about 654 residues and is composed of the n - terminally located signal peptide of 40 residues, followed by the 5 leucine - rich repeats (lrrs), atp binding site, and finally by the kinase domain at the c - terminal half of protein . Ser360 is located at the beginning of the kinase domain, right before the atp binding site that is assumed to be located in the region between residues 360 and 380 . In terms of the sequence, we can see that the n - terminal flanking region of ser360 is composed of leucine and charged residues (d, e, and r). This combination may force serine to be more exposed than predicted . In the disorder curve of this region this suggests that this serine can serve as a local hot spot, whose actual flexibility could be larger than that evaluated based on the predicted disorder score . Therefore, the factors determining the phosphorylation mechanism of ser360 of q9lvm0 can also be attributed to local structural flexibility and surface exposure . Figure 4 . Structural analysis for residues with high disorder score and low rsa . (aand b) are averaged disorder score and rsa for the segments centered at the phosphorylation site . The extended length of the segment on one side is shown on x - axis . Y - axis is the averaged disordered score predicted by pondr - vlxt in (a), and averaged rsa predicted by netsurfp in (b). Curves are plotted for: (a) q93yr3-s63; (b) q9lvm0-s360; (c) q940y5-s183; (d) q8rwz6-s183; (e) q9zuu9-s48; and (f) q9sct4-t758 . (c) disorder and rsa prediction for n - terminal half of q9lvm0 (at5g58300). Pink stars are phosphorylated serine (s360) on the curves of disorder score and rsa . Group iv has only 2 residues, which are thr580 of q9lvm0 and thr567 of q9fhk7 . Q9lvm0 is a putative receptor kinase containing five lrrs, and q9fhk7 is another lrr receptor - like protein kinase . These 2 sequences are highly similar to each other with the sequence identity of ~50% (see fig . The flanking regions of the phosphorylatable threonines in these two proteins are almost identical (also see fig . Therefore, the phosphorylation of these 2 residues should be determined by similar mechanisms . To investigate the factors influencing the phosphorylation, the disorder and rsa scores of q9lvm0 are plotted in figure 5 . From the disorder profile (which is shown by blue curve in fig . 5a), it is clear that although protein has low disorder score in the vicinity of the phosphorylatable thr580, the entire c - terminal region is very flexible starting at residue 560 as evidenced by the extremely high fraction of residues (~80%) that have disorder score higher than 0.5 . However, the sequence of the region directly flanking the phosphorylation site is enriched in aliphatic, aromatic, and charged residues . Therefore although this region is predicted to have lower disorder score, it can still be globally flexible . (a) disorder and rsa prediction for the c - terminal half of q9lvm0 (at5g58300), a putative receptor kinase . (b) is the wenxiang diagram for the helix - prone region within the segment shown in (a). Aromatic and aliphatic residues are colored red, and the other residues are in blue . Since this region is also predicted to be an -helix by netsurfp, we can imitate the spatial locations of the amino acids by using the so - called wenxiang diagram which helps intuitively analysis on the disposition of amphipathic -helices in heteropolar environments (see fig . It is clear that the hydrophobic and charged residues are spatially localized at different sides of an -helix . Besides, even though being predicted to be buried, the phosphorylatable thr is located on the surface of this amphipathic -helix . Therefore, the side - chain of thr can be much more flexible and exposed than the neighboring backbone atoms . Analyzing the structural properties of the kinases and the phosphorylation sites of target proteins is important since the efficient phosphorylation requires a conformational match originated from the coordinated movement of both the kinase active site residues and the substrate ., we summarized the structural properties of the region flanking phosphorylation site of the specific substrates, namely trans - membrane proteins from arabidopsis thaliana . The reasons the only a. thaliana trans - membrane proteins were chosen for the analysis reported in this manuscript are: (1) a. thaliana is a model plant that has been studied extensively and is still attracting a lot of attention, which makes the future experimental validation much easier; (2) the phosphorylation data of this set of proteins seem to be more reliable since the data have been cross - validated by different groups as stated in the database; (3) the trans - membrane proteins in a. thaliana play important signaling roles in detecting environmental stimuli; (4) our previous studies on trans - membrane proteins indicates that trans - membrane proteins have some unique features in term of protein intrinsic disorder; (5) large scale data set may contain large - scale errors that make the analysis more difficult . Our analysis revealed that both the structural flexibility and surface exposure of local region in the close vicinity of the phosphorylation sites are critical contributors to the productive phosphorylation process . This observation is complementary to the traditionally accepted dependence of the phosphorylation efficiency on the protein primary structure . However, beyond their amino acid sequences (or primary structures), proteins are characterized by various higher order structural properties, such as secondary structure, accessible surface area, (structural) intrinsic disorder, and 3d structure . This study focused more on those higher order structural properties, than on the traditionally analyzed sequence information . The analysis clearly showed that the broader structural viewpoint provides additional rationale for the molecular mechanisms of protein phosphorylation . Although new phenomena are discovered in this study, the limited number of reliable phosphorylatable residues in our data set limited the depth of the residue - specific analyses . As shown in table 1, there are only 17 and 2 phosphorylatable thr and tyr residues in proteins we analyzed . Therefore, subsequent studies are needed for gaining more information on the structural prerequisites for phosphorylation of sp.ecific amino acids . However, it should be noted that the phosphorylated tyrosine constitutes only several percent of phosphorylatable residues across the eukaryote proteomes . By taking into consideration that only about 10% of the phosphorylated proteins in a. thaliana are trans - membrane proteins, the actual number of phosphorylated tyrosine residues cannot be expected to be high . It is easy to imagine that the actual phosphorylation event can represent a very complicated process . For example, based on an intuitive analysis of the pondr - vlxt and rsa profiles (see fig . 3a), tyr31 of q42438 seems to be a difficult phosphorylation target, since this residue is located within a region predicted to be structured . 3c), this region is apparently more flexible than one could expect from the inspection of the pondr - vlxt profile . Intriguingly, recent studies revealed that the close neighbor of tyr31, the q42438 ser36, is a phosphorylatable residue . This observation provides a possible explanation for the tyr31 phosphorylation mechanism . According to our analysis therefore, it is very likely that ser36, being more solvent exposed than tyr31, can be phosphorylated first . Following this phosphorylation event, since there are only 5 residues between tyr31 and ser36, the local environment of tyr31 may also be changed simplifying the subsequent phosphorylation of this tyrosine residue . These 3 residues are close to each other on the sequence and phosphorylation of one of them can synergistically affect accessibility of two other residues . In addition to the influence of the sequentially neighboring residues, the effects of the residues that are not sequential neighbors but are spatial neighbors are of a special interest . Ser360 is located at the beginning of the kinase domain, whereas thr580 is positioned at the end of the kinase domain . Although these two sites are sequentially remote, the actual spatial distance between them is not determined since structure of q9lvm0 is not known . However, the kinase domain of q9lvm0 is similar (with the sequence identity of ~30%) to several other proteins whose 3d structures have been resolved . In these structures, therefore, it is unlikely that the phosphorylation of s360 and t580 of q9lvm0 may influence each other . Another example is found in an inorganic phosphate transporter q8vym2 as shown in figure 6 . This protein has 3 phosphorylation sites: thr263, ser509, and ser520, all located in its cytoplasmic regions . Since ser509 and ser520 are not far away from each other, one might expect the existence of synergetic effect of phosphorylation of 1 residue on the phosphorylation efficiency of another . In our previous study on methionine oxidation therefore, the question is whether the phosphorylation of these neighboring ser509 and ser520 residues has specific order . The importance of this question is determined by the fact that the functionality of this phosphate transporter can be controlled by various phosphorylation processes . The related question is whether phosphorylation of thr263 might influence the phosphorylation of s509 and/or s520 and vice versa . Since these 3 residues are cytoplasmic, their actual spatial distances could be very small . If this hypothesis is correct, then they will be able to affect each other . However, similar to other cases considered above, the available experimental are rather limited . Therefore, further studies are needed to better understand the phosphorylation mechanisms of this interesting protein . Figure 6 . Disorder and rsa prediction for q8vym2 (at5g43350). Pink stars are phosphorylated residues (t263, s509, and s520) labeled on both disorder and rsa prediction . The explanation for the above 2 different scenarios of phosphorylation is actually supported by the observation that many proteins undergo sequential or hierarchical phosphorylation phosphorylation . The sequential phosphorylation is originally proposed to explain the phosphorylation of an unsuitable site, which can be affected by the phosphorylation of another sequentially - remote site by a different kinase . Here, in our analysis, we further elaborated the process into 2 specific cases: influence by sequentially neighboring residues and influence by spatially neighboring residues . The information on phosphorylatable sites in transmembrane proteins of arabidopsis thaliana were collected from phosphat database . This database contains information on arabidopsis phosphorylation sites identified by mass - spectrometry experiments performed by different research groups . Only trans - membrane proteins were selected for our further analysis . After removing redundant and low - confidence records, 52 proteins and 75 phosphorylation sites were selected . The per - residue disorder scores were evaluated by pondr - vlxt and pondr - fit . Pondr - vlxt is very sensitive to the changes on local amino acid composition, and pondr - fit is one of the most accurate disorder predictors . Netsurfp was applied to predict both secondary structures and accessible surface areas of proteins under study . For each residue in the analyzed protein, the output of secondary structure prediction from netsurfp has three values, indicating the probabilities of formation of -helix, -sheet, and coil . Therefore, the accessible surface area was predicted in 2 forms: the relative surface accessibility (rsa) and absolute surface accessibility (asa). Asa is the real value, while rsa is defined as the ratio of actual asa of a given residue in a specific 3d structure to the maximum possible asamax of the same type of amino acid calculated from a tri - peptide of this amino acid flanked by either glycine or alanine . The information on phosphorylatable sites in transmembrane proteins of arabidopsis thaliana were collected from phosphat database . This database contains information on arabidopsis phosphorylation sites identified by mass - spectrometry experiments performed by different research groups . Only trans - membrane proteins were selected for our further analysis . After removing redundant and low - confidence records, 52 proteins and 75 phosphorylation sites were selected . The per - residue disorder scores were evaluated by pondr - vlxt and pondr - fit . Pondr - vlxt is very sensitive to the changes on local amino acid composition, and pondr - fit is one of the most accurate disorder predictors . Netsurfp was applied to predict both secondary structures and accessible surface areas of proteins under study . For each residue in the analyzed protein, the output of secondary structure prediction from netsurfp has three values, indicating the probabilities of formation of -helix, -sheet, and coil . Therefore, the accessible surface area was predicted in 2 forms: the relative surface accessibility (rsa) and absolute surface accessibility (asa). Asa is the real value, while rsa is defined as the ratio of actual asa of a given residue in a specific 3d structure to the maximum possible asamax of the same type of amino acid calculated from a tri - peptide of this amino acid flanked by either glycine or alanine.
|
This paradox was first resolved by matzinger in 1994 who proposed that our immune system is designed to combat danger, rather than mediate recognition of non - self over self . Pathogen - associated molecular patterns (pamps) and endogenous molecules created upon tissue injury, since called damage - associated molecular patterns (damps), signal the threat of either infection or injury to the organism, independently of their non - self- or self - identity [25]. Among the cellular receptors that sense these danger signals, toll - like receptors (tlrs) represent a key molecular link between tissue injury, infection, and inflammation . In the last decade a number of endogenous molecules specifically generated upon tissue injury that activate tlrs have been identified . Some are intracellular molecules normally inaccessible to the immune system that are released into the extracellular milieu as a result of cell necrosis or activation following injury . Others are extracellular matrix (ecm) molecule fragments that are released upon tissue damage or ecm molecules that are specifically upregulated in response to tissue injury . In addition to playing a key role in host defence against danger, activation of tlrs has been linked to the pathogenesis of many inflammatory and autoimmune diseases including sepsis, rheumatoid arthritis (ra), systemic lupus erythematosus (sle), inflammatory bowel disease (ibd), type i diabetes, and multiple sclerosis (ms). Hence, in recent years tlrs and associated signalling molecules have become attractive targets for their treatment and a number of inhibitors are currently in development or have progressed to clinical trials . Aberrant tlr activation is also thought to contribute to diseases with a strong association with inflammation such as cancer and atherosclerosis (reviewed in [711]). One of the key questions to emerge from these studies is what factors drive tlr activation during the progression of disease . There is an increasing body of evidence to suggest that damp - mediated inflammation plays a vital role . It is also becoming apparent that pamps and damps act in quite a different manner in order to stimulate an immune response . Here we review the mechanisms of damp recognition by tlrs, the signalling cascades, and the biological outcomes resulting from self tlr activation, focusing on the differences to non - self tlr activation . We also discuss the evidence that implicates endogenous molecules in pathological tlr activation and examine how blockade of damp action may be therapeutically beneficial . Understanding more about the differences between pamp- and damp - induced inflammation may enable us to specifically target inappropriate, pathogenic inflammation whilst leaving the host defence intact . The first report of a putative endogenous activator of tlrs dates back to 2000, when heat shock protein 60 (hsp60) was shown to induce cytokine synthesis through tlr4 activation . In the same year necrotic cells were found to induce pro - inflammatory and tissue repair gene synthesis and cause dc maturation in a tlr2 dependent manner, as a result of the release of their intracellular contents [13, 14]. The list of endogenous tlr2 and 4 activators has expanded quickly and encompasses other intracellular molecules such as heat shock proteins including hsp70, gp96 [1517], hsp22, and hsp72 [18, 19] and high - mobility group box-1 protein (hmgb1) [2022] as well as ecm molecules such as biglycan, tenascin - c, versican, and fragments of ecm molecules including oligosaccharides of hyaluronic acid (ha) and heparan sulfate (hs). For instance, tlr1 was shown for the first time to be required, along with tlr2, for the activation of professional antigen - presenting cells by -defensin-3, a host - derived antimicrobial peptide . Self - nucleic acids have also been described as endogenous danger signals, namely, mrna recognised by tlr3, single - stranded rna (ssrna) sensed by tlr7 and 8, and igg - chromatin complexes recognised by tlr9 . Interestingly, emerging data support the activation of tlr7 and 8 by antiphospholipid antibodies (apl) isolated from patients with apl syndrome [32, 33], as has been also shown previously for tlr2 and 4 [3436]. A more complete list of damps and their cognate tlrs can be found in figure 1 . Given the use of e. coli to produce many of these endogenous molecules recombinantly, and the fact that most endogenous proteins activate tlr2 and 4, originally described as sensors of microbial products such as lipopolysaccharides (lpss) and lipoproteins, the question of whether microbial contamination can partially or wholly account for damp activity remains a key issue . Erridge and samani recently showed that apparent stimulation of tlr4 by saturated fatty acids was due to microbial contamination in their preparations of bsa . In contrast, professional antigen - presenting cells that are not responsive to lps were shown to be activated by necrotic cells indicating that lps independent tlr4 activation does occur in response to endogenous ligands . Similar to tlr2, tlr3 was also shown to recognize cells undergoing necrosis during acute inflammatory events, independently of viral infection . Indeed, as details of the mechanisms of endogenous tlr ligand recognition emerge, it becomes clear that there are significant differences between pamp and damp activation of tlrs . In addition, the phenotype of mice with targeted deletions in a number of endogenous tlr activators confirms that removal of endogenous danger signals correlates with the effects of addition of exogenous damps . Together these data indicate that damp activity is not reliant on the presence of contaminating pamps . Recent data indicate that endogenous danger signals and microbial products can also cooperate in the induction of immune responses . Neither highly purified hsp preparations nor lps alone at concentrations corresponding to those found in contaminated hsp preparations could induce pro - inflammatory cytokine production (reviewed in [4042]). Further studies showed that hsp60 and gp96 can tightly bind to lps in a saturable manner and enhance its biological activity, as well as that of the tlr2 ligand pam3cys [4345]. In the light of these results, the function of hsps has been proposed to modulate early immune responses during infection by mediating a synergy between pamps and damps . Similarly, hsp90 has also been implicated in the recognition of cpg dna by tlr9 and the binding of hmgbs to nucleic acids is required for efficient recognition by tlr3, 7, and 9 [4648]. There is an increasing body of evidence that demonstrates how exogenous and endogenous activation of tlrs is mediated and this reveals that, whilst there is some overlap in molecular machinery, damps possess distinct mechanisms of action to pamps . These similarities and differences emerge below where we explore the mechanisms of pamp and damp recognition by tlrs and the subsequent tlr signalling and biological outcomes . Tlrs interact with a wide variety of ligands ranging from proteins and lipoproteins to nucleic acids and saccharides, all of which are different in size and chemical properties . The extracellular domains (ecds) of tlrs contain leucine - rich repeat (lrr) motifs that are responsible for pamp recognition . One structure shows that tlr3 interacts with hydrophilic double - stranded rna (dsrna) via surface - exposed sites . A second structure shows tlr1-tlr2 heterodimers bound to the hydrophobic pam3csk4 lipopeptide that fits in an internal hydrophobic pocket . Finally, the structure of the tlr4-md-2-lps complex shows that tlr4 employs the co - receptor md-2 to recognise lps and that no direct contacts between the receptor and the ligand take place [5254]. The latter structure also provided insights into the structure - activity relationship of the lipid a moiety of lps . Not only the number of lipid chains [55, 56] but also the phosphate groups and their positioning in the lipid a are important factors affecting the immunological activity of lps . This suggests that even minor modifications to ligands may cause significant changes in the responses they generate . These three crystal structures highlight three diverse modes of exogenous ligand recognition by tlrs involving tlr homo- and heterodimerization as well as direct tlr - ligand interactions or the use of co - receptors and accessory molecules . A number of accessory molecules have been shown to assist microbial recognition by tlrs . For instance, lps is extracted from the bacterial membrane by the lps - binding protein (lbp) after which it is transferred to cd14 . Subsequent transfer from cd14 to an additional accessory molecule md-2 then allows tlr4-mediated lps recognition . Interestingly, in the absence of md-2, the lps - dependent tlr4 signalling can be reconstituted by the mite dust allergen der p 2, which has structural and functional homology with md-2 and mimics the activity of md-2 by presenting lps to tlr4 [58, 59]. Hmgb1 can also mediate lps transfer to cd14 to initiate a tlr4-mediated pro - inflammatory response . In b cells, the tlr - like molecule radioprotective 105 (rp105) forms a complex with the md-2 homolog md-1 and is essential for regulating tlr2 and 4-dependent antibody production to the ligands lipoproteins and lps . Conversely, in macrophages and dcs, rp105/md-1 acts as a tlr4 decoy receptor that, by interacting directly with the tlr4 signalling complex, inhibits the ability of the receptor to bind microbial ligands [61, 62]. Cd14 facilitates lps transfer to tlr4/md-2 and, accordingly, in the absence of cd14 rough lps cannot initiate the trif / tram pathway and smooth lps cannot be detected at all [63, 64]. Cd14 binds also to triacylated lipopeptides facilitating their recognition by tlr2/tlr1 complexes and can enhance dsrna - mediated tlr3 activation nad(p)h oxidase 4 (nox4) modulates the production of lps - induced reactive oxygen species (ros) by interacting with the cytoplasmic tir domain of tlr4 [68, 69]. Tlr2 was shown to collaborate with dectin-1 in zymosan recognition or with the macrophage receptor with collagenous structure (marco) in addition to cd14 to respond to tdm, a cell wall glycolipid from mycobacterium tuberculosis . Collectively these data point to specific and complex mechanisms at the basis of pamp recognition, highlighted by the requirement of a number of distinct co - receptors and accessory molecules for individual ligands . Most of the proposed endogenous tlr activators have been shown to form complexes with tlrs in vitro by means of immunoprecipitation assays and functional cell - based assays or in vivo, taking advantage of mice deficient in tlrs or their adaptor proteins . Recently, fret confocal microscopy and gfp fragment reconstitution have been proposed to study tlr interaction and measure distances between receptors in the range of molecular interactions . This technique might be of great benefit in demonstrating and characterising endogenous ligand recognition by tlrs . There exists circumstantial evidence that damps and pamps may occupy the same or neighbouring binding sites on tlrs . For instance, surfactant protein a was shown to downregulate peptidoglycan and zymosan induced nfb activation and tnf secretion by binding to the extracellular domain of tlr2 in raw 264.7 and alveolar macrophages [73, 74]. However, some damps may utilize different binding sites; whilst the tlr4 mutations d299 g and t399i prevent activation by lps, these polymorphisms confer enhanced ability of tlr4 to respond to fibrinogen . There is also evidence that damps require different co - receptors and accessory molecules to pamps . Reviewing the proposed modes of endogenous ligand recognition leads to a rational classification of endogenous molecules based on the receptor, co - receptor(s), and accessory molecule(s) requirement for recognition by tlr(s) and subsequent cellular activation that is summarized in figure 2 . This includes both tlr2 and 4 agonists, such as hsp60, hsp70, and biglycan, as well as tlr4 activators such as oxidized ldl and s100 proteins [15, 23, 69, 76, 77]. A second group of damps requires only cd14 as an accessory molecule and these are surfactant protein a and d and lactoferrin [7880]. A third group comprises damps that have been shown to involve only md-2 in their recognition by tlrs . Among these, gp96 and hmgb1 activate tlr2 and 4, whereas fibronectin eda (fneda) and saturated fatty acids activate tlr4 [17, 20, 22, 8186]. A fourth group includes damps that use co - receptors or accessory molecules different from cd14 and md-2 . Biglycan was recently shown to induce the nlrp3/asc inflammasome through activation of tlr2/4 and purinergic p2x4/p2x7 receptors . Autoantibodies against dsdna and nucleosomes from sle patients induce dc activation through tlr2 if bound to hmgb1 [89, 90]. Similarly, hmgb1 mediates the activation of plasmacytoid dcs and b cells through tlr9 by dna - containing immune complexes through a mechanism involving the immunoglobulin superfamily member rage . Igg2a - chromatin immune complexes require the synergistic engagement of igm and tlr9 to activate b cells . Tlr7, 8, and tlr9 expressed by pdcs respond to self - rna and -dna respectively when coupled with the endogenous antimicrobial peptide ll37 [91, 92]. Furthermore, cd32 delivers dna - containing immune complexes found in serum from sle patients to intracellular lysosomes containing tlr9, leading to dc activation [89, 90]. Finally, b cells are activated by dna- or rna - associated autoantigens by combined b cell antigen receptor (bcr)/tlr9 or tlr7 engagement [93, 94]. This is a provisional list of endogenous activators and their accessory molecules that will certainly expand as we learn more about damp - tlr interactions . Collectively, these data indicate that several co - receptors and accessory molecules required for ligand recognition by tlrs are employed by both damps and pamps . Further detailed investigation of how damps are recognised by the cell is required to elucidate the precise structural organization of these receptor complexes . A signalling competent conformation of the receptor is required for tlrs to function; however it is not known whether the conformation induced by damps is similar or distinct to that produced by microbial structures where sequential changes in receptor conformation occur upon ligand binding (reviewed in). Ligand - induced receptor homo- or heterodimerization leads the cytoplasmic signalling domains of tlrs to dimerize . Despite diverse mechanisms of ligand interaction, pamp - tlr complex crystal studies showed striking similarities in the organization of ligand - tlr dimer complexes that may apply to all tlrs . All three structures feature an m-shaped tlr dimeric architecture in which the c - terminal ends of the tlrs converge and, presumably, cause dimerization of the intracellular domains for signal initiation (reviewed in). The resulting tir - tir complex initiates downstream signalling through recruitment of specific adaptor molecules . Five adaptors have been described so far: myeloid differentiation factor 88 (myd88), myd88-adaptor like (mal), tir domain - containing adaptor inducing ifn - beta (trif), trif - related adaptor molecule (tram), and sterile alpha and heat - armadillo motifs (sarm). Depending on the adaptors recruited to the tlrs, two major intracellular signalling pathways can be activated by tlrs . It involves the il-1r - associated kinases (irak), irak-1 and irak-4, tnf receptor - associated factor 6 (traf-6), and mitogen - activated kinases (mapk) and it culminates in the activation of the transcription factor nfb via the ikb kinase (ikk) complex . In turn, nfb mediates the transcription of pro - inflammatory cytokine genes . The second pathway, known as trif pathway, is independent of myd88 and can be activated upon stimulation of tlr3 or 4 . It leads to activation of the interferon - regulated factors (irf) family of transcription factors via recruitment of trif and results in the synthesis of interferon (ifn). Tlr signalling pathways induced by endogenous molecules in different cell types are poorly investigated, but recent studies report usage of distinct adaptor molecules and induction of distinct signalling pathways downstream of tlrs when stimulated with exogenous or endogenous molecules . In contrast, we have shown that the endogenous tlr4 agonist tenascin - c signals via myd88 . Similarly, biglycan has been shown to signal through tlr2 and 4 in a myd88-dependent manner . Tlr signalling results in the activation of transcription factors regulating the expression of specific genes whose products trigger various cellular responses . For example, nfb, ap-1, and irf5 control the expression of genes encoding inflammatory cytokines, whereas irf3 and irf7 induce the expression of type i ifn and ifn - inducible genes . Thus a large number of proteins are synthesised that mediate inflammatory and immune responses and include inflammatory cytokines such as il-1, il-6, tnf, il-12, ifns, chemokines, adhesion molecules, costimulatory molecules, growth factors, tissue - degrading enzymes such as metalloproteinases, and enzymes that generate inflammatory mediators such as cyclo - oxygenase 2 and inducible nitric oxide synthase (inos). Different microbial agents trigger multiple pathways in different cell types and induce the expression of distinct subset of genes [99103]. A detailed comparative analysis of the biological outcomes induced by different endogenous versus exogenous tlr molecules has not been performed . However, some crucial differences between host responses to endogenous versus microbial agents are emerging . For instance, expression of monoamine oxidase b and the anti - apoptosis protein bcl - xl was increased in neutrophils by hmgb1 but not by lps . Furthermore, whilst the cytokine expression profile induced by hmgb1 versus lps was similar, a slower induction of tnf mrna occurred upon lps stimulation compared to hmgb1 [20, 104, 105]. Hsp60 and lps, in addition to synergistically enhancing il-12p40 and ifn production in murine macrophages and in mhsp60-expressing cos1 cells, were shown to differentially activate apc function . Indeed, only hsp60 was able to stimulate the production of ifn in peritoneal macrophages and bone marrow - derived dcs and ifn release was not further increased by hsp60/lps complexes . A microarray analysis performed on the mouse alveolar macrophage cell line (mh - s) generated a list of genes that respond differently to hyaluronan and lps . For instance, mmp13, tgf-2, socs3, and other genes were induced exclusively by hyaluronan . There were also major differences in the cytokine profile induced . While some cytokines including tnf, mcp-1, and rantes were equally induced by both ligands, others, such as granulocyte macrophage - colony stimulating factor (gm - csf), granulocyte colony - stimulating factor (g - csf), and il-1, were significantly different . We have shown that tenascin - c stimulated pro - inflammatory cytokine synthesis in primary human macrophages and synovial fibroblasts in a cell type specific manner, which was significantly different from lps . Tenascin - c dose dependently induced tnf, il-6, and il-8 production in human macrophages . However, it only induced il-6 synthesis in synovial fibroblasts, whereas lps induced both il-6 and il-8 . Further investigation is required to fully define the differences in signalling pathways and gene expression induced by endogenous versus exogenous tlr activators . Damps are key danger signals that alert the organism to tissue damage and initiate the process of tissue repair . However, in addition to this physiological role in the response to tissue injury, there is evidence which indicates that endogenous tlr activators also contribute to the pathogenesis of many inflammatory and autoimmune diseases that are characterized by aberrant tlr activation . The etiology of many inflammatory and autoimmune diseases is unclear; the initiating stimuli are often not well defined and the reasons why the mechanisms that ordinarily control the immune response fail are not known . However, it is clear that these diseases are characterized by an extremely destructive tissue environment . Accordingly, high levels of damps occur locally and/or systemically in many of these conditions . For example, a wide range of endogenous tlr activators, including heat shock proteins, hmgb1, host dna, fibrinogen, fneda, and tenascin - c, are observed in synovia of ra patients but not in synovia from normal joints or non - inflamed synovia from osteoarthritis (oa) patients [106112]. High levels of hmgb1 and tenascin - c circulate in the serum of septic patients [113, 114], and high serum concentrations of dna - containing immune complexes are associated with sle, including nucleosome - hmgb1 complexes [90, 115]. In addition, elevated levels of low mw ha fragments are reported in the bronchial alveolar lavage fluid and serum of patients with inflammatory lung diseases [116118]. In many cases levels of endogenous tlr activators are indicative of disease activity; elevated levels of extracellular hmgb1 localize specifically to active lesions of multiple sclerosis (ms) patients and correlate with active inflammation . Furthermore, the s100 family of calcium binding proteins have long been reliable biomarkers of inflammation in a wide variety of diseases; for example, both mrp8 and mrp14 levels in the ra synovium and synovial fluid correlate with disease activity to a degree greater than levels of c - reactive protein (reviewed in). Figure 3 summarises some of the diseases with which endogenous tlr activators are associated . Further support of a role for endogenous tlr activators in driving disease derives from in vivo studies using experimental models of inflammatory disease . Levels of many damps are elevated during the pathogenesis of numerous diseases in rodent models . In addition, delivery of exogenous damps promotes inflammation in vivo via activation of tlrs . Intra - articular injection of the tlr4 activators fneda or tenascin - c induces joint inflammation in wild type but not in tlr4 null mice [24, 86]. Systemic injection of hs causes lethal sepsis, similar to that induced by lps or zymosan, in wild type but not in tlr4 null mice . Furthermore, dna released from necrotic hepatocytes stimulates cytokine synthesis via activation of tlr9 during murine acetaminophen - induced liver injury . These and other studies are summarized in table 1 . In addition, many damps can act as adjuvants; this has recently been comprehensively reviewed by kono and rock . For example, purified genomic dsdna boosted both antibody and cd8 + t cell responses in mice when injected with antigen . Likewise lactoferrin, defensins, low mw ha, and hmgb1 all exhibit adjuvant properties in vivo [124127]. Together these data show that many endogenous tlr activators exhibit pro - inflammatory properties in vivo . Whilst many damps can induce tlr dependent inflammation in vivo, this does not necessarily demonstrate that these molecules are important in the progression of disease . This evidence has come from mice that do not express specific endogenous tlr activators (table 2) and studies showing that inhibition of damp function can ameliorate disease in vivo (table 3) and we review these data below . Biglycan null mice have a considerable survival benefit in lps - induced sepsis due to reduced tlr2 and 4 dependent cytokine synthesis, cellular infiltration into tissues, and lower levels of active caspase-1 and mature il-1 in the kidney, lung, and circulation . We have shown that tenascin - c null mice are protected from persistent joint inflammation and tissue destruction during antigen - induced arthritis . In addition, mice lacking mrp8/mrp14 complexes are protected from endotoxin - induced lethal shock and e. coli - induced abdominal sepsis [140, 143] and exhibit reduced lesion volume, brain swelling, and inflammatory cell infiltration during cerebral ischemia . Furthermore, consistent with their enhanced expression during myocardial infarction, mice that lack mrp-8/14 complexes exhibited reduced inflammatory cell infiltration upon experimental arterial injury and attenuated atherosclerotic lesions and macrophage accumulation in plaques compared with mice deficient in apolipoprotein e alone . The fact that blockade of damp function ameliorates disease in vivo further supports a role for endogenous tlr activators in inflammatory disease . The best example of how this can be achieved is with hmgb1 (reviewed in [170174]), although manipulation of other damps including ha, neutrophil elastase (ne), and versican can all protect against disease (table 3). Damps comprise an enormously diverse subset of molecules . As such there exists a number of different mechanisms to prevent their inflammatory action, (i) blockade of tlr activationone strategy that has proved effective is to manipulate the function of individual damps by preventing tlr activation at the cell surface . Administration of polyclonal anti - hmgb1 antibodies or the dna - binding a box of hmgb1, a competitive inhibitor of the pro - inflammatory b box, can reverse the lethality of established sepsis [114, 153, 154] and ameliorate collagen - induced arthritis in rodents (reviewed in). However, whilst some reports demonstrate that monoclonal anti - hmgb1 antibodies are efficacious preventing organ damage in experimental models of sepsis, others suggest that monoclonal antibodies are not effective in suppressing arthritic disease in vivo . This may be due to the multivalent nature of the mode of action of hmgb1 . One alternative approach may be to use synthetic, bent oligonucleotides that have a high affinity for hmgb1, and suppress hmgb1-induced proliferation and migration of smooth muscle cells in vitro . Another approach may be the use of an engineered mutant fragment, hmgb1 mut (102105) carrying two glycine substitutions, that decreased tnf release induced by the full - length hmgb1 protein in human monocyte cultures . In addition, the n - terminal domain of thrombomodulin, an endothelial anticoagulant cofactor, exerts anti - inflammatory effects in a model of lethal endotoxemia partly by binding to and sequestering hmgb1 . One strategy that has proved effective is to manipulate the function of individual damps by preventing tlr activation at the cell surface . Administration of polyclonal anti - hmgb1 antibodies or the dna - binding a box of hmgb1, a competitive inhibitor of the pro - inflammatory b box, can reverse the lethality of established sepsis [114, 153, 154] and ameliorate collagen - induced arthritis in rodents (reviewed in). However, whilst some reports demonstrate that monoclonal anti - hmgb1 antibodies are efficacious preventing organ damage in experimental models of sepsis, others suggest that monoclonal antibodies are not effective in suppressing arthritic disease in vivo . This may be due to the multivalent nature of the mode of action of hmgb1 . One alternative approach may be to use synthetic, bent oligonucleotides that have a high affinity for hmgb1, and suppress hmgb1-induced proliferation and migration of smooth muscle cells in vitro . Another approach may be the use of an engineered mutant fragment, hmgb1 mut (102105) carrying two glycine substitutions, that decreased tnf release induced by the full - length hmgb1 protein in human monocyte cultures . In addition, the n - terminal domain of thrombomodulin, an endothelial anticoagulant cofactor, exerts anti - inflammatory effects in a model of lethal endotoxemia partly by binding to and sequestering hmgb1 . (ii) prevention of damp accumulationdamps can be generated by release from necrotic cells, secretion from activated cells, cleavage of larger molecules, or specific upregulation upon tissue injury . Indeed, ethyl pyruvate, stearoyl lysophosphatidylcholine, and nicotine have been shown to be efficacious in ameliorating experimental sepsis by preventing hmgb1 release during experimental sepsis [156158]. However, the mechanism by which they do so is unclear and these compounds are likely also to affect numerous other cell processes . Hmgb1 is released from cells by two distinct mechanisms: it is liberated from cells undergoing necrosis, or it is hyperacetylated and then actively secreted from stimulated cells . This non - classical secretion pathway is distinct from the passage through the er and golgi taken by signal tagged proteins, instead requiring the microtubule cytoskeleton . Other damps including the s100 proteins are also secreted in the same way and targeting this pathway therefore may potentially offer a means to modulate the release of intracellular damps.one class of damps comprises ecm fragments generated by release from intact matrices . Inhibition of this process has been demonstrated; for example, release of immune - stimulatory hs fragments from the ecm in vivo can be mediated by the proteolytic action of elastase . Injection of elastase into the peritoneal cavity of mice caused the release of hs and induced sepsis, nearly as effectively as direct injection of hs or lps . Thus therapeutic measures aimed at blocking elastase could reduce the production of endogenous tlr4 activators . Indeed, pre - treatment with ne inhibitor before induction of hepatic ischemia - reperfusion injury ameliorated liver damage . Hs fragments are also generated upon ecm oxidation by reactive oxygen species (ros). Extracellular superoxide dismutase (ec - sod) is an antioxidant enzyme that protects the lung from oxidant - mediated inflammation . One way in which it does this is to protect hs from oxidative fragmentation; bronchoalveolar lavage fluid from ec - sod knockout mice after asbestos exposure showed increased hs shedding from the lung parenchyma . An alternative strategy may be to alter the balance of immune - silent intact ecm molecules versus immune - stimulatory fragments either directly or indirectly . Specific over expression of high mw ha in the lung has been achieved using transgenic mice that constitutively express ha synthase . These mice showed that improved survival and decreased apoptosis during bleomycin induce lung inflammation .finally, for damps whose expression is specifically upregulated during inflammation it may be possible to manipulate this induction of expression . Indeed, knockdown of versican expression in lewis lung carcinoma cell lines (llc) ablated their tumorigenic capability, promoting mouse survival and reduced metastasis, whilst overexpression of versican in llc lines with low innate metastatic potential increased lung metastasis .together these data indicate that endogenous tlr activators significantly contribute to driving inflammatory disease in vivo and suggest that targeting this method of tlr activation may potentially be of therapeutic value in combating disease . Damps can be generated by release from necrotic cells, secretion from activated cells, cleavage of larger molecules, or specific upregulation upon tissue injury . Indeed, ethyl pyruvate, stearoyl lysophosphatidylcholine, and nicotine have been shown to be efficacious in ameliorating experimental sepsis by preventing hmgb1 release during experimental sepsis [156158]. However, the mechanism by which they do so is unclear and these compounds are likely also to affect numerous other cell processes . Hmgb1 is released from cells by two distinct mechanisms: it is liberated from cells undergoing necrosis, or it is hyperacetylated and then actively secreted from stimulated cells . This non - classical secretion pathway is distinct from the passage through the er and golgi taken by signal tagged proteins, instead requiring the microtubule cytoskeleton . Other damps including the s100 proteins are also secreted in the same way and targeting this pathway therefore may potentially offer a means to modulate the release of intracellular damps . Inhibition of this process has been demonstrated; for example, release of immune - stimulatory hs fragments from the ecm in vivo can be mediated by the proteolytic action of elastase . Injection of elastase into the peritoneal cavity of mice caused the release of hs and induced sepsis, nearly as effectively as direct injection of hs or lps . Thus therapeutic measures aimed at blocking elastase could reduce the production of endogenous tlr4 activators . Indeed, pre - treatment with ne inhibitor before induction of hepatic ischemia - reperfusion injury ameliorated liver damage . Hs fragments are also generated upon ecm oxidation by reactive oxygen species (ros). Extracellular superoxide dismutase (ec - sod) is an antioxidant enzyme that protects the lung from oxidant - mediated inflammation . One way in which it does this is to protect hs from oxidative fragmentation; bronchoalveolar lavage fluid from ec - sod knockout mice after asbestos exposure showed increased hs shedding from the lung parenchyma . An alternative strategy may be to alter the balance of immune - silent intact ecm molecules versus immune - stimulatory fragments either directly or indirectly . Specific over expression of high mw ha in the lung has been achieved using transgenic mice that constitutively express ha synthase . These mice showed that improved survival and decreased apoptosis during bleomycin induce lung inflammation . Finally, for damps whose expression is specifically upregulated during inflammation it may be possible to manipulate this induction of expression . Indeed, knockdown of versican expression in lewis lung carcinoma cell lines (llc) ablated their tumorigenic capability, promoting mouse survival and reduced metastasis, whilst overexpression of versican in llc lines with low innate metastatic potential increased lung metastasis . Together these data indicate that endogenous tlr activators significantly contribute to driving inflammatory disease in vivo and suggest that targeting this method of tlr activation may potentially be of therapeutic value in combating disease . Current strategies in clinical development for tlr blockade include (1) global blockade of individual tlr function using neutralizing antibodies, soluble tlr extracellular domains (ecds), natural antagonists, and small molecule inhibitors, (2) inhibition of signalling pathways - activated downstream of tlr stimulation using small molecules to target myd88/traf / irak complex formation, mapk, or ikk activity, or (3) using pamp antagonists such as lps inhibitors . Some of these compounds have reached phase ii clinical trials and the results are currently awaited, whilst others, particularly those targeting common signalling pathways such as mapk, have proved to be of limited efficacy (reviewed in). Suppressing damp activation of tlrs offers a host of new potential targets for treating inflammatory diseases that may be viable alternatives to current approaches . Evidence that blockade of these mediators can ameliorate disease in human studies is beginning to emerge . Hyaluronate improves pain and prostaglandin e (pge) levels in patients with ra, transfer of hsp - specific regulatory t cells inhibits inflammation in animal models of arthritis and exhibited promising results in preliminary clinical trials, hmgb1 antibodies prevent the activation of cells by serum from sle patients, and the neutrophil elastase inhibitor sivelestat improves the mortality rate of patients with sepsis [186, 187]. By carefully choosing a target unique to the response to tissue damage, and not to pathogen mediated activation of the immune response, this strategy may have the additional advantage of leaving the host response to infection intact . Given the evidence that supports the idea that distinct molecular machinery is required for damp activation of tlrs, another strategy would be to block co - receptors or accessory molecules essential for damp activation . In addition a comparative analysis of adaptors, kinases, and transcription factors involved in signalling activated by damps versus pamps may highlight key differences that, if selectively targeted, could lead to specific therapies engineered to silence danger signals without compromising the host immune defence . We have highlighted here the possible levels of intervention in damp activation of tlr - mediated inflammation, namely, manipulating damp activation of tlrs or controlling tissue level of damps . Whilst these strategies are efficacious in preventing experimental disease, there is also evidence that preconditioning with damps can have the same effect . Administration of small doses of hmgb1 one hour prior to induction of hepatic reperfusion injury protected from liver damage and reduced serum tnf and il-6 levels via inhibition of tlr4 signalling [188, 189] and lactoferrin can protect from lethal e.coli injection . It is apparent that low tissue levels of damps are beneficial during tissue repair to induce a resolvable, physiological immune response . We propose a situation where a damage chain reaction occurs: increasing levels of pro - inflammatory damps create more tissue damage which significantly amplifies the tissue levels of damps which go on to create yet more tissue damage ad infinitum . These tissue levels of damps become harmful and mediate a non - resolving perpetual inflammatory state (figure 4). Thus targeting damp - mediated activation of tlrs may block this chronic inflammatory loop, although it will be important to assess whether total blockade of damp function will compromise tissue repair to any deleterious extent . In addition, in the destructive milieu that occurs during inflammatory disease there are likely to be high levels of many damps . Working out which are keys to disease pathogenesis may not be a trivial matter, and combinations of inhibitors may be needed to successfully dampen down endogenously driven inflammation . Alternatively, hierarchies may exist amongst damps such as those that exist for inflammatory cytokines, for example, where tnf induces a cascade of cytokine synthesis . Indeed, low mw ha induces -defensin2 via tlr2 and 4 activation in murine keratinocytes ex vivo and in vivo . These damps may be key targets to prevent the induction of an autocrine loop of inflammation . These may be aided by approaches such as microarray and deep sequencing technologies, as well as proteomewide screening, to enable the comparison of the global effects of different damps on inflammatory gene expression . Likewise, examining the stimuli that induce damp expression or release upon tissue injury will be important in establishing a chain of command of damp action . In parallel, the development of validated reagents and tools which serve to ablate the expression or function of individual damps will yield key information about redundancy and co - dependency . The threshold of damp(s) required to induce disease may vary upon the duration and degree of host tissue damage . However, current knowledge about the kinetics of expression or release of damps and their turnover during disease progression is limited . Indeed, on one hand, validated commercial assays for measuring various endogenous danger signals are often unavailable or prohibitively expensive . On the other hand, access to patient specimens and thus, the correlation between degree of tissue damage and levels of damp(s) is either unknown or limited to small sample size, often representative of end stage of disease . The threshold of damps required to trigger chronic inflammation may also depend on a variety of host genetic factors, including single - nucleotide polymorphisms (snps), which can affect how humans respond to injury and develop disease . Examining the role of damps within the context of different genetic backgrounds will also be key to dissecting out their role in inflammatory disease . The use of larger patient sample sizes including diverse genetic populations and a befitting proportion of male and females will be vital . In addition, the development of mouse strains with much greater dna diversity than strains traditionally employed may provide mice with combinations of different traits that more closely reflect the genomic variations of humans in preclinical studies . We expect that the next few years will provide a much more concrete picture of how damps link tissue damage to chronic inflammation as an increasing number of tools become available . Finally, a normal wound healing response does not typically lead to chronic inflammation . This is, in part, because a number of mechanisms exist to negatively regulate tlr activation . These include the release of soluble decoy tlr receptors, intracellular inhibitory molecules such as irak - m, socs1, tam family kinases, and transmembrane regulators such as sigirr (reviewed in [8, 193]). Viruses have also evolved mechanisms to target adapters in tlr signalling: a46r from vaccinia virus, which sequesters myd88, mal, trif, and tram, and ns3/4a from hepatitis c virus, which degrades trif . In addition, recently, microrna, mir-147, whose expression is induced upon stimulation of multiple tlrs, was shown to attenuate tlr stimulation - induced - inflammatory response in macrophages . However, these pathways do not appear to discriminate between distinct methods of tlr stimulation and act on damp- and pamp - mediated activation alike . Chen et al . Recently identified one way in which specific activation of tlrs by damps, but not pamps, may be inhibited (reviewed in). Cd24, or heat stable antigen, is a gpi anchored protein that binds to damps such as hmgb1, hsp70, and hsp90 in order to suppress their activation of inflammatory signalling pathways . Cd24 null mice exhibit increased susceptibility to damp-, but not pamp, induced inflammation . This is mediated at least in part through cd24 association with siglec-10/g causing activation of associated phosphatases which are proposed to repress damp - initiated signalling . Dysfunction of this pathway might contribute to the etiology of autoimmune diseases and likewise may offer a means to selectively inhibit damp activity . In addition, stlr2 can blunt immune responses without preventing microbial recognition: mice injected with gram positive bacteria together with stlr2 exhibited reduced inflammatory cytokine levels and cell migration but this did not compromise their ability to clear live gram - positive bacteria - induced infection . As such enhancing naturally suppressive mechanisms may also be a viable strategy for reducing inflammation . Thus damps appear to be a double - edged sword . While being vital for tissue repair, they also play a role in the pathogenesis of many inflammatory and autoimmune diseases that feature aberrant tlr activation . In these diseases harmful stimuli cause tissue damage; in an attempt of tissue healing, inflammatory responses are initiated and generate damps that induce an autocrine loop of inflammation . Understanding why the natural mechanisms that keep damp - mediated inflammation in check fail in disease, as well as dissecting out which mechanisms of tlr activation and signalling are unique to damps, may enlighten our approach to engineering targeted and efficacious therapies designed to dampen inflammation.
|
This study was conducted at a tertiary eye care center, catering to a population of approximately a million . All patients on the diabetes mellitus register held at general practices in the catchment population were screened by a national diabetic eye screening program, and all patients with referable diabetic retinopathy (dr) were seen in dedicated dr clinics . In these clinics, all patients underwent a comprehensive ophthalmic examination, including visual acuity evaluation, slit - lamp examination, and dilated fundus examination, along with sdoct imaging and infrared fundus photography, and those patients who met the nice guidelines for intravitreal treatment with ranibizumab were referred to a dedicated dmo clinic . We retrospectively reviewed sdoct images of all eyes that were initiated on intravitreal ranibizumab treatment for dmo with central subfield thickness (cst) more than 400, as per nice guidelines, between april 2013 and march 2015 . Each oct was carefully observed for the presence of hyperreflective dots in a contiguous ring around the inner wall of cystoid spaces (pearl necklace images of patients displaying this sign were singled out and these were sequentially followed up for a minimum of 10 months to track the course of this sign . Sdoct images were acquired at every clinic visit as part of the established standard of care using the macula protocol for heidelberg sdoct (spectralis hra + oct; heidelberg engineering, heidelberg, germany). Octs were performed with volume scans with at least 19 single sections . On each follow - up the oct images of patients included for the study were matched with the infrared fundus photograph of the corresponding location . Clinical charts were retrospectively reviewed and patient characteristics of age, gender, electronic early treatment for diabetic retinopathy study visual acuity and response to treatment, were recorded and correlated with sdoct imaging findings . Totally, 267 patients (age 2491 years, 64 14.8 years) were seen and initiated on intravitreal ranibizumab therapy in the dmo clinic between april 2013 and march 2015 . 35 eyes of 35 patients (23 males, 12 females) were found to display the pearl necklace sign, giving a prevalence of 13.1% in our cohort of patients [table 1]. This sign was seen in cystoid spaces located in the outer nuclear / outer plexiform layer of the retina in 30 eyes [fig . 1] and lining the inner wall of a neurosensory detachment in 5 eyes [fig . 2]. The follow - up period ranged between 10 and 24 months (16 4 months). Details of patients displaying pearl necklace sign pearl necklace sign in outer plexiform layer the sign in subretinal space in the 35 eyes showing the pearl necklace sign, the mean best - corrected visual acuity (bcva) letter score at the start of treatment was 46.7 12.9 letters; at the final follow - up, the mean bcva was 53.5 14.1 letters . Of the 35 eyes, 15 (42.8%) improved by 10 letters or more; 3 eyes lost 10 or more letters over the follow - up period . The mean cst was 524 82 at baseline and 365 62.3 at final follow - up . Qualitative assessment of the pearl necklace sign over the follow - up period showed that of the 35 eyes, 28 showed a significant reduction in macular edema, and in 21 eyes the hyperreflective dots forming the pearl necklace coalesced to form a clump . This appeared as a visible clump of hard exudates in infrared fundus photographs [fig . The location of these hard exudate clumps was closely associated with the location of the intraretinal / subretinal cysts seen on oct [fig . As the edema resolved, the pearl necklace sign disappeared completely, without leaving visible hard exudates . (a) optical coherence tomography of the eye in fig . 1 at month 3; fluid resolved and hard exudate clump at exactly the same spot . (b) color fundus photograph of the eye in fig . 3a; clinically visible hard exudate in the area of pearl necklace (a) intraretinal pearl necklace extrafoveally . (b) four injections later showing partial resolution of edema and he in the same location as a pearl necklace . (c) 12 months and 10 injections later; he++ (a) pearl necklace sign before treatment . 5b showing new clump of he in the location of pearl necklace in three eyes, the pearl necklace sign was seen in cystoid spaces located subfoveally [fig . With intravitreal therapy, although there was resolution of macular edema, large clumps of hard exudates appeared subfoveally [fig . This was associated with a drop in the vision of 20 letters or more in these three eyes . Multiple studies published previously have described hyperreflective foci (hf), detectable by sdoct techniques, in various retinal pathologies, including exudative age - related macular degeneration and retinal vein occlusion . In age - related macular degeneration, it has been reported that after a loading dose of three intravitreal ranibizumab injections, the number of hfs reduced; the number of such hf at baseline was suggested as a predictive factor for the outcome of treatment . The presence of similar hf on sdoct, across all retinal layers, has also been reported in dmo . Gelman et al . Described a novel pearl necklace sign of the contiguous ring of hyperreflective dots along the inner wall of cystoid spaces in the retina in 21 eyes with exudative macular diseases . We found that this sign is not uncommon in dmo and was seen in 13.1% eyes in our series of patients . 75% of eyes where the dmo resolved with treatment developed clinically visible hard exudates in exactly the same location as the pearl necklace sign . The characteristic arrangement along the wall of the cystoid spaces may indicate a relatively large amount of lipoproteins / lipid - laden macrophages that tend to precipitate and leave behind clinically observable hard exudates once the edema resolves following intravitreal therapy . We did not find that the presence of this either predicts or adversely affects the outcome of treatment . Our results of a mean letter gain of 6.8 letters with 42.8% eyes improving by 10 letters or more and mean reduction in cst of 159 are comparable to those achieved in restore and drcrnet studies . However, of note is the fact that three eyes that had a dramatic loss of vision (20 letters or more) had subfoveal pearl necklace sign and a large clump of hard exudates appeared subfoveally as the edema resolved in these three eyes . We infer that the presence of this sign in a subfoveal location may result in accumulation of this particulate entity subfoveally (clinically visible hard exudates), causing irreversible damage to photoreceptors in that area, thereby limiting the long - term visual outcome . Hyperreflective dots arranged as a contiguous ring along the inner wall of cystoid spaces on the macular oct scan, termed as the pearl necklace sign, are commonly seen in dmo patients who require intravitreal treatment . With a resolution of edema, hard exudates frequently appear in the same location on the retina, implying that the pearl necklace sign is a precursor to hard exudates, in the majority of cases . The presence of this sign does not affect visual prognosis or the response to intravitreal treatment, except where this sign is located subfoveally.
|
Moyamoya disease (mmd) is an infrequent disease that is characterized by progressive occlusive or stenotic lesions at the distal portions of internal carotid arteries and an aberrant vascular network at the base of the brain that resembles puffs of smoke on angiography . Mmd has captured increasing and intensive attention from neurosurgeons because it has been deemed to be a major cause of stroke in adults and particularly in children despite its relative low incidence . Although a large number of studies have been conducted, the actual etiology and pathogenesis remain extremely unclear . However, in recent years, ring finger protein 213 (rnf213) was identified as a susceptibility gene among east asian populations, which resulted in a shift of people's attention to the relevant genetic factors . Rnf213 encodes a 596,000 protein that includes an alpha-2-macroglobulin, an aaa - type atpase and ring finger domains from its amino to carboxyl termini . Stated that the rnf213 c.14576g> a variant is detected in 95% of familial mmd cases and 79% of sporadic patients . Nevertheless, a portion of mmd patients do not carry the c.14576g> a variant and this portion is higher in western countries . It is disappointing that we have been unable to determine whether mmd is caused by a synergy of genetic and environmental factors or some other unknown causes . Further research should be directed toward illuminating the cause of mmd and identifying a more effective therapeutic strategy . The aim of this literature review is to help people comprehensively understand the research advances related to rnf213 in mmd patients . Because the rnf213 c.14576g> a variant is detected in 95% of familial mmd cases and 79% of sporadic patients, an increasing number of researchers have focused on mimicking mmd in mice via knock - in and knock - out technologies . However, sonobe et al . Did not discover any modification of angiogenesis after they generated mice lacking rnf213 . Soon after, this same team generated mice with the r4859k mutation of rnf213 and obtained results similar to those of the earlier study . To determine whether ischemia can result in cerebrovascular abnormalities in knockout mice, consequently, numerous researchers have insisted that mmd is primarily triggered by both genetic and environmental factors despite the ambiguous causes . Previous studies of environmental factors and the development of the mmd have emphasized the latent role of varicella zoster virus infection . A study of mmd and inflammatory signals suggested that rnf213 is associated with the immune response . In addition, two groups have recently demonstrated that interferon, which is invariably induced by inflammatory and immune responses, can stimulate the expression of rnf213 . Based on the two studies mentioned above, we have adequate reason to believe that the mmd is not triggered by a single genetic factor but rather is triggered by both environmental and genetic factors . Another examination conducted by sato - maeda et al . Indicated that the rnf213 gene is also expressed during transient middle cerebral artery occlusion, particularly in neurons, and this result provided new insight into the role of rnf213 in neuroprotection . Several studies have reported that rnf213 c.14576g> a variant carriers have reduced angiogenesis abilities, which contrast sharply with the pathologic characteristics of mmd . However, one study suggested that transient middle cerebral artery occlusion can activate the expression of rnf213 . These findings indicate the possible occurrence of a vicious cycle in which the expression of rnf213 aggravates ischemia, and ischemia induces the expression of rnf213 . Further research is certainly indispensable to confirming this hypothesis . Induced pluripotent stem cells (ipscs) using the fibroblasts of mmd patients and healthy controls in an effort to detect the associated angiogenic activities and discovered that the proliferation abilities of the cells from the patients and carriers were reduced compared with those of the cells from the controls . Therefore, how the rnf213 c.14576g> a variant gives rise to reduced angiogenesis has become an important question . From our perspective, this reduced angiogenesis ability might be caused by a mitotic abnormality, the pattern described by hitomi et al . Or through the regulation of the expression of matrix metalloproteinase 1 . Although we know of the critical connection between rnf213 and angiogenesis abnormalities, we do not possess sufficient evidence to interpret how reduced angiogenesis results in an aberrant vascular network at the base of the brain . Miyawaki et al . Studied patients with non - mmd intracranial major artery stenosis / occlusion (icaso) and found that 9 of 41 patients (21.9%) carried the c.14576g> a variant . To confirm their previous research, the following year consistent with the results of the previous study, the c.14576g> a variant was found to be present in 20/84 patients in a non - mmd icaso group, which indicated that the c.14576g> a variant is significantly associated with non - mmd icaso . Analyzed 352 consecutive patients with relevant intracranial arterial stenosis and discovered that 176 of the 352 patients with intracranial arterial stenosis carried the c.14429g> a variant, which is also termed c.14576g> a . In addition, the mutation genotypes of the rnf213 gene in an mmd population from taiwan (china) revealed that half of the carriers of the c.14576g> a variant had intracranial arterial stenosis . Liu et al . Generated rnf213-knockdown zebrafish and discovered irregular wall formations in major arteries and abnormally sprouting vessels . Interestingly, some other vascular diseases, such as premature coronary artery disease and stroke, aortic coarctation, thoracic aortic aneurysm, and stenosis of other arteries, have also been reported to be associated with rnf213 variants . In addition, two patients with co - occurring pulmonary hypertension and mmd were reported to have homozygous p.r4810k mutations in rnf213 . Interestingly, diabetes and blood pressure have also been found to be associated with rnf213; the ablation of rnf213 blocks the development of diabetes in mice, and the rnf213 c.14576g> a variant increases the risk of hypertension . Although the specific mechanisms remain unknown, we predict that rnf213 variants are indeed correlated with angiocardiopathy and cerebrovascular diseases . Based on the above research, we draw the following conclusions: (1) rnf213 is associated with non - mmd icaso and other cerebrovascular diseases, and (2) rnf213 is not associated with non - mmd icaso; however, mmd has been misclassified as icaso due to the late onset and the absence of one or two of the diagnostic criteria . These conclusions suggest that rnf213 genotype should be included in the diagnostic criteria for mmd because the treatment strategies for mmd and icaso are completely different . If mmd is treated with strategies designed for icaso, the actual result may be the opposite of the intended result . There is no doubt that rnf213 is a strong susceptibility gene for mmd among east asian people . Liu et al . Reported that the minor allele frequencies of p.r4810k are 1.4%, 1.3%, and 1.0% among the general populations of japan, korea, and china, respectively, but this does not explain the relatively lower frequency of mmd among the chinese . However, a subsequent large - scale screening for p.r4810k among east and southeast asians demonstrated that this contradiction was attributable to selection bias and suggested that carriers of the c.14576g> a (p.r4810k) variant are indeed less frequent among the chinese than the japanese and korean populations . Moreover, the c.14576g> a variant was detected in only 4 of 11 locations in china and was not detected in southeast asia, which indicates that environment factors might play a role in mmd . An investigation of the frequency of the rnf213 c.14576g> a variant in two korean populations revealed that the estimated frequencies of the variant allele were 1.13% and 1.32% in cord blood samples and adult samples, respectively, which again confirms that the frequencies of the variant allele in japan and korea are higher than the frequency in china and that rnf213 variants exhibit ethnic diversity . Given that there is no large - scale research on the association between rnf213 and mmd in the chinese han population, wu et al . Analyzed 170 mmd cases and 507 controls and discovered that the c.14576g> a variant is related to mmd and that the frequencies of this variant allele are much lower among the chinese han population than the populations of japan and korea . Intriguingly, this group stated that male chinese patients are more likely to be adversely affected than females (1.3:1), which contrasts with the opposite pattern in japan (1:18). In addition, the incidence of mmd in east asian is much higher than that in european countries, which could be partly be due to the ethnic diversity of rnf213 mutations . One study reported that no p.r4859k carriers were detected among 400 caucasian controls and five caucasian mmd patients . Moreover, cecchi et al . Also reported that the c.14576g> a variant was identified in 9/16 mmd patients of asian descent and in 0 of 94 patients of non - asian descent . In conclusion, the c.14576g> a variant is mainly detected in japanese, korean, and chinese populations . However, the frequency in the latter population is much lower than those of the former two populations . In addition, the rare rnf213 variants mainly exist in china and other non - asian countries; however, a recent study argued that the japanese also carry some rare variants . There are numerous differences in the clinical manifestations of mmd between young children and adults . In addition, a portion of patients with mmd have severe symptoms and early - onset whereas some patients present with slight headache or are asymptomatic . Although a clear understanding of the pathogenesis of mmd has not yet been achieved, the heterogeneity of rnf213, which has significant associations with mmd, provides a clue that indicates that the clinical manifestations of mmd may be associated with genetic background . Although two turkish siblings who were homozygous for the c.14576g> a rnf213 variant exhibited distinct clinical features and inoue et al . Also reported a family case of mmd that involved different phenotypes among family members with the heterozygous c.14576g> a variant, these authors have been unable to demonstrate that there is no relation between the rnf213 genotypes and phenotypes . A study conducted by miyatake et al . Discovered that patients who were homozygous for the c.14576g> a variant of rnf213 presented with earlier onsets and more serious symptoms than mmd patients who carried were heterozygous for the c.14576g> a variant . In addition, miyatake et al . Reported sibling cases of mmd in which the homozygous c.14576g> a variant manifested with an early - onset and severe clinical manifestation whereas the heterozygous c.14576g> a variant manifested with a relatively late onset and mild symptoms . In accordance with the above results, a recent study also confirmed that the homozygous c.14576g> a variant is associated with early - onset, severe symptoms, and an unfavorable prognosis . In addition, according to this report, the rnf213 c.14576g> a variant mainly causes mmd that presents with ischemia whereas the p.a4399 t variant is primarily associated with hemorrhaging in mmd . Importantly, kobayashi et al . Reported that rnf213 r4810k carriers have lower angiogenic capacities and are prone to cerebral hypoxia insults . It has been reported that chinese heterozygous carriers of the p. r4810k variant are younger at diagnosis, have more familial cases, more ischemic cases, and more frequently exhibit involvement of the posterior cerebral artery . Further research with large - scale populations should be performed to prove the conclusions of these authors . Overall, strong evidence demonstrates that various genotypes can lead to distinct phenotypes of mmd . This finding motivates us to reacquaint ourselves with the roles played by genetics in the mechanism of mmd and to routinely detect the genotypes of mmd patients to identify those who likely to experience early - onsets, severe symptoms, and bad prognoses because early diagnoses and interventions could prevent malignant outcomes of mmd . The guidelines for the diagnosis of mmd created in 1997 clarify the diagnostic criteria for mmd as follows: (1) stenosis or occlusion of the distal internal carotid artery, (2) an aberrant vascular network, and (3) bilateral lesions . The absence of any of these criteria excluded a patient from the spectrum of mmd . For example, unilateral lesions can only be called unilateral moyamoya phenomena and not mmd . Furthermore, if a patient meets all three of the above criteria and has other relevant basic diseases, such as hyperthyroidism, turner syndrome, meningitis, behcet disease, idiopathic pachymeningitis, and neurofibromatosis type 1, the patient should be given a diagnosis of moyamoya syndrome or quasi - mmd but not mmd . Given that the srnf213 c.14576g> a variant has been identified as a susceptibility gene for mmd, miyawaki et al . Analyzed the genotypes of nine patients with quasi - mmd to clarify whether moyamoya syndrome, which characteristics similar to those of mmd, exhibits an identical etiology or genetic background . These authors discovered that none of the patients with quasi - mmd had the rnf213 c.14576g> a variant whereas 66 of 78 patients with definite mmd had the variant . These findings indicate that mmd and quasi - mmd may be two completely separate diseases . Although these conditions have similar imaging manifestation, their pathogeneses might be totally different because the latter is more similar to the complications of other associated basic diseases, whereas the former is mainly associated with the genetic background . In addition, some individuals argue that the unilateral moyamoya phenomenon, especially combined with the rnf213 c.14576g> a variant, should be classified as mmd . Mineharu et al . Also reported on a patient with the c.14576g> a variant who exhibited rapidly progressing unilateral mmd . All of the above findings hint that the rnf213 c.14576g> a variant should be considered in the diagnosis of mmd . The growing literature demonstrates that the mmd is mainly caused by the synergy of genetic and environmental factors . We believe that an unknown genetic modifier might play a role in the etiology of mmd . In addition, from our perspective, genotype should be considered in the diagnosis of mmd to enable the application of therapy through the relevant effective surgery as soon as possible and to prevent misdiagnoses . Certainly, we all anticipate an easier but effective therapeutic strategy to cure this disease as predicted by some authors . This study was supported by the grants from the national science and technology supporting plan (the 11 five - year plan) (no . This study was supported by the grants from the national science and technology supporting plan (the 11 five - year plan) (no.
|
The pharmacokinetics of levocetirizine present a linear correlation with the administered dose, are not time dependent, and exhibit little variability among different subjects . Administered orally, levocetirizine is absorbed quickly and broadly; its bonding to plasma proteins is 95% and its distribution volume is low (0.3 l / kg), which, for a h-1 receptor antagonist, represents a real advantage.17 because its metabolism is limited, its pharmacokinetics are poorly modified by concomitant intake of other drugs . It is mainly excreted through the urine by glomerular filtration and active tubular secretion; therefore, it is recommended to prolong the time between doses in patients with chronic renal failure . In regards to its safety profile, no negative effects on alertness, reaction abilities, or ability to drive vehicles have emerged from the clinical studies reported in the literature after one or more doses of levocetirizine at the recommended dosage of 5 mg / day.1822 verster and colleagues18 have evaluated the effects of treatment with various antihistamines on memory, psychomotor abilities and mood state . Two antihistamines were examined: levocetirizine (5 mg) and diphenhydramine (50 mg) vs placebo, administered at three different times once daily on four consecutive days . The study group consisting of 48 healthy volunteers (24 males and 24 females) underwent a series of laboratory tests (verbal learning test, sternberg memory test, pursuit test, divided attention test) three hours after the first dose (acute phase) and at the end of the study, ie, on the fourth day (chronic phase). The results demonstrated that a single dose or repeated doses of levocetirizine had no modification on memory, attention and motor skills, whereas diphenhydramine induced a significant reduction in attention and motor skills as early as after the first dose.18 in the same group, an assessment of the effects on driving skills showed not statistically significant changes in the group treated with levocetirizine compared with placebo, unlike the results observed with diphenhydramine.19 the absence of sedative effects has been confirmed by two other double - blind, placebo controlled clinical studies conducted to evaluate the effects on cognitive and psychomotor functions, in groups of 20 and 19 subjects respectively, of treatment with levocetirizine20,21 or first - generation antihistamines like promethazine20 and diphenhydramine21 and second - generation antihistamines (cetirizine and loratadine).20 a study by potter22 reports the absence of significant adverse reactions during a six - week treatment with levocetirizine at 5 mg / day . In both two examined groups (in treatment with levocetirizine and placebo) was reported at least one adverse reaction in similar percentages: 60.0% and 68.1%, respectively.22 the most frequent adverse reaction was headache (34.7% both for levocetirizine and for placebo), influenza - like symptoms (16.7% and 13.9%, respectively), high respiratory tract infections (6.7% and 9.0%, respectively) and drowsiness (6.0% and 2.8%, respectively).22 apart from the cases of drowsiness, no reduction of the memory and psychomotor functions has been demonstrated.20 in one subject there was an increase in alanine aminotransferase, correlated with the drug, which regressed spontaneously after nine days.22 during this study there were no cases of increased electrocardiogram (ecg) qt interval.22 the absence of cardiotoxic effects of levocetirizine has been recently confirmed by a study conducted on 52 healthy subjects treated with 5 mg and 30 mg under dynamic monitoring according to holter method in the 24 hours following the dose.23 a study conducted in germany on 17,638 subjects (24) confirmed the good tolerability of levocetirizine with a rate of 1.6% of mild or moderate adverse reactions reported during administration (fatigue, headache, gastrointestinal disorders, dizziness, dry mouth). Allergic rhinitis is a high - prevalence chronic respiratory disease with a negative impact on the subjects quality of life, work activities, productivity or school performance, as well as on healthcare costs . Because of its benign nature levocetirizine is an antihistamine molecule that has been shown by various studies to have an effective and immediate action in reducing eye and nose symptoms of seasonal as well as perennial rhinitis . Its efficacy profile in the chronic treatment of rhinitic patients has been demonstrated to be better than other second generation antihistamines, including desloratadine and fexofenadine . An initial two - week randomized double - blind placebo - controlled study on 470 patients subdivided into three groups treated with 2.5, 5, and 10 mg levocetirizine, respectively, demonstrated that levocetirizine is effective in reducing the symptoms measured using the total four - symptom score: t4ss (nasal pruritus, ocular pruritus, rhinorrhea, and sneezing) in patients with seasonal rhinitis compared with placebo, and that the effect is dose - dependent.25 based on this study, it has been concluded that the 5 mg / day dosage presented the best risk benefit ratio for the treatment of nose and eye symptoms in seasonal allergic rhinitis.25 these results have been confirmed and extended in a multicenter, randomized, double - blind placebo - controlled study on 294 patients with perennial rhinitis.26 a scale with four values of increasing severity, from 0 to 3, was used to assess the five symptoms (rhinorrhea, nasal pruritus, ocular pruritus, sneezing, nasal congestion).26 out of 294 randomized patients, 144 were treated with placebo and 150 with levocetirizine at dosages of 5 mg / day for six weeks . Improvements in t4ss vs placebo were 86% in the first week and 47% at the end of the study.26 this study has also highlighted a significant effect of levocetirizine on improvement of nasal congestion, one of the most annoying among the symptoms associated with rhinitis and generally poorly responsive to antihistamine treatment.26 the efficacy of 5 mg levocetirizine has been compared with that of 10 mg loratadine in dust mites allergic patients by performing a challenge test in the vienna challenge chamber, a special facility where patients are exposed to pre - determined amounts of allergen, allowing an accurate evaluation of drug effects on the symptoms that appear after the allergen exposure.27 in the double - blind, placebo - controlled cross - over study, 39 patients received the challenge test through a six - hour exposure to dust mite allergens on two consecutive days.27 the drugs were administered after two hours of exposure . Symptom severity was assessed using the complex symptom score (css), consisting of the sum of the individual scores for rhinorrhea, nasal pruritus and sneezing.27 the percentage of patients with a css reduction of at least 20% was 43% for the placebo group, 66.7% for loratadine, 83.8% for levocetirizine, and the clinical improvement was achieved within 60 minutes after receiving levocetirizine, vs 90 minutes for loratadine.27 a comparative study vs desloratadine (the active enantiomer of loratadine), conducted on 23 subjects, also confirmed the substantially higher rapidity of levocetirizine s pharmacological action after a single dose administration.28 in addition, levocetirizine showed a more protective effect, when compared to desloratadine, in patients with seasonal rhinitis submitted to the specific nasal challenge test.29 the effect of levocetirizine on nasal obstruction, compared to desloratadine, has also been recently confirmed by ciprandi and colleagues30 in a pilot study conducted on 30 subjects with seasonal allergic rhinitis . The enrolled patients were assigned to randomized treatment with levocetirizine, desloratadine or placebo for two weeks and then assessed using a modified tss, including nasal congestion, as well as rhinomanometry to determine the presence of inflammatory infiltrate and cytokine secretion in the nasal secrete . The results have shown that only levocetirizine, and not desloratadine, is able to improve nasal air flows and to reduce significantly the il-4 and il-8 production.30 a comparison of the beginning and duration of the pharmacological action and clinical efficacy of levocetirizine vs desloratadine had been previously conducted in another randomized, double - blind, parallel - group clinical study based on the model known as environmental exposure unit (eeu), a special chamber that allows simultaneous exposure of up to 160 people at a predetermined level of pollen granules.31 out of 373 randomized patients, 141 were assigned to the cetirizine group, 140 to the desloratadine group, and 92 to the placebo group . The patients were exposed to ambrosia pollen in the eeu for seven hours on day 1 and for six hours on day 2; the symptoms were measured every 30 minutes . Levocetirizine was found to achieve a significant symptom reduction as early as the first hour, compared with three hours required for desloratadine to act; additionally, 24 hours after the first dose and just before receiving the second dose, symptom reduction was significantly higher in the patients treated with levocetirizine compared to subjects that assumed desloratadine . Both active treatment groups showed symptom improvement compared to the placebo - group.31 in a comparative study vs fexofenadine at a dosage of 120 mg, levocetirizine at a dosage of 5 mg proved to have a more potent and long lasting action in reducing rhinitic symptoms 2228 hours after the dose . Levocetirizine s speed of action and clinical efficacy resulted in a higher degree of patient satisfaction with the treatment.32 another study compared levocetirizine s efficacy against fexofenadine in reducing nasal congestion symptoms.33 the assessment was performed using infrared facial thermography, a noninvasive technique for the measurement of temperature changes in the nasal region . Because vasodilation and allergic immunophlogosis are associated with an increase in skin temperature in the nasal region, this technique allows the objective viewing of the patient s clinical improvement in terms of reduced blood flow and nasal congestion.33 the double - blind, controlled, cross - over study assessed baseline thermography vs the value measured 20 minutes after nasal challenge with histamine in 30 healthy subjects . The thermography was repeated in all 30 volunteers two hours and 24 hours after they had received 5 mg levocetirizine, 120 mg fexofenadine or placebo.33 while the thermography confirmed the efficacy of both antihistamine drugs in reducing immunophlogosis, as demonstrated by the significant reduction in perinasal skin temperature compared with placebo two hours after administration, the measurement performed at 24 hours demonstrated that levocetirizine produces a more marked extension of the decongested nasal areas and a more prolonged nasal temperature reduction than fexofenadine.33 as suggested by the recent allergic rhinitis and its impact on asthma (aria) guidelines,34 a new classification of allergic rhinitis in intermittent or persistent form has been made according to symptom duration and severity . In persistent rhinitis the symptoms are present for more than four days a week and for more than four weeks a year.34 the results of xpert (xyzal in persistent rhinitis trial), a 6-month multicenter, double - blind, placebo controlled study conducted on 551 patients with persistent allergic rhinitis, both perennial and seasonal, treated with levocetirizine and placebo confirmed that levocetirizine improves significantly not only the clinical symptoms assessed by the tss, but also the quality of life, as measured by the rqlq (rhinoconjuntivitis quality of life questionnaire).35 after six months, levocetirizine improved the quality of life of allergic patients by more than 30% compared to placebo.35 the study also demonstrated a reduction of the overall cost of the disease as calculated throughout the study period.35 a more detailed analysis proved that levocetirizine helped achieve a 43% saving on the social cost of persistent allergic rhinitis, equal to approximately 153 per month per patient . In regards to employed patients, the saving was approximately 65 per month in terms of work days lost because of allergic rhinitis.36 lastly, thanks to the widespread implementation of the aria guidelines34 and the recent scientific evidence of the role played by the h-1 receptor in allergic immunophlogosis,16 levocetirizine might soon be added to the traditional therapies for the treatment of atopic bronchial asthma, as it has already demonstrated a protective effect against adenosine monophosphate - induced bronchospasm in 15 subjects with allergic asthma.37 acute and chronic urticaria is one of the major diagnostic and therapeutic problem in allergologic field . The etiological diagnosis of urticaria is not always possible, and in fact it is formulated in less than 50% of the cases; moreover, this condition is often a symptom of systemic diseases of various natures (infective, metabolic or neoplastic). Consequently, the treatment of these patients, especially of those with chronic idiopathic urticaria, is particularly complex, as the pathogenesis of this clinical variant includes self - immune mechanisms38 with activation of tissue factors of coagulation.39,40 an initial study on 18 healthy volunteers was conducted on a model of allergic skin reaction after histamine prick test at a concentration of 100 mg / ml.41 the areas, expressed in mm, of both the wheal and the surrounding flare were calculated at different times after the test (0.5, 1, 2, 4, 6, 8, 10, 12, and 24 hours). Levocetirizine demonstrated higher efficacy and more prolonged action in inhibiting histamine - induced wheal formation than ebastine (10 mg), fexofenadine (180 mg), mizolastine (10 mg), and loratadine (10 mg).41 a comparison with cetirizine also showed that a 2.5 mg once daily oral dose of levocetirizine inhibited the histamine - induced wheal formation almost entirely in 18 normal subjects.42 the inhibiting effect was comparable to that achieved with 5 mg of cetirizine . The effect of levocetirizine began after approximately one hour, reached its peak six hours after administration and persisted for 28 hours.42 subsequent studies confirmed the blocking effect of levocetirizine on the histamine - induced skin reaction, and demonstrated its greater efficacy compared with desloratadine.28,43,44 levocetirizine induces a quantitatively greater reduction of histamine wheal in a higher percentage of patients for a longer time than desloratadine.44 a recent investigation conducted on 18 allergic patients submitted to aeroallergen skin prick tests (spt) measured the surface, in mm, of the spt - induced wheal and flare before and after the administration of placebo, desloratadine and levocetirizine.45 a serum and receptor assay of both antihistamine drugs was also performed . The study provided evidence that levocetirizine achieved stronger and more effective h-1 receptor blockage than desloratadine, although the latter was found in higher concentration at skin level.45 however, given the complexity of chronic idiopathic urticaria, the doubt remained whether levocetirizine would prove equally effective . In an initial double - blind, placebo controlled study, levocetirizine although at different dosages (2.5, 5, and 10 mg)produced a significant improvement in clinical parameters (pruritus intensity and duration, wheal number and size) and quality of life score, as determined using the dermatology life quality index (dlqi)46 in 258 patients with chronic idiopathic urticaria . The therapeutic effect of levocetirizine was significant when compared to placebo as early as the first week of treatment, and persisted throughout the entire duration of the study (4 weeks) even at the minimum dosage of 2.5 mg.46 subsequent studies have confirmed levocetirizine s speed of action and efficacy in 166 patients with chronic urticaria.47 the objective was to measure the change induced by levocetirizine on itching severity one week and four weeks after treatment, according to a scale from 0 (no itching) to 3 (more than 6 hours of itching per day), and to evaluate the quality of life through the dlqi.47 during the first week, treatment with 5 mg levocetirizine led to a marked improvement of itching severity and a reduction in wheal number and size compared with placebo . These effects remained stable throughout the three following weeks.47 during treatment, the quality of life (dlqi) score improved in both groups, but more noticeably in the group treated with levocetirizine.47 the results of the study on treatment impact on cost and productivity parameters are also noteworthy . The number of drug intakes because of a new flare - up of urticaria was considerably lower in the levocetirizine group than in the placebo group (approximately 10 times lower: 2.5 vs 25.9). Patients treated with levocetirizine also improved their work productivity during the study period.47 in a six - week double - blind, placebo - controlled study we conducted, the efficacy of levocetirizine was assessed in a population of 106 patients with chronic idiopathic urticaria at a daily dosage of 5 mg.48 the investigation included an assessment of symptoms (pruritus; number, size and spread of the wheal lesions; number of new flare - ups, with scores of 0 to 3 according to severity) using tss and vas (visual analogue scale at 10 cm); the assessment was then verified through a 5-question survey on qol changes.48 as early as the first three weeks, the study confirmed levocetirizine to be markedly more effective than placebo in reducing the scores of the considered scales (tss, vas, qolq).48 at the end of treatment 53% of the patients who had received levocetirizine reported total disappearance of symptoms, reduced itching intensity (85%), reduced number and spread of the wheal lesions (79% and 75% respectively) in significant percentages compared to subjects treated with placebo . Moreover, the beneficial effects of the treatment persisted up to seven days after the treatment suspension.48 an analysis of costs in 294 patients with chronic idiopathic urticaria treated with levocetirizine vs placebo has recently confirmed that, in terms of work and social costs, levocetirizine allows monthly savings for 91.93 per individual patient on the costs of medical investigations, combined therapies, days of hospital stays and loss of work productivity resulting in treatment costs of more than 1 per day.49 levocetirizine is a newly developed selective h-1 antagonist and is the r - enantiomer or active isomer of the racemate cetirizine . Its small volume of distribution, smaller even than that of cetirizine, confers improved safety because of its lesser passage through the blood - brain barrier and low cerebral receptor binding . The drug s safety is confirmed by the absence of cardiotoxic effects and the mild nature of the reported adverse reactions (fatigue, headache, dizziness, and dry mouth) during treatment, which do not generally interfere with the patient s well being even in the case of chronic treatment . According to the examined studies, levocetirizine represents a potent, consistent and long - lasting medication for the treatment of both intermittent and persistent allergic rhinitis and chronic idiopathic urticaria . In patients with allergic rhinitis, treatment with levocetirizine at a dose of 5 mg daily produced a significant decrease in sneezing, rhinorrhea, itching nose, itching eyes and nasal congestion . Also the efficacy of levocetirizine to treat chronic idiopathic urticaria was widely demonstrated . In particular, a long - term treatment with this antihistamine can improve the quality of life and symptoms and decrease the overall costs of allergic diseases; these are some of the key criteria for the successful treatment of chronic diseases.
|
Women with unresectable chest wall recurrence (cwr) of breast cancer are challenging patients to treat . They often receive doxorubicin, as it has considerable efficacy and is the most frequently used systemic agent for breast cancer [14]. When patients treatments fail following prior radiation and anthracycline therapy, clinicians face a dilemma as to what systemic agents and/or treatment modalities to use . Here we describe the combination of mild hyperthermia with a thermally sensitive doxorubicin containing liposome for patients with chest wall recurrences of breast cancer . The logic for this combination is multifold: 1) low temperature sensitive liposomal formulations of doxorubicin (ltld) have been engineered to rapidly release high concentrations of drug when exposed to temperatures ranging from 39.5 to 42.0 c [57]. These liposomes exhibit enhanced drug delivery to tumour tissue as a result of intravascular release . 2) hyperthermia partially reverses drug resistance to doxorubicin and increases perfusion, which should enhance drug delivery . 3) there is a strong clinical indication for increasing the local control rate in patients with cwr . Morbidities associated with local recurrence of breast cancer on the chest wall include pain, ulceration, odour, bleeding, lymphoedema and the psychological distress of having visible local disease . Local therapies such as re - irradiation with hyperthermia can achieve control in some patients . Although many patients with chest wall recurrences present with metastatic disease, a proportion can achieve durable local control and alleviation of symptoms . The objectives of this study were 1) to identify the maximum tolerated dose (mtd) of ltld, (thermodox) in the setting of local regionally recurrent disease in a heavily pretreated population, 2) to analyse pharmacokinetics (pk) when combined with local hyperthermia in multiple cycle dosing, and 3) to provide initial assessment of anti - tumour activity . The mtd was found to be 50 mg / m, after two dose - limiting toxicities were seen at a dose of 60 mg / m (grade 3 alt increase, and grade 4 neutropenia). Trial a was an investigator - sponsored trial at duke university medical center which ran from may 2006 to january 2010 and treated 18 patients . One other patient discontinued without completing cycle 1 due to a grade 2 hypersensitivity reaction to ltld that resolved without sequelae (described in detail in the results section). Trial b was a multi - center phase i trial sponsored by celsion, conducted from april 2009 to march 2011 . For both trials all women had histologically documented recurrent / metastatic adenocarcinoma of the breast, <3 cm thick, to allow adequate heating . Patients with distant metastatic disease and/or inflammatory disease were allowed . All had to have progressed after at least one course of hormonal therapy, provided their tumour was oestrogen (er) or progesterone (pr) positive . All patients had to have also received prior radiotherapy to their chest wall or breast either in the adjuvant or metastatic setting; no radiotherapy was to be administered to the area of recurrence within 14 days prior to enrolment . Patients had to have had systemic chemotherapy for recurrent disease (1 regimen in trial a, 2 regimens in trial b). All women had to be 18 years of age, not pregnant, able to provide consent, and have a zubrod performance status of 01 . Haematological indices had to be within normal limits and baseline muga / echocardiogram assessed left ventricular ejection fraction (lvef) must have been 50% . Previous doxorubicin and epirubicin must not have exceeded 450 mg / m and 900 mg / m, respectively . This limit is based on the dose equivalency for cardiotoxicity being 2:1 for doxorubicin to epirubicin . The only time dose escalated was when the prior level was found to be safe in a previous cohort . Then the entire next cohort of patients started and stayed at the next higher level dose increment . Prior to each treatment cycle, subjects received a 24-h prophylactic premedication regime designed to reduce immediate hypersensitivity reactions . Patients were to receive six cycles of ltld every 2135 days, followed immediately by local hyperthermia to the chest wall . In trial a, the initial dose level was 20 mg / m and sequential dose levels were to be 30, 40, 50, and 60 mg / m, given intravenously over 30 min . In trial b, the two dose levels were 40 and 50 mg / m; if no more than one of six patients had a dose - limiting toxicity (dlt) at 50 mg / m, then that dose level would be the mtd . Ltld was not planned to exceed the established mtd of 50 mg / m dose level . All patients were premedicated with a standardised regimen including dexamethasone, diphenhydramine and an antacid . Dexamethasone 10 mg per os twice a day three doses (the third dose was the morning of treatment). Approximately 1 h prior to the administration of the study drug, 500 ml of normal saline was infused intravenously \(iv). Approximately 30 min prior to the administration of the study drug, all of the patients received dexamethasone, diphenhydramine, and ranitidine . Hyperthermia treatments were to be given within 3060 min after completion of the ltld infusion, using fda - approved microwave or ultrasound superficial hyperthermia devices able to cover the target volume with a maximum of two hyperthermia fields . We used 915 mhz microwave applicators, with the bsd 500 (salt lake city, ut) commercial hyperthermia system . The applicator sizes available for use were a 19 10 cm, 15 8 cm, and a circular 6 cm applicator . An area of 16 8 cm falls within the 25% iso - sar (specific absorption rate) for the largest applicator . The hyperthermia dose goal was to maintain 40.042.0 c in greater than 90% of measured points for approximately 60 min duration . Maximum allowable temperatures in normal and tumour tissues were 44.0 c and 45.0 c, respectively . Toxicities were assessed using the us national cancer institute common terminology criteria for adverse events, v3.0 . To be evaluable for mtd, patients must have completed the first day of cycle 3 (days 143) or withdrawn due to a dlt . Haematological dlts included grade 4 thrombocytopenia, febrile neutropenia, or grade 4 neutropenia 5 days in duration (7 days in trial non - hematological dlts included grade 3 toxicities (except alopecia, nausea, and vomiting); in trial b, grade 3 fatigue was not a dlt . Secondary end points included characterising the safety and pharmacokinetic profile of ltld in multiple cycle dosing and computing the local objective response rate . All subjects were assessed for safety with treatment - emergent adverse events (aes), muga scans or echocardiograms (each patient had the same test done on all occasions), physical exams, vital signs, and laboratory measurements (including clinical chemistry, haematology, and urinalysis). Subjects were evaluated for efficacy at baseline, at cycles 3 and 5, and 2142 days after cycle 6 . For the patients with recurrent chest wall disease there are limited imaging techniques that can assist clinicians in deciding the course of therapy and in evaluating the effectiveness of chemotherapeutic agents . In trial a, digital infrared imaging (dii) was tested for its ability to estimate response and/or progression inside and outside the heated fields . Patients were imaged in a temperature controlled room with a digital infrared camera (irsnapshot, fluke, everett, wa) at baseline, prior to cycles 3, 5, and post - cycle 6 . Regions of interest (roi) were selected around the heated target lesions (tl) and non - heated target lesions (ntl) defined by the treating physician . The average and maximum temperatures in each roi were recorded for baseline and for each subsequent post - treatment image . In trial a, pk blood specimens were drawn in cycles 1 and 2 at approximately 0, 0.25, 0.5 (end of infusion), 0.75, 1.0, 1.25, 2, 3, 4, 6, 24 and 48 h and on days 4 and 8 . We measured levels of doxorubicin and doxorubicinol, the latter being an active metabolite implicated in the cardiotoxicity of doxorubicin . Urine specimens were collected before the start of the infusion and at approximately 2, 4, and 24 h and on days 4 and 8 . In trial b, pk was assessed during the first two cycles of study drug administration by drawing four blood samples (4 ml each) at specified time intervals of 30 2 min (i.e. At the end of the infusion) and at 5 0.5 h, 10 1 h, and 24 1 h following the start of the infusion . Thermal dosimetry was summarised as the tenth percentile of the temperature distribution of all sensors, or t90, meaning the temperature that is exceeded by 90% of all measurements (using fibreoptic thermometers) for each treatment . Two - tailed exact non - parametric tests are used for dose response analysis and for comparing the two trials in demographics, treatments, and outcomes . Patients in the two trials were similar on all 11 demographic and pretreatment characteristics except that trial a subjects had fewer total prior treatments (table 1, p = 0.0133) and a shorter time from cwr to first ltld treatment (p = 0.0046). Table 1.summary of baseline characteristics.characteristiccombined (n = 29)trial a (n = 18)trial b (n = 11)p valueage (years)0.1042 mean57.859.155.6 standard deviation8.29.74.7 minimum424249.2 median57.460.554.8 maximum757566.8oestrogen receptor (er) status (%) 1.0000 negative19 (65.5)12 (66.7)7 (63.6) positive9 (31.0)5 (27.8)4 (36.4) not assessed / unknown1 (3.4)1 (5.6)0 (0.0)progesterone receptor (pr) status (%) 0.6525 negative22 (75.9)14 (77.8)8 (72.7) positive6 (20.7)3 (16.7)3 (27.3) not assessed / unknown1 (3.4)1 (5.6)0 (0.0)her2 status (%) 0.1535 negative21 (72.4)15 (83.3)6 (54.5) positive6 (20.7%2 (11.1)4 (36.4) not assessed / unknown2 (6.9)1 (5.6)1 (9.1)triple negative for er, pr, and her2 (n,%) 0.1212 no12 (41.4)5 (27.8)7 (63.6) yes16 (55.2)12 (66.7)4 (36.4) not assessed / unknown1 (3.4)1 (5.6)0 (0.0)distant metastases at baseline (%) 0.2490 no16 (55.2)8 (44.4)8 (72.7) yes3 (44.8)10 (55.6)3 (27.3)time from initial diagnosis to chest wall recurrence (years)0.2515 mean4.13.84.6 standard deviation3.74.23.1 minimum0.50.50.7 median2.61.63.1 maximum12.512.510.4time from chest wall recurrence to first study treatment (months)0.0046 mean13.75.027.9 standard deviation24.95.436.5 minimum0.00.00.2 median7.42.413.5 maximum125.417.6125.4total number of prior treatments for breast cancer (%) 0.0133 12 (6.9)2 (11.1)0 (0.0) 26 (20.7)5 (27.8)1 (9.1) 310 (34.5)7 (8.9)3 (27.3) 47 (24.1)3 (16.7)4 (36.4) 51 (3.4)1 (5.6)0 (0.0) 62 (6.9)0 (0.0)2 (18.2) 121 (3.4)0 (0.0)1 (9.1)prior anthracycline exposure (mg / m)0.7233 mean304.1307.1 299.2 standard deviation115.4101.5 140.7 minimum80222 80.0 median256.5275 251.5 maximum570570 555.0 prior radiation exposure (cgy)0.7913 mean644961007021 standard deviation2455812.23895 minimum198045001980 median610061106040 maximum16 810738016 8101exact wilcoxon - mann - whitney test, two - tailed.2fisher s exact test, two - tailed.3excludes one subject who reportedly received a single anthracycline treatment of unknown dose.4excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . Summary of baseline characteristics excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . Most subjects (55.2%) were triple negative and 44.8% had distant metastases at baseline . The mean and median prior anthracycline exposures were 304.1 mg / m and 256.5 mg / m, respectively; the minimum total dose was 80.0 mg / m while the maximum was 570.0 mg / m . The mean and median prior radiation exposures were 64.49 gy and 61 gy respectively; the minimum total dose was 19.80 gy while the maximum was 168.10 gy . Both trials were similar in number of study treatments completed and in thermal doses (table 2). The thermal dose goal was to reach a temperature between 40 and 42 c in greater than 90% of measured points (t90) for approximately 60 min duration . A total of 165 hyperthermia fields were treated . Of these 165 hyperthermia treatment fields, 58 (35.2%) had a t90 of less than 40.0 c and the other 107 (64.8%) had a t90 between 40.0 and 42.9 c . Of all 165 treatment fields, 33 (20%) had a t90 below 39.5 c, the minimum temperature needed to release doxorubicin from ltld . Eleven (37.9%) of 29 subjects had at least one treatment field with a t90 below 39.5 c . Table 2.summary of study treatment.characteristiccombined (n = 29)trial a (n = 18)trial b (n = 11)p valuetotal number of study treatments (%) 0.7004 11 (3.4)1 (5.5)0 (0.0) 28 (27.6)5 (27.8)3 (27.3) 34 (13.8)1 (5.5)3 (27.3) 45 (17.2)3 (16.7)2 (18.2) 51 (3.4)1 (5.5)0 (0.0) 610 (34.5)7 (38.9)3 (27.3)combined (n = 165)trial a (n = 112)trial b (n = 53) p valuet90 for each hyperthermia treatment field (%) 0.4853 <40.0 c58 (35.2)37 (33.0)21 (39.6) 40.042.9 c107 (64.8)75 (67.0)32 (60.4) 43.0 c0 (0.0)0 (0.0)0 (0.0)1exact wilcoxon - mann - whitney test, two - tailed.2fisher s exact test, two - tailed . Summary of study treatment . Exact wilcoxon - mann - whitney test, two - tailed . Fisher s exact test, two - tailed . Thirteen subjects were evaluable for mtd in trial a and 10 in trial b. in trial a, dose escalation continued to the 40 mg / m dose level, at which time trial b initiated at 40 mg / m prior to reaching a mtd . In trial a, one patient experienced a grade 2 hypersensitivity reaction that included a drug - related fever at 30 mg / m; this was considered a dlt . Two of seven subjects at 40 mg / m experienced a dlt (grade 4 neutropenia lasting> 5 days and grade 3 dehydration requiring hospitalisation for support for 27 days). In trial b, one of six patients at the 50 mg / m dose level had a dlt (grade 3 hypokalaemia unrelated to study treatment), so the mtd was 50 mg / m . Five of the six non - evaluable patients withdrew due to progression of disease during the first two treatment cycles and one for an unrelated adverse event . Grade 4 toxicity was only observed in three (10.3%) patients with neutropenia and two (6.9%) with a neutrophil count decrease (table 3). Grade 3 toxicity included six patients (20.7%) with a neutrophil count decrease, five (17.2%) with neutropenia, four (13.8%) with leucopenia, and three (10.3%) with a white blood cell count decrease . All other grade 3 toxicities consisted of a single case of each of the following: anaemia, lymphopenia, thrombocytopenia, dehydration, axillary pain, fatigue, cellulitis, third degree burn adjacent to a silicone implant (trial b), activated partial thromboplastin time - prolonged, haemoglobin decreased, hypokalaemia, back pain, musculoskeletal chest pain, musculoskeletal pain, and lymphoedema . Two subjects, both in trial b, experienced first degree thermal burns that were managed conservatively and healed . (subjects are counted only once within each system - organ class and preferred term, at the highest severity grade experienced . N = 29. ).system - organ class / preferred termgrade 3 n (%) grade 4 n (%) grade 34 total n (%) blood and lymphatic system disorders1 (3.4)0 (0.0)1 (3.4) anaemia4 (13.8)0 (0.0)4 (13.8) leukopenia1 (3.4)0 (0.0)1 (3.4) lymphopenia5 (17.2)3 (10.3)8 (27.6) neutropenia1 (3.4)0 (0.0)1 (3.4) thrombocytopeniageneral disorders and administration site conditions axillary pain1 (3.4)0 (0.0)1 (3.4) fatigue1 (3.4)0 (0.0)1 (3.4)infections and infestations cellulitis1 (3.4)0 (0.0)1 (3.4)injury, poisoning, and procedural complications burns third degree1 (3.4)0 (0.0)1 (3.4)investigations activated partial thromboplastin time - prolonged1 (3.4)0 (0.0)1 (3.4) haemoglobin decreased1 (3.4)0 (0.0)1 (3.4) neutrophil count decreased6 (20.7)2 (6.9)8 (27.6) white blood cell count decreased3 (10.3)0 (0.0)3 (10.3)metabolism and nutrition disorders dehydration1 (3.4)0 (0.0)1 (3.4) hypokalaemia1 (3.4)0 (0.0)1 (3.4)musculoskeletal and connective tissue disorders back pain1 (3.4)0 (0.0)1 (3.4) musculoskeletal chest pain1 (3.4)0 (0.0)1 (3.4) musculoskeletal pain1 (3.4)0 (0.0)1 (3.4)vascular disorders lymphoedema1 (3.4)0 (0.0)1 (3.4) combined summary of grade 34 adverse events . (subjects are counted only once within each system - organ class and preferred term, at the highest severity grade experienced . There were no clinically significant cardiac toxicities; however, in trial b, one asymptomatic decline in lvef from 55% to 45% was recorded after six ltld treatments and a prior anthracycline exposure of 240 mg / m . In addition, there were no cases of hand foot syndrome, which has been reported with the use of non - temperature - sensitive liposomal doxorubicin . Plasma concentrations of doxorubicin achieved their maximum at the end of the 30-min infusion and subsequently declined rapidly (figure 1). As expected, plasma concentration of doxorubicin increased with each subsequent dose level (table 4). The near superimposition of curves for cycles 1 and 2 demonstrate that there was no accumulation of drug between cycles . The average plasma clearance of doxorubicin was 1.3 l / min / m, but there was considerable heterogeneity among patients . The average terminal plasma half - life for all patients was 35.15 min, but ranged from 9.26 to 45.27 min . There was no statistically significant difference between these variables among the various dose cohorts . Figure 1.pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite, doxorubicinol . The half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . (h)tmax (h)cmax (ng / ml)cmax/ d (ng / ml / mg / m)auclast (ng h / ml)auc/ d (ng / h / ml / mg / m)vz (l)cl (l / h)tmax (h)cmax (ng / ml)auc/ d (ng / h / ml / mg / m)doxorubicin 20 mg / m n = 3 patients (cycle 1)doxorubicinolmean34.750.73311 10055717 6008821072.204.0010.229.3cv% 44.520.501.8315.3015.3011.5211.5341.8714.463.084.0027.6040.20doxorubicin 30 mg / m n = 6 patients (cycle 1)doxorubicinolmean37.200.52516 20053925 0008341242.265.0013.826.6cv% 19.540.500.7524.2524.2524.6524.5739.3428.743.006.0838.4940.38doxorubicin 40 mg / m n = 9 patients (cycle 1)doxorubicinolmean33.520.61718 40046032 9008241202.463.0022.328.8cv% 22.750.501.0021.1221.1227.8327.8039.0729.792.0024.2039.0735.12auclast, area under the curve to the last measured plasma concentration; auc/d, auc extrapolated to infinity divided by dose; cl, clearance; cmax, maximum plasma concentration; d, dose; t1/2, terminal exponential half life; tmax, time to cmax; vz, terminal phase volume of distribution . Pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite, doxorubicinol . The half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . Trial a. auclast, area under the curve to the last measured plasma concentration; auc/d, auc extrapolated to infinity divided by dose; cl, clearance; cmax, maximum plasma concentration; d, dose; t1/2, terminal exponential half life; tmax, time to cmax; vz, terminal phase volume of distribution . For trial b sparse sampling results include the mean cmax of doxorubicin ranged from 19 800 to 25 400 ng / ml in the 40 to the 50 mg / m dose range and between cycles . The mean cmax of doxorubicinol ranged from 19.6 to 21.9 ng / ml in the 4050 mg / m dose range and between cycles . Both doxorubicin and doxorubicinol exhibit linear (dose - independent) pharmacokinetics following a single dose in the 4050 mg / m dose range . The within - subject variability in doxorubicin and doxorubicinol exposure was small between each administration cycle with mean cycle 2 vs cycle 1 ratios ranging from 0.99 to 1.06 . The local objective tumour response was similar in the two trials (table 5, 6 and supplementary tables 13). When combined, five (17.2%) complete local responses and nine (31%) partial local responses were seen . The rate of local response in these heavily pretreated patients was 48.3% (14/29, 95% ci: 30.166.5%). (a) photo of thermometry placement, and (b) position of the 18 10 cm applicator over the lesion . The margins of the tumour are easily seen by the red colour against the normal skin . (e) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region, prior to therapy . (f) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . (g) thermographic images of the chest wall prior to cycle 5 . By this time this was most likely the result of reduced perfusion and metabolism, associated with tumour regression . Table 5.efficacy: local objective response.local objective responsecombined n = 29 (%) trial a n = 18 (%) trial b n = 11 (%) stable / progressive15 (51.7)9 (50.0)6 (54.5)partial9 (31.0)5 (27.8)4 (36.4)complete5 (17.2)4 (22.2)1 (9.1)local objective response in the two trials is not significantly different: p = 0.6317 by exact wilcoxon - mann - whitney test, two - tailed . Table 6.efficacy: local objective response rates in the combined trials.local objective responsenumber rate (n = 29)95% citotal (partial + complete)14 (48.3)30.166.5partial9 (31.0)14.247.8complete5 (17.2)3.530.9 evaluation of treatment course for a patient who achieved a complete response . (a) photo of thermometry placement, and (b) position of the 18 10 cm applicator over the lesion . The margins of the tumour are easily seen by the red colour against the normal skin . (e) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region, prior to therapy . (f) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . (g) thermographic images of the chest wall prior to cycle 5 . By this time this was most likely the result of reduced perfusion and metabolism, associated with tumour regression . Local objective response in the two trials is not significantly different: p = 0.6317 by exact wilcoxon - mann - whitney test, two - tailed . Efficacy: local objective response rates in the combined trials . In trial a, time to local progression (ttlp) and overall survival were additional end points (supplementary tables 2 and 3). Response trend for ttlp, but it was not statistically significant . In trial b, ltld and approved hyperthermia therapy resulted in clinically significant (8 point) improvements in patient self - assessed qol on the fact - b scale . Six of 11 subjects (54.5%, 95% ci: 25.183.9) had a clinically significant qol improvement . Patients in the two trials were similar on all 11 demographic and pretreatment characteristics except that trial a subjects had fewer total prior treatments (table 1, p = 0.0133) and a shorter time from cwr to first ltld treatment (p = 0.0046). Table 1.summary of baseline characteristics.characteristiccombined (n = 29)trial a (n = 18)trial b (n = 11)p valueage (years)0.1042 mean57.859.155.6 standard deviation8.29.74.7 minimum424249.2 median57.460.554.8 maximum757566.8oestrogen receptor (er) status (%) 1.0000 negative19 (65.5)12 (66.7)7 (63.6) positive9 (31.0)5 (27.8)4 (36.4) not assessed / unknown1 (3.4)1 (5.6)0 (0.0)progesterone receptor (pr) status (%) 0.6525 negative22 (75.9)14 (77.8)8 (72.7) positive6 (20.7)3 (16.7)3 (27.3) not assessed / unknown1 (3.4)1 (5.6)0 (0.0)her2 status (%) 0.1535 negative21 (72.4)15 (83.3)6 (54.5) positive6 (20.7%2 (11.1)4 (36.4) not assessed / unknown2 (6.9)1 (5.6)1 (9.1)triple negative for er, pr, and her2 (n,%) 0.1212 no12 (41.4)5 (27.8)7 (63.6) yes16 (55.2)12 (66.7)4 (36.4) not assessed / unknown1 (3.4)1 (5.6)0 (0.0)distant metastases at baseline (%) 0.2490 no16 (55.2)8 (44.4)8 (72.7) yes3 (44.8)10 (55.6)3 (27.3)time from initial diagnosis to chest wall recurrence (years)0.2515 mean4.13.84.6 standard deviation3.74.23.1 minimum0.50.50.7 median2.61.63.1 maximum12.512.510.4time from chest wall recurrence to first study treatment (months)0.0046 mean13.75.027.9 standard deviation24.95.436.5 minimum0.00.00.2 median7.42.413.5 maximum125.417.6125.4total number of prior treatments for breast cancer (%) 0.0133 12 (6.9)2 (11.1)0 (0.0) 26 (20.7)5 (27.8)1 (9.1) 310 (34.5)7 (8.9)3 (27.3) 47 (24.1)3 (16.7)4 (36.4) 51 (3.4)1 (5.6)0 (0.0) 62 (6.9)0 (0.0)2 (18.2) 121 (3.4)0 (0.0)1 (9.1)prior anthracycline exposure (mg / m)0.7233 mean304.1307.1 299.2 standard deviation115.4101.5 140.7 minimum80222 80.0 median256.5275 251.5 maximum570570 555.0 prior radiation exposure (cgy)0.7913 mean644961007021 standard deviation2455812.23895 minimum198045001980 median610061106040 maximum16 810738016 8101exact wilcoxon - mann - whitney test, two - tailed.2fisher s exact test, two - tailed.3excludes one subject who reportedly received a single anthracycline treatment of unknown dose.4excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . Summary of baseline characteristics excludes one subject each whose prior anthracycline dose was reported as unknown and as not assessed . Most subjects (55.2%) were triple negative and 44.8% had distant metastases at baseline . The mean and median prior anthracycline exposures were 304.1 mg / m and 256.5 mg / m, respectively; the minimum total dose was 80.0 mg / m while the maximum was 570.0 mg / m . The mean and median prior radiation exposures were 64.49 gy and 61 gy respectively; the minimum total dose was 19.80 gy while the maximum was 168.10 gy . Both trials were similar in number of study treatments completed and in thermal doses (table 2). The thermal dose goal was to reach a temperature between 40 and 42 c in greater than 90% of measured points (t90) for approximately 60 min duration . A total of 165 hyperthermia fields were treated . Of these 165 hyperthermia treatment fields, 58 (35.2%) had a t90 of less than 40.0 c and the other 107 (64.8%) had a t90 between 40.0 and 42.9 c . Of all 165 treatment fields, 33 (20%) had a t90 below 39.5 c, the minimum temperature needed to release doxorubicin from ltld . Eleven (37.9%) of 29 subjects had at least one treatment field with a t90 below 39.5 c . Table 2.summary of study treatment.characteristiccombined (n = 29)trial a (n = 18)trial b (n = 11)p valuetotal number of study treatments (%) 0.7004 11 (3.4)1 (5.5)0 (0.0) 28 (27.6)5 (27.8)3 (27.3) 34 (13.8)1 (5.5)3 (27.3) 45 (17.2)3 (16.7)2 (18.2) 51 (3.4)1 (5.5)0 (0.0) 610 (34.5)7 (38.9)3 (27.3)combined (n = 165)trial a (n = 112)trial b (n = 53) p valuet90 for each hyperthermia treatment field (%) 0.4853 <40.0 c58 (35.2)37 (33.0)21 (39.6) 40.042.9 c107 (64.8)75 (67.0)32 (60.4) 43.0 c0 (0.0)0 (0.0)0 (0.0)1exact wilcoxon - mann - whitney test, two - tailed.2fisher s exact test, two - tailed . Summary of study treatment . Thirteen subjects were evaluable for mtd in trial a and 10 in trial b. in trial a, dose escalation continued to the 40 mg / m dose level, at which time trial b initiated at 40 mg / m prior to reaching a mtd . In trial a, one patient experienced a grade 2 hypersensitivity reaction that included a drug - related fever at 30 mg / m; this was considered a dlt . Two of seven subjects at 40 mg / m experienced a dlt (grade 4 neutropenia lasting> 5 days and grade 3 dehydration requiring hospitalisation for support for 27 days). In trial b, one of six patients at the 50 mg / m dose level had a dlt (grade 3 hypokalaemia unrelated to study treatment), so the mtd was 50 mg / m . Five of the six non - evaluable patients withdrew due to progression of disease during the first two treatment cycles and one for an unrelated adverse event . Grade 4 toxicity was only observed in three (10.3%) patients with neutropenia and two (6.9%) with a neutrophil count decrease (table 3). Grade 3 toxicity included six patients (20.7%) with a neutrophil count decrease, five (17.2%) with neutropenia, four (13.8%) with leucopenia, and three (10.3%) with a white blood cell count decrease . All other grade 3 toxicities consisted of a single case of each of the following: anaemia, lymphopenia, thrombocytopenia, dehydration, axillary pain, fatigue, cellulitis, third degree burn adjacent to a silicone implant (trial b), activated partial thromboplastin time - prolonged, haemoglobin decreased, hypokalaemia, back pain, musculoskeletal chest pain, musculoskeletal pain, and lymphoedema . Two subjects, both in trial b, experienced first degree thermal burns that were managed conservatively and healed . (subjects are counted only once within each system - organ class and preferred term, at the highest severity grade experienced . N = 29. ).system - organ class / preferred termgrade 3 n (%) grade 4 n (%) grade 34 total n (%) blood and lymphatic system disorders1 (3.4)0 (0.0)1 (3.4) anaemia4 (13.8)0 (0.0)4 (13.8) leukopenia1 (3.4)0 (0.0)1 (3.4) lymphopenia5 (17.2)3 (10.3)8 (27.6) neutropenia1 (3.4)0 (0.0)1 (3.4) thrombocytopeniageneral disorders and administration site conditions axillary pain1 (3.4)0 (0.0)1 (3.4) fatigue1 (3.4)0 (0.0)1 (3.4)infections and infestations cellulitis1 (3.4)0 (0.0)1 (3.4)injury, poisoning, and procedural complications burns third degree1 (3.4)0 (0.0)1 (3.4)investigations activated partial thromboplastin time - prolonged1 (3.4)0 (0.0)1 (3.4) haemoglobin decreased1 (3.4)0 (0.0)1 (3.4) neutrophil count decreased6 (20.7)2 (6.9)8 (27.6) white blood cell count decreased3 (10.3)0 (0.0)3 (10.3)metabolism and nutrition disorders dehydration1 (3.4)0 (0.0)1 (3.4) hypokalaemia1 (3.4)0 (0.0)1 (3.4)musculoskeletal and connective tissue disorders back pain1 (3.4)0 (0.0)1 (3.4) musculoskeletal chest pain1 (3.4)0 (0.0)1 (3.4) musculoskeletal pain1 (3.4)0 (0.0)1 (3.4)vascular disorders lymphoedema1 (3.4)0 (0.0)1 (3.4) combined summary of grade 34 adverse events . (subjects are counted only once within each system - organ class and preferred term, at the highest severity grade experienced . There were no clinically significant cardiac toxicities; however, in trial b, one asymptomatic decline in lvef from 55% to 45% was recorded after six ltld treatments and a prior anthracycline exposure of 240 mg / m . In addition, there were no cases of hand foot syndrome, which has been reported with the use of non - temperature - sensitive liposomal doxorubicin . Plasma concentrations of doxorubicin achieved their maximum at the end of the 30-min infusion and subsequently declined rapidly (figure 1). As expected, plasma concentration of doxorubicin increased with each subsequent dose level (table 4). The near superimposition of curves for cycles 1 and 2 demonstrate that there was no accumulation of drug between cycles . The average plasma clearance of doxorubicin was 1.3 l / min / m, but there was considerable heterogeneity among patients . The average terminal plasma half - life for all patients was 35.15 min, but ranged from 9.26 to 45.27 min . There was no statistically significant difference between these variables among the various dose cohorts . Figure 1.pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite, doxorubicinol . The half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . (h)tmax (h)cmax (ng / ml)cmax/ d (ng / ml / mg / m)auclast (ng h / ml)auc/ d (ng / h / ml / mg / m)vz (l)cl (l / h)tmax (h)cmax (ng / ml)auc/ d (ng / h / ml / mg / m)doxorubicin 20 mg / m n = 3 patients (cycle 1)doxorubicinolmean34.750.73311 10055717 6008821072.204.0010.229.3cv% 44.520.501.8315.3015.3011.5211.5341.8714.463.084.0027.6040.20doxorubicin 30 mg / m n = 6 patients (cycle 1)doxorubicinolmean37.200.52516 20053925 0008341242.265.0013.826.6cv% 19.540.500.7524.2524.2524.6524.5739.3428.743.006.0838.4940.38doxorubicin 40 mg / m n = 9 patients (cycle 1)doxorubicinolmean33.520.61718 40046032 9008241202.463.0022.328.8cv% 22.750.501.0021.1221.1227.8327.8039.0729.792.0024.2039.0735.12auclast, area under the curve to the last measured plasma concentration; auc/d, auc extrapolated to infinity divided by dose; cl, clearance; cmax, maximum plasma concentration; d, dose; t1/2, terminal exponential half life; tmax, time to cmax; vz, terminal phase volume of distribution . Pharmacokinetic profiles for cycles 1 and 2 at each dose level for doxorubicin and its cardiotoxic metabolite, doxorubicinol . The half - life of the drug was the same for cycle 1 and cycle 2 and was not dependent upon doxorubicin dose . Trial a. auclast, area under the curve to the last measured plasma concentration; auc/d, auc extrapolated to infinity divided by dose; cl, clearance; cmax, maximum plasma concentration; d, dose; t1/2, terminal exponential half life; tmax, time to cmax; vz, terminal phase volume of distribution . For trial b sparse sampling results include the mean cmax of doxorubicin ranged from 19 800 to 25 400 ng / ml in the 40 to the 50 mg / m dose range and between cycles . The mean cmax of doxorubicinol ranged from 19.6 to 21.9 ng / ml in the 4050 mg / m dose range and between cycles . Both doxorubicin and doxorubicinol exhibit linear (dose - independent) pharmacokinetics following a single dose in the 4050 mg / m dose range . The within - subject variability in doxorubicin and doxorubicinol exposure was small between each administration cycle with mean cycle 2 vs cycle 1 ratios ranging from 0.99 to 1.06 . The local objective tumour response was similar in the two trials (table 5, 6 and supplementary tables 13). When combined, five (17.2%) complete local responses and nine (31%) partial local responses were seen . The rate of local response in these heavily pretreated patients was 48.3% (14/29, 95% ci: 30.166.5%). (a) photo of thermometry placement, and (b) position of the 18 10 cm applicator over the lesion . The margins of the tumour are easily seen by the red colour against the normal skin . (e) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region, prior to therapy . (f) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . (g) thermographic images of the chest wall prior to cycle 5 . By this time this was most likely the result of reduced perfusion and metabolism, associated with tumour regression . Table 5.efficacy: local objective response.local objective responsecombined n = 29 (%) trial a n = 18 (%) trial b n = 11 (%) stable / progressive15 (51.7)9 (50.0)6 (54.5)partial9 (31.0)5 (27.8)4 (36.4)complete5 (17.2)4 (22.2)1 (9.1)local objective response in the two trials is not significantly different: p = 0.6317 by exact wilcoxon - mann - whitney test, two - tailed . Table 6.efficacy: local objective response rates in the combined trials.local objective responsenumber rate (n = 29)95% citotal (partial + complete)14 (48.3)30.166.5partial9 (31.0)14.247.8complete5 (17.2)3.530.9 evaluation of treatment course for a patient who achieved a complete response . (a) photo of thermometry placement, and (b) position of the 18 10 cm applicator over the lesion . The margins of the tumour are easily seen by the red colour against the normal skin . (e) thermographic camera image of chest well shows temperature distribution on the surface of the tumour region, prior to therapy . (f) thermographic image of the chest wall prior to cycle 4 shows reduced surface temperature compared with baseline . (g) thermographic images of the chest wall prior to cycle 5 . By this time this was most likely the result of reduced perfusion and metabolism, associated with tumour regression . Local objective response in the two trials is not significantly different: p = 0.6317 by exact wilcoxon - mann - whitney test, two - tailed . Efficacy: local objective response rates in the combined trials . In trial a, time to local progression (ttlp) and overall survival were additional end points (supplementary tables 2 and 3). There was a modest dose response trend for ttlp, but it was not statistically significant . In trial b, ltld and approved hyperthermia therapy resulted in clinically significant (8 point) improvements in patient self - assessed qol on the fact - b scale . Six of 11 subjects (54.5%, 95% ci: 25.183.9) had a clinically significant qol improvement . Ltld was tolerated well by our heavily pretreated patients with four dlts observed between two trials . Grade 34 neutropenia occurred in eight patients (27.6%) and was afebrile in all patients . There were no dose - limiting cardiac toxicities seen in our patients and there were no symptomatic lvef decreases seen on serial echo / muga imaging . This is similar to the cardiotoxicity profile commonly seen with non - temperature - sensitive liposomal doxorubicin, with very few cases of heart failure, and if any cardiac morbidity is seen it is often asymptomatic declines in lvef [1824]. Two trial b subjects experienced thermal burns, one grade 2 with possible radiation recall and one grade 3 event in a subject with a silicone breast implant . Mild to severe thermal injury is reported as a known side effect of hyperthermia . While not the primary end point of the trials, the combined local response rate of 48% is quite impressive . However, the median time to local progression in trial a was not long (4.9 months) and might be lengthened with technical improvements in delivery of hyperthermia and by treating future patients at the 50 mg / m mtd . Twenty per cent of all treatment fields had a t90 below 39.5 c, the minimum temperature needed to release doxorubicin from ltld . Eleven (37.9%) of 29 subjects had at least one treatment field with a t90 below 39.5 c . However, the local objective response rate of these 11 subjects was similar to that for the other 18 subjects (55% and 44% respectively, p = 0.7104). Thus, a modest improvement in minimum tumour temperatures without significantly increasing the maximum temperatures should prove useful . Moreover, it has been predicted mathematically and shown that maximal drug delivery with this drug formulation occurs when the drug is administered during heating, as opposed to heating after drug administration . In these phase unfortunately, due to the differences in time from when each patient received their infusion and subsequent heating, it was not possible to make meaningful interpretation of the heterogeneous pharmacokinetic values . Technical advances that would permit heating during chemotherapy administration could achieve as much as a two - fold increase in drug delivery . Doxorubicin has a terminal half - life reported in the 2048-h range, a non - temperature - sensitive liposomal formulation of doxorubicin (doxil) has a half - life of approximately 55 h, whereas ltld has a half - life considerably shorter, in the order of 35 min, regardless of dose . For ltld, drug delivery could be substantially increased by heating during drug administration, one might be able to maximise the therapeutic benefit . Gasselhuber has considered these factors theoretically to demonstrate the influence of pharmacokinetics, release kinetics and rate of extravasation of drug on drug accumulation in the heated volume . This trial included many patients with disease that extended beyond the outer perimeter of the applicators available with the current microwave hyperthermia system . In order to improve average temperatures and corresponding thermal doses skin interface temperatures as high as 45c for cases with only superficial disease (<1 cm deep), in order to extend high temperatures out to the margins of disease . Larger microwave applicators that can conform to contoured patient anatomy and adjust the heating pattern to accommodate irregularly shaped diffuse disease would be expected to raise thermal dose and minimum tumour temperatures substantially compared to the centrally peaked heating patterns of rectangular box - shaped waveguide antennas used in this study . Needham et al . Have shown that drug release occurs at 40c although maximal drug release rates occur nearer to 41.3c, which is the transition temperature for this liposome . Of all 165 treatment fields, 33 (20%) had a t90 below 39.5 c, the minimum temperature needed to release doxorubicin from ltld . Thus, moving to larger conformal array microwave applicators that can effectively heat much larger areas of contoured anatomy above the required threshold temperature for drug release should significantly improve drug delivery to large area locoregional disease . Radiotherapy plus hyperthermia can provide local control of superficial tumours; in recurrent disease, previously irradiated patients may benefit most . Treating with concurrent doxorubicin and radiotherapy has largely been abandoned due to the potent radiosensitisation and resultant morbidities seen with it in the past . However, there may be significant concerns with soft tissue and bone injury along with potential cardiac toxicity in the setting of left side cwr . One possible solution is to use a thermobrachytherapy surface applicator to deliver a conformal radiation dose with restricted depth of penetration in combination with superficial heating and ltld to localise treatment to the chest wall [3134]. Unfortunately, as is the case with many women who experience cwr, distant metastases are frequent and the majority of patients die of their disease . Trial a s median ttlp of 4.9 months and os of 9.0 months highlight the often poor prognosis of these patients; in trial b, the subjects had had even more prior treatment . One might also consider heat sensitive liposomal formulations of other agents that might also be combined with local radiotherapy . Over half (55.2%) of our patients had triple negative cwrs, and there is ongoing interest in using parp inhibitors in this cohort; the delivery of these agents might be enhanced with temperature - sensitive liposomal formulations . Over half of the subjects had been diagnosed with a breast cancer recurrence at the chest wall more than 6 months (median 7.4 months, mean 13.7 months) prior to their first study treatment and 44.8% had distant metastases at baseline . Despite the encouraging rate of local response, seven of 29 subjects (24.1%) progressed outside the study treatment field . We were able to achieve local control in nearly half the patients as a salvage therapy with ltld / hyperthermia treatment and it is reasonable to expect better results in a population with less advanced disease . This thermally enhanced therapy is safe and produces objective responses in heavily pretreated cwr patients.
|
Choroidal melanoma is the most common primary adult ocular malignancy, with an estimate incidence in the united states of approximately 5 cases per million inhabitants per year, with no clear data about its incidence in europe . However, in the last decades, conservative techniques have been developed demonstrating efficient tumor control . Brachytherapy [2, 3] is the most widely used treatment for small and medium choroidal melanomas, and enucleation nowadays is reserved for an end stage disease, mainly large tumors with poor visual function [46]. Its incidence is not well known . With respect to the choroidal melanoma, the frequency they are usually asymptomatic and only when exudation produces retinal edema, and exudative retinal detachment leading to decrease visual acuity, they are diagnosed and treated to prevent the total loss of vision, and the eye itself . Different forms of laser have been applied with a transient effect and recurrence of exudation, but the definitive treatments are based on different forms of external radiation therapy, including external and episcleral brachytherapy [9, 10]. We present a case of simultaneous choroidal melanoma and circumscribed choroidal hemangioma in the same patient, treated consecutively with i brachytherapy . At the time of diagnosis, the 47 year old male patient had a 5 month history of visual loss in his right eye (od). The best corrected visual acuity in that eye was 20/60 and less than 20/200 in left eye (os). Fundus examination revealed a melanotic lesion in superior temporal arcade in od, and a red - orange choroidal mass in macular area in os, with inferior exudative retinal detachment (fig . B scan - ultrasound of od revealed a nodular choroidal mass 8.5 mm in basal diameter and 2.7 mm of height, with choroidal excavation and kappa angle, suggestive of melanoma . The left eye showed a choroidal nodular mass with high reflectivity, 12.9 mm in basal diameter, and 4.7 mm of height, consistent with hemangioma, with associated retinal detachment . Fluorescein and indocyanine green angiography supported the diagnosis of choroidal melanoma in od, and circumscribed choroidal hemangioma with exudative retinal detachment in os . Adjuvant studies (orbital computed tomography scan, nuclear magnetic resonance, liver function test, hepatic scan - ultrasound) proved that there were not extraocular or systemic extensions . Episcleral brachytherapy with i was performed with ropes plaque of 11 mm consecutively in both eyes (fig . Dose - rate distributions were obtained by the plaque simulator bebig v 3.56 (gmbh, berlin, germany). Treatment duration was calculated using an excel spreadsheet assuming dosimetric contants and functions of the aapm tg-43 (american association of physicists in medicine task group) protocol . After surgical exposure of the scleral surface over the tumor base, transpupillary illumination was used drawing the tumor base . Brachytherapy was performed first on the left eye (choroidal hemangioma) delivering 45 gy, and 2 weeks later on the right (melanoma), delivering 95 gy . Between the two treatments cleaning and sterilization of the applicator and sources both tumors regressed, and retinal detachment disappeared . Before epiescleral brachytherapy with i treatment . Fundus photography of right eye (od) reveales a melanotic lesion in superior temporal arcade (a), showed as a nodular choroidal mass in b scan - ultrasound (c). Nuclear magnetic resonance studies (nmr) of the orbit shows a well - defined mass, hiperintense on t1 (e), and hipointense on t2 (g), without contrast enhancement . Left eye (os) fundus shows a red - orange choroidal mass in macular area (b), with inferior exudative retinal detachment (d), isointense on nmr - t1 (f), and hiperintense on t2 (h), with high contrast enhancement retinal diagram with dose distribution of episcleral brachytherapy with i (ropes plaque of 11 mm) in both eyes treatment characteristics after twelve years of follow - up, there has not been a tumor recurrence (fig . Nine years after treatment, a post irradiation cataract appeared in the left eye, and macular edema and hemorrhages in posterior pole of the right eye . The cataract was extracted on the left eye, and visual acuity was recovered up to 20/200 . An anti vascular endothelial growth factor agent (avastin) was injected three times in right eye (every three months), with resolution of the hemorrhages, but still with persistence of slight macular edema on optical coherence tomography examination with recovery and stabilization of the visual acuity up to 20/60 up to last examination . Twelve years after epiescleral brachytherapy with i. choroidal melanoma regressed in fundus examination (a), and in b scan - ultrasound (c) of right eye (od). Circumscribed hemangioma (b) and retinal detachment also disappeared (d) choroidal melanoma is the most common primary intraocular tumor in adults, and circumscribed choroidal hemangioma is a rare clinical entity . Is it not known if there is any association between either tumors, and it is a rare coincidence to find them in the same subject, resulting in bilateral reduced visual function in the patient . Our case involves a young patient with simultaneous tumors in both eyes, and because of this, it was considered a priority to apply local conservative treatment to preserve his eyes, and to retain visual function . In choroidal melanomas, conservative treatment with plaque radiotherapy has proved to be efficient to control local tumors with overall survival comparable to enucleation [5, 6]. These patients may have visual loss secondary to radiation retinopathy, a condition that may result from the exposure to radiation, and may be considered a bad prognostic factor, due to high radiation doses to the foveola . Although our patient received a high radiation dose on the posterior pole, he had a well - preserved visual function, after twelve years of following - up . Treatment of choroidal hemangioma is based upon tumor location, the presence of subretinal fluid, symptoms and potential for visual recovery . Because of the large size of the choroidal hemangioma in our patient, we could not use a less aggressive treatment . Epiescleral brachyterapy was an option for treatment, which has been reported to offer excellent results in large tumors [9, 10, 14]. Because of the subfoveal location of the tumor, the patient had some loss of vision in the eye with choroidal hemangioma, upon diagnosis . We used a low dose of radiation, which had lesser risk of complications, and after cataract extraction, the visual acuity of the patient was preserved . Choroidal melanoma has been associated with different systemic or ocular findings, but an association between choroidal melanoma and choroidal hemangioma has never been published . To our knowledge, this is the first reported case of simultaneous choroidal melanoma and circumscribed choroidal hemangioma in the same patient, treated successfully with i brachytherapy, achieving tumor control and preservation of useful visual function in both eyes, for 12 years.
|
Grape is also one of the most commonly consumed fruits in the world both as fresh fruit (table grape) and processed fruit (wine, grape juice, molasses, and raisins) [1, 2]. There are greater than one hundred grape species which are divided into 2 subgenera: euvitis and muscadinia . Commercially cultivated grapes are usually classified as table or wine grapes depending on their intended method of consumption . Table grapes usually bear large, seedless fruit berries with relatively thin skin, whereas wine grapes are smaller with thick skins . For instance, wine grapes usually contain 19% or higher sugar content by fresh weight . A growing body of epidemiological studies and randomized controlled human trials have associated the consumption of grapes, wine, and grape juice with a wide variety of health - promoting effects particularly the reduced risk of cardiovascular diseases, type-2 diabetes, certain types of cancers, and other chronic complications [713]. The beneficial effects of grape and relevant grape - derived food products are believed to be related to a variety of bioactive components in grapes [1416]. One major group of these components is phenolic antioxidants typically including anthocyanins, catechins, resveratrol, phenolic acids, and procyanidins . Based on our analysis, 100 grams of fresh grapes contain 63182 mg of the phenolic compounds . Flavonoids constitute the majority of phenolic compounds (6576%) in grapes . In red grapes, for instance, resveratrols, antochyanins, and catechins are concentrated in the skin part, while procyanidins are concentrated in grape seeds . The commercial grape skin or seed extracts are made from grape pomace which is typically regarded as a waste byproduct generated in the lucrative winemaking industry . Large amounts of this byproduct accumulate annually which leads to a waste - management issue . However, uses of grape pomace are limited but have been recycled as organic fertilizers, manure, and animal feed . Because grape skins and seeds are the predominant constituents in the pomace, this biomass is a rich source of phenolic antioxidants [20, 21]. We have previously extracted phenolic compounds from the skins of fresh norton grapes which are wine grapes with unusual small sizes . The norton grape skin contains 215.6 mg phenolic compounds per gram of the extract . The concentration of catechin and epicatechin is 8.71 and 3.45 mg per gram of the norton skin extract . Grape skin also contains a substantial amount of phenolic acids such as gallic acid, ferulic acid, caffeic acid, syringic acid, and p - coumaric acid with some being bound with sugars . Although resveratrol is predominantly contained in the grape skin, its concentration is only 0.21 mg per gram of the extract based on our hplc analysis . In contrast to grape skins, grape seeds contain a main unique group of phenolic compounds, procyanidins, which are flavan-3-ol derivatives and are colorless in the pure state . Oligomeric and polymeric procyanidins in grape seeds possess a broad spectrum of pharmacological, medicinal, and therapeutic properties and are one of the most potent natural antioxidants [2730]. They can be extracted during the latter stages of wine - making and are believed to contribute to color stability and organoleptic properties of wine [46]. In recent years, these proanthocyanidin compounds have extracted and purified from grape seeds and have become a common nutritional supplement . They mostly consist of (+) catechin and () epicatechin units, linked by c4c8 or c4c6 bonds and sometimes esterified by gallic acid on the epicatechin moiety(ies). These proanthocyanidins are the oligomer and polymer of flavan-3-ol with an average degree of polymerization (dp) ranging from 2 to> 15 and an average molecular mass ranging from 578 to> 5000 da . The proanthocyanidin content in grape seeds is highly dependent on their varieties and extraction procedures . In general, the galloylated procyanidins are present in considerably lower concentrations than the nongalloylated ones, and higher molecular weight polymers constitute the majority of proanthocyanidins in grape seeds . Antioxidant activities of grape phenolic compounds have been extensively investigated in vitro and in vivo . Studies from us and others showed that grape skin, seed, and pomace extracts possess potent free radical scavenging activities using oxygen radical absorbance capacity (orac), 2,2-diphenyl-1-picrylhydrazyl (dpph), and 2,2-azino - bis(3-ethylbenzothiazoline-6-sulphonic acid) (abts). Assays and some complex phenolics also show significant chelating activity on transition metal ions which are strong promoters of lipid peroxidation [18, 24, 27, 32]. The antioxidant activities of grape phenolics have also been demonstrated in various model systems such as protecting low - density lipoprotein (ldl) against oxidation brought about by cu, oxygen - centered radical - generating aaph, or peroxynitrite - generating sin-1 in vitro systems, preventing spleen cells from dna damage induced by hydrogen peroxide (h2o2), and reducing oxidative stress in pc12 cells induced by addition of fe and t - butyl hydroperoxide [3335]. However, the in vivo studies examining antioxidant activity of grape extracts have shown inconsistent results . Some studies showed that dietary intake of grape antioxidants helps to prevent lipid oxidation and inhibit the production of reactive oxygen species (ros). For instance, dietary supplementation of grape seed extract (600 mg / day) for 4 weeks was shown to reduce oxidative stress and improve glutathione (gsh)/oxidized glutathione (gssg) and total antioxidant status (taos) in a double - blinded randomized crossover human trial . Another study also demonstrated that grape seed extract supplementation (2 300 mg / day) improved plasma antioxidant capacity in the high - cholesterol human subjects . While other studies showed that dietary supplementation of grape juice, grape skin, or grape seed extracts exhibits either only a moderate antioxidative effect [11, 37, 38] or a neutral effect in animals and humans [3941]. We have recently found that 3-month dietary supplementation of grape skin and grape pomace antioxidant extracts (0.2% in diet, equivalent to equivalent to approximately 960 mg gse / day for humans) showed no effects on oxidative stress in diet - induced obesity mice [41, 42]. These results are consolidated by a recent report which showed that dietary supplementation of grape skin extract (1170 mg / day) had no significant effect on antioxidant enzymes including superoxide dismutase or catalase and also had no effect on 2-aminoadipic semialdehyde (aas) residues, a plasma protein oxidation product, or on malondialdehyde in plasma or in ldl, markers of lipoprotein oxidation in physically active individuals . This inconsistency may be related to the low absorption of grape phenolics since the absorption rate of polyphenol antioxidants is generally less than 1% . A number of studies suggest that the high consumption of grape components could be associated with the reduced risk of certain cancers such as breast cancer and colon cancer [4547]. The anticancer effects of grape antioxidants have been demonstrated in in vitro and in vivo models [4852]. Grape antioxidants have been shown to induce cell cycle arrest and apoptosis in cancer cells as well as prevent carcinogenesis and cancer progression in rodent models [54, 55]. Considering the diversity of grape antioxidants, it is very likely that these compounds are to exert potential anticancer activity by acting on multiple cellular events associated with tumor initiation, promotion, and progression . Proposed mechanisms of potential anticancer effects of grape antioxidants include antioxidant, anti - inflammatory, and antiproliferative activities . Grape antioxidants could act as free radicals scavengers, and chelating agents help to reduce physiological reactive oxygen species (ros). Ros is known as an important mediator of apoptosis since initiation and regulation of apoptosis is associated with modifications in the oxidative environment . Study has shown that dietary intake of grape antioxidants reduced rat mucosal apoptosis via modulation of both mitochondrial and cytosolic antioxidant enzyme systems together with an increase in cellular glutathione (gsh): glutathione disulfide (gssg) ratio, protecting normal colonic mucosa from reactive oxygen species (ros) attack [25, 59]. Grape antioxidants also exert anti - inflammatory activity which is believed to be associated with their chemopreventive effects [25, 41, 42]. Cancer chemopreventive agents include nonsteroidal anti - inflammatory drugs (nsaids) such as indomethacin, piroxicam, and sulindac, all of which inhibit cyclooxygenase (cox). This inhibitory activity is relevant to cancer chemoprevention because cox catalyzes the conversion of arachidonic acid to proinflammatory substances such as prostaglandins, which can stimulate tumor cell growth and suppress immune surveillance [60, 61]. A number of studies have demonstrated the inhibitory effects of whole grape extracts, individual grape antioxidants, or their mixture on cox activity and gene expression [6365]. In addition, a study found that grape antioxidants exert an antitumor activity partially related to their immunopotentiating activities through the enhancements of lymphocyte proliferation, nk cell cytotoxicity, cd4+/cd8 + ratio, il-2, and ifn- productions . Grape antioxidants are also shown to modify estrogen receptor (er) and are therefore especially relevant for gynecological cancers such as breast cancer . For example, some grape antioxidants such as resveratrol, quercetin, and catechin exhibit both estrogenic and antiestrogenic effects due to their structural similarity to the steroid hormone estrogen [67, 68]. Resveratrol was reported to bind er and er with comparable affinity but that the estrogen agonist activity of resveratrol was greater with er than with er . The binding affinity of grape skin anthocyanidins (anthocyanin aglycones) to er was 10,000- to 20,000-fold lower than that of the endogenous estrogen estradiol and these compounds at treatment levels of 1020 mols / l on mcf-7 cells exhibited a weak but statistically significant estrogenic activity . However, in combination treatments with estradiol, three grape anthocyanidins showed antiestrogenic activity, which could be potentially explained by competition for the estrogen receptor and lower intrinsic activity of the phytoestrogens than estradiol . It has been suggested that the number of hydroxy groups in grape pigments had a substantial effect on the estrogen activity . The presence of up to two hydroxy groups in the b - ring of the molecular structure decreased the affinity of the anthocyanidins to the er . Grape anthocyanidins showed estrogen - inducible cell proliferation in mcf-7 breast cancer cell line but not in the receptor - negative mda - mb-231 cell line . The fact that 4-hydroxytamoxifen, the receptor antagonist, can block the anthocyanidins - induced cell proliferation and combination treatments of anthocyanidins with estradiol - reduced proliferative activity of estradiol strongly suggest that the estrogenic activity of certain grape is relevant to its beneficial activity against estrogen - dependent cancers . Epidermal growth factor receptor (egfr) is a type i tyrosine kinase receptor belonging to a family of receptors that also includes her2, her3, and her4 . Aberrant egfr activation, mediated primarily through changes in gene amplification and autocrine stimulation, appears to be a key factor in tumorigenesis, as well as an essential driving force for the aggressive growth behavior of cancer cells . Grape antioxidants have been shown to inhibit expression of epidermal growth factor receptor (egfr) in head and neck squamous cell carcinoma (hnscc) cells which also caused an inhibition of the phosphorylation of extracellular signal - regulated kinase (erk1/2), the highly conserved ras / mitogen - activated protein kinase (mapk)-dependent pathway (one of egfr major downstream pathways). This effect is supported by another study that found that grape seed antioxidants inhibited constitutive activation of mapk / erk1/2 and mapk / p38 in mda - mb-468 cells . The effects of grape antioxidants on cell cycle arrest are reported to be involved in promoting the expression of p21(cip1)/p27(kip1) protein g1-phase arrest . Grape antioxidants can also target the transcription factor nuclear factor kappa b (nf-b) by inhibiting its dna - binding capacity to inhibit cancer cell invasion . Recent in vitro and in vivo studies on potential anticancer properties of grape antioxidants are discussed as follows . Grape antioxidants especially grape seed proanthocyanidins (gsps) show very promising inhibitory effects on a variety of cancer cells . Non - small - cell lung cancer (nsclc) represents approximately 80% of total lung cancer cases, the leading cause of cancer - related deaths . Gsps have been shown to induce apoptosis of nsclc cells: a549 and h1299, which are mediated through increased expression of proapoptotic protein bax, decreased expression of antiapoptotic proteins bcl2 and bcl - xl, disruption of mitochondrial membrane potential, and activation of caspases 9, 3, and poly(adp - ribose) polymerase (parp). Overexpression of cox-2 and prostaglandins (pg) is linked to a wide variety of human cancers . In vitro treatment of nsclc cells (a549, h1299, h460, h226, and h157) with gsps resulted in significant growth inhibition and induction of apoptosis, which were associated with the inhibitory effects of gsps on the overexpression of cox-2 and prostaglandin (pg) e2 receptors (ep1 and ep4) in these cells . Grape seed extract (gse) was also found to selectively inhibit the growth and cause cell cycle arrest and apoptotic death in both detroit 562 and fadu hnscc cells by activating dna damage checkpoint cascade, including ataxia telangiectasia mutated / ataxia telangiectasia - rad3-related - checkpoint kinase 1/2-cell division cycle 25c as well as caspases 8, 9, and 3 . In addition, gse - caused accumulation of intracellular ros was identified as a major mechanism of its effect for growth inhibition, dna damage and apoptosis, which was remarkably reversed by antioxidant n - acetylcysteine . Gsps have recently shown to concentration - dependent inhibit human cutaneous hnscc cell invasion, which was associated with a reduction in the levels of epidermal growth factor receptor (egfr) and the inhibition of the phosphorylation of erk1/2, a member of mitogen - activated protein kinase family . Additionally, inhibition of human cutaneous hnscc cell invasion by gsps was associated with reversal of epithelial - to - mesenchymal transition (emt) process, which resulted in an increase in the levels of epithelial biomarker (e - cadherin) while loss of mesenchymal biomarkers (vimentin, fibronectin, and n - cadherin) in cells . These data suggest a potential for gsps to be developed and used for the prevention of invasion / metastasis of hnscc cells . Melanoma is the leading cause of death from skin disease, and treatment of human melanoma a375 and hs294 t cells with gsps resulted in a concentration - dependent inhibition of invasion or cell migration of these cells, which was related to a significant reduction in the levels of cox-2 expression and pge(2) production . Oec - m1 cells lead to cell cycle arrest by increasing the expression of p21(cip1)/p27(kip1) protein without functioning mitochondria - mediated apoptosis, whereas gsp on scc-25 cells inhibits cell proliferation via both g1-phase arrest and mitochondria - mediated apoptosis in a dose - dependent manner as a result of alterations of bcl-2 . Moreover, gsp can inhibit the migration and invasion of both cells, which are associated with the suppression of matrix metalloproteinases (mmps), mmp-2, and mmp-9 . A polyphenolic fraction isolated from grape seeds that is rich in procyanidins inhibits constitutive activation of mapk / erk1/2 and mapk / p38 and causes an induction of cdki cip1/p21 and a decrease in cdk4 in mda - mb-468 cells . Constitutive activation of erk1/2 pathway has been shown to be associated with human breast carcinomas and derived cell lines for uncontrolled growth [80, 81]. These effects of gsp result in a g1 arrest in cell cycle, followed by an irreversible inhibition of cell growth . The activity is supported by another study which found that gse upregulates p21 (cip1) through redox - mediated activation of erk1/2 pathway and posttranscriptional regulation leading to cell cycle arrest in colon carcinoma ht29 cells . Gse is also protective against prostate cancer which was shown to inhibit histone acetyltransferases (hats) in lncap cells, leading to decreased androgen - receptor- (ar-) mediated transcription and cancer cell growth . In addition, gse can downregulate urokinase plasminogen activator (upa) and dna - binding activity of the transcription factor nuclear factor kappa b (nf-b) in highly metastatic androgen - independent pc3 prostate cancer cells and therefore inhibits cell invasion . Study found that procyanidins from wild grape seeds can regulate are - mediated enzyme expression via nrf2 coupled with p38 and pi3k / akt pathway in hepg2 cells and could be used as a potential natural chemopreventive agent through nrf2/are - mediated phase ii detoxifying / antioxidant enzymes induction via p38 and pi3k / akt pathway . Growth of certain colon cancer cells is also inhibited by gse which exerts both antiproliferative and apoptotic effects on caco2 and hct-8 colon cancer cells, and its inhibitive effects were stronger than isolated procyanidins, suggesting a potential additive or synergistic effect among the grape seed components . Another study found that the combination of resveratrol, a prominent grape skin component, and grape seed extract induces much more pronounced apoptosis in colon cancer cells, which is strongly correlated with p53 levels and bax: bcl-2 ratio . Most in vivo studies of anticancer properties of grape components focused on gse or proanthocyanidin fraction of gse (e.g., gsps). In 1999, agarwal and his colleagues conducted a thorough review on in vivo efficacy and potential working mechanisms of gse and grape - based products against a variety of cancers . Therefore, in this paper we discussed the in vivo studies that were conducted since 1999 . Dietary intake of gse (0.2% gse wt / wt in diet) decreased hnscc detroit 562 and fadu xenograft tumor growth by 67 and 65% (p <0.001), respectively . Xenografts from gse - fed groups showed decreased proliferation but increased dna damage and apoptosis . Administration of 50, 100, or 200 mg gsps / kg body weight of mice by oral gavage (5 d / week) markedly inhibited the growth of nsclc a549 and h1299 lung tumor xenografts in athymic nude mice, which was associated with the induction of apoptotic cell death, increased expression of bax, reduced expression of antiapoptotic proteins, and activation of caspase-3 in tumor xenograft cells, suggesting a consistency between the observations of in vitro and in vivo studies . The growth - inhibitory effect of dietary gsps (0.5%, w / w) was also shown on the nsclc xenografts, and the inhibition was associated with the inhibition of cox-2, pge(2), and pge(2) receptors (ep1, ep3, and ep4) in tumors . A recent study showed that dietary supplementation of grape seed extract (0.25 or 0.5% (w / w) caused strong chemopreventive efficacy in fischer 344 rats against azoxymethane- (aom-)induced aberrant crypt foci (acf) formation (as much as 60% reduction in number of acf and 66% reduction in crypt multiplicity). The literature search on various databases found only one human trial on grape products and cancer treatment that examined the role of grape products specifically grape seed proanthocyanidin extract in patients with breast induration following radiotherapy for breast cancer and found no significant effect . With respect to preventive effect, a human study showed that 8-week dietary supplementation of grape juice (480 ml / day) reduced lymphocyte dna damage by reducing the formation of reactive oxygen species by as much as 15%, suggesting that a potential anticarcinogenic role for grape products by providing antioxidant protection . In summary, with respect to cancer prevention and treatment, grape seed extracts or its proanthocyanidins have received most investigation for their potential anticancer activities . Some studies show very promising potential of gse as an anticancer agent . However, most available reports are focusing on their in vitro activities and mechanisms . Since the absorption of these phenolic compounds is limited, the dose responses of gse and its components need to be determined in animals and humans as well as its in vivo mechanisms . The potential use of grape skin and seed extracts in cancer prevention has great potential, and further investigation into this exciting field is warranted.
|
Over the past few years, many advances have been made in mass spectrometry techniques and protein enrichment strategies that have significantly improved the detection efficiency of phosphorylated proteins (1,2). Consequently, steadily increasing numbers of phosphorylated peptides are being reported from mouse and human cell lines as well as tissue samples (3,4). However, the knowledge of the phosphorylated sites per se is neither sufficient to identify how signals are propagated into cells nor adequate to define the complexity of the intracellular networks . To fully appreciate the relevance of phosphoproteomic approaches it is essential to gain additional knowledge about the biological conditions under which the phosphorylation occurs, to identify the enzymes (kinases and phosphatases) that switch on and off their substrates, and to understand the functional consequences that these modification events have on cellular processes . Amino acid phosphorylation is probably the most abundant of the intracellular post - translational protein modifications used to regulate the state of eukaryotic cells, with estimates ranging up to 500 000 phosphorylation sites in the human proteome (5). It is considered that cell regulatory systems exhibit the property of robustness, but that this vital property cannot be achieved without system complexity (6). Complexity is therefore inevitable and unavoidable, yet it is probable that it has so far been systematically underestimated . However, there are now indications that we are at the dawn of a new and more realistic era in our approaches to signaling research (7). More and more authors are highlighting the importance of factors such as cooperativity, networking, redundancy and decision - making by in - complex molecular switching as we move away from overly linear pathway - based descriptions of cellular systems (814). In this context, the efforts to deploy large scale phosphoproteomics to map cellular networks (e.g. (1517)) can be seen as indispensable to the process of covering more of the signaling network space . An important aspect to consider is the evolutionary conservation of the phospho - residues . Due to their crucial role in regulating protein function however, phosphorylation motifs are short, strongly dependent on the surrounding context (18) and often reside in unstructured and rapidly - evolving regions (19), hence they have been difficult to trace evolutionarily and mixed conclusions have been reported (20,21). Lack of data has limited the possibility for this kind of analysis; only recently has phosphoproteomic data been available from different model organisms, thereby enabling comparative studies of the evolutionary and functional dynamics of reversible phosphorylation across eukaryotes (20). A significant, though not so surprising, observation is that phosphorylated residues are significantly more conserved than equivalent but non - phosphorylated ones (10,22,23). Since the future knowledge and exploitation of reversible phosphorylation relies on the accessibility of the data, it is of fundamental importance to develop and maintain public repositories to facilitate data retrieval for both wet lab scientists and computational biologists . In this article we describe the content and the more recent features of phospho.elm, a manually curated web - based resource dedicated to eukaryotic phosphorylation sites . The core structure of the database has been retained (24,25) and extended, while new features have been implemented to improve data retrieval and presentation . In addition to a much larger data set, information for the phosphorylated residue, i.e. A conservation score (cs) and the surface accessibility score (either calculated or predicted), have also been included in the update . The phospho.elm data can be accessed by a user - friendly web interface, directly via url, or programmatically via a xml / soap web service . The user can query the database by keyword or sequence identifier [from uniprot (26) or ensembl (27)] to get information about single proteins / substrates, or by kinase name to retrieve all phosphorylated substrates of a particular kinase . Table 1.examples of different search options for retrieving data stored in the phospho.elm resourcephospho.elm data retrieval methodsinput queryresultaccess via web interface: http://phospho.elm.eu.org/protein name (keyword)retrieval of phosphorylation sites identified in sequences of the same substrate for multiple speciesuniprot or ensembl accretrieval of phosphorylation sites of a specific sequencekinase nameretrieval of phosphorylation sites recognized by the specified kinaseaccess via url: input prefix: http://phospho.elm.eu.org/byaccession/src_human.htmlretrieval of the human src (uniprot acc p12931)byaccession / p12931.htmlbyaccession / p12931,p07948.htmlretrieval of all the phosphorylation sites of two proteins (uniprot acc p12931 and p07948)byaccession / p12931,p07948.csvretrieval of a plain output of the phosphorylation sites of two proteins (uniprot acc p12931 and p07948)bydomain / cbl_sh2.htmlretrieval of phosphorylation sites which bind to the phospho - binding domain cbl_sh2p12931.fastaretrieval of the protein sequence stored in the phospho.elm databaseaccess via phosphoblast: http://phospho.elm.eu.org/pelmblastsearch.htmluniprot ac or text sequenceretrieval of phosphorylation sites that are conserved in related proteins (whether orthologues or paralogues)access via web service: http://phospho.elm.eu.org/webservice/phosphoelmdb.wsdlpelmdbws = phosphoelmdblocator().getphosphoelmdb()for retrieving phosphorylation sites recognized by the selected kinase (e.g. Alk)kinasename = alk'req = getinstancesbykinasetextsearchrequestmsg()req._querytext = kinasenameresult = pelmdbws.getinstancesbykinasetextsearch(req) examples of different search options for retrieving data stored in the phospho.elm resource the results page displays all phosphoproteins and phosphorylation sites (instances) meeting the searching criteria; the results tables can be sorted on any column, aiding inspection of the data according to different criteria, such as: the residue number and code, the pubmed references, the sequence (10) surrounding the phospho - residue and, when available, the upstream kinases as well as the phosphopeptide - binding domains, such as the sh2, 14 - 3 - 3 or ptb domains (these data have been annotated for 1250 phosphosites). Furthermore, links to matching kinase recognition motif entries stored in the elm database (28) is provided when available . Figure 1.output example of a phospho.elm search using the cyclin dependent kinase inhibitor 1b (uniprot p46527) as query . The results table contains: the phosphorylated residue and its position; surrounding sequence; kinase responsible for the phosphorylation; literature reference; type of source (htp / ltp); conservation score; link to elm database; annotation of domain which binds to the phosphorylated residue; protein domain identified by smart or pfam; a disorder score calculated by iupred; link to pdb structure; and accessibility score calculated by phospho3d . The conservation of the instance and the multiple sequence alignment that was used to calculate the cs can be inspected using the jalview plugin (top right). Furthermore links to phospho3d and the respective elm entry are shown at the bottom right . Output example of a phospho.elm search using the cyclin dependent kinase inhibitor 1b (uniprot p46527) as query . The results table contains: the phosphorylated residue and its position; surrounding sequence; kinase responsible for the phosphorylation; literature reference; type of source (htp / ltp); conservation score; link to elm database; annotation of domain which binds to the phosphorylated residue; protein domain identified by smart or pfam; a disorder score calculated by iupred; link to pdb structure; and accessibility score calculated by phospho3d . The conservation of the instance and the multiple sequence alignment that was used to calculate the cs can be inspected using the jalview plugin (top right). Furthermore links to phospho3d and the respective elm entry are shown at the bottom right . It should be mentioned that this percentage has decreased since the last phospho.elm publication (25); this data reflects the current limitation of both experimental and computational methods in assigning the kinase recognizing a given phosphorylation site . Since this information is relevant for gaining insights into the regulation of cellular processes, we provide direct links to networkin (29), a database of predicted kinase in addition, we encourage our users to explore the links to other resources that integrate information on signaling networks or protein protein interactions, such as mint (30) and string (31), to expand their knowledge of the phosphoprotein substrates . The entire phospho.elm data set can be freely downloaded in a tab - delimited format at: http://phospho.elm.eu.org/dataset.html the current release of the phospho.elm data set (version 9.0) contains more than 42 500 non - redundant instances of phosphorylated residues in more than 11 000 different protein sequences (3370 tyrosine, 31 754 serine and 7449 threonine residues). For each phosphosite we report whether the phosphorylation evidence has been identified by small - scale analyses (low - throughput, ltp) and/or by large - scale experiments (high - throughput, htp), which mainly apply ms techniques . The venn diagram in figure 2 shows the remarkably small overlap between the ltp and htp phospho - instances . A total of 4249 instances have been obtained exclusively by ltp experiments and 37 413 instances solely by htp assays while 846 instances were confirmed by both htp and ltp analyses . A total of 4249 instances have been obtained exclusively by ltp experiments and 37 413 instances solely by htp assays while 846 instances were confirmed by both htp and ltp analyses . The majority of the protein instances from phospho . Elm are vertebrate (mostly homo sapiens (62%) and mus musculus (16%)) though 22% are from other species, mainly drosophila melanogaster (13%) and caenorhabditis elegans (7%). In total, more than 300 different kinases have been annotated and a document providing additional information about all kinases annotated in phospho.elm can be found at http://phospho.elm.eu.org/kinases.html . In order to improve the biological understanding of a particular site and thereby indirectly providing the users with additional evidence, we have added information about sequence conservation . This will help researchers to better assess the reliability of the identified sites, especially for those derived from proteomic analyses . For each instance, we have calculated the conservation score (cs) as described in chica et al . The conservation of the phosphorylation sites in the database has been calculated using a tree - based approach specifically developed for assessing the conservation of short linear protein motifs (32), also accessible as individual service at http://conscore.embl.de . The method takes into account the presence / absence of the phosphorylated serine, threonine or tyrosine in relation to the global sequence conservation and gives a value between 0 and 1, where 1 indicates conservation in all the homologous sequences at a certain distance from the query sequence, and 0 corresponds to absence of conservation . The cs of an instance is an estimation of the persistence of a phosphosite during the divergent evolution of a homologous protein sequence set . In a protein - centered view a high cs, together with other contextual information such as high residue accessibility, represents cumulative evidence for the biological relevance of such a site . This is particularly useful when analyzing htp sites that might be phosphorylated in vitro but not in vivo . The distribution of the cs of manually annotated instances is indeed significantly (p - value <2.2e-16) skewed towards 1, in comparison to that of the instances coming from htp experiments (figure 3). Figure 3.distribution of the conservation scores for ltp and htp instances in the phospho.elm database . The two distributions differ according to the kolmogorov - smirnov test with p - value <2.2e-16, with the ltp sites being more conserved . The two distributions differ according to the kolmogorov - smirnov test with p - value <2.2e-16, with the ltp sites being more conserved . In a protein interaction network context, the cs can be used to suggest evolutionarily stable protein interactions as well as taxa - specific interactions that might have been gained during evolution as regulatory circuits are changed and modulated . Alignments between the phosphoprotein and the corresponding homologous sequences are available for close inspection of the conservation of the phosphosites of interest in different species (figure 1, button, the alignment editor jalview (33) (http://www.jalview.org) has been embedded as a java plugin in the html output . Here, known instances are highlighted in different colors according to the phospho - residues (light green for phosphotyrosine, purple for phosphoserine and red for phosphothreonine), while the conservation of the corresponding peptides in the aligned sequences are displayed as dark green columns . We urge users to look at these alignments, particularly if the cs is low, since there are several factors unrelated to the evolution of the protein sequence, e.g. Sequencing errors in not well studied genomes, which could artificially diminish the score even if the site itself is quite conserved across different species . Phosphorylation sites are often found in intrinsically disordered regions of proteins (34), which usually cannot be experimentally determined by x - ray crystallography . However, in a number of cases, they lie on globular domains whose sequence can confidently be mapped onto x - ray determined structures . For the latter sites, accessibility to the solvent can be calculated . Currently we have been able to assign an accessibility value to 3% of all the sites in phospho.elm (1281 of 42 574 instances) and we anticipate that this number will increase in parallel with the increase in solved structures . These data are particularly relevant for bioinformaticians who develop computational methods to predict kinase substrates . Because of the transient nature of phosphorylation events, phosphorylation sites tend to lie on the surface of proteins . Many studies [see via et al . (35) for a summary] have shown that the substrate specificity is not only dependent on the primary sequence of the motif hosting the phosphorylation site, but also on its structural conformation . The correspondence between a phospho.elm sequence and an x - ray protein data bank (pdb) structure (36) is based on sequence alignment using at least 98% global sequence identity and 100% identity at the phosphorylation site . When more than one pdb structure corresponded to a single phospho.elm sequence, one with the lowest resolution was retained . Whenever a site can be mapped onto a pdb structure, its solvent accessibility (sa in) is taken from dssp (37) and the corresponding percentage is obtained by normalizing the sa to the phospho - residue accessibility maximum value [as determined in (38)]. Furthermore, we have also integrated protein surface accessibility data and links to structural data (when available) obtained from the phospho3d database (39). For details on the structure, one can follow the link to pdbe (40) (http://www.ebi.ac.uk/pdbe). The accessibility data, however, should be interpreted in the context of the structure . For example, a low accessibility value (of 18%) is reported in the phospho.elm entry for the human src (uniprot p12931) tyrosine 530, which is a well known substrate of the csk kinase . This is due to the fact that the structure used to calculate the accessibility has been determined in a closed src conformation, where the phosphorylated tail binds to the sh2 domain . In general, when evaluating the sa of an instance, the user is advised to be aware of the instance molecular context . Note that in most cases, the best resolution structures are not in the phosphorylated conformation (i.e. With the phosphate moiety attached) or, as in the src example, they are in a phosphorylated but closed, inactive conformation . In particular, if a site becomes available to its cognate kinase only as a consequence of a conformational change, this might be reflected in a (transiently) low accessibility value . In the great majority of the cases (97%), either an x - ray reference structure is not available for a phospho.elm sequence or a structure can be found but the phosphorylation site falls in an unresolved (disordered) region of the structure . In these cases, we provide the users with predicted accessibility values . The sa predictions were carried out using the real - spine integrated system of neural networks (41). The accessibility score is shown as the last column in the html output (figure 1) and, when provided, it is linked to the phospho3d resource (http://arianna.bio.uniroma1.it/phospho3d). The user is encouraged to investigate this link to gain more insight into the structural features of the particular protein including a 3d representation of the instance as well as a comparison of all pdb entries available for that instance . The pdb entry that was used to calculate the score, is listed in the second last column of the html output and is linked to the pdbe resource at the ebi where different viewers are available for closer inspection of the site . In addition to providing more evidence about the structural properties of the region surrounding the phosphosites, we determine if the sites reside within domains annotated in the smart resource (42). Furthermore, for each phosphosite, a probabilistic score was calculated ranging from 0 (complete order) to 1 (complete disorder) using the iupred intrinsic order disorder predictor (43). Long and a window of 21 residues for smoothing the score . In the html output table, iupred scores below 0.5 (predicted ordered) are colored in grey while iupred scores above 0.5 (predicted disordered) are colored in black . Figure 4 shows the distributions of iupred scores for instances that reside either within (upper panel) or outside (lower panel) known smart domains . Outside the known domains, the sites are strongly skewed to the native disorder values, reaffirming the earlier analyses (34). These curves may help in understanding the nature of cell regulation as they imply that most protein phosphorylation explicitly modulates protein protein interactions in dynamic regulatory systems, rather than through allosteric regulation of the shape of the modified protein, although this is clearly an important function of the less abundant in - domain sites . Instances with an iupred score above 0.5 are predicted to be in a region of polypeptide sequence that is intrinsically disordered (i.e. Cannot fold into a stable native structure). Instances that reside outside globular domains have a tendency towards higher iupred scores (disordered, lower panel) whereas the scores of instances within domains are more evenly distributed (upper panel). Note that sites mapping outside the known domains are predicted to be predominantly in natively disordered polypeptides . Instances with an iupred score above 0.5 are predicted to be in a region of polypeptide sequence that is intrinsically disordered (i.e. Cannot fold into a stable native structure). Instances that reside outside globular domains have a tendency towards higher iupred scores (disordered, lower panel) whereas the scores of instances within domains are more evenly distributed (upper panel). Note that sites mapping outside the known domains are predicted to be predominantly in natively disordered polypeptides . A few years ago it was estimated that more than 100 000 phosphorylation sites might exist in the human proteome (44). Recently this number has been corrected upwards to more than 500 000 sites (5). Yet it seems quite plausible, given the low ltp / htp overlap in figure 2 . Other bioinformatics resources also incorporate substantial phosphorylation data: more general ones are uniprot (26), hprd (45), and phosphositeplus (46). The latter provides mainly phosphorylation sites from vertebrata, but also includes data from other ptms such as acetylation, methylation, ubiquitination, and o - glycosylation . Both phosida (47) and phosphopep (48) are specialized in annotation of large - scale experiments; phosphogrid for saccharomyces cerevisiae (49), virptm for viruses (50) and pdb for various plants (51) are devoted to specific species . Additional information on phosphorylation resources can be found at the phospho.elm link page (http://phospho.embl.de/links.html) and at the gps compendium of computational resources for protein phosphorylation (52) (http://gps.biocuckoo.org/links.php). In addition, a collection of phosphorylation databases and predictors has been recently published in a review by via et al . Though we intend to incorporate the most relevant large - scale analyses, we consider our main effort should be on the collection of manually curated phosphorylation sites and related information derived from small - scale experiments on various model organisms . In the near future, we plan to integrate more information on phosphorylation motifs and protein kinase specificity, such as the kinase docking motifs (53). In order to provide an up - to - date and comprehensive resource, we encourage our users to participate in the curation of the phospho.elm resource by submitting their own data (http://phospho.elm.eu.org/submit.html).
|
Thallus crustose, epiphloeodal, thick, up to 1 mm high, bulging and partly flaking away from the substratum, gray . Surface dull to rarely slightly shiny, smooth to somewhat mealy, continuous, unfissured . True cortex absent, thallus covered by continuous phenocortex up to c. 40 m high, hyaline, dense, conglutinated, formed from irregular hyphae . Photobiont layer usually continuous and well developed, sometimes becoming inconspicuous due to crystal inclusions, 70~120 (~210) m high, calcium oxalate crystals abundant, small to large, scattered or clustered, sometimes forming column - like structures, distinct . Medulla well developed, hyaline, not clearly separated to separated from the photobiont, of tightly packed interwoven hyphae with narrow lumina . Ascomata apothecia (lepadinoid - type), abundant, conspicuous, 0.5~1 (~2) mm diam ., pores wide, 0.3~0.8 (~1.8) mm in diam ., formed by proper exciple, proper exciple apically or in upper parts becoming visible from surface, rounded to irregular or angular, with an entire to indistinctly split, free, whitish to off - white, incurved to erect . Thalline rim margin moderately thin to thick, roundish to irregular or angular, entire, concolorous with thallus or brighter than thallus . Proper exciple leucodecton - type, cupular, becoming partly to entirely free, thin, c. 10~25 m deep at base, 20~35 m wide laterally, comprising hyaline to pale yellowish or pale brownish conglutinated prosoplectenchymatous hyphae, with a darker brown pigmentation or carbonization towards the apex, non - amyloid . Paraphyses simple, straight, interwoven, tips slightly thickened, adspersed with fine grayish to brownish granules . Epihymenium thin, up to 3~4 m, hyaline, with grayish to pale brown granules; small calcium oxalate crystals are found in the pruina of the hymneium . Asci thelotrema - type, narrowly clavate, 90~135 10~15 m; 4~8 spored, uniseriate, transversely septate (immature) to submuriform (mature), cell walls moderately thick, endospore thin, non - halonate, hyaline (young) (fig . 1b), non - amyloid, ellipsoid to subglobose to oblong, with roundish to narrowed - roundish ends, loci roundish to angular, subglobose to oblong, with same shaped end cells, (19~) 20~22.5 (~23.3) (9.2~) 10~12.5 (~13.5) m with 4~5 1~3 loci . Secondary metabolites: absent, but traces of a pale spot at rf 36 (uv+ rose red), pale brown spot at rf 25 (uv-), and an unknown fluorescent green (uv+ red) were reported out which may be chemical constituents of bark . The species is reported in and around shinhung temple and is found growing over carpinus laxiflora bark at an altitude ranging from 750~884 m. the forest in route from shinhung temple to ulsan cliff and sejon - bong is dominated by abies firma and carpinus laxiflora mixed with prunus yedoensis and other deciduous trees . The species is characterized by thick, bulging thallus with many calcium oxalate crystal inclusions, the immersed, round to irregular ascomata with free exciple, ellipsoid to roundish submuriform, brown ascospores and lack of secondary substances . It is often confused with l. glaucescens (nyl .) A. frisch, l. occultum (eschw .) A. frisch, which generally differs from l. desquamescens by having smaller ascomata and other characters described below . Presence of stictic acid chemosyndrome separates l. desquamescens from l. glaucescens, l. fissurinum, and l. subcompunctum, while the presence of norstictic acid separates l. occultum from l. desquamescens . Furthermore, the thallus of l. occultum is ecorticate, while that of l. fissurinum and l. subcompunctum is fissured to fissured - areolate . For further differentiation between these species 750 m, on caprinus bark, 25 may 2009, y. joshi & party, 090873 (kolri); 3805'36 " n, 12825'176 " e, alt . 884 m, on caprinus laxiflora bark, 25 may 2009, y. joshi & party 090934 (kolri). Thallus crustose, epiphloeodal, thick, up to 1 mm high, bulging and partly flaking away from the substratum, gray . Surface dull to rarely slightly shiny, smooth to somewhat mealy, continuous, unfissured . True cortex absent, thallus covered by continuous phenocortex up to c. 40 m high, hyaline, dense, conglutinated, formed from irregular hyphae . Photobiont layer usually continuous and well developed, sometimes becoming inconspicuous due to crystal inclusions, 70~120 (~210) m high, calcium oxalate crystals abundant, small to large, scattered or clustered, sometimes forming column - like structures, distinct . Medulla well developed, hyaline, not clearly separated to separated from the photobiont, of tightly packed interwoven hyphae with narrow lumina . Ascomata apothecia (lepadinoid - type), abundant, conspicuous, 0.5~1 (~2) mm diam ., pores wide, 0.3~0.8 (~1.8) mm in diam ., formed by proper exciple, proper exciple apically or in upper parts becoming visible from surface, rounded to irregular or angular, with an entire to indistinctly split, free, whitish to off - white, incurved to erect . Thalline rim margin moderately thin to thick, roundish to irregular or angular, entire, concolorous with thallus or brighter than thallus . Proper exciple leucodecton - type, cupular, becoming partly to entirely free, thin, c. 10~25 m deep at base, 20~35 m wide laterally, comprising hyaline to pale yellowish or pale brownish conglutinated prosoplectenchymatous hyphae, with a darker brown pigmentation or carbonization towards the apex, non - amyloid . Paraphyses simple, straight, interwoven, tips slightly thickened, adspersed with fine grayish to brownish granules . Epihymenium thin, up to 3~4 m, hyaline, with grayish to pale brown granules; small calcium oxalate crystals are found in the pruina of the hymneium . Asci thelotrema - type, narrowly clavate, 90~135 10~15 m; 4~8 spored, uniseriate, transversely septate (immature) to submuriform (mature), cell walls moderately thick, endospore thin, non - halonate, hyaline (young) (fig . 1b), non - amyloid, ellipsoid to subglobose to oblong, with roundish to narrowed - roundish ends, loci roundish to angular, subglobose to oblong, with same shaped end cells, (19~) 20~22.5 (~23.3) (9.2~) 10~12.5 (~13.5) m with 4~5 1~3 loci . Secondary metabolites: absent, but traces of a pale spot at rf 36 (uv+ rose red), pale brown spot at rf 25 (uv-), and an unknown fluorescent green (uv+ red) were reported out which may be chemical constituents of bark . The species is reported in and around shinhung temple and is found growing over carpinus laxiflora bark at an altitude ranging from 750~884 m. the forest in route from shinhung temple to ulsan cliff and sejon - bong is dominated by abies firma and carpinus laxiflora mixed with prunus yedoensis and other deciduous trees . The species is characterized by thick, bulging thallus with many calcium oxalate crystal inclusions, the immersed, round to irregular ascomata with free exciple, ellipsoid to roundish submuriform, brown ascospores and lack of secondary substances . It is often confused with l. glaucescens (nyl .) A. frisch, l. occultum (eschw .) A. frisch, which generally differs from l. desquamescens by having smaller ascomata and other characters described below . Presence of stictic acid chemosyndrome separates l. desquamescens from l. glaucescens, l. fissurinum, and l. subcompunctum, while the presence of norstictic acid separates l. occultum from l. desquamescens . Furthermore, the thallus of l. occultum is ecorticate, while that of l. fissurinum and l. subcompunctum is fissured to fissured - areolate . For further differentiation between these species 750 m, on caprinus bark, 25 may 2009, y. joshi & party, 090873 (kolri); 3805'36 " n, 12825'176 " e, alt . 884 m, on caprinus laxiflora bark, 25 may 2009, y. joshi & party 090934 (kolri). Thallus crustose, epiphloeodal, thick, up to 1 mm high, bulging and partly flaking away from the substratum, gray . Surface dull to rarely slightly shiny, smooth to somewhat mealy, continuous, unfissured . True cortex absent, thallus covered by continuous phenocortex up to c. 40 m high, hyaline, dense, conglutinated, formed from irregular hyphae . Photobiont layer usually continuous and well developed, sometimes becoming inconspicuous due to crystal inclusions, 70~120 (~210) m high, calcium oxalate crystals abundant, small to large, scattered or clustered, sometimes forming column - like structures, distinct . Medulla well developed, hyaline, not clearly separated to separated from the photobiont, of tightly packed interwoven hyphae with narrow lumina . Ascomata apothecia (lepadinoid - type), abundant, conspicuous, 0.5~1 (~2) mm diam ., pores wide, 0.3~0.8 (~1.8) mm in diam ., formed by proper exciple, proper exciple apically or in upper parts becoming visible from surface, rounded to irregular or angular, with an entire to indistinctly split, free, whitish to off - white, incurved to erect . Thalline rim margin moderately thin to thick, roundish to irregular or angular, entire, concolorous with thallus or brighter than thallus . . Proper exciple leucodecton - type, cupular, becoming partly to entirely free, thin, c. 10~25 m deep at base, 20~35 m wide laterally, comprising hyaline to pale yellowish or pale brownish conglutinated prosoplectenchymatous hyphae, with a darker brown pigmentation or carbonization towards the apex, non - amyloid . Paraphyses simple, straight, interwoven, tips slightly thickened, adspersed with fine grayish to brownish granules . Epihymenium thin, up to 3~4 m, hyaline, with grayish to pale brown granules; small calcium oxalate crystals are found in the pruina of the hymneium . Asci thelotrema - type, narrowly clavate, 90~135 10~15 m; 4~8 spored, uniseriate, transversely septate (immature) to submuriform (mature), cell walls moderately thick, endospore thin, non - halonate, hyaline (young) (fig . 1b), non - amyloid, ellipsoid to subglobose to oblong, with roundish to narrowed - roundish ends, loci roundish to angular, subglobose to oblong, with same shaped end cells, (19~) 20~22.5 (~23.3) (9.2~) 10~12.5 (~13.5) m with 4~5 1~3 loci . Secondary metabolites: absent, but traces of a pale spot at rf 36 (uv+ rose red), pale brown spot at rf 25 (uv-), and an unknown fluorescent green (uv+ red) were reported out which may be chemical constituents of bark . The species is reported in and around shinhung temple and is found growing over carpinus laxiflora bark at an altitude ranging from 750~884 m. the forest in route from shinhung temple to ulsan cliff and sejon - bong is dominated by abies firma and carpinus laxiflora mixed with prunus yedoensis and other deciduous trees . The species is characterized by thick, bulging thallus with many calcium oxalate crystal inclusions, the immersed, round to irregular ascomata with free exciple, ellipsoid to roundish submuriform, brown ascospores and lack of secondary substances . It is often confused with l. glaucescens (nyl .) A. frisch, l. occultum (eschw .) A. frisch, which generally differs from l. desquamescens by having smaller ascomata and other characters described below . Presence of stictic acid chemosyndrome separates l. desquamescens from l. glaucescens, l. fissurinum, and l. subcompunctum, while the presence of norstictic acid separates l. occultum from l. desquamescens . Furthermore, the thallus of l. occultum is ecorticate, while that of l. fissurinum and l. subcompunctum is fissured to fissured - areolate . For further differentiation between these species 750 m, on caprinus bark, 25 may 2009, y. joshi & party, 090873 (kolri); 3805'36 " n, 12825'176 " e, alt . 884 m, on caprinus laxiflora bark, 25 may 2009, y. joshi & party 090934 (kolri).
|
All authors have contributed significantly in designing and organizing to write manuscript, collecting data as well help in critical analysing the manuscript.
|
Several epidemiological studies have shown that the prevalence of bronchial asthma and obesity is increasing concomitantly worldwide among children and young adults . The mechanisms of these pathologies remain unclear despite a number of publications on the relationship between the two diseases [2, 3]. Obesity may be associated with respiratory symptoms via cardio - respiratory deconditioning, physiological restriction of the chest wall by excess adipose tissue, or comorbidities, including gastroesophageal reflux and sleep - disordered breathing . The disruption of immune tolerance mechanisms by obesity - associated adipokines and cytokines has been demonstrated to be involved in the association of obesity with asthma and autoimmune diseases . Leptin and adiponectin are two adipokines that are being studied to determine their association with asthma . Serum leptin is proinflammatory that affects both innate and adaptive immune responses, and serum levels are markedly increased in obesity [7, 9]. Serum adiponectin has important anti - inflammatory effects in obesity that inhibits proinflammatory cytokines (tnf - a, il-6, and nuclear factor - kb) and induces anti - inflammatory cytokines (il-10 and il-1 receptor antagonist) [7, 10]. Thus, leptin and adiponectin could have a role in the pathogenesis of asthma as supported by animal studies [11, 12], and only few studies have been done in humans to convincingly establish a link between adipokines and asthma [1315]. The aim of the present study was to evaluate serum leptin and adiponectin concentrations in asthmatic school children and to investigate their association with obesity and degree of asthma control . This prospective cohort study was conducted at the pediatric pulmonary clinic of the department of pediatrics, hamad medical corporation (hmc). From april 2012 to november 2012, 60 children (31 nonobese asthmatics and 29 obese asthmatics) met inclusion criteria . The following inclusion criteria were used: (i) age between 7 to 14 years; (ii) the diagnosis of asthma was based on physician's diagnosis and according to american thoracic society (ats) guidelines . In addition in accordance with guidelines of the global initiative with the asthmatic patients that had history of recurrent chest symptoms such as coughing, dyspnea, and wheezing, which were relieved by bronchodilator treatment, they also demonstrated reversible airflow limitation . The international study of asthma and allergy in childhood (isaac) questionnaire was used to assess asthma - related symptoms; (iii) patients visited as followup in the pediatric pulmonary clinics at hmc . Exclusion criteria were all of the children had been free of respiratory tract infections for more than 4 weeks prior to enrollment, healthy obese and nonobese subjects with any history of chronic lung disease such as cystic fibrosis (cf), non - cf bronchiectasis, chronic lung of prematurity (bpd), interstitial lung diseases, asthma exacerbation requiring systemic steroids within 4 weeks, secondary obesity with or without association with chromosomal or genetic anomalies . This study was reviewed and approved by the local ethics committee at hamad medical corporation (number 12006/12). During their initial visits, allergic rhinitis (ar) was assessed based on the medical history including symptoms and a physical examination, in addition to skin prick tests and serum ige . Patients spirometric tests were performed in the respiratory laboratory unit in accordance with standards of the american thoracic society . Forced vital capacity (fvc; in liters), forced expiratory volume in 1 second (fev1; in liters), and fev1/fvc were measured using a flow - sensing spirometer (sensor medicus model v6200, germany). All - age predicted values for spirometry were used and z - score was calculated . Anthropometric measurements were performed using digital electronic platform scale and standing height measurement without shoes using a stadiometer . Body mass index (bmi) was calculated by dividing weight in kg by height squared in meters {weight (kg)/(height (m))} and adjusted for age and gender . Normal weight was defined as bmi z - score between 1.96 and + 1.96 and obesity was defined as bmi z - score> 1.96 . Data on demographic, anthropometric, serum lipids, spirometric measures, and allergy status were recorded and analyzed . Blood samples were collected by a skilled and qualified technician at the outpatient clinic around 8 a.m. in the morning following an overnight fast . After collection, the blood samples were centrifuged for 10 minutes and stored at 70 c. the materials used for collection were disposable, adequately labeled, and of recognized quality . Leptin and adiponectin levels were measured using a commercially available enzyme - linked immunosorbent assay (elisa) kit according to the manufacturer's instructions and standard guidelines . The adequate sample was determined based on the primary outcome variables serum leptin and adiponectin levels between obese and nonobese asthmatic groups . As per literature review, the mean serum leptin levels in obese and nonobese asthmatic groups were found to be (16 7.5 ng / ml and 8.5 7.0 ng / ml) and adiponectin levels were observed to be (5.2 2.5 ng / ml and 3.0 2.0 ng / ml). With 90% power and at two sided 0.05 level of significance, the required sample size was 25 patients in each group . To account for the proportion of dropouts and nonparticipation it was planned to enroll 60 patients altogether . Categorical data was expressed as a frequency along with percentage and continuous data values presented in mean sd . Descriptive statistics were used to summarize all demographic anthropometric, serum lipids, and spirometric measures and other characteristics of the participants . Unpaired t - test was applied to compare mean of quantitative variables between the two independent groups (oa and noa). Quantitative variables means between more than two independent groups (well controlled, partially controlled, and uncontrolled asthma) were analyzed using one way analysis of variance (anova). The overall group was found to be significant, and bonferroni multiple comparison test was performed for pair - wise comparison . For nonnormal or skewed data the corresponding nonparametric tests mann - whitney u and kruskal - wallis tests were performed . For small cell frequencies, chi - square test with continuity correction factor or fisher's exact test was applied . Pearson's correlation coefficient was used to assess the strength of linear relationship between two or more quantitative variables . Multiple liner regression was applied to examine and assess the effect of demographic, anthropometric, and spirometric measures and allergy status on serum leptin levels . Scatter plot was constructed and used to demonstrate the graphical presentation of the linear relationship between the two quantitative variables . A two - sided p value <0.05 was considered to be statistically significant . All statistical analyses were done using the statistical package spss 19.0 (spss inc ., chicago, il). Between the periods from april 2012 to november 2012, a total of 60 asthmatic children, 29 with obesity and 31 without obesity, were enrolled in the study at the pediatric pulmonary clinic, hmc . There were 14 (23.3%) girls and 46 (76.7%) boys and mean age in obese asthmatic children was 10.9 1.9 years compared to nonobese asthmatic children 11.3 2.2 years (p = 0.432). The percentage of patients with allergic rhinitis was higher in obese asthmatic children compared to nonobese asthmatic children (62.1% versus 48.4%; p = 0.287). The demographic, anthropometric, serum lipids, and spirometric measures, allergy status, and other characteristics of the study population are shown in table 1 . There were no significant differences between oa and noa regarding age, sex, atopy serum total ige, fev1 z - score, and fvc z - score (p> 0.05). As expected, serum leptin levels were significantly higher among oa children compared to noa children (25.8 11.1 ng / ml versus 8.7 11.1 ng / ml; p <0.0001) while serum adiponectin levels were significantly lower among oa children compared to noa children (2.5 1.2 ng / ml versus 5.4 2.9 ng / ml; p <0.0001). Mean steroid dose does not differ significantly between obese and nonobese asthmatic children (301.1 152.8 versus 299.7 180.1; p = 0.975) as presented in table 1 . Most of the patients were considered to have adequate asthma controls (53.3% well controlled and 40% partially controlled) and 6.7% uncontrolled asthma with their respective medications . Serum leptin levels in well controlled, partially controlled, and uncontrolled asthma groups were found to be 17.01 14 ng / ml, 16.04 14.52 ng / ml, and 22.25 12.37 ng / ml, respectively . The serum leptin concentration in the uncontrolled group was higher than that in the well and partly controlled, but the difference was not statistically significant (p = 0.719). The serum adiponectin concentration in the uncontrolled group was observed to be lower 2.3 1.2 ng / ml compared to well controlled 3.8 2.5 and partially controlled 4.6 2.9 groups; however it did not differ significantly (p = 0.236). It is worth noting that the obesity was found to be similar across the asthma control groups . Lung function tests including fev1 z - score and fev1/fvc z - score ratio were strongly associated with degree of asthma controls . Mean fev1/fvc z - score was observationally higher among well controlled asthma 0.64 0.81 compared to partially controlled 1.13 0.84 and uncontrolled asthma 1.21 0.83 (p = 0.099). No significant association was observed between age, gender, bmi z - score, rhinitis, serum total ige, and asthma controlled groups . The comparison in the serum leptin, adiponectin concentrations, and other parameters in the three groups of asthma control is shown in table 2 . For the whole group of patients, bmi z - score was positively correlated with serum leptin levels (r = 0.74; p <0.001) and negatively correlated with adiponectin levels (r = 0.70, p <0.001) as demonstrated in figures 1 and 2 . The leptin level showed a significant negative correlation with the adiponectin levels (r = 0.61; p <0.001). No significant correlation was observed between leptin levels, ige, and spirometric parameters (data not shown here). Mean bmi and leptin were found to be higher in girls (24.6 5.9 ng / ml versus 23.7 7.2 ng / ml; p = 0.687) and (22.7 14.2 ng / ml versus 15.2 13.4 ng / ml; p = 0.081) compared to boys whereas mean adiponectin levels were significantly lower among girls compared to boys (2.6 1.1 ng / ml versus 4.4 2.8 ng / ml; p = 0.028). Stepwise multiple linear regression analysis showed that higher bmi (regression coefficient = 1.59; t = 10.3; p <0.001) and female gender (regression coefficient = 6.02; t = 2.41; p = 0.019) have had significant effect on serum leptin levels accounting effect of other covariates such as age, rhinitis, ige, fev1 z - score, and fvc z - score . There has been intense interest in the potential role of adipose tissue in the development of asthma in obesity and in the pathogenesis of asthma . Whether activity restriction causes obesity or obesity by itself causes the possibility that asthma may lead to obesity is less controversial, because of fear of exercise or inability to exercise regularly . The adipose tissue in obese subjects leads to a systemic inflammatory state which produces a rise in the serum concentrations of several proinflammatory cytokines, chemokines, and adipokines, such as leptin as proinflammatory and adiponectin as anti - inflammatory . As body weight increases, more leptin is produced as expected in our study population, where serum leptin levels show positive correlation with bmi z - score with higher levels in oa children in our study population . Adiponectin demonstrated a strong negative correlation with bmi z - score with lower levels in oa children, in contrast to a recent study where serum leptin levels were not elevated in obese asthmatics compared to nonobese asthmatics or controls but were only significantly raised in obese children without asthma . Although the relationship among obesity, asthma, and leptin cannot be adequately addressed in this study, we found that bmi is determining factor for leptin; however it did not have a significant association with asthma controls . The role of adipokines quite likely varies between different asthma inflammatory processes and reported data are inconclusive regarding the independent association between serum leptin or adiponectin and the risk of asthma . Adipocytes in the white adipose tissue are the main source of leptin, but adipocytes also secrete cytokines like tnf-, il-6, and il-10 . Tnf- stimulates the production of th2 type cytokines . In summary, a common inflammatory pathway in both, obesity and asthma, similar to leptin human data on the independent association between serum adiponectin concentration and asthma are currently inconclusive . In a recent study there were no significant differences between cell counts in induced sputum (eosinophils, macrophages, lymphocytes, and neutrophils) between obese and nonobese asthmatic patients . Asthma is often considered as a single disease entity, but it is actually a syndrome with many different pathological pathways ultimately leading to quite similar clinical presentation: variable airway obstruction with chest tightness, wheezing, and cough . Previously, conflicting results on the levels of adipokines in patients with asthma have been published including childhood asthma . Leptin has been reported to be increased [14, 25] or normal [26, 27] and adiponectin either decreased [28, 29] or normal [26, 27]. In addition, there are patient - related contributing factors like age, sex, and fat distribution . In this study, we did not find any correlation between leptin levels and ige or spirometric parameters although fev1 is considered a measure of asthma severity; it is not consistently related to inflammation or symptoms and is affected by multiple factors . This study examined the association of serum leptin and adiponectin in oa and noa children in relation with asthma control and we found that serum leptin and adiponectin concentrations did not differ among well controlled, partial controlled, and uncontrolled asthma groups suggesting that serum leptin levels may not have a major role among asthma control groups with obesity . In a recent study, where serum leptin levels were compared in intermittent, mild persistent, and moderate persistent asthma groups and found an increase in leptin levels correlated with the increase in the clinic severity of asthma, suggesting that serum leptin levels may reflect clinic severity of asthma, bmi z - score also did not differ significantly among the asthma control groups . That enrolled 2238 outpatient adults and 2429 children across the united states and found that high bmi was not a predictor of controlled asthma in children (or 1.54). We found that in obese and nonobese female asthmatic children, the levels of leptin were higher and adiponectin levels were lower than boys . The influence of leptin on increasing asthma risks varied by gender has been reported . Among asthmatic children, on the other hand, in a case control study conducted in 102 prepubertal asthmatic children, significant difference was observed in serum leptin levels between asthmatic and healthy children . To our knowledge this is the first study of this kind to report leptin and adiponectin levels in oa and noa children in relation to the degree of asthma control . Though, we have small percentage of patients in the uncontrolled asthma group and our data did not demonstrate a significant association between obesity and the degree of asthma control . In conclusion, our study findings indicate that among asthmatic school children higher serum leptin and lower adiponectin levels were significantly associated with obesity . Serum leptin and other factors should be sought for a better understanding of the connection between serum leptin and adiponectin levels with obesity and asthma controls . Further, larger prospective study with adequate statistical power needs to be conducted for generalization of the above findings.
|
The diagnosis of narcoleptics with cataplexy was made according to the revised international classification of sleep disorders . (8) and include: 1) loss of muscle tone has a visible effect or involves other muscle groups in addition to leg muscles; 2) frequency of cataplexy occurring> 1 per month; 3) duration of cataplexy (often or always) <10 min; 4) cataplexy (often or always) associated with normal state of consciousness . A standard polysomnographic study comprising one overnight recording followed by a mslt (multiple sleep latency test) patients were invited to lie down on a bed in a dark, sound - attenuated room and instructed to try to fall asleep . Sleep latency was defined as the time elapsed from the start of the test (lights out) to the first 30-second epoch scored as sleep . Each sleep latency test was ended 20 minute after the onset of sleep or after 20 minute of wakefulness . A sleep onset rem period (soremp) was defined as one or more epochs of rem sleep occurring within 15 minute of the first 30-second epoch scored as sleep . Subjects with a mean sleep latency of 8 minute on the mslt were evaluated for hla - dqb1 * 0602 and drb1 * 1501 . Other information including the presence of sleep attacks, hypnagogic hallucinations, sleep paralysis, and a positive family history of narcolepsy was obtained from patients and their families . Three of the patients were excluded because they had concomitant mild to moderate obstructive sleep apnea hypopnea syndrome . Twenty - nine normal subjects that responded to a local community advertisement and fulfilled a detailed clinical interview, sleep questionnaire, overnight polysomnography, which were evaluated and interpreted by two sleep medicine specialists . Exclusion criteria included a normal subject who showed an apnea - hypopnea index (ahi)> 4 or evidence for other sleep disorders such as periodic limb movement disorders on polysomnography . The exclusion criteria for normal subjects were those with a 1) mean daily sleep time <7 hours, 2) abnormal sleep - wake rhythm, 3) other sleep disorders, 4) heart or respiratory disease, 5) history of cerebrovascular disease, 6) other neurological (neurodegenerative diseases, epilepsy, head injury) or psychiatric diseases (psychosis, current depression), 7) alcohol or illicit drug abuse or current intake of psychoactive medications, and 8) a structural lesion on brain mri . All patients and normal subjects granted written informed consent before an mri scan was performed and the institutional review board at samsung medical center authorized the informed consent form and study protocol, which included an mri scan . The human leukocyte antigen (hla) plays a key role in autoimmune disease etiology . As one component of the trimolecular complex (major histocompatibility complex - peptide - t - cell receptor), the presence of specific hla alleles determines the repertoire of peptide epitopes that can be presented, thereby restricting the specificity of reactive t cells (9). The hla class ii region genes dqb1 * 0602 and drb1 * 1501 are currently the best genetic predictors for narcolepsy in humans (9, 10). Sequence - specific primers and a bigdye terminator v. 3.1 cycle sequencing kit (applied biosystems, foster city, ca) were used for hla - dqb1 * 0602 and drb1 * 1501 genotyping according to manufacturer's instructions (applied biosystems). Mri scanning was performed using a ge signa 1.5 tesla scanner (ge medical systems, milwaukee, wi). T1-weighted spoiled gradient recalled (spgr) coronal images were obtained using the following scanning variables; 1.6 mm thickness, no gap, 124 slices, repetition time / echo time (tr / te) = 30/7 msec, flip angle (fa) = 450, number of excitations (nex) = 1, matrix = 256 192, and field of view (fov) = 22 22 cm . The investigators performing the mri were blinded as to the order of the subject status was (patients versus normal subjects). Using spm2 (wellcome department of cognitive neurology, institute of neurology, university college london, uk) and matlab 6.5 (the mathworks, ma), an optimized vbm protocol was used to analyze brain tissue concentrations . The brain center point was placed on the anterior commissure . To create customized templates and prior images of gm, all mris of narcoleptic patients and normal controls were spatially normalized against the standard mni (montreal neurological institute) t1 spm template . Spatial normalizations were applied using the following a voxel size of 111 mm, cutoff spatial normalization, a 25 mm cutoff' nonlinear regularization, medium regularization, and 16 nonlinear iterations . The normalized images were subdivided into gm, white matter (wm), and csf spaces, and then sub - sampled for voxel sizes of 22 2 mm . To remove the isolated voxels of one tissue class which were unlikely to be a member of this tissue type, spatially normalized raw images, as well as gm and wm were averaged and saved into customized t1 templates, gm, wm, and csf prior images, respectively . Finally, the customized t1 template, gm and wm prior images were smoothed using an 8-mm full - width at half - maximum (fwhm) isotropic gaussian kernel (igk). The raw t1 images of all subjects (n = 102) were automatically subdivided into gm, wm, and csf partitions in native space . Spatial normalization parameters were estimated by matching gm with an own gm template, and then spatially normalized versions of the original images were created . The spatially normalized images were segmented using our own images taken beforehand (gm, wm, and csf partitions). The gm images were smoothed using a 12-mm fwhm igk and the final voxel size was 111 mm . An ancova covariate with age was used for the concentration analysis of gm images . The significance level (height threshold) in addition, cluster sizes less than 200 voxels were excluded (extent threshold, ke <200 voxels). Partial correlation analyses were set up with confounding factors such as age between gray matter concentrations (gmcs) and age of eds onset, disease duration, mean sleep latency of mslt, or epworth sleepiness scale were performed using spm2 using a whole brain mask . The mean values of the significant clusters were extracted from gm images at an uncorrected p - value <0.001 . Age, eds or cataplexy onset age, mean ess (epworth sleepiness scale) and sss (stanford sleepiness scale), and night polysomnographic findings were analyzed with the two - tailed t - test . To evaluate the prior hypothesis pertaining to the hypothalamus (4, 11, 12) small volume correction, a sphere with a radius of 30 mm and located at the center point (x, y, z: 0, 0, 0), was applied in the results . The recruitment criteria included patients with no central nervous system (cns) stimulant or cataplexy drug treatment history . The diagnosis of narcoleptics with cataplexy was made according to the revised international classification of sleep disorders . (8) and include: 1) loss of muscle tone has a visible effect or involves other muscle groups in addition to leg muscles; 2) frequency of cataplexy occurring> 1 per month; 3) duration of cataplexy (often or always) <10 min; 4) cataplexy (often or always) associated with normal state of consciousness . A standard polysomnographic study comprising one overnight recording followed by a mslt (multiple sleep latency test) patients were invited to lie down on a bed in a dark, sound - attenuated room and instructed to try to fall asleep . Sleep latency was defined as the time elapsed from the start of the test (lights out) to the first 30-second epoch scored as sleep . Each sleep latency test was ended 20 minute after the onset of sleep or after 20 minute of wakefulness . A sleep onset rem period (soremp) was defined as one or more epochs of rem sleep occurring within 15 minute of the first 30-second epoch scored as sleep . Subjects with a mean sleep latency of 8 minute on the mslt were evaluated for hla - dqb1 * 0602 and drb1 * 1501 . Other information including the presence of sleep attacks, hypnagogic hallucinations, sleep paralysis, and a positive family history of narcolepsy was obtained from patients and their families . Three of the patients were excluded because they had concomitant mild to moderate obstructive sleep apnea hypopnea syndrome . Twenty - nine normal subjects that responded to a local community advertisement and fulfilled a detailed clinical interview, sleep questionnaire, overnight polysomnography, which were evaluated and interpreted by two sleep medicine specialists . Exclusion criteria included a normal subject who showed an apnea - hypopnea index (ahi)> 4 or evidence for other sleep disorders such as periodic limb movement disorders on polysomnography . The exclusion criteria for normal subjects were those with a 1) mean daily sleep time <7 hours, 2) abnormal sleep - wake rhythm, 3) other sleep disorders, 4) heart or respiratory disease, 5) history of cerebrovascular disease, 6) other neurological (neurodegenerative diseases, epilepsy, head injury) or psychiatric diseases (psychosis, current depression), 7) alcohol or illicit drug abuse or current intake of psychoactive medications, and 8) a structural lesion on brain mri . All patients and normal subjects granted written informed consent before an mri scan was performed and the institutional review board at samsung medical center authorized the informed consent form and study protocol, which included an mri scan . The human leukocyte antigen (hla) plays a key role in autoimmune disease etiology . As one component of the trimolecular complex (major histocompatibility complex - peptide - t - cell receptor), the presence of specific hla alleles determines the repertoire of peptide epitopes that can be presented, thereby restricting the specificity of reactive t cells (9). The hla class ii region genes dqb1 * 0602 and drb1 * 1501 are currently the best genetic predictors for narcolepsy in humans (9, 10). Sequence - specific primers and a bigdye terminator v. 3.1 cycle sequencing kit (applied biosystems, foster city, ca) were used for hla - dqb1 * 0602 and drb1 * 1501 genotyping according to manufacturer's instructions (applied biosystems). Mri scanning was performed using a ge signa 1.5 tesla scanner (ge medical systems, milwaukee, wi). T1-weighted spoiled gradient recalled (spgr) coronal images were obtained using the following scanning variables; 1.6 mm thickness, no gap, 124 slices, repetition time / echo time (tr / te) = 30/7 msec, flip angle (fa) = 450, number of excitations (nex) = 1, matrix = 256 192, and field of view (fov) = 22 22 cm . The investigators performing the mri were blinded as to the order of the subject status was (patients versus normal subjects). Using spm2 (wellcome department of cognitive neurology, institute of neurology, university college london, uk) and matlab 6.5 (the mathworks, ma), an optimized vbm protocol was used to analyze brain tissue concentrations . The brain center point was placed on the anterior commissure . To create customized templates and prior images of gm, all mris of narcoleptic patients and normal controls were spatially normalized against the standard mni (montreal neurological institute) t1 spm template . Spatial normalizations were applied using the following a voxel size of 111 mm, cutoff spatial normalization, a 25 mm cutoff' nonlinear regularization, medium regularization, and 16 nonlinear iterations . The normalized images were subdivided into gm, white matter (wm), and csf spaces, and then sub - sampled for voxel sizes of 22 2 mm . To remove the isolated voxels of one tissue class which were unlikely to be a member of this tissue type, the hidden markov random field model was applied in all segmentation processes . Spatially normalized raw images, as well as gm and wm were averaged and saved into customized t1 templates, gm, wm, and csf prior images, respectively . Finally, the customized t1 template, gm and wm prior images were smoothed using an 8-mm full - width at half - maximum (fwhm) isotropic gaussian kernel (igk). The raw t1 images of all subjects (n = 102) were automatically subdivided into gm, wm, and csf partitions in native space . Spatial normalization parameters were estimated by matching gm with an own gm template, and then spatially normalized versions of the original images were created . The spatially normalized images were segmented using our own images taken beforehand (gm, wm, and csf partitions). The gm images were smoothed using a 12-mm fwhm igk and the final voxel size was 111 mm . An ancova covariate with age was used for the concentration analysis of gm images . The significance level (height threshold) in addition, cluster sizes less than 200 voxels were excluded (extent threshold, ke <200 voxels). Partial correlation analyses were set up with confounding factors such as age between gray matter concentrations (gmcs) and age of eds onset, disease duration, mean sleep latency of mslt, or epworth sleepiness scale were performed using spm2 using a whole brain mask . The mean values of the significant clusters were extracted from gm images at an uncorrected p - value <0.001 . Age, eds or cataplexy onset age, mean ess (epworth sleepiness scale) and sss (stanford sleepiness scale), and night polysomnographic findings were analyzed with the two - tailed t - test . To evaluate the prior hypothesis pertaining to the hypothalamus (4, 11, 12) small volume correction, a sphere with a radius of 30 mm and located at the center point (x, y, z: 0, 0, 0), was applied in the results . Using spm2 (wellcome department of cognitive neurology, institute of neurology, university college london, uk) and matlab 6.5 (the mathworks, ma), an optimized vbm protocol was used to analyze brain tissue concentrations . To create customized templates and prior images of gm, all mris of narcoleptic patients and normal controls were spatially normalized against the standard mni (montreal neurological institute) t1 spm template . Spatial normalizations were applied using the following a voxel size of 111 mm, cutoff spatial normalization, a 25 mm cutoff' nonlinear regularization, medium regularization, and 16 nonlinear iterations . The normalized images were subdivided into gm, white matter (wm), and csf spaces, and then sub - sampled for voxel sizes of 22 2 mm . To remove the isolated voxels of one tissue class which were unlikely to be a member of this tissue type spatially normalized raw images, as well as gm and wm were averaged and saved into customized t1 templates, gm, wm, and csf prior images, respectively . Finally, the customized t1 template, gm and wm prior images were smoothed using an 8-mm full - width at half - maximum (fwhm) isotropic gaussian kernel (igk). The raw t1 images of all subjects (n = 102) were automatically subdivided into gm, wm, and csf partitions in native space . Spatial normalization parameters were estimated by matching gm with an own gm template, and then spatially normalized versions of the original images were created . The spatially normalized images were segmented using our own images taken beforehand (gm, wm, and csf partitions). The gm images were smoothed using a 12-mm fwhm igk and the final voxel size was 111 mm . An ancova covariate with age was used for the concentration analysis of gm images . The significance level (height threshold) in addition, cluster sizes less than 200 voxels were excluded (extent threshold, ke <200 voxels). Partial correlation analyses were set up with confounding factors such as age between gray matter concentrations (gmcs) and age of eds onset, disease duration, mean sleep latency of mslt, or epworth sleepiness scale were performed using spm2 using a whole brain mask . The mean values of the significant clusters were extracted from gm images at an uncorrected p - value <0.001 . Age, eds or cataplexy onset age, mean ess (epworth sleepiness scale) and sss (stanford sleepiness scale), and night polysomnographic findings were analyzed with the two - tailed t - test . To evaluate the prior hypothesis pertaining to the hypothalamus (4, 11, 12) small volume correction, a sphere with a radius of 30 mm and located at the center point (x, y, z: 0, 0, 0), was applied in the results . All patients examined were right - handed . The mean age of the patients and normal subjects (m: f = 15:14) was 31.2 years . The onset age of eds in patients was 22.3 years (range of age: 8 - 37) and the cataplexy was 23.1 years (9 - 41). Twenty - three patients (79%) have suffered from hypnagogic or hypnapompic hallucinations and 19 patients (65%) had a history of sleep paralysis . The mean epworth sleepiness scale result was 17.5 in patients versus 4.3 in normal subjects (t - test, p <0.01). Positive hla typing (dr2 and dqb1 * 0602) was identified in 27 (93%) of the studied patients . The sleep study findings in patients and normal subjects were summarized in table 1 (normal subjects underwent only night polysomnography). All patients and normal subjects underwent a brain mri using the same protocol, which revealed no gross abnormal findings on visual inspection . Compared to normal subjects, narcoleptics with cataplexy showed reduced gm concentrations in bilateral thalami, left gyrus rectus, bilateral frontopolar gyri, bilateral superior frontal gyri, bilateral anterior short insular gyri, right superior temporal gyrus, and left inferior temporal gyrus at the level of uncorrected p <0.001 (fig . There were no regions of the brain that showed increased gm concentrations in narcoleptics with cataplexy . Using small volume corrected analysis, the gm concentration was significantly reduced in bilateral nuclei accumbens, bilateral hypothalami, and at bilateral thalami at the level of a false discovery rate p <0.05 (fig . 1c). A partial correlation analyses with the confounder of age between gmcs and age of eds onset, disease duration, mean sleep latency of mslt, or epworth sleepiness scale did not show statistically significant results . All patients examined were right - handed . The mean age of the patients and normal subjects (m: f = 15:14) was 31.2 years . The onset age of eds in patients was 22.3 years (range of age: 8 - 37) and the cataplexy was 23.1 years (9 - 41). Twenty - three patients (79%) have suffered from hypnagogic or hypnapompic hallucinations and 19 patients (65%) had a history of sleep paralysis . The mean epworth sleepiness scale result was 17.5 in patients versus 4.3 in normal subjects (t - test, p <0.01). Positive hla typing (dr2 and dqb1 * 0602) was identified in 27 (93%) of the studied patients . The sleep study findings in patients and normal subjects were summarized in table 1 (normal subjects underwent only night polysomnography). All patients and normal subjects underwent a brain mri using the same protocol, which revealed no gross abnormal findings on visual inspection . Compared to normal subjects, narcoleptics with cataplexy showed reduced gm concentrations in bilateral thalami, left gyrus rectus, bilateral frontopolar gyri, bilateral superior frontal gyri, bilateral anterior short insular gyri, right superior temporal gyrus, and left inferior temporal gyrus at the level of uncorrected p <0.001 (fig . There were no regions of the brain that showed increased gm concentrations in narcoleptics with cataplexy . Using small volume corrected analysis, the gm concentration was significantly reduced in bilateral nuclei accumbens, bilateral hypothalami, and at bilateral thalami at the level of a false discovery rate p <0.05 (fig . A partial correlation analyses with the confounder of age between gmcs and age of eds onset, disease duration, mean sleep latency of mslt, or epworth sleepiness scale did not show statistically significant results . In the present study, a vbm analysis was performed on the brain mris to identify cerebral structural abnormalities in the narcoleptics with cataplexy . Vbm methods for gm concentrations refer to differences observed in the proportion of gm voxels, which are defined based on signal intensity thresholds, compared to voxels representing other tissue types as gm density differences (13). On the contrary, the thickness of the cerebral cortex (ranging between 1.5 to 4.5 mm) reflects the density and arrangement of cells (neurons and neuroglia and nerve fibers) (14). Our study demonstrates a significant decrease in gm concentrations in the hypothalamus, nucleus accumbens, thalamus, anterior insular cortex, and in some cortical areas in the frontal and temporal lobes of the brains of patients with narcolepsy with cataplexy, when compared to normal subjects . In the present study, reduced gm concentrations in the bilateral hypothalami and nuclei accumbens may be related to a decreased number of hypocretin immunoreactive neurons in the hypothalamus of a narcoleptic brain (15). The neuropeptide hypocretin exists exclusively in the posterior hypothalamus of the human brain and plays a critical role in the neurobiology of narcolepsy (15). Our previous fdg - pet (fluorodeoxyglucose - positron emission tomography) (16) and spect (single photon emission computed tomography) studies (17) showed significant glucose hypometabolism and hypoperfusion in the bilateral hypothalami of narcoleptics . A recent proton mr spectroscopy study revealed that the hypothalamic n - acetylaspartate - to - creatine ratio was significantly lower in narcoleptics with cataplexy, when compared to narcoleptics without cataplexy or in normal subjects (18). The nucleus accumbens has been implicated in involvement in the regulation of the sleep - wake cycle via the mesolimbic - dopamine system (19), and in the interface between the limbic and motor systems (20, 21). However, others were unable to find similar changes in the hypothalamus or nucleus accumbens (5 - 7). One study suggested that the absence of detectable structural changes in hypothalamus and in hypocretin projection areas may be due to microscopic changes in these areas that are not detected by vbm, or alternatively, that functional abnormalities of hypocretin neurons are not associated with structural correlates (5). Other vbm studies found that a bilateral reduction of gm concentrations in inferior temporal and frontal brain regions (22) or in prefrontal and frontomesial regions (7). They acknowledged that the functional significance of these findings was unclear, but suggested that the involvement of a presumed autoimmune mediated process that destroys hypothalamic hypocretin neurons and extends to other neuronal populations . As pointed out, inhomogeneous patient groups, a stimulant or antidepressant medication history, and small sample sizes may have caused the negative findings of previous vbm studies (7). Because narcolepsy is composed of different subgroups, i.e., narcoleptics with or without cataplexy, and narcolepsy with a reduced or a normal hypocretin level in csf, it is important that homogenous subgroups of narcoleptic patients are identified in studies to facilitate accurate intergroup comparisons . The findings of the present vbm study, which included reduced gm concentrations in the hypothalamus and nucleus accumbens, may strengthen the prior hypothesis that these reductions are associated with eds and cataplexy in narcolepsy cases . Intralaminar nuclei are included in the' nonspecific ascending reticular activating system' and are functionally associated with the sense of attention, arousal, and consciousness (22). These central nuclei are also involved in the motor function in the basal ganglia circuitry and in cognitive, oculomotor, and limbic functions (23). The anterior thalamic nucleus belongs to the papez circuit, the neural circuit of emotion . The median thalamic nucleus has been implicated in the wake - sleep cycle (24). A decrease in metabolism and regional cerebral blood flow in the thalamus of the narcoleptic brain, thus, the reduction of gm concentrations in bilateral thalamic nuclei may be related to attention or cognition deficits, memory impairments as well as arousal and sleep - wake disturbances in narcolepsy . Depressive and neurotic symptoms are considered to be common in narcolepsy (25). Some have suggested that significant hypoperfusion of the limbic system may be related to the emotional instability seen in narcoleptics (17). The insular cortex has numerous connections with the cerebral cortex, basal ganglia, and limbic structures (26, 27). Mesial temporal lobe epilepsy patients with emotional symptoms have shown hypometabolism in the anterior insula by fdg - pet (28, 29). A gmc decrease in the anterior insular cortex found in narcoleptics with cataplexy suggested that a structural abnormality in that region may be associated with the cataplexy induced by emotional changes . We applied two types of statistical analyses, namely, an unpaired t - test for the group comparisons between the narcoleptic patients and normal subjects; and a small volume correction (svc) on the prior hypothesis, which mentions the hypothalamus, nucleus accumbens, and thalamic dysfunction in narcoleptics . The results obtained by the two methods were similar for the hypothalamus, nucleus accumbens, and thalamus . A svc can be applied when there is prior knowledge or consensus on an activation effect of a particular region instead of the entire brain (12, 30). Any clinical or animal experimental data can be the supportive evidence for a svc analysis . Spm99 and later versions, use the results to calculate corrected statistics across the whole brain by working out the shape and size of the whole brain volume in the analysis, and calculating the correction accordingly (11). Thus, for a whole - brain analyses, spm99 can offer a reasonable correction factor for the entire brain volume . For smaller volumes, the correction must take into account the geometric properties of the volume, such as shape and surface area . This is important, because you may well have an a priori hypothesis to test an area of expected activation in a spm . Because multiple comparisons across the whole brain image are too conservative, one must restrict their region of interest to a subset area instead of using the whole brain image . (11) gives results which allow for the choice of appropriate thresholds given that you are restricting your investigation to a certain volume of interest, defined shape, size, and so on . This is because both size and shape dictate how many resels the volume will contain . As the random fields tutorial explains, the number of resels in a volume is a measure related to the number of independent observations in that volume, and this in turn will dictate how strict our correction must be (http://imaging.mrc-cbu.cam.ac.uk/imaging/smallvolumecorrection). In conclusion, this study revealed significant gm concentration deficits in narcoleptics with cataplexy . Those areas included structures that may serve possible roles in wake - sleep controls, attention, or memory . These findings would be helpful in elucidating the pathomechanism of cerebral disturbances in patients with narcolepsy with cataplexy.
|
Acute lymphoblastic leukemia, the commonest cancer in childhood, is now curable in 80% of the cases . The increasing success in pediatric oncology is in part related to the use of more intensive chemotherapy and high - dose chemotherapy plus hematopoietic stem cell transplantation . A multitude of factors including skin and mucosal damage, the use of indwelling central venous devices, prolonged or profound neutropenia, and the concurrent use of immunosuppressants make opportunistic infections a frequent and potentially life - threatening complication in this group of children . Bloodstream bacterial infections continue to be the most significant cause of mortality and morbidity during anti - cancer treatment . Preventive measures targeting at the environment and the host have been implemented in order to reduce the morbidity and mortality associated with infectious complications in children receiving anti - cancer treatment and stem cell transplantation . In particular, most pediatric oncology centers have strict precautions pertaining to the supply and cleanliness of food to the hospitalized children even though most of the bloodstream infections are caused by endogenous bacteria found in the flora of the skin, the oral cavity, and the intestine, and specific reports on food - borne infections are lacking . The following cases in which the bacteremic illnesses were most probably acquired from consumption of contaminated food and beverages in the community are illustrative of the importance of food precautions in children undergoing cytotoxic chemotherapy even after discharge . A retrospective hospital chart survey was carried out to review all cases of documented bacteremia associated with febrile neutropenia in children undergoing anti - cancer treatment or hematopoietic stem cell transplantation in the children s haematology and cancer centre from march 2007 to february 2010 . Febrile neutropenia is defined as the occurrence of fever (core temperature higher than 38.5c) with an absolute neutrophil count below 110/l . A case of suspected food - borne infection was diagnosed if there was a history of consuming food or beverages that were not properly cooked in the preceding 24 hours of the positive blood culture, or if the organism identified is a probable probiotic commonly used in children s food and beverages . Three (14%) children died from infections with pseudomonas aeruginosa, stenetrophomonas maltophilia, and multidrug - resistant acinetobacter baumannii, respectively . Eleven episodes happened after the child was admitted to the hospital when only low - microbial diet was permitted . The infections in the other ten cases started while the children were discharged, of which three bacteremic illnesses were highly suspected of food - borne in origin . A 17-year - old boy from malaysia with localized osteosarcoma was recuperating at home after having received treatment with ifosfamide and etoposide . On day 14 after commencement of the chemotherapy, this was a local delicacy made with rice soaked in coconut cream and wrapped in pandan leaves . He started to have fever and vomiting four hours later with chills and rigors . On admission, he was noted to be in compensated septic shock and was immediately resuscitated with fluids and treated with intravenous meropenem . Blood taken from both lumens of the hickman catheter eventually grew sphingomonas paucimobilis that was sensitive to the antibiotic used . He recovered from the infection and neutropenia with filgrastim and continued chemotherapy treatment without any delay . A 2-year - old boy from indonesia with acute lymphoblastic leukemia was discharged after treatment with cyclophosphamide during the second part of the induction chemotherapy . While taking oral 6-mercaptopurine, he went with his family to enjoy a sushi dinner in a japanese restaurant . He was noted to be cyanotic with chills 10 hours later and was immediately admitted to the hospital . He was resuscitated with intravenous fluid for septic shock in the accident and emergency department followed by the commencement of intravenous meropenem and amikacin . The initial full blood counts showed mild anemia (10.2 g / dl), leucopenia (4.210/l), profound neutropenia (0.0810/l) and normal platelet counts . Acute lymphoblastic leukemia was diagnosed on bone marrow aspiration while the blood culture taken on admission grew lactobacillus species that was sensitive to penicillin and ceftriaxone but resistant to ciprofloxacin and erythromycin . A 17-year - old boy from malaysia with localized osteosarcoma was recuperating at home after having received treatment with ifosfamide and etoposide . On day 14 after commencement of the chemotherapy, this was a local delicacy made with rice soaked in coconut cream and wrapped in pandan leaves . He started to have fever and vomiting four hours later with chills and rigors . On admission, he was noted to be in compensated septic shock and was immediately resuscitated with fluids and treated with intravenous meropenem . Blood taken from both lumens of the hickman catheter eventually grew sphingomonas paucimobilis that was sensitive to the antibiotic used . He recovered from the infection and neutropenia with filgrastim and continued chemotherapy treatment without any delay . A 2-year - old boy from indonesia with acute lymphoblastic leukemia was discharged after treatment with cyclophosphamide during the second part of the induction chemotherapy . While taking oral 6-mercaptopurine, he went with his family to enjoy a sushi dinner in a japanese restaurant . He was noted to be cyanotic with chills 10 hours later and was immediately admitted to the hospital . He was resuscitated with intravenous fluid for septic shock in the accident and emergency department followed by the commencement of intravenous meropenem and amikacin . A 2-year - old girl from france was admitted for investigation of fever with no obvious source . The initial full blood counts showed mild anemia (10.2 g / dl), leucopenia (4.210/l), profound neutropenia (0.0810/l) and normal platelet counts . Acute lymphoblastic leukemia was diagnosed on bone marrow aspiration while the blood culture taken on admission grew lactobacillus species that was sensitive to penicillin and ceftriaxone but resistant to ciprofloxacin and erythromycin . Febrile neutropenia is a common complication in children with leukemia, bone marrow failure syndromes, and those receiving cytotoxic chemotherapy or undergoing hematopoietic stem cell transplantation . Bacteremia is seen in 1030% of cases and is associated with serious complications and death, with case fatality rates ranging from 924% in the recent series . Mucosal damage as a result of intense chemotherapy and the use of central venous devices are commonly identified as the predisposing factors for bloodstream infections in the neutropenic hosts . As a result, the causative organisms are usually part of the normal flora found in the oral cavity, the gut, and on the skin . Klebsiella pneumoniae, escherichia coli, and pseudomonas aeruginosa from the gastrointestinal tract are still the most common pathogens in our experience, accounting for nine of the 14 episodes of gram - negative bacteremia . Staphylococcus aureus, coagulase - negative staphylococcus, and bacillus species, commonly found on the skin, constitute five of the seven episodes of gram - positive bacteremia . Recent studies on the epidemiology of bacteremia in febrile neutropenic children have reported remarkably similar spectrum of organisms . The use of central venous catheters, prolonged neutropenia (> 14 days), profound neutropenia (<0.110/l), and comorbid conditions are strongly associated with bloodstream infections . Paul et al . Have also emphasized the duration of hospital stay as another predisposing factor, suggesting that nosocomial transmission of bacterial pathogens as an important causative factor . However, none of the studies has looked into the possibility of out - of - hospital acquisition of infection by the oral route . Food hygiene has long been regarded as an important aspect of infection control in the neutropenic host . It is a common practice that children undergoing cytotoxic chemotherapy and stem cell transplantation in the hospital are to receive the low - microbial diet . Once the patient is discharged, however, meticulous respect to food hygiene may not be followed . The present case reports illustrate the potentially dire consequences of the lapses in food precautions among the pediatric oncology population . The three cases represent 14% of the bacteremic illnesses complicating febrile neutropenia during the study period . The tropical climate, the popularity of local delicacies sold by hawkers and japanese cuisine with raw seafood could have contributed to such a high incidence of food - borne infections among the susceptible children . In cases #1 and #2, the infecting organisms, which are not found in the normal skin or gut flora, were most likely acquired from the improperly handled or uncooked food . The origin of the lactobacillus in case #3 was uncertain and molecular test to prove a genuine dietary source from probiotic strains is not available . However, concerns about potential pathogenicity and transfer of acquired drug resistance to resident flora have led to recommendations against their use in hospitalized and immunocompromised patients . Various attempts at reducing the risk of bacteremia have been attempted or implemented in pediatric oncology . Hematopoietic growth factors to ameliorate the severity and duration of neutropenia have been widely used with a consensus that infectious complications following chemotherapy and duration of hospital stay are reduced . The exclusion of unclean food and attention to food hygiene is often part of patient education and can be easily followed without much cost . In summary, food - borne bacteremic infections in febrile neutropenic children may be more prevalent in tropic regions where the warm climate and the abundant supply of improperly handled delicacies can predispose the children to the opportunistic pathogens . The relatively small patient sample and the multi - national composition of the patient population may limit the generalization of the observation . Nevertheless, compared with other risk factors, food - borne bacteremic illnesses in febrile neutropenic children can be readily prevented by diligent observation of the proper food handling.
|
The covered exstrophy is an extremely rare variant of exstrophy epispadias complex wherein the incomplete closure of the anterior abdominal wall does not include the skin; the entirety of the skin guarantees an easier management and lower distress comparing with the classic bladder exstrophy . If the bladder exstrophy is rare, with an incidence ranging from 2 to 5 cases per 100,000 live births and a male to female ratio of 2.3:1, the cover exstrophy is even more rare . The risk to develop a bladder cancer in patients with bladder exstrophy is significantly higher than the age - matched population, and some studies estimate this risk is as high as 700-fold greater . Bladder cancer in exstrophic bladder is generally a high undifferentiated carcinoma, more often adenocarcinoma resembling a colorectal carcinoma, rarely a squamous carcinoma, or urothelial carcinoma . In the event of cancerization, besides a radical cystectomy and a urinary derivation, an abdominal reconstruction is required if skin is involved . Pedicle flaps are the best choice to restore full thickness defect of the lower abdominal wall . Usually these flaps are harvested from the tight as myocutaneous or fasciocutaneous flaps and most of them are based on the system of the circumflexes femoral artery . The most used flaps are the tensor fascia lata (tsl) and the anterolateral tight flap. [79] less used for this kind of reconstruction are the rectus femoris and the vastus laterals flap . The gracilis flap has also been used in abdominal reconstruction, but it belongs to a different arterial system, less used in this type of reconstruction . The vac therapy is an option to repair septic wound of the abdomen with a second - intentions healing . The aim of this paper is to report a case of a cancerization of covered exstrophy and its surgical management . Because of the oncological resection, we removed the tumor with a full thickness demolition of the lower abdominal wall and pubic region . The reconstruction was made with a pedicle myocutaneous vastus lateralis muscle sparing flap that included in the flap a portion of fascia lata . A 47-year - old caucasian woman with a known - covered exstrophy, uterus didelphys, and external genital malformations (figure 1), that did not affect her ability to procreate (two caesarean sections), presented with recurrent macroscopic haematuria . Ct scan showed a left third grade hydronephrosis associated to a dysmorphic bladder, with a endoluminal neoformation of 10 cm of maximum diameter with irregular margins which appeared strictly in contact with the near organs and extending up to the abdominal skin . After a trans - urethral biopsy (tur - b) showing an infiltrating urothelial high - grade carcinoma (immunehistochemical exam [hic]: pankeratin ae1/3 + ck7 + ck20), based on the rapid tumor growth, a neoadjuvant chemotherapy based on cisplatin and gemcitabine was performed . No clinical response was obtained and the ct scan showed a worsening of local invasion . As a radical surgical excision was still achievable, a radical cystectomy with a wide iliac - obturator lymphadenectomy and bilateral urostomy was then performed . Preoperative view (a) and large abdominal wall defect after resection of the tumor (b). The suprapubic skin was removed and the defect was reconstructed by a right myocutaneous vastus lateralis muscle - spearing flap . A neobladder was not reconstructed. [14] cranially to the bispinoiliac line, the rectus abdominis muscles were sutured along the midline, while caudally, a full - thickness defect extended from the abdomen to the vaginal orifice (10 16 cm; figure 1). The size of the demolition required the use of a vascularized tissue to cover the exposed intestine . The advanced stage of the tumor and the lower expectative of life required a fast and safe reconstruction so we decided to use a myocutaneous vastus lateralis muscle - spearing flap from the right thigh . Only the superficial partition of the vl was harvested, preserving its nerve supply, and a portion of the fascia lata was included in the flap . The flap was passed under the rectus femoris muscle and a subcutaneous tunnel to reach the defect (figure 2). The fascia lata and the vastus lateralis aponeurosis were sutured laterally to the residual abdominal fascia and cranially to the rectus abdominis muscles . The vl filled the dead space in the pelvic floor and was sutured to the upper border of the vagina and its skin island provided an additional resurfacing layer (figure 3). Postoperative period was uneventful, and the flap showed no sign of ischemia or infection . Intraoperative view showing the musculo - cutaneous muscle - sparing vastus lateralis flap including a portion of fascia lata (b and c) and the pedicle of the flap (a). The tunnel in the inguinal region (a) and the insetting of the flap (b). Ct scan also showed a multidistrict metastatic disease and eight months after surgery the woman died . Exstrophy of the bladder is part of a spectrum of anomalies involving the urinary tract, the genital tract, the musculoskeletal system, and sometimes the intestinal tract . Despite an acceptable quality of life can be achieved with modern reconstructive technique, the disease is burdened by a high incidence of bladder cancer . Adenocarcinoma is the most common histological type in bladder exstrophy, accounting not only for over 90% of all carcinoma in these patients, but also squamous cell carcinoma or urothelial carcinoma may develop . The woman we observed had a locally advanced sarcomatoid urothelial carcinoma . To obtain a radical treatment, removal of a part of the abdominal wall the selection of reconstructive techniques in cases of patients with a short - life expectancy must be targeted to a very fast healing that gives them the possibility of receiving early adjuvant therapies with a good quality of life . To repair the defects and cover the exposed bowel,, we have harvested a myocutaneous vastus lateralis muscle - sparing flap, a safe and useful, yet not popular, option . In literature, several techniques have been described for the reconstruction of the abdominal wall by local flaps . The pedicled tfl used to be the workhorse to repair abdominal wall defects but it is often bulky and poorly vascularized . The alt flap allows to reconstruct big defects, but due to the lack of a muscular component in the flap, it does not allow for a functional reconstruction . Vacuum - assisted closure (vac) therapy may gradually close the abdominal wall defects over the bowels generating granulation tissue that can be grafted . This technique requires long time of healing, is associated to an elevated risk of fistula formation when the vac is in direct contact with bowel, and does not allow functional reconstruction of the abdominal wall . We have often used the myocutaneous vastus lateralis flap in the repair of the head and neck defects after cancer resection and we believe it is a very versatile and reliable flap, both free and pedicled . The anterolateral thigh area donor site is ideal for the repair of abdominal wall because it remains outside the areas of scarring due to any previous abdominal operations . The vastus lateralis myocutaneous flap can cover large defects (up to 20 10 cm); the possibility of including a large portion of the fascia lata helps to strengthen and stabilize the abdominal wall . The selective harvest of only a partition of the vastus lateralis reduces morbidity of the donor site . The intermediate and deep partitions of the vastus lateralis remain in situ and the innervation of the other heads of the quadriceps remains intact . The flap is tunneled under rectus femoris muscle so as to facilitate the insetting of the flap and reduce the possibility of twisting or compression of the pedicle . There are no big disadvantages connected to the use of this flap, one of which could be the necessity to use a skin graft to cover the donor site when the skin portion of the flap is larger than 810 cm . This technique allowed for a functional reconstruction of the abdominal wall, that would have prevented the development of future incisional hernias should the patient had a longer survival . Unfortunately, the fate of the patient was not favorable and, because of the advanced disease, the woman died eight months after surgery with evidence distant metastases . Bladder exstrophy is a predisposing factor for the development of not only advanced bladder cancer, usually adenocarcinoma but, as the case we report, also undifferentiated urothelial carcinoma . Patients with bladder exstrophy, even in the covered form, must be followed in order to early diagnose the malignant disease as treatment of advanced disease remains challenging . It often requires full - thickness excision of the abdominal wall and a subsequent reconstructive procedure . A myocutaneous vastus lateralis muscle - spearing flap is a safe and versatile option for morphofunctional reconstruction of large abdominal defects . The authors report no conflicts of interest . The authors alone are responsible for the content and writing of this article.
|
The economic importance of potato (solanum tuberosum l.) has grown considerably during the 12 000 years since its domestication and cultivation in the region of southern peru and northern bolivia around lake titicaca, bringing it to its current status as a staple crop in many developing and developed countries . A central challenge faced during cultivation, harvest, and storage of potatoes concerns the wounding of their surfaces and subsequent suboptimal healing conditions that lead to significant crop losses . Thus, it is of considerable commercial and nutritional importance to identify biomarkers that indicate the progress and completeness of healing for wounded surfaces in potato . As a rule, by 1 day after potato tuber wounding, a suberized closing layer begins to form as an initial healing response and by 56 days, it is fully developed . During the latter time period the nascent wound phellem layers emerge, signaling the beginning of wound periderm development for both russet and smooth skin genotypes . Because the wound - healing response varies with cultivar and species, four different cultivars with distinctive russeting features (norkotah russet, atlantic, chipeta, and yukon gold) (table 1) were chosen to compare metabolite profiles during closing layer formation and wound periderm initiation, at time points 3 and 7 days after wounding, respectively . Russeted characteristics are morphological features characterized by rough skin texture and proposed to arise from expansion of the tuber that results in cracking of the skin . The four cultivars selected for study also have contrasting commercial importance: atlantic and chipeta are used primarily for processing into potato chips, whereas norkotah russet and yukon gold are used for baking . The last one is considered to be a leading cultivar because of its high yield, attractive appearance and excellent storability . Although an increasing number of metabolite profiling reports have appeared for potatoes in recent years, the literature on compositional analysis of wound - induced potato tubers and especially polar extracts remains fairly sparse . In a study performed by yang et al, both polar and nonpolar wound - healing extracts from the russet burbank cultivar were analyzed using gas chromatography nonetheless, extensions of these profiling analyses across cultivars are desirable from both methodological and agricultural standpoints: high performance liquid chromatography (lc - ms) and nuclear magnetic resonance (nmr) may offer more robust characterization of the healing tissue extracts, and cultivar comparisons could show metabolite differences that reveal the molecular underpinnings of russeted skin character and/or wound - induced stress response . In turn, the oxidative stress due to wounding can unleash the production of antioxidant compounds, which are present in the native skin of potato and have already found practical use as preservatives in the food industry . Antioxidant evaluation of a purple potato cultivar using a diphenyl picrylhydrazyl (dpph) scavenging assay showed that the activity increased as a result of wounding, but a trend of decreasing dpph scavenging activity was reported in a wounded norkotah russet sample . This inconsistency could reflect a shortcoming of the dpph assay, whereby steric hindrance could compromise assessments of scavenging activities for larger phytochemical constituents . Thus, the current experimental design couples lc - ms and nmr metabolite profiling for four cultivars, at day 3 and day 7 after wounding, with broadly applicable extended - duration scavenging assays using 2,2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid ammonium salt) (abts). By coordinating information on chemical composition and antioxidant activity, the long - term goal is to develop improved methods that ensure rapid and complete wound healing for various potato cultivars while also providing a rich source of chemical compounds with potential application as functional foods . Hplc - ms grade acetonitrile, water, chloroform and methanol (j. t. baker, phillipsburg, nj) and formic acid (sigma - aldrich, st . Louis, mo) were used for lc - ms / ms and time - of - flight (tof - ms) analysis . 2,2-azinobis (3-ethylbenzothi - azoline-6-sulfonic acid ammonium salt) (abts), 6-hydroxy-2,5,7,8 tetramethylchromane-2-carboxylic acid (tci, tokyo, japan), and potassium peroxosulfate (sigma - aldrich, st . Potato tuber cultivars from the 2011 crop year were provided by joe nuez, university of california cooperative extension (davis, ca). Table 1 summarizes the differences in overall phenotypic characteristics that were used in making these selections . Freshly harvested potato tubers were peeled, and the internal flesh tissues were sectioned longitudinally with a mandolin slicer to obtain slices about 5 mm thick . The central part of the tuber was set aside to avoid the internal medulla . Slices were placed on wet cellulose filter paper and left for 3 or 7 days of healing on wire netting supports within closed plastic boxes at 25 c . Water was added at the bottom of the boxes to maintain humidity; healing proceeded in the dark . The brown surface layer of wound - healing tissue was collected carefully using a flat spatula, making efforts to avoid flesh (parenchyma) contamination . The samples were harvested at 3 and 7 days after wounding, representing the early healing tissue in which the suberized closing layer and the wound periderm were developing, respectively . Harvested wound periderm samples were frozen immediately in liquid nitrogen and stored at 80 c until processed . For processing, samples were ground under liquid nitrogen, freeze - dried, and again stored at 80 c . The samples were prepared for chemical analysis using a modification of the method employed by choi et al ., which enables concurrent extraction and partitioning of polar and nonpolar constituents and has become an established protocol for metabolomic studies of plant materials . Samples of 10 mg (dry weight) each were placed in jn glass vials (microliter analytical supplies, suwanee, ga) and extracted with 2 ml of 60% (v / v) methanol water by pan ultrasonication (branson ultrasonics, danbury, ct) for 1 min, followed by addition of 2 ml chloroform and sonication again for 1 min . Each extract was then incubated at room temperature in a shaker for 10 min, followed by tabletop centrifugation (beckman coulter, fullerton, ca) at 3000 rpm to produce three separate phases: soluble polar, soluble nonpolar, and an interphase of suspended particulates . Six replicate extracts were prepared per cultivar for each wound - healing time point (day 3 and day 7). The upper soluble polar extracts were removed carefully with a glass pasteur pipet and dried under a flow of nitrogen for a few hours . Aliquots of the polar extract were dried and reconstituted using a 100 mm ph 7.4 phosphate buffer in d2o that contained the internal standard dss (0.01 mg / ml). Spectra were recorded using a bruker avance plus spectrometer (bruker biospin, karlsruhe, germany) operating at a h frequency of 800 mhz and equipped with a cryomicroprobe that accommodates 1.7 mm o.d . Acquisition of the spectra was achieved using topspin version 3.1 software and an nmr samplejet accessory for automated sample changing . H nmr data were collected for the polar extracts at 298 k with a constant receiver gain, using 512 scans with 4 initial scans, a recycle delay of 1.0 s between acquisitions, and presaturation of the residual water signal set to a chemical shift of 4.695 ppm . The spectral window after fourier transformation and signal conditioning was 14 ppm defined by 32k data points . Liquid chromatography was conducted with a shimadzu uflc (shimadzu u.s.a ., canby, or) equipped with two lc-20 ad pumps, a sil-20ac automatic injector, a cbm-20a communication bus module and a cto-20ac column oven ., 3.0 m ascentisr c18 column (supelco analytical, bellefonte, pa). Each analysis was performed by injecting a 10 l sample into the column and eluting at 35 c with a flow rate of 0.4 ml / min . Six replicate extracts per cultivar were analyzed for each wound - healing time point, and each sample was injected twice . The mobile phase was composed of 0.1% aqueous formic acid (a) and 0.1% formic acid in acetonitrile (b) using a program of nonlinear gradient elution: 2% b (05 min), 210% b (58 min), 1015% b (813 min), 15% b (1325 min), 1530% b (2528 min), 3040% b (2850 min), and 40100% b (5060 min). The lc system was interfaced to an applied biosystems 4000 q trap mass spectrometer (applied biosystems, foster city, ca) for lc - ms / ms measurements . The source type was electrospray ionization (esi) and the source temperature was 300 c . Mass spectra were acquired in both positive and negative modes over the range m / z 1001300 . The optimized declustering potentials were 66 v in the positive mode and 140 v in the negative mode; chlorogenic acid and rutin, compounds reported previously in potatoes, were used as reference standards . The polar extracts were fractionated using an agilent 1200 series hplc - pda liquid chromatography system (agilent technologies, santa clara, ca) equipped with a g1322a degasser, g1311a quaternary pump, g1316a thermostatically controlled chamber, g1315b diode array detector, and g1364c analytical fractionator . The mobile phase composition, flow rate, gradient, and column were as described above . This fractionation protocol was repeated several times to generate sufficient material that could be concentrated and analyzed by tof - ms to obtain the exact mass of the compounds under investigation . Chromatographic fractions from the polar extracts were injected directly into a waters lct premier xe tof mass spectrometer (micromass, manchester, u.k .) Using a harvard 11 plus single syringe pump (harvard apparatus, holliston, ma) equipped with an esi interface and controlled by masslynx v4.1 software . Mass spectra were acquired in both positive and negative modes over the range m / z 1001300 . Nitrogen gas flowing at 300 l / h was used for both the nebulizer and in desolvation . The desolvation temperature was 150 c, and the source temperature was 80 c . For the dynamic range enhancement (dre) lockmass, a solution of leucine enkephalin (sigma - aldrich, st . Louis, mo) was infused by a secondary reference probe at 200 pg / ml in acetonitrile / water (1:1 v / v) containing 0.1% formic acid with the help of a second lc pump (waters 515 hplc). The reference mass was determined once every five scans for both positive and negative data collection; both types of esi data were collected using a scan time of 0.2 s and an interscan time of 0.01 s. the abts scavenging activity was assessed according to the method described by re et al . With minor modifications . Abts was generated by reacting an aqueous abts solution (7 mm) with k2s2o8 (2.45 mm) in the dark for 1216 h at ambient temperature and adjusting the absorbance at 734 nm to 0.70 (0.02) with ethanol . To a 2 l aliquot of the periderm extract of interest was added 198 l of abts reagent; the absorbance was recorded at 734 nm after initial mixing and subsequently at 5 min intervals (45 min in total) using a spectramax microplate reader (molecular devices, sunnyvale, ca). The percentage inhibition values for different concentrations were calculated using the following equation:1 a plot of percentage inhibition versus concentration was made for the reference standard, 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (trolox). On the basis of this plot, the trolox equivalent antioxidant capacity (teac, mol trolox / g dried sample) values were calculated for each extract . For metabolite profiling analysis, mestrec software version 4.9.9.9 (mestrelab research, escondido, ca) was used to correct the phase and baseline of each spectrum and to remove the spectral region containing the remaining water signal . The integrated area of each bin / bucket was normalized with respect to the area of all bins . Mzmine version 2.4 (vtt technical research center, helsinki, finland and turku center for biotechnology, turku, finland) was used to filter the spectra according to retention time and m / z range . The region of the chromatogram between 0 and 4 min, which contains primary metabolites reported previously, was not included in the current pca analysis . Principal component analysis (pca) of the normalized data from nmr and ms experiments was carried out using simca - p+ software version 13.0 (umetricas, ume, sweden) and pareto scaling . In addition, the data were subjected to orthogonal partial least - squares discriminate analysis (opls - da), in which data from a particular cultivar were assigned to one class that was then compared with another class comprising the remaining cultivars . The corresponding s - plots displayed extreme wings that yielded chemical shifts or mass - to - charge (m / z) ratios of the biomarkers that contribute to compositional differences among the tissue samples (figure 1). These variables were evaluated individually using variable line plots to ascertain if the markers were unique to a particular cultivar at a specified wounding time point (figure 1). Schematic representation of the experimental design, including typical data and statistical multivariate analyses including pca, opls - da and s - plot analysis of liquid chromatography - mass spectrometry (lc - ms) data (total ion current (tic) chromatograms in positive mode), leading to the detection of marker ions . Stacked lc - ms chromatograms of the polar extracts each represent average data from six biological replicates from day 3 potato wound periderm samples, color coded for norkotah russet (blue), atlantic (red), chipeta (green), and yukon gold (gold). The markers were then characterized using mass and fragmentation data (ms, ms / ms and ms / ms / ms) from the 4000q trap and the exact mass values from the tof - ms instrument, respectively . The marker compounds were identified tentatively by comparison of these data with published ms results using scifinder scholar and online databases such as pubchem, chemspider and metlin . To check the consistency of the ms - based identifications with observed nmr data for the extract mixtures, acd software (acd laboratories, toronto, canada) was first used to simulate the nmr spectra of the identified markers . The simulated h spectra of each compound were checked against the chemical shift list derived for biomarkers by opls - da and s - plot analysis of the experimental nmr data for extract mixtures . For example, a biomarker compound for the atlantic day 3 extract was tentatively identified as bis (dihydrocaffeoyl) spermidine, compound 5, (474.4 m / z; 18.1 min) (figure 1 and table 2). The simulated h chemical shifts for this ms - derived biomarker were compared with marker shifts derived from the experimentally observed nmr data for the extract mixture . Fragmentation data obtained from lc - ms / ms analysis using a 4000q trap instrument . Also among the biomarkers identified in native periderms of these four cultivars (huang et al ., unpublished observations). Isomeric compounds which were distinguished from each other by their retention times and the intensities of their mass fragmentation peaks . The wound healing time point is denoted by wd3 or wd7, and color coded depending on the cultivar(s) specific for the biomarker . The coloring scheme denotes atlantic (red), chipeta (green), norkotah russet (blue), or yukon gold (gold). Marker compounds found in all four cultivars that are specific to day 7 post wounding, which is associated with nascent wound periderm development . The (+) sign indicates that the compound in question is a marker for the day 7 time point . Also among the metabolites identified in native periderms of these four cultivars (huang et al . This compound can be distinguished from gas - phase dimer ions produced as artifacts during ms analysis: the observed m / z value of its molecular ion differs from a simple doubling of chlorogenic acid due to loss of water consequent with dimer formation . Visual inspection of the stacked h nmr spectra for wound - healing tissue extracts from various cultivars at days 3 and 7 (figure 2 and supporting information (si) figure s1, respectively) shows good consistency among the six replicates for each cultivar, a high degree of instrumental reproducibility, and modest but clear differences among the four cultivars . A more rigorous multivariate analysis of the data provides essential unbiased confirmation of these differences . The pca - associated score plots for the nmr data (figure 3) demonstrate that the polar metabolites for each of the four cultivars form distinct and nonoverlapping clusters, more distinct at day 3 compared with day 7 post wounding . To compare the metabolic profiles at different wound - healing time points, pca was carried out for day-3 and day-7 nmr data together; the resulting score plot (figure 4) shows a clear separation of metabolites at the two time points according to pc1 . Again, a closer convergence of the clusters for each cultivar is evident at day 7 . Stacked 800 mhz h nuclear magnetic resonance (nmr) spectra, showing average data from six biological replicates of polar extracts from day 3 potato wound periderm samples, color coded for yukon gold (gold), norkotah russet (blue), chipeta (green), and atlantic (red). Vertical expansions of the aromatic and multiple - bonded region between 6.0 and 8.0 ppm are shown in each inset . Pca score plots for the nmr data from extracts of day 3 (a) and day 7 (b) wound - healing samples, color coded for atlantic (red), chipeta (green), norkotah russet (blue), and yukon gold (gold) potato periderms . Pca score plot for the overall nmr data from extracts of the four cultivars at both day 3 (circles) and day 7 (triangles) post wounding (w). The samples are coded for atlantic (red, a), chipeta (green, c), norkotah russet (blue, r), and yukon gold (gold, y). In an analogous fashion, figure 2 and si figure s2 demonstrate consistency among lc - ms experiments on nominally identical samples and distinct signatures for each of the four cultivars and wound - healing time points . Even more definitively than via nmr data, score plots obtained from pca analysis of the lc - ms experiments show polar metabolite differences among the clusters corresponding to russet norkotah, atlantic, chipeta, and yukon gold cultivars (figure 5). As compared with day 3 (figure 5a), the convergent trend of metabolite compositions at day 7 is demonstrated by both the lc - ms score plot (figure 5b) and the overall pca analysis for both healing time points (figure 6), again aligning with the nmr - derived multivariate analysis (figures 3 and 4). This convergence of metabolite profiles with time, which has been observed previously in gc - ms - based multivariate analysis of russet burbank periderms, could reflect common biosynthetic pathways associated with wounding in the four cultivars . That is, if the initially distinct metabolite pools for the four cultivars accumulate a common set of phytochemicals associated with wound induction, these common metabolites will become increasingly dominant at later healing stages . Pca score plots for the lc - ms data from extracts of day 3 (a) and day 7 (b) potato wound - healing samples, color coded for atlantic (red), chipeta (green), norkotah russet (blue), and yukon gold (gold). Pca score plot for the overall lc - ms data from extracts of the cultivars at both day 3 (circles) and day 7 (triangles) post wounding (w). The periderm samples are coded for atlantic (red, a), chipeta (green, c), norkotah russet (blue, r), and yukon gold (gold, y). Opls - da analyses and their corresponding s - plots, illustrated in figure 1, provide chemical insight into the basis for variations in metabolic profiles . In particular, it is possible to identify the nmr chemical shifts and/or ms ions corresponding to metabolites (biomarkers) that accumulate or are specific for a particular cultivar or wound - healing time point from the extremes of the s - plots . By comparing the marker ions with published ms data using scifinder scholar (https://scifinder.cas.org/scifinder) or other online databases, it was possible to tentatively identify the polyphenolic amines, flavonoid glycosides, phenolic acids, and glycoalkaloids listed in table 2 . A total of 22 of 24 biomarkers were identified by ms / ms and ms - tof methods . As noted in the materials and methods section, early eluting primary metabolites were excluded from the current pca analysis . The majority of the identified biomarkers for atlantic and norkotah russet varieties, at both days 3 and 7 post wounding, are polyphenolic amines . Conversely, most of the polyphenolic amine biomarkers are found in the atlantic and norkotah russet cultivars (table 2). Polyphenolic amines have been claimed previously to offer resistance to potato pathogens such as phytophthora infestans and streptomyces scabies . Therefore, accumulation of these antimicrobial compounds can offer protection at the wound site and aid in development of an effective moisture barrier . The polyphenolic amine biomarkers include derivatives of spermine, spermidine, tyramine, and putrescine . Among these compounds, markers for closing layer formation include kukoamine isomers (1, 2), feruloyl putrescine and its isomer (3, 4), n, n - bis (dihydrocaffeoyl) spermidine (5), n, n, n - tris (dihydrocaffeoyl) spermidine (6), feruloyl tyramine (7) and caffeoyl putrescine (8) for the atlantic and/or norkotah russet cultivars . By contrast, other phenolic amines are found as biomarkers for these cultivars only after the closing layer has been formed and wound periderm formation has been initiated: coumaryl putrescine (9) for atlantic and n, n, n tris(dihydrocaffeoyl)spermine (10) for norkotah russet, respectively . Feruloyl tyramine (7) is a norkotah russet marker at both day 3 and day 7 time points . Compounds 6, 9, and 10 are also markers for the day 7 wound - healing time point in chipeta or yukon gold cultivars . The polyphenolic amine biomarkers listed in table 2 have been reported previously in the flesh of potato tubers . Feruloyl tyramine and related compounds are associated with the lesions and heavier skins formed by scab - infected potato tubers . (the phenolic amine grossamide (11), which is not a cultivar marker but is upregulated for all four cultivars, is discussed in the following section .) One additional unidentified biomarker (23) can be classified as a spermine derivative from its ms data . Finally, several of the polyphenolic amines in table 2 were also identified in native periderms (tuber skin) from these four potato cultivars (noted as for biomarkers, for nonbiomarker metabolites; huang et al . Kaempferol glycosides (1214) are detected as biomarkers for norkotah russet and yukon gold . All glycoside compounds have been reported in potato peels with the exception of potengriffioside (14), which was isolated from solanum crinitum lam . Tubers . One common potato phenolic metabolite that is identified as a biomarker for yukon gold and norkotah russet is chlorogenic acid (15). Feruloyl quinic acid (16) is a marker specific to norkotah russet at days 3 and 7; ferulic acid itself (17), which plays an integral role in suberin formation, is a marker for the day 3 extracts of yukon gold . Both 15 and 17 have been reported previously in the polar extracts from wound - healing russet burbank potato periderms . Finally, the atlantic and chipeta cultivars exhibit a caffeoylquinic acid dimer biomarker (18) in both 3- and 7-day wound - healing samples . Glycoalkaloids, compounds 1922, are identified as biomarkers for chipeta and norkotah russet cultivars . Chaconine (19) and solanidine solatriose (20) are detected in day 3 and day 7 chipeta samples, respectively, whereas leptinine ii (21) is a marker for day 3 norkotah russet polar extracts . Leptinine i (22) is a marker for day 7 extracts in all four cultivars and should thus be viewed as a marker associated with this later time point of wound - induced healing . The glycoalkaloids chaconine, leptinine ii, leptinine i, and solanidine solatriose have been reported previously in the tubers of norkotah russet potatoes . Chaconine has also been reported to be present in potato peels of diverse cultivars . Taken together, the glycoalkaloid compounds are viewed as an important class of potato biomarkers because of their demonstrated role in resistance to pests and pathogens . However, they also show concentration - dependent toxicity in organisms ranging from fungi to humans . Due to their structural similarity to steroidal hormones, glycoalkaloids are considered additionally to be promising intermediates in the production of contraceptives and steroidal anti - inflammatory drugs . Glycoalkaloids have been reported to have a wide range of bioactivities, including anticancer, anti - inflammatory, antinociceptive, and antipyretic effects . Although the current comparisons are limited to day-3 and day-7 time points, a prior extended time course study of healing russet burbank tubers reported a significantly different polar metabolic profile at day 0, the onset of wound induction . Opls - da and s - plot analysis of day-3 and day-7 wound - induced metabolite data for the four cultivars permits the identification of compounds that are more abundant at day 7, the healing time point related to the development of the nascent wound - healing periderm . These compounds include several classes of phytochemical substances: polyphenolic amines, flavonoid glycosides, phenolic acids and glycoalkaloids . A kukoamine isomer (1), feruloyl putrescine isomer (4), n, n bis(dihydrocaffeoyl) spermidine (5), grossamide (11), kaempferol hexoside (12), chlorogenic acid (15), ferulic acid (17), chaconine (19) leptinine i (22), spermine derivative (23) were all identified as markers specific to the day-7 healing time point ., thus, compounds produced in significantly larger quantities at the day-7 time point compared with day 3 can be associated with wound periderm development . Indeed, phenolic amines and glycoalkaloids similar to 1, 4, 5, 11, 19, and 22 have been reported to offer resistance against microbes, insects, and herbivores . Therefore, their accumulation during wound periderm formation could be part of the protective mechanism against infections . The current results complement a prior gc - ms study of wound - healing samples from russet burbank potato periderms, in which the majority of the identified constituents were primary metabolites but phenolic compounds such as chlorogenic acid, ferulic acid, iso - chlorogenic acid, caffeic acid, and coniferyl alcohol were also reported . No phenolic amines, flavonoid glycosides, or glycoalkaloids were identified in the earlier work, presumably because silylation produced species that exceeded the detectable m / z ratio, were only partially derivatized, or underwent side reactions rather than the desired formation of volatile derivatives . As shown in figures 36, robust multivariate analyses can be conducted for polar periderm extracts using either nmr or lc - ms data; chemical shifts and mass - to - charge ratios of markers for cultivar type or wound - healing time point can also be extracted from s - plots in opls - da analyses (figure 1). For each of the 22 ms - derived biomarkers identified by comparison with published mass spectral data (tof, lc - ms, and mass fragmentation) for potatoes or related plant species, we were able to simulate an nmr spectrum; the prediction could then be cross - checked against biomarker chemical shifts that had been determined from the wings of the corresponding nmr - derived s - plots . This situation is illustrated by the biomarkers for the yukon gold day 7 extract: for feruloyl putrescine (3), n, n, n tris(dihydrocaffeoyl spermine (10), kaempferol hexoside (12), potengriffioside (14), and chlorogenic acid (15), the ms - based identifications and associated nmr spectral simulations were supported by observed biomarker chemical shifts (e.g., 7.68, 7.48, 7.44, 7.32, 7.28, 7.20, 7.16, 7.04, 7.00, 6.96, 6.88, 6.84, 6.76, 6.72, 6.60, 6.56, 6.52, 6.40, 5.32, 4.26, 4.22, 3.90, 3.86, 3.82, 3.70, 3.38, 3.34, 3.30, 3.10, 2.22, 1.54, and 1.14 ppm). For biomarkers such as 23, however, the ms ion could not be identified because no published literature was available; it was possible to deduce its compound class from the associated ms fragments and to validate that supposition from the nmr - derived biomarkers . Such novel compounds then remain to be isolated and elucidated using standard but lengthy spectroscopic procedures . Even more seriously, lc - ms could miss an oligomeric biomarker i.e., give a false negative result, if the compound fails to ionize and thus goes undetected . Either previously unreported ms marker ions or biomarkers that do not ionize in ms experiments should be evident if analysis of the nmr data reveals marker shifts that fail to match the predictions for ms - identified compounds . Although h nmr methods have a broader detection range, they suffer from considerably lower molar sensitivity than ms . A pitfall associated with this limitation is illustrated by the observed marker shifts at 5.40 and 5.44 ppm, which are consistent with nmr spectra predicted for the leptinine ii glycoalkaloid (21), a metabolite that is accessible by lc - ms but does not satisfy biomarker criteria for the yukon gold day-7 polar periderm extract . The limited sensitivity of nmr could render this compound unobservable in the remaining cultivar samples, producing a false positive among the nmr - derived biomarkers . Finally, nmr - based identification of individual metabolites in an extract mixture is also challenged by incomplete spectral resolution, even when multidimensional experiments are conducted . Although a number of promising nmr - based metabolomic identification approaches have been proposed in recent years, they remain limited by the complexity of plant extract mixtures and the scope of current structural data libraries . Complications such as those illustrated above reflect incomplete structural databases for plant - derived materials as well as limited ms ionization and nmr sensitivity capabilities, respectively, arguing for use of a conservative dual - method analysis to improve the completeness of the resulting structural profile for constituent metabolites . As noted above, the oxidative stress associated with tuber wounding and the potential of potato - derived antioxidant compounds as food preservatives together motivate quantitative assessments of such compounds in potato cultivar samples . Polar extracts of day 3 and day 7 tissue samples were screened for their free radical scavenging activities . All extracts exhibited scavenging activity, and their activities increased with incubation time (figures 7 and 8). Thus, it may be deduced that the cultivars contain slow- as well as fast - acting antioxidants, underscoring the need for an assay such as abts that measures the scavenging capability of the extracts over an extended period of time . The assay has additional advantages such as absence of steric hindrance, a broad ph range, and minimal spectral interference from other natural products, distinguishing the current investigation from previous antioxidant research on extracts from potato peels . Abts scavenging activity of polar extracts from day 3 potato wound periderm samples expressed as teac (mol trolox / g dried sample), color coded for atlantic (red), chipeta (green), norkotah russet (blue), and yukon gold (gold). Values are expressed as mean standard error of the mean (n = 6). Abts scavenging activity of polar extracts from day 7 potato wound periderm samples expressed as teac (mol trolox / g dried sample), color coded for atlantic (red), chipeta (green), norkotah russet (blue), and yukon gold (gold). Values are expressed as mean standard error of the mean (n = 6). Note that the large standard error of the mean for yukon day 7 extracts corresponds to a percent error that is similar to the other extracts . At day 3, the order of activity among the cultivars was as follows: yukon gold norkotah russet (not significantly different, p> 0.05)> the order of activity was changed at day 7, to yukon gold> norkotah russet> atlantic> chipeta . Overall, the extracts of yukon gold stood out for their high scavenging activity, displaying the highest rates especially after 7 days of wound healing . Although the scavenging capability for most varieties is achieved early during closing layer development and maintained at comparable levels as a functional periderm barrier begins to develop, the yukon gold variety nearly doubles its scavenging activity at day 7 . This increase in activity could be attributed to the accumulation of antioxidant metabolite(s) during wound periderm development, where the measured extract activity will represent the net effect of potentiation, synergism and antagonism among components of a mixture of antioxidants . The presence of biomarkers such as kaempferol hexoside (12), potengriffioside (14), and chlorogenic acid (15), which have established antioxidant activities, could account for the high activity measured in the yukon gold extracts . At day 3, extracts of both yukon gold and norkotah russet demonstrate similar high scavenging activity so that analogously, antioxidant biomarkers such as kaempferol dihexoside (13) potengriffioside (14) chlorogenic acid (15), feruloylquinic acid (16) and ferulic acid (17) could be responsible for their robust scavenging activities . It is also instructive to compare the current antioxidant results with a prior study of unprocessed, baked and chipped tubers from yukon gold and atlantic cultivars . The abts scavenging activities, reported as teac values for extracts of those three preparations, were much smaller than values measured herein for both day-3 and day-7 wound - healing tissue extracts from the same cultivars (table 3). This trend persists even when the previously reported fresh - weight assessments are expressed commensurately to our dry - weight values: the scavenging activities of unprocessed tubers (presumably flesh and skin together) are 48 times lower than our late - time point wound sample, for instance . Although a portion of these differences may reflect variations in methodology, the most potent factors are likely to involve our focus on wound - healing tissues and wound induction . The scavenging activities of the samples are expressed as teac (mol trolox / g dried sample). The values are expressed as mean standard error of the mean (n = 6). Published teac values were measured for tubers . Adjusted by estimating that the tissue is 90%-by - weight water . The significantly higher activity observed for the current samples thus supports the potential of wound periderms as sources of antioxidants . Among the studied cultivars, yukon gold followed by norkotah russet may prove to be of highest value for future industrial applications . Moreover, time - dependent trends in antioxidant assessment can be viewed as a useful tool to monitor the wound - healing process in these potato cultivars.
|
Acute cholecystitis is the most common complication of gallbladder stones, and one of the most frequently seen acute surgical diseases (1). Before tokyo guidelines management strategy of acute cholecystitis was introduced for effective dissemination of the guidelines in the world (2, 3). Today, tokyo guidelines criteria are recommended for the diagnosis of acute cholecystitis, since it standardizes the treatment approach by staging the severity of the disease (4, 5). According to these guidelines, diagnostic criteria for acute cholecystitis include physical examination findings, laboratory results such as c - reactive protein (crp) and white blood cell levels, as well as radiologic evaluation . Following the diagnosis, clinical severity of the disease is defined and assigned to 1 of the 3 grades based on tokyo guidelines, which observes various clinical findings, including patient s history (duration of symptoms), physical examination, laboratory tests, and imaging methods (4, 5). Crp level is only used as a diagnostic criterion of acute cholecystitis, and it is not part of the determinant criteria of the severity assessment of the disease in the guideline . On the other hand, correlation between crp levels and severity of acute cholecystitis is a well - known fact, and several studies have reported that crp level is a reliable predictor of severe conditions of the inflammation in acute cholecystitis (6 - 13). But a cut - off level of crp that reveals the grade of the disease has not been proposed so far . Considering the relationship between crp levels and grade of inflammation, we investigated the levels of crp at different cut - off levels to predict the severity of the disease and its possible role in grading the disease according to tokyo guideline for our patients . The study is based on the retrospective analysis of 682 cases out of consecutive 892 patients with acute cholecystitis admitted to 2 different centers: sisli etfal training and research hospital, and arnavutkoy state hospital, general surgery clinics, in istanbul, turkey . Patients admitted to the hospital diagnosed with acute cholecystitis were identified retrospectively by using the international classification of disease, 10th revision (icd-10) codes between january 2011 and july 2014 . A total of 210 patients with other diseases causing high crp levels were excluded from the study as follows: 4 patients with connective tissue diseases, 14 patients with respiratory tract or pulmonary infections, 11 patients with genitourinary tract infections, 4 patients with inflammatory bowel disease, 4 patients with soft tissue infections, 3 patients recently underwent any surgical procedure, 2 patients with history of recent burns or trauma, 20 patients with chronic liver disease, 33 patients with malignancy, 108 patients accompanying pancreatitis or cholangitis, and 7 patients younger than 18 years (figure 1). Demographics, history, physical examination, laboratory, and imaging findings during admission of 682 patients were evaluated, retrospectively . Clinical variables consisting of laboratory and imaging findings were obtained during diagnosis at the time of the admission to hospital, and included in the study . The criteria of tokyo guidelines were used in grading the severity of acute cholecystitis, and patients were accordingly divided into 3 groups . Group 1 included the patients with grade 1 mild acute cholecystitis, while group 2 included grade 2 moderate acute cholecystitis, and group 3 comprised grade 3 severe cases (table 1) (3). They were studied using beckman coulter immage 800 device with the scale of mg / l . Pt - inr: prothrombin time - international normalized ratio; and wbc: white blood cell . Data were analyzed by using the statistical package for social sciences (spss, chicago il, usa, 2012). The significant cut - off levels of crp of groups were evaluated with roc curve analysis, to find out any significance related to the severity of the disease . Sensitivity and specificity for crp levels were included in roc data analysis, and youden s index was calculated for groups 2 and 3 . Results were evaluated with 95% confidence interval, and p values under 0.05 were considered to be statistically significant . Data were analyzed by using the statistical package for social sciences (spss, chicago il, usa, 2012). Variation of crp levels among study groups was analyzed with kruskal - wallis test . The significant cut - off levels of crp of groups were evaluated with roc curve analysis, to find out any significance related to the severity of the disease . Sensitivity and specificity for crp levels were included in roc data analysis, and youden s index was calculated for groups 2 and 3 . Results were evaluated with 95% confidence interval, and p values under 0.05 were considered to be statistically significant . Out of total participants, 415 patients were female, and 267 were male, with a mean age sd of 51.61 16.65 years and median age of 51 years (18 - 93). Following grading of the patients according to tokyo guidelines, 439 patients were classified into group i with grade 1 cholecystitis, 220 patients into group ii with grade 2 cholecystitis, and 23 patients had grade iii disease that put them into group 3 . Time of the onset of symptoms of a patient was evaluated in grading, according to the guideline . In 682 patients, the minimum time duration interval onset of symptoms and hospital admission was 20 hours, while the maximum interval was 190 hours . The mean, median, and interquartile range of age in group i was found to be 48.97 15.47, 48, and 71 y (18 - 89), respectively . In the same group the mean, median, and interquartile range crp value of 18.96 22.20, 10.2, and 19 mg / l (0.10 - 128.2), respectively . The mean duration between the onset of symptoms and hospital admission was 50.2 hours (20 - 65). The mean, median, and interquartile age range of patients in group ii were 55.06 17.51, 56 and 75 y (18 - 93), respectively . In the same group the mean, median, and interquartile range of crp values were 133.51 76.55, 135.2 and 120.9 mg / l (9.20 - 280.70). Those patients were considered as grade 2, because pure leukocytosis (> 18.000/mm) was found in 71, perforation of the gallbladder in 12, gangrenous gallbladder in 15, with symptoms lasting longer than 72 hours in 125 cases, including 15 cases with gangrenous cholecystitis and 12 with perforation of the gallbladder, as well as finding a palpable mass in the right upper quadrant in 24 patients . The mean duration between the onset of symptoms and admission was found to be 108.7 hours (36 - 190), of them 56.8% (125 patients) had a longer time than 72 hours . Twenty - three patients were entered later into group iii from group ii, because of having at least one organ insufficiency found during medical treatment or follow - up . Eleven of those patients developed oliguria and or increase in creatinine levels> 2 mg / dl during follow - up . Mean age of those patients with renal insufficiency was 56.7 y (39 - 67), and none of them had a previous renal disease or used any nephrotoxic agent . Following intravenous fluid therapy, renal functions came back to normal in all of them . An 89-year - old patient that had referred to the hospital with symptoms lasting longer than 96 hours had an onset of hallucinations and mental confusion . After neurological and psychiatric evaluations, it was differentiated as a delirium state, triggered by acute cholecystitis . In 3 patients, with a mean age of 58.3 y (45 - 72), platelet levels were decreased to 84000/mm, 92000/mm, and 95000/mm and they stayed at those levels during follow - up . We did not observe any bleeding due to thrombocytopenia in those patients, and the levels came back spontaneously to normal ranges following treatment of acute cholecystitis . In 8 patients, without any history of using anticoagulant agents, international normalized ratio (inr) levels were found to be increased to a mean level of 1.68 (1.50 - 1.98). In 6 of them, aspartate transaninase (ast) and alanine transaminase (alt) levels with 3 - 10 times of normal values were also observed with high inr levels . The mean age of those 6 patients that were considered to have hepatic dysfunction was 62.4 y (40 - 87) and hepatic failure did not develop in any of them . In group iii mean, median, and interquartile range of crp level in group iii was found to be 237.23 62.56, 250.7, and 218.5 mg / l (117.1 - 335.6), respectively . Their mean, median and interquartile range age were 68.78 14.28, 72 and 50 y (39 - 89), respectively . Crp levels in 121 patients were within normal limits, and all of these patients were in group i with grade 1 acute cholecystitis . Both group ii and group iii did not include any patient with normal crp levels . Abbreviations: ruq, right upper quadrant; wbc, white blood cell . When crp values were examined among the groups, mean and median crp levels in each group were found to be significantly different (p <0.0001). In addition, they were found to be highly correlated with the disease grade, and these correlations are statistically significant and moderately positive (p <0.001, r = 0.743) (table 3). After evaluating crp levels according to the disease grade, for group ii the auc (area under the curve) was 93.8%, which was very high . As the area under the curve for group ii is high, lr+ value is strong, the sensitivity of crp test is 75.5%, (moderate) and the specificity is 96.6%, (strong) for determining the grade 2 acute cholecystitis . For group iii, as the area under the curve for group iii is high, lr+ value is strong, with the sensitivity of 73.9% and the specificity of 75.5%, (moderate) for determining the grade 3 acute cholecystitis (figure 2). Youden s index was found to be 0.72 for group ii and 0.49 for group iii (table 4). As a result, although cut - off values of crp levels for both groups (groups ii and iii) have a diagnostic power; they are more meaningful for group ii than group iii to determine the grade of acute cholecystitis using crp levels . Abbreviation: r, correlation coefficient . Abbreviations: ppv, positive predictive value; npv, negative predictive value . According to the predictive values in our series, level of crp seems to differentiate cases from each other in terms of the severity of the disease as defined in tokyo guidelines . Following hospital admission, patients with crp level> 70.65 mg / l may be considered as grade 2 acute cholecystitis, while patients with crp level> 198.95 mg / l may be considered as grade 3 cholecystitis, and medical treatment can be planned accordingly . Cholecystitis is a syndrome that entails a continuation of clinicopathologic states (14); one end of this continuum is acute cholecystitis (15). Developed in 2007 and revised in 2013, tokyo guidelines standardized the diagnosis and treatment of acute cholecystitis for the first time (4, 5). In this guideline, the disease is diagnosed and its severity is graded based on clinical, laboratory and imaging results (table 1). Tokyo guidelines recommend early laparoscopic cholecystectomy for grade 1 acute cholecystitis and elective cholecystectomy for grade 2 patients as the first - line of treatment . If a patient with grade 2 acute cholecystitis does not respond to initial medical treatment, urgent, or early gallbladder drainage is required . For patients with grade 3 acute cholecystitis, urgent or early gallbladder drainage is essential in addition to organ support and medical treatment (5, 16). According to tokyo guidelines, crp, a well - known acute phase reactant that increases rapidly in inflammatory processes, is included in the laboratory findings for the diagnosis of acute cholecystitis . In various studies, crp has been found to be a strong predictive factor in determining the severity of gallbladder inflammation (17 - 19). In patients of acute cholecystitis with high levels of crp, conversion from laparoscopic to open procedure was found to be at higher rates (12, 20 - 24). However, unlike while blood cell count that has taken place in grading the disease according to the guideline, the predictive value of crp has not been determined and accepted among prognostic factors yet . Proceeding from this point, in our study, we aimed to observe whether this well - known inflammatory marker has a predictive cut - off level for the severity of the disease, i.e., be one of the decision keys before the onset of the treatment . According to our results, different grades of the disease can be distinguished from each other, based on different crp levels . In previous studies, regarding the grading of the disease according to tokyo guidelines, no cut - off values of crp have been proposed so far . However, in a study by nikfarjam et al ., crp value> 94 mg / l was found to be a significant risk factor for gangrenous cholecystitis (19). Similarly, asai et al . Reported a significant correlation between high risk of bactobilia and advanced age, high levels of crp, and the evidence of significant gallbladder infection . In their study, the cut - off crp value was found to be 134 mg / l for bactobilia (22). In general, levels of crp of up to 10 mg / l are considered clinically insignificant for acute inflammatory reactions . On the other hand, crp levels of 100 mg / l or more are strongly associated with local tissue necrosis (22 - 26). In a study that observed crp levels in the diagnosis of sepsis, the threshold value was considered to be> 100 mg / l, but no cut - off value was defined (27). In our study, patients with grade 2 acute cholecystitis were found to be statistically different than grade 1 at crp level of 70.65 mg / l or above, while patients with crp levels of 198.95 mg / l or above were found to be correlated with grade 3 diseases . According to tokyo guidelines, grade 1 patients are cases with uncomplicated acute cholecystitis . Therefore, very high crp levels are not usually encountered in patients with grade 1 acute cholecystitis . It is even possible to see patients with normal crp levels, such as some of the patients in group 1 (n = 121) of our study . Mg / l in grade 1 disease, and cut - off value for grade 2 was determined to be 70.65 mg / l, with a specificity of 96.6% . This level is under the threshold that points tissue necrosis and gangrene in the literature and seems to be compatible with cases of grade 1 acute cholecystitis . Unlike the cases with grade 1, gallbladder inflammation in grade 2 patients gets complicated, and may be accompanied by bacteremia, systemic inflammatory response syndrome (sirs) or sepsis, but not organ dysfunction . Thus, crp is expected to be at higher levels in this group . In our study, we found crp levels as high as 133.51 mg / l in group ii, significantly higher than group i. however, assuming crp cut - off value of 70.65 mg / l distinguishes grade 2 from grade 1; this value may be considered to be under crp values, indicating tissue necrosis and gangrene as reported in the literature . Nevertheless in our study, crp cut - off value of 198.95 mg / l differentiated grade 3 disease from grade 2 disease . Accordingly, patients with crp levels up to 198.95 mg / l can be assumed as grade 2 disease . Based on tokyo guideline, patients with grade 3 cholecystitis have accompanying organ dysfunction, but it was not emphasized in the first guideline whether it was evident at the time of admission or diagnosed during follow - up (4, 5). Pointed out that patients who have comorbidity, but are not complicated with organ dysfunction on admission, will be graded as 1 or 2 (28). Later, yokoe et al . Determined organ dysfunction as the proceeding of acute cholecystitis from mild / moderate forms into severe (29). In our study, 23 patients receiving medical treatment developed organ dysfunction during the course of the disease, so they were included into grade 3 disease . Those patients had been classified as cases with grade 2 disease at the time of the admission, but following failure of medical therapy, they were ended up with sepsis and/or organ dysfunction . The rate of mortality was 0% in all groups . In our study, mean crp level of grade 3 patients before any surgical procedure was found to be as high as 237.23 mg / l, which seems to be consistent with the main idea of the study . Although the severity of local inflammation is proportional to the increase in crp levels, some studies report no significant difference between non - infectious sirs, sepsis, and organ dysfunction in terms of crp levels (30 - 34). We found the cut - off values of crp as 198.95 mg / l with a sensitivity of 75.5%, in patients with grade 3 disease . However, up to the present, we did not found any similar study analyzing levels of crp at different cut - off values to predict the grade of the acute cholecystitis . Besides, our study has a larger number of cases compared to many previous studies on acute cholecystitis . On the other hand, number of patients with grade 3 acute cholecystitis in this study however, according to the studies that have evaluated tokyo guideline, grade 3 acute cholecystitis has been reported to evolve out of 1.2% - 6% of all cases (5, 22, 27, 29). In our study, this rate was found to be 3.3%, similar to these results . When the diagnosis of acute cholecystitis is determined based on the criteria of tokyo guidelines, severity of the disease should be assessed initially, to set up the management strategy . According to our results . However, further studies are needed to describe the exact role of crp level in grading acute cholecystitis.
|
Primary hyperparathyroidism (phpt) is a common endocrine disorder with an incidence of 0.4 to 1 per 1,000 individuals, with a peak during the 5 and 6 decades of life . 1 symptomatic patients, and those without symptoms that meet the guidelines for the 2002 nih consensus development panel for asymptomatic phpt, are candidates for parathyroid surgery . 2 the incidence of thyroid cancer has progressively increased in the united states over the past decade . The treatment of thyroid carcinoma is surgical, and requires thyroid lobectomy / isthmusectomy, total thyroidectomy, or total thyroidectomy with central lymph node dissection (ata guidelines 2009), depending upon stage of disease . 3 concomitant phpt in the setting of thyroid disease can present a surgical challenge for surgeons caring for these patients . Since ogburn first described synchronous primary hyperparathyroidism and thyroid carcinoma more than fifty years ago, there have been multiple reports examining these co - existing endocrine disorders . 4 rates of co - existing primary hyperparathyroidism and thyroid pathology range from 20 - 67%, with synchronous thyroid cancer occurring in 2 to 24% . This allowed the surgeon to examine all 4 parathyroid glands, but also allowed for a thorough examination of the thyroid gland . However, the modern management of primary hyperparathyroidism has moved towards minimally invasive approaches guided by nuclear medicine localization studies (tc - sestamibi scintigraphy) and intra - operative parathyroid hormone (pth) testing . This surgical approach allows for small incisions, lower morbidity, but less exposure of the thyroid gland, leading to concerns about missing co - existent, and significant thyroid pathology . We undertook a prospective, single - arm study examining all patients undergoing an operation for phpt to determine the prevalence of concomitant thyroid disease detected by preoperative thyroid ultrasound . Specific aim: to determine the prevalence of concomitant thyroid disease detected by preoperative thyroid ultrasound in patients undergoing surgery for phpt . Primary endpoint: the primary outcome variable in this study was prevalence of co - existent benign and malignant thyroid pathology . Study population: ninety - four of 110 patients screened for eligibility were enrolled in this study, conducted at two medical centers (walter reed army medical center from january 2005 through june 2008; johns hopkins university hospital from january 2008 through june 2008) under institutional review board approval at the respective institutions and adherence to hipaa compliance . Adult patients, age 18 years and older, with phpt based upon standard diagnostic laboratory criteria, were eligible for inclusion . Patients unable to provide informed consent, those having previously undergone prior thyroid or parathyroid surgery, or those with known thyroid disease, patients with medullary thyroid carcinoma and/or multiple endocrine neoplasm syndrome, and those declining enrollment were excluded . Prior to surgical intervention, thyroid ultrasonography was performed and suspicious thyroid findings were further investigated with fine needle aspiration biopsy (fnab) and/or thyroid resection . Any changes in the planned surgical procedure based on thyroid ultrasonography findings and/or fna results were recorded . Statistical analysis: descriptive statistics were used and study sample means are presented with standard deviations (mean sd). Clinical characteristics and preoperative evaluation: there were 110 patients evaluated and 94 patients enrolled: 71 females and 23 males, with a mean age of 5613 years (table 1). Three patients reported a prior history of neck radiation, and a family history of thyroid cancer was identified in one patient who had a multi - nodular goiter (mng). Preoperative laboratory evaluation confirmed hypercalcemia (mean: 11.0 0.5 mg / dl), elevated serum parathyroid hormone levels (mean: 117.9 50.7 pg / ml) and elevated 24-hour urine calcium (mean: 367.5 180.3 mg/24 hours) (table 1). Sestamibi identified parathyroid abnormalities in 86% (n=81) of patients suggesting a single parathyroid adenoma in 79% (n=74) and double parathyroid adenomas in 8% (n=7). The remaining patients (n=13, 14%) had a non - localizing study, and underwent standard four gland exploration . Preoperative thyroid ultrasound: ultrasound examination revealed co - existent thyroid abnormalities in 57% (n=54). The abnormalities ranged from dominant nodules <1 cm in 11 patients, dominant nodules 1 cm in 33 patients, and diffuse nodularity in the remaining 10 patients . Patients with thyroid pathology were slightly older (median age 60 versus 52) and more often female (m: f ratio 1:3.5 versus 1:2.6)(p = ns). The median size thyroid module size was 1.3 cm for all patients with thyroid pathology, and 1.5 cm for those patients that underwent fnab (n=31). Thyroid fnab results included 3 indeterminate, 25 benign and 3 malignant / suspicious for malignancy (table 2). Operative management: alteration of the operative plan attributable to underlying thyroid pathology occurred in 17% (n=16) of patients . Of these 16 patients, in addition to a parathyroidectomy, nine underwent total thyroidectomy (10%), and seven underwent thyroid lobectomy / isthmusectomy (6%) (figure 1). Pathological assessment: evaluation of all resected parathyroid tissue confirmed that 96% (n=90) of patients had a solitary adenoma, 2% (n=2) had double adenomas, 1% (n=1) had 4-gland hyperplasia, and 1% had a parathyroid carcinoma (n=1). Among the 16 patients who underwent either thyroid lobectomy / isthmusectomy (n=7) or total thyroidectomy (n=9), 5 patients (31%) had papillary thyroid carcinoma (ptc), 1 (6%) patient had follicular thyroid carcinoma, 9 (55%) had benign disease (mng, follicular adenoma, hurthle cell adenoma, adenomatoid nodule), and 1 (6%) had an intra - thyroidal parathyroid adenoma (figure 1). The prevalence of occult well - differentiated thyroid carcinoma in this study was 6% (6/94). There was no significant difference noted between patients with benign thyroid pathology and those with thyroid cancer in regards to patient age or size of lesion . This study was undertaken to determine the prevalence of concomitant thyroid disease identified by preoperative thyroid us in patients undergoing surgical treatment for phpt . It was also designed to determine how often incidentally discovered thyroid pathology would alter the surgical management of these patients . Additionally, it provided the incidence of non - medullary thyroid cancer in patients undergoing surgical management of phpt . Modern surgical management of phpt has transitioned from the traditional bilateral neck exploration to minimally invasive parathyroidectomy (mip). The lack of preoperative thyroid imaging, however, can lead to missed and/or incompletely treated thyroid abnormalities . Previous studies have noted that in the performance of neck explorations, thyroid lesions <1 cm in size are missed 94% of the time, and lesions that are 1 - 2 cm in size are missed 50% of the time . 10 milas and colleagues retrospectively examined 1,200 patients with phpt who underwent bilateral neck exploration; 850 patients did not receive preoperative imaging and 350 patients underwent preoperative neck ultrasound revealing coexisting thyroid disease in 43% . 11 the lack of preoperative ultrasound led to a 30% thyroid resection rate while preoperative ultrasound resulted in 20% of patients undergoing fnab and only 6% undergoing thyroid resection . In this current study, over 55% of patients with phpt had thyroid abnormalities with 17% undergoing a thyroid resection . Often times, isolated thyroid nodules that have benign cytology on fna can be safely followed with serial thyroid us thus avoiding the morbidity that can be associated with thyroidectomy, specifically recurrent laryngeal or superior laryngeal nerve injuries . Historically, the prevalence of thyroid cancer in patients with phpt ranged from 1 to 36% . 8,12,13,14,15 more recent published studies report the coexistence of non - medullary thyroid cancer in 2 - 18% of patients operated on for phpt . 5,8,16,17,18 strichartz and giuliano conducted a retrospective review of 308 patients who underwent an operation for hyperparathyroidism . 8 fifty - two (17%) patients had grossly apparent thyroid abnormalities with histologically proven thyroid disease, and 11 (4%) had differentiated thyroid cancer . Recently, in a retrospective review of 200 patients with phpt, morita, et al ., noted that 51% of patients with phpt had concomitant thyroid nodules and an overall 6% thyroid malignancy rate ., noted similar results with ultrasound detected thyroid abnormalities in 29% of patients with primary hyperaparathyroidism, although only 2% of patients were ultimately diagnosed with malignancy . 19 in the 94 patients examined in this prospective study, it was noted that over 55% had coexistent thyroid pathology noted on preoperative thyroid us, which contributed to a change in surgical approach in 17% . More importantly, 6% of patients underwent successful and timely treatment of well - differentiated thyroid cancer that may have otherwise been missed, presented at a more advanced stage, and/or required re - operative neck surgery . Although some might argue that occult well - differentiated thyroid cancer is of little clinical concern, is it important to note that the patients with occult well - differentiated thyroid cancer (<1 cm) have similar nodal and distant metastasis rates to patients with larger tumors (> 1 cm). Timely intervention for thyroid cancer avoids not only the risk and expense of neck re - exploration at a later time when the malignancy is clinically apparent but also the possibly more locally advanced disease when operation is delayed . Early diagnosis and timely treatment of thyroid cancer also avoids the medico - legal implications for a missed or delayed diagnosis . Another concern of a missed or delayed diagnosis of a thyroid malignancy coincident with phpt that should be noted is the requirement of re - operative surgery and the attendant risk of functionally limiting surgical morbidity . Although rates nerve injury rates of ~1% are often quoted for thyroid and parathyroid resections, reoperative thyroid surgery has notable increases in morbidity rates with laryngeal nerve injury rates of 1 - 12% and hypocalcemia in 0.3 - 15% of patients . The combined operative management of simultaneous thyroid and parathyroid disease is preferred given its demonstrated safety, as it avoids the increased operative morbidity of a second neck exploration . 14,15,16 this is particularly important in patients with unanticipated thyroid malignancy who can be treated safely at the time of initial operation for phpt . This study reinforces what has previously been demonstrated in patients with phpt; concomitant thyroid disease is not an infrequent occurrence . Preoperative thyroid ultrasound in patients with phpt is useful adjunct to parathyroid scintigraphy and identifying concurrent thyroid disease . It has also been shown to be a cost - effective undertaking when utilized in conjunction with mips . 13 with these points in mind, the debate about the nature and extent of treatment for isolated well - differentiated thyroid carcinoma is entertained in an entirely different context when considered in combination with phpt requiring surgical treatment . In line with national endocrine disease treatment center practice patterns, our adoption of mips for phpt attributable to a localizing adenoma precludes exploration of the entire neck and careful examination of the thyroid gland at time of operation . As such, timely diagnosis and treatment of the frequently encountered co - existing thyroid disease as shown in this study is advantageous, particularly considering the increased morbidity associated with a second neck exploration . Regardless of the surgical approach utilized, the inability to exclude coexistent thyroid pathology strictly on the basis of absence of palpable thyroid abnormality on clinical examination makes preoperative imaging of the thyroid gland with or without selective fnab of detected thyroid abnormalities prior to parathyroidectomy justified.
|
, cases of esophageal cancer treated with radiotherapy can often be divided into 2 groups: those with effective responses, in which radiation can control or cure tumors, and those with ineffective responses, in which radiotherapy has little or no efficacy [24]. Many studies of tissue and cellular responses to radiation have focused on the damage that is caused to proliferating malignant cells, leading to their deaths . Historically, topics of study related to radiotherapy have included the cell cycle, apoptosis, and dna repair and survival [5, 6]. Recently, accumulating evidence has suggested that radiation also leads to significant alterations to the tumor microenvironment, particularly with respect to its effects on immune cells . It has been reported that radiotherapy can induce various tumor cell death modalities, releasing tumor - derived antigens and danger signals, either of which could trigger antitumor immune responses [7, 8]. Macrophages exposed to th1 cytokines, including interferon - gamma (ifn-) and interleukin-2 (il-2), exhibit enhanced cytotoxic activity, production of proinflammatory cytokines, antigen presentation, and antitumor cellular immune response [10, 11]. Accordingly, for example, il-2 stimulates natural killer (nk) cell activity or cytotoxic t lymphocytes (ctls) to kill tumor cells . Ifn- is produced by the activation of t cells, and it can strengthen both the host t cell receptors' dependence and human leukocyte antigen (hla) restriction to cytotoxic t cells, increasing surface major histocompatibility complex (mhc) antigen expression, tumor necrosis factor concentrations, antitumor angiogenesis, and other antitumor responses [12, 13]. Ifn- can be controlled by regulating the fas / fasl expression of tumor cells and enhancing the sensitivity of tumor cells to the fas - mediated apoptosis pathway, thereby reducing the ability of tumor cells to evade the immune system attack and, accordingly, inhibiting the malignant proliferation of tumor cells [1416]. Therefore, we hypothesized that the immune response elicited by radiotherapy may be as important as the radiation itself for successful treatment . However, few studies have investigated serum il-2 and ifn- concentrations in effective and ineffective responses to radiotherapy . Particularly, there was not enough evidence to compare the changes in these concentrations during effective and ineffective responses to radiotherapy . In the present study, we sought to provide such evidence, specifically investigating correlations between radiotherapy outcomes and changes in the serum il-2 and ifn- concentrations during radiotherapy for esophageal cancer . Some studies have shown that the expression of cytokines (ifn- and il-2) is associated with radiation - related tissue damage and inflammation [17, 18]. To clarify the relationship between cytokine profiles and acute toxicity induced by radiotherapy, we also examined the associations between serum concentrations of il-2 and ifn- and radiotherapy - related acute toxicities (hematologic or of the esophagus, lung, or skin), which were graded prospectively . This study was approved by the ethics committee of the first affiliated hospital of xi'an jiaotong university (xi'an, china), and all participating patients gave their written informed consent . The study included 63 patients diagnosed with histopathologically confirmed squamous cell carcinoma of the esophagus (ct14, any n, any m) at the first affiliated hospital of xi'an jiaotong university, from february 2013 to july 2013 . In this study, clinical staging was performed using endoscopy, a barium swallow, computed tomography (ct) scans of the abdomen and chest, a pulmonary function test, a complete blood cell count, a serum chemistry profile, serum creatinine clearance, electrocardiography, complete history assessment and physical examination, and an assessment of karnofsky performance status . Eligible patients who were inoperable and were not fit for concurrent chemotherapy were treated with radiotherapy alone at the start of therapy . Here, inoperability was defined by the presence of distant metastases or an unfavorable preoperative risk score . Radiotherapy was administered in daily fractions of 2.0 gy (5 times per week) with a total dose of 6066 gy . Linear particle accelerators (lilacs) were used with a 10 mv x - ray beam and a multiple field technique . Blood was drawn once per week during radiotherapy; serum samples were separated by centrifugation at 3000 rpm for 5 min and stored at 80c . Serum il-2 and ifn- were measured with commercially available enzyme - linked immunosorbent assay kits (westang biotechnology company, shanghai, china) following the manufacturer's instructions . Samples were normalized to total protein as determined by a bicinchoninic acid assay (westang biotechnology company). Acute treatment - related toxicity was evaluated weekly during radiotherapy and documented using the year 2009 national cancer institute's common toxicity criteria (nci - ctc, version 4.0). Supportive treatment was extensive and included pain management, dietary counseling, and leukocyte - stimulating agents administered orally or by injection, if necessary . Short - term local efficacy in the esophagus was evaluated 4 weeks after finishing treatment and every 3 months for 1 year thereafter . The assessment included physical examination, history, endoscopy, a barium swallow, and thoracic / abdominal ct scans . In this study, short - term efficacy was analyzed according to the world health organization response evaluation criteria in solid tumors . Specifically, outcomes were classified as complete remission (cr), partial remission (pr), stable disease (sd), or progressive disease (pd), and the total effective response rate was defined as cr + pr . Fisher's exact test was used to compare categorical data . Between - group and between - sample differences in numeric data the wilcoxon signed - rank test was used to assess the statistical significance of associations between radiation and cytokine expression, using aggregated median cytokine concentrations at baseline and during radiotherapy . The signed - rank test was also used to assess the difference between cytokine concentrations at baseline and during radiotherapy . From february 2013 to july 2013, a total of 63 patients were enrolled in this study (table 1). Radiotherapy could result in any one of the following 2 outcomes: effective response (cr + pr) or ineffective response (sd + pd). All 63 of the patients completed treatment with radiotherapy and were followed for at least 6 months . During the short - term follow - up, the local efficacy of radiation in the esophagus was assessed using physical examination, endoscopy, barium swallow, and thoracic / abdominal ct scans . Five patients (8%) showed cr and 51 patients showed pr (81%), constituting 56 patients (89%) with an overall effective response (cr + pr). Four patients had sd (6%) and 3 patients (5%) had pd, together amounting to 7 patients (11%) with an overall ineffective response . As presented in table 1, the characteristics of the enrolled patients (including age, sex, and disease stage) were not significantly associated with the local short - term efficacy of radiation in the esophagus . Acute hematologic toxicity (leukopenia, anemia, and thrombocytopenia) occurred in 60 of the 63 cases (95%). Four of these 60 toxicities (6.7%) were of degrees iii - iv and 56 (93.3%) were of degrees i - ii . Degree i - ii nausea or vomiting occurred in 35 of the 63 cases (56%). Acute organ toxicity of the esophagus, lung, or skin occurred in 61 of the 63 cases (97%). Ten of these 61 cases (16.4%) were of degrees iii - iv and 51 (83.6%) were of degrees i - ii . The short - term local efficacy of radiation was not significantly associated with the rate of hematologic toxicities (p = 0.31). Figure 1 presents the ratios of (a) the variance of the cytokine (il-2 and ifn-) concentrations within each patient to (b) the total across - patient variance calculated for the baseline and during - radiotherapy measurements . It thereby compares intrapatient heterogeneity to interpatient heterogeneity for serum cytokine concentrations . For future studies, we suggest that this ratio of within - patient to between - patient variance should be reported as a measure of cytokine (il-2 and ifn-) heterogeneity for the patient population . We observed that the ratios were similar at baseline and during radiotherapy for the 2 tested cytokines . Recent results have suggested that the immune system mediates many of the antitumor effects of radiotherapy . Macrophages exposed to th1 cytokines, including interferon - gamma (ifn-) and interleukin-2 (il-2), exhibit enhanced cytotoxic activity, production of proinflammatory cytokines, antigen presentation, and antitumor cellular immune response . We examined the serum concentrations of immunomodulatory cytokines (il-2 and ifn-) in the effective and ineffective local response groups (figure 2). In the effective response (cr + pr) group, serum concentrations of il-2 and ifn- increased with the number of radiotherapy fractions that had been administered, reaching a maximum after about 2 - 3 weeks (1015 fractions of radiation) and gradually decreasing thereafter . In the ineffective response (sd + pd) group, serum concentrations of il-2 and ifn- remained approximately steady throughout the course of radiotherapy . These results indicate that the intensity of the radiotherapy - elicited immune response was positively associated with local response to radiotherapy in esophageal cancer . As shown in figure 2, we also found that serum il-2 and ifn- concentrations in the cr + pr group were both higher than the corresponding concentrations in the sd + pd group at the same time during radiotherapy . To clarify reported correlations between serum concentrations of il-2 and ifn- and acute toxicity during radiotherapy, we compared the maximum cytokine concentration in each patient during radiotherapy with the maximum grade acute hematologic toxicity and acute organ toxicity (figure 3). Our results suggest that changes in serum il-2 and ifn- concentrations are associated with an increased probability of acute hematologic toxicity . Further, the results suggest that changes in serum ifn- concentrations are associated with an increased probability of acute organ toxicity of the esophagus and that changes in serum ifn- concentrations are associated with an increased probability of acute organ toxicity of the lung or skin . Accumulating evidence shows that radiotherapy eliminates tumor cells by changing the local tumor environment, in addition to its more direct effects . Radiation - elicited changes to local tumor microenvironment may produce inflammatory factors and enhance the antitumor immune responses locally . To learn about the immune responses during cancer radiation therapy, it would be nice to detect regional lymph nodes of esophagus through immunohistochemical staining . But, in fact, it is difficult to obtain regional lymph nodes in patients during radiotherapy . Many studies have shown that il-2 and ifn- have important roles in antitumor immune activity . However, few studies have investigated serum il-2 and ifn- concentrations in effective and ineffective responses to radiotherapy . Particularly, there was not enough evidence to compare the changes in these concentrations during effective and ineffective responses to radiotherapy . In the present study, we have provided such evidence, specifically detailing correlations between radiotherapy outcomes and changes in the serum il-2 and ifn- concentrations during radiotherapy for esophageal cancer . All patients completed treatment with radiotherapy and were followed for at least 6 months . During the short - term follow - up, the local efficacy of radiation was assessed with physical examination, endoscopy, barium swallow, and thoracic / abdominal ct scans . Five patients (8%) exhibited cr and 51 patients exhibited pr (81%), constituting 56 patients (89%) with an overall effective response (cr + pr). Four patients had sd (6%) and 3 patients (5%) had pd, together amounting to 7 patients (11%) with an overall ineffective response . We found significant differences between patients with and without effective local response in terms of serum il-2 and ifn- concentrations . In the effective response (cr + pr) group, serum concentrations of il-2 and ifn- increased with the number of radiotherapy fractions that had been administered, reaching a maximum after about 2 - 3 weeks (1015 fractions of radiation) and gradually decreasing thereafter . In the ineffective response (sd + pd) group, serum concentrations of il-2 and ifn- remained approximately steady throughout the course of radiotherapy . Consistent with our hypothesis, results indicate that the intensity of the radiotherapy - elicited immune response was positively associated with the local response to radiotherapy in esophageal cancer . Several studies have shown that cytokine (ifn- and il-2) expression is associated with radiation - related tissue damage and inflammation . Increasing il-2 and ifn- expressions were associated with an increased probability of acute toxicity induced by radiotherapy . To examine the relationships between acute toxicity induced by radiotherapy and cytokine profiles, we examined associations between radiotherapy - related acute toxicities, which were graded prospectively, and serum il-2 and ifn- concentrations . To clarify reported correlations between serum concentrations of il-2 and ifn- and acute toxicity during radiotherapy, we compared the maximum cytokine concentration in each patient during radiotherapy with the maximum grade acute hematologic toxicity and acute organ toxicity (figure 3). Our results suggest that changes in serum il-2 and ifn- concentrations are associated with an increased probability of acute hematologic toxicity . Further, the results suggest that changes in serum ifn- concentrations are associated with an increased probability of acute organ toxicity of the esophagus and that changes in serum ifn- concentrations are associated with an increased probability of acute organ toxicity of the lung or skin . In the current study, we demonstrated that serum concentrations of il-2 and ifn- were positively associated with local response to radiotherapy in esophageal cancer . These findings suggest that the intensity of the radiotherapy - elicited immune response is positively associated with local response to radiotherapy in esophageal cancer . Further, changes in the il-2 and ifn- serum concentrations were associated with increased probabilities of acute hematologic toxicity and acute organ toxicity of the esophagus, lung, and skin . In fact, serum levels of il-2 and ifn- have been found positively associated with patients' outcome . But the relationship between radiotherapy inducing acute toxicity and outcome is unclear . In our future research we will research the relationships of il-2, ifn-, and other cytokines with radiotherapy acute phase response and outcome . These results suggest that deciphering the mechanisms of radiotherapy - elicited immune response may allow the development of therapeutic interventions that would enhance the efficacy of radiotherapy and convert some ineffective responses to effective responses.
|
Metal contaminated soils pose a severe threat to environment, agriculture and consequently via the food chain to human and animal health (schwitzgubel et al ., 2011). A promising approach to substitute costly remediation technologies is phytoextraction, the use of plants to clean up polluted soils (salt et al ., 1998). Efficient phytoextraction species should translocate high quantities of metals into their aboveground biomass without toxicity symptoms, and at the same time produce large amounts of biomass (pulford and watson, 2003; vangronsveld et al ., 2009). Metal hyperaccumulators take up and tolerate more than 100 mg kg cadmium (cd) or 10,000 mg kg zinc (zn) in their shoots, up to 1000-fold more than excluder species (rascio and navari - izzo, 2011; verbruggen et al . Hyperaccumulation of zn and cd has been shown for numerous members of the brassicaceae family . Especially noccaea (formerly thlaspi) caerulescens (j. presl and c. presl) f.k . Mey (escarr et al ., 2000; xing et al ., 2008), thlaspi goesingense halacsy (lombi et al ., 2000), thlaspi praecox wulfen and arabidopsis halleri (l.) o'kane and al - shehbaz (bert et al ., 2000; wenzel and jockwer, 1999) have been serving as model organisms to uncover the molecular basis of hyperaccumulation of essential and non - essential trace metals . However, those species typically do not produce high biomass, are limited in rooting depth and may not be competitive against weed outside their native environments . Therefore, the use of fast - growing, woody metal - accumulating species with larger root systems such as poplar (populus spp .) Or willow (salix spp .) Would enhance the efficiency of the phytoextraction process, making it economically feasible (marmiroli et al ., 2011; pulford and watson, 2003; thewys et al ., 2010). Accumulate considerable amounts of zn and cd in their aboveground organs (dos santos utmazian et al ., 2007; landberg and greger, 1996; robinson et al ., 2000 the goat willow salix caprea (s. caprea) accumulated up to 4680 mg zn kg and 116 mg cd kg dry weight in leaves in a metal - polluted habitat (unterbrunner et al ., 2007). There is a remarkable natural genetic variability among poplar and willow species and ecotypes adapted to soils of varying metal contaminations (laureysens et al . We have shown that genetically distinct s. caprea plants isolated from metallicolous sites accumulate significantly larger amounts of cd than those from non - metallicolous sites (puschenreiter et al ., 2010). Further analysis of a metallicolous s. caprea genotype, kh21 (kutn hora, czech republic), and a non - metallicolous genotype, f20 (forchtenstein, austria), revealed different root anatomical responses and element distribution pattern upon metal exposure (vaculk et al ., 2012). Moreover, analysis of heavy metal contents in leaves demonstrated that the metallicolous genotype kh21 accumulated significantly more cd and by trend more zn than the non - metallicolous genotype f20 (vaculk et al ., 2012). Whereas the basis of metal hyperaccumulation in woody species is largely unknown, the molecular mechanisms underlying the adaptation to metals in small model plants such as a. halleri or thlaspi / noccaea spp . A network of transporters tightly controls uptake into roots, xylem loading and vacuolar sequestration (broadley et al . Although these transporters are thought to balance the concentration of essential metals such as zn, they also unselectively transport toxic elements like cd (mendoza - cozatl et al ., 2011; verbruggen et al ., 2009b). Inside the cells, metals are chelated with small molecules such as the low molecular weight, cysteine - rich metallothioneins or non - translationally synthesized, glutathione - derived phytochelatins (cobbett and goldsbrough, 2002). Remarkable similarity in copy number expansion and transcriptional regulation was found for the xylem loading transporter heavy metal atpase 4 (hma4) in a. halleri and n. caerulescens, indicating parallel evolutionary pathways in these two brassicaceae species (hanikenne et al . Moreover, hma4 was recently found to be involved in maintenance of zn homeostasis also in poplar (adams et al ., 2011). This example of cross - species functionality suggests that well - studied pathways might also act in s. caprea metal tolerance . However, trees could have evolved also distinct mechanisms to cope with elevated metal concentrations . Proteomic studies on poplar (populus tremula l.) revealed numerous proteins influenced by long- and short - term cd exposure, especially belonging to primary carbon and glutathione metabolism (kieffer et al ., 2009). On the transcriptional level, a recent microarray - based analysis of populus euramericana guinier hybrids identified zn - responsive genes (di baccio et al ., 2011). A cdna - aflp approach identified chromium - inducible genes in four salix species (quaggiotti et al ., 2007). However, the transcriptional responses of salix spp . To cd and zn contamination remain unknown . Suppression subtractive hybridization (ssh) analysis allows the simultaneous identification of a multitude of genes in unsequenced species (diatchenko et al ., 1996). Gene networks involved in lead response in the legume sesbania drummondii (rydb .) Cory (srivastava et al ., 2007), in chromium metabolism of the oilseed crop crambe abyssinica hochst . (zulfiqar et al ., 2011), and in copper response in birch (betula pendula roth) (keinnen et al ., 2007) the aim of this study was to unravel candidate genes that might be responsible for the divergent cd accumulation of two natural s. caprea genotypes . In a biased approach the expression of putative s. caprea orthologs of known metal responsive genes was assessed . With an unbiased approach the gene expression analyses allowed for inferring molecular pathways involved in metal tolerance and accumulation in metallicolous and non - metallicolous s. caprea genotypes . Two salix caprea l. genotypes from a metal - polluted and an unpolluted control site in central europe were used . Genotype kh21 was collected near kutn hora (czech republic), a site historically metal contaminated due to ore mining and smelting activities . Kh21 had initially been characterized by higher zn and cd accumulation but lower biomass production than f20 in perlite - based cultures (puschenreiter et al ., 2010). The original plants were collected as cuttings at the two sites in 2003 and were kept in unpolluted soil in a tree nursery until preparation of green cuttings for the experiments . The experimental setup was performed as described in (vaculk et al ., 2012). Briefly, green cuttings with four internodes were rooted in quartz sand under tap water irrigation in a greenhouse for 60 days at 24/18 c day / night, 60% relative humidity, a 12 h photoperiod and 200 m m s par . Rooted cuttings were transferred into 1 l pots filled with perlite and irrigated with a nutrient solution containing (in m) 1000 ca(no3)2, 500 mg(so4)2, 50 kh2po4, 100 kcl, 5 h3bo3, 0.2 h24mo7n6o24, 10 mnso4, 2.5 cuso4, 0.25 niso4, 2.5 znso4 and 50 fe(iii)-ethylenediamine - di(o - hydroxyphenylacetic acid) (eddha), adjusted to ph 6.0 with 1 mm 2-(n - morpholino)ethanesulfonic acid (mes) as potassium salt (shen et al ., 1997) for eight weeks . Thereafter, control (normal nutrient solution), and zn + cd (nutrient solution with 0.5 mg l (4.5 m) cd as cdno34h2o plus 5 mg l (76 m) zn as znso47 h2o) treatments were continuously applied to four independent replicate plants for three months (14 weeks). Leaves were harvested for gene expression and metal analysis after two, eight and 14 weeks . Leaves were sampled at the same time on each harvesting day to avoid any possible diurnal variation in gene expression (zheng et al ., 2011). The zn and cd concentrations from four replicate plants are reported in (vaculk et al ., 2012). For rna isolation, 3 ml preheated extraction buffer (2% [w / v] hexadecyltrimethyl - ammonium bromide, 2% [w / v] polyvinylpyrrolidone, 100 mm tris / hcl ph 8.0, 25 mm ethylenediaminetetraacetic acid (edta), 2 m nacl, 0.5 g / l spermidine, 2.7% [v / v] 2-mercaptoethanol) were mixed with the frozen leaf powder and incubated at 65 c for 7 min . After two extraction steps with 3 ml ice - cold chloroform: isoamylalcohol (24:1, v: v), 0.25 volumes of ice - cold 10 m licl were added to precipitate rna at 4 c for 18 h. after centrifugation at 16 000 g, 4 c, 60 min, the pellets were incubated with 4 ml ice - cold 75% ethanol at 80 c for 60 min, followed by centrifugation at 16 000 g, 4 c, 20 min degenerate primers for metal responsive candidate genes were designed in conserved regions of the populus trichocarpa torr . & a. grey, a. thaliana and betula ssp . Genes (supplementary table s1). Their specificity was determined by sequencing and subsequent phylogenetic analysis (data not shown). Qpcr was performed in the rotorgene-3000 cycler (qiagen, germany) using the sybr green jumpstart taq readymix kit (sigma aldrich, usa) and the qpcr core kit for sybr green (eurogentec, belgium). Amplification occurred after an initial denaturation (10 min/94 c) in 40 cycles (94 c/5 s55 c/5 s72 c/25 s81 c/15 s85 c/15 s). At the end of each run, a melting curve was recorded between 65 c and 99 c . Data were analysed using standard curves of known pcr fragment copy numbers for each gene . Significance levels between the triplicate qpcr measurements of all biological replicates were calculated with student's t - tests . To identify further heavy metal induced genes, total leaf rna of kh21 plants treated with normal nutrient solution or with 5 mg l zn plus 0.5 mg l cd for eight weeks in perlite - based hydroponic equal amounts of rna from four replicate plants were pooled to obtain 20 g . Cdna synthesis, subtraction of the control from the metal - treated cdna pool and cloning of the differential, i.e. Metal induced, cdnas into the pal16 vector were performed by evrogen (moscow, russia) according to the protocol of diatchenko et al . The pal16 library of zn / cd induced cdnas was spread on lb plates (1:70 000) containing 75 mg l ampicillin, 12 mg l iptg and 30 mg l x - gal . White colonies were grown in 100 l lb (+ ampicillin, 75 mg l) in 96-well plates (ibl, austria) at 37 c, 180 rpm, for 6 h. 1 l culture was used for colony pcr using m13 primers to check for presence and length of inserts . To display differentially expressed colonies, 2 l pcr products were spotted on two positively charged nylon membranes (roche, germany) and uv crosslinked at 2400 mj . After prehybridization with easy hyb solution (roche, germany), membranes were hybridized with dig-11-dutp (roche, germany) labeled subtracted cdna pools from treated or untreated plants over night at 42 c . Washing at 83 c and detection were done according the manufactures protocol (roche, germany). Annotation was performed by blastn and tblastx in the p. trichocarpa genome database (http://www.phytozome.net/poplar.php; version 5.0) and ncbi (http://blast.ncbi.nlm.nih.gov/blast.cgi). To uncover the molecular basis involved in the differential metal storage and tolerance capabilities of s. caprea genotypes, the expression of orthologous genes known to respond to elevated metal concentrations in other plants was quantified in leaves with qpcr . Leaves were selected for the analysis because metal storage and tolerance in harvestable organs is of particular interest for phytoextraction crops that at the same time provide biomass for energy production (ruttens et al ., 2011; yc et al ., based on phylogenetic analyses with poplar, birch and arabidopsis thaliana (l.) heynh sequences, degenerated primers were constructed in conserved regions of the genes encoding the metal influx transporter zrt - irt - like protein zip6, the metal sequestering protein heavy metal translocating p - type atpase hma1, two metallothioneins (mt2b and mt3), the first three enzymes involved in cysteine and glutathione biosynthesis (serine - o - acetyl transferase sat1, o - acetylserin (thiol) lyase oasa1, -glutamylcysteine synthetase cad2), a metal tolerance protein mtp1, and two phytochelatin synthases (pcs1 and pcs2). To determine if the primers were specific for the potential orthologous genes, all pcr fragments amplified from s. caprea cdnas were sequenced and integrated into the phylogenetic analyses (data not shown). These ests have been deposited in the ncbi genbank with the accession numbers js807771js807786 (supplementary table s1). The expression of scmtp1, scpcs1 and scpcs2 were below the detection limit (data not shown). All other s. caprea orthologs of known metal responsive genes were expressed in a genotype - specific manner . According to their expression patterns during a combined zn and cd treatment of three months the first group included the metallothionein genes, scmt2b and scmt3, which were induced under metal stress independent of the genotype's origin and metal uptake capacity (fig . 1). Scmt2b and scmt3 were highly induced already after two weeks in the metallicolous genotype kh21, whereas the scmt2b induction was delayed in f20 . The second group contained scsat1 which was constitutively higher expressed in the metallicolous genotype throughout the whole experiment and additionally strongly induced at the two week time point of metal treatment (fig . 2). The third group comprised genes that were inducible only in the metallicolous genotype kh21 and not induced or even downregulated in the non - metallicolous genotype f20 (fig . 3). To identify additional candidate genes a suppression subtractive hybridization (ssh) library containing zn / cd induced ests more than 3000 colonies were screened for differential expression by colony pcr and reverse northern blot analysis . Clones differing most strikingly in their intensity when hybridized with either the labeled untreated or the metal - treated cdna library were selected for sequencing and bioinformatic analyses . In total, the more colonies were screened, the more duplicates were found, leading to the identification of 213 unique expressed sequence tag (est) clones . Using gene ontology (go) vocabularies, the ests were classified into 29 biological process terms (table 1). A full list of all identified s. caprea cdnas containing their poplar orthologs, chromosomal positions in the poplar genome and ncbi tblastx results is presented in supplementary table s2 . All the ests have been deposited to the ncbi genbank with the accessions numbers jk747484jk747796 . The most abundant est in the library shows partial homology to a gene coding for an unknown p. trichocarpa protein, which itself exhibits weak similarity to a member of the rapid alkalinization factor (ralf) gene family encoding small secreted peptide hormones (pearce et al ., 2001). This est clone was identified 120 times, suggesting a considerable transcriptional activation and thus a potentially important role in s. caprea metal tolerance . The second largest group with 53 members comprises genes encoding proteins of the photosynthetic apparatus, accompanied by numerous genes encoding constituents of basic cellular processes . In accordance with the initial hypothesis, eight ests of metal transporters and chelators were identified, one of them encoding scmt3 which had already been selected in the candidate gene approach (fig . 1). Thirty - two and nine ests showed homology to proteins of unknown function or were lacking similarities to already annotated genes, respectively . In order to determine the reliability of the ssh screening and their potential genotype - specific transcription, the expression of selected genes was compared in kh21 and f20 using qpcr (supplementary table s3, fig . Of special interest were genes identified several times during the screening, such as scralfl1 and a thylakoid membrane phosphoprotein (sctmp14) which occurred 120 and 10 times during the ssh library screen, respectively . The pectin methylesterase (scpme1) and a disease resistance protein encoding est (sctol21) were identified twice . The other selected genes are implicated in metal transport (schmad1, scmct1, scmt2a), or might be involved in metal perception or signaling due to their predicted plasma membrane localization (scpmp1, scwakl1). All these selected genes showed zn- and cd - triggered expression but at varying degrees . Three genes (sctmp14, sctol21, scmt2a) were only transiently activated in the metallicolous genotype kh21 at the time point of leaf sampling for the construction of the ssh library, i.e. After eight weeks of combined treatment, but not at any other time point (data not shown). Thus they are grouped to the first category of metal induced genes independent of the genotypes' origins and metal accumulation capacities . The other tested genes grouped to the third category with genes only induced in the metallicolous genotype kh21 . Scmct1, schmad1 and scpmp1 were induced only in kh21, whereas the basal expression level in f20 did not change . Scwakl1 and scralfl1 could hardly be detected in both genotypes in the control treatments, but were highly expressed in kh21 upon metal exposure (fig . Because of the highly genotype - specific expression pattern of scwakl1 and scralfl1, these two genes are promising candidates for future functional analyses . Although gene expression does not necessarily imply functional relevance (roosens et al ., 2008), expression profiling was a successful starting point for the identification of genes involved in metal hyperaccumulation (becher et al ., this approach is particularly useful for non - model plants with no sequence information such as s. caprea . This study presents the first and largest est collection of s. caprea currently available . Additionally, in - depth expression analyses of 14 genes revealed transcriptional responses to zn and cd in s. caprea, which may be a source to explain the different cd accumulation abilities of the two studied naturally occurring genotypes (vaculk et al ., 2012). Genes encoding two metallothioneins (scmt2b and scmt3), a pectin methylesterase scpme1, and to a lesser extent a polyphenol oxidase (scppo3) were induced irrespective of the genotypes' origin and metal uptake capacity . Metallothioneins are involved in metal sequestration in numerous species (cobbett and goldsbrough, 2002). Hybrid aspen (p. trichocarpa deltoides) ptdmt2b conferred cd tolerance to a cd sensitive yeast strain (kohler et al ., mt2b expression levels of p. tremula tremuloides correlated with foliar zn and cd concentrations on metal contaminated soil (hassinen et al ., 2009). Induced metallothionein expression might constitute a general metal response in s. caprea leaves allowing higher zn and cd uptake . Transcriptional upregulation of scpme1 suggests that modification of cell wall properties might be a general response to metal stress in s. caprea . Pmes modify cell walls by changing their degree of pectin methylesterification and creating free carboxylic groups that retain divalent cations, thereby enhancing the apoplastic metal binding capacity (pelloux et al . Numerous metals induce pme expression and activity, such as aluminum in rice (yang et al ., 2008) and zn in n. caerulescens (hassinen et al ., 2007). Both s. caprea genotypes accumulated high foliar zn and cd concentrations, however, the metallicolous genotype took up significantly more cd than the non - metallicolous genotype (vaculk et al ., 2012). This differential metal uptake correlated with constitutively higher expression of the cysteine biosynthesis gene scsat1 in the metallicolous genotype . Similar constitutively high sat expression was also observed in the nickel hyperaccumulator t. goesingense and its overexpression in arabidopsis leads to enhanced tolerance toward cobalt, zn and cd (freeman et al ., 2004; freeman and salt, 2007). While scsat1 was the only constitutively higher expressed gene, most others, such as the glutathione biosynthesis genes scoasa1 and sccad2, were induced only in the metallicolous genotype . Glutathione is important for metal detoxification in several plant species (seth et al . Overexpression of an arabidopsis ortholog of scoasa1 increased the cd tolerance (dominguez - solis et al ., 2004) while the cad2 - 1 mutant is cd sensitive (howden et al . Thus cysteine and glutathione quantifications might help to select zn and cd tolerant s. caprea genotypes . Two genes encoding putative orthologs of important metal transporters, sczip6 and schma1, were transiently induced only in the metallicolous genotype . Poplar zip6.1 and zip6.2 belong to a zn deficiency inducible family (migeon et al ., 2010) and athma1 has been shown to contribute to the detoxification of excess zn in arabidopsis (kim et al ., 2009). The metal homeostasis function is corroborated by their induction upon low and high zn in a. halleri (becher et al ., 2004). A cell wall - associated kinase - like (scwakl1) and an est with weak similarities to rapid alkalinization factors (scralfl1) displayed the most striking expression pattern . For the arabidopsis atwakl4 gene, an involvement in tolerance to multiple metal pollution was reported (hou et al ., 2005). However, metal - related functions are still elusive for scralfl1 (haruta and constabel, 2003; haruta et al ., 2008; pearce et al ., 2001) and the genotype - specific genes, the putative membrane protein (scpmp1), the metal - associated domain - containing protein, schmad1, and the mitochondrial copper transporter, scmct1 . Furthermore our ssh analysis implicated a wide range of cellular processes in response to long - term zn and cd exposure . The homology annotation of the upregulated ests predominantly revealed genes involved in photosynthesis, carbon fixation and carbohydrate metabolism which is consistent with a report on metal disturbed mitochondrial electron transfer in poplar (kieffer et al ., 2009). It appears that s. caprea compensates for the metal induced mitochondrial and photosynthesis defects by raising the corresponding mrna levels . Metals interfering with photosynthesis generate reactive oxygen species (verbruggen et al ., 2009a). A polyphenol oxidase (scppo3) was strongly metal inducible in the metallicolous and by trend elevated in the non - metallicolous genotype . High ppo levels created polymerized phenolic crystals serving as cd traps in cell walls of water lily (nymphaeae l.) (lavid et al ., 2001). Whether such crystals are also formed in s. caprea cell walls remains to be determined . Alternatively, ppo was implicated in herbivore defense in hybrid poplar (p. trichocarpa deltoides) (constabel et al ., 2000). As such, it is not the only est indicating parallel responses to biotic and abiotic challenges . Six disease resistance ests, among them two encoding a thaumatin / osmotin - like protein (sctol21) were isolated . The abundance of a thaumatin - like protein is also increased in cd - challenged poplar leaves (kieffer et al ., 2009). The present study demonstrates the complexity of the transcriptional network activated by zn and cd in s. caprea genotypes with different storage capabilities . It provides new candidate genes that might be responsible for naturally adapted s. caprea genotypes to cope with elevated zn and cd levels . This expression survey shows that naturally adapted, woody non - model plants such as s. caprea genotypes provide useful sources to identify novel molecular mechanisms of metal tolerance.
|
Dens invaginatus also known as dens in dente, or telescopic tooth is a developmental malformation that can occur on primary, permanent or supernumerary tooth . It is characterized by the inversion or infolding of the enamel and dentin towards the pulp chamber usually appearing as an opening on the surface of crown . The permanent maxillary lateral incisors are the teeth most frequently involved and in the majority of cases (dens invaginatus) appearing to represent simply an accentuation in the development of the lingual pit . A 30-year - old female reported to the clinic with chief complaint of swelling and periodic pain in the maxillary right and left anterior region for several years . Medical, dental and family histories were non - contributory . Extra oral examination of the head and neck region structures was within normal limits and corresponded to normal growth and development for that age . The determination of the lateral incisor as a permanent was carried out after careful consideration of history, clinical examination and radiographic appearance . The swelling was localized to the labial aspect of peg lateral region [figures 1 and 2]. Intraoral swelling on the labial aspect of 22 with diffuse margin, mucosa overlying is tense and erythematous . Crowns of 21 displaced mesially and labially and 24 displaced distally intraoral swelling on the labial aspect of 12 with diffuse margin . Crowns of 11 displaced mesially and 14 displaced distally intra oral examination also revealed the congenitally missing 13, 23 and 47 presented with clinically detectable pulpal exposure . A panoramic radiograph as well as intra oral periapical radiographs of 12 and 22 were ordered . Intra oral periapical radiograph in relation to 12 and 22 region revealed microdontic oval shaped lateral incisors . The coronal portion showed a small crown with normal radiopacity and the apical portion showed a dilated root with a central radiolucency surrounded by well - defined radiopacity [figures 3 and 4]. Periapical radiograph showing conical crown with bulbous root in relation to 22 periapical radiograph showing conical crown with dilated root in relation to 12 panoramic radiograph showed an oval shape radiolucent interior delineated by a well - defined radiopaque band at the periphery in relation to 12 and 22 measuring 2.4 2 cm and 3.5 2.5 cm in diameter respectively . The nasal floor was elevated in relation to 22 [figure 5a and b]. A panoramic image shows conical crown with dilated roots in relation to 12 and 22, pathologic migration of 11,21,14 and 24, elevation of left nasal floor sketch diagram of panoramic image shows (a and b) conical crown with dilated root, (c) elevation of left nasal floor the treatment plan included extraction of the peg laterals along with their root and subsequent prosthetic rehabilitation and the specimen was sent for hard tissue sectioning . Disorganized matrix of immature dentin with enamel spaces noted within central area suggestive of dilated odontoma [figure 6]. Decalcified section showing disorganized mass of immature dentin with enamel spaces within noticed in the central area; dentin with dentinal tubules circumscribing immature enamel matrix and pulpal tissue histological assessment revealed a final diagnosis of dilated odontoma . Dens invaginatus is a deep surface invagination of the crown or root that is lined by enamel . The first case of dens invaginatus in a human tooth was first described by a dentist named socrates in 1856 . Swanson and mccarthy (1947) were the first to present bilateral dens invaginatus malformation . The teeth affected often include lateral incisors, central incisors, premolars, canines, and molars . Growth pressure of dental arch results in buckling of enamel organ (euler 1939, atkinson 1943).kronfeld (1934) suggested that the invagination results from a focal failure of growth of internal enamel epithelium while the surrounding normal epithelium continues to proliferate and engulf the static area.the twin - theory (bruszt 1950) suggested a fusion of two tooth germs.infection was considered as an etiology by fischer (1936) and sprawson (1937). Growth pressure of dental arch results in buckling of enamel organ (euler 1939, atkinson 1943). Kronfeld (1934) suggested that the invagination results from a focal failure of growth of internal enamel epithelium while the surrounding normal epithelium continues to proliferate and engulf the static area . The twin - theory (bruszt 1950) suggested a fusion of two tooth germs . Infection was considered as an etiology by fischer (1936) and sprawson (1937). Most authors, meanwhile consider dens invaginatus as a deep folding of the foramen caecum during tooth development, which in some cases even may result in a second apical foramen . Clinically, unusual crown morphology (dilated, peg - shaped, barrel - shaped) or a deep foramen caecum may be important hints . Type 1: the invagination ends as a blind sac and is confined to the crown . Type 2: the invagination extends apically beyond the external cementoenamel junction ending as a blind sac, but not reaching the periapical tissues . Type 3: the invagination extends beyond the cementoenamel and a second apical foramen communicates with the periodontal ligament or periapical tissues . When dens in dente involve root - radicular dens invaginatus, it appears to be the result of an invagination of hertwig's epithelial root sheath . Radiographically, the infolding of enamel lining is more radiopaque than the surrounding tooth structure and can be easily identified . The radiographic invagination may vary in size and shape, form a loop such as pear shaped or slightly radiolucent structure to a severe form resembling a tooth within a tooth . In the most severe form dilated odontoma, the tooth is severely deformed, having a circular or oval shape with radiolucent interior . Histologically, the coronal invagination is lined by enamel, whereas radicular invagination is lined by cementum . Before eruption the lumen of invagination sometimes the invagination may be dilated and disturb the formation of tooth, resulting in anomalous tooth development termed dilated odontoma . In conclusion, a comprehensive multidisciplinary approach should be the treatment of choice with these types of cases of apparently unique and infrequent pathology . Extraction of teeth along with pathological tissues should be performed immediately to avoid delaying histological diagnosis, which could render subsequent treatment plan effectively.
|
The study was approved by the institutional animal care and use committee of the clinical research institute of seoul national university hospital (approval number 07156, 06 - 2006 - 210 - 9). Nine male dogs weighing 17 to 21.5 kg were assigned to one of 3 groups according to the distance that was to be maintained between the site of harmonic scalpel (hs) application and the recurrent laryngeal nerve (rln): (i) group 1 (1 mm); (ii) group 2 (2 mm); and (iii) group 3 (3 mm). The animals were administered 3 to 5mg / kg of intramuscular zolazepam as a premedication followed by 25 mg / kg of intramuscular cefazolin (chong kun dang pharmaceutical corp ., the animals were then intubated and administered 1% to 3% isoflurane as a general anesthetic . A midline skin incision of approximately 10 cm was made in the neck, and the left lobe of the thyroid and the left rln were identified . The hs (harmonic ace 36p; johnson & johnson medical, cincinnati, oh, usa) was applied near the rln at the assigned distance . Low power hs (70 m vibration) was applied for 10 seconds (figure 1). All procedures were performed by the same surgeon, who was experienced in thyroid surgery . An intramuscular injection of 0.4 ml / kg meloxicam was administered for postoperative pain control . One week later, the animals were administered 3 to 5 mg / kg of intramuscular zolazepam as a premedication, and repeat laryngoscopy was performed . Two weeks after the initial operation, the animals were returned to the operating theater for re - exploration . This was placed in formalin for histological evaluation of subacute morphological changes . The right lobe of the thyroid and the rln right thyroid lobectomy was performed, and hs was applied to the tissues adjacent to the right rln at the assigned distance (figure 1). All three fragments of right rln were immediately harvested and placed in formalin for histological evaluation of acute morphological changes . Thus, 3 left rlns from groups 1 and 2, and 2 left rlns from group 3 (a total of 8 nerves), were examined for the presence of subacute morphological changes . Nine right rlns from each group (a total of 27 nerves) were evaluated for the presence of acute morphological changes . The specimens were embedded in paraffin, sliced to a thickness of 3 - 4 mm, and stained with hematoxylin and eosin . Immunohistochemical (ihc) analyses were performed using 4-m - thick sections and the dako autostainer plus link (dako, glostrup, denmark). With the exception of primary antibodies, all ihc components were taken from the envision flex high ph kit (k8000; dako, glostrup, denmark). Antigen retrieval was achieved by treating the tissue sections with envision flex target retrieval solution (dm812; dako, glostrup, denmark; tris / edta buffer, ph 9) for 45 min at 95. the tissue sections were then incubated with mouse antihuman neurofilament monoclonal antibodies (nf; dako, glostrup, denmark) at a dilution of 1:2,000 for 20 min at room temperature . Envision flex peroxidase - blocking reagent (sm801; dako, glostrup, denmark) was used as the blocking buffer . Antibody binding was visualized with a peroxidaseconjugated polymer backbone (envision flex; sm802; dako, glostrup, denmark) and the use of diaminobenzidine as a chromogen . Appropriate positive control - tissues were used, and the omission of primary antigen was used as a negative control condition . All histological analyses were performed by a single neuropathologist who was blind to the study group of the specimens . The neurovascular bundles were evaluated for the presence of swelling, vacuolar change, and atrophy, and for myelin and axonal loss . The spss 15.0k program for microsoft the study was approved by the institutional animal care and use committee of the clinical research institute of seoul national university hospital (approval number 07156, 06 - 2006 - 210 - 9). Nine male dogs weighing 17 to 21.5 kg were assigned to one of 3 groups according to the distance that was to be maintained between the site of harmonic scalpel (hs) application and the recurrent laryngeal nerve (rln): (i) group 1 (1 mm); (ii) group 2 (2 mm); and (iii) group 3 (3 mm). The animals were administered 3 to 5mg / kg of intramuscular zolazepam as a premedication followed by 25 mg / kg of intramuscular cefazolin (chong kun dang pharmaceutical corp ., the animals were then intubated and administered 1% to 3% isoflurane as a general anesthetic . A midline skin incision of approximately 10 cm was made in the neck, and the left lobe of the thyroid and the left rln were identified . The hs (harmonic ace 36p; johnson & johnson medical, cincinnati, oh, usa) was applied near the rln at the assigned distance . Low power hs (70 m vibration) was applied for 10 seconds (figure 1). All procedures were performed by the same surgeon, who was experienced in thyroid surgery . An intramuscular injection of 0.4 ml / kg meloxicam was administered for postoperative pain control . One week later, the animals were administered 3 to 5 mg / kg of intramuscular zolazepam as a premedication, and repeat laryngoscopy was performed . Two weeks after the initial operation, the animals were returned to the operating theater for re - exploration . This was placed in formalin for histological evaluation of subacute morphological changes . The right lobe of the thyroid and the rln right thyroid lobectomy was performed, and hs was applied to the tissues adjacent to the right rln at the assigned distance (figure 1). All three fragments of right rln were immediately harvested and placed in formalin for histological evaluation of acute morphological changes . Thus, 3 left rlns from groups 1 and 2, and 2 left rlns from group 3 (a total of 8 nerves), were examined for the presence of subacute morphological changes . Nine right rlns from each group (a total of 27 nerves) were evaluated for the presence of acute morphological changes . The specimens were embedded in paraffin, sliced to a thickness of 3 - 4 mm, and stained with hematoxylin and eosin . Immunohistochemical (ihc) analyses were performed using 4-m - thick sections and the dako autostainer plus link (dako, glostrup, denmark). With the exception of primary antibodies, all ihc components were taken from the envision flex high ph kit (k8000; dako, glostrup, denmark). Antigen retrieval was achieved by treating the tissue sections with envision flex target retrieval solution (dm812; dako, glostrup, denmark; tris / edta buffer, ph 9) for 45 min at 95. the tissue sections were then incubated with mouse antihuman neurofilament monoclonal antibodies (nf; dako, glostrup, denmark) at a dilution of 1:2,000 for 20 min at room temperature . Envision flex peroxidase - blocking reagent (sm801; dako, glostrup, denmark) was used as the blocking buffer . Antibody binding was visualized with a peroxidaseconjugated polymer backbone (envision flex; sm802; dako, glostrup, denmark) and the use of diaminobenzidine as a chromogen . Appropriate positive control - tissues were used, and the omission of primary antigen was used as a negative control condition . All histological analyses were performed by a single neuropathologist who was blind to the study group of the specimens . The neurovascular bundles were evaluated for the presence of swelling, vacuolar change, and atrophy, and for myelin and axonal loss . One week postsurgery, 2 cases of a fixed vocal cord and 1 case of decreased vocal cord motility were observed in group 1, 1 fixed vocal cord was observed in group 2, and no abnormalities in vocal cord mobility were observed in group 3 (p=0.020) (table 1). Subacute morphological changes such as swelling, vacuolar change, and myelin and axonal loss were observed in the nerves of animals with abnormal vocal cord function (table 1, figure 2 and 3). Nine right rlns from each group (a total of 27 nerves) were evaluated for acute damage . Acute morphological changes such as swelling, vacuolar change, and myelin and axonal loss were observed in 5 of the 8 nerves from group 1, and in 1 of the 7 nerves from group 2, whereas no acute morphological changes were observed in any of the nerves from group 3 (table 2). One week postsurgery, 2 cases of a fixed vocal cord and 1 case of decreased vocal cord motility were observed in group 1, 1 fixed vocal cord was observed in group 2, and no abnormalities in vocal cord mobility were observed in group 3 (p=0.020) (table 1). Subacute morphological changes such as swelling, vacuolar change, and myelin and axonal loss were observed in the nerves of animals with abnormal vocal cord function (table 1, figure 2 and 3). Nine right rlns from each group (a total of 27 nerves) were evaluated for acute damage . Acute morphological changes such as swelling, vacuolar change, and myelin and axonal loss were observed in 5 of the 8 nerves from group 1, and in 1 of the 7 nerves from group 2, whereas no acute morphological changes were observed in any of the nerves from group 3 (table 2). Although many clinical studies for the usefulness of the hs during thyroidectomy speculated upon the safety of hs, it did not propose a safe distance for the application of hs in the vicinity of the rln during thyroid surgery . This study aimed to develop a large animal model for recurrent laryngeal nerve injury by hs . The majority of nerve injury studies have used a rodent sciatic nerve model as this is inexpensive, convenient, and involves straightforward histological analyses . Although the hs causes an increase in the temperature of adjacent tissues, the spread of heat is less than that associated with bipolar or monopolar coagulation . A study of pig arteries reported that the mean length of thermal spread was 1.6~2.4 mm . A study of rat sciatic nerves found that the length of damage caused by ultrasonically activated scalpels was 0.9~1.1 mm . In a further study of rat sciatic nerves, owaki et al . Concluded that use of the ultrasonic shears at a distance of 3 mm from the rln for less than 10 seconds at level 3 was safe . However, there is no large animal model to determine the clinically acceptable distance safety margin for the application of energy device in the vicinity of the recurrent laryngeal nerve . To our knowledge, the present study is the first to have examined the effect of hs application in the vicinity of the rln during thyroidectomy in large animal . There is a study using the rabbit but it did not used laryngoscopy to evaluate the vocal cord function . The canine model was selected since the vocal cords of dogs are more accessible than those of pigs, and are thus easier to evaluate the movement of the vocal cords by laryngoscope examination . Also, the anatomy of the thyroid gland is similar in dogs and humans, which facilitates the surgeons to mimic the real thyroid surgery as in human . In both species it is a dark red, elongated structure that is attached to fascia along the ventrolateral surfaces of the proximal trachea . The right thyroid lobe extends between the cricoid cartilage and the 5th tracheal ring, and the left thyroid lobe extends from the 3rd to the 8th tracheal ring . The gland is covered by the sternocephalicus and the sternohyoideus muscles ventrally and by the sternothyroideus muscle laterally . The common carotid artery, the internal jugular vein, and the vagosympathetic trunk are situated on the dorsolateral surface of the right thyroid lobe, and the esophagus lies over the dorsolateral surface of the left thyroid lobe . The caudal laryngeal nerves, termed the rlns in humans, are dorsal to the thyroid lobes . In this study we used 9 dogs for evaluation of both functional and histological outcomes . For histological outcomes both acute and subacute changes were evaluated using both sides of recurrent laryngeal nerves . As depicted in the results, there were functional abnormalities in the group 1 and 2, which were the groups of dogs with hs application in vicinity of less than 3 mm . In contrast, the group 3 with hs application with safety margin of 3 mm, there were no adverse outcomes . This is small sample size, however, conjunction with the study by owaki et al . Subacute morphologic changes were evaluated using left recurrent laryngeal nerves harvested 2 weeks after initial energy source application . Acute morphological changes were evaluated using right recurrent laryngeal nerves harvested immediate after energy source application during second operation . Acute changes were observed in group 1 and 2, which were the groups of dogs with hs application in vicinity of less than 3 mm . In contrast, the group 3 with hs application with safety margin of 3 mm, there were no adverse acute morphologic changes . We could depict from these results that the histologic changes could be matched with the functional outcomes . The anatomical and functional correlation of this canine model might provide a rationale to evaluate the safety margin of an energy device during thyroid surgery . This study has some limitations including; (1) have small sample size, (2) did not evaluated other energy sources, (3) have other ways to evaluate the function, such as electromyography, and (4) have short period observation after application of energy source . However, this study would warrant further study to determine the clinically acceptable distance safety margin for the application of an energy device in the vicinity of the recurrent laryngeal nerve.
|
Fungal infections, both community acquired and nosocomial represent a major challenge, particularly in immunocompromised patients, as the organisms tend to be resistant to common drugs . Amphotericin b (amb), a potent polyene is one of the drugs used in therapy for patients with deep - seated fungal infections caused by acquired immunodeficiencies and transplantations.1 though it remains a potent antifungal drug, its use is hampered by its low solubility in water and toxic side effects.2 to circumvent these side effects, various drug formulations such as liposomes, deoxycholate salts, and nanospheres have been reported and used for treatment.2 some of these formulations are less toxic than others, but each has its own limitations . To circumvent these limitations, the interaction of amb with serum albumins has been studied by a few groups, notably by butler et al and romanini et al.3,4 serum albumins are known for their ability to bind a variety of ligands . This property helps to render a water - insoluble substance soluble and transportable.6 their lack of immunogenicity and toxicity coupled with abundant availability makes them ideal candidates for drug delivery . Human serum albumin (hsa) is used as an excipient in some drugs and is also used for treating shock, burns, and acute respiratory distress, and in hemodialysis.5,6 bovine serum albumin (bsa) was also investigated as it is structurally homologous to hsa.7 considering the significant advantages of serum albumin as a drug delivery system, we resorted to in - silico analysis to identify the putative binding regions of amb to serum albumin . Earlier reports by romanini et al suggest that in hsa the residues lysine 199 and 525 participate in amb hsa interaction with binding energies around 10 m.4 for our analysis, autodock 3.0 suite developed by scripps research institute was used to compute and determine the region of amb binding on serum albumins.8 our docking results indicate that both human and bovine serum albumins have only one favorable binding site each for amb . Amb binds to hsa away from the central cleft of the molecule and interacts with six amino acids (at 3 vicinity) in domain iiia . These include, two glu (392, 396) and two gln (518, 400) residues and one residue each of arg424 and ser431 (figure 1). On bsa, amb binds in the cleft region, interacting with seven amino acids, of which two are lys (138, 455) and one residue each of asp135, glu423, gln427, arg451, thr542 (figure 2). The spectra of both bsa and hsa complexed with amb had some characteristic perturbations especially at around 335340 nm (figures 3a and 4a). Amb in phosphate - buffered saline with 1% dimethyl sulfoxide (dmso) displayed a characteristic peak at 340 nm, while the complex showed a spectral blue - shift of about 5 nm . In addition, a hyperchromic peak was observed, which may be attributed to the change in the environment of the molecule . The increasing absorbance at 335 nm is similar to the changes of the amb spectrum displayed in the aggregated state in water . Romanini et al observed and postulated that this hyperchromicity is due to the self perturbation of the amb dipole during dimer formation and is caused by dipolar forces involving polar groups present in the amb molecule.4 such prior observations agree with the notion that the amb monomer interacts with the polar groups present on the bound serum albumin . The antifungal activities of the amb albumin (hsa and bsa) complexes were tested by broth dilution against candida albicans and c. glabrata . Results from these experiments suggest that the complex retains antifungal activity that is equivalent to the drug alone (table 1). Since amb is known to cause lysis of erythrocytes, the complexes were also tested for hemolytic activity on human erythrocytes.9 the results showed that the prepared complexes have only a marginal protective effect against membrane damage (figure 6, samples e and f). Several published reports show that amb has a permeabilizing effect on red blood cell membrane.9 brajtburg et al have reported that the auto - oxidation of the polyene drug releasing reactive oxygen species leads to these anticellular effects.10 hence, we thought that the addition of a free radical scavenger or an antioxidant in the above albumin amb complex would help to lessen the hemolytic activity of the drug . Curcumin, a yellow pigment isolated from the rhizomes of curcuma longa has been reported to possess antioxidant activity and known to exhibit various pharmacological effects including antimicrobial and anticancer properties.11 coincidently, curcumin too is insoluble in aqueous medium and is poorly absorbed by the body.12 various formulations like polymeric nanoparticles and liposomes have been prepared to increase the bioavailability.13,14 incidentally, tsao et al reported that the presence of curcumin enhanced the inhibitory activity of amb against candida spp.15 this report, combined with the known antioxidant property, prompted us to investigate the use of curcumin along with amb . Barik et al have reported the formation of bsa curcumin complex with binding constants in the order of 1010 m.16 the same group has also studied the formation of hsa curcumin complex and reported that the site of curcumin binding to hsa is likely to be at domain iia, with binding constant estimated to be around 7.9 10 m.17 the latest report from bourassa et al on curcumin binding to bsa indicate the number of bound polyphenols (n) to be 1.0 and the binding constant to be 3.33 (0.8) 10 m.7 the docking simulations carried out by us indicate the presence of a single binding site on hsa, located away from the trp214, on domain ib (figure 1). With bsa, curcumin is more likely to bind in the vicinity of trp158 (figure 2). The proposed complex of curcumin with hsa / bsa was prepared, and spectral properties determined (figure 5). Albumin complex showed no intrinsic antifungal activity (data not shown) and was found to be nonhemolytic in nature (figure 6, sample b). Since the binding site of curcumin was located in a different domain of albumins (figures 2 and 3), there was a distinct possibility of formation of ternary complex involving albumins, amb, and curcumin . We therefore prepared an albumin, amb, and curcumin complex . The prepared complex was water soluble (10 mg of protein / ml of water). The spectral properties indicate the presence of hyperchromic peak at 335 nm similar to amb albumin complex with a broad shoulder around 450 nm representative of curcumin . Testing of a mixture of free amb and curcumin in the in vitro red cell lysis assay shows that the lysis induced by the antifungal agent is delayed (figure 6, sample d). When both the components are protein bound, the process of lysis is delayed even more (figure 6, samples g and h). Significantly, however, this reduction of hemolysis was achieved without compromising the antifungal activity of the ternary complex and was seen to be equivalent to that of albumin amb complex and the drug alone (table 1). Since the binding site of curcumin was located in a different domain of albumins (figures 2 and 3), there was a distinct possibility of formation of ternary complex involving albumins, amb, and curcumin . We therefore prepared an albumin, amb, and curcumin complex . The prepared complex was water soluble (10 mg of protein / ml of water). The spectral properties indicate the presence of hyperchromic peak at 335 nm similar to amb albumin complex with a broad shoulder around 450 nm representative of curcumin . Testing of a mixture of free amb and curcumin in the in vitro red cell lysis assay shows that the lysis induced by the antifungal agent is delayed (figure 6, sample d). When both the components are protein bound, the process of lysis is delayed even more (figure 6, samples g and h). Significantly, however, this reduction of hemolysis was achieved without compromising the antifungal activity of the ternary complex and was seen to be equivalent to that of albumin amb complex and the drug alone (table 1). There are several reports on the interaction of amb with albumin, and curcumin with albumin . These studies have focused more on understanding the nature of interaction between albumin and the ligand . Even though there are a few reports on the amelioration of toxic effects of certain drugs by curcumin, the use of the drug alone with curcumin in a protein - complexed form and its beneficial biological effects have not been reported . This indicates that the translocation of the antifungal agent from the protein to target membrane occurs readily . Although two distinct sites were noted for amb and curcumin in the in silico study, there is no unequivocal evidence to show that the albumin drug complex used in the present study is loaded with both ligands on all the protein molecules . It is quite likely that the complex preparation consists of a mixture of albumin molecules, some carrying both ligands, some with one ligand, and some free protein molecules . The presence of curcumin in proximity to amb may not have much significance in so far as the biological effect is concerned . What is perhaps important is the availability of curcumin at the site of action of amb . It may be relevant to mention here that ali et al reported the amelioration of the nephrotoxic effect of gentamicin by curcumin in rats.18 in this case, gentamicin was administered intramuscularly, while curcumin was given orally . There is also a report of enhancement of antifungal activity of amb or fluconazole towards candida species by curcumin . Cucumin has been shown to have protective effect on primaquine - induced oxidative damage.19 amb is thought to damage the mammalian cell membrane by formation of channels traversing membranes, and this requires self - associated molecules.2 whatever the mechanism of the damage process, we have also observed that with free amb and curcumin together, the red cell lysis process is delayed . Kala - azar (visceral leishmaniasis) disease caused by protozoal parasite leishmania donovani responds to treatment with amb . In the light of the finding reported here, it may be worthwhile to investigate the therapeutic use of a combination of amb and curcumin in the protein bound form.
|
Parasites were genetically characterised as hum / me/1997/mex / rych1 or as t. cruzi rych1 (snchez - guilln et al . Passages in 10-week - old balb / c mice at four - week intervals . Mice, infection and treatments - balb / c female mice (8 - 10 weeks of age and 25 5 g) were allocated at room temperature (21 - 23c). They received water and a commercial diet ad libitum (alimento balanceado de la cienega, sa cv). Mice were obtained and maintained in animal facilities from east biomedical research centre / mexican institute of social security (puebla, mx) in compliance with the guidelines official mexican norm nom-062-zoo-1999: technical specifications for the production, care and use of laboratory animals (de aluja 2002), as well as the international guiding principles for biomedical research involving animals (cioms / iclas 2012). The mice were randomly divided into four groups: infected non - treated (inf) (n = 36), infected l - name treated (inf l - name) (n = 36), non - infected l - name treated (non - inf l - name) (n = 36) and non - infected vehicle - treated (non - inf veh) (n = 36). Inf and inf l - name were inoculated i.p . With 1 x 104 trypomastigotes of t. cruzi rych1 in 50 l of 4% sterile sodium citrate on days 0, 30 and 60 . Inf l - name and non - inf l - name were treated with 25 mg / kg of l - name (n - nitro - l - arginine methyl ester hydrochloride, cat: n575, st . Non - inf veh were not infected with t. cruzi rych1, yet received i.p . Blood parasitaemia was determined by cutting 1 mm off of the tail tip, followed by counting the number of parasites per ml of blood using a haemocytometer (hart et al . Additionally, trypomastigotes forms where classify as thin form (small and immature) or thick form (large and mature) according to the specifications of the previously establish ratio method (width / length: w / l) (martins et al . The mice were euthanised by cervical dislocation (4 mice from each group) after the last bleeding . Tissue samples were collected for an immediate histopathology analysis and liver tissue was isolated and stored at -70c until further use . Histopathological analyses - samples from the heart, skeletal muscle and the large intestine were fixed in 10% formaldehyde, dehydrated in absolute alcohol and then embedded in paraffin . For each organ, tissue samples were stained with haematoxylin and eosin (h&e) and then examined by light microscopy using a zeiss microscope (carl zeiss ag, oberkochen, germany). Photographs were taken at the indicated magnification with an olym- pus x-785 digital camera coupled to the microscope . For t. cruzi nests analysis, mice were sacrificed at two and three weeks post - infection (p.i .) And their organs were analysed using h&e staining (heart, diaphragm, oesophagus, colon and skeletal muscle), followed by quantification of amastigote nests and inflammatory infiltrates (more than 10 mononuclear cells) in 100 fields at 100x magnification . Measuring the serum levels of no - the no levels were evaluated by measuring the nitrite (no2-) level in serum samples using the griess reaction (green et al . Nitrate was reduced to no2- using spongy cadmium (5 - 20-mesh, sigma). Sodium nitrite (nano2) was used to make a standard curve . Sodium nitrate (nano3) was used as a standard and to determine reaction efficiency . The overall reaction can be described as following: no3- + h2o + cd no2- + cd2 + + 2 oh- . The absorbency was measured at 540 nm in a microplate elisa reader (multiskan ms, labsystems oy, helsinki, finland). Quantitative reverse - transcriptase polymerase chain reaction (qrt - pcr) - liver samples were homogenised with a polytron willems (pt10/35) homogeniser (brinkmann instruments, westbury, ny, usa) in 1 ml of trizol (invitrogen, grand island, ny, usa) to 100 mg of liver tissue . The rna was extracted according to manufacturer s protocol . The cdna was synthesised using 4 g of total rna from liver tissue with 10 u of mmlv reverse transcriptase (gibco brl), 2 l of 10 x buffer without mg2 +, 10 mm dntps stock solution [2.5 mm each of da, dg, dc and dt (strategene)], 50 mm mgcl2 (gibco brl), 10 mm oligo - d(t) (gibco brl), 5 u ribonuclease inhibitor (gibco brl) and 10 mm dtt (gibco brl) in 20 l final volume, followed by incubation for 1 h at 37c . Primers were synthesised according to an alignment of the amino acid and nucleotide sequences reported for wild type mt - i mice (mbikay et al . 1981), sequences mt - i (fwd):tcccgagcattactaaa and mt - i (rev): accccagtttcttattg . Pcr reactions were synthesised using 6 l of cdna reaction (6 g), 2.5 u taq dna polymerase (gibco brl), 8 l of 10 x buffer without mg2 + (gibco brl), 10 mm dntps stock solution [2.5 mm each of da, dg, dc and dt (strategene)], 50 mm mgcl2 (gibco brl), 20 pmol of each mt - i primers, 0.8 pmol of each g3pdh primers [g3pdh (fwd): tgaaggtcggtgtgaacggatttggc and g3pdh (rev): catgtaggccatgaggtccaccac] in 80 l final volume . Mt - i and g3pdh were amplified simultaneously in ptc-100 thermal cycler (mj research, alameda, ca, usa) for 35 cycles (94c for 1 min, 54c for 1 min and 72c for 1 min). Pcr products were separated with a 1.5% agarose gel and visualised with 1% ethidium bromide . Mt - i copy numbers were divided by g3pdh (housekeeping gene) to standardise the data set . Statistical analysis - data is expressed as the mean (average) standard error . A two - way anova was performed to determine significant differences between the groups . When this analysis indicated a significance of more than 5%, a post hoc student - newman - keuls analysis was used to determine which groups significantly differed . The data was analysed and graphed using graphpad prism v.5 software (san diego, ca, usa). Parasitaemia levels of t. cruzi rych1 forms - balb / c mice that were inoculated i.p . With 1 x 104 trypomastigotes t. cruzi rych1 on days 0, 30 and 60 resulted in a development of the chronic phase of chagas disease in inf and inf l - name groups . To comprehend the role of no in the chronic phase of infection in vivo, l - name treatment was administrated by i.p injection (25 mg / kg) once a week since day 0 (4 h p.i .) 1994, james 1995) for the inf l - name and non - inf l - name groups . Parasitaemia levels were determined in the infected groups (inf and inf l - name) by microscopic examination of tail vein blood every three days for two months . After two months, they were examined every 15 days, until day 195 . The inf group presented thin forms of the t. cruzi rych1 parasite on day 6 and then became undetectable after day 12 . The thick forms of t. cruzi rych1 were detectable on day 6, with a peak of parasitaemia [0.45 x 106 parasites blood forms / ml (pbf / ml)] on day 27 (table i). After day 42, the infection started to shift from the acute phase to the chronic phase, during which pbf became undetectable under microscopic examination (table i). Interestingly, l - name promoted the earlier presence of thin forms of t. cruzi rych1 on day 3 and the thick forms on day 6, with a peak of parasitaemia on day 30, which was significantly higher than the inf (0.54 x 106 pbf / ml, p <0.05) (table i). In addition, with l - name treatment, blood parasitaemia were detectable until day 45 (table i). Therefore, these data suggest l - name treatment, which causes a decrease in no levels, is associated with an earlier detection of thin forms of t. cruzi rych1 and had a larger peak of parasitaemia at a later time . Table i parasitaemia levels of trypanosoma cruzi rych1 forms in infected non - treated (inf) and infected n - monomethyl - l - arginine treated (inf l - name) infected micedayinfinf l - name thin formsthick formstotal / mlthin formsthick formstotal / ml0 - -----3 - --0.06 0.24 - 0.06 0.2461.45 0.290.07 0.011.53 0.311.83 0.220.08 0.021.91 0.2491.14 0.251.40 0.312.55 0.561.34 0.432.48 0.673.82 0.70120.95 0.093.82 0.394.78 0.490.14 0.084.96 0.625.10 0.6515 - 6.37 0.576.37 0.57 - 7.73 0.727.73 0.7218 - 9.45 0.239.45 0.23 - 6.70 0.476.70 0.4721 - 16.22 1.4316.22 1.43 - 15.20 0.5115.20 0.5124 - 29.16 4.4329.16 4.43 - 19.80 0.9819.80 0.9827 - 45.77 3.9445.77 3.94 - 36.93 4.3036.93 4.3030 - 19.16 0.3119.16 0.31 - 54.53 3.1854.53 3.1833 - 9.66 0.609.66 0.60 - 27.10 1.6427.10 1.6436 - 4.44 0.374.44 0.37 - 10.60 0.9310.60 0.9339 - 1.78 0.161.78 0.16 - 2.53 0.442.53 0.4442 - 0.16 0.0470.16 0.047 - 1.80 0.0321.80 0.03245 - ---0.53 0.180.53 0.1860 - 195 - -----balb / c mice were inoculated with 1 x 104 blood trypomastigotes of hum / me/1997/mex / rych1 or t. cruzi rych1 on days 0, 30 and 60 in the inf and inf l - name groups . Treatment with l - name was administered with a 25 g / kg intraperitoneal injection once a week for inf l - name, beginning on day 0 (4 h post - infection). Balb / c mice were inoculated with 1 x 104 blood trypomastigotes of hum / me/1997/mex / rych1 or t. cruzi rych1 on days 0, 30 and 60 in the inf and inf l - name groups . Treatment with l - name was administered with a 25 g / kg intraperitoneal injection once a week for inf l - name, beginning on day 0 (4 h post - infection). Compartmental alteration and histopathological analysis of t. cruzi rych1 - clinical manifestations of the chronic phase of chagas disease [slight alterations in fur colour (yellowish) with piloerection, especially in the dorsal region, hunched posture and decrease activity - level] were observed at day 75 in inf and inf l - name mice and showed minimal physical differences when compare with previously reported mice models (vespa et al . Non - inf l - name and non - inf veh mice presented with healthy physical and clinical characteristics (displayed with a white brilliant fur, showed no signs of peeling and were physically active) and did not manifest any side - effects related to the administration of either l - name or diluents controls, respectively . After day 135, inf mice showed severe paralysis of the lower extremities when compared with inf l - name mice (supplementary data). Histopathological analysis showed the presence of parasite nests in inf mice starting at day 15 in skeletal muscle and heart tissues . As the time progressed, the maximum number of parasite nests was found to be in heart tissue followed by skeletal muscle on day 27 (p <0.01), with no significant presences in the diaphragm (table ii). This data correlates with the inf group s peak of parasitaemia (day 27) (table i). The inf l - name group showed a similar tissue preference profile, with heart and muscle tissue having a significantly greater expression than other examined tissues (day 21, p <0.01). Interestingly, at the time for the peak of parasitaemia (day 30), the amount of nest is considerably fewer than day 21 (table ii). Furthermore, the l - name caused a reduced amount of nests in heart and muscle tissue (after day 27 and during the chronic phase) (table ii). In addition with the l - name treatment, we were able to detect nests in other tissues: colon, diaphragm and oesophagus (day 21) (table ii). Therefore, it seems that l - name allows the establishment of nests in multiple tissues, but counteracts the severity of the invasion . Table iipreferential tissue growth / survival of trypanosoma cruzi rych1 in infected non - treated (inf) and infected n - monomethyl - l - arginine treated (inf l - name) groupsgroupinfday p.i.15212733 muscle4.0 2.519.5 5.6a24.6 8.0b7.0 4.7heart2.0 0.818.5 3.5a60.5 20.2b11.2 5.8diaphragm--1.4 1.0-colon----oesophagus---- groupinf l - name day p.i.15212733 muscle17.5 9.230.5 15.1b14.8 6.91.6 0.6heart4.0 3.428.8 11.2b11.8 2.81.4 1.2diaphragm-2.0 1.4 - -colon1.2 0.81.0 0.6 - -oesophagus-1.0 balb / c mice were inoculated with 1 x 104 blood trypomastigotes of hum / me/1997/mex / rych1 or t. cruzi rych1 on days 0, 30 and 60 in the inf and inf l - name groups . Treatment with l - name was administered with a 25 g / kg intraperitoneal injection once a week for l - name, beginning on day 0 . Number of parasite nests in tissue sample was determinate with haematoxylin and eosin staining at the indicated day . P.i . Balb / c mice were inoculated with 1 x 104 blood trypomastigotes of hum / me/1997/mex / rych1 or t. cruzi rych1 on days 0, 30 and 60 in the inf and inf l - name groups . Treatment with l - name was administered with a 25 g / kg intraperitoneal injection once a week for l - name, beginning on day 0 . Number of parasite nests in tissue sample was determinate with haematoxylin and eosin staining at the indicated day . P.i . : post - infection . To assess the severity of the invasion, we examined the heart and skeletal muscle tissue at day 135 p.i . The extensiveness of nest formation were examined by h&e staining of heart muscle (fig . 1 a, c) and skeletal muscle (fig . 1 b, d). We were able to view the presence of amastigote nests which were surrounded by lymphocytes infiltrate (fig . Planes corresponding to the inf group had an average of 7 4 nest per a field, whereas the inf l - name group had a significant lower amount (1.4 1.2 nest per a field, p <0.01) for the heart (fig . These results were similar for the skeletal muscle (3 2.2 vs. 1.6 0.57 for inf and inf l - name, respectively, p <0.01) (fig ., these results suggest that l - name affects the development of nests during the chronic phase by an unknown mechanism . . 1: histopathological changes in heart and skeletal muscle of trypanosoma cruzi rych1 in infected non - treated (inf) and infected n - monomethyl - l - arginine treated (inf l - name) groups . Balb / c mice were infected with 1 x 104 blood trypomastigotes of t. cruzi rych1 . Tissue samples were stained with haematoxylin and eosin and then examined by light microscope at 135 days post - infection . No levels of t. cruzi rych1 in inf and the effected of l - name treatment - we have demonstrated that no levels are higher in patients with the chronic phase of chagas disease (prez - fuentes et al . Therefore, the no levels were determined in all of the groups using the griess technique (green et al . The inf group showed a progressive increase in no levels, which reached a maximum value of 27.30 mol / ml after day 165 (fig . This was significantly higher than the non - infected mice (non - inf l - name and non - inf veh, p <0.001). The inf l - name group also showed an increase in no levels, peaking at day 75, which was also significantly higher than the inf group (15 mol / ml vs. 12.5 mol / ml, p <0.05). However, after day 75, the no levels decreased and returned to basal levels (similar to non - inf l - name and non - inf veh) by day 195 (fig . 2 a). These data suggest that l - name, at 25 mg / kg, did not block no levels during the acute phase, allowing the development of the chronic phase of chagas disease . Afterward, the no levels decreased significantly, thereby preventing damage that is normally caused by no during the chronic phase . 2: time course of nitric oxide (no) and metallothionein-1 (mt - i) levels in the liver of trypanosoma cruzi rych1 in infected non - treated (inf) and the effected of n - monomethyl - l - arginine (l - name) treatment . Inf and inf l - name were intraperitoneally inoculated with 1 x 104 blood trypomastigotes of t. cruzi rych1 on day 0, 30 and 60 . Inf l - name and non - infected l - name treated (non - inf l - name) received l - name once a week (25 mg / kg). Blood and liver rna was collected from each group on day 3, 15 and 45, then every 30 days . A: no levels determined by the griess method; b: mt - i and g3pdh gene expression determined by semi - quantitative polymerase chain reaction . Non - inf veh: non - infected vehicle - treated . Liver levels of mt - i in t. cruzi rych1 - one protein of interest that can regulate no levels is mt - i; therefore, the expression of mt - i was assessed in the murine model during the chronic phase . The mice were sacrificed at day 3, 15, 45 and then every 30 days . The liver rna was collected and mt - i levels were determined using semi - qrt - pcr . The mt - i gene expression was significantly higher during the acute phase in the inf group (fig . 2 b) (p <0.001); however, the mt - i levels decreased significantly as the time of infection prolonged (p <0.001). Whereas in the control groups (non - inf veh and non - inf l - name), the mt - i expression levels presented no significant difference and remained constant . With the inf l - name group, the mt - i expression significantly increased in a time - dependent manner with a maximum peak of expression at day 165 . This peak was a 2.7-fold higher than the inf group (p <0.001) (fig . These data suggest that mt - i levels increased with the treatment of l - name during the chronic phase . Correlation of mt - i and no during the chronic phase of chagas disease - mt production has been shown to increase in organisms exposed to high levels of reactive oxygen and nitrogen species (miles et al . However, we observed an inverse correlation between the levels of mt - i and no (fig . 3). While no levels remained continuously high during the chronic phase (fig . Mt - i levels showed a decrease in expression (fig . 2 b, open circle). Using these data, we determined an inverse correlation between no levels and mt - i expression (fig . The same inverse correlation was evident when no levels were inhibited by l - name (fig . 3 b) (r = -0.7480 p <0.001), which decreased the levels of no (fig . 2 a, open boxes) and increased the levels of mt - i (fig . Therefore, during the chronic phase of chagas disease, an inverse correlation between the levels of no and mt - i was observed . 3: spearman s correlations between blood nitric oxide (no) and liver metallothionein-1 (mt - i) levels during chronic phase of chagas disease . Balb / c mice were inoculated with 1 x 104 blood trypomastigotes of trypanosoma cruzi rych1 on day 0, 30 and 60 (inf and inf l - name). L - name was administered once weekly at 25 mg / kg [infected non - treated (inf) and infected n - monomethyl - l - arginine treated (inf l - name)]. Blood and liver rna samples were collected on day 3, 15 and 45, then every 30 days . No and mt - i level were determined by semi - quantitative reverse - transcriptase polymerase chain reaction . Virulence, infectivity and pathogenesis of t. cruzi are mediated by the strain (marinho et al . The state of puebla has an incidence rate of 7.7%, with the predominance in cardiac alterations (snchez - guilln et al . Our results have demonstrated that the hum / me/1997/mex / rych1 (t. cruzi rych1) strain, using balb / c mice as the host, was able to develop pathological and clinical characteristics of chagas disease . This allowed us to analyse the chronic phase of the disease as observed in the population of puebla . In our murine model, the physical changes corresponding to the chronic phase appeared after day 45, which correlated with absence of circulating parasites . These physical characteristics are consistent with other murine models, featuring alterations in fur colour with piloerection, hunched posture and severe paralysis of the lower extremities (da silva et al . Kinetics of parasitaemia in this model also showed similar levels to other well - studied strains in chronic phase (table i), such as t. cruzi tulahun, 21sf, mambai, bolivia, tbar / mx/0000/queretaro and mhom / mx/1994/ninoa (andrade & grimaud 1986, petray et al . Therefore, we are led to conclude that our model is physically similar to other murine models of chagas disease . In addition, parasitaemia levels for both groups were undetectable, as seen previously with other t. cruzi strains during the chronic phase (espinoza et al . Moreover, the preferential tissue growth study demonstrated that during the acute phase, l - name did significantly alter the severity of the infection, allowed infection to progress in organs in which parasitism is usually low / undetectable (table ii). The levels of parasitism in these organs, when compared to other strains, were unique for this strain (guarner et al . Normally, no is required by the immune system to eradicate the parasite during the acute phase of the infection . If no levels decrease, then augmented parasitaemia will eventually lead to the death of the murine host (vespa et al . 1994, james 1995). Treatment with no inhibitors resulted in an increase in parasitaemia and mortality during the acute phase (petray et al . 1996, 1998, millar & kahn 2000). However, it is still not clear what effect elevated blood no levels has on patients with the chronic phase of chagas disease . L - name, a no inhibitor, was administrated once a week between day 0 (4 h p.i .) To the end of experiment, at a dose of 25 mg / kg / week . Other groups ordinarily treated with ~5 mg / kg per / day, which corresponds to between 25 - 35 mg / kg each week (petray et al . This dose of 25 mg / kg / week allowed mice to survive the acute phase of infection and develop the chronic phase of chagas disease without decreasing their survival rate . In contrast, most mice treated with 5 mg / kg / day developed a severe acute phase, which eventually led to a high parasite burden and death (petray et al . 1995, jacobs et al . 1996, millar & kahn 2000). When the mice were treated with l - name at 25 mg / kg / week (inf l - name), no levels increased during the acute phase with no significant variation until day 75 (p <0.05) (fig . 3). Our purposed explanation is that the administration of l - name at 4 h p.i affected the no production during the first few days of the infection . This allowed the parasite to propagate quickly in blood, as demonstrated by the presence of the thin / immature forms of t. cruzi at an earlier timeframe (table i). The reason for the earlier detection of the thin / immature forms we are currently examining . We speculate that the increases of the thick / mature forms in blood are due to a block in tissue tropism . We were able to see a decrease of nest in l - name treated mice after day 27 (table ii) and day 135 (fig . The second notable affect was, at the initiation of the chronic phase (> day 75), no levels decreased significantly in inf l - name mice due to the l - name treatment (p <0.001). This correlated with the undetectable parasitaemia levels and the lower nest present in tissues . In addition, it also correlated with the significantly higher levels of mt - i . Many researchers have demonstrated that the trypomastigotes of t. cruzi are cleared by the liver (umekita et al . 2010). During inflammation, toxin insults and oxidative stress damage caused increased expression of mts in the liver (stankovic et al . Although published results suggest that an elevation in no levels will lead to an elevation in mt - i levels as a protective mechanism (arizono et al . 2012), our results demonstrate the contrary . When we evaluated the mt - i levels during the chronic phase of chagas disease, the inf group demonstrated a reduced mt - i level when the no level was elevated (fig . However, with the l - name treated mice, when the no level was low, the mt - i level was high (fig . We suggest that the chronic inflammation caused by chagas disease, which is signified by high levels of no, may led to a down regulation of mt - i . This is in agreement with the clinical data (prez - fuentes et al . Inflammatory cytokines tumour necrosis factor - alpha and interleukin-6 have been shown to regulate mts family proteins (liu et al . Therefore, during the chronic phase of chagas disease, we suggest that mt - i could be down - regulated by these pro - inflammatory cytokines . It will be crucial to further investigate and characterise the mechanism involved in the inhibition of mt - i during the chronic phase of chagas disease.
|
Supernumerary teeth are defined as those in addition to the normal series of deciduous or permanent dentition . They may appear as a single tooth or multiple teeth, unilaterally or bilaterally, erupted or impacted and in mandible / maxilla or both the jaws . The prevalence of supernumerary teeth varies between 0.1 and 3.8% and is more common in the permanent dentition. [13] the low prevalence of supernumerary teeth in primary dentition is because it is generally overlooked by the parents, is often of normal shape (supplemental type), erupt normally, and appear to be in proper alignment . The incidence is considerably higher in the maxillary incisor region followed by maxillary third molar and mandibular molar, premolar, canine and lateral incisors . Though there is no significant sex distribution in primary supernumerary teeth, males are affected approximately twice than females in the permanent dentition . Supernumerary teeth can be classified according to chronology, location (topography), morphology and their orientation . Chronologically, they can be classified as pre - deciduous, similar to permanent teeth, and post permanent or complementary; morphologically as conical, tuberculate, supplemental (eumorphic) and odontome; topographically as mesiodens, paramolar, distomolar and parapremolar, and according to orientation as vertical, inverted and transverse [tables 13]. Paramolars are supernumerary molars, usually rudimentary (dysmorphic), situated buccally or lingually / palatally to the molar row . Mostly, they are situated between the second and third molars, while in very rare cases they can be found in between the first and second molars [figure 1]. Distomolars are situated either directly distal or distolingually to the third molar and are usually rudimentary conical shape [figures 2 and 3]. Supernumerary teeth based on location supernumerary teeth based on morphology supernumerary teeth based on eruption and orientation presence of bilateral paramolars in between first and second molars right side intraoral peri - apical radiograph showing carious maxillary right second molar (17), paramolar and distomolar left side intraoral peri - apical radiograph showing carious maxillary left second molar (27), paramolar and distomolar several theories have been suggested for their occurrence, such as the phylogenetic theory, the dichotomy theory, occurrence due to hyperactive dental lamina and due to a combination of genetic and environmental factors . Generally, multiple supernumerary teeth are associated with diseases or syndromes . Supernumerary teeth show strong association with developmental disorders such as cleft lip and palate, cleidocranial dysostosis, gardener syndrome and less commonly with ehlers - danlos syndrome, fabry anderson's syndrome, chondroectodermal dysplasia, incontinentia pigmenti and tricho rhino - phalangeal syndrome . Supernumerary teeth may erupt normally, remain impacted, appear inverted or assume an abnormal path of eruption . As such, supernumerary teeth do not cause any complication . However, these may lead to delay or failure of eruption of permanent teeth, displacement, crowding, root resorption, dilaceration, loss of vitality of adjacent teeth, subacute pericoronitis, gingival inflammation, periodontal abscesses, dental caries due to plaque retention in inaccessible areas, incomplete space closure during orthodontic treatment, and pathological problems such as dentigerous cyst formation, ameloblastomas, odontomas and fistulae . Occasionally, supernumerary teeth are asymptomatic and may be detected as a chance finding during radiographic examination . Detailed history, clinical examination, thorough investigation, early diagnosis and appropriate treatment of supernumerary teeth are mandatory . Sometimes, clinicians may suspect the presence of supernumerary teeth, if there is failure of eruption or ectopic eruption of permanent tooth, persistence of deciduous tooth, wide diastema and obvious presence of additional teeth . An anterior occlusal or periapical radiograph [figures 2 and 3] using paralleling technique and panaromic view (orthopantomograph) [figure 4] are the most useful radiographic investigations to visualize supernumerary teeth . Recently, computed tomography has also been used to detect the presence of supernumerary teeth . A complete radiographic survey of the entire oral cavity is essential to identify the presence of all impacted supernumerary teeth because the ratio of impacted to erupted supernumerary teeth ranges from 3 to 1 . Treatment depends on the type and location of the supernumerary teeth and on its potential effect on adjacent hard and soft tissue structures . Occasionally, supernumerary teeth may lead to complications such as deep caries in the adjacent teeth, which may require restoration or endodontic therapy of the adjacent teeth as well [figures 5 and 6]. Supernumerary teeth can be managed either by removal / endodontic therapy or by maintaining them in the arch and frequent observation [figure 7]. Removal of the supernumerary teeth is recommended where there is associated pathology, permanent tooth eruption has been delayed due to the presence of supernumerary tooth, increased risk of caries due to the presence of supernumerary teeth which makes the area inaccessible to maintain oral hygiene [figures 1],altered eruption or displacement of adjacent tooth is evident, there are severely rotated teeth leading to further complication, orthodontic treatment needs to be carried out to align the teeth, its presence would compromise alveolar bone grafting and implant placement andthere is compromised esthetic and functional status . There is associated pathology, permanent tooth eruption has been delayed due to the presence of supernumerary tooth, increased risk of caries due to the presence of supernumerary teeth which makes the area inaccessible to maintain oral hygiene [figures 1], altered eruption or displacement of adjacent tooth is evident, there are severely rotated teeth leading to further complication, orthodontic treatment needs to be carried out to align the teeth, its presence would compromise alveolar bone grafting and implant placement and there is compromised esthetic and functional status . Opg showing maxillary bilateral paramolars and distomolars intraoral peri - apical radiograph showing completion of endodontic therapy in maxillary right second molar (17) intraoral radiograph showing restoration in maxillary second molar management of supernumerary teeth extraction should be performed carefully to prevent damage to adjacent permanent teeth, which may cause ankylosis and maleruption of these teeth . The clinician should be careful to avoid complications such as damaging nerve and blood vessels during manipulation of the tooth, perforation of maxillary sinus, pterygomaxillary space, orbit and fracture of maxillary tuberosity . Clinicians must also be alert as sometimes supernumerary teeth are fused with the adjacent tooth structure at crown or root level, which may make the extraction difficult. [1618] supernumerary teeth can also be kept under observation without extraction when satisfactory eruption of related teeth has occurred with no associated pathology and not causing any functional and esthetic interference . Supernumerary teeth can present in any region of oral cavity . These may erupt or remain impacted and may lead to various complications . Though the occurrence of paramolars is rare, clinicians should be aware of their presence and associated problems in order to formulate a sound treatment plan after thorough clinical and radiographic investigations, to meet the challenges.
|
The human t - lymphotropic virus type i (htlv-1) is a retrovirus that accounts for several human diseases (17). Two of the most frequent diseases induced by htlv - i are adult t - cell leukemia / lymphoma (atll) (8) and chronic progressive myelopathy, called htlv - i associated myelopathy / tropical spastic paraparesis (ham / tsp) (2). Individuals are at higher risk in endemic regions of the world, including iran and khorasan province in particular (9). Ham / tsp is described as the gradual onset of slowly progressive myelopathy, which predominately involves the corticospinal tract and is presented by sensory, motor, and urinary function impairments (10, 11). The diagnosis is based on clinical findings corroborated with detection of htlv - i antibodies in serum and cerebrospinal fluid (csf) (12). Polymerase chain reaction (pcr) can be used on peripheral blood and csf cells of infected individuals as well (13). Expansion and infiltration of immunocompetent mononuclear cells directed against viral antigens on the surface of infected t - cells in cns section might be responsible for the pathology of ham / tsp (14). Numerous electrophysiological studies have been administered to elucidate and establish the extent of cns involvement in patients with ham / tsp (1518). Somatosensory evoked potentials (sseps) are a series of waves that reflect the sequential activation of neural structures along the somatosensory ascending tracts . (1999) showed that the central motor and sensory conduction times were abnormal in patients with ham / tsp (19). Despite the fact that ham / tsp typically affects the lower extremities, corresponding neurological abnormalities of the upper extremities (i.e., pathologic hyper reflexia) (20) are seen in a minority of patients; therefore, we conducted this study to determine the extent of the central nervous system s engagement, particularly the cervical spinal cord, in ham / tsp patients by obtaining somatosensory evoked potentials (sseps) of the median nerve . Our cross sectional study was performed on 48 patients with ham / tsp who were referred to the neurology department at qaem hospital in mashhad, iran, from october 2010 to october 2011 . Various indices were measured for each ssep recording, including disease severity based on osame criteria (21) and duration of the disease, age, and gender . N11, n13, n20 conduction latencies, as well as n11-n13 and n13-n20 interpeak latencies (ipls) were measured for each ssep recording . Inclusion benchmarks were restricted to known cases of ham / tsp according to the world health organization s (who s) diagnosis guidelines . None of the patients was paraparetic or myelopathic due to non - htlv - i origins, and they had no coexisting causes of myelopathy, such as hiv, multiple sclerosis, vitamin b12 deficiency, or compressive sources . Informed consent was obtained from all subjects, and the hospital s ethics committee approved the study protocol . All patients underwent a comprehensive evaluation, which consisted of a medical history and clinical examination, serum and csf analysis by enzyme - linked immunosorbent assay (elisa) and polymerase chain reaction (pcr) to confirm the disease . In addition, mri of the brain and spinal cord and further laboratory tests were performed to rule out other causes of spastic paraparesia . Subsequently, median nerve sseps were elicited from confirmed ham / tsp patients utilizing a nihon kohden electromyography machine . The stimulus frequency was 36 hertz, and the frequency bandpass filter was set at 52000 hertz . The t - test was used for quantitative data, and the chi - squared test was used for the qualitative variables, with a value of p <0.05 being considered significant . All of the confirmed ham / tsp patients were subjected to clinical evaluation in the form of detailed history and a thorough physical examination, and, afterwards, recordings of median nerve sseps was performed on all of the cases . The initial sample had 53 patients, but five patients were excluded due to prolonged latency of n9, which is an indicator of peripheral nerve involvement . Consequently, 48 patients were enrolled in the study, six of whom had a duration of the disease less than two years, and the remaining patients had been afflicted by the disease for more than two years . The patients included in this study had a mean age of 45.6 14.2 years, and 34 (70.2%) of them were females . There was a positive family history for ham / tsp in 12 of the patients (25%). Forty - eight (100%) of the patients had a history of breastfeeding for more than one year, 20 (41.7%) of them had at least one major surgery, and 2 (4.2%) had a history of blood transfusion . Our patients were more likely to report complaints of abnormal gait and leg weakness (34 patients) and lower limb paresthesia and numbness (6 patients), while the rest had other complaints . Considering urinary manifestations, 28 were suffering from increased urinary frequency, 6 from urgency, and 10 from urinary incontinency . None of the patients had cutaneous, ophthalmic or hematologic signs or symptoms, and the neurological examination of cranial nerves and cerebellum failed to show any abnormalities; however, 3 patients had abnormalities of the autonomic nervous system . According to osame motor disability grading (mdg), the mean mdg was 3.2 1.4 in our study group (ranging from 1 to 5 with a mode of 3). Table 1 summarizes the findings from the sensory and motor examination of extremities . On the mri of brain and cervical spine, performed with a 1.5 tesla mri scanner, no significant lesions were observed in 45 patients, while 3 patients showed 13 small (<1 cm) cerebral white matter lesions . The normal n9 component in all subjects implied that the peripheral nervous system was intact, denoting nonparticipation of the median nerve . Also, severe abnormal n1113 ilp signifies engagement of cervical spinal cord . Table 3 shows the effect of gender and duration of the disease, and table 4 shows the effect of age and disease disability (according to osame mdg) all on median nerve ssep components . There was no remarkable correspondence between the different parameters of sseps with duration of disease, age, or gender of the patients, but there was a statistically significant correlation between the disease disability and each of the n1113 ilps and n1320 ilps . Htlv - i infection is lifelong and up to 4% of those infected will progress to ham / tsp with higher prevalence in females (22). Minimum age of patients in our study was 17, but, according to prior studies, it can occur at any age and, similar to our data, it is usually diagnosed in the fourth to fifth decade of life (23). Objective sensory examination did not reveal any superficial or deep sensory loss in upper extremities but abnormal deep tendon reflexes, hyper tonicity, and positive hoffman s sign were detected in almost all patients . These abnormal findings in the upper extremities were considered in earlier studies, and they suggest the possible involvement of the cervical spinal cord and cerebral cortex in the course of the disease (20). In our study, n9 and n11 components of sseps, which represent brachial plexus and dorsal root entry zone, respectively, were in normal limitation in all patients, showing that the peripheral nervous system was unimpaired in the ham / tsp patients . In contrast, cervical components of ssep, which are n13 and n1113 ipl, were abnormal in almost 50% of the patients, demonstrating that the cervical cord, particularly the dorsal column, is involved in this disease . Also, abnormalities were found in the n20 and n1320 conduction latencies of approximately 20% of patients are compatible with thalamocortical engagement, which is beneficial to demonstrate the pathophysiology of disease and its expansion in cns . A study performed by shimizo et al . On 13 patients with ham / tsp reported significant prolonged central motor conduction time (cmct) both in upper and lower extremities, and central sensory conduction time (csct) of only lower extremities (24). Also the cmcts were prolonged to a greater extent compared to cscts in both upper and lower extremities . In an earlier study by suga and colleagues, impairment of cmcts was found in the upper (17.6%) and lower (72.8%) extremities, and the cscts in the lower extremities were abnormal in 31.3% of patients, while cscts in the upper limbs were normal (19). Csct findings of upper extremities in this latter study conflict with our view on engagement of thalamocortical pathways and dorsal column of cervical spinal cord; therefore, we suggest further investigations using a larger number of patients . In a study by kakigi et al . On 19 patients, n13 and n20 conduction latencies in 3 patients and n913 ipls in 9 patients were significantly prolonged, indicating subclinical abnormalities in posterior column similar to our study; and the finding of prolonged p400 and p37 latencies in posterior tibialis nerve sseps supports our notion that cerebral white matter, cortex, and thalamocortical pathways are involved in the ham / tsp process (25). In our study, age, gender, and duration of disease had no remarkable effect on ssep parameters . This corroborates the findings of suga who could not find any correlation between duration of disease and ssep latencies, demonstrating that damage to cervical spinal cord occurs in early stages of the disease . In this study, we found a significant correlation between prolongation of n1113 and n1320 ipls and severity of disease disability, which was in accordance with shimizu et al.s observations (24); however, suga and colleagues reported no meaningful correlation between the severity of disabilities and either cmcts or cscts of the lower extremities (19). Also, no statistically significant correlation between abnormal cmcts and hyper reflexia in upper extremities was recorded in suga et al.s study (19). These findings might be due to peripheral axonal damage that occurs to a greater extent in the lower extremities and may lead to decreased sensitivity of recorded cmcts and cscts . We demonstrated that the increase in n1113 and n1320 ipls in accordance with severity of disabilities was directly correlated with the degree of spinal cord damage . A major limitation of the study could be described as insufficient cooperation of the patients for performing the ssep study, presumably resulting in an undesirable sample size . Despite the lack of obvious upper limb complaints in patients with ham / tsp, ssep of median nerve from cervical spinal cord to cortex were abnormal, indicating expansion of the lesion from the thoracic spinal cord up to the cervical spinal cord and thalamocortical pathways . We also demonstrated that abnormalities in the cervical spinal cord have a direct correlation with the severity of disability in patients with ham / tsp; however, further studies are recommended to confirm these findings . The practical implication of the present study can be defined as a valuable step forward in illustrating the demyelination process of the central nervous system through ssep, the process that typically eludes mr imaging.
|
Its defining histopathology is the existence of noncaseating epithelioid granulomas with accompanying mononuclear cell infiltration and microarchitecture destruction [1, 2]. Although sarcoidosis involves the lungs in> 90% of cases, it also affects the heart, skin, eye, and central nervous system . This accounts for its heterogeneous clinical manifestation which ranges from having no symptoms to severe consequences, namely respiratory insufficiency, cardiac death, neurological disease, and blindness . Sarcoidosis has been reported in all ethnic and racial groups with the majority of studies recording a peak incidence of 2039 years of age for both males and females and a bimodal distribution whereby women have another peak incidence at 6569 . Disease remission occurs in as many as two - thirds of patients, usually in the first 3 years after diagnosis . The erratic clinical course has impelled research into biomarkers that could delineate disease severity and outcome . To date, there exist no reliable and practical biomarkers for sarcoidosis . Moreover, despite earnest research efforts, the immunopathogenesis and aetiology underpinning sarcoidosis remains elusive . This review outlines the current understanding of sarcoidosis, with reference to ex vivo lymphocyte stimulation in the peripheral blood and bronchoalveolar lavage fluid (balf) of sarcoidosis patients, describes the exhaled breath condensate, an innovative method of identifying immunological markers, and proposes novel immunological markers to better characterise the immunopathogenesis of sarcoidosis . Peripheral anergy is observed despite exaggerated inflammation at disease sites . This is demonstrated by a reduced delayed - type hypersensitivity to tuberculin and common antigens . It has been postulated that underpinning this paradoxical situation is a disequilibrium between effector and regulatory lymphocytes (treg cells), notably cd4cd25foxp3 cells . These cells accumulate in the periphery of the granuloma and peripheral blood of patients with active disease and exert anti - proliferative effects on nave t cells . Others argue that the intense immune response at disease sites results in activated t cells gathering at these disease sites and consequent peripheral blood lymphopenia . Still others have suggested that with disease chronicity, immunosuppressive cd8 t cells become more abundant peripherally, resulting in an anergic response . Its centre is hypothesized to contain a poorly degraded antigen, surrounded by macrophages that will differentiate to epithelioid cells which subsequently fuse to form multinucleated giant cells . Cd4 t helper cells are interspersed in the granuloma while cd8 t cells, regulatory t cells, fibroblasts, and b cells surround the periphery [4, 12]. Birefringent crystals, hamazaki - wesenberg, schaumann bodies, and asteroid bodies may also be present but are nonspecific . The interplay of antigen - presenting dendritic cells (dcs) and nave cd4 t - cells is necessary for granuloma formation . They journey to lymph nodes where they mature and prime the adaptive immune system by displaying the antigen peptide on the surface major histocompatibility complex (mhc) class ii peptide groove . A specific t cell receptor (tcr) fixes its variable region to the antigen - mhc complex and is activated . To optimise this activation, cd28, a costimulatory signalling molecule on t cells, interacts with cd86 on dcs . The dcs also produce a battery of mediators which facilitates the sarcoid immune reaction (figure 1). The cd4 t cells that trigger the granuloma formation are strongly th1 polarised . Upon tcr activation, interleukin-12 (il-12) secreted by dcs is a th1 polarising cytokine . With the aid of stat4, il-12 facilitates ifn expression . Ifn binds to ifn receptors and stimulates stat1 which promotes tbx21 gene expression of t - bet . T - bet enhances ifn gene transcription competence and ultimately increases the production of ifn (figure 1). T - bet also up regulates il-12 receptor (il-12r) expression and antagonises gata3, a transcription factor that regulates th2 differentiation . This amplifies the responsiveness of cd4 t - cells to il-12 and inhibits il-4 and il-13 (cytokines that facilitate the fibroproliferative response) production . Il-18 upregulates il-12r and ifn expression while il-12 increases il-18 receptor expression on cd4 t cells . Therefore, il-12 and il-18 act synergistically to promote the formation of sarcoid granulomas [2023]. Ifn inhibits the expression of macrophage peroxisome proliferator - activated receptor (ppar), a negative regulator of inflammation . Under normal physiological conditions, macrophages constitutively express ppar. Ppar promotes macrophage il-10 production which inhibits the release of tnf, il-12 and matrix metalloproteinase (mmp) from dcs . In sarcoidosis, ifn production inhibits the expression of the immunosuppressive cytokine, il-10 (figure 1). This leads to an increase in the production of tnf, il-12, and mmp and induces chemokines cxcl-9, cxcl-10, and cxcl-11 production which, through the ligation of a t - cell receptor, cxcr3, induce t - cell chemotaxis . Mmps cause lung damage and fibrosis and the chemokines attract more tcells and myeloid cells into the inflammatory milieu . Moreover, increased tnf and decreased il-10 expression liberate dcs from the inhibition by macrophages, initiating a self - amplifying inflammatory loop . Tnf produced by the dcs also encourages cd4 t - cell proliferation and survival, directly through the induction of t - cell il-2r [24, 25] and indirectly by causing dc to mature into antigen presenting cells . Autocrine il-2 production results in the clonal proliferation of cd4 t cells (figure 1) [2, 28]. Persistent granulomatous inflammation can be attributed to the inability of the immune regulatory mechanisms to limit the duration of the inflammatory process . The inflammatory response is potentiated as saa proteins readily accumulate and release more soluble saa peptides into the surrounding tissue [29, 30]. However, the treg cells in the sarcoid granulomas (as opposed to peripheral treg cells) have undergone extensive amplification and are therefore impaired in their ability to repress immune responses . Moreover, they secrete proinflammatory cytokines (e.g., il-4) which encourages granuloma formation via mast cell activation and fibroblast amplification [31, 32]. Nkt cell numbers have been noted to be markedly reduced in sarcoid blood and balf except in patients exhibiting lfgren's syndrome (acute sarcoidosis characterised by uveitis, arthritis, erythema nodosum, bilateral hilar lymphadenopathy, and fever). Since lfgren's syndrome is often associated with disease remission, reduction in the number of nkt cells can account for the persistence of sarcoidosis . Disease remission occurs with the suppression of macrophage and t - helper cell activity by il-10 or when the presumptive antigen has been completely cleared (figure 1). Nonetheless, various cytokines which are able to support a fibrotic response have been found at disease sites in patients with sarcoidosis (e.g., transforming growth factor- (tgf-), mmp, and insulin growth factor-1 (igf-1)) [35, 36]. It has been proposed that a switch from th1 to th2 cytokine predominance may occur in chronic sarcoidosis in response to persistent inflammation . Tgf- recruits, activates, and transforms fibroblasts into myofibroblasts which have been strongly implicated in the development of fibrosis [17, 37]. Moreover, the th2 chemokine, ccl2, enhances fibroblast survival, augmenting the effects of tgf- . Additionally, the macrophages of patients with pulmonary fibrosis, under the influence of the th2 cytokine milieu, express ccl18 chemokines which facilitates lung remodelling via fibrosis [39, 40]. Although the majority of studies have used the th1/th2 model to explain the immunopathogenesis of sarcoidosis, by focusing solely on this model, there is a propensity to oversimplify the immunological process and divert research efforts away from other mechanisms . High levels of il-17/cd4 t lymphocytes have been found in the balf and granulomas of sarcoidosis patients, particularly in patients with active disease . Recently, richmond and colleagues verified the specificity of th17 cells for mycobacterial antigens, a commonly implicated antigen for sarcoidosis . Nkt cells produce th1 and th2 cytokines (ifn and il-4, resp . ). Blood nkt cells from sarcoidosis patients, when stimulated with a glycolipid stimulator, showed diminished levels of ifn, therefore suggesting that nkt cells exert regulatory activity which prevents disease progression . A myriad of observations have supported the notion that sarcoidosis can be caused by environmental and infectious agents . Moreover, based on chronic beryllium disease, an analogous granulomatous lung disease, it has been speculated that one or more antigenic stimuli may be involved in the pathogenesis of sarcoidosis . Therefore, it is highly likely that the development of a sarcoidosis reaction to an antigen depends on a combination of genetic polymorphisms, the host's immune status, and exposure to environmental agents . Both family and genetic host studies have recognised genes that are responsible for this genetic susceptibility . The multicentre study entitled a case control etiologic study of sarcoidosis (access) demonstrated that sarcoidosis patients were 5 times more probable than controls to report a parent or sibling with sarcoidosis . This led to the discovery of butyrophilin - like 2 (btnl2), a costimulatory molecule within the mhc locus . Single nucleotide polymorphisms (rs2076530 g a) in btnl2 may affect t - cell regulation and activation . The genome - wide association study conducted by hofmann and colleagues revealed an association for the annexin a11 gene located on chromosome 10q22.3 . The annexin a11 gene regulates calcium signalling, vesicle trafficking, cell division, and apoptosis . Hla class ii are cell surface proteins that prime the adaptive immune system to antigens . Hla - drb101 and hla - drb104, are negatively associated with sarcoidosis, whereas hla - drb103, hla - drb111, hla - drb112, hla - drb114 and hla - drb115 have been shown to increase the risk of sarcoidosis . Hla - drb103 is associated with lfgren's syndrome (~80% of patients with lfgren's syndrome experience disease remission). Finally, the hla - drb11501/dqb10602 haplotype was associated with severe and chronic pulmonary sarcoidosis [6, 47]. Variants of the tnf gene confer a 1.5-fold increased risk of having sarcoidosis . Apart from tnf, studies investigating other candidate genes (polymorphisms in the complement receptor 1 gene, nod, and ccr2 genes) were inconclusive and had poor reproducibility between populations [4952]. In some populations, variations in the gene that encodes for rage (a transmembrane receptor) however, the close proximity of this gene to the mhc region makes it difficult for one to ascertain if this association is due to linkage with neighbouring hla genes . There were no associations between polymorphisms in genes for vitamin d receptor or serum angiotensin - converting enzyme [45, 54]. The t - cells at sites of inflammation in sarcoidosis exhibit a restricted repertoire of tcr or genes . The expression of specific v, v, or + tcr genes in blood, lung, and at sites of kveim - siltzbach skin reactions implies that sarcoidosis is an antigen - driven disorder . There is a subpopulation of t cells (av2s3 (v2.3) cd4 t cells) from balf of hla - dr0301 sarcoidosis patients which is unique to sarcoidosis . Moreover, it has been shown that the amount of av2s3 balf t cells at the onset of sarcoidosis correlates positively with prognosis, suggesting that av2s3 t cells may offer some protective function against sarcoidosis . Numerous pathogens have been implicated and investigated in the etiology of sarcoidosis . Moreover, spatial crowding of unrelated sarcoidosis cases suggests that sarcoidosis can also be a result of exposure to environmental agents [1, 3]. Nonetheless the evidence supporting specific infectious and environmental factors varies significantly (table 1). Preliminary ex vivo studies that employed flow cytometry to investigate peripheral blood lymphocytes in sarcoidosis patients demonstrated a greater activation of nonstimulated cd4 and cd8 balf t cells compared to peripheral blood lymphocytes . For instance, some studies report that after lymphocyte stimulation, the proportion of cd4 t cells expressing il-4 and ifn obtained from the peripheral blood of sarcoidosis patients did not differ significantly from that of healthy controls [57, 58]. Other studies showed higher th1 and th2 levels of cytokine positive cd4 t cells compared to healthy controls [59, 60], emphasising the systemic nature of the disease . The difference in the percentages of il-4 and ifn secreting cd4 lymphocytes in balf and peripheral blood of sarcoidosis patients is insignificant [57, 58]. After balf cd4 lymphocytes were stimulated with ionomycin and phorbol 12-myristate acetate, there was an appreciable increase in secreted ifn but a decrease in il-4 expression in sarcoidosis patients compared to controls . Moreover, increased cytokine profiles have been verified by increased balf ifn/il-4 cd4 t cell ratios in sarcoidosis patients . It has also been shown that upon stimulation, compared with controls, there are increased numbers of cd4ifn cells in both balf and induced sputum of patients with sarcoidosis [88, 89]. After stimulation, more t cells express th1 than th2 cytokines in both the balf and peripheral blood of sarcoidosis patients and more cd4 t cells in balf express th1 receptors (cxcr3, ccr5, il-12r and il-18r) than cd4 t cells in the peripheral blood . . Although cd4 t cells largely express th1 cytokines, interestingly, following stimulation, only 80% and 40% of cd4 il-4 cells concurrently produce ifn and il-2 respectively, thus demonstrating that activated balf lymphocytes of sarcoidosis patients are capable of a complex, concurrent production of th1 and th2 cytokines . To further explore this dichotomy of blood th1/th2 equilibrium, nureki and colleagues showed that under unstimulated conditions, th1 and th2 chemokines (interferon - inducible protein-10 (ip-10) and thymus and activation - regulated chemokine (tarc)) were both increased in the serum of sarcoidosis patients . This was in agreement with previous findings that demonstrated elevated balf and peripheral blood il-13 (a th2 cytokine) mrna levels . Nonetheless, it has been suggested that th2 cell preponderance occurs in the peripheral blood of sarcoidosis patients and that this, together with the generalised intensification of th1 activity, gives the appearance of an increase in both th1 and th2 circulating cytokine expression in sarcoidosis patients compared to healthy controls . Flow cytometry data indicate that after stimulation, there is an increase in th17 related cytokine levels in both balf and peripheral blood . Another study also indicated that, after stimulation, there are lower levels of il-17a gene expression in cd4 t cells in patients with lfgren's syndrome compared to healthy controls . These data, together with data showing heightened th1 cytokine expression at disease sites, indicate that th17 cells have a systemic role in patients with non - lfgren's disease and is involved in sarcoidosis progression . Therefore, further studies investigating the cytokine profiles in blood lymphocytes of patients versus healthy controls are required to assess the th1/th2 balance, the regulatory mechanisms in the peripheral blood of sarcoidosis patients, and the functional significance of th17 cells . This makes diagnosing sarcoidosis a vexing clinical challenge, motivating researchers to look for other novel methods of diagnosing the disease . Exhaled breath condensate (ebc) has been subjected to intensive research as it provides a noninvasive alternative for sampling the airway and alveolar space a promising source of biomarkers for a variety of lung conditions [9597]. During exhalation, water evaporation droplets and volatile molecules (e.g., nitric oxide, carbon monoxide and hydrocarbons) diffuse as gases from the alveoli and bronchi to the mouth . They are joined by nonvolatile molecules (e.g., leukotrienes, prostanoids, urea, and cytokines) from the airway lining fluid and condense via a refrigeration device to give ebc (figure 2) [95, 98]. A number of immunological biomarkers have been recognised in ebc . However, there exists no sufficiently sensitive and specific marker for diagnosing and predicting the prognosis of sarcoidosis . Tnf, pai-1, and igf-1 levels in ebc were closely positively correlated with balf samples from sarcoidosis patients . The propensity of il-6 to form complex molecular forms of higher molecular weight could account for this discrepancy . Another study detected tgf-1, pai-1, tnf, il-8 and vascular endothelial growth factor in sarcoid ebc . However, the small sample size and the failure to make comparisons with healthy controls limited the usefulness of this study . Exhaled eicosanoids (e.g., 8-isoprostane (8-ip)) and cysteinyl leukotrienes were also found to be elevated in the balf and ebc of sarcoidosis patients . In a later study, high initial levels of 8-ip were shown to correlate with disease persistence; therefore, it could serve as a prognostic marker . Cellular and molecular biomarkers previously discovered in balf and serum of sarcoidosis patients could also serve as biomarkers . These include eosinophils, neutrophils, serum angiotensin converting enzyme (ace), neopterin, chitotriosidase, tgf-, and the chemokine ligand (ccl18) [28, 40, 57, 104107]. Other more novel markers include lysozyme, kerbs von lungren 6 antigen, and soluble il-2 receptor [108, 109]. Serum levels of these biomarkers were said to reflect increased parenchymal infiltration and lymphocytic alveolitis in sarcoidosis and can thus serve as potential ebc biomarkers . Nonetheless, only a few have been shown to be sufficiently sensitive and specific . Amongst the above - mentioned biomarkers, ace is the most contentious as it has been shown to have poor sensitivity and specificity and its activity is subject to the effects of gene polymorphisms . Nevertheless, it is elevated and measurable in the balf of sarcoidosis patients and could therefore serve as a sarcoid biomarker . Given the multifactorial nature of sarcoidosis, no ideal markers for detecting and monitoring the clinical course of sarcoidosis exist . Although ebc has advantages over bal (it is noninvasive, requires little instrumentation, does not introduce foreign substances into the lung or cause inflammatory changes, and can be repeatedly performed in sick patients), the lack of reliable markers and the inability of ebc to sample specific compartments of the lungs undermine these benefits . Microrna-29 (mir-29) and t - bet have been shown to modulate its production [114, 115]. This reduction skews the immunological response towards a th1 lineage by initiating a positive feedback loop which enhances ifn production . This also suggests that the up - regulation of mir-29a and mir-29b can mitigate ifn expression [115, 116]. Abnormal levels of microrna have been associated with the pathogenesis of cancers and fibrotic and obstructive lung diseases [117119]. It has also been implicated in the fibrotic progression of sarcoidosis . As previously mentioned (see immune reactions in sarcoidosis), it binds to a number of enhancers and to the promoter region of the ifn gene to promote ifn transcription . T - bet expression has been shown to correlate with ifn expression [16, 122, 123] in patients with multiple sclerosis, coeliac disease, crohn's disease, and behet's disease [126, 127]. Moreover, t - bet mrna has been shown to be elevated in the balf lymphocytes of patients with pulmonary sarcoidosis . However, due to posttranscriptional regulation and disparities in protein and mrna turnover rates, mrna levels are poor proxies for protein levels [129, 130]. Unfortunately, the literature is currently deficient of studies that measure t - bet protein levels in sarcoidosis patients and studies that juxtapose mir-29 and t - bet protein levels at sarcoidosis disease sites and in the peripheral blood . Research on these fronts can offer novel insights into the immune paradox associated with sarcoidosis and can pave the path for novel therapeutic strategies for the disease . Despite nearly 140 years of extensive research, the aetiology and pathogenesis of sarcoidosis and the mechanisms that regulate the immune reactions in the peripheral blood remain undetermined . Moreover, given its variable clinical manifestation and the lack of a reliable diagnostic test with uniformed reference values and measurements, diagnosing sarcoidosis remains a clinical conundrum for many physicians . Given that the majority of sarcoidosis patients have pulmonary involvement, ebc could be used as a non - invasive method to diagnose sarcoidosis . Besides being a potential immunological biomarker of sarcoidosis, interferon modulator levels in ebc and the peripheral blood can be compared to elucidate the regulatory mechanisms in the peripheral blood . Results from such studies may also explain the pathology underpinning the peripheral anergy seen in sarcoidosis.
|
The ingrown toenail is a common problem which occurs mostly in the first toe and causes a high amount of morbidity in affected patients . In this report we document a strange case of ingrown toenail of the first toe, which had developed as a huge mass and enveloped the nail . We describe here the cauterization of the nail matrix with phenol after surgical resection of the tumor, a treatment that had good results . A 56-year - old man came to our office complaining of pain, offensive smelling discharge and disappearance of the nail of the right great toe . Physical examination showed epithelized mass on the nail plate and fistulation from the proximal nail fold to the tip of the toe, epithelization did not occur on the nail plate side of the mass (figure 1). The clinical diagnosis of this tumor was epithelized granulation tissue caused by ingrown toenail, however squamous cell carcinoma was not denied completely . Photograph shows epithelized granulation tissue on the nail plate and fistulation from the proximal nail fold to the tip of the toe the operative treatment involved anesthetizing the toe with a digital nerve block using 1% lignocaine . The tumor mass was excised at the bilateral terminal base point, and was sent to pathology for an immediate diagnosis . The pathological finding was granulation tissue with partial scar formation, and the external surface of the tumor was covered with epithelial cells . Next, the nail plate was incised longitudinally from top to the root at a width of approximately 5 mm . The posterior nail fold and the nail matrix were cauterized completely with an 88% phenol - immersed cotton - tipped applicator for five minutes . The excessive skin and soft tissue of the tip of the toe were excised and trimmed (figure 2). Bilateral chemical matricectomy of the matrix was done with phenol after resection of the tumor eighteen months after the operation, there is no recurrence of the ingrown toenail (figure 3). Ingrown toenail deformity is a common nail pathology that causes intractable pain and discomfort, hindering normal walking and markedly decreasing the quality of life of patients . Ingrown toenails could be a cause of granulation tissue of the lateral nail fold of the finger or toe (1). However, an ingrown toenail creating such a huge mass on the nail plate, as in this case, is very rare . In the literature, to our knowledge, there have been no reports of cases similar to our patient . In the case presented here, the patient had treated his ingrown toenail himself for one year with an ointment purchased over the counter before he came to our office . However the granulation tissue of both sides of the nail had increased gradually and advanced on the nail plate in the medial direction . Finally, the granulation tissue from both sides adhered and epithelial cells advanced over the granulation tissue completely . Conservative and surgical forms of therapy for ingrown nails have been used, however, there is no common or unique form of treatment (26). In recent years, matrix phenolization of the nail bed has been used increasingly, and has been reported to give less discomfort and lower recurrence rates (7,8). The procedure of phenolization is easy to perform and does not require specialized equipment (9). In our reported case, after resection of the epithelized granuloma, both sides of the posterior nail fold and the nail matrix were cauterized completely with phenol . After this simple treatment the only disadvantage of the treatment was the smallness of the toenail, however, the patient did not complain of this aesthetic disadvantage due to the advantages of freedom from pain and the bad odour.
|
Since kells first reported the usefulness of visualizing a lead wire in a root canal on a radiogram in establishing the length of a root canal in 1899 [1, 2], radiography has been a pivotal tool in the practice of endodontics . Almost a century later, building on the pioneering efforts of those using conventional computed tomography (ct) and micro - ct, the introduction of maxillofacial cbct in 1996 provided the first clinically practical technology demonstrating application of 3d imaging for endodontic considerations . Radiography is essential to successful diagnosis of odontogenic and nonodontogenic pathoses, treatment of the pulp chamber and canals of the root of a compromised tooth via intracoronal access, biomechanical instrumentation, final canal obturation, and assessment of healing . Imaging achieves visualization of dental and alveolar hard tissue morphology and pathologic alterations to assist correct diagnosis . It provides information on the morphology of the tooth including location and number of canals, pulp chamber size and degree of calcification, root structure, direction and curvature, fractures, iatrogenic defects, and the extent of dental caries . The effects of periradicular and periapical disease can be determined, including the degree of root resorption and characteristics of periapical osteolysis . Larger lesions, only determined by imaging, may necessitate adjunctive surgical procedures in addition to conventional intracanal therapy . Diagnostic radiographs help predict the potential for complications, permit root fracture detection, and demonstrate periapical lesions . Intraoperative . During therapy radiograph achieved by placement of a metallic file(s) into the root canal(s) to a length that approximates that of the root as radiological and anatomic root apexes are almost never coincident . This ensures that mechanical debridement of the intracanal contents extends to the apical terminus of the canal and that obturation is dense, homogeneous, and contained within the root canal system . In addition, prior to final obturation, a final or pre - condensation radiograph is made to assure proper fitting of the master cone . Radiograph immediately after root canal obturation is made to assess the sealing condensation and containment of the root canal filling material within the root canal system . In cases where periradicular healing is incomplete, it acts as a baseline for assessment of healing in the medium and imaging is important in evaluating the results of previous therapy, delayed healing, evaluating potential obstacles to retreatment, as well as surgical considerations . Intraoral radiography is based on the transmission, attenuation, and recording of x - rays on an analog film or digital receptor, and requires optimized geometric configuration of the x - ray generator, tooth, and sensor to provide an accurate projection of the tooth . The image produced is a two - dimensional (2d) representation of a three - dimensional (3d) object . If any component of the imaging chain process is compromised, the resulting image may demonstrate exposure or geometric errors and be suboptimal . 3d characteristics such as complex dental anatomy and surrounding structures can make interpretation of 2d shadows difficult and can contribute to nonhealing of endodontic cases . Success in endodontics is assessed in healing of the periapical bone adjacent to obturated canals . . Showed that in evaluating healing of periapical lesions using 2d periapical radiographs there was only 47% agreement between six examiners . Goldman et al . Also reported that when those same examiners evaluated the same films at two different times, they only had 19%80% agreement between the two evaluations . In fields of dentistry where 3d imaging is necessary, cbct is considered by some to be the standard of care [914]. Cbct is accomplished by using a rotating gantry to which an x - ray source and detector are fixed . A divergent pyramidal- or cone - shaped source of ionizing radiation is directed through the middle of the area of interest onto an area x - ray detector on the opposite side of the patient . The x - ray source and detector rotate around a fixed fulcrum within the region of interest (roi). During the exposure sequence hundreds of planar projection images are acquired of the field of view (fov) in an arc of at least 180. in this single rotation, cbct provides precise, essentially immediate and accurate 3d radiographic images . As cbct exposure incorporates the entire fov, only one rotational sequence of the gantry is necessary to acquire enough data for image reconstruction . Cbct is a complementary modality for specific applications rather than a replacement for 2d imaging modalities [913]. The food and drug administration (fda) approved the first cbct unit for dental use in the united states in march 8, 2001the newtom dvt 9000 (quantitative radiology srl, verona, italy). Fda approval for three more cbct units quickly followed in 2003 followed for the 3d accuitomo, (j. morita mfg . Corp ., kyoto, japan) in march 6, the i - cat (imaging sciences international, hatfield, pa) in october 2, and the cb mercuray (hitachi, medical corp ., kashiwa - shi, chiba - ken, japan) on october 20 . Since 2003, a number of other cbct units have been fda approved in the united states, including the kodak 9000 3d, (carestream / trophy, marne - la - valle, france), which is currently the highest resolution unit (table 1). Several additional units are in various stages of development, testing, or application for fda approval . Cbct systems can be categorized according to the orientation of the patient during image acquisition, the scan volume irradiated, or the clinical functionality . Patient positioningdepending on the system employed, maxillofacial cbct can be performed with the patient in three possible positions: (1) sitting, (2) standing, and (3) supine . Equipment that requires the patient to be supine has a larger physical footprint and may not be readily accessible for patients with physical disabilities . Standing units may not be able to be adjusted to a height to accommodate wheelchair bound patients . Seated units are the most comfortable; however fixed seats may not allow ready scanning of physically disabled or wheelchair bound patients . As scan times are often similar to or greater than those used with panoramic imaging, perhaps more important than patient orientation is the head restraint mechanism used . Depending on the system employed, maxillofacial cbct can be performed with the patient in three possible positions: (1) sitting, (2) standing, and (3) supine . Equipment that requires the patient to be supine has a larger physical footprint and may not be readily accessible for patients with physical disabilities . Standing units may not be able to be adjusted to a height to accommodate wheelchair bound patients . Seated units are the most comfortable; however fixed seats may not allow ready scanning of physically disabled or wheelchair bound patients . As scan times are often similar to or greater than those used with panoramic imaging, perhaps more important than patient orientation is the head restraint mechanism used . Scan volumethe dimensions of the fov, or scan volume, are primarily dependent on the detector size and shape, beam projection geometry, and the ability to collimate the beam . The shape of the fov can be either a cylinder or spherical (e.g., newtom 3 g). Collimation of the primary x - ray beam limits x - radiation exposure to the region of interest (roi). Field size limitation therefore ensures that an optimal fov can be selected for each patient based on disease presentation and the region designated to be imaged . Based on available or selected scan volume height, the use of units can be designed as follows: localized region (also referred to as focused, small field or, limited field)approximately 5 cm or less, single arch5 cm to 7 cm, inter - arch7 cm to 10 cm, maxillofacial10 cm to 15 cm, craniofacial greater than 15 cm . In general, the smaller the scan volume, the higher the spatial resolution of the image . As the earliest sign of periapical pathology is discontinuity in the lamina dura and widening of the periodontal ligament space, it is desirable that the optimal resolution of the any cbct imaging system used in endodontics does not exceed 200 m the average width of the periodontal ligament space . The 3d accuitomo (j. morita, corporation, kyoto, japan)the first of the small fov systems provided a resolution of 0.125 mm . At the time of publication, nominal voxel resolution varies from 0.4 mm to 0.076 mm . The dimensions of the fov, or scan volume, are primarily dependent on the detector size and shape, beam projection geometry, and the ability to collimate the beam . The shape of the fov can be either a cylinder or spherical (e.g., newtom 3 g). Collimation of the primary x - ray beam limits x - radiation exposure to the region of interest (roi). Field size limitation therefore ensures that an optimal fov can be selected for each patient based on disease presentation and the region designated to be imaged . Based on available or selected scan volume height, the use of units can be designed as follows: localized region (also referred to as focused, small field or, limited field)approximately 5 cm or less, single arch5 cm to 7 cm, inter - arch7 cm to 10 cm, maxillofacial10 cm to 15 cm, craniofacial greater than 15 cm . In general, the smaller the scan volume, the higher the spatial resolution of the image . As the earliest sign of periapical pathology is discontinuity in the lamina dura and widening of the periodontal ligament space, it is desirable that the optimal resolution of the any cbct imaging system used in endodontics does not exceed 200 m the average width of the periodontal ligament space . The 3d accuitomo (j. morita, corporation, kyoto, japan)the first of the small fov systems provided a resolution of 0.125 mm . At the time of publication, localized region (also referred to as focused, small field or, limited field)approximately 5 cm or less, single arch5 cm to 7 cm, inter - arch7 cm to 10 cm, maxillofacial10 cm to 15 cm, craniofacial multimodalityhybrid multimodal systems combine digital panoramic radiography with a relatively small - to medium - fov cbct system . This combination is now priced at a level similar to upper - level digital panoramic radiographic systems of the relatively recent past . Cost savings come from the fact that the cost of cbct detectors is highly dependent on size . The promax 3d cbvt (planmeca oy, helsinki, finland) was the first to incorporate a small fov 3d sensor to their promax digital panoramic line, which can be also be retrofitted to any of the prior promax digital models . Examples of other hybrid units are the veraviewepocs 3d (j. morita, corporation, kyoto, japan), the picasso trio (vatech / e . Woo corporation, korea), and the kodak dental imaging 9000 ds (kodak dental imaging / practiceworks atlanta, hybrid multimodal systems combine digital panoramic radiography with a relatively small - to medium - fov cbct system . This combination is now priced at a level similar to upper - level digital panoramic radiographic systems of the relatively recent past . Cost savings come from the fact that the cost of cbct detectors is highly dependent on size . The promax 3d cbvt (planmeca oy, helsinki, finland) was the first to incorporate a small fov 3d sensor to their promax digital panoramic line, which can be also be retrofitted to any of the prior promax digital models . Examples of other hybrid units are the veraviewepocs 3d (j. morita, corporation, kyoto, japan), the picasso trio (vatech / e . Woo corporation, korea), and the kodak dental imaging 9000 ds (kodak dental imaging / practiceworks atlanta, ga, usa) (figure 1). There are advantages beyond reduced capital costs to small fov cbct units for endodontic applications . First, a small fov means that high - resolution images with a spatial resolution down to 0.076 mm isotropic voxel size can be achieved at very low exposure to ionizing radiation and without extensive reconstruction times that would be expected with larger fov systems due to the greater file sizes to be processed . Second, a restricted fov reduces the volume examined, and for which the practitioner is responsible to interpret . Small fov systems concentrate on the dental arches or individual temporomandibular joints, the structures in which the average dentist is most familiar . There is less detail of the cranial cavity, paranasal sinuses, ear, and neck structures less familiar to the average dentist . A small fov cbct system is undoubtedly too restrictive for maxillofacial surgeons who conduct craniofacial and orthognathic surgery or for complex implant / prosthetic situations where the jaws and both temporomandibular joints are best evaluated in toto rather than as individual components; however, third - party software is now available to stitch together adjacent small fov images . For a meaningful comparison of radiation risk, radiation exposures are converted to effective dose (e), measured in sieverts (sv). The sv is a large unit; so in maxillofacial imaging milli-[10; msv] or micro-[10; sv] sieverts are reported . The radiation dose to specific tissues is measured, adjusted for the amount of that tissue in the field of view, and weighted based on radiation sensitivity of the tissue . The weighted tissue / organ doses are then summed to assess effective dose (e). The tissues / organs used to calculate the effective dose are specified by the international commission on radiological protection (icrp). The organs used to calculate effective dose for imaging of the head include the bone marrow, thyroid, esophagus, skin, bone surface, salivary glands, brain, and remainder tissues . Published effective doses for digital panoramic radiographs range from 5.5 to 22.0 sv, while digital cephalometric radiographs have effective doses of 2.2 to 3.4 sv . This compares with an average annual effective dose from background radiation in the united states of about 3,000 sv (3.0 msv). There are a number of factors that will affect the radiation dose produced by a cbct system: the imaging parameters used (kvp, mas); pulsed beam versus continuous beam; amount, type, and shape of the beam filtration; the number of basis images dependent partly on use of 360 or lesser rotations; and limitations on the size of the field of view . Factors such as beam quality and filtration are unique to a specific machine, while other factors, such as fov, can sometimes be operator controlled . Typically, the smaller the field of view for a given system, the lower the radiation dose applied [19, 20]. Since the effective dose is computed from a weighted summation of doses to various organs, removing some organs from the path of the x - ray beam can reduce the effective dose . Since the radiation received by the thyroid gland contributes a large amount to the effective dose, limiting the beam to the maxilla instead of the whole head produces a lower effective dose . Tables 2 and 3 provide the most recent published radiation exposures for selected cbct units using icrp (2007) recommendations [1930] and compares them as multiples of digital panoramic examinations (using an average digital panoramic exposure of 14 sv obtained from the published range of effective dose) and equivalent days of per capita background dose (based on an annual full body background exposure of 3 msv). At the time of publication, the cbct unit with the highest resolution and the smallest field of view (the kodak 9000 3d) involves patient radiation exposure varying from as little as 0.4 to 2.7 digital panoramic equivalents depending on the part of the mouth studied . Perhaps the most important advantage of cbct in endodontics is that it demonstrates anatomic features in 3d that intraoral, panoramic, and cephalometric images cannot . Cbct units reconstruct the projection data to provide interrelational images in three orthogonal planes (axial, sagittal, and coronal). In addition because reconstruction of cbct data is performed natively using a personal computer, data can be reoriented in their true spatial relationships . Due to the isotropic nature of the constructed volume elements (voxels) constituting the volumetric dataset such mpr modes include oblique, curved planar reformation (providing simulated distortion free panoramic images) and serial transplanar reformation (providing cross - sections), which can be used to highlight specific anatomic regions for diverse diagnostic tasks (figure 2). Enhancements including zoom magnification, window / level adjustments, and text or arrow annotation can be applied . Cursor - driven measurement algorithms provide the clinician with an interactive capability for real - time dimensional assessment . On because acquisition occurs innately as high - resolution three - dimensional volumetric data and can be displayed as interactive images, cbct technology provides the clinician with an unparalleled visualization of the often complex relationships and boundaries between teeth and their associated pathology and anatomic features within the alveolus and jaws such as the maxillary sinus and mandibular canal and foramen . Despite the provision of the third dimension, the spatial resolution of cbct images (0.4 mm to 0.076 mm or equivalent to 1.25 to 6.5 line pairs per mm[lp.mm]) is inferior to conventional film - based (approx . 20 lp.mm) or digital (ranging from 820 lp.mm) intraoral radiography . However, the ability of this technology to demonstrate geometrically accurate images in all three dimensions and the elimination of anatomic noise facilitates the assessment of a number of features important in endodontic diagnosis, treatment, and long - term management . The optimal resolution for cbct images in endodontics is invariably task specific however; most aspects of endodontics involve imaging of small structures . Have recommended a minimal voxel resolution of 0.3 mm for the detection of external root resorption . Ex vivo research performed at our institution has determined the effect of isotropic voxel dimensions on observer detection of the presence or absence of secondary canals in the mesiobuccal root of the maxillary first permanent molar . Observer interrater reliability and detection of mesiobuccal canals increased substantially with increasing resolution with more than 93% accuracy with a voxel resolution of 0.12 mm but accuracy barely over 60% with 0.4 mm resolution . The diagnosis of other subtle conditions (e.g., initial stages of apical periodontitis) involving the periodontal ligament space, which has an average dimension of 0.2 mm, also demands high resolution . The cbct projection geometry results in the whole volume within the fov being irradiated with every basis image projection . Scattered radiation is produced omnidirectionally and is recorded by pixels on the cone beam ct detector but does not reflect actual attenuation of the object within a specific path of the x - ray beam . This can be eliminated somewhat by algorithms such as wavelet transformation of filtered back - projection data; however, because of the use of an area detector, some of this nonlinear attenuation is recorded and contributes to image degradation when not adequately attended to by noise reduction algorithms . Remaining noise contributes to the graininess of the image which can be more pronounced in images in systems using a large fov, especially where low signal due to restricted radiation exposure is the case . Maxillofacial cbct images presently lack the ability to record subtle changes in attenuation across a wide range of tissue radiodensities . In endodontics, contrast resolution might well be of importance in distinguishing the nature of periapical or sinus soft tissue contents . Three factors, inherent in the cbct acquisition process, presently limit contrast resolution: (1) scattered radiation contributing to the potential for increased noise, (2) cbct systems pronounced heel effect due to the divergence of the x - ray beam over the area detector producing nonuniformity of the incident x - ray beam, and (3) detector imperfections affecting linearity in response to x - radiation . These factors, and a desire to restrict dose, contribute to restricting the application of current maxillofacial cbct imaging to the assessment of osseous structures . Work continues to develop systems capable of a wide contrast range supporting both hard tissue and soft tissue applications while still limiting dose . Cbct images, like those from other diagnostic modalities, are susceptible to artifacts that affect image fidelity . Artifacts can be attributed to four sources: (1) the patient; (2) the scanner; (3) artifacts specific to the cbct system used including partial volume averaging, undersampling, and the cone beam effect; and (4) x - ray beam artifacts arising from the inherent polychromatic nature of the projection x - ray beam that results in what is known as beam hardening (i.e., mean energy increases because lower energy photons are absorbed in preference to higher - energy photons). Beam hardening results in two types of artifact: (1) distortion of metallic structures due to differential absorption, known as a cupping artifact; and (2) streaks and dark bands that can appear between two dense objects . The presence of dental restorations, including apically positioned retrograde restorations, in the fov can lead to severe streaking artifacts . As the cbct x - ray beam is heterochromatic and has lower mean kvp energy compared to conventional ct, such artifact can be pronounced in cbct images . In clinical endodontic practice, cbct scanners with a limited field of view might provide clearer images as they can avoid scanning structures outside the region of interest susceptible to beam hardening (e.g., metallic restorations, dental implants). A pubmed search performed in may 2009 (search terms: cone beam, cbct, endodontics, root canal, periapical) resulted in less than 30 comparative retrospective or ex vivo studies published quantifying specific clinical efficacies of cbct imaging in endodontics . Similarly a recent review performed by the sedentexct project indicated that while several nonsystematic reviews in the literature provide a favorable perspective of the role of cbct imaging in endodontics, only a few studies have been published that satisfy the criteria for formal systematic review . While there are presently no definitive patient selection criteria for the use of cbct in endodontics, the use of cbct in endodontic diagnosis should not be avoided or ignored . One of the authors (martin d. levin) is a board certified endodontist with a full time private practice with limited field cbct . Cbct has been used to assist diagnosis and facilitate treatment in more than half of all patients referred to his practice for assessment and treatment of complex endodontic conditions (figures 3 and 4). Depending on the equipment used, cbct exposure may subject a patient to only slightly higher radiation doses than conventional 2d imaging or considerably more, so it is important that practitioners follow professional judgment in minimizing the radiation dose to the patient to that deemed essential for optimal diagnosis and treatment guidance . There should be justification of the exposure to the patient such that the total potential diagnostic benefits are greater than the uncertain detriment radiation exposure might cause . Published research, while admittedly sparse, indicates that cbct has several applications in selected endodontic cases (figures 5 and 6). The absence of high prospective randomized clinical trials underlines the need for further research on the treatment outcomes related to cbct applications in endodontic practice . At this time cbct the success of endodontic treatment depends on the identification of all root canals so that they can be accessed, cleaned, shaped, and obturated . The prevalence of a second mesiobuccal canal (mb2) in maxillary first molars has been reported to vary from 69% to 93% depending on the study method employed . This variability occurs in the buccolingual plane where superimposition of anatomic structures impedes detection of small structural density changes [37, 38]. Conventional radiographic techniques, at best, can only detect up to 55% of these configurations (figure 7). Ramamurthy et al . Found that raters evaluating different two - dimensional film modalities were rarely able to detect more than a 50% presence of mb2 canals . They found differences in detection rates with complementary metal oxide semiconductors (cmoss), analog film, and photostimulable phosphor plates (psp) detecting 55%, 44%, and 39% of mb2 canals, respectively . Compared the ability of three board - certified endodontists to detect the number of root canals on intraoral digital (both charged - couple device and photostimulable phosphor) plate images with cbct in 72 extracted teeth (3 equal groups of maxillary molars, mandibular premolars, and mandibular incisors). They found that on average the observers failed to detect at least one root canal in 40% of teeth using intraoral radiographs . Cbct evaluations identified an average of 3.58 root canals (rcs) per maxillary molar, 1.21 per mandibular premolar, and 1.5 per mandibular incisor . Evaluation of ccd images demonstrated an average number of 1.0 rcs per mandibular incisor, 1.0 per mandibular first premolar, and 3.1 per maxillary molar . Evaluation of psp images demonstrated an average number of 1.3 rcs per mandibular incisor, 1.1 per mandibular first premolar, and 3.0 per maxillary molar . Investigated the internal morphology of extracted maxillary first molars by comparing detection rates obtained using an operating microscope and cbct to ex vivo sections . They reported an ex vivo prevalence of a fourth canal in 67.14% of teeth and additional root canals in 92.85% of mesiobuccal roots . Clinical assessment provided slightly lower overall (53.26%) but higher (95.63%) mb2 detection rates whereas cbct results showed the lowest overall (37.05%) detection rate . They indicated that cbct provided a good method for the initial evaluation of maxillary first molar internal morphology but that the use of operating microscopes was optimal . Unpublished ex vivo research performed at our institution investigated the effect of increasing voxel resolution on the detection rate of multiple observers of the mb2 on 24 maxillary first molars by cbct . Compared to the overall prevalence of mb2 (92% prevalence), cbct detection rates increased from 60% to 93.3% with increasing resolution suggesting that if cbct is to be used, then resolutions in the order of 0.12 mm or less are optimal . Cbct imaging has also been reported to characterize the high prevalence of the distolingual canal in taiwanese individuals, highlight anomalies in the root canal system of mandibular premolars, and assist in the determination of root curvature . The most common pathologic conditions that involve teeth are the inflammatory lesions of the pulp and periapical areas (figures 8, 9, 10, and 11). Compared the accuracy of 3 observers using high - resolution limited fov cbct to intraoral radiographic paralleling technique using two images, one with a horizontal tube shift difference of about 10 for the diagnosis of periapical pathology on 46 teeth . While cbct and intraoral radiographs identified 53 roots with lesions, cbct identified an additional 33 roots with lesions (62%). Observers agreed that additional clinically relevant material was provided by cbct imaging in 32 of the 46 (69.5%) teeth imaged . Stavropoulos and wenzel compared cbct (newtom 3 g) to digital- and film - based intraoral periapical radiography for the detection of periapical bone defects on 10 frozen pig mandibles by four calibrated examiners . They reported that cbct provides greater diagnostic accuracy (61%) compared with digital (39%) and (44%) conventional radiographs . Performed a similar study comparing the detection of chemically induced periapical lesions by three observers using digital- and film - based conventional radiography to two cbct systems (iluma, imtec imaging, ardmore, ok and icat, imaging sciences international, hatfield, pa). They found that cbct systems provided similar intra- and interobserver agreement substantially higher than either conventional radiography . They indicated that while detection rates for cbct were higher, they did not advocate the replacement of intraoral radiography for detecting periapical lesions in routine clinical practice due to financial and dose considerations . Estrela et al . Compared the accuracy of cbct, panoramic and periapical radiographs from a consecutive sample of 888 imaging exams of patients with endodontic infection (1,508 teeth) in the detection of apical periodontitis (ap). While a gold standard was not available, they found the detected prevalence of ap to be significantly higher with cbct (figure 12). Estrela and colleagues proposed a periapical index based on cone beam - computed tomography (cbctpai) for identification of ap . The cbct pai is a 6-point (05) scoring system calculated from determining the largest lesional measurement in either the buccopalatal, mesio - distal, or diagonal dimension and taking into account expansion and destruction of cortical bone . Using their criteria, 3 observers applied it to 1,014 images (periapical radiographs and high resolution cbct images) originally taken from 596 patients . Similar results are reported by low et al . Who compared the preoperative consensus assessment of the apical condition of 37 premolars and 37 molars in the maxilla (156 total roots) using periapical radiography and cbct referred for possible apical surgery and found the later method to demonstrate significantly more lesions (34%) than conventional radiography . Cbct showed significantly more findings including expansion of lesions into the maxillary sinus, sinus membrane thickening, and missed canals . Using an ex vivo model consisting of 2 mm diameter defects placed in the cancellous bone at the apices of 10 first molar teeth on six partially dentate intact human dry mandibles, patel et al . Reported a detection rate of 24.8% and 100% for intraoral radiography and cbct imaging respectively . The generally higher detection rates afforded by cbct are similar to those reported for conventional ct . This may be of clinical importance in patients who present with pain or who have poorly localized symptoms associated with an untreated or previously root treated tooth with no evidence of pathology identified by conventional imaging [5456]. While root fractures are less common than fractures of the crown and occur in only 7% or fewer of dental injuries [57, 58], they are difficult to diagnose accurately using conventional radiography . Numerous authors have illustrated the usefulness and importance of cbct in the diagnosis and management in specific aspects of dento - alveolar trauma, especially root fractures (figure 13) [5962], luxation and/or displacement, and alveolar fracture . Compared the accuracy of 4 observers in detecting ex vivo vertical root fractures (vrfs) on cbct and periapical images and assessed the influence of root canal filling on fracture visibility . They found an overall higher accuracy for cbct (0.86) scans than periapical radiographs (0.66) for detecting vrf which was slightly reduced by the presence of opaque obturation material . Similar results were reported by kamburolu et al . Who compared the diagnostic accuracy of 3 oral and maxillofacial radiologists in detecting simulated horizontal root fractures on conventional radiographic (analog film, psp and ccd - based digital) images and cbct of 36 teeth . They found that the sensitivity of cbct (0.92) was significantly greater than analog film (0.74), psp (0.71), and ccd (0.68) images . Retrospectively compared conventional periapical radiographs and cbct images for 20 patients with suspected root fractures . They found that cbct was able to detect fractures in 18 (90%) of patients whereas conventional periapicals could only detect fractures 6 to 8 of the cases (30% to 40%) and indicated that cbct was an excellent supplement to conventional radiography in the diagnosis of root fractures . The use of serial cross - sectional ct in diagnosing the size and location of external root resorption (err) has been well described (figures 14 and 15) [6668]. Similarly, several authors have presented selected cases illustrating the utility of cbct in the detection of small lesions, localizing and differentiation the resorption from other conditions, classification of the lesion, in determining prognosis, and directing treatment (figures 14 and 15) [54, 6973]. The accuracy of cbct in the detection of surface defects, while higher than conventional imaging modalities, is not perfect and appears to increase with increasing voxel resolution of the volumetric dataset . Cbct has also been shown to have particular application in the assessment of the postorthodontic apical root resorption and, in particular, of the roots of lateral maxillary incisors by impacted maxillary canines [7577]. Internal root resorption (irr) within the root canal itself is rare, usually asymptomatic, slowly progressing, and presents as a serendipitous finding on intraoral radiographic examination . The inflammatory etiology of the resorptive process is not fully understood, although irr has been associated with a history of trauma, persistent chronic pulpitis, and as well as orthodontic treatment . It is very common that internal and external inflammatory root resorption are confused and misdiagnosed . Still, accurate assessment is essential as these conditions represent totally different pathological processes, with different etiological factors and treatment protocols . Diagnosis using conventional radiography is difficult; however, unlike external resorption, which presents with irregular radiolucency and intact root canal, internal resorption has clearly defined borders with no canal radiographically visible in the defect (figure 16). Cbct has been used successfully to confirm the presence of irr and differentiate it from err . Monitoring the healing of apical lesions is an important aspect of postoperative assessment in endodontics . Pinsky et al . Investigated the accuracy of cbct (icat with 0.2 mm voxel resolution) in the detection of the simulated osseous defects of varying diameters and depths in an acrylic block and on the buccal cortex of a human mandible . They found mean accuracy for the acrylic block to be within the tolerance of the nominal resolution of the cbct unit (0.01 mm 0.02 (se) mean width difference and 0.03 mm 0.01 (se) mean height difference). For the human mandible, they found differences to be slightly higher (mean width accuracy, 0.07 mm (0.02 se); mean height accuracy, 0.27 mm (0.02 se)). They found that automated volume accuracy error was significantly higher (6.9 mm (4 se)) than manually derived measurements (2.3 mm (2.6 se)). As adequacy of root canal obturation is an important determinant of endodontic success, it might be considered that cbct is used in the initial and subsequent monitoring of the integrity of root canal fillings . Compared the subjective quality of 3 radiologists and 3 endodontists using limited field cbct, storage phosphor plate (spp), and f - speed analog film images for the evaluation of length and homogeneity of root fillings on 17 extracted permanent mandibular incisor teeth . They found that spp and f - speed film images were perceived as superior to the corresponding cbct images and they reported that this may be due to the presence of streaking artifacts from the gutta percha and sealer compromising the quality of those images as regards root filling evaluations . The utility of cbct in determining the precise nature of a perforation and the role of this on subsequent treatment has been illustrated by young (figure 17). Endodontic surgery is often complicated in the posterior teeth by their proximity to anatomical structures . The mandibular teeth can be close to the mandibular canal while maxillary molars are often close to the maxillary sinus . Cbct imaging provides several advantages for preoperative treatment planning especially in maxillary posterior teeth with apical pathology . They imaged 43 maxillary first molars on 31 patients referred for retreatment and measured the mean distance of the palatine root from the external vestibular cortex (mean; 9.73 mm) and the frequency that the maxillary sinus lateral recess lays between the roots (25%) to evaluate the ability to surgically approach the palatal root of a maxillary molar from a vestibular access as opposed to the more difficult palatal access . They concluded that cbct may play an important role in optimizing palatine root apicoectomy via directing surgery through vestibular access . The importance of cbct for apical surgery of teeth adjacent to the maxillary sinus has subsequently been illustrated by nakata et al . Who presented a case report localizing the presence of a periradicular lesion to a specific root and tsurumachi and honda who described the use of cbct in localizing a fractured endodontic instrument protruding into the maxillary sinus prior to periapical surgery . Most recently low et al . Compared the preoperative findings obtained from periapical radiography and cbct of 2 observers in the diagnosis of posterior maxillary teeth (37 premolars and 37 molars a total of 156 roots) referred for possible apical surgery . They also reported that numerous additional clinically relevant findings were seen significantly more frequently in cbct images including expansion of lesions into the maxillary sinus, sinus membrane thickening, and missed canals . Conventional intraoral radiography provides clinicians with an accessible, cost effective, high - resolution imaging modality that continues to be of value in endodontic therapy . There are, however, specific situations, both pre- and postoperatively, where the understanding of spatial relationships afforded by cbct facilitates diagnosis and influences treatment . The usefulness of cbct imaging can no longer be disputed cbct is a useful task specific imaging modality and an important technology in comprehensive endodontic evaluation.
|
Adenoid cystic carcinoma (acc) represents the second most common malignancy of the salivary glands and is associated with a poor long term prognosis . One of the important prognostic factors is the histological grade determined by the percentage of solid component in the tumor [13]. High grade transformation in acc is a recently defined entity, which is characterized by areas of conventional adenoid cystic carcinoma associated with concomitant presence of undifferentiated or poorly differentiated carcinoma . However, this has not yet been included in the grading schemes for salivary acc . Only a few cases have been reported in the literature involving minor salivary glands and submandibular gland [410]. We report the first case of acc with high grade transformation arising in the parotid . A 54-year - old male presented at a tertiary care center of north india with complaints of a painful mass in the right infra - auricular region for 1.5 years . The patient had noted a recent increase in the size of the mass and associated facial paresis for the last 2 months . On examination, he had a hard mass in the right parotid with restricted mobility and facial nerve involvement . Fine needle aspiration cytology was performed, followed by surgical resection of the tumor, histological examination and immunohistochemical work - up . Formalin - fixed paraffin - embedded tissue was sectioned at 24 m and stained with hematoxylin and eosin . The conventional adenoid cystic areas were graded according to the three tier grading system of szanto et al . . Primary antibodies used (dako, denmark) included cytokeratin (ck) and epithelial membrane antigen (ema) as markers of epithelial cell differentiation and s-100 and smooth muscle actin (sma) as markers of myoepithelial cell differentiation . The markers to analyze the biological behavior of the tumor included cd117, a c - kit proto - oncogene product, e - cadherin, a cell adhesion protein, her-2/neu, a transmembrane tyrosine kinase receptor and p53 protein, a tumor suppressor gene product . P53 and ki-67 were assessed quantitatively in both the conventional acc and high - grade areas . The reaction was visualized using the sensitive enzyme conjugated polymer - based detection system (envision visualization system, dako, denmark). The smears were stained with may grunwald giemsa, hematoxylin and eosin and papanicolaou stains . Formalin - fixed paraffin - embedded tissue was sectioned at 24 m and stained with hematoxylin and eosin . The conventional adenoid cystic areas were graded according to the three tier grading system of szanto et al . . Primary antibodies used (dako, denmark) included cytokeratin (ck) and epithelial membrane antigen (ema) as markers of epithelial cell differentiation and s-100 and smooth muscle actin (sma) as markers of myoepithelial cell differentiation . The markers to analyze the biological behavior of the tumor included cd117, a c - kit proto - oncogene product, e - cadherin, a cell adhesion protein, her-2/neu, a transmembrane tyrosine kinase receptor and p53 protein, a tumor suppressor gene product . P53 and ki-67 were assessed quantitatively in both the conventional acc and high - grade areas . The reaction was visualized using the sensitive enzyme conjugated polymer - based detection system (envision visualization system, dako, denmark). The fine needle aspiration smears were cellular with dispersed and few non - cohesive clusters of atypical cells on a hemorrhagic background . The atypical cells had intermediate to large, round to pleomorphic hyperchromatic nuclei, coarse chromatin, conspicuous nucleoli and variable amount of poorly defined cytoplasm . Differential diagnoses of adenocarcinoma (not otherwise specified), undifferentiated carcinoma, salivary duct carcinoma, basaloid adenocarcinoma and carcinoma ex pleomorphic adenoma were entertained.fig . 1fna smears showing dispersed population of highly pleomorphic cells with a small cluster of isomorphic basaloid cells surrounding a hyaline globule (arrow) (mgg) fna smears showing dispersed population of highly pleomorphic cells with a small cluster of isomorphic basaloid cells surrounding a hyaline globule (arrow) (mgg) on surgical resection, the tumor was vascular, encasing the facial nerve and infiltrating the subcutaneous tissue and adjoining fat planes . On gross examination, the tumor measured 5 4 2 cm and replaced the entire parotid except for a thin wedge of grossly uninvolved tissue at one side . The cut surface of the tumor was variegated with solid, cystic, hemorrhagic and necrotic areas . On microscopic examination the tumor was primarily composed of sheets and nests of cells with intermediate to large - sized hyperchromatic nuclei, prominent nucleoli, scant eosinophilic cytoplasm and frequent mitosis (> 20/10 hpf) (fig . 2). A discrete focus of conventional adenoid cystic carcinoma (grade ii) occupying <10% area of the studied sections was identified . The tumor cells in this focus were arranged entirely in cribriform pattern showing small basaloid cells with interspersed pseudocystic spaces containing fuschinophilic acellular hyaline material and infrequent mitosis (~1/10 hpf; fig . The tumor was diffusely infiltrating the adjoining salivary gland, fibrofatty tissue and skeletal muscle . A single lymph node was identified in the attached fat, metastatic deposits in which showed presence of high grade areas along with few foci of conventional acc . A retrospective review of the fine needle aspirate smears revealed few small aggregates of isomorphic basaloid cells.fig . 3conventional acc component with isomorphic basaloid cells in cribriform pattern (upper left) and high - grade undifferentiated acc component (lower right) high grade acc component showing pleomorphic undifferentiated cells with frequent mitoses (arrows) conventional acc component with isomorphic basaloid cells in cribriform pattern (upper left) and high - grade undifferentiated acc component (lower right) on immunohistochemistry the tumor was diffusely positive for cytokeratin, epithelial membrane antigen and s-100 in both the components . Smooth muscle actin was confined to the abluminal cells in the differentiated component but was negative in the high - grade component . This was interpreted as presence of both epithelial and myoepithelial differentiation in the conventional acc areas, while there was loss of myoepithelial differentiation in the high grade areas . P53 expression was seen in 20% tumor cells of conventional acc and was of moderate intensity . However the high - grade component displayed strong nuclear p53 positivity in ~60% of tumor cells . Ki-67 staining showed a cell proliferation index of <10% in conventional acc and 50% in the high - grade areas (fig . E - cadherin and c - kit (cd117) were positive in both the conventional and high - grade areas . 4nuclear positivity for ki67 (arrows) in greater proportion of cells in high - grade component (lower right) as compared to conventional component (upper left) (dab) nuclear positivity for ki67 (arrows) in greater proportion of cells in high - grade component (lower right) as compared to conventional component (upper left) (dab) a diagnosis of adenoid cystic carcinoma with high grade transformation was made . Five months of follow - up since surgery showed no recurrence or evidence of distant metastasis.table 1comparison of histology and immunohistochemical features in differentiated and high - grade componentsdifferentiated componenthigh grade componentrelative percentage1090histologyconventional acc grade iiundifferentiated carcinomarelative nuclear size124mitosis/10 hpf1>20ck, ema, s-100++sma+ (abluminal cells)p53 intensitymoderate in 20% cellsstrong in 60% cellski67 index<10%50%her-2/neue cadherin++c kit++ comparison of histology and immunohistochemical features in differentiated and high - grade components adenoid cystic carcinoma (acc) is an uncommon form of malignant neoplasm that arises most commonly in the major and minor salivary glands of the head and neck . It is often slow to metastasize, but has a persistent and relentless growth with a poor long term prognosis . Major and minor salivary glands including seromucinous glands of upper respiratory tract are the frequent sites of occurrence ., the tumor is composed of small uniform cells arranged in cribriform, tubular or solid growth patterns with interspersed globules and cylinders of hyaline basement membrane material . Have defined a three tier grading system which takes into account the histomorphologic pattern and percentage of the solid component . First used the term dedifferentiated adenoid cystic carcinoma to describe areas with pleomorphic tumor foci in close proximity to areas of conventional adenoid cystic carcinoma . Have reported eleven new cases with similar morphology and are proponents of the term adenoid cystic carcinoma with high grade transformation. This encompasses tumors showing a high grade carcinoma with either a conventional low grade acc as described by cheuk, or a solid variant of conventional acc as described by sato et al . As the associated component [5, 10]. Pubmed search revealed a total of 24 cases of dedifferentiated acc and acc with high grade transformation . Of these, 17 occurred in minor salivary glands of tongue, palate and sinonasal tract including a tumor in the hypopharynx [5, 6, 810]. We report the first case from parotid . The parotid gland, though the commonest site of conventional acc has not been reported earlier as a site of high grade transformation of acc . The transformed component showed prominent anisonucleosis, conforming to the criteria established by seethala et al ., requiring more than twofold nuclear enlargements as compared to the areas of conventional acc . Micropapillae and squamoid areas have been reported, but were not seen in our case [4, 5]. The cytological features of acc with high - grade transformation have not been reported earlier in the literature . We considered the cytological differential diagnosis of adenocarcinoma (not otherwise specified), undifferentiated carcinoma, salivary duct carcinoma, basaloid adenocarcinoma and carcinoma ex pleomorphic adenoma based on presence of a population of poorly differentiated atypical cells with occasional hyaline globules . On review, the aspirate smears were found to have small groups of basaloid cells, presumably derived from the conventional acc component . It needs to be emphasized that a thorough analysis of fine needle aspirate smears in such cases may reveal groups of basaloid cells and hyaline globules amidst a highly pleomorphic population which would be pointers to a diagnosis of acc with high - grade transformation . Pre - operative aspiration diagnosis in such cases would be of value in deciding the extent of surgery and also promote thorough sectioning and sampling of tumor tissue received, since conventional acc areas may represent only a minor component . In our case, other studies have reported similar figures [4, 5, 7, 9]. Immunohistochemical analysis revealed loss of myoepithelial markers in the high - grade component as reported in earlier studies [4, 5, 9]. The transformed component showed a ki-67 labeling index of 50% and p53 over - expression in 60% of tumor cells which was significantly greater than that in the conventional acc component . Similar findings have been reported earlier and attest to the morphologic picture as well as clinical outcome of such cases [5, 710]. C - kit was positive in both conventional and high - grade areas and did not help in discriminating between the two components as described in previous reports [4, 5, 7, 9]. E - cadherin expression, which has not been reported earlier, was seen in both the components . Previous studies have reported variable results of her-2/neu in the high grade component [4, 9, 10]. Her-2/neu negativity has been surmised as a helpful feature in ruling out the close differential of a hybrid acc - salivary duct carcinoma . In conclusion, we present the first report of adenoid cystic carcinoma with high - grade transformation arising in the parotid gland . We emphasize that thorough study of aspirate smears may reveal clusters of basaloid cells and hyaline globules in a highly pleomorphic tumor cell population that may help to clinch a difficult differential diagnosis and guide extent of surgery and tissue sampling post - surgery . Higher p53 and ki67 expression in the high - grade component with associated loss of myoepithelial markers, suggest their possible role in pathogenesis.
|
Establishment of parasitic infections is dependent on a delicate and constant interaction between host and parasite, specifically, interactions between the host immune system and molecules released by the parasite or located at the parasite surface [1, 2]. Parasitic organisms have evolved the ability to survive in such hostile environments by evading or neutralizing host defense systems . This process is mediated in part by molecules released by parasites that consist of excretion and secretion (es) products which may contain metabolites, enzymes, hormone - like factors, antioxidants, and proteinase inhibitors among others [3, 4]. Eosinophilic meningitis, also known as cerebral angiostrongyliasis, is an acute inflammation caused mainly due the presence of angiostrongylus cantonensis young in the meninges, parenchyma of the medulla, pons, or cerebellum . Humans get infected after ingestion of third - stage larvae residing in raw mollusks, vegetables, or contaminated water . To date, more than two thousand angiostrongyliasis cases have been reported, with most cases occurring in southeast asia and the pacific islands where the disease is endemic . However, angiostrongyliasis cases have now been reported in regions of the world where this disease has not previously been reported, that is, brazil, caribe, ecuador, australia, and the usa . This change in the epidemiology of angiostrongyliasis should serve as a warning to authorities that this disease is an emerging public health problem [710]. The present paper discusses the potential role of excreted and secreted (es) proteins in relation to angiostrongylus infections in the context of developing novel diagnostic and treatment modalities . In addition, various molecules, including interleukin- (il-2), 4, 5, 10, 12, 13, 16, 18, tgf-/, leukotrienes, proteases, reactive oxygen species (ros), and nitric oxide (no) secreted by eosinophils can play important roles in mediating protective antihelminthic responses [11, 12]. However, producing these molecules can damage cell membranes and tissues, ultimately contributing to the pathogenesis and pathophysiology associated with hypereosinophilic syndromes . Cerebral angiostrongyliasis is characterized by eosinophil infiltrates that kill immature worms residing in the meninges . Sasaki and coworkers demonstrated enhanced intracranial survival of a. cantonensis when eosinophilic responses were inhibited following treatment with anti - il-5 antibodies . By contrast, mice overexpressing il-5 killed worms faster and female worms were smaller than those developing in wild - type mice . The same results were observed with another angiostrongylus species, for example, a. costaricensis that causes abdominal angiostrongyliasis, a disease also associated with eosinophilia . Il-5 is an important cytokine associated with the progression of eosinophilia following an a. cantonensis infection . Specifically, il-5 levels were significantly elevated in the csf and peripheral blood of patients with eosinophilic meningoencephalitis due to infections with a. cantonensis [18, 19], corroborating previous data generated in mouse models of disease [16, 20]. Several studies have focused on developing therapeutic strategies designed to prevent eosinophil infiltrates by eliciting a switch from a th-2 to a th-1 type of response . Du et al . Observed decreased il-5 levels and elevated inf- levels in mice when an antihelminthic drug was administrated in combination with il-12 in an experimental a. cantonensis infection model . Another study using antihelminthic drugs in combination with steroids (to avoid severe inflammation due to larval death in the meninges) determined that in patients receiving both drugs, the il-5 levels and peripheral eosinophil counts were reduced . Recently, chuang et al . Demonstrated that administration of an anti - ccr3 monoclonal antibody that blocked the major receptor present on eosinophils (ccr3) reduced eosinophil infiltrates and consequently reduced the severity of neurological damage in mice . These data suggested that controlling the level of eosinophil infiltrates and the polarization of th-2 responses may reduce neurological damage resulting from a. cantonensis infections . A better understanding of the host - parasite interplay would facilitate the development of different approaches for disease treatment and reduction of disease - associated sequelae . Direct leucocyte chemoattractants for eosinophil cells have been found during in vitro studies of many parasites released molecules, including angiostrongylus cantonensis; however, the identity of those molecules is poorly known . Es released by parasites are likely key to parasite survival since es are continuously released and may promote tissue penetration, nutrient acquisition, and also immune system and oxidative stress evasion . Studies of es products from third - stage a. cantonensis larvae have demonstrated serine protease and metalloprotease activity likely associated with duodenal penetration . We previously demonstrated the presence of high levels of antioxidant enzymatic activities in es fractions of adult a. cantonensis worms, including superoxide dismutase (sod) and catalase (cat), which may be involved in parasite survival against oxidative stress generated by host immune responses . Another recent study investigating immunoreactive proteins from adult es preparations identified peroxiredoxin, serine proteases, heat - shock proteins, ferritin, galectin, aldolase, and proteases inhibitors . The potential role of these proteins on inflammatory processes and disease exacerbation is discussed in the following . Peroxiredoxin (prx) is an enzyme reported to exist in many parasites and known to play a central role in h2o2 detoxification . However, another function has been attributed to prx; for example, fasciola hepatica es products containing prx have been shown to downregulate th-1 type responses and to affect macrophage activation following injection into mice . In another study, neutralization of secreted prx during the course of an f. hepatica infection significantly reduced the th-2 responses, indicating that prx is a target for disease treatment . Indeed, knocking down the s. mansoni prx genes using rna - i dramatically increased oxidative damage to parasite proteins and lipids, which in turn reduced worm survival . Prx was found in es products of adult a. cantonensis worms that were recognized by immunoglobulins present in the serum of infected patients . Interestingly, as mentioned above, local th-2 responses were implicated in the development of csf and peripheral eosinophilia associated with a. cantonensis infections, and elimination of the worm combined with il-12 administration shifted the response from a th-2 to a th-1 type response . These observations raised the following hypothesis: blocking a. cantonensis prx activity would make the parasite vulnerable and weaken the th-2 response, making this molecule a viable treatment target . Heat shock proteins are a highly conserved group of proteins present in both prokaryotic and eukaryotic organisms . They are grouped into different families based on their molecular weights . Hsps function as chaperones, assisting in the proper folding of newly synthesized proteins even though hsps were first associated with stress - induced stimuli . Hsp70 is involved during adaptive response associated with the early stages of infection with the nematode trichinella spiralis; and hsps have also been associated with drug resistance in various leishmania spp . Protozoans . In addition, knocking down hsp90 in adult caenorhabditis elegans worms using rna - i resulted in cessation of egg production and in an embryonic lethal phenotype [34, 35]. Interestingly, inhibiting oviposition is of special interest as a new treatment alternative for abdominal angiostrongyliasis because eggs play a central role in pathogenesis, thereby making angiostrongylus hsps viable targets for disease treatment . Administration of recombinant hsp from the protozoan trypanosoma carassii activated goldfish macrophages in vitro and stimulated the production of the proinflammatory cytokines inf and tnf . Indeed, secreted hsp forms have been demonstrated to bind toll - like receptors 2 and 4 (tlr2 and tlr4) expressed on the surface of antigen - presenting cells (apcs) in a similar manner as lipopolysaccharide (lps), resulting in the production of proinflammatory cytokines . Moreover, hsps have been considered to play a role in the development and pathogenesis of some rheumatic diseases . Together, these data suggested that released a. cantonensis hsps may facilitate the inflammatory process, making further studies to better understand the role of this protein in disease pathology crucial . Galectins are a family of sugar - binding proteins with affinity for n - acetyl lactosamines, an interaction mediated via a conserved carbohydrate - recognition domain (crd). In mammals, galectin-1 has been demonstrated to inhibit th1 differentiation, leading to th2 responses . On the other hand, however, the function of helminth galectins still remains unclear even though brugia malayi and onchocerca volvulus galectins have been hypothesized to function as potential immune modulators [42, 43]. One of the most important classes of antigens expressed by several helminths is comprised of sugar molecules . Interestingly, helminthes activate innate immune cells via surface - expressed or -secreted products, including glycolipids and glycoproteins, through lectin receptors . This association may interfere with the induction of effective immune responses that could contribute to the modulation of inflammatory t - cell responses . In fact, the schistosoma egg glycan did not upregulate stimulatory molecules or produce cytokines when it was recognized and internalized by immature dendritic cells (idcs), indicating that conventional maturation of dendritic cells induced by toll - like receptors agonists was prevented . Moreover, galectins have also been identified as targets for disease diagnosis, for example, diagnosis of trichostrongylus colubriformis (gastrointestinal nematode) infections in sheep . In similar fashion, an es galectin from a. cantonensis was shown to be immunoreactive to antibodies present in serum from angiostrongyliasis patients, further supporting the potential use of this protein as a diagnostic antigen . Proteases are enzymes that catalyze the cleavage of amide linkages in macromolecular proteins and oligomeric peptides . Proteases are very important for parasite survival because they facilitate tissue penetration and nutrient acquisition . For example, hemoglobinases are proteases that degrade hemoglobin into peptides and amino acids, a fundamental process for nutrient acquisition for many parasites . Hemoglobinases from hookworms have been suggested as potential vaccine targets because of their immunogenicity and because their inactivation would interfere with hookworm feeding . Our previous work demonstrating that hemoglobinases present in es products from adult worms were recognized by sera from angiostrongyliasis - infected patients supports these observations . In addition, these enzymes may constitute therapeutic targets as observed by sijwali et al . Who demonstrated that disruption of falcipain-2 protein (an enzyme involved in plasmodium falciparum hemoglobin degradation) resulted in fitness injuries to early - stage trophozoites . It is reasonable therefore to hypothesize that blocking hemoglobinase activity would interfere with nutrient uptake resulting in death of the parasite . In fact, knocking down an s. mansoni hemoglobinase resulted in significant growth retardation in vitro . A parallel approach targeting enzymes responsible for sugar digestion (such as aldolase and beta - amylase) could also result in parasite elimination . Another protein identified in es samples was a cathepsin b - like protein, which is a cysteine protease . Cystein proteases from helminthes have been shown to be involved in degrading host proteins, including immunoglobulins, complement components, kininogen, hemoglobin, albumin, and extracellular matrix proteins . Interestingly, cysteine proteases from es preparations of paragonimus westermani, a tissue - invasive parasite that causes either pulmonary or extrapulmonary paragonimiasis in humans, were also implicated in human eosinophil degranulation in vitro . These findings may help in the understanding of the mechanisms of tissue inflammation associated with meningoencephalitis due to a. cantonensis infections since the cathepsin b - like protein was secreted by the parasite . Besides secreted proteases, parasitic organisms also have the ability to produce and release inhibitors for many types of proteases that may block host protease function, thereby facilitating parasite survival . Three kinds of protease inhibitors are commonly described in parasites: aspins, specific to aspartic proteases, cystatins, which block the activity of cysteine proteases, and serpins, which act on serine proteases . A cystatin from a. cantonensis (accystatin) was identified from a cdna library of fourth - stage larvae that was cloned and expressed in a prokaryotic system . The authors observed that recombinant accystatin significantly inhibited cathepsin b and significantly upregulated nitric oxide production by ifn-activated macrophages . Interestingly, cystatins identified from parasitic nematodes have been implicated in blocking cathepsin activity; however, they are also associated with stimulating the production of anti - inflammatory cytokines . These cystatin properties suggest that they can inhibit cellular proliferation while concomitantly establishing an anti - inflammatory environment favorable to parasite survival . As therapeutic targets, these inhibitors have been demonstrated to prevent allergic inflammation in both lung and intestines of mice treated with a filarial cystatin that modulated macrophage - mediated colitis, in addition to inhibiting eosinophil recruitment, downregulating il-4 production, and suppressing allergic airway hyper - reactivity . An aspartyl protease inhibitor secreted by a. cantonensis female adult worms was identified in an in vitro study; however, the role of aspins in helminthes is not clear . Nevertheless, the activity of porcine pepsin was not inhibited by a recombinant hookworm aspartic proteinase inhibitor . To date however, molecular analysis of the a. cantonensis genome revealed that only a small number of sequences have been deposited at genbank . As a consequence, protein identification by mass spectrometry is ineffective since the lack of peptide sequence homology to related proteins from other organisms makes identification difficult . The pathogenesis of eosinophilic meningitis is related to the development of significant inflammatory reactions in response to a. cantonensis worms residing in the nervous system . In response to the infection, eosinophils are recruited and several potent cytotoxic agents are released in an attempt to eliminate the pathogen . This immune - mediated attack frequently results in tissue damage and ultimately may exacerbate disease severity . In this paper, we discussed the putative diverse roles of released a. cantonensis molecules . Many kinds of molecules may act as immunomodulators, but these molecules may also be involved in disease exacerbation . Further studies using recombinant forms of the target proteins discussed above will be essential in evaluating and confirming the hypothesis presented here.
|
A fungal endophyte (coded g85) was isolated from the stems of a healthy milk thistle plant (silybum marianum). Using morphological characteristics and molecular studies (based on its1 - 5.8s - its2 and rpb2 sequence data; figures s2 and s3, supporting information), g85 was identified as penicillium restrictum (eurotiales, ascomycota). When grown on either potato dextrose agar (pda) or malt extract agar (mea) medium, this isolate produced striking red guttates on 10-day - old cultures that resembled droplets of blood (figures 1 and s1). Interestingly, when grown on 2% soy peptone, 2% dextrose, and 1% yeast extract (yesd), a few guttates were noted, but they lacked the deep red coloring seen on the other two media . Since yesd was the most nutrient rich of the three media, we hypothesized that the biosynthesis of compounds responsible for the red coloring was stimulated by nutrient stress . Regardless, the red guttates from g85 grown on pda were sampled using a micropipet and analyzed directly by high - resolution lc - ms, revealing the presence of several polyhydroxyanthraquinones . Due to the paucity of material obtained from the guttates (figure 1d), scale - up studies were conducted to provide reference materials for biological testing and to structurally elucidate the polyhydroxyanthraquinones . The chemical profiles of the guttates and the extract of the fungus grown in solid - state culture were nearly identical (figure s4). Chcl3 extract of the solid - state cultures of p. restrictum was purified using well - described natural product protocols (figure 1 and supporting information). This led to the isolation of a series of polyhydroxyanthraquinones, including the known compounds -hydroxyemodin (3), emodic acid (5), (+) -2s - isorhodoptilometrin (6), and emodin (9) and five new compounds (1, 2, 4, 7, and 8); their numbering refers to elution order via preparative hplc (figure 1f). Full isolation and characterization details are delineated in the supporting information (table s1 and figures s4s7), and although 6 was known, this represented the first characterization of its absolute configuration (via mosher s esters), resulting in a configuration opposite of literature reports . The compounds displayed uv / vis spectra (figure 1 g) characteristic of polyhydroxyanthraquinones, and the most notable difference in the structures was the nature of the side chain at the 6 position . A number of polyhydroxyanthraquinones, including compounds 3, 5, and 9, have been reported as major pigments of penicillium(40,51) and other fungal species, mushrooms, lichens, marine animals, and plants . (a) ten - day - old p. restrictum colonies grown on different nutrient media: top left panel pda, top right panel mea, and bottom panel yesd . (c) cotton blue stain of conidiophore and conidia of monoverticillate p. restrictum . (d) exudate (50 l) collected from the surface of the fungal colony via micropipet . (e) flowchart for the isolation of polyhydroxyanthraquinones from the solid - state culture extract (right) and guttates (left). (f) preparative hplc chromatogram (= 254 nm) of the meoh (g) uv profiles (190 to 500 nm) for compounds 13 and 6, as examples . The ability of mrsa to cause an infection requires a functional accessory gene regulator (agr) quorum - sensing system . This regulatory system is responsible for the production of toxins and exoenzymes that play a major role in the pathogenesis of acute infections . To explore potential antivirulence activity, the ability of the polyhydroxyanthraquinones (19) to suppress (or quench) the agr quorum - sensing system was evaluated . For these experiments reporter strain ah2759, which was derived from community - associated mrsa (ca - mrsa) strain lac of the usa300 pulse - field gel type, was utilized . This strain is clinically relevant due to the emergence of usa300 in community and hospital settings, their aggressive nature, and their ability to cause skin and soft tissue infections in otherwise healthy subjects . Strain ah2759 contains a plasmid with the agr p3 promoter driving transcription of a modified luxabcde operon from photorhabdus luminescens, thereby coupling quorum - sensing function with bioluminescence expression . Compounds 19 were tested as quorum sensing inhibitors against ah2579 at sub - growth - inhibitory concentrations; a representative dose response curve is shown in figure s8 . The polyhydroxyanthraquinones (19) suppressed quorum sensing with ic50 values in the 8120 m range (table 1). A preliminary structure the most potent activity was observed for compounds 3 and 6, which had side chains at the 6 position containing either a primary alcohol (3) or a secondary propanol (6) moiety . The least potent activity was observed for compound 1, which had a carboxylic acid side chain at the 6 position and was the only compound with a phenolic oh at the 2 position . The remaining compounds were essentially equipotent within the error of the experiment, with ic50 values ranging from 17 to 37 m; the side chain at the 6 position varied in all of them, and 8 was the only other compound with a substituent at the 2 position, a chlorine . As a parallel test of antivirulence activity and to corroborate the results in table 1, compounds were evaluated for suppression of the production of delta toxin, a hemolytic peptide encoded in the agr rnaiii transcript of s. aureus, by the same mrsa strain (ah2759); compounds 3, 4, and 1 were chosen as representative quorum sensing inhibitors with high, medium, and low activity, respectively . An immunoblot (figure 2) indicated dose - dependent suppression in toxin production by all three compounds, consistent with the ic50 values (table 1). The positive control, aip-2, a peptide known to target the agr system, also demonstrated dose - dependent suppression of delta toxin production . This peptide was more potent than the most active polyhydroxyanthraquinones (3 and 6). However, aip-2 is a labile thiolactone, which imparts several challenges with respect to drug development . Moreover, only a limited number of small molecules with activity as quorum sensing inhibitors in s. aureus have been reported, most of which are aip peptide analogues . Those few that are small molecules have ic50 values similar to 3 and 6 . Thus, these polyhydroxyanthraquinones may provide new leads for mrsa antivirulence drug development . Reporter strain ah2759 was grown in tsb with a dose response of control aip-2 (2500 nm; panel a) and compounds 1, 3, and 4 (0.3400 m; panel b). The above studies demonstrated biological activity of polyhydroxyanthraquinones isolated from fungal guttates and from whole fungal extracts . However, the analysis of such extracts inherently destroys biologically relevant data in regard to the location and timing of secondary metabolite production . From the extract data, it was not possible to confirm that 19 were concentrated in fungal guttates, to explore spatial relationships, or to assess temporal expression in situ . The distribution and relative concentrations of compounds 19 within guttates were explored by imprinting fungal plates, transferring chemical and spatial information onto a suitable surface for desi - ms imaging . Imprinting fungi prior to imaging was necessary, as both the fungal surface and guttates were easily disrupted by the pneumatic pressure of desi . Optical and desi - ms ion images of fungal imprints indicated successful transfer of chemical and spatial information (figures s10 and s11). A small compromise in spatial resolution during the imprinting process the detected polyhydroxyanthraquinones were most abundant within regions corresponding to the locations of guttate transfer . The spatial distribution of the polyhydroxyanthraquinones across the fungal surface was performed by sectioning a fungal colony perpendicular to the surface (figure s9), yielding sections comprising the depth of the culture medium (3 mm). The negative ion mass spectra were highly selective for 19, due to the phenolic moieties . Further, the ionization efficiencies of 19 were likely similar, and thus, relative ms abundance reflected concentration . A representative desi - ms spectrum, corresponding to fungal mycelium (figure 3a), shows compounds 29 in the m / z range 250400 . Desi imaging revealed a number of additional ions, presumably of fungal origin, as they were not observed to an appreciable extent in the mass spectrometric analysis of guttates and were absent in nonfungal regions of desi - ms ion images (figure s12). The spatial distribution of polyhydroxyanthraquinones (figure 3b) indicated localization of compounds 3, 4, 6, 7, and 9 at the fungal surface . Additional endogenous compounds (e.g., m / z 283.1, stearic acid; figure s12) also appeared localized at the surface . Co - localization of these compounds with fungal mycelia (figure s13) provided evidence of fungal origin . Furthermore, the polyhydroxyanthraquinones that were found to be concentrated on the fungal surface were the most active in the quorum sensing assays, with compounds 3 and 6 possessing ic50 values of <10 m (table 1). Compounds 2, 5, and 8 were distributed relatively uniformly throughout the section . The temporal distribution of polyhydroxyanthraquinones was observed to differ substantially between 8- and 24-day - old colonies . The optical and desi ion images, comprising the radius of the culture, are displayed in figure 4b with a 24-day - old colony on the right (i.e., center of plate) and an 8-day - old colony on the left (i.e., circumference of plate). An unknown ion detected at m / z 339.1, attributed to fungal growth in the culture, was distributed homogeneously between the day 8 and day 24 colonies, whereas compound 3 (m / z 285.1) was detected in greater relative abundance in the established colony, as indicated by the black coloration in the ion images (figure 4b). This finding was supported by normalized mass spectra obtained from day 8 and day 24 regions (figure 4a and c). The mass spectra indicated differences in the polyhydroxyanthraquinones being produced and their relative concentration . For example compound 3 was detected in both day 8 and day 24 colonies, and its concentration increased with colony age by 4-fold . Collectively, the desi - ms imaging suggested that the polyhydroxyanthraquinones were produced by fungal mycelia and were expressed differentially over time . Interestingly, the polyhydroxyanthraquinones that were more potent quorum sensing inhibitors were concentrated at the fungal surface, while less active compounds were diffused through the culture medium . These findings may have biological relevance, as production or concentration of bioactive secondary metabolites at the fungal surface could facilitate interactions with the surrounding environment . However, these data are only correlative, and it is also possible that the different distributions are a result of varying diffusivities of the compounds . Overall, the results demonstrate that fungal endophytes, and guttate - forming fungi in particular, are a potentially useful source of biologically active compounds . The small - molecule quorum sensing inhibitors identified from p. restrictum could serve as lead compounds for the development of new treatments for mrsa infections . Importantly, this study also illustrates the power of desi - ms as a means to obtain spatial and temporal information about the production of fungal secondary metabolites . (a) representative negative mode desi mass spectrum (m / z 250400). All polyhydroxyanthraquinones isolated by extraction were detected, except for compound 1, m / z 315 . Single asterisks (*) denote ions that display co - localization with p. restrictum . (b) ion images for detected compounds are displayed in false color, reflecting differences in relative mass spectral abundance . Ms was acquired once per pixel for a total analysis time of 0.61 s / pixel . An optical image of an adjacent section is also shown, and a colony along the upper - middle edge was confirmed by staining . Optical image size is 13 3 mm (w h). (a) normalized negative mode desi - ms of day 8 colony; polyhydroxyanthraquinones are noted by a single asterisk (*), and endogenous compounds are tentatively identified with double asterisks (* *). (b) optical image (optical image size is 35 4 mm (w h)) of p. restrictum with illustration of day 8 colony (left) and day 24 colony (right) location on the culture plate . Ion images corresponding to selected ions, m / z 339.1 and 285.1, are shown . Ms was acquired once per pixel for a total analysis time of 0.65 s / pixel . Uv, ir, and cd spectra were obtained on a varian cary 100 bio uv vis spectrophotometer (varian inc . ), a perkinelmer spectrum one with universal atr attachment (perkinelmer), and an olis dsm 17 cd spectrophotometer (olis, inc . ), respectively . Nmr experiments were conducted in methanol - d4 or dmso - d6 using a jeol eca-500 (operating at 500 mhz for h and 125 mhz for c; jeol ltd . ). Hrms data were measured using an electrospray ionization (esi) source coupled to an ltq orbitrap xl system (thermo) in both positive and negative ionization modes and by a liquid chromatographic / autosampler system that consisted of an acquity uplc system (waters corp . ). Hplc was carried out on varian prostar hplc systems equipped with prostar 210 pumps and a prostar 335 photodiode array detector, with data collected and analyzed using galaxie chromatography workstation software (version 1.9.3.2, varian inc . ). For preparative hplc, a gemini - nx (5 m; 250 21 mm; phenomenex) column was used . For semipreparative hplc, a gemini - nx (5 m, 250 10 mm; phenomenex) column was used . For analytical hplc, a gemini - nx (5 m, 250 4.6 mm; phenomenex) column was used . For uplc analysis, a beh c18 (1.7 m; 50 2.1 mm; waters corp .) A healthy asymptomatic plant of silybum marianum (milk thistle) was obtained from horizon herbs (lot #6510), a private seed company located in williams, or, usa, in august 2011 . The stem and leaves of the plant were cut into small pieces (approximately 25 mm in length) and washed in distilled h2o . Subsequently, the segments were surface - sterilized by sequential immersion in 95% etoh (10 s), sodium hypochlorite (1015% available chlorine; 2 min), and 70% etoh (2 min). The surface - sterilized segments were transferred under aseptic conditions onto 2% malt extract agar [mea; difco, 20 g of mea, 1 l of sterile distilled h2o amended with streptomycin sulfate (250 mg / l) and penicillin g (250 mg / l)]. To test the efficacy of the surface - sterilization procedure and to confirm that emergent fungi were endophytic and not of epiphytic origin, the individual surface - sterilized leaf and stem segments were spread and then removed on separate mea plates with antibiotics; the absence of fungal growth on the nutrient medium confirmed the effectiveness of the sterilization procedure . Plates were sealed with parafilm and incubated at room temperature in 12 h dark / light cycles until the emergence of fungal colonies was observed . One of the endophytes from milk thistle stems was assigned the accession number g85 . The cultures of g85 were subsequently grown on 2% mea, pda (difco), and yesd . The fungal culture is maintained at the university of north carolina at greensboro, department of chemistry and biochemistry fungal culture collection . The macromorphology and micromorphology of the fungus are described in detail in the supporting information . For the molecular identification of g85, the complete internal transcribed spacer regions 1 and 2 and 5.8s nrdna (its), along with the d1/d2 variable domains (partial region of large subunit of the 28s nuclear rdna, lsu), were sequenced using methods described previously and outlined in the supporting information; the its methodology has been proposed as a molecular barcode for fungi . We also sequenced the partial ribosomal polymerase ii subunit 2 region (rpb2; supporting information), as it has been used to demonstrate phylogenetic relationships among species currently recognized within penicillium . The combined its and lsu sequence (kf367458) and the partial rpb2 sequences (ab860248 and ab860249) were deposited in genbank . A herbarium voucher of the plant was generated from milk thistle seeds harvested from the same plot in oregon (lot #6462), and this was deposited in the herbarium of the university of north carolina at chapel hill (ncu602014). The red guttates observed on 10-day - old cultures on a petri dish with mea medium were collected with a micropipet (approximately 150 l of guttate). After collection, the same volume of meoh was added, and then the solution was filtered using 0.45 mm teflon filters and dried in vacuo; approximately 10 mg of dry material (red solid) was obtained . For the scale - up, the fungus was grown as a solid phase culture on rice using methods described previously (supporting information). For extraction, 60 ml of 1:1 meoh chcl3 was added, and the mixture was shaken for 16 h on a reciprocating shaker . The solution was filtered, and equal volumes of h2o and chcl3 were added to the filtrate to bring the total volume to 250 ml . The solution was stirred vigorously for 1 h and partitioned in a separatory funnel, and the bottom, organic layers were concentrated by rotary evaporation . The resulting sample was defatted by stirring for 1 h in a mixture of 50 ml of meoh, 50 ml of ch3cn, and 100 ml of hexane, and the biphasic solution was partitioned in a separatory funnel . The bottom layer was collected and evaporated to dryness, resulting in the meoh the instrumentation and methods utilized to isolate and structurally elucidate compounds 19 followed well - established protocols (supporting information). Culturing dishes containing p. restrictum raised on pda were selected at maturity (57 days). A distinct colony was excised using a razor blade, containing the full depth of the culture medium (3 mm), consisting of pda medium with filamentous fungal growth along the ventral surface . The frozen colony was then halved using a cryotome blade in a ventral - to - dorsal direction, yielding the transverse planar surface (figure s9). The halved colony was then embedded in optimal cutting temperature (oct) matrix, preserving the transverse plane orientation, in preparation for cryosectioning . The embedded colony was sectioned at a thickness of 15 m and, subsequently, thaw mounted onto glass microscope slides in preparation for mass spectrometric analysis . The embedded colony sections were retained at 80 c until the time of analysis . The sections were analyzed by desi using a laboratory - built prototype coupled to a linear ion trap mass spectrometer (ltq, thermo). Desi - ms imaging was carried out in the negative ion mode using the following parameters: 5 kv spray voltage, incident spray angle () 52, spray - to - ms inlet distance 8 mm, spray - to - surface distance 12 mm, 180 psi n2(g), and 0.7 l / min dmf sections were analyzed using a 2d moving stage in horizontal rows separated by a 200 m vertical step and subsequently converted into spatially accurate images . Post hoc processing of the hyperdimensional data provided the 2d ion images, retaining spatial relationships and displaying relative mass spectral abundances of particular ions . An in - house program was used for converting acquired xcalibur 2.0 mass spectral files (.raw) into a format compatible with biomap software (http://www.maldi-msi.org). A polytetrafluoroethylene (ptfe) surface was cleaned with meoh, allowed to dry, and dried further under an electronic desiccator for 10 min . The ptfe surface was then mounted onto the bottom of a 100 ml beaker using double - sided adhesive tape . A culturing dish (35 mm) was inverted, lowered, and touched to the ptfe surface; the touch consisted of contact with no additional applied pressure . The ptfe surface was removed from the glass beaker, adhered to a glass microscope slide using double - sided adhesive tape, and dried in the electronic desiccator for 15 min or until completely dry . Imprints were stored at 4 c until analysis; however, it was later determined that dry, imprinted samples yielded detectable mass spectral signal in ambient conditions for several weeks . Desi - ms imaging was carried out in the negative mode using the following major parameters: 5 kv spray voltage, incident spray angle () 52, spray - to - ms inlet distance 8 mm, spray - to - surface distance 12 mm, 180 psi n2(g), and 1.2 l / min meoh h2o (1:1) ph 10 by addition of nh4oh . A culture of p. restrictum was maintained at ambient conditions for 16 days, and fungal growth was apparent in the center of the culture plate . At day 16, the plate was opened, and a small amount of material was used to inoculate the edge of the plate (via a sterile inoculation loop). The plate was resealed with parafilm and maintained at room temperature (rt) for another 8 days . Subsequently, the culture was flash frozen, sectioned, and analyzed by desi - ms imaging as described above . The agr p3lux reporter strain ah2759 was created by transduction of plasmid pamiagrp3 using bacteriophage 80 as described previously . The plasmid was crossed into strain ah1263, which is the usa300 ca - mrsa strain lac cured of the native plasmid pusa03 that confers erythromycin resistance . Overnight cultures of ah2759 grown in tryptic soy broth (tsb) supplemented with chloramphenicol at 10 g / ml were inoculated at a dilution of 1:250 into fresh tsb containing antibiotic . Bacterial aliquots (100 l) were added to 96-well microtiter plates (costar 3603), where each well contained 100 l aliquots of tsb with antibiotic and the polyhydroxyanthraquinones at concentrations ranging from 0.2 to 2000 m . After mixing, the effective inoculum dilution was 1:500 and the polyhydroxyanthraquinone concentrations ranged from 0.1 to 1000 m . Plates were incubated at 37 c with shaking at 250 rpm, and a tecan infinite m200 plate reader was used to measure turbidity (od600) and luminescence at 1 h intervals beginning at 15 h of incubation . Response curves were generated with cell - density - normalized luminescence values, and ic50 values were obtained by a weighted, four - parameter logistic fit using kaleidagraph v4.1.3 (synergy software). Except for compounds 5 and 7, reported ic50 s were the average of two experiments, one with n = 3 and the other with n = 4 . Ic50 s for 5 and 7 were from the experiment with n = 4 . For some of the compounds, there was a significant growth delay at the 1000 m concentration; data from those wells were excluded from the analysis . Wells containing synthetic aip-2 (anaspec) at concentrations from 2 to 500 nm were included as a positive control . After collecting data in the agr p3lux assay, the cultures from the microtiter plate wells were pooled and filter sterilized using spinx 0.22 m filters . The media (2.5 l) from cultures treated with compounds 1, 3, and 4, as well as from cultures treated with aip-2, were subjected to sds - page on 15% gels . Following electrophoresis, gels were washed for 20 min in transfer buffer and proteins were transferred to immobilon - psq polyvinylidene difluoride (millipore) membranes for 90 min at a constant current of 160 ma . Membranes were soaked overnight with blocking solution [consisting of 4.25% nonfat milk and 0.75% bovine serum albumin in tris - buffered saline containing 0.1% tween 20 (tbst)] at 4 c with gentle agitation . Membranes were washed three times for 10 min with tbst at rt and probed for 1 h at rt with rabbit anti - delta toxin polyclonal antibody (abgen) diluted 1:2000 in blocking buffer . Membranes were washed again briefly with tbst and probed for 1 h at rt with goat anti - rabbit antibody conjugated to horseradish peroxidase (jackson immunoresearch laboratories) diluted 1:10 000 in blocking buffer . Membranes were briefly washed with tbst, and bound conjugate was detected using the supersignal west pico chemiluminescent substrate (thermo scientific) followed by exposure to classic x - ray film from research product international.
|
Skeletal muscle is the most abundant tissue, with a wide variety of physiological functions, and thus muscle loss results not only in physical dysfunction but also in metabolic impairment . Inflammatory mediators such as tumor necrosis factor alpha (tnf) and interleukin-6 (il-6) are important mediators of catabolic responses such as protein loss and of metabolic disturbances such as insulin resistance . They promote protein degradation by upregulating the expression of two muscle - specific ubiquitin e3-ligases, f - box protein (mafbx / atrogin-1), and muscle ring - finger protein 1 (murf1), which are involved in the ubiquitin proteasome pathway, and so lead to skeletal muscle atrophy . Recent studies have shown that obesity is associated with skeletal muscle loss and dysfunction, referred to as sarcopenic obesity . It is likely that obesity - induced inflammation, which is characterized by increases in macrophage infiltration and in levels of inflammatory cytokines / chemokines (e.g., tnf; monocyte chemoattractant protein 1, mcp-1) [57], is associated with this muscle atrophy . Given that muscle atrophy and inflammation exacerbate obesity - induced insulin resistance, dietary components that suppress obesity - induced skeletal muscle inflammation and/or atrophy could be useful for preventing obesity - related metabolic disorders . Quercetin (3,3,4,5,7-pentahydroxyflavone) is a polyphenolic flavonoid compound found in many dietary sources and intensively investigated for its multiple health - related effects such as antioxidant and anti - inflammatory activities [912]. We previously showed that quercetin inhibits the release of chemokines such as macrophage inflammatory protein-1 (mip-1/ccl3) from cocultured adipocytes / macrophages by interfering with inflammatory signaling and also reduced adipose inflammation by inhibiting macrophage accumulation and cytokine release in obese adipose tissue . Interestingly, this flavonoid also inhibits oxidative stress - induced and/or unloading - derived disused skeletal muscle atrophy in both skeletal muscle cells and muscle tissue [15, 16]. However, it is not clear whether it can prevent obesity - related skeletal muscle inflammation and atrophy . In the present study, we for the first time demonstrate that quercetin diminishes skeletal muscle atrophy through reducing obesity - induced muscle inflammation and that it does so by inhibiting inflammatory receptor signaling . Quercetin may be useful for protecting against obesity - induced sarcopenia and sarcopenia - related metabolic dysregulation . Eight - week - old male c57bl/6 mice were individually housed in a specific pathogen - free animal facility, with a 12 - 12 h light - dark cycle . The mice were fed a regular diet (rd) (13% of calories as fat from soybean oil; harlan teklad, madison, wi, usa), a high - fat diet (hfd) (60% of calories as fat from lard and soybean oil; research diets inc ., new brunswick, nj, usa), or an hfd supplemented with 0.05% quercetin (0.05 g quercetin/100 g diet) (hfd / q0.05) or 0.1% quercetin (hfd / q0.1) for 9 weeks . All animal experiments were approved by the animal ethics committee of the university of ulsan and conformed to national institutes of health guidelines . The mouse myoblast cell line c2c12 and the monocyte / macrophage - like cell line raw264.7 were purchased from the american type culture collection (atcc, manassas, usa). The c2c12 myoblasts (5 10 cells / ml) were grown at 37c in 5% co2 in dulbecco's modified eagle's medium (dmem) (gibco, ny, usa) containing 10% fetal bovine serum (fbs) (gibco), 100 units / ml penicillin, 100 g / ml streptomycin (invitrogen, carlsbad, ca, usa), and 20 g / ml gentamicin (gibco). When the cells reached 100% confluence, the medium was replaced with differentiation medium that consisted of dmem plus 2% horse serum (gibco), which was changed after 2 days . Raw264.7 cells were cultured to 80% confluence at 37c in 5% co2 in rpmi medium (gibco) containing 10% fbs, 100 units / ml penicillin, 100 g / ml streptomycin (invitrogen), and 20 g / ml gentamicin (gibco). For coculture, the raw264.7 cells were detached with 0.05% trypsin - edta (gibco) and raw264.7 cells corresponding to 25% of the number of confluent myoblasts (810 10 myoblasts / well of 24-well plate) were directly seeded into culture plates containing 3 day - differentiated myotubes in serum - free dmem . The same numbers of raw264.7 cells and myotubes were cultured separately and mixed after being collected / harvested, named as mixture (mix), same as ffa treated condition, which was named as mix / ffa . The cocultures were incubated for 24 h, following treatment with 500 m palmitic acid (ffa) in serum - free dmem containing 50 m bsa (co / ffa). Palmitic acid (sigma) was dissolved in ethanol and conjugated with bsa at a 10: 1 molar ratio before use . The established myotubes and macrophages were pretreated with 50 m quercetin in serum - free dmem for 1 h (co / ffa / q). An equal amount of dmso was used as a control for the quercetin - treated group . After incubation, the culture supernatants were collected to measure cytokine concentrations by elisas; at the same time samples of the cells were washed twice with pbs and lysed in trizol reagent (invitrogen) for quantitative real time pcr and in lysis buffer for western blot analysis . Gastrocnemius muscle tissues were collected and stored at 20c in rnalater (ambion, austin, tx, usa). Total rna was extracted from 50 mg muscle tissue samples, or cells were lysed with trizol reagent (invitrogen). Two microgram aliquots of total rna were reverse transcribed using m - mlv reverse transcriptase (promega, madison, wi, usa). Qrt - pcr amplification of the cdna was performed in duplicate with a sybr premix ex taq kit (takara bio inc ., forster, ca, usa) using a thermal cycler dice (takara bio inc ., all reactions were performed according to the same schedule: 95c for 10 s followed by 40 cycles of 95c for 5 s and 60c for 30 s. results were analyzed with real time system tp800 software (takara bio inc .) And all values were normalized to the levels of the house - keeping gene -actin . Gastrocnemius muscles (100 mg) were homogenized in 1 ml of 100 mm tris - hcl and 250 mm sucrose buffer (ph 7.4) supplemented with 0.25% protease inhibitor cocktail (sigma) and centrifuged at 10,000 g for 10 min at 4c . Levels of tnf and mcp-1 in the tissue homogenates or in the culture supernatants were measured by enzyme - linked immunosorbent assays (elisas) using the opteia mouse tnf and/or mcp-1 sets (bd biosciences, nj, usa). Amounts of cytokine were adjusted for the protein content of the homogenates determined with a bca protein assay kit (pierce, rockford, il, usa). Briefly, gastrocnemius muscle tissues were dissected and immediately frozen in liquid nitrogen . For protein extraction, tissues and cell cultures were homogenized in lysis buffer containing 150 mm nacl, 50 mm tris - hcl, 1 mm edta, 50 mm naf, 10 mm na4p2o7, 1% igepal, 2 mm na3vo4, 0.25% protease inhibitor cocktail, and 1% phosphatase inhibitor cocktail (sigma). Samples of 50 g and 10 g total protein extracted from tissues and cell cultures, respectively, were subjected to western blot analysis using polyclonal antibodies to cd68, murf1, nuclear factor of kappa light polypeptide gene enhancer in b - cells inhibitor alpha (ib, santa cruz biotechnology, santa cruz, ca, usa), and phosphorylated extracellular signal - regulated kinase (p - erk1/2), erk1/2, phosphorylated p38 mitogen - activated protein kinase (p - p38 mapk), and p38 mapk (cell signaling, danvers, ma, usa). -tubulin was used as a loading control, measured with mouse -tubulin antibody (abcam, ma, usa). Gastrocnemius muscles were fixed overnight at room temperature in 10% formaldehyde and embedded in paraffin . Eight - micron - thick sections were stained with hematoxylin - eosin (h&e), mounted on glass slides, and observed with an axio - star plus microscope . The diameters of the muscle fibers were determined using microscope axiovision software (carl zeiss, gottingen, germany). The results are presented as means standard error of the mean (sem). Variables were compared using student's t - test or analysis of variance (anova) with duncan's multiple - range test . We first examined the effects of quercetin on skeletal muscle inflammation . As shown in figures 1(a) and 1(b), hfd - fed mice had increased levels of inflammatory cytokines such as tnf and mcp-1 compared with rd - fed mice, and exposure to quercetin reduced these effects . Skeletal muscle transcript and protein levels of f4/80 and cd68, which were higher in the hfd - fed mice than in the rd - fed mice, were also reduced by quercetin in a dose - dependent manner (figures 1(c) and 1(d)). Subsequently, we examined the effect of quercetin on inflammatory receptors such as tnf receptor superfamily member 9 (4 - 1bb) and toll - like receptor 4 (tlr4), which are known to promote obesity - induced inflammatory responses in skeletal muscle [17, 18]. Transcript levels of the inflammatory receptors were lower in the skeletal muscle of the hfd / q0.05- and hfd / q0.1-fed mice than in that of the hfd - fed mice (figure 1(e)). Skeletal muscle atrophy is characterized by reduced muscle mass and fiber size [16, 19]. Quercetin did not alter food intake, and the body weight of hfd / q0.05-fed mice had a tendency to gain less weight than the hfd - fed mice, as previously reported, but not different from the hfd / q0.1-fed mice (table 2). As shown in figure 2(a), the ratio of skeletal muscle weight to whole body weight was lower in hfd - fed than in rd - fed mice, and this reduction was prevented in the hfd / q0.05- and hfd / q0.1-fed mice . Similarly, histological examination of gastrocnemius cross sections showed that mean muscle fiber diameter was higher in hfd / q0.05- and hfd / q0.1-fed mice than in hfd - fed mice (figure 2(b)). Murf1 was upregulated in the hfd - fed mice, but not in the hfd / q0.05- and hfd / q0.1-fed mice . The level of murf1 protein was also significantly reduced in the hfd / q0.1-fed mice compared to the hfd - fed mice and was similar to the level in the rd - fed mice (figure 2(d)). Because both macrophages and free fatty acids increase in obese skeletal muscle [20, 21], we cocultured c2c12 skeletal muscle myotubes (mb) with raw264.7 macrophages (mq) in the presence of palmitic acid (ffa) to mimic the obese microenvironment and treated the cells with quercetin . Quercetin significantly inhibited the increases in transcript and protein levels of inflammatory cytokines tnf and mcp-1 in these cocultures (figures 3(a) and 3(b)). Transcripts of other cell surface molecules that are involved in inflammatory responses, including 4 - 1bb and tlr4, were markedly reduced by quercetin (figure 3(c)). In agreement with this, coculture of mb / mq in the presence of ffa induced phosphorylation of erk and p38 mapk and degradation of ib, while the activation of these inflammatory signaling molecules was significantly inhibited by the presence of quercetin (figures 3(d) and 3(e)). Moreover, coculture of mb / mq along with ffa strongly increased the expression of the atrophic genes atrogin-1 and murf1, and as in the case of obese skeletal muscle (figure 2(c)), this increase was inhibited by quercetin (figure 4(a)). Quercetin was also found to reduce the level of murf1 protein in cocultured mb / mq treated with ffa (figure 4(b)). Skeletal muscle inflammation plays a crucial role in muscle atrophy and in systemic metabolic dysfunction [5, 22]. It is thought that a 10% increase in the ratio of skeletal muscle mass to total body weight is associated with 11% reduction in the risk of insulin resistance . Hence, the prevention of skeletal muscle inflammation and/or atrophy has been predicted to improve obesity - induced metabolic dysregulation . Studies have shown that quercetin increases skeletal muscle mitochondria function and attenuates insulin resistance in obese mice [24, 25]. It also decreases circulating markers of inflammation in mice fed a high - fat diet and inflammatory response in skeletal muscle of genetically obese mice . However, it remains unclear whether quercetin protects obesity - related skeletal muscle inflammation and atrophy . Quercetin decreased levels of inflammatory cytokines / chemokines (tnf and mcp-1) in the skeletal muscle of hfd - fed obese mice, and this inhibitory effect was confirmed in cocultured muscle cells / macrophages treated with ffa . Given that quercetin lowers the plasma concentration of ffa in genetically obese zuker rats, the reduction of inflammatory cytokines by quercetin may be partly associated with reduction of circulating ffa . Next, we inquired whether the reduction of skeletal muscle inflammation by quercetin protected against obesity - related skeletal muscle atrophy . Atrogin-1 and murf1 are believed to be key players in the development of skeletal muscle atrophy by promoting the degradation of proteins . Functional studies have shown that ablation of atrogin-1 or murf1 protects mice from muscle atrophy, while overexpression of atrogin-1 reduces myotube cell size [29, 30]. Intriguingly, we found that quercetin supplementation prevented obesity - induced decreases in muscle mass and fiber size in the skeletal muscle of the hfd - fed obese mice . In line with this, expression of atrophic factors atrogin-1 and murf1 was downregulated, indicating that quercetin protects against obesity - induced skeletal muscle atrophy, presumably through inhibition of muscle inflammation . It should be noted that transcription of the protein ligases atrogin-1 and murf1 is regulated by signaling pathways such as erk, p38 mapk, and ib kinase (ikk)/nuclear factor kappa - light - chain - enhancer of activated b cell (nf-b) [20, 3135]. Hence, the protective effect of quercetin may occur through inhibition of the phosphorylation of these kinases and presumably of nf-b activation . Indeed, we found that the activation of inflammatory signaling molecules was significantly inhibited by the presence of quercetin, indicating that the protective effect of quercetin against muscle atrophy is mediated by inhibition of inflammatory signaling and cytokine release . Like obesity - induced adipose inflammation, skeletal muscle inflammation is characterized by infiltration of macrophages and their interaction with muscle cells, and this plays a crucial role in the increased production of inflammatory cytokines [7, 20]. We confirmed that quercetin supplementation markedly reduced transcript and protein levels of the macrophage - specific markers cd68 and f4/80 in the skeletal muscle of hfd - fed obese mice, indicating that it prevented macrophage accumulation, which is in line with our in vitro observation that inhibits the chemotactic activity of macrophages . Thus, the reduced macrophage infiltration by quercetin may decrease the cross - talk between macrophages / muscle cells, which promotes their inflammatory responses [7, 17], and this may be favorable for the reduction of skeletal muscle inflammation . Inflammatory receptors such as toll - like receptors (tlrs) and the tnf receptor superfamily (tnfrsf) participate in initiating obesity - induced inflammatory responses . For example, binding of ffas to tlr4 leads to downstream signaling that activates inflammatory signaling molecules such as the map kinases erk and p38 [36, 37]. Meanwhile, engagement of 4 - 1bb (tnfrsf9) with its ligand 4 - 1bbl (tnrsf9) can activate the inflammatory signaling pathway involving map kinases in t cells and macrophages, and we have also shown that the 4 - 1bb/4 - 1bbl interaction on adipocytes / macrophages or muscle cells / macrophages promotes obesity - induced adipose and muscle inflammation [17, 39]; hence inflammatory receptor expression and their signaling are considered useful targets for protecting against obesity - induced inflammation [17, 39]. Interestingly, we observed that quercetin reduced transcripts of the inflammatory receptors tlr4 and 4 - 1bb in skeletal muscle, as well as in mb / mq cocultures . Moreover, in the cocultures it also inhibited phosphorylation of erk and p38 mapk and the degradation of ib, and these are downstream components of the signaling pathways activated by inflammatory receptors [17, 39, 40]. These findings indicate that the reduction of inflammatory cytokine production in obese skeletal muscle by quercetin may be at least in part attributed to downregulation of inflammatory receptors per se and inhibition of their inflammatory signaling . In conclusion, the present study for the first time demonstrates that quercetin can prevent obesity - induced skeletal muscle atrophy by suppressing inflammatory responses . These effects are associated with downregulation of the inflammatory receptors tlr4 and 4 - 1bb and inhibition of their inflammatory signaling pathways (figure 5). Quercetin may be a useful dietary component for preventing obesity - induced muscle inflammation and sarcopenia.
|
Cerebrovascular events still remain as one of the major leading causes of death and disability all over the world . Only in the united states, the annual incidence of these events has been estimated to be 780.000 strokes, 600.000 as the primary strokes and others as recurrent attacks . The management of cerebrovascular disorders has imposed a high cost on healthcare management systems with an estimation of 65.5 billion dollars in the usa in 2008 . Studies have given point estimation of 3-year stroke recurrence rates between 6% and 25% [35]. Incidence rates of first stroke recurrence were highest in the first year after index stroke with a risk of 8.0% ranging from 3.5% to 1.8% within the second, third, fourth, and fifth years . Ever, some potential risk factors have been identified to predispose patients to recurrent brain stroke including residual extracranial and intracranial occlusive disease and multiple and crescendo tias and hypertension (for early stroke recurrence) and advanced age, hypertension, heart disease, and diabetes mellitus (for late stroke recurrence) [5, 79]. In this regard, the main principles for recurrence of brain stroke include evaluation for risk factors and evaluation for cause (arterial and cardiac abnormalities), as well as management of the risk factors through lifestyle modification, using proper medications and surgical or endovascular interventions, if required . The first step for prognostic and preventive management of recurrent brain stroke is risk stratification of this event . Various scoring systems have been employed to stratify the risk for this event so far . The abcd2 score is now identified as a useful clinical prediction rule to determine the risk for stroke in the days following primary brain ischemic attacks, particularly after tias . This score has been structured based on five parameters of age, clinical features, duration of tia, blood pressure measure, and diabetes mellitus that scores of each item are added together to produce an overall result ranging between zero and seven . The follow - up period for this score can be either between 0 and 7 days of the cerebrovascular event (acute phase) or between 8 and 90 days (subacute phase). According to the risk stratification rule of this scoring system, the risk for recurrent stroke within 2 to 7 days ranged from 1.0% to 1.2% in the low - risk group, from 4.1% to 5.9% in the moderate - risk group, and from 8.1% to 11.7% in the high - risk group . The expected 90-day risks of stroke in these groups were 3.1%, 10%, and 17.4%, respectively . Interestingly, the relevance of some other risk profiles such as atrial fibrillation with increased risk for recurrent brain stroke has been proposed [14, 15], and thus it seems that adding this factor to common scoring systems such as abcd2 can increase its prognostic value for these patients . The present study aimed to add the presence of atrial fibrillation as a potential risk factor to abcd2 system and to modify it as a new scoring system named abcd2f . Then, the value of this new system was compared to the previous abcd2 system to predict recurrent brain stroke within 90 days of the initial cerebrovascular accident . In this study, 138 consecutive patients with the final diagnosis of ischemic cerebrovascular accidents (cva) or tias who referred to emergency ward of rasoul - e - akram hospital in tehran, iran, from september 2012 to december 2013 were eligible for the study . The patients with hemorrhagic cva or those who died within 90 days of discharge from the hospital were excluded (table 1). The primary information of the patients was retrospectively collected by reviewing the recorded hospital files and baseline characteristics, including demographics, medical history, clinical findings, and also laboratory and imaging parameters . With regard to assessing the patients' sequel, it was followed up by telephone in order to assess the reappearance of the symptoms of cva or tias . Furthermore, if the patients referred to emergency ward of the hospital within 90 days of primary admission, the additional data were also collected by reviewing the recorded files . The severity of stroke was assessed using the nihss score; as the score of 0 indicated no stroke symptoms, the score of 14 indicated minor stroke, the score of 515 indicated moderate stroke, the score of 1620 indicated moderate - to - severe stroke, and the score of 2142 indicated severe stroke . Using the baseline information, the level of risk for recurrent brain stroke was initially determined based on the abcd2 scoring system . Then, by adding a new score for the presence of atrial fibrillation to abcd2 system, the new scoring system as the study endpoint was to determine the value of abcd2 and abcd2f systems to distinguish occurrence of the recurrent brain stroke within 90 days of primary event and also to determine the discriminative value across the two scoring systems . Results were presented as mean standard deviation (sd) for quantitative variables and were summarized by absolute frequencies and percentages for categorical variables . Categorical variables were compared using chi - square test or fisher's exact test when more than 20% of cells with an expected count of less than 5 were observed . Quantitative variables were also compared with t - test or mann - whitney u test . A receiver operating characteristic (roc) curve was used to determine the value of scoring systems to distinguish occurring from nonoccurring recurrent stroke and also to determine the sensitivity and specificity . For the statistical analysis, the statistical software spss version 16.0 for windows (spss inc ., chicago, il) was used . In total, 138 patients were included within the study with the mean age of 65.48 12.03 years (ranged from 35 to 88 years) and 64.5% of them were males . Regarding the type of stroke, 76.8% had an ischemic stroke, and others suffered from tias . In electrocardiographic assessment, 64.5% had the normal pattern, while atrial fibrillation was revealed in 6.5%; furthermore, 13.0% had evidence of cardiac ischemic events, and 5.1% had cardiac blocks . With regard to initial symptoms on admission, 71.7% had weakness plus speech abnormality, 12.3% had speech abnormality alone, and 15.9% had symptoms related to posterior circulation . The duration of symptoms in patients who suffered from tia was less than 10 minutes in 4.3%, while the symptoms lasted more than 60 minutes in 11.6% of them . In total regarding hemodynamic indices, 52.9% had first systolic blood pressure higher than 120 mmhg, 30.4% had first diastolic blood pressure higher than 90 mmhg, and 29.7% had first pulse rate higher than 90 beats per minute . Assessing cardiovascular risk factors showed the history of cva in 13.0%, history of tias in 1.4%, history of ischemic heart disease in 24.6%, and history of valvular heart disease in 5.8% . 28.3% were diabetic, 56.5% were hypertensive, 15.2% were hyperlipidemic, and 23.2% were smokers . With respect to oral medications, aspirin was used in 26.1%, clopidogrel in 2.9%, and warfarin in 5.8% . The mean ejection fraction of left ventricle was 50.46 9.46 percent and, in 20.3% of cases, the ejection fraction of left ventricle was less than 35% . Left heart clot was only observed in 1.4% and left ventricle aneurism was observed in 4.3%, whereas wall motion abnormality in echocardiography was found in 18.8% . The mean of total initial nihss was 8.38 5.26 and 1.06 1.98 in patients with stroke and tia, respectively . Based on nihss, in patients with ischemic stroke, 23.8% had mild stroke, 61.9% had the moderate stroke, 13.3% had moderate - to - severe stroke, and only 1.0% had severe stroke . The follow - up of the patients for 90 days showed recurrent stroke, as tias or ischemic stroke was revealed in 9.4% . No difference was found between the patients with and without 90-day clinical recurrent stroke in both abcd2 score (4.62 1.80 versus 5.06 1.30; p = 0.406) and abcd2f score (4.77 1.96 versus 5.11 1.31; p = 0.395). In total, a strong correlation was observed between the two scoring systems (r = 0.984; p <0.001). Using the roc curve analysis for determining the value of scoring systems to predict recurrent stroke, the area under the curve for abcd2 was 0.434 (95% ci: 0.2450.623; p = 0.433) and for abcd2f it was 0.452 (95% ci: 0.2560.648; p = 0.567), indicating low value of both systems for assessing recurrence of stroke within 90 days of the primary event (figure 1). Multivariable logistic regression analysis (table 2) showed that none of the baseline factors could predict 90-day recurrent stroke . First, we aimed to assess the value of this tool to predict occurring recurrent brain stroke within 90 days of first attacks . Second, we would like to examine whether adding occurrence of atrial fibrillation to this scoring system could enhance its value to predict recurrent brain stroke within this follow - up time . In this regard first, we showed that the abcd2 scoring system was not valuable enough for predicting 3-month recurrent brain stroke . In other words, by using two statistical tools, including multivariable regression modeling and calculating area under the roc curve, we could not demonstrate its high power to distinguish recurrent stroke . As previously noted, the abcd2 scoring system was introduced to assess the risk for recurrent stroke during the first week of initial attack and thus its value to predict long - term stroke events had been already questioned . According to our results, it seems that the pure abcd2 cannot be applied to assess mid - term or long - term recurrent cerebrovascular events, at least in our patients' population . Second, we also showed that even adding the parameter of atrial fibrillation could not improve the predicting value of abcd2 . In total, the low power of abcd2 or its new version as abcd2f can be explained by some reasons . First, it seems that, for improving its predictive value, we have to consider some other potential risk factors for delayed recurrent brain stroke admission etiologic stroke subtype, prior history of tia / stroke, and topography, age, and distribution of brain infarcts . As also shown by ay et al ., the new scoring system named rre-90 including above parameters demonstrated good predictive performance with high reliability and also high external validity to predict 90-day risk of recurrent stroke . Thus, assessing this new scoring system among various populations such as our population is recommended . Second, a wide spectrum of risk factors has been identified as determinants for recurrent brain stroke . In other words, it has been indicated that diabetes and atrial fibrillation are two potential risk factors for mid - term recurrent attack of brain stroke . Even the origin of stroke can be a major factor . In total, the relationship between risk factors such as ethnicity, diabetes mellitus, hypertension, and atrial fibrillation and stroke recurrence has been examined in several studies [36]. However, few had sufficient sample sizes or used multivariable analysis to control for confounding factors . Furthermore, no estimates have been made of the proportion of stroke recurrences that are attributable to these risk factors . It should be noted that the risk factors for recurrence of stroke may be more complex and confounding . One of these major confounding factors is the type of the treatment following first cerebrovascular accident . From this point of view, the origin of stroke is very important and choosing of the type of treatment depends on it . As noted before, atrial fibrillation plays an important role in cardioembolic strokes . Also, ois et al . Showed that severe symptomatic cerebral arterial diseases have approximately five times risk for recurrence of stroke within 90 days . The mode of the treatment in these conditions, including interventional procedures or medical treatments, affects the outcome of event, particularly recurrence of stroke . In multivariate analysis, surprisingly, we found that discharge with clopidogrel increases the risk for recurrent stroke by more than five times (or = 5.23), but discharge with asa and warfarin has or of 0.69 and or of 1.21, respectively . The possible explanation for these results can be the small number of patients who take clopidogrel (29 patients); however, a more detailed study is recommended to clarify this challenge . In conclusion, it seems that either abcd2 scoring system or abcd2f scoring system cannot effectively predict 90-day recurrent brain stroke in our population . In other words, abcd2 and/or atrial fibrillation are not good scoring candidates for assessing the risk of recurrent stroke within first 90 days . In this regard, it is better to examine the value of other confirmed scoring tools such as the rre-90 system or to discover other potential risk profiles to structure the new scoring systems to predict recurrent brain stroke . The abcd2 and/or atrial fibrillation are not good scoring candidates for assessing the risk of recurrent stroke within first 90 days.
|
Postoperative cognitive dysfunction (pocd) is a major complication characterized by disordered thinking and impaired consciousness following surgeries and anesthesia, especially in elderly individuals . Early studies focused on pocd after cardiac surgery, but a recent study conducted by evered et al . Showed that it was associated with non - cardiac surgery and even with minor non - invasive procedures under sedation, such as coronary angiography . A large multi - center study reported that the incidence of pocd was 25% 1 week after non - cardiac surgery and about 10% 3 months after non - cardiac surgery . Cognitive changes after surgery prolong hospital stay, elevate perioperative medical cost, decrease postoperative quality of life, and increase surgical morbidity and mortality clinical studies have consistently suggested that the main causes of this injury include an exaggerated systemic inflammation, endothelial dysfunction, cerebral hypoperfusion, and microembolism . Others have specifically reported that pocd is indeed correlated with the serum protein levels of il-6, tnf-, s100, neuron - specific enolase (nse), and malonaldehyde (mda) [911]. In addition, animal studies have also shown that neuroinflammation and brain cell death after surgery and anesthesia may contribute to the brain functional changes [1214]. Although many drugs have been studied as neuroprotective during surgery and anesthesia, such as thiopental, propofol, ulinastatin, sevoflurane, and morphine, there is no agreement on the efficiency of prophylactic neuroprotectants in cardiac or non - cardiac surgery . Lidocaine, an inexpensive, widely available, and relatively safe compound, is a local anesthetic and class ib antiarrhythmic that readily crosses the blood - brain barrier . Initially demonstrated cerebral protection of lidocaine in a feline model of cerebral arterial gas embolism . Later clinical studies have also demonstrated the effects of lidocaine on perioperative neuroprotection [1921]. However, the mechanisms underlying lidocaine treatment - induced neuroprotection remain incompletely understood . Therefore, in the present study, we hypothesized that lidocaine ameliorated early cognitive damage in patients undergoing spine surgery . Also, we determined the effects of lidocaine treatment on the levels of il-6, tnf-, s100, nse, and mda in serum . 1 people s hospital and written informed consent was obtained from all patients before the study . The study included 87 american society of anesthesiologists (asa) physical status i or ii patients aged greater than 65 years scheduled for a spine surgery from september 2013 to february 2015 . Exclusion criteria included: mini - mental state examination (mmse) score <23 before surgery; history of neurological diseases (including alzheimer s disease and stroke history), psychological disorder, and drug or alcohol abuse; history of diabetes mellitus, severe hypertension, severe anemia, hepatic or renal dysfunction; unwillingness to comply with the protocol or procedures; inability to speak and read chinese . Patients were randomly allocated to 2 treatment groups: (1) lidocaine treatment group (n=40), a bolus of 1 mg / kg of lidocaine over 5 minutes administered after induction of anesthesia and followed by a continuous infusion at 1.5 mg / kg / h until the end of the surgery; or (2) control group (n=40), normal saline administered as a bolus and an infusion with the same volume and rate changes as the lidocaine group . Anesthesia was induced with midazolam (0.03~0.05 mg / kg), sufentanil (0.2~0.3 g / kg), cisatracurium (0.15~0.2 mg / kg) and propofol (2 mg / kg). Anesthesia was maintained by intravenous injection of propofol (4~12 mg / kg / h) and remifentanil (0.1~0.15 g / kg / min). Electrocardiogram, respiratory rate, pulse oximetry, petco2 and hemoglobin oxygen saturation (spo2) were continuously monitored during surgery . The blood samples were collected to observe changes in the levels of il-6, tnf-, s100, nse and mda before inducing anesthesia (t1), at the end of surgery (t2) and three days after the end of surgery (t3). Blood samples (5 ml) were allowed to clot for 2 h at room temperature and were then centrifuged for 15 min at 2000g at 4c . The levels of il-6, tnf-, s100 and nse were measured using an enzyme - linked immunosorbent assay (elisa) kit (neobioscience technology company, beijing, china) according to the manufacturer s protocol . Mda concentrations were determined using enzymatic methods following the manufacturer s instructions (jiancheng biologic project company, nanjing, china). Cognitive function was evaluated pre - operatively and three days post - operatively in a quiet room with only the patient and the experienced psychometrician . Intergroup numerical data, including il-6, tnf-, mda, s100 and nse concentrations were analyzed with the student s t - test; intragroup numerical data were analyzed with repeated measures anova . The differences between the values were considered to be significant at p<0.05 . All statistical tests and graphs were performed using statistical program for social sciences 20.0 software (spss, inc ., the study included 87 american society of anesthesiologists (asa) physical status i or ii patients aged greater than 65 years scheduled for a spine surgery from september 2013 to february 2015 . Exclusion criteria included: mini - mental state examination (mmse) score <23 before surgery; history of neurological diseases (including alzheimer s disease and stroke history), psychological disorder, and drug or alcohol abuse; history of diabetes mellitus, severe hypertension, severe anemia, hepatic or renal dysfunction; unwillingness to comply with the protocol or procedures; inability to speak and read chinese . Patients were randomly allocated to 2 treatment groups: (1) lidocaine treatment group (n=40), a bolus of 1 mg / kg of lidocaine over 5 minutes administered after induction of anesthesia and followed by a continuous infusion at 1.5 mg / kg / h until the end of the surgery; or (2) control group (n=40), normal saline administered as a bolus and an infusion with the same volume and rate changes as the lidocaine group . Anesthesia was induced with midazolam (0.03~0.05 mg / kg), sufentanil (0.2~0.3 g / kg), cisatracurium (0.15~0.2 mg / kg) and propofol (2 mg / kg). Anesthesia was maintained by intravenous injection of propofol (4~12 mg / kg / h) and remifentanil (0.1~0.15 g / kg / min). Electrocardiogram, respiratory rate, pulse oximetry, petco2 and hemoglobin oxygen saturation (spo2) were continuously monitored during surgery . The blood samples were collected to observe changes in the levels of il-6, tnf-, s100, nse and mda before inducing anesthesia (t1), at the end of surgery (t2) and three days after the end of surgery (t3). Blood samples (5 ml) were allowed to clot for 2 h at room temperature and were then centrifuged for 15 min at 2000g at 4c . The levels of il-6, tnf-, s100 and nse were measured using an enzyme - linked immunosorbent assay (elisa) kit (neobioscience technology company, beijing, china) according to the manufacturer s protocol . Mda concentrations were determined using enzymatic methods following the manufacturer s instructions (jiancheng biologic project company, nanjing, china). Cognitive function was evaluated pre - operatively and three days post - operatively in a quiet room with only the patient and the experienced psychometrician . Intergroup numerical data, including il-6, tnf-, mda, s100 and nse concentrations were analyzed with the student s t - test; intragroup numerical data were analyzed with repeated measures anova . The differences between the values were considered to be significant at p<0.05 . All statistical tests and graphs were performed using statistical program for social sciences 20.0 software (spss, inc ., seven patients were excluded because of refusal to neuropsychological evaluation after operation, thus leaving eighty patients who completed the blood sample collection and neurocognitive tests . There were no significant differences in age, sex, body weight, asa classification, operation time, and hospital stay between groups (p>0.05). Compared with the preoperative mmse scores, those on three days after surgery were significantly decreased in the control group . However, the mmse scores in the lidocaine group were markedly higher than those in the control group at t3 (figure 1, p<0.05). Serum assays were performed at 3 time points: preoperation (t1), at the end of surgery (t2), and 3 days after the end of surgery (t3). In the control group, however, the lidocaine group had lower serum il-6 concentration than that in the control group (figure 2a, p<0.05). There were no significant differences between groups in tnf- concentration at 3 time points (figure 2b, p>0.05). Serum levels of mda were higher at 3 days after surgery when compared with preoperative levels in the control group . However, the elevated levels were dramatically attenuated by lidocaine treatment (figure 3, p<0.05). Obviously, no significant differences in the level of mda were observed between groups at t2 (p>0.05). In the control group, there was a marked increase in the serum concentrations of s100 and nse at t2 and t3 compared with those at t1 . However, lidocaine treatment clearly inhibited the up - regulation of s100 and nse in serum (figure 4, p<0.05). The present study revealed that lidocaine can improve cognitive performance in elderly patients undergoing spine surgery . In addition, we reported for the first time that lidocaine can effectively decrease serum levels of il-6, mda, s100, and nse after non - cardiac surgery . Therefore, a potential mechanism underlying lidocaine treatment - induced neuroprotection may be to inhibit the release of il-6, mda, s100, and nse . These findings indicate that lidocaine may be a promising therapeutic approach for the treatment of pocd . Lidocaine confers cerebral protection via many mechanisms, including reducing the cerebral metabolic rate, reducing the ischemic excitotoxin release, and decelerating the ischemic transmembrane ion shift . Additionally, recent evidence has suggested that the neuroprotective effects of lidocaine may be associated with its anti - inflammatory and anti - apoptotic properties . However, previous clinical trials on the effects of lidocaine on pocd are contradictory, with improvements and no effect . This variability may arise from different timing and dose of lidocaine administered and different patient selection . In our study, the infusion protocol was designed to deliver a 1 mg / kg bolus over 5 minutes after induction of anesthesia, followed by a continuous infusion at 1.5 mg / kg / h until the end of the surgery . Our results suggested that the mmse scores of patients in the lidocaine group were markedly higher than those in the control group 3 days after surgery, implying that lidocaine may attenuate cognitive function in patients undergoing spine surgery . Studies suggest that the magnitude of inflammatory response is a risk factor for cognitive dysfunction after major surgery . Surgical trauma activates the peripheral innate immune system, resulting in the release of inflammatory mediators, which impairs cognitive function . Xu and colleagues found that serum levels of il-6 increased after general anesthesia in abdominal surgery and the increase may be associated with the occurrence of pocd . Their results showed that il-6 might serve an indicator to guide the prevention and treatment of pocd . Serum tnf- level is also suggested to be a critical mediator of inflammation - induced neuronal dysfunction . It is the first cytokine to be released following surgery and its peripheral blockade could limit the release of neuroinflammation and cognitive impairment in a mouse model of surgery - induced cognitive dysfunction . However, the studies mentioned above did not demonstrate the relationship between pocd and the levels of serum tnf-. In agreement, our results showed that concentration of serum il-6 increased at the end of surgery and 3 days after the end of surgery . There were no significant differences in tnf- level between the 2 groups at the 3 time points studied . Our results and those of others indicate that inflammatory response may be responsible for pocd and that lidocaine may prevent or reverse the cognitive deficits by inhibiting the response . Numerous studies support that oxidative stress precedes the development of neurodegenerative diseases such as pocd, mild cognitive impairment (mci), parkinson s disease, and alzheimer s disease (ad). Lipid peroxidation - induced oxidative dna damage is believed to contribute to neuronal death and neurological dysfunction . Previous studies have provided experimental evidence that increased levels of mda in peripheral blood are associated with development of ad and mci . Also, recent evidence suggests that elevated mda levels are a risk factor for cognitive decline in aged patients after orthopedic surgery and total hip - replacement surgery . Therefore, intervention using serum mda could be a primary prevention strategy for pocd . In the present study we have shown a steady increase in serum mda levels in the control group but not in the lidocaine group . S100 and nse are serum markers of neuronal injury and are increasingly used in diagnosis and prognosis of cognitive impairment after different kinds of surgery . S100, in astrocytes, is a calcium - binding protein that has been regarded as highly brain - specific . Normally, s100 cannot pass the blood - brain barrier to enter the blood stream . However, serum concentrations are increased after damage to central nervous cells as well as blood - brain barrier dysfunction . Studies have confirmed the value of s100 in assessment of cognitive deficits after various surgeries . Therefore, s100 protein release is a plausible candidate in assessment of incidence, course, and outcome of pocd . Nse is an isoenzyme of the glycolytic enzyme enolase, usually found in the cytoplasm of neurons and cells of neuro - endocrine differentiation . Our study has demonstrated that both the serum s100 protein and nse levels significantly increased at the end of the surgery and on postoperative day 3, suggesting that spine surgery may cause damage to brain tissue . Interestingly, s100 protein and nse levels were reduced after the administration of lidocaine, suggesting the neuroprotective effect of lidocaine . A limitation of this study is that we did not measure the serum concentration of lidocaine during or after surgery . An accepted therapeutic range is 2 to 5 g / ml, and detrimental effects, including arrhythmia, tremors, confusion, visual disturbances, impaired concentration, or even seizures and coma, usually occur at levels above 6 to 10 . However, we did not find any adverse effects caused by lidocaine in our study, which could be attributed to the relatively low lidocaine dose . Our results indicate that lidocaine treatment attenuated cognitive impairment in elderly patients undergoing spine surgery . Furthermore, serum il-6, s100, nse, and mda were involved in the mechanism underlying the therapeutic effect of lidocaine on cognitive function . Therefore, the results indicated that lidocaine may be an effective neuroprotective agent for the treatment of pocd . Further clinical investigation is warranted to determine its potential on the subsequent development and progression of pocd.
|
The hippocampal formation, a well - defined region of brain involved in the spatial learning performance, is especially vulnerable to the process of aging and shows early signs of age - related changes in the function and structure (1, 2). Previous studies indicated a decrease in the volume of the hippocampus during normal aging (3, 4). Other investigations showed that the dendritic atrophy occurs in the hippocampus during normal aging (5, 6). Furthermore, the reductions in the cerebral blood flow (7) and in the cerebral levels of many blood - borne trophic factors (8, 9) are also reported in the aged in comparison with young animals . Such changes in the hippocampus are suggested to represent a neurobiological substrate of hippocampal - dependent memory deficits (10, 11). Nowadays, a major focus in research on aging is concentrated on finding drugs to improve declining memory . The extract of ginkgo biloba (egb) leaves is one of the most common phytomedicines in many countries and preparations from the leaf of g. biloba have been therapeutically used to treat decreased cerebral blood flow, memory loss and mental confusion (1215). The egb could also improve performance in cognitive tasks in old animals (1618). The standardized egb, code - named egb 761, contains 24% flavonoids (quercetin, kaempferol and isorhamnetin) and 6% terpenoids (ginkgolides a, b and c and bilobalides) proanthocyanidins, and organic acids (19, 20). Egb has a relatively low molecular weight also, and it passes through the blood - brain barrier and induces a wide range of pharmacological actions on the central nervous system (21). The beneficial effects of egb 761 were supported by a variety of in vitro and in vivo studies (22). It improves the local cerebral blood flow by its anti - platelet activating factor (paf) activity (23), neutralizes oxidative free radicals through antioxidative properties (24, 25), acts as anti - stress agent by inhibiting corticosteroid synthesis (26), and stimulates cell growth by growth factor upregulation (27). In spite of numerous studies that indicated the positive effects of egb on neurobiological substrate of memory improvement, it is well known that the hippocampal dendritic systems play a critical role in spatial learning and memory . On the basis of this background, the experiments reported here were designed to determine whether long - term administration of egb has a positive impact on the structures of hippocampus in aged rats . In this study, cavalieri principle (28), was employed to estimate the volumes of constituents layers of cornu ammonis (ca) and a quantitative golgi study was used to analysis of dendritic branches of hippocampal pyramidal cells . Male albino wistar rats aged 24 months weighing 570600 g, acquired from the animal house of isfahan medical school, isfahan, iran, were maintained in standard laboratory conditions with food and water ad libitum under a 12:12 light - dark cycle (lights on at 7:00 am). The animals were randomly divided into experimental and control groups (n=8 in each group). The animals in experimental group orally received egb leaves (ginkogol, goldaru phytolaboratory, isfahan, iran) in the single dose of 100 mg / kg per day for 8 weeks (21, 26). Solution of egb in water was prepared fresh daily and administered orally in a volume of 2 ml / kg body weight . All animal experiments and housing was performed in accordance with rules approved by the ethical committee of shahid sadoughi medical university of iran . At the end of the experimental period, they were transcardially perfused with a phosphate - buffered solution of 4% formaldehyde and 1% glutaraldehyde and decapitated . Each hemisphere was serially sectioned in a coronal plane at 100 m with a calibrated vibratome (diapath, italy) and the sections were collected along the entire extent of the hippocampus . Starting at a random position, every 5 section with an interval of 500 m was taken . The dry sections were stained using hematoxylin: diped in distilled water, 4 min in hematoxylin, and washed in running tap water for 10 min . After rinsing they were dehydrated in 70% (10 min), 96% (2 5 min) and 99% ethanol (2 8 min), cleared 15 min in xylene; and coverglasses were mounted . Discrimination between the different subdivisions of the hippocampal formation was made according to cell morphology (figure 1). The volumes of the constituent layers of ca i.e. Oriens, pyramidal and radiatum lacunosum moleculare, were estimated on the basis of the cavalieri principle (28). The cross sectional areas of the layers were estimated by point - counting principle with a projection microscope (zeiss, germany) using a 4x objective lens at a final magnification of 64. a grid of systematic uniform test points, 30 mm apart, was randomly superimposed on each image . Each point represented an area, a (p) = 0.22 mm, in the section plane . The number of points hitting the layers, p, was multiplied with the area associated with each point, a (p), to obtain an unbiased estimate of sectional area of each profile . The reference volume, v (ref), was calculated from the following relationship, where t represents the intersection distance; v (ref) = t. p. a(p) = t. a low magnification micrograph of a hematoxylin stained section through the hippocampus of rat shows its different subregions and the layers of cornu ammonis . Dg; dentate gyrus ca; cornu ammonis, or; oriens, py; pyramidal, rad; radiatum lmol; lacunosum+molecular . Scale bar indicates 400 m no areal shrinkage correction was used in the study because of the insignificant magnitude of the shrinkage and because no difference in shrinkage was found between groups (mean areal shrinkage of 5% was detected). Sections were processed according to a modified version of the single - section golgi impregnation procedure (29). Hippocampal sections were incubated in 3% potassium dichromate in distilled water overnight . After rinsing in distilled water, the sections were mounted on plain slides and a coverslip was glued over the sections at four corners . They were incubated in 1.5% silver nitrate in distilled water overnight in darkness . On the following day, the slide assemblies were dismantled, tissue sections rinsed in distilled water and then dehydrated first in 95% ethanol followed by absolute ethanol . The sections were then cleared in xylene, mounted onto gelatinized slides and coverslipped . From the hippocampal pyramidal cell layer, 10 pyramids of the ca3 and ca1 regions were selected and pooled per animal in a single group . The morphological criteria used for selecting the neurons to be measured were as follows (30): (i) dark and consistent impregnation throughout the extent of dendrites; (ii) cell bodies located in the middle part of the section thickness in order to minimize branch segments cut off at the plan of the section; and (iii) relative isolation from other neighboring impregnated cells, blood vessels and silver deposits . Because these criteria were fulfilled solely by apical dendrites, the basal dendritic trees of pyramidal cells were not included in the estimations . The presence of cut terminal segments on a neuron was not considered as a criterion for its exclusion from the estimations because the elimination of these neurons would have biased the sample towards smaller neurons . Since, we found that in the golgi sections of experimental and control rats there was a similar percentage of cut branches (10%), the likelihood that these cut branches could have interfered with the final results is negligible . We observed on average 8% shrinkage of the sections in each group and these values were employed as a correction factor for the length measurements . The apical dendritic trees of ca3 and ca1 pyramidal cells were traced by hand with the aid of a camera lucida (leitz orthoplan, wetzlar, germany), at a final magnification of 640 . The centrifugal ordering of dendritic trees was used to estimate the number of dendritic segments per cell (31). The total number of segments per cell was calculated by summing the number of dendritic segments of all orders . For metric analysis, the dendritic length was measured using a zeiss interactive digitizing analysis system (zeiss, germany). A grid of concentric was placed over the camera lucida drawing of the dendritic field and the number of dendritic intersections crossing each concentric ring was counted . The concentric rings were calculated at intervals of 25 m for both ca3 and ca1 pyramidal cells . Whenever the dendrites extended beyond 375 m (circle 15), they were included in circle 15 . Student s t - test was performed on data from the experimental and control rats . Male albino wistar rats aged 24 months weighing 570600 g, acquired from the animal house of isfahan medical school, isfahan, iran, were maintained in standard laboratory conditions with food and water ad libitum under a 12:12 light - dark cycle (lights on at 7:00 am). The animals were randomly divided into experimental and control groups (n=8 in each group). The animals in experimental group orally received egb leaves (ginkogol, goldaru phytolaboratory, isfahan, iran) in the single dose of 100 mg / kg per day for 8 weeks (21, 26). Solution of egb in water was prepared fresh daily and administered orally in a volume of 2 ml / kg body weight . All animal experiments and housing was performed in accordance with rules approved by the ethical committee of shahid sadoughi medical university of iran . At the end of the experimental period, all rats were deeply anesthetized intraperitoneally with urethan (merk, germany). They were transcardially perfused with a phosphate - buffered solution of 4% formaldehyde and 1% glutaraldehyde and decapitated . Each hemisphere was serially sectioned in a coronal plane at 100 m with a calibrated vibratome (diapath, italy) and the sections were collected along the entire extent of the hippocampus . Starting at a random position, every 5 section with an interval of 500 m was taken . The dry sections were stained using hematoxylin: diped in distilled water, 4 min in hematoxylin, and washed in running tap water for 10 min . After rinsing they were dehydrated in 70% (10 min), 96% (2 5 min) and 99% ethanol (2 8 min), cleared 15 min in xylene; and coverglasses were mounted . Discrimination between the different subdivisions of the hippocampal formation was made according to cell morphology (figure 1). The volumes of the constituent layers of ca i.e. Oriens, pyramidal and radiatum lacunosum moleculare, were estimated on the basis of the cavalieri principle (28). The cross sectional areas of the layers were estimated by point - counting principle with a projection microscope (zeiss, germany) using a 4x objective lens at a final magnification of 64. a grid of systematic uniform test points, 30 mm apart, was randomly superimposed on each image . Each point represented an area, a (p) = 0.22 mm, in the section plane . The number of points hitting the layers, p, was multiplied with the area associated with each point, a (p), to obtain an unbiased estimate of sectional area of each profile . The reference volume, v (ref), was calculated from the following relationship, where t represents the intersection distance; v (ref) = t. p. a(p) = t. a low magnification micrograph of a hematoxylin stained section through the hippocampus of rat shows its different subregions and the layers of cornu ammonis . Dg; dentate gyrus ca; cornu ammonis, or; oriens, py; pyramidal, rad; radiatum lmol; lacunosum+molecular . Scale bar indicates 400 m no areal shrinkage correction was used in the study because of the insignificant magnitude of the shrinkage and because no difference in shrinkage was found between groups (mean areal shrinkage of 5% was detected). Sections were processed according to a modified version of the single - section golgi impregnation procedure (29). Hippocampal sections were incubated in 3% potassium dichromate in distilled water overnight . After rinsing in distilled water, the sections were mounted on plain slides and a coverslip was glued over the sections at four corners . They were incubated in 1.5% silver nitrate in distilled water overnight in darkness . On the following day, the slide assemblies were dismantled, tissue sections rinsed in distilled water and then dehydrated first in 95% ethanol followed by absolute ethanol . The sections were then cleared in xylene, mounted onto gelatinized slides and coverslipped . From the hippocampal pyramidal cell layer, 10 pyramids of the ca3 and ca1 regions were selected and pooled per animal in a single group . The morphological criteria used for selecting the neurons to be measured were as follows (30): (i) dark and consistent impregnation throughout the extent of dendrites; (ii) cell bodies located in the middle part of the section thickness in order to minimize branch segments cut off at the plan of the section; and (iii) relative isolation from other neighboring impregnated cells, blood vessels and silver deposits . Because these criteria were fulfilled solely by apical dendrites, the basal dendritic trees of pyramidal cells were not included in the estimations . The presence of cut terminal segments on a neuron was not considered as a criterion for its exclusion from the estimations because the elimination of these neurons would have biased the sample towards smaller neurons . Since, we found that in the golgi sections of experimental and control rats there was a similar percentage of cut branches (10%), the likelihood that these cut branches could have interfered with the final results is negligible . We observed on average 8% shrinkage of the sections in each group and these values were employed as a correction factor for the length measurements . The apical dendritic trees of ca3 and ca1 pyramidal cells were traced by hand with the aid of a camera lucida (leitz orthoplan, wetzlar, germany), at a final magnification of 640 . The centrifugal ordering of dendritic trees was used to estimate the number of dendritic segments per cell (31). The total number of segments per cell was calculated by summing the number of dendritic segments of all orders . For metric analysis, the dendritic length was measured using a zeiss interactive digitizing analysis system (zeiss, germany). A grid of concentric was placed over the camera lucida drawing of the dendritic field and the number of dendritic intersections crossing each concentric ring was counted . The concentric rings were calculated at intervals of 25 m for both ca3 and ca1 pyramidal cells . Whenever the dendrites extended beyond 375 m (circle 15), they were included in circle 15 . Student s t - test was performed on data from the experimental and control rats . The results showing the effect of egb on the volumes of the layers of the ca are represented in the table 1 . Statistical analysis revealed significant effect of egb on the volume of the layers of ca except in the oriens layer . Comparisons revealed that egb - treated aged rats had greater volumes than controls in the layers of pyramidal and radiatum lacunosum moleculare in ca3 and ca1 pyramidal fields (table 1). This study also showed that the volume of the whole hippocampal formation was significantly larger in egb - treated aged rats than their controls (table 1). Volumes of the layers (mm) of the cornu ammonis (ca) in the extract of ginkgo biloba (egb)-treated rats and respective controls . All values expressed as mean (sd) a significant increase of the dendritic branches of ca3 and ca1 pyramidal cells was present in sections from the egb - treated aged rats as compared to the controls (figure 2). Student s t - test revealed significant effect of treatment on the total number of segments per cell in both ca3 and ca1 pyramidal cells (table 2). The dendritic segment number of ca3 and ca1 pyramidal cells was respectively 15.6% and 15.2% higher in the experimental group than in controls . Results also showed that, in these neurons, the total dendritic length was larger in the egb - treated compared to control animals . Camera lucida drawing of golgi - impregnated ca3 (a, b) and ca1 pyramidal cells (c, d). Neurons from control rats are shown in the left column (a, c), from extract of ginkgo biloba (egb)-treated rats in the right column (b, d). Note an increase in the dendritic arborizations in egb - treated aged rats compared with controls . Scale bar=50 m (applies to all frames) comparison of dendritic trees (meansd) of extract of ginkgo biloba (egb)-treated and control rats statistical analyses revealed significant effect of treatment on the dendritic branching density of ca3 pyramidal cells in circles 1015 (figure 3); in addition, it indicated a significant difference in the dendritic branching density of ca1 pyramidal cells in circles 59 (figure 3). In both cases, the dendritic intersections were greater in egb - treated than in the control aged rats . Graphic representation of the dendritic branching density of ca3 and ca1 hippocampal neurons of extract of ginkgo biloba (egb)-administrated aged rats and control (con). The present study was designed to determine whether chronic administration of egb affects the structure of ca and the morphology of hippocampal pyramidal cells in aged rats . Our study showed that, 8 week treatment with egb increases the volumes of the layers of pyramidal and radiatum lacunosum moleculare in ca3 and ca1 pyramidal fields and the whole hippocampus in aged rats . Quantitative morphological analysis also indicated that there were increases in both the number and the length of dendritic segments associated with an increase in the dendritic branching density of ca3 and ca1 pyramidal cells in egb - treated aged rats . Although in this study we did not investigate the mechanisms underlying the beneficial effects of egb on the morphology of ca structure of aged rats, several lines of evidence could help to explain the neuroprotective effects of egb . Previous studies showed that chronic administration of egb 761 inhibits stress - induced corticosterone hypersecretion (26). It is reported that hippocampal neurons contain high levels of corticosteroid receptors (32) and it also demonstrated that glucocorticoids are regulators of neurotrophins in the hippocampus (33). Therefore, it could be proposed that a decrease in exposure to glucocorticoid concentrations following a chronic treatment with egb has a neuroprotective effect and lowers neurotoxicity and neuronal degeneration particularly in the ca3 subfield (34). In addition, early studies revealed that treatment with egb 761 increased the local cerebral blood flow in nearly all brain regions (35), and it may lead to elevated levels of many blood - borne trophic factors in these regions . It is reported that growth hormone (gh) stimulates most target cells to grow in size, and gh receptors are present in the brain (36). Thus, it is reasonable to speculate that the observed increase in both the hippocampal size and the extent of dendritic arbors might be the result of availability of neurotrophic factors such as gh . Positive effects of egb on the structure of hippocampal neurons may be related to its antioxidant properties (24, 25), antiapoptotic effect (37, 38) and inhibition of beta amyloid production and aggregation (39, 40). Protective effects of egb have been shown after experimentally ischemia (41, 42), for nitric oxide - induced toxicity (43) and -amyloid - induced cell death in hippocampal cells (44). In the present study, we used the total egb because various chemical constituents of egb, although active in pharmacological models, do not generally reproduce the actions of the total extract (21). While neuroprotective effects of egb and its components have been well documented only a few studies have examined the effect of egb on the structure of central nervous system . Barkats et al (45) examined the effects of egb 761 on age - related changes in the projection fields of hippocampal mossy fibers in old female mice . They reported that treatment with egb 761 (50 mg / kg / day) for 7 months led to a significant increase in the projection field of intra- and infrapyramidal mossy fibers in the ca3 field and to a significant decrease in the area of the stratum radiatum . Our findings on old male wistar rats is in agreement with the result of barkat s study (45), where they found significant increase in the number of ca3 dendritic arbors following long - term treatment with egb . However, they found a significant reduction in the area of the stratum radiatum, which is in conflict with our results showing a significant increase in the volume of radiatum layer in the ca3 region of egb - treated aged rats . This discrepancy could be related to several possible factors particularly the methodology employed to estimate the size of the ca3 layer . Although the size of a layer may be estimated in a number of ways, volume measurement, which was used in our study, provides a 3-dimensional analysis of structures based on observations made on two - dimensional sections . Other parameters including transsectional area depend not only upon size, but also on assumptions about the structure of the shape and orientation (28). Our results showed that long - term administration of egb in the aged wistar rats had neuroprotective effects and enhanced dendritic arbors in ca pyramidal cells of hippocampus . Findings of our study provide a neuroanatomical basis that is useful in explaining improvements in hippocampal - dependent cognitive tasks in both humans and experimental animals treated with egb . The findings of the present study also support therapeutic potential of egb in age - associated neurodegenerative diseases.
|
Percutaneous endoscopic gastrostomy (peg) tube is an important method of providing enteral nutrition to patients with swallowing disorders and those who need long - term enteral nutritional support . Because of its ease and safety of placement, the number of patients with peg tubes continues to rise . Most of the complications associated with peg tube are minor, but several have the potential to cause significant morbidity if not recognized and treated correctly . These two case reports illustrate one of the problems related to peg tube migration to the duodenum and its associated complications, including disturbance of the biliary flow and acute pancreatitis . A 76-year - old hispanic female who is a nursing home resident, with a past medical history of alzheimer dementia, diabetes mellitus, coronary artery disease, hypothyroidism, and oropharyngeal dysphagia for which she had a peg tube inserted 1 year before her admission . Her peg tube was replaced in the nursing home with a balloon gastrostomy tube shortly before her presentation . The patient was sent from the nursing home for abdominal pain of 1 day duration, the pain was associated with nonbloody nonbilious vomiting, without any change in bowel habits, fever, or chills . Her list of medications included tylenol, plavix, diltiazem, insulin lispro, levothyroxine, simvastatin, and esomeprazole . Initial vital signs showed blood pressure of 145/70 mmhg, pulse rate of 110 beat / min, and respiratory rate was 18 breaths / min, oxygen saturation was 98% on room air . Physical examination was significant for tachycardia, normal heart sounds with no murmurs or added sounds, normal breath sounds and a soft abdomen with epigastric tenderness and active bowel sounds, peg tube was noted in place . Laboratory studies showed hemoglobin of 12.1 g / dl, white blood cell (wbc) 8900/l (normal, 450011,000/l), platelets 322,000/l (normal, 150,000450,000/l), creatinine 1.53 mg / dl (normal, 0.61.3 mg / dl), urea 60 mg / dl, glucose 381 mg / dl, calcium 9.3 mg / dl, albumin 3.3 g / dl, alkaline phosphatase 248 u / l (normal, 50136 u / l), total bilirubin 0.5 mg / dl (normal, 0.31.2 mg / dl), aspartate aminotransferase 22 u / l (normal, 1030 l (normal, 31210 u / l), serum triglyceride, and serum calcium were within normal limits . Computed tomography (ct) scan of the abdomen [figure 1] revealed the suboptimal position of the peg tube, with the balloon and tip in the second / third portion of the duodenum, without evidence of pancreatic inflammation . A diagnosis of acute pancreatitis was made based on high lipase and abdominal pain . At bedside, the peg tube was pulled back to stomach and secured to the abdominal wall . The patient was treated conservatively with intravenous fluid and analgesics . Within the following 2 days, all of her symptoms improved, with normalization of her lipase, alkaline phosphatase, and creatinine . The patient was discharged after 2 days, and she did not have any further episodes of pancreatitis . Computed tomography scan of the abdomen showing the suboptimal position of the percutaneous endoscopic gastrostomy tube, with the balloon and tip in the second / third portion of the duodenum a 42-year - old male with past medical history of traumatic brain injury and quadriplegia had a gastrostomy tube placement 2 years ago for enteral feeding, he presented to our service with 1 day history of epigastric pain, associated with fever, chills . On initial evaluation, the physical examination showed vital signs within normal limits excepts for sinus tachycardia, unremarkable chest examination, abdominal examination showing gastrostomy tube in the mid - epigastric area, tenderness on superficial palpation in the epigastric area, no guarding, or rigidity . Laboratory studies showed wbc 16,000/l (normal, 450011,000/l), platelets 165,000/l (normal, 150,000450,000/l), creatinine 1.75 mg / dl (normal, 0.61.3 mg / dl), blood urea nitrogen 25 mg / dl (normal, 718 mg / dl), glucose 135 mg / dl, calcium 9 mg / dl, albumin 3.6 g / dl (normal, 3.55 g / dl), alkaline phosphatase 143 u / l (normal, 50136 u / l), total bilirubin 3.3 mg / dl (normal, 0.31.2 mg / dl), aspartate aminotransferase 205 u / l (normal, 1030 u / l), alanine aminotransferase 99 u / l (normal, 1040 u / l), lipase 12,883 u / l (normal, 31210 u / l), amylase 1996 u / l (normal, 25115 u / l), serum triglyceride, and serum calcium were within normal limits . Ct of the abdomen showed the migration of the peg tube to the second part of the duodenum with compression on ampulla of vater, pancreatic head edema, and peripancreatic inflammatory changes, suggestive of acute pancreatitis [figure 2]. Computed tomography of the abdomen showed migration of the percutaneous endoscopic gastrostomy tube to the second part of the duodenum although the gastrostomy tube was repositioned and pulled directly after the diagnosis was made, the patient had a complicated course in the hospital, with septic shock, multi - organ failure, third spacing, and capillary leak syndrome . We think that the poor outcome was mostly due to the delay in the diagnosis of acute pancreatitis . A 76-year - old hispanic female who is a nursing home resident, with a past medical history of alzheimer dementia, diabetes mellitus, coronary artery disease, hypothyroidism, and oropharyngeal dysphagia for which she had a peg tube inserted 1 year before her admission . Her peg tube was replaced in the nursing home with a balloon gastrostomy tube shortly before her presentation . The patient was sent from the nursing home for abdominal pain of 1 day duration, the pain was associated with nonbloody nonbilious vomiting, without any change in bowel habits, fever, or chills . Her list of medications included tylenol, plavix, diltiazem, insulin lispro, levothyroxine, simvastatin, and esomeprazole . Initial vital signs showed blood pressure of 145/70 mmhg, pulse rate of 110 beat / min, and respiratory rate was 18 breaths / min, oxygen saturation was 98% on room air . Physical examination was significant for tachycardia, normal heart sounds with no murmurs or added sounds, normal breath sounds and a soft abdomen with epigastric tenderness and active bowel sounds, peg tube was noted in place . Laboratory studies showed hemoglobin of 12.1 g / dl, white blood cell (wbc) 8900/l (normal, 450011,000/l), platelets 322,000/l (normal, 150,000450,000/l), creatinine 1.53 mg / dl (normal, 0.61.3 mg / dl), urea 60 mg / dl, glucose 381 mg / dl, calcium 9.3 mg / dl, albumin 3.3 g / dl, alkaline phosphatase 248 u / l (normal, 50136 u / l), total bilirubin 0.5 mg / dl (normal, 0.31.2 mg / dl), aspartate aminotransferase 22 u / l (normal, 1030 l (normal, 31210 u / l), serum triglyceride, and serum calcium were within normal limits . Computed tomography (ct) scan of the abdomen [figure 1] revealed the suboptimal position of the peg tube, with the balloon and tip in the second / third portion of the duodenum, without evidence of pancreatic inflammation . A diagnosis of acute pancreatitis was made based on high lipase and abdominal pain . At bedside, the peg tube was pulled back to stomach and secured to the abdominal wall . The patient was treated conservatively with intravenous fluid and analgesics . Within the following 2 days, all of her symptoms improved, with normalization of her lipase, alkaline phosphatase, and creatinine . The patient was discharged after 2 days, and she did not have any further episodes of pancreatitis . Computed tomography scan of the abdomen showing the suboptimal position of the percutaneous endoscopic gastrostomy tube, with the balloon and tip in the second / third portion of the duodenum a 42-year - old male with past medical history of traumatic brain injury and quadriplegia had a gastrostomy tube placement 2 years ago for enteral feeding, he presented to our service with 1 day history of epigastric pain, associated with fever, chills . The physical examination showed vital signs within normal limits excepts for sinus tachycardia, unremarkable chest examination, abdominal examination showing gastrostomy tube in the mid - epigastric area, tenderness on superficial palpation in the epigastric area, no guarding, or rigidity . Laboratory studies showed wbc 16,000/l (normal, 450011,000/l), platelets 165,000/l (normal, 150,000450,000/l), creatinine 1.75 mg / dl (normal, 0.61.3 mg / dl), blood urea nitrogen 25 mg / dl (normal, 718 mg / dl), glucose 135 mg / dl, calcium 9 mg / dl, albumin 3.6 g / dl (normal, 3.55 g / dl), alkaline phosphatase 143 u / l (normal, 50136 u / l), total bilirubin 3.3 mg / dl (normal, 0.31.2 mg / dl), aspartate aminotransferase 205 u / l (normal, 1030 u / l), alanine aminotransferase 99 u / l (normal, 1040 u / l), lipase 12,883 u / l (normal, 31210 u / l), amylase 1996 u / l (normal, 25115 u / l), serum triglyceride, and serum calcium were within normal limits . Ct of the abdomen showed the migration of the peg tube to the second part of the duodenum with compression on ampulla of vater, pancreatic head edema, and peripancreatic inflammatory changes, suggestive of acute pancreatitis [figure 2]. Computed tomography of the abdomen showed migration of the percutaneous endoscopic gastrostomy tube to the second part of the duodenum although the gastrostomy tube was repositioned and pulled directly after the diagnosis was made, the patient had a complicated course in the hospital, with septic shock, multi - organ failure, third spacing, and capillary leak syndrome . We think that the poor outcome was mostly due to the delay in the diagnosis of acute pancreatitis . Peg tube placement has become the preferred method to provide nutritional support for patients requiring long - term (> 46 weeks) enteral nutrition, due to its ease and safety of placement . Especially for those with oropharyngeal dysphagia and it is estimated that 10% of nursing home residents and about 1.7% of medicare patients over the age of 85 years undergo gastrostomy tube placement . The incidence of short- and long - term complications related to peg actual insertion is low . The overall complication rate has been reported to be between 4% and 23.8%, with a procedure - related mortality of 02% . The most common complications related to established peg tubes are peristomal infection and leakage, buried bumper syndrome, inadvertent removal, and fistulous tracts formation . More serious complications are infrequent and include peritonitis, necrotizing fasciitis, and aspiration . Acute pancreatitis secondary to migrated replacement gastrostomy tubes has also been reported in the literature . To the best of our knowledge, a total of 11 cases were reported, four of these cases were reported in the period of 1986 until 2005 . Eight cases were additionally reported in the period of 2005 until 2014 . Whether this is due to increased prevalence of peg tube use, increased awareness or even increased reporting of this potential complication is unclear . Brauner et al . Described 11 cases of reported acute pancreatitis caused by tube dislodgement in the duodenum, six of them had foley catheter, three had balloon gastrostomy with external disk bumper, and two had peg with external disk bumper . All mentioned cases were attributed to replacement of peg tube, none to new insertion . While time from the replacement of the tube to the onset of symptoms varied widely from 1 day to 1 year . Shah et al . Emphasized the importance of avoiding the use of foley catheter as permanent replacement options, as it was associated more with migration and subsequent pancreatitis . In our first case, which is the more frequent of the two, the peg tube was replaced shortly before pancreatitis, in the setup of a medical facility without any immediate complications and with no radiographic confirmation, then it was secured with an outer bumper and the balloon was inflated . We hypothesize that the tube migrated to the duodenum due to peristalsis or it was mistakenly placed in the duodenum when it was replaced . While difficult to prove causality, the rapid response of symptoms and surrogate endpoints with correction of the peg tube position, especially with the continuation of all of the patient's medications, favors peg tube disturbance of biliary flow as a precipitating factor to acute pancreatitis . Our two cases represent an addition to the literature and illustrate the potential complications associated with peg tube migration to the duodenum . Early recognition and management are essential to optimize outcomes . To avoid this complication we recommend periodic examination and documentation of the distance of the balloon from the skin to document the position of the tubes or any inadvertent migration of the tubes . The peg tube was secured to the abdominal wall with stitches in the first case only . Furthermore, the use of foley catheters as permanent replacement tubes should be discouraged as they are more likely to migrate, because they lack the external bumper to secure the tube to the abdominal wall, and they also lack the markings on the surface of the catheter which does not allow measurements of the depth of balloon placement . The exact incidence of peg tube migration to the duodenum is unclear, and early recognition and treatment of this complication is crucial . The physician should be aware of the symptoms and signs of peg tube migration and their complications, and use the appropriate diagnostic studies to confirm the diagnosis, especially in the setting of associated acute pancreatitis.
|
Psoriasis is a chronic t - cell - mediated inflammatory disease affecting the skin and joints . Recent epidemiological studies have shown that psoriasis patients are prone to develop cardiovascular and other metabolic syndromes . On the other hand, a variety of cutaneous disorders may be associated with psoriasis . Occurrence of autoimmune blistering disease in psoriasis is rare; here we report a case of coexistence of psoriasis with bullous pemphigoid (bp). A 57-year - old male presented with history of blisters all over the body of 10 days duration . The blisters were noticed first on the arm and later spread to other parts of the body . He had used both modern medicines and alternative medicines for psoriasis for a variable amount of time; in particular, antipsoriatic treatment was discontinued 26 months before the presentation . Cutaneous examination revealed tense bullae and crusted erosions on upper and lower limbs [figure 1]. Blisters were present both over the scaly plaques as well as on the normal skin [figure 2]. The skin biopsy from scaly plaque was consistent with the diagnosis of psoriasis and showed hyperkeratosis, parakeratosis, acanthosis, regular elongation of rete ridges . Direct immunofluorescence of the perilesional skin showed a strong linear basement membrane zone (bmz) band with c3 and a weak bmz band with igg [figure 3]; salt split study of skin biopsy (direct salt split) showed bmz band on the epidermal side (roof pattern) confirming the diagnosis of bp [figure 4]. Indirect immunofluorescence using human skin as substrate showed linear bmz band in serial dilutions of 1:10 and 1:80 . Patient was treated with methotrexate 10 mg / week orally along with topical betamethasone in cream base (0.3%). At 1-month follow - up, psoriatic lesions have improved; he used to get occasional new blisters . At 3-month follow - up, both conditions have subsided with postinflammatory pigmentation . Hyperpigmented scaly plaques on the thighs; single bulla on the normal skin on the left thigh . Linear basement membrane zone band with igg seen on the epidermal side of the salt split skin (dif, x20). Since the initial description of coexistence of bullous disease and psoriasis by bloom in 1929, several autoimmune bullous diseases associated with psoriasis have been reported in literature . These include pemphigus vulgaris (pv), pemphigus foliaceus (pf), pemphigus herpetiformis, bullous pemphigoid (bp), linear bullous dermatoses (lad), cicatricial pemphigoid (cp), epidermolysis bullosa acquisita (psoriasis bullosa acquisita) and a novel bullous dermatoses targeting 200 kda molecule present in the lower lamina lucida. [69] among these, bp is the most frequent condition to be associated with psoriasis (psoriasis pemphigoides); less than 50 cases of such association have been described in the english literature . This association is reported to be more common among men than women with an average age of onset at 63 years . In most cases, psoriasis preceded the development of bp, with an average time interval of 20 years (range, 160 years) between the two conditions . Whether the treatment of psoriasis, pathological events at the basement membrane zone (bmz) in psoriasis itself, common immunological or immunogenetic mechanisms, or a coincidence of multiple factors precipitates the autoimmune bullous diseases in these patients remain controversial . Since the coexistence was seen in patients who received wide range of treatment for psoriasis as well as in untreated patients, it is difficult to incriminate a single agent as a potentially causative factor in the development of bp . Reduced barrier function of the diseased psoriatic epidermis, combined with the irritant effects of therapies administered for psoriasis, such as anthralin, tar, and ultraviolet light, together with a low - grade immunologic bmz insult, may precipitate blister formation . Cram and fukuyama demonstrated the triggering role of ultraviolet light b (uvb) in the induction of bp . Psoralen and ultraviolet light a (puva) therapy is also known to induce blisters mimicking bp . This molecule, however, has been withdrawn now from the market due to serious neurological side effects . Changes at the bmz in psoriasis itself may be responsible for precipitating the bullous disease . The presence of chronic inflammation, trafficking of activated lymphocytes and abundance of antigen presenting cells in psoriasis could unmask, expose or alter bmz antigens, giving rise to autoantibody production . Electron microscopy studies have shown a focal discontinuity and reduplication of the basal lamina in psoriasis . The concept of epitope spreading whereby tissue damage from a primary inflammatory process causes the release and exposure of a previously sequestered antigen, leading to a secondary autoimmune response against the newly released antigen, may provide us with a unifying explanation for the development of subepidermal bullous disorders . Common immunogenetic or immunological mechanisms may also play a crucial role in this disease association . Psoriasis has been associated with other autoimmune diseases such as discoid and systemic lupus erythematosus, myasthenia gravis, crohns disease and ulcerative colitis . It may be suggested that psoriasis provides a particular predisposition of the immune system that, under certain circumstances leads to autoimmune response . Circulating antibodies against components of the malpighian layer and stratum corneum have been detected in the serum of psoriatic patients . The dysregulation of t - cell activity in psoriasis might result in the induction of specific antibodies to basement membrane antigens . However, recent studies have established that th17 is the primary pathogenetic subset; this subset of t cell also plays a key role in autoimmunity . Other drugs that have shown to be beneficial include dapsone, azathioprine, cyclosporine, erythromycin with etretinate . We have treated our patient with methotrexate (10 mg per week). At 3-month follow - up we believe that this is the first case report of psoriasis vulgaris coexistent with bp in indian literature.
|
The incidence of inguinal hernia continues to increase, with 500,000 new inguinal hernias diagnosed annually . The most recent data available show that approximately 800,000 inguinal hernia operations, not including bilateral or recurrent repair, were performed in 2003 . Inguinal hernia repair is one of the cornerstones of general surgery practice, and in some practices, the most commonly performed elective procedure . Because the procedure is common, surgeons continue to look for innovative ways to improve outcomes . Several open techniques are still being used, and many surgeons believe that those are the most appropriate techniques for hernia repair in general . The most commonly used open techniques include herniotomy (in children) and the bassini, shouldice, mcvay, and lichtenstein methods . Increasingly, both physicians and patients prefer minimally invasive inguinal hernia repair to open procedures, most likely because of the association of laparoscopic operations with decreased pain, quicker return to work, better cosmesis, less inflammation, lower rates of infection, and higher rates of overall satisfaction . It has been estimated that 15% to 20% of inguinal hernia surgeries in the united states are repaired using a laparoscopic technique . Tension - free repair has become the gold standard for inguinal hernias because of lower recurrence rates and improved patient comfort . The two common variations of laparoscopic inguinal hernia repair are the transabdominal preperitoneal (tapp) and the total extraperitoneal (tep) approaches . Of the two, tep is the preferred approach because tapp, which involves entry through the abdomen into the peritoneal cavity, has been shown to have more postsurgical complications . As minimally invasive inguinal hernia repair becomes more common, the surgical community now debates the utility of mesh fixation versus nonfixation . The type of mesh that has been used most often is a smooth polyester or polypropylene mesh, which may move or slide if not secured . Fixation of mesh with tacks, screws, or clips has led to numerous postoperative complications, including bowel obstruction, vascular injury, and migration into the bladder . More commonly, fixation devices are strongly implicated as a cause of postherniorrhaphy pain and chronic inguinodynia (inguinal pain). Glues, such as cyanoacrylate and fibrin tissue glue, have also been proposed as viable alternatives to the more standard tissue - disrupting fixation method . They have been on the market since 2006 and have been used in both open and laparoscopic operations . Their use eliminates the complication risk, increased operation time, and expense that come with the mechanical fixation of implanted mesh . The popularity and increased use of self - adhesive mesh have been attributed to growing evidence of low rates of recurrence and postsurgical pain . A recent meta - analysis comparing progrip (self - adhesive) mesh (covidien, north haven, ct, usa) to suture mesh revealed that self - adhesive mesh outcomes are equivalent to those obtained with suture mesh in open inguinal hernia repair . Based on these considerations, many surgeons regard the use of mesh in inguinal hernia repair as beneficial, and advances in this area will benefit the field . However, there are limited published data on the use of self - adhesive mesh during tep hernia repair . We wanted to investigate this specific question, and thus, the purpose of this study was to present our experience and evaluate early outcomes of patients who had undergone tep inguinal hernia repair with self - adhesive mesh . Patients for the study were identified by staff from the surgical group's database by using laparoscopic hernia repair, parietex progrip mesh, preperitoneal inguinal hernia repair, and total extraperitoneal as search terms . For this retrospective study, data were collected for all patients who underwent elective tep laparoscopic inguinal hernia repair with parietex progrip mesh from april 4, 2010, through july 22, 2014 . Patients were further screened by using the international classification of diseases, ninth version, code 550.90 (550.92 in recurrent hernia repairs) and the current procedural terminology code 49650 for inguinal hernia repair . Emergent cases, minors (age, <18 years), and patients who had not undergone tep with progrip mesh were excluded from the study . Relative contraindications include lack of fitness for general anesthesia because of comorbidities (ie, severe chronic obstructive pulmonary disease or severe coronary arterial disease), pregnancy, and a history of lower abdominal surgery . Patient variables included demographics, body mass index (bmi), indication for hernia repair, surgical approach, type of hernia, conversion from laparoscopic surgery to open, and complications . A routine follow - up appointment was defined as a clinic appointment scheduled 2 weeks after the operation . Outcomes assessed included postoperative complications (infection, hematoma, notable perioperative pain, paresthesia, numbness, and early recurrence), hospital length of stay, time to return to work, and patient satisfaction . The primary end point was a composite score, which was the sum of events, including early recurrence, conversion, infection, paresthesia, postoperative pain, and mortality . All patients were catheterized to empty the bladder before the abdomen was prepped and draped . 2 . A 2-cm transverse infraumbilical skin incision was made, and dissection was carried down to identify the anterior rectus sheath, which was then penetrated . A finger was placed just below the anterior rectus sheath which was penetrated and passed inferiorly, staying above the rectus muscle . The spacemaker dissection balloon (covidien) was inserted through a port, followed by the camera . Under direct visualization with a 10-mm laparoscope, the blunt - tip balloon was inserted in the same plane and connected to the co2 supply, and the preperitoneal space was distended, allowing visualization of all anatomic landmarks: the inferior epigastric vessels, cooper's ligament, poupart's ligament, the pubic symphysis, and the lateral abdominal wall the spermatic cord, with the vas deferens medially and testicular vessels laterally, was identified . The hernia sac was then visualized, identified as direct or indirect, and reduced . 7 . The sac was dissected completely and mobilized posteriorly until the psoas muscle was identified . The abdominal wall was exposed laterally, the psoas muscle posteriorly, and cooper's ligament medially . A previously rolled 3.5 6-inch portion of progrip mesh was placed through the camera port directed toward the lateral abdominal wall . Brief steady pressure was applied by the surgeon to allow self - fixation while the mesh was unrolled . The mesh was affixed to the anterior abdominal wall, medial to the midline, covering the direct defect . The surgeon then proceeded to open the entire mesh to cover the internal ring, femoral ring, and touch the psoas muscle posteriorly . Most important, the surgeon ensured adherence of the mesh to the psoas muscle, to prevent the hernia sac from slipping beneath the mesh, which would have caused a recurrence . Descriptive statistical analysis was performed with spss, version 16 (spss inc ., chicago, il, usa) statistical software . The test was used for categorical variables, and logistic regression was used to analyze data with dichotomous outcomes . Patients for the study were identified by staff from the surgical group's database by using laparoscopic hernia repair, parietex progrip mesh, preperitoneal inguinal hernia repair, and total extraperitoneal as search terms . For this retrospective study, data were collected for all patients who underwent elective tep laparoscopic inguinal hernia repair with parietex progrip mesh from april 4, 2010, through july 22, 2014 . Patients were further screened by using the international classification of diseases, ninth version, code 550.90 (550.92 in recurrent hernia repairs) and the current procedural terminology code 49650 for inguinal hernia repair . Emergent cases, minors (age, <18 years), and patients who had not undergone tep with progrip mesh were excluded from the study . Relative contraindications include lack of fitness for general anesthesia because of comorbidities (ie, severe chronic obstructive pulmonary disease or severe coronary arterial disease), pregnancy, and a history of lower abdominal surgery . Patient variables included demographics, body mass index (bmi), indication for hernia repair, surgical approach, type of hernia, conversion from laparoscopic surgery to open, and complications . A routine follow - up appointment was defined as a clinic appointment scheduled 2 weeks after the operation . Outcomes assessed included postoperative complications (infection, hematoma, notable perioperative pain, paresthesia, numbness, and early recurrence), hospital length of stay, time to return to work, and patient satisfaction . The primary end point was a composite score, which was the sum of events, including early recurrence, conversion, infection, paresthesia, postoperative pain, and mortality . All patients were catheterized to empty the bladder before the abdomen was prepped and draped . 2 . A 2-cm transverse infraumbilical skin incision was made, and dissection was carried down to identify the anterior rectus sheath, which was then penetrated . A finger was placed just below the anterior rectus sheath which was penetrated and passed inferiorly, staying above the rectus muscle . The spacemaker dissection balloon (covidien) was inserted through a port, followed by the camera . Under direct visualization with a 10-mm laparoscope, the blunt - tip balloon was inserted in the same plane and connected to the co2 supply, and the preperitoneal space was distended, allowing visualization of all anatomic landmarks: the inferior epigastric vessels, cooper's ligament, poupart's ligament, the pubic symphysis, and the lateral abdominal wall . The spermatic cord, with the vas deferens medially and testicular vessels laterally, was identified . The hernia sac was then visualized, identified as direct or indirect, and reduced . 7 . The sac was dissected completely and mobilized posteriorly until the psoas muscle was identified . The abdominal wall was exposed laterally, the psoas muscle posteriorly, and cooper's ligament medially . 9 . A previously rolled 3.5 6-inch portion of progrip mesh was placed through the camera port directed toward the lateral abdominal wall . Brief steady pressure was applied by the surgeon to allow self - fixation while the mesh was unrolled . The mesh was affixed to the anterior abdominal wall, medial to the midline, covering the direct defect . The surgeon then proceeded to open the entire mesh to cover the internal ring, femoral ring, and touch the psoas muscle posteriorly . Most important, the surgeon ensured adherence of the mesh to the psoas muscle, to prevent the hernia sac from slipping beneath the mesh, which would have caused a recurrence . Descriptive statistical analysis was performed with spss, version 16 (spss inc ., chicago, il, usa) statistical software . The test was used for categorical variables, and logistic regression was used to analyze data with dichotomous outcomes . The initial database search identified 1281 patients for laparoscopic hernia repair from april 4, 2010, through july 22, 2014, of which 543 were excluded because they had undergone other types of hernia repair (figure 1). Seven hundred ten patients were screened for tep eligibility, and 70 were excluded because they had undergone tep with marlex mesh (phillips petroleum co., bartlesville, ok, usa), were under the age of 18, or had incomplete data . Further review excluded 7 patients because of conversion to open during surgery due to severe adhesions, an irreducible hernia sac, or a densely attached rectus sheath . Thus, 640 patients who underwent tep hernia repair with progrip self - adhesive mesh were analyzed . The percentage of obese patients (bmi 30) in the study was 24.4%, and 75.6% were not obese (bmi <30). There were 94 patients with direct hernia, 462 with indirect hernia, and 84 with a combination of direct and indirect hernias . The more frequent indication for repair was primary hernia (601; 93.9%) compared to recurrent hernia (39; 6.1%). Average operation time from incision to closure was 43.9 minutes (17; range, 2090). All patients were discharged the same day and were scheduled for a 2-week follow - up . Cohort study flow diagram showing patient selection and exclusion criteria and the number of patients included in the study analysis . Characteristics of patients who underwent tep inguinal hernia repair with self - adhesive, velcro - type progrip mesh (covidien, north haven, ct, usa). Unless otherwise specified, data are the number of patients, with the percentage of the study sample in parentheses . Group sizes for categories that are less than the total sample are shown . Abbreviations: chf, congestive heart failure; copd, chronic obstructive pulmonary disease; mi, myocardial infarction; tep, totally extraperitoneal . Early recurrence was reported by 1 patient (0.2%), who had recurrence within 2 weeks caused by slippage of the mesh and underwent reoperation . Seventeen had hematoma; of those, 2 underwent drainage at 2 weeks, 19 were treated expectantly, and 2 underwent drainage later . At the 2-week follow - up, most of the patients (92.2%) reported no more than minimal pain, whereas 7.8% had notable pain that was managed conservatively with oral analgesics . Data are for hernia procedure outcomes in patients treated with tep inguinal hernia repair with self - adhesive, velcro - type progrip mesh . Unless otherwise specified, data are the number of patients, with the percentage of the study sample in parentheses . Binary logistic regression analysis was performed to determine the relationship between the patient variables and composite score end points . We found that age, ethnicity, bmi, and type of insurance were not associated with composite score . Recurrent hernia, unilateral versus bilateral hernia, and anatomic side were associated with composite score . Compared with the left - side hernia group, patients who had right - side hernia were 1.54 times more likely to have 1 or more complications (composite end point), but the difference was not statically significant . However, when unilateral occurrence was used as the reference point, patients who had bilateral hernia were 2.8 times more likely to have 1 or more complications (95% ci 1.395.80; p <.004). The initial database search identified 1281 patients for laparoscopic hernia repair from april 4, 2010, through july 22, 2014, of which 543 were excluded because they had undergone other types of hernia repair (figure 1). Seven hundred ten patients were screened for tep eligibility, and 70 were excluded because they had undergone tep with marlex mesh (phillips petroleum co., bartlesville, ok, usa), were under the age of 18, or had incomplete data . Further review excluded 7 patients because of conversion to open during surgery due to severe adhesions, an irreducible hernia sac, or a densely attached rectus sheath . Thus, 640 patients who underwent tep hernia repair with progrip self - adhesive mesh were analyzed . The percentage of obese patients (bmi 30) in the study was 24.4%, and 75.6% were not obese (bmi <30). There were 94 patients with direct hernia, 462 with indirect hernia, and 84 with a combination of direct and indirect hernias . The more frequent indication for repair was primary hernia (601; 93.9%) compared to recurrent hernia (39; 6.1%). Average operation time from incision to closure was 43.9 minutes (17; range, 2090). All patients were discharged the same day and were scheduled for a 2-week follow - up . Cohort study flow diagram showing patient selection and exclusion criteria and the number of patients included in the study analysis . Characteristics of patients who underwent tep inguinal hernia repair with self - adhesive, velcro - type progrip mesh (covidien, north haven, ct, usa). Unless otherwise specified, data are the number of patients, with the percentage of the study sample in parentheses . Group sizes for categories that are less than the total sample are shown . Abbreviations: chf, congestive heart failure; copd, chronic obstructive pulmonary disease; mi, myocardial infarction; tep, totally extraperitoneal . Early recurrence was reported by 1 patient (0.2%), who had recurrence within 2 weeks caused by slippage of the mesh and underwent reoperation . Seventeen had hematoma; of those, 2 underwent drainage at 2 weeks, 19 were treated expectantly, and 2 underwent drainage later . At the 2-week follow - up, most of the patients (92.2%) reported no more than minimal pain, whereas 7.8% had notable pain that was managed conservatively with oral analgesics . Data are for hernia procedure outcomes in patients treated with tep inguinal hernia repair with self - adhesive, velcro - type progrip mesh . Unless otherwise specified, data are the number of patients, with the percentage of the study sample in parentheses . Binary logistic regression analysis was performed to determine the relationship between the patient variables and composite score end points . We found that age, ethnicity, bmi, and type of insurance were not associated with composite score . Recurrent hernia, unilateral versus bilateral hernia, and anatomic side were associated with composite score . Compared with the left - side hernia group, patients who had right - side hernia were 1.54 times more likely to have 1 or more complications (composite end point), but the difference was not statically significant . However, when unilateral occurrence was used as the reference point, patients who had bilateral hernia were 2.8 times more likely to have 1 or more complications (95% ci 1.395.80; p <.004). The laparoscopic tapp approach was first used in 1982 and was modified in the early 1990s . Its rapid rise in popularity worldwide was tempered by increased postoperative complications especially nerve and vascular injuries . With the increasing trend toward laparoscopic repair of inguinal hernia, few studies, either retrospective or prospective, have reported the efficacy of tep repair with progrip mesh . The present study represents a large private practice group's experience in patients with inguinal hernia who underwent this procedure . The principal finding of the study is that the tep approach is safe and effective . Comparison of complications such as nerve damage, small bowel obstruction, bladder injury, vascular injury, chronic pain, and hernia recurrence in both open and laparoscopic inguinal hernia repair with fixation are well chronicled . Progrip is a polyester mesh with a top layer of resorbable polylactic acid microgrips that integrates into the tissue, providing an alternative to mesh fixation complications in both open and laparoscopic inguinal hernia repair . Furthermore, the anticipated challenge in obtaining the technical skill (increased learning curve for tep compared with that for lichtenstein and tapp) needed for the tep method did not result in a significant increase in complication rates . We agree in our surgical practice that the learning curve for tep is longer than that needed for tapp and open inguinal hernia repair . As reported by others, once the tep method was mastered, the learning curve for the placement of progrip mesh was reduced considerably ., there was one case of conversion to open due to adhesion, with operation time from incision to closure ranging from 17 to 80 minutes . The surgical appeal of the laparoscopic tep approach is the low rate of postoperative pain and a faster return to work . The repair is much more durable than that of open approaches (recurrence range, 6.2%10%). In our study the major downsides of laparoscopic hernia repair are reported to be the increased risk of specific complications, including vascular injury, nerve injury, and migration of mesh; the necessity for mesh fixation with clips or screws; and increased operative time . It provides an alternative to mesh fixation, thereby eliminating possible glue or hardware complications with no increase in the recurrence rate . The findings in our study contribute to the growing body of knowledge that mesh can be used effectively most of the time without tacking, suturing, or fixation by other devices . In our experience, deployment of self - adhesive mesh did not require additional time compared to fixation of nongripping meshes . We chose progrip mesh to circumvent mesh migration, which can result in early recurrence . Progrip is a lightweight (38 g / m), macroporous (1.1 1.7 mm), polyester mesh with resorbable polylactic acid microgrips . Its hydrophilic, macroporous, polyester monofilament features enhance fast and durable tissue ingrowth . Also its characteristic stickiness offers the crucial advantage that it can adhere to the psoas muscle posteriorly and the peritoneum cannot slip beneath the mesh, which is one of the principal causes of early recurrence . The follow - up period in this study was 2 weeks; mesh migration usually appears as an early recurrence, as in the case of 1 patient in this series . Morrison and jacobs examined recurrence at 1, 3, and 52 weeks after surgery . Only one patient had recurrence at 1 week, with no additional recurrence in the 3- and 52-week follow - ups . Another study, however, showed no recurrence at 2 weeks, 1 month, and 1 year after surgery . Koch et al reported that nonfixation (self - adhesive) mesh was not associated with an increased recurrence rate, postoperative complications, or increased cost . Messaris et al reported that general laparoscopic surgeons using the tep approach can obtain improved patient outcomes with less pain, low recurrence rates, and a low prevalence of chronic pain . These results are not limited to specialized hernia centers but appear to be consistent with the observations described in our study . The study is limited in that it is retrospective, without a long - term follow - up . The typical long - term follow - up after inguinal hernia repair is from 2.5 to 5 years . Our evaluation of the short - term recurrence rate is a measure of the surgeon's technical skill, which may be a proxy indicator for long - term effectiveness of the repair, since a poorly performed surgical repair with short - term recurrence is unlikely to have a favorable outcome 2 to 3 years after the surgery . However, the studies referenced in this paper demonstrate that recurrence with the tep procedure occurs early, with no additional recurrence during long - term follow - up . In routine surgical practice, these procedures are performed as elective outpatient surgeries, and most patients have a 2-week follow - up . Our patients were counseled before and after surgery by one of our authors (c.j.s . ), who is a nurse practitioner . At their 2-week follow - up, the patients were given instructions by the nurse to return as needed with any problems, such as hematoma, infection, numbness, paresthesia, pain, seroma, or any recurrent or new bulge . We purport that our outcome would have been the same if we had observed the patients up to a year or longer . We did not perform a head - to - head comparison of progrip mesh to other meshes in our study . In a limited study comparing progrip and polypropylene mesh in 60 patients, there was no statistically significant difference between the two meshes in recurrence, vessel injury, hematoma, infection, and complications from anesthesia . However, patients with progrip hernia repair returned to daily activities earlier than those having polypropylene repair (4 days vs 20 days). In our recent single - practice experience using progrip mesh, we conclude that the use of self - adhesive, velcro - type mesh in laparoscopic tep hernia repair is associated with reduced pain, low rates of early recurrence, infection, hematoma, and improved patient satisfaction . In our experience, this study lays the foundation for prospective and long - term follow - up studies that could include application of innovative technologies such as single - port tep in hernia repair.
|
Rhegmatogenous retinal detachment (rd) is one of the leading causes of vision loss in all countries around the world . Since 1970, epidemiologic studies have been conducted in ophthalmology to examine patient characteristics, risk factors, and prognosis . However, there are few studies focusing on the referral routes of patients with retinal detachment from the diagnosis to surgery, trying to determine the length and source of delays between the onset of symptoms and the arrival to the surgical unit . In brazil identifying the barriers and the needs of a population is essential to plan the national health system actions [3, 4]. The purpose of this study is to determine the reasons for delay in precocious treatment and to evaluate the perceptions and knowledge of patients with rd about their pathology at the admission in a tertiary care ophthalmic unit in brazil . This study was approved by the ethic committee of the hospital das clnicas da faculdade de medicina da universidade de so paulo (hc - fmusp), where it was conducted . A structured questionnaire was applied to patients admitted to the ward of the hc - fmusp with the diagnosis of rd over a prospective period from february to august 2010 . The interviews were carried out by two of the authors (tt, sts), focusing on the patient's symptoms, their perceptions of the severity of the disease, the pathway from the diagnosis to the arrival at hc - fmusp, and the time from the onset of the symptoms to presentation at our facilities . The inclusion criteria were as follows: minimum age of 18 years or the authorization of the legal guardian for study participation;rhegmatogenous retinal detachment with surgical repair indicated by a staff doctor of the retina and vitreous department of the hc - fmusp;signature of the free informed consent term;capacity to understand the questions asked . Minimum age of 18 years or the authorization of the legal guardian for study participation; rhegmatogenous retinal detachment with surgical repair indicated by a staff doctor of the retina and vitreous department of the hc - fmusp; signature of the free informed consent term; capacity to understand the questions asked . The exclusion criteria were as follows: previous rhegmatogenous retinal detachment surgery; difficulty in the comprehension of the questions during the interview; absence of a legal guardian to answer the questionnaire when the patient was not able to answer it alone . Forty - four patients (67,7%) were men and 21 (32,3%) women, with a mean age of 49,97 14,45 years . The first perceived symptoms were loss of visual acuity (67%), visual field scotoma (40%), floaters (37%), photopsias (29%), and symptoms not related to the retinal detachment (9%), such as pain and ocular discomfort . Only 15% of the interviewed patients had floaters and/or flashes without visual acuity loss and/or scotomas . Just 15% of the patients came directly to the hospital das clnicas; the other 85% were first seen by other ophthalmological services . The mean time from the beginning of the symptoms to the first complete ophthalmological evaluation for the patients that first came to the hospital das clnicas was 65,00 89,28 days, and for the patients referred from other services it was 27,07 146,36 days . The mean time from diagnosis in other services to examination at hospital das clnicas was 23,45 54,08 days . 64,6% of the patients sought assistance in the first week of symptoms, but only 28,6% of them were examined at the hospital das clnicas within a week . Figure 1 shows the time interval between the first symptoms and the patient arrival at the hospital das clnicas . The reasons patients did not have their surgery performed at the local of first diagnosis (in case of referred patients) were as follows: no retinal specialist was at the site (47%); they could not afford the surgery in a private practice facility (24%), or the private health insurance did not cover for the surgery (29%). The causes of the delay in medical care to patients that had more than 1 week of interval between the symptoms and the diagnosis are seem in table 1 . Main causes are: did not think it was a really severe problem (70%), thought it would heal by itself (56%), did not have money to go to the doctor office (16%), did not know where to go (10%), and other causes (24%), such as lack of eye doctors at the city of origin . The increasing demand for ophthalmic care results in delay for patient diagnosis and treatment at the public health system of brazil, as well as in other developing countries . Retinal detachment is a sight threatening condition, and the visual prognosis depends directly on the timing for correct diagnosis and surgical treatment . Moreover, the barriers to vitreoretinal evaluation and surgical intervention must be well known when planning requirements and resources . Rd surgery requires tertiary hospital facilities and specialized medical care, which is rare in developing countries, what makes it hard to achieve an appointment because there are few centers with trained retinal surgeons and vitreoretinal surgical equipment available . In brazil, the scenario is not different, in part because of the dimensions of the country and the large population . A previous study in another region of brazil with similar socioeconomic profile showed an incidence of 9,2 new cases of rd with surgical indication per 100.000 habitants / year . Even if we do not consider patients coming from other states of brazil, as many as 2.300 surgical appointments per year to take care of the new rd cases just in the so paulo metropolitan area were expected . This large burden increases the importance of prompt perception of initial rd symptoms by patients and where to find prompt care, in order to achieve better visual outcomes with the surgical treatment . The final visual results are directly dependent on the timing of the surgical repair, especially when the macula is attached . Macular detachment is a key indicator of visual prognosis, since once the macula detaches, less than 75% of patients will achieve a visual acuity of 6/12 or better . Unfortunately, the most common symptom perceived by the patients in this study was visual acuity loss, which corresponds to an advanced course of the disease with a probable macular detachment . Educational campaigns and periodic examination of patients at risk could be effective ways to address those issues [46]. The premonitory symptoms, despite not always present, should be emphasized in public health system in order to provide an opportunity to educate patients . The delay in presentation of rd cases is not apparently related to socioeconomic status, but to the low awareness of population about presenting symptoms [4, 5]. Most of the patients attended other centers of low complexity, as proposed by the brazilian public health system, but the patients from our study took in average almost one month to be examined in a tertiary center . Possible explanations for this delay from the first diagnose to an appointment at a tertiary center could be misdiagnose of the disease; lack of information about the availability of treatment; or the mechanism of accessing the tertiary service by the general ophthalmologist . Another important cause of delay in presentation was the lack of information from the patients about the severity of the symptoms . Most patients thought that a rd would not be a real problem and that it would heal by itself . It is interesting that the data are very similar to series in developed countries [4, 6]. Other causes of delays, such as difficulty in transportation and need of a care person, are also similar to what is found in other european or american series . The prognosis of retinal detachment is related to prompt repair, especially if the macula is attached . Patient and medical education about the disease symptoms and severities could potentially reduce the time between the first symptoms and specialized retinal consult . The public health system must be structured, with the accessing ways known by the attending doctors in every level of health care complexity systems.
|
The kidney is physiologically hypoxic despite its plentiful blood supply (as much as 20% of the cardiac output in humans), because an oxygen shunt is present between arteries and veins that run in close proximity . Therefore, it is reasonable to consider that erythropoietin - producing cells reside in the kidney, where they can sensitively detect hypoxia due to anemia . Physiological hypoxia in the kidney has been demonstrated in mammals using pimonidazole measurements and in hypoxia - monitoring transgenic mice and rats created by exploiting the hypoxia - inducible factor (hif) system . Augmented kidney hypoxia in ckd has also been confirmed in patients using blood oxygen - level dependent magnetic resonance imaging, as well as in animal models using the methods mentioned above . In ckd first, glomerulosclerosis leads to a reduction of flow in downstream peritubular capillaries, which can be further compromised by constriction of the efferent arterioles of glomeruli and peritubular capillaries themselves due to activation of the renin third, ecm deposition by fibrogenesis widens the distance between capillaries and tubules, diminishing the efficiency of oxygen diffusion . Following exposure to hypoxia, cells induce adaptive responses to survive the harsh environment . Among them hifs are heterodimers composed of an subunit, including hif-1, hif-2, and hif-3, and a common subunit, hif-1. Despite their constitutive expression, the subunits of hif are degraded by proteasomes and are not functional under normoxic conditions . Prolyl hydroxylases (phds) hydroxylate the conserved proline residues of hif- using oxygen, recruiting the von - hippel - lindau protein, which is a recognition component of e3 ubiquitin ligase . This results in the ubiquitination of the modified hif- subunits, and eventually leads to their proteasomal degradation . Under hypoxic conditions, hif- escapes post - translational modification by phds, forms a heterodimer with hif-1, and promotes the expression of its target genes . Its targets include glycolytic enzymes, which allow anaerobic atp production, and angiogenic factors, including vascular endothelial growth factors (vegfs), which can promote new vessel formation to increase oxygen supply . Despite such cellular - adaptive mechanisms, the proximal tubules are considered more susceptible to hypoxia because they solely depend on aerobic oxidative metabolism . Damaged tubular cells can, in turn, worsen glomerular lesions through tubular obstruction and maladaptive tubuloglomerular feedback . Thus, tubular injury aggravates two leading causes of tubular hypoxia, glomerular injury and interstitial fibrosis, which forms a vicious cycle and advances ckd . Therefore, these findings suggest that enhanced hif activity might protect the kidney against hypoxic injury and suppress the progression of ckd . In fact, activation of hifs by the systemic administration of an inhibitor of phds has been shown to mitigate tubular injury and capillary rarefaction in various ckd models . For example, hypoxic conditions alter the transcription of some genes through changes in the chromatin conformational structure and histone modification changes . Such epigenetic alterations in hypoxic renal cells may affect the pathophysiology of ckd, and may be newly emerging targets for therapy . In chronic diseases, tissue damage persists without resolution, often along with inflammatory leukocytes and fibrosis, as some repair mechanisms may be insufficient or maladaptive . Therefore, it is reasonable to consider recurrent and persistent injury to epithelial cells, which fulfill the predominant physiological functions in tissues, as the prime element that initiates and sustains fibrogenesis . Epithelial cell death can provoke pro - inflammatory responses through damage - associated molecular pattern molecule receptors, and lead to fibrosis . Cellular stress in epithelial cells also induces activation of innate immunity through the production of cytokines and chemokines . The cells that actually produce pathologic ecm are called myofibroblasts (mfs), which are activated mesenchymal cells that express -smooth muscle actin . Because epithelial - to - mesenchymal transition was proposed as a dominant mechanism that gives rise to mfs, their origin has been debated for decades . However, recent studies indicate that the dominant origin of mfs is not epithelial cells, but mesenchymal cells in most organs, including the kidneys, liver, lungs, skin, and spinal cord . In the kidney, some studies have shown that most of these mesenchymal fibroblasts are attached to the microvasculature and have proven to be pericytes . Other studies, however, argue that these mesenchymal progenitor cells are fibroblasts', although they did not investigate their anatomical relationship with vessels . Pericytes are cells that wrap around the endothelial tubes of capillaries, some of which are embedded in the basement membrane of capillaries with direct and indirect contact with endothelial cells . Factors produced by injured epithelial cells and other cells, including vegfs, platelet - derived growth factors (pdgfs), fibroblast growth factors, and transforming growth factor-, activate pericytes and induce their detachment from capillaries and conversion to mfs . In addition, it is worth noting that pericytes are erythropoietin - producing cells in the kidney, and mfs lose the capacity to produce this hormone . Monocytes are leukocytes in the circulating blood, but they are recruited to damaged tissue, where they differentiate into macrophages . Although it is well known that these monocytes / macrophages have a broad spectrum of functions and are subdivided, e.g., m1 and m2 macrophages, as a whole, they are thought to have a tendency to promote renal fibrosis because their ablation in a typical fibrosis model, unilateral ureteric obstruction (uuo), mitigates fibrosis . These cells produce profibrotic and pro - inflammatory factors, which maintain activation of mfs and their fibrogenesis . Furthermore, these inflammatory cells induce additional epithelial cell injury, creating a positive - feedback loop and developing fibrosis . Taken together, fibrosis advances in a manner in which repetitive and unresolved epithelial injury primes pericyte activation, inducing them to become mfs and in this section, we will describe the roles of hypoxia, particularly hifs, in fibrosis, with regard to its effects on epithelial cells, pericytes / fibroblasts, and monocytes / macrophages . Increased hif- in the renal tubular cells of transgenic mice with conditional von - hippel - lindau protein knockout in adulthood enhances vegf and pdgf - b expression and augments endothelial cell proliferation, increasing their numbers . Although increased production and deposition of ecm were also observed in these transgenic mice compared with control mice, they did not display renal injury or dysfunction these results are consistent with studies showing that conditional knockout of hif-1 in the proximal tubules lessens fibrosis in mouse uuo . Given that deposition of ecm is a part of repair processes unless it is uncontrolled, it is suggested that hif activation by hypoxia in tubular cells can mitigate renal damage through the upregulation of angiogenic and fibrogenic factors as adaptive responses . This idea is consistent with the observation that general activation of hifs mitigates renal injury in a ckd model . Human renal fibroblasts, isolated by morphologic criteria, showed increased expression of collagen i1 and tissue inhibitor of metalloproteinase-1, when they were exposed to hypoxia . By contrast, in mouse renal interstitial fibroblasts, hypoxia did not induce expression of collagen i, -smooth muscle actin, or transforming growth factor-1 in vitro . The discrepancy may derive from differences in the origins of the cells and/or methods of culture . For example, in hepatic stellate cells, which are considered as the equivalent of pericytes in the liver, hypoxia increases collagen i and vegf expression . During kidney fibrosis, vegf and pdgf given that hypoxia promotes the production of both growth factors in epithelial cells as mentioned above, hypoxia may indirectly cause pericyte loss, although its direct effects on pericytes remain to be elucidated . It should be noted that even primary pericytes derived from intact tissue tend to be activated and have characteristics of mfs when they are cultured under normal conditions without special stimuli . Therefore, to determine the precise roles of hypoxia and/or hifs in pericytes, investigation of the effects of specific overexpression and knockout of hifs in these cells in vivo is warranted . Lysozyme m (lysm)-cre is often utilized to control the expression of a gene specifically in monocytes and macrophages . Mice with increased hif expression in monocytes / macrophages, in which von - hippel - lindau protein is knocked out by lysm - cre, had fewer macrophages, although they exhibited comparable fibrosis and tubular damage in a uuo model . However, specific knockout of both hif-1 and hif-2 in macrophages increased the number of macrophages in uuo without affecting fibrosis . This discrepancy between inflammatory cells and fibrosis appears inconsistent with studies, showing that the ablation of macrophages mitigates fibrosis . One possible explanation is that hif upregulation and hif downregulation change the characteristics or subpopulations of macrophages, which alters the effects of alterations in macrophage number . This may result from a varied lysm - cre efficiency in macrophage subtypes because lysm - cre deletes a floxed gene in no more than 80% of macrophages . In addition, lysm is also expressed in neutrophils, and gene knockout can therefore also occur in the neutrophils of mice with a lysm - cre transgene . Therefore, changes in gene expression in neutrophils may have affected the development of fibrosis . Contrasting properties of hifs in myeloid - lineage cells have been reported in liver fibrosis . In a bile duct ligation model, macrophage - specific hif-1 knockout in mice using lysm - cre led to less fibrosis and ameliorated tissue injury . In conditional knockout mice, the numbers of macrophages had a tendency to decrease, but the difference was not significant . Similar results were obtained with hif-1 knockout . In this study, pdgf - b expression in macrophages was reduced by hif knockout, which may contribute to the observed decrease in fibrosis . Increased hif- in the renal tubular cells of transgenic mice with conditional von - hippel - lindau protein knockout in adulthood enhances vegf and pdgf - b expression and augments endothelial cell proliferation, increasing their numbers . Although increased production and deposition of ecm were also observed in these transgenic mice compared with control mice, they did not display renal injury or dysfunction these results are consistent with studies showing that conditional knockout of hif-1 in the proximal tubules lessens fibrosis in mouse uuo . Given that deposition of ecm is a part of repair processes unless it is uncontrolled, it is suggested that hif activation by hypoxia in tubular cells can mitigate renal damage through the upregulation of angiogenic and fibrogenic factors as adaptive responses . This idea is consistent with the observation that general activation of hifs mitigates renal injury in a ckd model . Human renal fibroblasts, isolated by morphologic criteria, showed increased expression of collagen i1 and tissue inhibitor of metalloproteinase-1, when they were exposed to hypoxia . By contrast, in mouse renal interstitial fibroblasts, hypoxia did not induce expression of collagen i, -smooth muscle actin, or transforming growth factor-1 in vitro . The discrepancy may derive from differences in the origins of the cells and/or methods of culture . For example, in hepatic stellate cells, which are considered as the equivalent of pericytes in the liver, hypoxia increases collagen i and vegf expression . During kidney fibrosis, vegf and pdgf given that hypoxia promotes the production of both growth factors in epithelial cells as mentioned above, hypoxia may indirectly cause pericyte loss, although its direct effects on pericytes remain to be elucidated . It should be noted that even primary pericytes derived from intact tissue tend to be activated and have characteristics of mfs when they are cultured under normal conditions without special stimuli . Therefore, to determine the precise roles of hypoxia and/or hifs in pericytes, investigation of the effects of specific overexpression and knockout of hifs in these cells in vivo is warranted . Lysozyme m (lysm)-cre is often utilized to control the expression of a gene specifically in monocytes and macrophages . Mice with increased hif expression in monocytes / macrophages, in which von - hippel - lindau protein is knocked out by lysm - cre, had fewer macrophages, although they exhibited comparable fibrosis and tubular damage in a uuo model . However, specific knockout of both hif-1 and hif-2 in macrophages increased the number of macrophages in uuo without affecting fibrosis . This discrepancy between inflammatory cells and fibrosis appears inconsistent with studies, showing that the ablation of macrophages mitigates fibrosis . One possible explanation is that hif upregulation and hif downregulation change the characteristics or subpopulations of macrophages, which alters the effects of alterations in macrophage number . This may result from a varied lysm - cre efficiency in macrophage subtypes because lysm - cre deletes a floxed gene in no more than 80% of macrophages . In addition, lysm is also expressed in neutrophils, and gene knockout can therefore also occur in the neutrophils of mice with a lysm - cre transgene . Therefore, changes in gene expression in neutrophils may have affected the development of fibrosis . Contrasting properties of hifs in myeloid - lineage cells have been reported in liver fibrosis . In a bile duct ligation model, macrophage - specific hif-1 knockout in mice using lysm - cre led to less fibrosis and ameliorated tissue injury . In conditional knockout mice, the numbers of macrophages had a tendency to decrease, but the difference was not significant . Similar results were obtained with hif-1 knockout . In this study, pdgf - b expression in macrophages was reduced by hif knockout, which may contribute to the observed decrease in fibrosis . Peritubular capillary rarefaction and fibrosis are causative factors in advancing ckd, as well as common hallmarks of ckd . This has been attempted through efforts to augment angiogenesis, and to preserve peritubular capillaries and mitigate hypoxia in tubulointerstitial areas . Considering that the simple invasion of endothelial cells into nascent organs during development provides inductive signals to promote organogenesis even without blood flow, angiogenesis may also promote tissue repair and regeneration through effects beyond simple oxygen and nutrition supply . As such, angiogenesis appears to be a more promising therapy for ckd, but success using this approach has not been achieved . However, angiogenesis occurs through complicated mechanisms including the coordinated actions of angiogenic factors . Among them, vegf - a (vegf) has predominant roles and by itself can induce angiogenesis . Although treatment with vegf gives rise to new vessel formation, the new vessels are leaky and unstable . Because leukocytes can be recruited through leaky vessels, they are also pro - inflammatory . This may be related to the fact that proliferation of endothelial cells unexpectedly occurs during the early phase of uuo, when increased vegf expression and macrophages numbers are also observed, followed by the loss of peritubular capillaries and advanced fibrosis . This suggests that incomplete angiogenesis may leave capillaries unstable with subsequent worsening of inflammation and fibrosis . These flaws primarily result from the absence of pericytes, which cover immature vessels composed of endothelial cells, inhibit the recruitment of inflammatory cells, and enable the vessels to function properly . It is natural to speculate that pericytes are converted into mfs, and physiological, or properly functioning, pericytes are scarce in ckd . Therefore, deactivation of mfs with subsequent restoration of pericytes is the cornerstone for ameliorating both hypoxia and fibrosis . First, we should consider why hypoxic tubular cells cannot induce sufficient angiogenesis although hypoxia is one of the most potent angiogenic stimuli . As mentioned above, in ckd, tubular cells are under hypoxic stress and can express angiogenic factors, including vegf . It is possible that an imbalance and/or a deficiency exists in the ability of some angiogenic factors to form mature and stable vessels by recruiting pericytes . It is known that several growth factor families, such as pdgfs, angiopoietins, and transforming growth factor-, contribute to the recruitment of pericytes to immature vessels composed of endothelial cells . If tubular cells predominantly express vegf and insufficient pericyte - recruiting growth factors, the new vessels will be immature and have fewer pericytes . In addition, pericyte - recruiting factors secreted from tubular cells maladaptively induce the detachment of pericytes from capillaries rather than recruitment to capillaries (figure 2). Future studies that verify the profiles and actions of angiogenic growth factors may facilitate ckd therapy aimed at proper angiogenesis . Given that fibrosis is essentially a protective response to tissue injury and is resolved upon removal of the injury, mfs should be capable of reverting to pericytes . In fact, chronic fibrosis can be reversible in patients when the primary insult is eliminated . However, in advancing fibrosis, pericyte recruitment to newer vessels may be hindered by its fibrogenic phenotype . The exact mechanisms that maintain activated states in mfs and prevent them from reverting to pericytes remain to be elucidated, although many of the growth factors involved in these processes have been identified . Verifying the culprit in intracellular furthermore, restored pericytes should resume the production of erythropoietin, which would ameliorate anemia in ckd . Hence, pericytes mitigate kidney hypoxia not only by increasing vessel stability but also by enhancing the capacity of blood to convey oxygen . They can express vegfs, pdgfs, fibroblast growth factors, and angiopoietins, sometimes in response to hypoxia . During angiogenesis and/or fibrosis, these factors are secreted from so - called m2' macrophages, which promote tissue repair . However, m2 macrophages are thought to be further subdivided into angiogenic and fibrogenic macrophages, although their relevance in vivo remains unclear . It is also possible that macrophages express a relatively homogenous repertoire of growth factors that is dependent on the surrounding milieu . Therefore, control of the differentiation of macrophage subtypes and/or growth factor production is another possible method for ckd therapy . In addition to determining the roles of particular cell populations, studies have revealed that the general activation of hifs by phd inhibition can promote angiogenesis . For example, peptide - mediated inhibition of phds generates more mature and less leaky vessels than those generated by growth factors . These findings indicate the existence of some unidentified factors or mechanisms promoting vessel stabilization through pericyte recruitment . Chemical phd inhibitors are under development and have therapeutic potential for the treatment of ckd . Although ckd and the resultant renal replacement therapy are an increasing burden for patients and society, no decisive therapeutic method has been developed . Fibrosis and hypoxia are major therapeutic targets for treating tubulointerstitial lesions in ckd . During fibrosis, pericytes leave capillaries and become ecm - producing mfs . This process results in capillary fragility and rarefaction, which are central causes of hypoxia . Therefore, deactivating mfs to restore pericytes naturally emerges as a potential ckd therapy . Much still remains to be elucidated, but future investigations may unravel the detailed mechanisms of the fibrotic process and thereby open new avenues for promising therapies to prevent or reverse ckd.
|
Anterior cruciate ligament (acl) tears are one of the most common knee injuries and single bundle (sb) acl reconstruction has been the traditional treatment since long.12 although results of sb acl reconstruction have been good, numerous studies indicate superiority of double bundle (db) reconstruction in terms of overall stability and better knee scores.34 biomechanical studies indicate that sb reconstruction does not fully restore normal knee kinematics and that each bundle (anteromedial (am) and posterolateral (pl)), makes a unique contribution to knee function wherein am bundle provides the major anterior restraint and the pl bundle contributes to rotational stability.3456 there are still many controversies concerning the surgical techniques in anatomic db reconstruction, namely in procedures for creating anatomic tunnels, graft preparation, tensioning and fixation345678 and therefore utility of anatomic db reconstruction has not yet been fully established . Recently, anatomic db reconstruction has been the center of interest as studies have postulated that it not just simply creates two mechanical bundles, but imparts best possible knee kinematics and stability.4689 this study evaluates outcome of antatomic double bundle reconstruction and identifies whether db is truly anatomical . 30 clinicoradiologically proven cases of acl rupture treated with db recnstruction were included in this prospective study . Exclusion criteria were, patients with any additional ligament injury or any previous knee ligament surgery, small native acl usually an insertion site <14 mm, severe bone bruising, a narrow notch, severe arthritic changes, malalignment or abnormal contralateral knee.10 the patients underwent a preoperative assessment including a history, clinical examination, knee examination (lachman test, pivot shift), lysholm score, international knee documentation committee (ikdc) scale (subjective as well as objective), standard radiograph (ap and lateral view) and magnetic resonance imaging (mri). This questionnaire consists of eight questions, with closed answers alternatives, of which final score is expressed nominally and ordinally, with a score ranging from 95 to 100 points regarded as excellent; 84 - 94 points, good, from 65 to 83 points, fair, and poor when values are equal or below 64 points . Recording of the lysholm score was done preoperatively and postoperatively.11 the ikdc rating scale consists of both a subjective questionnaire and an objective evaluation . The objective ikdc scale has total of seven domains related to the knee, reflecting both impairment and disability . The worst grading for first three key domains presence of effusion, knee range of motion (rom) and ligament stability determines the eventual ikdc grade . Patients are graded in four different grades a, b, c and d normal, nearly normal, abnormal, and severely abnormal, respectively.12 all patients underwent arthroscopic db acl reconstruction under regional anesthesia after obtaining written consent from the patients . A diagnostic arthroscopy was performed to confirm the acl tear and other findings (meniscal or chondral injury). The femoral footprint was identified and minimally debrided . While viewing at 90 of knee flexion, lateral bifurcate ridge is often seen on the femoral insertion between the am and pl bundles, whereas a lateral intercondylar ridge is often seen on the upper limit of both the am and pl bundles . These are useful surgical landmarks in addition to the native insertion fibers.1314 semitendinosus and gracilis tendons were harvested and prepared . The mean total length obtained for semitendinosus was 25 cm and for gracilis tendon it was 20 cm . The semitendinosus tendon (for the am bundle) and the gracilis tendon (for the pl bundle) were looped separately over closed loop endobutton . The thickness of the graft construct was measured using a tendon thickness measuring gauge to the nearest of 0.5 cm . Drilling of the am femoral tunnel was done through the am portal with the knee bent 90 to place the guide . Appropriate - sized endoscopic reamer was selected according to the graft diameter and the am femoral socket was made . Depth was regulated according to the desired insertion length and was 9 - 10 mm greater than the desired graft insertion to allow for the endobutton flip [figure 1]. Arthroscopic view showing drilling of femoral tunnels the femoral pl tunnel was drilled with the knee flexed to 120 and anatomic anterior cruciate ligament reconstruction (aclr) pl femoral aimer (smith and nephew, andover, united states of america) inserted with an appropriate sized post into the already made am tunnel . It was ensured that the shoulder of the am post was in contact with the lateral wall of the intercondylar notch . In all our cases, the length of the am tunnel ranged between 40 and 50 mm and the length of the pl tunnel ranged between 30 and 35 mm . Smith and nephew acufex director acl tip aimer (smith and nephew, andover, united states of america) was set at 55 for the placement of the anteromedial guide wire . The am tibial tunnel in the anatomic db reconstruction technique is more anteriorly located than in sb reconstruction . Once the post was secured, it was inserted into the am tibial tunnel until the distal end was flush with the tibial surface [figure 2]. The pl tunnel had a more medial and distal entry point on the tibial cortex than a standard acl tibial tunnel . An osseous bridge of approximately 2 - 3 mm was left between the two tunnels inside the joint . Arthroscopic view showing drilling of tibial tunnels finally, the grafts were passed [figures 35], the endobutton device was flipped, and the fixation was tested . It was ensured that full rom was achieved after fixation of the am and pl bundles and that there was no impingement within the intercondylar notch, neither with the lateral condyle wall in full extension nor with the posterior cruciate ligament in full flexion . Arthroscopic view showing passage of anteromedial graft arthroscopic view showing passage of postrolateral graft arthroscopic view showing both anteromedial and postrolateral graft the fixation method used on the tibial side was titanium interference screw (hib surgicals, india pvt . Ltd .) For both tunnels and augmentation with tendon staple [figure 6]. Am bundle was fixed in 60 flexion and the pl bundle was fixed in full extension . Immediate quadriceps and hamstring exercises started and partial weight bearing was allowed with crutches / walker in first postoperative week . After first week; range of motion in arc of 0 - 90 (closed kinetic chain) was started . Full weight bearing was allowed by 3 - 4 weeks and running and cycling after one month . The patient was followed up at 2 weeks for suture removal thereafter fortnightly for 2 months, monthly for next 3 months and then once in 6 months for clinical evaluation and complications if any . (a) anteroposterior and (b) lateral radiographs of a 28 year old male who underwent double bundle anterior cruciate ligament reconstruction at the time of final followup examination of the knee (lachman, pivot shift, rom) was done along with quantitative assessment of anterior tibial translation using genourob (gnrb), an alternative anterior knee laxity measurement device [figure 7]. The lower limb was placed in a rigid support with the knee at 0 of rotation, the restraining power being recorded . A 134 n thrust force was transmitted by a jack to the upper segment of the calf . It was assured that while the force was being applied, there was no hamstring muscles contraction . Displacement of the anterior tibial tubercle was recorded using a sensor with a 0.1 mm precision.15 functional evaluation was done according to the lysholm score and ikdc scale (subjective and objective). Clinical photograph of genourob arthrometer bilateral knee mri was done for visualization of the acl bundle anatomy and the appearances of graft components and graft orientation and compare it with the normal acl of the contralateral knee at final followup16 [figure 8]. The coronal oblique sequence with thin sections (2.5-mm slice thickness) or the use of 3-t imaging can differentiate the two bundles as discrete entities . In our institution, we obtained mri on a 1.5-t magnet and utilized coronal oblique sequence with thin sections for visualization of the same . The following parameters were evaluated: magnetic resonance imaging (mri) of the operated knee of a 26 year old male showing (a) sagittal anterior cruciate ligament (acl) angle 52.1 (b) coronal acl angle of 78.4 and 73.4 (c) tibial acl footprint as 13.6 mm and 12.3 mm . Mri of the normal knee of the same patient showing (d) sagittal acl angle 49.7 (e) coronal acl angle 73.4 sagittal acl - tibial angle: this is the angle between a line paralleling the midlateral tibial plateau and a line demarcating the anterior most margin of the acl, drawn on the midline image best depicting the acl . Normal value for patients with closed physes is (58.8 4.9).coronal acl tibial angle: this is the angle between a line demarcating the medial most margin of the long axis of the acl and a line connecting the medial and lateral most margins of the tibial plateau on the same section . Normal value for patients with closed physes is 69.1 7.4.acl foot print: acl footprint size was measured in sagittal midline section and compared with opposite normal knee.17 sagittal acl - tibial angle: this is the angle between a line paralleling the midlateral tibial plateau and a line demarcating the anterior most margin of the acl, drawn on the midline image best depicting the acl . Normal value for patients with closed physes coronal acl tibial angle: this is the angle between a line demarcating the medial most margin of the long axis of the acl and a line connecting the medial and lateral most margins of the tibial plateau on the same section . Normal value for patients with closed physes is 69.1 7.4. acl foot print: acl footprint size was measured in sagittal midline section and compared with opposite normal knee.17 data were analyzed using the ibm spss version 19 (ibm, new york, united states of america). Preoperative values and values at the final followup were compared using paired t - test . The objective ikdc scale has total of seven domains related to the knee, reflecting both impairment and disability . The worst grading for first three key domains presence of effusion, knee range of motion (rom) and ligament stability determines the eventual ikdc grade . Patients are graded in four different grades a, b, c and d normal, nearly normal, abnormal, and severely abnormal, respectively.12 all patients underwent arthroscopic db acl reconstruction under regional anesthesia after obtaining written consent from the patients . A diagnostic arthroscopy was performed to confirm the acl tear and other findings (meniscal or chondral injury). The femoral footprint was identified and minimally debrided . While viewing at 90 of knee flexion, lateral bifurcate ridge is often seen on the femoral insertion between the am and pl bundles, whereas a lateral intercondylar ridge is often seen on the upper limit of both the am and pl bundles . These are useful surgical landmarks in addition to the native insertion fibers.1314 semitendinosus and gracilis tendons were harvested and prepared . The mean total length obtained for semitendinosus was 25 cm and for gracilis tendon it was 20 cm . The semitendinosus tendon (for the am bundle) and the gracilis tendon (for the pl bundle) were looped separately over closed loop endobutton . The thickness of the graft construct was measured using a tendon thickness measuring gauge to the nearest of 0.5 cm . Drilling of the am femoral tunnel was done through the am portal with the knee bent 90 to place the guide . Appropriate - sized endoscopic reamer was selected according to the graft diameter and the am femoral socket was made . Depth was regulated according to the desired insertion length and was 9 - 10 mm greater than the desired graft insertion to allow for the endobutton flip [figure 1]. Arthroscopic view showing drilling of femoral tunnels the femoral pl tunnel was drilled with the knee flexed to 120 and anatomic anterior cruciate ligament reconstruction (aclr) pl femoral aimer (smith and nephew, andover, united states of america) inserted with an appropriate sized post into the already made am tunnel . It was ensured that the shoulder of the am post was in contact with the lateral wall of the intercondylar notch . In all our cases, the length of the am tunnel ranged between 40 and 50 mm and the length of the pl tunnel ranged between 30 and 35 mm . Smith and nephew acufex director acl tip aimer (smith and nephew, andover, united states of america) was set at 55 for the placement of the anteromedial guide wire . The am tibial tunnel in the anatomic db reconstruction technique is more anteriorly located than in sb reconstruction . Once the post was secured, it was inserted into the am tibial tunnel until the distal end was flush with the tibial surface [figure 2]. The pl tunnel had a more medial and distal entry point on the tibial cortex than a standard acl tibial tunnel . An osseous bridge of approximately 2 - 3 mm was left between the two tunnels inside the joint . Arthroscopic view showing drilling of tibial tunnels finally, the grafts were passed [figures 35], the endobutton device was flipped, and the fixation was tested . It was ensured that full rom was achieved after fixation of the am and pl bundles and that there was no impingement within the intercondylar notch, neither with the lateral condyle wall in full extension nor with the posterior cruciate ligament in full flexion . Arthroscopic view showing passage of anteromedial graft arthroscopic view showing passage of postrolateral graft arthroscopic view showing both anteromedial and postrolateral graft the fixation method used on the tibial side was titanium interference screw (hib surgicals, india pvt . Ltd .) For both tunnels and augmentation with tendon staple [figure 6]. Am bundle was fixed in 60 flexion and the pl bundle was fixed in full extension . Immediate quadriceps and hamstring exercises started and partial weight bearing was allowed with crutches / walker in first postoperative week . After first week; range of motion in arc of 0 - 90 (closed kinetic chain) was started . Full weight bearing was allowed by 3 - 4 weeks and running and cycling after one month . The patient was followed up at 2 weeks for suture removal thereafter fortnightly for 2 months, monthly for next 3 months and then once in 6 months for clinical evaluation and complications if any . (a) anteroposterior and (b) lateral radiographs of a 28 year old male who underwent double bundle anterior cruciate ligament reconstruction at the time of final followup examination of the knee (lachman, pivot shift, rom) was done along with quantitative assessment of anterior tibial translation using genourob (gnrb), an alternative anterior knee laxity measurement device [figure 7]. The lower limb was placed in a rigid support with the knee at 0 of rotation, the restraining power being recorded . A 134 n thrust force was transmitted by a jack to the upper segment of the calf . It was assured that while the force was being applied, there was no hamstring muscles contraction . Displacement of the anterior tibial tubercle was recorded using a sensor with a 0.1 mm precision.15 functional evaluation was done according to the lysholm score and ikdc scale (subjective and objective). Clinical photograph of genourob arthrometer bilateral knee mri was done for visualization of the acl bundle anatomy and the appearances of graft components and graft orientation and compare it with the normal acl of the contralateral knee at final followup16 [figure 8]. The coronal oblique sequence with thin sections (2.5-mm slice thickness) or the use of 3-t imaging can differentiate the two bundles as discrete entities . In our institution, we obtained mri on a 1.5-t magnet and utilized coronal oblique sequence with thin sections for visualization of the same . The following parameters were evaluated: magnetic resonance imaging (mri) of the operated knee of a 26 year old male showing (a) sagittal anterior cruciate ligament (acl) angle 52.1 (b) coronal acl angle of 78.4 and 73.4 (c) tibial acl footprint as 13.6 mm and 12.3 mm . Mri of the normal knee of the same patient showing (d) sagittal acl angle 49.7 (e) coronal acl angle 73.4 sagittal acl - tibial angle: this is the angle between a line paralleling the midlateral tibial plateau and a line demarcating the anterior most margin of the acl, drawn on the midline image best depicting the acl . Normal value for patients with closed physes is (58.8 4.9).coronal acl tibial angle: this is the angle between a line demarcating the medial most margin of the long axis of the acl and a line connecting the medial and lateral most margins of the tibial plateau on the same section . Normal value for patients with closed physes is 69.1 7.4.acl foot print: acl footprint size was measured in sagittal midline section and compared with opposite normal knee.17 sagittal acl - tibial angle: this is the angle between a line paralleling the midlateral tibial plateau and a line demarcating the anterior most margin of the acl, drawn on the midline image best depicting the acl . Coronal acl tibial angle: this is the angle between a line demarcating the medial most margin of the long axis of the acl and a line connecting the medial and lateral most margins of the tibial plateau on the same section . Normal value for patients with closed physes is 69.1 7.4. acl foot print: acl footprint size was measured in sagittal midline section and compared with opposite normal knee.17 data were analyzed using the ibm spss version 19 (ibm, new york, united states of america). Preoperative values and values at the final followup were compared using paired t - test . All patients were males with mean age of 25 7.45 years (range 18 - 44 years). The mode of trauma was sports injury (n = 22) and road traffic accident (n = 8). The pivoting stress was found to be the most common cause of acl rupture in our series (n = 14, 46.6%). Isolated acl tear was present in 16 cases (53.3%) and the rest of 14 cases (46.6%) were associated with meniscus injury . 22 patients (73.3%) presented with a feeling of giving way of the knee during routine work and guarded walking due to apprehension usually without pain, while 8 patients (26.6%) had the feeling of giving way only during sporting activity usually with pain . Mean preoperative lysholm score was 46.33 12.12, which improved to 93.13 3.31 at the time of the final evaluation and 22 cases (73.3%) had excellent results, while 8 cases (26.6%) had a good result . The mean preoperative subjective ikdc score was 43.52 9.20, which improved to 92.87 2.78 at the final followup . According to postoperative objective ikdc score, 26 patients (86.6%) were in group a and 4 patients (13.3%) were in group b. in this study mean differential anterior tibial translation was 1.07 0.80 mm (range 0.1 - 2.3 mm) [figure 9]. Though most of the patients (n = 26, 86.6%) regained very good rom (0 - 120 or above), 4 (13.3%) cases had mean 15 loss of terminal flexion . Graphical representation of anterioposterior translation of the operated knee as measured by genourob 6 cases (20%) complained of mild intermittent knee pain while 2 cases (6.6%) developed superficial infection, which healed with antibiotics and daily dressings . In 2 cases (6.66%) endobutton was flipped (> 3 mm) in soft tissue outside the femoral cortex, while in 4 cases (13.3%) there was sensory loss over upper medial tibia due to the involvement of the infrapatellar branch of saphenous nerve . Magnetic resonance imaging scans of operated and the contralateral normal knee showed the mean sagittal acl tibial angle [figure 8a and d] of 56.1 5.06 in the operated knee, which was in the range of normal values in literature (58.8 4.9) and were comparable to the values of acl in the contralateral normal knee . The mean coronal acl tibial angle (74.86 5.69) [figure 7b and e] and mean sagittal tibial acl footprint [figure 8c and f] of the graft (12.65 mm 1.93) too was in the range of normal values in literature and comparable to the values of contralateral normal knee [table 1]. Analysis of data from the last 10 years reveals that after anatomical single bundle acl reconstruction, 10% to 30% patients complain of pain and residual instability.18 and no> 60% of the patients make a full recovery after their acl reconstruction.19 double bundle construct has been shown to regain a structure that morphologically and functionally closely resembles a normal acl.6 as a result; several centers have attempted to improve upon the single bundle technique by reconstructing both the anteromedial and the posterolateral bundles of the acl . In our study, the mean preoperative lysholm score was 46.3 12.12 which is quite less as compared to the observations of fujita et al.20 and jrvel21 who reported a preoperative lysholm score of 67.4 and 69, respectively . This could be attributed to the fact that the majority of patients in our country get diagnosed late; the instability and its associated secondary damage in the knee due to delayed presentation may be the reason for a very low preoperative lysholm score in our patients . Our mean postoperative lysholm score and postoperative subjective ikdc score, of 94.13 3.31, 92.87%, respectively are in close proximity with those reported by siebold et al.22 (90% and 88%) and asagumo et al.7 (96.8% 5.1 and 85%). In our study, 100% cases reported their knees as normal or near normal (grade a + b objective ikdc) after reconstruction and so was the case with jrvel21 (100%), siebold et al.22 (97%) and kim et al.23 (91%). Our results are consistent with those of previous authors, indicating excellent restoration of anterior and rotatory stability for most patients.78 though lachman test is a reliable clinical test for diagnosis of acl rupture, quantification of anteroposterior tibial displacement still remains inaccurate . Laximetry reproducibility is significantly better with the gnrb than with the kt-1000 because its displacement transducer precision (0.1 mm) is higher than that of the kt-1000 (1 mm).15 in this study differential anterior tibial translation (when compared with normal knee) was 1.07 mm, which was in accordance with studies conducted by yasuda et al.8 and siebold et al.22 1.0 mm each and was far better than the rest of the studies on db and sb acl reconstruction [table 2]. No patient in our study reported instability during activities of daily living or doing strenuous activities . Differential anterior translation as compared to normal knee by gnrb arthrometer achieving rotatory control of the knee post acl reconstruction has been shown to increase patient satisfaction, decrease functional instability and potentially delay the development of osteoarthritis . The pivot shift is able to assess this rotatory component of knee laxity and appears to have the potential to become a benchmark in gauging the success of acl surgery.27 in this study, all patients were pivot shift negative after db acl reconstruction, which is comparable with the study conducted by jrvel21 and kim et al.23 in the recent past and was slightly better than siebold et al.22 and tohyama et al.25 (97% each). We saw a significant improvement of rotational stability according to the pivot shift, which might be related to the additional pl bundle reconstruction and the differential tightening of the two bundles of the graft . One could also speculate that the high number of negative pivot shift tests might also be related to the four tunnel technique, which increases the size of the footprint of the reconstruction . However, the pivot shift test is a subjective clinical tool to assess rotational stability and unfortunately, we still lack an accurate objective measurement method . Nevertheless, all good things come with a price; db technique also has its own concerns . Because there are more tunnels in a db technique, there are concerns regarding difficulties in revision acl reconstruction . One concern relates to tunnel enlargement, which can hamper acl revision surgery because of the potential need for a staged reconstruction in which the tunnels are bone grafted first, followed by the actual revision surgery performed after the bone graft has been incorporated.28 tunnel communication can also occur when drilling the tunnels if they are placed too close to each other.2930 because there are more tunnels to be created and more grafts to be fixed, the db technique can be associated with more technical difficulties than the traditional single bundle technique . The db acl reconstruction can be a technically demanding procedure, with increased costs due to more fixation material, grafts and a longer operative period.
|
Angiosarcomas are poorly differentiated neoplasms composed of stands of endothelial cells and have a very narrow lumen filled with blood cells . Angiosarcomas frequently originate from the vascular wall, usually from medium and large sized veins . They are malignant but rarely result in recurrences or metastases to lungs and lymph nodes . Angiosarcomas are commonly detected during the initial six months of life, since they usually involve the soft tissues of head and skin . They are the most frequently found benign neoplasms of the liver in children . In adults angiosarcomas are very rare findings, being mostly described in the liver, lungs, brain and bones . A 68-year - old patient was admitted due to loose bowel movements with traces of blood observed for a period of two weeks . The symptoms were initially recorded by the patient 6 months prior to admission and took the form of blood in the stool . Sigmoidoscopy revealed an elevated ulcerative lesion 20 mm in diameter, located 12 cm from the anal verge along with two small polyps (4 mm and 8 mm) situated 25 cm from the anal verge . Histopathology of the ulceration showed a tubular adenoma with chronic mucosa inflammation . Above the splenic flexure of the transverse colon, the colonic mucosa was pink and glossy with a mesh of dilated vessels suggestive of chronic inflammation . Remaining segments of the large intestine were normal on sigmoidoscopic examination . In spite of the benign pathologic result the patient was qualified for en bloc surgical resection on these aforementioned findings . A hard, exophytic tumor (5 cm 5 cm) was found intra - operatively on the mesorectal side of the rectum . The patient underwent resection of the upper rectum and sigmoid colon (with formation of end - to - end anastomosis with mechanical stitches) with regional lymphadenectomy . No complications were noted in the postoperative period and the patient was discharged eight days after surgery . Histopathology of the tumor revealed a g3 malignant angiosarcoma with chronic inflammation of the colonic mucosa (figs . The surgical resection margin was negative and no metastases were found in regional lymph nodes . Fragment of intestinal wall with neoplastic infiltration of muscular layer . On the left visible intestinal mucosa with lymphoid tissue . He, magnification 100 atypical, epithelioid cells without tendency to form blood vessel structures . . Only a few well - documented cases of angiosarcoma in this location have been reported in the literature [313]. The rare occurrence and high aggressiveness of this tumor preclude designing an optimal therapeutic approach . Surgical treatment seems to be the only effective treatment modality in cases of this malignancy with a colorectal localization . The reported cases of angiosarcoma have documented early spread of this malignancy after surgical treatment and a short overall survival . Among these cases was a 77-year - old patient reporting a history of constipation and bleeding from the lower alimentary tract, who was operated on for colorectal angiosarcoma . Numerous liver metastases were detected following the resection of the primary tumor and the patient died six months after surgery . Another reported case involved a 72-year - old patient with pulmonary metastases and colorectal angiosarcoma as the underlying primary malignancy . He was re - operated on several months later due to massive rectal bleeding, and intraperitoneal spread was detected . Additionally, the case of a 60-year - old female patient was presented, who was also operated on due to colorectal angiosarcoma . Little is known on the long - term outcomes of adjuvant treatment (radiotherapy and chemotherapy) following the surgical resection of angiosarcomas . Komorowski presented a case involving a 19-year - old patient, who was diagnosed with this malignancy . The patient was operated on and received four subsequent courses of chemotherapy and radiotherapy . At follow - up after 18 months, the patient was still alive with no signs of recurrence . Up to now, the longest postoperative survival in a colorectal angiosarcoma patient was reported by smith et al ., where a 16-year - old female patient survived 36 months after surgery . However, in most of the above - described cases, patients diagnosed with colorectal malignancies died within one year after resection due to neoplastic spread or postsurgical complications . In contrast, our patient survived four years after angiosarcoma resection and died due to myocardial infarction . Therefore, this is the first reported case of such long - term survival (48 months) after resection of colorectal angiosarcoma . The surgical approach implemented in our patient proved efficient, and seems the only effective modality in cases of angiosarcoma of such unusual locations as the large intestine . Further research is needed in order to verify the role of adjuvant treatment after surgical resection.
|
A global upsurge in human life expectancy and the recent phenomenon of late - life mortality deceleration have contributed to a higher demand for long - term care.1,2 accordingly, an increasing number of older people are living a longer life while struggling with comorbidities, physical and mental disabilities, emotional distress, and a rising level of dependency.3 usually, they require family assistance or other informal and personal forms of care as well as supportive services from health and social care providers.4 however, most disabled older adults prefer to be supported by their close relatives at home.2 as the baby - boom generation ages, a family can be perceived as a fundamental care institution, contributing to the success of policies aimed at keeping older people safe in their own homes and communities . Family carers (fcs) have a plethora of diverse responsibilities: providing nursing and transportation services for seniors; satisfying their hygienic, therapeutic, and emotional needs; and giving them psychological support.5,6 whether they are spouses, children, or more distant relatives, they are usually willing to broaden the range of care if required.7 however, the vast scope of duties fulfilled by fcs often overwhelms them, contributing to reductions in their employment or hours of work8,9 as well as deterioration of their physical and psychological health and, hence, a decrease in the well - being of all family members.10 these negative outcomes can escalate over time in parallel with the health deterioration of the cared - for persons . The negative impact of providing care is not recognized as a disease or a dysfunction, although sometimes it is compared to a silent disease or to suffering in silence11 and is often overlooked by clinicians focused only on the health problems of their elderly patients . It is widely recognized that providing care causes a multifaceted burden that encompasses the physical, psychological, and social spheres of a caregiver s life.1214 the first tool for quantification of this multidimensional hardship was developed by zarit et al in 1980;15 the burden interview was constructed to evaluate the stress levels experienced by carers of dementia16,17 and nondementia patients.18 soon afterward, other instruments were proposed . However, they often demanded very laborious evaluation processes.6 the tool that we use in this study for assessing a caregiver s distress from providing care is a short, seven - item subscale of the cope index developed by the carers of older people in europe partnership.19 this tool is specially designed as a brief first - stage screening instrument, feasible for use in clinical practice and suitably tailored to identify the carers who may require supportive intervention . The cope index emphasizes the subjective assessment by a caregiver of his or her own situation and circumstances . Thus, it partially shares the same conceptual territory as the burden of care but is intended to better capture how a caregiver self - evaluates on his or her individual internal scale, both cognitively and emotionally, in addition to the experiences and difficulties that he or she is going through in the process of providing care . Moreover, the cope index discriminates between negative and positive aspects of providing care, as it comprises three subscales: negative impact that measures the stress associated with providing care, positive value that quantifies satisfaction gained from being a caregiver, and quality of support that assesses self - perceived assistance from family members, friends, neighbors, and health and social services . The aforementioned three subscales reflect independent dimensions of care and have to be interpreted separately . They have also been validated as internally consistent, using a large sample of fcs drawn from six european countries.20 according to the literature, the range of risk factors for distress suffered by fcs may be extensive . The results of a recent meta - analysis11 point to the most significant risk factors being: female sex, low level of education, common residence with care recipients, depression and social isolation, financial stress, higher number of hours spent caregiving, and a lack of choice in being a caregiver . However, the substantial and chronic burden of an fc can be alleviated if clinicians allow fcs to act as proactive partners in care, recognize their burden, and intervene in order to reduce it.11 on the other hand, some studies also list care recipient - dependent or environment - dependent factors that result in a negative impact of care (nioc), for example, patients dyspnea,21 anemia, and poor mobility performance;22 behavioral disorders;23 the duration of care;24 or socioeconomic situation.25 however, studies that investigate the burden associated with providing care are usually selective in their setup, collecting data from patients with dementia,16,2327 with other well - defined conditions such as cancer22,23,28 or parkinson s disease,29 or are based on ambulatory or nursing home patients.30,31 to this end, very little is still known about the key factors that aggravate the chronic stress endured by caregivers of geriatric inpatients, hence the oldest, comorbid, most complicated and frail medical cases suffering from many overlapping medical conditions.32 the purpose of this study is to identify and investigate the best predictors of the highly negative effects that providing care to a comorbid older person exerts on his or her fc . This analysis can also be helpful in identifying those fcs who intrinsically feel distressed and overwhelmed with the demands and challenges of providing care . The data were collected from fcs and matched with the hospital records of the cared - for persons at their admission or during their short - term stay in a geriatric unit . Only community - dwelling inpatients with available fcs who agreed to participate in the study were involved . All fcs gave informed written consent, and this study was performed in adherence with the principles of the declaration of helsinki and approved by the bioethics committee of the medical university (resolution no . Altogether, 100 fc - inpatient dyads were recruited from june 2014 to september 2015 . Our secondary care sample consisted of inpatients, usually of advanced old age and with complex morbidities, referred to the geriatric ward by general practitioners, most commonly due to the deterioration of their chronic conditions . Fcs were interviewed following a questionnaire with structured response alternatives and a few open - ended questions . The 88-item questionnaire for fcs combined questions from both the eurofamcare questionnaire7 and the cope survey.19 the interviews were conducted face - to - face without the presence of the cared - for persons . The data for this study included inpatient interviews, laboratory reports, and clinical diagnoses, as well as various elements of the comprehensive geriatric assessment that provides the most complete interdisciplinary diagnostic instrument for the identification of medical problems in older patients.33 the nioc was measured using the seven - item negative impact subscale of the cope index with a possible range of values from 7 (minimal burden) to 28 (maximal burden).19,20 according to balducci et al,20 a caregiver who scores high on this subscale experiences high stress from providing care . The following questions were used to quantify the nioc: 1) is caregiving too demanding? 5) does caregiving cause you financial difficulties? 6) do you feel trapped in your role as a caregiver? 7) does caregiving have a negative effect on your emotional well - being? Each of these questions can be answered with never or not applicable (assigned value = 1), sometimes (assigned value = 2), often (assigned value = 3), or always (assigned value = 4). The nioc was quantified as the sum of the numerical values assigned to all answer choices . The dependent variable was defined as a dichotomous indicator of stress experienced in the process of providing care, where lower stress corresponds to nioc 15 and higher stress to nioc> 15 . The threshold value of nioc = 15 corresponds to the median value of the nioc score in our sample that comprises fcs of geriatric patients only . At the same time, the cut point of nioc> 15 distinguishes the 20% of all fcs who are the most severely burdened (ie, those fcs who had the highest score on the nioc subscale), according to the large cross - sectional eurofamcare survey on 6,000 informal carers of older people recruited in six european countries in 2005.20 we included many sociodemographic and care - related characteristics reported by fcs as potential explanatory variables (ie, predictors) for higher stress associated with providing care (table 1). These variables included: fc s age (in years), gender (male or female), marital status (married vs widowed, divorced, or single), place of residence (big city, small town, or village), employment (yes or no), relationship with the person in care (spouse, child, grandchild, sibling, or other relative), coresidence with older cared - for person (yes or no), education (primary, secondary, or higher), and motives for providing care (emotional bonds, lack of an alternative, too high costs of professional care, by request of cared - for person, by chance, or economic benefits), as well as the number of persons living with the cared - for person, care duration (in months), and care intensity (number of hours and number of nights per week). In addition, needs of the cared - for person (health, personal, mobility, emotional, housework, management of finances, financial support) and perceived importance of supportive services (information, training in caring, equipment to facilitate the caring process, financial support, rehabilitation at home, support in logistics of caring, respite care, transportation, opportunity to have more time, placement of the older person at nursing home) were included, with each element coded as a binary indicator, where zero indicated low or no need or importance, and one indicated high need or importance . Finally, we included the fcs self - evaluated health status and his or her self - rated quality of life, each rated on a 5-point scale: very good (assigned value = 1), good (assigned value = 2), neither good nor bad (assigned value = 3), bad (assigned value = 4), or very bad (assigned value = 5). Additionally, fcs answers to questions assessing the positive value of care according to the cope questionnaire 4) do you feel that anyone appreciates you as a caregiver? As well as the quality of support: 4) overall, do you feel well supported in your role of caregiver? Each of these questions could be answered as never or not applicable (assigned value = 1); sometimes (assigned value = 2); often (assigned value = 3); or always (assigned value = 4). In addition to carers data, inpatient - related characteristics were also included as potential predictors (table 2). These included inpatient s age (in years), gender (male or female), number of years spent in education, place of residence (urban or rural), mode of living (alone or with family), a high - stress situation in the recent past (yes or no), and feelings of loneliness (never, sometimes, or often). Anthropometric measures collected were the body mass index (bmi) and the waist - to - hip ratio (whr). Physical functional status was assessed using the barthel index34 an ordinal rating scale for basic activities of daily living (b - adl): feeding, bathing, grooming, dressing, bowel control, bladder control, toilet use, transfer (bed to chair), mobility, and stair use where the total score ranges from a minimum of 0 (complete dependence) to a maximum of 100 (complete independence). The ability to perform instrumental activities of daily living (i - adl) was measured using the duke oars assessment,35 where the total score ranges from 0 (lowest function) to 12 (highest function). Six domains of functions were covered, including preparing their own meals, shopping, handling their own money, using the telephone, and taking their own medicines . The risk of bed sores was evaluated using the norton scale, where the total score ranges from 5 (highest risk) to 20 (no risk of bed sores).36 the severity of depression symptoms was evaluated using the 15-item geriatric depression scale, where higher scores indicate more severe depression.37 cognitive functions were assessed using the clock drawing test, where the summary score ranges from 0 to 7 and higher scores indicate higher cognitive function, and the mini mental state examination (mmse),38 where the summary score ranges from 0 (the worst result) to 30 (the best result). Mobility, including the risk of falling, was assessed with the timed up and go (tug) test,39 which measures the seconds following the instruction to rise from a chair and walk at a comfortable and safe speed to a line that is 3 m away, turn around at the line, walk back, and sit down (the use of an assistance device was allowed if needed). The results were recalculated into speed of the whole tug performance (in meters per second), which provided higher explanatory power than the untransformed variable . For 13 bedridden cases, we assigned a tug speed of 0 m / s . Multimorbidity was measured with the charlson comorbidity index (cci),40 where the score ranges from minimum of 0 to maximum of 31, depending on the presence or absence of selected diseases (ie, heart failure, dementia, cerebrovascular disease, diabetes, chronic obstructive pulmonary disease, chronic kidney disease, and cancer, among others). Additionally, the presence of postural hypotension, falls in the previous year, urine incontinence, and bed sores was noted . All the data were routinely collected in all geriatric inpatients by the geriatric team (geriatricians, nurses, physiotherapists, and a psychologist). First, univariate analyses were performed to test the significance of relationships between the binary indicator of the higher stress, ie, higher nioc, and each of the carer - related variables (table 1) or inpatient - related variables (table 2). Second, computation - intensive, computer - assisted variable selection methods were used to 1) identify the optimal subset of predictors in a multiple logistic regression (lr) model of the higher stress from providing care and 2) validate the robustness of the final model . To this end, a large number of candidate lr models were estimated, where each of these models included a different subset of potential predictors . To reduce the computational burden, only those independent variables that achieved p - values <0.2 in the univariate analyses were included in this second - stage multivariate modeling . The best combination, ie, the subset of independent variables that provided the highest predictive power for the dependent variable in the final lr model, was determined according to the second - order variant of the akaike information criterion (aicc), tailored for moderate sample sizes (if the number of observations divided by the number of parameters is <40),41 and the bayesian information criterion (bic).42 both aicc and bic aim at preventing overfitting by balancing the goodness - of - fit of the statistical model against its complexity.43 the same combination of five independent variables was identified as the best according to both of these information criteria . Lr models with other possible subsets of predictors were considerably less supported by the data.41 the robustness and the out - of - sample predictive accuracy of the final lr model was tested with 10-fold cross - validation.44 to this end, the data were randomly divided into k = 10 equal subsets (each subset containing 10 observations), where k 1 such subsets (90 observations) formed a training block (sample), and the remaining subset (10 observations) formed a testing sample . The lr model with the best predictors was estimated on a training block and its out - of - sample discriminative power was evaluated on the remaining subset of observations . Bootstrapped confidence intervals (cis) for the out - of - sample auc measure, ie, average area under the receiver operating curve (roc), were computed.45 statistical analyses were performed with the stata software version 14.0 (statacorp lp, college station, tx, usa). The data were collected from fcs and matched with the hospital records of the cared - for persons at their admission or during their short - term stay in a geriatric unit . Only community - dwelling inpatients with available fcs who agreed to participate in the study were involved . All fcs gave informed written consent, and this study was performed in adherence with the principles of the declaration of helsinki and approved by the bioethics committee of the medical university (resolution no . Altogether, 100 fc - inpatient dyads were recruited from june 2014 to september 2015 . Our secondary care sample consisted of inpatients, usually of advanced old age and with complex morbidities, referred to the geriatric ward by general practitioners, most commonly due to the deterioration of their chronic conditions . Fcs were interviewed following a questionnaire with structured response alternatives and a few open - ended questions . The 88-item questionnaire for fcs combined questions from both the eurofamcare questionnaire7 and the cope survey.19 the interviews were conducted face - to - face without the presence of the cared - for persons . The data for this study included inpatient interviews, laboratory reports, and clinical diagnoses, as well as various elements of the comprehensive geriatric assessment that provides the most complete interdisciplinary diagnostic instrument for the identification of medical problems in older patients.33 the nioc was measured using the seven - item negative impact subscale of the cope index with a possible range of values from 7 (minimal burden) to 28 (maximal burden).19,20 according to balducci et al,20 a caregiver who scores high on this subscale experiences high stress from providing care . The following questions were used to quantify the nioc: 1) is caregiving too demanding? 7) does caregiving have a negative effect on your emotional well - being? Each of these questions can be answered with never or not applicable (assigned value = 1), sometimes (assigned value = 2), often (assigned value = 3), or always (assigned value = 4). The nioc was quantified as the sum of the numerical values assigned to all answer choices . The dependent variable was defined as a dichotomous indicator of stress experienced in the process of providing care, where lower stress corresponds to nioc 15 and higher stress to nioc> 15 . The threshold value of nioc = 15 corresponds to the median value of the nioc score in our sample that comprises fcs of geriatric patients only . At the same time, the cut point of nioc> 15 distinguishes the 20% of all fcs who are the most severely burdened (ie, those fcs who had the highest score on the nioc subscale), according to the large cross - sectional eurofamcare survey on 6,000 informal carers of older people recruited in six european countries in 2005.20 we included many sociodemographic and care - related characteristics reported by fcs as potential explanatory variables (ie, predictors) for higher stress associated with providing care (table 1). These variables included: fc s age (in years), gender (male or female), marital status (married vs widowed, divorced, or single), place of residence (big city, small town, or village), employment (yes or no), relationship with the person in care (spouse, child, grandchild, sibling, or other relative), coresidence with older cared - for person (yes or no), education (primary, secondary, or higher), and motives for providing care (emotional bonds, lack of an alternative, too high costs of professional care, by request of cared - for person, by chance, or economic benefits), as well as the number of persons living with the cared - for person, care duration (in months), and care intensity (number of hours and number of nights per week). In addition, needs of the cared - for person (health, personal, mobility, emotional, housework, management of finances, financial support) and perceived importance of supportive services (information, training in caring, equipment to facilitate the caring process, financial support, rehabilitation at home, support in logistics of caring, respite care, transportation, opportunity to have more time, placement of the older person at nursing home) were included, with each element coded as a binary indicator, where zero indicated low or no need or importance, and one indicated high need or importance . Finally, we included the fcs self - evaluated health status and his or her self - rated quality of life, each rated on a 5-point scale: very good (assigned value = 1), good (assigned value = 2), neither good nor bad (assigned value = 3), bad (assigned value = 4), or very bad (assigned value = 5). Additionally, fcs answers to questions assessing the positive value of care according to the cope questionnaire were taken into account: 1) do you feel you cope well as a caregiver? 2) do you find caregiving worthwhile? 4) do you feel that anyone appreciates you as a caregiver? As well as the quality of support: 4) overall, do you feel well supported in your role of caregiver? Each of these questions could be answered as never or not applicable (assigned value = 1); sometimes (assigned value = 2); often (assigned value = 3); or always (assigned value = 4). In addition to carers data, inpatient - related characteristics were also included as potential predictors (table 2). These included inpatient s age (in years), gender (male or female), number of years spent in education, place of residence (urban or rural), mode of living (alone or with family), a high - stress situation in the recent past (yes or no), and feelings of loneliness (never, sometimes, or often). Anthropometric measures collected were the body mass index (bmi) and the waist - to - hip ratio (whr). Physical functional status was assessed using the barthel index34 an ordinal rating scale for basic activities of daily living (b - adl): feeding, bathing, grooming, dressing, bowel control, bladder control, toilet use, transfer (bed to chair), mobility, and stair use where the total score ranges from a minimum of 0 (complete dependence) to a maximum of 100 (complete independence). The ability to perform instrumental activities of daily living (i - adl) was measured using the duke oars assessment,35 where the total score ranges from 0 (lowest function) to 12 (highest function). Six domains of functions were covered, including preparing their own meals, shopping, handling their own money, using the telephone, and taking their own medicines . The risk of bed sores was evaluated using the norton scale, where the total score ranges from 5 (highest risk) to 20 (no risk of bed sores).36 the severity of depression symptoms was evaluated using the 15-item geriatric depression scale, where higher scores indicate more severe depression.37 cognitive functions were assessed using the clock drawing test, where the summary score ranges from 0 to 7 and higher scores indicate higher cognitive function, and the mini mental state examination (mmse),38 where the summary score ranges from 0 (the worst result) to 30 (the best result). Mobility, including the risk of falling, was assessed with the timed up and go (tug) test,39 which measures the seconds following the instruction to rise from a chair and walk at a comfortable and safe speed to a line that is 3 m away, turn around at the line, walk back, and sit down (the use of an assistance device was allowed if needed). The results were recalculated into speed of the whole tug performance (in meters per second), which provided higher explanatory power than the untransformed variable . For 13 bedridden cases, we assigned a tug speed of 0 m / s . Multimorbidity was measured with the charlson comorbidity index (cci),40 where the score ranges from minimum of 0 to maximum of 31, depending on the presence or absence of selected diseases (ie, heart failure, dementia, cerebrovascular disease, diabetes, chronic obstructive pulmonary disease, chronic kidney disease, and cancer, among others). Additionally, the presence of postural hypotension, falls in the previous year, urine incontinence, and bed sores was noted . All the data were routinely collected in all geriatric inpatients by the geriatric team (geriatricians, nurses, physiotherapists, and a psychologist). We included many sociodemographic and care - related characteristics reported by fcs as potential explanatory variables (ie, predictors) for higher stress associated with providing care (table 1). These variables included: fc s age (in years), gender (male or female), marital status (married vs widowed, divorced, or single), place of residence (big city, small town, or village), employment (yes or no), relationship with the person in care (spouse, child, grandchild, sibling, or other relative), coresidence with older cared - for person (yes or no), education (primary, secondary, or higher), and motives for providing care (emotional bonds, lack of an alternative, too high costs of professional care, by request of cared - for person, by chance, or economic benefits), as well as the number of persons living with the cared - for person, care duration (in months), and care intensity (number of hours and number of nights per week). In addition, needs of the cared - for person (health, personal, mobility, emotional, housework, management of finances, financial support) and perceived importance of supportive services (information, training in caring, equipment to facilitate the caring process, financial support, rehabilitation at home, support in logistics of caring, respite care, transportation, opportunity to have more time, placement of the older person at nursing home) were included, with each element coded as a binary indicator, where zero indicated low or no need or importance, and one indicated high need or importance . Finally, we included the fcs self - evaluated health status and his or her self - rated quality of life, each rated on a 5-point scale: very good (assigned value = 1), good (assigned value = 2), neither good nor bad (assigned value = 3), bad (assigned value = 4), or very bad (assigned value = 5). Additionally, fcs answers to questions assessing the positive value of care according to the cope questionnaire were taken into account: 1) do you feel you cope well as a caregiver? 2) do you find caregiving worthwhile? 4) do you feel that anyone appreciates you as a caregiver? As well as the quality of support: 4) overall, do you feel well supported in your role of caregiver? Each of these questions could be answered as never or not applicable (assigned value = 1); sometimes (assigned value = 2); often (assigned value = 3); or always (assigned value = 4). In addition to carers data, inpatient - related characteristics were also included as potential predictors (table 2). These included inpatient s age (in years), gender (male or female), number of years spent in education, place of residence (urban or rural), mode of living (alone or with family), a high - stress situation in the recent past (yes or no), and feelings of loneliness (never, sometimes, or often). Anthropometric measures collected were the body mass index (bmi) and the waist - to - hip ratio (whr). Physical functional status was assessed using the barthel index34 an ordinal rating scale for basic activities of daily living (b - adl): feeding, bathing, grooming, dressing, bowel control, bladder control, toilet use, transfer (bed to chair), mobility, and stair use where the total score ranges from a minimum of 0 (complete dependence) to a maximum of 100 (complete independence). The ability to perform instrumental activities of daily living (i - adl) was measured using the duke oars assessment,35 where the total score ranges from 0 (lowest function) to 12 (highest function). Six domains of functions were covered, including preparing their own meals, shopping, handling their own money, using the telephone, and taking their own medicines . The risk of bed sores was evaluated using the norton scale, where the total score ranges from 5 (highest risk) to 20 (no risk of bed sores).36 the severity of depression symptoms was evaluated using the 15-item geriatric depression scale, where higher scores indicate more severe depression.37 cognitive functions were assessed using the clock drawing test, where the summary score ranges from 0 to 7 and higher scores indicate higher cognitive function, and the mini mental state examination (mmse),38 where the summary score ranges from 0 (the worst result) to 30 (the best result). Mobility, including the risk of falling, was assessed with the timed up and go (tug) test,39 which measures the seconds following the instruction to rise from a chair and walk at a comfortable and safe speed to a line that is 3 m away, turn around at the line, walk back, and sit down (the use of an assistance device was allowed if needed). The results were recalculated into speed of the whole tug performance (in meters per second), which provided higher explanatory power than the untransformed variable . For 13 bedridden cases, we assigned a tug speed of 0 m / s . Multimorbidity was measured with the charlson comorbidity index (cci),40 where the score ranges from minimum of 0 to maximum of 31, depending on the presence or absence of selected diseases (ie, heart failure, dementia, cerebrovascular disease, diabetes, chronic obstructive pulmonary disease, chronic kidney disease, and cancer, among others). Additionally, the presence of postural hypotension, falls in the previous year, urine incontinence, and bed sores was noted . All the data were routinely collected in all geriatric inpatients by the geriatric team (geriatricians, nurses, physiotherapists, and a psychologist). First, univariate analyses were performed to test the significance of relationships between the binary indicator of the higher stress, ie, higher nioc, and each of the carer - related variables (table 1) or inpatient - related variables (table 2). Second, computation - intensive, computer - assisted variable selection methods were used to 1) identify the optimal subset of predictors in a multiple logistic regression (lr) model of the higher stress from providing care and 2) validate the robustness of the final model . To this end, a large number of candidate lr models were estimated, where each of these models included a different subset of potential predictors . To reduce the computational burden, only those independent variables that achieved p - values <0.2 in the univariate analyses were included in this second - stage multivariate modeling . The best combination, ie, the subset of independent variables that provided the highest predictive power for the dependent variable in the final lr model, was determined according to the second - order variant of the akaike information criterion (aicc), tailored for moderate sample sizes (if the number of observations divided by the number of parameters is <40),41 and the bayesian information criterion (bic).42 both aicc and bic aim at preventing overfitting by balancing the goodness - of - fit of the statistical model against its complexity.43 the same combination of five independent variables was identified as the best according to both of these information criteria . Lr models with other possible subsets of predictors were considerably less supported by the data.41 the robustness and the out - of - sample predictive accuracy of the final lr model was tested with 10-fold cross - validation.44 to this end, the data were randomly divided into k = 10 equal subsets (each subset containing 10 observations), where k 1 such subsets (90 observations) formed a training block (sample), and the remaining subset (10 observations) formed a testing sample . The lr model with the best predictors was estimated on a training block and its out - of - sample discriminative power was evaluated on the remaining subset of observations . Bootstrapped confidence intervals (cis) for the out - of - sample auc measure, ie, average area under the receiver operating curve (roc), were computed.45 statistical analyses were performed with the stata software version 14.0 (statacorp lp, college station, tx, usa). According to the aicc and bic information criteria, the best lr model for predicting higher stress associated with providing care comprised of five predictors: 1) fcs self - evaluated health status (or = 2.28; 95% ci: 1.154.52), 2) fcs self - appraisal of coping well as a caregiver (or = 0.22; 95% ci: 0.10.52), 3) fcs sense of overall support in their role as a caregiver (or = 0.35; 95% ci: 0.180.70), 4) the number of care hours per week (or = 1.01; 95% ci: 1.001.02), and 5) the speed of the patient s tug performance (or = 0.01; 95% ci: 0.000.48). The marginal effects for each of the explanatory variables in the best lr model are depicted in figure 1 . Each panel represents the predicted probability of higher stress associated with providing care for all possible values of a best predictor, given that all other covariates are set to their average levels . The predicted probability that an fc experiences a high nioc varies in parallel to his or her self - evaluated health status (panel a). The probability rises from the level of approximately 0.15 for carers that rate their health as very good to approximately 0.8 for those who perceive their health as very bad . Fcs distress is strongly dependent on the self - perception of coping well as a caregiver (panel b). Thus, fcs almost always (predicted probability equal to 0.95) feel stressed in their roles as caregivers if they sense that they do nt cope well with their tasks . However, the probability of distress drops to <0.2 if they perceive they handle the caregiver s role well . Subjective perception of overall support, whether from family, neighbors, friends, or formal services, considerably alleviates the risk of high nioc, as the probability drops from approximately 0.8 to 0.15 with greater perception of support (panel c). On the other hand, an objective factor that affects the caregiver s subjective burden is the number of care hours per week . However, the increase in probability of experiencing distress is not extremely high; it changes from approximately 0.25 for carers that provide care for approximately 10 hours / wk to 0.6 for those fcs who live with their seniors and care for them around the clock on a daily basis (panel d). Interestingly, after controlling for the factors previously mentioned, the cared - for person s motor function turned out to be the only inpatient - related predictor that exerts an impact on fc (panel e). Those fcs who provide care for bedridden persons are more likely to be distressed, with a probability of 0.65 . On the other hand, the fcs who provide care for persons who are able to perform the tug test very quickly were significantly less likely to be distressed . Auc statistics amounted to 0.86, and the average out - of - sample auc obtained with the 10-fold cross - validation was equal to 0.83 (95% ci: 0.770.87). The risk of high distress among fcs results from a particular combination of observable values for five best predictors . The individual graphs depict combinations of tug test outcomes (on the vertical axis) and number of care hours per week (on the horizontal axis) for which an fc experiences high nioc (orange area), based on specific answers to questions: overall, do you feel well supported in your role of caregiver? Do you feel you cope well as a caregiver? How do you evaluate your overall health? For example, for those fcs who state that they sometimes cope well as caregiver, often feel overall well - supported and evaluate their health as very good, the upper right orange area of the graph corresponds to the pairs of tug outcomes and numbers of care hours that classifies an fc as being highly stressed (panel a). This orange area shrinks if an fc often copes well as a caregiver and sometimes feels well - supported (panel b) and broadens considerably if an fc often copes well as a caregiver, but never feels well - supported (panel c). Those carers sometimes cope well as a caregiver, sometimes feel well - supported, and evaluate their health as bad are nearly always classified as distressed by the care needs of their seniors, irrespective of tug outcome or number of care hours (panel h). Systematic assessment of distress suffered by fcs of the disabled, comorbid, and oldest - old persons is often ignored in routine clinical practice, usually due to time deficiency or absence of simple and feasible evaluation tools . On the other hand, it is known that the chronic stress of caregiving that results from persistent physical and mental strain can lead to several diseases and dysfunctions, such as depression46 or impaired endocrine and immune function.47 thus, fcs can be called invisible second patients, who at the same time have to play the key role in ensuring the quality of life of ill older people in their home environment.48 although in our empirical study, we took into account a very long list of potential explanatory factors, the application of statistical information criteria in the multivariate analysis allowed us to identify a short list of the five most important variables that enable us to successfully predict distress among fcs . Moreover, reliance on the information criteria in the variable selection process also allowed us to overcome limitations of the widely used forward or backward elimination methods, in particular the arbitrarily chosen confidence levels that must be appropriately corrected for the whole decision process and the poor performance of the stepwise methods in the presence of multicollinearity.49 our study shows that the less supported fcs feel and the less convinced they are that they cope well as caregivers, the more they will probably be stressed by their circumstances . Formal supports such as institutionalization, financial assistance, or counselling are known to reduce the burden on fcs,50 and the informal physical, emotional, and informational support reflected in the presence of a strong social network eases fcs distress.51,52 in the multivariate analysis, a predictor defined as a degree of overall support encompassed all of the aforementioned elements . This complex notion turned out to possess better predictive power for higher distress in fcs than other much more precise verbalizations of support channels (ie, support from family, friends or neigh - bors, health, and social services). Our results also indicate that the fc s level of stress is relieved by the ability to control and manage the challenges of a caregiver s role and, thus, to cope well with the needs of care recipients . This finding is in line with the observation that stressors in one domain of an fc s life usually compound or exacerbate difficulties in coping with the demands in other domains of life.53 thus, the distress suffered by fcs is directly related to their intrinsic perceived ability to handle the demands associated with providing care . As fcs usually face multifaceted physical, emotional, social, or spiritual challenges, targeted and timely interventions aimed at educating fcs on how to cope more efficiently with the everyday demands of a caregiver s role are of great importance.54 another explanatory variable that is independently associated with higher distress in fcs is his or her self - evaluated health . This relationship may not represent one - directional causality, as the physical and emotional strain in caregiving is known to result in deterioration of the carer s health.55,56 we show that subjective perception of the fcs own health status is independently associated with the probability of distress from providing care . If an fc sometimes feels well supported, sometimes copes well as a caregiver and perceives his or her health as bad or very bad, he or she will have a higher nioc, irrespective of the values taken by other covariates in the final model . Our results also show that the probability of higher distress in fcs increases with the number of care hours per week . This objective measure of fcs involvement is already known to be associated with subjective appraisal of carer s burden, because fatigue and burnout escalates if the caring is relentlessly time consuming.52,57 in the literature, there is conflicting evidence about relationships between distress suffered by fcs and objective characteristics of the care recipients.6 the study of garlo et al58 showed that there are no independent associations between sociodemographic or health - related characteristics of older cared - for persons with advanced chronic diseases and the burden from providing care, a result which might be explained by a carer s ability to adapt to his or her circumstances . Our results from the multivariate analysis also do not provide evidence of any significant relationships between a higher nioc among fcs and a declared disability or a diagnosed disease / disorder, including dementia, in cared - for persons . Slow motor performance, measured with the speed of the tug test, was the only patient - related factor in the multivariate model that best predicted higher distress among fcs . Gait speed or motor retardation is usually known to be valid as indicators of overall disability and even risk of death in older adults59,60 as well as they help to predict the subjective well - being.61 our results are consistent with this, as only the tug speed, representing the motor function of the care recipient, was selected for the final model, irrespective of dementia diagnosis, comorbidity level measured with the charlson index, or the presence of other disabilities assessed with the barthel or i - adl indexes . Similar findings were reported in a study based on older patients with cancer, although the motor retardation was measured with a different instrument.22 poor motor function of cared - for persons was already shown to exert an independent effect on a carer s burden in studies based on patients with parkinson s disease29 or with multiple sclerosis.62 according to pike et al,63 patients with greater walking impairment more often require additional caregiver support, visit healthcare professionals more frequently, and require more nondisease modifying drugs . Our findings indicate that the summed - up effect of a wide spectrum of dysfunctions might be expressed with a single variable measuring motor speed . To our knowledge, this significant independent effect of poor motor function in the oldest, most comorbid, and frail adults on the probability of high distress in their fcs is novel in the literature . First, in our study we did not measure the caregiver s functional status (including motor function), depression, or cognition, and these characteristics might potentially influence the high score on the nioc.27 second, the cross - sectional setup of our analysis does not permit statistical inference about causal, unidirectional relationships between some explanatory variables and higher distress in an fc . As mentioned previously, self - evaluation of health may be treated as both a cause and an effect of distress among fcs . Analogously, the inability to cope well with the caregiver s demands may increase a subjective appraisal of burden, whereas the converse may also be true, and a distressed fc may underrate his or her ability to stand up to the challenges of the caregiver s role . Regardless of this fact, both these explanatory variables proved to very successfully indicate the risk of distress among fcs . However, the obtained lr model allowed for a very good discrimination between lower and higher stress associated with caregiving and the high robustness of the observed relationships was successfully confirmed for out - of - sample observations using the statistical method of cross - validation . This study provides new insights into the process of simple and feasible identification of those fcs who feel highly stressed by providing care and, hence, warrant timely and careful consideration of their situation and circumstances . According to the optimal model, a caregiver s high nioc can be independently predicted by lower self - evaluation of health; poor subjective self - appraisal of coping well as a caregiver; lower intrinsic sense of general support; and two objective factors: higher number of care hours per week and lower motor function of the cared - for person . Among the predictive variables in the model, motor retardation as assessed by the tug test was the only patient - related predictor of higher nioc . This is a novel result since the majority of studies focuses mainly on the presence of dementia or different dementia - related factors for the burden suffered by fcs of older adults,16,24,26 whereas the beneficial effects of conventional case management are shown to be limited.64 thus, we show that educational initiatives aimed at promotion of suitably tailored physical exercises for older adults could be beneficial not only for the cared - for persons, but also for their carers . The practical clinical implication from our study is to enhance the mobility of hospitalized older patients by kinesitherapeutic treatment within a comprehensive geriatric approach . This is a challenging, but also rewarding task that has the potential to alleviate silent distress in fcs.
|
The mortality and morbidity from cvst in various prospective studies range between 8.8% and 44.4% . Conditions predisposing to dural sinus thrombosis include puerperium, trauma, malignancy, disseminated intravascular coagulation, hypercoagulable states, infections, medications (e.g., synthetic steroids and contraceptive hormones), connective tissue disorders, and dehydration . Headache is the most common symptom (8090%), other common presentations are focal or generalized seizures, focal neurological deficits, and alteration in sensorium . Occlusions in the superficial venous system are better tolerated and has a better prognosis than thrombosis in the deep venous system because of the extensive collateral supply . The treatment is aimed at opening up of the occluded sinuses by systemic anticoagulation and giving antiedema measures in the acute phase . Surgical decompression may be the option in cases with a large infarct volume and midline shift . In cases where there is no significant improvement following systemic anticoagulation, direct thrombolysis and mechanical thrombectomy can be considered . Here, we review the techniques and indications for endovascular treatment of cvst and long - term results in 8 cases of dural venous sinus thrombosis (dvst) that underwent mechanical thrombectomy with penumbra device with or without concurrent balloon angioplasty and chemical thrombolysis . Out of the 243 cases of acute cvt treated in a quaternary level teaching hospital over a period of 4 years, 8 underwent mechanical thrombectomy using the penumbra system, with or without concurrent balloon angioplasty and chemical thrombolysis . The ages ranged from 2040 years, with all the patients being females . In all 8 patients, the common presenting feature was headache [table 1]. In 5/8 patients, there was involvement of the superficial venous system, and in the rest there was involvement of the superficial and deep system . Seven out of 8 cases had venous infarct on the magnetic resonance imaging (mri) before endovascular thrombectomy was performed [figure 1]. Clinical and radiological profile mri brain showing areas of restricted diffusion in deep white matter of bilateral frontal lobes (arrow) in both diffusion (a) and adc maps (b) suggestive of infarcts . There is extensive subacute thrombosis of the entire superior sagittal sinus (straight arrow), both transverse sinuses (curved arrow), straight sinus (thin arrow), and multiple cortical veins in the mrv images (c - e) all patients were initially managed medically, systemic anticoagulation (intravenous unfractionated heparin) was started to keep the target ptt> 1.5 times the control . Anticonvulsants were started in patients who presented with seizures and also were given prophylatically to others with large venous infarcts involving the cerebral cortex . All patients were treated for raised intracranial pressure with acetazolamide (dose ranging from 250 mg thrice a day to 500 mg thrice day), intravenous dexamethasone, and hypertonic (3%) saline . These patients were taken up for endovascular thrombectomy after clinical and radiological worsening . In 5 out of 8 cases, balloon angioplasty was concurrently used along with the penumbra system (penumbra, alameda, usa). In the remaining 3 cases, however, transarterial cerebral angiography was not routinely performed to survey the dvst detail, except when required . Penumbra mechanical clot retrieval was done with additional balloon angioplasty and chemical thrombolysis were carried out on as required basis . A 6f envoy guide catheter (codman & shurtleff, inc, raynham, ma, usa) was first advanced through the femoral vein and placed at the base of the skull . The blocked dural sinuses were approached using an anteroposterior, lateral, or a combination of both projections . Using a 300 cm 0.014 in microwire, a 032 penumbra reperfusion microcatheter was advanced retrogradely into the anterior two - thirds of the superior sagittal sinus . To disrupt the thrombus, 5 mg tpa, or 2l urokinase was administered or a 35 mm balloon angioplasty was performed up to 23 times from the distal to the proximal end of the occlusion to sufficiently extract the thrombus . Then using a penumbra reperfusion catheter separator combination, thrombus extraction was performed [figures 25]. In cases where there was no significant angiographic recanalization of the sinus after 2 or 3 passes of the penumbra device along with thrombolysis / angioplasty, the procedure was discontinued . Thrombolysis was done by angioplasty (a) with a 3 mm 10 cm balloon (arrow) followed by mechanical thrombectomy (b) with a penumbra catheter system (arrow). No significant recanalization of superior sagittal sinus (arrow), transverse, and sigmoid sinuses in the post - thrombolysis venogram (c) mrv done 5 days after thrombolysis (a - c) shows partial resolution of thrombus in the superior sagittal sinus (straight arrow), transverse sinus (curved arrow), and straight sinus with residual filling defects . Mrv done two and a half years later (d) shows near complete recanalization of the superior sagittal sinus (straight arrow), transverse (curved arrow) and sigmoid sinuses, and straight sinus non - contrast ct brain axial images shows hyperdense area (arrow) in the parasagittal aspect of right high parietal region suggestive of a haemorrhagic infarct (a) mri brain done the next day shows heterogeneous lesion (arrows) in flair and t2 (b - d) with blooming on swi (e) in right parasagittal parietal region keeping with a infarct with haemorrhagic transformation . Mrv shows filling defects in the superior sagittal sinus (straight arrow), right transverse (curved arrow) and sigmoid sinuses (f and g). Ct brain done 6 days later shows (h) increase in haemorrhagic component in the right high fronto - parietal region (straight arrow) and new hypodense lesion in left high fronto - parietal region (curved arrow) with small foci of haemorrhage thrombolysis was done by balloon angioplasty (a) using a 3 mm 4 cm balloon (arrow) followed by mechanical thrombectomy (b) using a penumbra thrombectomy device (arrow). Post - thrombolysis venogram (c) shows minimal recanalization of the anterior superior sagittal sinus (arrow) and angiogram (d) showed no flow in the anterior superior sagittal sinus but a patent posterior segment of superior sagittal sinus medical management was continued in all patients . A repeat magnetic resonance venography (mrv) was performed if the patient showed no significant clinical improvement after 23 days . After discharge, the patient was followed up with, mrs score assessment and fundal examination . There were no hemorrhagic events during or after the procedure in any of the patients, nor any immediate or late endovascular - related complications was detected . Good improvement was noted at 6 months with mrs 02 in 5/8 (62%) cases [table 2]. Patients were followed for a mean of 14.5 months (range: 3 months to 26 months); there were no new neurological events during the follow - up period . Venous sinus thrombosis is a rare and potentially life - threatening condition, with a 30-day fatality rate of 3.4% in a multicentre international prospective study . Intravenous anticoagulation with heparin, followed by oral anticoagulation is the front - line treatment . When the clinical condition fails to respond despite standard medical management, endovascular therapy can be undertaken . All 8 patients described here were young, otherwise healthy individuals with severe and progressive neurological symptoms in spite of standard medical therapy . Before the era of mechanical thrombectomy devices, found that local thrombolysis was associated with a non - negligible incidence of major bleeding complications, including intracranial bleeding, potentially affecting patient outcome . In this study, urokinase was used because it was readily available and less expensive than rtpa . In only one case the use of mechanical thrombectomy with or without concurrent chemical thrombolysis has been reported using other devices, such as balloon angioplasty, the angiojet rheolytic catheter (possis medical, minneapolis, minnesota, usa), the merci retriever device (concentric medical, mountain view, california, usa), and the solitaire fr retrieval device (covidien, irvine, ca, usa), with each having their own inherent limitations . In 3 out of 8 cases, thrombolysis was combined with balloon angioplasty and mechanical thrombectomy to aid in clot retrieval . Here, we report possibly the largest series using the penumbra system for mechanical thrombectomy in dvst . The penumbra system is a modification of the manual proximal aspiration technique and consists of a dedicated reperfusion catheter connected to a pump, which applies continuous aspiration . A microwire with an olive - shaped tip called the separator is used to clear the tip of the reperfusion catheter from clot fragments to avoid obstruction . The ps has shown safety and efficacy in the mechanical treatment of acute ischemic stroke due to thromboembolism . In this report, the procedures utilized a 0.41 or 0.32 inch penumbra system reperfusion catheter based on the ease of the wire to traverse the thrombus . Balloon angioplasty augmentation was performed in cases where the penumbra system separator did not macerate the clot independently to allow optimum aspiration using the reperfusion catheter . While most cases did not demonstrate significant recanalization in the immediate post - thrombolysis imaging, they showed improvement in their clinical course after the procedure as well as significant resolution in the follow - up imaging [figures 3d and 6]. There were no intraprocedural complications and no procedure - related complications postoperatively . The mean follow - up period in this study was 14.5 months, which is unique compared to other similar studies . None of the patients had recurrent dural sinus thrombosis during the follow - up period . A multicentre randomized controlled trial may be required to measure the clinical efficacy on a large sample size . Mrv done 4 months later (a and b) showed near complete recanalization of the superior sagittal sinus (straight arrow), right transverse (curved arrow), and sigmoid sinuses cerebral venous sinus thrombosis is a rare but life - threatening condition that demands timely diagnosis and therapy . In cases of rapidly declining neurological status despite standard therapy of systemic anticoagulation, mechanical thrombectomy appears to be a safe and effective method when used alone or in combination with catheter - directed chemical thrombolysis.
|
Complete or partial edentulism is a common occurrence . To fabricate accurate dental prostheses for rehabilitation of an edentulous area, precise impression of the hard (dental) and soft tissue taken with impression material with high dimensional stability use of impression materials with inadequate dimensional stability and accuracy increases the costs of treatment due to the need for repeating the impression and re - fabrication of the prosthesis or the need for modifications . Moreover, long - term use of an improper prosthesis by the patients may have adverse consequences and can cause oral ulcers and subsequent infections . Thus, impression making plays an important role in fabrication of an accurate prosthesis and minimizes the costs and complications of prosthetic treatment . Different impression materials are available in the market with different compositions and characteristics, which make them suitable for use in different clinical situations . Sodium alginate, polyether and silicon materials such as polyvinyl siloxane are among the most commonly used impression materials . Zinc oxide impression pastes have long been used for final impression making of the edentulous jaws and rebasing of complete dentures . The polymerization shrinkage of these materials is insignificant following setting and has reported to be less than 0.1% . Having low consistency before setting, these materials can yield a precise impression with well - defined surface details . They are used for final impression making of edentulous ridges with small or no undercuts, or as a light body with other impression materials, bite registration pastes and temporary liners for dentures and surgical dressings . Moreover, they can be used for taking mucostatic or mucodisplacive impressions and they remain stable within their shelf life . The choice of impression material depends on the clinical indication and the clinician s judgment . Since in some cases dentists do not have quick access to a laboratory to pour the impressions, impression materials preserving their dimensional stability for long periods of time must be necessarily used . This study aimed to assess the effect of storage time and temperature on dimensional stability of impressions made with cavex impression material . A round stainless steel mold was fabricated with five grooves (three horizontal and two vertical) according to iso 3107:2011 . In addition to these grooves, the mold had two lateral grooves to be filled with the impression material . The mold had been specifically designed for the purpose of determining the dimensional stability of the impression material and reconstruction of details (fig . The mold with three horizontal and two vertical grooves cavex outline light body impression paste (cavex holland bv, rw haarlem, netherlands) was prepared as instructed by the manufacturer (mixing time of 45 seconds, working time of 2.15 to 3.30 minutes) and applied to the mold . The mold was placed on a block and stored in an incubator under 1 kg load, simulating oral conditions in terms of temperature and humidity (35c and 100% humidity) until completion of setting time . The casts were poured immediately (time zero) and after 30, 120, 240 and 420 minutes and 24 hours with type iv dental stone (heraeus kulzer inc ., south bend, in, usa)(fig . 2). Pouring the mold with stone all timings were kept using a chronometer (junso, tokyo, japan). The impressions were stored at room temperature (23c) in group one and in a refrigerator at 4c in group two . After completion of the setting time according to the manufacturer s instructions (final setting time of four minutes), the cast was removed from the mold . To determine the linear dimensional stability in each group, a digital caliper (mitutoyo, tokyo, japan) with 0.001 mm accuracy was used . Next, the distance between the vertical lines on the casts was compared with that in the immediately poured cast . According to walker et al, the change in the distance between the two vertical lines should not be more than 0.5%; otherwise, the impression cannot be identified as dimensionally accurate . The results were subjected to statistical analysis in spss version 22 (spss inc ., il, usa) to compare dimensional stability of the impressions based on the pouring time and storage temperature and calculate the absolute measurement error . The results showed that storage of impressions in a refrigerator and at room temperature for zero to seven hours had no effect on dimensional stability of the casts (p>0.05). However, 24 hours of storage in a refrigerator or at room temperature increased dimensional changes and decreased dimensional stability compared to the impressions stored for zero to seven hours in the same conditions (p=0.001). Also, a significant association was found between dimensional changes following the storage of materials in the refrigerator (4c) and at room temperature (23c) for 24 hours (p<0.01; tables 1 and 2). The distance (in millimeters) between the vertical lines on the casts of impressions kept at 23c the distance between the vertical lines (in millimeters) on the casts kept at 4c figure 3 compares the mean and 95% confidence interval of the measured dimensions on the casts based on the pouring time (the interval between the impression making and pouring). As seen in figure 3, the mean distance between the vertical lines on the casts (that can be used as an index to determine the acceptable threshold of dimensional changes) was 24.78 mm after zero to seven hours of storage . After 24 hours of storage in a refrigerator (4c) and at room temperature (23c), the difference () was found to be 0.13 mm, and exceeded the acceptable threshold of dimensional changes for metal oxide impression materials, which is 0.1 mm . Mean and 95% confidence interval of the measured dimensions on the casts based on the pouring time studies have shown that impression materials undergo dimensional changes due to the effect of environmental factors such as humidity and heat, composition of the impression material and storage time . Cavex outline is a commonly used rigid impression material and belongs to the group of metal oxide impression materials . This study aimed to assess the precision of stone casts made using cavex outline impressions after different storage times in order to find the most suitable pouring time and storage temperature . The results showed that storage of cavex outline impressions in a refrigerator or at room temperature from zero to seven hours had no effect on their dimensional stability (p>0.05). However, 24 hours of storage in a refrigerator or at room temperature increased the dimensional changes (decreased dimensional stability) compared to the impressions stored for zero - seven hours in the same conditions (p=0.001). Also, a significant association was found between dimensional changes due to 24 hours of storage of materials in a refrigerator (4c) and at room temperature (23c; p<0.01). Ghasemi et al, in their study evaluated the effect of storage time on dimensional changes of alginate, an irreversible hydrocolloid impression material . In their in - vitro, experimental study, 30 alginate impressions were made and poured after 15, 60 and 240 minutes with dental stone within 10 seconds and after 45 minutes . They concluded that increasing the pouring time from 15 to 60 minutes resulted in dimensional changes in the height of the small die but did not affect other dimensions . Their study was different from ours in that they used a metal pattern with two abutments for a three - unit bridge and a small and a large die; whereas, in the current study, a round stainless steel mold was used to assess the dimensional stability of cavex outline impression paste . Nonetheless, our results confirmed those of ghasemi et al, and showed that increasing the storage time decreased the dimensional stability of cavex outline impression material . Cohen et al, and hollenback and smith evaluated the dimensional stability of hydrocolloid impressions and showed that hydrocolloid impressions must be poured immediately or maximally within 12 minutes . Some researchers have reported that it is safe to keep the impressions in a humid environment for one to 18 hours [1416]. Recent studies on impression materials show that the manufacturers are attempting to increase the storage time of impression materials . Johnson and craig, eriksson et al, and schleier et al, reported that the storage time of hydrocolloid impression materials has increased and hydrocolloid materials can be stored in a humid environment for one, two or even four hours without undergoing significant dimensional changes . Comparison of extended - pour and conventional alginates revealed that the casts poured after five days were not significantly different from the standard models . Our findings were in line with the results of the above - mentioned studies and showed that storage for up to seven hours had no effect on dimensional stability, but 24 hours of storage resulted in unacceptable dimensional changes . Review of the literature yielded no similar study on dimensional stability of cavex outline metal oxide impression pastes . Thus, we compared our results with two other studies on different types of irreversible hydrocolloids from cavex . Erbe et al, in 2012 made impressions with seven different materials namely blueprint, cavex ca37, cavex color change, jeltrate, orthoprint, cavex orthotrace, and tetrachrom according to iso / cd 21563 . They compared the three - dimensional stability of irreversible hydrocolloid (ih) impression materials stored for up to seven days in low - moisture (in a humidor) and high - moisture (wrapped in a wet paper towel) conditions . The results revealed that if stored in a humidor, pouring of the ih impressions must be done within four hours . If stored in wet conditions, non - color - change ih impressions must be poured within two hours . In general, ihs with variable colors showed higher dimensional changes . For optimal dimensional stability, ih impressions must be poured as soon as possible . In another study in 2008, sedda et al . Evaluated the precision of casts made from alginate impression material poured immediately or after storage for specific time periods . They used five types of alginate namely ca 37 (cavex), jeltrate (dentsply caulk), jeltrate plus (dentsply latin america), hydrogum 5 (zhermack) and alginoplast (heraeus kulzer). The impressions were stored at 23c with 100% humidity and were then poured with dental stone immediately and after 24, 72 and 120 hours . Casts were evaluated and the results showed that the dimensional stability of the impression materials was influenced by the type of impression material and storage time . Our findings were in accord with those of the above - mentioned studies and showed that increasing the pouring time for up to seven hours had no significant effect on cavex outline but further increase in storage time from seven to 24 hours decreased the dimensional stability, and the obtained casts were no longer reliable . Assessment of the precision of stone casts obtained using cavex outline impressions stored for different time periods showed that the safe storage time for this impression material was zero (immediately poured) to seven hours and further storage for longer periods of time resulted in loss of dimensional stability . These findings suggest that impressions stored for more than seven hours should not be poured because of their decreased dimensional stability.
|
What are the evolutionary forces that drive operon formation in prokaryotes but not in eukaryotes? One idea is that stronger genome size constraints in prokaryotes provide a large benefit to reducing the number of promoters . Another idea is that the high rate of horizontal gene transfer in prokaryotes provides an advantage for functionally related genes to be grouped together to increase their probability of cotransfer (13). Another benefit of operon formation is that it decreases the fluctuations between the concentrations of the coexpressed proteins (4). Fluctuations in relative protein concentrations can be wasteful, for example, when multiple proteins form a tight complex or act in concert (47). Translational coupling, in which ribosomes translating an upstream gene aid the translation of the downstream gene on the same mrna molecule, has been emphasized as a way in which operon formation can reduce such fluctuations (6, 7). But strong translational coupling is not a general feature of operons (6). Here we show that cotranscription by itself can provide a substantial cost reduction in the production of protein complexes . This benefit decreases as the number of complexes increases, as required in larger cells . Thus, reduction in the shortfall of protein complexes provides an additional explanation for the abundance of operons in prokaryotes and archaea compared to the lack of that in eukaryotes . Considering a functional 1:1 complex of two different proteins, we compare a system in which the two genes are cotranscribed but not translationally coupled to a system in which the two genes are transcribed independently from promoters of equal strength (split). If 100 copies of the complex are required, then in the absence of noise (and assuming a tight complex), it would be sufficient to produce 100 copies of each protein . In a living cell, both systems would fall short of the 100-complex target because the number of each protein will fluctuate around 100, and the number of complexes is determined by the minimum level of the two proteins . However, in the operon arrangement, the levels of the two proteins tend to fluctuate in synchrony, and thus, the shortfall is substantially less; in this example, the average number of complexes produced by the operon is ~20% higher than that produced with the split arrangement (fig . 1). Another way of looking at this is that in order to ensure that at least 100 complexes are present in the cell for at least 95% (50%) of the time, then the cell must make on average 180 (110) copies of each protein in the operon arrangement, while it needs to make 190 (126) copies of each in the split case . The cost of protein complex formation is improved by operon organization . The red and blue traces show fluctuations in the numbers of two proteins produced stochastically in equimolar amounts from two separate promoters (top) or a single promoter (bottom). The yellow areas show the concentration of a 1:1 complex of the proteins (minimum of two proteins for a tight complex). Individual rna production, degradation, and translation events were random, with rates such that per generation, an average of 5 (left) or 250 (right) mrnas were made, each producing 20 proteins on average . The distributions of the number of complexes are shown on the side of the traces . Mean values (dashed lines) for the left panels are 78 (top) and 93 (bottom) and for the right panels are 4,851 (top) and 4,958 (bottom). The average complex levels fall short of the target, but the shortfall is larger when proteins are transcribed separately and when mrna numbers are smaller . Conversely, fluctuations in complex numbers (i.e., the widths of the distributions) are larger when the two proteins are cotranscribed . Other factors being equal, this avoidance of a shortfall should thus provide an evolutionary pressure for genes encoding complex - forming proteins to be cotranscribed . This prediction is supported by comparisons of metabolic genes conserved in diverse eubacterial and archaebacterial genomes (table 1). Genes encoding components of a strong complex (e.g., trpa - trpb) are more likely to be cotranscribed than genes encoding noncomplex - forming proteins acting in the same pathway (e.g., trpe - trpd). Conserved cotranscription of genes for complex - forming proteins + e. coli: trpb - trpa, tryptophan synthase; malf - malg, maltose abc transporter; cara - carb, carbamoyl phosphate synthetase; nrda - nrdb, ribonucleoside diphosphate reductase ., pairs cotranscribed in e. coli and used for the same pathway but are not complex forming (15). Data shown for one representative member of each genus obtained from the jvci - cmr database (bacterial and archaeal genomes) (16). Genes were judged likely to be cotranscribed when they were in the same orientation and the end of the upstream gene is <150 bp from the start of the other . Genes were judged unlikely to be cotranscribed when the intergenic distance was larger than 5,000 bp or when the genes were in opposite orientations . The size of fluctuations decreases when the number of mrnas or proteins is larger (fig . 1), which can be achieved by increasing the transcription rate, the translation rate, or the lifetime of the mrna (see materials and methods). In eukaryotic cells, noise generated in the production of complex - forming proteins is kept at a minimum by longer - lived mrnas and higher transcription rates (5). In escherichia coli, because the number of transcripts is generally low, it is the variation in these numbers (8, 9) that makes the largest contribution to noise . In fig . 1 and elsewhere, we have examined fluctuations when an average of 20 proteins is produced per mrna . However, recent measurements suggest that an average e. coli mrna produces ~100 proteins (9). This suggests that the noise benefit of operons may be ~2-fold greater than our estimates, since the number of mrnas needed to produce a given number of proteins would be smaller, and thus more noise sensitive, than what we assumed . The metabolic benefit of operon organization increases when the number of different proteins in the complex is larger (fig . 2). This is because having more proteins in the complex means that there are more chances for the level of one protein to fall below those of the others and thus to become limiting . The ~20% gain for a 2-protein operon increases to ~30% for a 4-protein complex and to more than 50% for a 30-protein complex (e.g., a bacteriophage particle). Thus, for e. coli, in which one - third of the transcription units are polycistronic (10), we estimate an overall lowering of the cell s metabolic cost by at least 0.2% due to this effect of cotranscription (table 2). The number of different proteins in the complex (genes carried by the operon) affects the average number of complexes formed in the operon (black) and split (red) arrangements (co and cs) in units of average production of each protein (a) (a), the percent gain due to the operon arrangement [100(cocs)/cs] (b), and the coefficient of variance (/x) of the number of complexes formed for the operon and split arrangements (c). Stochastic simulations were performed as shown for fig . 1, with an average of 100 (left) or 5,000 (right) of each protein produced per cell generation . Calculations of metabolic gain due to cotranscription numbers are estimates of average values or ranges for these complexes . Conversely, operon organization has the potential disadvantage of increasing fluctuations in the level of the complex (fig . 1) because the fluctuations in the components occur in synchrony and thus do not cancel each other out . Although this effect is small, roughly 20%, it does not diminish with increasing protein numbers (fig . 2). This effect and the reduced regulatory flexibility of cotranscription may favor independent transcription units in eukaryotes . In bacteria and archaea, the metabolic savings in the production of protein complexes seem to dominate, promoting operon formation . In our simulations, the individual rna production, degradation, and translation events occur randomly, with rates which secure a preset average protein number in a cell . Throughout the paper, we assume that each ribosome binding site initiates an average of 20 proteins before the mrna is inactivated by degradation factors . We assume that mrna has a much shorter lifetime than the encoded proteins and, accordingly, simulate protein production as an instant event happening immediately after the production of each mrna . We implement this by assigning each newly synthesized mrna a protein production capacity c drawn from an exponential distribution with a mean number of 20 . Subsequently, we increase the concentration of each protein encoded by the mrna by an amount drawn from a poisson distribution with mean c. in this way, protein production by subsequent genes carried by a given polycistronic mrna will vary to an extent, given by the variations in the number of random translation initiations . Finally, protein dilution upon cell division was taken into account by randomly distributing each protein between the daughter cells . In our simulations, we assign identical protein production capacity to each ribosome binding site on a polycistronic mrna . In this way, the intrinsic noise between two proteins (a and b) encoded by the same mrna is calculated (a/ab/b)2, proportional to (ab)2/ab, which decays inversely with the protein concentration . Assuming equal protein production capacity from different parts of the same mrna seems appropriate to estimate the gain of cotranscription, because a different average protein production capacity would obviously lead to systematic wastage if the proteins are required in equimolar amounts in a functional complex . Such a systematic difference in production capacity was present in a previous study (7) and resulted in the underestimation of the noise reduction due to cotranscription alone . Any systematic differences in protein production caused by a time delay in transcription or the directionality of mrna decay (7) can easily be compensated by altering the translation initiation sites of the genes without affecting the advantage of the operon arrangement . Premature termination of an rna polymerase within an operon can produce systematic decreases in protein production from distal genes (11) and can be compensated for in the same way to maintain equal numbers of the components of the complex . However, this kind of polarity reduces the transcriptional coupling between the genes and reduces the noise benefits of operon organization . In our paper, we focus on the amount of protein complex formed relative to the amount that would be produced if protein production and degradation were noise free . In our simulations, we assume that noise is independent of the mrna lifetime . This is true when the mrna lifetime is much shorter than the protein lifetime . Even in a more general case, where we do not make such an assumption, we can calculate noise in the protein number as follows: p2p2=pmkckl+pmkc(p+m) where p and p2 are the average and the variance of the protein number, respectively, m and p are the degradation rates for mrna and protein, respectively, and kc and kl are transcription and translation rates, respectively (12). Thus, the protein noise indeed approaches a constant for large m and kc, provided that the average number of protein copies produced per mrna, kl/m (in our simulations, 20 copies), is kept fixed . The estimate of overall synthetic gain of at least 0.23% for protein complex formation due to the use of operons in e. coli (table 2) uses the measurements of pedersen et al . (13), with later identifications of protein spots for high- and medium - abundance proteins, and an estimate of 50% protein for the dry cell mass (14). This gain is a minimum estimate, as it ignores the fraction of the protein mass comprising numerous different complex - forming proteins with lower expression levels whose encoding genes are cotranscribed . In our simulations, the individual rna production, degradation, and translation events occur randomly, with rates which secure a preset average protein number in a cell . Throughout the paper, we assume that each ribosome binding site initiates an average of 20 proteins before the mrna is inactivated by degradation factors . We assume that mrna has a much shorter lifetime than the encoded proteins and, accordingly, simulate protein production as an instant event happening immediately after the production of each mrna . We implement this by assigning each newly synthesized mrna a protein production capacity c drawn from an exponential distribution with a mean number of 20 . Subsequently, we increase the concentration of each protein encoded by the mrna by an amount drawn from a poisson distribution with mean c. in this way, protein production by subsequent genes carried by a given polycistronic mrna will vary to an extent, given by the variations in the number of random translation initiations . Finally, protein dilution upon cell division was taken into account by randomly distributing each protein between the daughter cells . In our simulations, we assign identical protein production capacity to each ribosome binding site on a polycistronic mrna . In this way, the intrinsic noise between two proteins (a and b) encoded by the same mrna is calculated (a/ab/b)2, proportional to (ab)2/ab, which decays inversely with the protein concentration . Assuming equal protein production capacity from different parts of the same mrna seems appropriate to estimate the gain of cotranscription, because a different average protein production capacity would obviously lead to systematic wastage if the proteins are required in equimolar amounts in a functional complex . Such a systematic difference in production capacity was present in a previous study (7) and resulted in the underestimation of the noise reduction due to cotranscription alone . Any systematic differences in protein production caused by a time delay in transcription or the directionality of mrna decay (7) can easily be compensated by altering the translation initiation sites of the genes without affecting the advantage of the operon arrangement . Premature termination of an rna polymerase within an operon can produce systematic decreases in protein production from distal genes (11) and can be compensated for in the same way to maintain equal numbers of the components of the complex . However, this kind of polarity reduces the transcriptional coupling between the genes and reduces the noise benefits of operon organization . In our paper, we focus on the amount of protein complex formed relative to the amount that would be produced if protein production and degradation were noise free . In our simulations, we assume that noise is independent of the mrna lifetime . This is true when the mrna lifetime is much shorter than the protein lifetime . Even in a more general case, where we do not make such an assumption, we can calculate noise in the protein number as follows: p2p2=pmkckl+pmkc(p+m) where p and p2 are the average and the variance of the protein number, respectively, m and p are the degradation rates for mrna and protein, respectively, and kc and kl are transcription and translation rates, respectively (12). Thus, the protein noise indeed approaches a constant for large m and kc, provided that the average number of protein copies produced per mrna, kl/m (in our simulations, 20 copies), is kept fixed . The estimate of overall synthetic gain of at least 0.23% for protein complex formation due to the use of operons in e. coli (table 2) uses the measurements of pedersen et al . (13), with later identifications of protein spots for high- and medium - abundance proteins, and an estimate of 50% protein for the dry cell mass (14). This gain is a minimum estimate, as it ignores the fraction of the protein mass comprising numerous different complex - forming proteins with lower expression levels whose encoding genes are cotranscribed.
|
Thalassemia is the most common hereditary blood disorder and approximately 240 million people worldwide carry beta thalassemia . Approximately 200,000 patients with thalassemia major have been documented in the world and each year about 60 million people will be added to this figure . About 3 million people are carriers of this disease, and about 26,000 people have thalassemia major and about 800 people are added to this figure annually . These patients require lifelong care, regular blood transfusions, and iron chelation, and they suffer from anemia, fatigue, and lack of tolerance toward physical activity . In addition, bone marrow overactivity causes observable changes in the face and skull . Moreover, growth failure, bone tissue loss, and enlarged liver are common . These negative changes cause anxiety and depression and numerous social and financial burdens for patients, families, and health systems . Suffering is a personal, mental, and complex experience, which has a historical, cultural, and social structure . The experience of suffering is often regarded as pain, while suffering is an experience that encompasses the totality of a person . Johnson believes that some of the important aspects of living with a threatening disease are how one understands its meaning, feels about his / her position, and experiences his / her suffering . Dildy, in a study on the suffering of patients with rheumatoid arthritis, found that the result of experiencing suffering, confusion, and loss of hope is the conscious reconstruction of the future and finding meaning through positive changes in life . Fredriksson showed how a care dialog which focused on the suffering of the patient minimized the vulnerability of the patient . Suffering is an important concept in nursing, and the purpose of nursing is to help prevent the experience of suffering, pain relief, coping with it, and finding meaning and growth through it . In addition, understanding this experience can help in providing essential information to improve the quality of life of patients . This is why nursing researches should be performed on the experience of suffering in different groups . This experience must be expressed by those who have experienced pain . To reach a deep understanding in this respect the thalassemia patients suffering was not comprehensively studied, this study was carried out to explore the experience of suffering due to self - care in patients with thalassemia . In order to discover the meaning of suffering due to self - care in thalassemia patients, content analysis technique, which seeks to understand the human emotions and implications of their life experiences, was used . Unstructured interview was used with one main question, exploratory questions, and field notes . The duration of interviews varied between 35 and 60 min and sampling was continued until data saturation, meaning that no new code or data was obtained and all the conceptual levels were completed . Data analysis was performed with qualitative analysis method with a conventional approach . In conventional content analysis, categories are extracted directly from textual data . Moreover, with this method, the hidden theme and patterns of the participants data content can be revealed . Immediately after each interview, the interviews and non - verbal communications, such as crying, were listened to a few times and were written . Interview transcripts were reviewed several times, and then, data were broken down into meaningful units . Semantic units were reviewed and the sematic codes for each concept were written . Then, the codes were categorized based on concept similarity and were made as small and compact as possible . The declining trend of data was observed in all analyzed units, and main categories and subcategories . Finally, the data were summarized into one main theme which was more general and conceptual . The ethical permit of the study was approved by the ethics committee of kerman university of medical sciences, iran (number k93/91). After clearly explaining the study objectives to the participants, they were asked to sign the informed consents, the permission to record their statements was obtained, and they were assured that their statements would be kept confidential . To validate the data, manuscripts, interviews, and analysis units were extracted with initial codes and were given to participants, and their opinions were taken and the necessary corrections were made . In addition, three professors in the field of qualitative research reviewed the study process . Using a combination of methods (interviews and field notes) with maximum variation in sampling, meaning interviews with various people (in terms of age, gender, education, etc . ), increased data authentication and transferability . After classification and merging of codes, four main categories were obtained including physical exhaustion, emotional, spiritual, and behavioral instability, society's beliefs, and living a hard life . Moreover, patient suffering was the theme of the study . Physical changes resulting from the diseasesuffering from self - care physical changes resulting from the disease suffering from self - care a. physical changes resulting from the disease some patients had deformed faces and the patients themselves and others were afraid of their faces; therefore, they had separated themselves from others and saw themselves as the burned generation . Some others suffered from growth retardation, delay in the appearance of secondary sex characteristics, low body strength, and inability to perform their favorite activities . A patient stated: being deformed is painful for me; i avoid appearing in public because they show me to each other . My strength is lower than normal kids and i cannot play football which i am interested in . They were also tired of taking drugs, desferal injection, soreness, and sensitivity of the injection area, and were willing to die to be free of them . For some patients, hepatitis, diabetes, heart disease, and other complications had made their lives a living hell and they referred it as a misty marsh . I sometimes pray to god to let me die and be free from all of this . They talked about the impact of anemia on themselves; among the physical problems were headache and paleness of the skin, and a psychological problem was aggression . Two sisters with thalassemia said: when we are anemic, we get frustrated and fight with each other . Mental damagesspiritual turmoil the illness and experiencing negative reactions from others had different psychological consequences . Most of the participants suffered from anxiety, worry, grief, loneliness, feelings of rejection, and depression . A patient said: i have anxiety because of the side effects of the disease, such as changes in appearance and fear of being mocked at school . Another patient stated: for me, the psychological suffering is more than the physical suffering of the disease; everywhere i go for work, they tell me i am deformed and cannot work, i am depressed and unsociable, i have repeatedly thought of suicide . Some patients were spiritually distressed; they felt guilty and considered their illness to be the result of their or their parents bad actions and saw it as divine retribution . A patient said: sometimes i regret my life and think why i should have thalassemia . I always think that may be god knew and this is retribution for our and our parents bad actions . Social stigmalack of a comprehensive support network lack of a comprehensive support network thalassemia patients considered the negative mindset of the society and officials regarding thalassemia, the societies behavior toward these patients, and not believing their abilities to be unjust and the result of lack of knowledge . The students talked about the outdated ideas of the teachers, magnifying of the illness, being considered incapable, being humiliated, and being disgraced . A girl with a disfigured face said: there is not a day that they do not mock me, i cannot go out into the street and not be humiliated, when people do not have culture this is the result . Young people felt lonely and needed a partner to rely on and they were concerned if they could ever get married . Some were annoyed by their family's lack of understanding of love and their need to get married, and not being able to marry the person they want . A teenager said: a person with thalassemia can fall in love and get married, but my family rejects this and tells me i am not allowed to . Another young man said: we cannot propose to anyone, and cannot love whoever we want, because not everyone chooses a thalassemia patient to live with . B. lack of a comprehensive support network lack of social support and health insurance, lack of a regular program for thalassemia, not having fixed custodians, lack of up - to - date educational advertisements in the media, existence of an outdated view toward the illness in cyberspace, not being noted and visible, and being ignored were the causes of great suffering for the patients . They want to be seen not as a patient, but as a person with thalassemia in the community . The most important pain we have is not having a regular program and a comprehensive protection act for thalassemia in iran; we have requested it many times, but they say it is not a priority . Financial constraintsmedication constraints financial constraints medication constraints a. financial constraints financial concerns had affected health care and irritated the patients . Those who were employed were dissatisfied with their job and were unable to work in their desired field . A patient said: the concerns of the patients are the expenses and having no money . They do not offer just any kind of work to a person with thalassemia and this hurts . B. medication constraints shortages and high prices of drugs, due to medication sanctions, had made care difficult, and forced the patients to use iranian medications, and these medications caused allergies and resulted in the discontinuation of the treatment . A girl stated: unfortunately we have sanctions now, i use iranian made desferal and i am allergic to it, but to keep my iron low, i have to bear the pain and soreness . Physical changes resulting from the diseasesuffering from self - care physical changes resulting from the disease suffering from self - care a. physical changes resulting from the disease some patients had deformed faces and the patients themselves and others were afraid of their faces; therefore, they had separated themselves from others and saw themselves as the burned generation . Some others suffered from growth retardation, delay in the appearance of secondary sex characteristics, low body strength, and inability to perform their favorite activities . A patient stated: being deformed is painful for me; i avoid appearing in public because they show me to each other . My strength is lower than normal kids and i cannot play football which i am interested in . They were also tired of taking drugs, desferal injection, soreness, and sensitivity of the injection area, and were willing to die to be free of them . For some patients, hepatitis, diabetes, heart disease, and other complications had made their lives a living hell and they referred it as a misty marsh . I sometimes pray to god to let me die and be free from all of this . They talked about the impact of anemia on themselves; among the physical problems were headache and paleness of the skin, and a psychological problem was aggression . Two sisters with thalassemia said: when we are anemic, we get frustrated and fight with each other . Mental damagesspiritual turmoil the illness and experiencing negative reactions from others had different psychological consequences . Most of the participants suffered from anxiety, worry, grief, loneliness, feelings of rejection, and depression . A patient said: i have anxiety because of the side effects of the disease, such as changes in appearance and fear of being mocked at school . Another patient stated: for me, the psychological suffering is more than the physical suffering of the disease; everywhere i go for work, they tell me i am deformed and cannot work, i am depressed and unsociable, i have repeatedly thought of suicide . Some patients were spiritually distressed; they felt guilty and considered their illness to be the result of their or their parents bad actions and saw it as divine retribution . A patient said: sometimes i regret my life and think why i should have thalassemia . I always think that may be god knew and this is retribution for our and our parents bad actions . Social stigmalack of a comprehensive support network lack of a comprehensive support network thalassemia patients considered the negative mindset of the society and officials regarding thalassemia, the societies behavior toward these patients, and not believing their abilities to be unjust and the result of lack of knowledge . The students talked about the outdated ideas of the teachers, magnifying of the illness, being considered incapable, being humiliated, and being disgraced . A girl with a disfigured face said: there is not a day that they do not mock me, i cannot go out into the street and not be humiliated, when people do not have culture this is the result . Young people felt lonely and needed a partner to rely on and they were concerned if they could ever get married . Some were annoyed by their family's lack of understanding of love and their need to get married, and not being able to marry the person they want . A teenager said: a person with thalassemia can fall in love and get married, but my family rejects this and tells me i am not allowed to . Another young man said: we cannot propose to anyone, and cannot love whoever we want, because not everyone chooses a thalassemia patient to live with . B. lack of a comprehensive support network lack of social support and health insurance, lack of a regular program for thalassemia, not having fixed custodians, lack of up - to - date educational advertisements in the media, existence of an outdated view toward the illness in cyberspace, not being noted and visible, and being ignored were the causes of great suffering for the patients . They want to be seen not as a patient, but as a person with thalassemia in the community . The most important pain we have is not having a regular program and a comprehensive protection act for thalassemia in iran; we have requested it many times, but they say it is not a priority . Financial constraintsmedication constraints financial constraints medication constraints a. financial constraints financial concerns had affected health care and irritated the patients . Those who were employed were dissatisfied with their job and were unable to work in their desired field . A patient said: the concerns of the patients are the expenses and having no money . They do not offer just any kind of work to a person with thalassemia and this hurts . B. medication constraints shortages and high prices of drugs, due to medication sanctions, had made care difficult, and forced the patients to use iranian medications, and these medications caused allergies and resulted in the discontinuation of the treatment . A girl stated: unfortunately we have sanctions now, i use iranian made desferal and i am allergic to it, but to keep my iron low, i have to bear the pain and soreness . The findings indicated the experience of pain by patients suffering from thalassemia in various physical, mental, spiritual, and social aspects . The most important finding of the study was the deformation and the negative reactions of people toward thalassemia patients . Individuals who have appearances that differ from others experience negative reactions such as staring, rude talk, and stigmatization . In the study by wahab et al ., the parents were concerned about the negative image formed in their children's mind and believed it to be the cause of their confidence reduction . These differences could be due to cultural differences and the support systems in these countries . Previous studies, the results of which were consistent with this study, showed that physical changes resulting from the disease lead to feelings of being different, diminished self - esteem, and feelings of inadequacy in some patients . Venipuncture pain, and fatigue caused by injections and medications were the sources of stress in the participants . Believed that iron chelation injection pain was the most important cause of anxiety and the most painful experience for thalassemia patients . Previous studies in this field reported pain, anxiety, fear, discomfort of venipuncture, fatigue, scarring, swelling, and redness at the injection site of desferal and wishing to be free of them ., had also felt worthlessness and wished to die; this was in agreement with the current study . In any case, when symptoms are well managed and patients feel they are in control, the wish to die will fade . The most important element of emotional turmoil of the patients was the physical changes in appearance . Moss and carr believed that malformed individuals were susceptible to problems such as depression, anxiety, shame, and disruption of communications . Previous studies, which were consistent with the present study, reported that the mental health problems of thalassemia patients included depression, loneliness, anxiety, fear of death, and aggression . This showed the need for psychological support of patients . Among the noticeable spiritual turmoil effects of the participants were despair, loneliness, and regret of life . Hope is a symbol of mental health, and chronic diseases have a negative impact on a person's level of hope . In the study by browne et al ., the participants had also experienced feelings of guilt and hopelessness . This is because nurses have focused more on the physical needs of the patients and the spiritual needs of patients have been neglected; moral support is also necessary . Stigmatization had important mental, social, and emotional effects on the patients, and could lead to unemployment, rejection, isolation, and even suicide . In the study by shum et al ., participants also considered thalassemia as a cause for shame and stigma and this matter led to social isolation and reduced their communications . However, studies in greece showed a good relationship between the society and the patients and no stigmatization of thalassemia patients . The reason for this difference may be related to cultural differences and the optimal care support systems of these countries . Other concerns of the patients were their parents lack of understanding of the patients love and marriage . The desire to marry is part of human nature and patients with thalassemia are no exceptions . In the study by wahab et al ., the muslim parents of the participants had concerns about finding the right partner for their children, which reflects the importance of this issue in the islamic world . The media and the government should plan measured programs and build the culture to overcome stigmatization of the disease and facilitate the marriage of these patients . A major concern was the lack of a safety net . Mentioned medical support, and family, social, spiritual, and peer support as their basic needs . In this study, the need for social support was highlighted . This could be because of the strong cultural and family ties, and weak social support in iran . The government needs to enact and implement laws protecting the employment and education of these patients . Poverty increased the suffering of patients; increased cost of living, traveling, and doctor visits were a heavy burden for thalassemia patients . In line with previous studies, participants of the present study had financial concerns . Policymakers should prioritize financial support of thalassemia patients to reduce the financial burden on families of these patients, and the ministry of health should support free treatment and diagnostic facilities for thalassemia patients . In the present study, anxiety of drug shortages doubled the experienced pain . In the study by shosha, unlike the present study, there was no shortage of drug . The findings of this study indicated the different aspects of pain and its profound impact on the lives of patients with thalassemia . A holistic and comprehensive approach including nursing, medical, educational, financial, social, psychological, and spiritual support could be designed and implemented to promote self - care and decrease the suffering of thalassemia patients . The findings of the present study are grounds for further research in a wider range to assess different aspects of the experience of suffering.
|
Plants can be attacked by many herbivorous insects and have evolved a variety of defense strategies, including morphological barriers, synthesis of toxic or repellent secondary metabolites, and the release of synomones that attract natural enemies of the herbivores . These defenses can be constitutive, i.e., expressed independent of the presence of an attacker, or inducible, in which case defense compounds accumulate in response to attack (karban and baldwin, 1997). Herbivores can detect induced defensive compounds and respond by avoiding these plants, which signal lower suitability as a host plant (landolt, 1993; de moraes et al ., 2001; kessler and baldwin, 2001; meiners et al ., 2005). Induced plant defense can affect herbivorous insects directly through the production of toxic compounds or indirectly through the production of cues that indicate intra- or interspecific competition for the herbivores (schoonhoven et al ., 2005). Moreover, induced plant defense signals can reduce the enemy - free space for the herbivores . For parasitoids and predators, induced infochemicals may indicate the presence of their host or prey on the plant (turlings et al . Phenotypic changes in individual plants may therefore affect insects at different trophic levels, and thus, the composition of the insect community and food web associated with the plant (price et al ., 1980; van zandt and agrawal, 2004; takabayashi et al ., 2006). Already in the 19th century, kirby and spence (1863) observed that pieris brassicae females preferred to lay their eggs on plants devoid of eggs . Later, this was confirmed under more controlled conditions by rothschild and schoonhoven (1977) for both p. brassicae and pieris rapae . This avoidance of infested plants is caused by a physiological response of the plant to oviposition, rather than by compounds excreted by the butterflies themselves (blaakmeer et al . . The butterflies also avoid egg deposition on leaves with feeding larvae (rothschild and schoonhoven, 1977). It was postulated that butterflies avoid laying eggs on herbivore - infested plants because herbivore attack induces defense compounds in plants that can influence the performance of their offspring and to reduce the risk of inter- or intraspecific competition and parasitism (thompson and pellmyr, 1991; shiojiri et al ., 2002). Egg - induced chemical changes in brassica plants are also known to arrest trichogramma parasitoids that parasitize pieris eggs (fatouros et al ., 2005). Oviposition - site selection involves an important behavioral decision in the life cycle of an herbivorous insect because hatching larvae have limited dispersal capacity (renwick and chew, 1994). P. rapae is a solitary butterfly that lays one egg at a time, whereas p. brassicae is gregarious and lays batches of about 20100 eggs . P. rapae appears to spread the risk of larval mortality, laying few eggs within any patch . This has the advantage of being able to exploit isolated plants (davies and gilbert, 1985). P. brassicae, however, needs patches of plants because one large egg batch will require more than one plant for all caterpillars to develop into adults . Rapae butterflies use visual, olfactory and tactile cues during these phases (rothschild and schoonhoven, 1977; renwick and radke, 1988). Acceptance of a site may be determined by the balance of positive and negative factors (renwick and radke, 1988). Renwick and radke (1988) suggest that olfaction does not play a role in attraction to a host plant, but may be involved in avoidance of non - host plants . P. rapae and p. brassicae are crucifer specialists and are known to use glucosinolates, toxic secondary metabolites characteristic for brassicaceae, as oviposition stimulants . Glucobrassicin and sinigrin are effective oviposition stimulants for p. brassicae and p. rapae (renwick et al ., 1992; van loon et al . A major signal - transduction pathway involved in induced plant defense is the octadecanoid pathway (arimura et al ., 2005). A central compound in the pathway is jasmonic acid (ja), which has an important role in direct and indirect defense in many plant species . In response to ja or methyl jasmonate (meja) treatment, increased concentrations of several compounds have been documented in a range of plant species, e.g., proteinase inhibitors (moura and ryan, 2001), polyphenol oxidases (thaler et al ., 1996), nicotine (baldwin et al ., 1996), trypsin inhibitors (cipollini and sipe, 2001), glucosinolates (cipollini and sipe, 2001; van dam et al ., 2004; mewis et al ., 2005), and increased volatile emission (boland et al ., 1995; dicke et al ., 1999; koch et al ., 1999). Several studies have focused on the larval stage of the herbivores and have shown reduced relative growth rates and leaf consumption (van dam et al ., 2000; gols et al ., 2003; van dam et al ., spraying of ja decreased the abundance of caterpillars, flea beetles, aphids, and thrips (thaler et al ., 2001). Other studies addressed the influence of ja application to plants on oviposition - site selection behavior of adult herbivores . These studies showed that ja application can result in induced resistance as well as induced susceptibility (stanjek et al ., 1997; kessler and baldwin, 2001; lu et al ., 2004). Here, we studied how ja application affects oviposition of two specialist herbivores on cabbage, pieris rapae l. and p. brassicae l. (lepidoptera: pieridae) that are closely related, yet differ drastically in the amount of eggs they put on one plant . Our study is the first to compare closely related herbivores with a different oviposition strategy, which might affect the consequences of ja - induced responses . Ja is known to mediate the induction of chemical defense responses in plants to feeding damage and deposition of eggs (dicke and van poecke, 2002; hilker and meiners, 2006; mumm and hilker, 2006). By using ja moreover, ja application has the advantage that visually detectable damage and the presence of herbivores or eggs are avoided . We made solvent extracts to address the identity of the active plant compounds that influenced butterfly behavior . Rather than testing whole - leaf extracts, however, we extracted the glucosinolates from the surface of both control and ja - treated plants and tested the oviposition preference of the butterflies for these glucosinolate fractions on a neutral substrate . Furthermore, we included a control experiment to exclude a potential direct effect of ja on oviposition behavior . We addressed the following questions: (1) does ja treatment of cabbage plants affect host plant selection of the two pieris butterfly species; (2) are there differences between solitary and gregarious butterflies; (3) does ja treatment affect glucosinolate levels in leaf surface extracts; and (4) do changes in glucosinolate levels determine the changes in oviposition preference? Plants and insects brussels sprouts plants, brassica oleracea var . Gemmifera l. (brassicaceae) cultivar cyrus were grown from seed in a greenhouse in plastic pots (11 11 11 cm) at 2028c, 4080% rh and a 16-hr light/8-hr dark photoperiod . Stock colonies of the large cabbage white p. brassicae and the small cabbage white p. rapae were maintained on brussels sprouts in a climatized room at 2022c, 5070% rh and a 16-hr light/8-hr dark photoperiod . Chemical analysis brussels sprouts plants were sprayed with 0.1 mm ja or control solution . Ja (() jasmonic acid, purity> 97%; sigma - aldrich, st louis, mo, usa) was applied to the surface of the leaves, i.e., plants were sprayed with a ja solution with 0.1% tween 20 until run - off or just with 0.1% tween 20 for the control . The next day, glucosinolates (gls) were extracted from the surface of the intact brussels sprouts leaves . Each sample consisted of four leaves (between the third to sixth leaf from the base of a plant) that were cut at the base of the petiole . Directly after cutting, the lamina was dipped for 5 sec in 300 ml of dichloromethane, and after a 5-sec interval, it was dipped for 5 sec in 150 ml of methanol (stdler and roessingh, 1990; van loon et al . The methanol was evaporated from the crude methanol dip - volume with a rotary evaporator (ika - werke gmbh, staufen, germany). For each treatment the extract was redissolved in methanol, desulphatased on a deae - sephadex a25 column, and separated on a reverse phase c-18 column by using high performance liquid chromatography (hplc) as described in van dam et al . Glucosinolate detection was performed with a photodiode array (pda) detector (200350 nm) with 229 nm as the integration wavelength . Sinigrin (sinigrin monohydrate, acros, nj, usa) was used as an external standard . We used the correction factors at 229 nm from buchner (1987) and the ec (ec, 1990) to calculate the concentrations of the glucosinolates . Desulfoglucosinolate peaks were identified by comparison of hplc retention times and uv spectra with standards kindly provided by m. reichelt, mpi chemical ecology and a certified rape seed standard (community bureau of reference, brussels, code bcr-367r). The surface area was measured directly after dipping, and the dry mass of the leaves was measured after drying at 50c for 72 hr . Herbivore oviposition preference test pieris adults emerged from pupae in a large oviposition cage (67 100 75 cm) in a greenhouse compartment at 2224c and 5070% rh . Apart from natural daylight, cages were illuminated by sodium vapor lamps (type son - t, 500 w, philips, the netherlands) from 8:00 a.m. until 2:00 p.m. in this cage, they were provided with a 10% sucrose solution and an oviposition substrate; depending on the experiment, a plant or an artificial leaf made of green cardboard paper sprayed with sinigrin . For the experiments, one male and one female butterfly were introduced per oviposition cage (67 50 75 cm) in the same greenhouse compartment, on the day before the experiment . In these cages, the treated leaves or papers and respective controls were introduced into the cages, and the butterflies were allowed to oviposit until the beginning of the afternoon . At 2:00 p.m., the leaves were removed, and the number of eggs was counted . The experiments were carried out in several cages per day and 34 d per treatment with new pairs of butterflies each day, adding up to a total of 2436 independent replicates . Surface application of ja the effect of ja - induced changes in brussels sprouts plants on butterfly behavior was tested in oviposition experiments with p. brassicae and p. rapae . Three concentrations of ja solution, 0.01, 0.1, and 1 mm, corresponding to approximately 1.25, 12.5, and 125 g ja / g fresh weight (or 0.25, 2.5, and 25 nmol ja / cm) respectively, were sprayed on the plants and tested against a control (plants treated with 0.1% tween 20). The next morning, just before the start of the experiment, the fourth, fifth, and sixth leaves from the base of the plants were cut, and their petioles were placed directly into a vial with tap water and introduced into the cages with butterflies . Systemic uptake of ja for p. rapae, two application methods were used to assess the effect of ja - induced changes in brussels sprouts on oviposition preference . For the second application method, the fourth, fifth, and sixth leaves were cut from untreated plants and placed in a 0.1-mm aqueous ja solution 22 hr before the start of the experiment . Total uptake of the solution was on average 6.3 1.5 ml per control leaf and 6.0 1.6 ml for ja - treated leaves (corresponding to approximately 20 g ja / g fresh weight or 5 nmol ja / cm, assuming homogeneous distribution over the leaf tissue after uptake). Effect of pure ja on oviposition preference in the next experiment, green cardboard paper sprayed with an oviposition stimulant was used to test the effect of pure ja on the oviposition behavior of p. rapae on an inert substrate . Sinigrin has been shown to be a suitable oviposition stimulant for pieris butterflies (van loon et al ., 1992a) and was therefore used to stimulate oviposition on the artificial substrate in this experiment . The paper (8 11.5 cm) was treated with 1 ml of a 5-mm sinigrin solution (janssen pharmaceutica, tilburg, the netherlands) by spraying it with a desaga chromatographic sprayer (heidelberg, germany). Subsequently, after drying, papers were sprayed with either 1 ml of a 1-mm ja solution or water (control substrates) just before the test (210 g ja / carton or 11 nmol ja / cm). Bioassays with purified glucosinolate (gls) fractions gls were extracted from the leaf surface as described for the chemical analysis . For each treatment, control and 0.1 mm ja, 60 plants were used for the extraction, of which four to five leaves per plant were dipped . Subsequently, the extracts were fractionated following the protocol of srensen (srensen, 1990). The gls were dissolved in methanol to make two concentrations, one corresponding to the amount of gls extracted from the material of two plants in 0.8 ml and one concentration corresponding to the amount of gls from one leaf in 0.8 ml . One gle corresponds to the amount of gls extracted from 1 g fresh and intact leaf . With an average weight of 6 g per leaf, the highest concentration corresponds to 48 gle and the lower concentration to 6 gle . With a sprayer, a volume of 0.8 ml of one of the solutions was sprayed on green paper following the same method as described above for the test of pure ja . Rapae butterflies were offered a two - choice situation, with one paper sprayed with gls extracted from control plants and one paper with gls from ja - treated plants . Performance of p. rapae caterpillars the development of first instar caterpillars to pupae was observed on control and ja - treated plants . Control plants were sprayed with a 0.1% tween 20 solution and ja - treated plants with a solution of 0.5 mm ja with 0.1% tween 20 . Thirty newly hatched p. rapae caterpillars were evenly distributed over two plants per treatment, 24 hr after treatment, and were placed in cages (67 50 75 cm) in a greenhouse compartment at 2224c and 5070% rh . The plants were replaced with new plants twice a week, so that the maximum time between induction and larval feeding never exceeded 5 d. the number of days until pupation and pupal weight were recorded . Statistical analyses each individual butterfly female was subjected to a two - choice situation, in which most individuals oviposited on both control and ja - treated leaves . As the egg load differed between individuals, the number of eggs on each treatment per individual was treated as a paired sample . The oviposition data for p. rapae were normally distributed; therefore, they were analyzed with a paired t - test . The oviposition data for p. brassicae were not normally distributed, and therefore, analyzed with the nonparametric equivalent of the paired t - test, the wilcoxon matched - pair signed - ranks test . The data on the developmental time of the caterpillars in the performance test were not normally distributed and were analyzed with a mann whitney u test for differences between the treatments . Pupal weight was normally distributed and analyzed with an analysis of variance (anova). Chemical analysis five gls were detected in b. oleracea leaf surface samples: glucoiberin, sinigrin, 4-hydroxyglucobrassicin, glucobrassicin, and 4-methoxyglucobrassicin (table 1). No significant difference was detected between ja - treated and control leaves for the total amount of gls per cm . The amounts of glucobrassicin, the most abundant glucosinolate in these samples, 4-methoxyglucobrassicin, and sinigrin, did not significantly differ between control and ja - treated leaves . The amounts of glucoiberin and 4-hydroxyglucobrassicin collected in the leaf surface extracts were significantly lower for ja - treated leaves compared to control leaves (table 1). The same results were obtained when calculated for the gls content expressed as nmol per mg dry weight (not shown). Table 1glucosinolate content in surface extracts of brassica oleracea leaves in pmol / cm for control and ja - treated plantscompoundcontrol treatment median (range)ja treatment median (range)zpglucoiberin10.7 (6.321.7)0 (06.0)2.7130.007sinigrin9.3 (023.5)4.2 (06.8)1.7740.0764-hydroxyglucobrassicin0.7 (06.1)0 (00)2.2070.027glucobrassicin34.9 (18.498.2)88.6 (38.6132.5)1.4790.1394-methoxyglucobrassicin0.5 (02.5)0 (01.3)1.3700.171total amount of glucosinolates64.1 (27.0155.7)90.0 (42.9138.8)0.5630.573interquartile range from first to third quartilen = 10n = 11 glucosinolate content in surface extracts of brassica oleracea leaves in pmol / cm for control and ja - treated plants interquartile range from first to third quartile herbivore oviposition preference: surface application of ja as p. brassicae lays its eggs in batches, both the number of egg batches and the number of eggs per leaf were counted . For the 1 mm ja treatment, the number of batches was significantly lower on ja - treated leaves than on control leaves (n = 36, z = 2.628, p = 0.009, wilcoxon matched - pair signed - ranks test), and the total number of eggs was significantly lower as well (n = 36, z = 2.035, p = 0.042, wilcoxon matched - pair signed - ranks test). For the 0.1-mm ja treatment, the result was similar (n = 27, batches: z = 2.223, p = 0.026; eggs: z = 2.138, p = 0.032, wilcoxon matched - pair signed - ranks test) (fig . 1). Experiments with 0.01 mm ja application did not show discrimination by the butterflies between the treated and control leaves (results not shown). Also, p. rapae butterflies significantly preferred to oviposit on control leaves compared to ja - treated leaves (fig . 2). The leaves treated with the two highest concentrations of ja tested, 1 and 0.1 mm, were avoided in favor of the control leaves (paired t - test, respectively, t = 3.805, df = 23, p = 0.001 and t = 3.681, df = 23, p = 0.001). The lowest concentration of ja tested, i.e., 0.01 mm, did not affect the distribution of eggs over the leaves (t = 0.662, df = 23, p = 0.52, paired t - test). Fig . The box represents the interquartile range from first to third quartile, the line across the box indicates the median; asterisks indicate statistical differences between the preference for control and ja - treated plants (* p <0.05, * * p <0.01, wilcoxon matched - pair signed - ranks test). A egg batches per female per leaf . 2pieris rapae oviposition preference (measured as the number of eggs per female per leaf) between control and ja - treated b. oleracea . Three concentrations of ja were tested against a control in 24 replicated experiments for each concentration . Mean numbers of eggs per female + sem are given; asterisks indicate statistical differences between the preference for control and ja - treated plants (n.s . P> 0.05, * * p <0.01, paired t - test) pieris brassicae oviposition on control and ja - treated plants . The box represents the interquartile range from first to third quartile, the line across the box indicates the median; asterisks indicate statistical differences between the preference for control and ja - treated plants (* p <0.05, * * p <0.01, wilcoxon matched - pair signed - ranks test). A egg batches per female per leaf . B eggs per female per leaf pieris rapae oviposition preference (measured as the number of eggs per female per leaf) between control and ja - treated b. oleracea . Three concentrations of ja were tested against a control in 24 replicated experiments for each concentration . Mean numbers of eggs per female + sem are given; asterisks indicate statistical differences between the preference for control and ja - treated plants (n.s . P> 0.05, * * p <0.01, paired t - test) systemic uptake of ja in the experiment with p. rapae that employed systemic uptake of ja through the petiole, the same result was obtained: the number of eggs on the ja - treated leaves (10.0 1.57) was lower than on the control (19.12 2.82) leaves (t = 3.976, df = 31, p <0.001, paired t - test). Effect of pure ja on oviposition preference when paper treated with sinigrin and ja was compared to paper with only sinigrin, there was no difference in the number of eggs the butterflies deposited on the two substrates (t = 0.438, df = 26, p = 0.67, paired t - test) (fig . 3). These results show that the observed effect of the ja treatment on herbivore oviposition behavior was due to induced changes in leaf tissue rather than to a direct repellent or deterrent effect of ja itself . 3oviposition of p. rapae on green paper sprayed with sinigrin plus ja and green paper with sinigrin only . P> 0.05, paired t - test, n = 27) oviposition of p. rapae on green paper sprayed with sinigrin plus ja and green paper with sinigrin only . P> 0.05, paired t - test, n = 27) bioassays with purified glucosinolate fractions the butterflies did not discriminate between the two gls fractions (table 2), the number of eggs on paper with the gls from control plants, and the number of eggs on paper with gls from ja - treated plants was not different for either concentration (concentration 6 gle: z = 1.514, n = 20, p = 0.130, wilcoxon matched - pair signed - ranks test; 48 gle: t = 0.523, df = 19, p = 0.607, paired t - test) (fig . 4). Table 2glucosinolate (gls) content in fractions from leaf surface extracts from control and ja - treated plants in pmol / cm, z and p - values of mann whitney u testglucosinolategls from control plantgls from ja - treated plantglucoiberin4.93.9sinigrin3.15.14-hydroxyglucobrassicinnot detectednot detectedglucobrassicin16.081.04-methoxyglucobrassicinnot detected0.8fig . 4oviposition of p. rapae on green paper sprayed with purified gls - fractions from leaf surface extracts of control and ja - treated plants . P> 0.05, paired t - test, n = 20) glucosinolate (gls) content in fractions from leaf surface extracts from control and ja - treated plants in pmol / cm, z and p - values of mann whitney u test oviposition of p. rapae on green paper sprayed with purified gls - fractions from leaf surface extracts of control and ja - treated plants . P> 0.05, paired t - test, n = 20) performance of p. rapae caterpillars about two - thirds of the caterpillars survived until pupation, and a similar number of caterpillars reached the pupal stage on both treatments, 19 on control and 18 on ja - treated plants (fig . 5). The caterpillars on ja - treated plants pupated on average after 15 d, while the caterpillars on the control plants pupated significantly sooner, on average after 13 d (mann whitney u, z = 4.071, p <0.001). The average pupal weight on the control plants, 165 3.4 mg, was similar to that on the ja - treated plants, 158 3.3 mg (anova, f = 2.665, df = 1, p = 0.112). 5development time of p. rapae caterpillars from hatching until pupation on control [open squares ()] and ja - treated [closed triangles ()] plants . Cumulative number of pupae per treatment development time of p. rapae caterpillars from hatching until pupation on control [open squares ()] and ja - treated [closed triangles ()] plants . Our data show that ja treatment of brussels sprouts leaves reduces the acceptance of leaves for oviposition by p. rapae and p. brassicae in a similar way . Treatment of leaves with 0.1 or 1 mm ja reduced the proportion of eggs the butterflies laid on these leaves . A concentration of 0.01 mm ja did not change oviposition preference . The former concentrations are comparable to the concentrations of ja or meja that were applied to several plant species in other studies and that reduced development of spodoptera exigua, trichoplusia ni, manduca sexta, thrips, and aphids (thaler et al ., 1996; avdiushko et al ., 1997; van dam et al ., 2000; omer et al ., 2001), and abundance of manduca quinquemaculata, s. exigua, thrips, and flea beetles in the field (kessler and baldwin, 2001; thaler et al ., 2001). For cabbage plants, lu et al . (2004) found inducible resistance in a susceptible brassica species (chinese cabbage, brassica campestris l.) and induced susceptibility in a resistant brassica species (common cabbage, b. oleracea) for plutella xylostella l. to exclude that ja itself caused the above effect, we tested the phytohormone on an inert substrate and studied two different application methods to the leaf material . The results of these experiments show that it was not ja itself that caused the difference in oviposition preference between control and ja - treated leaves, thus providing proof that processes in the plant induced by the ja treatment changed the acceptability of the leaves . It has also been reported previously that development of cabbage looper or tobacco hornworm larvae is not affected when meja is added to an artificial diet, but it is retarded when meja was applied to cabbage or tobacco plants (avdiushko et al ., 1997). In leaf surface extracts of ja - treated and untreated brussels sprouts, we found five glucosinolates . After ja application, glucobrassicin, the major glucosinolate in the b. oleracea cultivar we used, occurred at a level twice as high as in control plants, and glucoiberin and 4-hydroxyglucobrassicin concentrations decreased . However, most other studies on glucosinolate content in brassicaceous plants after induction by ja- or meja - treatment or insect attack have reported an increase in glucosinolates, although there is substantial variation among different species, or even genotypes, and type of induction (bodnaryk, 1994; cipollini and sipe, 2001; mikkelsen et al ., 2003; mewis et al ., we measured glucosinolate content in a surface extract after 24 hr, whereas most studies have measured glucosinolate content in whole leaf extracts and after a longer induction time . (2005) postulated that the wax layer does not contain glucosinolates, and the polar glucosinolates that are found by using the solvent extraction method are washed from the inner leaf to the outside through the stomata . Nevertheless, we chose a surface extraction method because the butterflies retrieve chemosensory information from the leaf surface, as they do not damage the leaf before ovipositing . Surface extracts are thus likely to give a better reflection of the chemosensory information used than whole leaf extracts . Both butterfly species distinguish between induced and non - induced leaves, most likely based on chemical differences, as ja - induced leaves do not display herbivore presence or damage . The different levels of two out of five glucosinolates in the surface extracts may provide a chemosensory basis for the oviposition preference observed, although the isolated gls from the two treatments yielded no differences in acceptance of the paper for oviposition . While the isolated gls on paper stimulated oviposition behavior, they appear not to be the main cue to discriminate between the ja - induced and non - induced cabbage plants . We did not quantify other chemicals, stimulants, deterrents, or precursors that might mediate preference behavior, such as isothiocyanates, terpenoids, other glycosides, or amino acids (huang et al ., 1993; renwick and chew, 1994; soldaat et al ., 1996; agrawal and kurashige, 2003). Both p. rapae and p. brassicae can perceive a broad range of chemicals (van loon et al . Electroantennogram responses to a range of plant volatiles are similar for both species (van loon et al ., 1992b), although host plant selection by pieris butterflies appears largely based on contact chemoreception rather than olfaction (renwick and chew, 1994). Host plant selection is suggested to depend on a balance of stimulants and deterrents and not just on the detection of presence or absence of particular compounds (huang et al ., 1993; bruce et al ., 2005). Therefore, glucosinolates, in combination with other stimulants or deterrents, may determine the acceptance of a host plant by the butterflies . The octadecanoid pathway, in which ja is a key molecule, is involved in induction of synomones in response to oviposition and to herbivore damage (meiners and hilker, 2000; dicke and van poecke, 2002; hilker and meiners, 2006; mumm and hilker, 2006). Ja treatment of plants results in emission of synomones that attract natural enemies like predatory mites and parasitoids (dicke et al ., 1999; hilker and meiners, 2002; van poecke and dicke, 2002; hilker and meiners, 2006). This attraction results in a higher natural enemy density around damaged plants, and therefore, it is advantageous for the herbivores to avoid oviposition on induced plants . Herbivores may use induced plant cues to detect the presence or absence of other herbivores, especially because plant cues are, although less reliable, often easier to detect than cues from the herbivores themselves (vet and dicke, 1992). Furthermore, induced plants may affect herbivores directly by influencing the performance of their offspring . For p. rapae, the development time differed between caterpillars feeding on ja - induced and caterpillars feeding on non - induced plants . Development of the caterpillars to pupae took longer on the induced plants, which exposes them to natural enemies for a longer time and gives them a disadvantage in the competition for resources with other herbivores . These results comply with those of agrawal and kurashige (2003), who showed that growth of p. rapae larvae was reduced on herbivore - induced brassicaceae . In summary: (1) ja treatment of b. oleracea results in avoidance of host plants by the two pieris butterflies; (2) the related gregarious and solitary butterfly species tested responded in a similar fashion to ja - treated plants; (3) ja treatment reduced the contents of two out of five glucosinolates in leaf surface extracts of brussels sprouts; and (4) the purified gls fractions could not explain the observed avoidance behavior . The results indicate that ja - induced infochemicals play an important role in host plant selection behavior of these butterflies; however, the phytochemicals involved still have to be elucidated.
|
Prevalence studies in the uk4 found that 2.6% of people aged 66 and over living in private households experienced abuse, and a similar study in ireland3 indicated a prevalence of 2.2% . These studies also show that elderly victims of abuse are in frequent contact with health care services, but few report the abuse.3,4 elderly people may tend to play down abuse problems or regard it as a private matter.3,5,6 possible barriers for not seeking help may be fear of isolation, not to be believed, that the victim is embarrassed, or fear that the abuse will escalate if they tell someone about it and they then interfere.7 older victims might lack the strength to report the abuse due to health status, low self - confidence and self - esteem, possibly caused by the abuse.7 these same factors will influence the strategies used to cope with the stress caused by abuse . Social support is an important factor for health and well - being and influences the elderly victim s coping strategies.8 behavioral factors, including coping style, are important determinants of health status, and will impact on how older people manage stress and maintain control over their lives, thereby protecting themselves from abuse.9 as a consequence at all encounters health professionals should be aware of signs indicating abuse of older people, be acquainted with relevant supporting services in the community, and discuss the problems as far as possible with the patient.10,11 such approaches may be crucial for how the older person appraises and copes with the abuse . Most research on stress and coping tracks back to the work by lazarus and folkman 30 years ago.12 the authors emphasize that stress comes into existence when there is an unbalance in the relationship between the person and environmental incidents or demands . The person might appraise the stress in several ways depending on the seriousness of the event, if values, beliefs and personal control are challenged, in addition to previous experience of stress and personal coping resources . Hence, people will manage stress in various ways depending on what is at stake, and the controllability of the situation.12 the comprehensive review by skinner et al13 assessing coping categories highlights the complexity of the coping phenomenon and critiqued commonly used distinctions such as problem - focused versus emotion - focused coping, as did lazarus,14 because no topologies covered the multidimensional aspects of coping . Skinner and zimmer - gembeck introduced a model of coping that included adaptive, episodic and interactional processes and the interplay between these levels.15 appraisal and reappraisal of demands at the interactional level in real time involves behavior reaction, in addition to emotion, attention, motivation, and cognition . The outcome is influenced by previous experience and strategies used to reduce stress together with present social context and support.15 studies about coping across age and sex differences in older and younger people are inconsistent.16 age related differences might be due to controllability of the situation more than developmental, contextual, or cohort factors.17 while others have found very slight age differences, but more sex differences in coping strategies.18 brennan et als19 study of coping trajectories in later life, indicates that people s coping strategies diminish from late middle age to older age, and that the decline was most evident in avoidance coping . This might be the result of the aging process, dwindling personal and social resources, and/or the way the older person perceives stressors in their life . This observation is in line with other research, for example, a study by kraaij et al20 which identified that the better the social support is, the less the older person will engage in avoidance coping and instead use more efficient strategies to manage stressors and emotional problems . Studies about coping and depressive symptoms, indicate that the elderly with a high degree of coping self - efficacy used more problem - focused than emotion - focused coping,20 and that such strategies strengthened the person s ability to be more resilient.8 over the last 20 years, the concept of resilience has received increased attention.21 resilience in older people can be understood as a process of adaption when challenged by adversity where the outcomes are influenced by internal and external factors.22 coping as a multi - dimensional adaptive process is much in line with the processes of resilience which stresses that personal qualities, and lifelong experiences, together with external and contextual factors will either bring on resilience or lead to inappropriate processes to overcome stress.15,21 as already mentioned, research indicates that coping strategies decline in old age, but this is not supported in the resilience literature.19 testing of the resilience scale suggest that a long life strengthens the person s ability to adapt to adversity,23,24 in particular if there are supportive social factors that prevent isolation and facilitate relationships.22 our aim was to explore the coping strategies elderly people used to manage stress caused by abusive offspring, and their ability to be resilient . The study used the world health organization definition of elder abuse as a single or repeated act, or lack of appropriate action, occurring within any relationship where there is an expectation of trust which causes harm or distress to an older person.25 the definition includes abuse of a physical, sexual, psychological / emotional, or financial nature, in addition to neglect . This study formed part of a project assigned by the norwegian directorate of health to the norwegian centre for violence and traumatic stress studies . A qualitative approach was used to explore the coping strategies used by older abused parents.26 the strategy was purposeful in that we recruited elderly people with experience of abuse . The criteria were that the participant was above 62 years old, living at home, and had sought professional assistance from the protective services for the elderly (pse) or a domestic shelter . Employees of these services contacted both present and past clients, and invited them to participate in the study . Pse exist only in two norwegian counties and participants were recruited from this area and from shelters nearby . The reasons given for withdrawal were that they did not wish to talk about the abuse after all, that they were too busy, or that they did not feel well at the time . Fifteen participants, including 12 women and three men from a range of socioeconomic backgrounds were recruited by the pse, including one from a domestic shelter . Therefore, this research is based on information provided by the 14 subjects it was possible to interview within the time frame of the project . The study group consisted of one married couple, and 12 participants who were either single or living alone . Generally, they were well educated and seven participants had upper - secondary school or higher education; all but two had had a previous occupation, although all were now retired . Several participants described that they suffered from chronic illness but did not consider their health to be poor as long they could manage on their own . All could manage activities of daily living, but six received some help with housework . Three participants reported having two abusers, whereas the other cases reported having only one abuser . According to information supplied by the participants, eight of the abusers had problems with alcohol and/or drug addiction, and four abusers had chronic mental health problems . The abuse problems had started several years earlier, and at the time of interview, ten participants were still being abused, although the frequency and intensity of the abuse had become less since they contacted the pse or domestic shelter . All participants were contacted by telephone and asked where they preferred to meet the researcher . Most invited the researcher to their home, but three preferred to meet at the pse office and two asked to meet in a caf . They had been together when abused by their son and complemented each other during the interview, however this might have influenced the information given . At the start of the interview, the participants were asked for background information, such as place of birth, where they lived, and educational level achieved, which they found easy to talk about, with some showing photographs of places they had lived or of their families . These conversations provided an opportunity to gain some knowledge about their lives, and to establish a trusting relationship before moving on to discuss their experiences and the problems related to abuse . The themes outlined in figure 1 were used to guide the interviewer during the interview . All but one interview was digitally recorded and transcribed verbatim in full or in part . Immediately after the interview, the researcher wrote a summary and notes describing the experience of the interview and dialogue with the participant . One interview inadvertently missed being recorded, so was not included in this paper because the notes taken were insufficient for further analysis . Qualitative content analysis was performed according to the method described by graneheim and lundman27 whereby text is structured according to themes derived from the interview guide, reading through and listening to entire interviews, and reading the literature.26,28 our preliminary analysis of the interviews indicated the type of abuse and the relationship between the victim and the abuser, the victim s understanding of the situation, and the way they interpreted the abuse being perpetrated by their offspring . This participant was an elderly widow in her 80s who had been abused by two of her four offspring who had drug addiction problems, and was struggling to find ways to cope with her circumstances . The criteria were that the participant was above 62 years old, living at home, and had sought professional assistance from the protective services for the elderly (pse) or a domestic shelter . Employees of these services contacted both present and past clients, and invited them to participate in the study . Pse exist only in two norwegian counties and participants were recruited from this area and from shelters nearby . The reasons given for withdrawal were that they did not wish to talk about the abuse after all, that they were too busy, or that they did not feel well at the time . Fifteen participants, including 12 women and three men from a range of socioeconomic backgrounds were recruited by the pse, including one from a domestic shelter . Therefore, this research is based on information provided by the 14 subjects it was possible to interview within the time frame of the project . The study group consisted of one married couple, and 12 participants who were either single or living alone . Generally, they were well educated and seven participants had upper - secondary school or higher education; all but two had had a previous occupation, although all were now retired . Several participants described that they suffered from chronic illness but did not consider their health to be poor as long they could manage on their own . All could manage activities of daily living, but six received some help with housework . Three participants reported having two abusers, whereas the other cases reported having only one abuser . According to information supplied by the participants, eight of the abusers had problems with alcohol and/or drug addiction, and four abusers had chronic mental health problems . The abuse problems had started several years earlier, and at the time of interview, ten participants were still being abused, although the frequency and intensity of the abuse had become less since they contacted the pse or domestic shelter . All participants were contacted by telephone and asked where they preferred to meet the researcher . Most invited the researcher to their home, but three preferred to meet at the pse office and two asked to meet in a caf . They had been together when abused by their son and complemented each other during the interview, however this might have influenced the information given . At the start of the interview, the participants were asked for background information, such as place of birth, where they lived, and educational level achieved, which they found easy to talk about, with some showing photographs of places they had lived or of their families . These conversations provided an opportunity to gain some knowledge about their lives, and to establish a trusting relationship before moving on to discuss their experiences and the problems related to abuse . The themes outlined in figure 1 were used to guide the interviewer during the interview . All but one interview was digitally recorded and transcribed verbatim in full or in part . Immediately after the interview, the researcher wrote a summary and notes describing the experience of the interview and dialogue with the participant . One interview inadvertently missed being recorded, so was not included in this paper because the notes taken were insufficient for further analysis . Qualitative content analysis was performed according to the method described by graneheim and lundman27 whereby text is structured according to themes derived from the interview guide, reading through and listening to entire interviews, and reading the literature.26,28 our preliminary analysis of the interviews indicated the type of abuse and the relationship between the victim and the abuser, the victim s understanding of the situation, and the way they interpreted the abuse being perpetrated by their offspring . This participant was an elderly widow in her 80s who had been abused by two of her four offspring who had drug addiction problems, and was struggling to find ways to cope with her circumstances . All participants were contacted by telephone and provided with verbal and printed information about the study prior to being interviewed . Written consent and permission to make digital recordings of the interviews all participants had support systems available through the pse or shelter in the event that the interview raised concerns or painful emotions that were difficult to handle afterwards . During the analysis, we identified several coping strategies, some of which seemed to be successful in terms of helping the elderly person move on with their life, while others seemed to fail . When analyzing the interviews, it was evident that each participant s main coping strategy was based on one of the approaches shown in figure 2 . A main finding of the study was that participants were searching to explain the abusive behavior of their offspring and why they could not behave like decent people . The data indicate that the participants needed to find an explanation beyond themselves and their role as a parent, ie, that there were circumstances beyond their control . This finding is noteworthy because none of those interviewed were asked to offer reasons for why their offspring abused them, and were only asked when the abuse started and the circumstances in which the abuse occurred . None of the participants denounced their offspring as bad people, or described them as lacking the skills to manage everyday life and family relationships; having an urgent need for money, drugs, or alcohol; or being unable to control negative emotions . In some way, there was an influence of factors beyond the control of the parent that put their offspring at risk of becoming an abuser . Participants mentioned relatives such as uncles or aunts with mental health problems or undesirable social behavior for unknown reasons that were interpreted by participants as bad genes . Another, when describing her daughter, said: i think she is like my aunt who wants to control other people all the time; she behaves like a psychopath . You know a chip off the old block . Those who had adopted children blamed the bad influence of their children s friends in youth or relationships they had entered into as adults . Participants also reported that their child had shown behavior problems very early on, often evident in primary or secondary school, that affected their relationships with family and friends . Participants were less willing to regard themselves as victims of abuse, even though they had contacted professional services . This attitude was noticeable in almost all participants . At the beginning of the study, participants were asked to describe how they would characterize what they had been exposed to by their offspring, ie, whether they saw it as offensive behavior, abuse, or mistreatment . This question seemed confusing for the participants, and they often fell silent or switched to talking about other issues . Most participants felt sorry for their offspring, regarding them as victims or losers in a complex society that they could not cope with or as people who could not function within a family . One stated at the beginning of their interview: it is my son who has a problem, not me . Statements made by the participants indicated that hope was a prominent coping strategy for several parents . They had not given up on their adult child, even though the problems had been present for years and involved serious instances of abuse . I do not really have any hope for my son, but at the same time, i cannot live without some hope the same participant described being woken up in the middle of the night by her son shouting: i ll kill you, whereupon he started to hit and hit and hit, you know . Another participant reported being terrorized by her daughter s unstable behavior, stating: participants who sincerely hoped that their situation would change were preoccupied with an everlasting search for better services and support for their offspring . This quest was very time - consuming and exhausting, and they reported often feeling that they were faced with a professional wall of silence . They could not accept that there was no longer any hope of a better life for their offspring . Her son had been abandoned by health and social services because of his inability to cooperate, his unrealistic expectations of the services available, his attempts to manipulate medical staff into prescribing tranquillizers and other drugs, and very aggressive behavior . This mother was constantly asking for her son s antidepressant and antipsychotic medication to be changed because she was not seeing any improvement . Her son had recently visited her for the first time since being admitted to an institution and was accompanied by two security guards . She described her son s physical and psychological condition as poor, describing his visit as follows: he sat in that chair and said to me: mother, i feel terrible . I have so much up top. I said to him, john, i understand. No, you do not understand the pain i have. Certainly, i understand your pain my son, but there is one thing your mother expects, which is that you take walks and exercise regularly . You know, john, medication can help you a lot, but you have to help yourself too . Taking a walk is the best medicine. He sat in that chair and said to me: mother, i feel terrible . I have so much up top. I said to him, john, i understand. No, you do not understand the pain i have. Certainly, i understand your pain my son, but there is one thing your mother expects, which is that you take walks and exercise regularly . You know, john, medication can help you a lot, but you have to help yourself too . Taking a walk is the best medicine. Participants who mainly used the abovementioned coping strategy had limited social interaction with family and friends because they lacked the strength needed to maintain close relationships due to depression, chronic pain, chronic sleep disturbance, and/or reduced mobility . Another common coping strategy used by participants was to accept that they had done their best as parents . This attitude helped them to understand that they had to live with their problems and that it was unrealistic to believe that the abuse would end . Several participants conveyed an understanding that something had gone wrong along the way, even though they had tried hard to do the best for their children . All these participants had been exposed to psychological abuse and two to severe financial abuse, with adverse consequences . One situation that resulted in psychological harassment occurred when an elderly parent transferred property to adult children, who started to quarrel about it . The elderly parent tried to resolve matters, but eventually came to realize that they would never be able to restore peace and order in the family . The consequence was a split family and a deadlocked conflict, whereby several of the offspring refused to have any contact with their parent . Lost contact with grandchildren and great - grandchildren is a source of much despair and emotional stress for elderly parents in this situation . Conversations with old friends and/or professional support helped these elderly parents to move on by putting distance between them and their problems . They tried to concentrate on other activities, such as reading a good book or watching an interesting television program, and when together with friends and family members they still stayed in touch with, they talked about things other than their problems . Small and good moments in everyday life were of value, described by the oldest participant as follows: every moment is important, you have to savor it and enjoy it if possible . You know, when i lay down in a good bed without any pain, i think about how lucky i am . I have done the best i could; it was done with the best intentions . Every moment is important, you have to savor it and enjoy it if possible . You know, when i lay down in a good bed without any pain, i think about how lucky i am . I have done the best i could; it was done with the best intentions . Several participants expressed an understanding of their situation, and that they could not take responsibility as parents for the miserable lives of their offspring, which often involved drug and/or alcohol abuse and/or mental health problems . One mother reported that her son invaded her home after the breakdown of his third relationship . The first thing he did when he came to visit her was to empty the refrigerator . He was often aggressive and asked for money . Over a period of years, she had become well acquainted with his bad behavior and knew that she could not cope with it any more . She had always managed to put her problems aside for a time, but now felt that it was impossible to do so . She had become depressed, cried a lot, and was hospitalized because of severe stress headaches . She attempted to talk to her son, asking him not to visit her so often, without success . That was the turning point for her, and she was finally able to get the help she needed to reclaim her life . She no longer felt the need to sit in darkness in her dining room without the television on pretending that she was not at home . Pse staff talked with the son, reached an agreement regarding how often he could visit his mother, and helped him find a better place to live . His mother did not believe that he would ever be able to sort out his life . The only thing she wanted was to be able to live in peace, and said: i do not think he will change, no, i am sure about that . He is almost fifty, and he has to sort out things himself . At that time, she was looking forward to going on holiday with her brother and collecting the puppy she had ordered . They had transferred their house to their son some years earlier, and at the time of interview were living in a small flat in part of the house . During the previous year, their son, who suffered from delusions, had a worsening of his symptoms, possibly as a result of taking less medication because of adverse effects . The son was often verbally aggressive, and a few months earlier had knocked his father to the ground without any warning, kicked him, and then hit his mother in the face . The couple contacted their general practitioner and other services where their son had received treatment, but the general practitioner was not willing to change the medication . This elderly couple understood that their son s situation was not their responsibility, but struggled to find partners in the health care system who were willing to take action and protect them from abuse . A main finding of the study was that participants were searching to explain the abusive behavior of their offspring and why they could not behave like decent people . The data indicate that the participants needed to find an explanation beyond themselves and their role as a parent, ie, that there were circumstances beyond their control . This finding is noteworthy because none of those interviewed were asked to offer reasons for why their offspring abused them, and were only asked when the abuse started and the circumstances in which the abuse occurred . None of the participants denounced their offspring as bad people, or described them as lacking the skills to manage everyday life and family relationships; having an urgent need for money, drugs, or alcohol; or being unable to control negative emotions . In some way, there was an influence of factors beyond the control of the parent that put their offspring at risk of becoming an abuser . Participants mentioned relatives such as uncles or aunts with mental health problems or undesirable social behavior for unknown reasons that were interpreted by participants as bad genes . Another, when describing her daughter, said: i think she is like my aunt who wants to control other people all the time; she behaves like a psychopath . You know a chip off the old block . Those who had adopted children blamed the bad influence of their children s friends in youth or relationships they had entered into as adults . Participants also reported that their child had shown behavior problems very early on, often evident in primary or secondary school, that affected their relationships with family and friends . Participants were less willing to regard themselves as victims of abuse, even though they had contacted professional services . This attitude was noticeable in almost all participants . At the beginning of the study, participants were asked to describe how they would characterize what they had been exposed to by their offspring, ie, whether they saw it as offensive behavior, abuse, or mistreatment . This question seemed confusing for the participants, and they often fell silent or switched to talking about other issues . Most participants felt sorry for their offspring, regarding them as victims or losers in a complex society that they could not cope with or as people who could not function within a family . One stated at the beginning of their interview: it is my son who has a problem, not me . Statements made by the participants indicated that hope was a prominent coping strategy for several parents . They had not given up on their adult child, even though the problems had been present for years and involved serious instances of abuse . I do not really have any hope for my son, but at the same time, i cannot live without some hope the same participant described being woken up in the middle of the night by her son shouting: i ll kill you, whereupon he started to hit and hit and hit, you know . Participants who sincerely hoped that their situation would change were preoccupied with an everlasting search for better services and support for their offspring . This quest was very time - consuming and exhausting, and they reported often feeling that they were faced with a professional wall of silence . They could not accept that there was no longer any hope of a better life for their offspring . Her son had been abandoned by health and social services because of his inability to cooperate, his unrealistic expectations of the services available, his attempts to manipulate medical staff into prescribing tranquillizers and other drugs, and very aggressive behavior . This mother was constantly asking for her son s antidepressant and antipsychotic medication to be changed because she was not seeing any improvement . Her son had recently visited her for the first time since being admitted to an institution and was accompanied by two security guards . She described her son s physical and psychological condition as poor, describing his visit as follows: he sat in that chair and said to me: mother, i feel terrible . I have so much up top. I said to him, john, i understand. No, you do not understand the pain i have. Certainly, i understand your pain my son, but there is one thing your mother expects, which is that you take walks and exercise regularly . You know, john, medication can help you a lot, but you have to help yourself too . Taking a walk is the best medicine. He sat in that chair and said to me: mother, i feel terrible . I said to him, john, i understand. No, you do not understand the pain i have. Certainly, i understand your pain my son, but there is one thing your mother expects, which is that you take walks and exercise regularly . You know, john, medication can help you a lot, but you have to help yourself too . Taking a walk is the best medicine. Participants who mainly used the abovementioned coping strategy had limited social interaction with family and friends because they lacked the strength needed to maintain close relationships due to depression, chronic pain, chronic sleep disturbance, and/or reduced mobility . Another common coping strategy used by participants was to accept that they had done their best as parents . This attitude helped them to understand that they had to live with their problems and that it was unrealistic to believe that the abuse would end . Several participants conveyed an understanding that something had gone wrong along the way, even though they had tried hard to do the best for their children . All these participants had been exposed to psychological abuse and two to severe financial abuse, with adverse consequences . One situation that resulted in psychological harassment occurred when an elderly parent transferred property to adult children, who started to quarrel about it . The elderly parent tried to resolve matters, but eventually came to realize that they would never be able to restore peace and order in the family . The consequence was a split family and a deadlocked conflict, whereby several of the offspring refused to have any contact with their parent . Lost contact with grandchildren and great - grandchildren is a source of much despair and emotional stress for elderly parents in this situation . Conversations with old friends and/or professional support helped these elderly parents to move on by putting distance between them and their problems . This can be described as putting family problems in a drawer and closing it as far as possible . They tried to concentrate on other activities, such as reading a good book or watching an interesting television program, and when together with friends and family members they still stayed in touch with, they talked about things other than their problems . Small and good moments in everyday life were of value, described by the oldest participant as follows: every moment is important, you have to savor it and enjoy it if possible . You know, when i lay down in a good bed without any pain, i think about how lucky i am . I have done the best i could; it was done with the best intentions . Every moment is important, you have to savor it and enjoy it if possible . You know, when i lay down in a good bed without any pain, i think about how lucky i am . I have done the best i could; it was done with the best intentions . Several participants expressed an understanding of their situation, and that they could not take responsibility as parents for the miserable lives of their offspring, which often involved drug and/or alcohol abuse and/or mental health problems . Psychological harassment and nagging about money were apparent in their stories . One mother reported that her son invaded her home after the breakdown of his third relationship . The first thing he did when he came to visit her was to empty the refrigerator ., she had become well acquainted with his bad behavior and knew that she could not cope with it any more . She had always managed to put her problems aside for a time, but now felt that it was impossible to do so . She had become depressed, cried a lot, and was hospitalized because of severe stress headaches . She attempted to talk to her son, asking him not to visit her so often, without success . That was the turning point for her, and she was finally able to get the help she needed to reclaim her life . She no longer felt the need to sit in darkness in her dining room without the television on pretending that she was not at home . Pse staff talked with the son, reached an agreement regarding how often he could visit his mother, and helped him find a better place to live . His mother did not believe that he would ever be able to sort out his life . The only thing she wanted was to be able to live in peace, and said: i do not think he will change, no, i am sure about that . As long as he does not bother me he is almost fifty, and he has to sort out things himself . At that time, she was looking forward to going on holiday with her brother and collecting the puppy she had ordered . They had transferred their house to their son some years earlier, and at the time of interview were living in a small flat in part of the house . During the previous year, their son, who suffered from delusions, had a worsening of his symptoms, possibly as a result of taking less medication because of adverse effects . The son was often verbally aggressive, and a few months earlier had knocked his father to the ground without any warning, kicked him, and then hit his mother in the face . The couple contacted their general practitioner and other services where their son had received treatment, but the general practitioner was not willing to change the medication . This elderly couple understood that their son s situation was not their responsibility, but struggled to find partners in the health care system who were willing to take action and protect them from abuse . Our findings indicate that one of the described coping strategies tended to be more evident in some participants individual coping behavior than the others . However, use of one strategy did not necessarily rule out using any of the other strategies, with coping responses varying according to the circumstances in which these elderly parents found themselves . Independent of the type and severity of abuse, all participants struggled to some degree with despondency . Despite the difficulties involved in making sense of their offspring s behavior the passage of time and their social, psychological, and physical resources helped participants to regain control over their lives, but this required a good deal of strength not to give in . The aim of this study was to gain knowledge of the strategies older abused people used to cope with everyday life, with the intention of informing health care workers when dealing with cases of elder abuse rather than adding to the body of literature of coping mechanisms . Still, knowledge of theoretical perspectives remains important when interpreting the results of this study . Based on recent research addressing coping in late life,8,18,19 the discussion of the result will be centered along different coping strategies in addition to the process of resilience.22,23 however, despite the critique, terms like problem and emotion - focused, or approach and avoidance coping exist in the literature . Though, it is necessary to keep in mind that such concepts complement rather than distinguish the coping strategies used by individuals.14 the findings of the present study indicate that there is a pattern of response to stressors linked with abuse that is visible in terms of coping style at the level of the individual . For example, the strategy used by participants in our study to make some sort of sense of the abusive behavior of their offspring was to find external factors or circumstances that were beyond their control as parents . Being abused by their own child is a serious life experience and may challenge participants values of the nuclear family, self - esteem related to upbringing of their children, and a sense of loss of control as head of the family . The degree of controllability is an important factor influencing the strategies chosen to prevent or reduce stress.12 the strategy to create external explanations may have the benefit of reducing the stress associated with the sense of failure as a parent . To take an active approach to the parent this stance seemed to be effective in helping these elderly parents to create meaning in a situation they were a part of but unable to resolve or control . The same mechanism might explain why participants were less willing to regard themselves as victims and this is a considerable finding . This could be interpreted as an emotional coping strategy to prevent stress by not accepting the seriousness of the situation . The cost of such a strategy may be that it prevents an active approach to abuse being taken, which in the long term could worsen the situation . Participants understanding of the situation and reluctance to be identified as victim might be a result of older people s understanding of abuse as a phenomenon that occurs in society but far from their own personal lives.5,6,29,30 naughton et al29 found that financial abuse and neglect were seldom associated with elder abuse, and that this lack of awareness had a negative impact on help - seeking behavior . Another issue is that the abused elderly may not acknowledge victimization because it can lead to social stigma associated with being an unsuccessful parent.30 such attitudes in the community might have a negative impact on the older person s ability to recover from adverse events like abuse and keep healthy . The feeling of shame might be prominent and contribute to less social contact.7 participants in the present study did not directly talk about embarrassment but all were reluctant to communicate their situation to anyone other than close family members and friends, and the abuse had gone on for a while before they sought professional support . Emotion - focused strategies might be effective if the stressor is rare or less serious, because it can promote cognitive reappraisal of the situation that leads to more problem - focused coping.12 however, if the demands and thereby the stress is high, too much emotion can bring about self - deception and distorting of the events that in the long term might increase the stress.12,20 our findings indicate that participants whose coping strategy was strongly hoping for a miracle underestimated the abuser s physical and/or mental condition and ability to change their behavior . In the long term, such a strategy is exhausting and counterproductive in that is likely to prevent the victim from getting on with their life because they get trapped in an abusive relationship . In addition, these participants tended to search for better services and support for their offspring, and in this way took an active approach to the problem, anticipating that solving the problems of their offspring would solve their problems as well . Both emotion - and problem - focused coping strategies may apply to reduce the stress related to abuse, and these strategies are therefore complementary and less mutually exclusive.8,12 toms et al8 found that both strategies were positively associated with resilience coping, but the correlation with problem - focused coping was much stronger to predict well - being in the elderly than emotional strategies . Lazarus emphasized the importance of situational factors and the person s emotions and described the two distinctions, problem - focused and emotion - focused, as intertwined coping functions.14 participants who understood the need to create distance between themselves and the offspring by withdrawing emotionally and physically eventually realized that it was their children s responsibility to sort out their own problems; the responsibility was not in the hands of their parents anymore . They had come to an understanding that they had done the best they could for their children . Most participants with this attitude had lived with abuse problems for a long time and reported that the abuse had become less serious . Taking such a stand might reflect the support of family and friends, the severity and frequency of the abuse, and/or the passage of time . Social and community belonging is essential for coping and for recovering from adverse events.7,22 discussing the issue with family and friends may contribute to a new appraisal of the situation, and thereby more efficient strategies to meet certain demands created by the abuse . Whether the abuse is ended or in some way controllable are essential factors for achieving some sort of resilience that enables the older victims to go on with their lives.7 research indicates that the importance of stressor controllability increases with age and the feeling of controllability promote healthy coping.16 the uk study of abuse7 showed that older victims of abuse felt frustrated, powerless, and depressed if they were unable to change their situation . The efficiency of any coping style has to be linked to outcomes as well as individual and social resources.19 the outcome desired by victims of offspring abuse might be different from that of victims of partner abuse, because the ties of kinship between victim and abuser are likely to be much stronger.31,32 none of the participants in our study expressed a desire to have no further contact with their offspring, and those who had lost contact with part of their family reported emotional distress . Therefore, it is imperative that professionals identify the ties in the abusive relationship at an early stage and what the victim wants to achieve by seeking professional assistance.33,34 the study by brennan et al19 of coping trajectory in later life indicate that coping styles were much the same even though there were slight declines in all strategies.19 however problem solving strategies increased with age and the use of support and guidance to handle stressors did not decrease which might reflect on problem solving strategies.16,19 the alleged decline in coping strategies is in some contrast to research about resilience which indicates that the ability to achieve resilience increases with age.22,23 it is suggested that challenging events over the lifespan will strengthen the ability to recover from adversity.23,24 however the resilience scale do not cover such challenging experiences as abuse and few studies ask older people to identify what they regard as adverse events.22 it is important to have in mind that previous life experiences might strengthen self - efficient coping processes, but fundamentally these experiences might increase the older person s vulnerability as well . The study by mowlam et al7 indicated that earlier traumatic events during the lifespan were activated by the abuse experiences and that it was difficult to find strength to bounce back in the situation they now were a part of . Support by someone close, in addition to professional support might help these older people find appropriate coping strategies . Based on the findings of the abovementioned studies, it is important to identify the social network and resources available to older victims of abuse, and if possible activate partnerships with the victim s significant others.11 it is also of value to identify the coping style to the older victim, ie, how they have responded to negative life events and the various stressors that occur in life . Our study has some limitations, in that all participants were recruited via a support service for victims of abuse, ie, the pse or a domestic shelter . Our study participants had the insight, resources, and problem - solving skills to understand that they needed professional help, so might have had more personal and social resources than most elderly victims of abuse . A further limitation is that all participants in our study were ethnic norwegian, and their coping strategies might differ from those in other cultures and societies . Nevertheless, we believe that this study makes a contribution to our knowledge about some of the coping strategies commonly used by elderly parents who are being abused by their offspring . Abuse of older people by their offspring represents a huge stress to individuals, and challenges the values and beliefs of both professionals and victims with regard to the caring nature of families . The findings of this study indicate that victims of abuse use a wide range of coping strategies to manage their everyday lives, and that some of the strategies used are strongly linked to a need to maintain their self - respect as parents . Participants that were able to create distance from their offspring emotionally and physically by realizing that the miserable situation was not their responsibility were able to bounce back from the dejection and find some sort of resilience . The time, seriousness and controllability of the events, support by family, friends and professionals were all important factors in this process.
|
Patients were enrolled in this institutional review board approved observational study (http://www.clinicaltrials.gov, nct00597883). Eligible patients were scheduled for elective cea for high - grade carotid artery stenosis and clinically diagnosed as having type 2 diabetes, whether therapeutically treated or not . Although the name of each patient s medication was available, information regarding complications of type 2 diabetes, duration of disease, duration of treatment, or fasting and postprandial glucose control was not available . All patients received general anesthesia with standard hemodynamic and temperature monitoring, as previously described (5). The surgical technique, anesthetic management, and indications for cea are previously described (5,28). All patients were examined with a battery of neuropsychometric tests that interrogate four cognitive domains verbal memory, visuospatial organization, motor function, and executive function as previously described (5,6,28,29). The four domains and their respective tests are: verbal memory controlled oral word association, buschke selective reminding, boston naming, and hopkins verbal learning test; visuospatial organization rey complex figure copy and recall; motor function grooved pegboard dominant / non - dominant and fine finger tapping dominant / non - dominant; and executive function halstead - reitan trails parts a and b. a reference group composed of 156 elderly patients undergoing spine surgery was used to account for trauma of surgery 4-h duration, residual effects of general anesthesia, and practice effect associated with repeated neuropsychometric testing . The reference patients are 60 years undergoing lumbar level laminectomy or microdiscectomy on 2 levels without fusion, tumor / cyst, or blood loss necessitating transfusion . These patients experience similar surgical and anesthetic times as well as a similar general anesthetic . The criteria for cognitive dysfunction are based on difference scores calculated for each test by subtracting the preoperative test performance from the postoperative test performance at 1 day . Similar to previous studies (9,30), a z - score was generated based on the reference group s performance; the mean difference score of the reference group was subtracted from the difference score for the cea patient and then divided by the sd of the reference group: ([differencecea mean differencereference]/sdreference). Therefore, each test is evaluated in units of sd of the reference group s change in performance . Cea patient domains were evaluated to account for both focal and global / hemispheric deficits: 1) 2 sd worse performance than the reference group in two or more cognitive domains or 2) 1.5 sd worse performance than the reference group in all four cognitive domains . The neuropsychometric tests, their scoring, and performance calculations are described in greater detail in previous work (5,9,28,31). A variety of factors can affect the neuropsychometric performance of patients after cea, but only age> 75 years and type 2 diabetes have been previously shown to independently affect performance (10). Statin use has been previously associated with less cognitive dysfunction in asymptomatic patients having cea (9). The apolipoprotein e (apoe)-4 polymorphism has been previously shown to be a risk factor for impaired cognitive performance after cea (32). Other factors that might also affect performance, but have not been shown to independently affect performance, were evaluated as well . These included years of education, bmi, a history of smoking, extensive peripheral vascular disease, hypertension requiring medication, symptomatic status, and duration of cross - clamping of the carotid artery . Blood samples were obtained from radial arterial lines into untreated blood collection tubes prior to the start of surgery . The samples were centrifuged, the supernatants extracted, and the plasma was stored at 80c . As previously described (27), mmp-9 activity was determined by calculating the ratio of mmp-9 to its inhibitor, tissue inhibitor of metalloproteinase-1 (timp-1). Therefore, to calculate the level of mmp-9 activity, we measured both mmp-9 and timp-1 concentrations in the plasma . The concentrations of mmp-9, timp-1, icam-1, and crp were measured using commercially available elisa kits (r&d systems, minneapolis, mn). Preoperative monocyte counts, glucose levels, hba1c, and lipid profiles were obtained from hospital laboratory tests drawn during standard routine preadmission testing 72 h before surgery . Insulin has been implicated in some studies as an anti - inflammatory and antiatherogenic agent (33). To account for any interacting inflammatory effects of insulin, other type 2 diabetes medications, or hba1c statistical analysis was performed using r environment for statistical computing (r development core team, vienna, austria). For univariate analyses, student t test, wilcoxon rank sum test, fisher exact a multiple logistic regression model was constructed to identify independent predictors of cognitive dysfunction in the type 2 diabetic cea patients only; no reference patients were analyzed in the regression model . All variables with p <0.20 in a simple univariate logistic regression with cognitive dysfunction were entered into the final model . Model fit and calibration were confirmed with the likelihood ratio test, hosmer - lemeshow goodness - of - fit test, and receiver operating characteristic analysis . Patients were enrolled in this institutional review board approved observational study (http://www.clinicaltrials.gov, nct00597883). Eligible patients were scheduled for elective cea for high - grade carotid artery stenosis and clinically diagnosed as having type 2 diabetes, whether therapeutically treated or not . Although the name of each patient s medication was available, information regarding complications of type 2 diabetes, duration of disease, duration of treatment, or fasting and postprandial glucose control was not available . All patients received general anesthesia with standard hemodynamic and temperature monitoring, as previously described (5). The surgical technique, anesthetic management, and indications for cea are previously described (5,28). All patients were examined with a battery of neuropsychometric tests that interrogate four cognitive domains verbal memory, visuospatial organization, motor function, and executive function as previously described (5,6,28,29). The four domains and their respective tests are: verbal memory controlled oral word association, buschke selective reminding, boston naming, and hopkins verbal learning test; visuospatial organization rey complex figure copy and recall; motor function grooved pegboard dominant / non - dominant and fine finger tapping dominant / non - dominant; and executive function halstead - reitan trails parts a and b. a reference group composed of 156 elderly patients undergoing spine surgery was used to account for trauma of surgery 4-h duration, residual effects of general anesthesia, and practice effect associated with repeated neuropsychometric testing . The reference patients are 60 years undergoing lumbar level laminectomy or microdiscectomy on 2 levels without fusion, tumor / cyst, or blood loss necessitating transfusion . These patients experience similar surgical and anesthetic times as well as a similar general anesthetic . The criteria for cognitive dysfunction are based on difference scores calculated for each test by subtracting the preoperative test performance from the postoperative test performance at 1 day . Similar to previous studies (9,30), a z - score was generated based on the reference group s performance; the mean difference score of the reference group was subtracted from the difference score for the cea patient and then divided by the sd of the reference group: ([differencecea mean differencereference]/sdreference). Therefore, each test is evaluated in units of sd of the reference group s change in performance . Cea patient domains were evaluated to account for both focal and global / hemispheric deficits: 1) 2 sd worse performance than the reference group in two or more cognitive domains or 2) 1.5 sd worse performance than the reference group in all four cognitive domains . The neuropsychometric tests, their scoring, and performance calculations are described in greater detail in previous work (5,9,28,31). A variety of factors can affect the neuropsychometric performance of patients after cea, but only age> 75 years and type 2 diabetes have been previously shown to independently affect performance (10). Statin use has been previously associated with less cognitive dysfunction in asymptomatic patients having cea (9). The apolipoprotein e (apoe)-4 polymorphism has been previously shown to be a risk factor for impaired cognitive performance after cea (32). Other factors that might also affect performance, but have not been shown to independently affect performance, were evaluated as well . These included years of education, bmi, a history of smoking, extensive peripheral vascular disease, hypertension requiring medication, symptomatic status, and duration of cross - clamping of the carotid artery . Blood samples were obtained from radial arterial lines into untreated blood collection tubes prior to the start of surgery . The samples were centrifuged, the supernatants extracted, and the plasma was stored at 80c . As previously described (27), mmp-9 activity was determined by calculating the ratio of mmp-9 to its inhibitor, tissue inhibitor of metalloproteinase-1 (timp-1). Therefore, to calculate the level of mmp-9 activity, we measured both mmp-9 and timp-1 concentrations in the plasma . The concentrations of mmp-9, timp-1, icam-1, and crp were measured using commercially available elisa kits (r&d systems, minneapolis, mn). Preoperative monocyte counts, glucose levels, hba1c, and lipid profiles were obtained from hospital laboratory tests drawn during standard routine preadmission testing 72 h before surgery . Insulin has been implicated in some studies as an anti - inflammatory and antiatherogenic agent (33). To account for any interacting inflammatory effects of insulin, other type 2 diabetes medications, or hba1c statistical analysis was performed using r environment for statistical computing (r development core team, vienna, austria). For univariate analyses, student t test, wilcoxon rank sum test, fisher exact a multiple logistic regression model was constructed to identify independent predictors of cognitive dysfunction in the type 2 diabetic cea patients only; no reference patients were analyzed in the regression model . All variables with p <0.20 in a simple univariate logistic regression with cognitive dysfunction were entered into the final model . Model fit and calibration were confirmed with the likelihood ratio test, hosmer - lemeshow goodness - of - fit test, and receiver operating characteristic analysis . In our cohort, 21.7% of type 2 diabetic patients exhibited cognitive dysfunction 1 day after cea . Eighty - eight of the remaining patients were taking other type 2 diabetes treatments: metformin (n = 70), glyburide (n = 9), sitagliptin (n = 6), and glimepiride (n = 3). There were no significant differences in the incidence of cognitive dysfunction among the type 2 diabetes treatments (insulin 18.2%, metformin 22.9%, glyburide 22.2%, sitagliptin 16.7%, glimepiride 0%, and no medication 25.0%). All variables were comparable between the reference group and cea patients, including age> 75 years (31.0 vs. 29.6%; p = 0.74), except for statin use; significantly more cea patients were taking statins than reference patients (60.8 vs. 29.7%; p <0.001). In univariate analyses, type 2 diabetic patients with cognitive dysfunction 1 day after cea had significantly higher preoperative levels of monocyte counts (9.1 2.0 10/l vs. 7.2 2.0; p <0.001), crp (32.5 12.9 vs. 10.8 9.9 mg / l; p <0.001), icam-1 (392.7 63.0 vs. 345.4 60.6 ng / ml; p <0.001), and mmp-9 activity (0.75 0.30 vs. 0.46 0.30; p <0.001) than those without cognitive dysfunction . There were no significant differences in inflammatory levels among the type 2 diabetes treatments . By univariate analyses with cognitive dysfunction, statin use, symptomatic status, apoe-4 status, preoperative monocyte counts, crp, icam-1, and mmp-9 activity were indicated for inclusion in the final multivariate logistic regression model predicting cognitive dysfunction in type 2 diabetic cea patients . Each unit of preoperative monocyte counts (odds ratio [or] 1.76 [95% ci 1.172.93]; p = 0.005) and crp (or 1.17 [1.101.29]; p <0.001) was significantly associated with higher odds of cognitive dysfunction at 1 day in type 2 diabetic patients undergoing cea (table 1). Patients with type 2 diabetes are at higher risk of exhibiting cognitive dysfunction, a subtler form of neurologic injury than stroke, after cea . Additionally, type 2 diabetic patients are known to have elevated systemic inflammatory markers compared with nondiabetic patients (1214). This study is the first of its kind to link an elevated preoperative systemic inflammatory state with cognitive dysfunction 1 day after cea in a cohort of type 2 diabetic patients . Our data demonstrate that for each unit of monocyte count (10/l) and crp concentration (mg / l), type 2 diabetic patients are 76 and 17% more likely to exhibit cognitive dysfunction 1 day after cea, respectively . Although icam-1 and mmp-9 activity did not maintain predictive significance in the multivariate logistic regression model, they are significantly elevated in those with cognitive dysfunction in univariate analyses . These findings are novel to the literature in that they link cognitive dysfunction after cea to preoperative inflammatory values in type 2 diabetic patients . The findings also support previous studies that have demonstrated deleterious effects of inflammation on cognition (34). The mechanism of this effect remains unclear, but we speculate that elevated systemic inflammation preoperatively may exacerbate the inflammatory response and stress of undergoing cea . It is reasonable to consider that systemic inflammatory markers, like monocytes, cross the blood these cytokines then potentially cause local inflammation in the brain and contribute to cognitive dysfunction . Whether the elevated inflammation remains in the periphery or infiltrates the central nervous system to act directly on the brain is unclear, but should be studied further in animal models . Cognitive dysfunction at 1 day can have a significant impact on quality of life such as earlier retirement, disability, and mortality (35) and has been associated with actual brain injury via elevations in glial markers of neuronal injury (s100b) (7); cognitive dysfunction is a pertinent consideration of surgical risk . Our observations suggest that type 2 diabetic patients with an elevated preoperative systemic inflammatory state are more likely to exhibit significant cognitive dysfunction 1 day after cea . This finding has important implications for the preoperative medical management of high - risk type 2 diabetic patients undergoing cea to treat high - grade carotid artery stenosis and requires further investigation . In conclusion, we find that type 2 diabetic patients with elevated levels of preoperative systemic inflammatory markers, like crp and monocyte counts, are more likely to exhibit cognitive dysfunction 1 day after cea . These observations have implications for the preoperative medical management of this high - risk group of surgical patients undergoing carotid revascularization with cea.
|
Glaucoma is a progressive disease affecting the optic nerve1 and is the second leading cause of blindness worldwide.2 the etiology of glaucoma is multifactorial, but elevated intraocular pressure (iop) has been associated with the risk and progression of the disease, resulting in visual field loss and optic disk cupping.1,35 reduction of iop is the only evidence - based treatment strategy for slowing glaucoma progression.1 to reduce iop to target levels, the european glaucoma society and previous studies recommend a therapy with topical medications as initial treatment.68 several topical, iop - lowering medications are available, but prostaglandin analogs (eg, latanoprost, bimatoprost, tafluprost, and travoprost), which reduce iop by increasing uveoscleral outflow of aqueous humor, are recommended as the first - line therapies by the european glaucoma society and previously reported studies because of their efficacy, favorable side - effect profile, and convenience.69 latanoprost, bimatoprost, and travoprost provide greater iop reduction than -blockers; however, this increased efficacy is accompanied by a greater incidence of ocular hyperemia.1013 a randomized, parallel - group, single - masked study (n=410) showed similar iop - lowering efficacies of bimatoprost, latanoprost, and travoprost.14 travoprost has been shown to maintain a mean iop reduction of 30% throughout a 24-hour dosing interval15 and was more efficacious than latanoprost over a 48-hour period after the last dose.16 among prostaglandin analogs, peak percentage reductions in iop were similar with bimatoprost (33%), latanoprost (31%), and travoprost (29%),17 with higher rates of ocular hyperemia reported with travoprost 0.004% and bimatoprost 0.03% compared with latanoprost 0.005%.10,12,17 benzalkonium chloride (bak) is the most commonly used preservative in ophthalmic medications and has been associated with various ocular surface symptoms, including hyperemia, burning, stinging, punctate keratitis, foreign body sensation, and dry eye.1820 bimatoprost 0.01% and latanoprost 0.01% each contain 0.02% bak, and travoprost 0.004% contains 0.015% bak . These bak concentrations have been shown to exert cytotoxic effects on cultured conjunctival and corneal epithelial cells and trabecular meshwork cell lines21,22 and cause pathologic alterations in corneal and conjunctival morphologies in animal models.23 in an effort to reduce ocular symptoms and avoid the corneal damage and tear film disruption associated with chronic bak exposure,24 a bak - free formulation of travoprost 0.004% containing the preservative polyquaternium-1 has been developed . In a randomized, multicenter, parallel - group, double - masked study, bak - free travoprost preserved with polyquaternium-1 provided iop control equivalent to that with bak - preserved travoprost, with a lower incidence of ocular hyperemia.25 limited data are available regarding the comparisons of polyquaternium-1-preserved travoprost with bak - preserved formulations of other prostaglandin analogs . The present study aimed to assess the efficacy and tolerability of bak - free travoprost 0.004% preserved with polyquaternium-1 in patients with open - angle glaucoma or ocular hypertension who were intolerant to bak - preserved latanoprost 0.005% or bimatoprost 0.01% . This 12-week, open - label, single - group study (clinicaltrials.gov i d, nct01493427; eudract i d, 2011 - 003816 - 21) was performed in belgium, spain, italy, and sweden between december 2011 and february 2013 . The study was approved by the ethical committees of the following institutions: hospital clinico san carlos - idissc, hospital ramon y cajal, and policlinico san mateo, and was compliant with the health insurance portability and accountability act and the ethical standards set forth by the declaration of helsinki and good clinical practice . Patients eligible for inclusion were aged 18 years with open - angle glaucoma or ocular hypertension who were receiving treatment with bak - preserved latanoprost 0.005% or bimatoprost 0.01% (branded or generic) for 4 weeks and who, in the opinion of the investigator, would benefit from a therapeutic switch because of tolerability concerns (based at the discretion of the study investigators). Iop in both eyes must have been safe in the opinion of the investigator such that vision and optic nerve integrity were maintained . In addition, iop must have been <30 mmhg while receiving latanoprost or bimatoprost . If the nonstudy eye required a pharmacologic therapy for iop control, it was required to be controlled with the study medication alone (ie, bak - free travoprost 0.004%). A best - corrected visual acuity of at least 6/60 snellen (1.0 logmar) was required in both eyes . All patients had to be willing and able to provide informed consent and discontinue other ocular hypotensive medications . Patients with any abnormality that prevented reliable applanation tonometry; patients with corneal dystrophy, conjunctivitis, keratitis, uveitis, or progressive retinal or optic nerve disease; and patients who had an intraocular or laser surgery 3 months before screening were excluded . Use of punctal plugs, punctal cautery, cyclosporine ophthalmic emulsion (restasis; allergan, inc ., irvine, ca, usa), or topical ocular corticosteroids for dry eye or keratoconjunctivitis sicca was not allowed . Systemic medications capable of altering iop were permitted but must have been stabilized for 7 days before screening . Eligible patients discontinued latanoprost or bimatoprost and self - administered one drop of bak - free travoprost 0.004% preserved with polyquaternium-1 (travatan preserved with polyquad; alcon laboratories, inc ., fort worth, tx, usa) every evening at ~8 pm for 12 weeks . If only one of the patient s eyes was dosed, the dosed eye was selected for analysis . If both eyes were dosed, then the worse evaluable eye was selected for analysis . Iop was assessed using goldmann applanation tonometry at the screening / baseline visit and during on - therapy visits at weeks 6 (3 days) and 12 (3 days), at approximately the same time of day (1 hour). To minimize confounding variables, all iop measurements for individual patients the primary efficacy endpoint was mean iop change from baseline at week 12; iop change from baseline to week 6 provided supportive data . The proportion of patients who achieved a target iop of 18 mmhg at week 12 was a secondary endpoint; all other assessments were considered exploratory . Adverse events (aes) were recorded at each study visit and coded based on the medical dictionary for regulatory activities version 15.0 . Descriptive statistics was provided for all study endpoints . The mean iop change from baseline at week 12 was analyzed using a paired t - test . To assess the effect of time on iop, the mean iop at baseline, week 6, and week 12 was analyzed using a mixed model that included visit and current treatment (ie, latanoprost 0.005% and bimatoprost 0.01%) as fixed effects and the visit by treatment interaction and patients as random effects . Differences in the ocular symptom surveys from baseline to week 12 were analyzed using wilcoxon signed - rank tests . Statistical analysis was performed using the sas 9.1.3 software (sas institute, cary, nc, usa), with p - values <0.05 considered statistically significant . Of the 202 patients screened, 201 patients were eligible for participation and 179 patients completed the study (figure 1). Two patients withdrew consent and did not receive the study drug; thus, 199 patients received 1 dose of the study medication (safety population). Of these, 187 patients completed 1 on - therapy visit and were defined as the intent - to - treat (itt) population . Patients who received study medication, completed all study visits, and satisfied inclusion and exclusion criteria were included in the per - protocol population (n=144). The mean patient age was 66.6 years (range, 1990 years; table 1). Most patients were women (58.8%) and received latanoprost before transition to travoprost (78.4%). Efficacy results were similar in the itt and per - protocol data sets; results for the itt population are reported . The mean iop was significantly reduced by 5.85% from baseline to week 12 (1.16 mmhg; p<0.001; figure 2); a similar iop reduction was evident at week 6 . Patients who had previously received latanoprost or bimatoprost at baseline had similar reductions in iop at both time points (latanoprost: 1.24 mmhg to 1.50 mmhg; bimatoprost: 1.05 mmhg to 1.16 mmhg; p0.004 versus baseline for all time points and previous treatment groups). The proportion of patients who achieved an iop of 18 mmhg was greater at week 6 (80.0%; n=144/180) and week 12 (81.2%; n=147/181) compared with that at baseline (73.3%; n=137/187). When asked to select between study medication and their previous medication, 74.9% of the patients (n=125/167) preferred bak - free travoprost over previous latanoprost or bimatoprost (25.1%; n=42/167; p<0.001). Most patients were very confident that they would adhere to their treatment regimen if they were prescribed their preferred medication (84.1%; n=143/170) or a medication not associated with burning or stinging (69.4%; n=118/170; figure 3). Ten patients discontinued bak - free travoprost preserved with polyquaternium-1 because of 15 aes (eye irritation, n=3; eye pruritus, n=2; and eye pain, photophobia, blurred vision, reduced visual acuity, conjunctivitis, eczema around the eye, foreign body sensation, headache, migraine, and dyspnea, n=1 each). Serious aes were reported in four patients (upper gastrointestinal hemorrhage, n=1; cholelithiasis, n=1; and respiratory infection, n=2); all were considered unrelated to bak - free travoprost . Throughout the study, 50 patients reported 73 treatment - emergent aes, most of which were reported by <2% of patients (table 2). Approximately, all of these were mild to moderate in severity (98.6%; n=72/73), and most were considered by the investigators to be unrelated to the study medication (58.9%; n=43/73). A majority of treatment - related aes were eye disorders (86.7%; n=26/30). Aes associated with few topical glaucoma medications may limit their use and necessitate switching to more tolerable medications.2629 switching from bak - preserved latanoprost or bimatoprost to bak - free, polyquaternium-1-preserved travoprost 0.004% provided additional iop reductions after 6 weeks of treatment that were maintained for up to 12 weeks . The severity of ocular surface disease was reduced 12 weeks after the transition to bak - free travoprost . At the end of the study, more patients preferred bak - free travoprost when asked to select between bak - free travoprost and bak - containing latanoprost or bimatoprost . Bak - free travoprost was associated with mild - to - moderate aes and was generally well tolerated . Preservatives such as bak that are commonly used in ophthalmic solutions are associated with burning, stinging, and dry eye and may increase the frequency of punctate keratitis.1820,3033 furthermore, increased time of bak exposure has been associated with a greater incidence of ocular surface disease,33 suggesting that patients with glaucoma or elevated iop controlled with a bak - preserved, iop - lowering medication may require a therapy switch over time because of bak - related tolerability concerns . Persistence and adherence to topical iop - lowering regimens are low,28 in part because of medication - related side effects;26,27,29 thus, improvements in ocular surface symptoms may have a beneficial effect on patients willingness to take their medication . Indeed, in the present study, more patients preferred bak - free travoprost over their previous medication and felt very confident that they would adhere to their treatment if prescribed their preferred medication or a medication that did not elicit ocular symptoms . Switching to polyquaternium-1-preserved travoprost was associated with iop reductions from baseline of ~1 mmhg, indicating that it had iop - lowering efficacy similar to that of the previous treatments of latanoprost or bimatoprost . However, the travoprost formulation maintained iop reductions while removing the deleterious effects of bak . Interpretation of these results is limited by the open - label, single - group study design . Patients may have been more likely to report symptom improvement after transition to bak - free travoprost preserved with polyquaternium-1 because they anticipated transition to a more tolerable medication . In addition, direct comparison between bimatoprost and latanoprost is not possible because of the forced switch aspect of the study . Finally, the 12-week duration of the study limits long - term efficacy or tolerability extrapolation . European patients with open - angle glaucoma or ocular hypertension who were switched from bak - preserved latanoprost or bimatoprost to bak - free travoprost preserved with polyquaternium-1 because of tolerability concerns experienced additional reductions in iop and improved ocular symptoms after the switch . Furthermore, when deciding between bak - free travoprost or bak - containing latanoprost or bimatoprost, a greater proportion of patients favored bak - free travoprost preserved with polyquaternium-1.
|
In 20022003 in kochi prefecture, western japan, 2 men sought medical care for rickettsiosis - like signs and symptoms . Case - patient 1 (61 years old) sought care for fever (39.2c), chills, and malaise 10 days after traveling to the mountains (day 0, the day of symptom onset). His physician prescribed cefdinir (300 mg / day). By day 3, signs and symptoms had not improved and an erythematous rash on his trunk had spread; the physician suspected infection with r. japonica or o. tsutsugamushi . The patient was hospitalized and intravenously administered minocycline (200 mg / day). Results (and reference values) for laboratory tests (day 3) follow: leukocytes, 5.8 10 cells / l (3.59.2 10 cells / l); thrombocytes, 225 l); aspartate aminotransferase, 59 u / l (<38 u / l); alanine aminotransferase, 61 u / l (<36 u / l); and c - reactive protein, 12.1 mg / dl (<0.3 mg / dl). Case - patient 2, a 73-year - old lumberjack, sought medical care for fever (39.2c), headache, and malaise (day 0, the day of symptom onset). On day 4, a disseminated maculopapular rash was noticed, especially on the trunk and lower limbs; jsf or scrub typhus infection was suspected . 10 cells / l; aspartate aminotransferase, 100 u / l, alanine aminotransferase, 45 u / l; and c - reactive protein, 17.2 mg / dl . In 2003, blood clots and serum samples from the 2 patients were transferred from kochi institute of health to the university of shizuoka, where they were stored at 20c until a retrospective analysis could be performed . Dna was extracted from the blood clots, and nested pcr was performed, as described (3,9), to detect sfg rickettsiae 16s rdna, o. tsutsugamushi 16s rdna, a. phagocytophilum p44/msp2, and ehrlichia spp . P28/omp-1 (table 1). To avoid dna contamination, we performed pcr, electrophoresis, and cloning were performed in separate laboratories . As a negative control, nested pcr without dna template samples was performed for each sample . Pcr detected a. phagocytophilum p44/msp2 multigenes in acute - phase blood clots from both case - patients, and sfg rickettsia 16s rdna was amplified from a sample from case - patient 2 (table 1). After in - hospital treatment with minocycline (200 mg / d), both case - patients improved clinically and were discharged on days 20 and 12, respectively, after symptom onset . Before being used in pcr, blood clots from the patients were homogenized by using biomasher (nippi inc ., tokyo, japan) and treated overnight with 100 u of streptokinase (wako pure chemical industries ltd, osaka, japan). Dna then was extracted by using the qiaamp dna mini kit (qiagen, valencia, ca, usa). Multiplex nested first - step pcr for sfg rickettsiae and o. tsutsugamushi was performed by using the following primers: ro-1f (5'-ccgtaaacgatgagtgctaga-3') and ro - r1 (5'-ccgagaacgtattcaccgc-3'). Multiplex nested second - step pcr for sfg rickettsiae 16s rdna was performed by using the following primers: r-2f (5'-gaagattctctttcggtttcgc-3') and r-2r (5'-gtcttgcttccctctgtaaac-3'). Multiplex nested second - step pcr for o. tsutsugamushi 16s rdna was performed by using the following primers: o-2f (5'-gacatggtagtcgcgaaaaatg-3') and o-2r (5'-tgcaatccgaactgagatacc-3'). A. phagocytophilum p44/msp2 was amplified by using primers p3726, p4257, p3761, and p4183, and ehrlichia spp . P28/omp-1 was amplified by using primers conp28-f1, conp28-r1, conp28-f2, and conp28-r2, as described (3,9). Amplicons of p44/msp2 were subjected to ta cloning (ta cloning kit; life technologies, grand island, ny, usa), and randomly selected recombinant clones were sequenced and analyzed phylogenetically (figure 1). A total of 28 p44/msp2 clones from case - patient 1 shared 27.5%100% similarity with each other and were widely dispersed in the tree . The 40 clone sequences from case - patient 2 shared 97.5%100% similarity with each other and grouped into a single cluster . Using blast (http://blast.ncbi.nlm.nih.gov), we compared the sequences with those in genbank; 27 previously identified p44/msp2 variants from human isolates and ticks collected in japan were identified as the closest relatives to p44/msp2 cloned from the 2 patients . We included the 27 variants in the tree; however, some were widely separated from the related clones (figure 1). For case - patient 2, the 389-bp sequence of the 16s rdna amplicon (determined by direct sequencing) was 100% identical to that of r. japonica yh (genbank accession no . Phylogenetic analysis of anaplasma phagocytophilum p44/msp2 multigenes detected in blood from 2 men in kochi prefecture, japan . Each p44/msp2 pcr product was cloned (ta cloning kit; life technologies, grand island, ny, usa) into the pcr2.1 vector, after which recombinant clones were randomly selected and the dna inserts were sequenced . The tree was constructed on the basis of the 117133 aa sequences of the p44/msp2 genes by using the neighbor - joining method . The closest relatives to sequences for the 2 case - patients those sequences have been published in genbank: patient2-day27 (obtained from a us patient); p44 - 2, p44 - 8, p44 - 10, p44 - 11, p44 - 13, p44 - 18e, p44 - 28, p44 - 35, p44 - 39, p44 - 40, p44 - 41, p44 - 48, varhh2, and wmsp5 are from human isolates; and 44-kda outer membrane proteins are from ticks collected in japan . Boldface font indicates the 28 p44/msp2 genes from case - patient 1 and the 40 from case - patient 2 . Data in parentheses indicate the number of p44/msp2 clones with identical sequences and the sequence accession numbers . Serologic evidence of infection was demonstrated by using indirect immunofluorescence assay (ifa) and western blot analysis as described (10,11). In ifas, igm and/or igg from serum samples from the case - patients reacted with a. phagocytophilum cultured in thp-1 rather than hl60 cells, and seroconversion was stronger in convalescent - phase serum samples (table 2). Igg titers against r. japonica were also higher in convalescent - phase samples from case - patient 2 . Western blot analysis further confirmed the specific reaction to the 44-kda outer membrane proteins (p44s) of a. phagocytophilum cultured in thp-1 cells and/or to the recombinant p44 - 1 (rp44 - 1) in serum samples (figure 2, table 2). However, using the same serum samples, we could not detect p44 antigens of a. phagocytophilum propagated in hl60 cells (data not shown), supporting the ifa result . * all western blot testing using recombinant p44 - 1 antigen detected igm and igg; the antigen reacted with all sera tested, as shown in figure 2 . Western blot analyses, using recombinant p44 - 1 protein (rp44 - 1) and anaplasma phagocytophilum infected thp-1 cells as antigens, of serum samples from 2 men, case - patients 1 and 2, who had a. phagocytophilum infection, kochi prefecture, japan . The escherichia coli, which produced rp44 - 1, was kindly provided by yasuko rikihisa (ohio state university, columbus, oh, usa). The rp44 - 1 and the rabbit hyperimmune serum (positive control serum) were prepared as described (11,12). The primary human serum samples tested were diluted 200- to 400-fold; rabbit serum sample (positive control) was diluted 2,000-fold . The goat antihuman igg and igm alkaline phosphatase conjugates (life technologies, grand island, ny, usa) were used as secondary antibodies . Rp, rp44 - 1 antigen; in, infected thp-1; un, uninfected thp-1 cells . In central and western japan, most cases of tickborne infectious and febrile disease have been reported as jsf (1,13), and r. japonica has been frequently detected in ixodid ticks in these areas . We found a. phagocytophilum infection in several species of ticks, and at least 3 species (h. formosensis, h. longicornis, and i. ovatus) seem to be associated with r. japonica and a. phagocytophilum (7,8). National surveillance during 19992010, showed that jsf was endemic in kochi prefecture during 19992004 . More recently, jsf - endemic areas are mie, kagoshima, wakayama, and kumamoto prefectures rather than kochi prefecture . Our survey demonstrating the presence of a. phagocytophilum infected ticks in mie and kagoshima prefectures (8) indicates that there is a risk for dual infection with r. japonica and a. phagocytophilum in jsf - endemic areas of japan . A. phagocytophilum cultured in hl60 cells is generally used as a source of antigen for serodiagnosis of human anaplasmosis . Our findings show, however, that titers of antibody against a. phagocytophilum propagated in thp-1 cells were higher than those propagated in hl60 cells . We further analyzed the transcription of p44/msp2 multigenes encoding p44 repertoires (major antigens of a. phagocytophilum) in infected hl60 and thp-1 cells by using reverse transcription pcr followed by ta cloning as described (7). The analyses showed that a transcript from the p44 - 60 gene and another from the p44 - 47 gene (75% and 25% of transcripts tested, respectively) were dominantly expressed in a. phagocytophilum propagated in thp-1 cells but not in hl60 cells; several transcript species other than p44 - 60 and p44 - 47 of p44/msp2 multigenes were expressed in a. phagocytophilum propagated in hl60 cells (data not shown). A previous proteomic study supported the variety of p44 repertoires produced by a. phagocytophilum in hl60 cells (14). The difference of p44/msp2 expression between hl60 and thp-1 cell cultures may reflect the discrepancy of antibody titers obtained by ifas . Furthermore, in ifas using infected thp-1 antigens, igm titers tended to be higher than igg titers, even in convalescent - phase serum samples . These patients probably produced igg reactive with p44 species other than p44 - 60 and p44 - 47 that were dominantly expressed in a. phagocytophilum propagated in thp-1 cells; western blot analysis showed that igg in patients strongly bound to recombinant p44 - 1 rather than p44s (probably including p44 - 60 and p44 - 47) of a. phagocytophilum propagated in thp-1 cells . Thus, cases of human anaplasmosis could go undiagnosed if only infected hl60 cells, and not thp-1 cells, are used as antigen for serodiagnosis of rickettsiosis - like infections, as is currently done when using ifas . We documented 2 cases of human granulocytic anaplasmosis in japan, 1 with and 1 without jsf coinfection . To avoid misdiagnosing cases of human anaplasmosis, we recommend that a. phagocytophilum propagated in thp-1 and in hl60 cells be used as antigens for the serodiagnosis of rickettsiosis - like infections.
|
Since 2010 when the seminal paper by sklov et al . Was published, many authors have begun to catalog the diagnosis and clinicopathologic characteristics of mammary analogue secretory carcinoma (masc). However, while the literature concerning the histological characteristics of masc is burgeoning, the cytomorphological features of masc and its addition to the differential diagnosis of a salivary gland fine - needle aspiration (fna) specimen by cytopathologists is just emerging . Until date, few cases of masc sampled by fna have been reported; with one lesion diagnosed via cytological analysis (the remaining cases received a final diagnosis of masc after histological evaluation). Here the case we present here is about a 51-year - old female who presented with an asymptomatic parotid mass found on routine examination . Computed tomography scan showed a hyper - attenuating 0.8 0.7 cm lesion in the superficial lobe of the right parotid gland, which was confirmed on magnetic resonance imaging . The patient underwent fna at an outside institution and a diagnosis of consistent with pleomorphic adenoma (pa) was rendered . The fna slides were reviewed at our institution for surgical management (notably the diff quick preparation from the outside institution was of poor quality). The fna specimen showed a monomorphic population of lesional cells arranged in papillary groups with transgressing vessels [figure 1]. The lesional cells demonstrated round nuclei, prominent nucleoli and foamy cytoplasm [figure 2]. Salivary gland neoplasm, low grade with differential diagnosis of acinic cell carcinoma (acicc) and low grade mucoepidermoid carcinoma (mec). Fine - needle aspiration cytology smear demonstrating a monomorphic population of cells with eosinophilic cytoplasm arranged in papillary groups (papanicolaou, 40) fine - needle aspiration cytology smear demonstrating lesional cells with round nuclei, prominent nucleoli and foamy cytoplasm (papanicolaou, 60, inset, 100) the patient subsequently underwent resection and the mass was received for histological evaluation . The lesion appeared as a well circumscribed gray - tan nodule within the superficial parotid gland, measuring 0.8 cm in greatest dimension . The histological examination displayed a circumscribed, unencapsulated lobulated mass with microcystic and tubular structures [figure 3]. The tumor cells had pale eosinophilic granular cytoplasm and low grade nuclei with distinct nucleoli [figure 4]. Focal invasion of the surrounding parotid gland was noted; however no perineural invasion or lymphovascular invasion was identified . A mucicarmine stain was negative, while periodic acid schiff with and without diastase failed to demonstrate intracytoplasmic glycogen, and highlighted secretory material in microcystic spaces . As masc was suspected, this material was tested for etv6 rearrangement by fluorescence in situ hybridization (fish), which demonstrated an atypical etv6 rearrangement in 167/200 cells (83%), confirming the diagnosis . Histologically, the tumor is a circumscribed, unencapsulated lobulated mass with microcystic and tubular structures (h and e, 2.5) histologically, the microcystic structures contain bubbly, eosinophilic secretions; the tumor cells have pale eosinophilic granular cytoplasm and low grade nuclei with distinct nucleoli (h and e, 40) mammary analogue secretory carcinoma, first described in 2010, is a newly recognized neoplasm of the salivary gland . As its name implies, it shares morphologic and cytogenetic characteristics with its counterpart in the breast . Occurring most commonly in the parotid, masc is a low grade neoplasm often confused with acicc, particularly the granular poor variant . Unlike acicc, masc is strongly positive for s100 and mammoglobin and negative for dog-1 . Masc also differs from acicc in its clinical presentation, occurring more commonly in males, frequently associated with lymph node metastases, and is thought to be more common in extra - parotid sites . This tumor harbors a unique translocation, t(12;15) (p13;q25) that results in the fusion of etv6 with ntrk3, which produces a transformative chimeric tyrosine kinase . Although present in several pathologic processes, if identified, this translocation is thought to be diagnostic of masc in the appropriate pathologic setting . Cytologically, masc is often confused with other oncocytic salivary gland tumors, including primarily acicc and mec, but also can rarely be misclassified as salivary duct carcinoma (sdc) and pa . Similar to the cases in the current literature, our case demonstrated a monomorphic population of lesional cells forming papillary groups with transgressing vessels . The individual cells demonstrated round nuclei with prominent nucleoli and abundant, eosinophilic foamy cytoplasm . Overall, the appearance was that of a low grade tumor, as pleomorphism and mitotic figures were not noted . While masc and acicc can have similar architectural patterns, masc may show evidence of mucin production, a feature not seen in acicc . Furthermore, according to some authors, masc is more likely to demonstrate greater variation in the size of cytoplasmic vacuoles . When compared to mec, particularly the oncocytic variant, masc can share features of mucin production and eosinophilia . However, architectural patterns such as papillae with transgressing vessels are more characteristic of masc and cells tend to have multivacuolation, as opposed to the univacuolation reported in cases of mec . Sdc often will exhibit nuclear pleomorphism and tumor diathesis, revealing its high grade nature and distinguishing it from masc . In those rare cases that appear less clearly malignant, sdc will still often demonstrate greater size variation and decapitation secretions (cell block). Although on the other end of the neoplastic spectrum of sdc, pa can also rarely be confused with masc (as occurred originally in the present case). The mucin production in masc may be so abundant as to be confused with the myxoid stroma of pa . However, in most cases it should be clearly distinguishable from the metachromatic material seen in pa . The key, and often present, features include the papillary architecture and distinct granular cytoplasm seen in cases of masc . Though, based on cytomorphology alone, the definite diagnosis can be challenging, in conjunction with available clinical clues (i.e., male patient, extra - parotid site) masc should be included in the differential diagnosis of fna specimens diagnosed as oncocytic salivary gland neoplasms or suspicious for acicc . This creates an opportunity for ancillary studies such as immunohistochemistry and/or fish analysis on cell block material, which may lead to the appropriate classification of the lesion prior to surgical resection . All authors of this article declare that we qualify for authorship as defined by icmje http://www.icmje.org/#author . Each author has participated sufficiently in the work and take public responsibility for appropriate portions of the content of this article . Tds, val and zb were each directly involved in the diagnosis of this case . As this is case report without identifiers, our institution does not require approval from institutional review board (irb) (or its equivalent). To ensure the integrity and highest quality of cytojournal publications, the review process of this manuscript was conducted under a double - blind model. (authors are blinded for reviewers and vice versa) through automatic online system.
|
High - resolution real - time observation of cells and cellular processes in their liquid environments is crucial for revealing cellular structures and functions . Electron microscopes (ems) can easily achieve a nanometer level resolution; therefore, ems are efficient tools for observing cellular structures . However, traditional sampling procedures limit the application of ems for real - time observation of liquid samples . Because of the high - vacuum operating conditions, extensive sample preparations (e.g., fixation, metal staining, plastic embedding and slicing, or freezing) are needed for biological tem samples . An in - depth understanding of cellular structures and intracellular processes requires real - time imaging of the entire biological object with high spatial resolutions in the native liquid environment . To allow real - time and fast observations of dynamic processes occurring in biological objects, environmental tem uses a differential pump technology and therefore allows cellular studies under partially hydrated conditions; however, this process is not conducted in pristine liquid environments [5, 6]. In situ liquid chamber tem has been developed recently for nanostructural systems; this enables the user to image and monitor biological samples in fully hydrated environments, thus providing real - time dynamic information . In this method, two ultrathin electron - transparent window chips are used to construct a liquid cell chamber; the liquid sample is sealed between these chips . The in situ liquid cells can be used in standard tem instruments . A variety of samples and processes of nanomaterials have been studied with this technique, including nanomaterial reactions and motion, nanocrystal depositions [11, 12], and self - assembly of nanolipoprotein discs . Biological cells have also been imaged in liquid with nanometer resolution, such as human leukocytes, cos7 fibroblast cells, yeast cells, k. pneumoniae cg43s3 cells, and the bacteria deinococcus radiodurans (d. radiodurans). E. coli has been reported to survive this tem imaging process at 2.8 s under a 200 kev electron beam . Imaged e. coli labeled with gold nanoparticles in liquid with scanning transmission electron microscopy (stem). However, they only showed the overall morphology and viability of e. coli cells with limited resolution . The stability of the cells under the electron beam, the resolution, and the dynamic observation are key issues that need to be further addressed . This study focuses on the fine structural analysis and dynamic observation of e. coli cells using in situ liquid chamber tem . The integrity, stability, and viability of the cells under electron beams, which have not been examined in previous studies, are also examined . Escherichia coli bl21(de3) was grown in luria - bertani (lb) broths at 37c for 12 h and then stored at 4c before being used . The liquid chamber used for the in situ tem was developed following a previously described procedure [911, 18]. In brief, silicon chips with 50 nm thick si3n4 membranes (ted pella, inc ., ca, usa) were used as the electron transparent windows for the liquid chamber . Tokyo, japan) was used for the in situ tem and was operated under a 200 kv acceleration voltage . The beam intensity measured on the phosphorous screen the e. coli cells used for fluorescence microscopy were suspended in 0.85% nacl after growth medium was removed . The sample live / dead baclight bacterial viability kit was from life technologies (eugene, oregon, usa). The liquid chamber was imaged directly by fluorescence microscopy (olympus ix51 inverted microscope, tokyo, japan) with exposure time: 67.08 ms . To investigate the cellular fine structures of bacterial cells under aqueous conditions, in situ tem was performed on an e. coli sample in the liquid chamber . Most of the cells appeared to be structurally robust against electron beam irradiation and preserved nanostructures during the tem imaging . The e. coli cells in the in situ bright field tem images (figure 1(a)) were oval - rod shaped . The results are comparable to previous in situ liquid chamber tem studies [7, 18]. Furthermore, as seen in figures 1(b)1(d), our e. coli images show more details than other reports in the literature, with several cellular structures detected outside of the oval - rod shaped bacterial cells and a few cells showing dim dark nucleoid centers, which are indicated by the two green arrows in figure 1(b). The fine structures outside of the e. coli cells in the in situ tem images may be attributable to pili, which are displayed as gray halos around some of the bacterial cells (figure 1(c)). Almost half of the e. coli cells showed pili, but the other cells had no apparent pili structures (figure 1(d)). Whether the pili were observed it is possible that the resolution of in situ tem might not be high enough to detect additional intracellular details of the e. coli cells, such as a clear nucleoid . However, images have been reported with better than 1 nm and even atomic resolutions using in situ liquid chamber tem, which indicates that getting enough resolution should not be an obstacle for the technology . In our in situ tem images of e. coli cells, pili were observed clearly, which are known to have diameters less than 10 nm . Resolutions better than 10 nm have been obtained as measured from the tem images, which is more than enough to image a clear nucleoid if it exists . Thus, the lack of details for e. coli is not due to the resolution limit of in situ tem but may be because of the stage of the cells during the observation . The absence of low contrast in the dark centers may suggest that the nucleoids in the e. coli cells under the fully hydrated environment were not as condensed as those cells that were dried or processed to be used in other imaging techniques . With nanometer resolutions and the capability of observing cells in their fully hydrated living environments, in situ tem is a more powerful tool than conventional ems . However, the length of time that a cell can withstand the electron beam irradiation without being subjected to structural damage or cell death is also of concern . Currently, studies have only successfully irradiated cells for several seconds using in situ tem, which has largely limited its applications to in situ monitoring of dynamic changes in the cells . In this study, e. coli cells demonstrated good structural stability . The cells were observed under the electron beam for extended time, and the majority of the cells did not show beam - induced structural damage . The cell viability was examined by using live / dead baclight bacterial viability kit, and the observations are shown in figure 2 . The cells exposed under tem high energy electron beam (figure 2(a)) still emitted green fluorescence (which indicated alive cells) (figure 2(b)), instead of red fluorescence (which indicated dead cells). Figures 2(c) and 2(d) show magnified versions of the images . The red arrows in figure 2(c) pointed to two cells which emitted obvious green fluorescence as shown in figure 2(d). The other cells also emitted green fluorescence but could not be observed clearly, possibly due to a variation of imaging depth . In addition to the overall stability and integrity under the in situ tem condition, several e. coli cells ruptured . In figure 3(a), a few cells in the right area of the picture that are circled by red dotted lines were found to be lighter, suggesting that they were broken cells . To the right of the figure, we detected several such broken cells forming a vertical line . In the magnified image in figure 3(b), one cell was broken from the top end . Compared to the intact cells, the ruptured cell showed a size extension at the broken site, which might partially be because of the unfolding of the cell membrane and the extruding pressure from the cytoplasm . The nonruptured end appeared to be smaller, possibly related to the loss of cytoplasm and pressure inside the cell . In figure 3(c), in addition to the partially broken cell in the upper part, a completely broken cell is displayed in the lower part of the image . This cell showed a dim cell membrane with a larger diameter than a complete cell, and the cellular region within the membrane boundary has a lighter shade than an unbroken cell . In figure 3(d), in addition to the cell to the right that was broken at one end, one e. coli cell to the left was broken from the middle, forming a pore . Figure 3(e) shows a lytic broken cell forming membrane fragments, and as a result the outline of the oval shape of the cell was not clear . Several studies have shown that e. coli cells become lytic when the cell membrane is damaged, releasing intracellular components . Additionally, the osmotic pressure across the membrane might also induce membrane rupture and cause more dramatic damage to a bacterial cell . The initiation of this rupture was not clear and may not necessarily be caused by the imaging because these cells might have already broken before being examined . Although rare, a dynamic process of cell damage has also been observed using in situ tem . Within a minute, an oval - shaped e. coli was quickly damaged . The outer ring of the oval - shaped e. coli cell became deeper gray, getting darker and wider with time . The image of the e. coli cell became brighter with time (figures 4(a)4(d)). In the final image (figure 4(f)), the contour of the e. coli was rod - like, smaller in size, and the brightness matched the background of the picture . In figures 4(a)4(e), approximately eight growing dark spots were also observed . One reason for such coincidental damage might be the effect of radiation from beam - sample interactions . When high energy electrons pass through an aqueous solution, the liquid system produces radicals and hydrated electrons, such as oh radicals [22, 23]. These radicals and hydrated electrons could damage the biomolecules of the cells . To analyze the effect of radicals on e. coli cells, 10 mg / ml glucose was added to the medium as radical scavengers . In the liquid chamber containing glucose this chamber showed lower red fluorescence than the liquid chamber without glucose (shown in figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2015/829302). This indicated less dead cells in liquid chamber with glucose . In the higher resolution images, figures 5(a) and 5(b) show video frames taken from the labeled region in figure 1(a). Partially because of the higher magnification these pili observed in the current work resemble those previously reported using conventional imaging techniques [24, 25]. Although the samples were in an isolated chamber, the liquid flow can still occasionally be observed in the sample . The liquid flow behavior was captured in the video . In figure 5(c) (lower right part of the image), we detected a thicker liquid layer flowing into the cell, which got darkened and blurred . Figure 5(d) shows an image taken after the thick liquid covered the full imaging region, which produced an almost featureless picture because of the electron diffraction through the thick sample . Figures 5(e)5(h) show magnified video frames taken from the labeled region in figure 5(a); the arrow points to a pilus that changed shape with time . For the video of figure 5 only, the imaging time was longer than 60 s, much longer than reported exposure time in the literature, and we did not see any structural damage to the cell . This makes a significant progress in dynamic observation of biosample using in situ liquid chamber tem . Generally, people believe there are big bubbles in the in situ liquid chamber [26, 27], filling the majority of the space, leaving possibly only an ultrathin layer of liquid on the two windows, which was indicated in figure 6 . Thus the cells are not necessarily surrounded by liquid only but are surrounded by liquid plus vapor, which explains the good image resolution . Even when surrounded by vapor only, the surrounding vapor pressure is much larger than in an environmental tem; thus the cells are more hydrated . Thus, it is easily understood that the liquid layer thickness can change with time due to liquid flow, resulting in the image resolution change, supporting the observation in figures 5(a)5(d). In addition to the motion of the pili and the liquid - cell interactions observed, tem allows the study of various events, such as flagellar motions, nanoparticle - cell interactions, and even cell divisions . Therefore, this tool could be beneficial in numerous important studies investigating cell structures and processes . In conclusion, in situ liquid chamber tem was used to image e. coli cells in liquid environments . The in situ tem results clearly displayed contours and fine cellular structures (such as pili) of the e. coli cells . Notably, the nucleoids in the e. coli cells in the fully hydrated environment appeared to be in noncondensed forms . Additionally, during our in situ tem experiments, most of the e. coli cells were robust under the electron beam, without showing structural damage over time . The liquid chamber tem allowed several fine structure and motion observations that were impossible with traditional tem or sem analyses . Liquid chamber tem is capable of in situ monitoring of significant biological processes, including cell rupture and cellular structural movement . Additionally, the motion of the pili was recorded for the first time using the liquid chamber tem technology . Overall, the in situ liquid chamber tem is a facile and efficient tool for e. coli analysis . This method provides reliable studies of the cellular structures and behaviors in their native growing environments.
|
Thrombotic thrombocytopenic purpura (ttp) is a rare and acute syndrome which involves multiple organ systems . In spite of the consistent findings of cardiac involvement in the autopsy studies, clinical evidence for cardiac involvement is surprisingly limited . We report a patient with seemingly remitted ttp, who presented with recurrent episodes of myocardial infarction (mi) and refractory coronary artery thrombosis . A 43-year - old man with recent anterior wall st - segment elevation mi (stemi), which had been previously treated with streptokinase, referred to our hospital . His past medical history included smoking and a history of ttp, which was in clinical remission after splenectomy 8 years previously . His physical examination was unremarkable, and there was no clinical or laboratory evidence of ttp . The patient had a platelet count of 367,000 in ml, hemoglobin concentration of 14 g / dl, and serum lactate dehydrogenase (ldh) of 287 iu / ml . In addition, there was an acceptable number of fragmented red cells on the peripheral blood smear . Echocardiography revealed left ventricular ejection fraction (lvef) of 35%, and selective coronary angiography showed a fully recanalized left anterior descending artery (lad) with an insignificant ostial lesion . Because the patient was asymptomatic, he was discharged on anti - ischemic medications - including aspirin (80 mg / d), plavix (75 mg / d), atorvastatin (40 mg / d), metoprolol, and captopril . Three weeks later, the patient presented again with prolonged resting chest pain, st elevation in the precordial leads, and new right bundle branch block on the electrocardiogram . Emergent coronary angiography was done, which showed a thrombotically occluded lad in the ostial portion, accompanied by a large clot in the non - dominant right coronary artery (rca) (figure 1). As a result, primary angioplasty was performed using manual thrombectomy, followed by bare - metal stenting (liberte 3.516), with resultant thrombolysis in myocardial infarction (timi) flow of 2 (figure 2). On account of the small caliber, we opted for non - intervention vis - - vis the rca and mere reliance on glycoprotein iib / iiia inhibitor therapy . The patient spent an uncomplicated hospital course and was discharged 7 days later with lvef of 20% . Of note, plavix (75 mg / d) was continued and the doses of aspirin and atorvastatin were raised to 325 mg / d and 80 mg / d, respectively . Right anterior oblique - caudal coronary angiographic view, indicating thrombotic occlusion of the ostial left anterior descending coronary artery final right anterior oblique - caudal coronary angiogram after primary angioplasty of the left anterior descending coronary artery the patient frequently reported chest pain during the next 3 months, which finally led to re - admission with the diagnosis of non - stemi . Apart from slow - flow coronary arteries, the previous lad stent was patent; however, there was a small globular intraluminal filling defect (possibly thrombosis) at the distal aspect of the stent, alongside the segmental thrombosis of the rca (figure 3). In light of these findings for the past two years since, he has been followed up on medication and has experienced no events . Large thrombosis in the right coronary artery evident in the left anterior oblique view of coronary angiogram this case demonstrates recurrent acute coronary events in a young male with a history of prior manifestations of acute ttp . Ttp is deemed one of the rare causes of non - atherosclerotic mi or a differential diagnosis in some cardiac - involving diseases such as infective endocarditis, systemic lupus erythematosus, and antiphospholipid antibody syndrome . Autopsy studies have shown that the heart is among the most frequently involved organs in patients with ttp, whether before or after the advent of modern therapies . Be that as it may, cardiac symptoms are rarely reported in the literature . In addition it seems that cardiac symptoms are predominantly manifested in the acute phase and are most commonly manifested as mi, congestive heart failure, and arrhythmias . Conducted a systematic review on thirty articles which reported a total of 111 ttp patients: cardiac symptoms were reported in 24 patients in thirteen articles;13 patients in eleven articles had symptoms described as chest or substernal pain; 10 patients in two articles had symptoms consistent with congestive heart failure; one patient had syncope attributed to a cardiac origin; mi was reported in 26 patients (including stemi in 7 patients and non - stemi in one patient;the type of mi was not described in the remaining 18 patients); congestive heart failure was reported in 17 patients; and arrhythmias were reported in 10 patients . Mi could be an early and severe complication of ttp, especially in those who have significantly elevated ldh and cardiac troponin i levels . Previous studies have concluded that the myocardial damage is most probably due to hemorrhagic necrosis from hyalinized arteriolar microthrombi rather than large - vessel coronary thrombosis, although stemi has also been reported . There is paucity of data regarding suitable therapeutic options because of the limited number of involved patients and the absence of uniform recommendations . It seems that the current recommendations on non - ttp patients might be attributable to ttp cases . The case presented herein poses the question whether ttp could play a role in the acceleration of coronary artery disease or recurrent thrombotic coronary events of large epicardial vessels even years after the acute phase . As ttp is quite rare, studies in this regard are very limited, and a broad follow - up of patients afflicted with this syndrome is required.
|
The importance of community - based health education in undergraduate curricula has been validated in medical education and practice. (12) the current shift of emphasis from curative to preventive medicine makes community - based medical education of utmost importance . Even though only a small proportion of medical graduates will eventually choose public health as their specialty, a thorough knowledge - base established through robust undergraduate training programmes in community medicine is essential for all practicing doctors . Despite this, the importance and significance of public health are often not fully appreciated,(13) with more emphasis being placed on hospital - based and curative medicine . While medical curricula must be effective and relevant as they are of fundamental importance in the training of doctors,(4) how effective or relevant they are may be a matter of perception. (5) poor implementation of curricula is known to result in unfavorable student perceptions. (6) furthermore, positive perceptions are known to increase student motivation and, therefore, learning . Brooks, a constructivist, suggests that student opinion should be sought and valued. (7) thus, frequent assessments of student perceptions are recommended and many agree that they are useful in the structuring of the curriculum,(89) making them more acceptable and beneficial . Since the integration of public health into the medical curriculum of the faculty of medicine, university of colombo, sri lanka, the community sciences stream has maintained a dynamic approach toward its teaching . The public health curriculum of the faculty of medicine, colombo, spans the five years of undergraduate training and is delivered as subject modules . The introductory sessions, dealing with the concept of health promotion, are conducted by weekly lectures, small group discussions, and student presentations . Apart from conventional lectures and small group discussions, during the third and fourth years, the stream provides students with opportunities for experiential learning . This is by way of a community - based programme, the purpose of which is to enable students to describe and assess health needs at community, family, and individual levels, become familiar with resources for health promotion, and to plan, implement, and evaluate sustainable interventions to improve health . Groups of students are allocated to specified communities (known as the community attachment programme) and families (known as the family attachment programme) for a period of 1218 months thus acquiring the competence to intervene and provide first - contact health care and promote health at various levels. (1011) this includes a research project, carried out in groups of three, during which students learn to develop a research idea, design a research protocol and data collection instrument, understand the ethical implications of research, conduct and analyze the results of the study, and finally, draft a research report and paper . The final - year teaching programme concentrates on community perspectives of medical care and is conducted by way of a string of lectures and interactive case discussions on health in hospitals, relaying of health - related information, social responsibilities of doctors, and how aspects of the community impact the outcome of clinical management . The aim of our study was to assess student perceptions of the public health curriculum and to identify factors which influence these . Data were gathered at the faculty of medicine, university of colombo, sri lanka, in 2010 . Out of 196 students, 184 students, i.e., 94% agreed to participate in the study following completion of the five year curriculum in public health . Recruitment was carried out amongst final - year students following a compulsory student activity so as to maximize participation; however, student participation was completely voluntary . Convenience sampling method was utilized and those not present on the day of assessment were excluded from the study . The questionnaire was prepared following focused group discussions among graduates of the same institution, who had also completed the public health course as part of their curricula . The questionnaire, in addition to gathering demographic data, asked students to evaluate the public health curriculum as a whole and to state their perceptions on specified components of the stream, such as the introductory programme, community - based learning, research project, and the final - year module on community perspectives of medical care through 90 separate questions . A 4-point likert scale was used to score and collect information and students were offered the options definitely, somewhat, not really, and no . When not considered individually for purposes of analysis, the responses definitely and somewhat were grouped together as a positive response and not really and no as a negative response . Data analysis was carried out utilizing statistical package for the social sciences 18 analytical software package . The study received ethical approval from the ethics review committee of the faculty of medicine, university of colombo . Data were gathered at the faculty of medicine, university of colombo, sri lanka, in 2010 . All medical students in their final year were invited to participate in the study . Out of 196 students, 184 students, i.e., 94% agreed to participate in the study following completion of the five year curriculum in public health . Recruitment was carried out amongst final - year students following a compulsory student activity so as to maximize participation; however, student participation was completely voluntary . Convenience sampling method was utilized and those not present on the day of assessment were excluded from the study . The questionnaire was prepared following focused group discussions among graduates of the same institution, who had also completed the public health course as part of their curricula . The questionnaire, in addition to gathering demographic data, asked students to evaluate the public health curriculum as a whole and to state their perceptions on specified components of the stream, such as the introductory programme, community - based learning, research project, and the final - year module on community perspectives of medical care through 90 separate questions . A 4-point likert scale was used to score and collect information and students were offered the options definitely, somewhat, not really, and no . When not considered individually for purposes of analysis, the responses definitely and somewhat were grouped together as a positive response and not really and no as a negative response . Data analysis was carried out utilizing statistical package for the social sciences 18 analytical software package . The study received ethical approval from the ethics review committee of the faculty of medicine, university of colombo . Hundred and eighty - four students (n = 184) who had completed their medical undergraduate course agreed to complete the questionnaire . Of those, 48% were males and 52% were females, which is comparable to the gender distribution in our faculty . Forty - eight percent (n = 84 out of 174) were residents of colombo, a district which is the urban hub of the country, while the majority (69.3%, n = 122 out of 176) had received their secondary education there as well . Forty - nine percent (n = 89 out of 144) had scored more than 60%, which is considered a class grading, at the most recent public health exam . By the end of the course, 81.8% (n = 148 out of 181) agreed to the question eighty - five percent (n = 155 out of 182) accepted what i learnt will benefit me in the future and the majority (67.5%, n = 112 out of 166) was satisfied that the programme has prepared me well to work in the community . Sixty - four percent (n = 116 out of 180) accepted they had a good perception regarding public health prior to starting the course . Significant associations between viewing public health as an important field in medicine were found with having had a good opinion about public health prior to starting the course, perceiving the community attachment programme as enjoyable, perceiving the module on community perspectives of medicine as enjoyable, and perceiving themselves prepared and competent to work in the community at the end of the course (p <0.01). Only 9% (n = 16 out of 179) definitely agreed with the statement i am interested in taking up a career in public health, while 43% (n = 76 out of 179) were definite that they were not . There was a significant association between students considering a future career in public health care and having had a good opinion about public health prior to starting, believing public health to be an important field, perceiving the community attachment programme as enjoyable and beneficial to the community, enjoying the module on community perspectives of medicine, and perceiving themselves prepared and competent to work in the community (p <0.01). Gender, grading obtained at the last public health examination, district of residence and district of school (both classified as belonging to colombo, the urban hub of the country or the other districts) did not appear to influence their choice (p <0.05) [table 1]. Factors determining (a) the perception of public health as an important field and (b) the interest in choosing a career in public health as described above, this portion of the curriculum is conducted in three parts a community attachment programme, a family attachment programme, and a research project . During the community attachment programme, groups of 1520 students are allocated to specified areas of a community to engage in public - health - related activities . Sixty - six percent (n = 120 out of 182) of students agreed to the question 65.2% (n = 120) accepted i learnt a lot about public health . Sixty - four percent (n = 117 out of 183) believed the community benefitted from our interventions, while 70.6% (n = 117 out of 180) accepted that it was personally beneficial as they agreed to the statement i feel what i learnt through this programme will be of use to me in the future . Forty - five percent (and 34.6% (n = 62 out of 179) agreed definitely to the statement the community cooperated with our efforts . Multiple site visitations are essential for the community - based programme throughout the allocated time period . Only 25% (n = 46) of the students perceived the community was definitely located at a convenient location, while 47.3% (n = 87) disagreed with the statement i had no difficulty in travelling to the community . Of the sample questioned 54.1% (n = 99 out of 183) agreed that time had been utilized efficiently throughout the attachment and 19.7% (n = 36 out of 183) were definite regarding that view . However, 56.4% (n = 102 out of 181) disagreed with the statement statistically significant associations were found between feeling satisfied about the amount they had learnt through the programme and students who had had a good opinion of public health prior to commencement of the course, those who had found the community attachment programme to be personally beneficial, those who felt that time had been utilized effectively, those who found their allocated communities cooperative and had enjoyed the attachment, and those who perceived the community benefitted (p <0.05, p <0.01) [table 2]. Factors determining satisfaction with regards to the amount learnt about public health through the community attachment programme further, enjoyment of the community attachment programme was significantly related to the convenience of the location and ease of travel to the chosen community, its residents cooperation, students perceiving the experience as personally beneficial and students believing that time had been utilized effectively (p <0.01) [table 3]. Factors which determine students enjoying the community attachment programme when considering the family attachment programme, during which pairs of students are allocated to provide community - based care to specified families, most students (66.5%, n = 121 out of 182) agreed that it was personally beneficial as they accepted the statement i feel what i learnt through this programme will be of use to me in the future . Fifty percent (n = 90 out of 181) agreed we were able to identify significant health issues in their allocated families and 54.1% (n = 98 out of 181) accepted the family was truly appreciative of our efforts . The majority (61.7%, n = 113 out of 183) firmly believed the family was welcoming and 53.3% (n = 97 out of 182) definitely felt the family was cooperative with the interventions . Most (45.6%, n = 83 out of 182) agreed sixty - four percent (n = 117 out of 182) were of the opinion that time was spent effectively throughout the programme . The research project encourages students to develop and conduct a health - related study under guidance . Seventy - four percent (n = 133 out of 181) disagreed to the statement i had been involved in research prior to the community research project . By the end of the course, 50% (n = 91 out of 182) agreed eighty - seven percent (n = 159 out of 183) accepted i am competent in applying for ethical clearance . The programme also gave the students an opportunity to learn how to use data analytical packages (e.g., spss) and 73.6% (n = 134 out of 182) felt majority definitely agreed to the statements i personally benefitted from this programme and i am interested in doing future research (60.1%, n = 110 out of 183 and 54.6%, n = 100 out of 183, respectively). However, only 36.4% (n = 67 out of 183) accepted i was able to publish or present our findings . Having a sound foundation in knowledge in carrying out research (methodology, utilizing data analysis software, and ethical considerations), feeling time was used effectively during the project, finding research to have been personally beneficial and having an opportunity to publish or present findings, all showed significant association with enthusiasm for future interest and involvement in research (p <0.01) [table 4]. Factors shown to generate interest in future research among students following the community medicine research programme in the introductory sessions, a majority of 61.4% (n = 113) accepted the topics were interesting and 85.8% (n = 157 out of 183) considered the topics were useful . However, most (58.7%, n = 108) disagreed with the statement the lectures were interesting . The majority accepted i enjoyed working in a group and i enjoyed the discussions (83.2% n = 153, 67.9% n = 125, respectively) and most (67.9%, n = 125) agreed with the opinion small group discussions were an effective method of learning . However, only 7.1% (n = 13 out of 183) definitely felt that time had been used effectively . Of those questioned, 79.3% (n = 145 out of 183) and 77.5% (n = 141 out of 182) respectively disagreed with the statements i was stimulated to read more and i regularly revised what i learnt . The final year of the curriculum, based on community perspectives of medicine, is delivered via a series of lectures and interactive case discussions . Sixty percent (n = 110 out of 182) felt the lectures were interesting, most (77.6%, n = 143 out of 183) were of the view the topics were useful and 54.1% (n = 99 out of 183) accepted the statement i enjoyed the lectures . Forty - five percent (n = 81 out of 182) definitely agreed with the statement what i learnt will be beneficial to me in the future . However, 25.3% (n = 46 out of 182) definitely disagreed with the statement the lectures did not interfere with ward - learning and only 25% (n = 45 out of 180) definitely agreed that we were able to concentrate on what was taught . Only 16.4% (n = 30 out of 183) definitely perceived time was utilized effectively in the final year, while the majority (57.3%, n = 105 out of 183) agreed otherwise . The majority (84.5%, n = 153 out of 181) accepted i attended lectures because attendance was recorded . I was stimulated to read more and i regularly revised what i learnt (38.3%, n = 69 out of 180 and 42.8%, n = 77 out of 180, respectively). By the end of the course, 81.8% (n = 148 out of 181) agreed to the question eighty - five percent (n = 155 out of 182) accepted what i learnt will benefit me in the future and the majority (67.5%, n = 112 out of 166) was satisfied that the programme has prepared me well to work in the community . Sixty - four percent (n = 116 out of 180) accepted they had a good perception regarding public health prior to starting the course . Significant associations between viewing public health as an important field in medicine were found with having had a good opinion about public health prior to starting the course, perceiving the community attachment programme as enjoyable, perceiving the module on community perspectives of medicine as enjoyable, and perceiving themselves prepared and competent to work in the community at the end of the course (p <0.01). Only 9% (n = 16 out of 179) definitely agreed with the statement i am interested in taking up a career in public health, while 43% (n = 76 out of 179) were definite that they were not . There was a significant association between students considering a future career in public health care and having had a good opinion about public health prior to starting, believing public health to be an important field, perceiving the community attachment programme as enjoyable and beneficial to the community, enjoying the module on community perspectives of medicine, and perceiving themselves prepared and competent to work in the community (p <0.01). Gender, grading obtained at the last public health examination, district of residence and district of school (both classified as belonging to colombo, the urban hub of the country or the other districts) did not appear to influence their choice (p <0.05) [table 1]. Factors determining (a) the perception of public health as an important field and (b) the interest in choosing a career in public health as described above, this portion of the curriculum is conducted in three parts a community attachment programme, a family attachment programme, and a research project . During the community attachment programme, groups of 1520 students are allocated to specified areas of a community to engage in public - health - related activities . Sixty - six percent (n = 120 out of 182) of students agreed to the question 65.2% (n = 120) accepted i learnt a lot about public health . Sixty - four percent (n = 117 out of 183) believed the community benefitted from our interventions, while 70.6% (n = 117 out of 180) accepted that it was personally beneficial as they agreed to the statement i feel what i learnt through this programme will be of use to me in the future . Forty - five percent (n = 83) definitely felt the community was welcoming and 34.6% (n = 62 out of 179) agreed definitely to the statement the community cooperated with our efforts . Multiple site visitations are essential for the community - based programme throughout the allocated time period . Only 25% (n = 46) of the students perceived the community was definitely located at a convenient location, while 47.3% (n = 87) disagreed with the statement i had no difficulty in travelling to the community . Of the sample questioned 54.1% (n = 99 out of 183) agreed that time had been utilized efficiently throughout the attachment and 19.7% (n = 36 out of 183) were definite regarding that view . However, 56.4% (n = 102 out of 181) disagreed with the statement i am interested in working in the field in the future . Statistically significant associations were found between feeling satisfied about the amount they had learnt through the programme and students who had had a good opinion of public health prior to commencement of the course, those who had found the community attachment programme to be personally beneficial, those who felt that time had been utilized effectively, those who found their allocated communities cooperative and had enjoyed the attachment, and those who perceived the community benefitted (p <0.05, p <0.01) [table 2]. Factors determining satisfaction with regards to the amount learnt about public health through the community attachment programme further, enjoyment of the community attachment programme was significantly related to the convenience of the location and ease of travel to the chosen community, its residents cooperation, students perceiving the experience as personally beneficial and students believing that time had been utilized effectively (p <0.01) [table 3]. Factors which determine students enjoying the community attachment programme when considering the family attachment programme, during which pairs of students are allocated to provide community - based care to specified families, most students (66.5%, n = 121 out of 182) agreed that it was personally beneficial as they accepted the statement i feel what i learnt through this programme will be of use to me in the future . Fifty percent (n = 90 out of 181) agreed we were able to identify significant health issues in their allocated families and 54.1% (n = 98 out of 181) accepted the family was truly appreciative of our efforts . The majority (61.7%, n = 113 out of 183) firmly believed the family was welcoming and 53.3% (n = 97 out of 182) definitely felt the family was cooperative with the interventions . Most (45.6%, n = 83 out of 182) agreed sixty - four percent (n = 117 out of 182) were of the opinion that time was spent effectively throughout the programme . The research project encourages students to develop and conduct a health - related study under guidance . Seventy - four percent (n = 133 out of 181) disagreed to the statement i had been involved in research prior to the community research project . By the end of the course, 50% (n = 91 out of 182) agreed eighty - seven percent (n = 159 out of 183) accepted i am competent in applying for ethical clearance . The programme also gave the students an opportunity to learn how to use data analytical packages (e.g., spss) and 73.6% (n = 134 out of 182) felt majority definitely agreed to the statements i personally benefitted from this programme and i am interested in doing future research (60.1%, n = 110 out of 183 and 54.6%, n = 100 out of 183, respectively). However, only 36.4% (n = 67 out of 183) accepted i was able to publish or present our findings . Having a sound foundation in knowledge in carrying out research (methodology, utilizing data analysis software, and ethical considerations), feeling time was used effectively during the project, finding research to have been personally beneficial and having an opportunity to publish or present findings, all showed significant association with enthusiasm for future interest and involvement in research (p <0.01) [table 4]. Factors shown to generate interest in future research among students following the community medicine research programme in the introductory sessions, a majority of 61.4% (n = 113) accepted the topics were interesting and 85.8% (n = 157 out of 183) considered the topics were useful . However, most (58.7%, n = 108) disagreed with the statement the lectures were interesting . The majority accepted (83.2% n = 153, 67.9% n = 125, respectively) and most (67.9%, n = 125) agreed with the opinion small group discussions were an effective method of learning . Eighty - one percent (n = 142 out of 175) agreed with however, only 7.1% (n = 13 out of 183) definitely felt that time had been used effectively . Of those questioned, 79.3% (n = 145 out of 183) and 77.5% (n = 141 out of 182) respectively disagreed with the statements i was stimulated to read more and i regularly revised what i learnt . The final year of the curriculum, based on community perspectives of medicine, is delivered via a series of lectures and interactive case discussions . Sixty percent (n = 110 out of 182) felt the lectures were interesting, most (77.6%, n = 143 out of 183) were of the view and 54.1% (n = 99 out of 183) accepted the statement i enjoyed the lectures . Forty - five percent (n = 81 out of 182) definitely agreed with the statement what i learnt will be beneficial to me in the future . However, 25.3% (n = 46 out of 182) definitely disagreed with the statement the lectures did not interfere with ward - learning and only 25% (n = 45 out of 180) definitely agreed that we were able to concentrate on what was taught . Only 16.4% (n = 30 out of 183) definitely perceived time was utilized effectively in the final year, while the majority (57.3%, n = 105 out of 183) agreed otherwise . The majority (84.5%, n = 153 out of 181) accepted i attended lectures because attendance was recorded . I was stimulated to read more and i regularly revised what i learnt (38.3%, n = 69 out of 180 and 42.8%, n = 77 out of 180, respectively). As described above, well - implemented curricula are received positively by students and are more likely to facilitate learning . The method that we used to assess student satisfaction with the curriculum was measurement of student perceptions . It may be argued that students perceptions of various aspects of the course are interdependent, and therefore, cannot be considered in isolation or that students who view a certain area of the curriculum positively are more likely to view others in a similar manner due to characteristics of their personality . While this may be true, it does not detract from the evidence that perceptions influence learning, whatever their basis may be . It is clear that perceptions alone may be inadequate in aiding assessment as they are subjective and liable to be affected by various situations and variables . However, when combined with an additional objective measure it holds great value. (12) the results of our study acknowledge the importance that students place in the field of public health as most students believe it will be of value in later practice . Although public health was not a popular choice of career, this is likely to have had many other contributory factors, and it is thus difficult to conclude that this was a reflection of how important the teaching programme was perceived to be . In our study, the region of residence and schooling did not show an association with public health being a career choice . It would have been interesting to compare the backgrounds of students interested in a career in community medicine with those who were not in greater detail, as mcauliffe and barnett suggest that there is a relationship between an individual's background and choosing to work in a similar setting. (13) however, analysis did reveal that career choice is affected by various perceptions on community - based learning, including perceiving the experience as mutually beneficial . A similar view is shared by modipa who, in his study on career choice, hypothesizes that individuals must be motivated by a need to work and serve for the good of the community. (14) thus, allocating students to communities with obvious health - needs may help students identify important health concerns and observe tangible improvements following interventions, rendering the experience more exciting and inspiring while providing valuable service to the community . Making the process of learning active, enjoyable and obviously personally beneficial, encourages students to be more involved in the education they receive . For example, field - based activities (community and family attachment programmes) which are mostly student - oriented and engaging were found to enjoyable . These ideas are further strengthened by a study on medical students by duke et al ., which, at its core, tests the same notion . He suggests that greater engagement will improve knowledge and a fun and structured experience will enhance learning. (15) nosek et al ., in a similar study states that attention is held longer when learning is made fun, and students prefer enjoyable teaching methods. (16) that being said students appeared to have problems with the access to their allocated community and since students appeared to find community - based learning less productive and enjoyable, when they perceived the location inconvenient, making field - based training accessible and enjoyable may ensure students better appreciate the community attachment programme and the field of public health . The research programme which utilized some of the above - mentioned principles was received very positively by students . Directly integrating the programme with a student scientific forum or student - based journal, which allows students to present their findings, may increase student perception of achievement and render the programme more productive . In the final year, most perceived that lectures had a tendency to disrupt their clinical work and claimed they were not able to fully concentrate on the subject matter, even though most agreed they found the lectures interesting which is in contrast to their response in regard to the introductory lectures in public health . It appears that students still have a tendency to give greater priority to clinical work over activities related to the public health curriculum . These observations have also been made by dare and bullen who state that there is a perception that population health is considered a poor cousin of the clinically orientated medical specialties. (11) if public health cannot at this point compete with its clinical counterpart a possible compromise would be to reduce the likelihood of any negative perceptions . Therefore, a suggestion would be to either conclude all components of the course prior to the final year, when students are likely to be more receptive, or to integrate community - based medicine with ward activities in the final year . One of the notable pitfalls in the curriculum was its failure to stimulate independent learning as large numbers admitted that they did not feel inspired to read up more on the topics taught, even though most found lecture topics useful and interesting . However, group and discussion - centered activities were received positively among our study populace . Suggest the combination of sgds followed by presentations is an efficacious method of learning(17) and our students, too, appeared to agree . A similar opinion, regarding problem - based learning (pbl) sessions, is shared by kwan, who hypothesised that a pbl - based curriculum is better than typical didactic teaching and will make students lifelong learners. (18) both these methods utilize group - based teaching at their core, a feature already present in the current system . Constructivists argue that while the responsibility of learning should be borne unto to the learner, instructors should be facilitators and not teachers, thus taking on a more passive role . To be effective, learning environments should guide students to reach their own understanding, while increasing students sense of autonomy and engagement in their education. (1922) based on these principles, we propose that introducing more problem - based activities, in preference of lectures, for delivery of factual knowledge, may, apart from being interesting, have the added advantage of promoting lifelong learning by motivating students to learn both independently and from one another . This study utilized one hundred and eighty - four final year students who had completed their undergraduate course in medicine at the faculty of medicine colombo, one of eight medical faculties in the country which have a combined annual output of 1100 doctors . However, the curriculum in public health and how it is implemented varies in each faculty and this study utilized convenience sampling for recruitment of its participants due to low sample numbers as each academic year has only 200 students 10 and only final years were considered; thus, it could be argued that the findings cannot be generalized to represent all the medical graduates of the country . However with a recruitment rate of 94% the findings of this study give a clear picture of the perceptions of students of the faculty of medicine, colombo . It would have been interesting to analyze each faculty individually and to understand variations in perception as per the curricula in place and it is our recommendation that similar studies be carried in other faculties as well . The curriculum in place has been able create a positive opinion about public health among medical students of the faculty of medicine, colombo, who understand its significance . However, students lack interest and motivation to learn independently and clinical components of medicine still take preference over public health . Active, engaging, and enjoyable methods of group - based teaching and a constructivist approach will likely be better received than traditional methods such as lectures, and we recommend the use of problem - based learning for delivery of factual knowledge . Ensuring teaching activities and programmes are structured, time - efficient, and student friendly will make the course more enjoyable and productive . While community - based learning is viewed positively by students, making these experiences mutually beneficial to both community and students is likely to inspire students to think favorably about a future in public health . We recommend that student opinions and perceptions should be assessed periodically to aid in the development of medical curricula.
|
A 78-year - old man noted dysarthria, gait slowness, and clumsiness when using spoon and chopsticks with his right hand for 2 weeks . He had a history of hypertension and experienceed head trauma due to falling down from the bed without altered consciousness about 3 months ago . The patient denied history of any anti - dopaminergic drugs . On neurologic examination, mental status was alert and orientation for time and place was impaired . The speed of finger and foot tapping was mildly decreased on right extremities . On gait, there was decreased arm swing on right side with normal base and preserved gait velocity . Brain mri showed a chronic subdural hematoma in the left convexity with slight midline shift to right (figure 1a). After 3 weeks, the rigidity, bradykinesia and gait slowness had almost completely disappeared (updrs motor score of 8). The olfactory identification function was normal (cross - cultural smell identification test: 9/ in a total of 12). Surgical evacuation24 or spontaneous resolution5 of the hematomas induced partial or complete recovery from the parkinsonism . Another case with dopa - responsive parkinsonism after subdural hematoma also have been reported.6 in the latter case, parkinsonian features occurred after surgical treatment of the subdural hematoma . Interestingly, the parkinsonian features occurred ipsilesional side of the subdural hematomas and nigral dopaminergic density using (123i) beta - cit spect scan (dat scan)6 and [18f] dopa positron - emission tomography7 were markedly decreased on the contralesional striatum of the hematoma, suggesting contralateral nigrostriatal lesion caused by midline shift . The mechanism leading to parkinsonism in patients with a subdural hematoma is not well understood . It has been suggested that direct compression on the basal ganglia by space - occupying lesions can cause the decreased number of dopaminergic receptors in the striatum which explains parkinsonism secondary to brain tumor.8 furthermore, the mass effect that compress the midbrain and thus interfere nigro - striatal dopaminergic transmission may also induce parkinsonism . In those mechanism, the levodopa - responsiveness may be depending on the region of compression and the involvement in the midbrain tend to be more responsive rather than basal ganglia compression.9 alternatively, with a viewpoint that secondary parkinsonisms related with space - occupying lesions are more prevalent in old age, it is possible that space - occupying lesions may unmask underlying subclinical status of parkinson s disease in a similar fashion that anti - dopaminergic drugs may unmask preclinical parkinson s disease.10 in that smell identification was well preserved in our patient, it is less likely that subdural hematoma may exaggerate preclinical status of pd in our patient . Although parkinsonism secondary to csh is rare etiology, it is important to recognize because it is potentially treatable . With careful history taking, it is recommended to take a brain imaging in patients with parkinsonism, especially showing acute or subacute onset.
|
Acute renal failure (arf) related to pregnancy refers to a spectrum of prognosis ranging from potentially preventable to fatal . This entity has received a major boost in terms of prevention due to improving obstetric care with special emphasis on abortion . Unfortunately, the efforts have found results in high income countries while the low income countries are still lagging behind . The most probable reason for this is better management of obstetric and prenatal stages as well as lesser incidence of abortion . The decline in the prevalence of pregnancy - related acute renal failure (prarf) has been dramatic, especially from 1970.1 nearly 15 - 20% of arf in india between 1970 and 1980 was attributable to obstetrical complication while latest status is approximately 9 - 13%.2 the current scenario shows a wide gap between the developed and under developed countries, and hence, the scope for improvement in obstetric measures to reduce morbidity and mortality associated with prarf . The aim of this study was to evaluate the magnitude of prarf in northern india, contributing factors responsible for pregnancy related acute kidney failure, its relation with morbidity and mortality and outcome in these patients . This prospective observational study was conducted from over a period of one year, nephrology unit in collaboration with department of obstetrics and gynaecology, king george's medical university, lucknow uttar pradesh, india . After informed consent and ethical clearance from institutional ethics committee, a total 520 patients of arf were screened, out of these 60 (11.5%) women suffering from prarf were enrolled and analyzed . Patients with end - stage kidney disease, prior hypertension, diabetes mellitus, history of renal stone, small size echogenic kidneys and recent history of urological intervention were excluded from the study . For each case, a detailed history, thorough physical examination including obstetric and pelvic examination was done by gynecologist . Physical examination like temperature, relevant laboratory investigations such as complete hemogram, blood urea, serum creatinine, electrolytes, coagulation profile, liver function test, 24-hour urinary protein, and ultrasound abdomen were carried out . Blood culture and vaginal swab few specialised investigations like renal ultrasonography and renal biopsies were performed in selected cases where recovery was delayed for more than 3 weeks . Arf was diagnosed when there was a history of sudden oliguria (urine output <300 ml over 24 hours), or anuria with a sudden increase in serum creatinine to more than 1.5 mg / dl or an increase in s. creatinine of more than 0.5 mg / dl per day from base line . Maternal outcome was recorded as full recovery, partial recovery, end stage renal failure or death . Partial recovery was suspected when renal functions showed improvement but did not return to normal even after 12 weeks . End stage renal disease was defined as patients with impaired renal functions for more than 3 months and requiring hemodialysis . Continuous data were summarized as mean sd while discrete (categorical) in% . Continuous variables were compared by one way analysis of variance (anova) and the significance of mean difference between the groups was done by tukey's post hoc test after ascertaining the normality and homogeneity of variances by shapiro wilk test and levene's test, respectively . Categorical variables were compared by chi - square () test . A two - sided (= 2) p <0.05 was considered statistically significant . All analyses were performed on statistica statistical software (windows version 6.0). Continuous data were summarized as mean sd while discrete (categorical) in% . Continuous variables were compared by one way analysis of variance (anova) and the significance of mean difference between the groups was done by tukey's post hoc test after ascertaining the normality and homogeneity of variances by shapiro wilk test and levene's test, respectively . Categorical variables were compared by chi - square () test . A two - sided (= 2) p <0.05 was considered statistically significant . All analyses were performed on statistica statistical software (windows version 6.0). Total 520 cases of acute renal failure with different etiologies were screened . Out of these 520 patients, 60 (11.5%) patients were of obstetric related arf . The age of the patients were between 20 and 41 years with a median age 28 years . 28 (46.7%) women were multi para and 32 (53.4%) women were primigravida . Acute renal failure occurred in 32 (53.3%) patients in early part of their pregnancy and in 28 (46.7%) patients, in later half of pregnancy and puerperium . There were 10 (16.7%) patients who had undergone major surgical procedures, (caesarian section) whereas 45 (75%) had vaginal deliveries . Majority of the patients, 32 (53.3%) had not received any antenatal care at any stage of their pregnancy and had undergone traditional birth attendant assisted home delivery, 20 (33.4%) patients had delivered in the hospitals but without antenatal care and 8 (13.3%) patients received some sort of antenatal care and their deliveries were carried out in the hospitals . 18 (30%) cases were residents of urban area and the remaining 42 (70%) were from village community . Anuria was observed in 23 (38.3%) cases, remaining 37 (61.7%) cases presented with decreased urinary output or oliguria [table 1]. Demographic profile of the patients out of 60 patients, septicemia was present in 25 (41.7%), hypertensive disorders of pregnancy, in 20 (33.3%), hemorrhage, in 8 (13.3%) patients, abortion, in five 5 (8.3%) patients . Hellp syndrome one 1 (1.67%) and disseminated intravascular coagulation was reported in 1 (1.67%) patient [table 2]. In the present study, 23 (38.33%) patients required hemodialysis while 37 (61.7%) were treated conservatively . However, both the groups showed significant (p <0.001) improvements (either lower or higher) in all biochemical variables and urine output at post treatment as compared to pre treatment except na and k in dialysis group . Improvement in blood urea, s. creatinine, na, k and urine output were 24.4%, 46.5%, 2.4%, 5.0% and 15.2%, respectively, higher in dialysis group as compared to conservative group . Though the improvements in all variables were statistically similar in two groups but clinically stated to be significant [tables 3 and 4]. While managing the patients, 37 (61.7%) were not dialysed, 33 (55%) patients recovered normal renal function with conservative treatment . Four patients of them were suffering from multiorgan dysfunction and in a state of shock . Complete recovery was observed in 45 (75%) patients out of 60 pregnancy related arf patients . 5 (8.4%) patients developed irreversible renal failure, whereas 1 (1.7%) patient developed partial recovery but not dialysis dependent . In our study maternal morbidity and mortality both were higher in dialysis group as compared to conservative group though statistically not significant [table 5]. 9 (15%) patients were expired (maternal deaths) and fetal loss was found in 25 (41.7%) patients [table 6]. Aetiology of pregnancy related acute renal failure comparison of biochemical parameter and urine output, pre - dialysis and post - dialysis improvement in biochemical parameters and urine output of two groups frequency distribution of maternal outcome of two groups maternal and neonatal outcome its incidence is less than 1:20000 of all gestations.34 statistics from other developing countries showed that pregnancy related acute renal failure (prarf) were in bangladesh, nigeria, ethopia and pakistan, 11%, 25.7%, 55.0% and 18% respectively.2567 in india recent studies done by other authors reported the prevalence of pregnancy related acute renal failure was 4.3%, 7.6%, 9.06%, 7.0% respectively.891011 in our study pregnancy related arf was reported, 11.5% . This discrepancy might be due to literacy rate, antenatal checkup, mode and place of delivery . Abortion was the main cause of obstetrical arf in late seventies.1 the proportion of arf secondary to septic abortions has decreased from 33.3% to 1.8% over the past 20 years.12 in our study septicemia was present in 25(41.7%) which was compatible to other indian study, (47.41%, 39.02%).8910111213 this discrepancy in aetiological factors of obstetrical arf between various studies conducted in developing countries might be due to difference in antenatal care, decrease incidence of obstetrical hemorrhages and early detection of eclampsia - preeclampsia . Sepsis induced prarf as a cause of maternal morbidity and mortality is a major concern in low - resource countries . In the present study, although, the relative contribution of arf following abortion was still lower than reported by others, but still alarming.21014 this might be due to legalization of abortion, increased public awareness about the complications of illegal abortion, and more important is the availability of better reproductive healthcare facilities especially through the national rural health mission in india.15 its incidence could be reduced further by preventing unplanned and unwanted pregnancies through increased use of regular contraception, backed - up method and use of emergency contraception.16 hypertensive disorders of pregnancy (preeclampsia - eclampsia of pregnancy) was found in 20 (33.3%) patients, similarly reported by other indian authors (47.41%, 39.02%).813 pre - eclampsia / eclampsia remains a major cause of prarf . In southern india, the most common cause of prarf has changed from hemorrhage to hypertensive disorders of pregnancy over the past 20 years.17 majority of the studies have reported eclampsia - preeclampsia as a major cause of obstetrical arf in developed countries.18 in our study hemorrhage as a cause of prarf was found in 8 (13.3%) patients which was compatible to other indian study (18.6%, 9.76%).813 the fact that eclampsia accounted for most (53.3%) of the prarf in hypertensive disorders group indicates that this condition was not adequately managed in its initial stages . According to the 2005 - 2006 national family health survey,19 only 50% of pregnant women in india had at least 3 antenatal check - ups . Incomplete coverage of prenatal care could be an important underlying factor with these complications being missed in their initial stages . While managing patients with obstetrical arf, majority of the patients require haemodialysis as a renal replacement therapy . In the present study, 23 (38.33%) however, both the groups showed significant (p <0.001) improvements (either lower or higher) in all biochemical variables and urine output at post treatment as compared to pre treatment except na and k in dialysis group . Improvement in blood urea, s. creatinine, na, k and urine output were 24.4%, 46.5%, 2.4%, 5.0% and 15.2%, respectively, higher in dialysis group as compared to conservative group . Though the improvements in all variables were statistically similar in two groups but clinically stated to be significant [tables 3 and 4]. In study by m.s . Najar11 hemodialysis was given to 32.5%, peritoneal dialysis in 15%, and both modality to 12.5%, while conservative treatment in 40% . This difference might be due to general condition of patient, severity of renal dysfunction . In our study maternal mortality was decreased by 20%, 9 (15%), as reported (18.57%) by other indian authors.10 although maternal mortality due to prarf has decreased recently,212 but it is still high.101720 the high mortality in present study could be due to various reasons such as poor prenatal care, inadequate emergency obstetric care at peripheral hospitals and late referral of women with severe complication . The majority of the remaining patients (1.7%) had partial recovery, not requiring renal replacement therapy . The better results reported in various studies from developed world might be due to good literacy rate, better health care facilities and postnatal care . Sepsis accounted 55.6% (5 out of 9 patients), pulmonary edema in 22.2%, hellp syndrome 1 (11.1%) and disseminated intravascular coagulation 1 (11.1%). Other study21 reported in their study of 10 year period, irreversible renal damage in 11.6% out of which 26.3% cases were of preeclampsia and eclampsia . We found fetal loss in 25 (41.7%) as compared to 44 - 55% in other studies.2223 thus this study showed that eclampsia - preeclampsia, sepsis, obstetrical haemorrhages and dic are the predominant causes of acute renal failure . These are very alarming figures but we can change this threatening scenario by providing good antenatal care and health facilities in the far - flung areas . Prarf is usually a consequence of obstetric complications . In our study, most common aetiological factors was septicaemia, therefore, preventive measures should be directed to addressing the lacunae of existing maternity care . Thus, priorities in management of arf include early recognition, institution of appropriate preventive measures, optimization of fluid balance, identification and treatment of cause, timely initiation of renal replacement therapy . In addition, the twin approaches of improving early referral and communication systems at the periphery and establishing more obstetric critical - care units with facilities for providing multidisciplinary services at the tertiary level may reduce mortality due to prarf.
|
The environment changes continually and, on an evolutionary time scale, these changes can impose selection pressures that alter the optimal expression of phenotypes or behavior . Behavioral plasticity, the ability of an animal to alter its behavior in response to changes of environmental conditions, is expected if the environment shifts appreciably across generations or within the lifetime of an individual, whereas costs incurred to learn appropriate responses to environmental stimuli may favor less pliable, environmentally canalized behavior when the environment is relatively static [reviewed by 15]. In this paper, we address issues related to how environmental stochasticity influences the control of female mate choice decisions in the context of a prominent model of searcher behavior . The sequential search strategy, the model that we use to address this issue, has an extensive history in the field of economics [reviewed by 6,7]. Janetos and real introduced this strategy as a potential rule by which females might sample and choose among prospective mates and numerous empirical and theoretical papers related to their ideas followed [reviewed by 10]. The solution of the model is a fixed, optimal threshold criterion against which the quality of prospective mates is compared . The threshold is invariant in the original formulations of the model because females were presumed to sample males from a known, static distribution of prospective mates that either does not change across generations or is somehow learned perfectly by searchers each generation . This assumption is clearly unrealistic and the impact of uncertainty about this distribution on mate choice decisions has been explored in a variety of contexts [1119]. For instance, hutchinson and halupka explored the performance of threshold - based decision rules when males are distributed in patches that differ in their composition of prospective mates and collins et al . Compared the performance of fixed and learned thresholds under conditions in which the distribution of males from which females choose varies spatially or temporally across generations . In this paper, we are concerned with the stability of an environmentally canalized, genetically determined threshold when environmental stochasticity causes perturbations of the distribution of prospective mates across generations of searchers . The existence of an evolutionary stable fixed threshold was tacitly assumed in various comparisons made by collins et al . And here we establish general conditions under which this assumption is justified . These considerations reveal, in addition, a simple algorithm by which the threshold could be learned . In this section of the paper, we provide a brief description of the search process and the assumptions used to derive the solution to the sequential search strategy, where the quality of a prospective mate the to - be - realized fitness gain to a searcher is revealed by inspection of a phenotypic indicator character [reviewed by 20,21]. The model can be applied when either sex is considered to be the searcher, but for simplicity we suppose that this role is played by females . Females pay an expected cost c> 0 to sample a prospective mate and inspect his expression of a phenotypic indicator character x, where x is bounded on the interval [0,). The cumulative distribution of x is f, which is presumed, for now, to be known by searchers . Prospective mates are sampled randomly and sequentially from f. the time horizon over which females search is unlimited and males are assumed to mate indiscriminately . Hence, the number p of prospective mates that can be sampled by a female is unrestricted and the phenotypes of males in any encounter sequence {x1, x2,, xp} are independent and identically distributed . The acceptability of an encountered male is determined by a comparison of his expression of x to a threshold criterion t. the indicator character of a sampled male is related to the to - be - realized fitness gain to a searcher by a function u, which is presumed to have a finite mean and to be continuously differentiable with respect to x. (for simplicity, u(0) 0 and du(x)/dx = u(x) 0 are also assumed .) A female who adopts a particular threshold criterion t terminates search and mates with the first prospective mate in a sequence of encounters whose phenotype is x t. this male is invariably the last prospective mate encountered in the sequence {x1, x2,, xp} because when the time horizon for search is unrestricted the threshold is fixed and an unacceptable, previously encountered male is never later accepted . The quality of an accepted male is u(xp) and the cost paid to sample p males is cp, where both the quality of a mated male u(xp) and the cost to sample a prospective mate c are measured in units of fitness to a searcher . Hence, the net fitness return to a searcher is u(xp) cp . The expected net fitness return v to a searcher who employs the threshold t is(1)vt=tuxdfx1ftc11ft . The first term on the right - hand side is the expected quality of a male whose expression of x equals or exceed t and the second term is the cost to sample a prospective mate multiplied by 1/(1 f(t)), the number of males that a female expects to sample to find an acceptable mate when the threshold t is used as the criterion against which males are evaluated . The optimal threshold criterion t * satisfies(2)ut*=vt*. In other words, the optimal phenotypic threshold is the x that causes a searcher to be indifferent between the acceptance of an encountered individual, which would yield a net fitness gain u if she mated, and the prospect of continued search, which would yield an expected net return v . Substitution of u(t *) for v(t) into (1), rearrangement and integration by parts leads to an expression of the solution that we will use throughout this paper, namely(3)c=t*ux1fxdx . The last important model property relates to the conditions under which a female will sample prospective mates . A female will search for a mate provided that c is less than the mean male quality because she otherwise has no incentive to engage in the search process . In particular, her expected net gain if she engages in search is negative whenever c>. The cumulative distribution of the male indicator character x, namely f, is more realistically expected to fluctuate from generation to generation and in the next section of the paper we establish sufficient conditions for the evolutionary stability of a genetically determined t * to perturbations of f. the optimal threshold t * is a function of the distribution f. if t * is continuous with respect to f, then under some conditions, which we will establish, it is stable to generational perturbations of f. in particular, we shall establish conditions on perturbations of f across generations that allow an unlearned, genetically determined t * to be optimal over an evolutionary time scale in comparison to any other genetically determined threshold . Imagine a sequence of distributions {fn} = {f1, f2, f3,} of x on the interval [0,) for which u has finite mean n> c, where {fn} is an evolutionary sequence of distributions, experienced over a sequence of n generations of searchers, that converges, as will be specified, on f. for each fn there is an optimal threshold criterion tn*. If these threshold criteria converge on the optimal threshold t * under f, then t * is optimal over the evolutionary sequence {fn}. Thus, our objective is to establish conditions on {fn} which imply that tn * converges on t*.theorem 1if fn converges to f uniformly on the interval [0,) of x and u is bounded on [0,), then tn * converges to t*.proofit cannot be true that {tn *} is unbounded . If fn converges to f uniformly on the interval [0,) of x and u is bounded on [0,), then tn * converges to t*. It cannot be true that {tn *} is unbounded . Imagine that the subsequence tni * of {tn *} tends toward infinity . Then(4)c=tni*ux1fnixdx=tni*ux1fx+fxfnixdx=tni*ux1fxdx+tni*uxfxfnixdxtni*ux1fxdx+tni*uxfxfnixdxtni*ux1fxdx+supuxsupfxfnix . The first term on the right - hand side approaches zero as i increases to infinity because u has a finite mean with respect to f. the second term converges to zero because fni converges uniformly to f. this contradicts the assumption that c> 0 . The bolzano weierstrass theorem then assures us that {tn *} converges to some number . Suppose that {tn *} converges to the limit s, where s t*. Then for i sufficiently large(5)0=cc=tni*ux1fnixdxt*ux1fxdx=tni*t*ux1fnixdx+t*ux1fnixdxt*ux1fxdx=tni*t*ux1fnixdx+t*uxfxfnixdx . The dominated convergence theorem applies to the first integral, with the integrable dominating function u(t). The conclusion is that(6)0=st*ux1fxdx . Because u strictly increases with x and f(t*) <1, this can happen only if s = t*. An analogous argument yields the same conclusion for the situation in which s t *, which proves that every convergent subsequence tni * converges to t*. The boundedness condition on u can be relaxed, as we now show, if a more stringent convergence condition is imposed on {fn}.theorem 2if fn converges to f in the sense of l(u(t)dt, [0,)), then tn * converges to t*.proofthe proof is similar to the proof of theorem 1 . If fn converges to f in the sense of l(u(t)dt, [0,)), then tn * converges to t*. The proof is similar to the proof of theorem 1 . If there is a subsequence tni * that tends toward infinity, then(7)c=tni*ux1fnixdx=tni*ux1fxdx+tni*uxfxfnixdxtni*ux1fxdx+fxfnix1 . The final expression on the right - hand side approaches zero as i increases, which contradicts the assumption that c> 0 . Now suppose that the bound on {tn *} is s, where s t*. Then for i sufficiently large(8)0=tni*t*ux1fnixdx+tni*uxfxfnixdx . The first integral can be zero only if s = t*. A similar argument yields the same conclusion for the situation in which s t *, which proves that {tn *} converges to t*. Another trade - off takes us to the next sufficient condition for the convergence of thresholds . Let the mean quality of males associated with distribution fn be n = 0u(x)dfn(x). The convergence of means, together with a much weaker mode of convergence in {fn}, then suffices for {tn *} to converge to t*.theorem 3if fn converges to f pointwise, and n converges to, then tn * converges to t*.proofthe proof is again structurally similar to that used in theorem 1 . If there is a subsequence {tn *} that tends toward infinity, then(9)c=tni*ux1fnixdx=tni*ux1fxdx+tni*uxfxfnixdxtni*ux1fxdx+ni. If fn converges to f pointwise, and n converges to, then tn * converges to t*. The proof is again structurally similar to that used in theorem 1 . If there is a subsequence {tn *} that tends toward infinity, then(9)c=tni*ux1fnixdx=tni*ux1fxdx+tni*uxfxfnixdxtni*ux1fxdx+ni. The final expression on the right - hand side approaches zero as i increases, which contradicts the assumption that c> 0 . Now suppose again that {tn *} is a convergent sequence with limit s, where s t*. Then for i sufficiently large(10)0=tni*t*ux1fnixdx+tni*uxfxfnixdx . The second integral is bounded by |n |, which converges to zero as i increases to infinity . This forces the first integral to zero, which can happen only if s = t*. An analogous argument yields the same conclusion for the situation in which s t*. The conclusion is again that {tn *} converges to t*.theorem 4if au(x)dfn(x) converges to au(x)df(x) for every measurable subset a of [0,), then tn * converges to t*.proofthis proof follows the proof that we used to establish theorem 1 . The generalized dominated convergence theorem is applied to the sequence of measures u(x)dfn(x) (or, from integration by parts, the measures u(x)[1 fn(x)]dx) and the sequence of indicator functions for the sets [tn *,). The latter are dominated by the unit constant function and the argument proceeds as in theorem 1 . If au(x)dfn(x) converges to au(x)df(x) for every measurable subset a of [0,), then tn * converges to t*. This proof follows the proof that we used to establish theorem 1 . The generalized dominated convergence theorem is applied to the sequence of measures u(x)dfn(x) (or, from integration by parts, the measures u(x)[1 fn(x)]dx) and the sequence of indicator functions for the sets [tn *,). The latter are dominated by the unit constant function and the argument proceeds as in theorem 1 . Finally, it is straightforward to illustrate why t * is optimal over an evolutionary time scale in comparison to any other environmentally canalized, genetically determined threshold whenever conditions on f are sufficient for tn * to converge to t*.corollary 1if tn * converges to t *, then v(tn *) converges to v(t*).proofthis statement follows directly from the fact that u is continuous (and independent of f) and the fact that v(t()) = u(t()). Hence, the expected net fitness return associated with t *, namely v(t *), is higher than the expected return associated with any other determined threshold and t * is evolutionarily stable against perturbations {fn} that converge, as we characterized, on f. if tn * converges to t *, then v(tn *) converges to v(t *). This statement follows directly from the fact that u is continuous (and independent of f) and the fact that v(t()) = u(t()). Hence, the expected net fitness return associated with t *, namely v(t *), is higher than the expected return associated with any other determined threshold and t * is evolutionarily stable against perturbations {fn} that converge, as we characterized, on f. thus far we have imagined that the threshold criterion is environmentally canalized and our concern was with the evolutionary stability of t*. Now we present a continuity result that applies specifically to situations in which a threshold is learned by searchers within a generation through their experiences with a single distribution f that has an associated optimal threshold criterion t*. The result that follows provides a sufficient condition and a simple algorithm for a searcher with no prior knowledge of f to learn a threshold that converges on t*. Imagine that a female observes a sequence of male phenotypes {xn} before search is initiated, where each xi is an independent and identically distributed sample from f. define the sequence of empirical distribution functions {fn} constructed from the realized sequence of encounters {xn} as(11)fnx=1ni=1nixix, where(12)ixix=1,ifxi> x0,otherwiseis the indicator function of [xi,). Notice that each fn is itself a random variable.theorem 5if {fn} is the sequence of empirical distributions, then tn * converges to t * with probability 1.proofthe glivenko cantelli theorem ensures that {fn} converges uniformly with a probability of 1 to f . Let yn be the random variable u(xn) for every n. the law of large numbers provides that(13)y1+y2+k+ynneywith probability 1 as n approaches infinity . If {fn} is the sequence of empirical distributions, then tn * converges to t * with probability 1 . Cantelli theorem ensures that {fn} converges uniformly with a probability of 1 to f . Let yn be the random variable u(xn) for every n. the law of large numbers provides that(13)y1+y2+k+ynneywith probability 1 as n approaches infinity . The optimal threshold under a sequential search strategy is expected to vary across generations of searchers when environmental conditions perturb the distribution of male quality . In this paper, we established conditions on perturbations of this distribution that permit the evolutionary stability of an environmentally canalized phenotypic threshold . In our formulation of the problem we supposed that each generation of searchers experiences a somewhat different distribution of prospective mates . In practice, the evolutionary time scale over which our results can be applied will depend on the magnitude of environmental perturbations across generations, where the perturbations are non - catastrophic and, over an evolutionary time scale, non - directional . The convergence conditions that allow for an optimal fixed threshold should be simple to establish in a typical evolutionary simulation that involves hundreds or thousands of generations . The convergence conditions that we derived effectively specify when environmentally induced perturbations of the distribution of male quality permit a particular environmentally canalized phenotypic threshold to outcompete all alternative genetically determined thresholds . How uncertainty about the distribution from which males are sampled influences mate choice decisions has been explored in a variety of other contexts [1119]. The sequential search strategy has been compared, for instance, with other search strategies under conditions in which males are distributed in patches and there is inter - patch variability in the quality of prospective mates . The expected net fitness return to searchers that apply a fixed threshold is, not surprisingly, reduced when search is confined to a single patch and the mean quality of males varies considerably among patches . The results derived from this scenario might similarly apply to conditions in which the mean quality of prospective mates varies across generations of searchers if we construe patches as generations . The evolutionary dynamics of environmentally canalized thresholds in patchy environments should, however, differ to some extent from cross - generational dynamics because when variability occurs across generations all searchers in a particular generation experience the same distribution of prospective mates . Developed a genetic algorithm to compare the performance of a learned threshold to a fixed threshold, where the mean quality of prospective mates varies spatially or temporally across an evolutionary time scale of many thousands of generations . They found that a learned threshold is most advantageous when there is high variability of the mean quality of males among patches or generations and that the relative performance of learned and fixed thresholds depends on the variability of male quality within patches or generations . The existence of an optimal, genetically determined threshold was tacitly assumed in some of their comparisons of learned and fixed thresholds . In this paper, we established conditions under which this assumption is justified, conditions on the distribution of male quality that permit the evolutionary stability of a genetically determined phenotypic threshold . Importantly, the results that we established do not depend on any particular parametric restrictions on the male indicator character, like normality, or simple shifts of the mean male phenotype across generations . Learned acceptance thresholds generally yield a higher expected fitness return than environmentally canalized thresholds when searchers experience high uncertainty about the quality of prospective mates and the cost to gather and process information on the distribution of male quality is small . Bayesian rules, like the one applied by collins et al ., are often used to model the dynamics of a learned threshold, where searchers are presumed to have some prior knowledge of the distribution of male quality [13,14,27,28; but see 15]. The convergence conditions that we established for the persistence of an environmentally canalized phenotypic threshold revealed a simple algorithm by which a searcher with no prior knowledge of the distribution could, in principle, learn a threshold that converges on the optimal threshold . The functional relation between the male indicator character and male quality was assumed to be invariant under the conditions that we established for the evolutionary persistence of an optimal, genetically determined phenotypic threshold . This relationship can, however, also shift across generations as a consequence of environmental stochasticity . The approach we used could be similarly applied to establish conditions on the evolutionary stability of an optimal fixed threshold when the fitness function is likewise perturbed.
|
The occurrence of intradialytic hypotension (idh) during hemodialysis (hd) continues to be a main problem in patients with esrd (end - stage kidney disease). We reviewed clinical and experimental literature in a variety of sources, including pubmed, current content, scopus, embase, and iranmedex regarding the possible effect of vasopressin administration in prevention of hypotension during hd to clarify its mechanism, efficacy, and safety . Although arginine vasopressin is widely recognized for its anti - diuretic properties, it is also a well - recognized vasoconstrictor . It has been shown that the vasopressin release (as it would normally be expected) does not increase in the majority of hd patients with recurrent dialysis hypotension . In addition, it has also been reported that vasopressin secretion (due to the osmotic stimulation) is the most important mechanism in blood pressure control in esrd patients receiving hypertonic solution for idh . Therefore, it is suggested that vasopressin administration may improve hemodynamic stability among esrd patients during hd . There are few clinical trials about this issue, suggesting that administration of exogenous vasopressin may be significantly associated with a decreased incidence of idh as well as cardiovascular stability in esrd patients in need of volume removal during hd . Vasopressin insufficiency may have an important role in the pathogenesis of hemodynamic instability during hd and administration of exogenous vasopressin is significantly associated with a lower incidence of idh . Although significant technical improvements have made since the introduction of hemodialysis (hd) in the early 1950, many complications with different underlying mechanisms still occur during hd (1 - 15). Intradialytic hypotension (idh), especially during ultrafiltration dialysis (in which fluid removal is the primary goal) continues to be a main problem, especially in the elderly, diabetic, and cardiovascular compromised patients (16, 17). Therefore, it is an important cause of inadequate dialysis among these patients . On the other hand, in the patients who need ultrafiltration during hd, the development of hypotension necessitates intravenous fluid replacement and therefore, it causes volume overload and some other significant complications (17). Unfortunately, the incidence of this problem is very high and ranges from 15% to 50%, especially among patients receiving ultrafiltration during hd (18). Many factors can contribute to hemodialysis hypotension, and they generally arise from these situations: fluid removal in an attempt to treat the volume overload and or to attain dry weight; reduction of plasma osmolality which causes water movement from extracellular space into the cells; use of a dialysate with low sodium concentration and or with acetate rather than bicarbonate as a dialysate buffer; reactions to the dialyzer membrane; use of antihypertensive medications and or ingestion of meal before or during hd session and cardiac arrhythmias or severe pericardial effusion with cardiac tamponade (12, 16, 19 - 31). According to above etiology, different strategies with variable success rate have been offered to prevent or diminish idh such as increased dialysate sodium concentration and sodium modeling, combination of sodium modeling and ultra - filtration, use of bicarbonate instead of acetate as a dialysis buffer, avoidance of low magnesium and low calcium dialysate, use of low dialysate temperature, avoidance of antihypertensive medicines on dialysis day, and no food intake during dialysis (32 - 46). In addition, a number of pharmacologic agents such as midodrine, carnitine and intravenous mannitol, have also been evaluated in the prevention of idh; however, because of a few comparative studies, there are no generally accepted guidelines for using these agents in prevention of hypotension during hemodialysis (47 - 51). Vasopressin is a well - recognized vasoconstrictor, and the role of vasopressin insufficiency has also been proposed in hypotension during hd . Thus, it is possible that vasopressin administration may improve hemodynamic stability among patients with end - stage renal disease (esrd) during hd (29, 52 - 54). This article reviewed and summarized some of the observations about the possible effect of vasopressin administration to prevent idh episodes . We used a variety of sources to collect current data for this review article . Published articles of pubmed, embase, scopus, current content, sid, google scholar, and iranmedex were searched with key words of ddavp or vasopressin and hypotension during hemodialysis . Our review study included articles published in english language from january 1986 to july 2012, as full - text manuscripts, or abstract forms about the effect of vasopressin in prevention of hypotension during hd . However, some studies examined other effects of vasopressin; for example, beladi moosavi and colleagues (3) studied its effect in relieving renal colic . Shimizu et al . (61) evaluated the mechanism of vasopressin secretion after infusion of a small amount of hypertonic saline and showed that hypertonic solutions induce a significant increase in arterial plasma osmolality without a significant effect on peripheral venous plasma osmolality . Therefore, it appears that by a mechanism similar to cardiopulmonary recirculation, increment in arterial plasma osmolality enhances vasopressin secretion and raises mean arterial pressure . Mechanism of vasopressin action was examined and concluded that its compensatory mechanism of hypotension and hypovolemia maintains and controls blood pressure, especially in inefficient cases . Mechanism of vasopressin secretion in a small amount of hypertonic saline infusion was studied, and it was found that hypertonic solutions increase arterial osmolality of plasma, but no significant effect on peripheral plasma osmolality . It seems that in esrd patients undergoing chronic hemodialysis, administration of vasopressin can significantly reduce frequency of the hypotension episodes, which affects the dialysis quality . Arginine vasopressin (avp), also known as anti - diuretic hormone (adh), is derived from a preprohormone precursor . It is released in the setting of hyperosmolality or nonosmotic stimuli, including volume depletion, hypotension, and nausea or vomiting . There are three receptors for avp, including v1a, v1b, and v2 receptors . Avp plays a key role in the regulation of sodium balance and plasma osmolality by increasing water absorption in the distal convoluted tubules and collecting ducts of the kidney via v2 receptors (55). Its antidiuretic property has been exploited clinically for the management of patients with diabetes insipidus and nocturnal enuresis . In addition, there is also some new evidence that avp may be effective for pain relieving in patients with acute renal colic possibly by its antidiuretic effect and decreasing intraurethral pressure . For example, a study showed that administration of desmopressin 40 g as nasal spray in patients with acute renal colic decreases the pain scores after 30 minutes in a notable percentage of patients without any apparent side effects (56). Vasopressin is a well - recognized vasoconstrictor by increment of peripheral vascular resistance via v1a receptors activation on vascular smooth muscle, but it appears that this effect is negligible in healthy individuals . However, in the setting of hypotension and hypovolemia, the hemodynamic response to vasopressin becomes an important compensatory mechanism in maintaining arterial pressure and tissue perfusion (56 - 59). For instance, in patients with septic shock, release of vasopressin (together with other vasoconstrictors) usually increases systemic vascular resistance and elevates blood pressure (57). In addition, in a study conducted in animals with hemorrhagic shock demonstrated that using v1 receptor antagonist increases hypotension (58). They showed in two separate studies that vasopressin concentrations do not increase in the setting of orthostatic hypotension among diabetic patients with severe diabetic neuropathy (60). In recent years, it has been observed that vasopressin release (as it would normally be expected) does not increase in the majority of hd patients with recurrent dialysis hypotension (61). Therefore, it is suggested that the vasopressin insufficiency due to decreased synthesis and or secretion may have an important role in the pathogenesis of hemodynamic instability during hd . In addition, as diabetes mellitus is the most common cause of esrd, the results of sato et al . And cignarelli et al . Studies also supported that the inappropriately low vasopressin concentrations may be a part of the underlying mechanism for idh in diabetic patients (59). Shimizu et al . Examined whether vasopressin is a part of the mechanism of blood pressure control in esrd patients receiving hypertonic solution for idh (61). They evaluated the effects of intravenous infusions of hypertonic saline, glucose, or physiological doses of vasopressin among 42 patients on long - term hd therapy during idh . The results of the study showed that hypertonic solutions increase plasma osmolality and plasma vasopressin levels . In addition, despite hypertonic solutions have been considered to act as plasma volume expanders; however, in the study, blood pressure increased independent of hypertonic saline effect on plasma volume . Therefore, it was suggested that vasopressin secretion due to osmotic stimulation is an important mechanism of blood pressure control . Vasopressin infusion was also increased mean arterial pressure and plasma vasopressin concentrations to the levels similar to those induced by the hypertonic saline and glucose . Finally, they strongly suggested that the osmotic stimulation of vasopressin secretion by hypertonic solutions has an important role in increasing blood pressure among these patients . They also claimed that vasopressin infusion may be an effective therapy to prevent idh episodes (61, 62). In another study, shimizu et al . Evaluated the mechanism of vasopressin secretion after infusion of a small amount of hypertonic saline and showed that hypertonic solutions induce a significant increase in arterial plasma osmolality without a significant effect on peripheral venous plasma osmolality . Therefore, it appears that by a mechanism similar to cardiopulmonary recirculation, increment in arterial plasma osmolality enhances vasopressin secretion and raises mean arterial pressure (63). To examine the role of insufficient vasopressin secretion in the pathogenesis of idh, friess et al . Measured plasma vasopressin level in 23 esrd patients with recurrent symptomatic episodes of hypotension during hd . Vasopressin concentration increased largely in 6 patients with hypotension and nausea during the study, but in the remaining 17 hypotensive patients without nausea, vasopressin level did not significantly increase during hd . Study also suggested the potential role of vasopressin insufficiency in the pathogenesis of idh (52). Study have also clearly supported the finding of the previous article . In their observational pilot study, they assessed and compared the baseline avp level and trend of avp with ultrafiltration in patients with and without idh . They observed that avp concentration did not increase as much as it would normally be expected in the idh patients compared with patients without idh . In their conclusion, they suggested that esrd patients with symptomatic idh are unable to increase appropriately avp secretion during hypotensive episodes (53). In summary, the results of above studies and other articles support the role of vasopressin insufficiency in the pathogenesis of idh and possibility of avp as a mechanism of therapy for patients with hemodynamic instability during hd . However, clinical trials on the vasopressin effect on prevention of idh are scant . In a double - blind, crossover fashion, lindberg et al . Assessed the efficacy of intranasal lysine vasopressin and placebo in the prevention of hypotension during hd . In their study, 6 patients with refractory hemodialysis - induced hypotension and abnormal autonomic testing were evaluated . The results of the study demonstrated that after using intranasal lysine vasopressin systolic, diastolic, and mean arterial blood pressures were significantly greater at 90 min of the dialysis session . In addition, the mean number of hypotensive episodes and the total volume of intravenous fluid administered (because of hypotension) decreased (54). (29) have also shown the efficacy of vasopressin in this issue and supported the findings of lindberg et al . Study, the plasma vasopressin concentration during hd was measured and shown that the level of plasma vasopressin did not increase during hd in spite of significant fluid removal . Then, in a randomized, double - blinded and placebo - controlled trial they examined 22 esrd patients and showed that, compared to a standard hemodialysis, blood pressure was more stable and the incidence of symptomatic hypotension did not increase by greater fluid removal among the patients receiving constant infusion of a nonpressor dose of vasopressin during hemodialysis . Only 9% of the patients in the vasopressin group (compare with 64% of the patients receiving placebo) had symptomatic hypotensive episodes . In addition, the increased fluid removal was also achieved only in the vasopressin group during the study . Finally, van der zee et al . Concluded that inadequate vasopressin secretion during hd is a likely contributor to the hypotension that limits removal of excess extracellular fluid, and administration of exogenous vasopressin, by supporting arterial pressure, may improve cardiovascular stability and facilitates volume removal during hd (29). The results of double - blinded and placebo - controlled clinical trial of beladi mousavi et al . They compared the effect of intranasal desmopressin, a synthetic structural analog of antidiuretic hormone and intranasal distilled water in prevention of idh among patients received ultrafiltration during hemodialysis . In the first month of this study, 17 patients with known symptomatic idh received nasal spray of distill water as a placebo and after a 30-day washout period, the patients received intranasal desmopressin 30 minutes before all hd sessions . When compared to the placebo group, the incidences of iidh episodes was significantly lower and the mean arterial blood pressure was significantly higher during hemodialysis with desmopressin (64). Hypotension during hemodialysis is the most common and important side effect of hd, especially in the elderly and cardiovascular compromised patients . It has a negative impact on health - related quality of life too (70 - 78). Unfortunately the incidence of this problem is very high and ranges from 15% to 50% of dialysis sessions . Many factors have been proposed causing hypotension during hd and different strategies, and a number of pharmacologic agents have been evaluated to prevent idh . Arginine vasopressin is widely recognized for its role in the regulation of sodium balance and antidiuretic properties . Moreover, it is a well - recognized vasoconstrictor and the role of vasopressin insufficiency in the pathogenesis of hemodynamic instability during hd has also been demonstrated in recent years by several observations . At first (52) and then other researchers showed that vasopressin release (as it would normally be expected) does not increase in the majority of hemodialysis patients with recurrent dialysis hypotension . (61) strongly demonstrated that vasopressin secretion due to osmotic stimulation is an important part of the mechanism of blood pressure control among esrd patients receiving hypertonic solution for idh . Hence, it is suggested that intravenous vasopressin and perhaps intranasal vasopressin administration may improve hemodynamic stability among esrd patients during hd . (61, 63) which have carried out on the possible effect of vasopressin in prevention of idh episodes . All of them suggested that administration of exogenous vasopressin may be significantly associated with a decreased incidence of idh episodes and cardiovascular stability among esrd patients in need of volume removal during hd . Although the results of these studies are interesting, the studies have some limitations such as short duration, lack of information regarding the patients, and small number of patients enrolled in the studies . Therefore, further multicenter clinical trials with longer duration and larger number of patients are needed to determine the effect of vasopressin administration for prevention of hypotension during hd . The strength point of our study was its comprehensiveness to review all studies about vasopressin without prejudice . One of the weak points of our study was the use of articles abstract in cases where their full text was not available.
|
Interatrial block (iab) is defined as impaired conduction between right and left atrium (la) and is reflected by prolonged p wave duration exceeding 120 ms on the surface ecg . Iab can be identified in up to 4050% of routinely performed ecgs but is frequently overlooked or ignored [1, 2]. Iab is associated with atrial electromechanical dysfunction, which in conjunction with delayed la contraction in relation to left ventricular (lv) contraction, may reduce cardiac output [3, 4]. In patients with atrio - ventricular (a - v) block, iab might be partially balanced, restoring the timing in the left heart . However, iab does not always coexist with a - v conduction prolongation . Nonetheless, it has been demonstrated that raa pacing may induce or exacerbate intra- and interatrial conduction disturbances [5, 6]. Biatrial (bia) pacing is one of the methods of reducing iab and decreasing the incidence of atrial tachyarrhythmias [79]. With respect to cardiac hemodynamics, however, the superiority of bia over standard raa pacing remains controversial as data from available studies are conflicting [1014]. Firstly, we aimed to investigate whether patients with iab and intact a - v conduction (i.e., patients without the balancing effect of prolonged a - v conduction) could benefit from bia in comparison to raa pacing in terms of hemodynamic performance . Secondly, we aimed to determine the influence of both pacing modes on prognostic markers: atrial natriuretic peptide (anp), brain natriuretic peptide (bnp), high sensitivity c - reactive protein (hs - crp), interleukin 6 (il-6), and neopterin . The study was conducted in patients with bia pacemakers implanted as a standard practice in our center in the course of 1 year due to sinus node dysfunction, documented symptomatic recurrent atrial fibrillation (af), signs of advanced intra- and interatrial conduction delay, and with indications for routine coronary angiography according to current european society of cardiology guidelines . Inclusion criteria were defined as follows: p - wave duration 120 ms during sinus rhythm, preserved a - v conduction (pq interval 200 ms), and more than 85% of pacing during 4 weeks before inclusion . Exclusion criteria included the following: structural heart disease, af requiring cardioversion within 4 weeks before and throughout the study, symptomatic heart failure (hf) new york heart association (nyha) class iii or higher, active infections, history of malignancies and connective tissue diseases, anti - inflammatory / immunosuppressive treatment, and acute coronary syndrome within 3 months before enrolment . All patients with any af episode during the hemodynamic assessment patients were excluded from the biochemical part of the study if af lasted longer than 24 h or required cardioversion . Initially, 34 patients fulfilled inclusion criteria, 6 of whom were excluded from analysis due to infection (1) and af recurrences (5). The study protocol was approved by the ethics committee of the medical university of lublin, poland and followed the guidelines of the declaration of helsinki . 1study protocol all patients had bia pacing system utilizing standard dual chamber pacemaker (axios dr or philos dr, biotronik gmbh, germany) implanted at least 6 weeks (6 to 45 weeks, median 8 weeks) before enrolment . Atrial channel was connected to the lead positioned in raa and ventricular channel to the lead implanted in mid / distal coronary sinus (cs) (corox la - h, biotronik gmbh, germany, bipolar, passive fixation). During bia pacing, an a - v delay was set to 15 ms . In order to ensure stable atrial pacing, the basic rate was programmed at least 10 bpm above intrinsic sinus rate (aai mode) to keep baseline heart rate 6075 bpm (depending on baseline bradycardia) and was constant throughout the study . In each patient, 100% pacing was ensured during echocardiographic and hemodynamic studies and at least 85% during biochemical study . At the beginning of the study and each time the pacemaker was reprogrammed, the raa and cs thresholds were checked, and the pacing impulse amplitude was programmed at least twice the measured pacing threshold . Investigators who performed hemodynamic and echocardiographic measurements and laboratory tests were blinded to the pacing mode . Standard invasive hemodynamic measurements were obtained in fasting patients in supine position following routine coronary angiography . Measurements were recorded after at least 5-min randomly assigned pacing mode raa or bia . Then, the pacing mode was switched to the other one (raa or bia), and after at least 5 min, measurements were repeated . Echocardiography was performed following the joint guidelines of the european association of echocardiography and the american society of echocardiography using commercially available ultrasound system (ie33, philips). La volume was measured from standard apical two- and four - chamber views at end - systole . La volume index (lavi) was calculated by dividing the la volume by body surface area . The closure of the mitral valve was determined from the parasternal long view using m - mode and timed to the qrs complex . Two weeks after hemodynamic measurements, the second part of the study was conducted in the same population . Anp, bnp, hs - crp, il-6, and neopterin were assayed twice: after 7 days of bia and 7 days of raa pacing in randomly assigned order (cross - over design). Blood samples were collected in fasting patients after at least 30 min of rest in supine position . Blood samples taken for cytokine analysis were immediately centrifuged (4,000 rpm for 10 min at 4 c). Concentrations of hs - crp (ibl, usa), il-6 (r&d, uk), and neopterin (r&d, uk) were determined with commercially available elisa test kits in accordance with manufacturers recommendations . Samples for anp and bnp measurements were collected into ice - chilled tubes containing edta and aprotinin, centrifuged (2,000 rpm for 20 min at 4 c), frozen, and stored at 80 c until assay . Anp and bnp were assayed with commercially available elisa test kits (bnp: ibl, germany; anp: wuhan eiaab science co., ltd). All patients had bia pacing system utilizing standard dual chamber pacemaker (axios dr or philos dr, biotronik gmbh, germany) implanted at least 6 weeks (6 to 45 weeks, median 8 weeks) before enrolment . Atrial channel was connected to the lead positioned in raa and ventricular channel to the lead implanted in mid / distal coronary sinus (cs) (corox la - h, biotronik gmbh, germany, bipolar, passive fixation). During bia pacing, an a - v delay was set to 15 ms . In order to ensure stable atrial pacing, the basic rate was programmed at least 10 bpm above intrinsic sinus rate (aai mode) to keep baseline heart rate 6075 bpm (depending on baseline bradycardia) and was constant throughout the study . In each patient, 100% pacing was ensured during echocardiographic and hemodynamic studies and at least 85% during biochemical study . At the beginning of the study and each time the pacemaker was reprogrammed, the raa and cs thresholds were checked, and the pacing impulse amplitude was programmed at least twice the measured pacing threshold . Investigators who performed hemodynamic and echocardiographic measurements and laboratory tests were blinded to the pacing mode . Standard invasive hemodynamic measurements were obtained in fasting patients in supine position following routine coronary angiography . Measurements were recorded after at least 5-min randomly assigned pacing mode raa or bia . Then, the pacing mode was switched to the other one (raa or bia), and after at least 5 min, measurements were repeated . Echocardiography was performed following the joint guidelines of the european association of echocardiography and the american society of echocardiography using commercially available ultrasound system (ie33, philips). La volume was measured from standard apical two- and four - chamber views at end - systole . La volume index (lavi) was calculated by dividing the la volume by body surface area . The closure of the mitral valve was determined from the parasternal long view using m - mode and timed to the qrs complex . Two weeks after hemodynamic measurements, the second part of the study was conducted in the same population . Anp, bnp, hs - crp, il-6, and neopterin were assayed twice: after 7 days of bia and 7 days of raa pacing in randomly assigned order (cross - over design). Blood samples were collected in fasting patients after at least 30 min of rest in supine position . Blood samples taken for cytokine analysis were immediately centrifuged (4,000 rpm for 10 min at 4 c). Concentrations of hs - crp (ibl, usa), il-6 (r&d, uk), and neopterin (r&d, uk) were determined with commercially available elisa test kits in accordance with manufacturers recommendations . Samples for anp and bnp measurements were collected into ice - chilled tubes containing edta and aprotinin, centrifuged (2,000 rpm for 20 min at 4 c), frozen, and stored at 80 c until assay . Anp and bnp were assayed with commercially available elisa test kits (bnp: ibl, germany; anp: wuhan eiaab science co., ltd). Differences between measurements were compared with wilcoxon s non - parametric test . A p value <0.05 was considered statistically significant . Initially, 34 patients fulfilled the inclusion criteria, 6 of whom were excluded from analysis due to infection (1) and af recurrences (5). Two patients developed af during the hemodynamic examination and 3 during the biochemical part of the study . Consequently, 28 patients were analyzed (15 males, 13 females; mean age 66.6 years). Results of ecg and echocardiographic and invasive hemodynamic measurements are presented in table 2 . Bia pacing, in comparison to raa pacing, resulted in statistically significant shortening of p wave duration (115 11 vs. 173 15 ms; p = 0.0001) and pq interval (190 10 vs. 221 14 ms; p = 0.0002).table 1patient characteristics (n = 28)numberwith coronary artery disease28with hypertension18with heart failure class nyha i19 nyha ii7with diabetes8mean left ventricular diastolic dimention (cm)4.7 0.5mean right ventricular dimension (cm)2.7 0.3mean ejection fraction (%) 57 4mean left atrial diameter (cm)4.4 0.4mean p wave duration during sinus rhythm in lead ii (ms)145 13mean pq interval during sinus rhythm in lead ii (ms)185 15mean qrs duration (ms)92 12pharmacotherapy (%) acei64 arb21 beta - blocker72 propafenone43 amiodarone14 loop diuretic28 vka72 asa75acei angiotensin converting enzyme inhibitor, arb angiotensin receptor blocker, asa acetylsalicylic acid, vka vitamin k antagonisttable 2effect of pacing site on cardiac hemodynamics, biochemical markers, and ecg parametersmeasurement / marker / parameterbiapraapp valuehemodynamic measurements rap (mmhg)5.6 2.36.0 2.1ns rv esp (mmhg)28.3 7.027.5 7.5ns rv edp (mmhg)7.4 2.57.8 2.8ns mpap (mmhg)18.1 4.417.9 4.3ns pcwp (mmhg)11.0 1,912.9 2.10.02 map (mmhg)106.3 12.5104.4 12.7ns co (l / min)4.9 0.84.1 0.70.02 ivcp (mmhg)6.5 3.57.1 4.1nsechocardiographic measurements vtim (cm)12.1 2.19.9 2.00.01 evmax (cm / s)96 1187 10ns avmax (cm / s)107 1090 110.04 e / a ratio0.89 0.120.88 0.12ns dte (ms)170 18175 19ns ivrt (ms)94 1097 9ns la area (cm)24 524 6ns lavi (ml / m)41 542.5 5.5ns mr area (cm)3.3 0.73.9 1.3ns p - a onset (ms)87 11119 150.0001 p - a peak (ms)146 11190 170.0001 p - a end (ms)214 16276 150.0001 a end - mc71 3236 550.001 aovti (cm)34 530 80.02 aopep (ms)108 18105 17ns lvet (ms)295 17289 19nsbiochemical markers anp (pg / ml)199 45265 480.002 bnp (pg / ml)122 32142 41ns hs - crp (mg / ml)2.1 0.42.8 050.02 neopterin (pg / ml)11.8 3.114.8 3.30.03 il-6 (pg / ml)4.4 0.65.3 0.70.02electrocardiographic parameters paced p wave duration (ms)115 11173 150.0001 pq interval (ms)190 10221 140.0002 qrs duration (ms)91 1292 11ns mean pacing rate (bpm)65 766 7nsmeasurements during bia and raa pacings at a fixed rate were compared (n = 28)a end - mc interval between the end of the atrial filling wave of transmitral flow and the mitral valve closure, anp atrial natriuretic peptide, aopep left ventricular pre - ejection time, aovti aortic velocity time integral, avmax peak atrial filling velocity, bnp brain natriuretic peptide, co cardiac output, dte deceleration time of early filling velocity, lvet left ventricular ejection time, evmax peak mitral early filling velocity, hs - crp high sensitivity c - reactive protein, il-6 interleukin-6, ivcp inferior vena cava pressure, ivrt isovolumetric relaxation time, la left atrial area, lavi left atrial volume index, map mean arterial pressure, mpap mean pulmonary artery pressure, mr mitral regurgitation area, ns not significant, p - a interval between the beginning of the atrial pacing spike and the onset / peak / end of mitral atrial filing wave, pcwp pulmonary capillary wedge pressure, rap right atrial pressure, rv esp / edp right ventricular end - systolic / end - diastolic pressure, vtim mitral velocity time integral patient characteristics (n = 28) acei angiotensin converting enzyme inhibitor, arb angiotensin receptor blocker, asa acetylsalicylic acid, vka vitamin k antagonist effect of pacing site on cardiac hemodynamics, biochemical markers, and ecg parameters measurements during bia and raa pacings at a fixed rate were compared (n = 28) a end - mc interval between the end of the atrial filling wave of transmitral flow and the mitral valve closure, anp atrial natriuretic peptide, aopep left ventricular pre - ejection time, aovti aortic velocity time integral, avmax peak atrial filling velocity, bnp brain natriuretic peptide, co cardiac output, dte deceleration time of early filling velocity, lvet left ventricular ejection time, evmax peak mitral early filling velocity, hs - crp high sensitivity c - reactive protein, il-6 interleukin-6, ivcp inferior vena cava pressure, ivrt isovolumetric relaxation time, la left atrial area, lavi left atrial volume index, map mean arterial pressure, mpap mean pulmonary artery pressure, mr mitral regurgitation area, ns not significant, p - a interval between the beginning of the atrial pacing spike and the onset / peak / end of mitral atrial filing wave, pcwp pulmonary capillary wedge pressure, rap right atrial pressure, rv esp / edp right ventricular end - systolic / end - diastolic pressure, vtim mitral velocity time integral there were pronounced differences in the transmitral flow assessed by pw doppler between the two pacing modes . Intervals from atrial pacing spike on the ecg to the onset (p - a onset), peak (p - a peak), and end (p - a end), of the mitral atrial filling wave (a) were significantly shorter during bia in comparison to raa pacing (87 11 vs. 119 15 ms, p = 0.0001; 146 11 vs. 190 17 ms, p = 0.0001; 214 16 vs. 276 15 ms, p = 0.0001). Mitral inflow velocity time integral (vti) (12.1 2.1 vs. 9.9 2.0 cm; p = 0.01) and peak velocity of the mitral atrial wave (avmax) (107 10 vs. 90 11 cm / s; p = 0.04) were higher during bia pacing . Intervals between the end of the atrial filling wave of transmitral flow and the mitral valve closure (a end - mc) were significantly longer during bia in comparison to raa pacing (71 32 vs. 36 55 ms; p = 0.001). In invasive hemodynamic examination, we observed beneficial effects of bia in comparison to raa pacing on cardiac hemodynamics . Bia pacing resulted in higher cardiac output (co) (4.9 0.8 vs. 4.1 0.7 l / min; p = 0.02) and lower pulmonary artery wedge pressure (pcwp) (11.0 1.9 vs. 12.9 2.1 mmhg; p = 0.02). In biochemical study, we demonstrated significantly lower serum concentrations of anp, hs - crp, il-6, and neopterin after 1 week of bia in comparison to raa pacing . There were no differences in total blood count, serum urea, creatinine and glomerular filtration rate between both pacing modes . Raa is the standard lead position routinely used for permanent atrial pacing even in patients with coexisting interatrial conduction abnormalities . It has been demonstrated that raa pacing exacerbates interatrial conduction disturbances and has unfavorable proarrhythmic and hemodynamic consequences . However, it is still a matter of debate whether bia in comparison to standard raa pacing could improve hemodynamics and prognosis in individuals with iab . In our study, invasive hemodynamic measurements revealed co increase and pcwp reduction during bia in comparison to raa pacing . Previous invasive hemodynamic studies indicating that bia pacing might increase co and decrease pcwp, when compared to high right atrium, concerned patients with iab and dual chamber pacing (ddd) pacing [10, 12]. In order to elucidate the hemodynamic effect of pure bia and raa pacing and to avoid potential influence of a - v delay and ventricular pacing during ddd stimulation, we focused on patients with intact a - v conduction . However, in both studies, echocardiography was used for lv systolic function evaluation, which obviously is less accurate than invasive measurements . Furthermore, populations in both studies were small and consisted of only 8 and 14 patients, respectively . Furthermore, patients with prolonged a - v conduction and heart failure associated with interventricular conduction abnormalities were not excluded, which might have blunted the effect of bia and raa pacing on cardiac hemodynamics . Consisted of patients with bradycardia tachycardia syndrome, and the interatrial conduction was not specified . It has been already demonstrated that patients without baseline iab do not benefit from bia pacing compared to sinus rhythm, while raa pacing has an unfavorable hemodynamic effect in this group . In our study, echocardiographic examination revealed higher vti of the mitral inflow as well as aortic vti during bia vs. raa pacing, which confirms with the observations made by matsumoto et al . . More synchronous la segment contraction during bia in comparison to single site (raa or cs) pacing might explain this observation [17, 18]. A positive influence of bia pacing on global systolic la function was observed in the stunned atrium after cardioversion of persistent af . It has also been demonstrated that raa pacing exacerbates interatrial conduction disturbances leading to unfavorable hemodynamic consequences . Raa pacing was detrimental to cardiac electromechanical function when compared to sinus rhythm . Since no measurements during sinus rhythm were performed in our study (because of substantial bradycardia), we cannot rule out the possibility that what we observed was not an advantageous effect of bia but only a correction of an unfavorable effect of raa pacing . Analysis of mitral inflow during raa pacing revealed that in the majority of our patients, there was no a end - mc delay, which suggested that lv contraction interrupted atrial filling . This effect was not observed during bia pacing, which prolonged left heart a - v interval . Lv activation occurs earlier during bia in comparison to raa pacing, and consequently pq interval is shortened . However, la is also preactivated, which results in shorter p - a onset, p - a peak, and p - a end of the doppler mitral a filling wave . The effects of change in left a - v timing (pq duration, p - a intervals, duration of e and a waves, ventricular relaxation, and velocity of transmitral flow (peak mitral early filling velocity / evmax and peak atrial filling velocity / avmax)) should not be considered the independent benefits of bia pacing because they are mutually dependent and are finally reflected in mitral and aortic vti as well as co. improved co during bia, in comparison to raa pacing, may be due to increased preload as a result of increased mitral inflow . Lv relaxation begins as an initial diastolic process, and lv pressure falls rapidly as the lv expands . Myocardial relaxation continues during early diastole to reach the minimal lv diastolic pressure, which helps with sucking and pulling the blood actively into the lv . Lv pressure then rises and the early diastolic filling decelerates until the time of atrial contraction when la pressure increases again to initiate the late filling and to complete diastole . It is becoming higher with shorter deceleration time (time from the peak to the baseline) as diastolic function deteriorates with increasing filling pressure . Relaxation abnormalities result in the reduction in the rate of lv pressure decline during the early diastole . Consequently, atrial contraction is responsible for a substantial proportion of diastolic filling . In our study, there was no difference in diastolic dysfunction indices (e / a, dte, ivrt, lavi) between bia and raa pacing groups . Additionally, these markers were within normal ranges . As there was no diastolic dysfunction in the studied population, raised mitral inflow can be primarily attributed to increased preload, resulting from optimal timing of la contraction and its contribution to lv filling [13, 22]. Previous researchers defined the effects of altered preload on the indices of transmitral doppler echocardiography [2325]. The la mechanical function can be described by three phases within the cardiac cycle [26, 27]. Firstly, during ventricular systole and isovolumic relaxation, the la functions as a reservoir that receives blood from pulmonary venous return and stores energy in the form of pressure . Secondly, during the early phase of ventricular diastole, the la operates as a conduit for transfer of blood into the lv after mitral valve opening via pressure gradient . During lv diastasis, thirdly, the contractile function of the la normally serves to augment the lv stroke volume by approximately 20% . The relative contribution of this booster pump function becomes probably more dominant in the setting of bia rather than raa pacing as a result of synchronous, thus more effective la contraction . These observations are convincing in the light of previous research, which suggested that the improvement of la contractile function, expressed as la ejection fraction, is possible after the reversion of atrial cardiomyopathy developed as a consequence of af . It is well established that raa pacing impairs inter- and intra - atrial conduction and prolongs pq interval; on the other hand, bia pacing shortens it, in comparison to sinus rhythm [18, 20, 30, 31]. Pq interval shortening might be the effect of quicker conduction from cs to a - v node in comparison to conduction from raa to a - v node . Additionally, the presence of two simultaneous depolarization wavefronts during bia pacing increases the possibility of going round potential slow conduction areas in the atria [9, 32, 33]. In our study, bia pacing turned out to be associated with lower serum anp as well as lower proinflammatory hs - crp, il-6, and neopterin concentrations in comparison to raa pacing . Both reduced anp levels and pcwp indicate that mean atrial pressure and stretch are lower during bia in comparison to raa pacing . This might be due to more synchronous atrial contraction and better a - v timing, which in this case is related to the increase of interval between the end of the atrial filling wave of transmitral flow and the mitral valve closure . This, in turn, prevents premature closure of the mitral valve before the completion of atrial contraction . If a - v conduction is intact, the iab during raa pacing shortens the time available for la activation, which is associated with premature mitral closure, abbreviated la contraction, and therefore higher la pressures and associated anp levels . Lower atrial pressure and stretch during bia pacing could partially explain its anti - arrhythmic effect [9, 35] since atrial stretch shortens the atrial refractory period, prolongs the interatrial conduction time, and increases the dispersion of refractoriness . Our study is the first to report that bia in comparison to raa pacing could be associated with the reduction of unfavorable prognostic proinflammatory markers of hf (hs - crp, il-6, and neopterin). A substantial body of evidence supports the concept that markers of inflammation (crp and il-6) are predictors of unfavorable cardiovascular events, including heart failure development [3740] and all - cause mortality irrespective of cardiovascular disease [41, 42]. Moreover, elevated levels of proinflammatory markers such as il-6 and crp increase the risk of supraventricular and ventricular cardiac arrhythmias and their complications [43, 44]. One may, therefore, hypothesize that permanent bia pacing, in comparison to raa, might be associated with better prognosis . The national health and nutrition examination survey revealed significant correlation between p wave duration and increased cardiovascular and all - cause mortality . In our study, p wave duration during bia pacing was significantly shortened in comparison to raa pacing, which seems consistent with changes in concentrations of proinflammatory markers . However, the issue requires further research to confirm whether this anti - inflammatory effect persists in longer observation . The studied population is relatively small, and the variability of measured parameters is quite considerable . During the time, between pacemaker implantation and the experiment, we believe that even if a subtle remodeling occurred, it had no substantial effect on the study results . One should also be aware of the carry - over effect of the preceding pacing mode in the cross - over design during echocardiographic, hemodynamic and biochemical studies . For the cytokine assessment, each pacing mode was programmed for 7 days and therefore should not be extrapolated to represent the effect of chronic pacing . Five patients developed af during raa pacing, and those patients were excluded from the study to avoid effects of af on atrial function, natriuretic peptides, and cytokines . If we assume that af during raa pacing was caused by escalated left a - v dyssynchrony, the exclusion of these patients might have diminished the studied effect . Different heart rates between subjects contributed to parameter variability and theoretically may have contributed to the differences in the findings . The reproducibility of doppler measurements in our echo laboratory was 95%, which we believe had no significant effect on the overall results of our study . The studied population is relatively small, and the variability of measured parameters is quite considerable . During the time, between pacemaker implantation and the experiment, patients were programmed to bia pacing, which might have contributed to remodeling . We believe that even if a subtle remodeling occurred, it had no substantial effect on the study results . One should also be aware of the carry - over effect of the preceding pacing mode in the cross - over design during echocardiographic, hemodynamic and biochemical studies . For the cytokine assessment, each pacing mode was programmed for 7 days and therefore should not be extrapolated to represent the effect of chronic pacing . Five patients developed af during raa pacing, and those patients were excluded from the study to avoid effects of af on atrial function, natriuretic peptides, and cytokines . If we assume that af during raa pacing was caused by escalated left a - v dyssynchrony, the exclusion of these patients might have diminished the studied effect . Different heart rates between subjects contributed to parameter variability and theoretically may have contributed to the differences in the findings . The reproducibility of doppler measurements in our echo laboratory was 95%, which we believe had no significant effect on the overall results of our study . Bia pacing, in comparison to raa pacing, acutely improves hemodynamic performance in patients with iab and preserved a - v conduction and is associated with the reduction of anp and markers of inflammation (hs - crp, il-6, and neopterin). Therefore, we provide an additional argument for considering bia, instead of standard raa pacing, which could improve cardiac hemodynamics and may influence prognosis in patients with iab and preserved a - v conduction . Still, we believe that the results should be confirmed in a larger cohort of patients.
|
A 69-year - old female patient (59.3 kg, 154.6 cm, body mass index 24.8) was scheduled for total knee replacement (tkr). Past medical history revealed that the patient underwent general anesthesia for prior tkr of the other knee three years at another hospital, and the patient failed to recall any specific events associated with anesthesia other than a sore throat, which is fairly common after intubation . The patient complained of occasional mild dyspnea during exercise, but chest radiographic readings by radiology were non - specific and we pursued further testing . Spirometry (fev 2.27 liters (l), fev1 1.84 l, fvc / fev1 81%) and arterial blood gas analysis showed normal results . Both lung sounds were clear and no chest abnormalities were observed . Upon entering the operating room, the patient was monitored with electrocardiograph electrodes, pulse oximeter, bispectral monitoring, and noninvasive blood pressure . After 3 minutes of pre - oxygenation with 100% oxygen, she was anesthetically induced with propofol (60 mg) and rocuronium (30 mg). After ventilating the lungs with a facial mask for two minutes without any difficulties, initial intubation was attempted with a conventional laryngoscope with the aim of inserting a 7.0 mm internal diameter endotracheal tube (ett), which failed to pass the larynx . After a second attempt failed with a 6.5 mm internal diameter ett due to continuous resistance when passing the vocal cords, we used a glidescope (verathon inc ., burnaby, canada) to visualize and identify the source of the resistance . The glidescope view indicated that the subglottic area was divided into two sections with a septum (fig . 1). A laryngeal mask airway (lma, i - gel, 4.0, intersurgical ltd ., wokingham, uk) was inserted for temporary ventilation with a tidal volume of 7 ml / kg and 12 breaths / min, but peak airway pressures of 30 mmhg did not improve even after injection of additional neuromuscular blockade . Predicting inadequate ventilation over several hours of anesthesia with i - gel inevitably resulted in the attending anesthesiologist awakening the patient and postponing surgery until further evaluation . After reversing the neuromuscular blockade with sugammadex (bridion, msd, kenilworth, nj, usa) 200 mg, the patient regained consciousness without any respiratory symptoms and the i - gel was removed . 3) performed consecutively after surgery revealed fibrous tissue at the glottic level dividing the anterior and posterior portion into 5.8 mm and 1.7 mm lengths, respectively . An initial chest radiograph revealed evident narrowing at the level of the glottis (fig . Re - questioning the patient regarding any discomfort or complications from the previous surgery revealed that the patient suffered from severe dyspnea and dysphagia after surgery 3 years ago, which lasted several weeks . Afterwards, she complained of continuous mild dyspnea on exertion, but did not consider these symptoms to be anesthetic sequelae . An otorhinolaryngologist consulted for treatment diagnosed post - intubation tracheal stenosis, but did not recommend aggressive or invasive treatment . After constructing a plan including the use of a supraglottic airway (sga) or smaller diameter ett in case of failed regional anesthesia, the patient underwent successful surgery with continuous epidural block . The main concern with difficult intubation or in cases where intubation fails is how to improvise methods for preventing such cases from becoming catastrophic before or during induction . Thus, providing safe anesthetic care and preventing intubation - related injuries remains a critical issue . We first explored why preoperative tests such as chest radiographs, spirometry, and abga were unable to diagnose the tracheal stenosis . Because most patients remain asymptomatic until 30% of the original diameter becomes obstructed, medical history alone is insufficient in predicting difficult airways . Post - intubation tracheal stenosis may go unrecognized or even misdiagnosed as asthma in patients whose symptoms are atypical . Thus, preoperative evaluations are essential in predicting difficult tracheal intubation, but with highly predicable tests currently lacking, only 50% of patients are actually found to have a difficult airway . In addition, screening via methods such as mallampati scores or measurement of thyromental distance lack reliability . A cohort study on the diagnostic accuracy of anesthesiologists in predicting difficult airways claimed that 93% (3154 out of 3391 anticipated difficult intubations) were actually not difficult, calling into question the accuracy of the anesthesiologists' predictions and emphasizing the challenges that are constantly encountered during anesthetic preparation . Guidelines such as the difficult airway algorithm by the american society of anesthesiologists provide strategies that ensure patient safety . In addition, brichet et al . Have proposed a stepwise therapeutic algorithm for optimal management according to the severity of post - intubation tracheal stenosis . In this case, we did not evaluate the airway tree upon the initial chest x - ray and relied solely on radiology interpretations . It may be challenging to differentiate true stenosis from vocal cord closure due to tracheal narrowing, or even c7 and t1 spinous process and lamina density without significant clinical symptoms or impressions . Therefore, more specific information regarding the patient's history may be useful for additional testing . When encountering a patient with airway stenosis, an anesthesiologist would in general instinctively reattempt intubation with a narrower diameter ett, but manipulation may compromise ventilation by increasing the risks of airway resistance, intubation failure, trauma, edema, bleeding, or perforation . However, the use of smaller ett remains controversial due to the possibility of inadequate oxygen delivery and maintenance of ventilation from increased airway resistance and the work of breathing, and would not have been attempted . Even if this attempt had succeeded, potential airway edema and obstruction would have delayed extubation after observation in the intensive care unit . Positioning of the tube above or below the stenosis is also discouraged due to difficulties of proper fixation . Despite known difficulties, donaldson and michalek inserted an i - gel in a patient with no specific medical history other than having been informed to warn future anesthesiologists of her " small breathing pipe " as observed during her previous anesthesia . Furthermore, lee et al . Ventilated a patient with a previous history of pulmonary tuberculosis and suspicious chest radiography findings in the beach - chair position with an i - gel. Subglottic stenosis was visualized with a fiberscope through the i - gel in both cases . Asai and shingu used a sga and a tube - exchange catheter and inserted a reinforced 6.0 mm ett in a patient undergoing surgery in the prone position . We believe that in our case, multiple attempts at intubation may have caused laryngeal edema, elevating peak inspiratory pressures which hindered ventilation with the use of i - gel. In our backup scenario, if continuous epidural anesthesia failed, intubation may have been attempted with a 5.5 mm ett via a flexible fiberoptic bronchoscope (because the largest diameter between the septum measured 5.8 mm) and possibly fixed past the stenosis to avoid accidental extubation or tracheal damage . Finally, preventable measures should be taken in daily practice to avoid factors causing lts, such as high endotracheal cuff pressures exceeding 30 mmhg, which induce tracheal damage . Perhaps choosing an ett resistible to bending and collapse, with soft, thin - walled cuffs that are compliant, may be beneficial . Practitioners should also consider improvements in high - volume low - pressure cuffs by switching from standard polyvinylchloride cuffs to polyurethane cuffs or the use of taperguard tubes to decrease the length of cuff contact with the trachea and internal pressure, thereby reducing the incidence of compromised capillary perfusion resulting in tissue ischemia and proliferation . At this time, because no clear recommendations or definite data indicate that one method is superior to the other, it may be best to adhere to the recommended internal cuff pressures and continuously check for over - inflation during surgery . However, with detailed history taking and comprehensive reevaluation, its cause can be determined . Anesthesiologists must always be prepared with anesthetic management plans that ensure patient safety in case of failure.
|
Quinolones, one of the commonly used broad spectrum antibacterials, are frequently associated with neuropsychiatric adverse effects . These may range from dizziness, headache, and sleep disturbances being the frequent ones, anxiety, suicidal ideations, delirium, hallucinations, agitation, confusion, psychosis, and catatonia being the other severe adverse events . Psychiatric adverse events in the form of manic reactions due to quinolones had been mostly reported to the food and drug administration (fda) and the world health organization (who) without sufficient clinical details, as well as validity of their diagnosis . Mania secondary to typhoid, dengue, and other febrile conditions have also been reported in literature . Typhoid fever has been shown to be associated with a range of neuropsychiatric manifestations with delirium being the most common presentation anteceding or occurring concomitantly with the fever mania is reported rarely . We report a case of recurrent mania, which developed each time, the patient was exposed to quinolone antibiotics . Ad is a 34-year - old homemaker, who previously, had two manic episodes with no family history of mental illness / bipolar affective disorder . She was not treated for the first episode and remitted within 1 month of the treatment with olanzapine 10 mg / day, and lithium carbonate 600 mg / day for the second episode . The index episode started in february 2014 when she developed fever, nausea, and vomiting acutely . She took paracetamol 500 mg orally with which fever subsided for once, but it recurred after 2 days and did not remit despite taking antipyretics further . She consulted a physician after 1 week of onset of fever (10 day) who diagnosed her with typhoid fever on the basis of serological investigations only (widal test positive; titers for agglutinin o> 1:160 and agglutinin h> 1:160); prescribed her oral ciprofloxacin 500 mg twice a day for a week . Fever subsided within the next 2 days, and she was asymptomatic for the next 5 days when vomiting and diarrhea recurred along with headache . Ciprofloxacin was continued for 1 more week . Though above mentioned symptoms remitted in the next 2 days, she was noted to get up early in the morning; would bath early and then start doing household chores . She became more active, indulged herself into multiple tasks at the same time, and left them incomplete . Her family reported her to be very cheerful, amusing, and jocular which was unlike her previous self . She increasingly participated in religious activities, indulged in unnecessary buying of clothes and jewellery . She took ciprofloxacin for 4 more days in that week . Despite stopping the medication, thereafter no improvement was noted . In the next 2 weeks there was no history of altered sensorium, disorientation, and any perceptual abnormalities . As she became unmanageable her general physical examination did not reveal any abnormality suggestive of either metabolic disorder or cerebrovascular disease . She was not receiving any other medications nor did she abuse any psychotropic substances such as cocaine or amphetamines . She was treated with olanzapine 10 mg and lithium carbonate 600 mg / day which was later on increased to 800 mg / day to achieve optimum serum lithium level . She achieved complete remission within 6 weeks . In her past, she had suffered from gastroenteritis at 45 occasions but sought treatment only on two occasions . These two episodes of gastroenteritis, which occurred 10 and 8 years back, were treated with ciprofloxacin and ofloxacin, respectively, but prescriptions were not available . On both occasions, she developed similar set of mental symptoms as in the index episode characterized by elated mood, decreased need for sleep, increased goal - directed activity, increased religiosity, over - talkativeness, and increase in goal - directed activities though severity were less . Hence, the diagnosis of medication - induced recurrent mania as per diagnostic and statistical manual of mental disorders fifth edition was kept . The patient and family members were cautioned for the use of quinolones in future as these were implicated as etiological in her mental illness . Krauthammer and klerman gave the concept of mania occurring in association with physical disorders, medications, and drugs of abuse which was labeled as secondary mania . An analogy to medical syndromes of multiple etiologies such as hypertension (essential vs. secondary) and parkinsonism (idiopathic vs. secondary) have also been drawn . Although the etiological dichotomy and validity of manic syndromes into primary versus secondary have been given on the basis of (1) close temporal association with an organic insult, (2) onset at a later age, (3) predominantly negative family history, and (4) negative premorbid history but we are still far from exact neurobiological etiology . Since the work of krauthammer and klerman, there have been many reports of secondary mania due to various etiologies . Without going into literature review of secondary mania, we here give the common causes of this syndrome which include medications (corticosteroids, isoniazid, levodopa, antibacterials, thyroxine, sympathomimetic drugs, chloroquine, baclofen, captopril, amphetamine, phencyclidine, and various anti - depressants), infectious diseases (such as viral encephalitis), metabolic (hemodialysis), intracranial neoplasms (meningioma), temporal lobe epilepsy, and head injury . The occurrence of mania has been reported in typhoid fever as well as with the use of a range of antibiotics, quinolones being the most notorious . However, typhoid fever as an etiological factor for manic reactions is not very commonly reported . In one of the previous case reports of mania in typhoid fever, the patient was afebrile at the time of onset of manic symptoms but was receiving ciprofloxacin, while in other case there were many other confounding factors, thus making it difficult to tease out the causative agent for hypomanic symptoms . In a retrospective review of the neuropsychiatric manifestations in 959 patients with typhoid fever, no case of mania was reported . On the other hand, mania in relation to antibiotics 103 cases were found in un-/published literature with the quinolone group of antibacterials being implicated as the causative agent in 48 (46.7%) cases . In another recent review of adverse drug reactions of quinolones, mania was reported most frequently and in association with the use of ciprofloxacin probably due to its wider use . Both of these reviews relied on the data provided by the fda and who, which in turn reported these adverse drug reactions during postmarketing surveillance . Although the mechanism of antibacterials leading to mania is unclear, the proposed hypothesis is their interactions with neurotransmitters, but competitive inhibition of gamma - aminobutyric acid receptors and induced epileptogenic neurotoxicity is suggested with reference to quinolones ., there was temporal relationship of onset of mania with use of quinolones in all the episodes and in addition to typhoid fever for the current episode . For the first two episodes, there was no fever, and information of the use of quinolones was only available from the caregiver . In addition, there are no reports of mania in gastroenteritis . However, in the current episode both the laboratory evidence of typhoid fever and prescription of ciprofloxacin were medically documented . By the time, the patient developed mania her fever had subsided and thus only ciprofloxacin can be incriminated as the causative agent . Although there are some pointers that establish the association of manic syndrome with the use of quinolones in the form of (1) occurrence of mania following quinolone use, (2) negative family history, (3) no independent manic reactions premorbidly (if the previous two episodes are also attributed to the use of quinolones); however, there is no definitive test to establish the specificity and strength of association which is a major limitation . Another limiting factor in this report is the lack of documented evidence of prior quinolone use and our reliance on the arbitrament of the caregiver . Antibiotics are one of the commonly used drugs at each level of healthcare including the primary care . It is prudent to be aware of such rare side effects of antibiotics, which might need the attention of a specialist mental health professional . Hence, it is recommended that a close watch to be kept for serious psychiatric manifestation in patients receiving quinolone antibiotics.
|
Posterior pelvic exenteration (ppe) is a significant procedure to achieve complete tumor removal within the pelvis in the surgical treatment of primary advanced ovarian cancer or, less frequently, of recurrent disease . In most cases of this supralevator - type resection a low colorectal anastomosis, which is usually located 4 to 7 cm above the anocutan line, is possible because the infraperitoneal rectum is preserved from invasion by the pelvic mass . Current studies, including a review of literature, report a frequency of clinically significant anastomotic leakage in up to 10%, mostly less than 4% . Anastomotic dehiscence is associated with an increased early and long term morbidity and mortality, mostly accompanied by a surgical re - intervention, a longer hospitalization, an impairment of anorectal function, and a delay of subsequent chemotherapy [1 - 5]. A 44-year old woman (gravida 2, para 1) underwent an optimal debulking surgery defined as complete tumor removal because of ovarian cancer figo stage iiic characterized by a pronounced intraperitoneal tumor spread . Midline laparotomy includes the following procedures: posterior pelvic exenteration (ppe; en bloc resection of inner genitals, about 19 cm rectosigmoid and complete pelvic peritoneum), infragastric omentectomy, appendectomy, extensive deperitonealization of the right hemidiaphragm, removal of multiple peritoneal tumor deposits and, finally, a systematic pelvic and para - aortic lymph node dissection . The anastomotic doughnuts were complete and, additionally, the integrity of anastomosis was tested by insufflation of methylene blue - stained saline solution . Histopathology revealed a serous adenocarcinoma originating from the ovaries (tnm - classification: pt3c, pn1 [5/97], pm1 lym [1/19], l1, v0, g3). The patient's postoperative recovery was uneventful over the next few days and her condition improved continuously . However, increased inflammation indicating values, leukocytes and c - reactive protein, decreased only gradually . After exclusion of possible foci a' blind' antibiotic treatment with cefuroxim and metronidazol was initiated on postoperative day 5 . Despite this therapy, the patient had complained of fever up to 38.5 every afternoon since the eighth day . On day 11 after surgery, leukocytes and c - reactive protein increased considerably in comparison with the values of the day before (11.3 15.510/l; 146.2 an abdominopelvic computer tomography scan revealed infected lymph cysts surrounding the iliac vessels on both sides (right, 76 cm; left, 87 cm), but there was no suspicion of any anastomotic leak . Regardless of the continued high temperature during the afternoon, the patient felt relatively comfortable; her bowel function was inconspicuous . One day later, the causal diagnosis of an anastomotic dehiscence, located 5 cm above the anocutan line, was demonstrated by transvaginal ultrasound (fig . Considering the patient's condition, it was decided to attempt an endo - sponge assisted treatment (fig . A parenteral nutrition for two weeks was initiated and during the nine - day transanal vacuum therapy the sponge was changed twice . Subsequently, a bowel rinsing was semi - weekly performed over the following two weeks (fig . The anastomotic leakage healed successfully and the patient recovered uneventfully and was discharged on postoperative day 29 . The first cycle of combination chemotherapy consisting of caboplatin auc 5 and paclitaxel 175 mg / m2 could be applied two weeks later . The application of transvaginal ultrasound to diagnose a leakage of colorectal anastomosis has not been previously described . The diagnostic criteria are the discontinuity of the rectal wall and an oscillating fluid flow between the bowel lumen and a surrounding hyperechogenic fluid collection, which is induced by pushing in the bowel wall by means of the ultrasound probe . In our opinion, ultrasound diagnostics should be integrated early in the diagnostic management of divergences from the expected course after any surgery . Further points of interest are the use of protective stoma to prevent anastomotic leakage and the treatment options of this complication in patients receiving ppe for ovarian cancer . The authors of a multicenter study concluded that a temporary protective stoma should be considered only exceptionally, because the rates of " anastomotic fistula " were the same with and without stoma, respectively (8.5% vs. 8.2%). In addition, there are only a few published studies including small numbers of patients . If an anastomotic dehiscence occurs, a re - operation to secondarily create a covering ileo- or colostomy or to drain the pelvic cavity in order to prevent severe septic complications is necessary in the majority of these cases . The endoluminal vacuum therapy of anastomotic leakages has been increasingly applied following resections in both the upper and lower gastrointestinal tract over the last few years . This approach can be integrated into both a surgical and conservative treatment regime, but the therapeutic effectiveness has not been verified by randomized clinical trials . Reports about the application of this method in the field of gynecologic oncology are absent . Our case demonstrates, firstly, that anastomotic leakage of colorectal anastomosis can be obviously diagnosed by transvaginal ultrasound and, secondly, in selected cases characterized by a small leak size and a local peritonitis confined to the pelvis, an attempt of conservative management based on transanal vacuum therapy is justified and may avoid creating a secondary diverting stoma.
|
Vaccines are one of the most successful medical interventions in human history and estimated to prevent more than 2.5 million deaths every year [1, 2]. In essence, vaccination is about convincing the immune system to treat a noninfectious artificially introduced substance as an invading pathogen and to raise an immune response that would protect the vaccine from future infection . Vaccination ideally induces an immune response equal to or better than that caused by natural infection . As a result, long - term immunity against a pathogen can be obtained that prevents the individual from disease as well as from transmitting the pathogen thus contributing to the herd protection of the whole society . The history of vaccination is considered to have started with edward jenner's experiments in 1796 showing that vaccination with pus from milk maids' blisters caused by cowpox protected humans against smallpox . Since then, the science of vaccines has come a long way, from using inactivated pathogens or toxins and attenuated live pathogens to recombinant subunit and glycoconjugate vaccines, and most recently towards structurally designed epitope - focused vaccines . In its simplest form, effective vaccination can be achieved with inactivated or attenuated pathogens . This has been and still remains the best available solution against many diseases such as measles, mumps, and varicella . Such vaccines have resulted in complete or almost complete eradication of devastating diseases like smallpox and polio . Despite the proven effectiveness in many cases, inactivated pathogens do not always generate adequate protection and attenuated pathogens have safety concerns caused by possible reverse mutations . Further, the logistics of immunizing people in developing countries with live attenuated vaccines is problematic due to the often strict requirements of an uninterrupted cold chain to keep the pathogens alive . Live attenuated vaccines also pose an increased risk for immunocompromised subjects that may not be able to respond adequately to limit the infection . In the 1970s, glycoconjugate and recombinant subunit vaccines revolutionized the field allowing the development of safer and more effective vaccines . Glycoconjugate vaccines superseded the previous capsular polysaccharide vaccines, enabling efficient t - cell activation required for long - term immunity . The general mechanism of how the carrier protein helps in t - cell engagement is still, however, unconfirmed [4, 5]. Glycoconjugate vaccines have proven successful against a number of bacterial pathogens such as haemophilus influenzae type b, neisseria meningitidis serotypes a, c, w-135, and y, and streptococcus pneumoniae . All of the current glycoconjugate vaccines target bacterial pathogens, but the technology is also potentially suitable against viruses like hiv, since their main antigens are highly glycosylated and some of the broadly neutralizing antibodies (bnabs) have been shown to bind to glycan moieties on the envelope attachment and fusion protein (env) surface . The advent of recombinant dna technology in the late 1970s was quickly adopted in the vaccines field . The new techniques enabled heterologous large - scale production of single proteins from pathogens and their modification in order to optimize proteins for vaccine use (e.g., by detoxification of undesirable catalytic activity). Recombinant subunit vaccines initially proved their usefulness against viruses like hepatitis b virus [8, 9] and human papilloma viruses but have since also been used in bacterial vaccines . An example of this is the recently approved 4-component vaccine against neisseria meningitidis serogroup b (menb) (bexsero) that is composed of three recombinant proteins and an outer membrane vesicle preparation from the bacteria . This menb vaccine is also the first vaccine approved for human use for which the starting point of development relied on genomic data and bioinformatics to select the initial pool of antigen candidates by reverse vaccinology (rv). The great developments in the speed of dna sequencing and the associated computational methods have enabled large - scale antigen mining by rv and it has already been used for several pathogens [1217], mainly bacteria, but recently also for herpes simplex virus to find surface expressed or secreted antigen candidates . Initially, candidates are often found to be suboptimal in terms of stability, safety, immunogenicity, or generating broad protection against all strains of the pathogen . Structural vaccinology (sv) is a rational approach that can be used to address these issues . Major aims in sv are the identification of protective b - cell epitopes on the antigens and optimizing the antigens in terms of stability, epitope presentation, ease of production and safety . Sv is a symbiosis between experimental methods like x - ray crystallography, electron microscopy and mass spectrometry, and computational methods like structural modeling, computational scaffold design and epitope prediction . Recent breakthrough examples in the fields of respiratory syncytial virus (rsv), human immunodeficiency virus 1 (hiv-1), menb and group b streptococcus (gbs) indicate that sv has the potential to become another revolutionary step in vaccine development given that many of the important infectious diseases currently not preventable by vaccines are not amenable to traditional approaches . In this review we discuss the experimental and computational aspects of three key modules of a modern vaccine development pipeline: reverse vaccinology, epitope characterization, and structure - based antigen optimization and design . Of the myriad of experimental methods, algorithms, and software developed for these approaches, we highlight the ones we consider of highest practical relevance for vaccine development . We summarize our view of the whole vaccine development process for current and near future vaccines in figure 1 . Traditionally, vaccine antigen candidates for subunit vaccines have been selected based on experimental data on function, abundance, and immunogenicity . These methods may have overlooked many potentially excellent candidates present with high abundance under the natural conditions during colonization and infection but which may have been present only in lower amounts on the pathogen surface during experimental characterization of antigen expression under laboratory conditions . Initially with shotgun sequencing approach and more recently with next - generation sequencing allowing rapid determination of sequences of whole genomes, vaccine candidate discovery especially on bacterial pathogens has shifted more towards computational prediction of suitable vaccine antigen candidates from genomic sequences using rv . To date, a number of different methodologies have been developed for high - throughput genomic sequencing of which the most commonly used are the sequencing by synthesis (illumina), ion semiconductor detection (life technologies), pyrosequencing (roche diagnostics), and more recently single - molecule real time sequencing (pacbio). Common to most ngs technologies, the output is a set of millions or even billions of short (50700 bases) sequence reads accompanied by a base - call quality metric . Thus, a major part of any ngs project is assembling the short reads together in a precise and reliable manner . Assembling raw sequencing data of a whole genome is still not trivial and every sequencing technology has its typical types of reads characteristics and sequencing errors that have to be accounted for . A detailed review of assembly methods is beyond the scope of this paper, but we suggest looking into other reviews for a description of the current state of the art [27, 28]. With the number of sequenced bacterial genomes already in the tens of thousands and availability of multiple, for some bacteria> 100, complete genome sequences, it has become possible to use a core set of genes shared by all strains in the rv computational analysis [16, 38]. Alternatively, the availability of multiple genome sequences from one species enables a comparison between the genomes of pathogenic and nonpathogenic strains, which can reveal genes important for pathogenesis that can often be good vaccine antigen candidates . The first step of any rv approach is to predict all orfs from the genomic sequence and pass them individually through several computational selection filters . In the classical rv approach the features selected are based on the assumption that, in order to be available for interactions with protective antibodies, the antigen has to be either surface - associated or secreted . Features that are typically computationally analyzed include transmembrane domains, leader peptides, homology to known surface proteins, lipoprotein signatures, outer membrane anchoring motifs, and host cell binding motifs such as rgd . The main software that was used in the first rv projects and has retained its popularity is psort, now in its third generation for prokaryotic sequences . Since the initial version of psort, a number of other software packages for protein cellular localization prediction in bacteria have been published, most using support vector machines on experimental datasets to train the software for prediction [4044]. Since psort remains one of the most widely used subcellular localization prediction software packages in rv, we briefly describe its underlying principles here . Psort comes with its own database psortdb composed of several thousand proteins with experimentally verified subcellular localization that it uses as a reference set for queries . Psort is a modular program analyzing several features known to be relevant for protein localization like sequence homology to proteins with known localization, signal peptides, amino acid composition, and motifs . In its latest versions psortb 2.0 and psortb 3.0 the software has also been trained against an extended psortdb dataset using an n - peptide composition - based support vector machine, a kernel learning algorithm to improve the percentage of proteins for which a prediction is reported . Psortb 3.0 covers all prokaryotes, including archea and bacteria with atypical cell wall or membrane topologies, and was reported to predict the subcellular localization with over 95% precision and with a recall of over 90% for both gram negative and positive test datasets . In general, based on subcellular location only, a large fraction (typically around 30%) of the whole proteome gets selected . In the first applications of rv on menb an astonishing number of 350 candidates and for gbs 312 candidates were expressed and tested in mice to find promising vaccine antigens [11, 16]. Carrying such a large panel of proteins through the whole workflow of cloning, expression, and purification and above all animal experiments is impractical, which has led to the development of narrowing methods combining computational and experimental, mainly mass spectrometric (ms), methods [4648]. Identification of an antigen candidate by ms provides proof of expression and can confirm surface localization . Expression can, however, vary in different culture conditions and what is observed in vitro may not always be representative of in vivo conditions . Several purely computational methods, summarized in table 1, have also been specifically developed for rv purposes . Nerve added, on top of psort subcellular localization analysis, exclusion of multipass membrane proteins and human homologues and positive selection for adhesin - like features, that is, proteins likely to have host cell adhesion functions . Jenner - predict, while using some of the same filtering criteria as nerve and vaxign, put more weight on the known host - pathogen interaction domains on proteins . Vacceed framework extended the vaccine antigen prediction also to eukaryotes, which are typically much more challenging targets due to their complexity compared to prokaryotes . Also approaches based on existing experimental data on features of known protective antigens have been used in vaccine antigen prediction . Vaxijen uses an alignment - free approach and is based on statistical methods using auto - cross covariance transformation of protein sequences into uniform vectors of principal amino acid properties . For whole proteomes, vaxijen was, however, reported to identify a set of proteins almost as large as traditional rv approaches . To increase selectivity, another method based on identification of structural and functional features in known bacterial protective antigens and using this data to discover new protective antigens this method relies on databases and tools such as pfam and smart to find features correlated with protectivity of antigens and searches for these features within the protein coding sequences of a particular genome . The program is designed not to take into account any localization signals, enabling recognition of intracellular antigens, the majority of which are t - cell antigens . Method was reported to be more selective than vaxijen leaving only a few dozen candidate antigens identified from a whole bacterial proteome to test experimentally, while still being able to select all the antigens in the menb (bexsero) and bordetella pertussis (daptacel) vaccines . Once a panel of candidate antigens has been selected, they need to be tested in preclinical animal models . The challenge here is that for many pathogens the correlates of protection are not clear . In other words, the animal experiments may not be reliable indicators of protection in humans, and following wrong or too few metrics, like immunogenicity only, can misguide antigen selection . Nevertheless, the candidate antigens have to fulfill at least three general key features: they have to be immunogenic, they have to be conserved and expressed in natural infection, and they have to be safely tolerated . Since the majority of vaccine - induced protection is generally based on antibodies, the antigen candidate has to elicit measurable, preferentially high antibody titers . Also, if a protein is toxic to experimental animals, the risks of use in humans are too high to consider it as a vaccine antigen as such . In some cases, like that of menb, at the time of antigen selection it was known that, for protection, antibodies that have complement - mediated bactericidal activity are required, which simplified the selection process . With many viruses, there are few antigen candidates to choose from and reverse vaccinology is not required . However, surface - exposed viral antigens often exhibit high degrees of sequence variability and conformational heterogeneity, which can make it difficult to produce stable immunogenic conformations and find epitopes conserved across different strains of the viruses . Independently of how one arrives at the selected antigen(s), the next step in understanding the molecular basis of protection and optimizing the antigen is to determine its structure and find the epitopes where protective antibodies bind . From the initial 7 entries deposited in the protein data bank (pdb) when it was established in 1971, the total number of macromolecular structures deposited is currently> 100,000, a vast collection of data achieved due to many technological innovations and advances in experimental methods of structure determination . The structures of most vaccine antigens and their epitopes can nowadays be determined and used for advanced, rational, structure - based vaccine design . Knowing the structures of antigens that are candidates to become vaccines enables rational design to fine tune their presentation to the immune system or to facilitate their manufacturing . At the same time, structures of antigen - antibody complexes provide useful information to understand the molecular nature of host - pathogen interactions and of pathogen- or vaccine - induced antibody responses . This information can in turn help to elucidate the effects of immunization and also provides useful knowledge for the development of general principles and computational tools for in silico predictions of protective epitopes . Systematic structure - based approaches applied to vaccine research can potentially save time and resources and can also aid the development of vaccines for difficult antigen targets that resist other traditional approaches . Knowing the exact regions of an antigen that are recognized and bound by antibodies provides essential information for antigen engineering and can be used to guide vaccine design and optimization . The experimental methods necessary to obtain such information are collectively called epitope mapping, and their important role in the early stages of vaccine design has been recognized for several years . Importantly, the postgenomic era and the rapidly increasing number of available structures of antigens and antigen - antibody complexes now open new possibilities for the development of novel tools that can reliably predict protective epitopes . Using either the sequence or the structure of antigens that are target vaccine candidates, these methods below, we will first review recent applications of epitope mapping methods with a focus on the high - resolution mapping by x - ray crystallography and the emerging potential of cryo - em, and we will then review the current status of computational methods for the prediction and design of b - cell epitopes . Reviews of computational methods for the prediction of t - cell epitopes have been provided previously [55, 56]. An epitope can be defined as the collection of atoms that directly contact or bind an antibody . Electrostatic attractions, water - mediated hydrogen - bond networks, and long - range forces such as ionic and hydrophobic interactions contribute to the overall binding affinity between an antigen and an antibody [5760]. In addition, it has been recently suggested that allosteric effects between constant and variable regions of antibodies play a role on antigen affinity or specificity [58, 61]. B - cell epitopes can be either linear (continuous or sequential) or conformational (discontinuous). While linear epitopes are short peptides made of a contiguous amino acid sequence fragment of a protein, conformational epitopes are composed of noncontiguous amino acids (in primary sequence) that are brought into close proximity within the folded 3-dimensional protein structure . It is estimated that most b - cell epitopes (up to 90%) are conformational . An empirical approach to epitope mapping is still essential in order to generate reliable information about antibody - antigen interactions, and many experimental methods of epitope mapping are available . Among those methods that do not require knowledge of the tertiary structure, of either the antigen or the antibody, are (i) the use of synthetic libraries of peptide fragments to scan their binding by an antibody (pepscan); (ii) the use of bacteriophages (or other organisms) displaying libraries of peptides on their surface to study their binding by antibodies (phage display); (iii) various strategies of mass spectrometry (ms) such as epitope extraction, excision, differential chemical modification, and more recently hydrogen - deuterium exchange (h / dx - ms); (iv) solution nmr epitope mapping [63, 64]. In contrast with the information provided by the mainly sequence - based methods cited above, x - ray crystallography delivers a clear visual definition and an atomic - level description of the epitope and paratope atoms forming the antigen - antibody interface . To date there are over 100 nonredundant antibody - antigen (i.e., fab - protein) complex structures deposited in the pdb, a number that is likely to grow further due to the increasing ease in obtaining and producing human fabs . An example of epitope mapping approaches has recently been published, showing the importance of employing different methods when a high - resolution picture of the epitope - paratope interface is not available . After failing to obtain crystals of the complex between the programmed death ligand 1 protein (pd - l1) and a monoclonal antibody that targets pd - l1 binding to its receptor, the programmed death protein 1 (pd-1), hao et al . Used limited proteolysis, hdx - ms, mutational studies, and surface plasmon resonance (spr) to reveal and characterize the epitope . Another example of interdisciplinary approaches to epitope mapping that instead illustrates the limitations of some methods has been reported for the menb factor h binding protein (fhbp) and its interaction with a monoclonal antibody (mab 12c1). Here, the crystal structure of the complex fhbp - fab 12c1 was solved at 1.8 resolution, revealing high - resolution details on an extensive epitope - paratope interface involving the variable heavy (vh) and variable light (vl) chains of mab 12c1 and both the n- and c - terminal domains of fhbp . This interface involves 23 fhbp and 33 fab residues and generates buried surfaces of ~1000 on fhbp and ~880 on fab 12c1 . In addition to the crystal structure of the complex, also hdx - ms revealed a large, discontinuous, conformational epitope, though with broader boundaries . Instead, pepscan and phage display identified partial epitopes only and, as expected, of exclusively linear nature . However, these partially mapped and linear regions were also part of the main epitope as identified both by the crystal structure and by hdx - ms . Epitope mapping by x - ray crystallography is probably one of the most powerful and important applications of structural biology in the field of vaccines research . But it is important to recognize that x - ray crystallography cannot be considered a universal solution to epitope mapping, as there are also limitations such as (i) the generation of crystals typically requiring large amounts of sample material, (ii) the lack of certainty that any protein, or antigen - antibody complex, will produce high - quality crystals, and (iii) the unpredictable timelines for the crystallization and structure determination processes that while in the most favourable cases can be very short (days - weeks) or indeed may even never be achieved . As an alternative, for small antigens (<30 kda), solution nmr can also be a rapid and accurate method for epitope mapping and is particularly useful if hsqc peak assignment for the antigen is already available . Examples of nmr epitope mapping include work on menb and gonococcus fhbp and the diii domain of dengue virus e protein [6870]. An emerging method in macromolecular structure determination is cryoelectron microscopy (cryo - em). Due to the impressive recent progress mainly in electron detectors and software algorithms, it is now possible to determine protein cryo - em structures to quasiatomic resolution using single - particle methods in 3d reconstruction [7174]. The great attraction of single - particle cryo - em compared to x - ray crystallography is that it requires only micrograms of sample and crystallization is not required . Moreover, since images of individual molecules are obtained, computational classification methods can be used to reveal multiple conformational states . Obtaining high - resolution reconstructions (<4) is however greatly facilitated by having a rigid, homogenous complex, preferably several hundreds of kilodaltons in molecular weight . Yet, even low - resolution em maps can be useful in providing information on the overall architecture of a protein or a protein complex and intermediate - resolution em maps can already offer insights into the arrangement of domains and localization of functional sites on the macromolecules . Docking of x - ray structures of individual subcomponents in em maps can be done with high precision, thus increasing the apparent resolvability of the results and making it possible to extract atomic details from the maps . Flexible fitting methodologies can be used to further improve the fitting of x - ray structures into the em density maps . Recent examples, where x - ray structures have been used to help detailed interpretation of cryo - em maps, include work on alternative function - related conformational states of a complex, a protein in complex with a cofactor and an antigen - antibody complex [7678]. Aiyegbo and coworkers described a hybrid method approach for epitope mapping, based on single - particle cryo - em and enhanced h / dx - ms to determine the location and mode of binding of rv6 - 25 fab directed against the vp6 epitope of human rotavirus . Interestingly, the structure of the rv6 - 25 fab attached to the double - layered particle (dlp) complex determined by cryo - em indicated a rather complex binding pattern that revealed differences in accessibility of the vp6 epitope depending on its position in the type i, ii, or iii channels (located at the icosahedral 5-fold and 3-fold axes of which the former serve as egress points of nascent viral mrna during viral transcription) (see figure 2 in). These variations in the accessibility of the rv vp6 capsid layer led to position - specific differences in occupancy for binding of the rv6 - 25 fab . A second innovative publication by bannwarth and collaborators described a new structural approach to characterize in 3d the poliovirus type i epitopes in virus - antibody immune complexes . Briefly, the inactivated polio vaccine (ipv) contains serotypes 1, 2, and 3 of poliovirus . The antigenic structure of pvs is composed by at least four different antigenic sites; thus the d - antigen content results in the combined activity of multiple epitopes . Characterization of the epitopes recognized by the different mabs was fundamental to map the entire virus surface and ensure the presence of epitopes able to induce neutralizing antibodies . In their new approach the authors describe how combination of single - particle cryo - em with x - ray crystallographic data allowed the identification of the antigenic sites for these mabs . The generation and comparison of five different 3d em maps generated from five different specific fab - virus and one mab - virus complex allowed the identification of exposed amino acid residues and finally the mab - antigen sites . This new approach can be used to map the whole epitopic viral surface and provide a comprehensive picture of main epitopes on the surface . In addition to the examples described above, cryo - em has successfully been used to map epitopes on several icosahedral viruses, generally difficult to crystallize due to their large size [81, 82]. Cryo - em also allows characterization of antigen - antibody complexes in situ, for example, on enveloped virus surface when tomographic reconstruction methods are used . Such approaches have allowed characterization of influenza ha in complex with a stem - directed mab showing that the stem is accessible for mab binding even though the virion surface is densely packed with ha and na spikes . Fabs have also been used to increase the size of the protein of interest for cryo - em imaging and reconstruction purposes . Since small (<100 kda) proteins have up to now been difficult to reconstruct due to lack of evident features and consequent failure in particle alignment, fabs with their well - known overall structure can be used to aid alignment and validation . Not only does this enable the structure determination of the protein of interest, but simultaneously produce a structure of the antigen - antibody complex . Thus, antigen - fab complexes are in fact easier to reconstruct than small antigens alone, which extends the capabilities of cryo - em to studies of smaller antigens . In a recent example, a fab from hiv bnab pgv04 was used to help reconstructing an env - fab complex to 5.8 resolution . Although x - ray crystallography is still the leading method for high - resolution antigen - antibody interaction characterization, single - particle cryo - em holds the promise to become complementary in cases where crystallography is not possible or feasible . Furthermore, since cryo - em can deal with heterogeneous samples, it may in the future become possible to characterize multiple complexes (e.g., from polyclonal sera) within the same sample, an important aspect for throughput and completeness in characterizing the full repertoire of antigen - antibody interactions, rather than just a few mab - antigen interactions . Epitope mapping studies performed over the last few decades have provided a wealth of information on epitope - paratope interfaces that have allowed a certain sophistication in the definition of an epitope . Some common themes of antigen - antibody interactions are starting to emerge, with potential benefits for the development of computational methods for the reliable identification of b - cell epitopes . Also, the constant evolution and refinement of computational methods for protein folding and design, driven by the growth of available protein structures in the pdb, may now further aid in elucidating the molecular bases of antigen - antibody interactions . Starting in the early 1980s, several sequence- and structure - based b - cell epitope prediction methods have been developed, as extensively reviewed elsewhere [52, 86]. However, developing robust computational methods for epitope prediction has proven to be a very difficult task, and their predictive performance remains far from ideal . Among the possible reasons for the limitations of current epitope prediction tools are the belief that we still possess somewhat weak or wrong hypotheses on the true nature of b - cell epitopes and on the structural bases for the ability of protective antigens to elicit functional antibodies [57, 87]. For example, the evidence that any residue of an antigen may become an epitope under certain circumstances poses a serious complication for most of the prediction methods . However, most of the currently available prediction algorithms try to discriminate between epitopic and nonepitopic antigen surface residues . Another obstacle to obtaining reliable predictions is the lack of large robust benchmark datasets and standard data formats, for which the community has proposed several solutions . In support of the need of more robust benchmarks, the most common computational methods of epitope prediction are sequence - based, and they specialize on predicting linear or continuous b - cell epitopes . These methods initially utilized sequence profiling by use of amino acid scales, where hydrophobicity, flexibility, solvent accessibility, or other physicochemical properties scales assign a propensity value to each amino acid, thus measuring their tendency to be part of a b - cell epitope . These methods were later exhaustively reviewed and questioned, showing how almost 500 propensity scales performed only slightly better than random and thus leading to the conclusion that they cannot yet be used to predict epitope location reliably . The use of machine - learning, knowledge - based methods was subsequently introduced in order to increase accuracy and reliability of the predictions . Several lines of evidence indicate that most epitopes are conformational, and prediction of discontinuous or conformational epitopes presents further challenges as they require as a prerequisite the antigen structure . Indeed, all discontinuous epitope prediction methods currently available require the 3d structures of the antigen, which may in some cases be very difficult or impossible to obtain . Despite continuous incremental advances in computational tools for the in silico prediction of 3d protein structures, the prediction of discontinuous epitopes still preferentially requires the experimental 3d structure to increase reliability . Some of the earlier approaches to conformational epitopes prediction used correlations of known epitopes with crystallographic temperature factors, protrusions from the protein globular surface, solvent accessibility, and flexibility . Also, both protein - protein binding site prediction tools and docking algorithms were introduced and tested for epitope prediction . It has been recently estimated that the accuracy of continuous b - cell epitope predictions methods can reach 6066% . Importantly, recent computational and experimental validation of both continuous and discontinuous epitope predictions made with the most well established methods currently available show that they all still perform rather poorly . More recent developments of computational methods for epitope prediction include the methods of electrostatic desolvation profiles (edp) and matrix of local coupling energies (mlce) [98100]. Both of these methods aim to elucidate the physicochemical determinants of antibody recognition by an antigen, starting from the structure of the antigen and the in silico analyses of its surface properties . This in turn allows making hypotheses on the optimal interface formation for protein - protein complexes in general (edp) and for antigen - antibody complexes (mlce). In particular, the mlce algorithm takes into account both dynamic and energetic properties of a protein surface, looking for sites that because of their intrinsic low - intensity energetic couplings with the rest of the protein will likely undergo conformational changes, as well as mutations with minimal energetic expense, which are both desirable properties for antigenic epitopes and will influence the way an antigen - antibody complex forms . The mlce does not require previous knowledge on antibody binding or the structure of an antigen - antibody complex, and as such it can be applied to any isolated protein antigen . Once those regions that are minimally coupled to the rest of the protein or the antigen, thus likely involved in antibody recognition, are localized, it is possible to introduce mutations that will increase the affinity for the antibody and at the same time will not affect the antigen's overall stability . Or it is possible to engineer stable regions of the antigen as more stable or dominant conformation of the one found in the original structural background of the entire antigen . Successful applications of the edp and mlce methods have been recently reported, which helped elucidate antigenic regions or immunogenic epitopes of several vaccine target candidates from burkholderia pseudomallei (namely, bpsl1050, the oligopeptide - binding protein a (oppabp), the flagellar hook - associated protein (flgkbp), and the acute phase antigen bpsl2765). A novel antibody - dependent prediction method has been recently introduced that instead of classifying ag residues a priori as epitopic or nonepitopic will predict the potential match between a given ab and a given epitope . In addition to the antigen structure, this method also utilizes antibody sequences or structures and thus it promises to bring a new paradigm in epitope prediction by trying to predict which region of an antigen will bind a specific antibody or group of related antibodies, rather than any generic antibody . This concept is similar to the one used for t - cell epitopes prediction and specifically in the assumption of the specific major histocompatibility complex molecule presenting the epitope, rather than the antigen . Combined with the growing field of immunoglobulin repertoire sequencing, this new approach promises to significantly increase the accuracy of b - cell epitope prediction methods . Also, by using antibodies structural or sequence information, this method might help focus the search for epitopes on certain antigenic regions and thus overcome the limitation of the antigen surface as a potentially continuous landscape of epitopes . For example, groups of clonally related antibodies will often bind to the same, or similar, antigenic sites . By determining the high - resolution structures of these antibody - antigen complexes and by analyzing their interaction, a clearer picture of the molecular bases for a recent study on the d8 protein of the vaccinia virus (vacv), which is a target of neutralizing abs elicited by the smallpox vaccine, shows how this computational prediction method performs better than the state - of - the - art prediction methods available . Importantly, in this same study it was shown how a significant increase of the prediction performance can be obtained when combining the antibody - specific predictions with relevant experimental data . The sections above have described how novel candidate antigens can be discovered initially by sequencing and analyzing the genome of a pathogen and how structural biology enriched by the combined addition of immunological and epitope mapping data can yield highly detailed information on the most immunogenic and protective regions of such antigens . The following sections aim to illustrate how this information can drive the design of improved vaccine antigens . In general, antigen optimization strategies can be divided into two main branches, one branch aiming for better antigenic properties in terms of presentation of epitopes that elicit neutralizing or protective antibodies broadly reactive against antigens from multiple strains of the target pathogen; the other branch equally important aiming for structural stabilization, homogeneity, ease of production, and safety of the antigen . Many pathogens manage to escape the host immune system by encoding surface - exposed antigens that exhibit high amino acid sequence diversity . The changing face presented by a variable pathogen represents a challenge for the host immune system and consequently for the successful design of vaccines with broad coverage . One example where this issue has been tackled, with promising preclinical results, regards the antigen fhbp of neisseria meningitidis . Fhbp is a highly immunogenic 28 kda lipoprotein present on the surface of the majority of meningococcal strains . It was identified both by the computational reverse vaccinology strategy and by more traditional membrane - fractionation methods and is an effective antigen included in two recently licensed vaccines that protect against menb (bexsero, trumenba), as reviewed recently . There are now over 800 unique fhbp peptide sequences deposited in the public neisseria database (http://pubmlst.org/neisseria/fhbp/), hundreds of which are from menb strains . The latter has implications when considering the design of a protein - based vaccine against menb; that is, in contrast with the highly successful glycoconjugate vaccines that efficiently target the capsular polysaccharides of serogroup mena, c, w, and y, a protein - based vaccine should elicit diverse cross - reactive antibodies affording coverage of as many strains as possible, where protein antigens may display extreme sequence diversity . Computational and immunological analyses of these fhbp proteins allowed their grouping into three major sequence variants, which have as little as ~65% sequence identity between variant groups (but typically> 90% identity within variant groups) which explains why the different variants are immunologically distinct . In short, it appears that each meningococcal strain can use one of three immunologically different fhbp molecules in order to achieve factor h binding and thus downregulation of the host alternative complement pathway to promote its survival in the blood . This antigenic variability promotes evasion of anti - fhbp directed immune responses, because the different fhbps are not broadly recognized by the antibodies previously induced by antigens of other variant groups . In order to overcome the meningococcal fhbp antigen sequence diversity, attempts were made to generate a single fhbp antigen capable of eliciting cross - reactive antibodies sufficient to enable bactericidal activity against all meningococcal strains . The three - dimensional (3d) structures of fhbp determined by nmr spectroscopy and later also by x - ray crystallography revealed a molecule composed of two similarly sized domains: an n - terminal taco - shaped beta - barrel and a c - terminal beta - barrel [113115]. From this structural starting point, scarselli et al . Designed chimeric fhbp molecules, using variant 1.1 fhbp as a scaffold to display surface patches representing epitopes from fhbp variants 2 and 3 (figure 2). The size and location of the grafted surface patches were selected and designed on the basis of two key analyses . Firstly, computational analyses of nonredundant antibody - antigen complex structures indicated that the typical epitope - paratope interface involves from 600 to 2000 surface area on each molecule [85, 116], thus suggesting the need to genetically engineer relatively large new surface patches . Indeed, single amino acids grafted from v2 or v3 were insufficient to elicit cross - reactive antigenicity . Secondly, epitope mapping studies performed using sera obtained from mice immunized with fhbp molecules of each variant group (v1, v2, and v3) suggested that the most immunogenic and protective epitopes of v1, v2, and v3 lay in nonoverlapping regions of the structure with the c - terminal domain of fhbp harboring most of the v2 and v3 epitopes . Thus, combined sequence- and structure - based inputs led to the computational design of numerous partially overlapping patches each containing a sufficient number of new surface - exposed residues that could potentially form at least one v2- and/or v3-specific conformational epitope on the v1 scaffold . Over 50 mutants were prepared and used to immunize mice . The resulting sera were tested in serum bactericidal assays for their ability to induce complement - mediated killing of menb strains displaying fhbp molecules of v1, v2, or v3 sequence types . This approach led to the successful design of a novel antigen able to induce broadly protective bactericidal responses against menb . V1-specific epitopes onto the gonococcal orthologue of fhbp (ghfp), which was previously reported to induce strongly bactericidal antibodies against fhbp v2 and v3, but only to a limited extent against fhbp v1 strains of menb . Immunization of mice with this ghfp scaffold chimera displaying v1 epitopes was shown to induce bactericidal antibodies against all three fhbp variants, thus demonstrating that combining epitopes from different yet closely related species can be a viable strategy to generate broadly protective antigens . To our knowledge, these two fhbp - centric studies currently represent the only demonstration that the antigenic sequence diversity of a pathogen can be overcome by computational and structure - based design . Clearly, a prerequisite and potential obstacle is detailed knowledge of the 3d antigen structure, though if a reliable template is available it may be possible to start with a homology model generated computationally, for example, using tools, such as i - tasser or rosetta, which have performed strongly during recent casp tests . We anticipate that these proofs of principle will pave the way for similar epitope grafting strategies targeting the variable antigens of alternative pathogens where strain variation causes incomplete protection upon immunization with antigens from one strain only . A second area where structural and computational biology have been combined synergistically is in the rational optimization of an antigen that presented the confounding issue of conformational heterogeneity . This approach was illustrated by research performed to identify an effective vaccine antigen to protect against respiratory syncytial virus (rsv). Rsv is an important unmet medical need; it is the main viral cause of severe respiratory tract disease in children worldwide, being responsible for approximately 6% of infant deaths [118, 119] and also affecting immunocompromised adults and the elderly . The fusion glycoprotein f is an obvious candidate vaccine antigen, and indeed is the target of a licensed therapeutic mab (palivizumab, or synagis). The f protein is a well - conserved trimeric surface antigen of 150 kda, but vaccine development was hampered by its conformational variability, typical of viral fusion glycoproteins that undergo large structural changes from prefusion to postfusion states when mediating membrane fusion . In short, while prefusion f might conceptually be the preferable antigen due to its exposure on the virion, it is only metastable as a recombinant protein and converts into a postfusion conformation . In contrast, a simple postfusion antigen was unsuitable, due to its tendency to aggregate, caused by an exposed hydrophobic fusion peptide segment . A promising postfusion f candidate antigen for rsv was rationally designed by removal of the hydrophobic fusion peptide, the transmembrane segment and the cytosolic region . The resulting antigen was readily produced, nonaggregating, homogeneous, highly thermostable and presented the key neutralizing epitopes recognized by palivizumab . Moreover, this postfusion f construct raised high titers of neutralizing antibodies in rodent models of rsv infection, suggesting that it is a promising antigen for clinical trials to protect against rsv . Subsequently, it was reported that much of the neutralizing activity present in human sera after infection targeted the prefusion f state . Design of a stable prefusion f construct was not feasible based on previously known structures but became possible following cocrystallization and structure determination of f in complex with the prefusion - specific human fab d25 . This antibody - antigen complex provided a platform for the computer - assisted design of point mutations to stabilize the protein in the conformation captured by the antibody . Analysis of cc bond distances enabled design of a number of cys substitutions that would introduce disulfide bonds that might covalently lock the f protein in the prefusion conformation (with the most successful pair of mutations being s155c and s290c). In addition, structural analysis revealed a number of sites where amino acid substitutions could enhance protein stability by filling only partially occupied cavities and thus increase hydrophobic packing interactions, in particular the cavity - filling mutation s190f . The designed antigen was further stabilized in its trimeric state by a c - terminal foldon domain, added specifically to ensure stable trimerization . This novel prefusion f candidate was subsequently shown to induce high titers of neutralizing antibodies in rodent and nonhuman primate models . Collectively, the various studies performed to generate both pre- and postfusion f antigen candidates demonstrate how structural studies, computational analyses, and modeling can guide site - directed mutagenesis to generate novel antigens for consideration in rsv vaccine trials . The hiv-1 env surface glycoprotein has also been a target for extensive research in the structural vaccinology field . Until recently, the structure of the native prefusion trimer had remained elusive . With the help of an engineered disulfide bond between the gp120 and gp41 subunits and an additional stabilizing mutation required to keep the gp41 in its prefusion conformation, a stable bg505 sosip.664 construct was obtained and crystallized and its structure was solved alone and in complex with bnabs pgt122 and 35o22 [127129]. Immunization of rabbits and macaques with sosip.664 constructs induced autologous neutralizing antibodies, a highly promising sign as the major hurdle in hiv vaccine development has been the inability to induce germline b - cells to mature and mutate to secrete the required bnabs . Recent breakthrough research indicates that a successful strategy for hiv immunization is likely to be composed of several temporally separate injections of which the first ones contain antigens capable of efficiently stimulating the rare b - cell precursors and subsequent injections containing native - like env that stimulate the already activated b - cell populations to undergo further somatic mutation thus evolving to bind the native env on the virion surface [131, 132]. Such a germline - targeting immunogen could be the minimal engineered outer domain (eod) assembled on nanoparticles developed by jardine et al . And a native - like env construct could be that recently developed through structure - based design on the sosip.664 background by do kwon et al . . Structure - based optimization of a vaccine antigen has also been used for borrelia burgdorferi outer surface protein a . The authors used nmr epitope mapping to reveal that protective epitopes were located exclusively on a c - terminal globular domain . Based on this knowledge, a truncated version of the molecule was designed and produced but found to be unstable and to induce poorer protection in mice compared to the wild - type protein . Replacing some of the charged residues within the core of the domain by hydrophobic residues improved the stability of the construct to levels similar to the wild - type, and likely as a consequence of the increased stability, the construct was found to be equally good as the wild - type in eliciting protective immunity in mice . Vaccinating with native antigens is not always optimal and engineered constructs containing only the protective epitopes may perform better in eliciting the optimal immune response . An important example is provided by the influenza haemagglutinin (ha) where immunization with the native protein in seasonal influenza vaccines drives a response mainly directed to the highly variable head region of this antigen resulting in the need to develop a new vaccine almost every year to fight the strains prevalent during a given year . A growing body of evidence suggests that the much less variable stalk region of ha contains neutralizing epitopes, and is therefore a rational point of focus in developing ha antigens . The challenge here is that, in order to direct the immune response to the stalk, the interfering effects of the variable immunodominant head have to be circumvented . The most common approach has been to attempt to make constructs containing only the stalk region . These constructs have had the tendency to be poorly producible in soluble form and to adopt the post - fusion conformation, where neutralizing epitopes are not retained . Recently, however constructs faithfully reproducing the pre - fusion stalk and capable of inducing bnabs have been reported [135, 136]. Used a computational minimalization approach to design fragment constructs that, basing on interaction network analysis, contained only the residues essential to faithfully reproduce the epitopes . Hydrophobic residues outside the epitope were mutated to prevent aggregation and the fragments connected by flexible linkers and trimerization enhanced by isoleuzine zippers or foldon domains . The obtained antigens were able to elicit bnabs and confer robust protection against lethal, heterologous viral challenge in mice . Another approach shown to improve the elicited antibody titers to ha, including bnabs to the stalk, is to express the full - length protein on the surface of ferritin nanoparticles . While none of the ha antigens reported so far can be considered as a universal influenza antigen, the promise is that through further design and engineering an antigen capable of inducing neutralizing antibodies to most if not all influenza strains can be developed . The examples described above demonstrate how knowledge of an antigen structure and its protective epitopes can be combined to generate novel vaccine candidates with improved characteristics based on closely related predefined scaffolds . However, it is also conceivable to identify protective epitopes that can be targeted by neutralizing antibodies and mount them as conformationally relevant fragments on non - related scaffold structures, thus enabling new degrees of freedom in antigen design that may overcome issues related to intrinsically problematic behavior of the full - length antigen . For example, as described above, the native rsv f antigen displays properties unsuitable for development as a vaccine antigen (e.g., meta - stability, or tendency for aggregation). Therefore, alternative methods were sought to enable design of novel rsv f conformational epitope presentation strategies, since the known epitope did not elicit neutralizing antibodies when used as a peptide immunogen, likely to due to lack of appropriate conformation of the unconstrained peptide . Briefly, the neutralizing epitope targeted by the therapeutic mab (palivizumab) was characterized by determination of its crystal structure in complex with the motavizumab fab an affinity - enhanced derivative of palivizumab with a picomolar dissociation constant (kd) for the same epitope in full - length f . The complex structure revealed a highly complementary paratope / epitope interface, with the epitope fragment of 24 residues in a helix - turn - helix conformation making many contacts between the two helices and the fab . Initial attempts were made to computationally screen all known structures in the protein data bank (pdb) that might be able to host this f - derived helix - turn - helix motif in a conformationally faithful manner, thus enabling epitope presentation on a heterologous scaffold . Indeed, a subset of structures was identified and subsequent grafting of the f epitope into three of these structures was attempted . One of these epitope scaffolds bound motavizumab with reasonable kinetics (although with an affinity considerably lower than the native f protein). However, when tested in mice, although this immunogen did induce antibodies able to recognize the f antigen, the immune sera lacked rsv neutralizing activity . There was not a clear explanation for the apparent inability to elicit a protective response, which may be linked to the lower affinity observed for motavizumab binding or to insufficient epitope mimicry or because additional epitopes outside the helix - turn - turn motif are required . To further develop the epitope scaffold strategy, correia et al . Devised new computational methods to design de novo scaffold proteins more ideally suited to display and accurately mimic the rsv neutralizing f epitope . Fold from loops (ffl), has four main steps: (i) selection of the functional motif and target topology to host the motif, (ii) ab initio folding to identify suitable main chain structures, (iii) iterations to select the most compatible low - energy side chain solutions, and (iv) automated and human - guided fine tuning to select the best structural candidates . In the specific test case, the latter step involved manual replacement of surface - exposed residues outside the epitope with those from the scaffold template protein and the computational selection of large hydrophobic residues to be inserted within the buried protein core . Importantly, leading designs were biophysically and structurally characterized, and at least eight constructs displayed key signs of being soluble and monomeric, with correct folding and high thermostability (tm> 75c); several also bound to motavizumab with high affinity (kd 694 pm), suggesting their faithful reproduction of the neutralizing epitope on these scaffolds (kd for wild - type f glycoprotein was 35 pm), confirmed by crystal structure determinations, and thus representing a major improvement on their previous efforts . Ultimately, the epitope scaffold designs were tested in mice and nonhuman primate animal models . Macaques produced robust binding responses against the autologous antigen scaffolds and rsv f protein, and neutralizing activity was detected in sera in up to 12 of 16 animals . Notably, some of the animals had neutralization titers comparable to those induced by natural human infection . We illustrate the development pathway from the f prefusion motavizumab epitope to the latest protection - inducing scaffolds of correia et al . In figure 3 . To summarize, this new structural and computational approach enabled generation of novel epitope scaffolds with robust antigenic properties and presented the f epitope in the desired conformation, as confirmed experimentally by structure determination alone or in complex with fabs and by immune recognition using sera from rsv - seropositive humans . These studies, which included preclinical experiments in nonhuman primates, ultimately provided a proof of principle for the design of epitope - focusing scaffolds that can successfully elicit neutralizing antibodies against a desired protective epitope . Clearly, this approach could be applied to the design of antigens against a variety of pathogens and could potentially be further developed by the incorporation of multiple epitopes per scaffold, thus increasing breadth of protection elicited by the antigen . Indeed, in the search for potent antigens to protect against hiv, a few promising studies have been performed using scaffolds to stably display portions of gp120 or gp41 [139141]. Ultimately, the structure - based computational design of epitope scaffolds appears to be a versatile and high - precision approach to vaccine discovery that holds great promise . Structural and computational biology have become important in designing vaccines against diseases unamenable to traditional empirical vaccine development strategies . Computational antigen selection tools are now sophisticated enough to allow a relatively straightforward selection of a limited number of vaccine antigen candidates from whole genomes as a starting point for vaccine development . However, bioinformatics predictions can fail to correctly identify the posttranslational modifications such as glycosylation, phosphorylation, and molecular rearrangement following proteolytic cleavage that can change the structure and potentially the antigenic properties of bacterial antigens . Integration with proteomics can represent a valid strategy to refine the antigen characterization as well as provide useful insights on abundance and subcellular localization of bacterial antigens [46, 142, 143]. With the increasing speed of x - ray crystallographic structure determination and the promise of cryo - em in rapid high - resolution structure determination, the number of antigen - antibody complex structures in the pdb is expected to rise at an increasing speed . A significant contribution to this will likely be provided by the fast characterization and cloning of antibodies enabled by b - cell sequencing . The availability of more experimental structures will also help in developing more reliable computational tools for epitope prediction as well as in designing scaffolds for epitope presentation; that is, the more we know, the more we can predict . Recent developments in epitope - oriented scaffold - based antigen design show great promise but still require additional successful examples to become the norm . A burning question, especially in the case of hiv, is that to what extent the epitope information of bnabs is useful for vaccination purposes since the germline b - cell receptors that need to first recognize the antigen are very diverse from the bnabs after somatic hypermutation . We expect that structural optimization in terms of thermostability, conformational heterogeneity, and safety are likely to show up as the first examples of sv in the pool of vaccines for approved use in human indeed, it will be very interesting to see how many of the promising preclinical candidates perform in clinical trials and which will get the privilege to lead the way for other sv - based vaccines of the future.
|
Oh, fmoc - tyr(bu\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{t}$$\end{document})oh, fmoc - gln(trt)oh, fmoc - glu(obu\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{t}$$\end{document})oh, fmoc - asp (obu\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{t}$$\end{document})oh, fmoc - pro oh, fmoc - his(trt)oh, fmoc - lys (mtt)oh, fmoc - val oh, fmoc - thr(bu\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{t}$$\end{document})oh) and boc - lys(fmoc)oh were purchased from novabiochem or irisbiotech; tentagelhl nh\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_{2}$$\end{document} resin (0.56 mmol / g, 110 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}m particle size) was purchased from rapp polymere . Benzotriazole-1-yl - oxy - tris - pyrrolidinophosphonium hexafluorophosphate (pybop) was obtained from novabiochem, tfa was from irisbiotech . 1,4-diazabicyclo[2.2.2]octane (dabco), diisopropylethylamine (diea), pitc, and solvents for peptide synthesis: dimethylformamide (dmf) and dichloromethane (dcm) were obtained from aldrich; alpha - chymotrypsin in crystal form (activity \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\ge $$\end{document}40 units btee / mg of protein, with the addition of trypsin inhibitor tlck) from bovine pancreas, aldrich; pyridine, methanol (meoh) and acetonitrile (mecn) were purchased from poch; iodoacetic acid from merck; n, n - diisopropylcarbodiimide (dic), triisopropylsilane (tis), and ammonium bicarbonate were purchased from fluka . Nh\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_{2}$$\end{document} resin (50 mg, 28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was suspended in dmf (1 ml) for 30 min . A mixture of boc - lys(fmoc)oh derivative (39.4 mg, 84 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), pybop (44 mg, 84 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), and diea (31 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l, 168 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was added and mixed for 2 h. then the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upvarepsilon $$\end{document}-amino group was used for peptide assembly according to fmoc strategy . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of n - terminal amino acid residues were acetylated using (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\text {ac} _ {2}$$\end{document}o / dmf / diea; 1:7.5:1.5). Side - chain protecting groups were cleaved with the mixture of tfa / tis / h\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_2$$\end{document}o (95:2.5:2.5; v: v: v) for 2 h and the peptidyl resin was washed with 5% solution of diea / dmf (3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min), dmf (6 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min), dmf / dcm (1:1; v: v, 1 min), dcm (6 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min), dcm / meoh (1:1; v: v, 1 min), and meoh (6 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min) and dried in vacuo . After peptide synthesis the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of n - terminal amino acid residues were deprotected . Then, the mtt protecting group was cleaved by using 1% solution of tfa in dcm (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 2$$\end{document} min, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 10$$\end{document} min, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 2$$\end{document} min). The peptidyl resin was washed with dcm (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), dcm / dmf (1:1; v: v, 1 min), 5% diea in dmf (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and dmf (7 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min). The mixture of iodoacetic acid (52 mg, 280 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) and dic (35 mg, 280 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), dissolved in dmf (0.5 ml), was added to the peptidyl resin (50 mg, 28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) and the reaction was allowed to proceed for 3 h. then dabco (63 mg, 560 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), dissolved in dmf (0.5 ml), was added to the reaction vessel and mixed for 24 h. after side - chain protecting groups cleavage, 50 mg of tentagel resin (28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was swollen for 30 min in water and then washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and water / pyridine (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min, 1:1). Free amino groups (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of lysine residues see fig . 1) were modified by phenyl isothiocyanate (146 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l, 560 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) in the mixture of water / pyridine (1:1; v: v) using cem microwave reactor (t \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$=$$\end{document} 70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c; e \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$=$$\end{document} 30 w). The resin was washed with water / pyridine (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$6 \times 1$$\end{document} min), water / meoh (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$1 \times 1$$\end{document} min), and meoh (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$4 \times 1$$\end{document} min). The ptu peptide derivatives bound to the resin were treated with tfa (1 ml, 30 min), which resulted in peptide cleavage through formation of pth derivatives . The obtained pth - peptide derivatives were dissolved in the mixture (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) of water, acetonitrile, and formic acid (50:50:0.1; v: v: v) and their structures were confirmed by hr - esi - ms / ms (spectrum s1, presented as an example). The peptidyl resin (5 mg) containing ptu peptide derivatives (obtained in the reaction with pitc), was washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and 0.01 m ammonium bicarbonate in water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Enzymatic digestion was performed in 0.01 m ammonium bicarbonate buffer for 1 h at 37 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c . After the supernatant separation, the resin was washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), acetonitrile (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Then two drops of each component (a: 80 g phenol in 20 ml ethanol, b: 2 ml 0.001 m kcn in 98 ml pyridine, and c: 5 g of ninhydrin in 100 ml ethanol) were added and incubated for 3 min at 100 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c . The resin was washed with methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and dmf (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Positive (purple beads) and negative (yellow beads) hits were separated manually, washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), acetonitrile (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and dried in vacuo . The obtained pth - peptide derivatives were dissolved in the mixture (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) of water, acetonitrile, and formic acid (50:50:0.1; v: v: v) and analyzed by hr - esi - ms / ms . All ms experiments were performed on an ft - icr (fourier transform ion cyclotron resonance) ms apex - qe ultra 7 t instrument (bruker daltonics, germany) equipped with standard esi source . Spectra were recorded for samples dissolved in the mixture of water, acetonitrile, and formic acid (50:50:0.1; v: v: v). The instrument was operated in the positive ion mode and calibrated before each analysis with the tunemix\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{tm}$$\end{document} mixture (bruker daltonics, germany) in quadratic method . The instrument parameters were as follows: scan range: 1001,600 m / z; drying gas: nitrogen; flow rate: 1.5 l / min; dry gas (nitrogen) flow: 4 l / min; analyte solutions (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) were introduced at a flow rate of 3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l / min; temperature: 200 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c; potential between the spray needle and the orifice: 4.2 kv . In the ms / ms experiments, the doubly charged \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\text {m} ^{2+}$$\end{document} precursor ions were selected on the quadrupole and subsequently fragmented in the hexapole collision cell . The obtained fragments were directed to the icr mass analyzer and registered as a ms / ms spectrum . A bruker compass dataanalysis 4.0 software was used . A sophisticated numerical annotation procedure (snap) the mass accuracy error for all obtained signals was in the range of 2 ppm . Tentagel hl nh\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_{2}$$\end{document} resin (50 mg, 28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was suspended in dmf (1 ml) for 30 min . A mixture of boc - lys(fmoc)oh derivative (39.4 mg, 84 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), pybop (44 mg, 84 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), and diea (31 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l, 168 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was added and mixed for 2 h. then the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upvarepsilon $$\end{document}-amino group was used for peptide assembly according to fmoc strategy . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of n - terminal amino acid residues were acetylated using (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\text {ac} _ {2}$$\end{document}o / dmf / diea; 1:7.5:1.5). Side - chain protecting groups were cleaved with the mixture of tfa / tis / h\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$_2$$\end{document}o (95:2.5:2.5; v: v: v) for 2 h and the peptidyl resin was washed with 5% solution of diea / dmf (3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min), dmf (6 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min), dmf / dcm (1:1; v: v, 1 min), dcm (6 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min), dcm / meoh (1:1; v: v, 1 min), and meoh (6 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min) and dried in vacuo . After peptide synthesis the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of n - terminal amino acid residues were deprotected . Then, the mtt protecting group was cleaved by using 1% solution of tfa in dcm (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 2$$\end{document} min, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 10$$\end{document} min, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 2$$\end{document} min). The peptidyl resin was washed with dcm (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), dcm / dmf (1:1; v: v, 1 min), 5% diea in dmf (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and dmf (7 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min). The mixture of iodoacetic acid (52 mg, 280 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) and dic (35 mg, 280 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), dissolved in dmf (0.5 ml), was added to the peptidyl resin (50 mg, 28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) and the reaction was allowed to proceed for 3 h. then dabco (63 mg, 560 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), dissolved in dmf (0.5 ml), was added to the reaction vessel and mixed for 24 h. after side - chain protecting groups cleavage, 50 mg of tentagel resin (28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was swollen for 30 min in water and then washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and water / pyridine (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min, 1:1). Free amino groups (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of lysine residues see fig . 1) were modified by phenyl isothiocyanate (146 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l, 560 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) in the mixture of water / pyridine (1:1; v: v) using cem microwave reactor (t \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$=$$\end{document} 70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c; e \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$=$$\end{document} 30 w). The resin was washed with water / pyridine (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$6 \times 1$$\end{document} min), water / meoh (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$1 \times 1$$\end{document} min), and meoh (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$4 \times 1$$\end{document} min). The ptu peptide derivatives bound to the resin were treated with tfa (1 ml, 30 min), which resulted in peptide cleavage through formation of pth derivatives the obtained pth - peptide derivatives were dissolved in the mixture (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) of water, acetonitrile, and formic acid (50:50:0.1; v: v: v) and their structures were confirmed by hr - esi - ms / ms (spectrum s1, presented as an example). The peptidyl resin (5 mg) containing ptu peptide derivatives (obtained in the reaction with pitc), was washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and 0.01 m ammonium bicarbonate in water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Enzymatic digestion was performed in 0.01 m ammonium bicarbonate buffer for 1 h at 37 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c . After the supernatant separation, the resin was washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), acetonitrile (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Then two drops of each component (a: 80 g phenol in 20 ml ethanol, b: 2 ml 0.001 m kcn in 98 ml pyridine, and c: 5 g of ninhydrin in 100 ml ethanol) were added and incubated for 3 min at 100 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c . The resin was washed with methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and dmf (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Positive (purple beads) and negative (yellow beads) hits were separated manually, washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), acetonitrile (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and dried in vacuo . The obtained pth - peptide derivatives were dissolved in the mixture (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) of water, acetonitrile, and formic acid (50:50:0.1; v: v: v) and analyzed by hr - esi - ms / ms . All ms experiments were performed on an ft - icr (fourier transform ion cyclotron resonance) ms apex - qe ultra 7 t instrument (bruker daltonics, germany) equipped with standard esi source . Spectra were recorded for samples dissolved in the mixture of water, acetonitrile, and formic acid (50:50:0.1; v: v: v). The instrument was operated in the positive ion mode and calibrated before each analysis with the tunemix\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{tm}$$\end{document} mixture (bruker daltonics, germany) in quadratic method . The instrument parameters were as follows: scan range: 1001,600 m / z; drying gas: nitrogen; flow rate: 1.5 l / min; dry gas (nitrogen) flow: 4 l / min; analyte solutions (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) were introduced at a flow rate of 3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l / min; temperature: 200 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c; potential between the spray needle and the orifice: 4.2 kv . In the ms / ms experiments, the doubly charged \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\text {m} ^{2+}$$\end{document} precursor ions were selected on the quadrupole and subsequently fragmented in the hexapole collision cell . The obtained fragments were directed to the icr mass analyzer and registered as a ms / ms spectrum . A bruker compass dataanalysis 4.0 software was used . A sophisticated numerical annotation procedure (snap) the mass accuracy error for all obtained signals was in the range of 2 ppm . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of n - terminal amino acid residues were deprotected . Then, the mtt protecting group was cleaved by using 1% solution of tfa in dcm (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 2$$\end{document} min, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 10$$\end{document} min, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 2$$\end{document} min). The peptidyl resin was washed with dcm (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), dcm / dmf (1:1; v: v, 1 min), 5% diea in dmf (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and dmf (7 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times $$\end{document} 1 min). The mixture of iodoacetic acid (52 mg, 280 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) and dic (35 mg, 280 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), dissolved in dmf (0.5 ml), was added to the peptidyl resin (50 mg, 28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) and the reaction was allowed to proceed for 3 h. then dabco (63 mg, 560 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol), dissolved in dmf (0.5 ml), was added to the reaction vessel and mixed for 24 h. after side - chain protecting groups cleavage, 50 mg of tentagel resin (28 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) was swollen for 30 min in water and then washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and water / pyridine (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min, 1:1). Free amino groups (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upalpha $$\end{document}-amino groups of lysine residues see fig . 1) were modified by phenyl isothiocyanate (146 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l, 560 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}mol) in the mixture of water / pyridine (1:1; v: v) using cem microwave reactor (t \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$=$$\end{document} 70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c; e \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$=$$\end{document} 30 w). The resin was washed with water / pyridine (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$6 \times 1$$\end{document} min), water / meoh (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$1 \times 1$$\end{document} min), and meoh (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$4 \times 1$$\end{document} min). The ptu peptide derivatives bound to the resin were treated with tfa (1 ml, 30 min), which resulted in peptide cleavage through formation of pth derivatives the obtained pth - peptide derivatives were dissolved in the mixture (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) of water, acetonitrile, and formic acid (50:50:0.1; v: v: v) and their structures were confirmed by hr - esi - ms / ms (spectrum s1, presented as an example). The peptidyl resin (5 mg) containing ptu peptide derivatives (obtained in the reaction with pitc), was washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and 0.01 m ammonium bicarbonate in water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Enzymatic digestion was performed in 0.01 m ammonium bicarbonate buffer for 1 h at 37 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c . After the supernatant separation, the resin was washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), acetonitrile (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Then two drops of each component (a: 80 g phenol in 20 ml ethanol, b: 2 ml 0.001 m kcn in 98 ml pyridine, and c: 5 g of ninhydrin in 100 ml ethanol) were added and incubated for 3 min at 100 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c . The resin was washed with methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and dmf (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min). Positive (purple beads) and negative (yellow beads) hits were separated manually, washed with water (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), acetonitrile (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min), and methanol (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$3 \times 1$$\end{document} min) and dried in vacuo . The obtained pth - peptide derivatives were dissolved in the mixture (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) of water, acetonitrile, and formic acid (50:50:0.1; v: v: v) and analyzed by hr - esi - ms / ms . All ms experiments were performed on an ft - icr (fourier transform ion cyclotron resonance) ms apex - qe ultra 7 t instrument (bruker daltonics, germany) equipped with standard esi source . Spectra were recorded for samples dissolved in the mixture of water, acetonitrile, and formic acid (50:50:0.1; v: v: v). The instrument was operated in the positive ion mode and calibrated before each analysis with the tunemix\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\mathrm{tm}$$\end{document} mixture (bruker daltonics, germany) in quadratic method . The instrument parameters were as follows: scan range: 1001,600 m / z; drying gas: nitrogen; flow rate: 1.5 l / min; dry gas (nitrogen) flow: 4 l / min; analyte solutions (70 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l) were introduced at a flow rate of 3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\upmu $$\end{document}l / min; temperature: 200 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^\circ $$\end{document}c; potential between the spray needle and the orifice: 4.2 kv . In the ms / ms experiments, the doubly charged \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\text {m} ^{2+}$$\end{document} precursor ions were selected on the quadrupole and subsequently fragmented in the hexapole collision cell . The obtained fragments were directed to the icr mass analyzer and registered as a ms / ms spectrum . A bruker compass dataanalysis 4.0 software was used . A sophisticated numerical annotation procedure (snap) the mass accuracy error for all obtained signals was in the range of 2 ppm.
|
The disease is clinically heterogeneous and is classified into three types based on the presence and severity of neurological symptoms . Type 1 is non - neuronopathic, while types 2 and 3 are acute and chronic neuronopathic, respectively . Type 3 is typified by slowing and looping of the horizontal saccadic eye movements, organomegaly and bony involvement . Bone deformities of the distal femurs, pathologic fractures, osteopenia and painful bone crises . Osteolytic lesions are rare and often characterized by large progressive intermedullary lesions with cortical thinning that may become necrotic,, . Previously, two adolescent patients with gd were reported to have bilateral symmetrical osteolytic lesions of the humerii and tibias, with cortical scalloping and indolent growth . Here we present a third patient with gd who has similar symmetrical bilateral osteolytic lesions, this time of the femurs . All three patients are young adults diagnosed with type 3 gd at an early age, with the same genotype, l444p / l444p, and each had a favorable response to enzyme replacement therapy (ert) administered since childhood . These atypical skeletal findings in unrelated type 3 gd probands sharing the same genotype further illuminate our understanding of the phenotypic spectrum in this single gene disorder in the post - treatment era . The patient is a 23 year old female followed at the national institutes of health under an institutional review board approved clinical protocol since her diagnosis of type 3 gd at age 7 months . Two years prior to her birth, her brother, also diagnosed with gd, died from a ruptured spleen at age 2 years . Her perinatal course was unremarkable, but an enlarged liver and spleen were noted at age 6 months, prompting dna testing for gd . The patient was started on ert with recombinant glucocerebrosidase at age 7 months at a dose of 60 iu / kg every two weeks . The dose was subsequently doubled to 120 iu / kg every two weeks when she reported hip pain at age 10 years . While she is currently asymptomatic, diffuse moderate reticular lung densities scattered bilaterally are noted on radiographs and computed tomographs of her chest, and pulmonary function tests show a mild restrictive ventilatory defect and a moderate diffusion abnormality . Years, the patient reported two episodes of bone pain that were sudden and severe occurring several months apart . The first, occurring in her left anterior thigh, resolved within a few days after self - treatment with acetaminophen . This was followed by a much more painful episode 7 months later in her right anterior thigh that lasted several weeks, was treated with tramadol, and ultimately resolved . On evaluation at age 23 years, radiographs of her femurs showed bilateral symmetrical lucent cortical lesions, centered in the medial cortices of the mid - diaphysis (fig . 1a). These had a benign appearance, resembling non - ossifying fibromas . On magnetic resonance imaging (mri), the femoral lesions had t2 signal hyperintensity, with marginal enhancement within the cortex of the midshaft diaphysis (fig . The diameters of the right femur lesion were measured at 1.9 cm - craniocaudad, 1 cm - transverse and 1 cm - anterior - posterior, while the left femur lesion was 3.6 cm - craniocaudad, 1.3 cm - transverse and 1.8 cm - anterior - posterior . The patient had normal bone densitometry for her age and no erlenmeyer flask deformities were noted on her radiographs . The patient is a 23 year old female followed at the national institutes of health under an institutional review board approved clinical protocol since her diagnosis of type 3 gd at age 7 months . Two years prior to her birth, her brother, also diagnosed with gd, died from a ruptured spleen at age 2 years . Her perinatal course was unremarkable, but an enlarged liver and spleen were noted at age 6 months, prompting dna testing for gd . The patient was started on ert with recombinant glucocerebrosidase at age 7 months at a dose of 60 iu / kg every two weeks . The dose was subsequently doubled to 120 iu / kg every two weeks when she reported hip pain at age 10 years . While she is currently asymptomatic, diffuse moderate reticular lung densities scattered bilaterally are noted on radiographs and computed tomographs of her chest, and pulmonary function tests show a mild restrictive ventilatory defect and a moderate diffusion abnormality . Years, the patient reported two episodes of bone pain that were sudden and severe occurring several months apart . The first, occurring in her left anterior thigh, resolved within a few days after self - treatment with acetaminophen . This was followed by a much more painful episode 7 months later in her right anterior thigh that lasted several weeks, was treated with tramadol, and ultimately resolved . On evaluation at age 23 years, radiographs of her femurs showed bilateral symmetrical lucent cortical lesions, centered in the medial cortices of the mid - diaphysis (fig . 1a). These had a benign appearance, resembling non - ossifying fibromas . On magnetic resonance imaging (mri), the femoral lesions had t2 signal hyperintensity, with marginal enhancement within the cortex of the midshaft diaphysis (fig . The diameters of the right femur lesion were measured at 1.9 cm - craniocaudad, 1 cm - transverse and 1 cm - anterior - posterior, while the left femur lesion was 3.6 cm - craniocaudad, 1.3 cm - transverse and 1.8 cm - anterior - posterior . The patient had normal bone densitometry for her age and no erlenmeyer flask deformities were noted on her radiographs . This is the third patient with type 3 gd with the unique features of symmetrical bilateral cortical bone lesions . Aside from the bone involvement, this patient shares other similarities with the previously reported cases including abnormal saccadic eye movements, gender, approximate age of disease onset and genotype . All three patients were free from the more common bony symptoms of gd that manifest as larger, progressively expanding lesions occupying corticomedullary regions of bone . Additionally, each patient was started on ert at an early age and responded favorably, with reduced organomegaly and improved hematologic parameters including hematocrit, hemoglobin and platelet counts . Ert with recombinant glucocerebrosidase, first introduced in the early 1990s, is the standard of care for patients with types 1 and 3 gd and has remarkably altered the extent of visceral, hematologic and bony manifestations, especially in children,, . Her future treatment plan includes conservative monitoring . The symmetric appearance, and similarity to the other two patients who did have pathologic confirmation of a gd - related process, aided in this decision . Bone disease is common in patients with type 1 and 3 gd, but the pathophysiology is still not well understood . It is believed that one cause of gd - associated bone pathology in marrow tissue is glucocerebroside accumulation which alters marrow vascularity and may lead to bone infarction, necrosis and fractures . Additionally, in gd, activation of macrophages may induce bone pathology by promoting inflammatory processes, arising from altered expression of cytokines and inflammatory mediators such as il-1, il-6 and tumor necrosis factor - alpha . An overall decrease in t - lymphocyte levels has also been reported in patients with gd who have bone involvement . Focal osteolytic lesions resembling those presented here have been associated with increased cathepsin k by activated osteoclasts, . More reliable, candidate biomarkers involved in the dynamic bone processes of osteo - immunology and remodeling are needed to better understand the gd - associated bone metabolism changes . The bilateral symmetrical osteolytic lesions seen in these three cases are atypical findings in patients with type 3 gd . A unique feature shared by the three patients was early diagnosis and treatment with ert, associated with a relatively benign clinical course . In previous generations, children with type 3 gd often did not survive to their second or third decade and thus, such findings may not had time to manifest and be recognized . Alternately, the findings might be related to the chronic, long - term treatment . Such cases not only serve to catalog the phenotypic diversity of gd - associated bone disease, but also expand our understanding of the evolving natural history of treated gd.
|
Diabetic nephropathy became the leading cause of chronic dialysis in 1998 . Since then, the incidence of this condition has increased, with only a recent plateau . However, diabetic nephropathy continues to account for a large proportion of all cases of chronic kidney disease (ckd), and remains by far the most common underlying cause of chronic dialysis among all kidney diseases5, consequently leading to the escalation of healthcare costs, thus representing a compelling medico - social issue of interest . The classification of diabetic nephropathy (hereafter classification) developed earlier by the research group of diabetic nephropathy at the ministry of health, labor and welfare (mhlw)6, and later revised by the joint committee on diabetic nephropathy (hereafter committee)7 is widely used in japan . However, as the concept of ckd was proposed, followed by the classification of ckd stages8, it became clear that there exists a subpopulation of patients with discrepant classifications of diabetic nephropathy and ckd . This is thought to be because of the fact that diabetic nephropathy is primarily classified according to the extent of albuminuria in addition to the glomerular filtration rate (gfr; i.e., creatinine clearance [ccr]), whereas ckd is primarily classified based on the estimated gfr (estimated gfr [egfr]). Meanwhile, egfr has become increasingly used to assess gfr, and a new classification of ckd was developed in 20129 . Against this background, the committee therefore discussed issues of interest in depth, and sought to develop a revision of the classification . Prior to revising the classification, as part of a mhlw - subsidized project on kidney disease, entitled diabetic nephropathy research, from the ministry of health, labor and welfare of japan, a historical cohort study was conducted by the research group of diabetic nephropathy, mhlw, involving a total of 4,355 subjects with type 2 diabetes from 10 participating healthcare facilities with the aim of evaluating renal events (i.e., a decrease in egfr to half the baseline level and/or the need for dialysis), cardiovascular events and all - cause mortality10,11 . Summarized below are the major findings of that study (for detailed information, please access the mhlw website http://www.mhlw.go.jp/ or refer to the literature cited above). Renal and cardiovascular events and all - cause mortality were significantly increased in the subjects with micro- or macroalbuminuria compared to that observed in the subjects with normoalbuminuria . In those with renal impairment (defined as a gfr <60 ml / min/1.73 m): the risk of renal events increased in association with the onset of microalbuminuria and further increased with the onset of macroalbuminuria in the subjects; the risk of cardiovascular events was increased those with micro-/ macroalbuminuria; and all - cause mortality was increased in the subjects with macroalbuminuria as well as those with normoalbuminuria and microalbuminuria who exhibited a gfr of <30 ml / min/1.73 m. renal and cardiovascular events and all - cause mortality were significantly increased in the subjects with micro- or macroalbuminuria compared to that observed in the subjects with normoalbuminuria . In those with renal impairment (defined as a gfr <60 ml / min/1.73 m): the risk of renal events increased in association with the onset of microalbuminuria and further increased with the onset of macroalbuminuria in the subjects; the risk of cardiovascular events was increased those with micro-/ macroalbuminuria; and all - cause mortality was increased in the subjects with macroalbuminuria as well as those with normoalbuminuria and microalbuminuria who exhibited a gfr of <30 ml / min/1.73 m. the risk of renal events increased in association with the onset of microalbuminuria and further increased with the onset of macroalbuminuria in the subjects; the risk of cardiovascular events was increased those with micro-/ macroalbuminuria; and all - cause mortality was increased in the subjects with macroalbuminuria as well as those with normoalbuminuria and microalbuminuria who exhibited a gfr of <30 ml / min/1.73 m. while that study was not a true prospective study, and involved only a limited number of facilities and patients from a population known to be less prone to cardiovascular events than those in western countries, the findings provide important insight into the prognosis of diabetic nephropathy in japanese patients . Therefore, in seeking to revise the classification, the committee gave due consideration to the above findings . The bulk of evidence for the classification of diabetic nephropathy comes from randomized controlled studies enrolling patients with diabetic nephropathy as defined based on the extent of albuminuria, and very little evidence is available for diabetic nephropathy as defined based on gfr . The current medical service fee schedule for guidance on preventing diabetes - associated dialysis was developed with the classification in mind . The guidelines for clinical efficacy evaluation of pharmacological agents for diabetic nephropathy (draft) currently in use were developed with the classification in mind . Therefore, after giving due consideration to all of these issues during the course of several sessions, the committee decided to leave the classification essentially unchanged for now (table1), while showing how it might be aligned with the widespread ckd classification based on gfr (egfr; appendix 1). The former is not, however, presented as a heat map, due to the limitations of the study referred to above, which involved a small number of patients with diabetic nephropathy and included no dialysis patients, providing the basis for this revision . Again, as all kidney diseases affecting patients with diabetes are covered in the classification, the committee called for attention, with notes included where required, in order to highlight the importance of the differential diagnosis between diabetic nephropathy and non - diabetic kidney disease in all stages . The differential diagnosis calls for collaboration with nephrologists; such collaboration is not limited to cases requiring a renal biopsy . Furthermore, given that the disease may not always progress in some patients, numerous notes were included in the table in order to call attention to these cases . Additionally, in view of the potential need to use multiple antidiabetic drugs over time, key precautions in view of drug use are included below the table . The major revisions to the classification are summarized as below: egfr is now substituted for gfr in the classification . The stages used in the classification have been simplified to include normoalbuminuria, microalbuminuria, macroalbuminuria and kidney failure . The division between a and b (early versus late macroalbuminuria) in stage 3 has been abandoned, and a and b have been reintegrated, due to the paucity of evidence for proteinuria of 1 g / day as the threshold for dividing the stage . Kidney failure has been redefined in all cases as a gfr less than 30 ml / min/1.73 m, which represents the threshold value for kidney failure obtained by quantifying the existing definition of kidney failure in the classification based on the classification of the japanese society of nephrology (jsn)12 with all other pre - kidney failure conditions redefined as a gfr of 30 ml / min/1.73 m or greater . Qualifying or illustrating phases in parentheses, such as e.g., incipient nephropathy, have been retained throughout the classification, as they have become common currency in the field, although their removal from the classification was suggested during the process of revision . Stress is now placed on the differential diagnosis of diabetic nephropathy versus non - diabetic kidney disease as being crucial in all stages of diabetic nephropathy . Classification of diabetic nephropathy 2014jdi diabetic nephropathy does not always progress from one stage to the next . The revised classification takes into account findings on the prognosis of type 2 diabetic patients from a historical cohort study carried out as part of the ministry of health, labor and welfare - subsidized project on kidney disease, entitled diabetic nephropathy research, from the ministry of health, labor and welfare of japan'10,11 . Although a glomerular filtration rate (gfr) of less than 60 ml / min/1.73 m is consistent with the diagnosis of chronic kidney disease, underlying causes other than diabetic nephropathy might be involved in patients with a gfr below 60 ml / min/1.73 m, thus calling for the differential diagnosis between diabetic nephropathy and any other potential non - diabetic kidney diseases . Patients with microalbuminuria are to be diagnosed as incipient nephropathy after the differential diagnosis based on the criteria for an early diagnosis of diabetic nephropathy . Precautions are required in patients with macroalbuminuria, in whom renal events (e.g., a decrease in estimated gfr [egfr] to half its baseline value, the need for dialysis) have been shown to increase as the gfr decreases below 60 ml / min/1.73 m. all patients with a gfr of less than 30 ml / min/1.73 m are classified as showing kidney failure, regardless of their urinary albumin / protein values . However, in those with normoalbuminuria and microalbuminuria, the differential diagnosis is required between diabetic nephropathy and any other potential non - diabetic renal diseases . Key precautions in view of drug use: this table is intended, first and foremost, as a classification of diabetic nephropathy and not as a guide to drug use . All drugs, including antidiabetic drugs, particularly renally metabolized agents, are to be used in accordance with their prescribing information, with due consideration to relevant factors, such as gfr, in each patient . Of note, the american diabetes association (ada) proposed in its clinical practice recommendations 2013 that all cases of albuminuria of 30 g / mg cr (= mg / g cr) be defined as increased urinary albumin excretion, thus abandoning the division between micro- and macroalbuminuria13 . Again, while this concept was retained in the clinical practice recommendations 2014, the ada further proposed that microalbuminuria and macroalbuminuria be redefined as persistent albuminuria of 30299 mg/24 h and 300 mg/24 h, respectively14 . While this change may result in the terms micro- and macroalbuminuria ceasing to be common currency in the clinical setting in the usa, to avoid confusion, the committee has chosen not to follow suit and rather err on the side of caution, thereby retaining these terms in the classification, given that they are less likely to no longer be used in scientific publications and are expected to remain common currency in japan . Last but not least, with a number of multicenter prospective studies currently underway, including the japan diabetes complication and prevention prospective (jdcp) study, jsn registries, japan diabetes clinical data management (jddm) studies and japan diabetes optimal integrated treatment for three major risk factors of cardiovascular diseases (j - doit3) randomized study, the committee also plans to further revise the classification in a timely fashion as required, as relevant evidence becomes available from these and other studies . In order to resolve the discrepancy between the existing classification of diabetic nephropathy and the current classification of ckd stages, the joint committee on diabetic nephropathy revised its classification of diabetic nephropathy . The new classification has already been uploaded onto the website of each member society represented on the joint committee as of january 10, 2014 . Again, in view of further revisions in the years to come, the joint committee has termed the revised classification, as the classification of diabetic nephropathy 2014.
|
In our daily clinical work we have noted an increasing number of cosmetic surgeries performed abroad in eastern and southern europe for financial reasons, similar to american lipotourism, or liposurgery performed abroad, mostly in latin america and the caribbean . In our opinion this cosmetic - surgery tourism will lead to an increasing number of cases of rare infections in europe, as has been observed in the united states [13]. We report a case of a 30-year - old woman, a german of turkish origin, who was admitted to our hospital in february 2014 for recurrent infections of the abdominal wall . Three months after surgery, in january 2013, she first noticed skin lesions near the incision lines . In the meantime, before she was admitted to our hospital, she had consulted several physicians regarding various abscesses of the left abdominal wall, but the abscesses always recurred after a short period of time . The patient was a nonsmoking woman with a normal body mass index of 21 kg / m and without a history of any serious disease or immunosuppression . Abdominal examination revealed extensive phlegmon and several locular abscesses in the abdominal wall (fig . We decided to relieve the largest abscess under local anesthesia, took a swab sample from an inner wound for microbiologic analysis, initiated antibiotic therapy with clarithromycin 500 mg twice a day and scheduled an extensive surgical debridement of the wounds with the patient under general anesthesia . Before surgery we performed magnetic resonance tomography (mrt) to exclude any deeper infections of the abdominal wall and to estimate the extent of the infection . The mrt revealed no infiltrations of the abdominal muscles; the two largest abscesses measured 9 1 cm and 5 2 cm . During the inpatient treatment we performed a surgical debridement of the wound and initiated a vacuum - assisted closure (vac) therapy . In the following the patient was discharged with inconspicuous wounds and in overall good health . In the meantime antimicrobial susceptibility testing by the gradient diffusion method found the following minimum inhibitory concentrations: amikacin 1.0 g / ml, levofloxacin 0.125 g / ml, moxifloxacin 0.047 g / ml, clarithromycin 1.5 g / ml, linezolid> 256 g / ml, rifampin> 32 g / ml, tetracycline 0.064 g / ml, imipenem 4 g / ml, meropenem 3 g / ml, ampicillin> 256 g / ml and amoxicillin / clavulanic acid> 256 g / ml . Two weeks after discharge the patient again presented with abdominal wall pain and indurations of the skin (fig . We reinitiated antibiotic therapy with clarithromycin 500 mg twice a day and reevaluated the surgical and medical treatment options in close cooperation with the institute of medical microbiology of the university hospital mnster . The swab sample taken from the wound at this time again grew m. fortuitum . Additionally, multiple flora were identified, including prevotella bergensis, actinomyces europaeus, staphylococcus epidermidis, micrococcus luteus, lactobacillus sp . And because of the continuous progression of the disease over the last months and the proximity to the internal abdominal organs, interdisciplinary discussion led to the conclusion that the case was a potentially life - threatening illness . It was decided that inpatient treatment with radical debridement of the infected abdominal soft tissue, in combination with targeted antimicrobial therapy according to the results of susceptibility testing, was necessary . For antimicrobial therapy we decided to treat the patient intravenously for 14 days with amikacin (15 mg / kg) and moxifloxacin 400 mg once per day, clarithromycin 500 mg twice a day and ampicillin / sulbactam 3 g every 8 hours . After that she received oral antimicrobial therapy with moxifloxacin 400 mg once a day and clarithromycin 500 mg twice a day for 3 months . We began the hospital treatment with this extended antibiotic therapy and radical debridement (fig . 1c), initiating vac therapy followed by several revisions with continued vac therapy to prepare the wound for skin grafting . The patient was discharged from hospital with prescribed oral antibiotics and was regularly followed up . At the 1-year follow - up there was no sign of reinfection, and no pathologic findings were found in the blood tests . M. fortuitum is a rapidly growing mycobacterium that can cause severe infections leading to unsuccessful wound healing, wound dehiscence and infection recurrence . Suspicion arises with a lack of response to conventional antibiotic regimens and if standard bacterial cultures remain negative . M. fortuitum is found in lakes, rivers, tap water, wastewater, and dust and dirt, and it can infect a wound when exposed to contaminated tap water . Hospital - acquired disease caused by poor hygiene of sanitary facilities has previously been reported, but these infections usually present as disseminated skin lesions and soft tissue lesions, predominantly occurring in the setting of severe immunosuppression, especially in aids [68]. It can be the cause of multiple types of infections such as sternal wound infections after cardiothoracic surgery or after breast augmentation surgery, e.g. Due to contamination of the wound with contaminated tap water . Recent outbreaks have also been described in immunocompetent hosts after use of contaminated whirlpool foot baths in nail salons . M. fortuitum infections after liposurgery have been reported in different continents but to our knowledge not yet in europe . There have been reported outbreaks of mycobacterium abscessus wound infections in lipotourists from the united states who underwent abdominoplasty in the dominican republic . Travelling to foreign countries, with their supposedly lower costs for cosmetic surgery, is relatively common in the united states; these cosmetic surgeries are performed mostly in latin america and the caribbean [13,11]. In recent years this kind of tourism seems to have recruited an increasing number of patients in europe too, which may confront physicians with uncommon disease patterns, especially physicians in private practice and those practicing in general medicine . Therefore, it is important to execute a full history of the patient and to know the significant signs of this rare infection . In particular, a negative standard bacterial culture, a lack of response to conventional antibiotic regimens and infection recurrence, particularly months after surgery, should set physicians' alarm bells ringing . We report a successful surgical and antibiotic treatment of a m. fortuitum infection after abdominoplasty . In our case awareness among physicians will, we hope, result in faster identification and treatment of these cases . It is important to make patients appreciate the higher standards of hygiene and the more skilled performance of these procedures even though they are associated with higher cost . Bargain hunters should be made aware that in the end the price of their abdominoplasty may be higher than expected.
|
The existence of conserved longevity pathways may seem counterintuitive from an evolutionary perspective . This is because evolution selects for reproductive success rather than long life . In fact, a leading theory of the evolution of aging, antagonistic pleiotropy, even stipulates that genotypes promoting reproduction earlier in life actually accelerate the aging process later in life (fig . 1). Consistent with this notion, several species experience a decline in early reproductive rate under cr conditions . In contrast, a recent report indicates that the same genes can confer high early - life fitness and long life . While future work is needed to improve our understanding of the evolution of aging and longevity, it is clear that various genetic and environmental conditions can alter lifespan . One of the promises of the study of conserved aging / longevity pathways is that it will lead to applications that help us reduce the morbidity associated with age - related diseases as well as increase overall human lifespan . (a) positive and antagonistic pleiotropy theories suggest that alterations conferring advantages in early life respectively trigger beneficial and deleterious effects at the post - reproductive age . It has long been appreciated that caloric restriction (cr) is a wide - ranging and potent anti - aging intervention . As early as 1935, it was observed that reduction of caloric intake relative to ad libitum (al; or unrestricted feeding) results in an extension in the average and maximal lifespan of laboratory mice . Since then, similar findings have been reported for a diverse range of organisms including yeast, nematodes, fruit flies, fish, rats, mice, and dogs, among others . The discovery of such a potent anti - aging intervention has set the stage for research into the biology of aging and its modulation by caloric restriction . However, contrary to the well - documented positive effects of caloric restriction, several studies reported caloric restriction to be neutral or even detrimental to lifespan . For example, studies have found that caloric restriction regimens fail to impact lifespan in rhesus monkeys, wild mice, medflies, an isolate of the nematode c. remanai, the spider l. hasselti, and some yeast strains . Even more striking, cr actually shortened lifespan in several models including houseflies, male butterflies, the rotifer cephalodella sp ., ilsxiss mice strains, and some yeast strains (table 1). The work done with ilsxiss mice is particularly poignant . A meta - analysis of all mice studies excluding the ilsxiss strains reveals an average cr - dependent increase in lifespan of 15% . When the ilsxiss strains are included in the meta - analysis the average increase in lifespan drops to 2.9% . The ilsxiss studies set cr at 60% of al intake in agreement with common standards in the field but it remains possible that more or less substantial restrictions may promote the lifespan of both ilsxiss and other mice strains . Taken together, these studies indicate that standard caloric restriction regimens do not universally promote longevity in various organisms . In other words, several more variables may exist within the equation determining the impact of cr on lifespan than originally anticipated . Caloric restriction has been proposed to impact lifespan by affecting genomic stability, autophagy, oxidative stress, nutrient intake and body weight, among other processes . Here we briefly highlight some of these processes and assess how they may be differentially impacted by cr to either positively or negatively affect lifespan . For reviews more focused on fully deciphering aging processes, we refer the reader elsewhere . How this impacts lifespan depends on which tissues are catabolised and the starting weight of the individual . As they start following cr regimens, obese individuals typically increase their lifespan as they lose fat mass . Simply put, this is because obesity is correlated with a number of age - associated pathologies such as cardiovascular disease and diabetes . Consistent with this rationale, in obese human males, cr reduces body fat while also significantly decreasing obesity - related pathologies such as high blood pressure and chronic inflammation . In addition, in obese mice, the combination of cr and omega-3-polyunsaturated fatty acid intake simultaneously counteracts adiposity and chronic inflammation . In contrast, fat loss under cr is linked to lifespan shortening in the non - obese . For example, in non - obese mice, cr - induced fat loss is inversely correlated with lifespan . In addition, age - associated pathologies such as respiratory disease correlated with body weight loss in non - obese humans although cr can lower biomarkers for cardiovascular disease in this segment of the population . Although losing body weight appears to lower lifespan in non - obese humans aged 5070 even when health status is considered, it is unclear if this applies to other age cohorts . Together, these studies and rationales suggest that the starting weight of an individual may dictate whether cr - induced fat loss positively or negatively impacts lifespan . Increased muscle mass has been shown to have an important protective effect in several age - related diseases and losing muscle mass can therefore be deleterious . Indeed, even in ilsxiss mice, lean / muscle body mass correlated positively with lifespan under cr conditions . Taken together . Therefore, the impact of cr - mediated weight loss on lifespan may be bidirectional dependent on the starting weight and tissue(s) catabolised . This indicates that there may be an optimal body mass density for lifespan . In humans, recent evidence has pointed toward this as being at the high end of what is typically considered a healthy weight, 22.525 kg / m . Alternatively, it is possible that weight loss in and of itself is a stressor whose deleterious side effects on lifespan are only mitigated if the starting weight is significantly above the ideal . Interestingly, the magnitude and quality of weight loss may also depend on the nutritional composition of the cr diet itself . In fact, the very idea that it is solely the actual decrease in caloric content that accounts for cr - dependent lifespan modulation has been questioned . Instead, it may be that the varying restriction of nutrients in different diets, which may be commonly referred to as a cr diet, can positively or negatively impact lifespan depending on the particular nutrients affected . The fruit fly d. melanogaster can be subjected to a yeast - based or sugar - based diet . Decreased intake of yeast or sugar increases lifespan . Interestingly, the positive effect on lifespan per calorie decreased was much more substantial under the yeast - based diet relative to the sugar - based counterpart . This suggests that it is not simply the decreased caloric content per se that solely impacts lifespan . One possibility is that restriction of yeast - based diets also limits the amount of other nutrients within this diet . Consistent with this reasoning, methionine restriction significantly increases murine lifespan independently of caloric content . It is conceivable that the restriction of several amino - acids or nutrients would have similar effects . Therefore, in addition to altering overall caloric intake, certain cr diets may also extend lifespan via restriction of various lifespan - limiting dietary components or nutrients . Specific nutritional composition may also explain contradictory results on the impact of different cr diets on lifespan . For example, one of many possible explanations for these apparently contradictory results on the effect of cr on rhesus monkey lifespan may be the dietary composition; the study in which the monkeys responded to cr had al diets with higher sucrose and lower antioxidants and omega 3 polyunsaturated acids . Thus, different cr regimens with multiple variations in overall nutrient balance are very likely to trigger a wide range of responses with respect to lifespan . For example, a cr regimen that restricts methionine while maintaining antioxidants might extend lifespan while a regimen that limits omega-3-polyunsaturated acids while maintaining sucrose may shorten lifespan . Overall, it is not surprising that the underlying nutritional composition of a diet influences the ultimate impact of cr regimens on lifespan . Future research in organisms with complex diets should carefully control for the nutritional composition of diets in order to accurately distinguish calorie - dependent from nutrient - dependent effects on lifespan . In addition, one should revisit some of the previously published cr studies to eliminate any potential confounding factors that may be linked to background nutrient deprivation or starvation . More specifically, experiments showing a decline in longevity in response to cr have not been generally performed across a range of nutrient levels and it remains possible that a number of these reports would have revealed enhanced longevity under similar caloric but different nutrient conditions . Beyond confounding dietary designs, cr certainly influences multiple processes operating at the cellular level . For example, cr can promote genome stability by sustaining dna repair processes and also protecting repetitive dna loci such as telomeres and rdna . However, pre - existing conditions in these endogenous pathways can occur in certain genetic settings, in which case the effect of cr on lifespan may rapidly turn from positive to deleterious . One of the dna repair pathways influenced by cr is base excision repair (ber), which repairs small non - helical distorting lesions in dna . Ber declines with age but caloric restriction prevents such age - associated declines in mice . This is likely linked to the ability of cr to promote rate limiting factors in the ber pathway . For example, cr increases the enzymatic activity of apyramidine / apurinic endonuclease as well as the expression of dna polymerase . Caloric restriction is also capable of activating nucleotide excision repair (ner), which repairs helical - distorting dna damage caused by large bulky adducts . In mice, as with ber, ner rates decline with age but this decline is prevented by cr . In addition, ner dysfunction is linked to skin cancer development and the premature aging disease xeroderma pigmentosum . Another dna repair pathway in which cr may be implicated is non - homologous end joining (nhej), which repairs the majority of dna double - stranded breaks (dsbs) in mammalian cells . Interestingly, ku expression declines with age in rats but cr can counteract this phenomenon . Future work will show if cr impacts actual nhej rates and if this in turn directly affects lifespan . Taken together, cr may promote lifespan by promoting the lifelong maintenance of several dna repair pathways . In fact, cr also modulates processes that help prevent dna damage from occurring in the first place . One area of intense investigation has been to understand the impact of cr on conserved repetitive dna loci known to significantly affect cellular lifespan from yeast to human . In particular, budding yeast has served as a highly valuable tool to decipher many conserved cellular aging mechanisms . Yeast lifespan can be analyzed both in terms of replicative lifespan (number of daughter cells produced by a new mother cell) and chronological lifespan (survival of non - dividing cells). Lifespan of the budding yeast s. cerevisiae is highly dependent on the stability of repetitive dna loci, in particular the rdna (rdna) repeats as well as the telomeres . Due to their highly repetitive nature, while this can be protective under extreme stress conditions, aberrant or hyperactive recombination within the repeats generally leads to chromosome instability and shortens cellular lifespan . Cr typically decreases recombination within the rdna repeats via a form of rdna silencing that represses intergenic rna pol ii - dependent transcription and this extends lifespan . Cr has been proposed to suppress recombination within rdna repeats through multiple mechanisms including the repression of the nutrient - sensing target of rapamycin (tor) complex as well as activation of the conserved nad - dependent histone deacetylase sir2 (silent information regulator 2). Interestingly, sir2 is required for cr - dependent extension of replicative but not chronological lifespan . More recently, cr has also been proposed to increase lifespan by suppressing the activity of rdna origins of replication preventing them from deleteriously competing with weaker replication origins elsewhere in the genome . In human cells, the sir2 homolog sirt1 (sirtuin 1) acts as a subunit of the enosc (energy - dependent nucleolar silencing complex) to ensure a form of rdna silencing that represses rna pol i - dependent transcription in a glucose - dependent manner . Sirt1, which is also activated by cr, is linked to cell survival in human cells . It is likely that sirt1-dependent rdna silencing increases cellular lifespan by decreasing deleterious recombination, similarly to yeast . On another front, telomeres are linear dna sequences that are located at the ends of linear chromosomes and are amplified to prevent excessive chromosome shortening and subsequent genome destabilization during cell division . Importantly, it is clear that telomere length maintenance as well as downstream sirtuin - dependent silent chromatin assembly are both critical to lifespan maintenance . Cr can promote subtelomeric silencing in yeast through sir2 and this translates to a longer cellular lifespan . Sirt6 (sirtuin 6), which is another human sir2 homolog, also promotes telomeric silencing in human cells . As cr increases sirt6 levels, this suggests that cr may promote mammalian lifespan in part by increasing telomeric silencing . Furthermore, in mice and rats, a cr diet helps maintain the length of telomeres over the lifetime of the animal . Telomere length maintenance is a strong predictor of lifespan and it is thus likely that cr - dependent telomere length maintenance promotes lifespan . Sirt1 may also regulate telomere length and attenuate age - associated telomere shortening, suggesting that cr acts upstream of sirt1 to regulate telomere length and promote lifespan . However, tor also appears to be important for telomere length maintenance and lifespan in yeast . Therefore, it is likely that cr acts through both sirtuins and tor modulation to in order to optimize lifespan - sustaining telomeric functions . It is important to note that additional cr - dependent processes maintaining rdna / telomere stability may still exist as currently identified pathways only partly account for the beneficial effects of cr at these repetitive genomic loci . Together, current literature clearly indicates that cr activates processes operating at least at the repetitive dna loci, rdna and telomeres, in order to prevent genome instability (fig . 2). We also note that the dysregulation of other types of repetitive dna sequences such as transposable elements have been linked to genome instability and aging . It is therefore possible that cr may somehow control these elements in order to promote lifespan . Overall, cr is a potent genome maintenance intervention that both prevents dna damage and promotes dna repair . Stability of dna is maintained by increasing dna repair pathways and controlling repetitive dna loci . Dna repair pathways controlled by cr include base excision repair (ber), nucleotide excision repair (ner) and non - homologous end - joining (nhej). At the repetitive dna loci, cr prevents deleterious recombination at the rdna repeats, increases telomeric silencing and maintains telomere length to increase lifespan . Cr can also increase genomic stability by lowering the production of reactive oxygen species (ros) as well as promoting the function of antioxidants (e.g., superoxide dismutase enzymes). Cr may decrease ros production by increasing mitochondrial efficiency or by decreasing mitochondrial membrane potential . Although these genome - stabilizing effects of cr can generally be viewed as beneficial, it is possible to imagine various settings in which they may ultimately shorten lifespan . For example, by decreasing dna recombination capacity and genomic flexibility, cells often lose the ability to efficiently adapt to variable environmental conditions . In addition, cellular aging can be beneficial in multicellular organisms that need to balance new cell generation and old cell clearance within tissues and organs . Consistent with this rationale, it was recently discovered that senescence itself is a normal part of development . This may eventually help explain how gestational cr is linked to accelerated aging in rats . It is also possible that hyperactivation of dna repair processes too early in life may disrupt the fine line between telomere maintenance and dna repair processes . This could in turn lead to the erroneous recognition of telomeres as broken dna ends . Future studies possibly employing systems biology tools to assess relationships between various cr - dependent genome maintenance processes at different stages of life could help clarify these points . Calorie restriction also increases autophagy, which is the mechanism responsible for catabolizing cellular components such as organelles by targeting them for lysosome - dependent degradation . While eliminating old cellular components that may be malfunctioning and/or cytotoxic, autophagy consistent with this notion, cr mimetics fail to extend the lifespan of autophagy - deficient c. elegans . In addition, arabidopsis requires autophagy genes for lifespan extension under light restriction, which is the autotrophic analog of cr . These data indicate that autophagy can mediate cr - dependent lifespan extension within various settings . For example, absence of the essential autophagic modulator beclin-1 abolishes the lifespan extension that has been observed in c. elegans upon overexpression of the sirtuin sir2.1 . We note that these effects may reflect changes to processes that are independent of sir2.1 itself, whose overexpression may not actually underlie the extended lifespan phenotypes initially reported . Cr - dependent suppression of tor also promotes autophagy in a variety of species and does so independently of sirtuins in c. elegans . This may be linked to the ability of tor to suppress adenosine monophosphate - activated protein kinase, which is a potent activator of autophagy . Thus, sirtuin activation and tor suppression may partly underlie autophagy - dependent lifespan extension by cr . Healthy aging is also thought to depend on the proper maintenance of adult stem cells . Interestingly, autophagy is essential for the lifelong maintenance of hematopoietic stem cells and for supporting an old blood system . This phenomenon appears to implicate a foxo3a - dependent gene expression program and is activated by cr . Overall, it is reasonable to conclude that autophagy underlies at least some of the beneficial effects of cr on lifespan . If specific autophagy - related processes can also be linked to the negative effects of cr on lifespan in certain settings remains unclear . One possibility may be that activating autophagy when autophagic vesicles cannot fuse with lysosomes such as in danon s disease would be deleterious as this leads to an accumulation of non - functional autophagic vesicles . In fact, aberrant autophagy genes are also linked to several other diseases including cancer (ovarian, breast, prostate, colon), autoimmune diseases (lupus), asthma, crohn s disease, and others . This greatly increases the clinical settings in which cr - dependent activation of autophagy may simply exacerbate phenotypes . In addition to promoting the autophagy of organelles including mitochondria, cr can decrease oxidative stress through several distinct pathways . Oxidative stress in an organism is largely due to the accumulation of reactive oxygen species (ros). By damaging nucleic acids, proteins, and other molecules, cr can promote lifespan by both lowering the production of ros as well as promoting the function of antioxidants that can repair ros - induced damage . However, cr also promotes mitochondrial activity, which inevitably increases the chance of ros production . Thus, a delicate balance must be maintained for cr to actually decrease ros - induced damage and extend lifespan ., cr activates sirt3 (sirtuin 3), which in turn promotes the deacetylation and consequent activation of the antioxidant enzyme sod2 (superoxide dismutase 2). Sirt3 activation also promotes the glutathione antioxidant idh2 (isocitrate dehydrogenase 2), which decreases age - associated hearing loss in mice . Therefore, cr may operate in part through sirtuins to promote the function of antioxidants and extend lifespan . As antioxidant activity counteracts the deleterious effects of ros, cr - dependent upregulation of antioxidants can promote lifespan extension . Of note, several reports have suggested that the antioxidant - dependent impact of cr on lifespan may reflect tissue specific processes that can also differ between organisms . Cr may also be capable of promoting lifespan by increasing mitochondrial efficiency and energy production . Indeed, cr increases mitochondrial respiration rates as well as the overall number of mitochondria in mouse cells . Cr can also increase the number of mitochondria in human cells . While increased mitochondrial bioenergetics can be beneficial, one explanation is that cr increases overall mitochondrial efficiency, thereby decreasing the number of electrons stalling in the electron transport chain (etc) and preventing excessive ros generation . Electrons stall in the etc when their rate of entry exceeds their rate of transit . It was proposed that cr - dependent improvement of mitochondrial bioenergetics may prevent electron stalling by permitting mitochondria to simultaneously process a greater number of electrons . Consistent with this possibility, cr - treated rats have decreased electron leaks within the etc complex i. thus, by increasing mitochondrial efficiency, cr may limit ros - generating electron leaks and promote lifespan . The latter increases with age and this lowers vacuolar storage capabilities . In turn, this increases the concentration of free cytoplasmic amino acids . It is thought that mitochondrial catabolism of cytoplasmic amino acids places a burden on mitochondrial carrier proteins and this in turn may overwhelm and increase mitochondrial membrane potential . Cr helps maintain a low vacuolar ph over lifespan, possibly through the lifespan - modulating usual suspect tor . Therefore, by maintaining a high vacuolar ph, cr can lower mitochondrial membrane potential, thereby decreasing ros production and increasing lifespan . Taken together, these studies point to cr as a suppressor of ros production as well as an activator of antioxidant processes . However, activation of the mitochondria is not always beneficial . In yeast sod2 knockout cells, this suggests that the increase in antioxidant activity is critical to maintain lifespan under cr . Without it, this seems to occur even if cr can lower ros generation during respiration in an antioxidant - independent fashion . Therefore, in these settings, the magnitude of oxidative damage caused by cr - mediated increases in respiration must be greater than the amount of oxidative damage decreased due to elevated mitochondrial efficiency and the maintenance of a low mitochondrial membrane potential . Furthermore, cr shortens the lifespan of yeast cells lacking vma (vacuolar membrane atpase). Vma proteins are responsible for vacuolar h - atpase function and therefore maintain vacuolar acidity by proton transport . Thus, cr fails to acidify vacuoles and increase amino acid storage in vma - deficient cells . The fact that cr shortens lifespan when its ability to lower mitochondrial membrane potential is impaired suggests that a low mitochondrial membrane potential is also required to compensate for the increased chance of ros production in the presence of cr - driven mitochondrial activation (fig . These data show that cr must maintain a low mitochondrial membrane potential and promote antioxidant functions in order to compensate for the elevation in ros levels that typically occurs upon cr - dependent increases in mitochondrial activity . Calorie restriction (cr) influences reactive oxygen species (ros) production through a delicate balance . When cr decreases mitochondrial membrane potential and increases antioxidant expression, ros production is reduced relative to ad libitum and lifespan may be increased (top scale). If either of these factors is absent, ros production will be increased relative to ad libitum and lifespan will be decreased (bottom scales). Overall, these findings paint the picture of a very delicate balance between lifespan extension and suppression through cr's effect on mitochondria . Cells will increase respiration and mitochondrial number, likely to compensate for decreased energy intake . Cr compensates for this via activation of antioxidant proteins and increasing mitochondrial efficiency via modulation of mitochondrial membrane potential . Overall, the combination of these changes allows cr to actually limit ros - dependent damage . However, when cr is unable to affect antioxidants or mitochondrial membrane potential, ros production is higher than in al . Conditions that alter the ability of cr to positively affect mitochondrial membrane potential can thus switch the effect of cr on lifespan from positive to negative . Lifespan outcomes may also reflect the notion that the effect of cr on antioxidants can display tissue and organism specificities . Overall, this delicate balance further highlights how cr is a broad acting intervention that may just be the key to unlocking the mysteries of aging . Calorie restriction has been proposed to impact lifespan by a great number of mechanisms, some of which are discussed here (fig . It is just emerging that various seemingly subtle changes in a genetic background can cause cr to have dramatically different consequences on lifespan . A recent study conducted in budding yeast indicates that the number of pathways the disruption of which causes the effects of cr on lifespan to change from neutral or positive to negative is substantial . These pathways include oxidative stress response, vacuolar function, and protein catabolism among others . It is important to note that different mutations impacting even the same pathway or organelle may cause cr to have different effects depending on the specific mutation . For example, although cr lowers the lifespan of superoxide dismutase mutants, it is mainly mitochondrial mutants that were found to positively respond to cr . However, several of the mutants whose lifespan responds positively to cr may reflect the ability of this broad acting dietary intervention to activate processes that correct or counteract defects triggered by the initial mutation . For example, tor inhibition, which is also achieved by cr, can alleviate mitochondrial disease in a mouse model of leigh syndrome . In contrast, within the setting of other mitochondrial diseases or even clinical conditions linked to dysfunctional autophagy genes, cr may actually shorten lifespan . This is likely to be only the tip of the iceberg as one can also imagine that cr will also exert unpredictable effects on cells / organisms carrying multiple genetic alterations or polymorphisms . Luckily, the fact that cr is expected to have a wide range of consequences on lifespan also implies that this dietary intervention will be beneficial within large fractions of the human population, be they healthy or suffering from various diseases . As we often strive to decrease our caloric intake in today s health - conscious society, it will also be just as important to identify those of us who may actually be harmed rather than helped by caloric restriction . Cr increases dna repair, promotes telomere length, decreases recombination particularly within repetitive dna loci, and may also ensure the function of weak dna replication origins . Taken together, the net effect of these changes is a decreased genomic flexibility and this may in turn prevent cells from efficiently adapting to various stress conditions (nuclear dashed box). Cr - dependent hyperactivation of dna repair processes early in life may disrupt the balance between dna repair and telomere maintenance . With regard to mitochondrial processes, cr increases antioxidant function and lowers membrane potential to lower ros production even in the presence of cr - dependent mitochondrial hyperactivity . However, in settings where cr - dependent increases in mitochondrial activity are not mitigated by other processes such as in superoxide dismutase mutant, cr increases ros - dependent damage (mitochondrial dashed box). In the vacuole, cr lowers ph, which promotes amino acid storage and may help lower mitochondrial membrane potential and overall ros levels . Vacuolar defects can cause cr to have a net negative effect on lifespan (dashed box inside vacuole). In the lysosome, cr promotes an increase in autophagy, which can help eliminate old organelles, including dysfunctional mitochondria . Mutations within autophagy genes are linked to a large number of clinical settings and this can in turn cause partial cr - dependent activation of autophagic processes triggering toxicity and lowering lifespan (dashed box within lysosome).
|
Resistance to antibiotics follows selection pressure and increases with their use . The current rate of resistance especially in gram - negative bacteria to multiple, most, or all antibiotics has reached alarming levels in many parts of the world . Such multidrug, extensively drug and pan - resistant bacteria limit therapeutic options and complicate clinical care . Since the late 1980s there has been a lack of true antibiotic innovation . No new classes of antibiotics meeting current unmet needs and being available for clinical use have been discovered for the last 30 years ., generating the data required for regulatory approval of a new antibiotic is difficult and expensive . Finally, antibiotics offer an unattractive return on investment to the private sector: revenues from antibiotics sales tend to be low, and higher revenues are offered in other disease areas . In 1980, there were more than 25 large, pharmaceutical companies with active antibacterial drug discovery programs; today only a few remain: glaxosmithkline, novartis, roche / genentech, merck, sanofi, medimmune . This creates an upstream knock - on effect, where small to medium enterprises (smes) and academics focused on antibacterial research may also struggle to secure financing as well as bring to market any promising products . The consequence of the innovation void is that doctors lack sufficient options for treating the most resistant infections in critically ill patients leading to significant morbidity and mortality . This also jeopardizes modern medicine s ability to safely perform other interventions such as routine surgeries and cancer treatment . Fortunately, there is now global recognition that antibiotic resistance is an emerging threat to public health, and political action is materializing, including through the g7 and g20 groups of countries, the world health organization (who), the united nations general assembly, the organization for economic co - operation and development (oecd) and many others . Both the british government and the european union (eu) have commissioned analyses regarding incentives to stimulate antibiotic innovation . The uk review on antimicrobial resistance (amr), chaired by lord jim oneill, delivered its final recommendations in may 2016 focusing not only on stimulating antibiotic innovation but also about increasing infection prevention and surveillance, examining alternative antibacterial technologies and improving rapid diagnostics . Other initiatives on amr (this term is now often used as synonym for antibiotic resistance) are also underway to provide concrete recommendations for overcoming important obstacles in the field of antibacterial drug resistance . For instance, the international research project drive - ab (i.e., driving reinvestment in research and development for antibiotics and advocating their responsible use, www.drive-ab.eu), is a consortium of 16 public sector partners and seven pharmaceutical companies supported by the european innovative medicines initiative (imi). Drive - ab is developing detailed recommendations regarding implementation, governance and financing of incentives to stimulate innovative antibacterial drug research and development (r&d). Its work is vetted by a broad range of stakeholders, and it is working closely with other ongoing initiatives related to antibiotic resistance . Concrete actions to stimulate greater antibiotic innovation have also been initiated . The united states biomedical advanced research and development authority (barda), the wellcome trust and the uk based amr centre have recently launched an early phase research accelerator called the combating antibiotic resistant bacteria biopharmaceutical accelerator (carb - x). It will fund antibacterial r&d from the first in - vivo proof - of - concept stage through phase 1 clinical development with an initial total program funding of more than usd 250 million . The united kingdom and china have recently launched the global antimicrobial resistance innovation fund aiming to attract gbp one billion . The global antibiotic research and development (gard) partnership is being incubated by the drugs for neglected diseases initiative (dndi) in collaboration with the world health organization (who) and in support of the global action plan for antimicrobial resistance . This partnership will focus on new antibiotic treatments addressing resistance and to promote their responsible use for optimal conservation, while ensuring equitable access for all in need . The imi programme new drugs for bad bugs (nd4bb) comprises currently seven projects and covers all aspects of antibiotic r&d . The eu continues to finance antibiotic resistance programmes across a range of areas via the joint programming initiative on amr (jpiamr), the eu framework programme for research and innovation horizon 2020 . It will also launch a joint action focusing on amr in 2017, likely including a call focused on r&d and innovation . Antibiotics and other anti - infective agents are like no other class of medicine, since consumption increases the emergence of resistance and diminishes the utility of the medicine for treating the population over time . Therefore, it is desirable to remove any incentives to unnecessarily consume these drugs . Yet the traditional reimbursement model for pharmaceuticals is based on sales volumes; manufacturers both innovating and generic earn revenues by maximizing unit - based sales, within legal standards . Many factors have contributed to the overconsumption of antibiotics, including, in the past, poorly regulated promotion and marketing practices . To avoid this undesirable incentive for antibiotic misuse, one delinked incentive recommended by oneill s amr review and others is called market entry reward . A market entry reward is a series of lump sum payments awarded to an innovator for achieving regulatory approval of an antibacterial therapy that meets predefined requirements . To effectively stimulate antibacterial innovation, the total reward payment needs to be significant in order to provide a reasonable return on investment as well as shift industry focus from other investment opportunities . Industry estimates that out - of - pocket costs of developing a new pharmaceutical in a global corporation are on average usd 1.4 billion, including failed programs and overhead costs . Whereas this figure is contentious and many argue that it is actually lower the r&d funds of large pharmaceutical firms are scarce, and shareholders expect that companies will allocate these funds effectively to deliver expected returns . Other therapeutic areas, like cancer or hepatitis c, can offer potential revenues of a billion or more usd per year . Therefore, a market entry reward designed to stimulate a multinational pharmaceutical company is estimated to require a total payout of between usd 0.8 to 1.3 billion paid out over a five - year period . This, of course, is a substantial amount for the public sector to pay out . So, the innovation delivered must meet carefully defined unmet public health needs . In other words, society s value for the specific antibacterial therapy must well exceed the billion dollar pay out . Since selection pressure is exerted as soon as a new antibiotic begins to be used and resistance may emerge and spread, it is in society s best interests to conserve the effectiveness of these novel antibiotics as long as possible . This means that these products should be used solely for patients where the antibiotic is expected to achieve better outcomes than any another antibiotic . This may translate into the novel antibiotic only being used rarely for confirmed targeted therapy, especially where current levels of multi - drug resistance are low and in countries with high standards of antibiotic stewardship and infection control . To ensure that society s significant investment is conserved, market entry rewards should be designed so that innovators will be incentivized and contractually bound to adhere to both sustainable use and access obligations, within their field of control . It is unethical to withhold life - saving antibiotics from patients anywhere in the world, and appropriate access, so long as the antibiotic is used appropriately, should expand the useful life time of a new antibiotic . The drivers of antibiotic resistance are interlinked, and single, isolated interventions have little impact . Therefore, the concept of sustainable use for antibiotics developed under such a new economic framework goes beyond classical hospital or community stewardship programs . Sustainable use policies aim to ensure that a range of actors are incentivized to extend the life time of a specific antibiotic or group of antibiotics . This includes the pharmaceutical company as a part of its sustainable use contractual obligations, governments of countries which receive the antibiotic at a reasonable price potentially as a result of a market entry reward, and, of course, physicians who administer the antibiotic . Examples of sustainable use obligations that pharmaceutical companies might need to agree to in order to receive delinked public payments could include: restricting sales for human use only not promoting the antibiotic beyond assisting qualified professionals to appropriately place the antibiotic within national and local guidelines, preferably by providing all necessary information according to pre - specified rules not donating any excess stocks of the antibiotic but rather disposing of it in a manner that does not contribute to environmental exposure performing environmental monitoring of its factories waste and those supplying active ingredients to ensure no leakage of the antibiotic into the environment labeling the antibiotic for restricted use by facilities deemed appropriate for the particular antibiotic for the particular geographic region, like tertiary hospitals or specialist centers equipped with specialized consultation services transparently reporting sales and implementing a warning system where a sudden significant increase in consumption by country is reported to the neutral governing body examples of sustainable use policies that would be implemented at national levels are listed below . One premise of these policies is that the innovation would be financed through a delinked reward, meaning that each, individual treatment would be affordably priced . These are focused on hospital antibiotics; orally available drugs for the community may need a different set of rules . Ensuring that mandatory hospital stewardship programs and responsible use policies are in place implementing appropriate stewardship controls, for instance, allowing the antibiotic to only be given by specifically authorized and trained staff in the case of a microbiologically proven infection; any other empiric use would need to be justified and documented monitoring consumption levels and addressing occurrences of inappropriate prescribing providing a centralized authorization procedure for outpatient antibiotic usage, in case of an orally available drug for multidrug - resistant microorganisms return of any left - over drugs by patients (in case of novel antibiotics available in tablet formulation) ensuring that there are no perverse incentives in place promoting the unnecessary consumption of the antibiotic incentivizing use of diagnostic tools as integral part of a stewardship programme and linking reimbursement to the use of diagnostics when disposing new antibiotics classify them as potentially hazardous pharmaceutical waste invest in research and implement policies for hospital waste water treatment that eliminates antibiotic residues many of these sustainable use policies are also relevant for older, generic antibiotics . In this article we have linked the policies to novel antibiotics since they can be contractually stipulated as a part of a delinked payment like a market entry reward . This also provides an opportunity to study and evaluate the effectiveness of the policies on a handful of antibiotics . If found effective, the policies could then be implemented on an expanded subset of essential antibiotics . The complex issue of market entry rewards will be discussed in 2017 during the g20 meeting . Drive - ab is working on such details that will be presented and published in mid-2017 . Drive - ab has published a policy brief that covers ideas for governance and financing (http://driveab.eu/wp-content/uploads/ 2016/ 08/policybrief - governancefinance.pdf). The australian drug reimbursement agency through its pharmaceutical benefits scheme (pbs) has classified specific antibiotics as restricted benefit or authority required . For example, physicians must obtain authority to prescribe quinolones from pbs and are only allowed to prescribe for specific pbs - listed infections . These restrictions have minimized resistance to these antibiotics in the outpatient setting compared to other countries . The government of australia also restricted the use of fluoroquinolones soon after they were registered for human use only in order to prevent their use in food - producing animals, resulting in successfully limiting resistance to this class in australia . Implementing unified global controlled use provisions for especially critical antibiotics would likely strengthen the sustainability of these antibiotics . The united nations single convention on narcotic drugs (1961) regulates narcotic drugs and certain psychotropic drugs globally to prevent the abuse of these substances and to protect society from the consequences of dependence while at the same time assuring access for appropriate medical use . However, the convention has been criticized since many low - income countries in particular have insufficient access to opioids resulting in the poor management of pain . Significant analyses are needed to determine the benefits of a controlled drug approach for the sustainability of critical antibiotics . The idea of tying comprehensive antibiotic sustainable use requirements to financing sources or incentives is relatively new . There are no real - world experiences in the antibiotic field that can be drawn upon to demonstrate the potential impact . However, a few notable programs are being planned addressing important parts of sustainable use policies . The centers for medicare and medicaid services (cms) have implemented a requirement combining antibiotic stewardship and infection prevention and control programs in all hospitals that receive federal funding (conditions of participation). Specifically, cms seeks to require: i) implementation of a hospital - wide antibiotic stewardship program (asp), ii) enhancements to infection prevention and control programs and greater coordination of surveillance activities with the asp, and iii) involvement of hospital leadership at all levels . Similarly, cms has finalized its conditions of participation for long - term care facilities . The european centre for disease prevention and control (ecdc) released draft eu guidelines on the prudent use of antimicrobials in human medicine . A comprehensive list of recommendations includes establishing a list of antimicrobials with restrictive measures for use (http://ecdc.europa.eu/en/publications/publications/draft-eu-guidelines-prudentuse-antimicrobials-human-medicine.pdf). The us s cdc, the ecdc, and who are also discussing and planning overarching policies building in sustainable use to innovation incentives . The discussions surrounding the restrictive, more sustainable use of antibiotics will stir much debate in the realm of clinical practice and decision - making, agricultural economics, and broader industrial policy . It will undoubtedly be seen as controversial . However, if large, public investments in antibacterial innovation are to continue, the results must be shown to add significant public health benefit for as long as possible . The public sector bodies financing new antibacterial incentives will need to reach consensus on how to use new antibiotics sustainably . Linking existing policies like stewardship policies, there is significant convergence in principles in the various initiatives calling for greater antibacterial innovation . These include: i) financing mechanisms that both support r&d and reward results in order to fill both early and late stage r&d; ii) implementing at least one delinked incentive rewarding innovators for bringing to market antibiotics effective against the most pressing public health threats related to multidrug - resistant bacteria; iii) building in provisions for both access and sustainable use into these innovation incentives; and iv) collaborating globally for both implementation and financing . There is no precedent for such sustainable use policies, yet through increased awareness and discussion, it is becoming rapidly apparent that these policies are necessary to protect the current and future, sizeable public health investments in antibacterial drug innovation.
|
Although the term myiasis was coined by f.w . Hope in 1840, it was first described by laurance in 1909 . Myasis has been defined as a pathological condition in which there is an infestation of living mammals with dipterous larvae, which, for at least a certain period, feed on living or dead tissue in the host and develop as parasites . In humans, the most commonly affected sites are the nose, eyes, skin wounds, sinuses, lungs, ears, gut, gall bladder, vagina, nasal cavities and rarely the mouth . The occurrence of myiasis in the oral cavity is unusual as oral tissues are rarely exposed to the external environment . Globally, a higher incidence of oral myiasis (om) is observed in tropical and subtropical regions of africa, america and south east asia due to favorable climatic conditions . It is classified as primary myiasis (caused by biophagous larvae also called obligatory myiasis) or secondary myiasis (caused by necrobiophagous larvae also called facultative myiasis). Oral factors like incompetent lips, poor oral hygiene, halitosis, anterior open bite, nocturnal mouth breathing, extraction wounds, facial trauma, ulcer - like lesions and oral carcinoma are predisposing factors for the occurrence of om . Oral myiasis caused by the chrysomya bezziana (cb) species is very rare in humans, which makes this case more unique . A 12-year old boy was reported with a chief complaint of swelling in the maxillary anterior region especially in the gingiva . Presence of worms was reported in his mouth, noticed by his parents for two days . He reported a maxillofacial trauma a week ago, leading to avulsion of teeth #11 and #21 . The patient s medical history revealed that he was epileptic (not under any antiepileptic drug) and mentally retarded since birth; consequently, he was unable to do his daily routine and required the help of his parents for daily activities . Intraoral examination revealed live larvae in the socket of tooth #11 and lingual sulcus of teeth #12 and #13 along with a swelling in the right premaxillary region and larvae showing a wriggling movement . There was an empty socket in place of teeth #11 and #21 and ellis class i fracture in teeth #12, #13 and #22 . Gingiva was red in color, soft and edematous in consistency and generalized bleeding on probing was observed . In addition, laceration of upper labial mucosa, incompetent lips, poor oral hygiene, halitosis and mouth breathing habit were also noticed (fig 1). A cotton swab impregnated with turpentine was then placed at the opening of the socket for 5 minutes . Dozens of larvae rushed out from the infected area, measuring one inch in length, which were then manually removed one by one with the help of clinical forceps (fig . Larvae wriggling in right pre - maxillary region and avulsed tooth socket the patient was then placed on oral ivermectin 6 mg once daily for three days and oral amoxicillin 250 mg three times daily for seven days . The procedure of manual removal of larvae was repeated once daily for three consecutive days . A total of 33 live larvae were removed from the wound . On the fourth day the patient s parents were advised to maintain proper oral hygiene for their child and advised to rinse his mouth twice daily with 0.2% chlorhexidine gluconate for 15 days under supervision . Was followed by topical application of 1.23% acidulated phosphate fluoride gel, restoration for teeth #12, #13, #22 and replacement of the missing teeth . Literature review revealed that there are a number of species, which can cause om . Male predominance has been noted (because of their outdoor activities and negligence of oral hygiene). It may be proposed that this leads to halitosis leading to attraction of flies as seen in almost all cases . However, in some cases it may be due to serious medical conditions, which are debilitating . The anterior part of the oral cavity including both jaws and the palate is commonly affected by om suggesting direct inoculation of tissues as described in the majority of cases but involvement of the posterior areas of both jaws is rare . Clinically, om may present as oral mucosal swelling, gingival inflammation [3,5, 12], laceration [2,3, 11] (as in our case), ulceration, periodontal disease, non - healing extraction wound, jaw bone fracture and secondary infestation to cancrum oris . Myiasis in human beings is caused by many species of larvae belonging to the order diptera . The cb, (screw - worm fly), belongs to the genera calliphoridae, whose larvae develop only in living tissues, and human cases of cb infestations are rare [5,6, 9]. The female adult cb fly lays around 150200 eggs on exposed wounds of mucous membranes of the nose, mouth and ear . The eggs hatch after 24 hours and the larvae thrive on living tissues for 57 days . The peculiarity of this maggot infestation is its ability to cause tissue invasion even without pre - existing necrosis . If there are multiple larvae in advanced stages of development and tissue destruction, local application of several substances will help remove all the larvae . If mechanical removal is impossible, placement of a variety of substances like petroleum, nail polish, animal fat, bees wax, paraffin, hair gel and mineral oil will deprive the oxygen and help in resolution of infested wounds either by killing the larvae or by forcing them superficially where they can be removed . Systemic prescription of oral ivermectin 6 mg once daily for three days [13,16, 17] (which is a semi - synthetic macrolide antibiotic derived from streptomyces avermitilis) often results in recovery of patients suffering from om . It acts by blocking the nerve impulses on nerve endings through the release of gamma amino butyric acid, which leads to paralysis and subsequent death of the parasite . Flushing of gingival wounds with topical application of nitrofurazone has shown promising results with no further intervention . Oral myiasis can be prevented by controlling fly population and maintaining personal and oral hygiene.
|
Drug rash with eosinophilia and systemic symptoms (dress) syndrome is a rare and life - threatening delayed drug hypersensitivity reaction characterized by skin eruption, fever, lymphadenopathies, and visceral involvement . Lamotrigine [6-(2,3-dichlorophenyl)-1,2,4-triazine- 3,5-diamine] is an antiepileptic drug, effective for a broad range of seizures in adults and children, which is structurally and pharmacologically unrelated to other antiepileptic medications . Several reports of lamotrigine - induced dress syndrome have been reported in the literature. [35] here we report a case of dress syndrome induced by lamotrigine, which was detected early and completely responded to the treatment / thereby reducing the morbidity in the patient . A 12 year old boy, with a known case of seizure disorder presented to the casualty with generalized maculopapular rash, fever and facial puffiness . The patient had been operated for gastric perforation when he was 3 days old following which the seizure episodes started . The patient was taking 1 tablet of 25 mg daily for the first 15 days; later the dose was doubled . On the 18 day, patient presented with generalized maculopapular rash, itching and fever and on 20 day he developed colicky abdominal pain and vomiting followed by facial puffiness . On examination, he was alert and oriented, with a temperature of 100f and pulse was 114/ minutes . There was significant angioedema of his face with edematous lips and swollen ears, and an extensive maculo - papular rash on his entire trunk [figure 1], buttocks, extremities and face . He experienced no joint pain or neurological symptoms, and no abdominal or respiratory complaints . He had 3 siblings: one of them also had history of epileptic disorders for which she was on treatment . Maculo - papular rashes on the trunk investigations revealed leukocytosis (15,960cells / cmm) with eosinophilia (19%) aec=2600/cmm . Hemoglobin was 10.8gm%, platelet count 2.53lakhs / cmm; esr and pcv were normal . Liver enzymes were raised with sgot=905u / l, sgpt=495u / l, alp=855u / l and ggt= 155u / l . Drug hypersensitivity syndrome (dhs), recently being also referred to as dress (drug reaction with eosinophilia and systemic symptoms) or didmohs (drug - induced delayed multi - organ hypersensitivity syndrome), is a distinct type of adverse drug reaction . The skin, liver and hematologic system are most commonly involved, with cutaneous changes being the most apparent . The presence of the 2 criteria, as given by bocquet et al ., has high sensitivity (> 95%) but weak specificity (<80%). There was eosinophilia, lymphadenopathy and liver enzymes were raised, which satisfied the criteria, and established a diagnosis of dress . Prompt resolution of the symptoms after the withdrawal of the lamotrigine, further supported the diagnosis . Lamotrigine was the probable cause of dress syndrome in the present case, as assessed by the naranjo causality criteria . Diagnostic criteria for drug hypersensitivity syndrome the liver is the most commonly involved organ in dress . The degree of hepatitis is related to the interval between the onset of the syndrome and the discontinuation of the anticonvulsant . Associated infection by human herpes virus 6 may also play a role in its development . Hypersensitivity reactions to aromatic antiepileptic drugs appear to have an immune etiology, much like the lamotrigine - induced reaction: bio activation, detoxification, covalent adduct formation, processing and presentation of antigen to the immune system, and consequent formation of antibody and t - cell immune effectors . These are usually detoxified by the enzyme epoxide hydrolase, which may be lacking or mutated in persons that develop the syndrome . It is chiefly metabolized by hepatic glucuronidation; the resulting metabolite has no pharmacologic activity and is excreted in urine . Our patient was comfortable when he was receiving single dose of lamotrigine, but he developed dress, 3 days after the dose was doubled . This may be explained by the fact that, there may be a threshold concentration of lamotrigine above which the body's ability to metabolize the drug may be overwhelmed, leading to a hypersensitivity reaction . In pediatric age group who are on sodium valproate the incidence of dhs (approximately 1 in 1,000 to 1 in 10,000 exposures) is probably underestimated . Though no standard treatment has been proposed, intravenous corticosteroids may be effective . In severe cases, pulse therapy with high dose of intravenous methyl prednisolone, plasmapharesis and human intravenous immunoglobin lamotrigine treatment has been associated with multiorgan failure, dress syndrome, acute hepatic failure, and disseminated intravascular coagulation . We suggest that these potentially fatal side effects should be considered in any patient when clinical deterioration follows treatment with this drug . Early recognition and withdrawal of the suspected agent may avoid irreversible damage to the liver and will be life saving . This case reiterates the necessity of early recognition of this syndrome, especially when lamotrigine is given concurrently with sodium valproate . It helps in the rapid resolution of dress, thereby mitigating the morbidity and mortality in the patient.
|
Fetuses with impaired intrauterine growth resulting from placental insufficiency are at increased risk of adverse short- and long - term outcome . In fact, intrauterine growth restriction (iugr) is a major cause of perinatal mortality and morbidity, and it is associated with several health problems throughout life . Current perinatal management of iugr fetuses is primarily aimed at deciding the optimal timing of delivery, followed by neonatal intensive intervention to achieve optimal growth rates in order to avoid adverse perinatal complications . Iugr can be regarded as a failure of a fetus that suffered nutritional deprivation to reach its genetic growth potential . This is principally a vascular disorder, which consists of impaired fetal growth and in fetal multivessel cardiovascular manifestations . The fetal circulatory response to placental insufficiency includes redistribution of the arterial circulation with preferential distribution of cardiac output towards the left ventricle, which mainly maintains an adequate oxygen supply to both the brain and the hearth . With further fetal deterioration, cardiac dysfunction results in abnormal venous flow velocity profiles, including reverse flow in the ductus venosus during atrial contraction and atrial pulsations in the umbilical vein . Moreover, fetal cardiac function differs in iugr compared to aga fetuses as placental insufficiency affects fetal hearth . In fact, iugr fetuses show an altered cardiac function in both systolic and diastolic phase, which determine an earlier and more pronounced right than left and diastolic than systolic fetal cardiac function deterioration . Fetuses are classified as iugr if estimated fetal weight (efw) is below the 10th percentile and umbilical artery pulsatility index (pi)> 2 sd . A modern classification system of stillbirth, recode, has shown that iugr is the most common factor identified in stillborn babies . Iugr is associated with increased risk of premature birth; increased morbidity among premature neonates, including necrotizing enterocolitis; low apgar score; hypoxic brain injury and its long - term sequelae; the need for respiratory support and chronic lung disease; retinopathy of prematurity; prolonged neonatal intensive care unit (nicu), and mortality . Furthermore, a number of causes of iugr are associated with an increased risk of iugr and intrauterine death (iud) in mother's subsequent pregnancy . The perinatologist plays a fundamental role in diagnosing the presence and cause of iugr in pregnancy to avoid major consequences, through ultrasound assessment of estimated fetal weight and doppler examination of fetal circulation . In particular, it appears to be a link between the length of intrauterine deficit and perinatal outcome . Low birth weight, caused either by preterm birth and/or intrauterine growth restriction, was recently known to be associated with increased rates of cardiovascular disease and noninsulin - dependent diabetes in adult life [610]. The developmental origins of adult disease hypothesis, often called the barker hypothesis proposes that these diseases originate through adaptations of the fetus when it is undernourished . These adaptations may be cardiovascular, metabolic, or endocrine, and they may permanently change the structure and function of the body, increasing coronary heart disease risk factors, such as hypertension, type 2 diabetes mellitus, insulin resistance, and hyperlipidaemia [1114]. This hypothesis originally involved from observation by barker and colleagues that the regions in england with the highest rates of infant mortality in the early 20th century also had the highest rates of mortality from coronary heart disease decades later . As the most commonly registered cause of infant death at the start of 20th century was low birth weight, these observations led to the hypothesis that low - birth - weight babies who survived infancy and childhood might be at increased risk of coronary heart disease in later life . As barker and his colleagues reported in several epidemiological and anthropological studies, in fetal life, tissues and organs go through the so - called critical periods of development although the fetal growth is influenced by its genes, several studies suggest that it is usually limited by intrauterine environment, in particular the nutrients and oxygen received from the mother . Influence linked to fetal and placental growth have an important effect on the risk of coronary heart disease and stroke . Thus, this theory focusing on intrauterine life, offers a new point of departure for research in cardiovascular disease . According to the thrifty phenotype hypothesis, deficient fetal supply may be followed by a programming, which includes circulatory adjustment and insulin resistance in liver and muscular tissue in order to spare the brain [610, 16]. In addition, postnatal overnutrition following intrauterine growth restriction may be pathogenetic for the development of obesity and type 2 diabetes whereas the elevated cardiovascular mortality rate may be associated with rapid postnatal catch - up growth in early infancy . Many reports of relationship between birth size and disadvantageous glucose and insulin metabolism have widely been reviewed . In particular, fetal growth retardation has been associated with increased insulin resistance, higher fasting insulin concentrations, and increased incidence of type 2 diabetes . Neonatal abdominal circumference has been shown to predict plasma cholesterol and fibrinogen levels in adults in later life, which are both risk factors for cardiovascular disease . Association between iugr and raised blood pressure in childhood and adult life has been extensively demonstrated around the world . In 1996, a review based on 34 studies involving more than 66.000 persons of all ages identified a negative relationship between birth weight and systolic blood pressure in childhood and adulthood . This relationship was independent of body size at time of blood pressure measurement, and its magnitude tended to increase with age [18, 19]. A similar review in 2001 based on 27 independent observational studies also evidenced a mean difference in systolic blood pressure of 1.7 mmhg per kilogram increment in birth weight . The review also documented a consistently negative association between birth weight and diastolic blood pressure . Besides low birth weight, 3 other early factors that are considered to be important risk factors for developing high blood pressure in adult life have been identified in individuals with iugr . First, accelerated postnatal growth in weight and length is suggested to increase the risk for developing hypertension and type 2 diabetes in later life . Second, it was postulated that altered angiotensin activity was an important factor underlying the fetal origins of adult diseases hypothesis . Also, hypoxia increased sympathetic nerve activity and catecholamine production and proliferation of juxtaglomerular cells (and thus renin - producing cells) are suggested as factors in the pathogenesis [20, 21]. A followup study recently published by cosmi et al . Demonstrates that systolic blood pressure measurements in 2-year - old children born intrauterine restricted are significantly higher compared to appropriate for gestational age children at the same age . From a historical viewpoint, it is clear that the barker hypothesis received significant support because of its public health implication . However, it must be considered that many confounders are known to influence blood pressure in adult life apart from birth weight . However, as stated by gluckman and hanson it is no longer possible to ignore the developmental phase of life and followup studies in early childhood will assist the medical community and public health to designing interventions in order to ensure the best possible fetal development . Endothelial dysfunction is an early event of atherosclerosis, preceding structural changes in the vascular wall . Atherosclerosis is thought to begin in childhood and to develop silently before clinical events such as myocardial infarction or stroke occur . As with major cardiovascular risk factors, impaired growth in utero is associated with functional (endothelial dysfunction) and structural (increased wall thickness) changes to the arterial vascular consistent with early atherosclerosis . Impaired fetal growth in infants is associated with increased sympathetic tone and lipid concentration, and reduced concentration of insulin - like growth factor-1, all of which might contribute to arterial wall thickening . However, these findings are difficult to interpret because of potential confounding by, or interaction with, postnatal influences, so this hypothesis needs further clarification . Atheromatous changes have been documented histopathologically by early childhood, and it has been assessed that the first atherosclerotic lesions actually begin to develop in the abdominal aorta . Nowadays, many studies demonstrated atherosclerotic wall thickening in the arteries of children with cardiovascular risk factors using ultrasound imaging assessing noninvasively early vascular changes . In 2005, skilton and coworkers added new interesting information to barker's hypothesis . They compared intima - media thickness (aimt) of the aortic wall in newborn infants with low birth weight with normal controls . In iugr newborns, the ultrasound - based measurement of abdominal aortic intima - media thickness in children was described as a feasible, accurate, and sensitive marker of atherosclerosis risk, and, as there was no confounding from childhood and adult exposures, they provided clear indications for a fetal contribution to later cardiovascular disease . Also, koklu et al . In 2007, evaluated the potential use of aimt in the study of high - risk neonates, concluding that aimt measurement in iugr newborns can help in the early identification of asymptomatic vascular dysfunction [2729]. Recently, cosmi et al . Studied aimt in fetuses for the first time and then in the same infants after a mean followup of 18 months . This study showed that aimt measurements in iugr fetuses were inversely related to estimated fetal weight, showing that low birth weight and doppler abnormalities may be correlated to an altered vascular structure causing possible endothelial damage, consistent with the finding that atherosclerosis begins to develop first in the intima of the aorta . Similarly, carotid intima - media thickness has been shown to be greater in children with low - birth weight . In a recent study, crispi et al . Confirms the presence of increased carotid wall thickness in children with iugr and that these changes persist into childhood . The increased arterial wall thickness could be the result of vascular remodeling linked to metabolic programming in intrauterine restricted life . They also highlighted that children with iugr show changes in cardiac morphology, subclinical cardiac longitudinal dysfunction, and hypertension, all of which increase linearly with the severity of growth restriction and are independent of gestational age at delivery, lipid profile, or body mass index . The importance of early identification and intervention in pediatric risk factors for cardiovascular disease is now well recognized, and this could open new opportunities for monitoring and intervention in newborns and children affected with intrauterine growth restriction . According to the fetal programming, the kidneys too appear to be extremely susceptible to intrauterine growth restriction and are often found small in proportion to body weight . Several studies in animals and humans have described a reduced number of nephrons after iugr . This results in an inborn decreased glomerular filtration surface area while renal blood flow per glomerulus is increased in attempt to maintain a normal overall glomerular filtration rate . According to the hyperfiltration hypothesis explained by brenner and coworkers [3335] this leads to glomerular hypertension and hypertrophy, which causes systemic hypertension and higher sodium reabsorption and glomerular damage resulting in albuminuria and glomeruloclerosis . Also, premature birth implies a shorter period of active nephrogenesis, as describes by rodrguez et al ., involving in impaired renal development . Therefore, iugr can lead to impairment of renal function . A kidney with a reduced nephron number has less renal reserve to adapt to dietary excesses or to compensate for renal injury . The pathway leading from small kidney to hypertension may include the rennin - angiotensin system, which is altered in the early phase of primary hypertension . An increased activity of the rennin - angiotensin system could be a compensatory mechanism in a decreased number of nephrons in order to maintain normal filtration . These mechanisms are well described in experimental study including iugr male rats, whose presented higher blood pressure and fewer glomeruli at 22 weeks of age . In the last five years, more clinical data are available regarding maturation of renal function in iugr infants . Keijzer - veen and colleagues in 2005, identified a positive association of birth weight and glomerular filtration rate (gfr). The investigators also detected a negative association of birth weight and serum creatinine, suggesting that iugr individuals are at greater risk to develop hypertension and progressive renal failure . This work made a significant contribution to understanding mechanism associated with the progression of cardiovascular disease and intrauterine retardation . In contrast rakow et al . Found that glomerular filtration rate and urinary protein patterns were similar between iugr 12-year - old children and controls, but kidney volume was smaller in the first group . A meta - analysis published by teeninga et al . In 2008, consisted of 201 patients (25 sga, 176 aga), showed that low birth weight has a strong influence on glomerular filtration rate and proteinuria, associated with a higher chance of developing several complications, including hypertension . A recent followup study demonstrated that 5-year- old children born iugr showed higher blood pressure, increased albuminuria, lower grf, and different urinary sodium excretion rate than controls . These observations support the contention that extrinsic renal injury is not a prerequisite for the initiation and perpetuation of renal injury and that certain circumstances, prenatally derived, intrinsic deficiencies in functioning renal mass may be sufficient to contribute to renal functional decline occurring with advancing age . Intrauterine growth restriction plays a significant role in short- and is long - term outcome and reflected in high incidence of brain dysfunction and neurodevelopmental impairment, as well as in somatic growth failure . These clinical consequences could not be apparent until later in childhood development and could involve poor academic performance, memory, visuomotor, and language difficulties, and executive function problems . Several longitudinal studies have addressed the question of correlation between cognitive development and somatic growth in iugr, using a different questionnaire dealing with aspects of reading, writing, spelling, and mathematics . An increased risk of cognitive impairment has been demonstrated in children with small head circumference . In other studies, iugr children have lower nonverbal and verbal iq than controls . According to data from the national collaborative perinatal project (19591976) the iq scores of 2719 iugr children tested at age 7 were 6 points lower than aga children . Behavioral problems, which might manifest only at school age, can have a great impact on school performance and social competence and have a negative influence on quality of life . Learning difficulties and behavioral problems are reported more often in iugr preterm infants compared to aga . They have an increased perinatal mortality and morbidity including behavioral problems, minor developmental delay, poor neurosensory development, and spastic cerebral palsy . Recent advanced magnetic resonance imaging studies have shown that iugr is associated with structural differences that can be identified very early in life, such as reduction in cerebral cortical grey matter, hippocampal volume, and sulcation index . These macrostructural alterations have been associated with microstructural and metabolic changes . As explained by baschat et al ., the iugr fetus enables sparing of the head while growing in a low - nutrient intrauterine environment and has neuroadaptative modification aimed at preserving brain oxygen supply in presence of chronic hypoxia . This process is identified clinically by a reduced doppler pulsatility index (pi) in the middle cerebral artery (mca). When multiple parameters are considered, such as gestational age and birth weigh, umbilical artery reversed end diastolic velocity (ua - redv) is identified as an important contributor to neurodevelopment . Brain sparing and cerebral arteries doppler results are objects of study as predictors of adverse neurological outcome, but these relationships are not well assessed [45, 50]. These findings have important implications for the prognosis and the management of intrauterine growth restricted fetuses and children, who should be closely followed up to identified individuals at risk . The importance of iugr in understanding adverse pregnancy outcome is relevant not only for clinicians, but also for public health service . During the last decade, knowledge of the short - term and long - term consequences of impaired fetal growth has increased at a very rapid rate and has involved lots of clinical aspects . At present, it is most important not only to develop efficient methods of preventing and diagnosing iugr, recognizing at - risk fetuses, and screening fetal growth restriction among low - risk pregnancies, but to work out followup and adequate treatment programs for the control of the disorders which may follow this conditions . Programming the right time to deliver is the best method to avoid adverse perinatal outcome; indeed, proper postnatal feeding and infant growth may be essential for long - term outcome.
|
The concept of controlled drug release from polymeric materials was first established in the 1960s by judah folkman when he discovered that exposure of anesthetic gases to the external surface of a silicone rubber arteriovenous shunt containing circulating rabbit blood caused the rabbits to fall asleep.1 based on this ability of gaseous molecules to permeate silicone rubber, it was postulated that solid drugs incorporated into silicone rubber (or other elastomeric polymers) could be implanted in the body to provide rate - controlled drug - delivery systems.2,3 the first controlled - release drug - delivery systems to be commercialized were two devices: alza s ocusert (an ophthalmic insert releasing pilocarpine at a constant rate for the treatment of glaucoma) and progestasert (an intrauterine implant providing a constant rate of progesterone delivery). Both were reservoir - type devices fabricated from the thermoplastic polymer poly(ethylene - co - vinyl acetate) (peva). The first commercial silicone elastomer device for controlled release was the population council s subdermal contraceptive implant norplant, first approved for use in finland in 1983 and marketed in the usa in 1991 . Consisting of six small (2.4 mm 34 mm) silicone elastomer cylinders, each filled internally with 36 mg of levonorgestrel (a progestin used in many birth - control pills), norplant was a direct extension of folkman s original concept and provided effective fertility control for five years . A second generation of norplant - type devices is currently available, containing either one or two drug - loaded rods and fabricated from either silicone elastomer or peva . In 1970, a us patent assigned to the upjohn company was published describing containing an effective amount of a medicament which is capable of passage through the drug - permeable polymeric material (figure 1a).4 this first description of the concept of a drug - releasing vaginal ring heralded an intense period of activity in ring development through the 1970s and 1980s, mainly focused around contraception and hormone replacement therapy and involving various ring designs . The world health organization (who) was at the forefront of this research with their program for the development of a silicone elastomer steroidal contraceptive ring to help contain the burgeoning population growth . The interested reader is directed to hoffman s excellent overview on the origins and evolution of controlled - release drug - delivery systems.5 vaginal rings are flexible, torus - shaped, silicone elastomer or thermoplastic devices that provide long - term, sustained or controlled delivery of pharmaceutical substances to the vagina for either local or systemic effect . Designed to be readily inserted and removed by the woman herself, they are generally positioned in the upper third of the vagina adjacent to the cervix . Although the exact location of ring placement is generally not critical for clinical efficacy, it may have implications for comfort in some women . The simplest vaginal ring design contains solid drug particles (usually in a micronized form) dispersed throughout the entire polymeric matrix . The drug - release yield from these so - called homogeneous or matrix rings (figure 1b) is governed by a permeation mechanism for which the release rate is dependent upon (1) the drug s solubility in the polymer, (2) the ability of the solvated drug to diffuse through the polymer, (3) the drug - loading within the device, and (4) the ring surface area . The drug - permeation process involves dissolution of the solid drug in the polymer, followed by diffusion of the solubilized molecules through the elastomeric polymer network . Drug near the surface of a matrix ring is released first, creating a drug - depleted layer through which solubilized molecules within the ring body must first diffuse in order to be effectively released . As time progresses the surface area of this inward - moving depletion boundary decreases, causing an increase in the thickness of the depletion layer, resulting in decreased drug - release rates over time . The sandwich and core vaginal ring designs (also known as shell and reservoir, respectively) were developed to provide constant daily release rates throughout the period of use, conforming to zero order the sandwich design (figure 1f) consists of a narrow drug - loaded polymer layer positioned between a nonmedicated inner central core and a nonmedicated outer membrane . The position of the drug core close to the surface ensures efficient delivery of drugs having poor polymer diffusion characteristics . Core - type rings contain the drug(s) within one or more central cores that are encapsulated by a drug - free outer polymer membrane (figure 1c e). Several individual drug - loaded cores of various lengths may be incorporated into the same core ring, thereby allowing delivery of multiple actives at predetermined and independent release rates . The release rates of both the core and sandwich - ring designs may be further modified by changing the thickness of the rate - controlling outer membrane . The range of materials used in the manufacture of vaginal rings is limited by the requirements for biocompatibility, flexibility, and high drug permeability . Silicones represent a category of synthetic polymers comprising a main chain of alternating silicon and oxygen atoms, and having two organic groups covalently bonded to the silicon atom (figure 2).10 the most common silicone derivative is that having two methyl groups, called polydimethylsiloxane . The linear polymeric forms of silicones are liquids at room temperature, even for large molecular weights . Elastomeric silicone materials are produced by incorporating reactive functional groups into the linear polymers that may be subsequently cross - linked using suitable cross - linking molecules . Silicone polymers, and particularly the elastomeric forms, have a long history of use in both medical devices and drug - delivery devices, stemming from their excellent biocompatibility and biodurability.11 silicone elastomer rings are generally made by elevated - temperature reaction injection molding, using either condensation or addition - cure chemistries.10 two estrogen - releasing, reservoir - type silicone elastomer vaginal rings have been commercialized for the treatment of menopausal symptoms related to estrogen deficiency . Estring (pfizer, new york, ny) contains a full - length reservoir core (figure 1c) and releases 7.5 g / day of 17-estradiol continuously over 3 months for the treatment of local symptoms . Femring (warner chilcott uk ltd, larne, northern ireland) contains a single partial - length reservoir core (single - core version of figure 1d) and releases either 50 g / day or 100 g / day (depending on core length) of the estradiol prodrug 17-estradiol-3-acetate over 3 months for the treatment of both systemic and local symptoms . Both rings show a high degree of user acceptability and are preferred by women over estrogen vaginal gels.1215 a 1-year combination contraceptive ring device, worn for 3 weeks per cycle and simultaneously releasing 15 mcg / day ethinyl estradiol and 150 mcg / day nestorone, is also in clinical development.1619 the first report of a microbicide - releasing vaginal ring described the continuous in vitro release over 8 days of the non - ionic surfactant nonoxynol-9 from a matrix - type silicone elastomer device.20 unlike the solid antiretroviral compounds currently being tested as hiv microbicides, nonoxynol-9 is a liquid at a room temperature, such that its release from the ring followed unconventional release kinetics . Nonoxynol-9 has since been discontinued as a microbicide candidate since studies showed that it increased the risk of hiv transmission following frequent application.21,22 a subsequent study showed that dapivirine (also known as tmc120) could be effectively released in vitro over 71 days from a silicone elastomer reservoir - type ring device.23 moreover, it was calculated that the constant daily rate observed of 130 g release could effectively be maintained for at least 1 year, and theoretically for up to 4 years . Many of the lead - candidate antiretroviral compounds being developed as hiv microbicides (eg, dapivirine, maraviroc, uc781, and mc1220) have physicochemical properties (specifically, high hydropobicity and low molecular weight) very similar to those of steroid molecules, suggesting that silicone elastomer vaginal ring formulations may also be useful for the controlled release of microbicides . Although numerous antiretroviral compounds have been tested in rings in vitro, only the dapivirine - matrix and reservoir - type silicone elastomer rings have reached the clinical stages of development (table 1). Two phase i safety studies have been completed for a 200 mg dapivirine reservoir ring (study ipm 001) (figure 3a),24 a 25 mg dapivirine reservoir ring (studies ipm 008 and ipm 01) (figure 3b),24,25 and a 25 mg dapivirine matrix ring (study ipm 018) (figure 3c).21 although these rings had different designs, they were both manufactured using a condensation - cure silicone elastomer system specifically designed for the incorporation and release of drug molecules . The ipm 001 and ipm 008 studies demonstrated good safety and tolerability for both the 25 mg and 200 mg dapivirine reservoir - type rings, compared with a placebo ring, during the 7-day study period . Reported vaginal - fluid concentrations of dapivirine at various locations along the cervicovaginal tract (introitus, cervix, ring position) were in the range 0.77.1 g / ml, with levels vaginal- and cervical - tissue concentrations on day 7 were between 0.3 g / g and 3.5 g / g . Plasma concentrations, which are a particularly important consideration from the perspective of the potential emergence of strains resistant to the drug in hiv - positive users, were less than 50 pg / ml . Dapivirine concentrations in vaginal fluid and tissue were more than three orders of magnitude greater than the in vitro ec50 against a wild - type hiv-1 strain.26,27 dapivirine levels measured with the 25 mg continuous core device (figure 3b) were generally higher (but did not reach statistical significance) than those for the 200 mg two - core ring device (figure 3a). This is consistent with the nature of membrane - type diffusion - controlled drug - delivery systems, where drug release kinetics are determined by the length of the reservoir and the thickness of the rate - controlling membrane, but not the drug - loading (which only influences the duration of release).28 reservoir rings are associated with several disadvantages compared with matrix - type rings, most notably their complexity of manufacture (a multistep process) and the relatively low (but constant) release rates . In the ipm 018 study (table 1), the pharmacokinetics of matrix and reservoir rings, each containing 25 mg dapivirine (figure 3b and c), were compared.25 the results clearly illustrated differences in dapivirine release rates, with significantly higher plasma and vaginal - fluid levels achieved with the matrix format, owing to the presence and rapid release of the drug at the device surface (figure 4). Vaginal - fluid levels peaked at ~1000 g / g 24 hours after placement of the matrix ring, and declined steadily to around ~10 g / g on day 28, immediately prior to ring removal (figure 4d). In general, vaginal - fluid levels for the reservoir ring were between one and two orders of magnitude lower than those for the matrix ring . Plasma levels of dapivirine ranged from 101000 pg / ml (figure 4a and b). The propanol by - product associated with condensation - type silicone elastomers can lead to a drug burst effect, where the incorporated solid drug is dissolved in the propanol, transported to the device surface, and subsequently deposited following evaporation of the propanol.2931 this solvent - aided deposition of the drug can artificially increase its release rate during the early period of use, beyond that attributed to the normal polymer diffusion - controlled process . Subsequent studies have confirmed that a substantial drug burst occurred with the early prototype condensation - cure dapivirine - releasing silicone elastomer rings, prompting a move to addition - cure silicone elastomer systems (which produce no solvent by - product during the silicone - curing reaction) for the future clinical development of the dapivirine matrix ring . Preliminary pharmacokinetic data (unpublished) from the ipm013 and ipm024 phase 1 studies for the addition - cure 25 mg - dapivirine ring showed detection of dapivirine in both vaginal fluid and plasma 1.5 hours after ring insertion; the maintenance of dapivirine concentrations in vaginal fluid was in the 1050 mcg / g range over the 35-day study period . The aspire phase iii study (mtn 020, table 1) of the addition - cure silicone elastomer 25 mg dapivirine ring will be launched at several african sites in 2012 and involve almost 3500 women . First results are anticipated in late 2014 or early 2015 . Following the success of antiretroviral combinations for the treatment of hiv infection, there is also considerable interest in combination microbicide products, including vaginal rings, that simultaneously release two or more microbicide compounds having different mechanisms of action . The first clinical trial of such a ring (ipm 026/mtn 013, table 1), comprising 25 mg dapivirine and 100 g maraviroc (an entry inhibitor) in an addition - cure silicone elastomer matrix format (figure 1b) is planned for 2012 with 48 healthy women using either the combination ring, a 25 mg dapivirine - only ring, a 100 mg maraviroc - only ring, or a placebo ring continuously for 28 days . Microbicide - releasing silicone elastomer vaginal rings have also been designed for use in macaques, enabling important pharmacokinetic and challenge studies to be performed in a more clinically relevant nonhuman - primate model.3234 thermoplastics are polymer substances that melt (and flow) upon heating and that harden again upon subsequent cooling . While most thermoplastic materials are not suitable for the fabrication of vaginal rings owing to their poor flexural and mechanical characteristics, a subset known as most notably, ethylene vinyl acetate copolymers (peva) are used as both the drug matrix and the rate - limiting sheath in the combination (etonogestrel + ethinyl estradiol) contraceptive vaginal ring device nuvaring . A number of other subdermal, implantable drug - delivery devices are also fabricated from peva, including implanon and virtasert . The vinyl acetate content (typically ranging from approximately 10% to 40%) and the molecular weight characteristics of the peva material play a major role in determining the mechanical properties, the ease of processing, and the drug release rates of the finished drug - delivery device . Nuvaring is a nonbiodegradable, flexible, transparent, colorless, contraceptive vaginal ring (table 1), developed by organon inc and first marketed in 2002 . It contains two active compounds, progestin etonogestrel (11.7 mg) and estrogen ethinyl estradiol (2.7 mg), both located within a central peva (28% w / w vinyl acetate) core as a supersaturated eutectic mixture, and surrounded by a nonmedicated polyethylene - co - vinyl acetate (9% w / w vinyl acetate) sheath layer . The slow permeation of the steroid molecules through the low - vinyl - acetate - content nonmedicated sheath provides for controlled release, resulting in mean daily release rates of 120 g etonogestrel and 15 g ethinyl estradiol over the 3-week period of use . The ring is used continuously for 3 weeks, and then removed for 1 week before being replaced with a new ring . Nuvaring is highly efficacious, with a pearl index of 1.18 and an efficacy of 99.1% . Off - label 28-day continuous use of nuvaring is also being evaluated.35 despite the commercial success of nuvaring, there have been very few reports of the use of peva for microbicide - releasing vaginal rings, probably owing to ongoing difficulties in accessing clinical - grade materials for testing in humans . A comparison of the pharmacokinetics of the nonnucleoside reverse - transcriptase inhibitor uc781 in rabbits following vaginal administration of ring segments fabricated from peva, polyurethane, and silicone elastomer showed similar in vivo release rates and kinetics.8 recently, a combination peva matrix - type ring providing simultaneous release of the microbicide candidate uc781 and the contraceptive progestin levonorgestrel has been reported.36 if the proof of concept of a microbicide vaginal ring device can be realized with the dapivirine - releasing silicone elastomer ring, then these multipurpose prevention technologies that combine hiv protection with effective contraceptive regimes will be actively pursued . Thermoplastic polyurethanes are also being evaluated for use in microbicide - releasing vaginal rings . As with peva, the properties of polyurethanes can be readily tailored by controlling their chemical structure (figure 2b), simply by adjusting the components of the reaction mixture (polymeric diol, a chain extender, and isocyanate) used in their synthesis . To date, polyurethane rings releasing either uc781, dapivirine, tenofovir, or a combination have been demonstrated in in vitro studies.6,7,9,37 constant daily release of dapivirine from matrix - type ring prototypes was sustained over 30 days, with the release rate dependent on the initial drug - loading.6 novel segmented polyurethane vaginal rings have also been evaluated for simultaneous release of dapivirine and tenofovir . Each drug was incorporated into its own rod segment before joining the rods to prepare the intact ring device.7 while this approach permits independent formulation of the component microbicides and control of release rates, the complexity of design and the required scaled manufacturing are obstacles to further development . Several new designs of vaginal ring device are also in development, all seeking to overcome the drug - permeability constraints associated with release of hydrophilic and/or macromolecular actives from conventional silicone elastomer and thermoplastic systems . The versaring technology platform (auritec pharmaceuticals) is based on drug - loaded pod inserts, comprising polymer - coated solid drug, incorporated into a silicone elastomer ring and exhibiting pseudo - zero order release kinetics.3840 drug cores are coated with layers of semipermeable poly(lactic acid) polymer . Coated drug pods are incorporated into silicone rings, and the drug is released through a delivery window in the silicone ring, with the release rate determined by the window diameter . The amount of drug released from each ring can be adjusted by changing the amount and composition of the polymer coating of the drug core, the size of the drug - delivery window, and the number of drug pods in each ring . Vaginal rings containing tenofovir provide in vitro daily release rates spanning 2.5 orders of magnitude (104000 mcg / day for tenofovir). The modular nature of the rings permits the release of multiple drugs having very different physicochemical characteristics . To date, in vitro release of tenofovir and acyclovir from the same ring segments has been demonstrated.40 in vivo studies have demonstrated sustained release of tenofovir in the micro - molar range over 14 days in rabbits and 28 days in macaques, with no local inflammation or altered vaginal flora.40 in rabbits, the vaginal tissue tenofovir levels at sacrifice were 3597 1678 ng / g . In the macaques, vaginal biopsies proximal and distal to the inserted rings at days 7 and 21 measured tenofovir levels at 76 54 mcg / g, over 100 times the ic 50 of tenofovir (2 m). Similar to the pod - insert vaginal ring, rod and tablet - insert vaginal rings comprise one or more polymeric solid dosage forms (lyophilized polymer gel rods and directly compressed tablets, respectively) inserted into a silicone elastomer ring.41 while the ring acts primarily as a retainer for the solid dosage inserts, it may also be used to load and deliver other microbicide candidates compatible with conventional permeation - controlled release mechanisms . Lyophilized inserts may be prepared by freeze - drying microbicide - loaded aqueous gel formulations . This technology is potentially useful for the production of solid dosage inserts containing peptide- and protein - based microbicide candidates, since it does not involve high temperatures, and the water - free insert serves to stabilize the active biomolecule . Once administered, the gel is slowly reconstituted by imbibing vaginal fluid, leading to sustained release of the active agent . Similar lyophilized tablets have recently been reported for the formulation of dapivirine.42 the compressed tablet - insert strategy makes use of traditional direct - compression tableting technology to manufacture conventional sustained - release solid dosage forms . Given the regulatory constraints, very few polymer materials apart from silicone elastomer and peva have been considered, to date, for the fabrication of vaginal rings . Matrix - type rings constructed from styrene - butadiene block copolymers have previously been evaluated for the sustained release of 17-estradiol for the treatment of postmenopausal symptoms.43 the use of polymers that control drug release by mechanisms other than permeation might be useful for the delivery of hydrophilic and/or large molecular weight actives . Vaginal rings constructed from biosoluble acacia gum, a nonbiodegradable hydrogel of 2-hydroxyethyl methacrylate, and sodium methacrylate, designed to provide sustained release for up to 28 days, have been reported for the simultaneous release of combination antiretroviral hiv microbicides and for combinations of microbicides with nonhormonal contraceptives.44,45 the silcs diaphragm has been under development by the program for appropriate technology in health since 1994 as an advanced, single - sized, cervical - barrier contraceptive device (figure 5).4651 similar in format to a reservoir - type vaginal ring device, silcs contains a specially designed flexible polymeric spring core (made from nylon-6), which is over - molded with silicone elastomer to form the barrier sheath . In preliminary clinical studies, silcs was found to be safe; and it performed as well as the standard latex diaphragm in preventing sperm from reaching the cervix when both devices were used with the spermicide nonoxynol-9 . The contraceptive efficacy of silcs is currently being evaluated in combination use with the contraceptive gel buffergel . If protection is similar to the standard diaphragm, these data will provide the basis for an application to the us food and drug administration . Given the similarity of structure between the nonmedicated silcs device and a reservoir - type, drug - releasing vaginal ring (ie, both contain a central polymeric core and an over - molded polymer sheath), and the newly emerging emphasis on the development of multipurpose prevention strategies,5254 the incorporation of a microbicide delivery function into silcs is currently being actively pursued.55 a modified silcs device comprising an injection - molded polyoxymethylene spring core, loaded with up to 20% dapivirine and over - molded with the standard silicone elastomer material, has been shown to provide constant in vitro daily release rates during continuous testing over 6 months.56 the general methods for the manufacture of silicone elastomer and thermoplastic vaginal rings, outlined in figures 6 and 7 respectively, involve the incorporation of the solid drug active(s) into the polymer, followed by injection - molding or extrusion into precision - machined ring - holds to form the final device . Depending on the format and complexity of the ring product design, there may be several distinct steps in the manufacturing process . Although the polymer - processing techniques of injection molding and extrusion are ubiquitous in the manufacturing of plastic parts for a wide variety of everyday applications (including various medical devices), the availability of contract manufacturers capable of handling the regulatory issues, manufacturing complexities, and raw material supplies associated with drug - delivery devices is very limited . These issues have been discussed previously,57 and are particularly pertinent, given the progress of the 25 mg dapivirine ring to phase iii clinical testing . If the mtn 020 trial (table 1) successfully demonstrates the efficacy of the 25 mg dapivirine matrix ring in reducing the incidence of hiv transmission, then several hurdles will need to be overcome before commercial launch, including accurate projected forecast demand and significant expansion of manufacturing capacity to meet global needs.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.