text
stringlengths 0
868k
|
|---|
Cutaneous adverse drug reactions are estimated to be about 30% of all adverse drug reactions and observed in 2 - 3% of hospitalized patients . Acute generalized exanthematous pustulosis (agep) is a generalized pustular eruption that is primarily drug - induced in probably more than 90% of case . In a few cases infections including cytomegalovirus and parvovirus b19, a spider bite was recently implicated as a possible cause of agep in three patients . Although various drugs have been implicated in this condition, there are no reported cases of agep caused by oral oxicams in the current literature . This was a case report of a 61-year - old female patient who was admitted to internal medicine department for renal colic . The patient had a history of longstanding arterial hypertension for 3 years treated with captopril, indapamide, nifedipine and diabetes mellitus for 3 years treated with glibenclamide, glimepiride and dyslipidemia treated with simvastatin . She was given oral piroxicam 20 mg / day by her primary care physician for treatment of renal colic . There were no other medications prior to starting piroxicam . At 4 days after starting oral piroxicam, she developed a generalized itchy eruption consisting of multiple papules that sometimes coalesced to larger and scaly plaques, on a background of widespread erythema with associated multiple 2 - 3 mm pustules [figure 1]. Her white blood cell count was 10.8 10/mm, with a 6.42 10/mm neutrophil count . The remaining laboratory tests performed were within the normal range: creatinine 61.1 mol / l, erythrocyte rate sedimentation at 30 mm / h, c - reactive protein 19.48 mg / l and her liver function tests were: aspartate transaminase 38 u / ml, bilirubin 9 mol / l and alkaline phosphatase 88 u / ml . Scattered neutrophils as well as eosinophils were noted within the dermis (according to the euroscar score, the most of criteria have been met by our patient who had a score of 9). Within a week of piroxicam withdrawal, the patient remained on the same therapies for her arterial hypertension, diabetes mellitus and dyslipidemia . Agep is a rare pustular severe cutaneous adverse reaction that generally presents with an acute edematous erythema and small non - follicular sterile pustules mostly beginning in folds or face and within hours becomes diffuse . Skin symptoms are almost always accompanied by fever (38c) and leukocytosis with a high neurophil count (7000/l). Other skin symptoms such as marked edema of the face, purpura, blisters and vesicles have been described . Additional systemic manifestations include mild eosinophilia, lymphadenopathy, acute renal failure and a mild elevation of liver enzymes . The multinational epidemiological case - control study on severe cutaneous adverse reactions (euroscar - project) has developed and used the well - defined euroscar group criteria to establish the diagnosis of agep . It allots 0, 1 or 2 points for each of 4 variables of morphology, 10, 0, 1, 2 or 3 for each of 5 variables of histological findings . In addition, it assigns 4, 2, 0 or 1 for each of 5 items of the disease's course . Its involved items yield causality levels of definite with a scale at 8 - 12 points, probable (5 - 7 points), possible (1 - 4 points) and excluded agep (0 point). The euroscar score was 9 and therefore, the case was specified as definite agep . Histological findings show subcorneal and/or intraepidermal pustules, with pronounced edema in the papillary dermis and a perivascular infiltrate of neutrophils and eosinophils . Studies show that antibiotics were the most common drugs implicated (75%), with no attributes to non - steroidal anti - inflammatory drugs (nsaids). Furthermore, there is an increasing number of cases caused by anti - fungals . A study done by chang et al . Analyzed 16 cases of agep with a relatively low association with systemic drugs (62.5%), there was no case of causative nsaids . There have been few cases implicating nsaids, including ibuprofen, diclofenac, topical bufexamac, naproxen and phenylbutazone . As corticosteroids are commonly used in the treatment of severe agep; they nevertheless, may trigger severe and rare agep . In this case, the clinical presentation and histology of a skin biopsy were consistent with agep . The other medications (nifedipine, captopril, indapamide, glibenclamide, glimepiride and simvastatin) were continued . This association could have been strengthened by performing patch test with piroxicam . Due to the self - limited and benign course of this disease, treatment is usually not necessary except for symptomatic therapy and withdrawal of the culprit drug . Some cases have been treated with intravenous hydrocortisone, oral prednisolone or methylprednisolone or topical agents alone . Drugs like infliximab were used in an over lop of agep - toxic epidermal necrolysis . In our case, the withdrawal of piroxicam was sufficient to resolve all clinical features in only 1 week.
|
Despite recent advances in the management of patients with heart failure, morbidity and mortality rates remain high . It is the only cardiovascular disease that has increased in prevalence over the last 20 years . With over 200,000 patients suffering from heart failure in the netherlands common causes of heart failure are ischaemic heart disease, uncontrolled hypertension and valvular disease . However, in up to 50% of the cases its exact cause remains initially unknown; this condition is called idiopathic dilated cardiomyopathy (dcm). Patients with idiopathic dcm are relatively young, ranging between 20 and 60 years, and often still in the prime of their lives . To discriminate different aetiologies of dcm, specific diagnostic methods including serum markers, cardiac biopsies and genetic screening are crucial to improve care and outcome in these patients . Dcm may be the consequence of a wide variety of causes, including virus - mediated disease, immune dysregulation, toxic and metabolic, inherited, and tachycardia - induced conditions (fig we will briefly discuss all the possible triggers of dcm with a special focus on inflammatory- and virus - mediated forms of dcm.fig . 1possible triggers of idiopathic dilated cardiomyopathy possible triggers of idiopathic dilated cardiomyopathy toxic cardiomyopathy results from toxic exposure of a variety of cardiotoxic agents, most notably alcohol and chemotherapeutic drugs . Metabolic cardiomyopathies can be caused by a wide spectrum of pathological metabolic conditions (table 1).table 1classification of toxic and metabolic cardiomyopathiesinfiltrativeamyloidosis (primary, familial autosomal dominant, senile, secondary forms) gaucher disease, hurler s disease and hunter s diseasestoragehaemochromatosis, anderson - fabry disease, glycogen storage disease (pompe), niemann - pick diseasenutritional deficienciesberiberi (thiamine), pellagra, scurvy, selenium, carnitine, nutritional disorder such as kwasiorkorendocrinediabetes mellitus, hyperthyroidism, hypothyriodism, hyperparathyroidism, pheochromocytomatoxicityalcohol, drugs (cocaine, catecholamines, lithium, phenothiazines, methysergide), heavy metals (cobalt, lead, arsenic) and chemical agentsconsequence of cancer therapyanthracyclines (doxorubicin, daunorubicin), cyclophosphamide and radiation classification of toxic and metabolic cardiomyopathies tachycardia - induced cardiomyopathy (tic) is caused by sustained rapid ventricular rates and is one of the well - known forms of reversible myocardial diseases after the normalisation of heart rate . It may follow any type of chronic cardiac arrhythmia: supraventricular tachyarrhythmias, ventricular tachycardia, and frequent premature ventricular complexes . The diagnosis of tic remains difficult since cardiomyopathy and tachycardia are often identified simultaneously . In up to 70% of the cases, a gene mutation may be the cause of dcm in up to 30% of the cases, therefore cardiogenetic screening is crucial in idiopathic dcm patients . The most common mode of inheritance is autosomal dominant transmission, although less common forms including x - linked, autosomal recessive and mitochondrial inheritance have also been described . The cytoskeletal proteins include dystrophin, desmin, lamin a / c, -sarcoglycan, -sarcoglycan and metavinculin . In case of the sarcomeric proteins they include -myosin heavy chain, myosin - binding protein c, actin, -tropomyosin, and cardiac troponin t and c. furthermore, phospholamban, tafazzin and the sodium - channel gene scn5a have also been reported . With the upcoming awareness of the importance of a patient s genetic background and the increasing numbers of mutated genes found, genetic testing for idiopathic dcm is becoming more common in clinical practice . In turn, this is an opportunity to unravel the molecular complexity of inherited dcm and develop possible disease - modifying therapies in the future . Virus infection may cause acute and chronic myocarditis, and viral persistence has been linked to the development of the most frequently reported viruses in patients in the developed countries were adenoviruses and enteroviruses . Recently, parvovirus b19 (b19v) and human herpes virus-6 are increasingly found in a significant percentage of patients diagnosed with both acute and chronic cardiomyopathy . While up to 50% of young adults and up to 90% of the elderly have been infected with these cardiotropic viruses, only an endomyocardial biopsies (emb) are the golden standard for the diagnosis of virus presence and inflammation in the heart . In the acute phase the living virus actively replicates within the myocardium, causing damage to cardiomyocytes and endothelial cells, in turn triggering the innate immune response . In most patients, this leads to viral clearance with subsequent adequate downregulation of the immune response resulting in a healthy recovered heart . However, in some patients the immune response is insufficient and clearance of the virus is not achieved . This may lead to viral persistence, causing progressive myocyte damage which may ultimately progress to biventricular dilatation with cardiac failure . Therefore, a certain genetic background appears to be a prerequisite to developing clinical symptoms of myocarditis and/or progression to virus - induced dcm . This is illustrated by viral proteases which may cleave dystrophin, a cytosolic protein which is also affected in patients with duchenne muscular dystrophy, leading to progression of heart failure symptoms in these patients . The role of viral infections in autoimmune disease has been a topic of interest for over a century . Firstly, by providing or presenting the disease - initiating antigen inducing the innate immune response, and secondly by direct myocardial involvement of immune - mediated inflammatory damage . While viral clearance by the innate immune response may improve clinical outcome, detrimental secondary effects may be triggered after the primary infection . Primed t - cells detect viral antigens and destroy infected cardiomyocytes through fas / fas ligand, tnf - alpha, cytokine and perforin pathways . In addition, some host myocardial cellular antigens may share epitopic similarities (molecular mimicry) with viral antigens, and may therefore induce an autoimmune response that can sustain the inflammatory response even after initial viral elimination . This autoimmune response induces a chronic inflammatory phase leading to immune - mediated myocyte damage . Secondly, besides a primary virus trigger for immune dysregulation, also organ - specific and systemic immune - mediated diseases such as wegener granulomatosis, churg - strauss syndrome or sarcoidosis are known to directly affect the heart . Cardiac involvement is one of the complications that substantially contribute to mortality and morbidity in patients with systemic inflammatory diseases . In addition, increased serum markers for immune activation and autoantibodies (i.e. /-myosin heavy chain, myosin light chain, troponin) may be detected in patients with autoimmune - mediated inflammatory disease . General screening for this immune dysregulation with subsequent increased serum markers is performed by measuring atrial natriuretic factor, soluble interleukin-2 and neopterin levels . Toxic cardiomyopathy results from toxic exposure of a variety of cardiotoxic agents, most notably alcohol and chemotherapeutic drugs . Metabolic cardiomyopathies can be caused by a wide spectrum of pathological metabolic conditions (table 1).table 1classification of toxic and metabolic cardiomyopathiesinfiltrativeamyloidosis (primary, familial autosomal dominant, senile, secondary forms) gaucher disease, hurler s disease and hunter s diseasestoragehaemochromatosis, anderson - fabry disease, glycogen storage disease (pompe), niemann - pick diseasenutritional deficienciesberiberi (thiamine), pellagra, scurvy, selenium, carnitine, nutritional disorder such as kwasiorkorendocrinediabetes mellitus, hyperthyroidism, hypothyriodism, hyperparathyroidism, pheochromocytomatoxicityalcohol, drugs (cocaine, catecholamines, lithium, phenothiazines, methysergide), heavy metals (cobalt, lead, arsenic) and chemical agentsconsequence of cancer therapyanthracyclines (doxorubicin, daunorubicin), cyclophosphamide and radiation classification of toxic and metabolic cardiomyopathies tachycardia - induced cardiomyopathy (tic) is caused by sustained rapid ventricular rates and is one of the well - known forms of reversible myocardial diseases after the normalisation of heart rate . It may follow any type of chronic cardiac arrhythmia: supraventricular tachyarrhythmias, ventricular tachycardia, and frequent premature ventricular complexes . The diagnosis of tic remains difficult since cardiomyopathy and tachycardia are often identified simultaneously . In up to 70% of the cases, a gene mutation may be the cause of dcm in up to 30% of the cases, therefore cardiogenetic screening is crucial in idiopathic dcm patients . The most common mode of inheritance is autosomal dominant transmission, although less common forms including x - linked, autosomal recessive and mitochondrial inheritance have also been described . The cytoskeletal proteins include dystrophin, desmin, lamin a / c, -sarcoglycan, -sarcoglycan and metavinculin . In case of the sarcomeric proteins they include -myosin heavy chain, myosin - binding protein c, actin, -tropomyosin, and cardiac troponin t and c. furthermore, phospholamban, tafazzin and the sodium - channel gene scn5a have also been reported . With the upcoming awareness of the importance of a patient s genetic background and the increasing numbers of mutated genes found, genetic testing for idiopathic dcm is becoming more common in clinical practice . In turn, this is an opportunity to unravel the molecular complexity of inherited dcm and develop possible disease - modifying therapies in the future . Virus infection may cause acute and chronic myocarditis, and viral persistence has been linked to the development of the most frequently reported viruses in patients in the developed countries were adenoviruses and enteroviruses . Recently, parvovirus b19 (b19v) and human herpes virus-6 are increasingly found in a significant percentage of patients diagnosed with both acute and chronic cardiomyopathy . While up to 50% of young adults and up to 90% of the elderly have been infected with these cardiotropic viruses, only an endomyocardial biopsies (emb) are the golden standard for the diagnosis of virus presence and inflammation in the heart . In the acute phase the living virus actively replicates within the myocardium, causing damage to cardiomyocytes and endothelial cells, in turn triggering the innate immune response . In most patients, this leads to viral clearance with subsequent adequate downregulation of the immune response resulting in a healthy recovered heart . However, in some patients the immune response is insufficient and clearance of the virus is not achieved . This may lead to viral persistence, causing progressive myocyte damage which may ultimately progress to biventricular dilatation with cardiac failure . Therefore, a certain genetic background appears to be a prerequisite to developing clinical symptoms of myocarditis and/or progression to virus - induced dcm . This is illustrated by viral proteases which may cleave dystrophin, a cytosolic protein which is also affected in patients with duchenne muscular dystrophy, leading to progression of heart failure symptoms in these patients . The role of viral infections in autoimmune disease has been a topic of interest for over a century . Firstly, by providing or presenting the disease - initiating antigen inducing the innate immune response, and secondly by direct myocardial involvement of immune - mediated inflammatory damage . While viral clearance by the innate immune response may improve clinical outcome, detrimental secondary effects may be triggered after the primary infection . Primed t - cells detect viral antigens and destroy infected cardiomyocytes through fas / fas ligand, tnf - alpha, cytokine and perforin pathways . In addition, some host myocardial cellular antigens may share epitopic similarities (molecular mimicry) with viral antigens, and may therefore induce an autoimmune response that can sustain the inflammatory response even after initial viral elimination . This autoimmune response induces a chronic inflammatory phase leading to immune - mediated myocyte damage . Secondly, besides a primary virus trigger for immune dysregulation, also organ - specific and systemic immune - mediated diseases such as wegener granulomatosis, churg - strauss syndrome or sarcoidosis are known to directly affect the heart . Cardiac involvement is one of the complications that substantially contribute to mortality and morbidity in patients with systemic inflammatory diseases . In addition, increased serum markers for immune activation and autoantibodies (i.e. /-myosin heavy chain, myosin light chain, troponin) may be detected in patients with autoimmune - mediated inflammatory disease . General screening for this immune dysregulation with subsequent increased serum markers is performed by measuring atrial natriuretic factor, soluble interleukin-2 and neopterin levels . The goals of treatment in patients with idiopathic dcm are to improve survival, slow disease progression, minimise risk factors, and alleviate symptoms . A standard heart failure regimen with lifestyle modifications should be initiated in all patients with this cardiac disease, including ace inhibitors, angiotensin - ii receptor antagonists, beta - blockers, diuretics, aldosterone antagonists, and digitalis . In some select patients known with rhythm disturbances and/or increased risk of sudden cardiac death, resynchronisation therapy combined with an implantable cardioverter device besides standard heart failure therapy, determination of the aetiology of idiopathic dcm is essential to initiate treatment strategies if possible . In some cases, the specific condition can be addressed, such as alcohol abuse and chemotherapy, to prevent disease progression . Catheter ablation should be considered in idiopathic dcm patients with frequent monomorphic pvcs (> 10% of qrs complexes), sustained rapid supraventricular tachyarrhythmias or ventricular tachycardias . In case of a previously unknown inflammatory heart disease, distinction between virus - positive and virus - negative inflammatory dcm, performed with emb, currently, sparse studies have investigated the role of antiviral therapy in an inflammatory dcm with viral presence . Recently, a pilot study with high - dose intravenous immunoglobulin (2 g / kg), known to especially eliminate the most frequently found b19v in cardiac biopsies, has demonstrated favourable effects on both cardiac function as well as virus elimination in virus - positive inflammatory dcm patients . Therefore, a randomised, double - blind, placebo - controlled study has been initiated in patients with unexplained heart failure related to a significant b19v myocardial persistence (> 200 copies/g dna). In the case of virus - negative inflammatory dcm patients, a randomised controlled trial has recently demonstrated the beneficial effects of immunosuppressive therapy on myocardial function . Patients received either prednisone and aziathioprine for 6 months (43 patients) or placebo (42 patients) in addition to conventional heart failure therapy for 6 months . Although other studies have also investigated the effects of immunosuppression in autoimmune - mediated inflammatory dcm (diagnosed by human leucocyte antigens or circulation auto - antibodies), only frustaci et al . Confirmed the absence of cardiotropic viruses in endomyocardial biopsies within his study population . Additionally, immunoadsorption therapy with subsequent immunoglobulin substitution has proven to be an effective immunomodulatory regimen in inflammatory dcm patients, although the presence of myocardial virus genome was also not addressed in these trials . In conclusion, a detailed diagnosis of virus presence, inflammation, autoimmune dysregulation and genetic background is needed in idiopathic dcm patients to develop better classification methods, more aetiology - based treatment strategies and sophisticated prognostic models in the near future.
|
Implanted materials such as pacemaker, ventriculoperitoneal shunt, hernia mesh, etc ., are reported to be migrated from their original area to the distant site; however, the exact mechanism of such migration is not always clear . Here, we present a unique case of foreign body (bullet) migration, which entered in the corpus through the loin and presented in scrotum after a long time of 8 years of initial injury . In our article, we have tried to explain the mechanism and pathway of such migration and also described the consequences following a low energy fire arm injury along with the literature review . A 35-year - old farmer presented to our outpatient department complaining of heaviness and feeling a mass inside his right scrotum for last 1-year . There was no significant change in the size of the mass throughout the period, but there was occasional pain, and the size of the hemiscrotum was not increased . On examination, right testis was found to be in slightly lower down position compared to left, without any visible mass or swelling . On palpation, an elongated, independent, patient gave the history of gunshot in right loin, 8 years back, which was managed conservatively with wound healing over 2 weeks . Impression of a foreign body through the scrotal skin patient was operated under local anesthesia in day care and a metallic foreign body (bullet) was delivered from a patent processus vaginalis sac [figure 2]. In cases of trauma, if foreign body (metallic or nonmetallic) accidentally entered in body, the wounds is usually surgically explored to control bleeding; to debride the nonvialable tissue; to repair the vital structure; and obviously the foreign body, which may be a continuous source of infection is also removed . Thus, the chance of retention of a foreign body like bullet inside the human body like in our case is very rare . Nevertheless, around a retained foreign body extensive fibrosis occurs, so it has a very less chance to migrate . There are few cases reported in the literature suggesting a migration of foreign body in from the abdomen into the scrotum among them, migration of ventriculoperitoneal shunt is the most common . It has also been shown that, migration usually occurs in the right side, because, right testis descends much letter the left testis, so chance of a patent processus vaginalis is more at that side and a large fraction of adults do have occult patent processus vaginalis without having clinical signs or symptoms of a groin hernia . It is really difficult to be sure about the exact path of the bullet in this case . However, it seems that, after entering into the peritoneum from the loin region, the bullet was present quiescent for some time; thereafter due to sudden rise of intra - abdominal pressure such as cough, defecation, etc ., or simply due to gravity, the bullet may have gradually traveled through the peritoneal or abdominal cavity and entered into the scrotum through the patent processus vaginalis, which the patient already had . The uniqueness of our case report is that, with extensive literature search, we have not been able to find any case describing migration of bullet from abdomen to scrotum.
|
Households were selected by a modified version of the cluster survey of the world health organization expanded program on immunization (4). First, we mapped the population of each census block in laredo and in a major portion of nuevo laredo (sector 1). In each city, 30 clusters were chosen from these census blocks by using a selection probability proportional to population . Four city blocks were randomly chosen from each of these clusters, and individual houses in one or more of those blocks were selected at random (where block maps were available) or systematically from a randomly chosen starting point . Binational teams, each composed of an epidemiologist, a nurse, and an entomologist, conducted the surveys . A blood sample was obtained by fingerstick from a randomly selected resident (ages 1865). A short questionnaire solicited general household information (number of inhabitants, type of construction, proximity to neighboring houses, number of bedrooms, presence and type of air - cooling system, and the presence and quality of window screens). Demographic data and travel histories of the blood donors serum samples were tested for anti - dengue immunoglobulin m (igm) by igm antibody - capture enzyme - linked immunosorbent assay (mac - elisa), and for anti - dengue igg by igg - elisa and mixed dengue antigens (5,6). Cary, nc) and sas - callable sudaan (research triangle institute, research triangle park, nc) software . Risk factors for igm and igg seropositivity were assessed by multivariable weighted logistic regression, accounting for stratification by country, clustering within each city, and different numbers of surveys per cluster . Surveys were completed in 622 households (309 in laredo, 313 in nuevo laredo), and 516 persons (228 in laredo, 288 in nuevo laredo) provided blood samples . Igm seropositivity (table 1) was lower in laredo (1.3%; 95% confidence interval [ci] 0 to 3%) than in nuevo laredo (16%; ci 12% to 20%). Igg seropositivity (table 1) was also lower in laredo (23%; ci 17% to 28% vs. 48%; ci 41% to 55%). Conversely, mosquito - infested containers were more abundant on the texas side of the border: the breteau index (the number of infested containers per 100 houses) was 91 in laredo versus 37 in nuevo laredo . Eighty - two percent of homes in laredo had central or room air - conditioning versus 24% in nuevo laredo . In laredo, evaporative coolers (a low - technology air - conditioning device that cools and humidifies air by drawing it from outdoors through a continually wetted screen) were less prevalent, a greater proportion of houses had intact screens, the average distance between houses was greater, and fewer persons lived in each house (table 2). Univariate analysis indicated a significant association between igm seropositivity and five variables: absence of air - conditioning, fewer room air - conditioning units, the presence of an evaporative cooler, no travel outside the laredo / nuevo laredo area, and shorter distances to neighboring houses (table 3). Igg seropositivity was significantly associated with absence of central air - conditioning, fewer room air - conditioning units, smaller plot size, and a shorter distance to neighboring houses (table 4). On multivariate analysis, backward selection of variables yielded two that remained significantly associated with igm seropositivity: absence of air - conditioning (odds ratio [or] 2.6; ci 1.2 to 5.6) and no history of travel beyond laredo / nuevo laredo in the previous 3 months (or 2.0; ci 1.0 to 4.0). Igg seropositivity was associated with absence of air - conditioning (or 2.4; ci 1.5 to 4.0), a history of crossing the border during the previous 3 months (or 1.8; ci 1.1 to 2.8), and a greater number of occupants per household (or 1.1; ci 1.0 to 1.2). By using the calculated prevalence ratio of 2.6 as an estimate of the relative risk of dengue in houses without air - conditioning, the proportion of dengue infections attributable to lack of air - conditioning in nuevo laredo was 55%, i.e., 55% of cases of dengue in nuevo laredo would not have occurred if all households in nuevo laredo had air - conditioning . Given the proximity of the two cities, the difference in transmission rates cannot be attributed to climate . Moreover, the mean daily temperature for august, the peak month of transmission, was 32.2c (mean maximum 40.0c; mean minimum 24.4c), several degrees higher than the mean for the hottest months on caribbean islands where dengue is common . Indeed, summer temperatures throughout the range of ae . Aegypti in the southern united states are hotter than in many tropical regions where the disease is endemic . Despite mosquito control campaigns on both sides of the border, ae . The breteau index was on a par with that observed during major dengue epidemics in puerto rico (cdc, unpub . The house index (the percentage of houses with at least one infested container) was 37%, seven times higher than the level (5%) equated with a high risk of dengue transmission by the world health organization (7). Thus, vector populations cannot account for the low rate of transmission on the texas side of the border . Aegypti is closely associated with human habitation and readily enters buildings to feed and to rest during periods of inactivity (8). In this context, casual observation supported the association of lack of air - conditioning with dengue transmission . In laredo, most shops, restaurants and other public places are air conditioned and have closed windows and self - closing doors, as do houses in residential areas, even in low income neighborhoods . By contrast, in nuevo laredo, many shops, bars, and restaurants are open to the street, and the windows and doors of houses are left open, particularly in the daytime . Thus, there is less opportunity for mosquito / human contact in laredo than in the mexican city . More than 85% of all buildings in texas are fully air conditioned (american society of heating, refrigerating and air - conditioning engineers, inc ., atlanta, ga; available from: url: http://www.ashrae.org/). Indeed, air - conditioning is ubiquitous in many parts of the united states . To maximize heating / cooling efficiency, even if infected mosquitoes gain entry to such buildings, the artificially dry atmosphere lowers their survival rate, and the cool temperature extends the extrinsic incubation period, reducing the likelihood of transmission . Aegypti feed on dogs, even when humans are readily accessible (9,10). In laredo whether these animals are an important blood source for the species would be an interesting topic for future research . The dollar cost of electricity is similar in laredo and nuevo laredo, but income, as indicated by per capita gross domestic product, is much higher in texas than in taumalipas (table 5). The proportional cost of maintaining air - conditioning for an entire dengue season is therefore much higher for the average family in mexico and is unaffordable for the majority . Thus, the ultimate determinant of dengue prevalence in this setting is socioeconomic rather than environmental . It has frequently been stated that dengue, malaria, and other mosquito - borne diseases will become common in the united states as a result of global warming (1114). Such predictions often refer to vectorial capacity, a simple model that incorporates the population density, biting frequency, and daily survival probability of the vector, and the extrinsic incubation period of the pathogen (15,16). Although the vectorial capacity model has proved useful for interpreting entomo - epidemiologic data, particularly for transmission of malaria (17), it does not incorporate factors like air - conditioning, use of vaporative coolers, and the behavior of mosquitoes and humans . If the current warming trend in world climates continues, air - conditioning may become even more prevalent in the united states, in which case, the probability of dengue transmission is likely to decrease . If the economy of mexico continues to grow, the use of air - conditioners may gain momentum south of the border.
|
Neuromuscular diseases (nmd), including duchenne muscular dystrophy (dmd), cause ventilatory insufficiency due to weakness of inspiratory muscles, such as the diaphragm1, 2 . Moreover, loss of ventilatory muscle strength and laryngopharyngeal function may cause difficulty in expectoration of airway secretions and foreign substances, and acute respiratory failure due to asphyxia or aspiration pneumonia3 . Chewing and swallowing problems are common in nmd and reflect the weakness of muscles in the cheeks, lips, tongue and pharynx; these frequently contribute to malnutrition . Ingestion and swallowing difficulties may occur at a certain age in nmd patients . In spinal muscular atrophy, these can occur from infancy to childhood4, whereas in dmd, swallowing difficulties usually happen after 15 years of age, following the appearance of respiratory failure . As a consequence of impaired oropharyngeal function, patients suffer from decreased quality of life (qol)5 and increased risk for aspiration pneumonia, which might contribute to or exacerbate respiratory failure4 . In recent years, noninvasive positive pressure ventilation (nppv) has been the first choice for respiratory management of nmd6 . Airway clearance with manually assisted coughing or mechanical insufflation - exsufflation (mi - e) had been recommended by guidelines across japan, europe, and united states for patients with impaired cough function to prevent pulmonary complications of asphyxia or aspiration and to avoid tracheostomy or tracheal intubation7,8,9,10,11,12,13 . In fact, these respiratory management strategies have been shown to significantly improve life expectancy and qol of dmd patients14, 15 . The aim of this study is to prove that manually assisted coughing or mechanical insufflation - exsufflation prevents pulmonary complication and contribute to continue oral intake safely and continue rate of oral intake in duchenne muscular dystrophy . The subject was a patient who was able to evaluate respiratory function in dmd patients hospitalized in our hospital at december 2014 . Dmd patients who could not undergo respiratory evaluation due to impaired comprehension, autism, and presence of tracheostomy were excluded . We reviewed the medical records for variables, such as use of mechanical ventilator, use of mie, and ability for oral intake . We investigated the duration of four periods of varying cough peak flow (cpf) value on unassisted coughing and manually assisted coughing and mi - e use (fig . 1.different study periods based in cpf value on unassisted coughing and manually assisted coughing and use of mi - e). Cpf was measured using a low range peak flow meter (assess; healthscan, inc ., cedar grove, nj), whereas mi - e was administered by coughassist and coughassist e70 (philips respironics, inc ., this investigation was conducted with the approval of the ethics committee of our hospital (registration number 28 - 1). Different study periods based in cpf value on unassisted coughing and manually assisted coughing and use of mi - e period a: unassisted cpf 270 l / min before mi - e use . Period b: unassisted cpf<270 l / min and manually assisted cpf 270 l / min before mi - e use . Period c: unassisted cpf<270 l / min and manually assisted cpf<270 l / min with mi - e used for emergency only . Period d: unassisted cpf<270 l / min and manually assisted cpf<270 l / min with constant use of mi - e . We reviewed the medical records of each period for signs of respiratory tract infection, which was determined based on frequency of fever (temperature> 37 c) that required antibiotics . The variables were compared among the four periods using one - way analysis of variance with bonferroni correction . Statistics analysis was performed using spss ver 22.0 j for windows (ibm spss japan inc ., a total of 58 dmd patients participated in this study; their average age was 28.7 8.0 (range, 1445) years . Ventilatory support was not needed in 6 patients [age, 18.4 2.7 (range, 1523) years]; whereas nocturnal nppv was needed in 7 patients [age, 21.4 5.1 (range, 1428) years] and full - time nppv in 45 patients [age, 31.2 7.0 (range, 1745) years]. All patients who were not on ventilatory support and those on nocturnal nppv were able to tolerate oral intake . Among the 45 patients on full - time nppv, 43 (95.6%) were able to continue oral intake for an average of 7.2 4.7 years (maximum 16.4 years), without the need for tracheal intubation due to acute respiratory failure from asphyxia or aspiration pneumonia (table 1table 1.characteristic of all patients at the end of studyno ventilatory support (n=6)nocturnal nppv (n=7)full - time nppv (n=45)age (range)18.4 27 (1523)21.4 5.1 (1428)31.2 7.0 (1745)vc (ml)2,081.7 602.11,118.6 687.3287.4 211.9mic (ml)2,537.5 179.72,311.4 510.11,703.0 708.7cpf (l / min)294.2 71.0202.1 96.754.1 62.6assisted cpf (l / min) 356.7 51.3324.2 58.6254.2 70.3mi - econstant use0 (0%)2 (28.6%)35 (77.8%)emergency use only6 (100%)5 (71.4%)10 (22.2%)power - enable6 (100%)7 (100%)42 (93.3%)operated vehicledisable0 (0%)0 (0%)3 (6.7%)nutritionoral feeding6 (100%)7 (100%)43 (95.6%) methodtube feeding0 (0%)0 (0%)2 (4.4%)nppv: noninvasive positive pressure ventilation; vc: vital capacity; mic: maximum insufflation capacity; cpf: cough peak flow; assisted cpf: manually assisted cough peak flow: mi - e: mechanical insufflation - exsufflation). The two remaining full - time nppv patients could not tolerate oral intake and required nasogastric tube feeding due to frequent choking at 33.2 and 36.1 years old, respectively . Nppv: noninvasive positive pressure ventilation; vc: vital capacity; mic: maximum insufflation capacity; cpf: cough peak flow; assisted cpf: manually assisted cough peak flow: mi - e: mechanical insufflation - exsufflation in all full - time nppv patients, mi - e was introduced when cpf was <270 l / min . In 35 of 45 patients, mi - e was used constantly at 35 times / day (period d). In the remaining 10 of 45 patients, mi - e was unnecessary or was difficult to use continuously every day; instead, mi - e was used only for emergency situations, such as choking and difficulty in sputum clearance, at a frequency of 01 time / month (period c). In regards to the progression of cpf and mi - e usage, as well as the frequency of fever requiring antibiotics in each period, for periods a, b, c, and d, the cumulative number of patients was 15, 33, 12, and 37, respectively; the frequency of fever requiring antibiotics was 39, 91, 173, and 258, respectively (table 2 table 2.frequency of fever needed antibiotics treatment as respiratory tract infections). Period c tended to have the highest rate of respiratory infection, but there was no statistically significant difference among the different periods . In our study, 95.6% of the dmd patients on full - time nppv were able to continue oral nutrition . A large - scale, multicenter study by saitou et al . Showed that despite the use of mechanical ventilation in a majority of hospitalized dmd patients, the rate of oral intake markedly decreased from 95.1% in 1999 to 66.8% in 201216 . On the other hand, wollinsky reported that only 3 (14.3%) of 21 dmd patients using full - time nppv required gastrostomy tube, whereas the remaining 18 (85.7%) were able to continue oral nutrition while using nppv17 . The high rate of oral intake in our study population may be explained by the fact that our patients continued full - time nppv during their meals . Reported that an available mi - e at home was more certain than manually assisted coughing techniques (i.e., use of resuscitation bag and chest thrust) in managing asphyxia due to severe food aspiration in a 29 year - old dmd patient18 . In our hospital, constant use of mi - e or the presence of a staff member who was knowledgeable in mi - e preparation during an emergency may explain the prolonged and safe oral intake of the majority of our patients on full - time nppv . The frequency of fever requiring antibiotics was the same between periods d and a (0.79 vs. 0.76, respectively) and there was no clear episode of aspiration pneumonia . Bianch compared the data of cpf and other respiratory function tests with and without respiratory complications such as repeated bronchitis and pneumonia at the convalescent stage when restarting oral intake in 55 patients that had cerebrovascular disorder or neurological disorder, with swallowing difficulty confirmed by video fluoroscopic examination (vf). The results showed that the cpf value of patients with respiratory complications was significantly lower than those without complications, and complications emerged when the value was under 242 l / min19 . Toussaint described that use of daytime nppv may help dmd patients with dysphagia in recovering from dyspnea or respiratory muscle fatigue during a meal . They recommended respiratory management using nppv and as needed manually 4assisted coughing and noninvasive airway clearance by mi - e to avoid tracheostomy in dmd patients with dysphagia5 . At our hospital, the setting for mi - e was usually at + 40 to + 55 cmh2o positive pressure and 40 to 55 cmh2o negative pressure20, 21, and was adjusted to gain enough cpf of 270 l / min). In this study, all patients on full - time nppv were noted to have improved cough function from an unassisted cpf of 54.1 62.6 l / min to cpf>270 l / min after use of mi - e . We considered that the use of mi - e and alteration of food consistency (pasty or minced) in these patients were able to prevent pulmonary complications, despite choking or wheezing during a meal . One limitation of this study was that we were unable to ascertain whether the febrile episodes that required antibiotics were from aspiration pneumonia or from other respiratory tract infections . The diagnosis of ingestion - swallowing difficulty in patients on full - time nppv was not confirmed by video fluoroscopy (vf). However, vf is not always useful and an ingestion - swallowing difficulty may be easily observed during a meal and based on changes in ventilation5, 22 . Use of manually assisted coughing and noninvasive airway clearance by mi - e enabled continuous and safe oral intake in dmd patients on full - time nppv . Both nppv and mi - e are important in avoiding tracheal intubation or tracheostomy and might improve the life expectancy and qol of dmd patients.
|
Real time pcr (rt - pcr) can rapidly, reproducibly and quantitatively determine changes in gene expression (1). Although microarray analysis can measure large scale gene expression levels simultaneously, its hybridization - related variation often demands validation by other methods . Routinely, rt - pcr is used to verify the observation from microarray studies . However, several artifacts can confound the analysis including: (i) amplification of undesired template secondary to mispriming or annealing at inappropriate temperatures; and (ii) susceptibility to rna contamination with genomic dna, especially when collecting samples from tumor tissues (2). Though the problem of genomic contamination is partially addressed by dnase treatment this method is often incomplete and its protracted use often diminishes the sensitivity of detection . This is a costly problem particularly when the detection of rare transcripts in precious tissue samples is desired (3). Low cost methods for detecting fluorescent dyes which bind to double stranded dna, such as sybr green, are most widely used and suitable for high throughput screening . Since these dyes are not sequence specific, careful consideration should be given to avoid generating extraneous amplicons . One of the obstacles to high throughput rt - pcr gene expression studies in which multiple unique transcripts are simultaneously measured in 96 or 384 well formats, is the necessity to individually optimize each assay for each target (4). Currently, the criteria for successful determination by quantitative rt - pcr require that: (i) the optimal amplicon should be located in a non repetitive region without segments of low complexity, (ii) the optimal amplicon size should be 100 bp to ensure the efficiency of taq polymerase processivity, (iii) if possible, primers should be designed to flank intron exon borders or primers anneal at a splice junction to distinguish genomic dna from cdna template, and (iv) primers have similar melting temperatures with 2070% gc content (5,6). It is a laborious and error - prone chore to design rt - pcr primers that meet these requirements . Rtprimerdb (), an online database, provides experimentally verified primer sets for 2699 human and 487 mouse genes (7,8). Primerbank () is a well known resource that covers most known human (33 741) and mouse (27 681) genes (9). However, its primer algorithm is not designed to span introns and is therefore more prone to amplify contaminating genomic sequences . Here we describe qprimerdepot, a primer database for rt - pcr analysis of> 99% of human (23 400) and mouse (18 733) refseq genes . These primers sets are designed to be used under uniform annealing temperatures to facilitate their application in large scale high throughput assays . Moreover, to reduce the noise from contaminating genomic dna (6), over 90% of the primer sets are designed to produce amplicons bridging exon: exon junctions of intron - bearing genes . Sequences file (refmrna.zip) and intron / exon information tables (refgene.txt.gz) of 23 463 human and 18 737 mouse refseq genes (ucsc hg17 and mm6) were downloaded from ucsc genome browser (). To assure amplicons free of repetitive elements and sequences of low complexity (10), we utilized biowulf, a high - performance linux cluster at the national institutes of health, to mask the repetitive elements using the repeatmasker application with built - in maskeraid (11). Primer3 (12) was used to design primers for each refseq entry, with the following parameters: for intronless genes (5.5% of human refseq genes and of 12.4% of mouse refseq genes), primers were set to be between 17 and 27 bp with 20 bp as optimum, and melting temperature was set to be between 57 and 63c with 60c as optimum, all other parameters, such as primer_self_any and primer_self_end, were set to default (8.0 and 3.0, respectively) to assure low self - complementarity . All cdna amplions were 90150 bp in size to ensure taq polymerase efficiency . For 99% of intron - bearing genes (94.5% human genes and 88.6% mouse genes bear at least one intron), primers were designed to flank or cross an exon - intron border in which the intron was one of the top three largest in the gene of interest . Thus, contamination by genomic dna would generate either a longer product, which can be detected by melting curve analysis, or no product if the contamination template length (intron> 3 kb) is too long for taq polymerase to traverse during the extension period . The blast algorithm was used via the nih biowulf linux cluster to evaluate all primers against corresponding refseq databases . The criteria for possible mis - priming requires that both primers have at least 15 matches in another refseq entry (i.e. Expectation value, e <1) (13,14). The blast result revealed that 891 of human and 420 of mouse primers may mis - prime to other refseq sequences . Sequence alignments of query and hit refseq using the blast2 algorithm (15) were performed and primer pairs which had <80% identities were filtered out of the database . Annotations are presented in the user interface for the individual primer sets that could mis - prime another refseq gene with> 80% identity . The sources of these mis - primed refseq will vary, but may include redundancy within the refseq database, transcript variants and paralogs of high sequence similarity . Each of these possibilities can be assessed by a direct link that is provided to in silico pcr () for all primer pair sets . This link allows the user to rapidly identify amplicon locations in the mouse and human genomes so that primer specificity can be visually assessed and validated . Qprimerdepot can be accessed at or by querying the database with a refseq i d or a gene name . Batch query service is available upon request if user provides standard gene name or accession number . Flat files and mysql dump file which have all primer information are also available upon request . Reverse transcription was applied with omniscript rt kit following manufacturer's protocol (qiagen). A 20 l rt reaction included 2 g universal reference rna (stratagen), 1 m oligo - dt primer, 2 l of 10 rt buffer, 0.5 mm each dntp, 10 u of rnase inhibitor, 4 u of omniscript reverse transcriptase, and depc - treated water . Primer sequences were extracted from our database and synthesized by integrated dna technologies (coralville, ia, usa). Quantitative rt - pcr was carried out in a dna engine opticon-2 real time pcr detection system (mj research). In brief, each 20 l reaction mix comprises 0.3 m primers (both 5 and 3 primers), 1 l template from reverse transcription and 10 l 2 quantitect sybr green pcr master mix (qiagen). Each reaction mix was incubated at 95c for 15 min, 40 cycles of 95c for 15 s and 60c for 1 min . A melting curve analysis which read every 0.3c from 65 to 95c was followed to assess the homogeneity of a pcr product . Sequences file (refmrna.zip) and intron / exon information tables (refgene.txt.gz) of 23 463 human and 18 737 mouse refseq genes (ucsc hg17 and mm6) were downloaded from ucsc genome browser (). To assure amplicons free of repetitive elements and sequences of low complexity (10), we utilized biowulf, a high - performance linux cluster at the national institutes of health, to mask the repetitive elements using the repeatmasker application with built - in maskeraid (11). Primer3 (12) was used to design primers for each refseq entry, with the following parameters: for intronless genes (5.5% of human refseq genes and of 12.4% of mouse refseq genes), primers were set to be between 17 and 27 bp with 20 bp as optimum, and melting temperature was set to be between 57 and 63c with 60c as optimum, all other parameters, such as primer_self_any and primer_self_end, were set to default (8.0 and 3.0, respectively) to assure low self - complementarity . All cdna amplions were 90150 bp in size to ensure taq polymerase efficiency . For 99% of intron - bearing genes (94.5% human genes and 88.6% mouse genes bear at least one intron), primers were designed to flank or cross an exon - intron border in which the intron was one of the top three largest in the gene of interest . Thus, contamination by genomic dna would generate either a longer product, which can be detected by melting curve analysis, or no product if the contamination template length (intron> 3 kb) is too long for taq polymerase to traverse during the extension period . The blast algorithm was used via the nih biowulf linux cluster to evaluate all primers against corresponding refseq databases . The criteria for possible mis - priming requires that both primers have at least 15 matches in another refseq entry (i.e. Expectation value, e <1) (13,14). The blast result revealed that 891 of human and 420 of mouse primers may mis - prime to other refseq sequences . Sequence alignments of query and hit refseq using the blast2 algorithm (15) were performed and primer pairs which had <80% identities were filtered out of the database . Annotations are presented in the user interface for the individual primer sets that could mis - prime another refseq gene with> 80% identity . The sources of these mis - primed refseq will vary, but may include redundancy within the refseq database, transcript variants and paralogs of high sequence similarity . Each of these possibilities can be assessed by a direct link that is provided to in silico pcr () for all primer pair sets . This link allows the user to rapidly identify amplicon locations in the mouse and human genomes so that primer specificity can be visually assessed and validated . Qprimerdepot can be accessed at or by querying the database with a refseq i d or a gene name . Batch query service is available upon request if user provides standard gene name or accession number . Flat files and mysql dump file which have all primer information are also available upon request . Reverse transcription was applied with omniscript rt kit following manufacturer's protocol (qiagen). A 20 l rt reaction included 2 g universal reference rna (stratagen), 1 m oligo - dt primer, 2 l of 10 rt buffer, 0.5 mm each dntp, 10 u of rnase inhibitor, 4 u of omniscript reverse transcriptase, and depc - treated water . Primer sequences were extracted from our database and synthesized by integrated dna technologies (coralville, ia, usa). Quantitative rt - pcr was carried out in a dna engine opticon-2 real time pcr detection system (mj research). In brief, each 20 l reaction mix comprises 0.3 m primers (both 5 and 3 primers), 1 l template from reverse transcription and 10 l 2 quantitect sybr green pcr master mix (qiagen). Each reaction mix was incubated at 95c for 15 min, 40 cycles of 95c for 15 s and 60c for 1 min . A melting curve analysis which read every 0.3c from 65 to 95c was followed to assess the homogeneity of a pcr product . Our database comprises pre - designed primers for 42 133 mouse and human refseq genes (table 1). For most genes the database provides a simple user interface where the user may enter either the hugo approved gene symbol or the refseq gene identifier (figure 1). The database graphic output provides information on the primary transcript location, number of introns, primer sequence, primer length, gc%, amplicon size, and genomic amplicon size . Also a direct link is provided for location of the genomic amplicon by in silico pcr (figure 2). Summary statistics for qprimerdepot primerdb web input interface for qprimerdepot (see text). Web output interface for qprimerdepot (see text). To experimentally evaluate the primer quality, 288 genes were arbitrarily selected from a list of genes known to function in the immune response . Universal human reference rna was reverse transcribed and used as template in pcr to examine the quality of the primers . Given the variation of transcript abundance, melting curve analysis followed by gel electrophoresis has been suggested to verify rt - pcr products (6). Visualization by the less sensitive ethidium bromide stain shows that> 70% of the primer sets produce an amplicon of the correct molecular weight that will amplify and be detected as a single species by quantitative pcr (figure 3). Several of the failures detected by gel electrophoresis are likely due to very low abundance transcripts in the universal rna, imperfect primer design, unanticipated high secondary mrna structure, or erroneous exon annotation in ucsc genome browser . Approximately 88.5% of primer sets produced no product in the absence of reverse transcriptase and the remaining sets produced detectable product only beyond 34 cycles of amplification possibly, due to primer dimers . Validation of pprimerdepot primer sets on 3% ethidium bromide stained agarose / acrylamide (3:1) gels after 38 cycles of amplification . The resistance of most qprimerdepot primer sets to contaminating input genomic dna is illustrated in figure 4 . Here the real - time amplification profiles of three intron - bearing genes (vefg, vegfb and vegfc) was compared to that of three non intron - bearing genes (xcr1, sstr4 and mc1r) after challenge with increasing concentrations of contaminating genomic dna (0.5500 pg/l). As demonstrated in figure 4, all three intron - bearing genes show robust resistance to> 500 pg/l of input genomic dna . This is in stark contrast to the three non intron - bearing genes where as little as 5 pg/l produces a significant false signal . Real - time pcr amplification profiles generated using qprimerdepot primer sets for non intron - bearing (xcr1, sstr4, mc1r) and intron - bearing (vefg, vegfb, vegfc) genes compared after the addition of increasing amounts of contaminating genomic dna . Taking advantage of the intron / exon inventory of refseq genes and primer3, a paradigm primer design tool, we designed primers which are contamination resistant for 99% of human and mouse refseq genes (table 1). Since the majority of the primer sets will amplify desired templates under unified annealing temperatures, high throughput multiplex analysis is achievable at a reasonable cost . Empirical screening and validation of primer set performance conservatively suggests that 7090% of the primer set designs are likely to perform effectively right out of the box with no need to adjust the conditions of amplification . Therefore, qprimerdepot is a valuable resource for qrt applications, especially in those circumstances requiring high throughput detection of rare transcripts in curated and/or patient - derived samples that often contain unavoidable contamination with genomic dna.
|
Titanium and its alloys widely used as implant biomaterials because of their relatively superior physical properties such as lower modulus, low density, and relatively low elastic modulus and because of their superior biocompatibility due to their excellent corrosion resistance, and bioinertness of the oxide layer . Therefore, titanium (ti) and its alloys mainly (ti-6al-4v) became the most suitable metal for endosseous implants fabrication . One of the most serious and prevalent mechanisms, for obtaining biofunctional and biocompatible material for biomedical use, is surface modification . The surface modification technique is a process that changes the material surface through changes in their chemical composition, structure, and morphology, but the bulk mechanical properties of the material not affected . Therefore, biomaterials surface in contact with the biological tissue or fluid is named biointerface . The biointerface is the place where the modifications are commonly carried out to make biomaterials more compatible, and these modifications are fall under three categories, namely, morphologic, physicochemical, and biological . Surface of biomaterials represents a crucial value for biomedical field and determine biocompatibility of the biomaterial because only the uppermost molecular layers are in intimate contact with the biological environment . Thus, any interaction between the implant materials and the biological environment occurs at or through the level of narrow zone termed as the interface . Therefore, the biomaterial scientists have a special concern with the interfacial chemistry that determined by the uppermost few nanometers that composed the materials surface . For an optimally bonding between the implant material and living bone in the human body, it is essential that the implant can form bone - like apatite layer on its surface . The nucleation of apatite on the surface of a material is induced by the functional groups on its surface . The surface modification of titanium implants is an interested issue for investigation aiming to induce acceleration of normal bone healing allowing immediate loading of the implant . The treatment of titanium surfaces by alkaline solution followed by heat treatment was described by some investigators, who successfully proved the bioactive induction both in vitro and in vivo . Hydroxyapatite formation onto ti surface can be accelerated by treatment titanium surface by naoh solution followed by heat treatment to produce layer of sodium titanate on titanium surface . Titanium surface that treated with alkaline solution followed heat treatment is thought to bond to living bone via formation of apatite layer on its surface while the titanium surface that treated with alkaline solution only did not . Recently, in vitro studies showed that bone - like apatite could be formed on the titanium surface that treated with alkaline followed by heat treatment when immersed in simulating body fluid (sbf) via formation of titana hydrogel on titanium surface . Among surface treatments, the anodizing exhibited effectiveness in modifying surface properties of metals, particularly in inducing the bioactivity of titanium . Anodic oxidation of titanium implants involved several changes in oxide characteristic increases not only the thickness of native oxide layer but also the surface texture such as the ability of fabricating porous ti oxide films, the changeability of the crystalline structure, chemical composition of oxide film, and through formation of rough and homogeneous tio2 layer with numerous nanoscale pores . The surface modification of titanium implants by anodic oxidation in phosphoric / sulfuric acid electrolyte systems showed an increase in oxide thickness, which significantly improves the bone response for better osseointegration between ti surface and surrounding bone . This study aimed to investigate the effect of different surface treatment on the bioactivity of titanium alloy (ti-6al-4v) and their ability to form calcium phosphate apatite crystals on their surfaces after immersion in a simulated body fluid . This study was performed in the department of biomaterials, faculty of dental medicine, al - azhar university . A total of fifteen samples made of ti-6al-4v alloy (extra low interstitials f 13084 alloy, usa) were used in this study . The sample dimensions were rectangular in shape of 15 mm in length, 7 mm in width, and 2 mm in thickness . The titanium samples were silky polished using sandpaper starting from gravel #400 to #1200, and then ultrasonically cleaned in deionized water for 5 min before dried by air dryer . Then, the samples were classified into three groups according to the following treatments: five sample each, according to the received surface treatment . The surface treatment involved anodization (group b) and alkali - heat treatment (group c). Ten samples of groups b and c were etched in acid blend of 80 ml / l hno3, 60 ml / l hf, and 150 ml / l h2o2 for 5 min at room temperature before the surface treatment . Five samples were subjected to anodization process, group b, after acid etching to form an oxide porous film on their surfaces . The anodizing processes were performed in electrochemical cell that has an anodizing solution as electrolyte and two electrodes using a direct current source with value of 20 v as constant voltage . A cathode of platinum is connected to the negative terminal of a voltage source and placed in the solution, and ti - alloy sample is connected to the positive terminal of the voltage source and also place in the solution as anode with about 4 cm as a fixed distance between cathode and anode . G / l (1 m h3 po4) aqueous solution (1 l total volume) having ph 1.5 that was stirred with magnetic stirrer with 180 rpm . The anodizing process was carried out at room temperature for 15 min, and then the samples were ultrasonically cleaned for 5 min in deionized water . The samples of group c were alkali - treated by immersion in 5 m naoh solution for 25 min at temperature 60c and washed with distilled water, and dried in the air . Then, the samples were heat treated at 600c for 1 h in a furnace at heating rate 30c / min . The surfaces of each group were characterized after surface treatment using x - ray diffraction (xrd) (philips analytical x - ray b.v . ), scanning electron microscopy (sem) (technics inc ., jeol jsm 5410, japan production), and atomic force microscopy (thermomicroscopes autoprobe cp research, scanner 100 m, usa). Before immersion in hank's balanced salt solution (hbss), the samples were rinsed with distilled water, washed further with ethanol in an ultrasonic bath for 20 min, and then dried in air . All the investigated samples were immersed for 7 days in the hbss which was used as sbf at ph 7.4 and 37c . Hbss was renewed every 3 days to maintain the level of ion concentration allowing for biomimetic coat precipitation on the sample surfaces . After the immersion of the ti - alloy samples in hbss, the specimens were removed from the solution, gently rinsed with distilled water and then dried at 60c for 24 h. to assess the biomimetic coat on the differently treated samples, microstructural / morphological changes of the specimens' surfaces were characterized . Meanwhile, the surface morphology was examined using sem . Energy dispersive x - ray analysis (edxa) (model: link isis - oxford england . The device is attached to jeol-5400 scanning microscope) assembled on the sem was used to determine the atomic% of calcium, phosphorous elements, and ca / p ratio of the precipitation . Fourier transformation infra - red spectroscopy (ftir) (ft/6300 type a. jasco, japan) was used to analyze qualitatively the chemical structure of biomimetic coat which precipitated on the immersed surface . Statistical analysis was performed using one - way anova followed by tukey's post hoc test at the significance level of = 0.05 . Statistical analysis was performed using one - way anova followed by tukey's post hoc test at the significance level of = 0.05 . The xrd analysis of the anodized group revealed the presence of anatase tio2 phase while the alkali - heat - treated group reveals the presence of rutile tio2 and ti - oh phases as shown in figure 1 . X - ray diffraction pattern of all investigated groups atomic force micrograph of the alkali - heat treated group shows the highest surface roughness among the all investigated group with multiple deep valises in three - dimensional (3d) image, followed by the anodized group, which shows severe undulation of the surface; however, no sharp peaks were evident in the 3d images and the least surface roughness was the control group, and its 3d image shows slight irregularities and serration of the metal surface due to polishing as shown in figure 2 . Atomic force micrographs of group a, b, and c (three - dimensional) the statistical analysis of the surface roughness of the different surface treated groups is shown in figure 3 . Anova test showed that there was a statistically significant difference among mean (ra) values of the investigated groups with p <0.05 . Pair - wise comparisons among the groups revealed that alkali - heat - treated group showed the highest statistically significantly mean (ra) value . Mean values of surface roughness (ra) of the investigated groups the scanning electron micrograph of the control group showed that polishing marks of ti - alloy obviously seen on the sample surface, and the anodized group revealed presence of numerous and unattached, well - defined, nano - sized pores while the alkali - heat - treated group revealed the presence of numerous, unattached, well - defined, nano - sized pores that arranged in an ordered pattern and equally distributed all over the structure on the surface spread among micro - sized particles . It was prominent that the pores are deeper with darker contrast [figure 4]. Scanning electron micrographs of group a, b, and c before and after immersion in hank's solution after immersion in hank's solution, the sem showed discrete small apatite crystals formed on the surface of the control samples and the edxa spectrum showed phosphorus atomic% of 53.94 and calcium atomic% of 46.05 and ca / p ratio of 0.85, which is much lower than stoichiometric value of hydroxyapatite (1.67). It indicates the synthesis of mono - calcium phosphate monohydrate of chemical composition of ca (h2 po4) 2.h2o and/or dicalcium phosphate dehydrate (brushite) ca hpo4.2h2o [figures 4-ii and 5]. Energy - dispersive x - ray spectrum of group a, b and c after immersion in hank's solution the sem of the anodized group showed contiguous layer of apatite nuclei formed on the surface of the anodized samples such that the substrate is not obviously seen and edxa spectrum showed phosphorus atomic% of 43.72 and calcium atomic% of 56.28 and ca / p ratio of 1.28, which is less than stoichiometric value of hydroxyapatite (1.67). This ratio indicates the synthesis of octacalcium phosphate of chemical composition ca8 (hpo4) 2(po4)45h2o [figures 4-ii and 5]. While the sem of the alkali - heat - treated group exhibited layer composed of an interconnected spherical particle, this layer is to some extent thicker, and the particles are larger in size . The edxa spectrum showed phosphorus atomic% of 37.96 and calcium atomic% of 62.04 and ca / p ratio of 1.67 . This ratio suggests the formation of calcium deficient hydroxyapatite or occasionally named precipitated ha of chemical formula caxhy (po4)z.nh2o [figures 4-ii and 5]. The ftir analysis of control group, group a, is shown in figure 6 . The spectrum revealed that the presence of vibration band at 606 cm is for symmetric stretching vibration of po4 (4). The bands at 865 and 985 cm are bands for symmetric stretching vibration of po4 (1) while band at 1019 cm for asymmetric stretching vibrations of po4 (3). The symmetric stretching vibrations of po4 (3) are represented by bands at 1058 and 1090 cm while the band at 1075 cm is absent . The symmetric stretching vibration bands of hpo4 group are observed at 1113, 1141 and 1226 cm . The symmetric stretching vibration bands of co3 are captured at 873, 1414, and 1453 cm . The reflectance bands characteristic for h2o were observed at 625, 3083, 3249, 3333, and 3546 cm which denoting oh group of ha . The carbonyl group c = o is identified from bands at 1698 and 1712 cm . Fourier transformation infra - red spectroscopy spectra of investigated groups a, b, and c after immersion in hank's solution the ftir analysis of anodized samples, group b, is shown in figure 6 . The spectrum revealed that the presence of vibration bands at 563 and at 604 cm is for symmetric stretching vibrations of po4 (4). The bands at 862 and 965 cm are bands for symmetric stretching vibration of po4 (1) while band at 1020 cm is for asymmetric stretching vibrations of po4 (3). The symmetric stretching vibrations of po4 (3) are represented by band 1076 cm while the band at 1047 and at 1096 is absent . The symmetric stretching vibration bands of hpo4 group are observed at 1114, 1143, and 1222 cm . The symmetric stretching vibration bands of co3 are captured at 875, 1416, and 1455 cm . The reflectance bands characteristic for h2o a broad and not very intense band in hap at 3230 cm may be due to the presence of lattice water in the solid or it caused by the h - bonding between the adsorbed h2o and the oh group of the apatite . The carbonyl group c = o is identified from bands at 1693 and 1760 cm . The ftir analysis of alkali - heat - treated samples, group c, is shown in figure 6 . The spectrum revealed that the presence of vibration bands at 561 and at 602 cm is for symmetric stretching vibration of po4 (4) while bands at 871, 960, and 985 cm are characteristic bands for symmetric stretching vibration of po4 (1) while band at 1019 cm is characteristic for asymmetric stretching vibrations of po4 (3). The symmetric stretching vibrations of po4 (3) are represented by band 1093 cm while the band at 1048 and 1075 cm is absent . The symmetric stretching vibration bands of hpo4 group are observed at 1111 and 1220 cm . The symmetric stretching vibration bands of co3 are captured at 1416 and 1455 cm . The reflectance bands characteristic for h2o were observed at 626, 3001, 3195, and 3550 cm which denoting oh group of ha . The carbonyl group c = o is identified from bands at 1712, 1726 cm . The anodization in h3 po4 produced anatase titanium oxide on the surface with phosphate originated from electrolytes and changed the surface topography . In addition, crystal structures of titanium oxide found on titanium surface after anodization allowed formation of calcium - phosphate in hank's solution with ion concentrations approximating those of human blood plasma . It is reported that in aqueous body fluid, the oh bonds easily to the ti of tio2 and subsequently ti - oh groups is formed . The isoelectric point of titanium oxide surface at electrolyte ph nearly 56 shows zero net charge . A positively charged surface will be created by production of (ti - oh2) in the surface layer at electrolyte ph <5 . The ti - oh will be deprotonated at electrolyte ph> 6, and becomes (ti - oh) so the surface will be a negatively charged . Therefore, the surface will be negatively charged at the physiological ph of ~7.4, due to the existence of deprotonated acidic hydroxides . That negatively charged surface can attract cations such as calcium that subsequently could react with hpo4 or h2 po4 to form calcium phosphates . The titanium cations can react with phosphoric acid to form phosphates as explained in the following reactions: ti + 2h3po4 ti(hpo4)2 + 4h (1) ti + ti(hpo4)2 + h3po4 ti2(po4)2 (hpo4) + 4h (2) in turn, the nucleation of calcium phosphate nanocrystals within nanopores could be facilitated by the presence of these phosphate ions . Ca9 (hpo4) (po4)5oh 3 ca3 (po4)2 + h2o (3) the reaction between the ti sample and naoh alkaline solution will lead to the formation of a layer of amorphous sodium titania on the ti surface . Alkaline treatment for 25 min would provide a titania layer of considerable thickness with mature submicrometer porosity . Further, heat treatment at temperature (600c) for extended time (1 h) resulted in a cracked layer with an increased thickness . The thickness and gradual transformation of the titania layer from an amorphous to a crystalline state depended almost linearly on the period and the temperature of the chemical treatment . This layer can induce apatite deposition in sbf by a mechanism was proposed by cui and kim 2008 . Their elucidation based on the reaction of na ions from sodium titanate layer, with h3o ions forming ti - oh groups on the surface . Those ti - oh groups on the titanium surface are essential for the formation of calcium phosphates . These negatively charged ti - oh groups react with positively charged ca ions from the sbf and form calcium titanate, which acts as nucleation sites for apatite crystal formation . Therefore, the more ti - oh groups, the more would be the ability to induce apatite nucleation . On accumulation of ca ions, the calcium titanate changed to be positively charged and combined with negatively charged phosphate to form calcium phosphates and then transform to apatite . The difference between the surface activities of chemically and electrochemically treated ti-6al-4v is due to the different surface morphology and structure, i.e., increased surface roughness lead to increased bioactivity . Although this research was carefully prepared, i am still aware of its limitations and shortcomings . First of all, the research was concerned only with in vitro and have not any in vivo study . Although this research was carefully prepared, i am still aware of its limitations and shortcomings . First of all, the research was concerned only with in vitro and have not any in vivo study . Electrochemical treatment of anodic oxidation in h3 po4 solution converted titanium oxide to the favorable anatase phase and provided po4 which acted as nuclei for developing ha crystals . Immersion in naoh solution before alkali - heat treatment of titanium alloy supplied sodium ions and titania hydrogel which are beneficial substrate to precipitate calcium and phosphorus in a ratio comparable to that of stoichiometric ha.
|
One of the most outstanding contributions to modern medicine has been the introduction of therapeutic organ transplantation . Despite their spectacular and resolutive nature, these procedures are not free of complications in transplant recipients . Neurological problems in particular, occur with a frequency of 2060%, depending on the organ transplanted . The percentage is higher for heart and bone marrow transplants, and lower in kidney recipients . Neurological complications can be subdivided into those common to all transplants and those specific for a given type of transplant . Headache, in particular, is a non - specific complication with a prevalence that varies between 3.2 and 35.2% according to the studies [2, 3]. Whereas major complications occurring after transplantation have been investigated [46], headaches are infrequently discussed as a clinically significant problem in the transplant literature, since they are generally considered less important than other complications such as encephalopathy, infectious diseases of the central nervous system, blood hypertension, organ rejection, therapy with cyclosporine or fk 506 [1, 710]. However, headaches have an important negative effect on life satisfaction of these patients according to matas et al . . To the best of our knowledge, only one study specifically dealt with headaches, and in particular migraine . Table 1 summarises data published on the incidence of neurological complications and, when reported, of headache and migraine for different transplant types [1829]. Results are quite variable, but it is difficult to compare them owing to the different methods used . In this study we considered the occurrence of different headache types in a group of renal transplanted patients before and during renal failure (rf), during dialysis, after transplantation.table 1occurrence of neurological complications in heart, kidney, liver, lung and heart - lung transplants in some studiesauthor (reference)type of transplantno . Of patientsneurological complicationsheadachemigraineno . 2004 kidney (cy)56nrns2nrkim et al . 2004 kidney (tc)41nrns12nrwhen reported, data regarding headache and migraine are givennr not reported, ns not specified, cy cyclosporine, tc tacrolimus occurrence of neurological complications in heart, kidney, liver, lung and heart - lung transplants in some studies when reported, data regarding headache and migraine are given nr not reported, ns not specified, cy cyclosporine, tc tacrolimus a total of 83 consecutive patients (55 males, 28 females; mean age 41.7 11.8, range 1863) at least 6 months after transplantation were included in the study . All the patients underwent orthotopic renal transplant at the general surgery department of our university . Data on patient age at the time of transplantation and the course of the illness are summarised in tables 2 and 3 . The most frequent diseases underlying rf were glomerulonephritis (53% of patients) and polycystic kidney disease (13%), followed by diabetes mellitus, ureteral malformation and systemic lupus erythematosus . A patient questionnaire was used to collect anamnestic information, with specific regard to pharmacological history and headache characteristics during distinct periods: before rf; during rf; during dialysis treatment; after the transplant . Blood pressure, weight, blood biochemistry parameters and cyclosporine dosage were measured and records of the same parameters from previous visits were obtained . All the patients were on immunosuppressive therapy with cyclosporine and corticosteroid; in addition, a large group was being treated with anti - hypertensive therapy.table 2age at transplantation (n = 83)agemalefemale<2001203087314015441501511>50175total5528table 3time elapsed in the different conditions (n = 83)timerenal failuredialysistransplantation16 months200612 months17184313 years18352736 years20207>6 years26106 age at transplantation (n = 83) time elapsed in the different conditions (n = 83) considering that all analysed variables were qualitative, a non parametric analysis was performed with the pearson s and the mcnemar s tests . The pattern of headache in the 83 patients during the various periods of their history is shown in table 4 . In group a (before rf), 27 patients suffered from headache: 17 migraines without aura (mo), eight episodic tension - type headache (etth) and two hypertension - related (hr). In group b (during rf), the 36 patients suffering from headache comprised 20 mo, two etth, 13 hr, one metabolic headache (mh). Of those with mo, 12 patients had suffered before rf and eight were new cases . For the other five mo patients in group the two etth cases had also suffered before rf; of the six remaining etth patients in group a, three developed hr, whereas in three headache ceased . Out of hr group, 11 were new cases and two patients had already suffered before rf . In group c (during dialysis) (table 4c), the 33 headache sufferers comprised seven mo, one etth, three hr, 22 dialysis headache (dh). All the group c mo patients had been in the same category in group b; of the remaining 13 group b mo patients, mo ceased in eight and five developed dh . The group c etth patient had been in the same category in group b. of the 22 dh patients 13 were new cases and nine had been categorised in group b (five mo, three hr and one etth). In group d (after transplantation), 37 patients suffered of headache: 15 mo, 10 etth, two etth + mo, two hr, four not classifiable (nc), two cyclosporine related (cy), one okt3 related headache (okt3), one primary stabbing headache (psh). Twenty three of whom were new cases (six mo, seven etth, two etth + mo, four nc, two cy, one okt3, one psh). Conversely, 26 patients suffering from headache (10 mo) before transplant were free of attacks at 612 months follow up.table 4occurrence of headache during the different periods of the history of the patients (n = 83)type of headacheabcdn%n%n%n%mo1720.52024.078.41518.0etth89.622.411.21012.0mo + etth00000022.4dh00002226.500nc00000044.8hr22.41315.733.622.4mh0011.20000psh00000011.2cy00000022.4okt3000011.2total2732.53643.33339.73744.5n number of patients, a before renal failure, b during renal failure, c during dialysis, d after transplant, mo migraine without aura, etth episodic tension - type headache, dh dialysis headache, nc not classifiable headache, hr hypertension related, mh metabolic headache, psh primary stabbing headache, cy cyclosporine related headache, okt3 okt3 related headache occurrence of headache during the different periods of the history of the patients (n = 83) n number of patients, a before renal failure, b during renal failure, c during dialysis, d after transplant, mo migraine without aura, etth episodic tension - type headache, dh dialysis headache, nc not classifiable headache, hr hypertension related, mh metabolic headache, psh primary stabbing headache, cy cyclosporine related headache, okt3 okt3 related headache in order to evaluate a possible significance of the different headache occurrence before and after transplant, we subdivided the headache patients into two groups, considering in the first only migraine patients and in the second all the other kind of headaches . In the first group, 17 (20%) patients suffered of mo before the transplant, 15 (18%) mo post transplant, without statistical significance (mcnemar s p = 0.79). In the second group, 10 (12%) patients presented headache before transplant, 22 (26.5%) after, with statistical significance (mcnemar s p = 0.004). All patients received immunosuppressive therapy of both cyclosporine and prednisone at dosages depending on the time elapsed since transplantation and clinical condition . To investigate a possible correlation between the headache and levels of cyclosporine and/or creatinine, we examined the post transplant follow - up results at 7 days and 13612 months for patients who had cyclosporine and creatinine levels above the normal range . There were no significant differences for both between patients with and without headache (pearson s p = 0.43 for cyclosporine and p = 0.73 for creatinine). We were able to establish a definite relationship with cyclosporine administration only in two cases in which the lowering the high cyclosporine level within the normal range, was followed by headache disappearance . Furthermore, 64 patients received azotioprine, 73 antihypertensive therapy; among the latter, 25 were treated with the beta - blockers, 18 with metoprolol, seven with atenolol . Table 5 summarises the data on the occurrence of mo in transplant patients with and without beta - blocker treatment . Comparison of the data reveals that administration of these anti - hypertensive agents, which are known to protect against migraine, did not influence mo development . Indeed, the onset or disappearance of mo showed no relation with doses nor with the type of beta - blocker used (metoprolol 50200 mg, atenolol 50100 mg). Tables 6 and 7 list the patient characteristics and the pattern of migraine attacks for subjects who developed mo after transplantation.table 5mo patients treated and not treated with beta - blockers in the different conditionsmotiming in the assumption of beta blockersbefore and after transplantintroduced after transplantnever treatedbefore and after transplant134after transplant134disappeared after transplant046table 6patients who developed mo after transplantnagesexrf etiologyrf lengthdialysistime elapsed after transplantsymptomsnetherapy148fpd822 t, anc, fur238fnk13118 mt, a, mfnc, dox, fur, metop, clon320fgn3 m23tnc, fur433mgn1 m17nall, c, ena, nifed, metop527fgn931tnat, c647mgn213tnc, clon, fur, simv730frm53 years 6 months2tnc822mpd26 months7nall, c, clonidine, fur, metoprgn glomerulonephritis, r renal failure, m months, rm renal malformation, nk not known, pn pyelonephritis, pd polycystic kidney disease, a asthenia, n normal, t tremor, mf mnesic failure, ne neurologic examination, all allopurinol, at atenolol, c cyclosporine, clon clonidine, dox doxazosin, ena enalapril, fur furosemide, metop metoprolol, nifed nifedipine, simv simvastatin; times in years when non specifiedtable 7attack features, treatments and associated headache in the patients with mo developed after transplantnf h1st attack ptfrequency of the attacksintensitytreatmentother headache1a2 daysevery 3 monthsseverensads2a3 monthsevery 15 daysmoderate - severensadsetth3p5 months23 at monthsseverensads4a2 monthsevery 56 monthsmoderate - severerestetth5p1 monthsmonthlysevererest6p67 monthsmonthlyseverensads7p34 monthsweeklymild - moderaterest8a1 yearweeklyseverensads fh family history for migraine, a absent, p present, pt post transplant, nsads not - steroidal anti - inflammatory drugs, etth episodic tension - type headache mo patients treated and not treated with beta - blockers in the different conditions patients who developed mo after transplant gn glomerulonephritis, r renal failure, m months, rm renal malformation, nk not known, pn pyelonephritis, pd polycystic kidney disease, a asthenia, n normal, t tremor, mf mnesic failure, ne neurologic examination, all allopurinol, at atenolol, c cyclosporine, clon clonidine, dox doxazosin, ena enalapril, fur furosemide, metop metoprolol, nifed nifedipine, simv simvastatin; times in years when non specified attack features, treatments and associated headache in the patients with mo developed after transplant fh family history for migraine, a absent, p present, pt post transplant, nsads not - steroidal anti - inflammatory drugs, etth episodic tension - type headache finally, the group of patients suffering from mo that persisted after transplantation (n = 10) showed no relevant change in the pattern of attacks in either frequency or intensity . The results show that headache is a diffuse problem in the transplant patients, affecting 44.5% of the study subjects and requiring specific treatment or diagnostic procedure in 8% . Comparing with the literature, the percentage of patients with headache is higher, respect to both liver and kidney transplant patients 31% and to liver transplant patients 735% [3, 23]. We found no reports on the prevalence of migraine after isolated kidney transplantation . In the only paper available on kidney transplant, headache affects only 3% of patients but this result is not comparable with ours, since this study considers only the acute complications occurring in the first 3 days after the surgical procedure . 1994 reported migraine in 18% of liver transplanted patients, in agreement with the results found here . According with ihs diagnostic criteria of headache induced by substance use or exposure (30), cyclosporine seems not to be a relevant factor in the development of headache and specifically of migraine; in the only two cases with a definite relationship, the headache was described as continuous, tightening, bilateral in location, and without neurovegetative symptoms, which disappeared on a decrease in cyclosporine dosage . However, we cannot exclude a role of cyclosporine in the genesis of headache not directly related to its high level; since in particular some patients may be predisposed to develop headache . About this point, if we consider that after transplant four patients presented no classifiable headache, condition not present before rf, during rf or during dh periods and situation de novo in four patients, seem possible that this therapy could somehow favour the development of headache, perhaps related to its vasoactive properties; however, the exact mechanisms by which the immunosuppressive drugs could induce or exacerbate headache are unknown . Six of the eight cases who developed mo after transplantation had a low frequency of attacks, which does not seem to be related to the use of a drug taken continuously . In none of these cases, the symptomatology was considered so important as to require modification of cyclosporine use . In two cases, the age on presentation of migraine was relatively advanced (46 and 47 years) and the first attack occurred within 1 month after transplant, casting doubt on a causative mechanism different from simply casualness . None of the patients reported migraine with aura (ma), a finding that differs from that of steiger et al ., who reported that 5/34 liver transplant patients developed ma after surgery; among different hypothesis, this could possibly be related to the different transplant organ . During dialysis, the number of patients with headache attributable to this procedure, without correlation with pre - existing headache or migraine, was remarkable . On the other hand, we observed a decrease in the number of mo patients during dialysis . Furthermore, no new mo cases occurred during this period, which was long enough (dialysis duration at least 1 year in 70% of patients and at least 6 months in> 98%) to exclude bias due to too short an observation period . We can hypothesise possible mechanisms related to the procedure of dialysis or to biochemical plasma changes in calcitonin gene - related peptide and substance p as recently demonstrated . An important point is the antihypertensive therapy taken by patients, in particular beta - blockers, which represent an important prophylactic treatment . There are no differences for beta - blocker treatment in the distribution of patients who developed mo after transplantation, those with pre - existing mo, or those for whom mo disappeared after transplant . In the three groups of patients with mo, the distribution of the cases with mo developed after transplant, with pre - existing mo or indeed in which disappeared is the same . The new cases with mo in therapy with beta - blockers are four, in three the introduction of the drug was after transplant in one was pre - existing the transplant . Of the 10 patients in whom mo disappeared, beta - blocker treatment was started after transplantation in four and the remaining six patients were not treated . In conclusion, the treatment with beta - blockers may be a cause that produces some difficulties in the interpretation of the data, but the detailed analysis of the results seems to indicate that the distribution of the patients regarding the appearance or disappearance of mo in the various groups of patients is random . After kidney transplant, we did not find an increase of mo cases, but a significant increase in the number of non specific headache such as non classifiable or etth . Further studies on the occurrence of neurological complications in transplanted patients should take in account also the development of headache specifically of migraine . Besides clarifying the extent of this problem, such investigations could give clues on its causative mechanisms, particularly with regard to immunosuppressive therapy.
|
In the current era of better survivals of low and very low birth weight babies and a widespread use of higher antibiotics, the incidence of fungal infection is commonly seen in high volume nicus - particularly those that accept out - born babies from distant places . Even though a vast majority of them subside with the regular anti - fungal agents, some of them require higher anti - fungal agents . We report a rare instance which warranted a surgical intervention for a fungal ball in the kidney . A 34-week preterm male baby delivered by vaginal delivery, weighing 1.45 kg, was admitted to neonatal intensive care unit (nicu) for ventilatory assistance in view of prematurity related apneic episodes . During the course of its management, the child was detected to have bacterial sepsis and antibiotics were changed as per culture sensitivity reports . The baby also received parenteral nutrition through a central line in view of prolonged ileus secondary to sepsis . Blood urea and serum creatinine had also risen to 86 mg and 1.1 mg, respectively, perhaps due to fungal sepsis . Ultrasound of the abdomen revealed a 3.3-mm hyper echoic lesion in the left renal pelvis with mild hydronephrosis, suggestive of a fungal ball . The neonate was put on liposomal amphotericin b for 2 weeks as per standard protocol . But, candiduria continued with systemic sepsis and the size of the fungal ball remained the same, necessitating start of the next generation antifungal agent, voriconozole . No response was noted clinically and sonologically after 2 more weeks of treatment, although blood urea and serum creatinine had gradually returned to normal limits . The neonatologists were concerned about the continuing sepsis and persistent candiduria and the persistence of the fungal ball in the left kidney, with no response to the parenteral antifungal for over a month . Three options were considered, as follows: per - cutaneous nephrostomy insertion with irrigation of the pelviscystoscopic insertion of a double j stentopen surgical approach per - cutaneous nephrostomy insertion with irrigation of the pelvis cystoscopic insertion of a double j stent open surgical approach the first two options were considered not feasible in this preterm baby because of the small renal pelvis and there was also technical difficulty involved in stenting the 1.5-kg infant . A soft friable mass measuring 3 mm in diameter was noted in the pelvis [figure 1], extending to the upper calyx, which was retrieved . The pelvis was thoroughly irrigated to clear any debris . The nephrostomy tube accidentally expelled on the second postoperative day and hence the pelvic irrigations could not be done . Although the initial postoperative ultrasound showed a tiny echogenic material in the upper calyx of left kidney, it cleared on the subsequent sonograms done after 2 weeks . The blood culture was sterile, the urine cleared of candida, and the baby was discharged on oral voriconozole for another 2 weeks . Invasive candidiasis is increasingly becoming a serious cause of late - onset sepsis in neonates and has a high mortality rate (25 to 35%) if not promptly and aggressively treated . Invasive fungal infection involving the urinary tract, eyes, meninges, spleen, liver, and joints is well known . About 35 to 42% of neonates hospitalized at nicu with candiduria have renal candidiasis, and a few of them are indeed fungal balls . Candida species are the 3 most common organism (after coagulase - negative staphylococcus aureus) isolated in late - onset sepsis in very low birth weight (vlbw) infants (<1500 g). Various factors contributing to the development of fungal sepsis include the immune - compromised state, low birth weight, use of broad spectrum antibiotics, central venous catheters, prolonged urinary catheterization, and parenteral alimentation . Although urinary candidiasis is fairly common in the current day nicus, invasive renal candidiasis leading to fungal ball is uncommon . Fungal balls in the urinary tract may cause long - lasting urinary obstruction and renal failure if adequate appropriate antifungal therapy is not promptly instituted . The diagnosis of fungal sepsis in high - risk neonates is difficult and is often delayed or missed as there are no specific clinical features . Sustained decline in the platelet count of 10% per day or more in a neonate on broad - spectrum antibiotics for suspected sepsis may be indicative of fungemia . It can be used to assess the dimensions of the lesion and, more importantly, the response to antifungal therapy . In the presence of candidemia and the absence of hematuria or pyuria, the calyces and the non - shadowing echo - dense material in the renal pelvis suggest renal candidiasis even without hydronephrosis . However, it is operator dependent and a high index of suspicion is required during sonography for the correct diagnosis . The response to these antifungal agents is usually good . In cases with incomplete obstruction, treatment with a combination of liposomal amphotericin b and fluconazole percutaneous streptokinase injection to renal pelvis through catheters has also been tried in conjunction with parenteral antifungal agents to lyse urinary fungus balls that are resistant to medical treatment and percutaneous drainage or irrigation . In fungal balls causing urinary obstruction and not responding to antifungals, surgical treatment in the form of percutaneous nephrostomy insertion with antifungal irrigation of the pelvis may be required . However, if the renal pelvis is not adequately dilated, per cutaneous nephrostomy would be difficult . In such situations, surgical removal of the fungal ball through a pyelotomy incision may be required . Intraoperative use of flexible renoscope and ultrasound, if available, may help in precise localization and in ensuring complete clearance of the lesion . No guidelines are yet available for the indication, the mode of treatment, and duration of treatment in neonates and infants with obstructing fungal balls . Our case did not show any response to 2 weeks of liposomal amphotericin and 2 weeks of voriconozole . With persistent sepsis, candiduria, and persistient fungal ball in the kidney, surgical option was best in view of the size of the child, and we obtained good results . This paper highlights the necessity for a prompt diagnosis and aggressive treatment of renal invasive candidiasis . Renal candidiasis with fungal balls is a rare but important cause of morbidity and mortality in low - birth weight neonates . A high degree of suspicion is needed in preterm neonates with persistent fungal sepsis not responding to routine antifungals . Although aggressive medical treatment with higher antifungal medications is effective in most cases, surgical intervention may be needed occasionally . In such cases,
|
The structure and property relationship (spr) in polymer nanocarriers are normally hard to be defined clearly, due to the polydispersity of polymer and the limited capability for the site - specific functionalization . In contrast, the biomacromolecule systems, e.g. Peptide, protein, and the oligonucleotides have a precise structure (sequence)property relationship in regulating the activities of the biologics . It is clear that the well - defined structures of materials are essential for the quantitative analysis of the spr in functional materials and allow for the application of the theoretical and computational approaches to rationally design and predict the properties of the nanocarriers . These approaches would significantly accelerate the development of the efficient nanocarriers for drug delivery, compared with the empirical approaches in nanocarrier development . Anticancer drugs encapsulated in nanoparticles, e.g. Liposomes, polymer micelles, and polymer nanoparticles, are normally administered via intravenous injections that require the nanocarriers to be hemocompatible and have stealth property in order to avoid fast clearance by the reticuloendothelial system (res). The formation of the nanocarriers is mostly driven by the hydrophobic aggregation or ionic interactions of the amphiphilic materials, which have a tendency to interact with cell membranes via hydrophobic or charge interactions . Such plasma membrane lytic activity may raise safety issues for in vivo applications of nanocarriers . Synthetic amphiphilic polymers have been synthesized to form micelle nanocarriers for drug delivery . To elucidate the spr in membrane activity is crucial in optimizing the nanocarrier for safe and efficient in vivo drug delivery . We have developed a biohybrid system, i.e. Poly(ethylene glycol) (peg)-b - dendritic oligocholic acid (ca) (named as telodendrimer) via peptide chemistry . It has a well - defined structure with the capability of the precise structural design and functionalization . Telodendrimers self - assemble into stable micelles for efficient paclitaxel (ptx) encapsulation and a few other anticancer drugs (see citations in supporting information [si]). While the paclitaxel - loaded micelles formed by such telodendrimers exhibited a safe profile in in vivo administration for anticancer treatment in mouse models and companion dogs, the empty telodendrimer micelles showed moderate hemolytic properties at relative high concentrations (1 mg / ml) in vitro . The former can be explained by enhanced hydrophobic interactions within the nanotherapeutics by loading highly hydrophobic ptx . However, the loading of some other drug molecules may not be able to stabilize the micelle and may result in hemolysis when given intravenously . The cross - linking approaches are able to stabilize micelles and reduce hemolytic properties . However, the additional reagents and treatments for micelle cross - linking usually require extensive purification before in vivo administration, which may lead to the loss of drug molecules and will be a significant burden for clinical application in terms of quality control and regulations . Therefore, there is a need to study the structure and hemolytic activity relationship of nanocarrier to eliminate the hemolytic potential, which could be studied via a series of structural modifications and the property characterization . Cholic acid, the key building block in telodendrimers, is known to have strong membrane activity as a small - molecule surfactant . The stacking between the hydrophilic surfaces of cholic acid units via hydrogen bonding is essential to shelter the polar groups allowing for the insertion of a whole complex into the hydrophobic phospholipids bilayer membrane . We hypothesize that introducing bulky hydrophilic groups onto hydroxyl groups of ca may disrupt the compact interactions between the polar surfaces of cas and increase the polar surface area (psa) of the whole complex, therefore reducing the membrane activity of telodendrimers . In order to modify the telodendrimer with a well - defined structure, we chose the bottom - up approach to modify cholic acid before being conjugated onto the telodendrimer . Glycerol or amino glycerol groups are introduced onto the cholic acid via ether bond formation with hydroxyl groups at the 3- and 7- or 12-positions . The core - forming subunits of the telodendrimers have been studied via molecular dynamics to study the conformations and the corresponding polar surface area (psa) to predict the membrane activities of the nanocarriers . Further, the telodendrimer subunits with different glycerol substitution were synthesized directly and the membrane activities were tested to validate the theoretical predictions . The anticancer drugs, paclitaxel (ptx) and doxorubicin (dox), were successfully loaded into the modified telodendrimer micelles . The drug loading capacity, stability, tumor targeting, and anticancer effects were systemically studied in vitro and in vivo . Monomethylterminated poly(ethylene glycol) monoamine hydrochloride(meo - peg - nh2hcl, mw: 5000 da) was purchased from jenkem technology (dallas, tx). Paclitaxel (ptx) was purchased from ak scientific (union city, ca). Nirf dye did (1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine perchlorate, d-307), was purchased from invitrogen . Tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium, mts] and phenazine methosulfate (pms) were purchased from promega (madison, wi). Cholic acid (ca), epichlorohydrin, diisopropyl carbodimide (dic), n - hydroxybenzotriazole (hobt), and all other chemicals were purchased from sigma - aldrich (st . Louis, mo). Molecular dynamics simulations were carried out using the freely distributed gromacs 4.5.5 software package.h nmr spectra of the small molecules and polymers were recorded using bruker avance 600 mhz spectrometer in cdcl3 or dmso - d6 . Particle sizes of micelle were measured using a dynamic lighter scattering (dls) particle sizer (zetatrac, microtrac inc .) And the area - based mean particle sizes were presented . The tem images of micelles were recorded on a transmission electron microscope (jeol jem-2100) and samples were stained with uranyl aceate . Vis nanodrop spectrometer and a simadzu hplc (lc20at) equipped with a c18 column and 55% mecn as mobile phase were used for detection of drug loading efficiency and drug release studies . Fortessa (becton dickinson, san jose, ca) flow cytometer was used for cell uptake study, and ivis-200 small animal imager was used for in vivo tumor imaging . The nomenclature of the telodendrimers and the dimer molecules followed the system used in the previous studies: for example, telodendrimer pegca8 indicates that the molecular weight of peg is 5 kda and there are eight cholic acids conjugated on the periphery of dendritic polylysine . The additional functional groups on ca were described as ca-4oh, ca-5oh, ca-3oh - nh2, representing one glycerol, two glycerols and one animoglycerol introduced onto cholic acid, respectively . The corresponding telodendrimers were named as peg(ca-4oh)8, peg(ca-5oh)8, peg(ca-3oh - nh2)8, the dimer molecules were synthesized from ca and ca derivatives via a lysine (k in abbreviation) bridge and named as kca2, k(ca-4oh)2, k(ca-5oh)2 . The preparations of cholic acid derivatives and the dimer molecules are described in si . As reported in our previous procedure, telodendrimers have been prepared from meopeg - nh2 with 5000 da molecular weight via stepwise solution phase fmoc - peptide chemistry . Briefly, fmoc peptide chemistry was used to couple (fmoc)lys(fmoc)-oh onto the n - terminal of peg (mw = 5 or 10 kda) using diisopropyl carbodimide (dic, 3 equiv) and n - hydroxybenzotriazole (hobt, 3 equiv) as coupling reagents in dmf overnight . Upon confirmation of negative results from the kaiser test for the reaction, chilled ether was added to the reaction solution to precipitate out the polymer, which was further washed twice with chilled ether . Fmoc protecting groups were removed by treatment with 20% piperidine in dmf for 30 min, and polymer was precipitated and washed with cold ether . After three steps of repeated coupling of (fmoc)lysine(fmoc)-oh and de - fmoc reactions, a dendritic polylysine was synthesized at one end of peg . Then, the active nhs esters of ca derivatives (shown in si) reacted with the free amino groups at the periphery of polylysine in the presence of triethylamine . The dry polymer product was dissolved in water and purified via dialysis (mwco: 3500 da) against pure water . Ptx was loaded into telodendrimer micelles via a dry - down (evaporation) method as described previously . Briefly, 20 mg of telodendrimer along with 4 mg of paclitaxel were first dissolved in chcl3 and evaporated on rotavapor to obtain a homogeneous dry polymer film . The film was reconstituted in 1 ml phosphate - buffered solution (pbs), followed by sonication for 30 min to allow micelle dispersion . No precipitation was observed with the monodispersed particle size from 15 to 30 nm during dls measurement, which indicated the complete drug loading . To track the biodistribution of nanoparticles, hydrophobic nirf dye did was coencapsulated with ptx into the micelles using the same method as described above . The particle sizes of the micelle solution were measured via a dls particle sizer . Finally, the micelle formulation was filtered with a 0.22 m filter to sterilize the sample . The encapsulation of dox into the polymeric micelles was carried out by following the procedure described previously . Briefly, 1 mg of dox - hcl was stirred with 3 mol equiv of triethylamine (tea) in chloroform (chcl3)/methanol (meoh) (1:1, v / v) overnight to neutralize hcl in dox - hcl . Ten mg of peg - ca8 or peg-(ca-4oh)8 telodendrimer was added into above dox solution in chloroform / methanol and mixed, evaporated on rotavapor to obtain a homogeneous dry polymer film, and further dried under high vacuum to further remove tea and solvents . The film was reconstituted in 1 ml phosphate - buffered solution (pbs), followed by sonication for 30 min, allowing the sample film to disperse into micelle solution . The particle sizes of the micelle solution were measured via a dls particle sizer . Finally, the micelle formulation was filtered with a 0.22 m filter to sterilize the sample . Two ml of blood was added into 10 ml of pbs, and then red blood cells (rbcs) were separated from plasma by centrifugation at 1000 g for 10 min . The rbcs were washed three times with 10 ml of pbs solution, and resuspended in 20 ml pbs . Two hundred l of diluted rbc suspension was mixed with polymers at serial concentrations (10, 100, 500, and 1000 ug / ml) by gentle vortex and incubated at 37 c . After 0.5 h, 4 h, and overnight, the mixtures were centrifuged at 1000 g for 5 min . The supernatant free of hemoglobin was measured by the absorbance at 540 nm using a uv vis spectrometer . Rbcs incubation with triton-100 (2%) and pbs were used as the positive and negative controls, respectively . The percent hemolysis of rbcs was calculated using the following formula: ptx loaded nanoformulations (500 ul) were placed in the dialysis bags with the mwco of 3.5 kda and dialyzed against 4 five ul of drug solutions were sampled at the designed time intervals and pbs solution were refreshed at each measurement . The ptx concentrations were analyzed via hplc (simadzu lc20 t) equipped with a c-18 column, and mobile phase was 55% mecn / water . The releases of dox from the nanoformulations were also studied using the samiliar dialysis method . However, the dox concentration was monitored at 480 nm using uv vis absorbance (nanodrop). The quantitative cellular uptake of various dox formulations by raji tumor cells was analyzed by flow cytometry . Briefly, 3 10 raji cells were incubated with free dox, dox - peg - ca8, or dox - peg - ca4 at different dox concentrations (1, 3, and 9 m) for 30 min or 2 h at 37 c, respectively . Then, the cells were washed with pbs three times and resuspended in pbs for the flow cytometry analysis using the fortessa (becton dickinson, san jose, ca). Cell - associated dox was excited with an argon laser (488 nm), and fluorescence was detected at 560 nm; 10,000 events were collected for each sample . Ovarian cancer cell line skov-3, colon cancer cell line ht-29, breast cancer cell line mda - mb-231 and lymphoma raji cell line were purchased from american type culture collection (atcc; manassas, va, u.s.a . ). Ovarian cancer cell line skov-3, colon cancer cell line ht-29, and lymphoma raji cell line were purchased from american type culture collection (atcc; manassas, va, u.s.a . ). All these cells were cultured in mccoy s 5a ovarian cancer cell line skov-3, colon cancer cell line ht-29, breast cancer cell line mda - mb-231 and lymphoma raji cell line were purchased from american type culture collection (atcc; manassas, va, u.s.a . ). Skov-3 and ht-29 cells were cultured in mccov s 5a medium and mda - mb-231 and raji cells were cultured with rpmi 1640 medium supplemented with 10% fetal bovine serum (fbs), 100 u / ml penicillin g, and 100 g / ml streptomycin at 37 c using a humidified 5% co2 incubator . Skov-3 cells were seeded in 96-well plates at a density of 10,000 cells / well 24 h prior to the treatment . Empty micelles and various formulations of ptx with different dilutions were added to the plate and then incubated in a humidified 37 c, 5% co2 incubator . After 72 h incubation, celltiter 96 aqueous cell proliferation reagent, which is composed of mts and an electron coupling reagent pms was added to each well according to the manufacturer s instructions . The cell viability was determined by measuring the absorbance at 490 nm using a microplate reader (biotek synergy 2 microplate reader). Results are shown as the average cell viability [(odtreat odblank)/(odcontrol odblank) 100%] of triplicate wells . Female athymic nude mice (nu / nu strain), 68 weeks age, were purchased from harlan . All animals were kept under pathogen - free conditions according to aaalac (association for assessment and accreditation of laboratory animal care) guidelines and were allowed to acclimatize for at least 4 days prior to any experiments . All animal experiments were performed in compliance with institutional guidelines and according to protocol approved by the committee for the humane use of animals of the state university of new york upstate medical university . A subcutaneous colon cancer xenograft mouse model was established by injecting 1 10 ht-29 or mda - mb-231 cancer cells in a 100 l of mixture of pbs and matrigel (1:1 v / v) subcutaneously at the right flank in female nude mice . Nude mice with subcutaneous tumors of an approximate 810 mm in diameter were subjected to in vivo nirf optical imaging . At different time points postinjection of did- and ptx - coloaded micelles formed by telodendrimer ii (the mass ratio of did and ptx within nanocarrier was 0.25:1:10), mice were scanned using a ivis-200 small animal imager at cy5.5 excitation and emission channels . The mice were anaesthetized by isofluorane gas before and during each imaging . After in vivo imaging, animals were euthanized by co2 overdose at 48 or 72 h after injection . Tumors and major organs were excised and imaged with the ivis-200 small animal imager . Advanced molecular dynamics simulations were performed to identify the most stable structures of ca dimers in polar (water) and nonpolar (decane) solvents . The initial structures of ca dimers were generated in the chembio 3d ultra 13.0.0.3015 software followed by molecular dynamics simulations in gromacs molecular dynamics package 4.5 . Gromos96 45a3 force field was used to model ca dimers and decane, while water was modeled using the spc / e potential . Each of the dimers was subjected to energy minimization in vacuum using the steepest decent algorithm; however, to explore the potential energy landscape and to identify a global minimum energy geometry, simulated annealing (sa) method was employed . For each of the ca dimers, a set of 1000 independent annealing simulations were performed from randomly selected starting structures generated by a canonical nvt ensemble simulation run at t = 1000 k. the annealing was then performed by gradually reducing the temperature from 1000 to 5 k over 1 ns . Each of the 1000 independent annealing profiles were analyzed to identify the one that led to the most stable structure . The minimum energy structure was then solvated in water and decane and equilibrated using isothermal isobaric npt ensemble at t = 300 k. the production molecular dynamics runs were performed at 300 k for 100 ns to calculate the average psa and representative equilibrium structure geometries . Cholic acid, the key building block in telodendrimers, is known to have strong membrane activity as a small - molecule surfactant . The membrane activity of the telodendrimer micelles is believed due to the facial amphiphilic structure of ca subunit, which self - assembles through hydrogen bonding with the hydrophobic surfaces exposed to the lipid bilayer . It has been reported that the oligomer of cholic acid (so - called molecular umbrella) can effectively deliver hydrophilic biomacromolecules through the phospholipid bilayer membrane . Also, the insertion of the assembled dimers or tetramers of ca into the phospholipid s bilayer membrane have been reported to form artificial ion channels, where hydrophilic hydroxyl groups are sheltered from the hydrophobic lipids . Therefore, the disruption of the packing between the hydrophilic surfaces of oligo - cholic acid is expected to reduce the plasma membrane lytic activity of these types of molecules and the peg - block - oligoca telodendrimers . In this study, glycerol and amino - glycerol have been introduced into the 3- and 7-oh or 12-oh groups of ca via ether bond formation to increase the steric hindrance while maintaining the facial amphiphilicity of ca (scheme 1). Reagents and conditions: (i) tfaa, anhydrous thf, 05 c, 1.5 h; (ii) t - buoh, below 5 c, then at rt for 7 h; (iii) nh3h2o (2030%), 05 c for 12 h, then rt for 4 h; (iv) epichlorohydrin, 50% naoh, (n - bu)4noh30 h2o, ch2cl2, rt, 16 h; (v) nh3 in meoh (7 m), licl (1.2 equiv) in a sealed container, rt, 24 h; (vi) fmoc - osu (1.2 equiv), diea (1.5 equiv), ch2cl2, 12 h; (vii) 50% tfa in ch2cl2, 0 c, 30 min; (iii) lioh water solution (10 equiv), rt, 1836 h; (ix) hosu (1.2 equiv), dcc (1.2 equiv), ch2cl2, rt, 12 h. first, the carboxylic acid of ca was protected via an acid labile tert - butyl ester via an intermediate of the hybrid anhydride with trifluoroacetic acid (tfa). A white powder of ca tert - butyl ester 1 was obtained with a yield over 97% . Next, epichlorohydrin was conjugated onto hydroxyl groups of ca in the presence of aqueous sodium hydroxide . Through flash column, the monosubstituted 2 and diepoxy substituted compound 3 it should be mentioned that the diepoxy - substituted compound 3 may be a mixture of the compounds of 3,5-disubstituted and 3,7-disubstituted species due to the similar reactivity of 5-oh and 7-oh groups . It was evidenced via the partial decrease of the proton signals on both 5 and 7 carbons (3.82 and 3.93 ppm), which corresponds to the c h with the unsubstituted hydroxyl groups (figure s1 in si). In addition, two new peaks appeared at 3.3 and 3.4 ppm, indicating the graft of glycerol onto both 5 and 7 carbons via ether groups . In this study, we did not attempt to separate these two isomers, since they may have very similar physical properties in telodendrimers . The tert - butyl ester of mono- and diepoxy - substituted compounds 2 and 3 were cleaved via a treatment with 50% of tfa in dcm at 0 c . In the next step, the epoxy groups were opened via the treatment with lithium hydroxide solution to yield diol derivatives 4 and 5 at yields of 84.4% and 36.5%, respectively . In addition, monoepoxy - derived compound 2 was treated with an nh3 solution in methanol in the presence of licl as a catalyst to introduce amino groups on the polar surface of ca (compound 6). Furthermore, free amine in compound 6 was protected via fmoc - osu, then tert - butyl ester in compound 7 was removed via the treatment of 50% tfa in dcm to yield fmoc - protected amino cholic acid 8 with an 88.4% yield after flash column purification . All the ca derivatives with free carboxylic acids 4, 5, and 8 were activated via coupling with hosu using dcc as a condensation reagent to yield active esters 9, 10, and 11, respectively, for telodendrimer conjugation . All the nmr spectra (figure s1 in si) and mass spectra (figure s2 in si) indicated the correct chemical structures of these intermediates of ca derivatives . Following our previous procedure, we further synthesized the telodendrimers i, ii, iii, and iv (scheme 2) via liquid peptide chemistry using ca and ca derivatives as building blocks to cap the periphery of dendritic polylysine . The proton signal of 3-oh on ca disappeared in telodendrimers ii and iv, and new hydroxyl groups on glycerol and amino - glycerol appeared in telodendrimers ii and iv, indicating the expected 3-position glycerol substitution . Five hydroxyl groups on diglycerol - substituted compound 5 were observed in the proton nmr spectrum (figure s1 in si), which was also shown in the nmr spectrum of telodendrimer iii . The complete disappearance of the 3-hydroxyl group and the partially decreased proton signals of both 7- and 12- hydroxyl groups on ca in telodendrimer iii were observed in the nmr spectrum (figure 1). In addition, the substitution on 12-oh caused the proton signal of c-18 methyl groups shifted partially toward the low field from 0.57 to 0.60 ppm . Similar phenomena have been reported in the literature . The above nmr results indicated that ca-5oh derivative may have two different isomers, e.g. 3,7- and 3,12-disubstitutions . The number of cholic acid and its derivatives coupled onto the telodendrimer were calculated to be 7.47.6 (theoretical number of 8) via the integration of peg proton signal and 18-methyl group on cholic acid . As expected, the engineered telodendrimer ii peg(ca-4oh)8 micelles exhibited negligible hemolytic properties compared with typical telodendrimer i pegca8 (figure 2) after incubation with red blood cells for both 4 and 20 h at 37 c . After being loaded with ptx, peg(ca-4oh)8 micelles were observed to be nonhemolytic up to 1 mg / ml after 20 h incubation . However, 100% and 50% hemolysis were caused by the original telodendrimer i pegca8 before and after ptx loading, respectively, at the same 1 mg / ml concentration . Telodendrimer iv with amino - derived cholic acid as building block shows almost 100% hemolysis even at a concentration as low as 0.1 mg / ml for a 4 h incubation period (figure 2). It is due to the positive charges on this telodendrimer iv increasing the interaction with negatively charged cell membrane . Very surprisingly, much more hydrophilic telodendrimer iii with five hydroxyl groups on each cholic acid scaffold also showed significant hemolysis at high concentrations of about 0.5 to 1 mg / ml after 4 h incubation, which was even higher than the parent telodendrimer pegca8 (figure 2). It has been reported that the bulky hydrophilic block in an amphiphilic polymer may disturb the liquid crystalline packing of lipid bilayer in addition to the effect brought by the hydrophobic block alone . In particular, block copolymers having branched polyglycerol as hydrophilic blocks show a far more pronounced effect on membrane structure as compared to copolymers with linear peo blocks . However, it is still unclear why the plasma membrane lytic activity of telodendrimers varied with the number of glycerols introduced on ca . Proton nmr spectra of the telodendrimers with ca and ca derivatives as building blocks . Hemolytic properties of telodendrimers with different glycerol modifications and with / without ptx loading after incubation with human red blood cells for 4 h (a) and 20 h (b). The triplicated data are presented as mean sd (*: p <0.05; * *: p <0.005). Although, it is not easy to study the interactions between micelles and plasma membrane directly via molecular simulation at the atom level, we could apply these approaches to study the conformations of the hydrophobic subunits of the telodendrimers, which directly interact with plasma membrane . It is believed that the plasma membrane lytic activity of a polymer micelle solution are caused by a small portion of the free amphiphilic polymers existing in solution rather than the intact micelles which are covered by a layer of inert hydrophilic polymer . Polar surface area (psa) is commonly used to characterize the permeability of a drug molecule . A small molecule with a psa less than 1.40 nm is likely to be able to penetrate through the cell membrane . Therefore, the psa of the polymer subunits can be used to compare their membrane activities . The density of the polar functional groups, i.e. Hydroxyl groups in cholic acid, contributes to the psa of telodendrimers . A dimer of cholic acids bridged via a lysine, kca2, is a subunit of telodendrimer i, which was calculated to have 3.15 nm of psa solely based on the functional group contribution . However, the varying conformation of a molecule may change its topological polarity significantly . Therefore, the stable conformation of the kca2 was studied via simulated annealing molecular dynamics simulations . The psa of the most stable conformations were calculated on the basis of the topology of the molecules . Energy - minimized folded conformations of the ca dimers (in vacuum) with varying glycerol substitutions displayed in two modes and orientations . As shown in figure 3, a hand - in - hand like hairpin conformation of kca2 with the efficient shelter of their hydroxyl groups at the interface of the complex formed via hydrogen bonding . A majority of kca2 hydrophobic surface is exposed, which favors membrane insertion and may directly contribute to the observed hemolytic properties . A considerably reduced psa of kca2 with the minimized energy was calculated in vacuum to be 1.08 nm (table 1), which was much smaller than the psa solely based on the functional group contributions (3.15 nm). In a biological system, the interaction of polymers with the plasma membrane occurs in an aqueous condition . Therefore, a comparison of the psa of ca dimers in the presence of water molecules may be more representative for the membrane activity of the free amphiphilic molecules in water . On the other hand, the disintegrated polymer micelle may merge with the cell membrane from the exposed hydrophobic core, especially when nanoparticles are chemically or physically anchored onto the cell membrane via targeting ligands or nonspecific interactions . In this case, the core - forming ca dimers aggregate in the hydrophobic core of the micelles . Therefore, the conformations of the ca dimers were equilibrated in hydrophobic decane to probe these scenarios . It is noticed that the molecules have small psa after being simulated in vacuum . After equilibration with the solvent molecules (water or decane) at 300 k for 100 ns, solvent molecules could insert into the folded structures . The hydroxyl groups were exposed more, and the psa increased, especially in aqueous conditions (table 1). However, the dimer molecules still remained in the folded conformations restricted by the hydrogen bonding . The stable structures in vacuum were first obtained by the simulated annealing process and then solvated in water or decane at 300 k and equilibrated . The production md simulation runs were performed at 300 k for 100 ns to calculate the average psa and the equilibrium structure geometries . According to our hypothesis, we expect to see the increased psa and the disrupted folding of the ca dimers after introducing bulky hydrophilic groups to ca . The molecular dynamics simulations revealed that the single - glycerol modified ca dimer, k(ca-4oh)2, also forms a hairpin - like folded conformation via hydrogen bonding (figure 3). Compared to kca2 the k(ca-4oh)2 dimer resulted in a lower - energy structure (figure s3 in si) using a simulated annealing approach that is attributed to the enhanced hydrogen bonding . However, as shown in figure 3, the extra hydroxyl groups are exposed to the solvent molecules at the bottom of the molecular clips . As expected, the k(ca-4oh)2 dimer possesses a higher psa in vacuum (1.19 nm) and after equilibration in water (1.65 nm) or decane (1.34 nm), which may prohibit the insertion of the telodendrimer into the hydrophobic lipid bilayer membrane . As shown in figure 3, the ca dimer with diglycerol modification, possessing five hydroxyl groups on each cholic acid, k(ca-5oh)2, forms a very stable folded conformation via an extensive hydrogen - bonding network . The stable conformations of folded k(ca-5oh)2 lead to the highest energy stabilization (figure s3 in si) during the annealing and folding process compared to other ca modifications . Most polar groups have been sheltered within the folded conformation, and the psa was calculated to be the smallest at 1.04 nm for k(ca-5oh_7)2 in vacuum, which is even smaller than that for kca2 in the original telodendrimer i. the possible isomers of the disubstituted ca dimers with the second glycerol on the 7 or 12 position (e.g., k(ca-5oh_7)2; k(ca-5oh_12)2 and k(ca-5oh_7/12)2 (figure s4 in si)) have the similar small psa values and low binding energies during the simulated annealing process (figure s3 in si). The smaller psa and stable conformation both contribute to the hemolytic activity of the telodendrimer iii . As shown in figure 3, the subunit of telodendrimer iv, k(ca-3oh - nh2)2, also formed a folded conformation via hydrogen bonding to partially shelter the polar groups after equilibration through molecular dynamics simulations . The psa of the amino - derived ca dimer with an energy - minimized folded conformation was calculated to be higher, 1.21 nm in vacuum, which is further increased to 1.43 nm upon protonation . However, the positively charged amino groups are located at the bottom of the resulting ca dimers, which are believed to induce stronger electrostatic interactions with phospholipid bilayer cell membranes . Accordingly, a 100% hemolysis was observed for telodendrimer iv even at 0.1 mg / ml after a 4 h incubation (figure 2), which is the combination of charge and hydrophobic effects . Structure of the cholic acid dimers with different glycerol substitution prepared via solution - phase organic synthesis (a); hemolytic properties of small - molecule dimers of cholic acid with different glycerol modifications after incubation with human red blood cells for 30 min (b) and 4 h (c). The triplicate data are presented as mean sd (*: p <0.01; * *: p <0.001). The above molecular simulation studies have clearly revealed the potential spr between ca modification and the hemolytic activity of telodendrimers . However, the direct validation of the computational simulation might be essential for applying these approaches to study the spr of nanocarriers . Therefore, cholic acid dimers studied in molecular simulation were synthesized and evaluated . Cholic acid dimers with the different glycerol substitution were prepared via solution - phase peptide chemistry (figure 4a). As shown in the si, k(ca)2, k(ca-4oh)2, and k(ca-5oh)2 have been characterized with proton nmr (figure s5 in si) and maldi - tof ms (figure s6 in si), demonstrating the right structures . The hemolysis properties of these three dimers were tested directly via red blood cell incubation . It is expected that these small molecules showed higher hemolysis compared with telodendrimers, due to the lack of peg sheltering . As predicated in the md simulation, the k(ca-4oh)2 exhibited a significantly lower membrane activity in hemolysis assays than both k(ca-5oh)2 and k(ca)2 for 30 min and 4 h incubation (figure 4b, c). It was also observed that unmodified k(ca)2 showed a significantly higher membrane activity than k(ca-5oh)2, especially at relatively low concentration of 0.1 mm . However, telodendrimer i pegca8 showed significantly lower hemolysis than telodendrimer iii peg(ca-5oh)8 after 4 h incubation (figure 2a). This may due to the better integrity of pegca8 micelles with the relative low cmc (as discussed below) compared with peg(ca-5oh)8 micelles, which are more hydrophilic with higher cmc . The dynamic nature of peg(ca-5oh)8 micelles makes them readily interact with the plasma membrane . (a) dls particle sizes of telodendrimer i and ii and the micelles loaded with ptx and dox . The mean particle sizes are presented based on area - distribution; (b) tem images of telodendrimer ii after being loaded with ptx and dox, respectively, with uranyl acetate staining (scale bar: 100 nm). The above chemical modifications of ca on the hydrophilic surface maintained the facial amphiphilic property of ca within the telodendrimer, which ensured the formation of micellar nanoparticles for drug loading . However, such modification on ca increased the critical micellization concentrations (cmcs) of the telodendrimers . The cmcs were measured via the classic pyrene 1:3 method to be 17.4 g / ml, 24.2 g / ml, 95.9 g / ml and 49.3 g / ml for telodendrimers i, ii, iii, and iv, respectively (figure s-7 in si). The significantly increased cmcs for telodendrimers iii and iv indicated the higher free polymer concentration in micelle solutions, which may further contribute to the enhanced hemolytic properties . The telodendrimer ii peg(ca-4oh)8 showed similar particle size and stability before and after ptx loading at 3/20 drug / polymer ratio, compared with the original telodendrimer i pegca8, due to the similar structures and cmcs . In addition, telodendrimers i and ii both exhibited good loading capacity and stability for another anticancer drug, doxorubicin (dox), at 1/10 drug / polymer w / w ratio . The particle sizes have been detected via dls to be 34 and 19.5 nm with narrow distribution, respectively (figure 5a). At these ptx and dox loading ratios, clear micelle solutions were obtained without any drug precipitation observed both by eye and by dls analysis, which indicated the complete drug loading efficiency . Further, no drug precipitation was observed from these ptx and dox nanoformulations after storages for weeks at 4 c . The tem studies have revealed the spherical micelles formed by telodendrimer i before and after ptx and dox encapsulation . In this study, we also utilized tem to study the morphology of the nanoparticles formed by peg(ca-4oh)8 . Narrow dispersed, homogeneous spherical nanoparticles were observed (figure 5b), which is similar to the dls analysis (figure 5a). On the contrary, telodendrimer iii can only assemble into smaller particles with heterogonous distributions, e.g. 1 nm and 5 nm sizes . It is due to the overwhelming hydroxyl groups introduced to the ca polar surface, which broke the balance of the amphiphilicity of telodendrimers . After ptx loading (2:10, w / w, ptx / iii), the sizes of the micelles increased to 62 nm with a small portion of larger sizes at 295 nm (figure s8 in si). Telodendrimer iv was observed to aggregate into micelles about 343 nm in size in pure water solution, which were reduced to about 11 nm upon adjusting ph to 5.5 due to the increased polarity and charge repulsion of positively charged amino groups . Such ptx - loaded nanoparticles (2:10 w / w ptx / iii) exhibited heterogeneous size distribution of 51 and 341 nm in pbs (figure s9 in si), which is not preferred for in vivo applications . The drug release of both ptx and dox from the telodendrimer ii were observed to be slightly slower than those from telodendrimer i (figure 6a, b), which may due to the stronger hydrogen bonding . Ptx released slowly from both nanocarriers with 50% drug release at about 18 h; in contrast, burst releases were observed for dox and 50% of drug released at 8 h, due to the better water solubility of drug molecules . Accumulative drug release profile of ptx and dox loaded in the nanocarrier formed with telodendrimer i (a) and monoglycerol derived telodendrimer ii (b); quantitative flow cytometry analysis of the cellular uptake of various dox formulations by raji cells after 30 min (c) and 2 h (d) incubation at three drug concentrations . The cell viability assays to evaluate the cytotoxicity of telodendrimer ii and the anticancer effects of the micelles loaded with ptx (e) and dox (f) on the skov-3 ovarian cell line and raji lymphoma cell line, respectively . Given the lowered membrane activity for telodendrimer ii, one may ask whether it will decrease the cell uptake and lower the efficacy of the encapsulated chemodrugs? To address this issue, we performed the quantitative flow cytometry study to analyze the cell uptake of the chemodrugs . Doxorubicin is a fluorescent anticancer drug molecule, which was loaded in nanocarriers for cell uptake study in flow cytometry experiments . As shown in figure 6c, d, the quantitative flow cytometric analysis demonstrated the similar cell uptake for free dox and dox loaded in telodendrimer micelles in raji cells after 30 min and 2 h incubation at different drug concentrations . The cellular uptakes of all dox formulations were in concentration- and time - dependent patterns . Furthermore, the in vitro cytotoxicity studies (figure 6f) revealed the similar anticancer effects on the raji lymphoma cells for the free dox and dox loaded in the nanocarriers i and ii after 72 h incubation . Additionally the ptx - loaded telodendrimer ii (ic50: 1.6 ng / ml) and ptx - loaded telodendrimer i (ic50: 3.4 ng / ml) exhibited slightly higher anticancer effects than free ptx (ic 50:14.5 ng / ml) formulated in a mixture of cremophore el and ethanol (1:1 v / v) in an ovarian cancer cell line, skov-3 (figure 6e). This may be due to the partial precipitation of ptx from the cremophore formulation after dilution with cell culture medium . Overall, the telodendrimer ii was nontoxic up to 0.5 mg / ml concentration for both cell lines . Ex vivo biodistribution of telodendrimer nanocarrier ii loaded with ptx and nirf dye did in colon cancer - bearing nude mice after 48 h postinjection via tail vein (a); the comparison of the average fluorescence intensity in various organs and ht-29 tumors between the animals given did - ptx - np ii or free dye did (b); ex vivo biodistribution of telodendrimer nanocarrier ii loaded with ptx and nirf dye did in breast cancer bearing nude mice after 72 h postinjection via tail vein (c); quantitative analysis of the average fluorescence intensity in various organs and mda - mb-231 tumors between the animals given did - ptx - np ii or free dye did (d). As reported in our previous studies, telodendrimer i nanocarrier was able to target various solid tumors efficiently in animal models . Therefore, we would like to further evaluate the biodistribution and tumor targeting properties of the optimized telodendrimers in solid tumor xenograft models, such as colon and breast cancers after intravenous injection of telodendrimer ii micelles coloaded with nirf dye did and ptx . Did is a hydrophobic near - infrared fluorescence cyanine dye, which could be stably entrapped within nanocarrier with very slow release profile (figure s-10 in si) and could be used as a surrogate to probe the distribution of the nanocarriers . As shown in figure 7, the ex vivo images revealed the highest uptake of fluorescent signal in tumors compared to other organs in both tumor types . The same targeting effects for telodendrimer i were also observed previously in animal models bearing solid tumors . The free did administration led to a relatively low accumulation in tumors and significant high deposition in lung, liver, and spleen, which were significantly reduced in animals treated with the nanoformulations . As shown in figure 7b and figure 6d, nanocarriers might be able to deliver much higher concentrations of hydrophobic drug molecules to tumor sites (24 fold), compared with the free did injections . With the enhanced in vivo anticancer effects for the ptx formulated in telodendrimer i nanocarriers, we anticipate these nonhemolytic nanotherapeutics formed by telodendrimer ii will further improve the anticancer effects via efficient tumor - targeted drug delivery . The further pk / pd studies and the in vivo efficacy of this optimized nanocarrier in delivering different chemodrugs in animal models will be tested and reported in a separate account . The spr of a telodendrimer system in interacting with plasma membranes has been clearly revealed via computational and experimental approaches . To minimize the hemolytic properties of telodendrimer nanocarriers, we took a rational approach to modify telodendrimer structures by introducing hydrophilic glycerol or amino - glycerol groups onto the polar surface of cholic acid . With the aid of molecular dynamics simulations, we had a better understanding of the relationship between plasma membrane lytic activity and the structural conformations of the amphiphiles . The introduction of hydrophilic monoglycerol onto the polar surface of cholic acid was predicated via molecular dynamics to be optimal in disrupting the molecular folding of the subunit of telodendrimer and increasing the polar surface area of the complex . On the contrary, introduction of two glycerols or an amino - glycerol on each cholic acid led to the increased hemolytic properties of the resulting telodendrimers, which were correlated with the decreased psa and the exposed positive charges in the molecular dynamics simulations, respectively . Further, the computation results have been verified in the experiments via the synthesis of the telodendrimer subunits, which were tested to be consistent with the theoretical prediction for the membrane activities . Such spatial modification of ca via monoglycerol grafting sustained the balance of the facial amphiphilicity of ca, therefore maintaining the ptx and dox loading capacity, stability, and anticancer effects of the nanotherapeutics . Given the nonhemolytic property, efficient cancer cell uptake, and the excellent in vivo tumor - targeted properties, the monoglycerol derivatized telodendrimer ii has been demonstrated as a promising nanocarrier for efficient anticancer drug delivery.
|
Tobacco use is a major modifiable risk factor for health, which is one of the leading causes of a range of cardiovascular and respiratory disorders in addition to various cancers in the body . India has a huge burden of tobacco - related morbidity, disability, and mortality . The global adult tobacco survey (gats) in 2010 revealed that 47.9% of males and 20.3% of females, constituting 34.6% of the adult population, used tobacco in one or the other form in india . Social and cultural acceptance among youth is one of the reason for higher prevalence of tobacco consumption in india . Among the 70% of nicotine dependent participants reporting that they want to quit, annually only 46% succeed . Unassisted tobacco cessation is very low unlike in the west . To assist the tobacco cessation efforts of tobacco users, tobacco cessation clinics (tccs) were started across india by the ministry of health and family welfare, government of india, with the support of the world health organization in 2002 . A tcc provides interventions such as behavioral counseling with or without medication (nicotine / non - nicotine replacement therapy). However, long - term outcome of these interventions conducted at tccs remained poor, but successful than unassisted tobacco cessation . A recently published study showed that only 26% participants improved at 3 months, 21% at 6 months, and 18% at 9 months . Major barriers for long - term tobacco cessation include peer pressure, lack of psychosocial support, attitude towards tobacco cessation, younger age, lack of community awareness, lack of trained professionals, and poor follow - up in subsequent visits . To improve tobacco cessation outcome, it needs to go beyond the health sector to multiple settings such as workplace, educational, and tobacco control policies . Workplace and educational setting has shown two to three times increase in tobacco cessation rate . These results are promising, but limited by uncontrolled study design, non - homogenous study population, and minimal interventions . To overcome the limitations of previously conducted studies, the present study aimed to compare the effectiveness of tobacco cessation services in clinical and workplace settings . The study was conducted with due permission and support from the management, union, and employees of the selected industry as well as hospital . Fifty employees working in the selected chemical industrial unit and willing to participate were enrolled in the workplace group . An equal number of age and sex - matched participants visiting tcc of jagruti de - addiction centre were recruited in the tcc group . The participants with a previous history of psychiatric illness or neurological illness were excluded from study . The aim and purpose of the study were explained to each participant, and those who are willing to participate were enrolled after signing the written informed consent form which was made available in the local language (marathi). The first session included an introductory lecture and interviews of the participants to collect preintervention data about various sociodemographic and risk factor variables . The follow - up sessions were offered at 2 weeks and 4 weeks, and then at 3 months and 6 months for both the clinical and tcc groups . During these sessions, professional help in the form of health awareness sessions, focus group discussion, one - on - one counseling, and pharmacotherapy including nicotine (gum, lozenges) and non - nicotine (bupropion and varenicline) replacement was provided to the employees by a team of doctors and counselors . During follow - up, abstinence was evaluated by self - report and biochemically confirmed by negative result of a cotinine test performed on saliva (a cotinine level of <15 ng per milliliter) or urine sample (with a level of <2 ng per milliliter). Sample size was based on change in the primary outcome variable (qualitative outcome i.e. Complete tobacco cessation, more than 50% reduction, no change, and drop out). The ps, power and sample size calculation version 3.1.2 was used for sample size calculation . Prior studies indicate that the probability of complete tobacco cessation after 6 months of treatment in clinical setting is 0.20 and odds ratio for tobacco cessation in workplace settings is 3.65 . The sample size was calculated with a power of 80%, precision rate of 5%, correlation coefficient () of 0.5, and matched in 1:1 ratio . The minimum sample size for this study was calculated to be 47, and therefore, 50 participants were included in each group . The statistical analysis was carried out by using the statistical package for the social sciences (spss) version 21.0 . The categorical variables were expressed in percentage and analyzed by independent chi - square test and fisher exact test . The quantitative data were expressed in mean sd (standard deviation), and compared using independent t - test . Multinominal logistic regression was used to predict the outcome of tobacco cessation in both the settings . For each test, the significance level was set at p <0.05 . Fifty employees working in the selected chemical industrial unit and willing to participate were enrolled in the workplace group . An equal number of age and sex - matched participants visiting tcc of jagruti de - addiction centre were recruited in the tcc group . The participants with a previous history of psychiatric illness or neurological illness were excluded from study . All the participants were enrolled in the month of august 2015 . The aim and purpose of the study were explained to each participant, and those who are willing to participate were enrolled after signing the written informed consent form which was made available in the local language (marathi). The first session included an introductory lecture and interviews of the participants to collect preintervention data about various sociodemographic and risk factor variables . The follow - up sessions were offered at 2 weeks and 4 weeks, and then at 3 months and 6 months for both the clinical and tcc groups . During these sessions, professional help in the form of health awareness sessions, focus group discussion, one - on - one counseling, and pharmacotherapy including nicotine (gum, lozenges) and non - nicotine (bupropion and varenicline) replacement was provided to the employees by a team of doctors and counselors . During follow - up, abstinence was evaluated by self - report and biochemically confirmed by negative result of a cotinine test performed on saliva (a cotinine level of <15 ng per milliliter) or urine sample (with a level of <2 ng per milliliter). Sample size was based on change in the primary outcome variable (qualitative outcome i.e. Complete tobacco cessation, more than 50% reduction, no change, and drop out). The ps, power and sample size calculation version 3.1.2 was used for sample size calculation . Prior studies indicate that the probability of complete tobacco cessation after 6 months of treatment in clinical setting is 0.20 and odds ratio for tobacco cessation in workplace settings is 3.65 . The sample size was calculated with a power of 80%, precision rate of 5%, correlation coefficient () of 0.5, and matched in 1:1 ratio . The minimum sample size for this study was calculated to be 47, and therefore, 50 participants were included in each group . The statistical analysis was carried out by using the statistical package for the social sciences (spss) version 21.0 . The categorical variables were expressed in percentage and analyzed by independent chi - square test and fisher exact test . The quantitative data were expressed in mean sd (standard deviation), and compared using independent t - test . Multinominal logistic regression was used to predict the outcome of tobacco cessation in both the settings . For each test the clinical and sociodemographic characteristics of the workplace and tcc groups are depicted in table 1 . There was no statistically significant difference between the two groups in terms of age, socioeconomic status, residence, type of tobacco use, and intervention for tobacco cessation . The age of initiation of tobacco use was significantly lower in case of participants attending tobacco cessation services than the workplace group (p <0.001). However, the fagerstrom score was higher and significant among the participants with tobacco cessation group than the workplace group (t = 2.03 df = 98, p = 0.045). Sociodemographic and clinical characteristics of workplace and tcc groups table 2 and figure 1 show the outcome of tobacco cessation at the end of 2 weeks, 4 weeks, 3 months, and 6 months after intervention, at the end of 2 weeks, (n = 9, 18%) participants in the tcc group and (n = 22, 44%) participants in the workplace group stopped tobacco consumption completely, whereas (n = 14, 28%) participants in the tcc group and (n = 22, 44%) participants in the workplace group reduced tobacco consumption . Tobacco cessation rate was increased in the subsequent visit in both the groups . However, proportion of tobacco cessation in the workplace group was higher in comparison to the tcc group . Outcome of tobacco cessation in two groups outcome of tobacco cessation in two groups at the end of 6 months, (n = 12, 24%) participants in the tcc group and (n = 30, 60%) participants in the workplace group stopped tobacco consumption completely, whereas (n = 4, 8%) participants in the tcc group and (n = 10, 20%) participants in the workplace group reduced tobacco consumption . Only (n = 1, 2%) participant at the end of 2 weeks and (n = 14,28%) participants at the end of 6 months were lost to follow up in the workplace group, while (n = 13,26%) participants at the end of 2 weeks and (n = 27, 54%) participants at the end of 6 months were lost to follow up in the tcc group . On multinominal logistic regression, odds ratio (or) for complete tobacco cessation was (or = 0.20, 95% ci = 0.0820.526, p <0.001), more than 50% reduction was (or = 1.29, 95% ci = 0.344.88, p = 0.70), and no change was (or = 0.25, 95% ci = 0.023.11, p = 0.28) in clinical group [table 3]. The present study aimed to compare the effectiveness of tobacco cessation services in clinical and workplace settings . We observed that the outcome of tobacco cessation improved in the workplace group than the clinical group . After 6 months of intervention, complete tobacco cessation rate was 2.5 times higher among the workplace group than the clinical group . In addition, the tobacco cessation rate was consistently maintained over period of 6 months, with a lower dropout rate in the workplace group than the clinical group . The literature on tobacco cessation suggests that most relapses occur within the first month of cessation, and that approximately 90% of the relapses occur within the first 6 months . The reasons for this may be that the workplace group was more homogenous and cohesive and peer support in workplace group may be more effective than family support in the tcc group . Peer pressure has a vital role as a predisposing, reinforcing, and enabling factor for tobacco use . Further studies are warranted to explore the role of peer pressure in tobacco cessation as most of the previous reviews and studies are inconclusive . The primary finding, i.e., improved outcome in workplace setting than that in the clinical group, is in support with almost three - quarters of the previously conducted studies and meta - analysis . There are few studies that showed contradictory findings, suggesting the non - effectiveness of workplace interventions . However, these studies were uncontrolled, having poor inclusion and exclusion criteria, and other methodological issues . In addition, the recently published cochrane review showed that there is strong evidence for some interventions (individual / group counseling, pharmacological treatment) which increases the tobacco cessation rate in the workplace . Self - help group and social support are less effective in tobacco cessation . Out of the 57 reviewed trials, only 5 trials examined outcome with pharmacotherpy, despite having high quality of evidence; most of the trials included one or more intervention at the workplace . In the present study, intensive, comprehensive, and multiple interventions were carried out at both the places, depending on indications in individual case, which may be the reason for higher success rate among the workplace group than the clinical group and previously conducted studies . Another important finding in the present study was that the tcc group participants were highly tobacco dependent than workplace group participants and the age of initiation of tobacco use was also lower among the tcc group participants than the workplace group participants . The early age of initiation of tobacco consumption and higher tobacco dependence may also be responsible for high failure rate and dropout in the tcc group than the workplace group in addition to various individual predictors such as sociodemographic variables (socioeconomic status and residence), number of quit attempts, motivational variables, and nicotine - related variables . Tobacco cessation barriers include poor knowledge, lack of advice and support, lack of motivation, as well as intrapersonal, social, cultural, and financial factors . Most of these barriers may be reduced or eliminated by multiple interventions carried out in our study such as pre - awareness session, focus group discussion, one - on - one counseling, and pharmacotherapy resulting in low dropout rate and adherence to the tobacco cessation program . Only few studies have been attempted in the indian context, the second largest tobacco consumer in the world, with variable success . The present study not only represents the success of workplace setting, but also of multiple interventions, as well as an intensive and integrated approach . In addition, workplace - based tobacco cessation interventions are cost effective . In the present study, there was no difference among the two groups for confounding factors such as sociodemographic variables and pharmacological intervention reflecting well - controlled and planned study design than previous studies . The present study population represents a small sample size, open - label design, and only male employees from low socioeconomic status . Further large scale, multicentric, controlled studies are required to better understand the role of gender, peer pressure, and sociocultural factors in tobacco cessation outcome in the workplace settings among the indian population . In the present study, there was no difference among the two groups for confounding factors such as sociodemographic variables and pharmacological intervention reflecting well - controlled and planned study design than previous studies . The present study population represents a small sample size, open - label design, and only male employees from low socioeconomic status . Further large scale, multicentric, controlled studies are required to better understand the role of gender, peer pressure, and sociocultural factors in tobacco cessation outcome in the workplace settings among the indian population . Our study shows that multiple, intensive tobacco cessation interventions are more effective in workplace setting than the clinical setting (tcc). Peer support and regular follow - up in the workplace setting may be responsible to increase the success rate . Our study findings suggest that there is a need of expansion of existing clinic - based tobacco cessation services to workplace tobacco cessation services.
|
Surveillance samples: fecal samples were periodically collected from feral pigeons at each prefecture (every two months in principle) in japan (except for aomori, akita, miyagi, aichi, hyogo, yamaguchi and ehime). The collected fecal samples were placed in screw - cap tubes and stored at 80c until virus isolation . Each collected sample was suspended at a concentration of approximately 10% in eagle s minimum essential media containing antibiotics . The suspension was centrifuged, and the supernatant was inoculated into the allantoic cavities of 912-day - old specific pathogen free (spf) chicken embryonated eggs . After inoculation, the eggs were incubated at 37c for 6 days unless the embryo died . The inoculated eggs were then chilled to 4c, and the allantoic fluids were harvested and tested for hemagglutination activity (ha). For negative samples, two allantoic fluids were pooled and re - passaged into two new eggs in order to confirm negativity . Identification of apmv-1 was conducted by the conventional hemagglutination - inhibition (hi) assay with apmv-1 specific antiserum . Nucleotide sequencing and phylogenetic analysis: viral rna was extracted from the infected allantoic fluids using a commercial kit (qiaamp viral rna mini kit, qiagen, valencia, ca, u.s.a .) According to the manufacturer s instructions . Briefly, after reverse transcription with superscript iii (life technologies, gaithersburg, md, u.s.a .) Using random 9 mers, pcr was performed to amplify cdnas using takara extaq (takara, tokyo, japan). For pcr amplification, 35 cycles were performed at 94c for 30 sec, 50c for 30 sec and 72c for 30 sec . The primer sequence and location were as follows: ndv - f2 (4235 5-tggagccaaaccgcgcacctgcgg-3 4258; and ndv - r2 (5000 5-ggaggatgttggcagcat-3 4983 . The sequences amplified by these primers included the cleavage site of the f protein and the region to construct a phylogenetic tree for genotyping the virus . A phylogenetic tree was constructed by the neighbor - joining method in mega6 . For the comprehensive analysis of apmv-1 in pigeons in japan, we used the new isolate obtained in this surveillance study and compared it with the japanese apmv-1 strains isolated from pigeons from 1984 to 2007 (table 1table 1.apmv-1 strains used in this studyvirusabbreviationyeargroupf protein cleavage site(position 112117)apmv1/pigeon / japan / ibaraki/84jp / ibaraki - pg/8419841grqkr - fapmv1/pigeon / japan / nagano-8/84jp / nagano-8-pg/8419841grqkr - fapmv1/pigeon / japan / fk-1/84jp / fk-1-pg/8419841grqkr - fapmv1/pigeon / japan / tochigi/86jp / tochigi - pg/8619861wrqkr - fapmv1/pigeon / japan / niigata/88jp / niigata - pg/8819881grqkr - fapmv1/pigeon / japan / kushiro/91jp / kushiro - pg/9119911grqkr - fapmv1/pigeon / japan / tokachi/91jp / tokachi - pg/9119911grqkr - fapmv1/pigeon / japan / kumamoto/95jp / kumamoto - pg/9519951grqkr - fapmv1/pigeon / japan / tochigi/95jp / tochigi - pg/9519952rrkkr - fapmv1/pigeon / japan / utsunomiya/95jp / utsunomiya - pg/9519952rrkkr - fapmv1/pigeon / japan / shiga/96jp / shiga - pg/9619962rrkkr - fapmv1/pigeon / japan / fukushima/96jp / fukushima - pg/9619962rrkkr - fapmv1/pigeon / japan / saitama/97jp / saitama - pg/9719972rrkkr - fapmv1/pigeon / japan / gunma/2000jp / gunma - pg/200020002rrkkr - fapmv1/pigeon / japan / kumamoto/2001jp / kumamoto - pg/200120013rrqkr - fapmv1/pigeon / japan / hiroshima/2002jp / hiroshima - pg/200220023rrqkr - fapmv1/pigeon / japan / mie/2002jp / mie - pg/200220023rrqkr - fapmv1/pigeon / japan / shizuoka/2002jp / shizuoka - pg/200220023rrqkr - fapmv1/pigeon / japan / saitama-1/2003jp / saitama - pg-1/200320033rrqkr - fapmv1/pigeon / japan / saitama-2/2003jp / saitama - pg-2/200320033rrqkr - fapmv1/pigeon / japan / tokyo/2006jp / tokyo - pg/200620063rrqkr - fapmv1/pigeon / japan / niigata/2007jp / niigata - pg/200720073rrqkr - fapmv1/pigeon / japan / kanagawa/2013jp / kanagawa - pg/201320134rrqkr - f). Pathogenicity test using intracerebral pathogenicity index: we compared the pathogenicity of representative strains of each group by the intracerebral pathogenicity index (icpi) test according to the office international des epizooties (oie) procedure . Briefly, one - day - old spf chickens were intra - cerebrally inoculated with 0.05 ml of a 1:10 dilution of infective allantoic fluid . The chicks were monitored during an 8-day observation period and scored as normal (score 0), sick or paralyzed (score 1) and dead (score 2). Total scores were determined, and the mean daily scores were calculated to obtain the icpi . Hemagglutination inhibition test: to understand the differences in antigenicity among pigeon apmv-1 strains, the hi test using four antisera against apmv-1 was performed using representative strains of each group as previously described . Isolation and characterization of the isolate: a total of 1,021 samples were collected during the study period . One apmv-1 virus was isolated from the sample collected at kanagawa prefecture (sampling site: sagamihara city) in february 2013 . We designated this isolate as apmv1/pigeon / japan / kanagawa/2013 and abbreviated it as jp / kanagawa - pg/2013 . As a result of the direct sequencing of the obtained pcr product, the isolate showed the deduced amino acid sequence rrqkr - f at the f0 protein cleavage site, which was identical to a virulent motif (table 1). Comprehensive phylogenetic analysis of apmv-1 in pigeons in japan: using phylogenetic analysis based on the f gene including the sequence of the cleavage site, all apmv-1 strains isolated from pigeons including jp / kanagawa - pg/2013 were clustered into a single genetic lineage, which was termed vib/1 within genotype vi: this is synonymous with lineage 4b [1, 18] (fig . 1.phylogenetic tree of the apmv-1 isolates mainly isolated from pigeons based on nucleotide sequences from a portion (nt 47- 420) of the f gene . The horizontal distances are proportional to the minimum number of nucleotide differences required to join nodes and sequences . The tree was generated using the neighbor - joining algorithm, and alignments were bootstrapped 1,000 times . These apmv-1 strains were further subdivided into four subgroups identified over 4 separate timeframes: 19841995 (group 1), 19952000 (group 2), 20012007 (group 3) and the novel subgroup isolated in 2013 (group 4). The group 1 strains were clustered together with the strains belonging to the genetic lineage vib/1-early european (eu / ea) group . Phylogenetic tree of the apmv-1 isolates mainly isolated from pigeons based on nucleotide sequences from a portion (nt 47- 420) of the f gene . The horizontal distances are proportional to the minimum number of nucleotide differences required to join nodes and sequences . The tree was generated using the neighbor - joining algorithm, and alignments were bootstrapped 1,000 times . The group 2 apmv-1 strains were clustered together with the strains belonging to the genetic lineage vib/1-recent european 1 (eu / re1) group . Among them, the jp / tochigi - pg/95 strain shares 100% nucleotide identity with a german apmv-1 strain (de-48/92), which was also isolated from a pigeon . Furthermore, the jp / shiga - pg/96 strain also shares 100% nucleotide identity with a german strain (de-57/95), which was also isolated from pigeons . The group 3 apmv-1 strains were clustered together with the strains belonging to the genetic lineage vib/1-recent european 2 (eu / re2) group . These strains were further subdivided into two groups that were composed of strains in eastern japan and western japan, respectively (fig . Interestingly, the phylogenetic analysis indicated that the apmv-1 strains isolated in western japan (kumamoto, hiroshima and mie) were clustered together with many chinese strains isolated from pigeons . On the other hand, the apmv-1 strains isolated in eastern japan (saitama, tokyo, shizuoka and niigata) were clustered together with the viruses isolated in european countries and the u.a.e . The group 4 apmv-1 strain was clustered together with the strains belonging to the genetic lineage vib/1, a recent european pigeon apmv-1 group mainly prevalent belgium and macedonia (fig . Each group in japan has specific amino acid motifs at the cleavage site of the f protein, namely, grqkr - f(except for one strain) (group 1), rrkkr - f(group 2), rrqkr - f(group 3) and rrqkr - f(group 4), respectively . Pathogenicity by the icpi test: the icpi of these strains ranged from 0.8 to 1.1 (table 2table 2.results of the icpi and hi tests among representative apmv-1 strains isolated from pigeonsvirusesgroupicpiantiserum againstb1/47jp / sato/30jp / shizuoka/85jp / nagano-8-pg/84jp / kumamoto - pg/9511.1325121024256jp / tochigi - pg/9521.0645121024256jp / kumamoto - pg/200131.132512512128jp / saitama - pg-2/200330.81625651264jp / kanagawa - pg/201341.13251251264) and were all proven to be pathogenic types, when assessed using criteria of oie . These indices were slightly lower than that of the first pandemic virus in pigeons isolated during 19831984 and suggest that numbers of basal amino acids were not associated with virulence in apmv-1 strains from pigeons as previously reported . Antigenic analysis by the hi test: as shown in table 2, no major antigenic differences were observed among these strains . Outbreaks of nd in pigeons are still being reported across the world, including japan . The origin of the panzootic in pigeons, which was defined as the third panzootic, appeared to be from the middle east during the late 1970s [3, 7]. This panzootic peaked during the early 1980s, which lead to a number of outbreaks of this disease in poultry and highlighted the importance of these pigeon - derived viruses in posing a real and continuous threat to the poultry industry [2, 5]. In japan, thereafter, these have been sporadic reports of cases and outbreaks of this disease in pigeons . Although surveillance for virus in feral waterfowl has been previously conducted [10, 13, 14, 19], it has not been comprehensively performed in feral pigeons . Previously, teske et al . Conducted surveillance for the virus in racing pigeons . In their report, although they could detect viral rna by real - time pcr assay, the virus was not isolated using embryonated eggs . In this surveillance study, a single virus was successfully isolated from 1,021 samples during a 2-year period (isolation rate approximately 0.1%). This isolation rate is lower than that (approximately 1%) in migratory waterfowls by our recent report . To our knowledge, this study is the first description of apmv-1 isolation from the feces collected from feral pigeons . This isolate was classified into genotype vi and was clustered only with viruses previously isolated from pigeons, suggesting that they were mainly transmitted among pigeons . To date, this type has mostly been isolated from pigeons in japan [8, 9] and has rarely been isolated from poultry . However, the isolated virus in our study was judged as a virulent type, suggesting that it posed a threat to the poultry industry . Indeed, jp / kanagawa - pg/2013 isolate was genetically close to virus isolated from chicken in macedonia (fig . 1). All japanese pigeon apmv-1 strains, including isolates in this surveillance study, were clustered into a single genetic lineage, which was termed vib/1 within genotype vi . These strains were further subdivided into four distinct subgroups (groups 14) of lineage vib/1 . Among them, the virus isolated in this surveillance was categorized as group 4, which was different from those previoulsy isolated (groups 13). Additionally, each subgroup has specific amino acid motifs at the cleavage site of the f protein . For example, the trading of pigeons from foreign countries, such as belgium, has been continuing every year according to the annual report of the quarantine service of the ministry of health, labour and welfare of japan . We speculate that this is one of the introduction routes for pigeon apmv-1 into japan . To prevent the introduction of pigeon apmv-1 into japan, it might be necessary to strengthen such quarantine system . The group 3 strains isolated in western japan from 2001 to 2002 were genetically related to many chinese strains . Among them, the w4 isolate has been suggested to be associated with waterfowl migration . This suggested that the virus is introduced from migrating birds . In order to further understand the epidemiology of apmv-1 in japan and the role of pigeons as a vehicle of transmission, surveillance
|
Quinolones, especially novel quinolones (6-fluoroquinolones), are synthetic broad - spectrum antibacterial agents that compete with beta - lactam . Macrolide antibacterial agents have been used to treat serious infections (1). Since the detection of plasmid - mediated quinolone resistance (pmqr) in klebsiella pneumoniae strains isolated from clinical specimens from the usa in the late 1990s (2, 3), three pmqr mechanisms have been discovered . One pmqr mechanism has been reported worldwide in various enterobacterial species in the presence of the qnr genes (4). Another mechanism is related to the aac (6)-ib - cr gene, which is responsible for decreasing susceptibility to quinolones by n - acetylation of a piperazinyl amine substituent of some fluoroquinolones (5). A third pmqr mechanism, which is based on a quinolone efflux pump protein, qepa, has been reported recently (6). Qnr is a member of the pentapeptide repeat family that protects dna gyrase and topoisomerase iv from quinolone inhibition (7). Extended - spectrum beta lactamase (esbl) strains are often plasmid - mediated, and most of these enzymes belong to the tem or shv families (8) that have been reported in many countries (9). In recent studies, a significant relationship was observed between quinolone resistance and the latest cephalosporin antibacterial agents (10 - 13). The association of qnr and esbl production genes or ampc - type lactamase has been observed (14). Furthermore, many studies have demonstrated that plasmids harboring qnr may also carry other genes that respond to esbl - producing strains (15, 16). Considering the worldwide spread of the qnr gene, especially in hospitalized patients, and the fact that few studies have focused on qnr genes in esbl - producing escherichia coli isolates in iran, the aim of this study was to determine the frequency of three qnr gene types in esbl - producing and non - esbl - producing e. coli clinical isolates at the imam reza hospital in mashhad, iran . The descriptive cross - sectional study included 200 e. coli clinical isolates collected from outpatients and hospitalized patients in imam reza hospital from may 2011 to july 2012 . We classied the patients as hospitalized if they were admitted to the hospital and stayed for a minimum of 24 hours . We classified the patients as outpatients if they were not hospitalized for more than 24 hours but visited a hospital, clinic, or associated facility for diagnosis or treatment (17). The sample size was calculated based on level of confidence, expected prevalence, and precision (corresponding to effect size) (18). The research was approved by the ethics committee of the faculty of medicine in mashhad . Clinical samples, including urine, blood, wound cultures, and csf, were processed in this study . Specimens were collected by a laboratory technician and immediately transferred to the microbiology department of mashhad university of medical sciences in sterile screw cap tubes containing 5 ml of tryptic soy broth (sigma; usa). Prior to specimen collection, criteria such as previous antimicrobial therapy, immune suppression, and presence of bacteremia because of other pathogens before and after colonization by e. coli were taken into consideration . Susceptibility tests for ciprofloxacin, ceftazidime, cefotaxime, and cefpodoxime were performed for esbl- and non - esbl - producing e. coli by using the standard disc diffusion test according to the clinical and laboratory standards institute guidelines (20). Ciprofloxacin (5 g), ceftazidime (30 g), cefotaxime (30 g), and cefpodoxime (10 g) disks (mast, uk) were placed on the inoculated plate and incubated at 35c for 16 - 20 h. drug resistance was recognized according to their zone sizes compared with the break point announced by the clinical and laboratory standards institute for enterobacteriaceae (20). Bacteria were cultured on a muller - hinton agar plate, and ceftazidime (30 g) versus ceftazidime / clavulanate (30/10 g), cefotaxime (30 g) versus cefotaxime / clavulanate (30/10 g), and cefpodoxime (10 g) versus cefpodoxime / clavulanate (30/10 g) (mast diagnostics, uk) were tested . Antibiotic disks were placed in media at a distance of 20 - 30 mm from other disks . After 18 - 24 hours incubation at 37c, esbl - producing organisms were detected by observation of a zone diameter increase of at least 5 mm around antibacterial agents in combination with clavulanic acid (20). The reference strain klebsiella pneumonia atcc 700603 was used as an esbl - positive control (10). E. coli isolates were cultured on macconkey agar (merck, germany) and incubated at 37c . After 24 hours, 1 - 5 colonies were suspended in te buffer, and suspensions were boiled for 10 minutes (21). Pcr was performed using gene - specific primers to detect two esbl - encoding gene types (blashv and blatem) (21). The following conditions were used: 2 minutes at 95c, followed by 35 cycles of 1 minute at 91c, 30 seconds at 52c, and 45 seconds at 72c, and 1 minute at 72c and 5 minutes at 72c for the final extension (19). Each 25 l of reaction mixture contained 2.5 l of 10 pcr buffer, 1.5 mm mgcl2 (25 mm), 320 m dntps (10 mm), 500 nm of each primer (10 pm/l), 50 ng template dna, and 0.5 u/l taq dna polymerase (cinnagen, iran). K. pneumoniae atcc 7881 containing the blashv and blatem genes (pasteur institute of iran, tehran) was used as a positive control . The pcr method was performed for three qnr gene types (qnra, qnrb, and qnrs) under the following conditions: 5 minutes at 94c, followed by 35 cycles of 30 seconds at 94c, 45 seconds at 50c, and 45 seconds at 72c and 5 minutes at 72c for the final extension . Pcr was performed in 25 l volumes, with each reaction mixture containing 2.5 l of 10 pcr buffer, 1.5 mm mgcl2 (25 mm), 200 m dntps (10 mm), 0.5 m of each primer (10 pm/l), 50 ng template dna, and 1 u/l of taq dna polymerase . Standard positive strains for the qnra, qnrb, and qnrs genes were not available in this study; therefore, in addition to checking the size of the amplicons, negative strains were repeated twice for accuracy . Additionally, pcr products were sequenced (one isolate for each gene) and analyzed with the basic local alignment search tool algorithm (http://blast.ncbi.nlm.nih.gov/blast.cgi). The descriptive cross - sectional study included 200 e. coli clinical isolates collected from outpatients and hospitalized patients in imam reza hospital from may 2011 to july 2012 . We classied the patients as hospitalized if they were admitted to the hospital and stayed for a minimum of 24 hours . We classified the patients as outpatients if they were not hospitalized for more than 24 hours but visited a hospital, clinic, or associated facility for diagnosis or treatment (17). The sample size was calculated based on level of confidence, expected prevalence, and precision (corresponding to effect size) (18). The research was approved by the ethics committee of the faculty of medicine in mashhad . Clinical samples, including urine, blood, wound cultures, and csf, were processed in this study . Specimens were collected by a laboratory technician and immediately transferred to the microbiology department of mashhad university of medical sciences in sterile screw cap tubes containing 5 ml of tryptic soy broth (sigma; usa). Prior to specimen collection, criteria such as previous antimicrobial therapy, immune suppression, and presence of bacteremia because of other pathogens before and after colonization by e. coli were taken into consideration . Susceptibility tests for ciprofloxacin, ceftazidime, cefotaxime, and cefpodoxime were performed for esbl- and non - esbl - producing e. coli by using the standard disc diffusion test according to the clinical and laboratory standards institute guidelines (20). Ciprofloxacin (5 g), ceftazidime (30 g), cefotaxime (30 g), and cefpodoxime (10 g) disks (mast, uk) were placed on the inoculated plate and incubated at 35c for 16 - 20 h. drug resistance was recognized according to their zone sizes compared with the break point announced by the clinical and laboratory standards institute for enterobacteriaceae (20). Bacteria were cultured on a muller - hinton agar plate, and ceftazidime (30 g) versus ceftazidime / clavulanate (30/10 g), cefotaxime (30 g) versus cefotaxime / clavulanate (30/10 g), and cefpodoxime (10 g) versus cefpodoxime / clavulanate (30/10 g) (mast diagnostics, uk) were tested . Antibiotic disks were placed in media at a distance of 20 - 30 mm from other disks . After 18 - 24 hours incubation at 37c, esbl - producing organisms were detected by observation of a zone diameter increase of at least 5 mm around antibacterial agents in combination with clavulanic acid (20). The reference strain klebsiella pneumonia atcc 700603 was used as an esbl - positive control (10). E. coli isolates were cultured on macconkey agar (merck, germany) and incubated at 37c . After 24 hours, 1 - 5 colonies were suspended in te buffer, and suspensions were boiled for 10 minutes (21). Pcr was performed using gene - specific primers to detect two esbl - encoding gene types (blashv and blatem) (21). The following conditions were used: 2 minutes at 95c, followed by 35 cycles of 1 minute at 91c, 30 seconds at 52c, and 45 seconds at 72c, and 1 minute at 72c and 5 minutes at 72c for the final extension (19). Each 25 l of reaction mixture contained 2.5 l of 10 pcr buffer, 1.5 mm mgcl2 (25 mm), 320 m dntps (10 mm), 500 nm of each primer (10 pm/l), 50 ng template dna, and 0.5 u/l taq dna polymerase (cinnagen, iran). K. pneumoniae atcc 7881 containing the blashv and blatem genes (pasteur institute of iran, tehran) was used as a positive control . The pcr method was performed for three qnr gene types (qnra, qnrb, and qnrs) under the following conditions: 5 minutes at 94c, followed by 35 cycles of 30 seconds at 94c, 45 seconds at 50c, and 45 seconds at 72c and 5 minutes at 72c for the final extension . Pcr was performed in 25 l volumes, with each reaction mixture containing 2.5 l of 10 pcr buffer, 1.5 mm mgcl2 (25 mm), 200 m dntps (10 mm), 0.5 m of each primer (10 pm/l), 50 ng template dna, and 1 u/l of taq dna polymerase . Standard positive strains for the qnra, qnrb, and qnrs genes were not available in this study; therefore, in addition to checking the size of the amplicons, negative strains were repeated twice for accuracy . Additionally, pcr products were sequenced (one isolate for each gene) and analyzed with the basic local alignment search tool algorithm (http://blast.ncbi.nlm.nih.gov/blast.cgi). Two hundred e. coli isolates were tested from 84 outpatients and 116 hospitalized patients at the imam reza hospital in mashhad, iran from may 2011 to july 2012 . The phenotypic confirmatory test identified 85 (42.5%) isolates as esbl - producing e. coli . The greatest proportion [72.9% (62 of 85)] of esbl - producing isolates was isolated from urine samples, followed by 8.23% (7 of 85) from wound samples, 8.23% (7 of 85) from blood samples, 3.52 (3 of 85) from ascitic fluid samples, and 2.35% (2 of 85) from secretion samples . The remaining 4.7% (4 of 85) of isolates were isolated from csf, pleural fluid, ear, and nose secretion samples . Blatem was present in 65 (76.47%) of 85 phenotypic esbl - producing isolates, while 23 (27%) esbl - producing isolates were positive for the blashv gene . Qnra, qnrb, and qnrs genes were prevalent in 31.5% (63 of 200), 17% (34 of 200), and 7% (14 of 200) of e. coli isolates, respectively . Both qnr genes (qnra and qnrs) and both esbl genes (blatem and blashv) were detected, while 32 isolates contained at least one esbl and one qnr gene . The disk diffusion method indicated that 86 (43%) isolates were resistant to ciprofloxacin . Additionally, 93 (46.5%), 104 (52%), and 105 (52.5%) isolates were resistant to ceftazidime, cefotaxime, and cefpodoxime, respectively . Blatem and blashv gene frequencies were 68.2% and 66.7%, respectively, in hospitalized patients . Qnra, qnrb, and qnrs gene frequencies were 63 (31%), 34 (17%), and 14 (7%), respectively . Qnr (a, b, s) frequencies in hospitalized patients and outpatients are summarized in figure 3 . Plasmid - mediated genes, such as qnr, may facilitate the spread and increase the prevalence of quinolone - resistant strains . To date, qnr genes have been widely detected in southern and eastern asia, north and south america, and europe . The present study demonstrated a high prevalence of qnr genes among esbl - producing e. coli isolates collected from the imam reza hospital in mashhad, iran . The high prevalence of qnr genes among esbl - producing enterobacterial species has been previously reported . Our study revealed that the qnr gene could co - exist with the blatem and blashv alleles . Pmqr strains, which carry the qnr gene, can transfer low - level quinolone resistance (22). Various studies have indicated that most enzymes from esbl - producing organisms can be horizontally transmitted by the same plasmids harboring qnr genes (22, 23). In this study, 85 (42.5%) of 200 isolates were recognized as esbl - producing e. coli . Furthermore, the prevalence of esbl - producing e. coli was high, especially in hospitalized patients . More than 70% of esbl - producing organisms were blatem- and/or blashv - positive . In a study conducted in mashhad, iran, the prevalence of esbl - producing e. coli and k. pneumoniae were 15.62% and 20%, respectively (21). In contrast, our results suggested that there is evidence of a higher prevalence of esbl - producers . In 2007, in a study in mashhad, the rate of esbl - producing e. coli was reported to be 57.5%, which was higher than the rate of esbl - producers in our study (24). In contrast, a study investigating the molecular pattern of esbl - producing k. pneumoniae in kashan reported that shv1 was the most frequent genotype (26). In the present study, the most prevalent gene among all isolates was qnra, followed by qnrb and qnrs . In a similar study in iran, qnra and qnrb, there have not been any previous reports of the qnrs gene in esbl - producing organisms in iran . Qnr gene frequency in esbl - producing e. coli varies by country . In egypt, qnrb1, qnra1, and qnrs were reported in 23.3%, 16.6%, and 16.6%, respectively, of 30 esbl - producing e. coli isolates (27). In morocco, among 39 esbl - producing enterobacteriaceae isolates, 14 (36%) were positive for qnr (qnra: 10%; qnrb: 23%; and qnrs: 3%) (28). In a study in kuwait, low prevalence was reported for qnr determinants in esbl - producing enterobacterial isolates . In this study, among 64 esbl - producing enterobacteriaceae, only two enterobacter cloacae and one citrobacter freundii isolates were positive for the qnrb - like gene, whereas no qnra - like or qnrs - like genes were detected (29). In the usa, among 313 ceftazidime - resistant enterobacteriaceae isolates, 23% were positive for either qnra or qnrb, while qnrs was absent (12). We found that in some of our isolates both qnr and esbl genes were detected . There are many reports on qnr and esbl gene insertion into the same plasmid that are consistent with our findings (15, 30). In korea, qnrb (subtype b4), shv12, and dha-1 were the most frequent genes in k. pneumoniae . Korean researchers found that shv-12 and dha-1 were co - produced with qnra1 and qnrb4 (31). In a taiwanese hospital, all qnr - positive esbl - producing e. cloacae isolates possessed the bla shv-12 and qnrb2-like genes (32). In this study, we found that tem was the most prevalent esbl gene and was co - produced with qnra as dominant qnr determinants . Resistance in these isolates could be caused by other resistance mechanisms, which are noted in previous studies (33). In our study this could occur because of insertion into the same plasmid, which can be easily transmitted to other organisms and increase the number of multidrug - resistant isolates . The high prevalence of quinolone - resistant genes at imam reza hospital of mashhad indicates antibiotic resistance, which is a major concern . Hence, the antibiotics prescription policy should be revised, and infection control measures should be improved.
|
The incidence of colorectal cancer (crc) is increasing and is now the fourth leading cause of cancer deaths worldwide . Twenty percent of the patients present with synchronous liver metastases and another 3040% develop liver metastases during followup . Hepatic resection remains the only potentially curable treatment and is now offered to 2025% of the patients whereas only 10% were selected for this treatment ten years ago . The main exclusion criteria for liver resection of colorectal liver metastases (crlms) are nonresectable liver metastasis (tumor growth into both portal branches and/or into both left and right liver vein), inadequately functioning residual liver parenchyma, or nonresectable extrahepatic disease . Close followup after primary crc (early detection of metastasis), implementation of new surgical techniques including two - stage hepatectomy with portal vein embolization [4, 5] and transplantation methods, and the introduction of new chemotherapy and biological agents capable of converting inoperable cases to a resectable status by tumor downsizing have increased the number of patients eligible for resection of liver metastases [6, 7]. As a consequence, reresection of patients with recurrent disease is now offered to an increasing number of selected patients [8, 9]. A cohort of 239 patients with crc and synchronous or metachronous crlms eligible for liver resection with curative intent was followed from 2002 to 2011 . The aim of the study was to examine overall and disease - free survivals related to number of resections, therapeutic downsizing, surgical technique, and other factors considered to have prognostic value . All patients were considered preoperatively by a multidisciplinary team . The assessment included computed tomography (ct) of the abdomen and chest with the addition of magnetic resonance (mr) or ultrasonography with contrast when resectability could not be determined after ct . Positron emission tomography (pet) became available in 2009 and was used to assess extrahepatic disease in selected cases . Intraoperative contrast - enhanced ultrasonography (ceu) was used in every procedure after 2007 to assess resectability and tumor expansion as previously described . Preoperative carcinoembryonic antigen (cea) levels were determined in all patients in the most recent 5-year period . Laparoscopic resection was introduced during the last 4-year period for selected patients with small, subcapsular lesions or lesions in the lateral or lower segments (segments ii, iii, ivb, v, and vi). The term two - stage hepatectomy was used where the first surgical step included nonanatomical resection on one side combined with postoperative portal vein embolization of the most affected side, followed by a second step with formal resection of the side with remaining disease . Information was retrieved from medical records, including operation, radiology, and pathology reports . Followup was performed in our outpatient clinic at 4, 8, and 12 months and from the second postoperative year at 6-month intervals for a total of 5 years . Size of the largest tumor and number of metastases were used to compare tumor load between subgroups and the tumor load was calculated by points based on the worst score for each parameter in the basingstoke predictive index (8 points if diameter of the largest tumor> 10 cm; adapted to 8 points / cm and 4 points if> 3 metastases; adapted to 1 point / number of metastases and multiplied by 10 to produce a score where size and load are equally representative). We assessed our results against established risk factors reported by others [1214] (see supplemental figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2013/727095). Filemaker pro 9.0 (santa clara, ca, usa) was used to register data that were analyzed in spps 16.0 (chicago, il, usa). Kaplan - meier plots and log - rank (mantel - cox) comparisons were used to compute cumulative survival data . Group means were compared using student's t - test if the variables passed a normality test; otherwise medians where compared with rank - sum test . The study and database were approved by the oslo university hospital data protection officer for research . Patients undergoing surgery for crlms (adenocarcinoma) were registered partly prospectively and partly retrospectively in a database from october 2002 to august 2011 . In the study period, a total of 268 patients were initially included . Of these, 27 patients were deemed inoperable intraoperatively due to extensive hepatic or extrahepatic metastatic disease and excluded from the study . Five of these patients were scheduled for two - stage hepatectomy but were inoperable at the 2nd surgical step . In addition, two patients in the original database received liver transplants and were excluded resulting in a total of 239 patients analyzed in the present study . The cohort of 239 patients with metastatic colorectal cancer patients resected for liver metastasis was examined for overall and disease - free survivals . Liver resection of the crlms was successfully accomplished in 90.7% (n = 214) of the planned single - stage procedures and in 83.3% (n = 25) of the planned two - stage procedures (mean age 64.3 years, range 2689 years; 118 females; table 1). A total of 353 surgical procedures were registered in the cohort, representing primary resections (n = 239), secondary resections (n = 65), and tertiary resections (n = 21); 2nd step of two - stage hepatectomy (n = 25) and 2nd step of single - stage surgery converted to two - stage without embolization (n = 3; see supplemental table s2 for details of the surgical procedures). In 16 patients with rectum cancer (after 2008), a liver - first approach was chosen . Intraoperative mortality was zero; however three (1.3%) died within 30 days after the surgical procedure (day 17, 29, and 29, resp . ). At a median observation time of 24 months (range 1108 months by october 2011) 99 of the 239 patients (41.1%) were alive and disease - free, and 64 (26.8%) of the patients were alive with recurrent disease and were currently receiving palliative treatment or were undergoing evaluation for re - resection . Furthermore, 66 of the patients (27.6%) had died of the disease and 10 (4.2%) had died of unrelated reasons or of unknown cause . The cumulative overall 5- and 9-year survivals were 46.0 and 34.9%, respectively, and comparable to that of other centers (36 to 58% and 23 to 36% for 5- and 10-year survivals, respectively [12, 13, 1823]). The disease - free survivals were 24.0 and 20.0% for 5- and 7-year follow - up periods, respectively (figure 1(a)). The locations of recurrent disease are presented in supplemental table s3 and show a shift in target organ as the disease continues to recur . In the observation period 146 patients presented with a second recurrent disease and surgery with curative intent was performed in 65 (44.8%) of them . A third recurrent disease presented in 69 patients and surgery with curative intent was performed in 21 (30.4%). Overall survival appeared to be the same after the first, second, and third resections and the disease - free survival was similar in the groups resected once and twice (figure 1(a)). Furthermore, survival after the second resection was comparable independently of whether the location of the recurrent disease was to the liver, lung, or elsewhere (figure 1(b) and supplement table s3). The average time from surgery of the primary tumor to resection of the first crlm was 11.7 months; the average time from surgery for the crlm to the presentation of a second recurrent disease (irrespective of localization) was 10.1 whereas the mean time from the second to the third recurrence was 11.0 months . Preoperative (neoadjuvant) chemotherapy was given to 46.9% of the patients (n = 112, table 1). The indications for neoadjuvant chemotherapy changed during the study period . In the first 5-year period (20022006, n = 24; 32.9%), neoadjuvant therapy was primarily given to nonresectable patients . In the last 5-year period (20072011, n = 88; 53.0%), the indications were broader and included patients with high tumor load (3 or more metastases or large metastasis above 30 mm (diameter) or synchronous metastases) and from january 2010 young patients with elevated cea and ecog performance status 0 - 1 . The cumulative overall 5-year survival of patients receiving neoadjuvant chemotherapy was 36.1% versus 52.6% in the nonneoadjuvant group (p = 0.008) whereas survival between the two groups appeared similar during past 80 months (figure 2(a)). The 5-year disease - free survival was 21.0% in the neoadjuvant group versus 26.5% in the non - neoadjuvant group (p = 0.025). Tumor load was significantly higher in the neoadjuvant group (figure 2(a), insert). Stratification of neoadjuvant chemotherapy combined with tumor load revealed that the survival in patients with high tumor load receiving preoperative chemotherapy was increased compared to that of patients not receiving chemotherapy . In contrast, patients with low tumor load who did not receive neoadjuvant chemotherapy had increased survival compared to the survival of those who received chemotherapy . Five of them (16.7%) were inoperable at the second surgical step and excluded from the study and results . Patients selected for two - stage hepatectomy had a higher risk of developing recurrence as all patients in this group presented with recurrent disease within 2 years compared to a 60.7% recurrence in patients subject to a single - stage procedure in the same time interval (figure 2(b)). Nonetheless, the overall survival in the group that received two - stage hepatectomy appeared comparable to that of the single - stage procedure group with the limited data available . Of the 25 patients who underwent the two - stage procedure, six (24.0%) were alive with a mean observation time of 17 months (range 645) and were reported to be disease - free at the time of examination of the cohort . Since the introduction of laparoscopic resection in 2008, 60 patients have been selected for this procedure of which 48 were successfully completed (20.0% conversion rate). In addition, the first step of planned two - stage surgery was performed laparoscopically in two patients . Patients selected for a laparoscopic approach had a better outcome than patients selected for open surgery (figure 2(c)) and lower tumor load (insert). Primary tumor lymph node status, histological differentiation grade, synchronous or metachronous disease, tumor size (metastasis), numbers of metastases, affected liver segments, and cea levels turned out to be prognostic markers affecting survival (supplemental figure s1). Furthermore, we found ascending age to be a positive prognostic marker for disease - free survival (figure 3(a)). In contrast, examining the overall survival, we observed an apparent higher mortality in the older patient group . Extrahepatic disease (n = 19, figure 3(c)) and positive hepatic resection margin (r1/r2, n = 31, figure 3(b)) impaired disease - free survival . However, overall survival was not affected by resectable extrahepatic disease or positive resection margins . In the present material, men had better overall outcome and rectum cancer correlated positively with overall and disease - free survivals (supplemental figure s1a and b). Surgical treatment of crlms is offered to an increasing number of patients with metastatic crc . This has opened several new avenues in the treatment of this patient group, and as a consequence fundamental questions in tumor biology and clinical strategies are now being challenged . Recent reports on survival following re - resection of crlms and resection of extrahepatic metastases support a more aggressive treatment practice [8, 2527]. Neoadjuvant chemotherapy to downsize crlms increases the number of resectable cases and provides the opportunity to target a larger patient population . In the present study patients who received neoadjuvant chemotherapy to downsize crlms reached a long - term overall survival comparable to that of primary resectable patients, despite widespread disease . It is, in this connection, important to note that tumor load calculations were performed based on information in the pathology reports and are therefore postneoadjuvant chemotherapy which means that they underreport the initial tumor load . Here we report that second and third resections of recurring crlms should be considered when possible and that resection also should be assessed in patients with extrahepatic recurrences as their prognosis does not appear to be worse, but for strict recommendations randomized clinical trials would be needed . Patients selected for laparoscopic approach had a better outcome than patients selected for open surgery (figure 2(c)), which may be related to the selection criteria and tumor load . A recent report indicates laparoscopic results comparable to those of open surgery when the selection criteria are identical for the two procedures . Females are reported to have a better prognosis after liver resection for crlms than males and colon cancer to have better prognosis than rectum cancer . However, in the present material, men had better overall outcome and a primary rectum cancer correlated positively with overall and disease - free survivals (supplemental figure s1a and b). The latter may reflect observations that neoadjuvant radiochemotherapy and a more radical surgical technique, total mesorectal excision (tme), have improved survival after treatment for rectum cancer . Ascending age has been reported to be both negatively and positively correlated with survival [12, 14, 29]. We found ascending age to be a positive prognostic marker for disease - free survival (figure 3(a)), which may be related to more aggressive tumor biology in younger patients . A higher proportion of the young patients presented with recurrent disease and the recurrence occurred more rapidly than in older patients . Interestingly, the overall survival curves were inverted compared to disease - free survival with respect to the different age groups (figure 3(a)). This could be explained by increased surgical and adjuvant efforts towards young and otherwise healthy patients . If this is the case, this in itself could be proof that an aggressive approach could produce long - term survivors . Recent genetic and molecular studies of metastatic malignant disease indicate that metastases often develop in parallel to the primary tumor from an early stage, and that the tumor biology of the metastases is not necessarily more aggressive than that of the primary tumor [30, 31]. Previous studies addressing the growth rate of various malignant tumors including crc indicate that the tumor volume doubling time (tvdt) of the metastases is comparable to that of the primary tumor . This may suggest that metastases identified late and removed in re - resection procedures could represent tumors that were not recognized at the time of surgery of the primary tumor or the first metastasis due to their small size, rather than progressively developing and increasingly aggressive metastases . In our cohort, this may be reflected in the observation that overall survival and oncologic outcome were comparable in patients with successful outcome of the first resection and those who required a second or third resection . In line with this thinking, recurrent disease may be a misnomer as the disease may not be recurring but continues to deliver earlier established metastases growing in parallel and reaching a size that allows diagnosis at different time points following the primary surgery . Thus, resection of metastases may in many cases represent incremental tumor - reductive surgery rather than treatment of recurrent disease . This may also help to explain why the discrimination between r0 and r1/r2 resections of crc metastases is not crucial with respect to overall survival (our data and). These findings are in contrast to expected results from current scoring systems [12, 14]. In conclusion, metastatic disease is systemic or multifocal in its nature and may encompass unrecognized foci at the time of surgery in most if not all patients irrespectively of the presentation at diagnosis . Eradication of all tumor tissue may therefore not be conceivable in the majority of the patients . However, this recognition should not preclude an aggressive treatment approach with repeated resections that continue to reduce tumor load . Extrahepatic metastatic spread has previously been considered an end - stage disease . In recent years, however, combined liver and lung resections have produced long - time survivors . Six patients in our cohort presented with concomitant pulmonary lesions with uncertain malignant potential; resection of crlms was performed with a wait and watch approach taken with respect to the development of pulmonary metastases . In four patients the pulmonary metastases progressed but were accessible by lung resection and three of these were alive and had remained disease - free until the time of examination of the cohort . It is also interesting to observe that patients resected for recurrent disease to the lung after first having performed hepatic resection had comparable and maybe even better survival compared to those repeatedly resected for recurrent disease in the liver, and as such, pulmonary metastases may not be a sign of an explosive metastatic spread . The presented results indicate that surgical treatment, when possible with or without neoadjuvant treatment, significantly prolongs life and may in some cases cure the disease, even when extensive . Hence, efforts to identify or induce technically resectable cases are crucial and include early detection of metastatic spread, improved surgical techniques, and neoadjuvant chemotherapy to downsize the metastases . Patients that become resectable after neoadjuvant therapy appear to reach the same survival rate as that of as patients that are primary resectable . Furthermore, neoadjuvant therapy may also be used for selection of patients with the best prognosis after surgical resection, as patients that progress during ongoing treatment will probably not benefit from surgical treatment . The present report adds to the current knowledge base of the outcome of an aggressive treatment approach to metastatic crc . Although metastatic crc has a poor prognosis, surgical treatment has clear patient benefit and strategies to make patients resectable and available for surgery should be pursued.
|
Low birth weight (lbw) is one of the most important predictors of the health and survival of the infant . Lbw and preterm babies are particularly vulnerable to illness and death during their initial years of life . Lbw infants suffer more episodes of common childhood diseases like diarrhea, respiratory infections and the spell of illness is more prolonged and serious and often leads to hospital admission compared to normal birth weight (nbw) infants . In 2013, nearly 22 million newborns an estimated 16 per cent of all babies born globally that year had lbw . The problem of lbw babies is more serious in india and other south east asian countries . National family health survey 3 in india estimated that out of all the newborns who were weighted at birth 22% of them were lbw . High percentage of lbw babies among the newborns is reflected on the heath of neonates and infants in india with high mortality and morbidity in these age groups and lbw being one of the main causes of neonatal and infant deaths in india . Longitudinal studies are useful to observe the health and disease pattern of lbw babies over time . These types of studies reveal the velocity of growth, duration of illnesses, mortality etc ., of lbw babies in comparison to nbw babies . In rural india, incidence of lbw babies are more (23.3%) than the urban areas (19.3%). These babies grow with many added disadvantages which hamper their growth and development in the most crucial years of life . But there are few longitudinal studies involving rural lbw infants in our country especially in this region . Therefore, this longitudinal study was carried out in rural areas of assam to assess the morbidity pattern of lbw babies during their first 6 months of life and to compare them with nbw counterparts . The study was undertaken in boko - bongaon development block, kamrup district of assam . It was a rural block situated about 85 km west of guwahati city and connected by national highway no-37 . For our study we purposively selected 30 lbw babies (0 - 2 months) and equal numbers of nbw babies of the same age group (total 60 infants) over three subcenter areas under boko phc . Then from each subcenter we selected 10 numbers of lbw babies and equal numbers of nbw babies from subcenter registers who fulfilled our inclusion criteria . Then they were tracked to their homes with the help of local community level health workers and their parents were interviewed . The infants were followed up in monthly intervals till 6 months of age . During the follow up, the infants were clinically examined, anthropometric measurements were taken and predesigned pretested questionnaires were used to obtained information from the parents . Schedule was pretested in three village of the same block with 25 infants . Any available medical records like doctor's prescription, hospital discharge certificate, laboratory investigation reports were also examined for data collection . Inclusion criteria: all singleton infants, whose parents were permanent residents of the study area and gave informed consent to be part of the study and who were available for the follow up for 6 months . Exclusion criteria: multiple births, infants not available for follow up for 6 months, those infants whose birth weight was not known, infants with major congenital malformations, severe birth asphyxia and chromosomal anomalies were excluded from the study . Considering the level of significance at 5% and power of the study 80% we have calculated the sample size taking the earlier prevalence p1 = 87% and p2 = 51% among the two groups . Calculated sample size considering 10% nonrespondents and loss to follow up we decided to take 30 infants in each follow - up group . Important definition we used for morbidity status of the infants where there was no available medical records: acute diarrhea: infant was considered to be suffering from diarrhea if she / he passed liquid or watery stool more than three times a day or in case of young infants if the stools had changed from usual pattern and were many and watery (more watery than fecal matter) or a recent change in consistency or frequency of stool . Acute respiratory tract infection (ari): an infant was considered to be suffering from ari when she / he had running nose, cough with or without fever, fast breathing, and difficulty in breathing with or without chest in drawing during the recall period . Ear infection: history of discharge from ear and swelling or redness in and around the ear was taken as ear infection . Skin infection: an infant was considered to be suffering from skin disease if she / he had localized skin eruption (papule, pustule), itching, umbilical redness and draining pus . Eye infection: an infant was considered to be suffering from eye infection if mother gave history of reddening of eye, watering or discharge . Ethical clearance was obtained from medical college ethics committee and written informed consent was taken from each participant . The data were entered in ms excel 2007 software and statistical analysis was done in spss 17.0 software . Among the 30 lbw infants, there were 17 males (56.7%) and 13 females (43.3%). Majority of the lbw babies belonged to the joint family (66.7%). Among the mothers, 20% were illiterate and 60% of the mothers were hindu by religion . The study revealed that out of the 30 mothers 8 were primipara (26.7%) and teenage mothers . Out of 30 women, 2 (6.7%) were unregistered for antenatal care during the pregnancy and 23% of the women had less than 4 anc during pregnancy . But no significant statistical association could be found between age of the mother, education and parity of mother, numbers of anc visits, and type of family with the birth weight of baby . Ari, diarrhea, skin infection, fever and ear infection were the common morbidities among the infants . Table 1a shows that incidence of ari was highest among all the morbidities in both nbw (8 episodes) and lbw infants (12 episodes) during first 2 months of age . On comparison the incidence of all the morbidities were found to be higher among the lbw infants (61.2%) than the nbw infants (38.8%). Study subjects according to morbidity pattern at 2 months of age during 3 and 4 months of age, episodes of morbidities were higher among the lbw infants (62.5%) than the nbw infants (37.5%). Ari remained the morbidity with highest incidences (24 episodes) in both nbw and lbw infants [table 1b]. During 5 and 6 months of age, more episodes of morbidities occurred in the lbw group (54.5%) than the nbw group (45.5%). Ari was the predominant morbidity (18 episodes) in this age group followed by diarrhea (8 episodes) and skin infection [table 1c]. Study subjects according to morbidity pattern at 4 months of age study subjects according to morbidity pattern at 6 months of age during the follow - up period of 6 months it was seen that lbw infants had more episodes of hospitalization (65%) than the nbw infants (35%). Out of the 30 lbw infants, 26 were exclusively breast fed up to 6 months of age . Among them incidence rate of morbidity was found to be 43.5 per 100 infant months . While four lbw infants were not exclusively breast fed till 6 months of age and among them incidence of morbidity was found to be highest (incidence rate of 66.7 per 100 infant months). Among the nbw infants 23 those infants who were of nbw at birth and were exclusively breast fed till 6 months of age had fewer incidences of morbidities (incidence rate of 42.8 per 100 infant months). At 6 months of age, 77.4% of lbw infants were found to be underweight, while 22% of nbw infants were also underweight at 6 months of age [table 2]. On calculating relative risk (rr) for under nutrition it was found that lbw babies were at 3.74 times greater risk of under nutrition in first 6 months of age compared to nbw counterparts . Distribution of lbw and nbw infants according to their nutritional status at 6 months of age incidence rate of episodes of morbidity was found to be highest among those lbw infants who remained underweight (<2sd) during the follow - up period (incidence rate of 49.3 per 100 infant months). Among the nbw infants, incidence rate was high among the underweight infants (incidence rate of 42.8 per 100 infant months). While the lowest incidence rate of morbidity was among the nbw infants who were of normal weight at 6 months of age [table 3]. The present study revealed that during the follow up, the incidence of morbidities were higher among the lbw babies compared to nbw babies . The illnesses suffered by the infants during the follow - up period were ari, diarrhea, skin disorders, fever and ear disorders . Similar studies in india have found that diarrhea, ari, fever of short duration, and sore eyes were the common illnesses in infancy . The present study observed that ari was the predominant morbidity in the lbw infants during first 6 months of their age . Sharma et al . Also found that prevalence of ari was higher among lbw babies and showed a strong association, as compared to nbw babies . Similarly, jackson et al . Observed that lbw was a significant risk factor for ari . Our study also found that lbw infants had more episodes of morbidities compared to nbw infants . Observed that there were increased morbidity episodes in infants who were term and birth weight below 3 percentile for their gestational age . Barros et al . Too found that preterm and lbw babies presented with increased morbidity during infancy . The present study found that during the follow - up period up to 6 months of age, lbw infants had more episodes (65%) of hospitalization than the nbw infants . Paul et al . Also in their follow - up community - based study in an urban slum of kolkata found that hospitalization rates were more in lbw infants than in nbw infants during first year of life . The incidence rate of episodes of morbidities was found to be highest among lbw infants who were not exclusively breast fed up to 6 months of age . Among the exclusively breast fed infants the incidence rate was higher among lbw infants than the exclusively breast fed nbw infants . A similar study in south india showed that breast feeding protects against overall morbidity and acute respiratory illness among children who were exclusively breast fed for 6 months . Also found that lbw infants who were exclusively breast fed till 4 months of age had lower risk of morbidities than those who were not exclusively breast fed . Oddy et al . And lamberti et al . Also had similar findings in their studies . The study also found that during first 6 months of age most of the lbw babies remained underweight and incidence rate of episodes of morbidity was highest among those lbw infants who remained underweight at 6 months of age . Motta et al . Also found that lbw was an important risk factor of nutritional risk at the end of the first year of life . Our study used purposive sampling instead of random sampling and there might be some selection bias . Frequency of the follow up was another limitation; we followed up the infants in monthly intervals instead of biweekly follow up due to lack of resources . Our study used purposive sampling instead of random sampling and there might be some selection bias . Frequency of the follow up was another limitation; we followed up the infants in monthly intervals instead of biweekly follow up due to lack of resources . Out study findings indicated the vulnerability of lbw babies during the infancy to various infections, morbidities and malnutrition . Though the study had many limitations the study findings like increased incidence of morbidity, malnutrition and increased hospital admission among the rural lbw infants compared to nbw infants point to the need of special care to those vulnerable infants . Health education to parents, regular follow up of lbw infants through trained health workers and training of grass root level health workers on care of lbw babies are some measures which should be implemented.
|
Mesoporous semiconductor oxide electrodes are used in different applications including electrochemical sensing, electrochromic devices and photoelectrochemical generation of fuels or electrical energy . All these applications rely on the external manipulation or tracking of the charge transfer between an optically and/or chemically active layer and an external contact . The macroscopic rate of charge transfer between the mesoporous film and a conductive substrate is the result of a sequence of intermingled microscopic processes . These processes, which are associated with carrier generation, recombination, transport and transfer, take place on different time scales and compete kinetically with each other . Due to a high concentration of trap states electron transport in mesoporous semiconductor oxide films is orders of magnitude slower than in single crystals . In photoelectrocatalytic and photovoltaic applications electron collection at the external contact competes with charge recombination in the bulk of the semiconductor and at the interfaces within the porous film, limiting solar conversion efficiency . The use of electrochemical doping (charge transfer reductive doping), where electron / proton or electron / li pairs incorporated within the oxide passivate the electron traps, is a very efficient way to temporarily improve photoelectrochemical activity, and as such, constitutes an elegant way to improve charge separation within these materials . Although many efforts are being pursued in this direction, a comprehensive study of these electronic defects is still missing . To reach such a level of understanding, one needs to carefully identify the nature of the recombination centers and transport - limiting traps in mesoporous semiconductor electrodes, which is a significant challenge for both experimentalists and theoreticians . It is well established that the fundamental processes associated with the transport, transfer, and recombination of photogenerated charge carriers in mesoporous semiconductor electrodes are determined by both the distribution of band gap states and their population, i.e., the position of the fermi level within the film . Electrochemical methods such as cyclic voltammetry and electrochemical impedance spectroscopy have proven useful in characterizing electronic states in nanostructured semiconductor oxide electrodes, though the chemical nature of the traps remains controversial . Specifically, charge / discharge measurements provide information on the distribution of electrochemically active states in mesoporous electrodes, where electron accumulation is compensated by the adsorption of ions at the oxide surface . For tio2 electrodes in an aqueous acidic electrolyte the generation of ti centers is compensated by proton uptake (eq 1)1importantly, in the case of small cations (such as h or li), charge injection and compensation not only take place at the semiconductor / electrolyte interface, but can become a three - dimensional process via insertion of ions into subsurface regions of the nanocrystals . The reversibility of this charge accumulation opens up the possibility of driving fast reduction reactions at the semiconductor / electrolyte interface . On the other hand, electrochemical doping was found to modify, at least temporarily, the electrode performance in different applications ranging from dye - sensitized solar cells to photocatalysis and supercapacitors . The doping of mesoporous tio2 electrodes with li (which is isovalent with h) has recently been demonstrated to enhance electron transport and improve efficiency in perovskite solar cells . Whereas different studies discuss an increase of the electrode performance upon electrochemical doping phenomenologically by accelerated charge transport and reduced recombination, the underlying microscopic details remain to be elucidated . For tio2, theoretical studies have recently addressed at the single particle level the geometry and energetics of electron trap states in the bulk and at the semiconductor / electrolyte interface . Deep electron traps located at the grain boundary are found to slow down charge transport unless high current densities ensure a high average occupation of transport - limiting traps . Such trap filling effects have recently been highlighted for deep traps in oriented tio2 nanotube arrays by dynamic photocurrent measurements . In addition, these states may act as recombination sites exerting a further deleterious impact on the photocurrent . The high structural and electronic complexity of mesoporous semiconductor oxide electrodes makes an investigation of the nature, concentration, and location of electronic trap states and the elucidation of their impact on charge recombination and transport very challenging . Designing appropriate model systems to understand the action of these states is difficult . Indeed, their complexity must be high enough to realistically mimic processes in technologically relevant materials, but low enough to result in clear structure activity relationships that can be supported by both experiments and theoretical modeling . In this work, we combine first - principles theoretical calculations with the electrochemical characterization of nanostructured rutile tio2 films to demonstrate that particle / particle interfaces introduce deep traps . These interfaces represent favorable locations for proton segregation, which can be induced by the electrochemical doping of the porous electrodes . A long lasting (hours to days), but reversible accumulation of electrons and protons (i.e., e / h or h doping) at the interface is tracked by cyclic voltammetry via the shift toward more positive potentials of a pair of capacitive peaks, which is associated with trap states at the particle / particle interface . The passivation of recombination centers by e / h doping leads to a transient photocurrent enhancement due to improved electron / hole separation for those electrodes, which are characterized by a high concentration of particle / particle interfaces (i.e., random particle networks). For electrodes lacking a high density of particle / particle interfaces (i.e., arrays of oriented nanocolumns) this study highlights the importance of particle / particle interfaces in mesoporous films and provides strategies to actively manipulate the density of electronic states and their population by electrochemical methods . The resulting long - lasting (> 15 h) improvement of photoelectrode performance after electrochemical doping is explained by using theoretical calculations that are in qualitative agreement with experiments . Slurries of rutile tio2 nanoparticles (sachtleben, nano rutile) were prepared by grinding 1 g of tio2 powder with 3.2 ml of h2o, 60 l of acetylacetone (99+%, aldrich), and 60 l of triton x (aldrich) and were spread with a glass rod onto fluorine - doped tin oxide (fto) conducting glass (pilkington, tec 15, resistance 15 /) using scotch tape as a spacer . Alternatively, ti foils (goodfellow, 99.6+%, 250 m) were used to investigate a possible impact of the substrate type on the electrochemical and photoelectrochemical properties . However, the nanoparticle (np) films were annealed and sintered for 1 h at 450 c in air . After sintering a film thickness of 3.5 2.0 m was determined by scanning electron microscopy (sem). The films are formed by a random network of elongated particles with a length of 50 nm and a width of 20 nm (figure s1a, b and ref (33)) and are of pure rutile phase (figure s2). As shown in a previous study, furthermore, it was estimated that a high fraction of the exposed surface is formed by (110) facets . Electrodes formed by a rutile tio2 nanocolumn (nc) array were prepared using a hydrothermal synthesis . Concretely, 21.6 ml of a 6 m hcl solution were mixed with 360 l of tetra - n - butylorthotitanat (98%, merck millipore). The solution was placed in a teflon - lined steel autoclave (45 ml, parr instruments) containing fto substrates and was heated to 150 c for 15 h. after synthesis, the electrodes were thoroughly rinsed with water . These films consist of rutile tio2 nanocolumns with a rectangular cross section and with a width of 80180 nm and a length of 1.5 m (figures s1c, d and s2). As highlighted previously, individual nanocolumns are porous and consist of a bundle of oriented and single crystalline nanowires with a diameter of 1020 nm . The nanowires are elongated along the direction and are expected to expose (110) facets at the surface . The endings of the nanowires can be observed at higher magnifications at the top parts of the nanocolumns (inset in figure s1c). For both types of electrode the contact area and the uncovered parts of the substrate were finally sealed by epoxy resin . Spin polarized density functional theory (dft) calculations are performed using the projector augmented wave formalism as implemented in the vienna ab initio simulation package . The 3d and 4s electrons of ti, and the 2s and 2p electrons of o are treated as valence electrons and expanded in a plane wave basis with energies up to 500 ev . Ernzerhof exchange correlation functional and correct for the self - interaction error (sie) for electrons by employing a dft+u approach . The hubbard u parameter for the ti 3d - states is taken from previous work which fitted to spectroscopic properties of surface oxygen vacancies (uti = 4.2 ev). We also employ a hubbard u term to correct the sie on o 2p - states (uo = 7.5 ev) in order to make the results transferable to future calculations which will consider electrons and holes . However, we note that the addition of a hubbard u term on o does not affect the calculated trapping energies reported in the present work . For the conventional cell of rutile a 6 6 9 monkhorst pack k - point grid is used and structural optimization is performed until forces are less than 0.01 ev / . Using the perdew burke ernzerhof exchange correlation functional we obtain lattice parameters within 2% of experiment (a = 4.67 and c = 3.03). To investigate the interaction of electrons with the grain boundary defect, we attempt to localize an electron polaron at all inequivalent ti sites within the grain boundary supercell . To achieve this, we create a precursor potential well for electron trapping by displacing nearest neighbor anions away from a particular ti site by 0.1 followed by full self - consistent optimization of the structure . In cases where this displacement procedure alone is insufficient to direct the self - consistent optimization into the desired charge localized metastable state, we manually set the orbital occupancy using a modification to the vasp code developed by allen and watson . However, we stress that in all cases the resulting metastable states are fully and self - consistently optimized . For calculations involving charged defects (such as electron polarons), overall neutrality to identify prospective proton incorporation sites in the grain boundary supercell, we make use of the fact that protons will form a bond with lattice oxygen ions at a distance of approximately 1.0 . We computationally identify the set of positions within 1.0 0.1 of each lattice oxygen ion . We further reduce the number of possible proton positions by identifying the proton positions around each oxygen ion that has the lowest electrostatic potential (thereby representing the most favorable position for the proton on electrostatic grounds). In this way, we can readily obtain a large number of prospective proton positions, which provide the initial coordinates for full geometry relaxations . Using this procedure, inequivalent proton sites with the this procedure is straightforward to implement and may, with suitable modification, be applicable to modeling protons in low symmetry structures (such as nanoparticles or surfaces) in a wider range of oxide materials . Rutile tio2 nanoparticle (np) electrodes (consisting of a random network of tio2 particles, figure s1a, b) and nanocolumn (nc) electrodes (consisting of an array of oriented nanocolumns, figure s1c, d) have been used in the present study as model systems for investigating the effect of nanocrystal organization and interconnection on electrochemical and photoelectrochemical properties . The voltammetric response of a rutile tio2 np electrode is characterized, in the absence of significant faradaic currents (i.e., in 1 m methanol/0.1 m hclo4 aqueous solution purged from o2), by a charge accumulation region at low potentials (figure 1a). The photocurrent onset potential, which yields an estimate of the conduction band edge position in the semiconductor, lies for this electrode at eag / agcl 0.5 v (figure s3a). Cvs for rutile tio2 np (a) and nc (b) electrodes before and after an electrochemical doping at eag / agcl = 0.6 v for 3 h. for the np electrode the effect of subsequent polarization for 15 h at 0.8 v (dedoping) is also shown . Previous analyses of the density of electrochemically active band gap states in mesoporous tio2 films by cyclic voltammetry and electrochemical impedance spectroscopy have demonstrated the presence of a broad exponential distribution of states below the conduction band edge in the accumulation region in the case of anatase electrodes, which is absent in rutile tio2 films . Currents in the accumulation region (eag / agcl <0.25 v, figure 1) of rutile tio2 electrodes have been attributed to the population / depopulation of electronic states in the conduction band compensated by proton adsorption at the oxide surface . However, for both tio2 modifications, a narrow distribution of deep trap states is typically present and gives rise to a pair of capacitive peaks in the cyclic voltammograms (cvs), which is also observed on rutile tio2 np electrodes (figure 1a). 0.13 v and lie thus 0.30.5 v below the conduction band edge of the semiconductor . In the following, we will focus in detail on the intensity of these signals and on the energetics of the associated trap states in mesoporous films featuring different morphology (i.e., np versus nc films) and will follow their modification upon electrochemical doping . The corresponding signal is much less pronounced for the rutile tio2 nc electrode (figure 1b) as compared to the np electrode (figure 1a). Previous studies reported that for both ordered one - dimensional nanostructures and single crystal electrodes, the peaks are virtually absent, whereas they show a high intensity for thin film electrodes consisting of random nanoparticle networks . In line with previous interpretations, we assign the couple of capacitive peaks observed for the np electrode to the contribution of electron traps at particle / particle interfaces . Interestingly, the contribution is asymmetric, the anodic peak being much broader than the cathodic peak (figures 1a and s4a). Slow kinetics for h extraction (compare eq 1) or a change in the electrode conductivity may contribute to this effect . The cvs in figure 1 were obtained by applying to the electrode a linear potential profile with a scan rate of 20 mvs . Importantly, at fast scan rates, it is possible that not all of the deep traps in the mesoporous film are equilibrated with the fermi level of the conducting substrate . This is the reason why even large perturbation techniques such as cyclic voltammetry may yield for deep trap states only apparent chemical capacitances . Therefore, we performed charging and discharging measurements using extremely long lasting perturbations in the potential range featuring the capacitive peaks (figure s5). We measured the capacitive currents upon stepping the electrode potential in potential steps eag / agcl = 0.02 v first from 0.2 to 0.2 v (charge accumulation) and then from 0.2 v back to 0.2 v (charge extraction). After every step, the potential was kept constant for 60 s and the accumulated / extracted charge density associated with each potential step (left axis in figure s4b) was determined by integration of the resulting current transient (figure s5). To obtain the chemical capacitance associated with interface traps (right axis in figure s4b) the charge was then referred to eag / agcl . Such an analysis yields a much higher symmetry of charging and discharging branches, nevertheless, there is still an imbalance of positive and negative charge pointing to a partial irreversibility of charge accumulation . The chemical capacitance extracted from these measurements (right axes in figure s4a, b) has thus to be considered an apparent capacitance . From the total charge accumulated upon stepping the potential from 0.2 to 0.2 v (35 ccm, figure s4b), we estimate (using the average values of film thickness and particle size and assuming a film porosity of 0.5) the number of extracted charges to correspond to 25 electrons per tio2 nanoparticle . As previously reported, tio2 electrodes can be electrochemically doped by cathodic polarization . Following polarization at eag / agcl = 0.6 v significant changes are observed in the cv of a rutile tio2 np electrode (figures 1a and s4a): the peak corresponding to deep traps is displaced by 0.08 v toward more positive potentials, while a slight increase of the peak intensity is observed upon doping . The same observations are made in the absence of methanol (figure s6). Qualitatively the same conclusions can be drawn from the large perturbation charging / discharging experiment (figure s4b). Electrochemical doping induces only minor changes at eag / agcl <0.2 v, although a slight increase of the capacitive current is observed at 0.45 v <eag / agcl <0.25 v. importantly, we do not observe a shift of the photocurrent onset potential upon electrochemical doping (figure s3b) indicating that the band edges are not displaced significantly . All changes in the cvs are reversible with respect to prolonged polarization at 0.8 v (t> 15 h, figure 1a). These observations point to a dynamic and transient change of the density of electrochemically active states upon electrochemical charge accumulation in np electrodes . Importantly, no significant change of the cv is observed upon doping of a nc electrode (figure 1b). Electrochemical doping has a beneficial effect on the photoelectrochemical performance of rutile tio2 np electrodes as deduced from photocurrent transients (figures 2a and s7) and cvs (figure s8a). Concretely, the photocurrent generated by the electrode in a 0.1 m hclo4 aqueous solution containing 1 m methanol as a hole scavenger depends significantly on the electrochemical pretreatment of the film as shown in the following . First the photocurrent of a pristine electrode was recorded at eag / agcl = 0.8 v. then the electrode was polarized at progressively more negative potentials in the accumulation region corresponding to the electrochemical doping of the film . After every doping step the photocurrent was again recorded to sample the impact of doping on the photoelectrocatalytic activity of the electrode . Two doping parameters were systematically changed doping potential (figure s7) and doping time (figure 2). Whereas electrode polarization for 20 min at edop = 0.5 v induces only minor changes of the photoelectrocatalytic activity, we observe an up to 3-fold photocurrent increase when doping at edop = 0.6 v (figure s7). The photocurrent enhancement by electrochemical doping is a very slow process . Only after 4 h of polarization at 0.6 v no further changes after such a long doping time the photocurrent has experienced an increase by a factor of 7 (photocurrent enhancement factor, pcef = 7, figure 2a). Photocurrent transients recorded upon uv exposure of rutile tio2 np (a) and nc (b) electrodes before and after electrochemical doping at eag / agcl = 0.6 v for different doping times (t0.6vdop). Importantly, the photocurrent increase is reversible with respect to prolonged polarization at positive potentials (figure s8). However, even after 15 h of charge extraction (by electrode polarization at 0.8 v) the photocurrent still exceeds its initial value by 30% . These results highlight that the beneficial effect of electrochemical doping is transient, but long lasting . The relative photocurrent enhancement upon doping is much less pronounced for rutile tio2 nc electrodes (pcef = 2, figure 2b). Also in this case the beneficial effect is reversible with respect to polarization at 0.8 v (not shown). A comparison of the photocurrent evolution following the progressive electrochemical doping of np and nc electrodes is shown in the chronoamperometric profiles in figure s9 . Importantly, these results confirm that the increased current measured upon uv exposure of doped electrodes corresponds indeed to a faradaic photocurrent and does not simply result from a light - induced extraction of charges accumulated in the doping step . The additional charge transferred (after doping) from the tio2 film to the conducting substrate upon uv exposure exceeds by far the charge injected from the conducting substrate into the tio2 film upon electrochemical doping (figure s9a). From the electrochemical characterization of np and nc films we have gained the following pieces of information about the impact of electrode morphology and electrochemical doping on the density of electrochemically active states and on the photoelectrocatalytic activity: (i) for porous films consisting of a random particle network (np electrodes) a high density of deep electron traps gives rise to a couple of capacitive peaks in the cv . This signal is virtually absent in films consisting of oriented nanocolumn arrays (nc electrodes). (ii) prolonged polarization of np electrodes at eag / agcl = 0.6 v (electrochemical or charge transfer reductive doping) induces a displacement of these capacitive peaks by 0.08 v toward more positive potentials and a minor increase in the chemical capacitance at 0.45 v <eag / agcl <0.25 v. these changes are reversible with respect to charge extraction (dedoping) upon prolonged electrode polarization at eag / agcl = 0.8 v. both processes (doping and dedoping) are extremely slow (hours to days). (iii) electrochemical doping increases the photoelectrocatalytic activity of np electrodes toward methanol oxidation as sampled by a 7-fold increase of the photocurrent (pcef = 7). The activity enhancement is transient and the photocurrent relaxes slowly back to its initial value (t> 15 h). The beneficial effect of electrochemical doping is much less pronounced for rutile tio2 nc electrodes (pcef = 2). To help interpret the experimental results discussed above and provide deeper atomistic insight into the effect of protons on electron trapping we perform first - principles theoretical calculations for a model interface in nanocrystalline tio2 . In particular, we consider the (210) rutile tio2 grain boundary, the structure of which has been investigated previously both experimentally and theoretically (figure 3a). While this interface possesses a high degree of symmetry it has atomistic features which are expected to be representative of more general interfaces in nanocrystalline tio2, namely, reduced ion coordination and local strain at the interface . In a recent theoretical study, it was demonstrated that this grain boundary is associated with interfacial ti ions which can trap electrons more strongly than bulk ti lattice sites . This effect is due to local variations in the electrostatic potential near the grain boundary and changes in ion coordination and bond strain with similar effects found at tio2 surfaces.figure 4 shows the distribution of electron trapping energies (defined with respect to the energy of an electron trapped on a bulk ti site) for ti ions within 6 of the grain boundary plane . We note that at finite temperature electrons may hop between ti sites at the interface . The activation energy for electron hopping between adjacent sites was calculated previously to be about 0.3 ev in the bulk and up to 50% higher at the interface . Owing to their increased stability the equilibrium occupation of interfacial traps will remain higher than that in the bulk . Therefore, the presence of deep traps at this interface provides a semiquantitative model for the voltammetric feature of electron trapping states (pair of capacitive peaks) observed in the pristine tio2 np electrodes by cyclic voltammetry (figure 1a). As such it is a useful reference system on which to explore the interaction of protons with interfaces and the subsequent effect they have on electron trapping . For the following discussion, it is important to keep in mind that the energy scale and the electrochemical potential scale have opposite signs, i.e., a trap state becoming more stable (i.e., deeper) will be characterized by a more negative trapping energy and a more positive electrochemical potential . (a) optimized structure of the pristine (210) rutile tio2 grain boundary showing the electron spin density associated with an electron in the most stable site (isosurface shown in purple). (c) (h)(e) decorated (210) rutile tio2 grain boundary . (d) (h)(e) decorated (210) rutile tio2 grain boundary with an additional electron trapped in the most stable site . Ti sites, o sites, and h ions are represented by blue, red, and green spheres, respectively . Distribution of electron trapping energies (et) within 6 of the pristine and (h)(e)-doped grain boundary . Et is defined with respect to the energy of an electron trapped on a bulk ti site (horizontal dashed red line). All levels in the shaded region correspond to interfacial sites which are available to trap electrons more strongly than the bulk crystal (hereafter referred to as interface traps). The side panels show the spatial distribution of interface traps (highlighted by orange spheres). The ti site which already has a trapped electron in the (h)(e)-doped interface is unavailable to trap additional electrons (indicated by the light blue sphere on the right side panel). On (h)(e)-doping, the number of available interface traps is reduced by 50% (from 1.89 10 to 0.95 10 cm). Electrochemical doping of tio2 by prolonged polarization is likely to be associated with the incorporation of h ions from the aqueous solution to compensate the negative electron charge trapped at interfaces . To assess this possibility we first investigate the interaction of protons with the (210) rutile tio2 grain boundary . On introduction into the tio2 lattice protons form bonds with lattice o ions resulting in oh species . While previous theoretical studies have identified the most stable structure of the oh species in bulk rutile tio2, it is not straightforward to deduce the likely proton configurations in the lower symmetry grain boundary region . To address this problem we identify prospective positions for h incorporation based on analysis of the three - dimensional electrostatic potential and screen 80 different configurations to identify the most stable structure (see experimental section). For these calculations we consider one h ion in a supercell of dimensions 9.1046 10.439 corresponding to a density of 1.05 10 cm . The most stable h incorporation site is found at the grain boundary and is 0.6 ev more stable than in the bulk (figure 3b). The presence of h induces a transformation in structure near the grain boundary as compared to the pristine structure . In particular, one of the ti ions near the grain boundary relaxes toward the oh ion . We next investigate the interaction of electrons with the h decorated grain boundary structure identified above . By making suitable initial atomic distortions around each ti site in the supercell followed by full optimization of the total energy with respect to relaxation of all ion coordinates we obtain a series of metastable configurations corresponding to electrons trapped on different ti ions (see experimental section). The most stable electron trapping ti site is located at the grain boundary directly adjacent to the oh species (figure 3c). This defect can be considered as a h atom with the proton and electron dissociated onto neighboring sites . Very similar defect centers are found in nanocrystalline mgo where they have been characterized in detail by electron spin resonance and theoretical calculations . Hereafter, we will refer to these proton plus electron defects produced by h doping as (h)(e) centers, following the nomenclature of previous studies . The (h)(e) center should provide a reasonable model for the electron traps in the np electrodes following electrochemical doping and polarized for sufficiently short times at a positive potential . We have also computed the fermi contact hyperfine coupling parameter for (h)(e) in the most stable position segregated at grain boundary 7.5 mhz . This is significantly reduced compared to that calculated for the isolated h atom 1402.6 mhz (close to the experimental value of 1422 mhz). This could provide an experimental signature of (h)(e) centers at the grain boundary . If each proton at the grain boundary has already trapped an electron forming a (h)(e) center (as shown in figure 3c) one may ask how additional electrons added to the system would interact with the interface (for example as realized experimentally by cv measurements on electrochemically doped electrodes). To address this question we obtain fully optimized metastable configurations corresponding to the localization of a second electron on all ti sites in the supercell . An electron trapped on a bulk - like ti site has a very similar local geometry and spin density to the bulk - like polaron in the pristine grain boundary . This provides a reference with which to assess the trapping energies of sites in the vicinity of the grain boundary . We find a distribution of trapping energies for ti ions within 6 of the grain boundary plane spanning a similar range to that found for the pristine interface and the most stable electron trap is again located close to the grain boundary (figure 3d). The distribution of electron trapping energies associated with the pristine and (h)(e)-doped grain boundaries are compared in figure 4 . The pristine grain boundary presents 18 ti sites per supercell that can trap electrons more strongly than in the bulk (i.e., traps with et <0, hereafter referred to as interface traps). This corresponds to an interface trap concentration of 1.89 10 cm with an average trapping energy of 0.14 ev . Following (h)(e)-doping the number of interface traps are found to trap electrons corresponding to an interface trap concentration of 0.95 10 cm . Analysis of atomic structures indicates that a number of effects are responsible for the modification of interfacial traps on (h)(e)-doping . As noted above, the presence of h induces a localized deformation, which changes the structural and electrostatic environment of ti sites near the grain boundary . We find a strong correlation between the electron trapping energy of a given ti site and its corresponding electrostatic potential, as discussed previously for the pristine case . In particular, the presence of the (h)(e) center modifies the electrostatic potential on ti sites near the grain boundary destabilizing a number of traps . At the same time one of the ti sites adjacent to h that was not a trap in the pristine case becomes a trap after doping . The net result is that the number of ti sites available to trap electrons is reduced by 50% . The optimized atomic structures for the pristine and doped grain boundaries are provided in the supporting information . In addition to the reduced concentration of interface traps there is also a reduction in the average trapping energy (i.e., from 0.14 to 0.26 ev). The shift in average trapping energy of about 0.12 ev is of the same order as that observed experimentally for doped electrodes by cv (0.08 ev, figure 1a). Although the average depth of grain boundary traps is increased, the significant decrease in the density of interface traps provides an explanation for the improved photoelectrocatalytic activity of electrochemically doped electrodes observed experimentally . Due to the high specific surface area of mesoporous semiconductor electrodes, the main contribution to the density of electronic band gap states as sampled by electrochemical methods such as cyclic voltammetry results from processes at the semiconductor / electrolyte interface . Indeed these electrodes typically show a reversible charging / discharging behavior on short time scales . For tio2 electrodes the corresponding accumulated charge was shown to scale linearly with the internal area of the semiconductor / electrolyte interface . Nevertheless, processes with different kinetics contribute with different relative intensities to the overall signal . Consequently, when extracting a chemical capacitance from the measured capacitive current, those electronic states getting populated by very slow charging processes will be underrepresented . This is true for electronic states in subsurface regions of the semiconductor, such as the electron traps at particle / particle interfaces giving rise to the pair of capacitive peaks in the cvs of rutile tio2 np electrodes (figure 1a). Importantly, whereas electrochemical methods based on charge / discharge measurements provide information on the distribution of electrochemically active states, it must not be ignored that a persistent charge accumulation in the mesoporous film may modify both the fermi level and the density of states itself . In this context, it is well established nowadays that long lasting reductive treatments of mesoporous films may result in a long lasting accumulation of charges (electrochemical or charge transfer reductive doping), thereby significantly influencing the macroscopic electrode behavior in different applications . Whereas the technological implications of such an electrochemical manipulation of the electrode properties are clear, the underlying reasons and microscopic details of this phenomenon are unknown . Our observations from electrochemical measurements and results from first principle theoretical calculations give a consistent picture of electron and proton trapping in nanocrystalline tio2 films of different morphology . Calculations indicate that (h)(e) decoration modifies the distribution of electron traps at particle / particle interfaces (figure 5i). An increase of the depth of interface traps goes along with a 50% decrease in their density . Consistent changes of the density of electrochemically active states are tracked by voltammetry (figure 5ii). Upon electrochemical doping of rutile tio2 np electrodes, i.e., upon a long lasting accumulation of electron / proton pairs in the film, we observe a reversible shift toward more positive potentials of capacitive peaks associated with trap states at particle / particle interfaces . In addition an increase of the chemical capacitance is observed at more negative potentials, i.e., at 0.45 v <eag / agcl <0.25 v. such a modification was previously related to the population of subsurface states upon a light - induced insertion of protons and electrons affording faster charge transport in dye - sensitized tio2 films . Here we show that the partial removal of interface traps upon (h)(e) decoration of particle / particle interfaces may contribute to such a capacitance change . The main contribution to currents in the accumulation region of both pristine and doped electrodes (contributions at eag / agcl <0.25 v highlighted in red in figure 5ii), however, are associated with the population / depopulation of electronic states in the rutile tio2 conduction band compensated by proton adsorption at the oxide surface (ecb / hads states, figure 5c, d) as discussed in detail in a previous study . Scheme highlighting the effect of electrochemical doping on the density of electrochemically active states and on light induced charge separation . Electrochemical charge accumulation in np electrodes is reversible on the time scale of a cv measurement, i.e. When recording the electrode s voltammetric response between 0.8 and 0.6 v (and vice versa) at a scan rate of 20 mvs (figure 5a c). In this case charge accumulation takes place mainly at the particle surface and at those grain boundary states located near the oxide / electrolyte interface . Prolonged polarization of np electrodes at eag / agcl = 0.6 v (t0.6vdop = 4 h) induces electrochemical doping and thus a population of trap states deep within the particle / particle interfaces (figure 5 d). This charge accumulation is not reversible on the time scale of a cv measurement (figure 5d rather there is a long lasting (though reversible, vide infra) modification of the density of electrochemically active states . In the voltammetric experiment (figure 5d f) charge accumulation and charge extraction take now place on a film featuring particle / particle interfaces, which are partially decorated by (h)(e). Consequently, band gap states are associated with modified trapping energies resulting in a modified density of electrochemically active states (figure 5i and ii . The concerted uptake of e / h pairs in particle / particle interface regions upon cathodic polarization (i.e., electron injection from the conducting substrate and insertion of protons from the electrolyte into the oxide) and the reverse process taking place upon anodic polarization (i.e., electron transfer to the substrate and proton diffusion through the solid phase into the electrolyte) are expected to proceed very slowly . The increased intensity of the pair of capacitive peaks associated with traps at the particle / particle interface can be explained by the enhanced conductivity in the doped film which allows populating and depopulating electron traps faster and deeper within the particle / particle contact area . The persistence of electrochemical doping is associated with the slow kinetics of h diffusion from the gb core to the oxide / electrolyte interface . The dedoping of the film can thus only be achieved upon prolonged polarization at eag / agcl> 0.2 v (e.g., t0.8vdedop = 15 h, figure 5a, f). The increased photoelectrocatalytic activity of doped electrodes can be attributed to the deactivation of a major fraction of interface traps and recombination sites by the decoration of particle / particle interfaces with (h)(e) (figure 5a, f). Indeed, calculations point to a 50% decrease in density of interface traps following (h)(e) doping (figure 4), which is expected to affect charge separation at the particle / particle interface in two ways: by accelerating electron transfer across the grain boundary and by reducing electron / hole recombination . On the other hand, kamat and co - workers reported on the deactivation of recombination centers due to trap filling and the generation of ti / h centers in tio2 electrodes . Enhancement of the transport properties of mesoporous tio2 electrodes for perovskite solar cells via li doping has also been demonstrated and is proposed to involve a similar mechanism . While not investigated theoretically in this work, hole trapping may also be modified in a favorable way upon (h)(e) doping . Beneficial effects of electrochemical doping have been reported not only for tio2, but also for zno, wo3, and bivo4 films . We believe that our findings will contribute to a better understanding of interfacial processes at play in different metal oxide - based materials . We have tracked the long lasting accumulation of electron / proton pairs in rutile tio2 films consisting of a random nanoparticle network (i) via a reversible shift of a capacitive peak in the cv, which we associate with trap states located at particle / particle interfaces, and (ii) via the transient enhancement of the photoelectrocatalytic activity toward methanol photooxidation . Theoretical calculations indicate that interfaces between crystals in tio2 represent favorable locations for the segregation of proton defects, being up to 0.6 ev more stable than in the bulk crystal . Importantly, (h)(e) doping of grain boundaries significantly modifies the electronic properties of the particle / particle interface . For ti ions within 6 of the interface a shift in the average trapping energy of deep traps of 0.12 ev . A 50% reduction of the overall number of deep electron traps at the grain boundary is considered to be the main reason for the beneficial effect of electrochemical doping of rutile tio2 np electrodes on their photoelectrocatalytic activity . The qualitative agreement between our experimental results and theoretical calculations strongly supports our detailed description of these complex interfacial systems.
|
Catheter ablation of af is now recognized as a class i indication for treatment of symptomatic af refractory to at least one membrane active anti - arrhythmic drug . Ablation of af, while effective, can sometimes be a time consuming procedure with significant fluoroscopy exposure for the patient and physician . Until recently, the surrogate markers for tissue contact during pulmonary vein isolation (pvi) with or without additional lesion formation were electrogram diminution and impedance changes during ablation, but there was no direct quantitative way to ensure adequate tissue contact to maximize effective lesion formation . With the development of the biosense webster smart touch force sensing ablation catheter good electrode - tissue contact with objective measurement of contact force (cf) by use of an irrigated cf - sensing catheter has been demonstrated to be safe and effective in rf ablation procedures . We conducted this study to assess the real - world impact of contact - force sensing on procedure and fluoroscopy times during radiofrequency (rf) ablation of af . The institutional review board at einstein medical center, philadelphia, approved the study protocol . This was a retrospective study that included patients who had undergone rf ablation of af at einstein medical center between august 2012 and august 2014 . The first 15 patients who underwent rf ablation of af with the thermocool smarttouch catheter were included in the cf group, while the last 15 patients who underwent rf ablation of af with the thermocool sf catheter were included in the sf group . Inclusion criteria included patient age> 18 years, at least one documented episode of symptomatic paroxysmal or persistent af, non - responsiveness to at least one anti - arrhythmic drug therapy (class i, class iii or atrioventricular nodal blocking agents) and previous af ablation within the last two years at einstein medical center, philadelphia . Procedure time was defined as the time interval in minutes between insertion of the first diagnostic catheter to the removal of the last diagnostic catheter after ablation . Left atrial time was defined as the time interval in minutes between the first transseptal puncture and removal of the last diagnostic catheter from the left atrium after ablation . Ablation time was defined as the summed duration of the individual ablation times in minutes . The thermocool smarttouch catheter (biosense webster, inc ., diamond bar, california) is a 7.5 fr cf sensing catheter and has a 3.5 mm tip electrode with 6 small holes (0.4 mm diameter) around the circumference for saline irrigation . The catheter tip electrode is mounted on a precision spring, which permits micro - deflection, which is measured by three magnetic sensors located proximal to the spring . The system calculates the associated magnitude and angle of cf based on the micro - deflection, which is displayed both continuously and as the average value (over 1 s) on an electroanatomical mapping system (carto xp, biosense webster, inc . ). The thermocool sf catheter (biosense webster, inc) is a non - cf sensing, open irrigation catheter with an 8 fr tip electrode, 3.5 mm in length with 56 very small holes (diameter 0.0035) positioned around the entire electrode . Intracardiac echocardiography was performed using a 9 fr linear phased array ultrasound catheter (acunav, biosense webster inc ., diamond bar, ca), which was advanced into the right atrium to guide the trans - septal procedure, (puncture) monitor ablation catheter position and development of any pericardial effusion during the procedure . Double trans - septal procedure (puncture) was performed after intravenous heparin bolus administration to maintain activated clotting time> 350 s. two long 8.5 fr sheaths (agilis, st jude medical, inc . And st jude medical, inc .) Were introduced into the left atrium (la). Electroanatomic shell of the la and the pulmonary veins (pv) was created using a pentaray nav catheter (biosense webster inc ., diamond bar, ca) and a magnetic - based electroanatomic mapping system (carto system, biosense webster inc ., diamond bar, ca). A circular electrode catheter (lasso, biosense webster, inc the thermocool smarttouch or thermocool sf mapping / ablation catheter was inserted through the second trans - septal sheath . To calibrate the cf sensor to 0 g (baseline non - contact value), the cf - sensing catheter was positioned centrally in the la chamber without endocardial contact, confirmed by fluoroscopy and intracardiac echocardiography . Pulmonary vein antrum isolation by a circumferential lesion set was performed in all 30 patients with confirmation of entrance and exit block . The peak contact force in the thermocool smarttouch group did not exceed 40 g, and a minimum contact force of 510 g was targeted . It included ablation of complex fractionated atrial electrograms, la linear ablation lesions and cavotricuspid isthmus ablation in cases of inducible atrial flutter ., diamond bar, california) is a 7.5 fr cf sensing catheter and has a 3.5 mm tip electrode with 6 small holes (0.4 mm diameter) around the circumference for saline irrigation . The catheter tip electrode is mounted on a precision spring, which permits micro - deflection, which is measured by three magnetic sensors located proximal to the spring . The system calculates the associated magnitude and angle of cf based on the micro - deflection, which is displayed both continuously and as the average value (over 1 s) on an electroanatomical mapping system (carto xp, biosense webster, inc . ). The thermocool sf catheter (biosense webster, inc) is a non - cf sensing, open irrigation catheter with an 8 fr tip electrode, 3.5 mm in length with 56 very small holes (diameter 0.0035) positioned around the entire electrode . All procedures were performed under general anesthesia with mechanical ventilation . A decapolar catheter was inserted transvenously and positioned in the coronary sinus . Intracardiac echocardiography was performed using a 9 fr linear phased array ultrasound catheter (acunav, biosense webster inc ., diamond bar, ca), which was advanced into the right atrium to guide the trans - septal procedure, (puncture) monitor ablation catheter position and development of any pericardial effusion during the procedure . Double trans - septal procedure (puncture) was performed after intravenous heparin bolus administration to maintain activated clotting time> 350 s. two long 8.5 fr sheaths (agilis, st jude medical, inc . And sl1, st jude medical, inc .) Were introduced into the left atrium (la). Electroanatomic shell of the la and the pulmonary veins (pv) was created using a pentaray nav catheter (biosense webster inc ., diamond bar, ca) and a magnetic - based electroanatomic mapping system (carto system, biosense webster inc ., diamond bar, ca). A circular electrode catheter (lasso, biosense webster, inc .) Was inserted into the la for recording pulmonary vein (pv) potentials . The thermocool smarttouch or thermocool sf mapping / ablation catheter was inserted through the second trans - septal sheath . To calibrate the cf sensor to 0 g (baseline non - contact value), the cf - sensing catheter was positioned centrally in the la chamber without endocardial contact, confirmed by fluoroscopy and intracardiac echocardiography . Pulmonary vein antrum isolation by a circumferential lesion set was performed in all 30 patients with confirmation of entrance and exit block . The peak contact force in the thermocool smarttouch group did not exceed 40 g, and a minimum contact force of 510 g was targeted . It included ablation of complex fractionated atrial electrograms, la linear ablation lesions and cavotricuspid isthmus ablation in cases of inducible atrial flutter . Data are reported as mean sd for continuous variables and as number and percentage for categorical variables . Student t - test was used to compare continuous variables and the chi - square test was used to compare categorical variables . Thirty consecutive patients were included, 15 patients had af ablation using thermocool smarttouch catheter and 15 had af ablation using thermocool sf catheter . Nine patients underwent additional ablation: 5 had additional focal non - pv ablation targeting complex fractioned electrograms while the remaining 4 underwent focal and linear ablation . Two patients underwent additional focal non - pv ablation targeting complex fractioned electrograms, while 5 underwent additional focal and linear non - pv ablation . Acute success described as achievement of entrance and exit block at all pulmonary veins and maintenance of sinus rhythm was achieved in all patients in both groups . There were no acute post - procedural complications in both groups . A comparison between the mean procedure, fluoroscopy, ablation and left atrial times and the average number of ablations in the thermocool smarttouch versus the thermocool sf group is presented in table 2 . Mean fluoroscopy time (19.4 8 vs 40.7 8 min) and left atrial time (151.7 44 vs 185.7 35 min) were significantly lower in the thermocool smarttouch group . There were no significant differences in procedure time and ablation time between the two groups: procedure times; (thermocool smarttouch 204 37 min vs thermocool sf 207 37 min); ablation times (thermocool smarttouch 121 32 min vs thermocool sf 122 37 min). A comparison between the mean procedure, fluoroscopy, ablation and left atrial times and the average number of ablations in the subsets of patients who underwent pvi alone and those who underwent pvi plus additional ablation is presented in table 3 . There was significant fluoroscopy time reduction noted early on within the first five cases with cf sensing catheter as compared to non - cf sensing group (thermocool smarttouch first 5 27.64 6.3 min vs thermocool sf 40.7 8 min) (table 4). Also, fluoroscopy time was significantly lower in the last five patients compared to the first five patients in the cf - sensing group (thermocool smart touch last 514.96 7.8 min vs thermocool smart touch first 527.64 6.3 min) (table 5). When af patients who only underwent pvi were compared, fluoroscopy time and left atrial time were significantly lower in the thermocool smarttouch group (fig . 1, fig . 2). Fluoroscopy time was also significantly lower in the thermocool smarttouch subgroup with additional focal or linear ablation (fig . 1). Use of cf - sensing catheter has been proven to be safe and effective in rf ablation of af . However, its real - world impact on fluoroscopy time and procedure time during af ablation is largely unknown . Our study has demonstrated a significant reduction in mean fluoroscopy time with the use of a cf - sensing catheter . This reduction in fluoroscopy time was seen in patients who underwent pvi alone as well as patients who underwent additional focal or linear non - pv ablation . There was also a significant overall decrease in the left atrial time with the use of cf - sensing catheter . There was no significant reduction in the procedure time, ablation time or the number of ablation lesions with use of cf sensing . The single - procedure efficacy rate of catheter ablation of drug - refactory paroxysmal af is 6080% twelve months after the procedure . The current incidence of major complications after catheter ablation for atrial fibrillation is between 1% and 5% . Much effort has been invested in the last fifteen years in improving efficacy but the results have so far been modest . Ability to quantify the amount of force used during ablation has the potential advantage of increasing efficacy by reducing late pv reconnection, streamlining the ablation procedure and minimizing some of these complications . It has been shown in prior studies that contact - force is a major determinant of lesion size . An open - irrigated contact - force sensing catheter helps in selection of optimum rf power and application time to minimize the risk of steam pop and thrombus while increasing lesion size thereby ensuring effective pv isolation, the smart - af study demonstrated that ablation with the thermocool cf - sensing catheter was safe and effective for the treatment of drug refractory symptomatic paf . Another study using a different cf - sensing catheter system demonstrated that contact force during catheter ablation for af correlated with better clinical outcomes . A longer catheter dwell time in the left atrium exposes patients to thrombus or char formation on ablation apparatus, air entry with an inevitable variability in the degree of anticoagulation during the procedure . We demonstrated a significant decrease in the catheter dwell time in the left atrium in the thermocool smarttouch group which could potentially lead to a reduction in complications related to atrial fibrillation ablation . X - ray exposure is associated with stochastic (cancer and genetic defects) and deterministic risks (hair loss, skin burns, cataracts, diminished fertility, bone marrow suppression etc). Rf ablation for atrial fibrillation is associated with significant radiation exposure for patients and medical staff due to the length of the procedure, and patient comorbidity like obesity . The additional lifetime risk of excess fatal malignancies normalized to 60 min of fluoroscopy has been reported to be 0.07% for women and 0.1% for men . Another study has estimated the average excess of fatal cancers to be 650 per million patients undergoing rf ablation requiring 1 h of fluoroscopy, and average risk for genetic defects was determined to be 1 per million births . Our study demonstrates further reduction of fluoroscopy time with use of a contact - force sensing catheter along with use of a 3d electroanatomical mapping system . Reduction in fluoroscopy time was evident early on with the first 5 patients with use of cf sensing catheter as compared to use of non - cf sensing catheter . Further, there was significant reduction in fluoroscopy time in last 5 patients as compared to first five patients out of a total cohort of 15 patients in the cf - sensing group . This reflects that the learning curve for the use of the cf - sensing catheter is smooth and operator confidence builds quickly with less reliance on fluoroscopy during navigation and ablation . The finding of our study is in agreement with the recent study by jarman et al . Where they looked at 600 patients undergoing af ablation and demonstrated that use of cf sensing catheter was associated with reduced fluoroscopy time in multivariate analysis . Zero - fluoroscopy ablation procedures with use of cf sensing catheter has been shown to be feasible . With evolving technology, this could be a reality in real world practice for af ablation in the future . This was a retrospective single - center study which has inherent problems with selection bias and confounding by unmeasured variables . Our sample size was small and we did not have medium or long - term follow - up results . This may preclude quantification of the presumed risk reduction associated with use of cf catheter . We opted to enroll subjects in a 1:1 fashion to cf group and sf group . We did not perform cost analysis comparing the ablation procedures with two different catheter technologies . Our study, however, reflects real world practice outside of the clinical trial setting . However, all the procedures done in our study were performed by a single operator using identical ablation technique . Only acute procedural outcome was assessed during the study since medium term follow - up data was unavailable . In this study, we demonstrated that the use of irrigated cf - sensing catheter significantly reduces fluoroscopy and left atrial times during af ablation.
|
Flank hernias are protrusions of abdominal visceral contents through weakened areas in the lateral abdominal wall . They are most commonly caused by trauma but can also be caused by previous surgery, after which the hernia would be considered incisional . Flank hernias occur in 0.2% of blunt trauma patients but are also seen after abdominal and thoracic operations . As a part of this group, lateral intercostal herniation following a surgical procedure has been reported in only six cases in world literature . We present a rare case of an incisional flank hernia into the 11th and 12th intercostal space with strangulation of the large bowel . This case illustrates the clinical picture of a patient with emergent strangulated hernia and highlights the critical steps in the management of this catastrophe . A 79-year - old african american man was brought to the emergency department after being found unresponsive with labored breathing . He had a past medical history of mechanical mitral valve replacement at age 61, hypertension, congestive heart failure, prior upper gastrointestinal bleed while on warfarin, stroke at age 74, and an open right nephrectomy at age 63 for renal cell carcinoma . On admission, the patient was noted to be hypotensive with altered mental status and a glasgow coma scale of 12 (eye: 4, voice: 3, motor: 5). Blood and serological examinations showed metabolic acidosis with ph 7.21, lactate 6.8 mmol / l, base deficit 14.4, leukocytosis (white blood cell count 43.9 10 k / mcl), supra - therapeutic international normalized ratio (inr) 8.9, elevated aspartate aminotransferase (ast) 3517, and elevated alanine aminotransferase (alt) 1503 . Computed tomography (ct) scan of the abdomen and pelvis without contrast showed herniation of the right colon through the right 11th and 12th ribs (fig . The diagnosis of bowel obstruction versus strangulated bowel was suspected secondary to the clinical picture of abdominal distention, and serology showing metabolic acidosis, leukocytosis, and lactic acidosis . The patient was admitted to the surgical intensive care unit (sicu) for resuscitation and correction of his supra - therapeutic inr prior to surgical intervention . Upon exploration of the abdomen, the hepatic flexure of the colon was prolapsed through a 2.5 cm defect in his right flank . A right hemi - colectomy followed by ileostomy with mucous fistula the posterior fascia was then closed over the hernia defect with interrupted polydioxanone (pds) suture . This patient had a complicated postoperative course secondary to multi - organ system failure and sepsis leading to progressive deterioration and death . A comprehensive search of the pubmed database was done using the search terms intercostal hernia, incisional hernia, and flank hernia . Duplicates and non - human studies abdominal wall hernias have a prevalence of 1.7% for all ages and 4% for those older than 45 years of age . Incisional hernias result from non - healing or late disruption of the fascial layers of the wound after previous surgical incision into the abdominal wall . Protrusion of abdominal or chest contents through the area of weakened abdominal wall into the intercostal space is a rare possibility . Incisional intercostal flank hernias are most commonly caused by trauma, but have also been reported as spontaneous . There are only six previously described cases of incisional intercostal flank herniation after a surgical procedure . Contents of the hernia sac in previous reports include small bowel, large bowel,,,, and liver, while our patient had herniation of the right colon . The herniation was most commonly right sided and was left sided in two cases, . The indication for surgery was most commonly renal cell carcinoma, but other indications were angiomyolipoma, marsupialization of liver hydatid cyst, and abdominal aortic aneurysm repair . The location of herniation was most commonly 10th or 11th intercostal space but the 9th intercostal space was the location in one case . Causes of intercostal herniation include penetration of the intercostal muscle, dislocation of the costo - transverse joint, paralysis of the thoracic muscle caused by intercostal nerve injury, injury to the costal cartilage, and excessive abdominal pressure which can be associated with obesity, ascites, and bowel obstruction, . The diagnosis can be made upon physical examination and ultrasonography . When these results are inconclusive, a definitive diagnosis of flank herniation can be made using ct, . Operative correction is indicated in patients with symptomatic herniation, incarcerated / strangulated herniation, or asymptomatic herniation that directly affects the patient's quality of life . Once a hernia has become incarcerated, emergent surgical management is necessary to avoid strangulation and small bowel obstruction . This rate increases to 23.4 per 100,000 for all hernias with an associated mortality rate of 7% for patients over 60 years of age . The surgeon must pay close attention to the repair of intercostal incisional hernias due to an exceptionally high recurrence rate of 28.6% . Urgent diagnosis and management in the setting of strangulation is paramount given the associated increase in morbidity and mortality . This patient had a complicated postoperative course secondary to multi - organ system failure and sepsis leading to progressive deterioration and the patient s untimely death . After an extensive two month long search for relatives of the deceased, we were unable to find any relatives.
|
The development of efficient catalytic methods for the formation of bonds between main group elements is of considerable interest for the continued development of main group chemistry . Such processes enable new discoveries to be made in the promising application areas that main group species are now occupying, such as high performance polymers, emissive materials, etch resists for lithography, and precursors to ceramic thin films or devices . However, the development of this field lags substantially behind the advances made in catalytic c c and c x bond formation, for which there are now a myriad of efficient ways to promote such unions that are important for the construction of new molecules . Catalytic dehydrocoupling of amine and phosphine boranes is one method that has emerged for the formation of b p bonds, and development in the area has been spurred on by the potential for ammonia in addition, polymeric materials that can arise from dehydropolymerization of primary analogues are also of significant interest as they are valence isoelectronic with technologically ubiquitous polyolefins . Although the metal catalyzed formation of polyaminoboranes has attracted recent attention, catalytic routes to polyphosphinoboranes have also been known since 1999 . Perhaps the best example is that of the [rh(cod)2][otf] catalyzed dehydrocoupling of secondary, h3bpr2h, and primary, h3bprh2, phosphine boranes to give oligomeric and polymeric materials (scheme 1). Although initial reports demonstrated that catalysis using [rh(cod)2][otf] was a homogeneous process (i.e., not colloidal), there has been only sporadic further work on elucidating the mechanistic details . Progress has no doubt been slowed due to the fact that the reaction conditions reported for phosphine borane dehydrocoupling often require melt conditions, thus making interrogation of the catalytic cycle problematic . Recently, we have reported that the rh(i) complexes [rh(pbu2h)2(-fc6h5)][bar4], and [rh(l)(-fc6h5)][bar4], [l = ph2p(ch2)3pph2] are particularly well - suited to the study of the dehydrocoupling mechanism of secondary phosphine boranes in solvents such as fluorobenzene; and on the basis of the observation of intermediates, kinetic studies, and h / d exchange experiments we have proposed a catalytic cycle for the dehydrocoupling of h3bpr2h (r= ph, bu; scheme 2). For this cycle, intermediate species were isolated, but their structures could not be confirmed by x - ray crystallography . In particular for r = ph, a -b - agostic complex b, and the product of dehydrocoupling f, that is proposed to sit off cycle, could be isolated and spectroscopically characterized . Under stoichiometric conditions the observation that b transforms into f on gentle heating allowed for kinetic parameters to be determined that suggested that the rate - determining step(s) for dehydrocoupling were located within the transformations b to d. in solution phase the turnover limiting step for catalysis is proposed to be the displacement of the linear diboraphosphine product (i.e., f to a), although under the melt conditions used for efficient catalysis this may well be different . Further insight comes from the observations that for r = bu the barrier to dehydrocoupling is higher (70 c versus 25 c for reaction), p h activation appears also to be a higher energy process, different intermediates (a and e) are observed, and the turnover limiting process in catalysis is now suggested to be the p h activation / dehydrocoupling steps . Prior work has demonstrated a similar difference in relative rates of dehydrocoupling of secondary h3bpr2h [r = p-(cf3)c6h4, ph, bu, bu] and primary h3bprh2 [r = ph, bu, bu] phosphine boranes using the [rh(cod)2][otf] catalyst, and this was suggested to be due to a combination of steric and electronic (relative p h bond strengths) factors, although the mechanism of dehydrocoupling of phosphine boranes using this catalyst is currently not known . H bond is such that spontaneous dehydrocoupling occurs in the absence of catalyst, with electron - withdrawing aryl groups [p-(cf3)c6h4] undergoing faster reaction than electron - donating [p-(ome)c6h4]. Very recent work has shown that paramagnetic ti(iii) centers might also be involved in dehydrocoupling of phosphine and amine boranes when using cp2ti - based catalysts, while oligomerization of base - stabilized phosphino likely decomposition routes in rh - systems for phosphine borane dehydrocoupling to form bis(phosphine)boronium salts have also recently been discussed ., we report an extension of our investigations into the mechanism of phosphine borane dehydrocoupling using the {rh(ph2p(ch2)3pph2)} fragment, by varying the electronic and steric profile of the secondary phosphine boranes h3bpr2h [r = 3,5-(cf3)2c6h3; p-(cf3)c6h4; p-(ome)c6h4; adamantyl], as well as investigations with the primary phosphine borane h3bpcyh2 . Dehydrocoupling forms the corresponding metal bound linear diboraphosphines h3bpr2bh2pr2h and h3bprhbh2prh2, respectively these studies provide insight into the determining role of the electronics and sterics of the phosphine borane in the dehydrocoupling process, as well as providing as yet unreported examples of the solid - state structures of the intermediates related to the catalytic cycle . We also report for the first time the partial control of diastereoselectivity in dehydrocoupling of primary phosphine boranes, that can additionally be biased by use of a chiral chelating phosphine on the rhodium center . A range of secondary phosphine boranes with differing electronic and steric properties have been used in this study (1, 2, 3, and 4, figure 1), which also provide comparison with the previously reported ph, 6, and bu, 7, analogues . The primary phosphine compounds 2(33) and 3(38) are known adducts and offer electron - withdrawing and donating aryl groups, respectively . The synthesis of adamantyl - substituted phosphine, 4, an analogue of 7, has been reported in the patent literature . Compared with the butyl group, adamantyl has a greater steric bulk due to its larger volume and rigid structure . The new linear diboraphosphines, 1013, have also been synthesized to aid in the identification of final dehydrocoupling products . Complexes 1012 are synthesized by a rh - catalyzed process from the corresponding phosphine boranes, while primary phosphine containing 13 has been synthesized in good isolated yield (85%) by addition of [nbu4][bh4] to the bis(phopshine)boronium [(cyh2p)2bh2]br . Addition of 2 equiv of 1 to [rh(l)(-fc6h5)][bar4] [l = ph2p(ch2)3pph2] in 1,2-f2c6h4 solution at 25 c rapidly (on time of mixing) resulted in the formation of [rh(l)(h)(,-pr2bh3)(-h3bpr2h)][bar4], 14 [r = 3,5-(cf3)2(c6h3), scheme 3], which was characterized by nmr spectroscopy, esi - ms (electrospray ionization mass spectrometry), and single crystal x - ray diffraction . Likewise, the use of 2 equiv of phosphine borane 2 or 3 results in the formation of the analogous complexes 15 [r = p-(cf3)c6h4] and 16 [r = p-(ome)c6h4], respectively, which were fully characterized using solution techniques . All these complexes proceed to dehydrocouple (vide infra), and only for 14 was an analytically pure crystalline solid obtained . Even so, dissolution of crystalline material of 14 resulted in the observation of small amounts (approximately 510%) of the associated dehydrocoupling product in the solution nmr spectra after short periods of time . Complexes 15 and 16 could only be isolated as oils, but their characterization by nmr spectroscopy and esi - ms was fully consistent with their formulation . [bar4] anions are not shown . The solution nmr spectra for 14, 15, and 16 are very similar to those previously reported for [rh(l)(h)(,-pph2bh3)(-h3bpph2h)][bar4] (i.e., b, scheme 2(31)), and data for 14 is discussed in detail . Two of the resonances are broadened significantly compared to the other two, suggesting these phosphorus atoms are bound to a quadrupolar boron center . One of these shows both a large trans pp coupling [j(pp) 244 hz] and coupling to rh [j(rhp) 75 hz], while the other is a broad singlet . The other two signals are sharper and are assigned to the two p environments of the ph2p(ch2)3pph2 ligand . One of these sharper resonances [29.5, ddd, j(rhp) 130, j(pp) 35, j(pp) 21 hz] is assigned to the phosphorus atom trans to the weakly bound -b - agostic interaction on the basis of the larger rh coupling constant, while the other signal [11.3, ddd, j(rhp) 103, j(pp) 244, j(pp) 35 hz] is assigned to the phosphorus atom trans to the coordinated phosphido ligand . In the h nmr spectrum of 14 one broad, relative integral 3h, signal is observed at 0.78, indicative of a rhh3b interaction in which the b h bonds are undergoing rapid site exchange on the nmr spectroscopic time scale between terminal and bridging sites . A broad, relative integral 1h, resonance at 6.12 cooling of the solution to 0 c led to the resolution of this signal as doublet [j(ph) = 65 hz], fully consistent with its trans disposition to a phosphine . The remaining bh(terminal) signals are not observed, and it is likely they are coincident with the {ch2}3 signals . A sharper signal at 16.21, relative integral 1h, is assigned to a metal hydride resonance, in which the coupling to both rh and p is clearly small and unresolved . The ph group is observed at 5.81 that collapses into a singlet in the h{p} nmr spectrum . The b nmr spectrum shows a broad signal centered at 39.8, which is not shifted significantly from that of free phosphine this is assigned to a coincidence of the -b hrh agostic and rhh3b signals, as has been noted previously . Complexes 15 and 16 have similar h, b, and p nmr spectra, and thus we assign very similar structures . Crystals of complex 14 of suitable quality for analysis by x - ray diffraction were obtained by layering of a 1,2-f2c6h4 solution with pentane at 26 c . The structure of 14 in the solid - state (figure 2) is fully consistent with the structure deduced from the solution nmr spectroscopic data . The formally rh(iii) center adopts a pseudo - octahedral geometry, with the chelating phosphine ligand and the hydride located on one of the faces of the octahedron . H activation, and is bound to the metal via a phosphido bond [rh1p3, 2.3045(10)] and a -b - agostic bond [rh1b1, 2.515(4)]. The other phosphine borane unit occupies the last coordination site via a -rhh all the hydrides (b h and rh h) were located in the final difference map . The structure is in full accord with the solution nmr spectroscopic data, confirming the spectroscopic assignments that have been made previously . -b - agostic interactions are known, and we have recently reported [rh(,-pph2bh2pph3)(pph3)2][bar4] in which a base - stabilized phosphine borane adopts a -b - agostic interaction with the rh - center . Phosphine boranes are also known, and bimetallic complexes showing both b - agostic and borane coordination modes have been reported . Compared to a rh(i) complex that shows a bidentate -coordination mode for the borane, [rh(pbu2h)2(-h3bpbu2h)][bar4], the rhb distance for the -interaction in 14 is considerably longer [2.188(3) versus 2.740(4), respectively], consistent with this different binding motif . Similar changes in mb distance have been noted on moving between and coordination modes in chelating phosphine boranes . Some hydrogen atoms are omitted for clarity . Selected bond lengths () and angles (deg): rh1p1, 2.778(10); rh1p2, 2.3163(9); rh1p3, 2.3045(10); p3b1, 1.913(4); p4b2, 1.918(4); rh1b1, 2.515(4); rh1b2, 2.740(4); rh1p3b1, 72.54(14); rh1b2p4, 121.3(2). Complexes 1416 undergo spontaneous dehydrocoupling (25 c) to form products of the general formula [rh(l)h(,-pr2bh2pr2bh3)][bar4]: 17, r = 3,5-(cf3)2c6h3; 18, r = p-(cf3)c6h4; 19, r = p-(ome)c6h4 (scheme 4). This process also results in the liberation of h2 (observed, h nmr spectroscopy). For 17 and 18 there are additional products formed, assigned as [rh(l)(pr2h)2][bar4], 21 and 22, respectively, on the basis of nmr spectroscopic data . These complexes are formed in parallel to 17 and 18, as preformed 17 (vide infra) does not proceed to form 21 . Complex 21 has been independently prepared by addition of two equivalents of hp((cf3)2c6h3)2 to [rh(l)(-fc6h5)][bar4]. Time = 6 h 17/21, 18/22 (25 c); 8 h 16/19 (35 c). This mixture of products observed for the electron - withdrawing phosphine substituents (i.e., 1 and 2) contrasts with that found for when r = ph and p-(ome)c6h4, which yield the dehydrocoupled (e.g., 19 and f, scheme 2) product in essentially quantitative form (95% by p{h} nmr spectroscopy). Complex 17 has been synthesized cleanly from direct addition of the preformed dehydrocoupled diboraphosphine product, 10, to [rh(l)(-fc6h5)][bar4], scheme 5 . It was from this reaction that material of 17 suitable for single crystal x - ray diffraction was obtained . Figure 3 shows the solid - state structure of 17, in which the diboraphosphine acts as a chelate to the rh(iii) center, via a phosphido group and two b - agostic interactions: [rh(l)h(,-pr2bh2pr2bh3)][bar4] [r = 3,5-(cf3)2c6h3]. All the hydride ligands (b h and rh h) were located in the final difference map . The rh(iii) center has pseudo - octahedral geometry, in which the oligomeric phosphine borane is bound tridentate to the metal through -bh2rh [b2rh1, 2.280(5)] and phosphido [p3rh1, 2.3925(10)] interactions . The rhb distance is considerably shorter than those observed in 14, consistent with the -bidentate binding mode of the borane . Selected bond lengths () and angles (deg): rh1p1, 2.3241(11); rh1p2, 2.2650(11); rh1p3, 2.3925(10); rh1b2, 2.280(5); rh1p3b1, 110.88(15); b1p4b2, 107.5(2). The nmr spectroscopic data for 17 are fully consistent with the solid - state structure being retained in solution and are also very similar to that reported for the analogous complex formed from the deydrocoupling of 6 (r = ph). Two of these signals are well - resolved and show coupling to rh, 46.6 [j(rhp) 111 hz] and 12.8 [j(rhp) 91 hz], and are attributed to the chelating phosphine ligand . One of these signals (12.8) also shows large p p coupling [j(pp) 260 hz] suggesting a trans position relative to the phosphido center . The other two environments are broad, typical of those observed when coupling to a quadrupolar boron center . For one of these trans the h nmr spectrum shows three different broad, relative integral 1h, environments assigned to the bh3 moiety [4.54, 1.20, and 4.37]. This indicates that the bh3 unit is not undergoing exchange on the nmr spectroscopic time scale, as noted previously for similar -mh3b systems . The rh h signal is observed at 13.98 as a sharper signal, although this also shows unresolved coupling . The b nmr spectrum shows two different environments [27.1 and 0.21] for the two boron atoms present in the diboraphosphine, with the latter assigned to the -h3b unit on the basis of the large downfield shift from free ligand (= + 36.8). Spectroscopic data for complexes 18 and 19, that are produced by the direct dehydrocoupling route are similar, although for 18 this is also formed as a mixture with 22 . The dehydrocoupling reaction (i.e., 14 to 17) shows a dependence on the substituents on the phosphine . For electron - withdrawing aryl groups (e.g., p - cf3), it is faster when compared with electron rich groups (i.e., p - ome). Following these processes in situ using nmr spectroscopy demonstrated that these dehydrocoupling reactions follow a first order rate profile for the consumption of the starting material over at least three half - lives (see supporting information): 1 3 h (25 c); 2 3 h (25 c); 6 14 h (25 c);3 8 h (35 c), 120 h (25 c). That the parallel products 21 and 22 are formed in approximately equal ratio to the dehydrocoupled product (17, 18, respectively)) suggests that k1 k2 (scheme 4). In addition to this parallel process, direct comparison of the rate constants is further complicated by the fact that 16 19 required heating to 35 c to make the reaction run over a convenient time scale for analysis by nmr spectroscopy . Nevertheless these relative rates reflect previous observations on the rate of catalytic dehydrocoupling when the electronics of a system are changed, in as much as electron - withdrawing groups promote the reaction . Interestingly, for all the aryl complexes initial p h activation to form a phosphido hydride complex (i.e., 14) is very rapid, occurring on time of mixing . H activation that is rate - determining for the dehydrocoupling event, as we have commented on for r = ph . In this study we suggested that b h activation / reorganization in intermediates such as b (scheme 2) prior to p h bond, and calculations on analogous h3bl (l = lewis base) systems show that the b h bond is considerably weaker when there are electron - withdrawing groups on the lewis base . However, we cannot rule out that the relative p h bond strengths in intermediates such as 14 also might play a role, or that there is a change in the rate determining step on changing the phosphine borane ligand, as the intimate details of the mechanism leading to p the observation that for an electron - withdrawing phosphine there is a significant proportion of parallel product formed that results from p b bond cleavage has been noted previously in phosphine borane complexes to give either simple adducts or further reaction to yield bis(phosphine)boronium salts . Prior to the formation of the parallel product 21 (r = 3,5-(cf3)2c6h3) an intermediate is observed that has been characterized by h and p{h} nmr spectroscopy as [rh(l)h(,-pr2bh3)(pr2h)][bar4] 20, i.e., a complex that sits directly between 14 and 21 by loss of one bh3 fragment (scheme 6). B bond cleavage, formally of the -h3bpr2h ligand, to afford a complex with a -b - agostic interaction from a phosphide borane ligand (as for 14) and a simple pr2h ligand trans to a hydride . Complex 20 was not isolated in pure form, being observed alongside 14 and the final products 17/21 . However, after 2 h reaction a significant proportion of 20 is present (20% by p nmr spectroscopy), allowing for its identification aided by comparison with the nmr spectroscopic data for 14 (supporting information). In particular four environments are observed in the p nmr spectrum, with only one of these broadened significantly by coupling to quadrupolar boron . This signal also shows a large, mutual, trans j(pp) coupling with another phosphine environment . In the high - field region of the h nmr spectrum a broad doublet is observed at 7.06 [j(hp) = 76 hz] which is assigned to the -b - agostic interaction, while there is a relatively sharper one at 9.61 [j(hp) = 165 hz] assigned to rh h, and again rh coupling is not resolved . These assignments were confirmed by h{p}, h{b}, and h / p correlation experiments . Borane h3bp(adamantyl)2h, 4, to [rh(l)(-fc6h5)][bar4] in 1,2-f2c6h4 solution at 25 c rapidly results in a color change from orange to purple and the formation of the new bound rh(i) phosphine borane complex [rh(l)(-h3bp(adamantyl)2h)][bar4], 23, which was characterized in situ by nmr spectroscopy . This complex could not be isolated as it undergoes further reaction, by p b bond cleavage at room temperature, to form 24 (scheme 7). Addition of 1 equiv of 4 resulted in a final mixture of 24 and [rh(l)(-fc6h5)][bar4]. The h nmr spectrum of complex 23 immediately after preparation shows a broad, relative integral 3h, signal at 1.36 characteristic of a -bound phosphine borane that is undergoing site exchange between the coordinated and uncoordinated b h environments . Two signals are observed in the p{h} nmr spectrum, in a 2:1 ratio at 35.1 [j(rhp) 167 hz] and 30.1 (br). Over time (1 h), complex 23 disappears to be replaced by a new complex that has been characterized by nmr spectroscopy and a solid - state x - ray diffraction experiment as [rh(l)(phr2)(h3bphr2)][bar4] (24, r = adamantyl). Figure 4 shows the structure of the cation present in 24 in the solid - state . A rh(i) center is in a pseudo - square - planar geometry with a chelating ligand, and the other two coordination sites are occupied by p(adamantyl)2h and a -h3bp(adamantyl)2h [rhb, 2.457(7)] ligands, respectively . The solution nmr spectroscopic data for 24 are fully consistent with the solid - state structure, and in particular the trans disposition of p1 and p3, and the -h3bpr2h ligand . Some hydrogen atoms are omitted for clarity . Selected bond lengths (): rh1p1, 2.2262(16); rh1p2, 2.2861(16); rh1p3, 2.3568(15); rh1b1, 2.457(7); b1p4, 1.936(7). A significant amount of p b bond cleavage product is thus observed for both electron poor aryl phosphine boranes (e.g., 14) and very bulky electron rich phosphine boranes (e.g., 24), but not the electron rich aryl phosphine 3 or h3bpph2h (6). Interestingly we have recently reported that for h3bpbu2h p b bond cleavage is also observed during dehydrocoupling catalysis being accompanied by a further dehydrocoupling step, through which bis(phosphine)boronium salts are ultimately formed . Similar complexes can be prepared on rhodium using h3bpph2h and pph3 under stoichiometeric conditions . One suggested mechanism for this process is the reaction of a short - lived phosphino borane (or its masked equivalent) with coordinated phosphine, not dissimilar to the mechanism suggested for the formation of diaminoboranes from amine boranes and amines catalyzed by alkaline earth catalysts . Complexes 20 and 24 serve as models for intermediates in this process [rh(iii) and rh(i), respectively], although we do not observe the formation of corresponding bis(phosphine)boronium salts in this case . Boranes can yield polyphosphinoboranes, rather than the simple oligomers observed with secondary phosphine boranes (scheme 1). With an appreciation of the intermediate metal complexes formed with secondary phosphine boranes from this and previous work, it was of interest to explore whether the proposed dehydrocoupling mechanism for secondary phosphine boranes using [rh(l)(-fc6h5)][bar4] could be applied to primary analogues . Boranes is important, as these processes currently remain unresolved due to the melt conditions employed that make following intermediates or kinetics problematic . In situ investigations using stoichiometric quantities of primary phosphine boranes h3bpphh2 resulted in immediate reaction when combined with [rh(l)(-fc6h5)][bar4], but a number of products were formed which we have not been able to convincingly characterize . This mixture of species observed is in contrast with h3bpph2h where single products are formed analogous to 1416 . However, reaction of [rh(l)(-fc6h5)][bar4] with a slight excess of h3bpcyh2 (5) in 1,2-f2c6h4 solution at 25 c led to the instantaneous formation of only two complexes in a 1:1 ratio, 25a and 25b, [rh(l)h(,-pcyhbh3)(-h3bpcyh2)][bar4], as a proposed diastereomeric pair (scheme 8). These new products are directly analogous to those formed with secondary phosphine boranes (i.e., 14), and the nmr spectroscopic data match closely . The p{h} nmr spectrum from this reaction shows 8 resonances, in addition to a broad peak at 35.5 due to excess phosphine signals centered at 31.7 and 30.5 are assigned to one of the chelating phosphine ligand p environments in each diastereoisomer, and show characteristic j(rhp) coupling constants consistent with a rh(iii) center . Complex overlapping multiplets at 11.8 [2 ddd] represent the resonances for both diastereomers of the second chelated phosphorus center, which is trans to the phosphide position, displaying a large trans pp coupling constant [j(pp) 200 hz] in addition to coupling to rh and cis - p . The remaining 4 signals are broad indicating the phosphorus centers are bound to a quadrupolar b nucleus . Of these, peaks at 11.0 and 32.1 are assigned to the phosphide centers of each diastereomer trans to the chelating phosphine [j(pp) 200 hz], and resonances at 39.8 and 44.2 as assigned to phosphorus centers in the -bound phosphine borane unit . These large differences in chemical shift of the phosphido signal (21.2) might reflect significant local difference in steric pressure between 25a and 25b at this group . Interestingly, a much smaller difference is observed with the dehydrocoupled products (26a / b, 3.5) in which the phosphide group is part of a chelate ring . The h nmr spectrum does not have the necessary resolution to separate out the diastereomers in the hydride region, with broad resonances observed at 2.3 (3 h, bh3), 7.9 (1 h, rh h complexes 25a / b cannot be isolated in pure form, and characterization by nmr spectroscopy is best performed on freshly prepared samples, as after 1 h (25 c) they have undergone dehydrocoupling to give a mixture of two resolvable diastereomers 26a and 26b, with one of the diastereomers present in a significantly larger amount 6:1 (scheme 8), indicating that the dehydrocoupling step occurs with some stereocontrol . The decomposition product [rh(l)(ph2cy)2], analogous to 21/22, was also observed . Nmr spectroscopic and esi - ms analysis suggests that the dehydrocoupling products formed are direct analogues of 17 . This mixture of diastereomers can also be synthesized cleanly by direct reaction of [rh(l)(-fc6h5)][bar4] with the preformed diaboraphosphine h3bpcyhbh2pcyh2 (13) in 1,2-f2c6h4 solution at 25 c (figure 5 for the solid - state structure). Immediate measurement of the p{h} nmr spectrum after mixing showed clean conversion to complexes 26a and 26b in an approximate 1:1 ratio, interestingly different from the 1:6 ratio observed from dehydrocoupling . Molecular structure of 13 . Displacement ellipsoids are drawn at 50% probability level . Selected bond lengths () and angles (deg): p1b1 1.9267(18), b1p2 1.9381(18), p2b2 1.926(2); p1b1p2 108.34(9), b1p2b2 113.32(9). Resonances in the p{h} nmr spectrum of 26 can, again, be assigned aided by reference to those of structurally characterized 17 . Peaks centered at 37.9 and 34.5 result from the chelated phosphorus trans to the b - agostic site, while the signals for the phosphorus trans to the phosphido group overlap at 10.7, and display characteristic j(pp) trans coupling [255 hz]. The broad resonances of the diboraphosphine are observed at 19.8 and 16.2 for the phosphido center [j(pp) 255] and 14.9 and 16.6 ppm for the remaining site . The high - field region of the h nmr spectrum of 26a/26b shows a slight downfield shift of the rh h hydride resonance to 16.1, when compared to 25a/25b, while the -bh2rh units are observed as two broadened resonances at 2.98 (1h) and 5.98 (1h). For these hydride signals the separate signals are not resolved for each diasteroisomer, although each resonance is rather asymmetric suggesting two overlapping environments . A p{h} nmr spectrum taken of this mixture after 18 h at 25 c showed a significant change in the ratios of the diastereomers 26a/26b (scheme 9). The peaks for one isomer at [34.5, 16.2, 10.7, and 14.9] have reduced relative area, giving an approximate ratio of 6:1 for the two diastereoisomers . This ratio is similar to that found from direct dehydrocoupling in 25a/25b after 1 h (vide supra), underscoring the stereocontrol occurring in the p leaving this solution for one week resulted in no significant change to this ratio, suggesting equilibrium had been reached . We suggest that the mechanism for equilibration involves reductive elimination of the phosphido and hydride ligands to form a rh(i) phosphine borane complex, similar to e in scheme 2, which then undergoes rapid oxidative addition of the other p h bond . This must be a reversible process, leading to a thermodynamic ratio of the diastereoisomers and the resulting selectivity . Unfortunately we were unable to deduce the stereochemistry of the preferred isomer using roesy experiments or a solid - state structure . However, inspection of models leads us to propose that the thermodynamic product is likely to have the cyclohexyl group pointing away from the chelating phosphine ligand s phenyl groups, i.e., 26b . That these diastereoisomers are a result of the metal activation of the prochiral terminal p h bonds in 13 is shown by addition of an excess of dppe to 26a / b . This affords [rh(dppe)(l)][bar4] with the concomitant formation of free 13 (scheme 9). We have briefly explored the use of a chiral metal / ligand fragment in dehydrocoupling, [rh(bdpp)] [s, s - bdpp = (2s,4s)-2,4-bis(diphenylphosphino)pentane]. This chiral ligand was chosen as electronically and sterically (i.e., bite angle) it is similar to ph2p(ch2)3pph2 . Addition of h3bpcyh2, 5, to [rh(bdpp)(-fc6h5)][bar4] results in the immediate formation of two diastereoisomers of [rh(bdpp)h(,-pcyhbh3)(-h3bpcyh2)][bar4], 27, in a 3:1 ratio (scheme 10). Although we are unable to comment on the absolute configuration of these isomers, it is interesting to note that this is biased away from the 1:1 ratio observed in the achiral system . Compounds 27a / b proceed on to dehydrocouple to form diastereoisomers of [rh(bdpp)h(,-prhbh2prhbh3)][bar4], 28, 1:5:3:0 ratio . The same mixture of diasteroisomers can be formed by direct addition of 13 to [rh(bdpp)(-fc6h5)][bar4]. Initially a 2:1:2:1 ratio of 4 isomers is observed, that changes to a 5:1:3:0 ratio after 18 h. we are unable to comment in more detail on the conformation of these isomers, although the observation of stereocontrol in the direct dehydrocoupling is similar to that observed for the achiral system . Addition of excess dppe to this mixture forms a product identified by esi - ms as [rh(bdpp)(dppe)] and free 13 (by p and b nmr spectroscopy). We have not explored whether there is enantiocontrol at the central {pcyh unit} arising from this pb coupling event on release from the metal . Boranes h3bpbu2h and h3bpbu2bh2pbu2h, which on addition to [rh(l)(-fc6h5)][bar4] gave the corresponding rh(i) -phosphine borane complexes with no p such selectivity for primary over secondary phosphines in p h activation at a metal center has been described previously for both phosphine and phosphine borane ligands . In particular it has been shown that addition of h3bpphh2 to pt(pet3)2h(pph2bh3) results in exchange of the metal bound phosphide complex to give the primary phosphido borane complex . Here it was suggested that the greater thermodynamic driving force for formation of the primary phosphido p bonds to smaller primary phosphido ligands are likely to be stronger . Under the standard catalytic melt conditions (90 c, 5 mol%), [rh(l)(-fc6h5)][bar4] will dehydrocouple the secondary aryl phosphine boranes used in this study to form the corresponding linear diboraphosphines 1012, although we have not explored in detail the temporal evolution of these systems due to the problems associated with directly interrogating the melt . However, trends can be observed . For electron - withdrawing groups (1 and 2), complete consumption of starting the reaction at this temperature is not selective, and although the main product is the linear diboraphosphine, there are products that we tentatively identify as the cyclic oligomers (bh2pr2)n (n = 3, 4). Our results are broadly in line with the previously reported catalyzed dehydrocoupling of 2 using [rh(cod)cl]2, which, at a slightly lower temperature (60 c, 16 h, melt), affords the linear diboraphosphine product in 69% isolated yield, while at 100 c only the cyclic oligomers are isolated . The mechanism of formation of the higher cyclic oligomers, (bh2pr2)n, remains to be resolved . For electron - donating 3 the reaction is slower using the [rh(l)(-fc6h5)][bar4] catalyst (8 h) but overall is more selective . For r = ph we have previously shown that [rh(l)(-fc6h5)][bar4] catalyzes dehydocoupling to give the corresponding linear diboraphosphine in greater than 95% conversion after 4 h. for secondary phosphine boranes, h3bpph2h thus offers balance between overall rate and selectivity . Conditions: [rh(l)(-fc6h5)][bar4], 5 mol%, 90c, melt . Given the product distributions and likely decomposition pathways in the melt it is inappropriate to comment in detail on the nature of the rate - determining steps during catalysis under these conditions . However, on the basis of the solution studies, p b bond formation, (dehydrocoupling) is faster with electron - withdrawing groups . The temporal differences in observed product conversion in the melt could reflect a difference in the rate of the p b bond forming event, or alternatively, they could reflect the ease at which the bound product is substituted on the metal center, i.e., a turnover limiting step . To probe this latter scenario, reaction between 19 (aryl - ome) and diboraphosphine 11 (aryl - cf3) to form 18 and free 12 demonstrates that an equilibrium is established slightly in favor of 18 (scheme 11). This suggests that there is not a strong inherent difference in binding strengths between the two products, with the implication being that the observed rate differences in the melt arise from the dehydrocoupling step . Although this is different from what is observed in solution at room temperature, in which release of the product is likely the turnover limiting step, it is consistent with the high local concentration of h3bpr2h that being under melt conditions (90 c) would promote such a substitution . [rh(l)(-fc6h5)][bar4] also acts as a catalyst for the dehydrocoupling of primary phosphine boranes . Under melt conditions (90 c, 5 mol%, 4 h) h3bpphh2 is dehydrocoupled to give a major product which is identified by p nmr spectroscopy as being polymeric (bh2pphh)n by comparison with previously reported data for purified material coming from the [rh(cod)2][otf] catalyzed process [49.3, d, j(ph) 350 hz, 1,2f2c6h4; lit . : 48.9,, j(ph) 360 hz, cdcl3]. There were also other species observed 55, which could be reduced in relative concentration (to 10%) by precipitation into hexanes . Interestingly, these proposed shorter chain oligomers are present in a greater proportion at shorter reaction times, which might suggest that polycondensation is occurring to give higher molecular weight polymer . Under non - melt conditions (toluene heated to reflux, 0.5 mol%, 16 h) these shorter oligomers are by far the dominant species (supporting information). Positive mode esi - ms (electrospray mass spectrometry) of the melt reaction product demonstrated polymerization, showing repeat units of [h(pphhbh2)npphh2] up to n = 10 (supporting information). Similar analyses have been reported for amine borane dehydropolymerization . That these polymers are terminated by {pphh2} groups rather than {bh3} this formulation also argues against cyclic oligomers being observed by esi - ms, and presumably the additional phosphine arises from p b bond cleavage . Use of h3bpcyh2 under these conditions afforded significantly more complex mixtures that we were unable to resolve . The solid - state structures of the intermediates in the dehydrocoupling of secondary phosphine boranes using the {rh(ph2pch2ch2ch2pph2)} fragment have been determined . This demonstrates that the complex that precedes dehydrocoupling to form a linear diboraphosphine has bound and p borane ligands, while the product has a linear diboraphosphine bound to the metal center . For aryl phosphine boranes, electron - withdrawing groups (cf3) promote stoichiometric dehydrocoupling faster than for more electron - donating (ome) groups . This increase in rate is accompanied by a significant degree of parallel and competitive p b bond cleavage to afford metal complexes with two monodentate phosphine ligands, which we suggest is due to a weakening of the p these systems also turnover catalytically under melt conditions, with the overall rate of conversion broadly following the relative dehydrocoupling rates observed in the stoichiometric studies, suggesting that the dehydrocoupling step under melt conditions might also be the turnover limiting step . Boranes, to such an extent that stoichiometric dehydrocoupling is not observed . For this phosphine a significant observation is that, for primary phosphine boranes, which are precursors to polyphosphinoboranes, use of the {rh(ph2pch2ch2ch2pph2)} fragment results in some apparent diastereoselectivity in the dehydrocoupling step, at least in the stoichiometric reactions that produce metal - bound diboraphosphines . Such selectivity could well have implications in the control of the stereochemistry of polymer that would result from further insertion events . A significant future challenge is to harness any inherent bias in each dehydrocoupling insertion step productively while also developing the necessary spectroscopic and physical characterization markers to interrogate the oligomer and polymer stereochemistry . All manipulations, unless otherwise stated, were performed under an atmosphere of argon, using standard schlenk and glovebox techniques . Glassware was oven - dried at 130 c overnight and flamed under vacuum prior to use . Hexane and pentane were dried using a grubbs type solvent purification system (mbraun sps-800) and degassed by successive freeze pump thaw cycles . Cd2cl2, c6h5f, and 1,2-f2c6h4 were distilled under vacuum from cah2 and stored over 3 molecular sieves, 1,2-f2c6h4 was stirred over alumina for 2 h prior to drying . Bis-1,3-(diphenylphosphino)propane (dpp3) and (2s,4s)-2,4-bis(diphenylphosphino)pentane (bdpp) were purchased from aldrich . [rh(nbd)cl]2 and [rh(nbd)(dpp3)][bar4] were prepared as previously described . (4-methoxyphenyl)2hpbh3 (3), (adamantyl)2hpbh3 (4), and cyh2pbh3 (5) were prepared by the same method as me3pbh3 but with the phosphine changed . (4-trifluoromethylphenyl)2phbh3 (2) and (3,5-bis(trifluoromethyl)phenyl)2pcl were prepared according to literature procedures reported by clark et al . Nmr spectra were recorded on a bruker avd 500 mhz spectrometer at room temperature unless otherwise stated . In 1,2-c6h4f2, h nmr spectra were referenced to the center of the downfield solvent multiplet (7.07), and p and b nmr spectra were referenced against 85% h3po4 (external) and bf3oet2 (external), respectively . The spectrometer was prelocked and preshimmed using a c6d6 (0.1 ml) and 1,2-c6h4f2 (0.3 ml) sample . Esi - ms were recorded on a bruker microtof instrument . In all esi - ms spectra there was a good fit to both the principal molecular ion and the overall isotopic distribution . Signals in the p{h} nmr spectra were integrated relative to those in similar environments (i.e., rh p or b p) to obtain the relative ratios of products, and data was acquired with a pulse repetition time of 1 s. this avoids potential problems with different relaxation times for different phosphorus environments . Nevertheless, the quoted relative ratios based upon this data should be treated as qualitative rather than quantitative . A solution of (3,5-bis(trifluoromethyl)phenyl)2pcl (1.48 g, 3.0 mmol) in diethyl ether (5 ml) was added dropwise to a diethyl ether (20 ml) suspension of libh4 (0.070 g, 3.21 mmol) cooled to 5 c with an ice bath . The diethyl ether was removed in vacuo, and the residue was dissolved in hexanes (30 ml) and filtered through celite . The hexanes were reduced in vacuo to 10 ml, and the solution was placed in the freezer (20 c) overnight yielding colorless crystals . Excess hexanes were decanted, and crystals were dried to afford a fine white powder which was subsequently washed with 2 3 ml of cold hexanes . Removal of all volatiles under reduced pressure yielded 630 mg of fine white powder (1). H nmr (300 mhz, cdcl3): 8.14 (br s, 1 h, p - ar - h), 8.09 (br s, 2 h, o - ar - h), 6.58 (dm, jhp = 388 hz, 1 h, ph), 0.32.0 (br m, 3 h, bh). P{h} nmr (121 mhz, cdcl3): 4.7 (br s, ph). B{h} nmr (160 mhz, cdcl3): 41.7 (br s, bh3). F nmr (282 mhz, cdcl3): 62.9 (s, cf3). Ei - ms (70 ev) m / z (%): 458 (62) [m bh3]. (adamantyl)2phbh3 was prepared under the same conditions as me3pbh3 but with (adamantyl)2ph instead of pme3 . H nmr (300 mhz, cdcl3): 3.61 (dm, 1 h, jhp = 379 hz, ph), 2.11 to 1.83 (30 h, adamantyl - h), 0.41 to 0.15 (br m, 3 h, bh). P{h} nmr (121 mhz, cdcl3): 40.1 (br m, ph). B{h} nmr (160 mhz, cdcl3): 44.8 (br d, bh3). Calcd for c20h34bp: c 75.89%, h 10.84% . A youngs flask charged with 0.25 mmol of r2phbh3 (118 mg of 1, 84 mg of 2, 65 mg of 3) and 5 mol% of [rh(dpp3)(c6h5f)][bar4] (18.4 mg, 0.0125 mmol) was heated to 90 c for 4 h (10 and 11) or 8 h (12) in melt conditions . The resulting solids were washed with n - hexane and recrystallized from a mixture of diethyl ether and hexane at 18 c (10 30 mg, 25%; 11 22 mg, 26%; 12 32 mg, 49%). H nmr (300 mhz, cdcl3): 8.09 to 7.89 (12 h, ar h), 7.32 (dm, jhp = 412 hz, 1 h, ph), 2.45 (br m, 2 h, bh2), 1.11 (br m, 3 h, bh3). P{h} nmr (121 mhz, cdcl3): 1.7 (br s, phr2), 14.0 (br s, pr2). B{h} nmr (160 mhz, cdcl3): 33.2 (br s, bh2), 37.7 (br s, bh3). H nmr (500 mhz, cd2cl2): 7.77 to 7.52 (16 h, ar h), 7.04 (dt, jhp = 426 hz, jhh = 7.8 hz, 1 h, ph), 2.37 (br m, 2 h, bh2), 1.02 (br m, 3 h, bh3). P{h} nmr (202 mhz, cd2cl2): 3.5 (br s, phr2), 15.4 (br s, pr2). B{h} nmr (160 mhz, cd2cl2): 33.7 (br s, bh2), 37.6 (br s, bh3). H nmr (500 mhz, cd2cl2): 7.64 to 6.77 (16 h, ar h), 6.69 (dt, jhp = 415 hz, jhh = 6.6 hz, 1 h, ph), 3.84 (s, 6 h, ch3), 3.80 (s, 6 h, ch3), 2.14 (br m, 2 h, bh2), 0.96 (br m, 3 h, bh3). P{h} nmr (202 mhz, cd2cl2): 7.6 (br s, phr2), 22.1 (br s, pr2). B{h} nmr (160 mhz, cd2cl2): 33.3 (br s, bh2), 37.1 (br s, bh3). To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 2 equiv of h3bpr2h (32 mg of 1, 23 mg of 2, 18 mg of 3 0.068 mmol) was added 1,2-f2c6h4 (5 ml). The solution was stirred at room temperature 10 min, and a change in color from pale orange to bright yellow was observed . Complexes 15 and 16 were isolated as yellow oils, and characterized in situ by nmr spectroscopy and esi - ms . Complex 14 could be crystallized at 24 c in the freezer inside the glovebox (yield 29.6 mg, 37%). Complexes 15 and 16 could not be isolated cleanly, and attempts to do so led to intractable mixtures of 15 and 16 with 18 and 19, respectively . Slow diffusion of pentane (10 ml) over a solution of 14 in 1,2-f2c6h4 at 24 c afforded yellow crystals (one of which was employed for an x - ray diffraction study). H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 5.81 (d, jhp = 435 hz, 1 h, ph), 3.120.81 (8 h, 3ch2 dpp3 + bh2), 0.78 (br, 3 h, bh3), 6.12 (br, 1 h, bh signals from the aromatics were not observed due to being overlapped by signals from 1,2-f2c6h4 . H nmr (500 mhz, 1,2-f2c6h4, selected data at 0 c): 6.12 (d, jhp = 65 hz, 1 h, bh rh). P{h} nmr (202 mhz, 1,2-f2c6h4): 29.5 (ddd, jprh = 130 hz, jpp(cis)= 35 hz, jpp(cis) = 21 hz, ph2p(ch2)3pph2), 11.3 (ddd, jpp(trans) = 244 hz, jprh = 103 hz, jpp(cis) = 35 hz, ph2p(ch2)3pph2), 0.7 (dd, jpp(trans) = 248 hz, jprh = 75 hz, rh - pr2bh3), 2.62 (br s, phr2bh3). B{h} nmr (160 mhz, 1,2-f2c6h4): 6.2 (bar4), 39.8 (br, 2 bh3). Esi - ms (1,2-c6h4f2, 60 c) positive ion: m / z = 1431.07 (calcd 1431.07, m 2bh3). Anal . Found: c 46.82%, h 2.39% . H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 4.90 (d, jhp = 414 hz, ph), 3.011.10 (8 h, 3ch2 dpp3 + bh2), 1.18 (br, 3h, bh3), 6.95 (d, jhp = 78 hz, 1 h, bh signals from the aromatics were not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 27.3 (ddd, jprh = 127 hz, jpp(cis) = 37 hz, jpp(cis) = 16 hz, ph2p(ch2)3pph2), 11.8 (ddd, jpp(trans) = 231 hz, jprh = 100 hz, jpp(cis) = 37 hz, ph2p(ch2)3pph2), 0.3 (dd, jpp(trans) = 231 hz, jprh = 70 hz, rh - pr2bh3), 5.96 (br s, phr2bh3). B{h} nmr (160 mhz, 1,2-f2c6h4): 6.2 (bar4) 39.9 (br, 2 bh3). Esi - ms (1,2-c6h4f2, 60 c) positive ion: m / z = 1159.13 (calcd 1159.13, m 2bh3). H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 4.93 (d, jhp = 409 hz, 1 h, ph), 3.77 (s, 6 h, och3), 3.69 (s, 6 h, och3), 3.160.58 (8 h, 3ch2 dpp3 + bh2), 1.11 (br, 3 h, bh3), 6.53 (d, jhp = 73 hz, 1 h, bh h). Signals from the aromatics were not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 27.3 (ddd, jprh = 132 hz, jpp(cis) = 37 hz, jpp(cis) = 12 hz, ph2p(ch2)3pph2), 9.5 (ddd, jpp(trans) = 227 hz, jprh = 98 hz, jpp(cis) = 37 hz, ph2p(ch2)3pph2), 0.7 (br dd, jpp(trans) = 227 hz, jprh = 65 hz, rh - pr2bh3), 11.2 (br s, phr2bh3). B{h} nmr (160 mhz, 1,2-f2c6h4): 6.2 (bar4) 38.7 to 49.8 (br, 2 bh3). Esi - ms (1,2-f2c6h4, 60 c) positive ion: m / z = 1021.25 (calcd 1021.25, m c6h4ome), 900.17 (calcd 900.17, m 2bh3, c6h4ome), 775.17 charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 2 equiv of h3bpr2h (32 mg of 1, 23 mg of 2, 18 mg of 3 0.068 mmol) was added 1,2-f2c6h4 (5 ml). The solution was stirred at room temperature for 24 h. the formation of h2 gas is also observed . Complexes 17 and 18 could not be isolated cleanly; they were observed with 22 and 23, respectively . Method b follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 1 equiv of 10 (32 mg, 0.068 mmol) slow diffusion of pentane (10 ml) over a solution of 17 in 1,2-f2c6h4 at 24 c afforded yellow crystals (one of which was employed for an x - ray diffraction study). H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8h, bar4), 7.69 (s, 4h, bar4), 4.40 (vbr, 1h, bh) 3.102.12 (8h, 3ch2 dpp3 + bh2), 1.20 (vbr, 1h, bh), 4.54 (vbr, 1h, bh), 13.98 (s, 1h, rh signals from aromatics not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 46.6 (dd, jrh p(cis)= 36, ph2p(ch2)3pph2), 29.5 (m, jp p(trans) = 260, rh - pr2bh3pr2hbh3), 12.8 (ddd,, jp p(trans) = 260, jrh p(cis) = 33, ph2p(ch2)3pph2), 2.7 (s, rh - pr2bh3pr2hbh3). B{h} nmr (160 mhz, 1,2-f2c6h4): 0.21 (br), 6.2 (s, bar4), 27.1 (br). Esi - ms (1,2-f2c6h4, 60 c) positive ion: m / z = 1457.09 (calcd 1457.12, m). H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 4.24 (v br, 1 h, bh), 2.611.72 (8 h, 3ch2 dpp3 + bh2), 1.29 (v br, 1 h, bh), 4.65 (v br, 1 h, bh), 14.90 (s, 1 h, rh p{h} nmr (202 mhz, 1,2-f2c6h4): 42.5 (dd, jprh = 106 hz, jpp(cis) = 34 hz, ph2p(ch2)3pph2), 28.6 (m, jpp(trans) = 272 hz, rh - pr2bh3pr2hbh3), 15.3 (ddd, jpp(trans) = 272 hz, jprh = 101 hz, jpp(cis) = 33 hz, ph2p(ch2)3pph2), 6.4 (s, rh - pr2bh3pr2hbh3). B{h} nmr (160 mhz, 1,2-f2c6h4): 0.4 (br), 6.2 (s, bar4), 25.9 (br). Esi - ms (1,2-f2c6h4) positive ion: m / z = 1185.17 (calcd 1185.18, m). H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 3.77 (s, 3 h, och3), 3.76 (s, 3 h, och3), 3.69 (s, 6 h, och3), 2.851.72 (8 h, 3ch2 dpp3 + bh2), 1.03 (v br, 1 h, bh), 4.00 (v br, 1 h, bh), 14.55 (s, 1 h, rh h). Signals from aromatics not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 42.7 (ddd, jprh = 109 hz, jpp(cis) = 35 hz, jpp(cis) = 12 hz ph2p(ch2)3pph2), 28.1 (br m, jpp(trans) = 279 hz, rh - pr2bh3pr2hbh3), 12.5 (ddd, jpp(trans) = 279 hz, jprh = 88 hz, jpp(cis) = 12 hz, ph2p(ch2)3pph2), 11.7 (br s, rh - pr2bh3pr2hbh3). B{h} nmr (160 mhz, c6h4f2): 3.42 (br), 6.2 (s, bar4), 27.7 (br). Esi - ms (1,2-f2c6h4) positive ion: m / z = 1033.27 (calcd 1033.27, m). Method a follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 2 equiv of h3bpr2h (32 mg of 1) the solution was stirred at room temperature for 24 h. the formation of h2 (gas) is also observed . Method b follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (20 mg, 0.034 mmol) and 2 equiv of phr2 (31 mg, 0.068 mmol, r = 3,5-bis(trifluoromethyl)phenyl) after stirring for 10 min the solution was evaporated to dryness and the solid washed with pentane (2 ml). Complex 21 was isolated as yellow solid (yield 17.8 mg, 57%). H nmr (500 mhz, 1,2-f2c6h4): 8.33 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 6.41 (dm, jhp = 375 hz, 2 h, ph), 2.62 (br, 4 h, 2 ch2 dpp3), 2.17 (m, 2 h ch2, dpp3). . P{h} nmr (202 mhz, 1,2-f2c6h4): 9.6 (m, 2p, aabbm), 5.5 (m, 2p, aabbm). Esi - ms (1,2-f2c6h4) positive ion: m / z = 1431.04 (calcd 1431.07, m). H nmr (500 mhz, 1,2-f2c6h4): 8.33 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 5.91 (dm, jhp = 359 hz, 2 h, ph), 2.57 (br, 4 h, 2 ch2 dpp3), 2.06 (m, 2 h ch2, dpp3). Signals from aromatics not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 12.2 (m, 2p, aabbm), 5.2 (m, 2p, aabbm). To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and h3bpr2h (4) (11 mg, 0.034 mmol) was added 1,2-f2c6h4 (5 ml). The solution was stirred at room temperature for 1 min, and a change in color from pale orange to purple was observed . H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.68 (s, 4 h, bar4), 3.45 (d, 1 h, jhp = 380 hz, b - ph), 2.521.12 (36 h, adamantyl - h + dpp3 ch2), 1.36 (br, 3 h, bh3). Signals from aromatics not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 35.1 (d, jprh = 167 hz, dpp3), 30.5 (br, b esi - ms (1,2-f2c6h4) positive ion: m / z = 629.09 (calcd 629.08, [rh(dpp3)(c6h4f2)]). Method a follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 2 equiv of h3bpr2h (4) (22 mg, 0.068 mmol) was added 1,2-f2c6h4 (5 ml). The solution was stirred at room temperature for 24 h. complex 24 was isolated as orange solid . Method b follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 1 equiv of phr2 (10 mg, 0.034 mmol) the solution was stirred for 5 min, and then 1 equiv of h3bpr2h (4) (11 mg, 0.034 mmol) was added . The solution was stirred for 5 min, and complex 24 was isolated as orange solid (yield 48 mg, 71%). Slow diffusion of pentane (10 ml) into a solution of 24 in 1,2-f2c6h4 at 24 c afforded yellow crystals (one of which was employed for x - ray diffraction studies). H nmr (500 mhz, 1,2-f2c6h4): 8.33 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 3.30 (d, jhp = 362 hz, 1 h, b - ph), 2.87 (d, jhp = 412 hz, 1 h, ph), 2.451.56 (66 h, dpp3 ch2 and adamantyl - h), 0.24 (br, 3 h, bh3). P{h} nmr (202 mhz, 1,2-f2c6h4): 60.4 (ddd, jpp(trans) = 266 hz, jprh = 142 hz, jpp(cis) = 30 hz, ph2p(ch2)3pph2), 30.5 (s, phr2bh3), 22.8 (dd, jprh = 163 hz, jpp(cis) = 30 hz, pph2(ch2)3pph2), 6.6 (ddd, jpp(trans) = 270 hz, jprh = 144 hz, jpp(cis) = 30 hz, rh - pr2bh3). B{h} nmr (160 mhz, 1,2-f2c6h4): 6.0 (s, bar4), 42.2 (br, bh3). Esi - ms (1,2-f2c6h4) positive ion: m / z = 956.30 (unidentified fragment). Calcd for c99h103b2f24p4rh: c 59.50%, h 5.20% . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) was added 1,2-f2c6h4 (5 ml). A 2 equiv portion of h3bph2cy (5) (0.68 ml, 0.1 m solution in 1,2-f2c6h4, 0.068 mmol) was then added . The solution was stirred at room temperature for 1 min, and a change in color from orange to pale yellow was observed . Complexes 25a and 25b were observed as an approximate 1:1 ratio of isomers and were characterized in situ by nmr spectroscopy . Complexes 25a and 25b could not be isolated as they reacted quickly to form complexes 26a and 26b . The p{h} nmr spectrum of this reaction mixture indicates that 2 diastereomers are present; while we were able to identify the 2 sets of 4 resonances each (labeled and, based on coupling constants and approximate integrations) it was not possible to determine which set of signals belonged to which diastereomer . H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 2.730.32 (32 h, 3 ch2 dpp3 + bh2, cyh, ph), 2.29 (v br, 3 h, bh), 7.92 (br d, 1 h, bh - rh), 17.51 (s, 1 h, rh p{h} nmr (202 mhz, 1,2-f2c6h4): 31.7 (dm, jprh = 134 hz, ph2p(ch2)3pph2), 30.5 (dm, jprh = 129 hz, ph2p(ch2)3pph2), 11.8 (overlapping ddd, jpp(trans) = approximately 200 hz, jprh = approximately 104 hz, jpp(cis) = approximately 25 hz, ph2p(ch2)3pph2), 11.0 (br d, jpp(trans) = approximately 200 hz, rh - phcy - b), 32.1 (br d, jpp(trans) = approximately 200 hz, rh - phcy - b), 39.8 (br s, rh h3bph2cy), 44.2 (br s, rh h3bph2cy). Esi - ms (1,2-f2c6h4, 60 c) positive ion: m / z = 747.20 (calcd 747.21, m 2bh3). To a stirred solution of pcyh2 (3.40 ml, 10% wt in hexane, 2.0 mmol) in dichloromethane (20 ml) was added brh2bsme2 (1.0 ml, 1.0 m in ch2cl2, 1.0 mmol) and the solution stirred at room temperature for 2 h. the resulting colorless solution was concentrated in vacuo to approximately 3 ml, and diethyl ether (30 ml) was added to precipitate a white solid . The solvent was decanted off and the solid washed with a further 10 ml of diethyl ether . The solid was redissolved in dichloromethane, filtered, and recrystallized from a mixture of dichloromethane and diethyl ether at 18 c to yield white crystals (first crop 0.190 g, second crop 0.041 g, overall yield 71%). At room temperature in cd2cl2 [(cyh2p)2bh2]br undergoes a degenerate exchange reaction; [(cyh2p)2bh2]br is in equilibrium with cyh2pbh2br + ph2cy . This exchange process does not occur at 60 c on the nmr time scale, and each of these species can be observed . In the solid - state h nmr (500 mhz, 60 c, cd2cl2): 5.46 (dm, jhp = 429 hz, [(cyh2p)2bh2]), 4.75 (dm, jhp = 388 hz, cyh2pbh2br), 2.52 (dm, jhp = 196 hz, cyh2p), 2.371.16 (cyh and bh). P{h} nmr (202 mhz, 60 c, cd2cl2): 35.5 (br s, [(cyh2p)2bh2]), 38.2 (br s, cyh2pbh2br), 107.5 (s, cyh2p) [(cyh2p)2bh2]br (0.150 g, 0.461 mmol) (prepared as above) and [nbu4][bh4] (0.119 g, 0.461 mmol) were added to a schlenk tube . Dichloromethane (10 ml) was added, and effervescence was observed; the solution was stirred at room temperature for 1 h. the solvent was removed in vacuo, and n - hexane (20 ml) was added to the white solid . The solution was filtered to remove [nbu4]br and concentrated to approximately 2 ml . Storage of this solution for 16 h at 18 c yielded colorless crystals of 13 (0.102 g, 86%). H nmr (500 mhz, 25 c, cd2cl2): 4.68 (dm, jhp = 386 hz, cyh2pbh2phcybh3), 3.50 (dm, jhp = 326 hz, cyh2pbh2phcybh3), 2.170.02 (cyh and bh). P{h} nmr (202 mhz, 25 c, cd2cl2): 36.6 (br, cyh2pbh2phcybh3), 45.1 (br, cyh2pbh2phcybh3). Anal . Found: c 55.79%, h 11.82% . Method a follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) was added 1,2-f2c6h4 (5 ml) followed by 2 equiv of h3bpcyh2 (5) (0.68 ml, 0.1 m solution in 1,2-f2c6h4, 0.068 mmol). The solution was stirred at room temperature for 12 h. the formation of h2 is also observed . Complexes 26a and 26b were characterized as a mixture in solution by nmr spectroscopy and esi - ms . The p{h} nmr spectrum of this reaction mixture indicates that 2 diastereomers are present; we were able to identify the 2 sets of 4 resonances each (labeled 26a and 26b, based on coupling constants and approximate integrations) and tentatively assigned the individual diastereomers (scheme s5, supporting information) by inspection of a model . Method b follows . To a youngs flask charged with [rh(dpp3)(c6h5f)][bar4] (50 mg, 0.034 mmol) and 1 equiv of cyh2pbh2pcyhbh3 (13) (8.8 mg, 0.034 mmol) complexes 26a and 26b were characterized as a mixture in solution by nmr spectroscopy and esi - ms . H nmr (500 mhz, 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 4.353.01 (ph and bh), 2.920.92 (30 h, 3ch2 dpp3, bh2, cyh), 2.98 (br, 1 h, bh - rh), 5.98 (br, 1 h, bh - rh), 16.08 (s, 1 h, rh signals from aromatics not observed due to being overlapped by signals from 1,2-f2c6h4 . P{h} nmr (202 mhz, 1,2-f2c6h4): 37.9 (dm, jprh = 102 hz, ph2p(ch2)3pph2), 34.5 (dm, jprh = 102 hz, ph2p(ch2)3pph2), 19.8 (br d, jpp(trans) = approximately 255 hz, rh - phcyb), 16.2 (br d, jpp(trans) = approximately 255 hz, rh - phcy - b), 10.7 (overlapping dm, jpp(trans) = 255 hz, jprh = 88 hz, jpp(cis) = approximately 25 hz, ph2p(ch2)3pph2), 14.9 (br s, rh - phcybh2phcybh3), 16.6 (br s, rh - phcybh2phcybh3). Esi - ms (1,2-f2c6h4, 60 c) positive ion: m / z = 773.26 (calcd 773.24, m). [rh(nbd)2][bar4] was synthesized by an adaptation of the preparation of [rh(cod)2][bar4]. [rh(nbd)2][bar4] (0.100 g, 0.0869 mmol) was dissolved in ch2cl2 (10 ml) to produce a deep red solution . (2s,4s)-2,4-bis(diphenylphosphino)pentane (bdpp) (0.0383 g, 0.0869 mmol) was added, and a color change to red was observed . The solution was stirred for 1 h at room temperature before the solvent was removed in vacuo . N - pentane (20 ml) was added, and the solution was sonicated to produce an orange powder . The solvent was decanted and the solid washed with pentane (2 20 ml). The product was dried in vacuo and isolated (yield 0.102 g, 78%). H nmr (300 mhz, cd2cl2): 7.72 (s, 8 h, bar4), 7.56 (s, 4 h, bar4), 7.707.36 (m, p - ph), 4.86 (m, 2 h, = c h), 4.30 (m, 2 h, = c h), 3.90 (m, 2 h, nbd c h), 2.77 (m, 2 h, p c h), 1.84 (tt, jhh = 6.45 hz, jhp = 19.95 hz, 2 h, ch2), 1.58 (m, 2 h, nbd ch2), 1.13 (m, 6 h, ch3). P{h} nmr (121.6 mhz, cd2cl2): 27.4 (d, jprh = 149 hz). Anal . Found: c 54.32%, h 3.18% . [rh(bdpp)(nbd)][bar4] prepared as above (0.020 g, 0.0133 mmol) was added to a high - pressure nmr tube and dissolved in fluorobenzene (0.5 ml). H nmr (500 mhz, c6h5f): 8.32 (s, 8 h, bar4), 7.61 (s, 4 h, bar4), 5.63 (m, 2 h, ar h), 2.38 (m, 2 h, p - ch), 1.40 (m, 2 h, ch2), 0.78 (m, 6 h, ch3). Signals from p - ph not observed due to being overlapped by signals from c6h5f . Signals from norbornane (from hydrogenation of norbornadiene) can also be observed at 2.12 (m, 2 h, nba c h), 1.40 (m, 2 h, nba ch2, overlapped), 1.11 (m, 2 h, nba ch2). P{h} nmr (202 mhz, c6h5f): 39.9 (d, jprh = 194 hz). Esi - ms (c6h5f, 60 c) positive ion: m / z = 639.13 (calcd 639.12, m). [rh(bdpp)(c6h5f)][bar4] (26) was prepared in a high - pressure nmr tube as above . To this was added 2 equiv of h3bph2cy (5) (0.27 ml, 0.1 m solution in 1,2-f2c6h4, 0.027 mmol) and the solution mixed for 1 min . Complexes 27a and 27b were observed as ratio of isomers and were characterized in situ by nmr spectroscopy . Complexes 27a and 27b could not be isolated as they reacted quickly to form complexes of 28; signals for 28 can be observed in both h and p{h} nmr spectra of 27a and 27b which, along with the presence of h2, show that the complexes rapidly undergo dehydrocoupling to form complexes of 28 . The p{h} nmr spectrum of this reaction mixture indicates that 2 diastereomers are present; while we were able to identify the 2 sets of 4 resonances (labeled and, based on coupling constants and approximate integrations), it was not possible to determine which set of signals belonged to which diastereomer . H nmr (500 mhz, c6h5f + 1,2-f2c6h4): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 4.19 to 0.32 (ch3, ch2, ch, bdpp, bh2, cyh, ph), 1.80 to 3.31 (v br, 3 h, bh3), 7.54 to 8.86 (br d, 1 h, bh - rh), 17.73 (br s, 1 h, rh signals from aromatics not observed due to being overlapped by signals from c6h5f and 1,2-f2c6h4 . H2 can be observed in the nmr spectrum as a sharp singlet at 4.52 ppm suggesting that some dehydrocoupling to complex 28 has occurred . This is further evidenced by the small rh h hydride signal at 16.07 ppm which is observed for complex 28 . P{h} nmr (202 mhz, c6h5f + 1,2-f2c6h4): 42.5 (dm, jprh = 129 hz, ph2p(ch2)3pph2), 32.6 (dm, jprh = 119 hz, ph2p(ch2)3pph2), 28.3 (overlapping ddd, jpp(trans) = approximately 208 hz, jprh = approximately 98 hz, jpp(cis) = approximately 32 hz, ph2p(ch2)3pph2), 3.6 (br d, jpp(trans) = approximately 208 hz, rh - phcy - b), 12.1 (br d, jpp(trans) = approximately 208 hz, rh - phcy - b), 42.1 (br s, rh [rh(bdpp)(c6h5f)][bar4] was prepared on an nmr scale from [rh(bdpp)(nbd)][bar4] (0.020 g, 0.0133 mmol) as above . This solution was transferred by cannula to an nmr tube containing cyh2pbh2phcybh3 (13) (3.4 mg, 0.0133 mmol), and the solution was mixed briefly to yield a pale yellow solution . [rh(bdpp)(c6h5f)][bar4] was prepared on an nmr scale from [rh(bdpp)(nbd)][bar4] (0.020 g, 0.0133 mmol) as above . To this was added 2 equiv of h3bph2cy (5) (0.27 ml, 0.1 m solution in 1,2-c6h4f2, 0.027 mmol) and the solution mixed for 18 h. the p{h} nmr spectrum arising from method a indicates that 4 diastereomers are present; while we were able to identify some of the signals from the 4 sets of 4 resonances (labeled,, $, and & based on coupling constants and approximate integrations), it was not possible to determine which set of signals belonged to which of the diastereomers . See figure s7, supporting information h nmr (500 mhz, c6h5f): 8.32 (s, 8 h, bar4), 7.69 (s, 4 h, bar4), 5.472.46 (ph), 2.110.63 (ch, ch2, and ch3 bdpp, bh2, cyh), 3.21 (br, 1 h, bhrh), 5.65 to 6.85 (br, 1 h, bhrh), 16.09, 16.20, and 17.04 (s, 1 h, rh signals from aromatics not observed due to being overlapped by signals from c6h5f and 1,2-c6h4f2 . P{h} nmr (202 mhz, c6h5f): 58.9 (ddd, jprh = 107 hz, jpp(cis) = 30 hz, jpp(cis) = 12 hz, ph2p(ch2)3pph2), 58.0 (dm, jprh = 102 hz, ph2p(ch2)3pph2), 46.6 (dm, jprh = 100 hz, ph2p (ch2)3pph2), 43.6 (dm, jprh = 102 hz, ph2p(ch2)3pph2), 28.7 (ddd, jpp(trans) = 254 hz, jprh = 90 hz, jpp(cis) = 32 hz, ph2p(ch2)3pph2), 27.5 (ddd, jpp(trans) = 250 hz, jprh = 92 hz, jpp(cis) = 32 hz, ph2p(ch2)3pph2), 24.817.7 (overlapping m, jpp(trans) = approximately 254 hz, jprh = approximately 87 hz, jpp(cis) = approximately 26 hz, ph2p(ch2)3pph2 and rh - phcy - b), 13.5 to 20.6 (br s of 4 isomers, rh - phcybh2phcybh3). Esi - ms (1,2-c6h4f2, 60 c) positive ion: m / z = 801.29 (calcd 801.29, m). In order to establish that dehydrocoupling had occurred when method b was used to form complexes 28, excess (10 equiv) of 1,2-bis(diphenylphosphino)ethane was added to the reaction mixture to release the dehydrocoupled product, cyh2pbh2phcybh3, from the metal center . The p{h} nmr spectrum showed two broad signals at 37.9 and 43.9 which are in agreement with those found for compound 13 . In a procedure similar to that reported by manners et al ., phh2pbh3 (0.248 g, 2.0 mmol) was dissolved in toluene (10 ml) either in the presence of [rh(dpp3)(c6h5f)][bar4] (14.7 mg, 0.01 mmol) or with no catalyst present . The solution was heated to reflux for 16 h before cooling to room temperature . The solution was concentrated in vacuo and added to stirred hexane (100 ml) to produce a white precipitate . The solvent was decanted and the solid washed with hexane (2 50 ml). The solid was dried in vacuo and isolated in air (yield 0.110 g rh catalyzed, 0.101 g uncatalyzed). The p{h} nmr spectrum of the isolated solids produced by the different methods are very similar with several very broad peaks from 45 to 57 and very broad peaks of lower intensity from 72 to 87 . This is in agreement with the results obtained by manners et al . For uncatalyzed polymerization of phh2pbh3 . A youngs flask charged with phh2pbh3 (31 mg, 0.25 mmol) and 5 mol% of [rh(dpp3)(c6h5f)][bar4] (18.4 mg, 0.0125 mmol) was heated to 90 c for 4 h in melt conditions . The p{h} nmr spectrum shows a peak at 49.3 ppm in agreement with that observed by manners et al . For polymeric material and a lower intensity resonance at 55.0 ppm . See supporting information figure s9 . In the p{h} nmr spectrum the peak at 49.3 ppm split into a broad doublet with a jph coupling constant of approximately 350 hz . Analysis by esi - ms of the reaction mixture showed a repeating pattern corresponding to the polymeric repeat unit [phhpbh2], see figure s10, supporting information.
|
Coronary artery aneurysm is defined as coronary dilatation, which exceeds the diameter of normal adjacent segments or the diameter of the patient's largest coronary vessel by 1.5 times . Aneurysms are observed most commonly in the right coronary artery, and least frequently in the left main coronary artery . Among the causes of coronary artery aneurysm, aneurysms following drug eluting stent implantation has also been described . We present the case of a patient who had infective coronary artery aneurysms that developed after percutaneous intervention (pci), leading to coronary artery to bronchial fistula and manifested as massive hemoptysis . A 54-year - old male with history of hypertension initially presented with acute onset chest pain . On evaluation, he was detected to be having critical stenosis in left anterior descending artery (lad) and left posterior descending artery (lpd) for which drug eluting stenting was done . However, he had a recurrence of angina after 06 months and on subsequent re - evaluation, in - stent restenosis of the lad was diagnosed . There was no cough, pleuritic chest pain, loss of appetite and weight loss . He was febrile (temp 102f), blood pressure was 104/70 mmhg, pulse 90/min, respiratory rate 18 breaths / min . Mantoux test was 5 mm in diameter and there was no afb on sputum examination . Based on radiological appearance pneumonia was diagnosed presumptively, and he was started on intravenous broad - spectrum antibiotics . Fiber optic bronchoscopy revealed mucosal erosion with flap at the entrance of lul bronchus on the medial aspect, with ongoing bleeding from the site . Fibreoptic bronchoscopy revealed bleeding underneath the mucosal flap at the entrance of lul bronchus on medial aspect (white arrow) cect chest was done, which showed the coronary stent in the position in the left anterior descending and posterior descending arteries . A post contrast study displayed extravasation of contrast into this soft - tissue density with identifiable communication with lad [figure 2a]. These findings were indicative of aneurysm arising from lad in the vicinity of the stent . There was patchy consolidation in lingular segment abutting mycotic aneurysm suggestive of communication between the aneurysm and lung [figure 2b]. (a) cect (chest)mediastinal window showing extravasation of contrast into lad aneurysm communicating with lad (white arrow). (b) cect (chest)parenchymal window aneurysm lad with consolidation of adjacent lingular segment (black arrow) coronary angiography [figure 3] confirmed the findings of cect chest showing aneurysm involving lad in the vicinity of stent with normal left circumflex and right coronary arteries and extravasation of contrast . Lad aneurysmectomy, extraction of stents and coronary artery bypass grafting (cabg) with left internal mammary artery (lima) to lad was done . After surgery, the patient improved symptomatically with cessation of hemoptysis and subsidence of fever . Thereafter, he was continued on medical management in the form of dual antiplatelet agents, antianginal and antihypertensive drugs . Coronary angiogram demonstrating aneurysm in left anterior descending artery (black arrows) other causes of coronary artery aneurysm include kawasaki disease, percutaneous coronary interventions (pci), inflammatory arterial diseases, systemic lupus erythematosus, syphilis, takayasu disease, chest traumas and connective tissue disorders . Coronary artery aneurysms after pci are sporadic (0.3 - 0.6%) being described in few case reports only . Our patient developed coronary artery aneurysm, as a complication of pci, which is a rare entity . Coronary artery aneurysm in our patient was further complicated by coronary artery to bronchus fistula leading to hemoptysis . Coronary artery aneurysm complicating into the coronary artery fistula in connection with lung has not been reported yet . Previously coronary artery fistula (post coronary artery aneurysm) has been described in relation to cardiac chambers only . Residual dissection and deep arterial wall injury (rupture or resection of the vessel media) caused by oversized balloons or stents, high - pressure balloon inflations, atherectomy, and laser angioplasty have all been associated with coronary artery aneurysms after coronary intervention . Drug - eluting stents (des), which locally elute antiproliferative drugs, can dramatically inhibit neo intimal growth, thereby suppressing re - stenosis but at the same time potentially causing coronary aneurysms due to other mechanisms, such as delayed re - endothelialization, inflammatory changes of the medial wall, and hypersensitivity reactions . Coronary infection after stenting can present days to weeks after intervention, most frequently as an acute coronary syndrome, in gross contrast to this, our patient presented with hemoptysis, which has not seen in earlier studies . Our patient had a fistulous connection with left bronchus as the complication of the aneurysm which was quite evident on bronchoscopy, computed tomography and intraoperatively . There was associated consolidation of lingular segments due to trickling down of blood from fistula . Treatment options for coronary aneurysm consist of medical management with the use of antiplatelet and anticoagulation therapy to prevent thrombus formation within the aneurysm . Surgery should be considered for patients with large aneurysms because of the high risk of rupture . Our patient had developed the fistula as a result of the mycotic coronary artery aneurysm for which he underwent lad aneurysmectomy, extraction of stents and cabg with lima to lad.
|
Hydration mediates many processes in nature, among which are protein folding, phase partitioning of chemicals, and protein there is increasing interest in taking advantage of the water thermodynamics and structure in drug design . Indeed, methods such as watermap and gist use explicit solvent simulations to score the stability of specific water sites in an enzymatic active site by the means of explicit solvent simulations . These methods have the disadvantage of being relatively slow, which opens the way for more approximate methods including grid or szmap that treat water as a fluid lacking correlations interacting with a solute via an effective solvent potential as in the case of szmap . More approximate methods based on continuum solvent models can also capture certain aspects of hydration such as the high dielectric polarization of water . They have the advantage of being orders of magnitude faster than molecular simulations, but lack the packing and h - bonding structure of water, which greatly limits the behavior of the model where the size and anisotropy of water molecules matter . An intermediate approach using liquid state integral equations, called the three - dimensional reference interaction site model (3d - rism), is very attractive for applications where the high dielectric polarization, the detailed interactions with a solute, and the multibody correlations of the solvent structure matters . The 3d - rism method produces an approximate average solvent distribution around a rigid solute . It is orders of magnitude faster than molecular simulations and does not share the sequestered - water sampling problem that molecular simulations have . Compared to the independent particle approximation or continuum models, it has the advantage of treating water in a liquid state, incorporating the molecular correlations in an effective way . The 3d - rism approach becomes an interesting alternative in many applications to the more traditional methods . However, a major weakness of the 3d - rism is its poor ability to compute, with any reasonable accuracy, the hydration free energy (hfe) of organic solutes . This defect is related to the problem of all extended rism theories in dealing with the thermodynamics of hydrophobicity . Figure 1 shows the inadequacy of the 3d - rism with the kh closure hfes for a set of 504 small organic molecules when compared to experimental results (c.f . Comparison of the 3d - rism / kh prediction of the hydration free energy with experimental results for a set of 504 small organic molecules . It is important to be able to calculate with sufficient accuracy the hfe of small solutes given that the equilibrium for ligand binding depends on both the direct interaction of the ligand as well as the desolvation penalty . Explicit solvent approaches such as watermap and gist are scoring functions not designed to compute hfes since these methods do not account, for example, for the cavity free energy . The independent particle methods and continuum approaches are also missing most of the cavity free energy and usually rely on surface area (sa) scaling or other approximate types of methods . It is known that sa types of approaches do not produce accurate cavity terms compared to more rigorous theoretical calculations . It is therefore of great interest to find a theoretical formalism to compute the full hfe including the cavity free energy component . In this article, we test 3d - rism with the kh closure and the ng modified free energy functional against converged explicit solvent simulations . We show that only a single component of the energy functional is responsible for most of the error correction . In the next sections, we first briefly review important aspects of the 3d - rism / kh; we then show results and present our calculations . The fundamental equations that lead to the practical framework we use can be derived using the variational principle in the density functional theory of liquids . This formally states that, given an external potential (e.g., the interaction potential coming from a solute), the true physical solvent distribution density minimizes the grand canonical potential functional . The ornstein zernike type of integral equation such as the rism approximation for molecular solvents, may be used to compute solvent density and thermodynamic functions that can be solved on a spatial grid . Alone, it is difficult to use this approach to treat complicated solutes such as drug - like molecules or proteins . The 3d - rism method makes possible applications such as computing the hfe of more elaborate solutes . The idea is to fix a single solute (implying infinite dilution of the solute) and compute the solvent perturbation using any of a number of closures . The 3d - rism equations with a suitable closure only need the solute and solvent potential parameters as input, typically from molecular two - body additive force fields (e.g., amber, charmm, etc . ), and the solvent thermodynamic conditions (bulk solvent density, temperature, and composition). Once solved, the 3d - rism equations yield approximate density distribution functions, direct correlation functions (dcf) for each h and for o in the case of pure water . The distribution function is the three - dimensional analog to the radial distribution function (also called pair distribution function). It gives the spatial density of the solvent atoms in the presence of a solute . The auxiliary dcfs are essential to relating the solvent distribution functions to the solvent free energy . It is very convenient that, using thermodynamic integration, an exact equation can be derived for the hfe . The equivalent formalism applied to molecular simulations requires multiple simulations, each of which account for the variation of a transformation parameter . However, as previously shown, the approximate 3d - rism hfes lack sufficient accuracy when compared to either experiments or more rigorous simulation methods . This will be further demonstrated hereafter . In an attempt to improve the 3d - rism hfes, the theoretical corrections had success on a limited number of molecules and focus on the improvement of the closure equation with additional so - called bridge terms . Universal correction (uc) shows that, with a two parameter fit to the partial molar volume, the 3d - rism hfe can be reasonably well corrected . The original uc is given by1where guc is the corrected hydration free energy in kcal / mol, gkh is the 3d - rism hydration free energy using the kovalenko hirata (kh) closure in kcal / mol, is the number density of bulk water (0.0333 molecule /), and vm is the partial molar volume in units of / molecule . The correction optimized by palmer et al . Is quite interesting . Here, we go beyond a fit to experimental hydration free energies . We find a correction optimized on computed quantities that ultimately only depends on fundamental atomic quantities derived from simulation and the thermodynamic state of the system . Also, our proposed method stems from correcting the analytical free energy functional found in 3d - rism / kh and provides a better understanding of the nature of the hfe errors . To accomplish this, we fit with a single parameter based on a computed lennard - jones sphere hfe to obtain a demonstrably transferable constant that scales a well - known approximate bridge function . In order to set the stage for what follows, it is useful to examine the equation used to calculate the hfe and derived, as stated above, directly from the thermodynamic formulation . The formulas and its approximation changes with different closure equations, but for the approximate kh closure one has2where kb is the boltzmann constant, t is the temperature in kelvin units, is the bulk density of solvent center (0.0333 for oxygen and 0.0666 for hydrogen), and () is the deviation of the solvent particle density relative to bulk for the solvent center . The position dependent change in density can be written as o () = o () o where o () is the calculated oxygen density distribution of water that results from the 3d - rism calculations . The function (x) is a heaviside step function that effects the quadratic term of the density deviation when the density is less than bulk . Finally, the direct correlation function for a solvent particle is noted c (). The solute solvent interaction potential, used in the 3d - rism calculation, is defined as3where the i summation is over the solute centers, 0 is the vacuum permittivity, the atomic partial charges are denoted by q, and the distance between the point and the ith solute atomic center coordinate is given by ri . The standard lennard - jones potential is used where i is the energy well depth associated with the ith solute atom, is the energy well depth associated with the solvent particle, and the lennard - jones atomic radius minima are denoted by . It is useful to point out at this stage that the hfe can be formally split into its nonpolar (np) and electrostatic (ele) components4 each of these terms can be calculated using molecular simulations and the free energy perturbation (fep) technique using double decoupling for instance . The gnp term corresponds to the work required to create a cavity with lennard - jones attractions in water, while all the atomic charges of the solute are zero . The gele term corresponds to the work needed to restore the solute atomic partial charges in solution once the cavity is created . In other words, it is the cost (or gain) of the reorganization of the solvent when the solute lennard - jones volume recovers its full polarity . This separation of the total free energy commands a stepwise calculation with a specific order of decoupling in simulation where the atomic partial charges need to be zeroed before decoupling the lennard - jones parameters . These free energy quantities can also be computed individually with 3d - rism using eq 2 in two steps: gnp is calculated using eq 2 from a 3d - rism / kh run with the solute atomic partial charges set to zero, and then gele is computed using eqs 2 and 4 . We can rewrite eq 2 with the definition of a free energy density function integrand for each solvent center, noted g (), as follows5which simplifies the notation when the volume of integration v is partitioned by a surface within which the solvent is excluded vin and the part of space outside the exclusion domain vext6then, for the integral over vin, gkh is split into an electrostatic and a nonpolar component . We wish to correct the behavior of the 3d - rism / kh hfes for the problematic behavior of the nonpolar component only . An effective bridge function correction to the hfe may be introduced by scaling the dcfs (c functions) in eq 5 by a constant yet to be determined . This leads directly to7from which one recovers eq 2 when the full dcfs are used (= 1). It is useful to note that the most positive contribution to gkh comes from conp () inside the molecular core exclusion domain . Also, the theoretical separation of the solvent water molecule densities into oxygen and hydrogen in the exclusion domain should be dominated by the repulsive core behavior (exclusion) of single water molecules . This led us to consider the oxygen correction only given that the packing is mainly represented by the oxygen l - j in most water models8 this leaves us with an equation with one adjustable parameter . We can optimize the free energy functional by adjusting the parameter following a strategy employed by others with bridge functions . We note that the bridge function correction proposed here is not computed self - consistently in the integral equation but only for the free energy form itself . The 504 molecules used in this work come from a compilation done by rizzo et al . And then enriched by mobley et al . With extensive free energy perturbation results . The atomic partial charges, computed using am1-bcc, and starting geometry come from the supporting information of mobley et al . The small molecule lennard - jones parameters were set using the moe assignment rules based on the opls parameters and functions . The solute geometries were optimized using moe and the mmff94 force field with the moe 2011.10 rfield implicit solvation model with a dielectric of 80 to account for the formation of intramolecular polar interactions . We used the c - tip3p water model that was shown to reproduce the pair correlation function of pure water in simulation . It should be noted that the results for all rism like integral equations are approximate . E, the o = 0.156 kcal / mol, o = 1.76827, h = 0.152 kcal / mol, and h = 0.6938 . The oh distance is set to 0.9572 and the hoh angle to 104.52. the main difference with the standard tip3p water model is the addition of a hydrogen repulsive l - j term set to match the water dimer potential of the tip3p water model and the water water pair correlation functions, which eliminates the need for other approximations typically needed . The calculations were conducted using ambertools, version 1.4 . The kovalenko hirata (kh) closure the susceptibility response function of the pure liquid was computed using the ambertools rism1d program based on the drism method . The calculation was stopped when the direct correlation function residuals reached 10, the temperature was set to 298 k, and the water dielectric constant was set to 78.497 . The produced correlation functions were used as the input to the 3d - rism program for which the grid spacing was set to 0.4; the minimum distance between any atom of the solute and the boundary of the grid box was set to 10 . The calculation was converged to a direct correlation function residual of 10 per point . In all cases, the hfes produced with these parameters had numerical errors around 0.1 kcal / mol . Our choice of calculation parameters allowed computation of hfes within seconds instead of many tens of minutes as previously reported . This was achieved by reducing the grid density, by reducing the grid volume, and by lowering the convergence thresholds . The improved timings come from the combined effects of a careful scan of the parameters and the efficient mdiis algorithm . The presented approach is orders of magnitude faster than explicit solvent simulation that typically requires thousands of cpu hours . The vin region or interior volume was determined using the 3d - rism calculation grid . At each grid point, the lennard - jones interaction potential between the water oxygen and the solute was calculated . Any point with a potential larger than 10 kcal / mol was considered as part of vin and included as part of the integration domain of eq 8 . Beyond 5 kcal / mol, the boundary threshold does not need to be fitted . What matters is that the water density must be very low . A threshold based on the lennard - jones potential as opposed to the water oxygen density has the advantage of decoupling the choice of the boundary from the 3d - rism solution . The reported standard errors are estimated for the fitted parameters and the predicted quantities using 2000 samples in a bootstrap analysis . As mentioned in the introduction, the calculated 3d - rism / kh hfes do not correlate well with either experimental or fep values, as clearly shown in figures 1 and 2a . Even more troubling, the dynamic range of the values calculated with 3d - rism is not reasonable . However, this explanation does not lead to a straightforward correction since the calculation of the entropy is not explicit in the formula . When the fep - calculated hfe is partitioned into the nonpolar and electrostatic components, the 3d - rism evaluation of the electrostatic components of the hfe correlates remarkably well, as shown in figure 2c, given that no parameter is fitted . The slope is close to one and the y - axis intercept close to zero . Plots of g fep vs g 3d - rism, gnp fep vs gnp 3d - rism, and gele fep vs gele 3d - rism . The total 3d - rism / kh hydration free energy (hfe) does not correlate with the simulation based free energy perturbation hfe (a). The nonpolar component of the hfe explains most of the errors (b) because the electrostatic component (c) of the hfe obtained with 3d - rism correlates well with the fep results . The nonpolar contribution explains most of the variance observed in the residuals of the calculated hfes as shown in figure 2b . Therefore, gnp needs to be corrected . Here, we use eq 8 . It seems natural to simplify the problem to the calculation of the hfe of monatomic spherical lennard - jones (lj) solutes, which by definition do not have atomic partial charge and bear the simplest molecular shape one can imagine . For this purpose the optimization of the parameter in eq 8 to reproduce the calculated hfes of the lj monatomic solutes shows considerable improvement as demonstrated in figure 3a and b (see also figure 4). The dcf scaling factor obtained was = 0.380 . To verify that it is not only valid for the solute of spherical shapes, table 2), the two values are statistically indistinguishable, which suggests that the optimal value of is solute - shape - invariant, at least for molecules of the size and shape of our data set . Once again, the correction applied on the dcf in the solvent - excluded volume markedly improves the correspondence between the 3d - rism and the calculated fep gnp as shown by the correlation graph illustrated in figure 3a . Most notably, the dynamical ranges of both fep and corrected 3d - rism match; the correlation slope is close to one and the intercept close to zero . Using our corrected nonpolar 3d - rism component and the electrostatic term leads to a corrected 3d - rism hfe in good agreement with fep . Indeed, with a single constant fitted to the lj solute hfe, one cannot statistically distinguish fep from 3d - rism hfes as shown in figure 3b . Plots of g fep vs g 3d - rism and vs g 3d - rism corrected . The optimization of the parameter in eq 8 improves the hydration free energy (hfe) correlation for a series of lennard - jones monatomic solutes as shown above, where (a) the initial 3d - rism formula (c.f . Eq 2) is applied and where (b) the correction is applied (c.f . Plots of gnp fep vs gnp 3d - rism corrected and g fep vs g 3d - rism corrected . The corrected 3d - rism nonpolar hydration free (hfe) energy (c.f . Eq 8), using = 0.38 obtained by fitting monatomic lennard - jones solute hfes, shows a significant improvement for both the nonpolar component and the total hfe over the original formulation . The repulsive bridge correction (rbc) from kovalenko and hirata was shown to improve the hfe of inert gas atoms, and we computed the hfe using their thermodynamic perturbation theory (tpt) approximation . Although we observed that the comparison with experimental results changed the r of the rbc - tpt model from 0.2 to 0.6, the gnpr remains poor at a value of 0.16 . The refit was necessary because we used a more extensive data set and a different water model . It is interesting to observe that the fit on the lj solute data set leads to statistically similar constants to those fit to the mobley hfes . Furthermore, the addition of a constant (b in table 2) did not significantly improve the model . The fact that the corrections presented in table 2 and using either the water - excluded domain or the more empirical approach based on the partial molar volume have similar accuracy is not too surprising since the partial molar volume is related to the solvent - excluded volume given that the former represents the volume of one solute in pure water . In this study, we showed that the 3d - rism hydration free energy (hfe) with the kh closure formula is not accurate when used on a large data set of 504 small molecules for which experimental and double decoupling free energy perturbation (fep) values are available from the literature . The decomposition of the hfe into its electrostatic and nonpolar components lead us to conclude that the electrostatic component of the hfe is reasonably well reproduced without any empirical fit, i.e., using standard molecular mechanics parameters for the lennard - jones potential and the am1-bcc partial charge model . However, the nonpolar component of the hfe was the clear source of error . We have found that scaling the nonpolar oxygen - solute ng - style direct correlation bridge function contribution to the hfe only over the solvent - excluded region using a single scaling constant brings the theoretically correct 3d - rism formula to much better agreement with the corresponding simulated fep and experimental values . It was also surprising that this single parameter is the same for lennard - jones monatomic solutes and for a diverse set of 504 small molecules . This -corrected hfe functional can simultaneously reproduce the high level fep nonpolar hfes, the fep electrostatic hfes, the fep total hfes, and the experimental hfes of the set of 504 small molecules used in this study . It is important to realize that the optimal was not fit to experimental quantities but solely to computed quantities . Moreover the transferability of the parameter from a lennard - jones solute to small molecules suggests that it is a shape - independent property . Ultimately, it was derived from atomistic fundamental properties of a lennard - jones force field at a relevant thermodynamic state . The ability of the -corrected 3d - rism nonpolar free energy term to reproduce the fep - calculated corresponding values is remarkable, and here we compare it to recent attempts using different methods . First, it was shown that surface area or volume based approximations do not correlate with the fep nonpolar components . Previous attempts using the full dispersion solvent solute terms were shown to be challenging and demonstrated poor transferability . Wagoner and baker had optimized an approach based on a combination of the weeks anderson chandler decomposition and scaled particle theory . In their work, they focus on the hfe of 11 alkanes and were able to match the fep computed hfe with an r of 0.71 and an r of 0.38 against experimental results . The -corrected 3d - rism values on this subset lead to an r of 0.72 versus fep and 0.88 versus experimental results . More recently, chen et al . Have developed a method based on a differential geometry approach with three free parameters that predicted the experimental hfe of 11 alkane molecules with a root - mean - square error (rmse) of 0.12 kcal / mol . The corresponding -corrected 3d - rism rmse is 0.44 kcal / mol . In their article, they show that the rmse on the prediction of the experimental hfe on 19 alkanes is 0.33 kcal / mol . The results of chen et al.s method s ability is most likely due to their focus on alkanes, whereas we tried to cover a more broad range of chemical species . Finally, guo et al . Used a level - set based approach, called vism - cfa, to compute the nonpolar component of the hfe . Using the mobley data set, they report an r of 0.76 versus experimental results and of 0.84 versus fep . Our corresponding results reported in table 1 are 0.88 and 0.96, respectively . However, the vism - cfa r for the nonpolar hfe component is only 0.42 . Although encouraging, all these methods are either less accurate or more limited than the model developed here . Furthermore, the herein presented semiempirical method has strong theoretical underpinnings that only rely on theory and computed quantities . Finally, the correction we found for the 3d - rism formulation of hydration free energy shows that it accounts accurately for most of the physical phenomena involved in the hydration free energy of small molecules . The major asset in 3d - rism is the computational expediency at which converged hydration functions can be calculated within a few seconds for small molecules . It is reasonable to think that this accuracy can translate into more complex environments such as protein binding sites . A proper demonstration based on experimental evaluations remains challenging due to the lack of high quality data available.
|
Mongolia s guidelines on tuberculosis care and services recommend dst for patients with newly diagnosed tb when they remain sputum smear - positive after 3 months of tb treatment, when they are in close contact with someone with drug - resistant tb, or when they are co - infected with hiv (ministry of health mongolia, world health organization, global fund supported project on aids and tb, unpub . We performed a retrospective cohort study of all new sputum smear positive patients who began directly observed therapy for tb in ulaanbaatar during 2010 or 2011 . Hiv - infected patients and those with close contact with mdr tb patients were excluded . About 45% of the population of mongolia lives in ulaanbaatar, the country s capital . Tb cases were reported to mongolia s ntp database from 9 districts of ulaanbaatar, a prison hospital, and a hospital for the homeless . Cases that were subsequently diagnosed as mdr tb were identified from the ntp mdr tb database . Cases were excluded from the analysis if standard first - line treatment was altered for any reason . New sputum smear positive tb cases were defined as cases in patients who had> 1 acid - fast bacillus in> 1 sputum sample and who had never received tb treatment before . These patients were given routine first - line treatment, consisting of isoniazid, rifampin, pyrazinamide, and ethambutol during a 2-month intensive phase followed by isoniazid and rifampin during a 4-month continuation phase . Mdr tb was diagnosed if the mycobacterium tuberculosis strain isolated was resistant to at least isoniazid and rifampin . Sputum samples were processed at the mongolia national reference tb laboratory, which used solid cultures (lwenstein - jensen medium and ogawa) and bactec mycobacteria growth indicator tube 960 (becton, dickinson and company, franklin lakes, nj, usa) liquid cultures during the study period . Phenotypic dst was performed by using the bactec mycobacteria growth indicator tube and lwenstein - jensen medium (7,8). The xpert mtb / rif assay (cepheid, sunnyvale, ca, usa) was not available in mongolia before 2013 . In total, 1,920 new sputum smear positive patients were identified during the study period; 45 were excluded from the analysis because they did not receive standard first - line treatment because of adverse drug effects or drug shortages . Table 1 summarizes the demographic characteristics of all 1,875 patients included in the study . Among these patients, 476 (25%) were employed; 63 (3%) were homeless, and 50 (3%) were prisoners . Student, enrolled in higher education or vocational training . School - age, enrolled in primary or secondary school . Districts with <50 new sputum smear positive patients (baganuur, nalaikh, bagakhangai). A total of 1,436 (77%) patients were cured, and 102 (5%) completed treatment (6), but for 156 (8%) patients, first - line treatment failed . An additional 34 (2%) patients were transferred out (i.e., transferred to a different reporting unit with unknown treatment outcome), 41 (2%) died, and 106 (6%) interrupted treatment for> 2 consecutive months . Treatment failure rates were highest among adults 3554 years of age, prisoners, and those who were homeless (table 1). Among the 1,875 new sputum smear positive case - patients, therefore, of the 156 total patients for whom first - line treatment failed, 54 (35%) had mdr tb . Bivariate analysis showed that mdr tb among patients in whom first - line treatment failed was significantly associated with being female (odds ratio [or] 2.1, 95% ci 1.14.1), <35 years of age (or 3.3, 95% ci 1.66.7), and employed or a student (or 5.1, 95% 2.410.8) (table 2). These associations remained significant after adjusting for sex, age, and occupation (table 2). For 32 (59%) mdr tb patients for whom first - line treatment failed, complete resistance to all 4 first - line drugs tested (isoniazid, rifampin, ethambutol, and streptomycin) was found (technical appendix table). In ulaanbaatar, mdr tb was diagnosed for more than a third of sputum smear positive patients in whom standard first - line tb treatment failed . Resistance against all first - line drugs tested was found for 60% of these patients . This finding suggests successful transmission of these highly resistant strains, as has been documented in other mdr tb a high level of streptomycin resistance among patients in whom first - line treatment has failed indicates that use of the standard retreatment regimen prolongs the duration of ineffective treatment and should be abandoned . Apart from poor patient outcomes and the risk for ongoing tb transmission, continued use of an inadequate treatment regimen encourages the amplification of drug resistance . Ideally, universal dst would be offered at the time of diagnosis, but in the absence of sufficient resources, increased use of rapid molecular diagnostics should be considered . Despite implementation hurdles, the xpert mtb / rif assay rapidly confirms m. tuberculosis infection and assesses resistance to rifampin without the need for extensive laboratory infrastructure (10). Rapid testing should be considered for all patients in whom mdr tb is suspected, including those for whom sputum smears did not convert to negative after 23 months of first - line treatment . Prompt initiation of appropriate therapy should improve patient outcomes and reduce ongoing mdr tb transmission within the community . In this context, the addition of spatial information and accurate mapping of mdr tb hot spots within mongolia may guide targeted strategies for early detection and treatment for mdr tb . Our study does have limitations . Dst was performed at the discretion of the treating physician, and detection bias may have influenced mdr tb risk factor analyses . Because not everyone was tested, the reported mdr tb rate represents a minimum estimate . Without dst results from specimens collected before treatment initiation however, although a patient can acquire mdr tb after 23 months of tb treatment, acquisition of mdr tb is unlikely if quality - assured multidrug treatment and directly observed therapy are used . The conclusion that most cases represented primary mdr tb not detected when the patient originally sought treatment is further supported by the high rate of resistance against all first - line drugs . Comparison with previous drug resistance surveys indicates that the proportion of mdr tb cases among new sputum smear positive patients increased from 1.0% (4/405) during 199899 (11) to 1.4% (9/650) in 2007 (12) to 3.4% (66/1920) in our study . This increase in transmitted drug - resistant tb requires closer scrutiny and concerted global action (13). Phenotypic resistance to first - line drugs among multidrug - resistant tuberculosis patients for whom first - line treatment failed.
|
Currently, it is believed that about one - third of the adult population in united states is obese, and this percentage is rising . As a result, we are witnessing a concurrent increase in the number of bariatric procedures performed for treating obesity in this country . For many, weight loss surgery is the treatment modality of choice for the severely obese . It has been shown that surgical interventions significantly improve the quality of life and reduce long - term morbidity and mortality . The data collected over an 18-year period (19872004) from the international bariatric surgery registry shows that more and more people are choosing surgery, and those undergoing surgery are now older and much heavier . As many as 25% of patients undergoing weight loss surgery require repeat surgery, either due to complications or failed weight loss . These patients are particularly at high risk, as the morbidity following these reoperative procedures is often high (922%), and mortality is not insignificant (01.4%). We believe that the true incidence is higher, and it will further rise in the next few years . This is because firstly, the number of gastric bypass surgeries performed is increasing rapidly, and secondly there is an increased awareness about this complication . More and more cases are being reported, and there are now better imaging modalities to detect this complication early . Such is the sensitivity that many authors suggest that confirmatory radiological images should be obtained with ct scan prior to proceeding to the operating room [7, 8] (figures 2(a), 2(b) and (3)). Still, other investigations such as plain film x - ray and ultrasound have been used to help make the diagnosis . The classic triad of abdominal pain, bloody stools, and a palpable mass is rarely seen in these cases of intussusception, and therefore, it is important to take a multimodality approach . The combined use of clinical history, physical exam, and radiographic images increases the sensitivity significantly and helps to plan the surgery in a more suitable time frame . Although our ability to detect and treat intussusception following gastric bypass surgery has improved, its etiology remains somewhat unclear . Most people still believe that intussusception is related to dysmotility, which develops secondary to the development of ectopic pacemakers . Other proposed mechanisms include development of new lead points such as sutures or staple lines and focal nodal hyperplasia . However, in the vast majority of cases, no identifiable lead points or aberrations in anatomy are detected [7, 9, 10]. A comprehensive search was conducted to identify the literature published worldwide including articles, reviews, case reports, and series and abstracts describing intussusception after gastric bypass surgery . Both open and laparoscopic, confirmed diagnosis of intussusception either preoperative or postoperative based on pathology . Patients with gastric bypass surgery for reasons other than weight loss, intussusception not associated with weight loss surgery, and diagnosis of intestinal obstruction due to causes other than intussusception were excluded in this review . The data was extracted using a structured form that included information regarding demographic profile, medical history, weight loss, clinical presentation, radiographic imaging, diagnosis, management, and posttreatment course in these patients (table 1). Seventy one patients were identified including seven patients from our own series, in 29 studies published worldwide between the years 1991 and 2011 . The majority of patients identified were females (n = 70, 98.6%), with the median age of 35.5 years (range, 2060 years). Sixty nine patients (97.2%) underwent roux - en - y gastric bypass, one patient received loop gastric bypass, and an other patient was treated with gastric bypass for weight loss, but the operative details were not available . Over the course of twenty years, seventy one patients were reported; however, the majority of these cases (n = 56, 79%) were reported after the year 2005 . The median time to presentation (from the time of weight loss surgery to development of intussusception) was 36 months (range, 6133 months). Amongst the patients with data available, the mean excess weight loss was about 145 pounds . Most of the patients presented to the physician with complaints of diffuse abdominal pain, nausea, and vomiting . However, in nearly all patients, the abdomen was described as soft and without obvious peritonitis . A palpable mass was reported in 7 (9.8%) patients only . Amongst the 47 patients with detailed data available regarding imaging, in other patients, the diagnosis was established based on findings from abdominal radiographs (n = 3), intraoperative (n = 3), small bowel follow - through (n = 2), and ultrasound (n = 1), respectively . At the time of initial presentation, 68 (96%) patients underwent surgery, while 3 (4%) patients were treated nonoperatively . Amongst the patients treated operatively, 51 patients (75%) were found to have retrograde intussusception, 8 patients (11.8%) were reported to have antegrade intussusception, and the remaining 9 cases (13.2%) were not specified (figure 4). Further, within this group, 48 (70.6%) patients underwent revision of anastomosis with small bowel resection, 16 (23.5%) patients had surgical reduction without resection, and the remaining 4 (5.9%) patients were treated with plication only . Amongst the three patients that were treated nonoperatively, one patient presented with repeated admissions, which eventually led to operative intervention, while the other two remained stable . Interestingly, both these patients who remained stable were diagnosed with intussusception based on findings obtained from abdominal radiographs . In the postoperative period, 20 patients developed complications ranging from pain and ileus to obstruction and recurrence (table 2). Amongst these, nine (45%) patients were readmitted with recurrence (range, 0.532 months). Five of these patients with recurrence had been treated conservatively without bowel resection or reconstruction of anastomosis at the time of initial presentation / surgery . All these five patients were subsequently managed with surgical reexploration, small bowel resection, and reconstruction of the anastomosis . Given the small number of patients in this paper, a detailed statistical analysis has been withheld to prevent invalidation and bias . Intussusception in adults is relatively rare however; in patients undergoing gastric bypass surgery, the incidence is believed to be rising . Our analyses pose several questions that need to be answered: what are the risk factors? What is the etiology and why are females more commonly affected as compared to males? And what is the appropriate management of patients presenting with intussusception after gastric bypass surgery? To answer these questions the overall rate of complications associated with gastric bypass surgery is between 15% and 20% [1113]. The spectrum of these complications is diverse, ranging from minor wound infection, nausea, and vomiting to anastomotic leak, pulmonary embolism, and death . According to the available literature, surgeon experience, operative approach, body mass index (bmi), old age, and underlying medical conditions such as diabetes, hypertension, and sleep apnea are the major risk factors [11, 12, 1416]. There is no specific gender or age predisposition, although in some studies, men and older patients were found to be more prone to complications [12, 17]. In our analysis, however, we found that nearly all patients affected with intussusception were females (n = 70, 98.6%). If we consider the fact that females are more likely to undergo gastric bypass surgery (4 out of 5 patients are females) [17, 18], and are also more likely to develop nonsincegastric bypass associated primary pathologic intussusception (55% in females and 45% in males), the percentage of females developing intussusception after surgery may still exceed the likelihood that this was due to chance alone . However, at this stage given the small number of patients in our analysis, this may be considered an observation rather than a fact . The majority of patients identified in our analysis were young with a median age of about 35.5 years . However, since most of the patients developing pathological primary intussusception or complications after gastric bypass surgery are relatively old [12, 17, 19], this group of patients are certainly in contrast to the conventional older patient population developing complications after gastric bypass surgery . Therefore, this raises a question whether younger patient population is at risk at developing this specific complication . Also, it was noted that most patients (97%) underwent roux - en - y gastric bypass surgery and had significant excess weight loss (150 pounds). Since roux - en - y gastric bypass causes significant weight loss and this weight loss has been found to be associated with significant thinning of the mesentery, it is believed by some that thinned mesentery offers less resistance to invagination once the intussusception is initiated . It can, therefore, be argued that a relative young age and a significant excess weight loss are contributing factors to the development of intussusception after weight loss surgery . In summary, female gender, a relative young age, and significant excess weight loss after gastric bypass surgery may be considered as potential risk factors for the development of intussusception after gastric bypass surgery . The etiology for developing intussusception after gastric bypass appears more complex than previously thought . To date, the most widely accepted view has been that the creation of roux limb disrupts the natural intestinal pacemakers in the duodenum and allows for the formation of ectopic pacemakers or migratory motor complexes in the roux limb . It is believed that the electric potential generated by these ectopic pacemakers migrates in both the distal as well as the proximal limbs . This creates an area or segment of dysmotility, which according to some authors is responsible for developing intussusception in these patients [7, 10]. Researchers have also attributed the phenomenon of roux stasis syndrome and the resultant delayed emptying to this alteration in motility . Animal studies replicating roux - en - y gastric bypass construction have shown that suppression of these ectopic pacemakers by either electrical pacing or by using an uncut roux prevents stasis by maintaining enteric myoneural continuity . It is our belief that the etiology of intussusception after gastric bypass is multifactorial and occurs due to the combination of the following: (1) disruption of the natural pacemakers . In the process of creating the roux limb, this leads to a decreased pacesetter potential in the distal roux limb and causes activation of the ectopic pacemakers in this limb . These ectopic pacemakers generate new pace - setting potentials that travel in both distal as well as proximal direction, resulting in delayed emptying and stasis of the roux limb; (2) thinning of the mesentery . This leads to a decreased cushion effect and increased bowel mobility around the roux limb and the jejunojejunostomy site, thereby creating a zone of instability . The combination of these two factors is believed to increase the risk of telescoping and intussusception and accentuate abnormal waves of dysmotility . This may explain why there is a delay in presentation and why most patients with this condition have lost a substantial amount of weight . Still, more analyses need to be made between patients with substantial weight loss from gastric bypass (roux - en - y) and others to determine if rates of intussusception show a statistically significant difference . The majority of patients presented with nonspecific abdominal symptoms including diffuse abdominal pain, nausea, and vomiting . Interestingly, in nearly all of these patients, the abdomen was found to be soft, nonrigid, and without obvious peritonitis or any palpable mass (seen only in 7 patients). Further, we observed that in our series, most of the patients had nonspecific laboratory findings / values, without any indication or reflection on the underlying pathology in these patients . Since both physical examination and initial laboratory investigations were nonspecific and did not relay the appropriate information on the severity of the underlying pathology to the clinicians, we argued that the onus of diagnosing intussusception was dependent on further radiological investigations . We found that ct scan was the diagnostic study of choice in majority of patients studied . Most patients were found to have been investigated with more than one radiological investigation; however, the diagnosis was not established until the ct scan was completed . It may therefore be prudent to argue here that the ct scan is not only sensitive, but is also reliable in establishing the diagnosis early, and thus, in potential high - risk patients (females, young age, and significant excess weight loss), ct scan should take precedence over other investigations in diagnosing intussusception . As regards the treatment, some authors have suggested that simple reduction without resection is safe, while others have opted to proceed with resection of the bowel to prevent reoccurrence . Obviously, in cases that necessitate resection (bowel ischemia or necrosis), the latter is the treatment of choice . We found in our analysis that the majority of patients required small bowel resection and revision of the anastomosis . Those patients who were initially not treated with resection / revision subsequently developed recurrence and had to be operated again . Within our clinical experience, we found that the operative technique (open or laparoscopic), length of the limb, or the type of suture material / staplers made no difference in outcome . As long as the patients were treated with resection / revision, they did not develop recurrence . With regards how the revision is done, it is a matter of debate until more information becomes available . However, because of the limited number of small patients and lack of statistical validation, these findings must be considered in light of clinical experience at this stage . The diagnosis of intussusception in adults is relatively rare; however, we are noticing an increase in the incidence of this complication in patients who have undergone gastric bypass surgery . At present, the etiology is not very well understood, and most believe that dysmotility due to the development of ectopic pacemaker plays a crucial role in creating an unstable zone that predisposes to telescoping of the bowel . Further, the thinning of mesentery due to excessive weight loss decreases the cushion effect and potentially augments the unstable zone . Female gender, relative young age, and loss of significant amount of excess weight loss are potential risk factors for developing intussusception . The diagnosis is often difficult and not straightforward . This is because the initial physical examination and laboratory investigations are nonspecific . Further, it has been noted that plain x - rays and ultrasound are generally nonconfirmatory and can potentially blur the clinical picture further . Therefore, we propose a low threshhold for multimodality approach using a combination of initial examination, ct scan, and early surgical intervention to aid in diagnosis as well as provide optimal treatment . We believe that surgical intervention should entail bowel resection and revision of anastomosis as it prevents recurrence . As regards the technique is concerned, we will leave it at the discretion of the individual surgeon.
|
Puerto rico receives the impact of the global phenomenon known as african dust events (ade)or storms [13]. This atmospheric formation is one of the largest in the world capable of transporting billion of tons of mineral dust from the northwest african region of sahara - sahel to the caribbean and the americas . It also contributes to dust transport into the south region of europe and to the east coast of asia . Dust particles comprise a wide range of components derived from biogenic materials such as pollen, microorganisms, insects (e.g., locusts); fossil fuel, biomass burning and mostly eroded mineral soils [1, 4, 5]. Pm10 particle pollution is mainly derived from anthropogenic and natural sources such as ade influenced by input of warm air masses; and traffic and industry emissions from urban environments and secondary atmospheric processes [68]. It has been reported that approximately half of the bacterial population isolated from ade particles are gram - negative containing enx, also known as lipopolysaccharide (lps) [1, 9]. An estimate of ~10 bacteria is found per gram of top soil; thus ade can mobilize high microbial masses downwind; and given that dust episodes are common, high incidences of asthma related to lps may be encountered [1, 9]. Enx levels present in pm10 (whole extracts) collected throughout the atlantic ocean were reported as high as 6.41 eu / m during an ade compared to 0.50 eu / m and 0.80 eu / m before and after the respective ade . Ade pm10 pollution and the high enx concentration found in particles suggests that it could very well be an important pm biological component influencing respiratory and cardiovascular diseases [3, 5, 10, 11]. In fact, the united states environmental protection agency (2009) stated that there was suggestive evidence about a causal relationship between short - term coarse particle exposure and cardiovascular / respiratory / mortality effects . Moreover, pm10 concentration can reach high levels (up to 263 g / m) during dust storm days and be associated to increased mortality compared to clear days (up to 42 g / m), increased respiratory hospital admissions, and outpatient visits for bronchitis, asthma, and upper respiratory tract infections . Exposures to enx along with other environmental agents such as indoor allergens, viruses, and air pollutants (e.g., particulate matter or pm) have been linked to worsened lung function, atopy, enhancement of asthma pathogenesis, and/or already established inflammation [14, 15]. These molecules have also been associated with the biological action (e.g., inflammatory effects) of ambient particles in in vitro and in vivo models [3, 1618]. The bronchial epithelium represents the first line of pulmonary defense, functioning as a physicochemical barrier to the external environment and initiating the required signals for systemic response [19, 20]. It is capable of recognizing microorganisms and their products, secreting antimicrobial factors and other molecules involved in inflammatory responses [19, 20]. Enx can stimulate the innate immune system, causing the production of inflammatory cytokines, maturation of antigen - presenting cells, and upregulation of receptors, and even can cause influx of macrophage like cells to the alveolar space, which can enhance inflammation in the asthmatic lung [2123]. The discovery of pattern recognition receptors (capable of sensing pathogen associated molecular patterns or pamps), toll - like receptors (tlrs) functional expression in respiratory airway epithelial cells, which are involved in allergic sensitization, underlines their importance in inflammation and the pathogenesis of respiratory disorders such as asthma and allergy [2428]. These receptors have the capacity of signaling to secrete diffusible chemotactic molecules and cytokines, upregulate surface adhesion molecules, and enhance expression of antimicrobial peptides . Expression of tlr110 has been determined in primary as well as human bronchial epithelial cells, beas-2b [24, 30, 32], where tlr7, tlr8, and tlr10 are the least expressed . Tlr2 can recognize some atypical lps as long as peptidoglycans or pgn and lipopeptides derived from gram - positive bacteria and fungal molecules . Tlr4 responds to lps via interaction with accessory proteins such as cd14, a glycophosphatidyl inositol - anchored coreceptor, which can exist in soluble and membrane bound forms [29, 35]. Two signaling pathways have been described for tlr4: the myeloid differentiation factor 88, myd88-dependent (also used by tlr2 heterodimerized with tlr1 and tlr6), and myd88-independent . Both pathways lead to the degradation of inhibitor of nf-b (ib) and transcription factor, nf-b translocation to the nucleus in order to induce the expression of proinflammatory and host defense genes [20, 30, 36]. Some of the proinflammatory mediators induced by the myd88-dependent pathway are cytokines and chemokines (e.g., il-6 and il-8) [20, 24, 30, 37]. Il-6 can stimulate b cells and promote t cell activation, growth and differentiation and il-8 is a chemokine responsible for neutrophil chemoattraction and activation [29, 3840]. Ultimately, neutrophils induce goblet cells growth, mucus production, and alveolar wall damage . Our laboratory has studied the toxic and proinflammatory effects of rural ade aqueous and organic pm10 and pm2.5 pr extracts in vitro using human bronchial epithelial cells, beas-2b [2, 3, 4143]. In addition, chemical characterization (trace elements quantification) of african dust storms (pm2.5) collected in the aerosol and oceanographic science expedition (aerose) during march 2004 was also evaluated . Other investigators have also studied the contribution of airborne particulate matter to proinflammatory outcomes in that type of cells [4548]. This study aims to study the toxicological and proinflammatory contribution of biological constituents (enx) present in puerto rican ade pm10 collected at a rural and urban environment in vitro . The beas-2b cell line was employed for that purpose since it is suitable and one of the models most affected by the interaction, deposition, and toxic effects of air pollution particles has an important role in surveillance being easily activated by superficial exposure to microbial factors and is the most promising model to assess respiratory sensitization of chemical compounds [49, 50]. Therefore, this work aims to characterize the pm10 carried by ade to puerto rico during 2004 . Then, particular emphasis is given to the study of the in vitro proinflammatory potential of natural enx carried to the island . Pm10 from a rural site is employed and the input of anthropogenic enx added from local urban sources is specially considered throughout the analysis . Ade and non - ade samples (pm10 quartz filters) were determined based on parameters and selection criteria previously reported [2, 3]. The pm filters were obtained from stations located at the municipalities of fajardo / rural (reference) and guaynabo / urban site (figure 1). Briefly, pm10 data reported by the puerto rico environmental quality board in conjunction with the aerosol index satellite image records (total ozone mapping spectrometer, toms) for each day was used to identify ade and non - ade days at a considerable confidence level . All the dust events were classified and the mean duration through the year period of 20002012 was determined . An ade day was defined as a day characterized by a pm10 concentration above the background level of 18.3 g / m with a concurrent presence of aerosol clouds over pr (as showed by toms). A day before and one to two days after the event were also considered as ade . Ade input was analyzed to assess the frequency event arrival pattern to pr . In an effort to study a possible correlation between ade and respiratory health outcomes in pr, pediatric hospitalization cases due to respiratory conditions (by means of total services offered to asthma cases) were retrieved from the health insurance administration (ases) of pr and evaluated . Data was meticulously revised and individuals affected by asthma were considered for one service per day, allowing for an appropriate distribution of total and age - categorized cases for statistical analyses (see section 2.8 ahead). Organic extracts from pm10 quartz filters classified as ade and non - ade from march 2004 were soxhlet extracted following the procedure described in rodrguez - cotto et al . . Briefly, filters were submitted to a 48 hr extraction period in a 1: 1 hexane to acetone solution (fisher, waltham, ma); the resulting extracts were dried under a gentle nitrogen stream and dissolved in dimethylsulfoxide (dmso, sigma, st . Two organic composite samples at a final concentration of 100 mg / ml were prepared as stocks from each site corresponding to the same month . A 1/1000 dilution of the organic extracts was used to determine endotoxin concentrations employing the kinetic limulus amebocyte lysate assay (kinetic - qcl, lonza, walkersville, md) as recommended by the manufacturer . The assay is based on the activation of a proteolytic cascade by enx in the serum of the horseshoe crab limulus polyphemus . A standard curve (500.005 eu / ml) was prepared from escherichia coli o55:b5 endotoxin . Absorbance readings (405 nm) at 37c were recorded using an elx 808 microplate reader (biotek instruments, winooski, vt) and data analyzed using the winkqcl software (lonza, walkersville, md). Human bronchial epithelial cells (beas-2b, atcc #crl-9609) were cultured and maintained with keratinocyte growth medium (kgm-2, walkersville, md) at 37c, 5% co2 . Cells from passages 4469 were grown in 96-well plates and exposed for 24 hr to different ade / non - ade pm10 organic (510 g / ml range) extract concentrations in three independent experiments . Negative controls were verified in three different ways: unexposed (media alone), dilution (vehicle: dmso used in the organic extracts), and process (organic extract derived from a blank filter). Endotoxin inhibition experiments were conducted by preincubating the extracts to 10 g / ml polymyxin b sulfate (pmb, sigma, st . Louis, mo) in a sonic water bath for 30 min prior to cell treatment in order to prevent any aggregates and allow time for inhibition . Other negative and positive controls were exposed to media preincubated with pmb, lps (0111:b4, sigma, st . Cell supernatants were collected after each exposure and stored at 80c until further cytokine analyses . Cytotoxic effects of pm10 on exposed cells were assessed using the neutral red bioassay (sigma, st . After exposures, media were removed and neutral red dye was added at 100 g / ml for 3 hr . Following this incubation, cells were fixed with 1% calcium chloride (sigma, st . Louis, mo) and 0.5% formaldehyde (invitrogen, life technologies, grand island, ny), rinsed with phosphate buffered saline, and solubilized with 1% acetic acid (fisher, waltham, ma) and 50% ethanol . Cell viability was determined by absorbance at 540 nm in an ultramark microplate reader (bio - rad, hercules, ca). Triton x-100 (fisher, walthman, ma) at 25 g / ml was used as a positive control for cytotoxicity . The levels of proinflammatory cytokines (il-6 and il-8) in cell supernatants of three independent experiments were simultaneously determined in cell supernatants using a multiplex bead assay (millipore) in the dual laser flow analyzer with a luminex 200 software (luminex corp ., basically, multiplex bead assays are solid phase immunoassays that allow simultaneous quantitative detection theoretically of up to 100 analytes in a single microtiter by flow cytometry . The median fluorescence intensities of fluorochrome - conjugated antibodies bound to individual microspheres are derived from the flow analysis of 100 microspheres per well (in duplicate). Cytokine standard curves were constructed using a 5-parameter logistic fit [2, 3]. Beas-2b cells were seeded in 96-well plates and exposed to ade / non - ade pm10 extracts (fajardo and guaynabo) with and without the enx inhibitor (pmb). The mrna expression of tlrs and coreceptor cd14 were determined using quantitative real - time pcr at exposure times of 12 hr (tlr2) and 7 hr (tlr4), specific time points selected based on previous time course data which revealed peak expression of the receptors . Total rna was isolated using trizol reagent (invitrogen, life technologies, grand island, ny) and its integrity and purity were verified by gel electrophoresis . The cdna was synthesized using high capacity cdna reverse transcription kit (applied biosystems, foster city, ca) and quantitation of 100 g / ml samples performed using a stepone pcr instrument (applied biosystems, foster city, ca) based on commercial taqman assays and gene expression master mix (applied biosystems, foster city, ca). The pcr program used consisted of 2 min at 50c, 10 min at 95c followed by 45 cycles of 15 s at 95c, and 1 min at 60c . Ct data was analyzed employing the stepone software (applied biosystems, foster city, ca) and normalized to the glyceraldehyde-3-phosphate dehydrogenase (gapdh) housekeeping gene . Beas-2b cells were seeded in 6-well plates and exposed to ade / non - ade pm10 organic extracts (fajardo and guaynabo) with and without pmb (enx inhibitor) and incubated for 4 hr . Nuclear extracts were prepared using the nuclear extract kit (active motif, carlsbad, ca) following the manufacturer's guidelines . Protein concentrations were determined using the bradford - based assay (protein assay, bio - rad, hercules, ca) by measuring absorbance at 595 nm in an ultramark microplate reader (bio - rad, hercules, ca). Nuclear extracts (5 g protein) were evaluated in three to four independent experiments using the transam nf-b enzyme - linked immunosorbent assay (elisa) based kit (active motif, carlsbad, ca) for nf-b activation . The kit functions through the use of oligonucleotides containing the nf-b consensus binding site which are immobilized in a 96-well plate and the range of detection is 0.210 g of nuclear extract . Absorbance was measured on a spectrophotometer (bio - rad, hercules, ca) at 450 nm . Statistical significance was set at p 0.05 and results were graphed using the graphpad instat 3 software . A possible association between the pediatric asthma cases (total and subdivided in age groups) and three variables was tested through examining proportion differences and population homogeneity followed by a correlation analysis . The variables were (1) pm10 concentration; (2) pm10 increment (calculated from subtraction: average high concentration values average low concentration values); and (3) ade days reported for the rural (fajardo) and urban (san juan) site during 2004 and 2005 for comparison . The analysis of pm10 concentration data for a period of 12 years in conjunction with satellite imaging indicated that the mean ade duration increased from 2001 until a peak in 2003 and 2004, decreasing to its background levels in 2006 followed by fairly constant mean values until 2012 (figure 2(a)). When the average storm durations of all these years are analyzed in a per month basis a remarkable finding reveals that march is characterized by the longest ade (11.8 days), followed by may (11.4 days), june (9.3 days), and september (5 days). Clearly, ade duration varies throughout the year with a peak in march and decreasing after june (figure 2(b)). The mean pm10 concentration for the urban site during 2004 also showed increase during the months of march and june (figure 2(c)). The asthma cases maintain a similar pattern (urban and rural) throughout the island for this year with the highest incidence occurring during the months of march 2004 (figure 3(a)). A reevaluation of pediatric claims for 2004 shows that march has the highest number of asthma cases with the most significant affected category being children between 0 and 5 years of age, followed by those of 612 and 1318 (figure 3(b)). The number of 05 years cases for san juan was significantly higher than those for fajardo; however that was not observed for the 612 and 1318 age ranges (z = 6.09; p value = 0.00 for 05 years cases / z = 4.83; p value = 1.00 for 612 years cases / z = 2.56; p value = 0.995). A statistical analysis of the annual distribution of asthma cases during 2004 at the rural and urban sites revealed that case frequency distribution was different in all the 2004 months (= 82.84 and 56.75; p value = 0.00). A correlation analysis revealed a relation between total asthma cases and both pm10 concentration (strong association with a correlation coefficient, r = 0.715 and p value = 0.009) and increment in the rural site, fajardo, pr (table 1). The pm10 concentration was related to asthma cases in the rural site distributed in all the 3 categories, the 05 years being the strongest one, but pm10 increment was only significantly correlated to that same category . Asthma cases during ade days were also associated to the rural site (r = 0.548; p value = 0.042) and somewhat marginally to the urban site, san juan, pr (r = 0.470; p value = 0.089). Adjustments made by location and year of event (2004 versus 2005) did not exhibit any significant correlations (data not shown). Urban and rural organic extracts were nontoxic at 5 g / ml and toxic at 10 g / ml (figure 4). The positive control, lipopolysaccharide (lps), was tested at 10 g / ml and was also nontoxic (data not shown). A concentration of 168 eu / mg was measured in the pm10 ade sample from the urban compared to 116 in the non - ade counterpart (table 2). Endotoxin concentration in the non - ade extract was comparable between the rural and urban sites but higher in the ade extract from the urban site . Pmb pretreatment to the extract reduced significantly (~4550%) the inherent toxicity of the urban site both derived from ade and non - ade material (figure 5). Endotoxins were present in a considerable level and responsible for most of the toxicity at the urban site . Urban ade extract is a strong inducer of il-6 secretion in beas-2b lung epithelial cells resulting in 200-fold higher than the non - ade extract (figure 6(a)) while il-8 was around 30-fold (figure 6(b)). Enx inhibition was able to significantly decrease both interleukin levels induced by the urban ade organic extract . Although il-6 and il-8 were also found to increase in the non - ade extract at the urban site, the effect was significantly lower than that obtained from extracts during ade (figure 6(b)). Pm10 organic extracts were capable of inducing the mrna levels of tlr2 and tlr4 at both the urban and rural sites . All ade extracts induced tlr expression with the exception of tlr4 by the rural extract (figure 7). However, the ade urban extract had a significant influence on the expression of both tlr2 and tlr4 (figures 7(a) and 7(b)). Neither of the non - ade extracts was able to induce any tlr expression (figure 7(a)). The use of pmb was not very effective in reducing tlr expression in non - ade samples at either site . Conversely, the use of enx inhibitor was effective in reducing only the tlr4 expression induced by the ade extract from the urban site (figure 7(b)). The enx found in the urban ade extract have the greatest effects on tlr2 (although not significant) and on tlr4 (3-fold) mrna inductions . Cd14 mrna expression was not detected in beas-2b even in the positive control (lps) treated samples . Cells exposed to ade / non - ade organic extracts from both urban and rural sites showed nuclear factor kappa b (nf-b) activation at 4 hr (figure 8) only for the ade urban extract . The use of the endotoxin inhibitor, pmb, significantly reduced that activation to basal levels . High african dust (based on ground pm10 concentration and aerosol images) was reported for 2004 and specifically for the month of march and june [2, 3, 41]. The analysis of mean ade duration per year and monthly mean from 20002012, compared to pm10 concentration for the urban site, undoubtedly supports the use of pm10 derived from march 2004 . This particular year was one of the few with the most extended ade and march was characterized by elevated mean ade duration during the entire period added to an increase in pm10 concentration . This is the first time that an analysis for ade duration in puerto rico has been reported . Furthermore, analysis of asthmatic data also showed an increase in pediatric cases during march, but this was not the case for june, even though it was a month with high pm10 concentration . This is consistent with studies from montealegre et al . In pr showing a lower occurrence of asthma attacks during june . The difference observed between march and june could be explained by various factors such as the difference between ade occurrence, stability and composition, the length of cloud exposure days, and individual protection during a known dust season . In addition, it was found that asthma claims correlate to average pm10 concentration (in all three age categories), pm10 increment, and ade days in 2004 in the rural site . The urban site extract showed a marginally significant correlation between asthma cases and ade days . These associations are in agreement with what was reported for the caribbean island of trinidad back in 2001 - 2002 . The pediatric asthma cases reported at the urban site were significantly higher compared to the rural site, suggesting that urban activities are contributing to the exacerbation of this illness . Local air pollution at the urban site sets the conditions that are accentuated during the advent of african dust storms . Evidence of this is stated in a case - control study conducted by loyo - berros et al . Which discovered that the risk of asthma attacks in children from catao (close to san juan), pr, was associated to residing in the proximity of anthropogenic air pollution sources . Others have suggested the influence of high traffic and industries in risk to pediatric asthma . The high number of cases reported during the fall and winter months, characterized by reduction in ade and lower pm10 mass concentration [2, 3], could be attributed to other biological or chemical components such as pollen, dust mites, and fungal spores, which increase with humidity changes . Endotoxin concentrations have been reported during the warmer spring and summer seasons, where bacteria and plants develop more [1, 57, 58]. The biological constituents of endotoxins are more prevalent and exhibit greater biological responses in the coarse pm than fine and ultrafine . The use of the enx inhibitor (pmb) demonstrated the importance of endotoxins on lung cell toxicity to urban pm10 organic extracts . The effect was not observed in the rural extracts, indicating that enx derived from urban local emissions are potent mediators of toxicity . Moreover, endotoxins found in both extracts (ade / non - ade) were similarly capable of causing cytotoxicity to the level of reaching basal cell viability, indicating that the potency of enx is dependent on type rather than quantity itself, which also explains the difference between rural and organic fractions . Investigators studying the effect of urban air pm have found cytotoxic effects caused by enx (in pm10 - 2.5 fraction) and have suggested that the inhibitory action of pmb may be slightly nonspecific but nonetheless measure of the microbial contribution to cellular responses [59, 60]. The authors found an inhibition of cytotoxicity upon use of pmb in gram - negative but not in gram - positive bacteria; however in the case of inflammatory responses (which are discussed later) a higher reduction was observed with gram - negative bacteria . Endotoxins appear to affect cellular responses irrespective of the content, which could explain the similar effect obtained between ade / non - ade extracts . These molecules are one of the most important and studied pm constituents to which many respiratory health problems (respiratory symptoms, atopic reactions, airway and systemic inflammation, and pulmonary function decline) have been attributed [14, 61]. Asthma is thought to worsen to increased enx exposure, particularly in individuals sensitized against allergens . Also, these toxins can intensify existing sensitization, eosinophilic influx into lung tissue and mucus production, among others . Previous reports have acknowledged the presence of gram - negative bacteria in african dust storms, supporting the presence of enx in transatlantic material [1, 9]. Endotoxins in ade urban organic extracts were higher than in rural extracts (168 vs 114 eu / mg) reported by rodrguez - cotto et al . Some state that human activity increases microbial matter (increasing aero - dispersed enx) suspended in the atmosphere [6163]. Others argue that enx levels tend to be lower in urban settings [14, 64]. These reports suggest that enx in air will depend on the characteristics of the environment . In the present work, the toxins appear higher in the puerto rican urban environment, which supports the hypothesis that human activity modifies the environment enhancing enx enrichment . This local urban load is augmented by incoming contributions from african dust, which are prolonged during march, april, and may months . Pm10 have been reported to induce the release of cytokines in beas-2b and alveolar macrophages [46, 6567]. Our study reports that ade pm10 organic extracts recovered in pr also induce the release of il-6 and il-8, illustrating their inflammatory strength on human bronchial epithelial cells . The release of il-6 and il-8 was partial but predominantly reduced upon pmb pretreatment demonstrating the importance of enx involvement in this response . This effect has also been described after pmb pretreatment in pm10 using human alveolar and mouse macrophages [65, 68, 69]. In the case of human alveolar macrophages a dramatic il-6 reduction of 59% was found upon air pollution (insoluble pm10 characterized by 4 eu / ml) treatment with pmb; and on the other side, mouse macrophages exposed to urban particles exhibited il-6 reduction after pmb treatment . The proinflammatory effect of endotoxins in pm10 was also previously described in alveolar epithelial cells (a549) exposed to urban versus rural pm10, where even though rural particles were more il-6 and il-8 inducers, an association was observed with higher endotoxin content in the particles . Other studies have indicated that endotoxin content is not directly correlated with inflammatory response [59, 60], giving importance to enx types and other microbial and organic components in the extracts . The use of pmb increased the secretion of il-6 and il-8 for the non - ade urban extract instead of reducing it . This could be due to differences in enx types extracted and present during different times and locations . For example, it has been shown that lung cell responses vary depending on the e. coli serotype or bacteria species present . It is also possible that other biological agents such as peptidoglycans and fungal spores, not inactivated by pmb, may contribute to il release [18, 72]. The enx may interact with some of those other agents, possibly preventing them to effectively induce the release of proinflammatory cytokines . Upon pmb pretreatment differences in the contribution of enx to the proinflammatory response could also be explained by distinct components adsorbed to pm and the particle sources . Interactions between pm constituents and enx have been proposed between, for example, enx / metals and enx / inactive fungi (e.g., -glucans) [15, 65, 73]. Enx are recognized by tlrs (mostly tlr4 and partially tlr2) on the bronchial epithelial cell surface, activating intracellular signal transduction that will ultimately lead to the induction of proinflammatory genes such as il-6 and il-8 via the transcription factor, nf-b nuclear translocation . Both tlrs were found to be induced by organic extracts, but the tlr4 exhibited the stronger effect in beas-2b after exposure to the urban ade extract . Pretreatment with pmb was able to reduce tlr4 expression, indicating the importance of enx in positively regulating its own receptor expression . Biological constituents in pm have been recognized to be important agents in tlr4/2 signaling since heat inactivation of microbial materials is able to diminish tlr expression [72, 74]. The tlr2 was induced by both rural and urban ade extracts showing cell responsiveness to other molecular patterns (e.g., other bacterial products: peptidoglycans and lipopeptides) recognized by tlr2 possibly present in ade, despite the fact that tlr2 expression is lower in this cell line . Moreover, this increase in expression was not due to atypical enx as proven by the lack of response due to enx inhibition (pmb). Pm10 extracts are largely tlr4-dependent and activate alveolar macrophages to produce cytokines while pm2.5 tends to be tlr2-dependent and activates bronchial epithelial cells for the same outcome . Reinforcing these distinct findings, expression of both tlr2 and tlr4 mrnas has been reported by others in beas-2b [25, 76] and tlr2 expression has been found to be ligand - dependent . Overall, we found that pm10 extracts induce tlr2 expression in rural and urban environments while tlr4 expression is only induced by urban dust . Expression of these tlrs in bronchial epithelial cells supports the triggering of innate immunity in the respiratory epithelium . Contradictory results have been shown by different studies in terms of its mrna expression (low levels or none) in beas-2b [77, 78]. A cd14-independent mechanism of cell activation has been suggested as possible in bronchial epithelial cells [26, 35]. These differences could be explained by distinct basal activation or the differentiation state of the epithelial cells employed . In addition, soluble forms of cd14 from serum plasma can mediate lps - induced cell activation in epithelial cells under low cd14 membrane expression . Nf-b transcription factor is a key player for cytokine induction; it was stimulated after 4 hrs by ade organic extracts only from the urban site . More importantly it was shown that this activation was directly related to enx since pmb was able to significantly reduce nf-b activation . The il-8 promoter contains the nf-b response element indicating that at least part of il-8 transcriptional activity is dependent on nf-b as well as il-6 . Diesel exhaust particles have also been reported to activate this factor in beas-2b, which demonstrates that human activity can modify the environment activating immunological responses in humans . It appears that pm10 is able to promote inflammatory responses through nf-b . On the contrary, a previous study using pm2.5 organic extracts from the same ade source did not find any nf-b activation in beas-2b . Instead this work establishes the importance of differences in bronchial epithelial responses by extracts derived from pm10 ade collected from distinct puerto rican areas (urban / guaynabo versus rural / fajardo). Particles from different environments differ in their potential to induce inflammatory biomarkers due to different chemical (e.g., organic, inorganic compounds), biological (e.g., enx), and physical agents (e.g., particle size, seasons, and emissions) [66, 82]. African dust storms can take 3 to 5 days before it reaches the caribbean . As the dust is transported and settles it becomes mixed with adjacent air masses that contain particular aerosols including biomass - burning products and anthropogenic compounds from various sources . Local urban pm10 contains a mixture of microbes and organic and inorganic constituents, which are unique to the site and season . It was noted that african dust reaching pr increases the concentration load of enx and inorganic and other organic constituents that uniquely interact in urban environments stimulating the secretion of proinflammatory cytokines in targeted cells . By studying african dust events using satellite imaging and onsite specific pm10 concentrations it was possible to learn more about the duration and occurrence of this global storm phenomenon in puerto rico . Furthermore, ade material at an urban and rural site was successfully obtained to conduct specific in vitro testing . The enx were identified as one of the unique components being incorporated in the local puerto rican environment which is biologically active through specific exposure pathways . The enx interactive complex formed in the environment associates with pm10 and strongly activates and induces tlr4 expression while weakly affecting tlr2 . This tlr interaction triggers the signal transduction pathway of nf-b leading to the release of proinflammatory il-6 and il-8 . For the first time epidemiological asthma data is directly linked to african dust storms events (march 2004) in puerto rico . Using data from a 12-year period, in addition, a direct correlation between children of 05 years suffering from asthma and ade in the month of march 2004 was reported . Moreover, asthma cases during this period were highly prevalent and amplified at the urban site . The in vitro toxicological testing of ade material from that same month supports these findings . Using the correct treatments to avoid respiratory and cardiovascular exacerbations during a pollution episode (e.g., ade) the present study contributes in evaluating the effect of enx derived from african dust reaching puerto rico . It points out that adverse health outcomes depend not only on pm mass concentration but also on biological constituents as part of a complex mixture which is modulated by urban emissions . As a matter of public health, these findings greatly recommend preventive measures for the puerto rican population since asthma in puerto rico is highly prevalent and patients constantly complain of having exacerbations during ade . More importantly, this research highlights the tlrs as potential targets to consider in the future road of asthma drug therapy and even personalized medicine.
|
Reduction or elimination of microflora during root canal treatment is achieved by the combined effect of both chemomechanical preparation and intracanal medications . The removal of microorganisms and other irritants from the confines of the root canal is conducted by means of the mechanical action of instruments and the flow and backflow of the irrigating solutions . Biopure mtad (dentsply / tulsa, tulsa, ok, usa), which is a mixture of a tetracycline isomer, citric acid, and a detergent, has been recommended as a final rinse irrigant because of its antimicrobial properties and its ability to remove the smear layer . Aztreonam, which is a synthetic monocyclic beta - lactam antibiotic, has a molecular structure different from older beta - lactam antibiotics as it has a less complex nucleus . Metronidazole, a nitroimidazole compound, is a broad - spectrum antibiotic and exhibits activity against anaerobic bacteria and protozoa . It demonstrates effective antibacterial activity against anaerobic cocci as well as gram - negative and gram - positive bacilli . In the treatment of periodontal disease, it has been used both topically and systemically . The objective of this research was to assess and compare the antibacterial and antifungal effectiveness of biopure mtad, aztreonam, and metronidazole against obligate anaerobic bacteria, i.e., bacteroides fragilis and propionibacterium acnes, facultative anaerobic bacteria, i.e., enterococcus faecalis, and yeast, i.e., candida albicans . The microorganisms selected for this study, i.e., b. fragilis atcc 25285 (group 1), p. acnes atcc 6921 (group 2), e. faecalis atcc 29212 (group 3), and c. albicans atcc 10231 (group 4), were obtained from the american type culture collection and stored at a temperature of 10c to 20c in a freezer . Strains of the selected microorganisms were reactivated in the respective media at a given temperature and time . Groups 1 and 2 activated in brain heart infusion broth supplemented with hemin and menadione at 37c for 48 h. group 3 activated in brain heart infusion broth for 24 h at 37c . Group 4 activated in sabouraud dextrose agar broth at 37c for 24 h. after the revival of microorganisms, four to five well - isolated colonies of each strain were picked up with a sterile loop, later dissolving them in respective test tubes containing 0.85% of 5 ml sterile saline to create a turbidity of 0.5 mcfarland scale (1.5 10 cfu / ml) for the preparation of inoculum . The resulting suspension was then spread on agar plates with the help of a sterile cotton swab in a form so that a lawn growth was observed . The media used for the four groups were as follows: group 1 wilkins - chalgren agar plate (himedia, mumbai). Group 2 brain heart infusion medium (himedia, mumbai) with 1% glucose . 1 was used to prepare 6-mm diameter discs, which were later soaked in 40 l of normal saline and biopure mtad, respectively . The company - made aztreonam and metronidazole antibiotic discs (bd diagnostic, india) were also used for the test . These antibiotic discs were then aseptically transplanted to the agar plate formerly incubated with microorganisms . For group 1 and group 2, agar plates biopure mtad, aztreonam, metronidazole, and normal saline containing discs, and for group 3 and group 4, agar plates, biopure mtad, aztreonam, and normal saline prepared discs were transferred aseptically . Group 1 and group 2 agar plates were incubated in an anaerobic environment created using the anoxomat system (mart microbiology bv, netherlands) for 48 h. group 3 and group 4 plates were incubated for 48 h at 37c under the aerobic conditions, in an atmosphere of 10% co2, in a co2 incubator (new brunswick, usa). Antibiotic solution of biopure mtad was prepared by mixing powder and diluent . Sterilized whatman paper no . 1 was used to prepare 6-mm diameter discs, which were later soaked in 40 l of normal saline and biopure mtad, respectively . The company - made aztreonam and metronidazole antibiotic discs (bd diagnostic, india) were also used for the test . These antibiotic discs were then aseptically transplanted to the agar plate formerly incubated with microorganisms . For group 1 and group 2, agar plates biopure mtad, aztreonam, metronidazole, and normal saline containing discs, and for group 3 and group 4, agar plates, biopure mtad, aztreonam, and normal saline prepared discs were transferred aseptically . Group 1 and group 2 agar plates were incubated in an anaerobic environment created using the anoxomat system (mart microbiology bv, netherlands) for 48 h. group 3 and group 4 plates were incubated for 48 h at 37c under the aerobic conditions, in an atmosphere of 10% co2, in a co2 incubator (new brunswick, usa). The results obtained were statistically evaluated using one - way anova test and the intergroup comparison was done using bonferroni multiple comparison test . Value of p <0.001 was considered statistically significant . Bacteroides fragilis (group 1) [tables 1a and b]propionibacterium acnes (group 2) [tables 2a and b]enterococcus faecalis (group 3) [tables 3a and b]candida albicans (group 4) [tables 4a and b]. Bacteroides fragilis (group 1) [tables 1a and b] propionibacterium acnes (group 2) [tables 2a and b] enterococcus faecalis (group 3) [tables 3a and b] candida albicans (group 4) [tables 4a and b]. Effect of root canal irrigants and their values of zone of inhibition against bacteroides fragilis intergroup comparison of mean zone of inhibition size for the irrigants against bacteroides fragilis effect of root canal irrigants and their values of zone of inhibition against propionibacterium acnes intergroup comparison of mean zone of inhibition size of irrigants against propionibacterium acnes effect of root canal irrigants and their values of zone of inhibition against enterococcus faecalis intergroup comparison of mean zone of inhibition size for irrigants against enterococcus faecalis effect of root canal irrigants and their values of zone of inhibition against candida albicans intergroup comparison of mean zone of inhibition size of irrigants against candida albicans disc diffusion technique, a well - established method for antimicrobial research, has been applied in this study . This method has an advantage that chemical properties of tested medicaments do not alter during the procedure and also it is less technique sensitive . Anoxomat system was used for anaerobic culture in the current study as earlier research had shown that with the use of this system commendable growth is achieved, in terms of density and colony size . Evidently, the anoxomat method is considerably reliable and appears to support the growth of strict anaerobes efficiently . Zone of inhibition around specimens was measured in the present study using a vernier caliper at three different points as done in previous studies . In the present study tabulated results demonstrated that metronidazole produced the maximum zone of inhibition against b. fragilis [graph 1]. Demonstrated that metronidazole was effective against b. fragilis, which is in agreement with the results obtained in the current study . Comparison of mean zone of inhibition of root canal irrigants against bacteroides fragilis antimicrobial efficacy against p. acnes in the existing study was shown to be maximum by metronidazole [graph 2]. Effect of metronidazole on p. acnes has been reported with mixed findings in the literature . Gaetti - jardim jnior et al . Determined the positive antibacterial effect of metronidazole against p. acnes, and the results obtained were in accordance with the present study . Similarly, effat khodeinae et al . Demonstrated that 2% metronidazole showed adequate efficacy against p. acnes while evaluating the efficacy of 2% metronidazole gel against acne vulgaris . In contrast to the above results, few studies reveal no effect of metronidazole against p. acnes . Comparison of mean zone of inhibition of root canal irrigants against propionibacterium acnes metronidazole is a potent bactericidal, which is efficacious against anaerobes that are composed of electron transport components, i.e., ferredoxin, which are capable of donating electrons to metronidazole, developing highly reactive nitro radical anions that kill susceptible organisms by a radical - mediated mechanism . This could be a possible reason for its high antimicrobial efficacy against b. fragilis and p. acnes . In the present study, metronidazole was not used to test antimicrobial efficacy for e. faecalis and c. albicans because it is ineffective against facultative anaerobes . Krishna et al . In their study demonstrated that 10% metronidazole was not effective against e. faecalis among the tested intracanal medicaments . Demonstrated that long - standing metronidazole therapy preferred the establishment of c. albicans in the oral cavity of rats . In the current study, maximum mean zone of inhibition against e. faecalis was revealed by biopure mtad [graph 3], which is in accordance with several other studies . Newberry et al . In their study identified that seven out of the eight tested strains of e. faecalis growth were affected when mtad was used as a final irrigant . However, results of this research are in contradiction to reports which refute the antimicrobial effect of mtad against e. faecalis . Comparison of mean zone of inhibition of root canal irrigants against enterococcus faecalis in the present study, antifungal effect against c. albicans was shown only by mtad this result obtained was in agreement with the result given by arslan et al ., who demonstrated antimicrobial action of mtad against c. albicans and e. faecalis . The antifungal effect of mtad can be attributed to the better flow and penetration properties of doxycycline . Showed that mtad is ineffective against c. albicans and its substantivity may be altered when used in conjunction with naocl . Mtad in the current research has revealed substantial zone of inhibition against both b. fragilis and p. acnes . This may be possibly due to the occurrence of doxycycline as earlier research has confirmed the action of doxycycline on b. fragilis and p. acnes in inhibiting the protein synthesis . Aztreonam in the present study showed significant antimicrobial efficacy against b. fragilis and mild antibacterial activity against e. faecalis but was completely inactive against p. acnes and c. albicans microorganisms . Aztreonam, a bactericidal antibiotic, acts by interrupting with the formation of the bacterial cell wall . It causes lysis and death of gram - negative bacteria by binding to the penicillin - binding protein-3 (pbp-3), which might be the reason for its activity against b. fragilis . Poor affinity has been shown for the pbp-3 of gram - positive and anaerobic bacteria which could be the reason behind its mild activity against e. faecalis . On the basis of results obtained in the current study, it may be stated that biopure mtad can be recommended as an effective alternative to the currently used root canal irrigants due to its superior antimicrobial properties against both aerobic and anaerobic microbial organisms as well as c. albicans . Metronidazole and aztreonam, on the other hand, are, however, not significantly efficacious against all strains of microbes commonly present in the root canal, thus limiting their use as an effective antimicrobial root canal irrigant . Although the present study was done with strict adherence to all the scientific protocols, still further studies are required to evaluate the efficacy of the different irrigants, which may further widen their horizon in the field of endodontics.
|
Caucasian and caribbean men have a higher incidence of prostate cancer than men in asia . Prostate cancer remains the second leading cause of cancer death in men after lung cancer . The incidence of latent prostate cancer observed at autopsy and the incidence and prevalence of clinically manifest prostate cancer increase substantially with age . The most common sites of metastasis are the bones and regional lymph nodes, followed by the liver, lungs, brain, and digestive system . Lymphatic dissemination occurs most often in regional lymph nodes such as the obturator, internal, and external iliac lymph nodes, followed by presacral and para - aortic lymph nodes . Usually, neck lymphadenopathies are encountered in head and neck mucosal or skin squamous cell carcinomas or melanoma as well as in malignant lymphomas . Systemic neck metastases have been described in the lungs, stomach, kidneys, and testicles . To the authors knowledge, only few cases of neck metastases from prostatic adenocarcinoma have been reported . In this article we report a very uncommon case of the concomitant occurrence of a prostatic adenocarcinoma with neck metastases (ct3 g2 cn0 cm1) and an advanced laryngeal squamous cell carcinoma without neck metastases (pt4a g2 pn0 cmx r0). In august 2011, a 67-year - old swiss man was admitted to the head and neck surgery department due to dysphonia and airway aspiration, with recent progressive dyspnea . The patient was also known for a metastatic prostate cancer (ct3 g2 cn0 cm1) since 2004, which had been treated with hormonotherapy and orchidectomy . Physical examination (panendoscopy) showed a very large obstructive tumor infiltrating and fixing the 3 levels of the right larynx . No cervical adenopathy was found clinically . On the diagnostic ct scan, a 5-cm mass of the right vocal cord with osteolysis of the thyroid and arytenoid cartilage and invasion of the surrounding muscles was noted . After a multidisciplinary discussion, the patient was treated by a total laryngectomy and bilateral supraselective neck dissection . The histological analysis showed a moderately differentiated squamous cell carcinoma of the larynx, infiltrating the right cricoid and thyroid cartilages and extralaryngeal soft tissues . Of the 71 lymph nodes examined, 19 were metastatic but due to an adenocarcinoma compatible with the prostate cancer . The involved lymph nodes were all on the left side, while a focal lymphangiosis from an adenocarcinoma was found in the soft tissue of the right side specimen . The laryngeal tumor was then classified as pt4a pn0 (0/71) cmx r0 . Due to the nature of lymph node metastases (adenocarcinoma) with laryngeal r0 resection in the setting of a patient who presented postoperative complications (respiratory insufficiency, non - st - segment elevation myocardial infarction [nstemi], and peritracheostoma necrosis), it was decided not to add immediate adjuvant radiotherapy, but to initiate hormonotherapy with bicalutamide and zoledronic acid . The ct scan revealed an enlarged lymph node of 4 5 cm, with central necrosis . The ultrasound - guided fine needle aspiration showed malignant cells of a squamous cell carcinoma . A surgical approach was rejected because of the poor general condition of the patient, and radiochemotherapy (cetuximab) was proposed . The left cervical metastatic lymph node was treated with 70 gy and the ipsilateral cervical region (levels ii after an initial partial remission, the tumor progressed and the patient developed distant pulmonary metastases . A further line of chemotherapy (cisplatin, 5-fu, and cetuximab) was administrated and the patient died 1 year after the completion of the combined chemoradiotherapy from regional and distant cancer progression . Superficial lymph node metastases are a rare occurrence in prostate cancer, particularly metastases to the supraclavicular lymph nodes which are seen in about 0.33% of patients with prostate carcinoma, and accounts for about 13.4% of all atypical metastatic sites . Supradiaphragmatic spread of prostate cancer has been postulated to occur hematogeneously via the vertebral venous system, or batson plexus, accessible via direct extension from the primary cancer site . In the present case, the presence of cervical lymph node prostate adenocarcinoma metastasis concomitantly with a laryngeal squamous cell carcinoma is at least intriguing . Whether the development of the laryngeal cancer influenced the dissemination of the prostatic cancer cell in the cervical lymph nodes remains questionable . It is more likely that the cervical lymph node metastases were present before the laryngeal cancer and their diagnostic was purely incidental . Also the lymph node recurrence after surgery was different from the initial diagnostic since it was the squamous cell carcinoma that recurred and not the prostatic cancer . Whether the addition of postoperative radiotherapy would have prevented such a recurrence remains uncertain in the light of the rapid progression observed . However, one can emphasize that the presence of an adenocarcinoma in the lymph nodes changed the prostatic cancer prognostic in this patient, hence contributing to the changing of our usual radiotherapy indication . The whole setting was surprising, and may remind us of a rare event called collision tumors . Collision tumors have been defined differently by various authors with some minor variations . In the present case one of the oldest definitions of a collision tumor by meyer is defined as the meeting and eventual intermingling of two malignant neoplasms arising at independent topographical sites . More recently, dodge added that in order to accept a tumor of mixed structure as a collision tumor, the 2 histologies should be clearly separated in the metastases, and furthermore it requires the absence of any transitional pattern between the 2 tumor types . Finally, spagnolo and heenan are less restrictive, and allow some transitional pattern, with a zone of intermediate histological appearance . Even if a collision of lymph node metastases of 2 carcinomas from separate sites is very rare, in this case we had the metastatization of 1 carcinoma to the site of the drainage of another carcinoma, but we never found the 2 histological types as close as requested to reach the definition of a collision tumor . While the occurrence of such a clinical behavior remains rare, the chronology and the sublocation of the recurrences in the present case emphasizes the need of histological verification of different sites of recurrence when 2 or more primary cancers are known in a patient, particularly when the treatments of those primary cancers vary widely . The authors report no conflicts of interest . The authors alone are responsible for the content and writing of the paper.
|
Labour pain is a universal experience among women but the perception differs between individuals and this is influenced by both physical and psychological factors . The difference in pain perception among parturients depends on factors such as pain threshold, culture, social status, parity, prenatal education, counseling, support during labour and medical intervention.12 the practice of obstetric analgesia may have well been established in developed countries, it is still in infancy in most developing countries . In fact in some countries, the majority of the pregnant women do not even know that labour pains can be relieved.3 the benefits of pain relief in labour, however, extend far beyond mere humanitarian ones and it should be clearly recognized that appropriate pain relief may improve the general course and success of labour.34 as a result of increased knowledge and sophistication in most developed countries, parturients are aware of pain relief in labour and may demand and experience practically pain - free labour.5 in our environment, due to the lack of resources and competing priorities, pain - free labour is not achieved in most cases.6 studies on patients perception of the quality of care in labour have identified that pain relief, information obtained about labour and presence of support person in labour as important aspects of quality care in labour.7 ekiti state university teaching hospital, ado - ekiti south - western nigeria, is an emerging teaching hospital established in 2008; hence, there is a need to study the practice of obstetric analgesia in her labour ward . The aim of this study would be to evaluate the perception of labour pains among the parturients, their knowledge and awareness of pain relief during labour, the types of obstetric analgesia available and the outcome of their labour . The outcome of this study would help to strengthen or modify the practice of obstetric analgesia in the labour ward of the hospital . The study was a cross - sectional design involving pregnant women who presented at the labour ward of the ekiti state university teaching hospital, ado - ekiti and the study was carried out between january 2009 and december 2010 . The ekiti state university teaching hospital, ado - ekiti serves as a referral centre for all the specialist and general hospitals in the state . The study involved the use of structured questionnaire administered to parturients within 2 hrs of delivery . The inclusion criteria were all women with singleton pregnancy who presented in labour, whose gestational age was between 37 and 42 weeks, the cervical dilatation was at least 4 cm but not more than 7 cm and gave a verbal consent to participate in the study . The exclusion criteria were all women whose gestational age was less 37 weeks, those with multiple pregnancy, those who were scheduled for elective caesarean section and those who did not agree to participate in the study . The data was collected using structured questionnaires that were administered to consecutive consenting parturients by members of the study team . The research instrument has three sections: the first section obtained information about socio - demographic characteristics of the parturients - age, parity, occupation of parturients and their husbands, tribe and religion; the second section elicited information about labour history and its outcome - gestational age at presentation in labour, onset of labour, duration of labour, outcome of labour, baby's outcome, apgar score and birth weight of baby while the third section inquired information about pain perception in labour - pain perception was assessed using a three - point verbal rating scale of mild, moderate and severe, use of analgesia in labour, type of analgesia given, degree of pain relief obtained assessed on a four - point verbal rating scale of no, minimal, moderate and maximum relief, back rubbing and companionship in labour . The first and third sections were obtained directly from the parturients while the second section was obtained from the labour record in their case files . The social class of each parturient was determined by adding the scores from the husband's occupation and woman's level of education as described by olusanya et al.8 the data collected was entered into and analyzed using the statistical package for social sciences (spss) version 15 . The results were presented using frequency tables and percentages and summarized using relevant descriptive statistics such as means . Table 1 showed that the age of the respondents ranged between 17 and 40 years with a mean of 26.50 4.58 . Majority of the respondents were yoruba, christians with tertiary education and belonged to the upper social class . Sociodemographic characteristics of the respondents table 2 showed that 936 (92.5%) of the parturients had spontaneous labour while 76 (7.5%) of them had induction of labour . Majority (75.2%) of the women described their labour pains as severe in nature and 13 (1.3%) of them described it as being mild . Three hundred and fifty - seven (35.3%) of the parturients were given analgesia in labour and pentazocine injection was the form of analgesic given to all of them . Majority 159 (44.5%) of those that were given analgesic in labour had mild relief of their labour pains while only 65 (18.3%) obtained maximum relief of their pains . Obstetric data and labour summary of respondents table 3 showed that 611 (93.3%) of the respondents that were not given analgesia would have wanted the relief of the pains while 44 (6.7%) of them would not want to receive analgesia in labour . The reasons given by those who would have wanted relief of their labour pains were that this would have helped to tolerate the labour experience better and also made them to co - operate with labour room staffs . Out of 44 parturients who did want analgesia given in labour, 19 (43.2%) of them want to experience the pains of labour believing that it is natural for a woman to have this, 13 (29.5%) believed that the analgesia would slow down the progress of their labour while 6 (13.6%) of them thought it may affect their baby . Majority, 609 of the parturients had their back rubbed by an attendant or relative during labour while 403 of them did not have their back rubbed during labour . Out of the 609 women whose back were rubbed in labour, 426 (69.9%) of them reported that this decreased their labour pains while 183 (30.1%) reported that this practice was not helpful in relieving the pains . Four hundred and forty - two (43.6%) of the respondents had one form of companion or the other during labour while 570 (56.4%) of them did not have any form of companion during labour . For those who had companion, majority 81% of the companion were the labour ward staff while the rest were their relatives . Majority, 79%, of those who had companions reported that this helped them to cope better the labour pains and the whole labour process while the rest 21% of them reported no benefit . Majority 75.1% of the respondents were taught about pain relief in labour during their antenatal clinic visits while 24.9% of them were not taught . Pain perception and factors relating to it among respondents table 4 showed that the degree of pain relief obtained from the analgesic given during labour statistically influenced the outcome of labour and that of the baby for each parturient with p value of 0.030 and 0.028, respectively, but not statistically associated with the duration of labour with the p value of 0.809 . Pain relief among respondents and the outcome of labour table 5 showed that the verbal pain score described by the respondents was statistically influenced by the antenatal education received by the respondents, higher parity, upper social status and higher educational attainment of the respondents with p value of 0.01, 0.03, 0.03 and 0.02, respectively, but not by their tribe, religion and the type of labour with p value of 0.21, 0.08 and 0.30, respectively . The outcome of labour and of the baby were also not statistically influenced by the pain score of the respondents with p = 0.31and 0.11, respectively . Higher level of educational attainment was found out as significant predictor of pain perception among parturients because this exposes them to educational materials that change their orientation that labour pain is a myth and with improved knowledge about the availability of modern methods of pain relief in labour . This is similarly reported by olayemi et al.6 and onah et al.9 but differs from the report of kuti et al.10 that it is not influenced by parity and educational status . However, perception of labour pains did not differ significantly among parturients from the different ethnic groups in this study and similar perception of labour pains have been reported previously by studies from different ethnic regions in nigeria.91011 also interestingly, parturients expressed no difference in pain perception in both spontaneous and induced labour which is in contrast to reports by olayemi et al.6 and onah et al.9 that induced and augmented labour are more associated with a higher perceived pain than spontaneous labour . Despite the high level of awareness of pain relief in labour among the parturients having been taught in the antenatal clinic, only 35.3% of them had analgesic given in labour and pentazocine injection was the only analgesic given . The analgesic used in this centre may be ineffective in most cases as only very few parturients had maximum relief of their pains, the outcome of labour in these parturients- majority had spontaneous vaginal deliveries- and their babies were still better . This reflects the low level of practice of obstetric analgesia in this centre despite the availability of more effective methods of pain relief but the well documented benefits of the obstetric analgesia to the mother and their babies have been demonstrated in this study.4 this is similarly reported by onah et al.9 many of the parturients who were not given analgesic desired to have pain relief in labour . This desire for analgesic in labour was significantly associated with the higher educational level, social status and the antenatal education received among the parturients . Most educated women and those of upper social class live a less physically stressful life that would make them less accustomed to pains and suffering compared to the less educated women . They are also well informed about the documented advantages of pain relief in labour.6 this is contrast to the less educated women who do not desire pain relief because labour pain is considered as natural and a mark of womanhood and that drugs used may affect the progress of their labour and the outcome of their babies.912 parturients who had companions with them and also had their back rubbed during labour reported a decrease in their labour pains perception and that this helped them to cope better with the labour process . This was similarly reported in previous studies by hodnet et al.7 and abushaika et al.12 in places where doulas (lay women who are trained in labour support) are available, continuous labour support provided by them has been shown to consistently decrease the use of obstetric intervention.13 this practice should be encouraged since companionship in labour is one of the components of the active management of labour as opposed to what obtains in most centres in nigeria where relatives even their spouses are not allowed to stay with parturients in labour.10 this study has shown that many of the parturients described the labour process as being painful with only few having access to obstetric analgesia while majority would rather want a pain - free labour by accepting analgesics in labour . It is therefore essential that the practice of obstetric analgesia be stepped up with the introduction of parenteral opioids, epidural and inhalational analgesia into obstetric practice in our health care facilities in nigeria.39 in developed countries, obstetric anaesthesiology is a well - established subspecialty that takes care of analgesic need of parturients in labour to ensure a pain - free labour but in nigeria, the derth of anaesthesiologists has been a major challenge facing subspecialisation among the few available even in well - established tertiary health centres and teaching hospitals . Government should encourage training of more doctors in the field of obstetric anaesthesiology to administer this in the labour wards by providing additional incentives for them . The support of health care personnel in labour, provision of infrastructure and maternal involvement in decision making are clearly central in achieving a positive child birth experience . It is, therefore, imperative that attention is paid to this not only in this centre but in nigeria so that our parturients would enjoy the benefits of a pain - free labour . This would give our women the dignity they deserve and feel honored when performing their god giving role and reduce adverse maternal and fetal outcomes . Limitations to this study include the subjective assessment of labour pains and the relief obtained from analgesia by the parturients rather than by an objective method . The study was also limited by the fact that other methods of pain relief in labour are not readily available in this centre . My acknowledgment goes to all pregnant mothers that participated in this study and to the registrars, house officers and labour ward staff who helped in administering the questionnaires.
|
Department of health and human services, 600,000 hysterectomies are performed each year in the united states . It is the second most common major operation that women undergo, and it is estimated that more than one - third of all women will have undergone the procedure by the age of 65 . During supracervical hysterectomy, the surgeon removes only the body of the uterus; in a total hysterectomy, the surgeon removes the cervix along with the uterus . In the past, it was thought that leaving the cervix in place would result in improved sexual function and decreased rates of incontinence . A meta - analysis of 9 randomized controlled trials found that women who underwent supracervical or total hysterectomy for benign gynecologic conditions showed no postoperative difference with regard to sexual function or incontinence . A retrospective analysis comparing perioperative outcome of laparoscopic total and supracervical hysterectomy found that total hysterectomy is associated with a higher risk of urinary tract injuries and a higher risk of conversion to laparotomy . Women who undergo supracervical hysterectomy are more likely to have postoperative vaginal bleeding from the cervical stump . Rates of persistent bleeding have been reported from 0.92% to 25% of cases, with most series reporting rates between 5% and 10% . Some studies have identified endometriosis and menorrhagia before hysterectomy as risk factors for postoperative bleeding, whereas a more recent study failed to demonstrate an association with endometriosis . Older age (especially> 57 years) and bilateral salpingo - oophorectomy (bso) performed during the hysterectomy may in fact be preventative against postoperative bleeding, but only isolated studies have demonstrated these findings . Furthermore, the data on removal of the endocervix at the time of hysterectomy are inconsistent . One condition that has been minimally studied with regard to postoperative cervical stump bleeding is adenomyosis, a histologic diagnosis made when endometrial glands and stroma are found within the myometrium of the uterus . This ectopic endometrial tissue induces smooth muscle cell hypertrophy that leads to a globally enlarged uterus and can cause symptoms of menorrhagia, pelvic pain, and dysmenorrhea . With supracervical hysterectomy, endometrial tissue may be left behind at the cervical stump, or fragments from morcellation could become implanted in the stump and cause postoperative vaginal bleeding . Given the scarcity of data related to adenomyosis and bleeding after laparoscopic supracervical hysterectomy, we conducted a retrospective study to determine what factors, including a pathologic diagnosis of adenomyosis, are associated with postoperative bleeding . The charts of patients who had undergone laparoscopic supracervical hysterectomy performed by either of 2 surgeons from january 1, 2003, through december 31, 2012, were reviewed . The patients were excluded if they had undergone a total laparoscopic hysterectomy, had no follow - up with the primary surgeon, or were lacking a record of a postoperative visit or a pathology report . The electronic medical record was used to abstract the patient's age at the time of hysterectomy; postmenopausal status, defined as no menstrual period in the 12 months preceding the surgical procedure; body mass index (bmi), uterine weight, indication for hysterectomy in the operative note, concomitant bso confirmed by pathology report, the presence of endometriosis in a pathology specimen, surgical ablation of the endocervix documented on the operative report, a pathology report of adenomyosis, and the presence of endocervical tissue in the specimen . Endometriosis was deemed to be present if found by pathology of a separate specimen of excised peritoneum or on the serosa of the uterus, fallopian tubes, or ovaries . Documentation of postoperative bleeding was collected from office charts, including time of initiation, duration, resolution, and any medical or procedural intervention undertaken . We used the procedure codes for laparoscopic supracervical hysterectomy, with and without bso, and identified 368 charts . One hundred twelve charts were excluded because there was no documented postoperative follow - up appointment, leaving 256 patients (69.6%) in the analysis . The subjects were categorized into 3 groups, no postoperative bleeding (group a), bleeding during the first 12 postoperative weeks (group b1), and bleeding at more than 12 weeks (group b2). Patients in whom bleeding started in the first 12 weeks after the operation and continued after 12 weeks or who were treated for bleeding after 12 weeks were included in group b2 . Bleeding during the first 12 weeks, but not after, was considered to be normal during the postoperative healing period . The latter may be more clinically significant, as it can affect quality of life and may necessitate additional long - term treatment . Comparisons between the 3 groups were performed by 1-way analyses of variance (anova) and pearson tests, with post hoc tukey and bonferroni corrections, respectively . Fisher's exact test was performed for comparison of treatment for postoperative bleeding between groups b1 and b2 . Multinomial logistic regression was performed to calculate the odds ratio (or) for pathology - identified endometriosis when bleeding was present . All analyses were performed with spss for windows, version 20.0 (spss inc ., a post hoc power calculation was also performed with endometriosis as the primary outcome of interest . The level of statistical power, which was calculated with pass 11 (ncss statistical software, kaysville, utah), was found to be 70% . We used the procedure codes for laparoscopic supracervical hysterectomy, with and without bso, and identified 368 charts . One hundred twelve charts were excluded because there was no documented postoperative follow - up appointment, leaving 256 patients (69.6%) in the analysis . The subjects were categorized into 3 groups, no postoperative bleeding (group a), bleeding during the first 12 postoperative weeks (group b1), and bleeding at more than 12 weeks (group b2). Patients in whom bleeding started in the first 12 weeks after the operation and continued after 12 weeks or who were treated for bleeding after 12 weeks were included in group b2 . Bleeding during the first 12 weeks, but not after, was considered to be normal during the postoperative healing period . The latter may be more clinically significant, as it can affect quality of life and may necessitate additional long - term treatment . Comparisons between the 3 groups were performed by 1-way analyses of variance (anova) and pearson tests, with post hoc tukey and bonferroni corrections, respectively . Fisher's exact test was performed for comparison of treatment for postoperative bleeding between groups b1 and b2 . Multinomial logistic regression was performed to calculate the odds ratio (or) for pathology - identified endometriosis when bleeding was present . All analyses were performed with spss for windows, version 20.0 (spss inc ., a post hoc power calculation was also performed with endometriosis as the primary outcome of interest . The level of statistical power, which was calculated with pass 11 (ncss statistical software, kaysville, utah), was found to be 70% . The patients' mean age was 45.2 years; 10 (3.9%) were postmenopausal . The median bmi was 25.7, and the median uterine weight was 191 g. of the 256 patients, 59.8% had fibroids, 12.5% had pelvic pain, and 16.8% had abnormal uterine bleeding as the primary indication for hysterectomy . Most of the operations (86.7%) were performed by the senior author, and the remaining ones (13.3%) were performed by the second author . Only 15.2% of the patients underwent bso at the time of hysterectomy, 14.1% had evidence of endometriosis reported by pathology, and 78.1% underwent surgical ablation of the endocervix . On the pathology report almost 27% had documented postoperative bleeding: 15.6% in group b1 and 11.3% in group b2 . Bmi, uterine weight, indication for hysterectomy, concurrent bso, surgical ablation of the endocervix, and presence of endocervical tissue or adenomyosis reported by pathology did not differ significantly between the 3 groups (p> 0.05). Comparison of potential risk factors in the 3 study groups bmi, body mass index; bso, bilateral salpingo - oophorectomy; ci, confidence interval . Group a: no post - operative bleeding, group b1: bleeding 12 weeks, group b2: bleeding> 12 weeks . Group a vs. b1, p = 1.000; group a vs. b2, p .001; group b1 vs. b2, p = .032 . Group a vs. b1, p = .181; group a vs. b2, p <.001; group b1 vs. b2, p = .035 . The mean age of the 3 groups was significantly different, with younger patients being at significantly higher risk of postoperative bleeding (p = .002). Post hoc analysis showed that there was no significant difference in mean age between the patients in groups a and b1 (p = .999). However, the patients in group b2 were significantly younger (41.5 5.7 years) than those in groups a (45.8 5.9 years) and b1 (45.3 7.3 years) (p = 0.001 and 0.032, respectively). Furthermore, although the groups were not significantly different, no postmenopausal patients were found in group b2 . Comparative mean ages of the 3 study groups after the postmenopausal and bso patients were removed are presented in table 2 . The mean age between groups was found to be statistically significant when the postmenopausal patients alone were removed from the analysis (p = .002). Post hoc analysis showed that there was no difference in mean age between groups a and b1 (45.3 5.5 vs 44.2 5.8 years; p = .511) or groups b1 and b2 (44.2 5.8 vs 41.5 5.7 years, p = .109); however, group b2 was significantly younger than group a (41.5 5.7 vs 45.3 5.5 years; p = .002). The results were similar when the postmenopausal and bso patients were removed from the analysis . Mean age of the 3 study groups with postmenopausal and bso patients removed bso, bilateral salpingo - oophorectomy . Group a vs. b1, p = .511; group a vs. b2, p = .002; group b1 vs. b2, p = .109 . Group a vs. b1, p = .348; group a vs. b2, p <.001; group b1 vs. b2, p = .086 . An overall statistically significant difference was found between the 3 groups with regard to endometriosis on the pathology report (p <.001). Post hoc analyses showed no statistically significant difference between groups a (9.6%) and b1 (17.5%) (p = .181). Significantly more patients in group b2 (37.9%) had endometriosis than in groups a (p <.001) and b1 (p = .035). More specifically, although the patients with endometriosis were more likely to have bleeding, endometriosis was found to be a nonstatistically significant predictor when comparing groups a and b1 (or = 0.53; 95% confidence interval [ci] = 0.211.37; p = .191). However, patients with endometriosis were more likely to bleed at more than 12 weeks than were those in group a (or = 0.16; 95% ci = 0.010.41; p <.001) and group b1 (or = 0.31; 95% ci = 0.100.95; p = .040). Finally, no statistically significant correlation was found between age and pathology report of endometriosis (p = .174). The treatment methods used for the 2 groups with postoperative bleeding are presented in table 3 . The most common treatment for patients with postoperative bleeding included observation (40/69, 57.9%), with application of silver nitrate (15/69, 21.7%) being the next most common . Several patients (5/69, 7.2%) had silver nitrate and ferric subsulfate (monsel's solution) applied, and 1 (1.4%) had only ferric subsulfate applied . Approximately 4.3% (3/69) underwent trachelectomy (1326 months after hysterectomy) and 1 patient (1.4%) opted for medical treatment with oral contraceptives . There was no statistically significant difference in the treatment modalities used in groups b1 and b2 (p> 0.05). Our study was focused on determining the risk factors associated with persistent cervical stump bleeding after laparoscopic supracervical hysterectomy . In the current literature, furthermore, lieng et al discovered that only 50% of patients who underwent supracervical hysterectomy were aware that they could experience persistent postoperative menstrual bleeding . After patients who experienced postoperative bleeding within 12 weeks of surgery were excluded, our rate of postoperative bleeding (11.3% of the cases) is consistent with published rates, which range from less than 1% to more than 25% . Some of these studies include any postoperative bleeding, whereas others document only cyclical vaginal bleeding . We included all patterns of postoperative bleeding, as all may reduce quality of life . Only patients with documented follow - up were included in our study; this criterion prompted exclusion of approximately 30% of the patients who underwent laparoscopic supracervical hysterectomy during the study period . The low follow - up rate is due to the nature of the referral practice, as operations are often performed in conjunction with the referring physician, and not all patients have office follow - up . There are 2 ways that this failure may affect our rate of postoperative bleeding . The patients were instructed to follow up with the referral practice if problems occurred after the surgery; thus, the actual rate of postoperative bleeding may have been less than calculated, in that there may have been no follow up in patients with no bleeding . Both of these possibilities may have influenced the reported rate of postoperative bleeding in the study sample . One variable that has not been examined extensively in the literature is bmi as a risk factor in postoperative bleeding of the cervical stump . A higher bmi often indicates greater adiposity, which implies increased peripheral conversion of androgens to estrogen and possibly increased persistent bleeding caused by hormonal stimulation of any remaining endometrium . Bmi was not found to be significantly different between the 3 groups, confirming the previous findings of ghomi et al, who reported the data of 67 patients who underwent laparoscopic supracervical hysterectomy and were observed for 15 months . There was no statistically significant difference between the 3 groups for indication of surgery and pathology report of adenomyosis . All of these findings are consistent with the data published by ghomi et al . However, our findings differed, as they found that 24% of patients experienced postoperative bleeding when the ovaries were preserved, versus 0% after undergoing a bso . Although only 39 of our patients underwent a bso at the time of supracervical hysterectomy, their result was not confirmed by our findings . The persistent postoperative bleeding in patients despite concomitant bso may have been caused by peripheral conversion of androgens to estrogen or stimulation by ovarian remnants . Many surgeons fulgurate the endocervical canal at the completion of hysterectomy in an attempt to ablate any possible remaining endometrium and prevent postoperative bleeding . In a meta - analysis, nouri et al found that bipolar coagulation of the endocervical canal decreases rates of postoperative cyclical bleeding, but, similar to ghomi et al, we were unable to confirm this finding . One limitation in the reliability of the data for this finding is that fulguration of the canal may have been performed but was not described in the operative note . However, no statistically significant difference was found between pathology for the 3 groups in terms of surgical ablation of the endocervical canal or endocervical tissue . Two studies demonstrated decreased rates of bleeding when endocervical tissue was present on the uterine specimen, but the difference was not statistically significant . Nouri et al demonstrated in a meta - analysis that uterine resection below the level of the internal os is protective against bleeding . This procedure is considered to be protective against persistent postoperative bleeding, as it could be inferred that the presence of endocervical tissue indicates that the entire lower uterine segment was excised, and no endometrial tissue was left in situ . A limitation of this finding is that one cannot assume that the amputation of the uterus from the cervix was uniform, nor is there an anatomic line between the cervix and the uterus . Therefore, at one level, some endocervical tissue may be excised, but at another area of the amputated endometrium, it may remain in situ . Two variables were found to be more common among the patients who had postoperative bleeding at more than 12 weeks, younger age, and endometriosis . Patients who experienced postoperative bleeding at more than 12 weeks were significantly younger than those who did not and those who had postoperative bleeding within 12 weeks of the operation . This finding is consistent with the results reported by lieng et al, who performed a retrospective cohort study of 240 women and found that the older women were less likely to have postoperative menstrual bleeding persisting up to 3 years . Initially, it was thought that younger patients were less likely to have undergone a bso at the time of surgery and to be postmenopausal before surgery, and, in them, ovulation therefore continued along with stimulation of any remaining endometrium, whereas the older patients underwent surgically or naturally induced menopause . After we removed postmenopausal and bso patients from the analysis, the group with postoperative bleeding at more than 12 weeks was significantly younger than the group with no bleeding, but was not significantly younger than those with bleeding within the first 12 weeks . This finding may provide an additional tool for discussing the risks of persistent bleeding after laparoscopic supracervical hysterectomy, depending on the patient's age at the time of the operation . A greater proportion of patients in the group with postoperative bleeding at more than 12 weeks had evidence of endometriosis at the time of surgery confirmed by pathology report . This result is consistent with findings by okaro et al in a retrospective study of 70 women who underwent laparoscopic supracervical hysterectomy and were observed up to 66 months . They found that 82% of the patients with postoperative cervical stump symptoms, whether it was pain or bleeding, had evidence of endometriosis, whereas 32% of those without such symptoms had evidence of endometriosis . A possible explanation is that tissue affected by endometriosis was left on the cervical stump during surgery, and as patients continued to produce estrogen, the ectopic endometrial tissue stimulated postoperative vaginal bleeding . Furthermore, there was evidence of cervical endometriosis in pathology and cytology specimens from papanicolaou smears; thus, the presence of endometriosis in the cervix could cause persistent cervical stump bleeding . Other studies, however, have not demonstrated a correlation between endometriosis and cervical stump symptoms . As young age and endometriosis were both associated with postoperative bleeding beyond 12 weeks, we evaluated the possibility of a correlation between the 2 variables . We identified no significant correlation between young age and the presence of endometriosis; thus, each variable individually was associated with persistent postoperative bleeding in our patient population . Although 11% of the patients experienced postoperative bleeding, it may be encouraging that, of those, only half needed treatment, perhaps because some women who experience bleeding do not regard it as bothersome . This conclusion confirms the findings of lieng et al that, although 24% of the women reported continued menstrual bleeding after supracervical hysterectomy, it was viewed as minimal by 90% of them, with a mean degree of adverse patient reaction of 1.13 on a 10-point visual analog scale . The extent and disturbance of the vaginal bleeding varies, but most patients undergo minimal intervention performed in the physician's office and few require an additional procedure such as a trachelectomy . In a study of 310 patients who underwent trachelectomy an average of 26 years after supracervical hysterectomy, hilger et al reported that more than 50% did so for prolapse and only 9% for bleeding . In our study, it is possible that those who were initially under observation after surgery were followed up elsewhere; thus, their treatment would not have been captured . Although the study was found to be powered at less than 80%, it included the largest sample size to date (compared with those in previous studies). Another significant strength of the study is that there were only 2 primary surgeons, thus eliminating differences between surgical technique and experience . Limitations include the retrospective design of the study, with reliance on medical charts to determine the presence or absence of postoperative bleeding, as well as findings and treatment . Future studies might include a prospective study with postoperative follow - up of patients at regular intervals with telephone calls or surveys, to ask them specifically about postoperative bleeding, treatment, and resolution . In addition, as power morcellation of the excised uterus or fibroids is currently a matter for debate in the gynecologic community, we report that we had no cases of uterine leiomyosarcoma in our study sample . We currently counsel all patients regarding the potential risks and benefits of power morcellation, as well as the alternatives, and have successfully performed power morcellation in a bag under direct visualization in more than 50 patients, similar to the methods used in a recently published study . Most women experience no further menstrual bleeding after surgery, but there is the possibility of bleeding from the cervical stump . Younger patients and those with endometriosis who desire to have no further vaginal bleeding may benefit from having total rather than supracervical hysterectomy . All patients who undergo laparoscopic supracervical hysterectomy should be counseled about the possible alternatives, benefits, and risks, including continued vaginal bleeding from the cervical stump and the possibility of postoperative treatment and procedures.
|
Viral hemorrhagic fevers (vhfs) represent an important class of emerging diseases and are classified as category a priority pathogens by the national institute for allergy and infectious diseases . The vhfs lassa fever and the argentine, bolivian, venezuelan, and brazilian hemorrhagic fevers are caused by members of the arenaviridae . Despite their status as emerging infectious diseases, little is known about the molecular basis of the pathology of these diseases, and this has hindered the design of antiviral therapeutics . Arenavirus pathogenesis is believed to involve the dysregulation of cytokines; for example, infection with the virulent lassa virus (lasv) prevents macrophage activation and tnf- production, whereas infection with the avirulent mopeia virus induces proinflammatory cytokine production, a similar effect has been shown with attenuated and virulent isolates of pichind virus (picv); proteomic and kinomic level analyses have also shown differential cell signaling events induced by attenuated and virulent arenavirus infection [46]. Currently, the only drug used in the treatment of these infections is the broad - spectrum antiviral, ribavirin, which requires administration within the first week of infection to be most efficacious . As only a small proportion of patients infected with lasv develop a hemorrhagic fever, indicators of prognosis will be critical in the efficient management of healthcare resources during epidemics . Currently, the best prognostic marker for severe disease is viral load, with high levels of virus correlating with increased likelihood of severe disease . However, quicker methods of prognosis determination would be of significant use in a clinical setting . We have previously used surface - enhanced laser desorption ionization time - of - flight (seldi - tof) mass spectrometry to characterize proteins bound to a thioaptamer (oligonucleotides with thiophosphate backbone substitutions) on a proteinchip array . Seldi is a high - throughput profiling platform that combines retentive chromatography and mass spectrometry in one platform refs . The process involves selective extraction and retention of proteins on chromatographic chip surfaces arranged in an array of spots and their subsequent analysis by mass spectrometry . In this study, we have used seldi - tof to compare cell extracts for representative protein signatures following infection . Picv is a genetically characterized model for lassa fever and recent construction infectious clones may allow the role of individual sequence changes in determining pathogenesis to be elucidated [10, 11]. Using two variants of picv, p2, which causes a mild, self - limiting infection, and p18, which causes a lethal hemorrhagic disease, we can identify signatures unique to mild and severe infection, and which reflect common responses . In this report we show that, consistent with previous data from several groups, the virulent variant more closely resembles mock - infection, suggesting a suppression of cellular responses to infection [2, 5, 13]. In addition, we identify one of these protein peaks by tandem mass spectrometry as prothymosin-, which may indicate a potential therapeutic target for the treatment of hemorrhagic arenavirus infection . Murine monocyte - like p388d1 cells were maintained in rpmi supplemented with 5% fetal bovine serum and 5 mm glutamine . Cells were infected in triplicate with peg purified p2 or p18 picv at a multiplicity of infection of 5 or mock infected with virus purification medium . Cells were harvested at 8 timepoints and cytoplasmic and nuclear extracts prepared . For animal experiments, male hartley guinea pigs were infected intraperitoneally with 1000 plaque forming units of the p2 or p18 variant of picv or mock - infected with phosphate buffered saline (n = 7 per group / timepoint) and sacrificed at 1 and 6 days post infection . Cells were fractionated into cytoplasmic and nuclear fractions as previously described with the addition of a nuclear purification step using optiprep (axis - shield, oslo, norway) gradients . Briefly, lysates were underlayered with 10 ml 30% optiprep and 5 ml 35% optiprep and centrifuged at 4c for 30 minutes at 4300 g. the interface was removed and placed in a fresh tube which was filled with sucrose buffer i (described in dyer & herzog, 1995) plus 1.5 mm cacl2 . Following centrifugation at 4c for 15 minutes at 1900 g, the pellet was resuspended in sucrose buffer i and the centrifugation repeated . 5.4 ml buffer containing 10 mm tris and 9 m urea (ph 9) was added to 2.7 ml combined cytoplasmic portion of mock-, p2-, and p18-infected macrophages, and the mixture was incubated at 4c for 20 minutes . It then was dialyzed against 50 mm tris (ph 8), after which the dialyzed solution was added to 30 l packed q hyperd f beads (pall corporation, pa), and incubated for 30 minutes at 4c . The beads were collected by centrifugation (3000 g, 1 minutes) and the supernatant was saved as flow - through . The proteins bound to the beads were eluted by lowering the ph of the buffer in five fractions (90 l of each eluent in 50 mm of each ph buffer): q1 (ph 6.5), q2 (ph 5.5), q3 (ph 4), q4 (ph 3) and q5 (ph 3 + 1 m nacl). 10 l of each fraction was added to 90 l 50 mm tris (ph 8) buffer and was captured on q10 anion exchange proteinchip array surfaces (bio - rad laboratories, hercules, ca) with a bioprocessor biomek 3000 (beckman coulter, fullerton, ca). The mass spectra of the proteins captured on q10 chips were recorded on the pcs 4000 proteinchip array reader (bio - rad laboratories, hercules, ca). Experiments were run in triplicate at the 8 time points mentioned above, leading to a total of 72 samples each for the cytoplasmic and nuclear fractions . Seldi spectra were recorded on the pcs4000 proteinchip system at a laser intensity setting of 2600 . Analysis was limited to the molecular weight (mw) range 2 kda20 kda . Log - transformed peak intensity values were subjected to a 2-way anova test with matlab v. r2007a (the mathworks, natick, ma). P - values were calculated for three null hypotheses: (a) that all samples from the mock, p2, and p18 infections came from the same population, (b) that all samples from the eight different time points came from the same population, and (c) that the effects due to the two factors, infection and time, are additive ., palo alto, ca) was used for hierarchical clustering (hc) to group the biomarkers detected by the timecourse analysis described above . Seldi peak intensities were first z - score normalized and hc was then run using the unweighted average method, with euclidean distance as the similarity measure and average value as the ordering function . Following hc, principal components analysis (pca) was performed transforming the data into a small number of dimensions to visualize the clustering of the biomarkers . (edge) as this technique is designed for the analysis of timecourse data [15, 16]. The method builds on the false - discovery rate (fdr) developed by benjamini and hochberg to control the expected proportion of falsely rejected null hypotheses . For the multiple significance testing performed in the analysis of - omics data, the q - values provide a more meaningful and practical measure than the p - value . Appropriate cutoffs are imposed on the q - value to control the desired proportion of falsely rejected hypotheses . The cytoplasmic samples were treated with 9 m urea to denature the proteins, fractionated by q hyperd f beads, and eluted into flow - through (ft), and five ph factions at ph 6.5, 5.5, 4.0, 3.0, and ph 3 + 1 m nacl . The chip was loaded on the high - resolution qstar xl spectrophotometer and data collection was performed . The fragment masses were used as probes to search the mouse protein database for protein identification . Tandem mass spectrometric peptide sequencing was accomplished using qstar xl (applied biosystems inc ., foster city, ca) quadrupole time of flight instrument equipped with ciphergen proteinchip interface pci 1000 . The instrument was calibrated externally using the known ms / ms spectrum of acth peptide (124) at 2465.2 m / z, where four fragment ions and the parent ion were used as calibration points . All mass spectra were acquired in positive ion mode with collision energy that follows the rule of approximate 50 ev / kda parent peptide mass . Fragmentation information from tandem ms spectrum was first submitted to the sequence query program in matrix science (http://www.matrixscience.com/) for possible identities with a precision tolerance of 0.4 da for ms / ms fragments and 70 ppm for the parent peptide . 60 ul of packed protein g agarose beads (santa cruz biotechnology, ca) were incubated with 30 ul mouse monoclonal antibody against prothymosin alpha (alexis biochemicals, ca) for 1 hour at 4c, followed by three times wash of 1xpbs, 50 ul combined cytoplasmic portion of mock-, p2-, and p18-infected macrophages was then added to the beads, and the solution was incubated at 4c for 2 hours, followed by three times wash of 1xpbs + 0.1% triton x-100 . After a brief wash with water, proteins bound to the antibody against prothymosin alpha were eluted with 60 ul of elution buffer containing 0.3% tfa and 50% acetonitrile . The eluant was analyzed by pcs 4000 proteinchip array reader (bio - rad laboratories, hercules, ca). Supernatants from infected triplicate cultures were added to 96-well plates in triplicate wells (nunc) and incubated overnight at 4c . Wells were then blocked with 5% w / v bovine serum albumin for 1 hour . Primary antibody (antiprothymosin-1, santa cruz, santa cruz, ca, 1/2000) was added to wells in blocking solution and incubated for 2 hours . Wells were then washed four times in phosphate buffered saline + 0.05% tween-20 for 5 minutes prior to incubation with secondary antibody (anti - rabbit ig hrp conjugate, 1/2000) in blocking solution for 1 hour . Wells were washed as before and levels of [pro] thymosin are indirectly assayed by the addition of the colorimetric substrate tmb (sigma, st louis, mo). Peritoneal cell extracts from infected guinea pigs were analyzed by surface enhanced laser desorption ionization (seldi) mass spectrometry (figure 1). Peaks were identified that could discriminate between type of infection (e.g., figure 1, box a) and stage of infection (e.g., figure 1, box b). Consistent with our previous findings, infection with the virulent p18 variant of the virus resulted in a spectrum that more closely resembled mock infection than infection with the attenuated p2 virus . We next infected triplicate cultures of murine p388d1 macrophage - like cells for a timecourse of infection from 15 minutes to 16 hours . We used a cell line for this study in order to increase the sample quantity for downstream assays and database searching for identification by mass spectrometry . We have previously used this cell line to investigate picv - host interactions and are familiar with how cellular responses in this cell line model those seen in primary guinea pig macrophages . Triplicate nuclear and cytoplasmic samples were prepared following mock - infection or infection with p2 or p18 picv at 15 m, 30 m 1, 2, 4, 8, 12, and 16 hours post infection . Statistical analysis by anova and edge identified 27 and 35 significantly different peaks, respectively . Hierarchical cluster analysis revealed similarities in peak patterns between p2 and p18 infection at late times (12 and 16 hours) post infection (data not shown), but that p18 was most similar to mock infection at early times post infection, consistent with our previous results . We identified several peaks as two sh3-domain binding proteins, stathmin, prothymosin-, thioredoxin, and various ribosomal proteins . Prothymosin- was identified as a significantly differentially expressed protein peak with and edge q value of 0.0164 . We have previously identified prothymosin- as a node in a signaling network constructed following kinomics analysis of picv - infected cells and so was selected for additional study . The pattern of prothymosin- peak expression in a representative sample of cytoplasmic extracts is shown in figure 2 . Lower peak intensity following infection with p18 picv can be seen at 1, 2, and 4 hours post - infection . However, prothymosin- can shuttle between the cytoplasm and the nucleus where it functions as a histone h1 binding protein and is associated with cell growth [1921]. Prothymosin- and the peptide thymosin-1, produced by proteolytic processing of prothymosin- and an immune - modulator, can also be secreted [2224]; for these reasons, the changes in peak intensities may not reveal the functional changes and effects in prothymosin- activity and regulation . In order to verify the marker with molecular mass at 3787 da, the cytoplasmic portion of the combined mock-, p2-, and p18-infected macrophages was fractionated on q hyperd f beads with six fractions including the flow - through; each fraction was further captured on q10 protein chip array surfaces . The marker protein was highly enriched in q3 fraction on q10 array surfaces (data not shown). The molecular mass of the marker is only 3787 da; since the qstar xl instrument can analyze parent ion up to 5400 m / z, the peak could be identified as prothymosin- without any further purification (figure 3). Protein g agarose beads coupled to a monoclonal antibody against prothymosin alpha were used to immunoprecipitate prothymosin- from extracts; the same protein peak at 3787 da was identified (figure 4(b)). We harvested supernatants from triplicate infected cultures over a 16-hour timecourse of infection and assayed the levels of (pro)thymosin- in the supernatants (figure 4(a)). As the thymosin peptide is contained within prothymosin-, we are unable to distinguish between these peptides . Infection with the attenuated p2 variant of picv induced consistently higher levels of (pro)thymosin- in supernatants than mock infection or infection with the virulent p18 variant, ranging a 22.5-fold increase over baseline (mock - infected) levels (figure 5(a)). Levels of secreted (pro)thymosin- were significantly higher (p <.05) from 15 minutes to 8 hours postinfection . Consistent with many of the significant peaks in the seldi analysis and many of our previous observations, the response induced by p18 infection more closely resembled mock - infection than infection with p2 picv [35], although p18 did begin to induce higher levels of secreted (pro)thymosin- than mock - infection at late times postinfection . We infected triplicate cultures of p388d1 cells with p2 or p18 picv or mock infected with peg purification medium and prepared whole cell extracts at 24 hours post infection . Stathmin expression was significantly reduced in both p2 and p18 infected cells compared to mock, with p18 infection showing reduced stathmin expression compared to p2 across triplicate experiments (figure 5(b)). Stathmin expression is controlled by a number of transcription factors, including a signaling module based around nf-b, ap-1, c - myc, and p53, which we have previously shown to be differentially regulated in picv infection [4, 5], and which may suggest the molecular basis for differential stathmin expression . Many virus infections present with nonspecific flu - like symptoms complicating diagnosis; additionally, very few markers exist for determining the prognosis of infection . In particular cases, such as in the response to an epidemic or an intentional release, the ability to quickly triage patients on the basis of likely outcome could play a significant role in the management of what might be limited healthcare resources . The development of biomarkers that correlate with disease prognosis would be a valuable clinical tool . Biological phenomena, such as the progression of viral infection studied here, are temporal in nature, and the resulting observations need to be analyzed with statistical techniques that can reveal temporal differential expression . Edge analysis of our data uncovered 35 differentially expressing proteins as compared to 27 by 2-way anova . (2005) first demonstrated with genomic data, that dynamic methods such as edge are more effective at discovering candidate biomarkers that may be hidden to static methods . It is worth noting, however, that edge is a univariate method and it examines the data protein by protein (peak by peak, in the case of the present method) to evaluate differential expression . These studies demonstrate that seldi mass spectrometry can be used to determine differences between attenuated and virulent virus infection, and that the development of characteristic diagnostic and prognostic in addition, we have shown that this approach can be used as a discovery tool to determine potential mechanisms of pathogenesis and identify targets for therapeutic intervention at the level of modulation of the host immune response . In this model system, we have used two variants of a picv which result in a mild infection, from which the animals recover, or a severe hemorrhagic disease . Further studies will use only the virulent virus variant and investigate the differential responses between animals that succumb to infection and those which recover . This study represents an important proof of principle that mass spectrometry methods can be used to differentiate between infections that result in severe disease and those that are self - limiting, suggesting that diagnostic and prognostic assays can be developed which function by detecting host responses to infection, rather than virus material directly . This may allow the development of assays which can identify the agent of infection a priori and which may be less prone to reduction of assay sensitivity by viral mutation . We also identified differential secretion of a host immunomodulatory peptide between infection with attenuated and virulent virus variants although we could not discriminate between prothymosin- and thymosin-1 in this study . As infection with the attenuated virus leads to a mild - infection and viral clearance, it is likely that the correct immune signaling events are activated, leading to the development of protective immunity, events which may be suppressed in virulent infection . The use of immunomodulation and targeting of the host - responses to, and critical cellular - factors for, infection may be a viable therapeutic option in the treatment of infectious disease and may allow existing drugs to be repositioned [2832]. Decreased thymosin-1 secretion in virulent infection may contribute to the lack of development of the protective immune response, potentially through failure of proper induction of nf-b, map kinase, and myd88 pathways [33, 34]. Thymosin-1 is already being tested as a therapeutic against hiv / aids, sepsis, hepatitis b and c viruses, and several cancers [24, 3540]. Its characterized pharmacodynamics and kinetics may facilitate its development as a therapeutic for emerging infectious diseases . Interestingly, prothymosin- has been shown to interact with camp response element - binding (creb) binding protein and can stimulate nf-b and ap-1 driven transcription . We have previously identified these transcription factors as being centrally involved in mediating host - responses to picv infection [35]. Nf-b and ap-1 have also been implicated in mediating host - responses to other lassa fever models and hemorrhagic fever infections such as ebola and rift valley fever [4245]. Modulation of creb binding protein function is the mechanism used by the a238l protein of the hemorrhagic dna virus african swine fever virus, to modulate pro - inflammatory gene transcription . The protein translocates to the nucleus and alters creb binding protein and p300 function, preventing recruitment to enhanceosomes and inhibiting expression of genes including tnf- and cox-2 [4649]. We have used seldi mass - spectrometry to compare protein signatures following infection of guinea pigs with attenuated and virulent virus variants . This study demonstrates proof of principle that proteomic methods can distinguish between attenuated and virulent forms of infection in vivo . We have shown that, consistent with previous studies, infection with the virulent virus results in responses more similar to mock - infection, suggesting an inhibition of host responses . We identified a peptide - prothymosin--which contains the soluble immune mediator thymosin-1 as being differentially expressed between infections and confirmed differential secretion . These studies shed further light on the mechanisms of hemorrhagic arenavirus pathogenesis, identify a potential strategy for therapy, and illustrate how proteomic approaches for biomarker discovery can generate additional hypotheses for further, targeted investigation . H. wang and l. o. lomas disclose employment by vermillion inc . During the period of performance of this study.
|
Gastric cancer (gc) is the fourth most frequently occurring cancer in the world, with 989,600 new cases (8% of total) and 738,000 deaths (10% of total) estimated worldwide in 2008 [1, 2]. Gc has a significant global burden, with a particularly high incidence in eastern europe, south america, and eastern asia [2, 3]. Several factors are associated with an increased risk for gc, the most common including helicobacter pylori infection and smoking [4, 5]. Until recently, the most common forms of gc were fundus and distal gastric cancers; however, there has recently been a shift to a greater prevalence of adenocarcinoma . Current treatment guidelines recommend the use of surgical gastric resection for the management of resectable gc; however, there is variation between countries regarding the extent of lymphadenectomy that is performed alongside gastrectomy [1, 3, 6, 7]. Traditionally, hemostasis during gastrectomy has been achieved using a variety of techniques, including suture ligation and monopolar electrosurgery . For instance, suture ligation not only is a time - consuming process, but is also associated with the risk of knot slipping . Further, in monopolar electrosurgery, the high temperatures (150c400c) that result from using electrical energy to cauterize the tissue can spread into neighboring structures, increasing the risk of injuring surrounding tissue [8, 9]. Ultrasonic devices have been developed to address the challenges associated with conventional hemostasis techniques . Through its design, the device converts electrical energy into mechanical energy, causing the blade to vibrate at a frequency of 55.5 khz . Simultaneous cutting and coagulation of tissue are achieved by the high frequency vibration of the blade, which generates stress and friction in the tissue molecules . In turn, this disrupts hydrogen bonds and generates heat, causing protein molecules in the tissue to denature and adhere to one another, thereby forming a hemostatic seal . Importantly, no electrical current is passed through the patient, which reduces the risk of burns and injury . Additionally, unlike monopolar electrosurgery, the harmonic scalpel operates at lower temperatures, thereby dispersing less energy to surrounding tissues and reducing the risk of thermal damage [9, 10]. Several studies have demonstrated the clinical and surgical advantage of the harmonic scalpel over conventional techniques in different surgical areas, including thyroidectomy [1013], cholecystectomy [14, 15], and colectomy [1619]. More recently, a number of randomized controlled trials (rcts) have investigated the use of this device compared to conventional techniques in gastrectomy [20, 21]. In this procedure, the harmonic device is typically used for tissue dissection and sealing of smaller to moderately sized blood and lymphatic vessels, while hemoclips or surgical ties are used for major blood vessels, such as the gastric or gastroepiploic vessels . Results from these studies demonstrate that the harmonic scalpel can significantly improve outcomes such as operating time in gastrectomy procedures . Further, comparison of ultrasonic devices to conventional methods in a meta - analysis of rcts and observational studies performed by chen and colleagues associated beneficial outcomes with ultrasonic scalpels in open gastrectomy procedures . Presently, there are no meta - analyses examining the exclusive impact of the harmonic scalpel in gastrectomy . Consequently, this systematic review and meta - analysis paper was conducted to evaluate the performance of the harmonic scalpel versus conventional techniques in both open and laparoscopic gastric surgery for patients with gastric cancer . A systematic search of 21 databases was conducted, including medline via pubmed, the cochrane central register of controlled trials (central), embase, and 18 other national databases (table 1). Specific inclusion criteria were defined according to picos (i.e., population, intervention, comparator, outcomes, and study design). Studies were considered eligible for inclusion if they were rcts comparing the use of harmonic surgical devices to conventional methods, such as monopolar electrosurgery and suture, clips, or knot - tying (table 2), in human subjects, for all types of surgery . Full - text studies were then excluded firstly if they did not focus on either open or laparoscopic gastrectomy for gastric cancer, secondly if they used advanced energy devices other than harmonic devices, and thirdly if they used the harmonic device outside of the cleared indication . In the harmonic studies that were included, the methods section had to identify that the harmonic device was the principal device used for the procedures . Disagreements between reviewers regarding study inclusion were resolved through consensus or by consultation with a third reviewer . For included studies, details (i.e., baseline characteristics and outcomes) data extraction was conducted by two independent reviewers with discrepancies resolved by consensus or a third party . The data from non - english articles were translated, extracted, and included in the form . One reviewer conducted the data extraction, which was cross - checked by a second reviewer . Clinical outcome measures included the following: (1) operating time, (2) intraoperative blood loss, (3) drainage volume, (4) length of hospitalization, (5) transfusion risk, and (6) complication rate . When necessary, study authors were contacted for additional methodological details regarding whether open or laparoscopic surgery was performed; however, study authors were not contacted for missing data . Missing variance data were calculated from other effect estimates and dispersion measures where feasible and appropriate . Variance measures (i.e., standard deviation (sd)) were not reported in one study for operating time or in another study for drainage volume . Therefore, the missing variance measures were imputed according to the standard methods outlined by cochrane . Another study reported all continuous outcomes as medians with 95% confidence intervals (ci); therefore, assuming a normal distribution, the data were imputed using methods outlined by cochrane and hozo et al . . The quality of the included studies was assessed using the risk of bias algorithm outlined by the cochrane guidelines . Studies were scored as having low, unclear, or high risk of bias for the seven domains (sequence generation, allocation concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome data, selective outcome reporting, and other issues) in the assessment tool . Final decisions were dependent on the combination of these factors and the individual characteristics of each study . Study quality was assessed by two independent authors, where disagreements were resolved through consensus or by consultation with a third author . The meta - analysis was performed using review manager (version 5.3, the nordic cochrane centre, the cochrane collaboration, copenhagen, denmark, 2014). Continuous variables (operating time, intraoperative blood loss, drainage volume, and length of hospitalization) were analyzed for mean differences (md) using the inverse - variance method . Dichotomous variables (transfusion risk and complication rate) were analyzed for risk ratios (rr) using the mantel - haenszel method . A random - effects model was used for the meta - analysis and forest plots were generated for all outcomes within review manager . Sensitivity analyses were completed for study quality, where studies with unclear or high risk of bias across several measures were excluded [20, 26, 28], and for the type of conventional technique used, where studies using only monopolar electrosurgery (i.e., excluding suture ligation) were included [24, 2931]. Further, sensitivity analyses were conducted by excluding any study outcomes for which imputed data were required . A total of 4,541 records were identified from database searching, of which 4,153 were excluded during the title and abstract review (figure 1). Of the 388 full - text articles retrieved for review, 378 were further excluded if studies were non - rcts, had an undefined manufacturer, and did not use a harmonic device within the cleared indication, the publication was unavailable and had nonhuman subjects, or the surgical procedure was not gastrectomy . Ten studies, consisting of a total of 935 patients that reported on the use of harmonic devices in gastrectomy, were included in the meta - analysis [20, 21, 23, 24, 26, 2832]. Sample sizes of the included studies ranged from 40 to 253 patients and study length ranged from 11 to 48 months . In all studies, harmonic surgical devices (i.e., harmonic scalpel, harmonic wave, and harmonic focus) were compared to conventional techniques in gastrectomy . In five studies, the conventional method used was monopolar electrosurgery alone [24, 2831]; four studies reported using monopolar electrosurgery in combination with suture ligation or clips [21, 23, 26, 32]; one study did not report the specific conventional methods used . Of the ten included studies, five were chinese; however, patient characteristics were comparable across all included studies . Operating time was reported in nine studies [20, 21, 23, 26, 2832] and eight studies reported intraoperative blood loss [20, 21, 26, 2832]. One study reported operating time for lymphadenectomy patients only and was therefore excluded from this outcome . Nine studies [20, 21, 24, 26, 2832] reported on drainage volume and three studies reported the postoperative length of hospital stay [26, 28, 31]. Five included studies described the complication rate for both treatment groups [21, 24, 26, 28, 31] and the rate for blood transfusions was reported in two studies [26, 28]. Of the 10 included studies, nine reported on open gastrectomy and one on laparoscopic gastrectomy . The overall results of the risk of bias assessments are presented in figure 2 and the results of the individual study quality assessments are summarized in table 3 . Randomization method was reported in four studies: two studies used a random permuted block design [21, 23], one reported the use of a random number table, and one described the use of a lottery system . Only one study described concealment of the randomization sequence . Of the nine studies that did not report blinding, risk of performance bias was deemed low in six studies [20, 21, 24, 29, 30, 32], where nonblinding was assumed to have no impact on the outcomes assessed . Nine studies reported all prespecified study outcomes; however, selective reporting remained unclear in one study . Attritions or exclusions were reported in two studies [21, 23] but were assumed to have no clinical impact on the observed effect size . In three studies, there were no patient withdrawals in five studies [20, 26, 28, 31, 32]. Additional bias was unclear in one study, as there was a reported difference in surgeon status between treatment groups (harmonic group: 40% residents versus conventional group: 56.7% residents). Studies generally reported positive results which could result from a publication selection bias; however, funnel plots did not indicate any clear omission of negative studies . Mean operating time was statistically significantly reduced by 27.50 minutes (95% ci: 42.20 to 12.81; p = 0.0002; 9 studies; i = 91%) with the harmonic scalpel in contrast to conventional methods in open gastrectomy (figure 3). Results demonstrated that, with the harmonic scalpel, mean intraoperative blood loss was statistically significantly reduced by 93.15 ml (95% ci: 125.29 to 61.00; p <0.00001; 8 studies; i = 86%) in open gastric resection (figure 4). Mean drainage volume was statistically significantly reduced (md = 138.83 ml; 95% ci: 177.57 to 100.10; p <0.00001; 9 studies; i = 94%) with the harmonic scalpel (figure 5). The study device also showed significant reductions in drainage volume in open surgery (md = 134.36 ml; 95% ci: 172.86 to 95.87; p <0.00001; 8 studies; i = 94%). While a subgroup analysis for studies using laparoscopic surgery was not performed due to limited data, the results from the primary analysis and open surgery subgroup analysis were in line with those from the single study that conducted gastrectomy laparoscopically . On the basis of the three studies comparing the harmonic scalpel to conventional techniques in open gastrectomy, no statistically significant differences in the postoperative length of hospitalization were observed (md = 0.63 days; 95% ci: 2.48 to 1.23; p = 0.51; 3 studies; i = 65%) (figure 6). Results demonstrated a lower risk of blood transfusions with the harmonic scalpel than with conventional methods, although not statistically significant (rr of 0.68; 95% ci: 0.38 to 1.19; p = 0.18; 2 studies; i = 0%) (figure 7). The main reported complications for both study groups included postoperative bleeding, chylous leakage, gastrointestinal paralysis, and wound infection . The harmonic scalpel reduced the risk of postoperative complications compared to conventional techniques, although not significantly so (rr = 0.58; 95% ci: 0.33 to 1.02; p = 0.06; 5 studies; i = 12%) (figure 8). Similar results were observed between the open surgery subgroup and the single study reporting on laparoscopic gastric resection . Sensitivity analyses . Results of sensitivity analyses on study quality were similar to the primary analysis and were relatively robust to variables tested with some exceptions . For operating time, intraoperative blood loss, and drainage volume, results remained statistically significantly lower with the harmonic scalpel in all sensitivity analyses (table 4). Also, when studies with a higher risk of bias were removed, it is interesting to note that the harmonic scalpel significantly reduced the risk of postoperative complications compared to conventional techniques (p = 0.03). For hospital length of stay and transfusion risk, there were an inadequate number of studies to conduct a full meta - analysis for some sensitivity variables . Additionally, results of the primary analysis were insensitive to whether or not conventional methods focused solely on monopolar electrosurgery or when the imputed results by wilhelm et al ., lu et al ., and inoue et al . Were excluded for operating time, drainage volume, or all continuous variables, respectively . Given the challenges associated with conventional hemostatic techniques in gastric surgery, advanced devices that can overcome these drawbacks and improve surgical outcomes may be preferred . This meta - analysis assessed the performance of the harmonic scalpel compared to electrosurgery or suture ligation in gastrectomy . The breadth of the systematic search was quite extensive, with a large quantity of international, national, and regional databases searched . The findings of the meta - analysis support the benefit of using the harmonic scalpel in surgery, with a significant reduction in operating time, drainage volume, and intraoperative blood loss, in comparison to conventional methods . Although no significant differences between groups were observed for other outcome measures, results numerically favored the harmonic scalpel for reducing length of hospital stay, transfusions, and postoperative complications . The main reported complications for both study groups included postoperative bleeding, chylous leakage, gastrointestinal paralysis, and wound infection . Results for all outcome measures remained relatively consistent when subgroup and sensitivity analyses were conducted, which restricted included studies by type of conventional device, type of surgery, and data imputation of results, highlighting the robustness of the findings . However, sensitivity analyses excluding lower quality studies produced a significant reduction in the risk of complications with the harmonic scalpel . Methods outlined by cochrane were used to evaluate the quality and potential bias of the included studies . Results showed that the quality of included studies was acceptable overall, with fairly low risk of bias . A more general meta - analysis by chen et al . Compared the use of ultrasonic scalpels to conventional techniques in gastrectomy, providing evidence that these devices can reduce operating time and intraoperative blood loss, without compromising patient safety . The results of our meta - analysis confirm the findings of this published study, add more recent data, include only rcts, and exclusively assess harmonic scalpel use in gastrectomy . Our findings are also aligned with several meta - analyses that evaluated the efficacy and safety of this ultrasonic device in patients undergoing thyroid surgery [10, 12]. In the recent analysis of thyroidectomy by contin et al ., the harmonic scalpel significantly reduced operating time, blood loss, and postoperative drainage compared to other hemostatic techniques, demonstrating the clear benefits across surgical areas . Furthermore, evidence demonstrates that the favourable outcomes associated with the harmonic scalpel can translate into cost - savings for hospital institutions [33, 34]. Although all the studies included within this analysis performed gastrectomy plus d2 lymphadenectomy, it is important to note that the extent of lymphadenectomy performed alongside gastric resection differs between countries and institutions . While some suggest that a less extensive d1 lymphadenectomy is the minimum standard for gastric cancer, this is not universally implemented in lower incidence countries (e.g., united states). Conversely, in eastern asia, where nearly half of gastric cancer cases occur, d2 lymphadenectomy is typically the standard procedure performed . Prospective studies in both the east and west have shown that less extensive lymphadenectomies likely result in understaging of patients and increased locoregional recurrence; yet the effect on overall survival is more challenging to determine . Further randomized studies in western patients are required in order to make conclusions regarding the survival benefits of d2 lymphadenectomy . First, not all data were available to inform variance inputs for the meta - analysis . In order to overcome this, imputation methods and assumptions outlined by cochrane sensitivity analyses excluding outcomes with imputed data showed that results remained similar to the primary analysis . Second, since the heterogeneity between studies was significant for the majority of the meta - analyses, a random - effects model was used to pool all outcome data . Third, data were not available from all studies for each of the included outcomes to be statistically combined in this meta - analysis, and four of the studies had less than 50 subjects . Therefore, some outcome results may not be as rigorous due to small sample sizes . Additionally, not all studies reported the rate of total postoperative complications; therefore the total rates included in the meta - analysis represent an addition of individual complications reported in the studies . Last, because the authors did not have access to the study protocols of the included publications, there is potential for some variation in the study quality . The exclusion of lower quality studies in sensitivity analyses produced a significant reduction in the risk of postoperative complications; however, this exclusion did not impact all other outcomes . Furthermore, this study should be viewed as representative of outcomes for open gastrectomy, since only one of the ten studies was performed laparoscopically . The single laparoscopic study did not evaluate operative time, blood loss, hospital stay, or patient transfusion risk . Exclusion of the laparoscopic study did not have a substantial impact on the parameters that were measured therein, namely, drainage volume and total complication rate . In summary, relevant to physicians and economic stakeholders, reductions in resource use have potential cost implications for hospitals . For example, reductions in intraoperative blood loss can decrease the need for blood loss management resources, such as expensive blood products, and hemostatic agents . Further, several studies have revealed the high costs associated with operating time [3537]; hence the use of time - saving devices in surgery can lead to substantial savings . Essentially, products that require fewer people and less steps are more time - cost efficient . These savings in operating time and other resources (e.g., reduced hospital stay) can help to offset the product acquisition cost . However, there is still a need for further costing studies to fully elucidate this impact of resource aversion on potential cost savings . The harmonic scalpel is an effective surgical technique compared to conventional methods in gastrectomy and lymphadenectomy . It offers several clinical advantages, including reduced operating time and blood loss, which can ultimately benefit the surgeon, patient, and hospital, without the addition of safety concerns.
|
The study group consisted of 186 caucasian nondiabetic subjects participating in the catanzaro metabolic risk factors study (catameris), a metabolic disease prevention campaign for cardiometabolic risk factors (6). After 12-h fasting, subjects underwent an oral glucose tolerance test and a euglycemic - hyperinsulinemic clamp, as previously described (6). Whole - body glucose disposal (wbgd) was calculated as reported (6). Mets was defined according to american heart association and national heart, lung, and blood institute criteria . The study was approved by the institutional ethics committees, and written consent was obtained from all participants . Variables with skewed distribution were log transformed for analyses . A logistic regression analysis was used to determine the association between the tertiles of igf-1 or il-6 and the mets and its individual components . Relationships between variables were sought by multivariate linear regression analysis to assess the magnitude of their effect on wbgd . After adjusting for sex and age, igf-1 levels were negatively correlated with bmi, waist circumference, systolic blood pressure, triglycerides, fasting insulin, and homa and positively correlated with wbgd . After adjusting for age and sex, il-6 levels were positively correlated with bmi, waist circumference, systolic blood pressure, fasting insulin, and homa and negatively correlated with wbgd and igf-1 levels . In a logistic regression model adjusted for age and sex, igf-1 in the lowest tertile (<135 ng / ml) was associated with an increased risk of having mets (odds ratio [or] 3.07 [95% ci 1.27.9]), low hdl choldesterol (3.15, [1.28.1]), and larger waist circumference (4.67, [1.811.9]) compared with the highest tertile (> 221 ng / ml). After adjusting for age, sex, and lipid levels, igf-1 in the lowest tertile was associated with increased risk of insulin resistance, i.e., the highest homa tertile (3.08, [1.27.6]) or lowest wbgd tertile (3.31, [1.0110.9]). Conversely, in a logistic regression model adjusted for age and sex, il-6 in the highest tertile (> 2.5 pg / ml) was associated with an increased risk of having mets (3.21 [1.28.1]), high blood pressure (2.63 [1.16.4]), and larger waist circumference (4.42 [1.811.0]) compared with the lowest tertile (<1.3 pg / ml). After adjusting for age, sex, and lipid levels, il-6 in the highest tertile was associated with increased risk of insulin resistance, i.e., the highest homa tertile (2.14, [1.015.31]) or lowest wbgd tertile (4.64, [1.514.1]). To estimate the independent contribution of variables to wbgd, we carried out a multivariate regression analysis in a model including age, sex, bmi, waist circumference, triglycerides, hdl cholesterol, il-6, igf-1, and fasting and 2-h postchallenge glucose levels . The four variables that remained significantly associated with wbgd were age (p = 0.01), waist circumference (p = 0.01), 2-h postchallenge glucose (p = 0.001), and il-6 (p = 0.04), accounting for 61.2% of its variation . In this study, we report an inverse relationship between plasma igf-1 and il-6 levels consistent with clinical (7) and experimental data showing that igf-1 acts as an anti - inflammatory molecule inhibiting il-6 expression (4) and that il-6 decreases igf - i levels by increasing its clearance (5). Both igf-1 and il-6 are associated with mets and its individual components, but in opposite directions . Higher il-6 and lower igf-1 levels confer increased risk of having mets and its two underlying pathophysiological abnormalities, i.e., visceral obesity and insulin resistance . Interestingly, multivariate regression analysis showed that il-6 but not igf-1 levels were independently associated with wbgd . These results raise the possibility that proinflammatory molecules may have a more important role than anti - inflammatory proteins in the development of insulin resistance and mets . This study has some limitations: first, its cross - sectional nature makes it impossible to draw any conclusions on causality . Furthermore, while increasing evidence supports the concept that a low - grade proinflammatory state associated with increased visceral adiposity may induce insulin resistance and hence mets (1), it has been recently demonstrated (8) that acute il-6 exposure directly increases glucose metabolism in intact human skeletal muscle; our data do not allow exclusion of the possibility that increased il-6 levels in our population may represent an attempt to counteract insulin resistance by increasing glucose transport . However, it has also been observed (9) that reduced igf-1 levels are protective and associated with prolonged lifespan in centenarians, and we cannot exclude that in the study population decreased igf-1 levels represent a reactive rather than a causative state.
|
Paratuberculosis (johne's disease) is a chronic inflammatory bowel disease, primarily affecting ruminants . Losses associated with paratuberculosis include failure to thrive, reduced milk production, reduced reproductive performance, reduced culling value and increased replacement rate . Moreover, there are potential concerns about the safety of dairy products . Risk management of paratuberculosis is the process of identifying measures or actions that reduce the risk of exposure of a herd to map to an acceptable level . This risk is a function of the probability of an adverse effect and the severity of that effect, consequential to exposure to map . Therefore, risk management of paratuberculosis in a dairy herd requires an assessment of the likelihood of paratuberculosis occurring in the herd and the economic impact of paratuberculosis on the herd . Also, an assessment of measures that can be taken to reduce this likelihood and impact are required . These assessments should be made in view of goals of the farmer, such as herd size, milk production, product quality and the time span the farmer aims to remain in the farming industry and of constraints such as resources for paratuberculosis control . Finally, risk management of paratuberculosis requires definition of an acceptable level of the risk of losses due to paratuberculosis . Depending on this acceptable level, paratuberculosis control can aim at suppression (control) of the infection or even eradication of map . The likelihood of paratuberculosis occurring in a herd is related to the history of the herd, the (regional) herd - level prevalence and the herd management . Not surprisingly, cows in herds with a history of clinical signs of paratuberculosis are more likely to be test - positive than cows in a herd without such history . Thirty per cent of 143 herds in three irish counties had one or more seropositive cattle (barrett, personal communication). Furthermore, given the proportion of test - positive herds, the estimated proportion of truly infected herds is largely dependent on the specificity of the test being used . Cattle in large herds, and in herds in which animals were bought in from other herds, are more likely to be test - positive . Furthermore, factors that increase exposure of susceptible calves to map such as exposure of calves to faeces of adult cows, group housing for periparturient cows and group housing for pre - weaned calves increased the risk of cattle or herds to be test positive . Also, cleaning maternity pens after each use if information on the infection status of a herd is not available, culture of map in environmental samples can indicate whether or not map is present in the herd . In a recent study, more than 75% of herds with faecal culture positive cattle were detected by culturing four or five samples from the cows' environment such as the milk parlour exit, the floor of the holding pen, a common alleyway, or the manure pit . The economic impact of paratuberculosis includes production losses due to sub - clinical and clinical cases, losses due to increased replacement of animals and costs of control measures . Because most cases of paratuberculosis are subclinical, and precise prevalence data are often lacking, it is difficult to assess the economic consequences of paratuberculosis . Other studies showed losses in test - positive animals of up to 19.5% of the 0 to 305 days - in - milk production, depending on parity . However, using simulation modelling, an overall mean annual loss of $35 per cow, increasing to $72 per cow per year after 20 years was estimated for a typical 100-head us dairy herd . Similarly, in a recent scottish study, annual losses were estimated at 27 per cow . More importantly than direct losses, a milk price reduction for infected herds can result from consumer concerns about the zoonotic potential of paratuberculosis the issue of a potential role of map in the pathogenesis of crohn's disease in humans has not yet been resolved . If map is implicated, then milk is a possible vehicle of transmission of the organism to humans, because map has been detected in raw milk and might not be effectively inactivated by pasteurisation . The key element in prevention of introduction of map into a dairy herd is a closed herd management i.e., no introduction of cattle from other herds . A closed herd management is feasible if young stock are raised in the herd: a one - year study (sept 2001 - aug 2002;) found that, amongst dutch dairy herds in which young stock were raised, 55% of herds were closed . However, when introduction of cattle into dairy herds is necessary to achieve goals of farmers (such as optimising production), purchasing cattle from certified map - free cattle herds only is highly recommended . Tests for paratuberculosis are too insensitive to avoid introduction of map if only the introduced cattle are tested . Therefore, certified map - free herds are important in a control programme for paratuberculosis as a source of non - infected cattle . Certification programmes to identify map - free herds have been developed in several countries . In the netherlands, a certification - and - surveillance programme has been developed in which herds can obtain' map - free' status following five negative annual herd examinations (the first herd examination by elisa and faecal culture of elisa - positive animals, the second to fifth examinations by pooled faecal culture: . In infected herds, reducing the infection pressure on susceptible animals is paramount . It is generally assumed that the majority of infected cattle have been infected during the first six to 12 months of life . Firstly, preventive management measures that reduce contact between the susceptible calves and infectious adult cattle are generally advised . A checklist including preventive measures can be used in advising farmers (tables 1, 2, 3). Secondly, vaccination has been advocated . However, although vaccination does reduce clinical disease and economic losses of paratuberculosis, it does not reduce transmission of map . Thirdly, the infection pressure can be reduced by a test - and - cull scheme . Tests frequently used in control programmes for known infected herds are individual faecal culture, pooled faecal culture and serum - elisa . The diagnostic characteristics of these tests very much depend on the stage of the infection - and - disease process: animals at a progressed stage are more likely to be detected . Because at any point in time only a small proportion of infected animals is at such a progressed stage of infection, the overall sensitivity (i.e., detection rate of infected animals) is low . Strategically pooled faecal culture, in which faecal samples of five animals stratified by age are pooled, was found to have a relative sensitivity of 86% compared to individual faecal culture . The serum - elisa currently used at our laboratory (elisa bovine paratuberculosis serum verification, pourquier institute, france) was found to have a relative sensitivity of 41% compared to individual faecal culture . However, the test characteristics need to be balanced against the costs of the various tests . For example, at our laboratory, costs (2006) of individual faecal culture are 30.26 per sample, costs of pooled faecal culture are 43.34 per pool of five samples and costs of elisa are 7.11 per sample (excluding vat). However, because of the low sensitivity of tests, testing in a control programme needs to be repeated at regular intervals (for instance, once per year) to reduce the infection pressure on susceptible animals . Preventive management measures around birth of calves that are to be retained in the herd preventive management measures between birth and weaning of calves that are to be retained in the herd preventive management measures between weaning and one year of age of calves that are to be retained in the herd so far, neither preventive management measures alone, nor a test - and - cull scheme alone have been shown to give reliable results in a majority of map - infected herds . Therefore, in known infected herds, it is strongly advisable to combine vigorous execution of preventive management measures together with a test - and - cull scheme . With respect to test - and - cull, farmers aiming at elimination of map are advised to annually test all cattle of two years of age and older by faecal culture . Farmers aiming at suppression rather than elimination of map, can consider using an elisa instead . However, culling based on faecal culture is more effective, because of the higher sensitivity of faecal culture . Positive elisa results can be confirmed by faecal culture; however, in infected herds this is needless if an elisa with a high specificity is used (more than 99%). In these herds, it is advisable to cull all test - positive cattle and their lastborn calves . Furthermore, veterinary practitioners are advised to regularly do a' reality check', to monitor the implementation of the control programme that was intended by the farmer . It is widely recognised that the most effective way to reduce any potential human health risk of exposure to map through consumption of dairy products is to control and prevent paratuberculosis in the national dairy herd . Therefore, the potential losses to the dairy industry due to consumer concerns about milk safety might be reduced by implementation of a milk quality assurance programme for paratuberculosis in dairy herds . Such a quality assurance programme has recently been developed for dutch dairy herds . In the programme, herds are certified as' low - map bulk milk' if, with a certain probability, the concentration of map in bulk milk does not exceed a maximum acceptable concentration (mac). The mac was set at 10map organisms per litre of bulk milk, based on pasteurisation studies . This does not necessarily mean that a' low - map bulk milk' herd is free of map . Therefore, such a milk quality assurance programme can be run at considerable lower costs than a certification - and - surveillance programme for' map - free' herds . The milk quality assurance programme starts with an initial assessment; test - negative herds enter a surveillance procedure and test - positive herds enter a control procedure . Although quantification of map in bulk milk might seem the preferred method to distinguish between' low - map bulk milk' herds and other herds, methods to routinely quantify map in large numbers of bulk milk samples are not yet available . The control procedure in test - positive herds is done by annual serological herd examinations or by biennial herd examinations by faecal culture . Herd examinations by serology and by faecal culture include all cattle of three years of age and older, and two years of age and older, respectively . Using a stochastic simulation model of paratuberculosis transmission in dairy herds (johnessim;), it was shown that such a programme effectively ensures the quality of' low - map bulk milk': more than 96% of certified herds were below the mac of 10map organisms per litre of bulk milk (figure 1;). It should be realised that animals in an advanced stage of infection (high shedders) contribute most to the contamination of bulk milk . However, a closed herd management and vigorous execution of preventive management measures were found essential to increase the probability of obtaining and keeping a' low - map bulk milk' status . Estimated number of map organisms per litre of bulk milk immediately after an initial assessment in simulated herds that were test - negative (and therefore certified as' low - map bulk milk') and test - positive at that assessment, in a simulation of a bulk milk quality assurance programme in closed dutch dairy herds . Several keys to success of risk management of paratuberculosis can be identified on the herd level, on the veterinary practice level as well as on the national level . One of the keys to success on each of these levels is to have realistic expectations of the results of paratuberculosis control . Worldwide, the aim of control programmes nowadays shifts from eradication of map to (only) suppression of the infection . Keys to success for individual farmers include a closed herd management and a vigorous execution of preventive management measures . Farmers need to realise that many herds are infected at a low prevalence without the farmer noticing, and that in these cases the infection can spread rather quickly . Therefore, preventive management measures are also advised if clinical signs of paratuberculosis are absent . In known infected herds, or herds in which test results indicate an infection, combining preventive management measures with culling of animals that are (going to be) infectious is expected to be the key to success . As mentioned before, culling based on faecal culture is far more effective than culling based on elisa . A prerequisite to success in known infected herds is to accept all positive test results as such . In known infected herds, positive elisa results have a high predictive value, especially if an elisa is used with a high specificity (more than 99%). In that situation, more harm is done by not culling test - positive animals in which a conformation test is (false) negative, than by culling a false - positive animal . A key to success for veterinary practitioners is a sound understanding of the epidemiology and control of paratuberculosis . Therefore, veterinary practitioners are encouraged to visit websites such as http://www.paratuberculosis.org and http://www.vetmedce.org to regularly update their understanding of the risk management of paratuberculosis . A key to success of risk management of paratuberculosis on a national level is to develop a paratuberculosis programme in which a high proportion of herds participate . Even an excellent programme is useless if not appreciated by farmers or if incentives to participate are lacking . Therefore, involvement of the dairy processing industry in a paratuberculosis milk quality assurance programme is required . Milk price differentiation is supposed to be a powerful incentive to stimulate participation in a programme . However, the incentive should be directed towards achieving targets of the programme (such as a' low - map bulk milk' status) rather than towards participation in the programme as such . To reduce the economic effects on the dairy industry of potential consumer concerns about the safety of dairy products, such a programme can be run at relatively low costs for the majority of participating herds, because' low - map bulk milk' herds do not necessarily need to be map - free . Median total discounted costs for 20-year participation by a typical dutch dairy herd (initial herd size of 65 adult cattle, with an annual increment of 5%) in a programme consisting of an initial assessment by elisa, surveillance by biennial elisa and control by biennial faecal culture have been estimated at 6,000 per herd . Again, stimulating a closed herd management of participating herds is an essential key to increase the proportion of' low - map bulk milk' herds in the long term . However, because a closed herd management may not always be feasible, establishment of a nucleus of certified' map - free' herds, to enable low - risk trade of cattle, is another key to success on the national level . It is concluded that the likelihood of paratuberculosis occurring in a herd and its economic impact are important issues in risk management of paratuberculosis in dairy herds . Measures that can be taken to reduce this likelihood and impact include closed herd management, preventive management measures, test - and - cull of infected animals and participation in quality assurance programmes, such as a programme for' low - map bulk milk' . Keys to success include realistic expectations of the results of paratuberculosis control, development of a quality assurance programme that is appreciated by farmers and incentives for farmers to participate in such a programme . Comments of p. hartigan, j. verhoeff, g. van schaik, p. franken and a. kummeling on the manuscript are gratefully acknowledged.
|
Takotsubo cardiomyopathy (tc), also called stress cardiomyopathy or apical ballooning syndrome, is a syndrome of reversible stress - induced cardiomyopathy associated with profound emotional or physical stress . Tc is characterized by transient left ventricular (lv) dysfunction with ischemia - like chest pain and ischemia - like electrocardiographic (ecg) changes and lack of any obstructive epicardial coronary artery disease observed at the time of emergent coronary angiography . Lv wall motion abnormalities usually involve apical and/or midventricular myocardial segments with wall motion abnormalities extending beyond a single epicardial coronary distribution . Although several pathological mechanisms have been proposed, the precise pathophysiology of tc is still not entirely understood . We present a case with lung adenocarcinoma whose initial hospital admission was due to tc . A 59 year - old man without any history of cardiovascular disease was admitted to emergency service with the complaint of chest and back pain . Ecg revealed sinus rhythm with a rate of 70/min, 2 - 3 mm st elevations in v2 and v6 [figure 1]. He was on antihypertensive medication and smokes 20 cigarettes per day for more than 20 years . He was immediately taken into the cardiac catheterization laboratory with the diagnosis of acute anterior myocardial infarction . Transthoracic echocardiography demonstrated apical akinesia with a dynamic lv outflow tract obstruction (peak resting gradient: 45 mmhg, peak gradient reaches to 177 mmhg and mean gradient to 81 mmhg with valsalva maneuver) [figure 3]. St elevations returned towards baseline and his complaints were improved progressively with medical treatment, which included antiplatelet agents and anticoagulation, beta adrenergic receptor blocker and renin - angiotensin system blocker agents . Twelve - lead electrocardiography samples of patient obtained at admission (a) and 2 days later (b) coronary angiography and left ventriculography of the patient transthoracic echocardiography images of the patient demonstrating left ventricular systolic apical ballooning (arrows) and left ventricular outflow tract obstruction patient had a cachectic appearance and had complaints of backache and dysphagia with weight loss of 25 kg during the last 12 months . Endoscopic examination revealed esophageal obstruction due to external compression . Computed tomography scan of the chest revealed a mass with 5 x 2.5 cm diameter at the level of right pulmonary upper lobe on the posterior segment, extending from retrotracheal to paravertebral space with bone invasion . Fine needle aspiration biopsy obtained from mass showed neoplastic cells and immunohistochemical analysis demonstrated that these cells were reactive with ck7, ck20, and ttf-1 antibodies . He was diagnosed with lung adenocarcinoma and whole body positron emission tomography (pet) demonstrated hypermetabolic subcarinal and paraosephageal lymphadenopathies and lytic / sclerotic lesions on thoracic vertebral bodies (t 3 - 4 - 5) and right sided ribs (from 4 to 9), which were accepted as metastases . Repeat transthoracic echocardiogram performed 10 days after admission revealed complete resolution of lv systolic dysfunction and disappearance of lv outflow gradient [figure 4]. Tc usually mimics acute coronary syndrome and the most common abnormalities on the ecg are st elevations on the precordial on the precordial leads . Usually there is only a moderate rise in cardiac enzymes which is disproportionate with the size of the affected myocardium . Dynamic lv outflow tract (lvot) obstruction may occur in up to a fourth of tc subjects . Basal hypercontractility related venturi effect has been suggested as a cause of dynamic lvot obstruction . Tc is a transient syndrome and resolution of symptoms with complete echocardiographic and clinical recovery is expected within 2 to 3 weeks of presentation . Our patient had complete recovery of cardiac symptoms and echocardiography performed 10 days after presentation revealed complete resolution of both wall motion abnormalities and dynamic lvot obstruction . Several pathophysiological mechanisms have been suggested for tc among them coronary artery vasospasm, coronary microcirculation dysfunction, and catecholamine overload . Exposure to emotional or physical stress and increased sympathetic activity has been reported in most cases of tc . Excessive catecholamine production in patients with pheochromocytoma has also been shown to induce reversible lv dysfunction . Prognosis of tc seems favorable in the absence of significant underlying co - morbid conditions . However, a high rate of concomitant malignancies were reported in a prospective tc registry and burgdorf- et al . They evaluated 50 patients with tc and 50 age- and gender- matched control patients with acute anterior myocardial infarction (mi). They reported that 9 patients with tc (18%) and 3 patients with mi (6%) had a previous history of malignancy at the time of the index event . On follow - up, 7 malignancies were newly diagnosed in the tc group, whereas no new case of malignancy was found in the control group . These observations have suggested a possible association between malignancies and tc, which may be a result of paraneoplastic phenomena . A variety of malignancies were observed in patients with tc in their study, such as bronchial carcinoma, colorectal carcinoma, breast carcinoma, endometrial carcinoma, melanoma, bladder urothelial carcinoma, gastric carcinoma, and chronic lymphocytic leukemia . On the basis of these observations, burgdorf et al . Suggested to perform cancer screening in patients with tc . To the best of our knowledge, our patient had bone metastases causing backache and had complaints of dysphagia with weight loss of 25 kg during the past 12 months, which might also have constituted sufficient physical stress for the development of tc . We contribute this case report to the growing set of literature data regarding the presence of various concomitant malignancies in patients with tc.
|
The international continence society defines overactive bladder (oab) as: urgency, with or without urge incontinence, usually with frequency and nocturia in the absence of infection or any other proven causative pathology.1 thus the oab population includes both patients with urge incontinence (oab wet) as well as without urge incontinence (oab dry). Indeed, the incidence of oab dry has been reported at 66% of oab patients while 33% have oab wet and suffer from leakage.2 with prevalence rates similar to those of asthma and chronic bronchitis, the burden of this disease is enormous and presents great cost to society.3 the national overactive bladder evaluation (noble) program was a large scale, well designed epidemiological study which reported the prevalence of oab in the us at approximately 16% with the distribution between men and women being roughly equal and with the prevalence mounting with increasing age.3 similar results were seen in epidemiological studies in europe with prevalence rates of oab in the 12% to 17% range.4 the pathophysiology of oab is not completely understood and likely there are multiple pathways leading to the end disease state . Normal bladder storage and micturition function requires precise neurologic and muscular coordination; possible alterations at the myogenic, mucosal and neurogenic levels may contribute to the condition . While causative myogenic and mucosal alterations would take place at the end organ (bladder and urethra), adverse changes in bladder innervations in such neurogenic theories, alterations in the neurologic pathways that normally provide tonic inhibition of detrusor contractions may account for the disease state.5 alternatively, sensory nerve endings in the bladder may become hypersensitive, resulting in detrusor overactivity.5 indeed, research studying the role of the urothelium in normal and abnormal micturitional states has advanced dramatically and shaped the field of oab . It has long been understood that the autonomic nervous system plays a critical role in micturition . The sacral parasympathetic outflow provides excitatory input to the bladder via the pelvic nerve, which results in detrusor contraction . Bladder ganglia cells excite detrusor smooth muscle with release of both cholinergic neurotransmitter in the form of acetylcholine and also non - cholinergic, non - adrenergic neurotransmitters.5 acetylcholine activates muscarinic receptors on the detrusor smooth muscle and is considered a key neurotransmitter for detrusor function . There are 5 distinct subtypes of the muscarinic receptor throughout the body (m1m5), the m2 and m3 sub - types predominating in the bladder . Although the density of m2 receptor is higher than the m3 receptor in the human bladder, m3 is thought to be more important in the manifestation of detrusor contractions.6 given this basic understanding of neuroanatomy, it is not surprising that muscarinic cholinergic receptors became early therapeutic targets in oab treatment . Oxybutynin immediate release (ir) represents the first such medication approved by the fda specifically for the treatment of oab in 1975.7 it was originally investigated in the 1960s for the potential treatment of gastrointestinal hypermotility . Researchers incidentally discovered its usefulness as an agent for oab and it has been since widely used for decades . In addition to its anticholinergics effects oxybutynin also shows some in vitro activity as a direct smooth muscle relaxant8 and early in vitro studies on rabbit detrusor also noted moderate local anesthetic action.9 clinical efficacy for treatment of oab symptoms was well documented in the 1990s.10 despite proven efficacy, oxybutynin ir shows some major shortcomings as a therapeutic drug, namely high side effects, some so bothersome that some patients prefer to discontinue treatment and endure the disease itself rather than deal with the side effects . Lawrence et al showed a 6-month treatment adherence rate of only 32% in a retrospective analysis 515 patients prescribed oxybutynin ir in a pharmacy claims database.11 these pitfalls stem from fact that oxybutynin has a relatively nonspecific affinity for all of the various muscarinic receptors which are widespread throughout the human body . In addition to muscarinic receptors in the bladder, oxybutynin has particular affinity for muscarinic receptors in the central nervous system (cns), gastrointestinal (gi) tract, parotid gland and eye which may account for troublesome cognitive impairment, constipation, dry mouth and difficulty with papillary accommodation . Of these, dry mouth appears to be most prominent, occurring in up to 80% of patients taking oxybutynin.12 beyond bother, decreased salivation may predispose to oral infections and dental caries as well as inhibit proper mastication and swallowing, particularly in the elderly.13,14 given the limitations of oxybutynin ir, it comes as no surprise that alternative agents would be explored in the hopes that tolerability could be improved while maintaining efficacy in the treatment of oab . Other antimuscarinics such as propantheline, methantheline, emepronium, dicyclomine, and terodiline were once employed as alternative oab treatment options as they were perceived to be more tolerable, however they were eventually abandoned due to either lack of efficacy and/or poor tolerability.15,16 currently, there are five different antimuscarinic drug formulations on the market for treatment of oab in addition to oxybutynin . Tolterodine, propiverine, trospium, darifenacin and solifenacin all possess differing pharmacokinetic properties relating to organ and receptor subtype selectivities as well as structural differences . In addition, a separate strategy for changing the side effect profile of oxybutynin was employed by using an extended release (er) formulation . In addition, a patch formulation of oxybutynin was developed in hopes that tolerability could be improved through of use of a different delivery system which altered drug metabolism and lengthened the drug dosing interval . An oxybutynin gel formulation was recently introduced into the us market with similar aims . In this article we focus our attention on oxybutynin er formulation likewise meant to simplify drug dosing and improve on the side effect profile of the older oxybutynin ir . Oxybutynin er came to market in the united states in 199817 with intent to improve upon tolerability, convenience and compliance while maintaining efficacy by offering once daily dosing . Oros oxybutynin chloride (oxybutynin er, ditropan xl) is an extended - release oral tablet formulation (oros) which utilizes osmotic pressure to deliver the drug at a controlled rate over 24 hours . The tablet itself consists of a semi - permeable membrane covering a drug layer which overlies an osmotically active push layer . In the gi tract, the absorption of water by this osmotically active layer results in the expulsion of the drug (which has likewise absorbed water forming a suspension) out a small opening in the membrane . Pharmacokinetic studies show that after the first dose of oxybutynin er, plasma drug concentration rises for 6 hours and then maintains a constant concentration for up to 24 hours with steady state plasma concentrations achieved by day three of treatment.18 normally, when absorbed in the upper gi tract, oxybutynin ir undergoes first pass metabolism by the cytochrome p450 system into its active metabolite n - desethyloxybutynin (ndo). This may be particularly important as ndo has been proposed to be responsible for more dry mouth than oxybutynin itself.19 however, because the oros system delays the release of oxybutynin in the er formulation, it is thought that the parent drug is not biologically available until the tablet reaches the large intestine . By this point, the drug has bypassed the upper gi s first pass metabolism system and is left to be absorbed in the colon where conversion to ndo is less likely and absorption is mainly of the parent drug itself . Biologically inert components of the tablet including the tablet itself are ultimately eliminated in the feces . The drug did show at least 40% greater decrease in urinary urge incontinence versus placebo in a 6-week trial though the results are recorded in abstract form only.20 in an early industry sponsored study anderson et al for the ditropan study group enrolled 105 patients with urge incontinence into a randomized, double blind study of dose titration to compare the efficacy and safety of controlled and immediate release oxybutynin . They concluded that both groups shared a similar rate of reductions in urge incontinence and total incontinence episodes while the oxybutynin er group reported significantly less dry mouth at 68% compared to 87% for any degree of complaint.21 another study published in the year 2000 sought to compare the efficacy and safety of oxybutynin ir as well as to determine rates of dry mouth . The authors enrolled known anticholinergic responders with seven or more urge incontinence episodes per week into a dose escalation trial of the ir and er drug forms starting at 5 mg per day and increasing to 20 mg per day as limited by intolerable side effects . They likewise found comparable rates of reduction in incontinence episodes with similar rates of dose - dependent dry mouth, but moderate to severe dry mouth was significantly less prominent in the group receiving oxybutynin er . Stratified by dosage, the greatest differences were at the 10 mg per day (8.5% for the er group vs 25.6% for the ir group) and 15 mg per day doses (19.4% for the er group vs 38.9% for the ir group) groups.22 nevertheless, the early data on direct comparisons between oxybutynin ir and er remain limited by trial design shortcomings including studying enriched populations such as known responders and reporting results on a completer basis . Some are reported only in abstract form at meetings and many are industry sponsored, thus limiting the ability to make evidence - ased conclusions of the two drug formulations . In 2005 individualized doses of oxybutynin er for urinary incontinence.23 his group combined data from three flexible - dosing studies of patients with urge urinary incontinence or mixed incontinence; two of the data sets used were from trials completed in the late 1990s on er versus ir oxybutynin while the third was from a study published in 1999 by the ditropan xl study group on evaluation of a new once - daily formulation of oxybutynin for the treatment of urge urinary incontinence.19,20,24 a total of 420 patients combined were assigned to treatment with oxybutynin er . In the combined dataset, 420 patients were assigned to treatment with oxybutynin er . Treatment began with 5 mg daily of oxybutynin er and was increased in 5-mg increments at intervals of approximately 1 week until the patient either achieved complete continence or experienced intolerable side effects . The patients remained on maxiumum dose for 2 to 12 weeks according to which study they were participating in . Of these patients, some 14% had withdrawn prior to completion of their respective trial (some 6.7% due to adverse events), leaving 368 on drug at the end of the study periods . From the pooled data, 40% of these patients achieved total dryness with 80% sustaining 70% or better improvement in incontinence at their respective doses . Dry mouth was the most prevalent adverse event, but some of the studied patients experienced only mild or no dry mouth at all . The authors made note of the fact that 7% of the patients selected the dose of 30 mg per day with only slightly higher rates of dry mouth and similar rates of treatment discontinuation due to adverse events as subjects at lower daily doses . The authors freely acknowledge the limitations of post - hoc analysis of pooled data from studies that employed varying methodologies . In addition they recognize that the three studies each contained some of the previously discussed study design flaws common to early studies of oxybutynin er versus ir, further weakening conclusions drawn in this paper.21 the next round of clinical trials involving oxybutynin mainly focused on comparison studies to other oab medications . Two large, multi - center, prospective, randomized clinical trials comparing oxybutynin er and tolterodine tartrate in oab patients stand out for their sound methodology and power relative to all other clinical trials employing oxybutynin er: the overactive bladder: judging effective control and treatment (object) study25 and the overactive bladder: performance of extended release agents (opera) trial.26 the object study was conducted between march and october 2000 at 37 us study sites with the objective to compare the efficacy and tolerability of fixed dose extended - release oxybutynin and tolterodine tartrate at 12 weeks . The study enrolled and randomized 315 women and 63 men with overactive bladder who received either oxybutynin er 10 mg daily or tolterodine tartrate 2 mg q 12 hours in a double - blind, double - dummy fashion . Trial completion was accomplished by 276 women and 56 men while a total 46 discontinued early, 29 because of adverse events (14 in the oxybutynin er and 15 in the tolterodine group). Efficacy was assessed using self (diary) reported incontinence episodes as a primary outcome measure . The diaries documented number of voids as well as number and nature of incontinence episodes . Study findings included similar tolerability and discontinuation rates as well as similar adverse event rates for both drugs . In the object study, oxybutynin er proved significantly more effective than tolterodine in reducing the mean number of weekly urge incontinence episodes at end of study as well as total incontinence episodes and total urinary frequency . Urge incontinence episodes improved from 25.6 14.7 to 6.1 9.7 for oxybutynin er and 24.1 14.5 to 7.8 11.1 for tolterodine . Total number of incontinence episodes per week decreased from 28.6 17.9 to 7.1 12 for oxybutynin er and from 27 17 to 9.3 13.4 for tolterodine . Micturitions per week decreased from 91.8 22.6 to 67.1 22.1 for oxybutynin er and from 91.6 20.2 to 71.5 20.5 for tolterodine . Both drugs significantly improved all studied outcome parameters . The authors made note of the limited applicability of 12 week results with regards to a chronic condition such as oab . They also noted that the study population was selected by specialists rather than primary care physicians who treat most oab and that study population was not racially diverse, though this is a common limitation in most oab studies . It should be noted that object compared once daily oxybutynin er to twice daily tolterodine tartrate, though this formulation of tolterodine has essentially been replaced in most cases by the once daily formulation of tolterodine which is expected to improve patient compliance . Regardless, object did compare oxybutynin er with the most widely prescribed non - generic anticholinergic medication at that time in a blinded head to head randomized clinical trial in the us.23 it must be noted that the object study was funded by alza corporation in mountain view, california, a bio - pharmaceutical company with specialization in drug delivery systems and developer of the oros drug delivery system . The authors include advisors, investigators and speakers for alza corporation as well as one employee stockholder of alza corporation . The second large multicenter trial, opera, was likewise funded by the alza corporation as well as ortho - mcneil pharmaceutical in raritan, nj, makers of oxybutynin er . Opera authors likewise disclosed relationships including: medical consultant, investigator, advisor as well as an employee and stockholder of ortho - mcneil and an employee and stockholder of azla . The opera trial sought to compare the efficacy and tolerability of extended - release formulations of both oxybutynin chloride and tolterodine tartrate in women with overactive bladder . The trial ran from november 2000 to october 2001 and pitted oxybutynin er head to head with the most prescribed once daily anticholinergic in a prospective, randomized, double - blind study conducted at 71 us centers . Us women aged 18 years or older who documented 21 to 60 episodes of urinary urge incontinence per week and an average of 10 or more voids per 24 hours were recruited . A total of 790 women were randomized to receive either 10 mg of oxybutynin er or 4 mg of tolterodine er per day . Randomized groups were similar in both demographics and severity of oab while prior treatment for oab was not an exclusion criteria . Patients kept 24-hour voiding diaries at baseline and during weeks 2, 4, 8 and 12 of treatment . Outcome measures were reduction from baseline in the number of urinary urge incontinent episodes / week, weekly total incontinence episodes and weekly micturition frequency numbers . A similar number of patients completed the study in both groups (87% for the oxybutynin er group versus 89% for the tolterodine er group .) Likewise, rates of discontinuation due to adverse events were essentially equal with 20 oxybutynin patients and 19 tolterodine er patients . There was no statistical difference in the number of weekly urge incontinent episodes at the end of study for the competing groups . After 12 weeks of treatment, the oxybutynin er group saw a reduction from a mean of 37.1 to 10.8 urge incontinent episodes per week while the tolterodine er group dropped from 36.7 to 11.2 . The oxybutynin er group performed slightly for reducing total mean number of weekly incontinent episodes and weekly micturition frequency . For total incontinent episodes per week, the oxybutynin group went from 43.4 to 12.3 and the tolterodine group from 42.4 to 13.8 . Total decrease in mean number of voids per week was 28.4 for the oxybutynin group versus 25.2 for the tolterodine group; respective means were 66.4 and 71.7 at the end of 12 weeks treatment . Slightly more patients in the oxybutynin er group reported no incontinence episodes in their final diary versus the tolterodine er group at 23% versus 16.8% completely dry . Dry mouth was more common in the oxybutynin er group at 29.7% versus 22.3% in the tolterodine group; while statistically significant, the majority of the dry mouth effects were categorized as mild (93% of oxybutynin er participants and 95% of tolterodine er participants.24 overall, the opera study shows oxybutynin er to have modestly greater efficacy than er tolterodine at its most commonly prescribed dose . The authors point out that the flexible dosing allowed for oxybutynin provides a wider range of fda approved dosages allowing individuals to balance their respective efficacy and tolerability without turning to off label dosages as would be required with tolterodine er of 4 mg daily . One obvious limitation of the opera study is its study population of women only . While women do constitute the majority of patients presenting with complaints of overactive bladder, the condition is certainly not limited to women . Some epidemiological studies would argue that the prevalence in men is nearly equal.3 in 2006, anderson et al published a post hoc analysis of data from the opera trial specifically comparing the efficacy and tolerability of oxybutynin er and tolterodine er in women with or without prior anticholinergic treatment for oab . They found that oxybutynin er was significantly more effective in reducing micturition frequency by week 12 among the population of patients with prior anti - cholinergic treatment experience . Likewise in this particular subgroup, the participants taking oxybutynin er reported a statistically significant greater chance of being incontinence free and they had a greater reduction in number of urge incontinence episodes . In contrast, the anticholinergic - naive group showed statistically equal efficacy for all study parameters with the exception of average number of micturitions per week at study completion; this parameter favored the participants taking oxybutynin er . Dry mouth was more common in the oxybutynin er study participants, but only in the group with history of prior anticholinergic treatment.27 several clinical trials address the use of oxybutynin er in special populations, including the elderly, children, and neurogenic bladder . Interestingly, while the concept that oab may contribute to male lower urinary tract symptoms has become more widely accepted28 we were unable to identify any studies in the literature focusing on oxybutynin er in the male subpopulation . Oxybutynin er is considered: pregnancy catetory b, reproduction studies in the mouse, rat, hamster and rabbit showing no definite evidence of impaired fertility or harm to animal fetus . According to the manufacturer s package insert: the safety of ditropan xl administration to women who are or may become pregnant has not been established . Therefore ditropan xl should not be given to pregnant women unless, in the judgement of the physician, the probable clinical benefits outweigh the possible hazards . It is unlikely that studies of oxybutynin in pregnant women will ever be undertaken . The elderly represent a special population in oab treatment particularly related to risk of negative effects on the cns such as cognitive impairment and memory problems . They tend to be at risk for poly - pharmacy, often taking a variety of medicines besides anticholinergics which may also have adverse effects on the cns . As the number of medications use increases, so does the risk to the older patient including problems with compliance as well as potential drug - drug interactions which can cause adverse events or alter drug efficacy.29 older patients are at risk for falls and sleep disturbances, and they often already suffer from dry mouth, dry eye, and vision problems as well as gi motility problems including constipation.30 kay et al studied the differential effects oxybutynin er versus the drug darifenacin on memory in older patients . In a multicenter, double blind study, 150 healthy individuals over the age of 60 with oab were randomized to receive oxybutynin er, darifenacin or placebo . Initial dose for oxybutynin er was 10 mg daily, and increases in 5-mg increments was permitted up to 20 mg by the end of this 3-week study . Initial dose for darifenacin was 7.5 mg each day for 2 weeks, with permitted increase to 15 mg each day for the final week . Primary outcome was the effect of each antimuscarinic versus placebo at 3 weeks on recent memory as measured by the delayed recall name - face association test . Secondary end points included delayed recall on the first - last name association test and the misplaced objects test . Results of this study showed that oxybutynin er caused significant memory deterioration, while darifenacin did not cause memory changes significantly different from placebo . While oxybutynin er may be fda approved to 30 mg daily dose, the most commonly prescribed dosage is 10 mg daily which is the same dose selected for object and opera trials . Despite this potential dosage mismatch, interval evaluation of study subjects does show a drop in measured cognitive function in the oxybutynin er group after one week even at 10 mg daily . Despite the short duration of the study, it does show that older patients with pharmacological steady state plasma levels of oxybutynin er may have an increased risk of impaired cognitive function relative to those in steady state taking darifenacin.31 contrary to the relatively high dose oxybutynin er used in previous study, lackner reported a randomized, placebo - controlled trial of the cognitive effect, safety and tolerability of 5 mg daily dosage of oxybutynin er in a population of cognitively impaired nursing home residents with urge incontinence . The authors cite that oab is undertreated in this population due to the fear that the frail older patient is more susceptible to anticholinergic associated adverse reactions . They note the lack of studies to document safety and efficacy of anticholinergics in the frail elderly population despite the high prevalence of urinary urge incontinence in particular . In this trial, 50 women aged 65 and older with urge incontinence and documented cognitive impairment were randomized to oxybutynin er versus placebo and followed closely for 4 weeks . Primary outcome measures included the confusion assessment method (cam,) an accepted, validated and widely used diagnostic algorithm to measure cognitive function . Changes in cam score from baseline were the primary outcome with presence or absence of delirium as determined by the cam . Other secondary endpoints were further standardized measurements of cognition . In short, the study showed that oxybutynin er 5 mg daily was well tolerated in elderly female nursing home patients with mild to severe dementia . There was no significant impairment in cognitive function in the treatment group by any measured outcome at any measured point in the study . There were no more withdrawals in the treatment versus placebo groups nor was there any difference in adverse events . Rates of agitation and falls were equal with 54% of the participants in both groups experiencing at least one fall during the months preceding, including and following the trial . Study limitations include the short duration, homogenous caucasian female population as well as lack of information about efficacy at this dosage.32 however, these results do contradict the guidelines of the american neurological association, the american psychiatric association and the beers criteria for potentially inappropriate medication use in older adults33 and conclusions about their use in this population remain guarded . Cns side effects do represent a cause of potential severe consequences in the elderly in particular . Current us prescribing information applying to all forms of oxybutynin states under precautions: a variety of cns effects have been reported including hallucinations, agitation, confusion and somnolence . Patients should be monitored for signs of anticholinergic cns effects, particularly in the first few months after beginning treatment or increasing the dose . It also cautions that the drug should be used with caution in patients with pre - existing dementia treated with cholin - esterase inhibitors due to risk of aggravation of symptoms and that the drug should be used with caution in the frail elderly . Children represent another highly unique special population to consider when considering drug therapy . Drug treatment of neurologically intact children with oab type symptoms generally focuses on incontinence, which can, in older children have marked effects on the child s social and psychological development and well being in addition to causing great stress and anxiety in parents . Beyond behavioral therapy and biofeedback, clinicians, parents and patients often wish to turn to drug therapy to treat oab . While studies on oab drugs in adults are limited and conflicting, only one non - randomized clinical study was identified investigating therapeutic efficacy and tolerability of oxybutynin er in children . The authors identified 86 girls and 46 boys between the ages of 5 and 18 years of age who were referred to a pediatric urology clinic with diurnal urinary incontinence and oab symptoms including urinary frequency, urgency, posturing associated with urge and/or spontaneous urinary incontinence . These children were arbitrarily assigned to receive tolterodine ir, tolterodine er or oxybutynin er based primarily on the formulary restrictions of their health care plans . Medications were started at the lowest dose available in non - liquid form (tolterodine ir and er at 2 mg, oxybutynin er 2 mg) and titrated according to response and tolerability . After thorough baseline evaluations, study nurses assessed efficacy by voiding diary and side effects on the basis of direct questioning to parents and patients . Validated instruments were not used and it appears that assessments did not occur at set, prescribed points in time . In 2003 the authors reported their retrospective analysis citing that all medications appeared well tolerated and that the er formulations of both oxybutynin and tolterodine were significantly more effective than ir tolterodine . Oxybutynin er was again significantly more effective than either formulation of tolterodine for control of daytime urinary incontinence and micturition frequency.34 while this non - randomized, non - blinded retrospective study using non - validated instruments contains serious flaws, it nevertheless represents the very small amount of literature devoted to use of oxybutynin er in children and suggests that the use of this type of medication is safe and effective in children and that oxybutynin er is at least as effective as either formulation of tolterodine . One other study focused on the use of oxybutynin er in children with neurogenic bladder (ngb). This is a distinct and important subset of patients who frequently require aggressive management of bladder issues to maximize social functionality as well as to protect renal function . While published studies as early as 1977 address the use of oxybutynin ir in this population, very little is available regarding oxybutynin er in children with ngb.35 interestingly, no studies were identified which reported specifically on use of oxybutynin er in adults with neurogenic bladder . Franco et al reported on use of three different formulations of oxybutynin in children aged 615 years of age who performed clean intermittent catheterization (cic) and who had documented neurogenic detrusor overactivity at 24 different centers in the us and europe . Sixty one patients received oxybutynin er while 28 received oxybutynin ir and 30 were treated with oxybutynin syrup . Improvement of urodynamic parameters was seen in all treatment arms as well as increased continence . Likewise all three drug formulations were well tolerated and no patient discontinued treatment due to adverse events related to oxybutynin . In contrast to other studies, constipation represented the most frequently reported adverse event in this population while dry mouth is not even listed as occurring at 5%.36 despite flaws, this report does provide some evidence for tolerability of oxybutynin er in this small but important patient population . First, one must understand the staggering financial cost of oab in modern society; estimates of dollars spent annually in the us alone run to us$12 billion.37 while non - pharmacological treatment methods may be employed, anticholinergic medications represent the mainstay of treatment for oab and drug costs contribute considerably to the overall burden of cost related to oab . However, some studies do indicate that drug therapy for oab may be associated with decreased utilization of other healthcare resources resulting in cost savings elsewhere;38 naturally, the cost of therapeutic medication for oab may offset these net savings . Considerable literature in the managed care and pharmacoeconomics literature is devoted to these issues including evaluations of oxybutynin er as a therapeutic choice for oab . The economic modeling is quite complex and unique in each case due to the regional or geographic variation with myriads of variables affecting cost of treatment and cost of disease state . One european study sought to study the cost - effectiveness of long - term pharmacological management of urge urinary incontinence using ir oxybutynin and tolterodine as well as er formulations of the two drugs in the united kingdom . The study included estimated costs of incontinence products such as pads which are often paid out of pocket in the us and often overlooked . They concluded that tolterodine ir was less cost effective than the other three drug choices.39 in contrast, two large us retrospective studies designed to determine financial cost and benefit of treatment with er formulations of oxybutynin versus tolterodine estimated healthcare costs based on reimbursement for services (hence only covered benefits) by using enormous patient databases related to us health insurers.40,41 both studies found cost savings in total reimbursement costs over one year for patients treated with tolterodine er versus oxybutynin er . Antimuscarinic agents remain a mainstay of therapy for the treatment of oab . While this medication class has proven efficacious for this condition, decreased tolerability due to antimuscarinic side effects oxybutynin has proven to be effective for the treatment of oab however antimuscarinic side effects such as dry mouth and constipation often limit patients compliance with it . The use of the oros delayed release delivery system is an excellent example of how altering the delivery of the active agent can improve oxybutynin s tolerability while still maintaining its effectiveness . This transformation has allowed oxybutynin to remain a formidable treatment option for oab despite the introduction of newer and more tissue - specific antimuscarinic agents . Oxybutynin er has clearly demonstrated its applicability in the treatment of oab and voiding dysfunction in the adult population . Oxybutynin ir has been widely used in the pediatric population for neurogenic bladder and voiding dysfunction though there are limited studies looking at the oxybutynin er formulation in children . The incidence of oab and urinary incontinence increases with age yet the use of oxybutynin in this population is cautioned due to concerns that older patients may have problems with increased side effects especially for cns, memory and cognition.
|
Celiac disease is a prevalent autoimmune disorder, with documented presence in populations of north and south america, europe, north africa, south and west asia, and australia . The symptoms of the disease are triggered in genetically susceptible individuals by ingestion of wheat and related cereal proteins of rye and barley . The ensuing innate and adaptive immune responses to the ingested proteins are responsible for inflammation, villous atrophy, and crypt hyperplasia in the small intestine, as well as the production of autoantibodies against the transglutaminase 2 (tg2) enzyme . In addition to intestinal symptoms, celiac disease may involve extra - intestinal complications . Dermatitis herpetiformis is the skin manifestation of celiac disease, affecting about 1020% of celiac disease patients and is characterized by papulovesicular lesions and presence of granular deposits of iga in the dermal papillae . Elimination of the offending cereals from diet is currently the only effective mode of treatment for celiac disease . Willem karel dicke was the first to recognize the importance of the removal of wheat and related cereals from diets of celiac disease patients in 1950 . Shortly after that, the alcohol - soluble subfraction containing the gliadin proteins was determined to contain the main toxic factor in the offending grains . Gliadin proteins were found to trigger b and t cell - mediated immune responses, which were thought to play a significant role in the inflammatory cascade in celiac disease . Antibodies against gliadin proteins were demonstrated to be closely associated with celiac disease and were widely utilized as serologic markers of the condition prior to the discovery of anti - tg2 autoantibodies . Antibodies against specific deamidated sequences of gliadin were eventually found to be more specifically associated with celiac disease than those against unmodified native gliadin . In addition to the gliadins, glutenin proteins of wheat, initially thought to be harmless, were later reported to trigger antibody and t cell immune responses in celiac disease patients . Together, gliadins and glutenins comprise approximately 70 different proteins, collectively referred to as gluten . They are the major storage proteins of wheat and related cereals, representing about 75% of the total protein content of wheat grain . The nongluten proteins comprise the remainder of the wheat proteome and include several minor storage proteins, -amylase / protease inhibitors, and a variety of other enzymes . These proteins are generally much more soluble in water or aqueous salt solutions than gluten proteins and have been historically referred to as albumins / globulins . Several nongluten proteins, including -amylase / protease inhibitor, thiol reductase, serine protease inhibitor (serpin), and -amylase have been identified as potent allergens in ige - mediated wheat allergy and/or baker s asthma . However, the nongluten proteins of wheat and related cereals generally have been considered to be nontoxic and to lack immunogenic potential in the context of celiac disease . A few studies on small numbers of patients have examined immune reactivity to crude albumin / globulin extracts in celiac disease, with divergent results . The earliest of these investigated antibody reactivities in 24 untreated celiac disease patients (but no healthy controls) by an immunodiffusion assay, reporting antibodies to gliadin in six and to a crude pbs extract of wheat flour in seven patients . A subsequently published article reported elevated igg reactivity to both gliadin and albumin / globulin protein extracts in 15 untreated celiac disease patients when compared with three normal controls, although the patients exhibited significantly lower titers of antibody to the albumin / globulin extract than to gliadin . Another report on three patients with celiac disease described increased antibodies to an extract of albumins / globulins in comparison to two controls, but the utilized extract appeared to contain gluten contamination . A study of six children with celiac disease found increased antibodies to albumin and globulin fractions in comparison to six unaffected controls, although information about the relative purity of the antigenic mixtures used in the immunoassays was not provided . In contrast, the latest of these studies with 10 celiac disease patients found no significant cellular or humoral response to the total extracts of albumins or globulins in comparison to 10 unaffected controls . The authors of this study attributed the contradiction between their and others observations to the presence of extensive gluten contamination in the earlier studies . A recently published report suggested that the nongluten -amylase / protease inhibitor proteins play a role in triggering the inflammatory response associated with celiac disease as innate immune activators through the engagement of the tlr4-md2-cd14 complex, but probably without concomitant b or t cell involvement . Apart from these specific studies, the nongluten proteins of wheat and related cereals have not been examined in the context of celiac disease, and their potential for immunogenicity remains unclear . In this study, we use high - resolution two - dimensional gel electrophoresis, immunoblotting, proteome mapping, and tandem mass spectrometry (ms / ms) to show that specific nongluten proteins of wheat trigger a robust humoral immune response in patients with celiac disease or dermatitis herpetiformis . Serum samples were from 120 individuals, including 50 patients with celiac disease (18 male, 46 white race, mean [sd] age 44.6 [17.5] years), 20 patients with dermatitis herpetiformis (11 male, 20 white race, mean age 43.1 [20.8] years), and 50 unaffected controls (20 male, 46 white race, mean age 37.1 [11.3] years). All cases of celiac disease were biopsy - proven and diagnosed according to previously described criteria . All patients with dermatitis herpetiformis had biopsies demonstrating classic histology, as well as the characteristic immunofluorescence pattern showing clear granular iga deposits in the dermal papillae . The celiac disease and dermatitis herpetiformis patients were on a gluten - containing diet . Serum samples were obtained from patients and healthy controls under institutional review board - approved protocols at columbia university and at university of utah . This study was approved by the institutional review board of columbia university medical center . Hard red spring wheat triticum aestivum butte 86 flour was suspended in 1 ml of 40% ethanol and mixed for 30 min at room temperature . The supernate was removed, chilled at 4 c for 1 h, combined with 1.9 ml of 1.5 m nacl, and stored at 4 c overnight . The precipitate was removed by centrifugation, rinsed with h2o, and dissolved in 0.2 ml of 0.1 m glacial acetic acid . The solution, containing gluten proteins, was lyophilized and stored at 20 c . Fifty milligrams of flour was suspended in 200 l of buffer (50 mm tris - hcl, 100 mm kcl, 5 mm edta, ph 7.8) at 4 c and incubated for 5 min with intermittent vortex mixing . Samples were centrifuged at 4 c for 15 min at 14,500 g. the supernate was collected, and proteins were precipitated by the addition of 4 volumes of cold (20 c) acetone . Following incubation overnight at 20 c, samples were centrifuged at 14,000 g for 15 min at 4 c . The pellet was rinsed with cold acetone, air - dried, and stored at 20 c . All patients and controls were tested for the currently recommended full panel of the most sensitive and specific serologic markers of celiac disease, including iga antibody to tg2, igg antibody to deamidated gliadin, and iga antibody to deamidated gliadin . Iga antibody to recombinant human tg2 was measured by elisa, according to the manufacturer s protocol (euroimmun ag, luebeck, germany). Igg and iga antibody reactivities to deamidated gliadin, as represented by a previously described glutamine glutamate substituted trimer of a fusion peptide containing the sequences plqpeqpfp and peqlpqfee, were measured by separate elisas, according to the manufacturer s protocols (euroimmun ag). Serum igg and iga antibodies to the gluten and nongluten protein extracts were measured separately by elisa as previously described, with some modifications . Prior to the elisa analyses, the protein profile of each extract was assessed by sds - page, using the xcell surelock mini - cell electrophoresis system, 412% nupage bis - tris precast gels, and 2-(n - morpholino)ethanesulfonic acid (mes) buffer (life technologies, carlsbad, calif . ). A 2 mg / ml stock solution of the gluten extract in 70% ethanol or the nongluten protein extract in pbs was prepared . Wells of 96-well maxisorp round - bottom polystyrene plates (nunc, roskilde, denmark) were coated with 50 l / well of a 0.01 mg / ml solution of protein extract in 0.1 m carbonate buffer (ph 9.6) or left uncoated to serve as controls . After incubation at 37 c for 1 h, all wells were washed and blocked by incubation with 1% bovine serum albumin (bsa) in pbs containing 0.05% tween-20 (pbst) for 1.5 h at room temperature . Serum samples were diluted at 1:200 for iga and at 1:800 for igg measurement, added at 50 l / well in duplicate, and incubated for 1 h. each plate contained a positive control sample from a patient with biopsy - proven celiac disease and elevated igg and iga antibodies to each protein extract . After washing, the wells were incubated with hrp - conjugated antihuman igg (ge healthcare, piscataway, n.j .) Or iga (mp biomedicals, santa ana, calif .) The plates were washed and 50 l of developing solution, containing 27 mm citric acid, 50 mm na2hpo4, 5.5 mm o - phenylenediamine, and 0.01% h2o2 (ph 5), was added to each well . After incubating the plates at room temperature for 20 min, absorbance was measured at 450 nm . Absorbance values were corrected for nonspecific binding by subtraction of the mean absorbance of the associated uncoated wells . The corrected values were first normalized according to the mean value of the positive control duplicate on each plate . The mean antibody level for the unrelated healthy control cohort was then set as 1.0 au, and all other results were normalized accordingly . The kcl - soluble proteins were separated by two - dimensional electrophoresis as previously described . Mg / ml in a solution containing 9 m urea, 4% nonidet p-40, 1% dithiothreitol, and 2% servalyt 3 - 10 iso - dalt the first dimension capillary tube gels contained 9.2 m urea, 4% (total monomer) acrylamide / bis, 2% nonidet p-40, 2% servalyt 3 - 10 iso - dalt, 0.015% ammonium persulfate, and 0.125% temed . Isoelectric focusing was performed using a mini protean ii tube cell (bio - rad, hercules, calif . ). Eighteen micrograms of protein was loaded for gels that were to be coomassie - stained for visualization of the separated proteins, while 3.6 g of protein was loaded for gels that were to be used for subsequent transfer and immunoblotting . Proteins were separated in the second dimension by sds polyacrylamide gel electrophoresis, using the xcell surelock mini - cell electrophoresis system, 412% nupage bis - tris precast gels, and mes buffer . Protein transfer onto nitrocellulose membranes was carried out with the iblot dry blotting system (life technologies). The membranes were incubated for 1 h in a blocking solution made of 5% milk and 0.5% bsa in a solution of tris - buffered saline containing 0.05% tween-20 (tbst). Incubation with patient and control serum specimens (1:2000 for iga and 1:4000 for igg determination in dilution buffer containing 10% blocking solution and 10% fetal bovine serum in tbst) was done for 1 h. serum samples from celiac disease (n = 14) and dermatitis herpetiformis (n = 6) patients with elevated iga and/or igg antibody reactivity to nongluten proteins, in addition to 5 healthy controls, were included . Detection of bound antibodies was by the ecl system (millipore, billerica, mass .) And autoradiography film (crystalgen, commack, n.y . ). Following immunodetection, bound antibodies were removed from the nitrocellulose membranes with restore western blot stripping buffer (thermo scientific, rockford, ill . ), and the membrane proteins were visualized using colloidal gold stain (bio - rad). Each immunoblot was aligned to its corresponding colloidal gold - stained membrane using the samespots software (version 4.5) (totallab ltd . Proteins in the two - dimensional electrophoresis spots that were the main targets of the antibody response were identified initially by comparison to a previously generated proteomic map of butte 86 flour . Spots were excised from gels and placed in wells of a 96-well reaction plate, leaving a blank well between each sample . Proteins in each sample - well were reduced, alkylated, and then digested with trypsin using a digestpro instrument (intavis, koeln, germany) according to the manufacturer s instructions . The resulting tryptic peptides were eluted into a collection tray that was then placed into the autosampler compartment of an easy - nlc ii (thermo scientific, waltham, mass .) That was interfaced by a nanoelectrospray source to an orbitrap elite mass spectrometer (thermo scientific). Four microliter fractions were loaded by the autosampler onto an integrafrit trap column (100 m 200 mm, with 5 m, 120, reprosil - pur c18 aq packing) (new objective, woburn, mass . ), washed with 20 l of solvent a to remove salts, then switched in - line with the analytical column (75 m 10 cm of 3 m, 120, reprosil - pur c18 aq packing) (new objective) and eluted with a gradient of 100% solvent a to 30% solvent b over 30 min into the orbitrap elite mass spectrometer . Solvent a was water and solvent b was acetonitrile, both optima lc / ms grade, containing 0.1% formic acid (thermo scientific). Peptides were detected in the orbitrap with the ft survey scan set to scan a range from 300 to 2000 m / z at a resolution of 60,000 . The 10 most intense peaks were automatically subjected to collision - induced dissociation (cid). The mass range for the cid scans was set to high and the minimal signal threshold to 10,000 . Dynamic exclusion with a repeat count of 1 was enabled for a duration of 10 s. normalized collision energy was set to 35 . Processing of raw files to mascot generic format (mgf) files was carried out using msconvert from the proteowizard open - source project [http://proteowizard.sourceforge.net/downloads.shtml]. A first pass search of the ms / ms spectra was conducted against the superwheat database (version #140828). For this study, the superwheat database (version #100211) described in dupont et al . Was updated with ncbi triticeae (taxid: 147389) protein sequences (download date: 08/28/2014) as well as with the translated sequences of 137 ests, contigs, or pcr products from butte 86 (supplemental file 1). Mascot version 2.3 [www.matrixscience.com] and x! Tandem version 2010.12.01.1 [http://www.thegpm.org/tandem/] were used to match instrument - generated spectra to fasta sequences in the superwheat database . For the first and second pass search, the parent mass tolerance was set to 15 ppm and the fragment error to 0.4 da . Charge state screening allowed + 1, + 2, and + 3 charge states to be selected, and one missed cleavage was allowed . Analysis, validation, and display of the data were carried out using scaffold version 4.3.2 [http://www.proteomesoftware.com]. The output results files from the two different search engines were combined in individual folders and analyzed as separate mudpit experiments . A second database of fasta files was generated from the first pass search by exporting from scaffold all proteins that contained one peptide hit and had a protein probability of 20% and peptide probability of 0% . A reverse - concatenated database was created from these sequences . The resulting subset database, containing 14,776 sequences, was used for the second pass search . Criteria for protein acceptance in the second pass search was set in the scaffold validation software package to a protein probability of 99% and a requirement for four matching peptides having a parent peptide mass accuracy of 2 ppm and a calculated 95% probability . The list of proteins identified in each spot is shown in supplemental file 2 . The protein with the greatest number of exclusive unique spectra sequence coverages determined by scaffold were adjusted for the presence of the signal peptides as predicted by signalp 4.1 [http://www.cbs.dtu.dk/services/signalp/]. The data files associated with this study were archived at ucsd center for computational mass spectrometry in the massive data set project . The raw mass spectrum files, the sequence database files, and the scaffold results report can be downloaded from ftp://msv000078887:a@massive.ucsd.edu/. In order to visualize scaffold report results, a free viewer can be downloaded from http://www.proteomesoftware.com/products/free-viewer . To visualize the instrument raw files, the cdnas encoding the identified serpin protein in spot 1a (gi: 224589270) and the purinin protein in spot 2a (bu_purinin#3) (table 2) were synthesized (after codon optimization for an e. coli expression system) based on amino acid sequences shown in supplemental file 4 . For the purinin, a potential signal peptide cleavage site was detected at position 19 and amino acids 119 were therefore excluded . The synthesized genes were inserted between the restriction sites ndei and hindiii of the tag - free vector e3 to create the e. coli expression vectors e3 - 224589270 and e3-bu_purinin#3 . Linearized vectors were transformed into e. coli, and protein expression was induced by adding 100 mm isopropyl -d-1-thiogalactopyranoside to the culture for 4 h at 37 c . Cells were lysed in lysis buffer (50 mm tris, 1 mm pmsf, ph 8.0), and inclusion bodies, containing insoluble proteins, were collected for purification . After washing (50 mm tris, 1% triton x-100, 300 mm nacl, 2 mm dtt, 1 mm edta, ph 8.0), pellets were dissolved in 8 m urea . The purified proteins were suspended in refolding buffer (50 mm tris, 10% glycerol, 150 mm nacl, ph 8.0). The molecular weight and relative purity of the proteins were assessed by sds - page, following the above protocol . The identity of each protein was confirmed by mass spectrometry - assisted peptide mass mapping, as previously explained . Antibody reactivity to the generated recombinant serpin and purinin proteins was assessed by immunoblotting . Recombinant proteins (0.2 g) were separated by sds - page and transferred onto nitrocellulose membrane . Detection of bound hrp - conjugated secondary antibodies was by ecl and the fluorochem m imaging system (protein simple, santa clara, calif . ). Differences between groups were analyzed by parametric or nonparametric one - way analysis of variance (anova) with posthoc testing for multiple comparisons . Statistical analyses were performed with prism 6 (graphpad, san diego, calif . ). Iga antibody to tg2 and igg / iga antibodies to deamidated gliadin, which are considered to be highly specific and sensitive for celiac disease, were measured in all patients and controls . Celiac disease and dermatitis herpetiformis groups displayed significantly higher mean levels of iga anti - tg2 antibody (figure 1a), iga antideamidated gliadin antibody (figure 1b), and igg antideamidated gliadin antibody (figure 1b) than those of healthy controls (p <0.0001 for all comparisons). Mean levels of antibody to (a) human tg2 (iga) and (b) deamidated gliadin fusion peptide (iga and igg) in patients with celiac disease and dermatitis herpetiformis in comparison with unaffected controls, as determined by elisa . The gel electrophoresis profiles of the gluten and nongluten protein extracts used for the elisa analyses are shown in figure 2a . Levels of iga and igg class antibodies to the extracted gluten and nongluten protein fractions were measured in all patients and controls . Compared with healthy controls, the two patient groups displayed significantly higher mean levels of iga (p <0.0001 for celiac disease; p <0.001 for dermatitis herpetiformis) and igg (p <0.0001 for both) antibody to gluten proteins (figure 2b). In addition, compared with healthy controls, the celiac disease and dermatitis herpetiformis patient cohorts exhibited significantly increased serum iga (p <0.0001 for both) and igg (p <0.0001 for both) antibody reactivity to the proteins of the nongluten extract (figure 2c). (a) gel electrophoresis profile of the butte 86 protein preparations used for the antibody assays: (1) gluten extract (5 g) and (2) nongluten protein extract (5 g). Molecular weight markers, shown to the left of the panel, are in kda . (b, c) comparison of mean levels of iga and igg antibodies to gluten (b) and nongluten (c) proteins in patients with celiac disease or dermatitis herpetiformis in comparison with unaffected controls, as determined by elisa . Error bars represent the standard error of the mean . In order to identify the molecular targets of the detected increased antibody response to nongluten proteins in celiac disease and dermatitis herpetiformis patients, a randomly selected subset of antibody - positive sera was further analyzed . Antibody reactivity was characterized by immunoblotting following two - dimensional separation of the nongluten proteins of the wheat cultivar butte 86 . The two - dimensional electrophoresis pattern of the nongluten proteins following coomassie staining is shown in figure 3a . The immunoblotting analyses demonstrated antibody reactivity to specific nongluten proteins of wheat in 19 of 20 analyzed patient sera . These included 10 of 11 celiac disease and 2 of 3 dermatitis herpetiformis samples tested for iga reactivity, and 9 of 9 celiac disease and 6 of 6 dermatitis herpetiformis samples tested for igg reactivity . None of the control sera exhibited antibody binding to any proteins at the dilutions and exposures tested . (a) pattern of proteins of the nongluten extract after separation by two - dimensional gel electrophoresis and coomassie staining . Proteins in five groups, shown in boxes, were found to be the main nongluten antigen targets of the antibody response: serpins, purinins, -amylase / protease inhibitors, globulins, and farinins . (b e) immunoblots showing serum antibody reactivity to the two - dimensionally separated proteins in representative patients and healthy controls: (b) igg reactivity to serpins, purinins, -amylase / protease inhibitors, globulins, and farinins in a patient with celiac disease; (c) igg reactivity to serpins, purinins, and -amylase / protease inhibitors in a patient with celiac disease; (d) igg reactivity to serpins and globulins in a patient with dermatitis herpetiformis; (e) iga reactivity to serpins and farinins in a patient with dermatitis herpetiformis; (f) igg and (g) iga reactivity in healthy controls, indicating lack of binding to nongluten proteins . Molecular weight markers (in kda) proteins within five regions of the two - dimensional gels reacted with patient sera (figure 3). Comparison of the positions of the reactive proteins with a proteomic map of butte 86 flour suggested that the reactive proteins belonged to the following distinct protein groups: serpins, purinins, -amylase / protease inhibitors, globulins, and farinins (figure 3 and table 1). Identities of proteins in individual spots that reacted with sera were verified by ms / ms using an orbitrap elite mass spectrometer and subsequent database search . Peptide data for the predominant protein in each spot are displayed in supplemental file 3, along with the sequence coverage of each protein . Supplemental file 4 contains the amino acid sequences of the identified target proteins from table 2 . Because of the sensitivity of the instrument, the analysis indicated that most spots contained multiple proteins (supplemental file 2). However, the majority of the spectra obtained from each spot corresponded to a specific protein that was deemed the predominant protein in the spot (table 2 and supplemental files 2 and 3). The ms / ms data confirmed the presence of the five protein types that had been initially identified through comparison of spot positions with the proteomic map of butte 86 flour . For spots 2c and 2d, the ms / ms data indicated that the spots contained purinin proteins (bu_purinin#1 and bu_purinin#2) (supplemental files 2 and 3 and table 2), even though nonpurinin type proteins in those spots had the highest exclusive unique spectrum count . Five distinct protein groups were identified as the main targets of the antibody response through comparison of the positions of the reactive proteins with a proteomic map of butte 86 flour: serpins, purinins, -amylase / protease inhibitors, globulins, and farinins . Numbers refer to the specific immunoreactive protein groups, as marked in figure 3a . Number of sera found to have igg and/or iga antibody reactivity to spots in each protein type group, as described in the materials and methods section . Protein in each spot for which the highest number of exclusive unique spectra were obtained . Protein sequences derived from the translation of butte 86 ests or contigs are indicated by protein sequences derived from the translation of contigs from harvest 1.14 est assembly [http://harvest.ucr.edu/] are indicated by sequences of all identified proteins in the table are provided in supplemental file 4 . Number of sera found to have igg and/or iga antibody reactivity to each protein spot, as described in the materials and methods section . Ms / ms data indicate that the spot also contains a purinin, bu_purinin #1 (supplemental files 2 and 3). Ms / ms data indicate that the spot also contains a purinin, bu_purinin #2 (supplemental files 2 and 3). In this spot, a similar number of exclusive unique spectra were obtained for globulin-2, bu_globulin-2_contig_18428, but a greater number of total spectra were obtained for bu_purinin #3 (supplemental files 2 and 3). Description of results according to patient group is presented in tables 1 and 2 . Patients were most frequently reactive to serpins (75% of tested celiac disease and dermatitis herpetiformis patient samples), followed by purinins (65%), -amylase / protease inhibitors (60%), globulins (40%), and farinins (35%). The most frequently reactive individual protein spot was identified as a serpin (spot 1a in figure 3a; gi: 224589270) (table 2). Fifteen of the 20 patients (75%) and none of the controls exhibited antibody reactivity to this protein spot . Within the purinin group, the most reactive spot (2a) was identified as bu_purinin #3; 10 of 20 patients (50%) displayed antibody reactivity to it . Frequencies of reactivity to the identified proteins did not appear to be substantially different between the celiac disease and dermatitis herpetiformis groups . In order to further confirm the presence of antibody reactivity to selected nongluten antigens identified in this study, we generated proteins by recombinant expression based on the available amino acid sequences for the serpin in spot 1a and the purinin in spot 2a . Immunoblotting with the recombinant proteins confirmed the presence of igg and/or iga antibody reactivity to the specific serpin and purinin proteins in patients with celiac disease or dermatitis herpetiformis who had been found to be positive for antibodies to spot 1a and/or spot 2a (figure 4). Healthy controls did not display any reactivity at the serum dilutions and image acquisition exposures used . Serum antibody reactivity to a recombinant serpin, representing spot 1a (gi: 224589270), and a recombinant purinin representing spot 2a (bu_purinin #3). (a) sds - page profile of the purified recombinant serpin (lane 1) and purinin (lane 2) proteins, following coomassie staining . (b e) immunoblotting with the recombinant proteins, demonstrating iga (b, d) and igg (c, e) antibody reactivity to serpin (b, c) and purinin (d, e). Lanes 1 and 2 correspond to sera from two representative patients, while lanes 3 and 4 represent sera from two healthy controls . Molecular weight markers are shown to the left of each panel (in kda). Heightened adaptive immune response to ingested gluten proteins of wheat and related cereals is a hallmark of celiac disease . A few earlier studies, carried out on small numbers of celiac disease patients, had attempted to assess immune reactivity to nongluten proteins of wheat . However, the results were inconsistent, and the purity of the antigenic mixture in the crude nongluten protein extracts used for detecting immune reactivity was later questioned . Here, we have demonstrated the presence of a robust humoral response to specific nongluten proteins of wheat in patients with celiac disease and dermatitis herpetiformis . The detailed analysis of antibody reactivity through two - dimensional immunoblotting and ms / ms identification of target proteins provides unequivocal confirmation that the main targets of the antibody response are, in fact, specific proteins that have not been categorized as gluten or previously recognized as triggers of humoral response in celiac disease . Wheat serpin proteins belong to the large family of serine protease inhibitors that are present in many organisms, most of them acting as suicide substrate inhibitors of chymotrypsin - like proteases . Other nongluten target antigens of wheat included purinin, -amylase / protease inhibitor, globulin, and farinin proteins . The mechanism responsible for generating antibodies against proteins that are generally thought of as nontoxic in the context of celiac disease is not clear . The elevated antibody reactivity to nongluten proteins may be driven by the enhanced inflammatory environment in the gut, brought on by the villous damage and ensuing epithelial barrier dysfunction that are triggered by gluten in celiac disease . However, it should be noted that we did not detect antibodies against a broad array of nongluten proteins . For example, no antibody reactivity to triticin proteins, which are present at similar or higher concentration in wheat flour as serpins, globulins, farinins, and purinins, was found . Also, serpins make up a substantially lower percentage of total protein content of butte 86 flour than the -amylase / protease inhibitors but were a more frequent target of patient antibody response . Therefore, the elevated antibody reactivity to nongluten proteins appears to be directed at a rather specific set of antigens . Another possibility is that the peripheral antibody response to gluten proteins in celiac disease may cross - react with specific nongluten antigens that contain similar epitopes, thus contributing to the detected levels of antibodies against nongluten proteins . A homology analysis indicates that the newly named purinin proteins are close in sequence to -gliadins . In addition, there are short sequences in the identified -amylase / protease inhibitors and another newly characterized group of proteins, the farinins, which are similar to those in certain -gliadin and low molecular weight glutenin proteins . In addition, the reactive centers of some of the identified serpin antigens resemble the glutamine - rich repeats in gluten proteins . Whether these particular shared sequences are actually immunogenic and capable of contributing to the presence of cross - reactive antibodies the observed increase in iga and igg antibody responses to specific nongluten proteins brings up the obvious question of whether the identified immune response might be relevant to the pathogenic mechanism of celiac disease . Similar to gluten proteins, serpins and -amylase / protease inhibitors are resistant to proteolytic digestion and are therefore likely to be present in the form of long stretches of incompletely digested, and potentially immunogenic, sequences in the small intestine . The observed iga, along with igg, reactivity to the identified nongluten proteins points to a mucosal origin for the immune - triggering event . However, it remains to be seen whether the mucosal b cell response is accompanied by a corresponding intestinal cd4 t cell reactivity to the nongluten proteins . Presence of lamina propria cd4 t cells with specificity for sequences of the identified nongluten proteins may contribute to the celiac disease - associated pathways in the gut, for example, by providing additional help to the autoreactive cd8 intraepithelial cytotoxic t cells that drive epithelial cell damage . It is also possible that the detected antibodies to nongluten proteins would themselves contribute to the mucosal lesion . Similar to the effect shown for antigluten antibodies, the antibodies against the nongluten proteins may be involved in inducing local complement activation and mucosal damage . They may also contribute to recruitment of various leukocytes that lead to antibody - dependent cell - mediated cytotoxicity, a process that has been previously demonstrated for antibodies to gluten . However, the observed immune response to nongluten proteins, as was mentioned earlier, may be the result and a bystander marker of intestinal barrier damage and inflammation, without playing a role in the pathogenic mechanism of celiac disease . In conclusion, the results of this study clearly demonstrate that the humoral response to wheat in celiac disease is not limited to gluten antigens but is also directed at specific nongluten proteins . While direct conclusions cannot be drawn about the pathogenic effects of the identified nongluten proteins, these findings should prompt further research into their potential role in contributing to the inflammatory processes that result in mucosal damage in patients with celiac disease . The possibility of such a role for these proteins is worthy of attention, especially as therapies other than gluten exclusion from the diet are under development . For example, proteolytic enzymes with specificity for the toxic fragments of gluten, may be insufficiently active against other immunogenic proteins . In addition, further investigation of the utility of the identified antibodies as potential biomarkers in celiac disease or other gluten - related disorders may be warranted.
|
According to the world health organization, resistance to antibiotics is the biggest challenge in drug development . There is a need not for one new antibiotic substance but several, so these can be combined and strengthen the human position in the fight against bacterial resistance (kaplan and laing 2004). Bacterial pathogens have a variety of mechanisms that contribute to their ability to colonize and cause disease in human hosts (staskawicz et al . It is well known that the virulence of a microbe, i.e. Its ability to infect, is correlated with its ability to adhere to tissue, and, in particular, to its capability to withstand forces from rinsing flows (ofek et al . Some bacteria mediate adhesion by use of long attachment organelles, also referred to as fimbriae or pili . P pili, a prototype helix - like pili, are produced by uropathogenic escherichia coli (upec) strains and are predominantly associated with kidney infection (pyelonephritis) (sauer et al . 2000). The rod of p pili consists of more than a thousand papa subunits, assembled into a helical right - handed structure with 3.3 subunits per turn (gong and makowski 1992; bullitt and makowski 1995), ending in a linear tip structure that anchors the papg adhesin at the distal end (jacob - dubuisson et al . 1993; kuehn et al . As is further alluded to below, the ability of such attached bacteria to withstand forces caused by rinsing flows is not only given by the properties of the adhesin receptor interactions, but is also strongly affected by the biomechanical properties of these organelles (duncan et al . It has been found that the compliance of helix - like pili (i.e. Their response to force), and thus their ability to assist in the adhesion process, depends strongly on the quaternary structure of the pilus . These pili have an intricate and extraordinary force versus elongation response that consists of a combination of a constant elongation force (in the so - called region ii), originating from sequential uncoiling of the helix - like structure, and a sigmoidal pseudo - elastic response (region iii), caused by a conformational change of the head - to - tail interaction between the subunits of pili that takes place in a random order (jass et al . 2007, 2008; bjrnham et al . 2008; axner et al . 2009). These extraordinary biomechanical properties, primarily those of region ii, which enable significant elongation of pili length [more than five times the original length for p pili (jass et al . 2004)] under a constant force, and the fact that the uncoiling is fully reversible (fllman et al . 2005), have been regarded as being of special importance to the ability of a piliated bacterium to remain attached to the host tissue (despite being exposed to a substantial external force) by redistributing an external shear force among a multitude of pili (bjrnham et al . 2008). Presumably, they are a major reason why the ability of attached bacteria to withstand forces caused by urine flow is strongly affected by the properties of the pili shaft per se (duncan et al . This implies that the pilus rod and the tip - associated adhesin are both important in the ability of bacteria to withstand strong rinsing forces (bjrnham and axner 2009). During recent decades for example, fimbrial tip - mediated and shear - dependent adhesion (le trong et al . 2010) and a shear - enhanced adhesion mechanism (whitfield et al . Inhibitors targeting the adhesion process, i.e. Carbohydrate derived competitive inhibitors for adhesin receptor interactions, have been developed (wellens et al . 2008; salminen et al . 2007; ohlsson et al . 2002; krogfelt et al . 1990). In addition to this ligand - based approach, several bicyclic 2-pyridones, referred to as pilicides, have been rationally designed to prevent pili formation . It has been suggested that pilicides inhibit the chaperone usher interaction, thus preventing the essential event in which the n - terminus of the usher (a membrane protein involved in the pili assembly) recognizes and binds to incoming chaperone subunit complexes (pinkner et al . These pilicides can efficiently inhibit pili biogenesis without affecting bacterial growth (berg et al . 2006; pinkner et al . 2006; cegelski et al . 2009; chorell et al . 2010). In contrast, so far, the pili rod has not been used as a target for antibiotics . In this work we investigated whether it is possible to affect the biomechanical properties of helix - like pili by using a substance that can bind to an elongated pilus at the single organelle level, primarily compromising the uncoiling recoiling process . We show, by use of force - measuring optical tweezers (fmot), that the biomechanical compliance of p pili can be impaired without breaking the backbone of the pilus . Thus, the pili rod can be regarded as a new target for novel drug candidates combating uropathogenic bacterial infections . The escherichia coli (e. coli) strain used was hb101/ppap5, which is a clone carrying the wild type pap gene cluster from upec strain j96 (lindberg et al . 1a . Because it has previously been found that study of fewer pili per bacterium enhances the ability to capture a single organelle for force measurements, a pilicide, a substituted ring - fused 2-pyridone (bibc10, fig . 1b), referred to as pilicide 1 by berg and almqvist (2007), was used to chemically manipulate the number of pili expressed per bacterial cell . For pilicide concentrations below that required for total inhibition of pili, the bacteria express fewer pili, in a concentration - dependent manner, although with the same biomechanical properties as for untreated bacteria (berg et al . Bacteria were therefore cultured on trypticase soy agar (tsa; becton dickinson, nj, usa), supplemented with 50 g / ml carbenicillin (duchefa biochemie, limhamn, sweden) in the presence of 2.2 mm pilicide at 37c overnight . To remove pilicide possibly present on the surface of the bacteria, the bacteria were washed three times by dilution (20,000-fold) with dulbecco s phosphate - buffered saline (dpbs, 10 mm phosphate, 130 mm nacl, ph 7.0, sigma - aldrich, schnelldorf, germany) just before use in force measurements . Expression of pili was confirmed by atomic - force microscopy (afm) imaging as described elsewhere (berg and almqvist 2007). A typical bacterium cultured on a plate containing 2.2 mm pilicide 1 is shown in the afm micrograph in fig . 1afm micrographs of hb101/ppap5 cells expressing p pili: a bacterium cultured under normal conditions, b chemical structure of pilicide 1, c bacterium cultured on a plate containing 2.2 mm pilicide afm micrographs of hb101/ppap5 cells expressing p pili: a bacterium cultured under normal conditions, b chemical structure of pilicide 1, c bacterium cultured on a plate containing 2.2 mm pilicide papd and fimc, periplasmic chaperones from e. coli, were expressed and purified as described elsewhere (lindberg et al . Bovine serum albumin (bsa) and insulin - like growth factor binding protein-5 (igfbp-5; both from sigma - aldrich) were used as controls of the papd specific inhibitory effect . These proteins were separated by spinning for 12 min at 14,000g at room temperature using a microcon centrifugal filter device (millipore, solna, sweden) in a hermle z200 m / h centrifuge . Polyacrylamide gel electrophoresis (sds - page; acrylamide - bis (50:1); biorad laboratories, hercules, ca, usa), stained by pageblue protein staining solution (fermentas international, helsingborg, sweden). Polymeric microspheres (9.7 m, duke scientific, palo alto, ca, usa) were immobilized by heating a droplet of suspension at 60c for 1 h on microscope cover slips (vwr, stockholm, sweden) and functionalized with 0.01% poly - l - lysine (sigma - aldrich, stockholm, sweden). On top of these spheres, samples containing bacteria, papd (1.4, 2.8 and 11.3 m), or control proteins (2.8 m), and 3.0-m polymeric microspheres (duke scientific) were applied in a total volume of 10 l . A string of high - vacuum grease (dow corning, midland, mi, usa) around the sample and a second cover slip were used to protect the sample against evaporation . Force measurements were performed by use of optical tweezers, as described elsewhere (fllman et al . Briefly, a free - floating bacterium was trapped at low power by use of a focused laser beam and attached to a poly - l - lysine - coated bead fixed on the cover slip . A small bead (3.0 m) was then captured and the trap was calibrated by use of the power spectrum method in order to determine the stiffness of the trap (fllman et al . Thereafter, the trapped bead was moved back and forth close to the bacterium until pili attached to it . Data acquisition was started and the piezo - stage automatically set in motion, at an elongation speed of 0.1 m / s, in order to separate the bacterium from the small bead . If several pili were initially attached to the trapped bead, the separation was repeated so pili detached from the bead until a single pilus remained . The escherichia coli (e. coli) strain used was hb101/ppap5, which is a clone carrying the wild type pap gene cluster from upec strain j96 (lindberg et al . 1a . Because it has previously been found that study of fewer pili per bacterium enhances the ability to capture a single organelle for force measurements, a pilicide, a substituted ring - fused 2-pyridone (bibc10, fig . 1b), referred to as pilicide 1 by berg and almqvist (2007), was used to chemically manipulate the number of pili expressed per bacterial cell . For pilicide concentrations below that required for total inhibition of pili, the bacteria express fewer pili, in a concentration - dependent manner, although with the same biomechanical properties as for untreated bacteria (berg et al . Bacteria were therefore cultured on trypticase soy agar (tsa; becton dickinson, nj, usa), supplemented with 50 g / ml carbenicillin (duchefa biochemie, limhamn, sweden) in the presence of 2.2 mm pilicide at 37c overnight . To remove pilicide possibly present on the surface of the bacteria, the bacteria were washed three times by dilution (20,000-fold) with dulbecco s phosphate - buffered saline (dpbs, 10 mm phosphate, 130 mm nacl, ph 7.0, sigma - aldrich, schnelldorf, germany) just before use in force measurements . Expression of pili was confirmed by atomic - force microscopy (afm) imaging as described elsewhere (berg and almqvist 2007). A typical bacterium cultured on a plate containing 2.2 mm pilicide 1 is shown in the afm micrograph in fig . 1afm micrographs of hb101/ppap5 cells expressing p pili: a bacterium cultured under normal conditions, b chemical structure of pilicide 1, c bacterium cultured on a plate containing 2.2 mm pilicide afm micrographs of hb101/ppap5 cells expressing p pili: a bacterium cultured under normal conditions, b chemical structure of pilicide 1, c bacterium cultured on a plate containing 2.2 mm pilicide papd and fimc, periplasmic chaperones from e. coli, were expressed and purified as described elsewhere (lindberg et al . Bovine serum albumin (bsa) and insulin - like growth factor binding protein-5 (igfbp-5; both from sigma - aldrich) were used as controls of the papd specific inhibitory effect . These proteins were separated by spinning for 12 min at 14,000g at room temperature using a microcon centrifugal filter device (millipore, solna, sweden) in a hermle z200 m / h centrifuge . Polyacrylamide gel electrophoresis (sds - page; acrylamide - bis (50:1); biorad laboratories, hercules, ca, usa), stained by pageblue protein staining solution (fermentas international, helsingborg, sweden). Polymeric microspheres (9.7 m, duke scientific, palo alto, ca, usa) were immobilized by heating a droplet of suspension at 60c for 1 h on microscope cover slips (vwr, stockholm, sweden) and functionalized with 0.01% poly - l - lysine (sigma - aldrich, stockholm, sweden). On top of these spheres, samples containing bacteria, papd (1.4, 2.8 and 11.3 m), or control proteins (2.8 m), and 3.0-m polymeric microspheres (duke scientific) were applied in a total volume of 10 l . A string of high - vacuum grease (dow corning, midland, mi, usa) around the sample and a second cover slip were used to protect the sample against evaporation . Force measurements were performed by use of optical tweezers, as described elsewhere (fllman et al . Briefly, a free - floating bacterium was trapped at low power by use of a focused laser beam and attached to a poly - l - lysine - coated bead fixed on the cover slip . A small bead (3.0 m) was then captured and the trap was calibrated by use of the power spectrum method in order to determine the stiffness of the trap (fllman et al . Thereafter, the trapped bead was moved back and forth close to the bacterium until pili attached to it . Data acquisition was started and the piezo - stage automatically set in motion, at an elongation speed of 0.1 m / s, in order to separate the bacterium from the small bead . If several pili were initially attached to the trapped bead, the separation was repeated so pili detached from the bead until a single pilus remained . Fmot have previously been used for characterization of the biomechanical properties of several different types of pili (andersson et al . 2011), so the compliance of various types of pili is well known . A typical force versus elongation curve for p the data show that a helix - like pilus has a force versus elongation response that can be seen as composed of three regions (andersson et al . 2force versus elongation response of a single p pilus elongated at a speed of 0.1 m / s . The characteristic elongation regions i, ii, and iii are marked force versus elongation response of a single p pilus elongated at a speed of 0.1 m / s . The characteristic elongation regions i, ii, and iii are marked region i is a short region, of little relevance to this study, in which the entire pilus is elongated elastically with no conformational change . In region ii, elongation originating from sequential breaking of the turn - to - turn [tt; previously referred to as layer - to - layer (andersson et al . 2006b)] interactions of the quaternary structure of the pilus occurs at constant force; this is often referred to as an uncoiling of the pilus rod . The breaking of interactions in this region is sequential, caused by the fact that each turn of the quaternary structure of pili consists of ~3 subunits, each of which interacts with a corresponding subunit in the neighboring turn . Hence, each turn interacts with the subsequent turn via ~3 subunits, each of which experiences a fraction (~1/3) of the force to which the pilus is exposed . The interaction connecting the outermost unit in the folded part of the rod, on the other hand, experiences the entire force . This implies that, during elongation, breaking of the tt interactions occurs sequentially, which gives rise to a force plateau . For sufficiently low elongation velocities, p pili have been found to uncoil at a force of 28 pn (jass et al . 2004; fllman et al . 2005). For higher velocities, above the so called corner frequency, the uncoiling force increases logarithmically with elongation velocity . Moreover, inasmuch as each tt interaction can open and close a number of times, uncoiling of the helix - like structure has been found to be fully reversible, which, in turn, implies that the pili can rapidly and automatically contract after being unfolded by an external force (fllman et al . 2005). As was alluded to above, these unique biomechanical properties [together with the fact that the uncoiling process of the rod is assumed to reduce the persistence length of the pili substantially, from being similar to the length of the pili, as demonstrated for type 3 pili of klebsiella pneumoniae (chen et al . 2011), to a fraction of it] provide bacteria with extraordinary ability to redistribute an external shear force along several attachment organelles in such a way that no single pilus will experience a substantially greater force than the others; this is beneficial for the ability of a bacterium to sustain substantial rinsing flows . To investigate the possibility of compromising the biomechanical properties of p pili, primarily by reducing the force within region ii of the force versus elongation curve, we used papd, the chaperone involved in the biogenesis of p pili in vivo, as a test substance . The mechanism of assembly of different types of pili has been well studied (vetsch et al . 2006; sauer et al . 1999; remaut et al . 2006; rose et al . 2008), and it is known that papd is responsible for folding of the subunits and for their transport to the usher for assembly of p pili (barnhart et al . Thus, in the formed pili the binding site of papd to pili subunits, in what is known from the donor strand exchange mechanism, is already occupied by the neighboring subunit . However, the crystal structure of a protein complex consisting of two papa molecules interacting with each other via donor strand complementation suggests that the papd molecule can still interact with this type of complex (verger et al . 3overall 3d structure of the papd / papa / papa complex (pdb i d 2uy6): papd (blue), donor strand complemented (dsc) papa (purple), and donor strand exchanged (dce) papa (green) are shown in ribbon representation with -stands as arrows and -helixes indicated as cylinders . The f--stand of papd (amino acids 107113) is indicated by an arrow, as is the c - terminal -stand of dscpapa (amino acids 152162) overall 3d structure of the papd / papa / papa complex (pdb i d 2uy6): papd (blue), donor strand complemented (dsc) papa (purple), and donor strand exchanged (dce) papa (green) are shown in ribbon representation with -stands as arrows and -helixes indicated as cylinders . The f--stand of papd (amino acids 107113) is indicated by an arrow, as is the c - terminal -stand of dscpapa (amino acids 152162) the donor strand complemented papa subunit is drawn in purple and referred to as dscpapa . The nte of this unit is inserted into the donor strand exchanged papa subunit, which, according to the donor strand complementation mechanism, is referred to as dsepapa, which is drawn in green . Beside the well - documented donor strand complementation between the two papa subunits, an additional presumptive interaction has been observed in the papa / papa / papd complex . The c - terminal -strand of dscpapa and the f--strand of the papd [amino acids 107113 (holmgren and branden 1989)] are located in close proximity and can probably interact with each other (indicated by black arrows in fig . Possible interaction with papa subunits in the pili rod led to the choice of papd as the test molecule for this proof - of - principle demonstration of compromise of the biomechanical properties of the pili rod in this work . 2, helix - like pili have a unique and complex force versus elongation response . Normally, a single pilus has a characteristic force plateau in the force versus elongation response (region ii) that is flat and repeatable (which originates from sequential uncoiling of the tt interactions in the helix), whereas region iii has a sigmoidal shape (which originates from entropy - driven transitions of the head - to - tail bonds opening and closing in random order) (jass et al . 2004; fllman et al . During retraction, and for sufficiently low elongation and retraction speeds, the response is fully reversible [with the exception of a dip in the transition from region iii to ii, which is considered to be caused by the lack of a nucleation kernel for formation of the first turn of the quaternary structure during contraction (axner et al . 2006a, 2009; lugmaier et al . 2008)]. To assess the effect of papd on the compliance of the pilus rod, force versus elongation data were collected from eight series of seven replicate elongations and retractions of p pili in the presence of different concentrations of papd and control proteins . It was found that in the presence of papd, the force versus elongation data and the contraction response of p pili were altered markedly . As can be seen in fig . 4, which shows a typical force versus contraction response after the first elongation in the presence of papd at three different concentrations, the recoiling forces of p pili at 1.4 m (violet line) and 2.8 m (green line) of papd were slightly lower than when no papd was present (red line) and contained a number of recurring dips.fig . 4transition from region iii to ii during retraction of a single p pilus in the presence of papd at different concentrations . In samples with no or a low concentration of papd, contraction from an elongation of approximately 2.7 m takes place in region ii, indicating recoiling, whereas in the sample with 11.3 m papd, the force decreases towards zero monotonically (which is reached for an elongation of approximately 1.6 m), indicating no recoiling transition from region iii to ii during retraction of a single p pilus in the presence of papd at different concentrations . In samples with no or a low concentration of papd, contraction from an elongation of approximately 2.7 m takes place in region ii, indicating recoiling, whereas in the sample with 11.3 m papd, the force decreases towards zero monotonically (which is reached for an elongation of approximately 1.6 m), indicating no recoiling when a higher concentration of papd was used (5.6 m, black line, and 11.3 m, blue line) the recoiling force dropped drastically . At 11.3 m papd the force went monotonically to zero with no characteristic plateau . At 5.6 m papd did not completely impair the recoiling of p pili, but the recoiling force was lower than for additions of 1.4 and 2.8 m papd . Numerical analysis of the recoiling process during the first half of the plateau in region ii (from 2.7 to 1.2 m in fig . 4) resulted in recoiling forces of 29 0.7, 25 0.8, 23 1.3, 17 1.4, and 5.5 2.2 pn for 0, 1.4, 2.8, 5.6, and 11.3 m papd, respectively (expressed as the mean standard error of the mean (sem), n = 8). This indicates that papd significantly affects the retraction properties of the rod, suggesting that papd interacts with papa subunits in the uncoiled pili by inhibiting the ability of the latter to form tt interactions, thus preventing the pili from recoiling and contracting . This implies that in the presence of the highest papd concentration the pilus lost virtually all of its compliance . Also the uncoiling force for subsequent uncoilings was found to be affected by the presence of papd . For the lowest papd concentrations, the uncoiling force decreased with the number of elongations . Figure 5a shows seven repeated uncoilings of the same pilus in the presence of 2.8 m papd . In addition, from the characteristic appearance (with a plateau) during the first uncoiling (red curve), for repeated elongations, the uncoiling curve gradually deteriorated; the plateau became shorter and the force curve transformed to a sigmoidal shape, as is illustrated by the blue curve (the seventh recoiling).fig . 5a seven successive elongations of a single p pilus in the presence of 2.8 m papd . Whereas the response from the first elongation has the conventional plateau, indicative of sequential uncoiling, a sigmoid like response was observed for subsequent elongations, indicating the presence of entropy, which in turn originates from stochastic (non - sequential) opening of the tt - bonds . D force versus elongation curves for a single p pilus in the presence of 2.8 m bsa, fimc, and igfbp-5 respectively . Elongation of the pilus was stopped when the pilus had become fully uncoiled and the elongation had proceeded into region iii; this was followed by retraction, giving rise to a recoiling of the pilus . This procedure was repeated seven times on the same pilus a seven successive elongations of a single p pilus in the presence of 2.8 m papd . Whereas the response from the first elongation has the conventional plateau, indicative of sequential uncoiling, a sigmoid like response was observed for subsequent elongations, indicating the presence of entropy, which in turn originates from stochastic (non - sequential) opening of the tt - bonds . B d force versus elongation curves for a single p pilus in the presence of 2.8 m bsa, fimc, and igfbp-5 respectively . Elongation of the pilus was stopped when the pilus had become fully uncoiled and the elongation had proceeded into region iii; this was followed by retraction, giving rise to a recoiling of the pilus . This procedure was repeated seven times on the same pilus the results from analysis of the uncoiling force (the force plateau) in the presence of papd and control proteins and the shortening of the plateau are summarized in table 1, in which each entry represents the average of eight series of seven uncoiling cycles . Because pili length can vary, the lengths of the force plateaus were normalized to that of the first elongation in each set of measurements . Any normalized length below unity thus indicates shortening of region ii.table 1uncoiling forces in the presence of 2.8 m papd and control proteins during seven repeated elongations, and the relative lengths of the force plateau compared with the length of the plateau during the first elongation cycle (mean sem, n = 8)cycleforceplateau, pnrelative length of the plateaupapdcontrolpapdcontrol128 1.428 0.311228 1.830 0.50.83 0.061327 1.828 0.50.61 0.051426 1.828 0.40.56 0.031522 1.127 0.30.44 0.041621 1.426 0.30.44 0.041720 1.427 0.40.39 0.061 uncoiling forces in the presence of 2.8 m papd and control proteins during seven repeated elongations, and the relative lengths of the force plateau compared with the length of the plateau during the first elongation cycle (mean sem, n = 8) the sigmoidal shape signifies the occurrence of entropic processes, which indicates that the tt interactions can open and close in a random order . This suggests that consecutive turns in the helical structure of the pilus rod no longer interact with each other via multiple tt interactions per turn, which is the underlying cause of the sequential unfolding of the quaternary structure; it reveals that the turns, instead, interact by a single tt interaction per turn, which then enables opening of the helix - like coil in a random order, caused by blocking of the tt interactions by papd . 5a, the form of the elongation curves is not fully sigmoidal; instead they often have a plateau (or a slightly sloping plateau) in their center . This originates from sequential opening of tt interactions from the part of the pilus in which the consecutive turns still bind by several interactions . The relative length of the plateau, given in table 1, thus represents how large a fraction of all the turns of the pili can still bind by multiple tt interactions . Conversely, the complementary length, i.e. One minus the relative length, indicates how large a fraction of all the turns bind solely by a single tt interaction . Table 1 indicates that the number of turns that bind solely by a single tt interaction increased as a function of the number of elongation retraction cycles the pilus was exposed to . After three elongation retraction cycles (i.e. For the 4th elongation) under the prevailing conditions, approximately half of the turns interacted with their neighboring turns by one tt interaction only . After six elongation retraction cycles (i.e. For the 7th elongation) most, approximately 60%, of the turns bound solely by one tt interaction . This is in agreement with the assumption that the binding of papd is cumulative . A similar change in the shape of the response with the number of elongations was observed during the recoiling process (data not shown). Moreover, the number of dips in the force versus contraction plot was found to increase with the number of elongations . Spontaneous dips in the recoiling curves have been observed previously and attributed to spontaneous miscoilings (andersson et al . In addition, the effect of repeated elongations for low papd concentrations was comparable that of a single elongation at a higher papd concentration . This implies that the effect of papd increased cumulatively with both the concentration of papd and the number of elongations (the latter is illustrated by the data presented in table 1). Furthermore, it was found that papd only affected linearized (stretched or uncoiled) pili; the first uncoiling curve in a series of elongations was always unaffected by its presence, even after an hour of exposure of unstretched (coiled) pili to papd . The fact that papd only bound to papa units when the rod had been uncoiled indicates that it exclusively binds to the inner parts of the helix - like rod, e.g. As was indicated by fig . In addition, the cumulative effect indicates that the interaction between papd and uncoiled p pili is strong enough for papd to remain bound to the pili during repeated elongation and retraction cycles . To verify the recoiling inhibiting effect of papd, bsa, igfbp-5, and fimc the molecular weight of igfbp-5 is similar to that of papd but with a secondary structure that is dissimilar to that of papd . Bsa has another secondary structure and a molecular weight that is almost twice that of papd (hung et al . The third control protein, fimc, is a chaperone that is involved in the biogenesis of type 1 pili in e. coli in the same way as papd mediates the biogenesis of p pili . Fimc has 50% amino acid sequence homology with papd, and the two proteins have similar 3d structures and molecular weights (jones et al . 1993). As can be seen by comparison of a single pilus in the presence and absence of 2.8 m control proteins (fig . 2), it was found that subsequent elongation of p pili was only very slightly affected by the presence of control proteins . It was, moreover, found that, in the presence of these control proteins, the force versus extension / contraction response of p pili remained virtually unchanged after the first elongation in a series of seven repeated elongations (table 1), the number of dips in the recoiling curves was found to be similar during the first and the last extension cycles indicating that the effect of control proteins is weaker than that of papd and not cumulative . A much higher concentration of control proteins (11.3 m) resulted in detectable disturbances of the recoiling process occasional dips in the recoiling curves resulting in a temporary reduction in uncoiling force . However, the uncoiling force reverted to the normal level during repeated elongations (data not shown). A schematic illustration of the recoiling inhibitor mechanism from a single bacterium that bind by two helix - like pili is shown in fig . 6 . To mimic the effect of mechanical stress of urine flow in vivo the six horizontal panel pairs (16) represent a series of consecutive flow conditions: no flow (panel pair 1), high flow (2), low flow (3), and high flow (illustrated by three panel pairs, 46). The high and low flow conditions represent cases where the force to which the bacterium is exposed, ftot, is slightly larger than twice the uncoiling force (fuc) and slightly smaller than the uncoiling force, i.e. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{tot}}> 2f_{\text{uc}} $$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{tot}} <f_{\text{uc}} $$\end{document}, respectively . The low flow condition (3) can even represent a case with no flow . The first and the second columns of the panels represent pili in the absence and presence of recoiling inhibitor, respectively.fig . 6schematic illustration of the recoiling inhibitor mechanism on helix - like pili . A bacterium is attached to the host tissue by two identical pili adhering by specific adhesin the helix - like pili are depicted as springs, with their length approximately representing their degree of elongation . The arrows indicate the force each pilus sustains schematic illustration of the recoiling inhibitor mechanism on helix - like pili . A bacterium is attached to the host tissue by two identical pili adhering by specific adhesin the helix - like pili are depicted as springs, with their length approximately representing their degree of elongation . The arrows indicate the force each pilus sustains in the absence of flow, the bacterium is initially attached by both pili, neither of them elongated (panels a1 and b1). When the bacterium is exposed to a shear flow, it will rotate (as is indicated in the subsequent panels), so the uppermost pili will be elongated the most . For high flow conditions (panels a2 and b2) as long as they do so, the two pili will take up the same force, half of the force to which they are exposed, i.e. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{upper}} = f_{\text{lower}} = f_{\text{tot}} /2 $$\end{document}, which is a force that the specific adhesin receptor interaction is presumed to be able to withstand for a substantial time (longer than the force exposure time), so the bacterium will remain attached . In the absence of a recoiling inhibitor (the first column), when the flow decreases (panel a3) the two pili will retract until both have contracted into region i. during subsequent elongation (panels a4a6), the two pili will again elongate into region ii in a manner similar to that in panel a2, i.e. By sharing the force equally, i.e. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{upper}} = f_{\text{lower}} = f_{\text{tot}} /2 $$\end{document}, which is a force the specific adhesin receptor interaction can withstand for the duration of the force exposure, so the bacterium will stay attached . When a recoiling inhibitor is present (the second column), on the other hand, the compliance of the pili will be compromised as a result of linearization of the pilus (panel b2). However, there will be no indication of this during the first elongation cycle (because the recoiling inhibitor only attaches to the uncoiled part of the pilus); the reduced compliance will affect the force response solely during subsequent refolding, and more so for the pilus that has been extended the most, which here is assumed to be the upper one (because this has enabled binding of more of the recoiling inhibitor). Under the simplified assumption that the upper pilus loses most of its compliance, as was the case for the highest concentrations of papd in fig . 4, whereas the lower one is affected less, the upper pilus will take significantly less force than the lower (in the limiting case when it has lost all of its compliance, it will take no force, whereas the lower one will take all, i.e. \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{upper}} \approx 0 $$\end{document} whereas \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{lower}} \approx f_{\text{tot}} $$\end{document}) and so will retract less than the lower pilus during the subsequent low flow exposure (panel b3). Under the condition that \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{tot}} <f_{\text{uc}} $$\end{document}, the lower pilus will retract all the way to region i. when the bacterium is again exposed to a higher flow, the upper pilus will take virtually no force (because of its compromised compliance), whereby the lower one will sustain virtually all of the force (panel b4). This implies that the adhesin receptor bond of the lower pilus will be exposed to a significantly larger force, close to ftot (> 2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f_{\text{uc}} $$\end{document}), which is a force at which the adhesin receptor bond will rapidly break (panel b5). When this pilus has detached, the upper pilus will be exposed to the entire force, and this hence, in the presence of a coilicide, the bacterium becomes detached from the host tissue . Taken together, our findings suggest that the presence of a substance that can bind to the inner parts of an elongated helix - like pilus as a coilicide should also affect the attachment lifetime of piliated bacteria exposed to urinary flows . As is schematically indicated in fig . (by the six pairs of panels that illustrate different consecutive flow conditions), for a bacterium that becomes attached to a host surface with multiple pili (in this case illustrated by two pili), a force that is slightly larger than twice the pili uncoiling force will, in the absence of any coilicide (depicted by the left column of panels), be distributed fairly evenly among the two pili (exactly evenly as long as both pili elongate slowly in region ii), also for a multitude of subsequent elongations and retraction cycles (a2a4). As has been discussed previously (bjrnham and axner 2009), this provides the bacteria with a capability to distribute an external force among a mulitude of pili, which implies they can withstand strong rinsing flows, which, in turn, facilitates adherence and colonization processes critical for virulence . However, as can be seen by a comparison of the two columns of fig . 6, in which the second column illustrates the response of a bacterium in the presence of a coilicide, the situation changes drastically when the bacterium is exposed to a coilicide . Although the first elongation (panel b2) is identical to that without papd present (panel a2), subsequent recoiling will be compromised (as is schematically indicated for one of the two pili in panel b3). When a coilicide binds permanently to the inner parts of the helix - like rod, subsequent elongation will be affected . Because one of the pili has lost its compliance, this pilus can no longer withstand substantial force, the other (less compromised, or non - compromised) pilus will be exposed to most of the force (panel b4). This implies that adhesin at the tip of this pilus will be exposed to a significantly larger force, so it will rapidly become detached from its receptor [under the condition it is attached by a slip bond (bjrnham and axner 2009)], which in turn quickly leads to detachment of the entire bacterium (panels b5b6). In this study, we have investigated whether it is possible to compromise the compliance of helix - like pili by the use of a so - called coilicide . The test substance in this work was papd, because it has been found to bind to the inner parts of a linearized helix - form p pili rod . The experiments showed that although the first uncoiling of a given pilus was not affected by the substance investigated, subsequent uncoiling and recoiling (i.e. After the first elongation - and - contraction cycle of the pili) were affected by the presence of papd . Moreover, use of control substances showed that this effect was obtained specifically in the presence of papd (and not in the presence of the different tested control proteins). At the highest papd concentration used the recoiling force dropped to zero, implying the pilus lost all ability to contract, which in turn affected subsequent elongations . At lower papd concentrations, the plateau during elongations that constitutes region ii was transformed into a sigmoidal response, similar to the response of region iii, which indicates that elongation in region ii was predominantly governed by entropic processes, indicative of a bond opening / closure process that takes place in a randomized order . This behavior suggests that the consecutive turns of subunits no longer form a multitude of parallel interactions . Our results also show that papd can affect the pilus response even at low concentrations (a single pilus consists of ~1,000 papa subunits and, for the papd concentrations used in this work the estimated number of papd molecules per single pilus is only a few). All this indicates that the presence of papd can significantly affect the compliance of p pili and that it can do so even at low concentrations . It has thus been demonstrated that the biomechanical properties of helix - like pili can be compromised by a coilicide . It is our expectation that this can be demonstrated also with other types of substance than papd and that coilicides can be found for other types of pili also; because different kinds of helix - like pili have a similar uncoiling mechanism, it is therefore feasible that one can affect many other types pili in a similar manner . The results of this study thus provide a new strategy in the search for novel antibacterial drugs small synthetic molecules that can compromise the biomechanical properties of bacterial pili . In contrast to previously known pilicides that inhibit the chaperone usher interaction during pili biogenesis, it is proposed the coilicides inhibit the uncoiling / recoiling process of already assembled and surface - located pili . If the ability of bacteria to redistribute external shear forces is compromised, they will no longer be able to resist urine flow, and they will, therefore, presumably be swiftly removed from the host . It is possible that a substance with pili - compliance - compromising ability either can serve as an alternative to existing antibiotics in the future or can be part of a broader strategy, also including substances that can compromise other parts of the adhesion process . This study also demonstrates that fmot is not only a technique useful for redistribution of micrometer - sized objects and force measurements, but also for active manipulation of individual macromolecules, serving as an important tool in the search for novel anti - virulence targets, for example the inner parts of helix - like pili.
|
Breast cancer is the most frequently diagnosed cancer in women and is associated with substantial morbidity and mortality . Breast cancer is a heterogeneous disease with different subtypes that are based upon the expression level of estrogen receptor (er), progesterone receptor (pr), and her-2/neu receptor (her-2). Triple - negative breast cancers (tnbc), are breast tumors characterized by lack of expression of estrogen (er), progesterone (pr), and her2neu receptors and comprise 15% of all breast cancers . Most tnbc have a basal - like molecular phenotype by gene expression profiling [2, 3]. Tnbc also shares clinical and pathologic features with hereditary brca1-related breast cancers including lack of er / pr and her2neu, presence of p53 mutation, basal gene expression patterns, and brca1 inactivation by either mutation or pathway dysfunction [46]. Most of these tumors are high grade or poorly differentiated tumors [7, 8]. Tnbc has been shown to be associated with a poorer prognosis compared to receptor positive breast cancer subtype . Tnbc is not responsive to hormonal therapies such as tamoxifen and aromatase inhibitors nor to inhibitors of her-2 such as trastuzumab . Whether the poorer outcome with tnbc is the result of the loss of these therapeutic options or is the result of a more aggressive tumor biology or both is unknown . African - american women have higher breast cancer death rates compared to caucasian women, despite having a lower incidence of breast cancer . Based on the 20012005 data from the louisiana tumor registry, breast cancer mortality was 25.3% for caucasian females and 40.9% for african - american females . Some investigators believe that socioeconomic factors play a significant role in breast cancer disparities, while others speculate that it is the biologic differences that play a central role in outcome disparities . Tnbc has been demonstrated to be more prevalent among young african - american females when compared to caucasian women and is the basis for the argument in favor of biology as the culprit for breast cancer disparities . However, many of these studies do not adequately control for socioeconomic status (ses). Possibly related to ses is the observation that african american women are less likely to be diagnosed at an early stage when treatment can improve survival . Additional other potentially ses - related factors that may contribute to the survival difference include unequal access to medical care, health insurance status, treatment noncompliance, and socioeconomic status . Louisiana state university health sciences center in shreveport (lsuhsc - s) is a public hospital and is unique in that the majority of the patients treated are uninsured or receive medicaid and are of low socioeconomic status . We have previously demonstrated that at lsuhsc - s overall survival of breast cancer patients is similar between african - american and caucasian women when controlled for ses . However, this study did not specifically evaluate whether such parity of outcome occurred in the subset of patients with tnbc . Our current study is aimed to address the following question: among patients with tnbc who are of similar socioeconomic status and given equal access to medical care, does the survival disparity between the racial / ethnic groups still exist? Briefly, patients with stage 0 to 3 breast cancer who were treated before october 2008 were accrued and analyzed . Of the 803 breast cancer patients in the database, we excluded 17 patients because of the patients belonging to other ethnicities (hispanics or asians) or having incomplete data . Of the remaining 786 patients, 468 patients were african - americans and 318 patients were caucasians . Triple - negative breast cancers (tnbcs) are defined as tumors that lack estrogen, progesterone, and her-2 expressions . The majority of patients (~90%) were treated at fwcc / lsuhsc - s and the remaining patients were treated at a safety - net hospital, the ea conway hospital, a sister public hospital managed by lsuhsc - s . The american joint committee on cancer (ajcc) 6th edition was used to stage patients . Two society - of - surgical - oncology-(sso) fellowship trained surgical oncologists performed the surgeries at fwcc / lsuhsc - s . Three general surgeons, each of whom had more than 10 years of surgical experience, performed surgeries at e. a. conway hospital . A weekly multidisciplinary tumor board conference was held to discuss all breast cancer cases performed for the previous week . Discussion of care of patients treated at e. a. conway was conducted via telemedicine conferencing . Attendants of the weekly tumor board included a myriad of specialists (surgical oncologists, medical oncologists, radiation oncologists, radiologists, geneticists, residents, fellows, nurses, researchers, coordinators, and educators). All patients were offered standard treatment protocols for adjuvant and neoadjuvant chemotherapy and radiation therapy . Definitive surgeries included either breast conservation therapy (bct, lumpectomy with tumor - free margin, sentinel lymph node dissection and/or axillary lymph node dissection, and breast irradiation) or a mastectomy (axillary lymph node dissection in select cases). After bct, fractionated megavoltage external beam irradiation (encompassing the whole breast) to a total dose of 50 gy/25 fractions was administered using tangential treatment portals; the supraclavicular area is irradiated (to the same total dose) when indicated (i.e., presence of disease to four or more axillary lymph nodes). Adjuvant systemic chemotherapy was offered and administered as indicated per current standard of care . Patient follow - up consisted of a history and physical examination every 3 months for 3 years, every 6 months for years 4 and 5, and annually thereafter . A chest x - ray, mammogram, complete blood count, and liver function tests were obtained annually . Clinical data were accrued and recorded prospectively and included age at diagnosis, comorbid conditions, stage of disease, treatment protocol, surveillance protocol compliance, cancer recurrence, and death . Socioeconomic statuses were assigned to each patient based on two sources: the internal revenue service 2001 zip - code - based income tract and the lsu hospital computer service database . These sources did not differ between the two racial / ethnic groups and the data were not combined across methods . The internal revenue service 2001 zip - code based income tract reports income as median annual income (mai) per zip code stratified into quintiles based on ten thousand dollar increments . If the percentage of patients falls within 1% of either stratification group, the average of both groups was used to estimate the mai . Because the 2001 tax year approximates the middle of dates of surgery for our patient population our hospital computer services database was used to link patients' financial code with their names, medical record numbers, initial dates of diagnosis, and icd-9 diagnosis code 174.0174.9 . These financial codes were then used to stratify patients into the following subsets: commercial insurance, medicare, medicaid, or indigent / free care . Because this database only tracks patients for the past 7 years the impact of race / ethnicity on the outcome of patients with tnbc breast cancers was assessed by comparing outcomes between caucasian and african - american women . Asian and hispanic women comprised less than 5 patients in our large database and therefore were excluded from analysis . Clinical outcomes were then compared to five reports on outcome for patients with tnbc (table 4) [1, 8, 1416]. The chi - square test was used to analyze categorical data, and the independent samples t - test was used to compare means . Disease - free survival (dfs) was calculated from the date of surgery to the date of first recurrence (local or distant) or date of last follow - up . Overall survival (os) was calculated from the date of surgery to the date of death from any cause or date of last follow - up . The kaplan - meier survival method and the log - rank test were used to generate and compare survival curves . The cox proportional hazard regression model was used to perform multivariate analyses . Risk ratios and 95% confidence intervals (ci) were calculated from the model . There were 138 african - american women (68%) and 64 caucasian women (32%) with tnbc representing 29% (138/468) of the african - american women and 20% (64/318) of the total number of caucasian women in our database . The mean age at diagnosis was 54 years for african - american women and 60 years for caucasian women (p = 0.38), and the mean follow - up time was 52.8 months . The median annual income by zipcode for the entire group of patients with tnbc was $16,577 (range, $15,367 to $36,788). The median annual income was $16,493 (range: $15,367 to $36,772) for african - american women and was $16,667 (range: $15,795 to $36,787) for caucasian women . The differences between the median incomes were statistically significant (p <0.001) although the magnitude of such differences does not appear to be clinically relevant . All patients resided within geographical areas with reported median annual incomes of $40,000 or less, and approximately 90% (181/202) were in areas with a reported median annual income of less than or equal to $30,000 . The financial data at the time of diagnosis indicated no difference in the percent of patients with commercial insurance, medicare, medicaid, or free care (table 1). Of all the clinicopathologic parameters examined, only tumor grade (p = 0.04), type of definitive operation (p = 0.01), and median annual income (p <0.001) were significantly different between the two racial / ethnic groups . Mean age at diagnosis (p = 0.38), mean tumor size (p = 0.35), tumor size distribution (p = 0.25), nodal distribution (p = 0.50), stage distribution (p = 0.31), receipt of adjuvant therapy (p = 0.33), and financial class distribution (p = 0.69) were not significantly different between the two racial / ethnic groups (table 1). Overall, locoregional recurrences occurred in 13.8% (28 of 202 patients) of patients . The locoregional recurrence rate for african - american women was 20% (13/64) for caucasian women (p = 0.08). Additionally, 41/202 (20.3%) of the entire tnbc cohort died by the time of last follow - up (december 2009) with a mortality rate of 20% (28/138) for african - american women and 20% (13/64) for caucasian women (p = 0.85). To discern the impact of race / ethnicity on the outcome for patients with tnbc, we evaluated os and dfs between african - american and caucasian women (figures 1 and 2). In our previous studies, we demonstrated that neither os nor dfs was significantly different between the two racial / ethnic groups, specifically in a large cohort of 786 patients with stage 03 breast cancers and a cohort of 375 patients with er - negative tumors . Within the er - negative tumors, we were able to identify a significant proportion of patients to have tnbc (54%). Similar to our previous findings, in the subgroup of women with tnbc, we found no statistically significant difference in dfs or os between the two racial / ethnic groups . 50% for caucasian women; the median dfs was 99 months for african - american women and 60 months for caucasian women (p = 0.16) (figure 1). 72% for caucasian women; the median os was 138 months for african - american women and 64 months for caucasian women (p = 0.95) (figure 2). The cox proportional hazard model was used to compare race / ethnicity, age at diagnosis, tumor grade, median income, t - stage, and n - stage for risk of cancer recurrence and overall survival (tables 2 and 3). Note that although race / ethnicity was an independent predictor for dfs (p = 0.027), it was not an independent predictor for os (p = 0.98). Clinical independent predictors for dfs were t - stage (p = 0.001) and n - stage (p = 0.05). Only n - stage (p = 0.01) was an independent predictor for os . Suboptimal results run the risk of masking any potential significant differences in outcomes between african - american women and caucasian women . Therefore, we compared our outcomes for women with tnbc with outcomes reported in the literature [1, 8, 1416]. In selected published series, the 5-year os rate ranges from 59.6% to 80% and the 5-year dfs rate ranges from 30.8% to 72% . African - american women have a lower incidence of breast cancer but a higher breast cancer mortality rate when compared to caucasian women [1719]. While some investigators attribute it to differences in income and social status, which affect access to and receipt of treatment, others accredit it to racial / ethnic differences in tumor biology and responsiveness to treatment [1012, 14, 17, 18, 2023]. Race / ethnicity as an independent predictor of survival in breast cancer has been reported in several studies, although most do not adequately control for socioeconomic status (ses) and/or tumor subtype (i.e., tnbc). In our initial study of 786 patients with operable breast cancer (stage 0iii), we demonstrated that race / ethnicity had no impact on outcome when equal access was rendered, regardless of patients' financial statuses . In that study, outcomes at lsuhsc - s rivaled those reported by the national cancer data base (ncdb). These results were achieved in a population that has historically been associated with poorer outcomes; over two - thirds of our patients were classified as having either medicaid or free care and the median annual income for both groups was less than $17,000 . A potential confounder of the above study was an imbalance of the different breast cancer subtypes between african - american and caucasian women . We noted that african - american women had a significantly higher proportion of er - negative tumors than caucasian women . To address this, we separately evaluated outcomes for 375 patients with er - negative breast cancers to determine whether there was disparity between the two racial / ethnic groups . However, similar to the results of our initial study, we found that there were no significant differences in breast cancer mortality rates between african - american and caucasian women who had er - negative tumors . Again, these results were achieved in a relatively homogenous cohort of patients with low ses . One of the limitations of our er - negative study was that it did not delineate the proportion of patients who had tnbc . Tnbc is used by clinicians in reference to the basal - like subtype of breast cancer although only 85% of tnbcs are basal - like . Numerous studies have shown that tnbc is associated with a decreased overall survival when compared to receptor - positive tumors and that tnbc is more prevalent among african american women . This fact has popularly been thought of as being one of the major contributors of disparity in outcomes between african - american women and caucasian women . However, our results demonstrated that even within the tnbc cohorts race / ethnicity had no impact on outcome . These results were obtained despite african - american women having had a significantly higher tumor grade than caucasian women (grade 3 = 68% versus 51%; p = 0.04) and that tnbc was more predominant among african - american women than caucasian women . The principle that race / ethnicity should have no impact on outcome for patients with tnbc was further reinforced by a study by dawood et al . . In this study of nearly 500 patients who were treated with primary systemic chemotherapy followed by definitive surgery, neither pathologic complete response rates (pcr) nor survival outcomes differ between the two racial / ethnic groups . The five - year overall survival rate for all breast cancer subtypes is approximately 89% and this rate drops precipitously for patients with tnbc (77% to 80%) [1, 16]. What is unique about our cohort is that we were able to control for socioeconomic status and receipt of systemic therapy, thus eliminating any potential socioeconomic biases . Based on our previous and current data and findings, we can conclude that disparity in survival between african - american females and caucasian females can be mitigated when all patients are provided with the same standard of care breast cancer treatment . This paradigm seems to be applicable for wide variety of breast cancer, including those with tnbc . In addition, our data do not support the idea of biological differences in tumor subtypes between caucasian and african - americans . The higher proportion of younger african - americans developing tnbcs compared with caucasians may still contribute to the overall worse outcomes, even though the responses to treatment are similar.
|
Study area, blood sampling and elisa test: this study was conducted on 117 japanese black cattle (bos taurus) production farms located in the cities of kawaminami and tsuno, miyazaki prefecture, japan (fig . 1). In this area, many of cattle were fed by loose housing system . From august 2013 to august 2014, a total of 1,823 blood samples were collected from all the breeding cattle and heifers in each farm using evacuated blood collection tubes containing edta . All blood samples were centrifuged (1,500 g, 5 min), and the plasma was used for blv enzyme - linked immunosorbent assay (elisa) tests (jnc co., ltd ., tokyo, japan), according to manufacturer s instruction with modification . We confirmed that the detection sensitivities of this elisa tests using plasma and serum as sample are comparable (data not shown). Dna extraction and viral load quantification by real - time pcr analysis: out of 1,823 blood samples, genomic dna was extracted from 88 seropositive samples . Quantitative real - time pcr analyses were performed using an applied biosystems 7300 real - time pcr system (applied biosystems, foster city, ca, u.s.a . ). Blv pol and bola - dra sequence - specific primers were used to quantify proviral loads in infected cattle . The amplifications were performed in 10-l reaction volumes containing 5 l of sybr premix dimereraser (takara bio inc ., otsu, japan), 0.1 l of rox reference dye, 0.3 l of primers (3 pmol each), 1 l of a template dna sample (50 ng each) and pcr - grade water . The specificity of the pcr products was confirmed by amplicon melting - curve analyses . The relative numbers of proviral and bola - dra copies were calculated using the comparative threshold cycle method . Proviral loads were calculated as the relative number of proviral copies divided by half the relative number of bola - dra copies and represented as the number of proviral copies per 100 cells . To avoid pcr amplification failure due to viral nucleotide variations in the pol primer region, we also amplified the blv ltr region using the primers ltr256 and ltr453 . Sequencing and phylogenetic analysis of the blv gp51 env gene: pcr amplification of the full - length blv gp51 env gene was performed in 10-l reaction volumes containing 1 l of 10x ex taq buffer, 0.8 l of dntp mix, 0.05 l of takara ex taq (takara bio inc . ), 0.5 l of primers (5 pmol each), 1 l of template dna sample (50 ng each) and pcr - grade water . Primers for blv gp51 full f (5-caa tcg tcg gtg gct agg ac-3) and blv gp51 full r (5-gag gtg agt ctc tga tgg cta ag-3) were used to amplify the gp51 env gene . The amplified fragments were treated with illustra exoprostar (ge healthcare life sciences, buckinghamshire, u.k .) According to the manufacturer s instructions . The sequencing reactions were performed using one of the primers listed above together with a bigdye terminator v3.1 cycle sequencing kit (applied biosystems), purified using a bigdye xterminator purification kit (applied biosystems) and analyzed with an applied biosystems 3730 dna analyzer . An alignment of the full - length blv gp51 env gene (906 bp) and a phylogenetic tree were constructed using mega6 software . A phylogenetic tree was constructed using the neighbor - joining method based on kimura s two - parameter model . The seroprevalences of blv infection among cattle in kawaminami and tsuno were 3.0% (31/1013) and 7.0% (57/810), respectively (table 1table 1.the seroprevalence of blv infection in the cities of kawaminami and tsunocitynumber (no .) Of infected /examinedcattle (%) farms (%) kawaminami31/1013 (3.0)6/65 (9.2)tsuno57/810 (7.0)8/52 (15.3)total88/1823 (4.8)14/117 (11.9)). The seroprevalence of blv - positive farms in these cities was 9.2% (6/65) and 15.3% (8/52), respectively . The seroprevalence of blv in both cities extremely varied among farms (2.1100%) (table 2table 2.the seroprevalence and genotype of blv in infected farmsfarm idblv seroprevalence(infected /examined)blv genotypesubgenotype(accession no. )t992.1% (4/195)ii-6 (lc007981)i-9 (lc007984)i-16 (lc007991)k1103.7% (1/27)ii-8 (lc007983)k84.0% (1/25)ii-3 (lc007995)t494.5% (1/22)--t6110.0% (1/10)ii-11 (lc007986)t5314.3% (1/7)ii-15 (lc007990)t8320.0% (1/5)ii-5 (lc007980)k2921.4% (3/14)iii- (lc007993)t6934.9% (29/83)ii-1 (lc007977)i-4 (lc007979)i-7 (lc007982)t11852.0% (13/25)ii-7 (lc007982)i-17 (lc007992)k9452.6% (10/19)ii-1 (lc007977)i-13 (lc007994)k10052.9% (9/17)ii-2 (lc007978)t4258.3% (7/12)ii-10 (lc007985)i-14 (lc007989)k18100% (7/7)ii-12 (lc007987)). Although blv infection was not found in many small size farms, the average seroprevalence at the blv infected farms in small size farms was higher than in large and middle size farms (table 3table 3.the relationship between farm size and blv seroprevalencefarm size (no . Seroprevalence at positive farms (%) farmscattlefarms (%) cattle (%) <20896327.84.540.220502362821.74.117.5>50656333.35.811.8). Genotypes i and iii were identified in this study, and genotype i accounted for 94% (17/18) of isolates . We classified genotype i into 17 subgenotypes depending on a phylogenetic tree analysis (fig . 2.a phylogenetic tree analysis of blv isolates based on full - length gp51 env gene sequences and the viral loads in infected cattle . Blv isolates are represented by the ids of the infected cattle and the affected farm . The reference strains are represented by genbank accession numbers, together with the country of isolation . Subgenotypes are indicated by roman and arabic numerals with underline, and genotypes are indicated by roman numeral . Triangle shapes indicate the subgenotypes observed in only one cattle infected in this study . Out of 88 seropositive cattle, 11 were negative for pcr detection and not included for phylogenic analysis . Bootstrap support values (> 80% in 1,000 replications) are shown for key nodes only . ). Only 13 subgenotypes of blv spread in each farm, and most blv isolates were genetically different from farm to farm (table 2). However, the same subgenotypes were isolated from 2 farms (subgenotype i-1 was found on t69 and k94, and i-7 was found on t69 and t118). These farms were geographically separated, and there was no interaction among the personnel of these farms . To understand the horizontal transmission occurring in the field, we quantified the viral loads and combined these data with the phylogenetic tree . Except for less than 20 months of stay or separated cattle, untransmitted strains tended to be found in cattle with less than 3 copies/100 cells (table 4table 4.details about the cattle that untransmit blv to other cattleviral load(copies/100 cells)cattle idblvsubgenotypedurationof stay (month)separation69.2384 t83i-517no46.0564 t53i-1510no37.6646 t61i-1117no35.1545 k94i-1311no29.9488 t42i-1033yes12.386 t69i-419no2.953 k110i-836no1.0366 k29iii33no0.8865 t99i-1635no0.731 k8i-330no<0.1781 t99i-935no). This result indicates that cattle with less than 3 copies/100 cells were unlikely to spread the virus for about 30 months in the field . One strain (subgenotype i-14) was not amplified by the pol primer . However, the ltr primer effectively amplified this strain, and nucleotide variations were found in the pol primer region (data not shown). A phylogenetic tree analysis of blv isolates based on full - length gp51 env gene sequences and the viral loads in infected cattle . Blv isolates are represented by the ids of the infected cattle and the affected farm . The reference strains are represented by genbank accession numbers, together with the country of isolation . Subgenotypes are indicated by roman and arabic numerals with underline, and genotypes are indicated by roman numeral . Triangle shapes indicate the subgenotypes observed in only one cattle infected in this study . Out of 88 seropositive cattle, 11 were negative for pcr detection and not included for phylogenic analysis . Bootstrap support values (> 80% in 1,000 replications) are shown for key nodes only . Both cities of kawaminami and tsuno suffered from fmd outbreak in late march 2010, and all the cattle and pigs in this area were culled [20, 21]. Japanese black cattle were introduced predominantly from the southern part of kyusyu (kumamoto, kagoshima, oita and miyazaki prefectures), and most of the introduced cattle were checked for blv infection by elisa . The infected cattle were immediately separated from the non - infected cattle, and only the non - infected cattle were used for breeding . Our study revealed that only 3.0% and 7.0% of cattle and 9.2% and 15.3% of farms were seropositive for blv in kawaminami and tsuno, respectively . The seroprevalence of blv was higher in tsuno than in kawaminami, but this result was influenced by the high seroprevalence of farm t69 in tsuno . The result of an epidemiological study indicates that blv screening before their introduction into a herd could not completely prevent the spread of blv . However, it clearly lowered the prevalence of blv infection in this area, considering the fact that more than 40% of cattle were infected in the kyusyu area . An additional testing at later time point is essential for complete prevention of the blv infection . In small - size farms (less than 20 cattle), the average seroprevalence of cattle in seropositive farms was higher than in large- and middle - size farms . The small size farms tend to feed cattle in higher density environment, and that might increase the opportunity for contact between infected and uninfected cattle . Previous studies have reported that genotypes i and iii have been isolated primarily from japanese cattle and that genotype i mainly prevails in japan [2, 3, 15, 17, 24]. In this study, this result may reflect the prevalence of genotype i in kyusyu area, though our study was conducted in a limited area and further analyses are required . The same subgenotypes (i-1 and i-7) were isolated from different farms . Although the reason is unclear, the result indicates that these subgenotypes might be major strains of genotype i. in japan, blood - sucking insects are recognized as an important cause of blv transmission route [10, 24]. The weather of kawaminami and tsuno located in southern part of kyusyu is warm and humid, and there are a large number of blood - sucking flies . To prevent transmission among herds, 200 m distance has been proposed . However, separating 200 m between two herds is impractical for most of japanese farms . The result indicates that the viral transmission between two adjacent farms rarely occurs . Although the study did not investigate the number of blood - sucking flies or with or without fly net in farm, these factors could affect efficiency of blv transmission . In this study, some cattle were infected with more than 100 copies/100 cells (fig . Cattle infected with more than 1 copies / cell have been reported in other studies [5, 6]. However, further discussion and research are needed to clear whether blv is integrated more than one copy per cell . Many studies have suggested that a useful strategy to limit blv transmission within a herd is to quantify proviral loads and cull cattle with high viral loads [8, 25]. However, concrete data of viral load in relation to viral transmission have not been so far demonstrated . Our results show that more than 3 viral copies/100 cells are a risk factor for horizontal transmission of the virus in the field and it may alter depending on the environment and/or the feeding system . Detection and slaughter of all infected cattle are the fastest way to completely control blv in a herd . However, this method is economically difficult for many farmers without any financial supports . We suggest that identification of the risk cattle, infected with more than 3 blv copies/100 cells, and separation of those from uninfected cattle may lead to a successful control of blv infection in a herd without significant cost . This study contributes to the development of economically feasible blv eradication programs and control strategies.
|
Skin grafting is a widely used method for the reconstruction of wound closures that cannot be closed primarily . Skin grafts are indicated to accelerate the healing of burns, ulcers, and other wounds, reduce scar contractures, and enhance cosmesis . A skin graft may be meshed to cover a greater surface area at the recipient site . Surgical staples are a common and expeditious method of affixing a mesh skin graft, particularly to large recipient areas . The sewing of the graft using absorbable sutures may be more prudent in children or sensitive areas of adults . However, these affixing procedures have disadvantages, such as pain during staple removal and the time required for suturing . The edges of a meshed skin graft are generally not mesh like but exhibit a dendritic structure . These dendritics are sometimes trimmed or placed on normal skin, but they are not merely left to dry and drop off . Dendritics are too small to thread, but they can be attached using octyl-2-cyanoacrylate (dermabond; ethicon inc ., however, we do not affix the graft on the recipient's defective skin area because of the danger of obstructing the epithelialization of the mesh . Alternatively, we use negative - pressure dressings (vac; kinetic concepts inc ., a nonadherent material must be placed as an interface between the skin graft and the vac sponge to prevent a disruption of the graft during removal of the dressing . The initial dressing should remain in place for approximately 5 days (3 - 7 days) unless pain, odor, discharge, or other signs of complication develop . A total of 14 patients (five males and nine females) under went skin graft using this technique . The ages ranged from 9 months to 86 years (mean = 62.3 years). The skin defects included two burn ulcers, two decubitus, and 10 chronic leg ulcers . All grafts were accepted without complications . A 72-year - old man with a chronic leg ulcer after debridement for necrotizing fasciitis the dendritics of the mesh skin graft were affixed using dermabond six - month postoperative result dermabond was initially used to replace the suturing of superficial wounds, but it is currently used in a variety of techniques . Dermabond has been used recently as a skin bolster to assist the primary closure of wounds in patients with thin skin . The fixation time is equivalent to surgical stapler fixation and the removal of sutures is not required because the graft is affixed with absorbable sutures . Local anesthesia may be necessary for pain relief during surgical stapling and sewing, but it is not necessary for the dermabond technique . Dermabond costs approximately $18 per tube, whereas skin staples are $16 and absorbable sutures are $6 per suture . The dendritic bonding technique is a quick and easy method for the fixation of mesh skin grafts in any patient.
|
The main objective of this work is to show how process mapping may contribute to the improvement of intra- and inter - organizational integration of care . Under logic of service integration, quality of care depends not only on how the internal processes are implemented, but also on the quality of the transitions of care with external entities . We conducted a case study on a health centre located in the centre region of portugal . Activities are guided by formalisms imposed by law and by the good practices of professionals . Most used to communicate with other entities are the phone and paper . Under the rncci (rede nacional de cuidados integrados e continuados national network for integrated care), the information is all organized in an integrated manner, and the processes are support by a customized, nation - wide, web - based information system . However we have demonstrated the viability and the benefits of process mapping techniques in the context of a health centre . Where, who of each process, sub - process, task and activity and to develop graphical views of the processes.
|
Allergic conjunctivitis is a common problem that ophthalmic practitioners have to deal with, almost on daily basis, as it affects nearly 40% of the populace in advanced nation [1, 2]. Various studies in africa have indicated the prevalence of allergic conjunctivitis to range between 7.3 and 32% [3, 4]. The conjunctiva is a dynamic immunologic tissue that suffers lymphoid hyperplasia in reaction to a stimulant such as pollens, animal dander, and other environmental antigens . Allergic conjunctivitis (ac), therefore, is clinically characterized by pruritus, hyperemia, chemosis, tearing, and photophobia . These clinical symptoms are the reason for the high morbidity associated with ac and consequential impact on quality of life of ac victims [7, 8]. Due to the large burden of ac and its spate of increase all over the world and across all ages, it possesses a great challenge to the health care resources of many countries [9, 10]. Mast cell plays an important role in these allergic inflammations [11, 12]. Available medical therapies which include antihistamines, mast cell stabilizers, corticosteroids, nonsteroidal anti - inflammatory drugs, immunomodulatory agents, and allergen - specific immunotherapy could be rendered ineffective due to discomfort associated with administration of medications, intricacy of administration guidelines, perceived lack of efficacy by users, and/or adverse effects . In the light of these bottlenecks associated with effective management of ac, current studies have focused attention on plants and natural products based therapeutic strategies in the bid to broaden treatment horizon, improve efficacy, and address safety concerns . Heliotropium indicum l. (boraginaceae), also known as indian heliotrope, is one such plant used in the traditional management of conjunctivitis [15, 16]. Although h. indicum is well - studied medicinal plant, its traditional use in treating ocular allergic inflammation is yet to be evaluated . This study therefore sought to evaluate the antiallergic effect and possible mechanism of action of whole plant aqueous extract of heliotropium indicum l. in ovalbumin - induced allergic conjunctivitis in dunkin - hartley guinea pigs . Heliotropium indicum was collected from the botanical gardens of the university of cape coast, cape coast, in the central region of ghana (5.1036n, 1.2825w) in november 2012 . It was identified and authenticated by a botanist at the school of biological sciences, college of agricultural and natural science, university of cape coast, cape coast, ghana, where a voucher specimen with number 4873 has been deposited at the herbarium for future reference . Whole plants of h. indicum were washed thoroughly with tap water and shade - dried . The dry plants were milled into coarse powder by a hammer mill (schutte buffalo, new york, ny). One and half kilograms of the plant powder was mixed with one liter of water . The mixture was soxhlet - extracted at 80c for 24 h. the aqueous extract obtained was freeze - dried (hull freeze - dryer / lyophilizer 140 sq, warminster, pa). The powder (yield 12.2%), labeled as hie, was stored at 4c and reconstituted in normal saline to the desired concentration for dosing in this study . Ovalbumin (ova) (cayla - invivogen, toulouse, france), aluminum hydroxide (merck, darmstadt, germany), chloroform (sigma - aldrich, usa), cetirizine (mcneil consumer healthcare, washington, usa), and prednisolone (taizhou baida pharmaceutical chemical co., ltd ., dunkin - hartley guinea pigs (weight 300 25 g) were kept in the animal house of the school of biological sciences, university of cape coast, ghana . The experimental animals were housed in aluminum cages (34 cm 47 cm 18 cm) with soft wood shavings as bedding, under ambient laboratory conditions (temperature 28c 2c, relative humidity 6070%, and a normal light - dark cycle). The study protocols were approved by the institutional review board on animal experimentation of the faculty of pharmacy and pharmaceutical sciences, kwame nkrumah university of science and technology, kumasi, ghana (ethical clearance number fpps / pcol/0030/2013). All activities performed during the studies conformed to accepted principles for laboratory animal use and care (eu directive of 1986: 86/609/eec) and association for research in vision and ophthalmology statement for use of animals in ophthalmic and vision research . Screening was performed on hie to ascertain the presence of phytochemicals using standard procedures described by harborne and kujur et al . . Oiac was carried out as described by shoji et al . And abokyi et al . . Guinea pigs were sensitized by two intraperitoneal injections of 0.2 ml solution containing 100 g ova and 0.01 mg aluminum hydroxide in phosphate buffer saline (ph 7.4) at an interval of 2 weeks . On day 8 after the sensitization, conjunctivitis was induced by topical instillation (challenge stage) of ova (1.5 mg ova in 10 l pbs) into the conjunctival sac of each eye . Physical and slit lamp (marco ii - b, lombart instrument, japan) biomicroscopic ocular examinations were conducted . Hyperemia of palpebral conjunctiva, chemosis of bulbar conjunctiva, and lid swelling (clinical symptoms of ac) observed in the animal were an indication that ac had been induced . Groups i iii were treated with 30, 100, and 300 mg kg hie, respectively, group iv was treated with 10 mg kg chlorpheniramine, and group v received 30 mg kg prednisolone, while group vi (control group) was treated with 10 ml kg pbs . A normal control group, group vii (no sensitization and challenge, no interventionary treatment), was kept under experimental condition . All treatments were per os and were started 24 h after the last topical challenge . Clinical examination was performed on days 1, 3, 5, and 7 in the various groups of animals . Hyperemia of palpebral conjunctiva, chemosis of bulbar conjunctiva, and lid swelling were scored on a scale of 03 . The total of clinical scores for hyperemia of palpebral conjunctiva, chemosis of bulbar conjunctiva, and lid swelling was also evaluated as an overall clinical score . Twenty - four hours after the last treatment had been administered, guinea pigs were anesthetized with chloroform and whole blood was collected from the jugular vein into pyrogenic free test tube (indigo instrument, waterloo, canada). Serum was prepared by centrifuging the clotted blood (temperature 25c, speed 3000 g) for 5 min using a mikro 220r machine (hettich zentrifuge, tuttlingen, germany). The serum was then subjected to enzyme - linked immunosorbent assay (elisa) (mybiosource, san diego, ca, usa) as per the manufacturer's instructions briefly described . The precoated antibodies were either one of the following: guinea pig ova sigg, sige, and ige monoclonal antibody and the detecting antibodies, a biotin labeled polyclonal antibody . In each case avidin - peroxidase conjugates were then added to the elisa wells; tetramethylbenzidine (tmb) substrate was used for coloring and washed out . The absorbances were then read at 450 nm using an urit-660 microplate reader (urit medical electronic co., ltd ., the eyeballs together with the conjunctiva and lids of animals from the various groups were exenterated and fixed in 10% buffered formalin . Histopathological assessment was done by a specialist pathologist at komfo anokye teaching hospital, kumasi, ghana . The statistical analysis of data obtained was made using graphpad prism version 5.0 (graphpad software, inc . Differences between treatment groups and the controls were estimated using one - way analysis of variance (anova) followed by dunnett's multiple comparisons test (post hoc test) at a confidence level of 95% . Probability values less than or equal to 5% (p 0.05) were considered significant . Preliminary phytochemistry showed that flavonoids, saponins, cyanogenic glycosides, sterols, tannins, and alkaloids were present in hie (table 1). The clinical scores for oiac indicated a u - shaped effect of hie in mitigating the clinical signs of allergic conjunctivitis . The 30 and 300 mg kg significantly (p 0.001) attenuated the clinical signs of allergic inflammation and not the 100 mg kg (figures 1(a) and 1(b)). Chlorpheniramine and prednisolone (reference drugs) significantly (p 0.010.001) attenuated the clinical signs of ac (figures 1(a) and 1(b)). Hie showed a u - shaped effect in decreasing (p 0.010.001) sera ova - specific ige, igg, and total ige antibodies in serum . Prednisolone caused significant reduction (p 0.001) in the immunoglobulin, but chlorpheniramine did not (figures 24). The histopathological assessment showed remarkable signs of mononuclear infiltration in conjunctival tissue of the control (pbs treated) group . Treatment with 30 and 300 mg kg showed a reduction in mononuclear infiltrations but not the 100 mg kg hie treated group . Ovalbumin - induced allergic conjunctivitis model in the guinea pig has been used in preclinical studies in screening for potential antiallergic agents . It has been noted as an ideal model for both ige mediated and non - ige mediated allergic conjunctivitis . It is biphasic with the early - phase reaction driven primarily by mast cell degranulation and ensues right after exposure to the allergen; the late - phase reaction is marked by cell infiltration, mainly eosinophils, neutrophils, and lymphocytes, 6 to 24 hours after antigen application, corresponding to the clinical findings of allergic conjunctivitis . Activation and conscription of inflammatory cells and the liberation of cytokines, chemokines, adhesion molecules, and proteases promote more serious chronic forms . The low clinical scores obtained for the extract treated group justify the extract's potency in relieving the noisome symptoms associated with the underlying pathology of allergic conjunctivitis, the hallmark of most antiallergic agents . Although the u - shaped dose - response effect observed in clinical scores of ocular allergy remains unclear, it has been reported in several pharmacological investigations . This observation could be due to the inhibitory tendencies of the active phytochemical at that dose . Hie reduced both allergen- (ova-) specific igg and ige indicating a mechanistic deviation of activity from antihistaminic and mast cell stabilizing agents [20, 27]. Treatment with chlorpheniramine irrespective of the favorable clinical outcome regarding the resolution of allergic inflammation had no significant effect on allergen - specific igg, ige, and total sera ige . This is because the release of histamine whose receptors are the target for antihistaminic agents lies downstream immunoglobulin production . The extract treatment causing relevant reduction in allergen - specific immunoglobulins was similar to the effect of the steroid treatment (prednisolone). This presupposes that the extract may have immunomodulatory and or immunosuppressive effect [13, 29]. A number of immunomodulatory compounds have been isolated from natural products [30, 31]. Antioxidant - rich extracts have been found relevant as immunomodulatory or immunosuppressive agents and have been mainly used in control of the immune response in conditions like transplantation, autoimmune disorders, and alleviation of allergic diseases . Some studies have already reported the antioxidant properties of both extract and different fractions of h. indicum which in effect suggest that hie's antiallergic inflammatory effect could probably be due to its rich antioxidant constituents such as flavonoids, alkaloids, and tannins [3234]. Hie treatment reduced serum levels of ige which is one of the necessary ingredients in the promulgation of allergic inflammatory processes . When an allergen (e.g., ovalbumin) is taken up by antigen presenting cells (e.g., allergen - specific b cell), via the cell surface immunoglobulin receptor, processed fragments are then presented in the context of major histocompatibility class ii (mhc class ii) to th2 cells recognizing the allergen - mhc ii complex . Activation of the allergen - specific th2 cells results in the expression of il-4, il-13, and cd154 and introduction of class switching to ige . Class switching, a process involved in the biosynthesis of immunoglobulins, is driven by allergens . Nevertheless, basophils express high levels of il-4, il-13, and cd154 after stimulation and it has been postulated to play a role in polyclonal amplification of ige production and in the differentiation of th2 cells . These immunoglobulins bind to high - affinity ige receptor; fcr1 expressed on mast cells and basophils as tetramers (2) and on antigen presenting cells, at much lower levels, as trimers (2) leading to degranulation of mast cells . Studies have shown that the density of human basophil and mast cell fcr1 expression is associated with serum ige levels . Mast cell degranulation is dependent on syk kinase responsible for signaling proceedings subsequent to mast cells and basophils stimulation . This assertion is supported by recent finding indicating that syk kinase deficient mast cells and basophils do not undergo degranulation after fcr1 aggregation . The extract in this case indicates a mechanistic efficacy in reducing serum ova allergen - specific and total ige levels . The aqueous whole plant extract of heliotropium indicum exhibits antiallergic effect in ovalbumin - induced conjunctivitis in guinea pigs via a probable immunomodulating or immunosuppressive action supporting its traditional use in treatment of conjunctivitis.
|
Glaucoma, an optic neuropathy affecting over 60 million people, is the second cause of global blindness and draws intensive attention because of the irreversibility of glaucomatous optic nerve damage . Previous studies have found that collagen tissues create changes in glaucoma patients, such as biomechanics changes of trabecular meshwork (tm), thinner sclera, and laminar cribrosa [35]. However, are these changes the result of elevated intraocular pressure (iop) or are they the primary original factors causing glaucoma? Elevated iop is generally considered as the main risk factor in glaucomatous pathogenesis, which is primarily caused by increased aqueous humor outflow resistance . Previous studies hypothesized that one of the main causes of this is biomechanical and molecular changes of the extracellular matrix (ecm) in the tm . This study assumes that changes in collagen, as the main component of ecm in the tm, may be involved in increased aqueous humor outflow resistance and elevation of iop . We can find that patients have variable susceptibility to glaucomatous optic neuropathy, which presents with high - tension glaucoma, normal - tension glaucoma (ntg), or ocular hypertension . Sclera and lamina cribrosa, known as the load - bearing tissues, may be responsible for that . Collagen plays structural roles and contributes to mechanical properties, organization, and shape of tissues . Collagen changes can result in a weaker structure, including changes in elasticity and compliance of collagen tissues, and decreased density and thickness of these tissues, which may be more sensitive to elevated iop . Based on the above, this study hypothesized that primary change of collagen is an original factor in the pathogenesis of glaucoma . Ecm in tm is believed to be essential for maintenance of the normal outflow system . Changes in biomechanics of ecm, caused by dysfunction and structural alteration of collagen, affect the tm function and the aqueous humor outflow . Comparing the stiffness of tm in normal tissue and glaucomatous tissue, last et al . Found that the stiffness of glaucomatous tm significantly increased, which resulted from dysregulation of ecm . Studies also found that glaucomatous eyes have different forms of ecm deposited within the cribriform layer to increase the outflow resistance . Hence, changes in tm elasticity and mechanical load may have a significant role in glaucoma . Several alterations in collagen expression and transcription have been characterized in the tm of primary open - angle glaucoma (poag). Type i collagen is the major component of structures within the tm collagen beans and uveoscleral aqueous humor outflow pathways . Targeted type i collagen mutation and induced an elevation of iop in mice, and their results suggested an association between iop regulation and collagen turnover . The turnover of collagen causes difficulty in hydrolyzation by matrix metalloproteinases (mmps), leading to accumulation of type i collagen . Another collagen, type vi, also increases, which is associated with sheath - derived plaques in the cribriform meshwork . Thus, collagen abnormality in the outflow pathway appears to play an important role in the elevation of iop and may be one of the significant original factors of glaucoma . A variety of cellular and molecular changes can occur that modify the connective tissues of the optic nerve and surrounding sclera in aging, ocular development, and glaucomatous disease . These changes remodel the microenvironment of the optic nerve, and presumably change the susceptibility to axonal injury in this region . Many experimental and clinical studies have found that the biomechanical properties of sclera shift to being less elastic and stiffer in glaucoma [1517]. Sclera has a collagen - rich ecm, and collagen constitutes 90% of scleral dry weight . Collagen fibers in sclera are organized into irregularly arranged and somewhat interwoven lamellae; the lamellae varying in thickness . The variations of collagen may lead to inter - individual differences in scleral material properties . Previous detailed modeling studies found that scleral material properties were varied over physiologic ranges, suggesting that there could be significant inter - individual differences . Inter - individual variations in sclera, particularly peripapillary scleral thickness, can result in vastly different biomechanical responses to iop . Thinner sclera is more sensitive to developing glaucoma . For example, decreased density of collagen in the peripapillary sclera was found in glaucoma; and in high myopia eyes, sclera is elongated and thinned, which increases risk of developing poag . The region of laminar cribrosa in the optic nerve head (onh) is the principal site of retinal ganglion cells (rgcs) axonal insult in glaucoma . The lamina cribrosa provides structural and functional support to the rgcs axons while passing from the relatively high - pressure environment in the eye to a low - pressure region in the retro bulbar cerebrospinal space . However, because of discontinuity in the corneal - scleral shell, lamina cribrosa is often considered a weak spot in mechanically loaded systems, and is the site of substantial stress concentration . Collagen types i, iii, iv, v, and vi constitute the main composition in the lamina cribrosa, and these macromolecules change with age . As this tissue ages, individual differences, leading to more or less of a particular macromolecule of the extracellular matrix, may alter the support function of the lamina cribrosa and influence the degeneration of the optic nerve associated with glaucoma . The inter - individual variations in lamina cribrosa thickness are responsible for ability to resist damage . Recently, using spectral domain optical coherence tomography (sd - oct), park et al . On the other hand, thin lamina cribrosa leads to a decreased distance between the intraocular space and the space of the retrobulbar cerebrospinal fluid compartment at a given trans - lamina cribrosa pressure difference between both compartments, the pressure gradient gets steeper due to the reduced distance between both compartments . Hence, one may assume that even at the same iop level, individuals with thinner lamina cribrosa will have increased susceptibility to glaucomatous optic neuropathy . A recent study strongly claimed that the lower and upper quadrants of onh are indeed lower density, and that if exposed in increased iop, this region is an area of vulnerability and may be the first site to become damaged . This may help understand the selective visual field loss observed in the initial stages of glaucoma . Besides thickness and density, ocular developmental differences and mechanical properties changes with aging form the inter - individual variations of susceptibility to developing glaucoma . Laboratory evidence has also demonstrated the potential role for collagens in glaucomatous optic neuropathy . In glaucomatous monkey eyes, alterations in the three - dimensional organization of collagen fibrils were observed in the optic nerve head, suggesting that these architectural changes may affect the flexibility and resilience required of the lamina cribrosa in supporting optic nerve fibers . In glaucoma and suspected glaucoma, the content and/or the composition of the collagen molecules in the lamina cribrosa is significantly changed, and differs from that of normal eyes . One can therefore speculate that a primary collagen disturbance might be involved in the pathogenesis of glaucoma . Evidence, as mentioned above, indicates that the inter - individual differences of sclera and lamina cribrosa will affect susceptibility to glaucoma . This may explain the individual variation to elevated iop seen clinically . During rises in iop, if these tissues are strong enough to resist elevated iop and to prevent the optic nerve from being damaged, ocular hypertension occurs . In contrast, if these tissues are weak, normal - tension glaucoma is presented . Based on this evidence, this study hypothesizes primary changes in collagen molecules results in a weaker structure, which increases susceptibility to glaucoma . Evidence from a meta - analysis strongly indicates that individuals with myopia have an increased risk of developing poag . People with moderate and especially high myopia have a two - fold to three - fold increased risk of glaucoma compared with that of non - myopic subjects, and this risk is independent of other glaucoma risk factors and iop . Myopia is a complex pathology of ocular structure with elongated axial length . Increasing axial length results in many structural changes such as thinner sclera and lamina cribrosa and weakness of the fibroglial matrix of the nerve fibers at the optic disc . The explanation is thought to be that variation of collagen structure and amounts leads to weakness of these tissues, which could contribute to the high susceptibility of the optic disc to iop fluctuations and to the increasing risk of glaucomatous neuropathy . Collagen undergoes significant changes during the development of myopia . In regard to the development of myopia, previous studies found a significant loss of scleral tissue weight and subsequent scleral thinning associated with a narrowing and disconnection of collagen fiber bundles and a reduction in the number of bundles . Reduction of collagen amounts in sclera is a result of both decreased collagen synthesis and increased collagen degradation . These ultrastructural variations suggest a derangement of the organization and growth of the collagen fibers, which result in the thinning of sclera . Moreover, the thinning of the peripapillary sclera is an additional biomechanical factor that increases tension in the lamina cribrosa beams, leading to increased glaucoma susceptibility . Many experimental and clinical studies have found that the biomechanical properties of sclera shift to being less elastic and stiffer in glaucoma [1517]. Some scientists indicate that these changes may be related to the development of glaucoma . Sclera has a collagen - rich ecm, and collagen constitutes 90% of scleral dry weight . Collagen fibers in sclera are organized into irregularly arranged and somewhat interwoven lamellae; the lamellae varying in thickness . The variations of collagen may lead to inter - individual differences in scleral material properties . Previous detailed modeling studies found that scleral material properties were varied over physiologic ranges, suggesting that there could be significant inter - individual differences . Inter - individual variations in sclera, particularly peripapillary scleral thickness, can result in vastly different biomechanical responses to iop . Thinner sclera is more sensitive to developing glaucoma . For example, decreased density of collagen in the peripapillary sclera was found in glaucoma; and in high myopia eyes, sclera is elongated and thinned, which increases risk of developing poag . The region of laminar cribrosa in the optic nerve head (onh) is the principal site of retinal ganglion cells (rgcs) axonal insult in glaucoma . The lamina cribrosa provides structural and functional support to the rgcs axons while passing from the relatively high - pressure environment in the eye to a low - pressure region in the retro bulbar cerebrospinal space . However, because of discontinuity in the corneal - scleral shell, lamina cribrosa is often considered a weak spot in mechanically loaded systems, and is the site of substantial stress concentration . Collagen types i, iii, iv, v, and vi constitute the main composition in the lamina cribrosa, and these macromolecules change with age . As this tissue ages, individual differences, leading to more or less of a particular macromolecule of the extracellular matrix, may alter the support function of the lamina cribrosa and influence the degeneration of the optic nerve associated with glaucoma . The inter - individual variations in lamina cribrosa thickness are responsible for ability to resist damage . Recently, using spectral domain optical coherence tomography (sd - oct), park et al . Found that lamina cribrosa thickness was significantly thinner in ntg than in poag . Thin lamina cribrosa provide less biomechanical support for the optic nerve . On the other hand, thin lamina cribrosa leads to a decreased distance between the intraocular space and the space of the retrobulbar cerebrospinal fluid compartment at a given trans - lamina cribrosa pressure difference between both compartments, the pressure gradient gets steeper due to the reduced distance between both compartments . Hence, one may assume that even at the same iop level, individuals with thinner lamina cribrosa will have increased susceptibility to glaucomatous optic neuropathy . A recent study strongly claimed that the lower and upper quadrants of onh are indeed lower density, and that if exposed in increased iop, this region is an area of vulnerability and may be the first site to become damaged . This may help understand the selective visual field loss observed in the initial stages of glaucoma . Besides thickness and density, ocular developmental differences and mechanical properties changes with aging form the inter - individual variations of susceptibility to developing glaucoma . Laboratory evidence has also demonstrated the potential role for collagens in glaucomatous optic neuropathy . In glaucomatous monkey eyes, alterations in the three - dimensional organization of collagen fibrils were observed in the optic nerve head, suggesting that these architectural changes may affect the flexibility and resilience required of the lamina cribrosa in supporting optic nerve fibers . In glaucoma and suspected glaucoma, the content and/or the composition of the collagen molecules in the lamina cribrosa is significantly changed, and differs from that of normal eyes . One can therefore speculate that a primary collagen disturbance might be involved in the pathogenesis of glaucoma . Evidence, as mentioned above, indicates that the inter - individual differences of sclera and lamina cribrosa will affect susceptibility to glaucoma . This may explain the individual variation to elevated iop seen clinically . During rises in iop, if these tissues are strong enough to resist elevated iop and to prevent the optic nerve from being damaged, ocular hypertension occurs . In contrast, if these tissues are weak, normal - tension glaucoma is presented . Based on this evidence, this study hypothesizes primary changes in collagen molecules results in a weaker structure, which increases susceptibility to glaucoma . Evidence from a meta - analysis strongly indicates that individuals with myopia have an increased risk of developing poag . People with moderate and especially high myopia have a two - fold to three - fold increased risk of glaucoma compared with that of non - myopic subjects, and this risk is independent of other glaucoma risk factors and iop . Myopia is a complex pathology of ocular structure with elongated axial length . Increasing axial length results in many structural changes such as thinner sclera and lamina cribrosa and weakness of the fibroglial matrix of the nerve fibers at the optic disc . The explanation is thought to be that variation of collagen structure and amounts leads to weakness of these tissues, which could contribute to the high susceptibility of the optic disc to iop fluctuations and to the increasing risk of glaucomatous neuropathy . Collagen undergoes significant changes during the development of myopia . In regard to the development of myopia, previous studies found a significant loss of scleral tissue weight and subsequent scleral thinning associated with a narrowing and disconnection of collagen fiber bundles and a reduction in the number of bundles . Reduction of collagen amounts in sclera is a result of both decreased collagen synthesis and increased collagen degradation . These ultrastructural variations suggest a derangement of the organization and growth of the collagen fibers, which result in the thinning of sclera . Moreover, the thinning of the peripapillary sclera is an additional biomechanical factor that increases tension in the lamina cribrosa beams, leading to increased glaucoma susceptibility . In addition, recent theories about glaucomatous optic neuropathy cannot effectively explain the different susceptibility of individuals to elevated iop . This article hypothesizes that glaucoma is a disorder disease with a series of characteristic pathological alterations of collagen in its content, distribution, ultrastructure, and metabolism . Inter - individual differences in scleral and lamina cribrosa caused by variations of collagen contribute to inter - individual variation in susceptibility to elevated iop . Collagen, as an original cause of glaucoma, plays an important role in glaucoma pathogenesis . Some changes in eye collagen may occur before the development of glaucoma or glaucomatous optic neuropathy.
|
Children with special health care needs (cshcn) are at increased risk for poor health outcomes . The cshcn population is growing, the need for services is increasing, and the capacity to provide cshcn services is decreasing due to public sector financial constraints . It is critical to demonstrate the needs of this vulnerable population and evaluate the effectiveness and value of cshcn programs [2, 3]. Public health nurses (phns) in washington state serving cshcn sought to describe cshcn client needs and evaluate cshcn programs using a standardized terminology, the omaha system . They selected the omaha system because many of the local washington state public health jurisdictions used electronic health records and the omaha system for clinical documentation . Standardized terminologies have potential to advance the development of practice standards and assessment guidelines and overall quality improvement policies and procedures [57]. This work builds on previous efforts to describe care and evaluate outcomes in other states and programs . The maternal child health bureau (mchb) defines cshcn as those who have or are at increased risk for a chronic physical, developmental, behavioral, or emotional condition and who also require health and related services of a type or amount beyond that required by children generally . The mchb has advanced a national agenda for achieving and measuring the success of cshcn programs . The purpose of this agenda is to provide and promote family - centered, community - based, coordinated care for cshcn and to facilitate the development of community - based systems of services for such children and their families . Since the 1980s, this agenda has guided state and federal programs through the identification of six key indicators of progress . These indicators describe the necessity for the early identification of problems in order to provide an opportunity for intervention, as well as the organization of services in order to provide accessible and appropriate interventions . Identifying health care problems experienced by cshcn and their families provides information about the larger service system, while a successful system of services results in high levels of child and family health and well - being . Partnering across jurisdictions to define, measure, and monitor a system of care for cshcn at the state level may lead to the promotion of best practice . Uniform data, specifically, state - level data from the national surveys of cshcn, is a key in driving system of care improvements and facilitating state and local program planning efforts [11, 12]. However, little research exists describing the role or benefits of a standardized process for phn agencies to assess and document nursing activities related to cshcn programs . Programs that address the unique needs of cschn have long been a component of the public health system . Public health nursing contributes a unique service for this population and the health system by assessing health status and access to other health services, assuring that families receive the services they need, and providing findings to policy makers . Cshcn often require long - term services for complex needs, consuming a disproportionate share of health care dollars spent on children . Therefore, they are especially vulnerable to health care issues such as access, quality, and cost containment (denial of care). In washington state, the cshcn program goal is to assure children and youth with special health care needs achieve the healthiest life possible by promoting access to integrated, family - centered, culturally competent, and community - based programs and services . The adoption of electronic health records and public health information systems varies across jurisdictions in the united states . Many local public health jurisdictions in washington state implemented commercial and agency - developed public health information systems over the past several years . However, some local public health jurisdictions continue to use paper systems for all data tracking and documentation . The phns developed a solution to this challenge, through the use of a common standardized terminology in all paper or computerized platforms (the omaha system) [4, 15]. The resulting uniform data could then be combined across all jurisdictions, regardless of how the data were collected . The objective of this study was to evaluate the feasibility of implementing a state - wide case management, surveillance, and program evaluation system for cshcn program using a standardized omaha system protocol and visit report . This paper reports preliminary data from the first four months after the implementation of the standardized data collection protocol . The university of minnesota institutional review board and state of washington institutional review board approvals were obtained for this study . All local public health agencies in washington state were invited to a statewide training on the data collection system (september 2010) and to participate in the data collection starting november 2010 . The data collection period for this study ended in february 2011 . Visit reports were submitted to state of washington department of health cshcn officials for program evaluations by 25 of the 35 local agencies during this time period . The department of health entered the deidentified data into a spreadsheet and provided the spreadsheet to the research team for analysis . The omaha system was selected by washington state cshcn directors for this statewide program evaluation, because it is a standardized interface terminology used widely for computerized documentation in community care settings . Instead, it provides a comprehensive, holistic architecture for describing, documenting, and evaluating health care by enabling practitioners to collect relevant clinical data and identify client strengths and needs . A previous study compared omaha system kbs ratings for high risk families including families of cshcn served in phn home visiting programs by four local public health agencies in another state (minnesota). The omaha system consists of three components: the problem classification scheme, the intervention scheme, and the problem rating scale for outcomes . The problem classification scheme is used to identify and classify health - related issues and includes 42 problems . Problems are uniquely identified by distinctive definitions and signs and symptoms (s / sx). The intervention scheme is used for addressing the problems which are described using the four - level intervention scheme . The four terms of the intervention scheme are: problem from the problem classification scheme, category (action term), target (defined term that further specifies the intervention), and care description (undefined, customizable term). The problem rating scale for outcomes is used to measure client knowledge, behavior, and status (kbs) related to each client problem . Kbs ratings are documented using a likert - type ordinal scale from 1 (lowest) to 5 (highest). The state of washington department of health together with phns serving cshcn sought to develop a uniform cshcn evaluation protocol including the development of practice standards and assessment guidelines . The purpose of their project was to generate data for overall quality improvement and outcomes reporting . They created the evaluation protocol in response to three important trends: (1) the need to respond to federal maternal - child health national performance measures, (2) the fact that many of the public health agencies had the electronic capacity to collect standardized data, and (3) many of the agencies were using the omaha system for other maternal - child health programs . Title v technical assistance funds supported consultation for this project from a nationally known expert in the use of the omaha system for program evaluation . Phns serving cshcn in washington state created a logic model for program evaluation based on hhs title v national performance measures (npm) for addressing cshcn national performance measures (table 2). During a ten - month period, phns in local public health agencies jointly developed and implemented a standardized visit report operationalizing the national performance measures using the omaha system . Over a series of four meetings, they selected eight problems for the standardized visit report: income, residence, communication with community resources, caretaking / parenting, abuse, neglect, growth and development, and health care supervision . The visit report was available in electronic and paper form (see example in figure 1). Data quality for new omaha system users was supported by peer training, and by the use of the kbs rating guide supplement, also available online . The only known characteristics of the sample were that the cshcn who received phn visits qualified for services through the hhs title v cshcn definitions and criteria . Omaha system variables were problems; s / sx; intervention categories and targets; and knowledge, behavior, and status ratings for client problems . For dependent clients such as cshcn, the knowledge rating reflects the caregiver's knowledge while behavior and status ratings reflect the child's behavior and status . The omaha system partnership for knowledge discovery and health care quality provided in - kind data management and analysis for the project . Descriptive statistics were used to quantify the number of clients and s / sx by problem for all problems with 10 or more instances in the data . From the visit reports (n = 127), 314 problems and 853 interventions were documented . The most common problem identified was growth and development followed by health care supervision, communication with community resources, caretaking / parenting, income, neglect, and abuse . The most common intervention category was surveillance (60%), followed by case management (24%) and teaching, guidance, and counseling (16%). On average, there were 2.7 interventions per problem and 6.7 interventions per visit . The mean kbs ratings for each problem are reported in figure 2 . For the growth and development problem (n = 80), the most common s / sx were abnormal results of developmental screening tests (40%), inadequate achievement / maintenance of developmental tasks (40%), age - inappropriate behavior (30%), and abnormal weight / height / head circumference in relation to growth / age standards (23%). For the health care supervision problem (n = 57), the most common s / sx were inability to coordinate multiple appointments / treatment plans (23%), inadequate source of health care (21%), inadequate treatment plan (21%) fails to obtain routine / preventative health care (18%), inconsistent source of health care (11%), fails to return as requested by health care provider (9%), and fails to seek care for symptoms requiring evaluation / treatment (7%). For the communication with community resources problem (n = 57), the most common s / sx were unfamiliar with options / procedures for obtaining services (58%), language, cultural, educational, transportation barriers (38%), difficulty understanding roles / regulations of service providers (36%), inability to communicate concerns to provider (24%), dissatisfaction with services (20%), limited access to care / services / goods (14%), and inability to use / have inadequate communication devices / equipment (2%). For the caretaking / parenting problem (n = 48), the most common s / sx were difficulty providing physical care / safety (33%), difficulty providing cognitive learning experiences and activities (33%), difficulty providing preventative and therapeutic health care (31%), expectations incongruent with the stage of growth and development (19%), difficulty providing emotional nurturance (17%), dissatisfaction / difficulty with responsibilities (15%), difficulty interpreting or responding to verbal / nonverbal communication (15%), and neglectful or abusive (4.2%). The most common s / sx of the income problem (n = 45) were low / no income (78%), ability to buy only necessities (33%), uninsured medical expenses (18%), difficulty buying necessities (18%), and difficulty with money management (11%). For the residence problem (n = 18), the most common s / sx were cluttered living space (44%), structural barriers (11%), homelessness (11%), structurally unsound (6%), inadequate heating / cooling (6%), steep, unsafe stairs, (6%) inadequate / obstructed exits and entries (6%), presence of lead based paints (6%), and unsafe equipment / wiring (6%). For the neglect problem (n = 12), the most common s / sx were of the signs and symptoms documented in the neglect problem included inadequate / delayed medical care (25%), included lacks necessary supervision (17%), while lacks adequate physical care (8%), lacks emotional support (8%). Of the 127 visit reports, four abuse problems were recorded, which is less than the threshold of 10 cases established a priori . Therefore, the frequency of s / sx and mean kbs ratings were not reported for the abuse problem . The washington state cshcn program developed and implemented a state - wide case management, surveillance, and program evaluation system using the omaha system, demonstrating the feasibility of this approach . Preliminary data suggest serious needs in the cshcn population that should be further investigated, especially related to health care access for cshcn and services needed to address developmental issues . The phns suggested the very low kbs ratings for the growth and development problem may reflect the fact that funding reductions have severely limited phn services in local health jurisdictions . As a result, the cshcn program policy shifted to focus on a small subset of the most seriously affected children . Omaha system s / sx data provide insight into the characteristics and needs of cshcn and families . In this study, the s / sx and very low kbs ratings for the health care supervision and communication with community resources problems suggest that there are serious gaps in the sources of health care and treatment plans for cshcn and that families have difficulty accessing care due to barriers in the system . The s / sx also suggest that very few families are unwilling to access care or use resources . These findings relate to the npm: community resources are organized so families can use them easily, child has a medical home, and families are decision - makers in their child's care and are satisfied with the services they receive . The s / sx of the caretaking / parenting problem most often related to providing adequate physical care, cognitive learning experiences, and health care . The s / sx of the income problem most often related to income shortages, while few families had budgeting difficulties . These findings relate to the npm: families have adequate public and/or private insurance to pay for the services they need . The s / sx of the residence problem most often related to excessive household clutter, while few homes had structural deficits and few families were homeless . The most common s / sx of the neglect problem were related to medical neglect and child supervision . Overall, these results describe the stressful circumstances that families of cshcn in this study experienced on a daily basis . Consistent with the goal of the cshcn program, phns have traditionally worked with families to promote access to services (program website). The use of the cshcn visit reports will generate large data sets that will enable further evaluation of the effectiveness of phn interventions for these problems . Previous studies have described intervention tailoring and effectiveness for high risk families [1921]. Further research is needed to identify approaches most successful in supporting families of cshcn, so that resources can be used efficiently and effectively, and the npm goals for cshcn and their families can be achieved . The use of the omaha system enabled the aggregation of standardized cshcn data for program evaluation . Assessments and intervention data from 25 of 35 local health jurisdictions were included in this study . The 127 visit reports were submitted to the department of health on the paper visit report forms . Data from electronic documentation of cshcn assessments and interventions were not included in this study but will be available in the future . It is essential for state and local health jurisdictions, software vendors, and policy makers to work together to achieve the goals of standardized, interoperable systems to support uniform data collection for program evaluation and research . The results of this study will be used by the washington state cshcn program to focus nursing activities on the problems most likely to be encountered by phns serving the cshcn population . National, state, and local officials have a responsibility to develop, support, and maintain cshcn programs [1, 22]. Public funding for cshcn programs in washington state has been greatly reduced since the inception of this cshcn program evaluation initiative and continues to be in jeopardy [14, 23]. The data obtained in this study suggest that serious needs are likely to be unmet in the current economic climate due to funding shortfalls and related reductions in cshcn program staffing . With all research using large observational data sets, limitations of the data include observer bias and fidelity to documentation procedures . While the sample of 127 clients from 25 local health jurisdictions demonstrates the feasibility of the approach, bias toward submitting forms for clients with the greatest need may exist . This limitation is supported by the phn interpretation of the findings reported in section 5.0 . Therefore, alternative explanations for the findings must be considered . In this study, many of the local health jurisdictions started to use the omaha system for the cshcn at the beginning of the data collection period . Documentation quality was supported by peer training and the use of kbs rating guide supplements . Further research is needed to create quality assurance measures that can be implemented as an integral part of program evaluation . This study demonstrates the feasibility of a structured approach to case management, surveillance, and program evaluation for cshcn using a standardized terminology . The use of the omaha system facilitated uniform data collection of client assessments and services across 25 of 35 local health jurisdictions in the first four months of the evaluation . Preliminary findings suggest that critical needs existed among cshcn in washington state . In the future, larger data sets will be used to evaluate the quality of phn services, inform public policy, and improve the health cshcn and their families.
|
In the current era of coronary stenting and adjunctive platelet gp iib / iiia blockade, efficient and effective therapy can be offered to patients who present with non - st segment elevation acs . Empirically defined durations of medical' stabilization' offer no specific advantage to this patient population (unstable angina; non - st elevation acute myocardial infarction). Unfortunately, prior trials comparing an' aggressive' (invasive) versus' conservative' (non - invasive) strategy were performed before the advent of platelet gp iib / iiia blockade and coronary stenting . These studies identified excess' hazard' for early intervention and appeared to confirm prior retrospective analyses which had suggested that percutaneous coronary intervention (pci), performed at the time of diagnostic catheterization (ad hoc) or during the first week following presentation for unstable angina, was associated with an increased rate of procedural failure and major hospital complications . Thus, the current agency for health care policy and research (ahcrp) guidelines published in 1994 promote' conservatism' to avoid' early hazard' and, unfortunately, define treatment strategy (invasive versus conservative) before adequately assessing patient risk . In light of recent developments in interventional technology and adjunctive pharmacology as well as in our understanding of accurate risk stratification, it is most appropriate at this time to reevaluate our approach to patients with non - st segment elevation acs . Non - st segment elevation acs has become the most frequent admission diagnosis in the united states medicare population . In addition, the prognosis of this syndrome with' conventional' therapy (aspirin, unfractionated heparin, nitrates, beta blockers and no revascularization strategy) remains guarded . Analysis of the control arms for randomized trials of new treatment modalities reveals an incidence of death or nonfatal myocardial infarction of 8 - 15% at 30 days and 10 - 20% at 6 months following enrollment . Observations on the natural history of unstable angina confirm an alarming incidence of death or myocardial infarction (17%) and the requirement for symptom - driven revascularization by either angioplasty (30%) or coronary artery bypass graft surgery (cabg) in 27% of patients at one year following presentation . Average published hospital lengths of stay for the diagnosis of unstable angina range from 4 - 14 days internationally (5 days in the usa). Indeed, recent data from the european enact registry of unstable angina demonstrate an average intensive care unit stay of 3.4 days with a total hospital of stay of 8.4 days . These observations point to the need for more effective and efficient treatment strategies for patients who present with non - st elevation acs . Randomized controlled trials have established the superiority of dalteparin (versus placebo) and enoxaparin (versus unfractionated heparin) for reducing the occurrence of death or nonfatal myocardial infarction, requirement for urgent revascularization or recurrence of angina pectoris in patients who present with non - st elevation acs . The sequence of subcutaneous dalteparin therapy followed by random allocation to early revascularization (average 6 days) reduced the composite endpoint of death or nonfatal myocardial infarction to 6 months compared with subcutaneous dalteparin followed by a conservative (no revascularization) strategy . A preliminary experience with pci following 48 h subcutaneous enoxaparin therapy, from the essence trial performed in france, reported an extremely low rate of major cardiac events and supports an' early invasive' strategy for this patient population . Separately conducted placebo - controlled randomized trials have proven the efficacy of platelet gp iib / iiia blockade in reducing ischemic events before and particularly during pci in patients with non - st elevation acs . This benefit of platelet gp iib / iiia inhibition is additive to that conferred by aspirin and unfractionated heparin and is most evident in those patients undergoing early pci (<72 h following enrollment). In summary, adjunctive pharmacotherapy with either low molecular weight heparin or platelet gp iib / iiia blockade can improve clinical outcomes of patients with non - st elevation acs, particularly when administered in sequence with early coronary revascularization . Coronary stents may improve clinical outcomes in patients with unstable angina pectoris when compared with the results obtained with standard balloon angioplasty . In a nonrandomized observational experience, stents (versus balloon angioplasty) nevertheless, major adverse cardiovascular events are increased in patients with unstable angina following coronary stent deployment . Patients with non - st segment elevation acs have abnormalities in platelet size and function that may be protracted following presentation . This state of' platelet hyperactivity' may in part explain the previously observed hazard of early pci . Conversely, adjunctive pharmacotherapy with prophylactic abciximab during pci (particularly stent deployment) significantly reduces periprocedural complications, improves clinical outcomes and confers a long - term (1 year) survival advantage in patients with acs . The survival advantage accrued by patients treated with abciximab cannot be ascribed to stent deployment alone . In the absence of adjunctive abciximab therapy, coronary stents have not been associated with a mortality reduction . Recent data lead us to question the prior doctrine that early coronary revascularization is fraught with hazard in patients with non - st elevation acs . For example, the 1999 united states national heart, lung, and blood institute (nhlbi) dynamic registry demonstrates no increase in major hospital complications following' ad hoc' pci, despite the more frequent presence of unstable angina and angiographically demonstrable coronary thrombus in these patients . Coronary stents were deployed in almost 70% and adjunctive platelet gp iib / iiia blockade was administered in 36% of patients undergoing ad hoc pci . In a separate report from the nhlbi dynamic registry, major hospital complications (death, q - wave myocardial infarction or urgent bypass surgery) were infrequently observed in patients undergoing pci for non - st segment elevation myocardial infarction . Adjunctive platelet gp iib / iiia blockade was administered in 45% of these pci procedures . Furthermore, the 1996 new york state cardiac surgery database for cabg following non - q wave myocardial infarction demonstrates no increase in risk for mortality (adjusted odds ratio [95% confidence interval]= 1.01 [0.51, 1.98]) when surgery is performed 3 - 8 days following presentation when compared with cabg for all other classes of angina (mortality 1.3%). This experience stands in stark contrast to the 12% in - hospital mortality reported from the vanqwish trial when cabg was performed during the initial hospitalization for non - q wave myocardial infarction . In 1996, abciximab was incorporated into a practice guideline for patients undergoing pci by ohio heart health center (ohhc) operators at the christ hospital in cincinnati, ohio, usa . To assess the impact of this strategy, three separate cohorts of unstable angina patients having pci either before (1995) or after (1997, 1998) implementation of guideline - driven abciximab therapy were compared . Average preprocedural hospital length of stay was reduced from 0.96 (1995) to 0.26 (1998) days and total hospital stay from 2.82 to 1.59 days, respectively (fig . This abbreviated hospital length of stay was observed in 352 consecutive patients treated in 1998 and compares favorably with the established 4 - 14 day length of stay for unstable angina pectoris noted previously . The same ohhc operators achieved a 57% reduction in major cardiac events (death, q - wave myocardial infarction or urgent revascularization) in - hospital and an 81% reduction in the requirement for urgent revascularization within 30 days following pci (fig . The cost increment of technology (stents and abciximab) was more than offset by cost savings attributable to the reductions in both hospital length of stay and costly adverse clinical outcomes (fig . Other factors contributing to the reduced cost of care may have included a dedicated, high volume interventional unit, capitated vendor contracts for catheterization laboratory resources and an active clinical research program . Similar improvement in clinical outcomes and a net cost reduction associated with adjunctive abciximab use during pci in patients with non - st elevation acs was reported by lundstrom et al . These investigators observed a reduction in the requirement for urgent revascularization as well as in total costs to 6 months following pci with adjunctive abciximab . A recently published observational study lends further support for an aggressive,' early invasive' approach to patients who present with non - st elevation myocardial infarction . Patient and procedural demographics, hospital and long - term outcomes in patients treated for non - st elevation myocardial infarction in hospitals favoring an early invasive treatment strategy were compared with similar data derived from hospitals favoring a noninterventional or' early conservative' approach . Coronary angiography was performed in 90% of patients and early pci (6 h) in almost half of all patients admitted to early invasive hospitals . Acknowledging significant differences in baseline demographics between the patients treated at conservative versus invasive institutions, both in - hospital and late (4 year) survival was improved in aggressively treated patients . Percentage utilization of abciximab or coronary stents to treat unstable angina by ohio heart health center operators at the christ hospital, cincinnati, ohio, usa for each treatment cohort . Adapted with permission from . Preprocedure (mean sd) and total hospital length of stay for each treatment cohort . Incidence of occurrence in - hospital of major adverse cardiac events (mace: death, q - wave myocardial infarction [qmi], urgent coronary revascularization) following pci, and the requirement for urgent revascularization (percutaneous or surgical) within 30 days by treatment cohort . Adapted with permission from . Average total hospital cost (mean sd) for treating a patient with unstable angina for each treatment cohort . Total cost includes the cost of abciximab and coronary stents . Significant improvements in the ability to risk - stratify patients who present with non - st elevation acs have evolved . The single most accurate and readily available predictor in this population is the serum troponin level . Elevation in the serum level of either troponin t or i predicts adverse clinical outcomes . A quantitative relationship between troponin level and risk of death, myocardial infarction or urgent revascularization has been established . Troponin is a surrogate marker for platelet - thrombus formation, microvascular embolization and minor myocardial injury . In addition to predicting risk, an elevated troponin level also predicts a beneficial response to abciximab therapy . Similar observations have been made between elevation in serum troponin level and a beneficial response to therapy with intravenous tirofiban or subcutaneous dalteparin in patients with non - st elevation acs . Thus, troponin predicts magnitude of clinical benefit from therapy with either platelet gp iib / iiia blockade or low molecular weight heparin . Another predictor of risk in patients with non - st elevation acs is the 12-lead electrocardiogram . Both the presence and magnitude of st segment depression on the 12-lead electrocardiogram correlate directly with mortality in follow - up . Patients who manifest signs of left ventricular decompensation or ischemic mitral valve dysfunction during episodes of angina should also be considered high risk . <48 h) predicts the subsequent occurrence of death or myocardial infarction and class c (medically refractory angina) adversely affects survival to 30 days . The correlation between braunwald symptom class and subsequent occurrence of ischemic events may be explained in part by the correlation between symptom class and the presence of thrombus on selective coronary angiography . Risk can be assessed by angina symptom class, presence or absence of hemodynamic compromise, electrocardiographic st segment depression and elevation in serum troponin (fig . Patients who have elevated serum troponin should receive therapy with platelet gp iib / iiia blockade and/or low molecular weight heparin . If pci is performed, coronary stent deployment is desirable and adjunctive gp iib / iiia blockade is indicated unless a specific contraindication is present . Optimal long - term outcomes, specifically a survival advantage, are conferred by adjunctive abciximab therapy during pci . Furthermore, cabg performed 3 - 8 days following presentation for non - st elevation infarction is not associated with increased risk for mortality . Thus, efficient and effective therapy can now be offered to patients with non - st elevation acs . Empirically defined periods of medical stabilization most likely add cost without incremental benefit . Proposed algorithm for assessment and treatment of patients with unstable angina or non - st segment elevation myocardial infarction (mi). Patients judged to be at high risk on the basis of symptom complex, electrocardiographic st segment depression or elevation in serum troponin level are eligible for adjunctive platelet gp iib / iiia inhibitor therapy and early coronary angiography . Er, emergency room; tele, telemetry; ccu, coronary care unit . Adapted with permission from.
|
Globally, diarrhoea is the second greatest cause of mortality in children aged <5 years after pneumonia . Children in low- to middle - income countries are at risk of frequent diarrhoea episodes; the 2011 national survey in ethiopia estimated that 134% of children in the <5 years age group had suffered an episode of diarrhoea in the preceding 2 weeks, although prevalence was> 20% in some regions . Numerous infectious agents cause diarrhoea; many of which are zoonotic, with campylobacter being one of the main bacterial causes, especially in children aged <2 years [46]. While the organism is also frequently isolated from healthy children and adults, and morbidity appears to decline with age, adults with hiv infection are also at increased risk of campylobacter - associated diarrhoea and bacteraemia . Different routes by which humans are exposed to campylobacter include ingestion of contaminated food and water, direct contact with infected animals or carcasses, from environments contaminated with animal faeces or sewage, or direct person - to - person transmission [4, 7]. In countries with a highly developed intensive poultry industry, there is considerable epidemiological evidence that chickens are the main source of human campylobacter infection [810]. In developing countries, far less is known about the epidemiology of campylobacter, but it has been found at high levels in retail poultry meat, and strains isolated from chickens have been observed to correlate with human isolates in terms of biotype and serotype . Around 83% of ethiopia's population, currently estimated at 96 million, chicken production is an integral part of most rural families livelihoods (an estimated two - thirds of ethiopian villagers keep poultry) and birds are commonly kept at night on perches within the family dwelling, frequently in the kitchen [14, 15]. In ethiopia, it has been reported that chickens and poultry meat have a higher campylobacter prevalence compared to other farm animal and meat products [16, 17], and exposure to pets and livestock, including chickens, has been associated with increased odds of campylobacter isolation in diarrhoeal children aged <5 years . Furthermore, in a study from egypt, campylobacter diarrhoea was more common in households where animals were present in food preparation areas . It might, therefore, be anticipated that an important route by which rural families are exposed to campylobacter is from the faeces of infected chickens, which may contaminate the shared living environment . The national poultry population in ethiopia is estimated at 493 million, and is constituted of about 97% indigenous chicken ecotypes . These birds are predominantly maintained under a traditional free - range, scavenging or semi - scavenging system with minimal inputs for housing, feeding or healthcare . Despite their low production performances in terms of egg and meat output, indigenous chickens are well adapted to the local environmental conditions and fulfil a variety of social and cultural functions, in addition to being both nutritional and economic assets . In the last 20 years, poultry production in ethiopia has started to be seen as a profitable venture, and more families in urban and peri - urban areas have started to keep small- to medium - sized flocks (about 501000 birds) under semi - intensive management . Entrepreneurs have also started to invest in the poultry industry by setting up larger flocks of exotic breeds kept under semi - intensive / intensive management, particularly in the cities of dukem, debre zeit and nazeret, close to the capital, addis ababa . Efforts have also been made by the government of ethiopia since the early 1990s to boost the productivity of indigenous birds kept by poor rural families through its genetic improvement programme, based on the introduction and distribution of exotic breeds by poultry multiplication centres throughout the country . Several non - governmental organizations are also involved in the distribution of intensively reared chickens to smallholder farmers . Although still accounting for a small proportion of ethiopia's poultry, this on - going shift to more intensive production using commercial breeds may alter the dynamics of zoonotic infections such as campylobacteriosis . While housing chickens may limit their exposure to environmental pathogens and reduce direct and indirect contacts between people and chickens, campylobacter is known to spread very rapidly in housed flocks and interventions to limit exposure and transmission are likely to be ineffective, impractical or unaffordable in village poultry production settings . Stresses, such as heat stress, or food and water restriction, is known to be detrimental to the chicken's immune function, altering tissue invasion of intestinal bacteria [24, 25]. However, different types or lines of chickens show variation in both the effect of heat stress on their immune response and their ability to regulate the immune response to campylobacter . The links between management system, chicken welfare, stress and the biology of campylobacter infections remain poorly understood, but have raised concerns about how farming systems may impact on public health risk [2830]. As yet in ethiopia there has been little research examining how the changing dynamics of chicken production may have consequences for public health . The aim of this study was to investigate the impact of production settings and systems in ethiopia on the epidemiology of campylobacter, and to consider the potential implications of this evolving production system for human health in the country . Therefore, the main objectives were (i) to determine the environmental prevalence of campylobacter in different geographical areas, including rural and peri - urban areas; and (ii) to investigate whether campylobacter prevalence varied in chickens from the same area reared under different production systems . To investigate differences in campylobacter prevalence in village chickens between geographical areas, a cross - sectional study was conducted between october 2012 and april 2013 in three woredas (administrative regions) in the oromia region of ethiopia . Woredas are further subdivided into kebeles, which are the lowest administrative unit in ethiopia, and may contain several villages or sub - areas . Woredas were purposively selected based on known characteristics of their poultry production systems and bird ecotypes and, for the two rural sites, knowledge that there had been no recent poultry development programmes in the areas . Horro woreda is located about 310 km west of the capital, addis ababa, and jarso is about 560 km east . Over 95% of the population horro is considered an area of high agricultural potential and produces an annual food surplus, whereas, in jarso, agricultural land is limited and the area tends to have a food deficit every year, with the poor reliant on food aid to cover the food gap . Debre zeit (also called bishoftu) is an urban centre located 47 km east of addis ababa within the ada'a woreda in the east shewa zone . Sampling was conducted in four kebeles in each of the two rural districts, where over 70% of households were estimated to own chickens, but where there were no known semi - intensive or intensive poultry farms . Twenty households were recruited to participate from each kebele; names of potential participants were randomly selected from a list of farmers in each kebele, provided by local development agents . Development agents are employees of the local agricultural extension service, whose role is to provide farmers with access to training, research and technologies (http://www.moa.gov.et/policies-and-strategies). Households were excluded from the study if they did not own at least two chickens: 30% extra additional names of potential participants were included in the random selection to allow for exclusions or non - participation . In the peri - urban area of debre zeit, five kebeles were selected for inclusion in the study, all of which contained at least one intensive chicken farm . As chicken ownership was believed to be markedly lower in this woreda, random selection of households was not considered feasible; instead, convenience sampling of households was undertaken based on transect walks through the kebeles and identification of households which kept free - ranging scavenging chickens . In addition, in order to investigate differences in campylobacter prevalence between different production systems, 20 intensive / semi - intensive farms within the same debre zeit kebeles were purposively selected for sampling during the same time period as the cross - sectional study . Sample sizes were determined based on available logistic and laboratory resources (i.e. Dna extraction kits) between the three study sites . The unit of sampling was defined as either a backyard chicken - producing household (i.e. A household that kept at least two chickens under free - ranging scavenging conditions, with or without feed supplementation) or an intensive poultry farm . For the purposes of this study, an intensive farm was defined as one which kept at least 50 birds under confined conditions and provided all feed . On the day of sampling, flock information such as flock size and type was collected by interviewing the householder / farmer . Flock type was broadly grouped into four categories: indigenous ecotypes; rhode island red (rir), an established multi - purpose breed, or rir hybrids (normally rir crossed with local ecotypes, which are difficult to distinguish morphologically from pure rir birds); cobb 500, a commercial fast - growing broiler breed; and mixed flocks, which contained both local ecotypes and pure or hybrid rir birds . For each unit, a single sample was collected from the ground by walking through the household environment where chicken faeces were concentrated in the case of the extensive system or inside the chicken shed in the more intensive system, using one disposable fabric overshoe (boot sock) worn over the footwear . Boot socks were pre - moistened with sterile physiological saline before use, in order to allow maximum uptake of campylobacter . To avoid cross - contamination between different flocks, for each sampling a clean disposable plastic overshoe was worn to separate the footwear from the fabric boot sock . After collection, each boot - sock sample was carefully placed into a clean ziplock sterile plastic bag and kept under refrigerated conditions until processing . Samples were processed within 6 h to 30 days depending on the district of collection . Boot socks were processed individually in the microbiology laboratory of addis ababa university college of veterinary medicine and agriculture . Each boot sock was placed in a sterile plastic stomacher bag with 200 ml sterile saline water, and the mixture was treated in a stomacher at medium speed for 1 min to release detached matter . The boot sock was then left for about 10 min at room temperature to allow the solid material to settle . Without disturbing the sediment on the bottom, 1 ml of the suspension the suspension was centrifuged for 7 min at ~12 000 g. the supernatant was discarded and the bacterial dna was extracted from the pellet using a commercial dna extraction kit (promega wizard genomic dna purification kit, usa). After dna extraction, 50 l of the supernatant, containing the suspended dna, was added to 450 l sterile distilled water, and stored at 4 c . Samples were then exported under license to the university of liverpool, where they were analysed with a pcr assay specific for the genus campylobacter on the basis of 16s rrna gene sequences (16s rdna; table 1) [35, 36]. Table 1.primers used in the 16s rrna pcr assay for identification of the genus campylobacter (product size 857-bp dna)primersequence 53c412 fgga tga cac ttt tcg gag ccampr2ggc ttc atg ctc tcg agt t primers used in the 16s rrna pcr assay for identification of the genus campylobacter (product size 857-bp dna) isolates were confirmed and identified to species level (c. jejuni or c. coli) using a multiplex pcr as described by klena et al . Based on differences in the lpxa gene (table 2). All primers used in this work were obtained from eurofins mwg operon (germany) and all pcr constituents were supplied by thermo scientific (uk). Table 2.primers used in the lpx gene pcr assay for campylobacter isolates speciation (product size: c. coli 391 bp and c. jejuni 331 bp)primersequence 53lpxac . Jejuniacaacttggtgacgatgttgtalpxarkk2 mcaatcatgdgcdatatgasaatahgccat primers used in the lpx gene pcr assay for campylobacter isolates speciation (product size: c. coli 391 bp and c. jejuni 331 bp) basic descriptive statistics, graphs and multilevel logistic regression modelling were performed using r software, using the core functions, the plotrix library, the mgcv library and the lme4 library (r foundation for statistical computing, austria). A multilevel multivariable model was constructed to investigate whether area, production system or breed kept had any effect on the odds of a flock being detected as campylobacter positive . As cobb 500 chickens were only kept under intensive systems, and all other types were only kept under backyard scavenging systems, the variables breed and production system were combined to create a variable called type of flock, with four categories: intensive - cobb 500, scavenging - rir, scavenging - mixed, and scavenging - indigenous. The functional form of the relationship between flock size (the only continuous explanatory variable) and the outcome was assessed using generalized additive models and suggested inclusion of a linear relationship was appropriate . Backward stepwise model selection was used to identify fixed effects to be retained in the model . The full model included the presence or absence of campylobacter (at the genus level, as detected by pcr) as the outcome variable and the type of area (urban or rural), the type of flock and the flock size variables as fixed effects . Variables with a likelihood ratio test statistic p value 005 were retained in the model . The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional committees on human experimentation and with the helsinki declaration of 1975, as revised in 2008 . A total of 239 boot - sock samples were collected from the three districts: 79 from horro, 80 from jarso and 80 from debre zeit . The overall campylobacter prevalence detected across the three geographical areas using pcr diagnostic techniques was 184% . Pcr assay for assignment of campylobacter species was performed on all 44 campylobacter - positive samples . In total, only 16 (364%) samples gave positive results using this multiplex pcr assay, and for all 16 samples a positive result was obtained for c. jejuni . In the rural horro region, all flocks sampled consisted purely of indigenous bird ecotypes, while in jarso, despite a reported absence of current distribution programmes for exotic birds in this rural region, 12 (15%) of the 80 flocks sampled were made up either partially (n = 9), or entirely (n = 3) of rir or rir hybrids . In the peri - urban kebeles around debre zeit, 28% of the scavenging flocks consisted partly (n = 10), or exclusively (n = 7) of rir or rir hybrids . Higher campylobacter prevalence was found in the peri - urban (463%) compared to the rural (44%) environments (fig . The prevalence was still significantly higher in the peri - urban flocks (417%), even when the intensive flocks were excluded (= 455, p <0001). Of the two rural areas, horro had the higher prevalence (89%) of positive flocks, while no flocks were detected as positive by pcr in the jarso region . 1.proportion of flocks tested positive by pcr for campylobacter, showing location, bird and farm type . Proportion of flocks tested positive by pcr for campylobacter, showing location, bird and farm type . Points are scaled relative to the number of flocks of each type tested . The final multi - level multivariable model (table 3) suggested that flocks in the peri - urban area were at considerably greater odds of being detected campylobacter positive [odds ratio (or) 219, 95% confidence interval (ci) 202350], even after controlling for the type of flock . After controlling for type of area, there was insufficient evidence to reject the null hypothesis of no difference in risk between mixed exotic / indigenous and indigenous - only backyard flocks . By contrast, backyard flocks which consisted only of rir or rir hybrids and housed flocks of cobb 500 chickens were at increased risk compared to the backyard mixed flocks (or 181, 95% ci 181839 and or 65, 95% ci 11387, respectively). Inclusion of flock size or any two - way interaction terms did not significantly improve the model (likelihood ratio test statistic p values> 005); hence these were not included in the final model . Table 3.final multi - level multivariable logistic regression model of factors associated with detection of campylobacter by pcr from environmental samples collected from chicken production sites in three regions of ethiopiavariablelevelsparameter estimates.e.or95% cip valuefixed effectsintercept4511type of arearuralreference004*peri - urban3112219202350001type of flockbackyard: mixedreference003*backyard: indigenous1108290615202backyard: rir / hybrid2912181181839001housed: cobb 50019096511387004random effectvariance estimatekebele08s.e ., standard error; or, odds ratio; ci, confidence interval; rir, rhode island red. *likelihood ratio statistic p value for overall variable . Final multi - level multivariable logistic regression model of factors associated with detection of campylobacter by pcr from environmental samples collected from chicken production sites in three regions of ethiopia s.e ., standard error; or, odds ratio; ci, confidence interval; rir, rhode island red . The greatest risk factor identified in this study for detection of campylobacter in the environment of the sampled chicken flocks was location in the peri - urban area, where many farms are starting to intensify their production systems . Campylobacter is highly prevalent in intensive production systems in developed countries, with birds often having high levels of infection, posing a public health risk . While it is therefore perhaps unsurprising that the more intensively farmed flocks in the peri - urban areas were at increased risk, it is of particular concern that the greater risk in the peri - urban area persisted despite controlling for the type of flock, suggesting increased risk in all flock types in the peri - urban area, irrespective of breed and production type . Although the high levels of campylobacter in intensive and semi - intensive flocks are clearly of concern for farm and abattoir workers and for public exposure through contaminated meat (as is the case in more economically developed countries), this study suggests that attention should also be paid to other potential routes of transmission in situations where scavenging poultry remain commonplace . The backyard flocks, which live closely with people, can potentially contaminate the human living and food preparation environment, and infections may be shared with livestock and other animals (including peri - domestic pests) in the household . Further work is needed to identify the reasons for the increased detection of campylobacter in flocks in the peri - urban area, compared to the rural areas . Key questions to be addressed should include the impact of the close proximity of backyard production to large intensive farms, the potential effect of the distribution of exotic or improved birds from poultry multiplication centres to smallholder producers, the effect of movement of birds through trade, and other factors which may be associated with differences in the ecology of campylobacter between peri - urban and rural areas . Furthermore, where there is close inter - species contact, such as was evident in many households in this study, the potential role of transmission from humans or other peri - domestic animals and livestock to chickens should also be considered . An alternative explanation for the higher prevalence of detection in the peri - urban area, independent of the type of flock, is that there is some other local factor in this region which increases the risk of detection of campylobacter in this area, such as a more favourable environment, climate or increased presence of wild bird, insect or rodent vectors . One of the features of debre zeit is the presence of numerous permanent and seasonal lakes, which provide habitat for birds and insects . The positive flocks in horro were also located in kebeles where bodies of water are a feature, whereas jarso, where no positive flocks were identified, has a much more arid climate and no substantial water bodies were present in the kebeles where sampling was carried out . Only a single peri - urban region was sampled in this study, therefore these results may not be generalizable to other areas . However, it is of note that other major urban centres of poultry production and distribution in ethiopia, such as awassa and bahir dar, are also located close to large permanent lakes . Of the backyard flocks, the odds of campylobacter detection in the environmental samples was greatest for those flocks consisting of only rir birds, or their hybrids . The cause of this is unknown, but factors underpinning this finding may include a genetic susceptibility of this breed, that this breed type is subjected to particular stress when kept under backyard management, or differences in the campylobacter - exposure risk between these and indigenous flocks, such as bird sources, contact patterns or behaviours . It has previously been reported that survival of rir - type birds in backyard conditions is poor, compared to indigenous breeds, and they are poorly adapted to scavenging and highly susceptible to disease . It should be considered that such stress might have implications beyond the health and welfare of the bird, if it alters carriage of zoonotic pathogens such as campylobacter . A potential limitation of this study was that samples collected from the two rural areas had, of necessity, a longer gap between collection and processing than samples collected in the peri - urban area, which was in close proximity to the laboratory facility . It has not been possible, in this study, to analyse whether this time lag had any impact on the detection rate of campylobacter from the study samples . While viable campylobacter decline rapidly in stored samples, especially at temperatures> 4 c, it has been shown that dna - based pcr methods continue to detect campylobacter in manure for at least 30 days even in samples stored at temperatures up to 52 c . However, this also highlights that the pcr - based method used in this study detected campylobacter dna, not viable bacteria, so further work is required to better evaluate the public health risk of these findings . Only just over one - third of campylobacter - positive samples could be identified to the species level . This is not surprising, as the multiplex pcr was not designed for speciation on dna extracted from boot - sock samples and, given the amount of dna present in such samples, sensitivity may be an issue . That all 16 samples identified to the species level were found to be c. however, the possibility that other species are present should not be discounted, particularly as these may include some species less pathogenic to people . Further investigation with more sensitive methods is needed in order to clarify the relative importance of different campylobacter spp . And molecular epidemiological approaches are required to determine the extent to which the campylobacter identified in each area and flock - type are similar . There is currently much interest in ethiopia in developing the poultry industry and enhancing the productivity of backyard chickens, and current programmes often advocate the adoption of high - producing breeds and changing from scavenging to semi - intensive management . This can be readily observed in the peri - urban areas, such as debre zeit, where exotic chickens such as the rir have been incorporated into the scavenging flocks, with the aim of enhancing egg production . There is also ongoing research to retain the desirable characteristics of the indigenous poultry types while raising the output of eggs and meat from the scavenging system by selective and cross - breeding of the local ecotypes with exotic breeds . Since this study was performed, improved indigenous birds selected over seven generations for increased productivity traits (body weight at age 16 weeks and cumulative egg number at week 45 of lay) in debre zeit have been placed on farms in the horro and debre zeit regions to evaluate their performance under semi - intensive conditions . While higher productivity is desirable to increase food availability, it is important that measures to enhance food security are also evaluated in terms of their ability to produce safe food . Backyard chickens are an important component of families livelihoods, and likely to remain so for many years to come, even in the face of increasing urbanization . While chicken production can contribute to improved livelihoods and nutrition, careful consideration is required of all impacts of programmes to develop the chicken production sector if negative human health effects may also occur . Here, we identify a greater risk of environmental detection of campylobacter in a major peri - urban production area in ethiopia, compared to rural areas . Further work is needed to determine whether other zoonotic pathogens may be similarly affected . If chicken production in urban / peri - urban areas increases the risk of environmental contamination with campylobacter (and, potentially, other zoonotic pathogens), then managing these risks will be a vital component of veterinary public health services in these areas . Furthermore, agricultural development programmes aimed at improving chicken production in rural areas, especially where this involves distribution of intensively reared birds or major changes to the management system, need to carefully consider the potential for perturbation to the ecology of campylobacter in these areas.
|
Annually more than half a million peripheral nerve injury cases are reported worldwide (daly et al ., 2012). Gold standard technique to repair a completely transected nerve with gap size larger than 30 mm . However, anaesthesia, denervation and numbness of the donor site, painful neuroma formation and time consuming operations are main limitations of this technique (hood et al ., 2009). In the last few years, numerous micro - surgical techniques (tsintou et al ., 2015) have been developed to reconstruct a long segment of a damaged peripheral nerve (sedaghati et al ., 2014). Advancements in the field of tissue engineering and biomaterial science (tsintou et al ., 2015) have led researchers to develop synthetic nerve conduits as an alternative to nerve autografting . However, to date, the clinical use of the clinically approved nerve conduits is limited to small diameter nerves with short gaps (<30 mm) as their basic hollow tube designs fail to mimic extracellular matrix (ecm) nanostructure (moore et al ., so, they become incompetent to support axonal regeneration in defects with longer gaps and larger diameter (matsumoto et al ., 2000). Extracellular matrix (ecm) is one of the important components that influence neural repair and regeneration . Ecm molecules regulate schwann cells (scs) morphology, migration and myelination by providing support and anchorage site for these cells (platt et al ., 2003; armstrong et al ., 2007 it is well documented that ecm regulates axonal growth via providing binding sites and guides the growing axons during development and regeneration (baron - van evercooren et al ., 1982; furthermore, it has been discovered that the interaction between scs and ecm molecules is essential for the release of diffusible nerve growth factors from scs which are crucial for neurite outgrowth (armstrong et al ., 2007). They not only have effect on the cell adhesion but also on transducing growth related signals by influencing intracellular signalling, particularly through the mitogen - activated protein kinase kinase (mek) pathway (juliano et al ., 2004; it has been revealed that scs up - regulate expression of integrins on contact with dorsal root ganglion neurons (einheber et al ., 1993). Several isolated and purified forms of ecm peptide sequences, like rgd, have been used experimentally to enhance neural regeneration (rogers et al ., 1983; santiago et al ., 2006 many adhesive proteins present in ecm, such as fibronectin, vitronectin, collagen and laminin, contain rgd cell adhesion sequence in their integrin recognition sites, which is cell surface receptor that recognizes the rgd sequence of various proteins . When this sequence is recognised by its integrin, it provides signals for cell attachment, growth, maturation and differentiation (hersel et al ., 2003). Extensive research over the last decade has revealed that the ecm derived rgd sequence, can act as an integral cell adhesion recognition sequence which interacts with a variety of integrins and promote cell attachment, neurite outgrowth and differentiation (ruoslahti, 1996; plow et al ., 2000; rashid et al ., 2004). As a result of these molecular changes, scs proliferate and develop a scaffold ahead of the re - growing axon fibers which encourage nerve regeneration (webber and zochodne, 2010). Incorporation of a small amount of rgd peptide, for instance 1 fmol / cm, has shown effectively improved cell adhesion to the non - adherent surface (rafiuddin ahmed and jayakumar, 2003). Rgd peptide facilitates sc outgrowth at low doses but will disrupt endogenous fibronectin signalling and regeneration at higher doses (liu et al ., addition of rgd has shown to affect the physiochemical properties of neural scaffold's surface . Surface topography and chemistry of biomaterial have been shown to be extremely important in determining cell - material interactions by influencing cellular properties such as cell adhesion, proliferation, differentiation, cell - cell reactions and cytoskeleton organisation (jell et al ., 2009). Schematic diagram of cell attachment and spreading on un - coated (a) and arginine - glycine - aspartic acid (rgd)-coated (b) surfaces (adapted from sedaghati et al ., 2014). The interaction between cellular integrin receptor and rgd sequence on the surface of a biomaterial is important in controlling the intracellular signalling pathway . For instance, a significant reduction in water contact angle of rgd - poss - pcl (polyhedral oligomeric silsesquioxane modified poly (caprolactone) urea urethane) sample compared to poss - pcl sample is a good indication of a decrease in the surface hydrophobicity of the rgd - poss - pcl samples (sedaghati et al ., 2014). This peptide may alter nanocomposite surface hydrophobicity to a more polar surface by introducing charged functional groups on polymer surface whereby water molecules in the proximity of the polymer surface bind strongly onto it (jell et al ., 2009). Hydrophilicity is known to promote schwann cell attachment by influencing the adsorption of cell adhesion ligands present in the ecm (lee et al ., 2003; sun and downes, 2009; hong and kim, 2010). Scs morphology and process outgrowth on rgd - poss - pcl revealed a significant increase in the sc spreading and process at day 3 of cell culture studied by s100 immuno - staining and haematoxylin . Whilst cells grown on tricalcium phosphate (tcp) sample retained their undifferentiated flat polyhedral morphology with no measurable process and tended to cluster together and rather than spreading . It is therefore speculated that rgd - poss - pcl surface with less hydrophobicity not only favours better cell attachment but also enhances further morphological differentiation and spreading of neural cells . These findings confirm that recognition of rgd peptide by its integrin on cell membrane may provide signals for neural cell spreading, migration and differentiation (jifeng et al ., 2010; (2014) showed that incorporation of rgd and -tcp in the pdlla conduit resulted in the microenvironment rich in nerve growth factor (ngf) and brain - derived neurotrophic factor (bdnf), which assist to neutralize the oxidative stress and to improve the cytoskeletal protein expressions in vivo . Sciatic nerve regeneration was faster when the rgd peptide was present in a rat model (xiao et al ., 2013). Addition of other bioactive molecules such as ngf and fk506 into conduit containing rgd motifs enhanced functional outcome similar to that of a nerve autograft following neural repair (yan et al ., 2012). Nerve conduits have emerged as alternatives to the nerve autografting for defects with a gap length of up to 30 mm in order to eliminate its drawbacks such as unavailability of appropriate - sized nerves and donor site morbidities . Several biological and synthetic materials have been tested for development of nerve conduits with different physiochemical properties (sedaghati et al ., 2011). Nanotechnology and nano - based materials have attracted considerable amount of attention among researchers in last three decades . A nanocomposite is a multi - phase compact material where the dimension of the one of its phases is in the size range of 1100 nm . These nanoparticles can be used as the link between the molecules of different composite polymers due to their advantageous size and directly affect nanocomposite's thermal, mechanical, electrical, catalytic, optical and chemical properties (sun and downes, 2009; torabinejad et al ., 2014; yazdimamaghani et al ., 2014 furthermore, considerable increase in the surface to volume ratio of nanocomposite in addition to the decrease in the volume distinguishes this material from usual composites (figure 2). These features allow a higher number of reactions happen on the surface of a nanocomposite . There is a great hope that bio - nanocomposite materials can potentially resemble the characteristic of native ecm (shekaran and garcia, 2011). Natural ecm proteins, such as collagen and laminin molecules, exhibit specific nano - structural features (i.e., nano - meter scale (10 - 9)). Surface modificantion of conevsntional composite biomaterial including topography and chemistry by incorporating nanoparticles can influence cell attachment, growth and differentiation during tissue regeneration . Poss nanoparticles are one of the most promising nanomaterials for medical applications (kannan et al ., 2005; ghanbari et al ., 2011b), consisting of a distinctive nanocage structure comprising an inner inorganic framework of silicon and oxygen atoms and an outer shell of organic functional groups the chemical composition of this nanoparticle makes it a unique nanoparticle that could potentially be used to improve the physiochemical properties of the copolymers (ghanbari et al ., 2011a). Incorporation of this nanoparticle into poly - caprolactone (pcl) resulted in the synthesis of poss- incorporated poly (caprolactone) urea / urethane (poss - pcl) nanocomposite polymer with considerably enhanced physiochemical properties including increased in tensile strength and surface roughness compared to conventional pcl (chawla et al ., 2014). Scaffold made of this nanocomposite are currently under investigation for nerve (sedaghati et al ., 2014) and skin (yildirimer and seifalian, 2015) tissue regeneration and implants needed for paediatric cases . Nano - fibrous scaffolds also offer great potential in the field of neural tissue engineering (olakowska et al ., 2010). Nano - fibrous scaffolds can be produced by different fabrication technique such as electrospinning and self - assembly (ellis - behnke et al . 2009) using numerous materials, such as synthetic polymers, proteins, lipids, dna and glass . Processing parameters such as solution - flow rate, applied voltage, polymer concentration and molecular weight and the distance between the needle tip to the ground collection plate can directly or indirectly affect the properties of nano - fibrous scaffolds (hu et al . Nano - fibers have larger surface area relative to their dimensions (biazar et al ., 2010). This feature can enhance tissue regeneration where it provides the possibility of coating the outside of a nano - fiber with various biochemical substances essential for cell survival, growth and differentiation (tysseling - mattiace et al . Pc12 cells grown on fibrous scaffold secreted a higher amount of dopamine compared to the control tissue cultures . Furthermore, neurites of differentiated pc12 cells were highly aligned and longer on parallel phb fibres than random fibres, thereby indicating the importance of fiber orientation for neural regeneration (figure 3). Schematic diagram of parallel (a) and randomly (b) aligned electrospun nano - fibers . Nano - fiber alignment, orinetation and chemistry can control cellular behaviour such as proliferation and differentiation . Ecm components, especially rgd peptide sequence, have been exhibited to promote neural tissue regeneration by providing a favourable environment in animal models . Potential treatments under research including alteration of the intrinsic ecm and incorporation of nanoparticles into the scaffolds allow the delivery of combination of neurotrophic factors and cells . Nanotubes and nano - fibres also have shown to be promising strategies for neural tissue engineering in which they support and enhance axonal growth based on their nanometre - scale physiochemical properties . Many of these changes have demonstrated noticeable ability to enhance neural regeneration in vivo . Whilst there is potential of using such scaffolds and biomolecules for therapeutic improvements in clinical setting, no clinical study is published yet.
|
At iii is the most important plasmatic inhibitor for the activated coagulation factors [1, 2]. Primary target is certainly thrombin followed by inhibition of the free factors of coagulation: x a factor, ix a factor, vii a factor . . A decreased activity of at iii may be resolved by the heparin or low molecular weight heparin administration . Determination of the level of at iii should be performed before and in the time of heparin administration [5]. At iii the substitution treatment with at iii and the normalisation level in the plasma have beneficial effects in sepsis and inflamatory diseases through decreased concentrations of some proinflamatory cytokines (il6, il8)[6, 7]. We present the case of a 28-years old man, with second degree obesity, dyslipidemic syndrome, healthy carrier of hbs antigen . At 26 years old, the patient faced a surgical intervention for thrombosis of the portal vein and at 28 years he was operated for thrombosis of mesenteric veins . The evolution was favourable after treatment with 1 and 1/2 cp of sintrom /day, with a quick time between 25 - 30% and inr value of 2,5 - 3,5 . The patient went to the clinic of hematology from craiova where the putative diagnosis was thrombophilia . There was determined at iii concentration, which represented 40% of the normal value; concentrations of protein c, s and leiden v factor were normal . Deficiency of at iii is autosomally dominant transmitted with variable shield factor . In 1965 egeberg described the first case of at iii deficiency . Until now, it is estimated that 2 - 4% through thrombotic episodes, encountered before 50 years are correlated with genetic deficiency of at iii . The majority of the patients are heterozygous with plasmatic levels of at iii approximatively 50% from normal values . Homozygous status is incompatible with life (severe venous thrombosis immediately after birth). Inherited types of at iii deficiencies are: type i of at iii deficiency is quantitative, the concentration and activity of at iii are decreased; is a result of reduced synthesis of biologically normal protease inhibitor molecules . Type ii - deficiency of at iii is qualitative (the substitution of an aminoacid with another aminoacid), resulting a functional deficit of the factor . Lane classified this type of deficiency in more variants: a. type ii rs (realixe site) included mutations which affect the aminoacids of the clivation zone of the at iii by thrombin (between arg 393 and ser 394) or some adjacent aminoacids . B. type ii hbs (heparin binding site)- is independent of the interaction at iii - heparin . C. typel ii pe (pleiotropic effect) - multiple mutations result in abnormalities to the reactive site as well as binding sites . The heterozygous patients with familial deficiency of at iii type i presented recurrent thrombosis; the ones with hbs type deficiency has not had an increased incidence of thrombosis, although there were cases in literature described by the descendants of these patients with thrombosis before 20 years . Deficiency of at iii type ii may be segregated by special methods such as the determination of heparin binding properties . Acquired deficiency of at iii are present in: cirrhosis, liver cancer, nephropathy, dic, sepsis, preeclampsia, treatment with l - asparaginaze or oral contraceptives, poli traumatisms, severe intoxications, heparinotherapy . In deficiency of at iii anticoagulant activity is ineffectual, fact showed by a defective extention of aptt or an important increase of the markers: soluble fibrin, 1 + 2 factor . At iii activity clinical manifestations in the deficiency of at iii: thrombotic manifestations appear around the age of twenty, and in the 4 - 5 decades of life 2/3 of patients are symptomatics . Thrombosis affect especially the venous system and more the rarely arterial system .. the veins of the legs, mesenteric veins and cave veins are frequently affected . It is made via activated x factor or activated ii factor, in the presence of a normal concentration of heparin (heparin - cofactor method). Diagnosis of at iii deficiency involves familial study (siblings) and the elimination of a pathological status which induced a decreased level of plasmatic concentration of at iii . : decrease liver synthesis of proteins, proteic deficiencies, chronic nephropathy (nephrotic syndrom with urinary wastage of at iii), abusive intake of at iii (dic, acute leukemias, hemolytic uremic syndrome, sepsis with gramm negative). Concentrates contain 1000 ui of at iii (kiberninr hs 1000) administration of 50 ui of at iii / kgc increases plasmatic concentration of at iii and reaches approximately a 120% value at a heterozygous patient with a initial plasmatic concentration of 50% treatment with concentrates of at iii is specific for the patients which faced surgical interventions and pregnant women with at iii deficiency (at iii concentrate + heparin prophylaxis). Heparin therapy is for all patients with at iii deficiency, including pregnant women with risk of embriopathy at these preparates . Women with at iii deficiency should avoid administration of oral contraceptives . In the context of frequent thrombotic accidents at a young age and decreased level of at iii the established diagnosis was of deficiency of at iii; familial study showed an inherited nature of deficiency (patient's father was heterozygous but without thrombotic accidents and the descendants of the patient, aged between 2 - 6 years, presenting a 50% of deficiency of at iiii, without thrombosis until those ages)(fig . The prominence of the deficiency of at iii heterozygous form at the patient as well as his descendants is important for the prevention of thrombotic accidents in the future in the presence of spontaneous venous thromboembolism with uncommon localisations (mesenteric veins, portal vein, renal and retinal veins) in young patients inherited antithrombin deficiency must be considered . Obesity, dyslipidemic syndrome, immobilization, surgical procedures, acute or chronic infectious diseases increase risk of thrombosis.
|
Need can be defined as whatever is required for health or comfort; though there are various ways to look at it as normative, felt, expressed, fundamental, etc . A person with psychiatric disorder needs all things that anybody needs to lead a good life . A person's need at a given point of time is likely to be influenced by different factors including type of illness, stage of illness, response to treatment, age, gender, socioeconomic status, support system, and place of stay . Some studies, however, show that needs of persons with severe mental illness are not related to age, gender and education . Whereas persons recovered from these illnesses may express many needs; persons with severe negative symptoms may express minimal needs or no needs . Numerous scales and schedules are available to explore rehabilitation needs of persons with psychiatric illness . These include needs for care assessment, camberwell assessment of needs (can), and perceived rehabilitation needs questionnaires for people with schizophrenia . The most commonly used schedule in indian studies for assessing rehabilitation needs are rehabilitation needs assessment scale (rnas) and can . Rnas schedule collects purely qualitative information from patients (on 6 items) and caregivers (on 2 items), but does not require observer rating . Can is a family of questionnaires to assess needs of persons with mental health problems . It has clinical practice versions, research version, and short appraisal schedule version (cansas) for persons with severe mental illness . The indian studies have assessed rehabilitation needs in out - patient or in - patient set - up or both . Studies have assessed rehabilitation needs from caregivers of persons with chronic mental illnesses in a community sample and in inpatients . The patients in these studies were suffering from schizophrenia, chronic psychosis, severe mental illness comprising bipolar disorder, schizophrenia, and psychosis not otherwise specified (nos). The main needs expressed in these studies were need for employment (65%) and help for family (55%); accommodation for in - patients and help for family for outpatients; social skills (80%), employment (65%), providing help to families (60%); help for family and modification in families attitude toward them; attitude modification, employment and help for family and help for family, employment, vocational training and psychosocial modification . A retrospective case records based study on needs of chronic psychiatric patients admitted in a tertiary hospital, reported the need for the development of community outreach programs, especially in areas where no psychiatric services are available . (2010) reported that patients expressed the need for welfare benefits, information about condition, money, help for psychotic symptoms and psychological distress . In the same study, caregivers expressed the need for help in welfare benefits, psychological distress, money, company, and intimate relationships . Caregivers in community sample expressed needs in areas of help for the family, employment and occupation, psychosocial modification and skills training . Caregivers of in - patients with schizophrenia patients reported felt need in managing the behavior and social - vocational problems of patients; health issues of caregivers; education about schizophrenia; rehabilitation; and managing sexual and marital problems of patients . In a study of 101 patients with schizophrenia, 42 had high unmet needs . This was associated with poverty, lower education, and persistent psychopathology . In an indian psychiatric society multicentric study on assessment of health care needs of persons with severe mental illness, patients reported needs in money, welfare benefits, transport, information about the illness and treatment, relief of psychological distress, company, household skills, and intimate relationships . Psychiatric rehabilitation services (prs) at the national institute of mental health and neurosciences (nimhans), bengaluru runs a day - care center for in - patients and outpatients . At any given point of time, the center has a range of vocational sections including candle making, bakery, bamboo, weaving, plastic molding, tailoring, horticulture, carpentry, leather, printing, crafts, recreation, domestic skills, and computer section . Nine female patients admitted in a closed ward for many years (2 - 27 years) due to difficulty in discharging them attend various sections of their choice during the day . The current study was planned to assess rehabilitation needs of this special population to help us understand and cater to their needs . To assess the rehabilitation needs of chronic female inpatients attending day - care in prs, nimhans, bengaluru, karnataka, india . To assess the rehabilitation needs of chronic female inpatients attending day - care in prs, nimhans, bengaluru, karnataka, india . Due to unique needs of this special population, an interview schedule was developed by expert consensus [box 1]. Focused group discussion was done among the authors of the paper, after going through available scales / schedules . The schedule included needs like accommodation, safety, diet, grooming, privacy, illness management, family, relationships, sexual, recreation, education, occupation, vocational training, financial, emotional, spiritual and any other needs . In addition to whatever facilities you are availing here, do you need anything else? Before applying the interview schedule . Rehabilitation needs of chronic inpatients as the patients resided in the hospital, their interactions were limited to nursing staff, hospital attenders, vocational instructors in day - care and treating team . The perspectives of nursing staff in patient's ward, vocational section instructor of the day - care section attended by the patient and treating psychiatrist (senior resident in psychiatry) were also independently sought . Nine female inpatients hospitalized for more than 1-year and attending day - care in prs were included in this study . Sociodemographic details were collected using proforma designed for the study . The diagnosis made by the treating unit was noted . Due to unique needs of this special population, an interview schedule was developed by expert consensus [box 1]. Focused group discussion was done among the authors of the paper, after going through available scales / schedules . The schedule included needs like accommodation, safety, diet, grooming, privacy, illness management, family, relationships, sexual, recreation, education, occupation, vocational training, financial, emotional, spiritual and any other needs . In addition to whatever facilities you are availing here, do you need anything else? Before applying the interview schedule . Rehabilitation needs of chronic inpatients as the patients resided in the hospital, their interactions were limited to nursing staff, hospital attenders, vocational instructors in day - care and treating team . The perspectives of nursing staff in patient's ward, vocational section instructor of the day - care section attended by the patient and treating psychiatrist (senior resident in psychiatry) were also independently sought . Nine female inpatients hospitalized for more than 1-year and attending day - care in prs were included in this study . Sociodemographic details were collected using proforma designed for the study . The diagnosis made by the treating unit was noted . Four patients were diagnosed with schizophrenia, four patients with bipolar affective disorder and one patient was diagnosed with mental retardation with epilepsy with psychosis nos . Sociodemographic details detailed interview about rehabilitation needs was not possible for the patient with mental retardation with epilepsy with psychosis nos due to her symptomatic status . Hence, rehabilitation needs have been mentioned for eight patients from patient's perspective [table 2] and nine patients from perspective of nursing staff, treating team and vocational instructors [tables 35]. Rehabilitation needs: patient's perspective (n = 8) rehabilitation needs: nursing staff's perspective for nine patients rehabilitation needs: treating team's perspective for nine patients rehabilitation needs: vocational instructor's perspective for nine patients the patients were staying in the closed ward as either they did not have any close family members (5) or their family was not willing to take them home currently (4). They were attending the following vocational sections: bamboo (3), computer (2), tailoring (1), mat weaving (1), leather (1), and craft section (1). To the question in addition to whatever facilities you are availing here do you need anything else? 8 out of 9 reported that they did not want anything else . Most of the patients and all hospital staff interviewed felt that the hospital provided the patients safe, clean accommodation, and enough privacy . In terms of food, both patients and hospital staff felt that breakfast was provided early . The treating doctors felt that more nutritious and less oily food should be provided to these patients; though one of the doctors felt that the food given here was okay as the patient had never complained . Patients expressed unmet needs in grooming such as talcum powder, soap, paste, shampoo, ornaments, etc . Which they required when they went out of the ward for day - care . Patients expressed unmet needs in recreation like listening to music, watching tv, and reading books . Everyone interviewed expressed the need for increasing monthly incentives, which can enable patients to have food of their choice occasionally and buy items for grooming . Treating psychiatrists and vocational section instructors wished that the patients should get more incentives but did not specify any amount . One of the doctors was not aware about how much incentives patient was getting and could not comment . The nursing staff felt that only two patients needed to stay in closed ward and rest of them could be placed outside or sent out to work . Some interesting suggestions by the treating doctors were about having facilities of listening to music and beauty - parlor facilities for the patients . The most commonly expressed rehabilitation needs were more incentive for attending day - care, change in food timing, more variety in food, avenues for recreation and more involvement by family . Five out of nine patients were symptomatic, but were referred to day - care as the treating team felt that they were fit to engage in activities . The patient who could not be interviewed in detail was highly productive in the section she was attending . Probably they were not asked about the needs previously or they might not have felt the need to express themselves or they did not think that these needs might be fulfilled . This highlights the fact that patients may not spontaneously come out with their needs and have to be specifically asked about it . Both patient and staff felt that patients had enough privacy, even though they stayed in general wards (15 - 20 patients in one ward) and used common toilets . The possible reason is that patients may have got used to living in the same environment . The hospital staff felt that seven of them could be sent for work, but only four among those seven patients expressed interest in working . Others were 40 or more than 40 years of age (5 of them in 40s and 2 in 60s). The nursing staff expressed concern regarding the change in societal attitude towards patients, but only three patients expressed the need for change . Patients again might have got used to the environment in the hospital, and their interaction with the society had reduced significantly . A similar view was not expressed by either treating team or vocational instructors as they might be with the patient for limited time, but nursing staff were observing these patients more closely . Vocational instructors expressed need that patients should get more incentives, have more variety in food and they should be engaged in work . The patients had material needs like variety and taste of food, some grooming items, and an increase in incentives . It is possible that patients had got used to living in the current situation with limited needs and were unaware about increasing costs of things in the outside world . The hospital authorities were sensitized about this, and the incentive has recently been increased to rs . Most of the patients had expressed passive recreation needs (listening to music, watching tv); they did not express much active recreation (going out, playing games etc . ). This suggests that they might have got used to spend time just sitting in the ward in their free time . We had included sexual needs in the schedule, but we did not probe it specifically as it was a sensitive issue . Many of the expressed needs could be met if the patients were placed back in the community . Some of them could not adjust in nongovernmental organizations when they were placed outside and came back to the hospital again . In future, careful admissions should be planned to avoid families abandoning patients in the ward . For prolonged admissions where family members cannot stay with the patient, families should make regular visits to meet the patients and should take them out for a short duration . In those with poor family support, attempts to reintegrate patients back to the community should be pursued at the earliest . Else, patients may become comfortable in the hospital, which may make attempts in community reintegration difficult . As evidenced in the present study, long - term hospitalization can reduce aspirations for independent living of patients . For chronic patients who are hospitalized due to poor family support, the hospital atmosphere such patients are in a state of handicaptivity who are left with little options other than accepting the security of a hospital due to lack of better available alternatives . National human rights commission, india (2012) recommends that authorities may find some jobs for fully recovered patients on nominal remunerations within the hospital to rehabilitate them . Positive social role models, avenues to take up a career / studies, fulfillment of social milestones (like getting married, being financially independent, becoming parents) and support in their pursuits is necessary to help them in their road to recovery . It is important to develop services like supported housing, supported education and supported employment to cater to their complex needs . Such supported approaches will be helpful in social reintegration, reduce stigma, improve quality life, and reduce disability and dependency on the hospital set - up . Small sample size, interviews were not audio - taped, emotional needs were not asked from patients once the nursing staff expressed about them . Small sample size, interviews were not audio - taped, emotional needs were not asked from patients once the nursing staff expressed about them.
|
Angioleiomyoma or vascular leiomyoma is a rare benign tumor formed by smooth muscle cells in the vascular wall or by remnants of embryonic tissue, commonly found in the uterus (95%), skin (3%), and gastrointestinal tract (1.5%).1 2 less than 1% of all vascular leiomyomas occur in the nasal cavity.3 4 hachisuga et al describe only 48 cases (8%) of angioleiomyoma in the head and neck in a study with 562 cases . Only 5 of the 48 cases were located in the nasal cavity, accounting for 1% of all angioleiomyomas.5 maesaka et al reported the first case of angioleiomyoma in the nasal cavity in 1966.6 only 30 cases have been documented in english in the literature . Forty - nine additional cases have been reported in the japanese literature.7 the origin of angioleiomyoma of the nasal cavity is uncertain, partly due to the scarcity of smooth muscle in the nasal cavity . Three hypotheses have been proposed for the origin of smooth muscle tumors in the nasal cavity: from aberrant undifferentiated mesenchymal cells; from elements of smooth muscle in the walls of blood vessels and of piloerector muscles; or from both previous hypotheses, simultaneously.2 8 9 10 11 12 13 some articles indicate that sexual hormones and epstein - barr virus infection can affect the genesis of nasal angioleiomyoma.3 12 the literature shows a prevalence of angioleiomyomas of the nasal cavity in female patients (in a 2:1 ratio between females and males) between the fourth and sixth decades of life, and affecting mainly the inferior nasal conchae.7 9 these angioleiomyomas develop in the mucosa of the nasal cavity as single solid small cutaneous masses . They can be painful or not and can expand.4 12 they usually manifest as epistaxis (56.25%) and with nasal obstruction (56.25%).11 computed tomography (ct) and magnetic resonance do not conclude the diagnosis . Surgical excision with histologic examination is the only way to make a definite diagnosis.4 in addition to that, conventional light microscopy studies for the identification of angioleiomyoma after staining with hematoxylin - eosin can be performed using special staining, such as masson trichrome stain, or immunohistochemical markers such as smooth muscle actin, desmin, myoglobin, s-100 protein, and vimentin . The treatment of choice is total lesion excision.2 8 10 11 12 13 recurrence is extremely rare after total excision . In this report, we present the case of a 49-year - old woman with a diagnosis of angioleiomyoma of the nasal cavity . A 49-year - old woman was referred to the department of otolaryngology and head and neck surgery of a tertiary hospital, in october 2008, with complaints of nasal obstruction and formation of scabs in the left nasal cavity for 12 years . In addition, pain and bulging in the external region of the nasal ipsilateral cavity were mentioned . On physical examination and anterior rhinoscopy, a reddish mass was observed obstructing the whole left nasal cavity and vestibule, associated with a bulging in the left paranasal region . Nasofibroscopy showed the presence of a reddish intracavitary sessile lesion in the inferior nasal concha, which occupied the whole left cavity and prevented the progression of the nasofibroscope . The cavum area was unobstructed . Given the clinical condition, a ct scan of the facial sinuses, biopsy of the lesion, and preoperative tests were ordered . The ct scan showed the presence of an oval lesion of soft tissue density that measured 2 cm in its longest axis, exhibited heterogeneous enhancement after injection of endovenous contrast, and was located in the left nasal cavity, in the transition between the cartilaginous and the bone parts of the nasal septum, in close contact with the latter (fig . 1). The histopathologic examination showed a squamous papilloma with keratinization of the superficial mucosa without atypias, which confirmed the need to excise the lesion . Computed tomography of the skull in axial (a) and coronal (b) sections, showing oval lesion of soft tissue density measuring 2 cm in its longest axis and located in the interior left nasal cavity, in the transition between the bone and cartilaginous parts in the nasal septum in contact with the structure . An incision was performed in the lateral mucosa of the left nasal cavity until the lesion was observed and pericapsular tissues were removed for total excision of the lesion . A nasal plug was inserted and a portion of the specimen was sent for anatomopathologic analysis . The anatomopathologic result showed an irregular portion of brownish tissue of firm and elastic consistence measuring 1.6 1.5 1.1 cm . Microscopy revealed a benign lesion composed of multidirectional bundles of neoplastic smooth muscle cells with interspersed thick - walled vessels . (a and b) histologic sections: angioleiomyoma composed of bundles of neoplastic smooth muscle with interspersed thick - walled vessels (hematoxylin and eosin, 100). There was no report or signs of epistaxis . During the outpatient follow - up, leiomyomas of the nasal cavity are located in the nasal conchae, septum, paranasal sinuses, vestibule, and cavity floor.12 histologically, the vascular type is composed of bundles of relatively organized smooth muscle cells with interspersed thick - walled vessels . It is rarely included in the differential histopathologic diagnosis.4 other tumors of the nasal cavity are: nasal angiofibroma, hemangioma, inverted papilloma, malignant lymphoma, fibromyoma, leiomyoblastoma, hemangiopericytoma, angiosarcoma, angiomyolipoma, and vascular leiomyosarcoma.10 in the present case, the clinical diagnosis, which was based on anamnesis, physical examinations, and complementary tests, presented low sensitivity and reproducibility . During the assessment, a diagnosis of inverted papilloma was suggested, which required complementary tests for confirmation, according to the literature's scientific guidelines . The ct helped delineate and correlate the anatomical planes, surgical margins, and characterization of the intranasal mass; however, it did not provide specific conclusions . The preoperative biopsy did not coincide with the postoperative histologic study, because the total excision of the lesion (providing more and better - quality material) facilitates the anatomopathologic analysis . The surgical excision combined with the histologic study is the only way to make a definite diagnosis in these cases.4 depending on the extension and location of the lesion, its excision may be performed via endoscopy,2 8 10 11 12 ktp532 laser,2 or open surgery.2 3 8 12 preoperative selective embolization should be considered for hypervascular or large lesions . The patient did not have any relapse of the lesion during the 30 months of outpatient follow - up . Angioleiomyoma of the nasal cavity is a rare benign tumor that is difficult to clinically diagnose and requires a detailed and invasive investigation . The complementary tests should guide the diagnostic reasoning; however, we concluded that it is essential to perform a postoperative anatomopathologic study to make a definite diagnosis of angioleiomyoma of the nasal cavity.
|
The cavernous malformation (cm), also known as cavernous angioma or cavernoma, is a vascular malformation characterized by the presence of sinusoid - like capillary vessels containing blood with poor circulation.4) cms vary in size from a few millimeters to a several centimeters . However, unlike giant aneurysms, defined as having diameters of 25 mm and over, no threshold dimension has been accepted for a giant cm (gcm).8) kim et al.12) studied a variety of cms sized between 1 mm and 75 mm, and reported a mean size of 14.2 mm . The majority of cms are small but they can occasionally reach significant size . Although arbitrary, lawton et al.13) defined a gcm as a cm with a diameter greater than 6 cm . Although rare, if cms are over a certain size, they may be referred to as gcms . A right - handed, 19-year - old male was referred to the division of neurosurgery due to right sided motor weakness (grade ii / ii) that persisted for 3 months . Since the age of 5, the patient had been clinically diagnosed with 1st grade mental retardation and epilepsy with daily prescription medication as follows: levetiracetam 500 mg 1 t twice a day (bid), valproate 600 mg 1 t bid, topiramate 100 mg 1 t bid, clonazepam 0.5 mg 1 t per day . Also, the patient had familial history of an 18-year - old sister with an astrocytoma on her left pons, diagnosed when she was 10 years old . After a surgical resection, she fully recovered . The patient's computed tomography (ct) scan revealed a well - defined cystic mass with a size of 7.24.66 cm filled with 2 cm intra - cystic nodule on left fronto - parietal lobe . The mass was lobulated, ovoid, and bulging, and had surrounding edema with mass effect . The patient's magnetic resonance imaging (mri) showed the mass as low signal intensity (si) in t1-weighted images (wi), but high si in t2wi (fig . The 2 cm intra - cystic nodule was heterogeneous high si in t1wi, low si in t2wi and slightly enhanced, heterogeneous high si in t1-weighted contrast - enhanced coronal image (fig . . Based on the ct and mri findings, the lesion was diagnosed as a low - grade glioma or congenital infection such toxoplasmosis or cytomegalovirus, or even a neurocysticercosis . A left frontal craniotomy was performed, followed by a transcortical approach to remove the mass . From the mri, the t1 low si, t2 high si lesion in the surgical field was identified as a cyst with yellow fluid, and was removed with aspiration . The intra - cystic nodule, which was 22 cm in size, freely movable, relatively hard, with a yellow surface, and low vascularity, was resected en bloc . However, the histological exams of the mass revealed it to be a cm (fig . 2). The follow - up ct scan showed no residual lesion (fig . Cms are relatively rare vascular anomalies composed of abnormal cavernous endothelial - lined spaces lacking smooth muscle and intervening neural tissue.2) these malformations have a reported prevalence rate of 0.4 to 0.9% based on autopsy and mri series.22) most cms occur sporadically as solitary lesions.2)10) on rare occasions, cms reach a significant size, 6 cm in diameter or larger, becoming what may be defined as a gcm.13) the pattern of growth is probably recurrent bleeding, followed by organization of the clot, pseudocapsule formation, and secondary expansion.3) although cms may occur in patients in their twenties to forties, the majority of gcms develop in children, with the youngest reported case being 3.5 months of age.1)3)4)20)22) the gender balance is equal in cms, but there seems to be a female predominance in gcms.4)22) familial cms account for 20% to 50% of patients.18) however, in review of literature for gcms, no familial occurrence has been reported.22) multiple cms may occur in 10% to 30% of sporadic cases and up to 84% in familial cases, but multiple gcms have not been reported.22)23) the gcm may clinically present with symptoms ranging from headaches to catastrophic, life - threatening hemorrhages . A significant number of gcms present with a seizure, acute - onset of a severe headache, or a new focal neurologic deficit.8) on the other hand, large, slow - growing lesions often manifest with increased intracranial pressure from obstructive hydrocephalus or the mass occupying significant space . The subtle onset of right sided motor weakness, as seen in this case, has been reported in literature as the result of the mass growth occurring slowly and without significant hemorrhage.3) the causes of cystic degeneration of cms remain unknown . Research points to recurrent minor hemorrhage of internal vascular sinuses or neocapillaries within cms as possible factors . Bleeding episodes within a cm cause the osmotic pressure across the cm membrane to change, leading to gradual fluid accumulation within the cm, cystic degeneration, and subsequent cm growth.15)19) cystic degeneration within the cms in the cerebellopontine angle is a progressive process; cms may be at different stages . As a result, when imaging examinations are performed, the cms may show various features of cystic degeneration . For example, multiple cysts may be seen within the solid component of the cm, as in this case, and a large cyst may be seen in combination with small nodules . All of these features contribute to different enhancement patterns upon contrast - enhanced ct or mri examination, which can vary from no enhancement at all to marked enhancement . Appear only rarely.18) cms in the form of a cystic growth with a well - defined capsule are unusual.18) on the other hand, in existing reports of gcms, the radiographic appearances vary widely from completely solid to primarily cystic, or heterogeneous masses composed of both components.11) also, the presence of contrast enhancement is highly inconsistent, ranging from nonexistent to intensely enhancing . A number of studies report cm lesions that mimic the appearance of high - grade glial neoplasms such as oligodendrogliomas, because they appear tumefactive on mri, having an infiltrative pattern, as well as significant perilesional edema.13)22) initially, in this particular case, the mass was diagnosed as a glioma, perhaps oligodendroglioma or anaplastic astrocytoma, due to visible calcifications, perilesional edema and mass effect.6)13)22) considering the multiple parenchymal calcifications, a well defined cystic mass, and an intra - cystic nodule, we suspected a congenital infection, such toxoplasmosis or cytomegalovirus infection, or even a neurocysticercosis.14)21)22) therefore, we carried out a serologic test for cytomegalovirus antibody immunoglobulin m, cysticercus antibody, but the serology was negative . During the histopathological biopsy, we found hemosiderin depositions, necrotic tissues, microvasculatures, and an absence of neural tissue, leading to the conclusion that the mass was a cm.1) in a retrograde analysis, the hemosiderin depositions in gradient - echo view and the absence of infiltrative pattern in mri support the likelihood that the mass is a cm rather than a glioma.1) calcifications around gcms have been previous documented.16)20) however, diffuse multiple calcifications co - occurring, such as this case, is unprecedented . Diffuse multiple calcifications may be formed separately from gcms, by diseases such as toxoplasmosis, rubella and cytomegalovirus as congenital infections.5)7)21) in our case, the patient was diagnosed with 1st grade mental retardation and epilepsy when he was 5 years of age . However, at the time, no study was done for brain imaging or congenital infections . It is highly probable that seizure and mental retardation could be congenital infections but it cannot be conclusively identified.5)7)9) genetically cerebral intraparenchymal cms are associated with 3 cerebral cm (ccm) genes, ccm-1, ccm-2 and ccm-3 . The disease is autosomal dominant and almost all mutations in the ccm genes result in loss of function . It has been suggested that a' second hit' in a patient with an existing embryonal nonfunctioning ccm gene results in complete loss of function and proliferation of endothelial cells.17) we did not investigate genetic implications in this case . The current neurosurgical management of cms, when indicated, consists of image - guided surgical resection of the entire mass, regardless of the size . Standard surgical indications include recurrent hemorrhage, progressive neurologic deterioration, and medically refractory epilepsy.4) when resection may have an unacceptably high risk, such as cms located in eloquent cerebral parenchyma, stereotactic radiosurgeries have been attempted with varying degrees of success and increased risk of postoperative hemorrhage . Many cases report favorable outcomes with surgical resection of gcms.1) our surgical approach was different from the typical gcm resection, since the lesion was almost entirely cystic . We took a transcortical approach, followed by cyst aspiration, and intra - cystic nodule removal . The postoperative ct was almost entirely clear of the mass, and the patient's right - sided motor weakness improved with no complications . In this case, a gcm with a large cyst was examined and treated by a surgical resection to alleviate the patient's neurologic deficit . This report serves to broaden the differential diagnosis of large cystic supratentorial intracranial masses . Since the imaging char acteristics, clinical presentations and natural history of gcms are variable, the possibility of gcms should be considered in differential diagnosis of intracranial mass lesions.
|
Learning anatomy and pathology from the dissection of human bodies and examination of internal organs has traditionally played an important role in the training of doctors, particularly surgeons and pathologists; hence the human body is often referred to as the best medical textbook . However, organ retention issues and the subsequent introduction of the human tissue act have led to a substantial decline in autopsy rates and therefore opportunities for research and training in the past decade in the united kingdom [1, 2]. Consented autopsies in children have become virtually non - existent . Even when autopsies are performed, parents usually request that all internal organs be returned to the body for burial . The royal colleges and the department of health have recently warned that shortage of donor bodies is putting medical teaching in the united kingdom at risk . In order to ensure that the important information provided by post - mortem assessment is not lost, there has been increasing interest from the medical profession, policy makers and the public to develop less invasive methods, such as magnetic resonance (mr) imaging and minimally invasive biopsies, to provide alternatives to conventional autopsy . Importantly, such approaches may be more acceptable to parents, as they do not involve open dissection of the body [47]. Large prospective studies are now ongoing in the united kingdom, comparing the accuracy of such approaches to conventional autopsy . As part of one such study, we have been acquiring three - dimensional (3d) mr data sets [7, 8] that can be reconstructed in 3d . Furthermore, we have used a technique known as rapid prototyping (3d printing) to build real 3d models of the right side of the heart and pulmonary trunk [9, 10], and have demonstrated that these models can improve clinical decision - making when treating patients . In the current study, we examine the feasibility and potential applicability of combining 3d post - mortem mr data from fetuses and infants with rapid prototyping to create models of post - mortem features, with the aim of improving understanding and teaching of pathological conditions . In addition, such models could be clinically useful and highly acceptable for explaining post - mortem findings to parents and demonstrating pathological findings in the medico - legal setting . We acquired post - mortem mr images in 11 fetuses and infants, prior to autopsy, using a 1.5-t mr scanner [avanto, siemens medical solutions, erlangen, germany (n = 10)] or a 9.4-t mr scanner [vnmrs, varian, palo alto, calif ., usa (n = 1)] for fetuses less than 20 weeks . These cases were selected from a post - mortem mr imaging database, to reflect common structural abnormalities and/or injuries that are encountered in routine clinical practice, and to demonstrate the use of the technique across a wide variety of organs . We used a t2-weighted 3d turbo spin echo sequence for mr imaging (table 1). In one case, ct data of the skull was also acquired (somatom definition, siemens, forchheim, germany; parameters: collimation 2 32 0.6 mm, rotation time 0.33 s, pitch 0.2, kvp 120, mas per rotation 375). Table 1typical mr imaging parameters for 3d (isotropic) t2-weighted fast spin echo (fse) sequenceparameter1.5-t mr9.4-t mrcoilhead (volume coil)rapid 39-, 72- or 150-mm volume coilseffective te (ms)360120tr (ms)3,500500echo train length1698field of view (mm)125 200 64100 50 50matrix160 252 80512 256 256voxel dimensions (mm)0.8 0.8 0.80.2 0.2 0.2averages101scan timeup to 50 minup to 70 minflip angle90/12090/180 typical mr imaging parameters for 3d (isotropic) t2-weighted fast spin echo (fse) sequence a biomedical engineer with 6 years experience in image processing reconstructed digital 3d volumes of the body and internal organs using image post - processing software (mimics 12.1, materialise, leuven, belgium), as previously described [810]. In brief, the digital 3d datasets (.stl format) were imported into a rapid prototyping system where the volumes were converted into solid objects, layer by layer . Usa), that utilises inkjet print heads to deposit a binder into plaster powder was used for opaque and colour parts ., usa) that employs an ultraviolet laser to cure liquid resin was used to build transparent models . We have demonstrated excellent accuracy of the proposed methodology in a previous study, with operator error <3.4% . The local research ethics committee approved the study and parental consent for imaging was obtained as stipulated by the ethics committee for all consented post - mortems (04q050841). For one case, the study sponsors had no role in the design or conduct of the study, in the collection, analysis, or interpretation of the data, or in the writing of the report . All the authors had access to the data and had the final responsibility in the decision to submit the paper for publication . The local research ethics committee approved the study and parental consent for imaging was obtained as stipulated by the ethics committee for all consented post - mortems (04q050841). For one case, the study sponsors had no role in the design or conduct of the study, in the collection, analysis, or interpretation of the data, or in the writing of the report . All the authors had access to the data and had the final responsibility in the decision to submit the paper for publication . Cases included eight fetuses [median gestation 20 (range 1630) weeks and weight 337 (651,800) g] and three infants [median age 12 (range 816) weeks and weight 14 (13.216.5) kg]. Post - mortem mr imaging was done at a median time of 4 (range 26) days after death . Three - dimensional reconstruction from the post - mortem mr images and rapid prototyping was feasible in all cases . Time for image elaboration was between 1 and 20 h and varied according to mr image quality and number of organs reconstructed . Rapid prototyping time was between 1 and 12 h according to volumes of the object, and costs were between 10 and 240, depending on the final model size . Structural anatomy and significant pathologies were easily identifiable by visual examination of the 3d models (figs . 1, 2, 3 and 4). Fig . 1rapid prototyping of brain from high - field (9.4-t) mr images of a 16-week fetus . A external appearance of the brain . B the brain cut open in the axial plane . G germinal matrix, c cerebrospinal fluid inside the lateral ventricles . Conventional autopsy was difficult in this case due to autolysis of the brain and dimensionsfig . Teratoma is occupying most of the abdomen, displacing the intestines and other visceral organs . H heart, s spleen, a adrenals, i intestine, lk left kidney, rk right kidney, l liverfig . 3a c fractured skull and underling parenchymal bleed in the brain of an infant . This model was built by combining and registering ct images, which provided the 3d skull structure, with mr data that were used to reconstruct the bleed volumes and positionsfig . 4external body rapid prototyping of (a) a 19-week fetus with a large exompholos, (b) an 18-week fetus terminated for a large myelemenigocele and exompholos (pentalogy of cantrell) and (c) a 20-week fetus with short limb skeletal dysplasia rapid prototyping of brain from high - field (9.4-t) mr images of a 16-week fetus . A external appearance of the brain . B the brain cut open in the axial plane . G germinal matrix, c cerebrospinal fluid inside the lateral ventricles . Conventional autopsy was difficult in this case due to autolysis of the brain and dimensions a external rapid prototyping of a 30-week fetus with sacrococcygeal teratoma . Teratoma is occupying most of the abdomen, displacing the intestines and other visceral organs . H heart, s spleen, a adrenals, i intestine, lk left kidney, rk right kidney, l liver a c fractured skull and underling parenchymal bleed in the brain of an infant . This model was built by combining and registering ct images, which provided the 3d skull structure, with mr data that were used to reconstruct the bleed volumes and positions external body rapid prototyping of (a) a 19-week fetus with a large exompholos, (b) an 18-week fetus terminated for a large myelemenigocele and exompholos (pentalogy of cantrell) and (c) a 20-week fetus with short limb skeletal dysplasia we have shown that accurate 3d models of fetal and infant anatomy, including internal organs, can be created by rapid prototyping of whole - body post - mortem mr images . Structural abnormalities of visceral organs and their relations to each other can be easily demonstrated, with a permanent record of the exact anatomical features for each individual case created . We feel that future application of such models may be useful in several ways: improved understanding of complex congenital abnormalitiescongenital abnormalities often occur in small fetuses, where the exact relations may be difficult to appreciate because of the small size of internal organs and autolysis . Furthermore, whilst the pathologist performing the autopsy may delineate the features during dissection, demonstration of such findings to others at a later date, for counselling or teaching, has traditionally been difficult . Not only does rapid prototyping allow for a permanent 3d record of the features and relative position, but also simple magnification enables larger replicates of the pathological features (fig . 1), making it easier to appreciate abnormal anatomy.continued medical training from post - mortem datamodels of organs prepared by this technique may have important applications in medical training, particularly in anatomy and pathology . The rapid prototyping models can be stored long term without degradation or specific storage requirements . Such models can be annotated and since they are entirely non - identifiable, provide an ongoing unique teaching resource . For research purposes in the setting of rare congenital abnormalities this may also be important, since uncommon anomalies can be modelled, observed and categorised, without needing to retain either the fetus or organ, and precise replicas of rare findings could be produced multiple times and therefore shared across many training centres.parental counsellingclinicians may find these models particularly useful for explaining the abnormalities to parents, such as following a termination of pregnancy . Traditional post - mortem photographs are inappropriate for discussion with many parents, since the body is visible and blood will be present making the images unsuitable . However, this technique allows construction of a dissociated clean model of the abnormal organ without requiring any autopsy photographs to be used . Some parents may indeed want to keep artificial replicas of their baby (fig . 4) or organ, which could help in bereavement process.demonstration of significant pathologies in medico - legal casesin many medico - legal cases relating to the deaths of infants and children, juries and judges often depend heavily on evidence provided by pathologists, including post - mortem photographs and/or drawings, to understand the nature and mode of injury . However, in many cases, for the reasons stated above, autopsy photographs are deemed inappropriate for use in court due to the presence of blood or other non - specific post - mortem features . Rapid prototyping models allow demonstration of only the significant pathological findings with clear annotations and may be useful in demonstrating the mode of injury in such cases in the context of legal evidence (fig . Reconstruction of the anatomical features may also be valuable in other settings, such as mass disasters or cases in which a body is decomposed, so that conventional autopsy is difficult.use of rapid prototyping for in - utero fetal diagnosis and managementwith development of rapid multi - slice snapshot mr sequences, 3d volume reconstruction of fetal organs has become possible . Therefore, rapid prototyping may have significant implications for in - utero fetal mr imaging, particularly in understanding the exact relations of the internal organs in cases of complex anomalies such as fetal diaphragmatic hernias and conjoined twins, which may allow planning of subsequent surgical management in such fetuses in the future . In addition, facial models created by rapid prototyping of in - utero mr, may be useful in identifying facial dysmorphism in cases of genetic syndromes and allow clear demonstration of the extent of facial clefting . Modelling of the skeleton would be useful for diagnosing cases of skeletal dysplasia.a replacement for plastinationover recent years, there has been controversy and public outcry related to the use of plastination to exhibit the human body and aid in medical training . For the process of plastination, body parts are immersed in acetone chilled to 13f, and the water removed from every cell . The parts retain their colour and shape, and many organs have a plastic appearance . However, plastination requires the use of human bodies and therefore raises issues of acceptability; the rapid prototyping technique we describe does not involve use of any human tissue . Improved understanding of complex congenital abnormalities congenital abnormalities often occur in small fetuses, where the exact relations may be difficult to appreciate because of the small size of internal organs and autolysis . Furthermore, whilst the pathologist performing the autopsy may delineate the features during dissection, demonstration of such findings to others at a later date, for counselling or teaching, has traditionally been difficult . Not only does rapid prototyping allow for a permanent 3d record of the features and relative position, but also simple magnification enables larger replicates of the pathological features (fig . 1), making it easier to appreciate abnormal anatomy . Continued medical training from post - mortem data models of organs prepared by this technique may have important applications in medical training, particularly in anatomy and pathology . The rapid prototyping models can be stored long term without degradation or specific storage requirements . Such models can be annotated and since they are entirely non - identifiable, provide an ongoing unique teaching resource . For research purposes in the setting of rare congenital abnormalities this may also be important, since uncommon anomalies can be modelled, observed and categorised, without needing to retain either the fetus or organ, and precise replicas of rare findings could be produced multiple times and therefore shared across many training centres . Clinicians may find these models particularly useful for explaining the abnormalities to parents, such as following a termination of pregnancy . Traditional post - mortem photographs are inappropriate for discussion with many parents, since the body is visible and blood will be present making the images unsuitable . However, this technique allows construction of a dissociated clean model of the abnormal organ without requiring any autopsy photographs to be used . Some parents may indeed want to keep artificial replicas of their baby (fig . Demonstration of significant pathologies in medico - legal cases in many medico - legal cases relating to the deaths of infants and children, juries and judges often depend heavily on evidence provided by pathologists, including post - mortem photographs and/or drawings, to understand the nature and mode of injury . However, in many cases, for the reasons stated above, autopsy photographs are deemed inappropriate for use in court due to the presence of blood or other non - specific post - mortem features . Rapid prototyping models allow demonstration of only the significant pathological findings with clear annotations and may be useful in demonstrating the mode of injury in such cases in the context of legal evidence (fig . Reconstruction of the anatomical features may also be valuable in other settings, such as mass disasters or cases in which a body is decomposed, so that conventional autopsy is difficult . Use of rapid prototyping for in - utero fetal diagnosis and management with development of rapid multi - slice snapshot mr sequences, 3d volume reconstruction of fetal organs has become possible . Therefore, rapid prototyping may have significant implications for in - utero fetal mr imaging, particularly in understanding the exact relations of the internal organs in cases of complex anomalies such as fetal diaphragmatic hernias and conjoined twins, which may allow planning of subsequent surgical management in such fetuses in the future . In addition, facial models created by rapid prototyping of in - utero mr, may be useful in identifying facial dysmorphism in cases of genetic syndromes and allow clear demonstration of the extent of facial clefting . Modelling of the skeleton would be useful for diagnosing cases of skeletal dysplasia . A replacement for plastination over recent years, there has been controversy and public outcry related to the use of plastination to exhibit the human body and aid in medical training . For the process of plastination, body parts are immersed in acetone chilled to 13f, and the water removed from every cell . The parts retain their colour and shape, and many organs have a plastic appearance . However, plastination requires the use of human bodies and therefore raises issues of acceptability; the rapid prototyping technique we describe does not involve use of any human tissue . Ultimately, the utility of these applications will need to be explored with future studies . At present, preparation of rapid prototyping models require specialist skills, expertise and equipment, which is likely to be available only in few selected centres in the united kingdom . However, it would be possible to perform post - mortem mr imaging in most large hospitals and these images could be transmitted easily to a specialist centre for subsequent analysis and preparation of the models . Furthermore, with continued refinement of the rapid prototyping technique it will be possible to create future models that have the similar consistency, feel and colour to native human organs . In summary, post - mortem mr imaging and rapid prototyping can create accurate 3d models of fetal and infant anatomical features and these models may have many potentially important medical and medicolegal applications, whilst removing the need for retention of organs.
|
Complete genome sequencing has become the standard modus operandi for bacterial genomics, and tens of eukaryotic genomes have also been completely sequenced (see http://www.genomesonline.org). Plant genomics is, however, frequently hindered by the typically large and repetitive nature of the genome . Certain plant species have genome sizes that dwarf the human genome; the 1c genome size for broad bean (vicia faba) is at least 26 000 mb (plant dna c - values database), or over eight times the size of the human genome . The selection of candidate plant genomes for complete sequencing is, therefore, based on the scientific and anthropocentric value of the plant and the feasibility of a meaningful sequencing and assembly strategy . While several diverse plant species [arabidopsis thaliana (1), oryza sativa (2,3) and populus trichocarpa] have been or will shortly be completely sequenced, the majority of plant genomes remain largely inaccessible . Arabidopsis and rice are certainly model plant systems but, are neither truly representative of any other given species nor are they general indicators for gene content across the whole plant kingdom . The first forays into comparative plant genomics using arabidopsis and rice as reference genomes have demonstrated that there is a remarkable degree of underlying sequence diversity between these species (2,3). This firmly advocates the need to at least sample the protein - coding component of more taxonomically exotic plant genomes . Cdna preparation and expressed sequence tag (est) sequencing remain a dominant methodology for accessing the protein coding (and expressed) portion of the genome . Many laboratories are independently sequencing very large numbers of sequences from a broad and bio - diverse spectrum of plant species (figure 1). Est sequences retain their exalted status for several reasons [for a review see (4)]. They are technically simple to produce and cheap to sequence.ests provide a robust approximation of the expressed gene content of the parental genome under given sampling conditions and can be used for primitive expression profiling between tissues (5).the extensive redundancy typical of est collections also allows for the selection of putative molecular markers (6,7).cdnas may be used as a substrate for arraying, to create cdna microarrays; this allows for true gene expression profiling (8). Ests provide a robust approximation of the expressed gene content of the parental genome under given sampling conditions and can be used for primitive expression profiling between tissues (5). The extensive redundancy typical of est collections also allows for the selection of putative molecular markers (6,7). Cdnas may be used as a substrate for arraying, to create cdna microarrays; this allows for true gene expression profiling (8). With an excess of 5.4 million sequences from over 320 species, the current public plant est sequence databases (embl release 80) (9) are a valuable and contextually rich but under - utilized resource . If we consider just the large est collections with over 5000 ests, 5.1 million ests from 74 species are represented . These species, while highly biased towards the key plant taxonomic clades of the rosids, asterids and monocots, still contain representative species, from other key taxonomic groups . The species represented contain representatives of single cellularity the red and brown algae and lower plants gymnosperms, basal angiosperms and the angiosperms . With such a wealth of signals for investigation of the underlying genomic changes in gene - content, protein structures and domain composition, the est collections surely deserve detailed analysis and investigation . The opensputnik database has been designed as an interim platform for the exhaustive annotation and analysis of est sequences in a comparative context . In addition to clustering sequences, a peptide sequence is identified, thus, providing a more sensitive target for the identification of functional and structural features . Sequences are placed in context with the currently available complete plant genomes and are associated with other clustered est collections . The opensputnik database, thus, creates a platform upon which the intricate patterns of generalist house - keeping genes and lineage - specific gene families may be teased apart . While the provision of an integrated resource containing a diverse mixture of clustered and contextually placed unigene sequences is not unique [e.g. Tigr gene indices database (10), ncbi unigenes (11) or plantgdb at iowa state university (12)], the opensputnik database is currently distinct in its focus towards functionally describing unigene sequences on the basis of both orthologous gene annotations and the application of bioinformatics methods for ab initio annotations . The opensputnik database has been programmed using the java programming language and utilizes the postgresql relational database management system to archive and retrieve sequences and their annotations . Therefore, opensputnik is largely platform - independent and has been implemented using a server client model to allow for calculation in a distributed and heterogeneous computational environment . The methods implemented within opensputnik are described as functional objects and the analytical pathway is described as a directed acyclic graph (figure 2). The current version of opensputnik utilizes the complete public plant est collection that was available from the european molecular biology laboratory (embl) at the start of spring 2004 (embl release 78). A rule was imposed so that est collections of at least 4500 sequences would be included . Over four million est sequences representing 55 distinct plant species prior to sequence clustering, ests were aggressively trimmed of any likely residual vector or polylinker sequences using the crossmatch application (p. green, unpublished data) and the national center for bioinformatics information (ncbi) univec database . Sequences <55 nt in length were excluded at this stage . To prevent the aggregation of sequences on the basis of low complexity sequence islands, all low complexity sequences were masked using the repeatbeater algorithm (biomax informatics, martinsried, germany). The masked sequences were clustered into pools of related sequences using a suffix tree based approach (hpt2 algorithm; biomax informatics). To encourage the aggregation of sequences, hpt2 was run using a similarity threshold of 0.7 and a number of network iterations equalling the number of masked ests . The resulting clusters were assembled into unigene sequences using the cap3 algorithm with standard settings . Within the larger est collections, to simplify the analysis, larger clusters were truncated to an arbitrary threshold of a maximum of 2500 ests . Some individual ests representing the most highly expressed genes were absent from their cognate unigenes . It is probable that each derived unigene sequence represents an expressed and properly spliced mrna . Extensive amounts of either 5-untranslated region (5-utr) or 3-utr may exist within the unigene sequences . The identification of a meaningful peptide sequence lends value to the dataset by allowing us to exclude sequences of low protein - coding potential, and additionally allows the use of peptide - annotation algorithms . Training data were produced by identifying probable open reading frame (orf) sequences from a blastx (14) analysis against the swiss - prot (15) database arbitrarily filtered at 1e10 . Estscan was used with the derived model to predict the most likely peptide for each unigene sequence . The numbers of ests, unigenes and peptides are shown for each of the 55 opensputnik plant species along with estimates of actual coding potential and redundancy across the individual libraries (table 1). The unigene sequences and peptides from each of the included species have been annotated using a selection of bioinformatics tools that are relevant to comparative genomics and biological understanding . Sequences are annotated for structural and functional characters using interpro domains (16), tmhmm for the identification of transmembrane domains (17), targetp for the prediction of organellar targeting (18) and signalp for subcellular localization (19). The blast algorithm is used to reflect similarities of individual sequences with known proteins in the swiss - prot database, predicted proteins in the uniprot database (20) and to organism specific sets of proteins not restricted to a.thaliana, o.sativa or aggregated plant proteins . The complete sequence collections are summarized using the mips catalogue of functionally annotated proteins (funcat) (21) and gene ontology terms (22). A collection of methods has been implemented to provide the typical figures and charts that are often seen in est collection publications . Graphical representation of sequence lengths, number of ests within unigenes and clone - library representation are all included . Also included are reports summarizing the functional distribution of unigenes using both goslims and the mips funcat . A query interface to the opensputnik database is provided by a web application product written for the zope web application server . The openzputnik portal at http://sputnik.btk.fi provides access to all core est collections through a single unified interface . When an opensputnik collection is selected, an interface that provides routes to the underlying data will be displayed . Additionally, a page is included to access sequences on the basis of pre - computed reports and a blast server is included so that sequences may be identified on the basis of similarity to a known sequence . Sequences may be identified on the basis of a variety of criteria not restricted to gc content, length, name or predicted function . When a sequence is selected, a single page summary report is displayed for the sequence . This summarizes key information that includes wherever appropriate, the best blast matches, functional information and physical attributes . Navigation tabs are provided so that a user may access all primary information derived or associated with a single sequence . All data within the opensputnik database is freely available to the scientific community . Please contact the author to request the inclusion of additional methods . The analytical pipeline may be applied to novel and proprietary sequence collections as either a collaboration with, or as a service of, the bioinformatics core facility provided at the turku centre for biotechnology . The source code to the opensputnik engine and core reporting architecture is being open - sourced and released to source forge (www.sourceforge.com). The opensputnik group will prepare one or two releases of the clustered plant unigenes per year . Additional plant species will be included into the pipeline as they exceed our arbitrary size threshold . Additional groups of organisms will be integrated in the future with a comparative mammalian unigene database planned for spring 2005 . Additional emphasis is being placed on the creation of generic reports that can distil the essence of large and heterogeneous sequence collections . Further synchronization of the completed resources with the gene ontology and dynamic integration and comparison of groups of species is in progress . The challenge is to stay abreast with the ever - growing collections of sequences and the novel bioinformatics methodologies that offer us the ability to better understand the nuances within our sequence collections.
|
Inflammatory bowel disease (ibd) is a chronic, complex inflammation of gastrointestinal tract which includes at least two major disorders: crohn s disease (cd) and ulcerative colitis (uc). Ulcerative colitis, with a slightly higher incidence than cd, affects only the colon and inflammation is typically confined to the mucosa whereas cd can affect any part of the gastrointestinal tract and inflammation is often transmural . Despite extensive research, the etiology of ibd is unknown, but accumulating evidences suggest that it results from an interaction between genetic and environmental factors, leading to an abnormal immune response of the intestinal mucosa to intra luminal antigens (1). Ethnic and familial aggregations of ibd and greater concordance for ibd in monozygotic twins are major evidences for a central role of genetic factors in the disease patho - genesis . Over the past years, these evidences were supplemented by molecular data from genome - wide linkage studies of multiply affected ibd families; which are likely to play a more prominent role in crohn s disease than in ulcerative colitis (2). Genome wide association studies have been shown that several chromosomal loci are associated with ibd . These loci are located on chromosomes 16q12 (ibd1), 12q13 (ibd2), 6p13 (ibd3), 14q11 (ibd4), 5q31 - 33 (ibd5), 19p13 (ibd6), 1p36 (ibd7), 16p (ibd8), 3p (ibd9) and 7q . Among these loci ibd3 region, located on chromosome 6p21, encompasses the tumor necrosis factor- (tnf-) gene (3). Tnf- gene, due to its position and function, is a strong positional and functional candidate for ibd susceptibility . Tnf- is a multi - functional pro - inflammatory cytokine and a primary mediator that is involved in the early phase of the cytokine cascade and plays an important role in the initiation and regulation of the immune response . Data from a number of studies has confirmed that tnf- is increased in the serum, stool, intestinal tissue and peripheral blood monocytes of ibd patients and the efficacy of tnf antibody in ibd patients added further evidence (4). Several single nucleotide polymorphisms (snps) have been described in tnf- gene, which five in the promoter region are of great concern; including -1031 [thiamine (t) to cytosine (c) substitution] -863 and -857 [both (c) to adenine (a) substitutions], -308 and -238 [both guanine (g) to adenine (a) substitutions]. These snps are located outside of the coding sequence such as introns and 5- or 3- regulatory sequences . These non - coding snps may significantly affect the process of transcription by altering the structure of transcription factor binding sites within gene promoters or the structure of enhancers or silencers within introns or at other regulatory sites . These alterations result in changes of protein production thus may significantly contribute to the pathogenesis of various diseases (5). Among the fore mentioned snps, -863 affects the binding site of the tnf- protein to nf-b, a well characterized transcriptional regulator which increases the transcription of tnf-; while -857 mutation affects the binding site to oct1, a transcription regulator which decreases the transcription of tnf-. It has been suggested that variability in the promoter and coding regions of the tnf- gene may modulate the magnitude of the secretory response of this cytokine (6). In this study, we evaluated the frequency of five tnf- gene promoter polymorphisms (-1031, - 863, -857, -308 and -238) in iranian cd and uc patients comparing with healthy controls . Such studies for clearing the association of important immune system related genes with ibd may be useful to determine the probability of the disease appearance familial members of the patients . In this case - control study a total of 206 patients with ibd (156 patients with uc and 50 patients with cd) and 200 unrelated healthy sex and age matched individuals of iranian origin were enrolled . The study was performed during a two year period (20082010) at taleghani hospital, shahid beheshti university of medical sciences, tehran, iran . The diagnosis of cd and uc was based on the clinical, endoscopic, radiologic, and histopatho - logic findings (7) by an expert gastroenterologist . Controls were selected from healthy subjects without any gi symptoms or positive familial or history of ibd . A written informed consent, confirmed in re - search center of gastroenterology and liver diseases (rcgld), shahid beheshti university m.c . Genomic dna was extracted from peripheral blood by the standard phenol - chloroform method (8). Pcr was performed for investigating tnf- gene promoter polymorphisms (-1031, -863, -857, -308 and -238) by specific primers (9). Volume containing 10 mmtris - hcl, ph 8.8, 1.5 mm mgcl2, 50 mmkcl, 250 mdntps, a 0.50-mm concentration of each primer, 2 u of taq dna polymerase (fermentas, germany), and 200 ng of genomic dna . The pcr protocol for all polymorphisms was as follows: initial denaturation at 94c for 10 min, followed by 35 cycles of denaturation at 94c for 30 s, annealing at 55c for 30 s, extension at 72c for 30 s and a final extension at 72c for 10 min . Appropriate synthesis of pcr products was confirmed by agarose gel electrophoresis (1.5%) and visualized by ethidium bromide staining (0.5 g / ml). Amplification of the flanking regions was followed by restriction fragment length polymorphism (rflp) method to detect each polymorphism . The rflp products were run on 2% aga - rose gel after digestion and stained with ethidium bromide (0.5 g / ml) for visualization under uv light . These frequencies were assessed for association with cd or uc, using the standard test . Results were analyzed by the spss software (version 13, usa), and p <0.05 was considered significant . The frequency of the mutant allele -1031 was significantly higher in patients with cd compared to healthy controls (26% in cd patients vs. 15.5% in controls, p=0.02, or=1.91; 95% ci, 1.14 - 3.23). The frequency of this polymorphism was also higher in cd patients compared to uc patients (26% in cd vs. 12.2% in uc, p = 0.001, or = 0.40, 95% ci: 0 . This allele frequency in uc patients was similar to healthy controls (12.2% vs. 15.5%). None of the mentioned snps were more frequent in uc patients compared to healthy controls . The details of the mutant allele frequencies and their comparisons are demonstrated in table 2 and 3 . The frequency of tnf- gene genotypes for 5 evaluated snps in iranian cd and uc patients compared to healthy controls the allele frequencies of tnf- gene polymorphisms in iranian cd and uc patients compared to healthy controls since ibd is characterized by a failure to confine the usual self - limited gut inflammatory response, genes involved in determining the level of the immune response in the inflammatory pathway might be risk factors in the disease pathogenesis . Tnf- gene codifies one of the most potent pro - inflammatory cytokine and immune modulator of inflammation, thus it constitutes an important candidate for determining genetic susceptibility in inflammatory responses . Recent studies suggest tnf- gene as a strong positional and functional candidate for ibd (4). Our results showed a significant higher -1031 mutant allele frequency in iranian cd patients compared to healthy controls . This polymorphism demonstrated a similar pattern in a study in canadian population (p=0.008, or=9.9, 95% ci: 1.3 - 78) (11) as well as in a japanese study (p=0.004, or= 1.68, 95% ci: 1.18 - 2.39) (14). Other studies in uk (12) (25) and a canadian study (10) did not report any higher frequency of this polymorphism . In our study, the -863 mutant allele frequencies were higher in uc and cd patients comparing to healthy controls but these frequencies were not statistically significant . Considering other studies assessing the same polymorphism, a wide range of results was reported . The similar results to this paper, were reported in two studies (10) (11) from canada, a study on a european population in uk (12), and two separate studies in asia including korean (13) and chinese (14) populations . On the other hand, in a japanese study the -863 mutant allele demonstrated an association with crohn s disease (p=0.004, or=1.72, 95% ci: 1.19 - 2.48) (15). In our study, the -238 mutant allele frequencies were higher in cd patients comparing to control group, but this difference was not statistically significant . Similar to our study, in other studies such as a hungarian study (16), two canadian studies (10) (11) also a japanese study (15) and a chinese study (14) for the snp -238 the differences between patients and controls were not significant . The allele frequency of snp -308 was lower than both in uc and cd patients comparing to control group without any significance in our study . Similar to our study, some studies (10, 12, 15, 17 - 19) did not find any significant difference in the frequency of the -308 mutant alleles in patients compared with healthy controls . But on the other side, -308 mutant allele frequency between patients and controls in some studies (14, 16, 20 - 24,) a significant difference was found between the uc and controls but this difference was not significant between cd patients and controls . The allele frequency of snp -857 was also lower in uc patients and higher in cd patients comparing to control group with no statistical significance in this study . Similar to our study in canadian study (10), an italian study (20) and a chinese study (14) for the snp -863 the difference between patients and controls were not significant . While in some studies such as two studies in uk (12, 25) and in a study in korea (13) frequency of snp -863 was significant in patients and controls furthermore, in a japanese study (15) allele frequency in snp -857 between cd and hc was significant and that was nt significant between uc and hc . In our study allele frequency of snp -1031 was higher in uc and cd patients comparing to control group and this differences between cd patients and control group was significant . Similar to our study a canadian study (11) and a japanese study (15) showed allele frequency in polymorphism -1031 between cd and hc was significant and this mutant allele frequency was not significant between uc and hc similar to our study . This mutant allele frequency in some studies for example in uk (12) (25) and a canadian study (10) was not significantly different . In an overall meta - analysis in new zealand on three common snp in 2008 which was performed on previous studies shows that carrying the tnf - alpha receptor snps -238,-308 or -857 were not significantly associated with the risk of ibd, both in the new zealand population as well as in the international studies (26). As it was discussed there were some studies similar to and some different from our study throughout various parts of the world, but despite some conflicting results many of these studies have provided important evidences for the influence of cytokine gene polymorphisms on disease susceptibility, onset and course as well as response to drug therapy . The variability of the results may be due to genetic / ethnic variations among different populations or the presence of different pheno - types among the patients in different studies . Besides, in iran, the studies with high sample size and use of more advanced laboratory techniques seem to be necessary . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.
|
The preoperative preparation of a patient for video - laparoscopic cholecystectomy (vlc) is well defined and includes short - term antibiotic therapy, prevention of deep venous thrombosis, and prophylactic cleaning and disinfection of the skin . Open access, during a hasson video - laparoscopic cholecystectomy (vlc) technique, is through the umbilicus . The umbilicus is an area rich in bacteria, so we thought it might be useful to use prophylactic topical antibiotic therapy in this region to reduce the incidence of postoperative infection at the umbilical port site . Umbilical port - site infection during cholecystectomy is reported to be 9% even for a difficult cholecystectomy . The role of topical antibiotic prophylaxis is particularly useful in prevention of local infections in patients with other major risks, such as immunodeficient patients, patients taking immunosuppressive drugs, uncompensated diabetic patients, and others . In the literature, no data show differences in umbilical port - site infections in the video - cholecystectomized patients who undergo different techniques of peritoneal access: hasson, veress, and others . The aim of this study was to evaluate the use of topical prophylactic antibiotic (ie, rifamycin) for prevention of post - vlc infection at the umbilical port - site . From september 2006 to april 2007, 59 patients with uncomplicated gallstones underwent vlc, in the division of general surgery, department of surgical sciences of the university of foggia, school of medicine, polyclinic of foggia, italy . Of these, 48 patients were enrolled in the study: 30 females and 18 males with a mean age of 38 years (range, 21 to 64), affected by the same clinical scenario . Rifamycin was chosen as the topical medication because it is has been used by our institution for the treatment of local infections with good results . Rifamycin is usually used topically for the treatment of infections caused by germs, such as pyodermitis, dermatitis, skin plagues, abscesses, infected wounds, exposed trauma, and fistulae, as recommended based on the technical information about the drug . We evaluated the results of the topical antibiotic therapy on a series of patients with no added risk for infection . Therefore, we excluded from this study patients with preoperative clinical conditions that might predispose to the development of port - site infection . The preoperative exclusion criteria were the following: (1) acute cholecystitis with localized peritonitis; (2) umbilical hernia; (3) immunodepressed patients; (4) uncompensated diabetes . Four patients with uncompensated diabetes and 2 patients with umbilical hernia were excluded from the study . The intraoperative exclusion criteria were the following: (1) perforation of the gallbladder in the peritoneal cavity during vlc; (2) perforation of the gallbladder during its removal through the umbilicus with bile leakage . The patients who were excluded from the study in the intraoperative phase were the following: 3 patients with intraperitoneal perforations of the gallbladder and 2 patients with perforations during specimen removal through the umbilicus . The first group (rifamycin group) was treated with rifamycin (24 patients), and the second group (control group) was not treated with rifamycin (24 patients). So, for all patients, we applied the usual prophylactic systemic antibiotic protocol used within our institution by means of the preoperative intravenous administration of 2 g of ceftriaxone, followed by a second intraoperative dose, and a final dose after 24 hours . The 2 protocol studies foresaw the application of some simple procedures in the treatment of the umbilicus during the pre-, intra-, and post - vlc phases; the registration of some objective clinical signs and subjective clinical symptoms completed the 2 protocol studies . Twelve hours before vlc, the patients underwent the following: disinfection of the umbilical and periumbilical skin with iodopovidone;application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilicus . Disinfection of the umbilical and periumbilical skin with iodopovidone; application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilicus . All patients underwent: suture of the umbilical access: muscular fascia and of the skin wound with vicryl;disinfection of the umbilical wound and periumbilical skin with iodopovidone first, and then with 0.9% saline solution;application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilical wound . Suture of the umbilical access: muscular fascia and of the skin wound with vicryl; disinfection of the umbilical wound and periumbilical skin with iodopovidone first, and then with 0.9% saline solution; application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilical wound . Postoperative phase . At 12, 24, 36, 48, and 72 hours after vlc, rifamycin was applied in a sterile fashion to the umbilical wound of all the patients . Evaluation of the results of the topical antibiotic prophylaxis, in relation to the development of signs of local infection, was executed by means of subsequent controls at 12, 24, 36, and 48 hours after vlc and on the third, fourth, fifth, sixth, and seventh post - vlc day . The evaluated parameters were the following: (1) umbilical region pain (pain scale from 0 to 5); (2) analgesic drug administration for localized umbilical region pain; (3) signs of inflammation of the umbilical wound (rubor, tumor, calor); (4) purulent leakage through the umbilical wound; (5) dehiscence of the umbilical skin sutures . On the 60th post - vlc day, the possible presence of incisional hernia in the umbilical region was registered . The protocol for the control group patients (called control protocol) had the same phases as the above - mentioned protocol but rifamycin was not one of the pre-, intra-, and postoperative medications applied . The same surgical equipment was used to perform the vlc operative technique in all 48 cases . The data were analyzed using statistical package for social sciences software (spss version 11.0) by means of the chi - square test . Twelve hours before vlc, the patients underwent the following: disinfection of the umbilical and periumbilical skin with iodopovidone;application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilicus . Disinfection of the umbilical and periumbilical skin with iodopovidone; application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilicus . After gallbladder removal through the umbilicus, all patients underwent: suture of the umbilical access: muscular fascia and of the skin wound with vicryl;disinfection of the umbilical wound and periumbilical skin with iodopovidone first, and then with 0.9% saline solution;application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilical wound . Suture of the umbilical access: muscular fascia and of the skin wound with vicryl; disinfection of the umbilical wound and periumbilical skin with iodopovidone first, and then with 0.9% saline solution; application of a sterile medication with 3ml of rifamycin (250 mg) on the umbilical wound . Postoperative phase . At 12, 24, 36, 48, and 72 hours after vlc, rifamycin was applied in a sterile fashion to the umbilical wound of all the patients . Evaluation of the results of the topical antibiotic prophylaxis, in relation to the development of signs of local infection, was executed by means of subsequent controls at 12, 24, 36, and 48 hours after vlc and on the third, fourth, fifth, sixth, and seventh post - vlc day . The evaluated parameters were the following: (1) umbilical region pain (pain scale from 0 to 5); (2) analgesic drug administration for localized umbilical region pain; (3) signs of inflammation of the umbilical wound (rubor, tumor, calor); (4) purulent leakage through the umbilical wound; (5) dehiscence of the umbilical skin sutures . On the 60th post - vlc day the protocol for the control group patients (called control protocol) had the same phases as the above - mentioned protocol but rifamycin was not one of the pre-, intra-, and postoperative medications applied . The same surgical equipment was used to perform the vlc operative technique in all 48 cases . The data were analyzed using statistical package for social sciences software (spss version 11.0) by means of the chi - square test . The topical administration of rifamycin reduced the incidence of omphalitis, a finding that is statistically significant . For evaluation of omphalitis, we chose clinical observation for local signs of inflammation, secretion from the wound, and dehiscence of cutaneous suture . The results were reported by means of histograms . In histogram one (figure 1), the mean values of the postoperative observations of pain localized in the umbilical region in patients in both groups are reported (p<0.001). In histogram 2 (figure 2), the number of patients in both groups that required added analgesic drug administration (yes or not) was reported (p<0.005). Histogram 3 (figure 3) depicts the mean values (on a scale of 0 to 5) of local signs of inflammation (wound warmness, hyperemia, umbilical wound swelling) in the umbilical region in the patients of both groups are reported (p<0.001). Histogram 4 (figure 4) depicts the number of patients in both groups who suffered purulent leakage through the umbilical wound (yes or not) (p<0.005). Histogram 5 (figure 5) depicts the number of patients in both groups who had dehiscence of the umbilical skin sutures (yes or no) (p<0.001). Signs of phlogosis of the umbilical wound (n=24). Umbilical wound leakage (n=24). Clinical data were registered at 12, 24, 36, and 48 hours after the vlc and also on the third, fourth, fifth, sixth, and seventh post - vlc day; for the patients dismissed before the third postoperative day, there was an ambulatory outpatient control . The mean postoperative stay was 3 days in the rifamycin group (range, 1 to 8), and 4 days in the control group (range, 3 to 8). The mean postoperative stay was 3 days in the rifamycin group (range, 1 to 8), and 4 days in the control group (range, 3 to 8). It is treated quite simply as an outpatient problem, but omphalitis represents discomfort for the patient, and it can cause a delay in the resumption of work . But, above all, omphalitis is a risk factor for the development of incisional umbilical hernia, which may occur in greater than 1% of cases . Postoperative umbilical port - site infection after vlc is a factor in the morbidity of this procedure, as it requires twice as much outpatient observation and treatment . The occurrence of problems that were statistically significant (p<0.001) included referred pain of the umbilical region, local development of the classical signs of inflammation (rubor, tumor, calor, and others), and dehiscence of the cutaneous suture . Our results show that in patients treated with rifamycin, umbilical port - site infections occurred less often than in the control group . Even analgesic usage and purulent secretion from the umbilical wound were statistically different (p<0.005) between the study group and the control group . On the whole, a graphic representation of the results depicts a statistically significant difference between the 2 groups of patients, in favor of the rifamycin group . Moreover, control of the umbilical port - site infections is a relevant element in the patients with metabolic diseases and/or with alterations of the immune system, because they are frequently exposed to infections . Topical antibiotic prophylaxis was efficacious in reducing infections, but its use is not meant to replace systemic antibiotic prophylaxis . Rather, its use is to serve as an adjunct to systemic antibiotic prophylaxis so that the usual antibiotic protocol is not changed (ie, short - and ultra short - term antibiotic therapy). The main result of this study is that umbilical port - site infections can be reduced by the topical use of rifamycin . In addition, patient comfort was enhanced in the rifamycin group compared with the control group . Patients in the rifamycin group had minor postoperative morbidity caused by the presence of omphalitis, shorter postoperative stay, and almost no need of outpatient ambulatory medications . The cost of the use of rifamycin in the pre-, intra-, and post - vlc period is surely less than is required for the ambulatory treatment of a postoperative wound infection . Patients can resume work sooner, and ambulatory management requires less commitment in terms of human resources (physicians, nurses) and medical materials . The literature reports the use of several methods to reduce the incidence of post - vlc umbilical port - site infections, such as specimen removal by means of an endo - bag, but in no study is the topical utilization of an antibiotic (like rifamycin) described during the pre-, intra-, and post - vlc periods . The advantages derived from the use of rifamycin are significant, even if they are for a minor postoperative complication . In this study, we examined a simple, economic way to treat the umbilicus to significantly reduce the incidence of post - vlc omphalitis . The data gathered showed positive and statistically significant results in favor of the rifamycin group . Based on the above, use of topical rifamycin on the umbilicus is proposed as a rapid, safe, and economic way to reduce postoperative morbidity following vlc.
|
High cumulative doses of anthracyclines (300500 mg / m) are frequently administered to children with cancer . Cardiac toxicity is a serious adverse effect that limits the therapeutic potential of anthracyclines and threatens the cardiac function of pediatric cancer patients leading to debilitating long - term effects resulting in poor quality of life in cancer survivors [15]. This is particularly devastating in children who are cured of their cancer because they have to endure the debilitating cardiac dysfunction for the rest of their lives with limited exercise capacity which may also lead to other chronic illnesses . B - type - natriuretic peptide (bnp) is a polypeptide hormone predominantly released from the cardiac ventricles in response to volume expansion and pressure overload . Bnp is found in the circulation as bnp-32 and the nh2-terminal portion of probnp (nt - probnp). Bnp levels are elevated in patients with left ventricular systolic dysfunction and correlate with the severity of symptoms and prognosis [614]. Measuring serum pro - bnp levels is a reliable way to monitor the cardiac function of patients receiving cardiotoxic drugs such as anthracyclines . Selenium (se) is a trace element distributed in a small amount in the soil and certain foods . It is an important antioxidant, and its absence has been associated with cardiomyopathy in people living in areas with poor levels of soil se . It is a cofactor for glutathione peroxidase which catalyzes the reduction of hydrogen peroxide using glutathione . It is an essential element to remove free radicals from the body and to prevent oxidative tissue damage [1519]. Se supplementation could potentially prevent cardiac toxicity of anthracyclines [1620]. In this study, we assessed anthracycline - induced cardiotoxicity by measuring pro - bnp levels and echocardiographic (echo) findings, and we investigated the potential protective effect of se supplementation in a group of children with high pro - bnp levels and/or cardiac dysfunction . Plasma level of pro - bnp was measured, and echocardiography (echo) was performed in 67 pediatric cancer patients (45 boys and 22 girls, ages between 2 and 18 years, median age 12 years) with a variety of tumors (leukemias, lymphomas, solid tumors) after completing anthracycline - containing treatment . Sera were stored at 20 degrees centigrade until selenium levels were measured with atomic absorption method . Patients with low level of se were supplemented with se (100 mcg / day). Comparisons between the groups were done using mann - whitney u test, wilcoxon sign test, and fisher's exact test . Levels of statistical significance were set at a p value <0.05 . The results were expressed as range (minimum and maximum) and median . In eleven patients who had high pro - bnp levels and/or cardiac failure pro - bnp levels ranged between 10 and 8022 pg / ml with a median of 226.3 pg / ml (normal <120 pg / ml). Fifty - six patients had normal pro - bnp levels (8.2119.6 pg / ml, median 32.4 pg / ml). As seen in table 1, the difference in levels of pro - bnp between these two groups was significant (p <0.001). Serum se levels were low in 10 of these 11 patients with high pro - bnp levels and/or cardiac failure (20129 mcg / l, median 62 twenty - six of 56 patients with normal pro - bnp levels were also investigated for se levels (51.3150 mcg / l, median 99.4 mcg / l). There was a significant difference between se levels of patients in high pro - bnp and normal pro - bnp groups (p <0.001) (table 1). Abnormal echo findings were observed in 7 of 11 (63.6%) patients with high pro - bnp levels and/or cardiac failure group . Only 1 (3.8%) of 26 patients with normal pro - bnp levels had abnormal echo finding . A patient with normal pro - bnp and low se level died in 1 month because of progressive disease with respiratory failure and cardiac failure . The probability of having abnormal echo findings was significantly higher in patients with high pro - bnp compared to those with normal pro - bnp (p <0.001) (table 2). Eight of 11 patients with low se and high pro - bnp levels were supplemented with se 100 mcg per day for 433 months (median 6 months). Three of 8 patients had cardiac failure according to echo and were supplemented with se in addition to digoxin and ace inhibitors . All 3 patients were doing well with normal echo findings and normal pro - bnp levels after a follow - up periods of 33, 14, and 5 months . Five patients, 3 with normal echo and 2 with diastolic dysfunction (one with low pro - bnp level, other with high pro - bnp level) also, were supplemented with selenium (100 mcg per day). One patient who had diastolic dysfunction with normal pro - bnp did well with se supplementation with normalization of echo findings, but she later died due to progression of her cancer . Another patient with diastolic dysfunction as well as 3 patients with normal echo had normal se and pro - bnp levels after 46 months of se supplementation . Only 3 patients were not supplemented with se in the high pro - bnp and/or cardiac failure group, because one of them had normal se level, the second one died with progressive disease in a very short period of time, and the third one had pro - bnp level within normal limits after the removal of intracardiac tumor thrombus with open heart surgery (table 3). In se - supplemented group, supplementation period was between 4 and 33 months (median 6 months). Before supplementation, pro - bnp levels were between 10 and 843 pg / ml (median 175 pg / ml). After supplementation, pro - bnp levels were 2536 pg / ml (median 73.5 pg / ml) which were significantly lower than pretreatment levels (p = 0.018). Pretreatment se levels were between 20 and 83 mcg / l (median 57 mcg / l) which were significantly higher than presupplementation level (p = 0.028) (table 4). After achieving normal se and pro - bnp levels, 26 months after supplementation repeat measurements of se levels were 75106 mcg / l (median 83 mcg / l), and pro - bnp levels were 10123.5 pg / ml (median 106.5 pg / ml), which were lower for se (p = 0.068) and higher for pro - bnp (p = 0.109) compared to se - supplemented period (table 4). The main long - term toxicity of anthracyclines is cardiac dysfunction associated with their chronic and/or high - dose administration . Severe cardiomyopathy and congestive heart failure may develop any time after the completion of the treatment . The precise pathogenesis of anthracycline - induced cardiotoxicity is still uncertain, and it is likely to be multifactorial in origin . Nevertheless, pivotal role is attributed to the iron - catalyzed intramyocardial production of reactive oxygen species (ros), which cause damage of various targets in the myocardial cells [15]. Probrain natriuretic peptide (pro - bnp) is released by cardiac cells, and serum levels are elevated even before the development of overt cardiac distress symptoms related to impairment of left ventricular systolic or diastolic function leading to increased left ventricular wall stretch . Recent studies have also suggested that ischemia itself may promote release of bnp [7, 2024]. In the present study, we evaluated cardiotoxicity in 67 pediatric patients with cancer (leukemia, lymphoma, and solid tumor) after they completed treatment with anthracycline - containing regimens . We also evaluated se levels and the effects of se supplementation with regard to cardiotoxicity because previous studies with keshan disease (kd) suggested potential protective role of se for cardiac dysfunction observed in se deficiency . Kd, a potentially fatal form of cardiomyopathy, first found in keshan county, northeast china, is one of the most harmful endemic diseases . The disease is characterized by multifocal myocardial necrosis and fibrosis and leads to congestive heart failure and cardiogenic shock . Although the exact etiology of kd is unclear, se deficiency is a major contributing factor . Investigations into the epidemiology of kd revealed that individuals living in areas with se - poor soil were under a high risk of development of the disease . Individuals living in those areas had low dietary intakes of se that were reflected in low serum and hair levels of se . Populations living in areas of china with se - rich soil did not develop kd [2528]. In this study we have investigated the potential role of se in anthracycline - induced cardiotoxicity in pediatric cancer patients undergoing chemotherapy . We found an association between low se levels and anthracycline cardiotoxicity which could be prevented by se supplementation . These results suggest that se deficiency may have an effect on anthracycline - induced cardiomyopathy, which may have similarities to kd . The family of selenoproteins includes glutathione peroxidases, the redox enzymes that take advantage of the chemical properties of se to remove free radicals by reduced glutathione and thus to form oxidized glutathione . Se supplementation had a protective effect on ischemia / reperfusion injury in experimental animals; it improved the recovery of cardiac function, decreased ultrastructural changes, increased the expression of glutathione - related enzymes, and partially affected the antioxidant capacity of the tissues together with an effect on gene transcription level [29, 30]. Se supplementation prevented the hypoxia / reoxygenation injury of the isolated neonatal cardiomyocytes and resulted in an no - related increase of inotropic response of cardiac muscle to the beta - adrenergic stimulation by isoproterenol . Oral se supplementation has been shown to reverse the biochemical evidence of the se deficiency [2931]. The beneficial effect of treatment with the inorganic form of se was also demonstrated in experimental models of cardiac injury [31, 32]. Kim et al . Have shown that lipopolysaccharide - activated human t cells with relatively high concentrations of selenite had lower nf - kb - binding and -decreased no production . Similarly, turan et al . Observed that total nf - kb in the cardiac muscle was reduced by se . Se effect can be monitored with pro - bnp, a good marker of cardiac function [7, 35]. Dietary supplementation of 100 g se (sodium selenite) in patients receiving total parenteral nutrition has been reported to prevent arrhythmias and cardiomegaly and lead to an increase in left ventricle ejection fraction . In addition, the incidence of keshan disease, an endemic dilated congestive myocardiopathy in areas of se deficiency in china and russia, has been shown to be decreased by oral se supplementation at a dosage of 150300 g / week [36, 37]. It should be noted that se supplementation has also been suggested as a strategy for prevention of myocardial disease in other studies of human cardiac pathology [3638]. The results of our study support the hypothesis that se supplementation could be considered as a strategy for treatment and prevention of anthracycline - induced cardiomyopathy observed in children with cancer . Our results also suggest that se supplementation should be continued much longer to ameliorate or prevent anthracycline - induced cardiotoxicity . In conclusion, our results suggest that se supplementation may have a potential role in the protection against anthracycline - induced cardiac toxicity in patients with high pro - bnp level and/or cardiac failure and low se levels.
|
Lying at the interface between dermatology and psychiatry; dermatitis artefacta (da) is an enigmatic entity, one excellent imitator and, therefore a source of great confusion for unsuspecting physicians as well as for trained specialists . The confusion and consequent misdiagnosis might unnecessarily increase morbidity and mortality of these patients . We describe here a classic case of da, which closely mimicked deliberate self - harm (dsh) in patients with borderline personality disorder (bpd). Since bpd, with 6080% dsh rates,1) warrants separate and focussed attention; unscrambling it from da becomes imperative . An 11 year old third - born rural bengali girl from lower economic strata, with nil - contributory past / family / developmental history; visited psychiatry outdoors for sudden - onset multiple fine cuts on left forearm and forehead . She had reportedly been wearing full - sleeved clothes for last 12 weeks in hot summer and had changed her hairdo to cover forehead, both going unnoticed until the mother found blood - stains on her sleeves; and fearing she had tried to kill herself, consulted us . However, history did not reveal behavioral disturbances, disruptions in activities of daily living, significant affective or psychotic symptoms . Forearm lesions were linear, horizontal and tailing towards right (dominant - hand). They were present in closely drawn pairs; a few having associated hesitation - cuts . Patient denied making any of the cuts, and claimed that they had appeared by themselves over last 7 days . When told that there was no such skin condition which would manifest like these, she became rigid in her opinion . During the interview, she appeared relaxed; speech was soft / coherent / relevant, and no perceptual / thought abnormalities could be elicited . Her full scale intelligence quotient on malin s intelligence scale for indian children (misic)2) was 88, which indicated normal intelligence . Assessment on junior temperament and character inventory3) failed to reveal significant impairment in any of the scales measuring novelty seeking, harm avoidance, reward dependence or persistence . Scores on hamilton anxiety rating scale (ham - a)4) was 14 indicating mild anxiety; and on hamilton rating scale for depression5) was 6 indicating no depression . We were unable to find any material gains from the lesions, after thorough clinical and historical evaluations . The patient was admitted to an open ward along with her mother for the purpose of administering psychotherapy, and supervised initiation of pharmacotherapy . Dermatology consultation maintained a provisional diagnosis of da after due considerations, and advised conservative management of the skin lesions . She was started on fluoxetine 10 mg, along with supportive psychotherapy and family therapy based on the advises of the treating team . Patient s denial of the origin of the lesions and their unpredictable occurrences proved a major hindrance to abc analysis and behavior - based interventions; and initial focus was thus maintained on establishing rapport . She was discharged without development of fresh lesions after 7 days of in - patient stay, and there had been nil fresh crops at 1 month s follow up . At follow up, her ham - a score had reduced to 10, and side - effects to pharmacotherapy were none . Da applies only to conditions in which skin lesions appear in a mysterious ways while the patient denies all responsibilities for them . These often reflect deeply buried psychological distresses, which need to be sincerely sought after.6) linear excoriations, inflicted through fingernails or sharp objects, are the second most common manifestation of da after ulcers.7) interestingly, a large number of these patients visit dermatologists, for whom this condition remain a source of great discomfort and a diagnosis of exclusion.7) the condition is diagnosed in dermatological practice using gupta and guptas8) classificatory system under disorders associated with self - inflicted dermatoses, which is self - explanatory in a sense . Mean age of presentation has been put at around 20 years, with a female preponderance and a greater prevalence in lower socio - economic strata.7) the history in these patients is usually hollow;9) and those with an apparent cause as psychosis or malingering need to be excluded.7) diagnosing da requires a high degree of suspicion, a meticulous appraisal of the dermatological signs and a detailed evaluation of psychological faculties . Similarly, management requires an eclectic combination of an empathetic patient - doctor relationship, a supportive environment, psychotherapeutic and pharmacological interventions,7) thus entailing a proper liaison . From a psychiatrist s perspective; lesions in our patient closely resembled hesitation cuts and dsh, generally seen in those with bpd . Bpd is characterised by classical presentations of a pervasive pattern of instability of interpersonal relationships, self - image, and affects, and marked impulsivity10) with a central feature of emotional dysregulation.1) dsh noted in bpd patients form an important dimension of this disorder and constitutes the chief reason for treatment utilization in this patient population.1) though termed parasuicidal, thus signifying a lack of intent, such behaviors could nevertheless be fatal or at least a source of significant morbidity for the patient as well as his / her family . Such behaviors have been attributed to the inherent tendency towards experiential avoidance, escape learning and impulsivity in these patients,1) and they require an assertive and active therapist . The demonstrated success of dialectical behavior therapy in managing bpd cases requires that they be identified at the earliest, before much damage has been incurred.11) dsh in da, on other hand, is driven more by the underlying negative affect states, and cognitive - behavioral approach suits these patients more, within a passive yet empathetic psychiatrist - patient relationship . Differences also exist in the way these patients are managed pharmacologically . While stress and anxiety in da would respond to ssris most of the time; they require extreme caution in bpd to avoid mood dysregulation and induced switch.12) in our patient we had carefully ruled out malingering and other major psychiatric conditions through detailed clinical and psychometric evaluations to arrive at a diagnosis of da . Our case reiterates the utility of detailed evaluation of dsh in practise, a need for liaison with dermatology, for the psychiatrist to be open to possibilities and be ready to go beyond what is seen.
|
Most recently, studies dealing with functional changes in prolapsing hemorrhoids have treated patients with the prolapsed hemorrhoids (pph) method . There is little information available on the physiological and clinical abnormalities which may develop in the anorectum of patients with grades ii or iii hemorrhoids that have undergone rubber band ligation or direct current electrotherapy . This study is a comparison of three methods of treating uncomplicated internal hemorrhoids in grades ii and iii: ferguson hemorrhoidectomy, rubber band ligation (rbl) and direct current electrotherapy . From jan 2004 to oct 2005, 150 patients with symptomatic grades ii and iii hemorrhoidal disease were included . There were 73 (48.6%) men and 77 (51.4%) women who presented with fresh rectal bleeding, perianal pain and itching, mucus discharge or a prolapsing lump . Exclusion criteria were: age over 50 or less than 25 years, history of previous procedures in the anorectal area, anal manometric pressures less than normal, presence of concomitant anorectal disease (including anal fissure) and diabetes mellitus . All treatment modalities were discussed with patients and those asking for a specific procedure were excluded . Patients were randomly divided into groups a, b and c. randomization was performed by block randomization and the five patients scheduled for operation in each day were treated by one modality . Group a underwent the ferguson hemorrhoidectomy, group b underwent rbl and group c underwent electrotherapy . The hemorrhoids were excised in one or two main positions, the vascular pedicles were sutured and the muscosa was closed using 3/0 absorbable suture material with running sutures . Direct current electrotherapy was done under general anesthesia with the patient in the lithotomy position . During surgery, the speculum was inserted such that only one hemorrhoidal tag was exposed to the surgeon at each attempt . A single tip probe was inserted into the base of the hemorrhoid about 1 to 1.5 cm in the longitudinal axis of the tag and at a slight angle to the anal canal . Then, a 30ma direct current was applied for 2.5 to 3.5 minutes according to the size of the tags or stopping criteria . All patients were re - evaluated at one week, two weeks and three months post - surgery . Research personnel blinded to the surgery technique asked patients about their symptom relief and possible complications, which included pain and incontinence . Anorectal manometry was performed from one to ten days before surgery and repeated three months after treatment . Manometry was done with a fine fluid filled, open tipped, multilumen 4-channe l system which perfused at a rate of 1 ml normal saline per minute, (medtronic polygram 98, denmark). The volume of the first sensation (vfs), the maximum tolerated volume (mxtv) and the rectoanal inhibitory reflex (rair) were recorded . The maximum resting pressure (mxrp), maximum squeezing pressure (mxsp), mean resting pressure (mrp) and mean squeezing pressure (msp) were also obtained . A score of 7 or greater was considered as severe pain; between 4 and 7, moderate pain; and less than 4, mild pain . The study was approved by shiraz university ethics committee and written informed consent was provided from each patient . Statistical significance was assessed with two - tailed student s t - test for dependent and independent samples, as appropriate . Data was analyzed using spss statistical software package for windows, version 16.0 (spss inc ., there were 150 patients, 72 (48%) with grade ii and 78 (52%) with grade iii hemorrhoidal disease . Patients were divided into group a (n=47, 31.4%), group b (n=51, 43%) and group c (n=52, 34.6%). The mean ages of the patients were: group a 40 2 years; group b 40 5 years; and group c 41 9 years, which was statistically comparable . The mean duration of symptoms was 119 days (range: 10 - 804). The most common symptom was prolapse in 80%, followed by bleeding in 79.8% and pain in 75.2% . Regarding postoperative complications, hemorrhoidectomy was associated with a significantly higher incidence of itching compared to rbl or electrotherapy . Postoperative bleeding was identical between the three groups . The most dramatic difference between postoperative clinical side effects among these three groups was pain . While most subjects who underwent hemorrhoidectomy suffered severe postoperative pain (mean=8), the dominant pain score in the rbl group was moderate (mean=5) and the majority of patients who underwent electrotherapy had only mild postoperative pain (mean=2) (p<0.05). There was no statistically significant difference in fecal continence following the three therapeutic modalities . There was a significant statistical difference in preoperative mrp and msp between degree ii and iii hemorrhoids (table 1). * p - value was assessed with student s t test for dependent samples . Mrp, msp, mxrp and mxsp remained unchanged after rbl and electrotherapy (tables 2 and 3), whereas mxrp and mxsp declined significantly after hemorrhoidectomy (table 4). * p - value was assessed with student s t test for dependent samples . * p - value was assessed with student s t test for dependent samples . * p - value was assessed with student s t test for dependent samples . Mrp and msp remained unchanged, even in the hemorrhoidectomy group (table 4). Vfs significantly increased in the hemorrhoidectomy group when compared with the preoperative period (table 4). Vfs did not change significantly after rbl and electrotherapy (tables 2 and 3). The aim of this study was to compare physiological changes after treatment of hemorrhoidal disease using three different methods . Raised anal pressures have been documented in patients with prolapsed hemorrhoids, which are possibly due to vascular hypertension within the anal cushions . The morphological basis of this phenomenon can be the hypertrophied external sphincter, probably from hyperactivity in response to an irritated anal mass and from voluntary hyperactivity because of fear of mucous discharge originating from the pile . Furthermore, patients having less pronounced hemorrhoids (grade ii) had significantly lower mrp and msp than patients having grade iii hemorrhoids . Increased vfs which develops in parallel to the development of prolapsed hemorrhoids seems not to be reversible after hemorrhoidectomy . On the contrary, it worsens after surgery which is possibly due to scar formation . Though the differences in vfs were statistically significant, the patients did not report any problems . Hemorrhoidectomy, as expected, caused the most significant changes in anorectal physiology and for this reason has been discouraged for widespread first option use in the treatment of grades ii and iii hemorrhoids . Rbl, despite the lack of significant effect on anorectal manometry seems to be inferior to the electrotherapy method due to the presence of rare, but major side effects and more pain associated with this modality . Finally, we determined that electrotherapy is a good choice for the treatment of grades ii and iii internal hemorrhoids due to its high success rate, low cost, ease of procedure, lack of significant side effects, significantly less postoperative pain, and most importantly, minimal anorectal physiological change . Thus, we can recommend this procedure as one of the options of choice for treating internal hemorrhoids.
|
Alterations in microvascular perfusion are common characteristics of patients with systemic inflammation and sepsis and substantially contribute to the development of organ failure [1, 2]. Microcirculatory defects in critically ill patients such as capillary leakage and disturbed capillary perfusion are not necessarily reflected by macrohemodynamic parameters (e.g., mean arterial blood pressure, cardiac index, and central venous oxygen saturation) that are commonly assessed at the intensive care unit (icu). In fact, a recent study revealed that although global hemodynamic variables were relatively preserved in patients with severe sepsis, their microvascular perfusion as assessed by complex invasive flow imaging techniques was severely altered, predicted the progression of organ failure and the overall mortality risk . The underlying mechanisms of microvascular dysfunction in sepsis result from different factors such as endothelial dysfunction, leukocyte - endothelium interactions, coagulation and inflammatory disorders, hemorheologic abnormalities, and functional shunting . The activation of the endothelium, as reflected by increased levels of circulating biomarkers, has been suggested as a main promoter in the pathogenesis of disturbed microcirculation . Based on the potent vasodilative effects of nitric oxide (no), the arginine - no pathway might be substantially involved in inflammation, infection, and organ injury . The natural inhibitor of no synthase, asymmetric dimethylarginine (adma), has been found elevated in patients with sepsis and related to mortality risk [711]. Adma is assumed to exert detrimental effects on endothelial function, cardiovascular homeostasis, and cardiovascular outcomes . In contrast, relatively little is known about the other methylated form of l - arginine, symmetric dimethylarginine (sdma). Thus, sdma has long been regarded as an inert, functionally inactive molecule . However, using highly specific in vitro models with primary endothelial cells, sdma was found to reduce endothelial no synthesis via competition with arginine at the cellular transporter and increased intracellular reactive oxygen species in a dose - dependent manner, already at very low, physiological concentrations . Circulating levels of sdma in serum have been consecutively investigated in several cohorts of patients with cardiovascular and renal diseases, demonstrating an association of sdma with glomerular filtration rate and extent of coronary artery disease and atherosclerosis . We hypothesized that sdma might be involved in endothelial dysfunction during critical illness and sepsis, resulting in organ failure . Therefore, we investigated sdma serum levels in a large cohort of 247 consecutively enrolled critically ill patients in order to identify associations between sdma and organ dysfunction, metabolism and disease severity as well as to assess the prognostic value of sdma for icu and long - term mortality . All patients that were admitted to the medical icu were consecutively enrolled, except for patients who were expected to have a short - term (<72 h) intensive care treatment due to postinterventional observation or acute intoxication . Patients who met the criteria proposed by the american college of chest physicians and the society of critical care medicine consensus conference committee for severe sepsis and septic shock were categorized as sepsis patients and the others as nonsepsis patients . After discharge from our hospital, the outcome was assessed during a follow - up period by directly contacting the patients, their relatives, or primary care physician . Written informed consent was obtained from the patient, his or her spouse, or the appointed legal guardian . As a control population, we analyzed 84 healthy blood donors (57 male, 27 female) with normal values for blood counts, c - reactive protein, and liver enzymes . Blood samples were collected upon admission to the icu (prior to therapeutic interventions) as well as in the morning of day 7 after admission . After centrifugation at 4c for 10 minutes, serum and plasma aliquots of 1 ml were frozen immediately at 80c . Sdma serum concentrations were analysed using a commercial enzyme immunoassay (immundiagnostik, bensheim, germany). The scientist performing experimental measurements was fully blinded to any clinical or other laboratory data of the patients or controls . Due to limited technical resources and changes in the original patient cohort due to discharges from the icu and deaths, follow - up sdma measurements were only performed in 42 patients . Due to the skewed distribution of most of the parameters, differences between two groups were assessed by mann - whitney u test, and multiple comparisons between more than two groups have been conducted by kruskal - wallis anova and mann - whitney u test for post hoc analysis . Box plot graphics illustrate comparisons between subgroups, and they display a statistical summary of the median, quartiles, range, and extreme values . The whiskers extend from the minimum to the maximum values excluding outside and far out values which are displayed as separate points . An outside value (indicated by an open circle) was defined as a value that is smaller than the lower quartile minus 1.5-times interquartile range or larger than the upper quartile plus 1.5 times the interquartile range . A far out value was defined as a value that is smaller than the lower quartile minus three times interquartile range or larger than the upper quartile plus three times the interquartile range . Single parameters that correlated significantly with sdma levels at admission were included in a multivariate linear regression analysis with sdma as the dependent variable to identify independent predictors of elevated sdma . The prognostic value of the variables was tested by univariate and multivariate analyses in the cox regression model . Statistical analyses were performed with spss (spss, chicago, il, usa). In order to investigate sdma in critical illness, we measured sdma serum concentrations in a large cohort of medical icu patients at admission (= before therapeutic intervention) and on day 7 (table 1). Sdma serum levels were significantly higher in icu patients (n = 247, median 0.84 mol / l, and range 0.154.0) as compared with healthy controls (n = 84, median 0.38 mol / l, range 0.201.06, and p <0.001; figure 1(a)). No associations between sdma levels and sex or age were observed in controls (data not shown). About two thirds (n = 160) of the icu patients consecutively enrolled into our study presented with either sepsis or septic shock upon icu admission (table 2). Importantly, patients with sepsis (n = 160, median 0.89 mol / l, and range 0.194.0) had significantly higher sdma serum concentrations at icu admission compared to patients with non - septic origin of critical illness (n = 87, median 0.67 the site of infection (table 2) was not associated with sdma levels (detailed data not shown). However, sdma levels were related to disease severity, as patients with apache - ii score values greater than 10 displayed significantly elevated sdma serum concentrations (figure 1(c)). Elevated sdma levels had been observed in patients with metabolic and cardiovascular disorders . In our cohort of critically ill patients, sdma levels did not differ between patients with or without type 2 diabetes or obesity, defined as a body mass index> 30 kg / m (detailed data not shown). In 42 patients, paired blood samples were available for sdma measurements at icu admission and at day 7 of icu treatment . Individual sdma levels remained stable during the first week of icu therapy (table 1, figure 1(d), not significant by paired wilcoxon test). In order to understand possible mechanisms underlying elevated serum sdma levels in critically ill patients, we performed extensive correlation analyses with various laboratory parameters . At admission to the icu, serum sdma concentrations were closely correlated to biomarkers displaying organ dysfunction . In detail, sdma was found to correlate significantly with markers reflecting renal failure such as creatinine (r = 0.687, p <0.001), cystatin c (r = 0.714, p <0.001) or inversely with their glomerular filtration rates (figure 2(a)). Moreover, sdma levels correlated with clinically used biomarkers of hepatic dysfunction like reduced protein (r = 0.172, p = 0.013), pseudocholinesterase (r = 0.292, p <0.001), or bilirubin excretion (figure 2(b)). In line with the elevated sdma concentrations observed in patients with sepsis, various biomarkers indicating systemic inflammation were associated with circulating sdma . In fact, sdma levels correlated with white blood cell counts (0.190, p = 0.003), c - reactive protein (r = 0.261, p <0.001), procalcitonin (r = 0.407, p <0.001), tumor necrosis factor (r = 0.324, p = 0.004), and soluble urokinase plasminogen activator receptor (supar, r = 0.494, p <0.001), a prognostic biomarker in sepsis . Sdma levels correlated with adma (r = 0.384, p <0.001) as well . When selected parameters that were correlated with sdma serum levels by univariate analysis (i.e., creatinine, pseudocholinesterase, bilirubin, supar, adma, c - reactive protein, and procalcitonin) were included in a multivariate regression analysis, only creatinine (p <0.001) and procalcitonin (p = 0.023), but not liver function markers, adma, or supar, remained independent predictors of sdma concentrations (table 3). Based on the close correlation between sdma levels at admission and disease severity scores, we hypothesized that circulating sdma might be capable of identifying patients at high risk of mortality . Indeed, patients that died during the course of icu treatment (about one quarter of the total cohort) had significantly higher serum sdma levels at admission compared with the icu survivors (median 1.33 versus 0.74 we thus performed cox regression analyses and kaplan - meier curves to assess the impact of the initial sdma serum concentrations on icu mortality among critically ill patients . Low sdma levels upon admission to the icu were a strong prognostic predictor for icu survival (p = 0.021, cox regression analyses). In multivariate cox regression analyses, including markers of inflammation / infection (crp, wbc), circulatory (lactate), hepatic (bilirubin, protein, and inr), and renal (creatinine) deterioration at admission, sdma remained an independent significant prognostic parameter (hazard ratios and p values are presented in table 4). Kaplan - meier curves displayed that patients with sdma levels of the upper quartile (> 1.7 mol / l) had the highest mortality (log rank 8.14, p = 0.0171, figure 3(a)). We found the best cutoff value to discriminate survivors from non - icu survivors for serum sdma of 1.2 mol / l (log rank 15.15, p = 0.0001, figure 3(b)). During the follow - up observation period of approximately three years, the overall case fatality rate increased to 47.3% of the study cohort (table 1). Sdma serum concentrations at admission to the icu were significantly higher in patients with unfavourable outcome (median 1.09 versus 0.67 mol / l, p <0.001). By cox regression analysis, initial serum sdma levels significantly predicted long - term prognosis (p = 0.010). Kaplan - meier curves proved that sdma levels of the highest quartile (> 1.7 mol / l) were strongly associated with fatal outcome (log rank test 13.49, p = 0.0012, figure 3(c)). Sdma levels of 0.75 mol / l discriminated the long - term prognosis of critically ill patients (log rank test 14.15, p = 0.0002, figure 3(d)). Interestingly, when sdma levels were adjusted to renal function by calculating the sdma / creatinine ratio, patients that died during the observation period still displayed significantly elevated sdma / creatinine values (p = 0.012, detailed data not shown), confirming that the association of sdma with long - term mortality was independent of renal function . The excessive endothelial activation in systemic inflammation and sepsis affects hemostasis, leukocyte trafficking, vascular permeability, and the extent of disturbed microcirculation . There is experimental and clinical evidence that dysregulation of the arginine - no pathway critically contributes to this process . It had been previously demonstrated that adma as an endogenous no synthase inhibitor is a promoter of vascular dysfunction in patients with sepsis [710]. Our study now shows that also sdma, another methylated form of l - arginine, is also significantly upregulated in critically ill patients, especially in conditions of sepsis, associated with inflammation and organ failure as well as a yet unrecognized indicator for mortality risk in medical icu patients . A prominent finding in our heterogeneous cohort of critically ill medical patients was the independent association of sdma serum levels with biomarkers reflecting renal dysfunction and systemic inflammation by multivariate analyses . The fact that renal function was an important independent determinant of circulating sdma levels was not surprising, because sdma is excreted via the urine, and sdma has been found elevated in studies of patients with end - stage renal disease [12, 22]. There is also experimental evidence that dimethylarginines can be metabolized by the liver as well, which would well explain its increase in icu patients with hepatic dysfunction . Furthermore, the close correlation between sdma levels and inflammatory biomarkers such as procalcitonin or tumor necrosis factor may indicate that protein catabolism induced by systemic inflammation might contribute to elevated systemic sdma levels in critically ill patients . Due to our study design, which focussed on regulation of sdma in critically ill patients at admission to the icu, we were unable to further analyse whether the persistence of elevated sdma, as observed in patients with available longitudinal sdma measurements, reflects persistent systemic inflammation or is rather an epiphenomenon of multiorgan failure in these patients . Our study identified sdma as a prognostic marker in patients with critical illness, both for icu and long - term mortality . Importantly, sdma remained independently associated with mortality in multivariate regression analyses, corroborating that sdma is not only an epiphenomenon of acute organ dysfunction . These data strongly indicate that elevated sdma levels in icu patients reflect prognostically relevant pathomechanisms such as microcirculatory dysfunction due to endothelial activation . The accumulation of sdma might reduce endothelial no synthesis, as it competes with arginine for cellular transport across the y transporter and might promote endothelial stress, as it has been showed to increase intracellular reactive oxygen species in human endothelium [12, 15]. Similar cause - effect relationships have been proposed for chronic, low - grade inflammatory processes such as atherosclerosis . One might speculate whether therapeutic interventions intended to increase vascular tension during the hyperdynamic state of sepsis via modulating arginine - no interactions could be beneficial in critically ill patients . Despite its potential pathogenic implications, sdma serum levels were closely associated with icu as well as long - term mortality risk in our cohort of critically ill medical patients . Our study now identified possible cutoff values of circulating sdma as indicators for increased mortality risk . This raises the possibility that implementing sdma in risk stratification algorithms might further increase the prognostic accuracy of current clinical scoring system at the icu . Future studies should therefore not only aim at exploring the pathogenic role of sdma in sepsis and concomitant endothelial dysfunction but also evaluate the clinical applicability of sdma measurements as a prognostic biomarker in critical illness . Our study demonstrates significantly upregulated serum levels of sdma in critically ill patients, especially in patients with sepsis . The potential value of sdma as an indicator of endothelial dysfunction in medical icu patients and its correlations to biomarkers of renal, liver, and circulatory failure function should be confirmed in experimental models of systemic inflammation and in different clinical settings . The clear association of circulating sdma levels with clinically relevant endpoints such as icu or long - term mortality gives rise to the expectation that integrating sdma into current tools of risk assessment in critically ill patients might improve their prognostic accuracy.
|
Mr . A.l . Is a 27-year old male, who was originally diagnosed at the age of 6 with tourette s syndrome manifested by vocal tics, presented to his family physician with a 4-month history of hoarseness . Is treated for his tourette s syndrome using haloperidol 1 mg twice daily, clonazepam as needed and sertraline . On physical examination, he was found to have a hoarse voice and vocal tics . Direct flexible nasopharyngoscopy revealed a polypoid lesion originating from the free edge of the anterior left true vocal fold (figure 1). This lesion was amenable to transoral endoscopic microsurgical resection using a carbon dioxide (co2) laser, and after a discussion with the patient, he agreed to proceed with resection . Was also asked to completed the university of michigan voice - related quality of life (v - rqol) questionnaire which he scored 24 overall and considered his voice quality as poor . No dysplasia or malignancy was identified and the lesion was diagnosed as a vocal cord polyp . Two weeks after endoscopic co2 resection of the left vocal fold lesion, repeat laryngoscopic examination revealed complete resolution of the lesion with no evidence of scarring or web . Repeated the v - rqol questionnaire post - operatively and scored 11 overall and rated his voice quality as very good . The relationship between vocal trauma, smoking, and gastroesophageal reflux disease and vocal cord polyps is well documented.1 other rare cases of recurrent vocal cord polyps have been documented in relation to autoimmune diseases such as systemic lupus erythematosus and hashimoto s thyroiditis.2 while there is substantial evidence for vocal cord trauma, a review of literature failed to demonstrate previous documentation of a relationship between vocal tics or tourette syndrome and vocal fold lesions.410 the etiology, pathophysiology and clinical manifestations of vocal polyps and nodules are well understood . Traditionally, polyps are associated with intermittent intense vocal abuse and smoking while vocal nodules are thought to arise from chronic minor vocal cord abuse . In the case of mr ., he has no history of using his voice professionally or episodes of intense trauma . The cause of this patient s laryngeal lesion then is likely secondary to the history of chronic minor vocal cord abuse suffered from vocal tics in his tourette syndrome . In this way, we also demonstrate that the minor laryngeal trauma has led to the development of a polyp rather than bilateral nodules . As it has been shown previously, it can be difficult for a pathologist to distinguish polyps and nodules.11,12 as previously stated, we had treated his hoarseness by excising the causative lesion . On the other hand, should this situation recur in this patient given the continuing vocal tics, definitive treatment for the vocal tics should be pursued . Unfortunately, unlike other incidences of vocal trauma, voice coaching would not be beneficial . More recently, vincent et al.13 has shown the advantages of using botulinum toxin in the treatment of laryngeal tics . Despite the possible confounding history of cigarette smoke exposure moreover, the possibility of vocal cord polyps should not be isolated to those patients who use their voice professionally . With the evidence from this case report, further study into the prevalence of vocal cord lesions in patients with tourette syndrome manifested by vocal tics may be warranted.
|
Despite the large number of studies about left ventricular noncompaction (lvnc), many uncertainties exist . Echocardiography is accepted as the method of choice for lvnc diagnosis . Magnetic resonance imaging (mri) was used extensively for this purpose as well; however, artifacts from arrhythmias or breathing and higher cost are its disadvantages . Large areas of hypertrabeculation (ht) can be seen in many diseases including dilated cardiomyopathy (dcmp) and even in normal subjects . It is not known whether this hypertrabeculation is a milder form of noncompaction (nc) or a different pathology . Three sets of echocardiographic criteria proposed by chin, jenni, and stllberger developed to differentiate lvnc from other diseases . In spite of the existing criteria this problem may result from the nature of these criteria which depends on the finding of an area with maximal nc, or the number of ht / nc areas in lv . Failure to find the area with maximal nc or all ht / nc areas may result in a misdiagnosis . Measuring the percentage of hypertrabeculated or noncompacted myocardium (ht / nc%) may decrease misdiagnosis . We introduce a method for this measurement by echocardiography and examined it on a cohort of patients with lvnc cardiomyopathy, dcmp, and normal subjects . In order to create a 3-dimensional concept from september 2009 to june 2011 targeted subjects for this study were enrolled . All children with a diagnosis of dilated or lvnc cardiomyopathy admitted at our hospital or referred to our outpatient clinics were included and a control group of healthy subjects were also selected in a convenient method . For lvnc cardiomyopathy patients, the study period extended to june 2012 due to the small number of patients . A noncompacted to compacted myocardial dcmp was diagnosed when a patient had left ventricular ejection fraction (lvef) less than 50% (present or past) and disease duration of at least 3 months . The control group consisted of age - matched children referred to our outpatient clinics, with a final diagnosis of innocent murmur or non - cardiac chest pain and normal echocardiogram . Two dcm patients with poor echocardiographic windows were excluded from the study . After obtaining informed consent from the parents, all study subjects were echocardiographically investigated by a single echocardiographer using a single echocardiographic scanner (micromaxx ultrasound system, sonosite inc . The main reason for using this scanner was its portability which permitted us to study subjects in both the intensive care unit and outpatient clinics . Echocardiographic parameters including left ventricular ejection fraction (lvef), left ventricular fractional shortening (lvfs), and left ventricular myocardial performance index (lvmpi) were obtained . The nc / c ratio during systole was measured as described by jenni et al . The ht / nc% was defined as the mean percentages of ht / nc myocardium at three levels: apical, papillary muscles, and mitral valve . At each level, short axis view at systole was obtained and three areas were measured: whole myocardium and lv cavity (a), area encompassing only ht / nc myocardium and lv cavity (b), and only lv cavity (c) (fig . The ht / nc% at each level was calculated by using the following formula:% ht - nc = 100 (b - c)/(a - c) the parameters required to calculate the percentage of hypertrabeculated / noncompacted myocardium . The numbers 1, 2, and 3 refer to the apical, papillary muscle and mitral valve levels, respectively the apical level was defined when a small amount of lv cavity can be seen to precisely measure all desired areas (fig . 1). The papillary muscle level was defined when these muscles were first viewed when sweeping echocardiography probe from the apex toward the cardiac base . Maximal care was undertaken not to include papillary muscles, aberrant chordae tendineae and lv bands in the ht / nc areas . The study was accepted by the ethical committee board of tehran university of medical sciences and in accordance with good clinical practice and the declaration of helsinki . Descriptive statistics such as mean, standard deviation (expressed after), and frequency were calculated for each variable . Independent - sample t, chi - square, and pearson correlation tests were used for the statistical analyses . Twenty six patients with dcmp, 4 with lvnc cardiomyopathy and 25 normal subjects were enrolled in the study . There was no statistically significant difference regarding the sex, age, weight, and body surface area between dcmp and control groups (table 1). Demographic and basic echocardiographic data in three groups * nc / c, noncompacted to compacted myocardial thickness; dcmp, dilated cardiomyopathy, lvnc, left ventricular noncompaction comparing the averages in dcmp and control groups patients with dcmp had statistically lower ef, fs, mpi, and higher nc / c ratio in comparison to the normal subjects (table 1). The%ht / nc% at all 3 levels and its average were significantly higher in the dcmp group than in the normal subjects (table 2). The ht / nc% was significantly correlated with the nc / c ratio (correlation coefficient = 0.543, p<0.001). Left ventricular hypertrabeculation / noncompaction percentage at three different levels in the left ventricle sd: standard deviation; dcmp: dilated cardiomyopathy; lvnc: left ventricular noncompaction comparing the averages in dcmp and control groups lvnc was accepted as a distinct type of cardiomyopathy by the world health organization . However, there are many controversies regarding its etiology, pathogenesis, diagnosis, and management . The diagnosis is especially important because the prognosis and management of lvnc differ from those of its differential diagnoses . The chin criteria was first described and based on x - to - y ratios at 3 levels (mitral valve, papillary muscle, and apex). X corresponds to the distance between the epicardial surface and trough of a trabecular recess, while y to the distance between the epicardial surface and peak of the trabeculation . The measurements should be performed at end diastole and a ratio up to 0.5 is required for the diagnosis of lvnc . The jenni criterion postulates a systolic ratio of nc myocardial thickness to the adjacent compacted myocardium of more than 2 at the thickest part of myocardium, confirmation of blood flow in the recesses, absence of any cardiac abnormality, and the presence of characteristic trabeculations and deep recesses between the trabeculations . Pignatelli et al suggested that a ratio of at least 1.4 is sufficient for the diagnosis of lvnc in children . Jenni criterion is the most accepted among these three sets and used for the diagnosis of lvnc in this study . The stllberger criteria require the presence of at least 4 trabeculations distal to the papillary muscles at one plane and intertrabecular spaces filled from the ventricular cavity . Definite diagnosis is present when the patients fulfill both jenni and stllberger sets of criteria, while probable corresponds to the fulfillment of just one, and possible to the situation where the number of trabeculations is less than 4 or the nc / c ratio is lower than two . Kohli et al studied a cohort with heart failure and investigated all these 3 sets of diagnostic criteria ., 78.7% met the chin criterion, 63.8% the jenni criterion, and 53.2% the stllberger criteria . Only one set of criteria was fulfilled by 36.2% of the patients, while only 29.8% met all sets . Only 3 out of these 8 patients were diagnosed accurately by 2-dimensional echocardiography using jenni criterion . The idea of lvnc quantification by area measurement was first introduced by belanger et al . We introduced a new method for the quantification of ht / nc of lv and examined it on patients with dcmp, lvnc cardiomyopathy and normal subjects . The echocardiographer should investigate at least 3 levels in the myocardium and the result is based on an average rather than the areas of maximal involvement . We showed that this ht / nc% is well correlated with a carefully measured maximal nc / c ratio . Petersen et al measured the nc / c ratio during diastole and showed that a value greater than 2.3 could be 86% sensitive and 99% specific for the diagnosis of lvnc . Alhabshan et al measured the end - systolic nc / c ratio by both mri and echocardiography . They found that mri can found a higher nc / c ratio than echocardiography in some subjects . They found a diastolic value of 22% in their unique lvnc patient and a mean of 11.3% (range 1.5 - 19) in 10 dcm patients . Fernndez - golfin et al studied the same method on a larger cohort of ischemic heart disease, dcm, valvular heart disease, and left ventricular hypertrophy patients, and normal subjects . They found relatively higher values in their patients (17.24.9 in normal subjects, 23.36 in dcm patients). They studied patients with lvnc, dcm, hypertrophic cardiomyopathy (hcm), and normal subjects they found that mean percentages were 3210 in lvnc, 114 in dcm, 124 in hcm, and 125 in controls . They reported that a percentage of more than 20% can be 93.7% specific and similarly sensitive to predict the presence of lvnc . In our cohort, only two dcmp subjects had a percentage higher than 17% while our 4 lvnc patients had values of 73, 24, 17, and 24% . This means that the threshold value of 17% can distinguish lvnc from dcmp with 92% specificity and 100% sensitivity and from normal subjects with 100% specificity and sensitivity . Color doppler echocardiography confirmation of direct blood flow from the ventricular cavity into deep intertrabecular recesses seems to be necessary for the diagnosis of lvnc, as it is a unique feature of this disease . Our suggested echocardiographic threshold value of 17% is very close to the mri threshold of 20% which was suggested by jaquier et al, and korcyk et al . In summary, our suggested method is the echocardiographic equivalent of mri ht / nc% measurement while the jenni criterion is the equivalent of mri nc / c ratio measurement . Second, the study was performed in a pediatric setting; therefore, this method was not examined on adult patients . In addition, it was impossible to blind the echocardiographer to the diagnosis of the studied subjects . Although the echocardiographer tried his best, there may be some bias in the echocardiographic measurements . Second, the study was performed in a pediatric setting; therefore, this method was not examined on adult patients . In addition, it was impossible to blind the echocardiographer to the diagnosis of the studied subjects . Although the echocardiographer tried his best, there may be some bias in the echocardiographic measurements . We introduced a new echocardiographic method to measure ht / nc% and tested it on patients with dcm or lvnc, and normal subjects . We showed that the percentage had a statistically significant correlation with the noncompacted to compacted lv ratio.
|
Mean life expectancy has been increasing in many countries, and the management of malignancies in the elderly has thus become a global issue [1, 2, 3]. Hepatocellular carcinoma (hcc) is a common malignant tumor with poor prognosis, and the numbers of elderly patients with hcc are expected to increase around the world . Several studies in the 1990s and early 2000s reported significantly higher rates of morbidity and mortality after hepatectomy in elderly patients [5, 6, 7, 8]. On the other hand, recent studies have found that the short- and long - term outcomes of hepatectomy in elderly patients are similar to those in younger patients [4, 9, 10, 11, 12]. The indications for hepatic resection in elderly patients have been questioned, and given the increasing number of affected elderly patients, this issue requires serious consideration . He underwent a medical examination for hypertension and chronic atrial fibrillation, during which a mass was palpated through the abdominal wall . Iu / l (normal 530), alkaline phosphatase (alp) 334 u / l (normal 115359), gamma - glutamyl transferase (-gtp) 230 iu / l (normal 050), lactate dehydrogenase (ldh) 177 iu / l (normal 106211), albumin (alb) 3.6 g / dl (normal 3.75.5), total bilirubin (tb) 0.71 mg / dl (normal 0.21.0), and prothrombin time - international normalized ratio (pt - inr) 1.03 . Child - turcotte - pugh grade was a. the indocyanine green retention rate at 15 min (icg - r15) was 8% . The concentration of serum alpha - fetoprotein (afp) was 3,600 ng / ml (normal <20) and plasma des--carboxy prothrombin (dcp), also known as protein induced by vitamin k deficiency or antagonist - ii, was 93,300 mau / ml (normal <40). Contrast - enhanced computed tomography (cect) revealed a tumor measuring 78 mm in diameter in the left lateral sector of the liver (fig . The operation time was 370 min, and the amount of blood loss was 978 ml . Laboratory data were as follows: ast 35 iu / l (normal 535), alt 21 iu / l (normal 530), alp 198 iu / l (normal 050), ldh 162 iu / l (normal 106211), alb 2.9 g / dl (normal 3.75.5), tb 0.7 mg / dl (normal 0.21.0), and pt - inr 1.18 . The concentration of serum afp was 1,210 ng / ml (normal <20) and plasma dcp was 209 mau / ml (normal <40). Cect revealed a tumor measuring 20 mm in diameter in segment 2 of the liver, accompanied by tumor thrombi toward the main left portal vein (fig . The patient requested radical surgery, so left hemi - hepatectomy was performed (fig . The operation time was 304 min, and the amount of blood loss was 379 ml . He underwent a medical examination for hypertension and chronic atrial fibrillation, during which a mass was palpated through the abdominal wall . Iu / l (normal 530), alkaline phosphatase (alp) 334 u / l (normal 115359), gamma - glutamyl transferase (-gtp) 230 iu / l (normal 050), lactate dehydrogenase (ldh) 177 iu / l (normal 106211), albumin (alb) 3.6 g / dl (normal 3.75.5), total bilirubin (tb) 0.71 mg / dl (normal 0.21.0), and prothrombin time - international normalized ratio (pt - inr) 1.03 . Child - turcotte - pugh grade was a. the indocyanine green retention rate at 15 min (icg - r15) was 8% . The concentration of serum alpha - fetoprotein (afp) was 3,600 ng / ml (normal <20) and plasma des--carboxy prothrombin (dcp), also known as protein induced by vitamin k deficiency or antagonist - ii, was 93,300 mau / ml (normal <40). Contrast - enhanced computed tomography (cect) revealed a tumor measuring 78 mm in diameter in the left lateral sector of the liver (fig . The operation time was 370 min, and the amount of blood loss was 978 ml . Laboratory data were as follows: ast 35 iu / l (normal 535), alt 21 iu / l (normal 530), alp 198 u / l (normal 115359), -gtp 67 iu / l (normal 050), ldh 162 iu / l (normal 106211), alb 2.9 g / dl (normal 3.75.5), tb 0.7 mg / dl (normal 0.21.0), and pt - inr 1.18 . The concentration of serum afp was 1,210 ng / ml (normal <20) and plasma dcp was 209 mau / ml (normal <40). Cect revealed a tumor measuring 20 mm in diameter in segment 2 of the liver, accompanied by tumor thrombi toward the main left portal vein (fig . The patient requested radical surgery, so left hemi - hepatectomy was performed (fig . The operation time was 304 min, and the amount of blood loss was 379 ml . Mean life expectancy has been increasing in many countries, and the management of malignancy in the elderly has become a global issue [1, 2, 3]. General markers of liver function, such as levels of ast, alt, serum tb and alp, are largely unaffected by aging . In contrast, decreases are seen in serum levels of alb, some amino acids and some coagulation factors, including fibrinogen, prothrombin and thromboplastin . Several studies in old rodents have suggested that aging compromises the regenerative capacity of the liver after hepatectomy or ligation of the portal vein [16, 17]. Advanced age is already a high risk factor for staying alive, and the risks associated with surgical treatment are thus considered to be further magnified . Furthermore, advanced age increases complications such as high blood pressure and diabetes mellitus . In recent years, hepatectomy for much more elderly patients has been attracting increasing attention . Several studies in the 1990s and early 2000s reported significantly higher rates of morbidity and mortality in elderly patients [5, 6, 7, 8]. On the other hand, recent studies have reported the safety of surgery in elderly patients [4, 9, 10, 11, 12]. The age standards for hepatectomy are rising because hepatectomy is being performed with increasing safety . After stringent criteria for hepatectomy were proposed, the mortality rate decreased markedly . With the development of surgical energy devices, such as vessel - sealing instruments and ultrasonic surgical devices, furthermore, in recent years, the laparoscope for hepatectomy has been attracting attention as a means to reduce surgical stress . Such developments are contributing to the increasing use of hepatectomy and the increasing standard age of recipients . However, the optimal age limits remain unclear . In our department, we place emphasis on anesthetic procedures to reduce surgical stress . We have been able to perform major hepatectomy in patients over 90 years old with no postoperative complications . Here, we reported two cases of successful treatment for patients over 90 years old, and our cases represent the oldest cases yet described to have undergone major hepatectomy . Case 2 remarked that elderly patients who were afraid of undergoing surgery at her age could be encouraged by her results.
|
Osteonecrosis or avascular osteonecrosis (avn) of the femoral head is a devastating multifactorial disease that affects 20 000 persons each year in the united states . Although the pathophysiology of avn has not been completely elucidated, this progressive clinical condition is characterized by bone death and reduced local blood flow . As bone repair occurs, the imbalance of osteoclast - medicated resorption and delayed new bone formation result in mechanically weak bone that collapses under the load of weight . After collapse, due to extreme pain and loss of hip function, most patients require standard total hip arthroplasty (tha). However, because of the young age of many of these patients, a hip replacement cannot be expected to last the patient s lifetime; therefore, when feasible, attempts should be made to save the femoral head prior to collapse with use of less invasive treatment modalities [79]. There is currently no uniformly accepted pharmacologic treatment that retards avn progression and prevents bone collapse . In contrast to other drugs, bisphosphonates (bps) are potent anti - reabsorptive agents that act by inhibiting the action of mature osteoclasts in the bone, which theoretically normalizes the uncoupled bone remodeling, contributing to femoral head collapse . In the last decade, many studies have investigated the application of bps in the treatment of avn [1019]. Nevertheless, the lack of controlled and long - term results, the substantial heterogeneities of genres in bps, the unclear indication of various stages of avn, and the combination of adults and juveniles, complicate the interpretation of recent systematic reviews and necessitate new evidence . Of different bps, in addition, application of bps in children raises great concern due to its potential harmful effects on the growing skeleton of juveniles . Therefore, we performed a systematic review restricted to alendronate therapy for adult avn . By summarizing recent randomized controlled trials and long - term follow - up studies, the purpose of this systematic review was to determine the efficacy and safety of alendronate for adult avn during short- and long - term follow - up . Our hypothesis was that alendronate therapy could be well - tolerated and: 1) improve clinical function and pain, 2) retard the progression of femoral head collapse and/or reduce the incidence of tha, and 3) be influenced by stage of the disease . Four electronic databases (pubmed, embase, the cochrane central register of controlled trials, and china national knowledge infrastructure) were searched using a search strategy combining the terms in boolean logic: (alendronate or fosamax) and (avascular necrosis or aseptic necrosis or osteonecrosis) and (femoral head). Trials were included if they were randomized or nonrandomized clinical trials, cohort, case - control studies, and series of cases in which alendronate was used for treatment of avn of the femoral head in adults, with adequately reported data on diminishment of pain, or improvement of articular function, or retardation of bone collapse progression, or need for arthroplasty . We also manually searched reference lists of review articles, and included studies to identify other potentially eligible studies . After exclusion of duplicates, 1 reviewer (lrb) performed an initial title and abstract screening of articles to discard those that were clearly ineligible, then 2 reviewers (lt and zhm) independently examined the full article to assess the trials for eligibility for inclusion, with disagreements resolved by discussion . Citations were excluded if they were animal studies or targeted adolescences or used alendronate in combination with any other treatments . If necessary, we attempted to contact the author of the original report to obtain further details . From each article we extracted the following details by using standardized forms: authors, year of publication, geographical location of study, study design / level of evidence, study population (hips / patients), patient sex and age, follow - up duration, interventions, outcomes, and adverse events . The level of evidence of each study was rated on basis of oxford centre for evidence - based medicine levels of evidence (march 2009). The outcome of interest included clinic function and hip pain improvement of avn patients after alendronate treatment . Clinical failure was defined as the need for tha . For the radiographic evaluation, although various classification systems were used among the studies, they shared fundamental similarities; therefore, radiographic failure here were defined as any lesions progressed to a higher stage from baseline stage . Due to the included avn comprising both pre - collapse and early - collapse stage, collapse rates were separated and considered as a new occurrence of collapse or an increased collapse of greater than 2 mm . Data could not be analyzed using a meta - analysis due to the methodological heterogeneity and limited number of the available controlled studies . Of these, we included 8 articles with 788 hips in this systematic review [1219]. All the studies targeted adult avn patients within stage iii classified by x - ray, magnetic resonance imaging (mri), both according to ficat and arlet (3 studies), association research circulation osseous (arco, 2 studies), or steinberg (university of pennsylvania system, 2 studies). Four studies were restricted to non - traumatic avn patients and the other 4 articles from the same group did not specify the etiology . The doses and duration of alendronate administration differed among the studies . In 5 of the included studies full weight - bearing was only permitted in 1 study and 4 studies only allowed partial or no weight - bearing . Six studies reported short - term results of alendronate treatment on avn (<4 years) [12,1519], and the other 2 reported long - term results (4 years). Only 3 studies contained a control group, 2 of which were randomized controlled trials that reported the details of randomization and blinding . Most of the included studies were prospective non - controlled studies and 4 of them were from the same institution reporting on the same group during different follow - up period . As presented in table 1, the level of evidence for the studies ranged from 1b to 3b . The current evidence is level 3a, which is limited to the small number with small sample size and the majority of non - controlled studies . Table 2 showed the outcomes reported from studies evaluating alendronate use in avascular osteonecrosis of the femoral head . Studied 16 patients with avn of the femoral head most of them secondary to the use of corticosteroids . They used a regimen of alendronate 10 mg / day + calcium 1 g / day + vitamin d supplement, and the mean duration of therapy with alendronate was 24.7 weeks . Patients that used alendronate had a significant improvement in pain as early as 12 weeks, with a reduction in the need for analgesics and improvement in functional capacity in all patients, and this improvement was maintained for 24 weeks . The observation was extended to a total of 60 patients (100 hips), with an average follow - up of 37 months . Alendronate was used in daily doses of 10 mg or weekly doses of 70 mg; these authors confirmed these findings and further suggested that alendronate would retard the progression of avn and avoid the early indication of surgery in mid - term follow - up . Another study with short - term follow - up was performed by chen et al ., which included 83 patients with non - traumatic avn of the femoral head 33 of the patients were arco i and the rest were arco ii . They were given oral alendronate 70 mg weekly, and evaluated with harris criteria at baseline and 3 months after treatment . In the patients with arco i avn, the scores of pain and function were improved after treatment (p<0.01). Similarly, in the patients with arco ii avn the scores of pain and function were both improved after treatment (p<0.01). And the score of activity was also enhanced obviously, which was not observed in arco i avn patients . They concluded that alendronate is effective in treatment of early - stage adult non - traumatic avn of the femoral head, especially for arco ii patients . The first rct with short - term results evaluating the treatment of alendronate on avn of the femoral head was by lai et al . . They studied 40 patients with steinberg stage ii or iii c non - traumatic avn of the femoral head . The patients were divided into 2 groups, half of them received alendronate 70 mg / week orally and the other half did not receive this medication . The patients were monitored radiologically every 10 weeks and observed for a minimum of 24 months . At the end of the study, the mean hhs was 49.29.2 points in the control group and 74.47.8 points in the alendronate group . It was also demonstrated that only 2/29 femoral heads with an (0/17 in stage ii, 2/12 in stage iii) collapsed in the group that received alendronate 70 mg / week, whereas in the group that was randomized to not receive this medication, collapse occurred in 19/25 (9/13 in stage ii, 10/12 in stage iii) femoral heads (p<0.001). One hip in the alendronate group underwent tha, whereas 16 hips in the control group underwent tha (p<0.001). Thus, they concluded that alendronate appeared to prevent early collapse of the femoral head in the hips with steinberg stage ii or iii c non - traumatic avn . In a study by nishii et al ., 14 patients (20 hips) with arco i iii avn received alendronate 5 mg / day and were compared in a nonrandomized manner with a group of 8 patients (13 hips) that did not receive alendronate . All the patients received periodical radiologic evaluation at 3, 6, and 12 months . At the end of follow - up, the group of patients receiving alendronate had less pain and a lower frequency of femoral head collapse when compared with the control group . Specifically, they found progressive collapse occurred only in hips with extensive necrosis (greater than the medial 2/3 of the weight - bearing area of the femoral head with / without involvement of acetabula edge, termed type c2 and c1, respectively) in both groups, which had a much higher incidence in the control groups . In total, collapse occurred in 6/13 of articulations in the control group and in only 1/20 in the alendronate group (p=0.008). Moreover, 2 of 13 hips in the control group needed tha, but none of patients needed surgery in the alendronate group . Therefore they suggested alendronate had the potential to prevent collapse of the femoral head, even with extensive necrosis, within 1 year . Chen et al . Recently performed a 2-year, multicenter, prospective, randomized, double - blind study involving a total of 52 patients (65 hips). Twenty - six patients (32 hips) were assigned to a scheme of alendronate 70 mg / week for 104 weeks and were compared with a group of 26 patients (33 hips) that received placebo . At the end of the study, mri evaluation revealed that 21 of the 32 hips in the alendronate group and 20 of the 33 hips in the placebo group had progressed (p=0.636). Four of 32 hips in the alendronate treatment group underwent tha, and 5 of 33 hips in the placebo group had tha (p=0.837). No differences were noted in hhs, or short form 36 scores between the 2 groups . Thus, the extensive lesion of necrotic area might impair the prognosis of the avn when alendronate was used . The long - term data was from a study by agarwala et al ., who presented a clinic radiological analysis of 395 hips with a mean follow - up of 4 years and then further extended the follow - up of 40 patients (53 hips) with avn to 10 years; those patients were treated with oral alendronate for 3 years, and the data demonstrated although clinical functions showed a general trend of worsening after discontinuation, patients tolerated the decline well, as suggested by the reduction in pain of ficat and arlet stage i iii patients 10 years after onset of alendronate treatment . More importantly, the rates of radiologic progression and femoral head collapse were markedly reduced even at 10 years as compared to the historical data available for natural history of hips with untreated avn . At 10 years, 46 (87%) of the 53 hips survived, that is, had a satisfactory clinical result . Hip loss to arthroplasty occurred in 1 each of stage i (7%) and stage ii (5%) hips and in 5 (26%) of stage iii hips . Of the 34 hips that were in pre - collapse stages at the onset of the study, at 10 years 10 had collapsed, indicating a collapse rate of 29% for a period of 10 years . They thereafter indicated that the benefit is particularly marked if the treatment is begun in the pre - collapse stages of the disease (stage i or ii). Even in stage iii hips some benefit was obtained from treatment with alendronate by at least a delay in the need for total hip replacement . The most common adverse effects across the studies were gastric dyspepsia mentioned in 3 studies and dizziness mentioned in 2 studies, both of which occurred after treatment initiation and were self - limiting . No osteonecrosis of the jaw were seen irrespective of the dose or duration of alendronate . The most studied is core decompression, which works by reduction of intramedullary pressure inside the femoral head by making a drill hole, thus improving blood flow to bone . Osteotomy could relocate the necrotic area of bone from the weight - loading area of the acetabulum, so as to redistribute the weight loading to articular cartilage, which is supported by healthy bone . The increasingly applied method is bone graft, aiming to provide mechanical support to subchondral bone or cartilage . There are various types of bone grafting, some combined with osteotomy, osteochondral grafts, muscle pedicle bone grafts, and some are vascularized grafts to improve blood flow of the bone by achieving revascularization . It has been used to replace the necrotic bone segment to prevent collapse in steinberg stage i iii femoral avn . However, the efficacy and safety of the above procedures are still controversial [7,2729]. Due to the reported efficacy of total hip arthroplasty and the typical age of patients with osteonecrosis, it has recently been questioned whether these invasive procedures are appropriate, given the potential difficulty of later conversion to a hip replacement . Conservative treatment that helps improve function and delays femoral head deformity could be valuable time - buying strategy for some patients . Some of the pharmacologic agents that have been used to treat osteonecrosis of the hip are statins, anticoagulants, prostacyclin, and bps [1019]. The theoretical benefit of statins is based on the association of increased fat cell size with an increased risk of development of hip osteonecrosis . Anticoagulants may inhibit the aggregation of platelets and enhance blood flow to ischemic areas of bone . However, collapse of the femoral head appears to be a consequence of the non - coupling of bone reabsorption and bone regeneration rates . In this context, collapse could be prevented if the reabsorptive activity of the necrotic bone during the repair phase was inhibited or slowed until the formation of sufficient new bone . The efficacy of alendronate therapy of femoral head deformity was indicated by several experimental studies consisting of both adult rat and rabbit models induced by femoral head ischemia . In 2 closely related studies, alendronate given subcutaneously (200 mg / kg / d) was able to preserve femoral head structure in mature rats during a 6-week follow - up . In another study, 3-week alendronate therapy reduced degeneration of articular cartilage and improved subchondral bone volume and mineral density in adult rabbits at 12 months, which therefore might be the reason that alendronate treatment could preserve the shape of the femoral head affected by avn . Regarding alendronate for the treatment of avn in clinical trials, in the present review, only 8 articles were published . Our literature search found were 2 recent systematic reviews evaluating bps for avn, 1 of which only included 3 observational short - term studies in juveniles, and the other with 6 small short - term trials that reported substantial heterogeneities across studies in patient group (adults and adolescents) and treatments (other bps and combined therapy). In contrast to previous reviews, the inclusion criteria of the current review were restricted to articles that studied alendronate treatment for adult avn . Due to ongoing debate on long - term effects of alendronate on the growing skeleton, we limited the studied population to only adults . The inclusion of most recent longer - term results and rct would also help to update the previous evidence . Furthermore, after determining an overall profile of clinic outcome and the rates of radiographic and clinical failure, the collected data were further stratified by radiographic stage and by duration of follow - up to determine whether any of these factors influenced the results . However, generally speaking, the studies included in the current review still present various limitations most used observational non - controlled methods; small numbers of patients; different avn stages of patients when treatment was initiated; and lack of uniformity in dose and time of alendronate use . These articles, in addition, had various durations of follow - up and were composed of various subgroups of patient populations . Bearing in mind the above - mentioned limitations, most studies suggested a positive short - term and middle - term efficacy in pain reduction, improvement of articular function, slowing of bone collapse progression, and delaying the need for arthroplasty in adult avn patients with the use of alendronate treatment . This is of great clinical significance, as most of the included patients are young or active patients who are likely to require a revision at some point in the future and the effective slowing of femoral head deformity by alendronate could help to avoid early tha . Favorable long - term results were also presented by agarwala s 10-year study in treated patients even after alendronate discontinuation . In addition, there were no severe adverse effects associated with alendronate treatment observed during short- or long - term follow - up . Another finding of the current review is that although patients in all stages appeared to have potential benefit from alendronate treatment, the application in early avn with small size lesion was suggested by most of the included studies . Specially, as shown in chen s study, when extensive osteonecrosis (stage ii c and iii c) were radiographically presented, alendronate did not have any benefits . Thus, the efficacy of alendronate for avn with large necrotic legions should be considered more carefully . Agarwala et al . Studied 16 patients with avn of the femoral head most of them secondary to the use of corticosteroids . They used a regimen of alendronate 10 mg / day + calcium 1 g / day + vitamin d supplement, and the mean duration of therapy with alendronate was 24.7 weeks . Patients that used alendronate had a significant improvement in pain as early as 12 weeks, with a reduction in the need for analgesics and improvement in functional capacity in all patients, and this improvement was maintained for 24 weeks . The observation was extended to a total of 60 patients (100 hips), with an average follow - up of 37 months . Alendronate was used in daily doses of 10 mg or weekly doses of 70 mg; these authors confirmed these findings and further suggested that alendronate would retard the progression of avn and avoid the early indication of surgery in mid - term follow - up . Another study with short - term follow - up was performed by chen et al ., which included 83 patients with non - traumatic avn of the femoral head 33 of the patients were arco i and the rest were arco ii . They were given oral alendronate 70 mg weekly, and evaluated with harris criteria at baseline and 3 months after treatment . In the patients with arco i avn, the scores of pain and function were improved after treatment (p<0.01). Similarly, in the patients with arco ii avn the scores of pain and function were both improved after treatment (p<0.01). And the score of activity was also enhanced obviously, which was not observed in arco i avn patients . They concluded that alendronate is effective in treatment of early - stage adult non - traumatic avn of the femoral head, especially for arco ii patients . The first rct with short - term results evaluating the treatment of alendronate on avn of the femoral head was by lai et al . . They studied 40 patients with steinberg stage ii or iii c non - traumatic avn of the femoral head . The patients were divided into 2 groups, half of them received alendronate 70 mg / week orally and the other half did not receive this medication . The patients were monitored radiologically every 10 weeks and observed for a minimum of 24 months . At the end of the study, the mean hhs was 49.29.2 points in the control group and 74.47.8 points in the alendronate group . It was also demonstrated that only 2/29 femoral heads with an (0/17 in stage ii, 2/12 in stage iii) collapsed in the group that received alendronate 70 mg / week, whereas in the group that was randomized to not receive this medication, collapse occurred in 19/25 (9/13 in stage ii, 10/12 in stage iii) femoral heads (p<0.001). One hip in the alendronate group underwent tha, whereas 16 hips in the control group underwent tha (p<0.001). Thus, they concluded that alendronate appeared to prevent early collapse of the femoral head in the hips with steinberg stage ii or iii c non - traumatic avn . In a study by nishii et al ., 14 patients (20 hips) with arco i iii avn received alendronate 5 mg / day and were compared in a nonrandomized manner with a group of 8 patients (13 hips) that did not receive alendronate . All the patients received periodical radiologic evaluation at 3, 6, and 12 months . At the end of follow - up, the group of patients receiving alendronate had less pain and a lower frequency of femoral head collapse when compared with the control group . Specifically, they found progressive collapse occurred only in hips with extensive necrosis (greater than the medial 2/3 of the weight - bearing area of the femoral head with / without involvement of acetabula edge, termed type c2 and c1, respectively) in both groups, which had a much higher incidence in the control groups . In total, collapse occurred in 6/13 of articulations in the control group and in only 1/20 in the alendronate group (p=0.008). Moreover, 2 of 13 hips in the control group needed tha, but none of patients needed surgery in the alendronate group . Therefore they suggested alendronate had the potential to prevent collapse of the femoral head, even with extensive necrosis, within 1 year . Chen et al . Recently performed a 2-year, multicenter, prospective, randomized, double - blind study involving a total of 52 patients (65 hips). Twenty - six patients (32 hips) were assigned to a scheme of alendronate 70 mg / week for 104 weeks and were compared with a group of 26 patients (33 hips) that received placebo . At the end of the study, mri evaluation revealed that 21 of the 32 hips in the alendronate group and 20 of the 33 hips in the placebo group had progressed (p=0.636). Four of 32 hips in the alendronate treatment group underwent tha, and 5 of 33 hips in the placebo group had tha (p=0.837). No differences were noted in hhs, or short form 36 scores between the 2 groups . Thus, the extensive lesion of necrotic area might impair the prognosis of the avn when alendronate was used . Who presented a clinic radiological analysis of 395 hips with a mean follow - up of 4 years and then further extended the follow - up of 40 patients (53 hips) with avn to 10 years; those patients were treated with oral alendronate for 3 years, and the data demonstrated although clinical functions showed a general trend of worsening after discontinuation, patients tolerated the decline well, as suggested by the reduction in pain of ficat and arlet stage i iii patients 10 years after onset of alendronate treatment . More importantly, the rates of radiologic progression and femoral head collapse were markedly reduced even at 10 years as compared to the historical data available for natural history of hips with untreated avn . At 10 years, 46 (87%) of the 53 hips survived, that is, had a satisfactory clinical result . Hip loss to arthroplasty occurred in 1 each of stage i (7%) and stage ii (5%) hips and in 5 (26%) of stage iii hips . Of the 34 hips that were in pre - collapse stages at the onset of the study, at 10 years 10 had collapsed, indicating a collapse rate of 29% for a period of 10 years . Mean time to collapse was 4.2 years . They thereafter indicated that the benefit is particularly marked if the treatment is begun in the pre - collapse stages of the disease (stage i or ii). Even in stage iii hips some benefit was obtained from treatment with alendronate by at least a delay in the need for total hip replacement . The most common adverse effects across the studies were gastric dyspepsia mentioned in 3 studies and dizziness mentioned in 2 studies, both of which occurred after treatment initiation and were self - limiting . No osteonecrosis of the jaw were seen irrespective of the dose or duration of alendronate . The most studied is core decompression, which works by reduction of intramedullary pressure inside the femoral head by making a drill hole, thus improving blood flow to bone . Osteotomy could relocate the necrotic area of bone from the weight - loading area of the acetabulum, so as to redistribute the weight loading to articular cartilage, which is supported by healthy bone . The increasingly applied method is bone graft, aiming to provide mechanical support to subchondral bone or cartilage . There are various types of bone grafting, some combined with osteotomy, osteochondral grafts, muscle pedicle bone grafts, and some are vascularized grafts to improve blood flow of the bone by achieving revascularization . It has been used to replace the necrotic bone segment to prevent collapse in steinberg stage i iii femoral avn . However, the efficacy and safety of the above procedures are still controversial [7,2729]. Due to the reported efficacy of total hip arthroplasty and the typical age of patients with osteonecrosis, it has recently been questioned whether these invasive procedures are appropriate, given the potential difficulty of later conversion to a hip replacement . Conservative treatment that helps improve function and delays femoral head deformity could be valuable time - buying strategy for some patients . Some of the pharmacologic agents that have been used to treat osteonecrosis of the hip are statins, anticoagulants, prostacyclin, and bps [1019]. The theoretical benefit of statins is based on the association of increased fat cell size with an increased risk of development of hip osteonecrosis . Anticoagulants may inhibit the aggregation of platelets and enhance blood flow to ischemic areas of bone . However, collapse of the femoral head appears to be a consequence of the non - coupling of bone reabsorption and bone regeneration rates . In this context, collapse could be prevented if the reabsorptive activity of the necrotic bone during the repair phase was inhibited or slowed until the formation of sufficient new bone . The efficacy of alendronate therapy of femoral head deformity was indicated by several experimental studies consisting of both adult rat and rabbit models induced by femoral head ischemia . In 2 closely related studies, alendronate given subcutaneously (200 mg / kg / d) was able to preserve femoral head structure in mature rats during a 6-week follow - up . In another study, 3-week alendronate therapy reduced degeneration of articular cartilage and improved subchondral bone volume and mineral density in adult rabbits at 12 months, which therefore might be the reason that alendronate treatment could preserve the shape of the femoral head affected by avn . Regarding alendronate for the treatment of avn in clinical trials, in the present review, our literature search found were 2 recent systematic reviews evaluating bps for avn, 1 of which only included 3 observational short - term studies in juveniles, and the other with 6 small short - term trials that reported substantial heterogeneities across studies in patient group (adults and adolescents) and treatments (other bps and combined therapy). In contrast to previous reviews, the inclusion criteria of the current review were restricted to articles that studied alendronate treatment for adult avn . Due to ongoing debate on long - term effects of alendronate on the growing skeleton, we limited the studied population to only adults . The inclusion of most recent longer - term results and rct would also help to update the previous evidence . Furthermore, after determining an overall profile of clinic outcome and the rates of radiographic and clinical failure, the collected data were further stratified by radiographic stage and by duration of follow - up to determine whether any of these factors influenced the results . However, generally speaking, the studies included in the current review still present various limitations most used observational non - controlled methods; small numbers of patients; different avn stages of patients when treatment was initiated; and lack of uniformity in dose and time of alendronate use . These articles, in addition, had various durations of follow - up and were composed of various subgroups of patient populations . Bearing in mind the above - mentioned limitations, most studies suggested a positive short - term and middle - term efficacy in pain reduction, improvement of articular function, slowing of bone collapse progression, and delaying the need for arthroplasty in adult avn patients with the use of alendronate treatment . This is of great clinical significance, as most of the included patients are young or active patients who are likely to require a revision at some point in the future and the effective slowing of femoral head deformity by alendronate could help to avoid early tha . Favorable long - term results were also presented by agarwala s 10-year study in treated patients even after alendronate discontinuation . In addition, there were no severe adverse effects associated with alendronate treatment observed during short- or long - term follow - up . Another finding of the current review is that although patients in all stages appeared to have potential benefit from alendronate treatment, the application in early avn with small size lesion was suggested by most of the included studies . Specially, as shown in chen s study, when extensive osteonecrosis (stage ii c and iii c) were radiographically presented, alendronate did not have any benefits . Thus, the efficacy of alendronate for avn with large necrotic legions should be considered more carefully . Our findings support consideration of alendronate use for avn in adults because short - term and long - term favorable results could be expected, particularly with the early stage and with small necrotic size . Nevertheless, the lack of large - scale, randomized, and double - blind studies should be noted, and future studies should be developed to demonstrate the following aspects . 1) the detailed indication of avn for alendronate treatment should be further clarified; for example, what type of avn, traumatic or non - traumatic, which stage of avn, including what size and what location of the necrotic lesion should be preferentially indicated . 2) there are a number of patient - specific factors that must be considered, including age, comorbidities, life expectancy, health, and activity level . 3) we also need to optimize the strategy of treatment, including timing of treatment initiation and alendronate therapy dose and duration.
|
Opioid analgesics represent a cornerstone therapy for ameliorating moderate to severe pain and chronic pain, including that in both malignant and nonmalignant patients . Analgesic tolerance phenomenon is observed in prolonged opioid abusers with a progressive need for higher doses to achieve constant analgesic effects . Although analgesic tolerance mechanisms are not fully understood, certain hypotheses have been proposed, including changes in the shape, function, and concentration of opioid receptors . In both, previous studies and medical practice, the duration of anesthesia in opium abusers has been reportedly shorter than that in non - abusers . Recent advances in knowledge of the mechanisms of pain have revealed that there is cross - interaction and cross - tolerance between local anesthetics and opioid compounds in chronic opioid users . Previous studies have shown there is an increased need for supplemental analgesics to achieve effective sedation in opium abusers . In addition, shorter duration of spinal anesthesia with local anesthetics has been observed in chronic abusers compared with that in non - abusers . Lidocaine, a local anesthetic and antiarrhythmic drug, has been used for many years for relief of several painful conditions . Previous studies investigated changes in spinal neuronal activity, their mediators, neuronal cellular channels, and receptors in the presence of exposure to repeat dosage of opioids . Previous findings revealed that neuroplastic changes caused by opioid consumption include adaptive changes in promoting pain transmission and the subsequent diminished antinociception as a result of opioid tolerance . The present clinical study was designed to compare the required lidocaine dose and analgesic time in opium abusers and non - abusers undergoing similar suturing for finger lacerations . In this descriptive, analytical, case - control study, we evaluated 200 patients (age range, 18 - 60 years; 109 opium abusers and 91 non - abusers) with finger lacerations referred to the emergency department for ambulatory surgery . Since no similar studies have been performed in this field, we conducted this cross - sectional study between march 2012 and march 2013 to evaluate all finger laceration patients who referred to imam reza hospital, which is a referral trauma center in mashhad city, east of iran . The exclusion criteria included history of diabetes, past or present neuropathy, repetitive lacerations at the affected site, concurrent bone fracture, vascular or tendon damage, and mental disorders . We explained the patients that their case records would remain confidential and admitting to any history of opioid abuse could assist in alleviating any pain associated with the procedure . The patients included in the case group were chronic opium users who had been self - administering either orally or by inhalation for at least 1 year . In addition to self - reporting, the control group subjects had no history of opium use for any reason within the preceding 2 years . Digital block anesthesia was performed by nurses in 200 subjects undergoing surgical repair of finger lacerations . The ideal procedure was described both theoretically and practically for the nurses who would be performing it . Digital block was performed on one side of the affected finger by inserting a 25-gauge needle to the side of the extensor tendon . The needle, while kept close to the phalanx, was then advanced toward the volar skin at the most distal part of the web . Prior to the procedure, local paresis was assessed by needle sensation at the distal end of the injured finger . Next, 2 ml of 1% lidocaine was slowly injected, every 30 s and the attainment of paresia retested . In case sensation was still evident, an extra dose of 0.5 ml of 1% lidocaine was injected until complete pain relief was obtained . Time to onset of complete analgesia and lidocaine dose administered were recorded for each subject . Instructions were given to administer a fixed analgesic dose by the initial injection and to leave a 5-min interval before further administration . Intensity of pain is usually evaluated using a visual analog scale (vas), a 10-cm horizontal line ranged from no pain to severe pain, and numbered from 0 to 10 (0 = no pain, 5 = moderate pain, and 10 = worst pain). The patient marks the point that he / she feels represents his / her perception of his / her current state . In this study, it is a measurement instrument for subjective characteristics or attitudes that cannot be directly measured . When responding to a vas item, respondents specify their level of agreement to a statement by indicating a position along a continuous line between two end points . This was a blind study, those performing the abovementioned procedures and recording them were unaware of whether subjects were addicts . The data were analyzed using statistical package for social sciences (spss) for windows version 11.05 (spss inc, chicago, il, usa). All data were checked for normality by kolmogorov smirnov test (ks test). In addition, descriptive statistics and comparison of means (one sample t - test and paired sample t - test) were used . Numerical data are expressed as either mean standard deviation (sd) or a proportion of the sample size . We used an independent sample t - test between the two groups (opium abusers and non - abusers) for evaluating the difference between variables considered, including gender, duration of anesthesia, and the required lidocaine dosage . In this descriptive, analytical, case - control study, we evaluated 200 patients (age range, 18 - 60 years; 109 opium abusers and 91 non - abusers) with finger lacerations referred to the emergency department for ambulatory surgery . Since no similar studies have been performed in this field, we conducted this cross - sectional study between march 2012 and march 2013 to evaluate all finger laceration patients who referred to imam reza hospital, which is a referral trauma center in mashhad city, east of iran . The exclusion criteria included history of diabetes, past or present neuropathy, repetitive lacerations at the affected site, concurrent bone fracture, vascular or tendon damage, and mental disorders . We explained the patients that their case records would remain confidential and admitting to any history of opioid abuse could assist in alleviating any pain associated with the procedure . The patients included in the case group were chronic opium users who had been self - administering either orally or by inhalation for at least 1 year . In addition to self - reporting, the control group subjects had no history of opium use for any reason within the preceding 2 years . Digital block anesthesia was performed by nurses in 200 subjects undergoing surgical repair of finger lacerations . The ideal procedure was described both theoretically and practically for the nurses who would be performing it . Digital block was performed on one side of the affected finger by inserting a 25-gauge needle to the side of the extensor tendon . The needle, while kept close to the phalanx, was then advanced toward the volar skin at the most distal part of the web . Prior to the procedure, local paresis was assessed by needle sensation at the distal end of the injured finger . Next, 2 ml of 1% lidocaine was slowly injected, every 30 s and the attainment of paresia retested . In case sensation was still evident, an extra dose of 0.5 ml of 1% lidocaine was injected until complete pain relief was obtained . Time to onset of complete analgesia and lidocaine dose administered were recorded for each subject . Instructions were given to administer a fixed analgesic dose by the initial injection and to leave a 5-min interval before further administration . Intensity of pain is usually evaluated using a visual analog scale (vas), a 10-cm horizontal line ranged from no pain to severe pain, and numbered from 0 to 10 (0 = no pain, 5 = moderate pain, and 10 = worst pain). The patient marks the point that he / she feels represents his / her perception of his / her current state . In this study it is a measurement instrument for subjective characteristics or attitudes that cannot be directly measured . When responding to a vas item, respondents specify their level of agreement to a statement by indicating a position along a continuous line between two end points . This was a blind study, those performing the abovementioned procedures and recording them were unaware of whether subjects were addicts . The data were analyzed using statistical package for social sciences (spss) for windows version 11.05 (spss inc, chicago, il, usa). All data were checked for normality by kolmogorov smirnov test (ks test). In addition, descriptive statistics and comparison of means (one sample t - test and paired sample t - test) were used . Numerical data are expressed as either mean standard deviation (sd) or a proportion of the sample size . We used an independent sample t - test between the two groups (opium abusers and non - abusers) for evaluating the difference between variables considered, including gender, duration of anesthesia, and the required lidocaine dosage . Both groups were matched regarding age, body weight, and duration of surgery, and there was no statistically significant difference between age group and the required dose of lidocaine . However, mean difference in onset of anesthesia among age groups was significant (p = 0.04). Patients aged 50 - 60 years of age had a higher duration of onset time of anesthesia than other groups . In the opium abuser group (79 males and 30 females), there was no statistically significant difference in onset time of anesthesia between male (11.03 1.45 min) and female patients (8.40 1.07 min) (p <0.05). In addition, the mean required lidocaine dose in male (7.10 1.08) and female patients (5.53 0.09) in the opium abuser group was significant (p <0.001). Comparison of the two groups showed that lidocaine dose and time to onset of anesthesia were significant [table 1]. Moreover, this table shows that opium abusers needed significantly higher lidocaine doses compared with that of non - abusers . Furthermore, the duration of time to onset of anesthesia in opium abusers was prolonged significantly compared with that in non - abusers (p <0.001). Among different age groups of opium abusers evaluation of the effect of chronic opium use showed a statistically significant difference between opium abusers for 4 - 5 years compared with that in abusers for less than 5 years (p = 0.001). This subgroup of chronic opium abusers (4 - 5 years) experienced significantly higher time of onset of anesthesia compared with nonchronic abusers (p = 0.001). Opioids include a group of substances such as opium, morphine, heroin, codeine, tramadol, and methadone . To the best of our knowledge, the current study is the first to compare the required lidocaine dose and the duration of onset of anesthesia in opium abusers and non - abusers referred for repair of finger lacerations . In the present study, we found a significantly longer delay of analgesia in nonopioid abusers than that in abusers . In addition, we found that an increased dose of lidocaine was required in abusers compared with that in non - abusers . Moreover, we observed that opium abusers with a more than 5-year history of opium abuse were significantly different compared with chronic abusers with less than 5-year history of opium use regarding both delay in time to onset of anesthesia and dose of lidocaine . In addition, male abusers experienced significantly prolonged onset of anesthesia and required much higher lidocaine doses compared with female abusers, but not significantly more than normal gender variation . Gupta et al ., reported similar findings in a study about intrathecal fentanyl with 5% bupivacaine in chronic opium abusers . They reported much longer mean time to onset of adequate analgesia in opium abusers than that in non - abusers . Nevertheless, although the primary cause of change in anesthetic mechanisms is still unclear, the following factors are debatable: some type of cross - tolerance between local anesthetic agents and opioids based on voltage - gated sodium channels or classic opioid receptors in the central and peripheral nervous systems and structural similarities between opioid and local anesthetic receptors in the spinal cord . Dabbagh et al ., showed a significantly shortened duration of neural block, both sensory and motor, with bupivacaine in opium abusers . They proposed that at the neuronal level, there were numbers of possible mechanisms including cross - tolerance between local anesthesia and opioid compounds . Therefore, such patients should be managed for a prolonged duration of anesthesia and analgesia . Vosoughian et al ., studied chronic opium abusers receiving intrathecal hyperbaric preservative free 5% lidocaine in dextrose and documented a shortened duration of spinal block in opium abusers . Ossipov et al ., demonstrated that repetitive exposure to opioids could trigger certain mechanisms that induced exaggerated pain sensation due to descending facilitation, upregulation of spinal dynorphin, and enhanced release of excitatory transmitters from primary afferents . The condition termed opioid - induced hyperalgesiais characterized by the absence of nociceptive sensitization caused by chronic exposure to opioids . In chronic pain patients who experience worsening pain despite increasing doses of opioids, the clinical role of opioid - induced hyperalgesia is gaining more recognition . This phenomenon is characterized by a paradoxical response whereby a patient can become more sensitive to painful stimuli . In addition, it explains the loss of opioid efficacy in our patients as well as other similar studies . It is believed that some opioids and its metabolites can activate n - methyl - d - aspartate receptor, which may result in increased neuronal excitation . Thus, when these receptors and associated neurons are stimulated, painful neuron impulse may be caused . Meanwhile, because the mechanism of action of lidocaine is via the na channel block, in chronic opium abuser, it may cause changes in the function of action of lidocaine and reduce the effects of lidocaine, but more research is needed to prove this . The findings of this study suggest a longer time to onset of anesthesia and higher lidocaine dose required in opium abusers, particularly chronic abusers, compared with similar patients not abusing opium . Moreover, the difference in the required lidocaine dose observed in the current study is a variable that has not previously been studied and may be useful in the design of further clinical trials to evaluate different procedures to quantify the optimum dosage for this patient group.
|
Cesarean sections have been a global public health concern for decades.13 as a key component of comprehensive emergency obstetric care (emoc), the adequate provision of cesarean sections during intrapartum care is a life - saving procedure.2,3 this is particularly vital for mothers living in low and middle income countries, where access to emoc is low and resources to provide quality care are limited.35 notwithstanding the well - recognized life - saving role of cesarean sections, international comparisons show that rates of cesarean sections vary greatly across countries and high coverage does not necessarily lead to good health outcomes.1,2 elective cesareans can increase the risk of maternal morbidity, neonatal death, and neonatal admission to an intensive care unit.1 the overuse of cesareans is therefore a real public health concern, not only because cesareans are costly, incurring a financial burden for the families and society, but also because they may entail a health risk for women and children s health . The threshold above which cesarean sections are in excess of need is not well known, but the world health organization suggests a maximum threshold of around 15%.6 recent global estimates consistently show that rates of cesareans have been rising dramatically over the recommended threshold, particularly in latin american and some asian countries.7,8 the debate on why rates of cesareans rise quickly continues, and both supply and demand side factors are thought to play a role.1,9 the preponderance of obstetricians in providing intrapartum care and the perverse financial incentives associated with cesareans are the main factors considered from the supply side, whilst for the demand side, discussions center around women and families preferences . To date no consensus has been reached on the main factors driving the cesarean epidemic . As the largest developing country, the people s republic of china bears a substantial burden of maternal and child mortality worldwide, and was included as one of the 68 countdown countries to achieve the two millennium development goals (mdg) related to maternal and child health (mdg 4 and 5).10,11 to address the high burden of maternal mortality, a universal hospital delivery strategy was introduced by the chinese government in the mid-1990s.12 in 1995, the law on maternal and infant health care was passed to guarantee each woman s right to a hospital for quality intrapartum care . Both supply and demand side interventions have been put forward since then . Infrastructure has been strengthened, medical staff were trained and supervised in township and lower level hospitals, and referral channels to tertiary hospitals were reinforced.12 in 2003, the government launched the new cooperative medical scheme (ncms), which provides health insurance coverage for the majority of the rural chinese population for medical care, including hospital delivery . By 2007, health insurance had achieved near universal coverage in the people s republic of china, greatly increasing the financial accessibility to facility - based intrapartum care for the chinese population.13 consistent national data show that the people s republic of china s hospital delivery strategy has been successful in reducing maternal and neonatal mortality.10,11 in 1988, less than half of all women gave birth in a hospital, yet 20 years later hospital births have become nearly universal and socioeconomic inequalities in hospital births have nearly disappeared.13 over the same period, maternal mortality declined by 47%86% and neonatal mortality by 48%70% . As a result, the people s republic of china is now quoted as a successful example in the developing world in achieving mdg 4 and 5.10,11 at the same time however, rates of cesarean sections have been rising dramatically . In 20072008, the national rate was 46.2% and 40% of cesareans were reported to have no clinical indications.14 in this paper, we systematically reviewed peer - reviewed articles in both chinese and international journals on the theme of cesarean sections in the people s republic of china . From a multidisciplinary perspective, particularly health policy and systems research, we discuss the current knowledge on the prevalence, reasons, and consequences regarding cesarean sections in the people s republic of china . We add up the literature not only by describing the specific phenomenon from the people s republic of china, but also by contributing to the international debate on why cesareans rise and how it might be related to a country s health system development . We systematically searched pubmed for peer - reviewed articles . Since only a limited amount of chinese journals were indexed by pubmed, we also comprehensively searched the following chinese databases: the china national knowledge infrastructure, wanfang, and the vip information . The databases were searched from inception to september 1, 2013 . To identify further relevant studies, reference lists of included articles were hand - searched and reviewed . When searching pubmed, we included studies that reported caesarean or the following study types were included: clinical trial, meta - analysis, randomized controlled trials, and all types of observational studies, including cohort studies, case control studies, cross - sectional studies, and case reports . However, since most of the chinese journals, which are not indexed by pubmed, are not peer - reviewed and the majority of these papers are not original research, we screened the title and abstract and intentionally chose important and relevant articles for this review . Finally, we got 97 results on pubmed . Full texts of these potentially suitable articles were obtained and reviewed . With 17 articles picked out from chinese databases and five additional papers hand - searched, we finally arrived at 82 papers for this analysis (figure 1). Amongst these articles, 30 reported the prevalence and trends in cesareans, 48 reported the reasons for performing cesareans, and 30 reported the consequences of cesareans, where 23 articles reported both the prevalence and the reasons, 1 reported both the prevalence and the consequences, and one reported all three themes . The following search formula was used for pubmed: (humans[mesh terms] and (clinical trial[all fields] or meta - analysis[all fields] or randomized controlled trial[all fields] or case reports[all fields] or classical article[all fields] or clinical trial, phase i[all fields] or clinical trial, phase ii[all fields] or clinical trial, phase iii[all fields] or clinical trial, phase iv[all fields] or comparative study[all fields] or controlled clinical trial[all fields] or corrected and republished article[all fields] or english abstract[all fields] or evaluation studies[all fields] or historical article[all fields] or journal article[all fields] or multicenter study[all fields] or twin study[all fields])) and (caesarean or caesarean section or cesarean or cesarean section) and (china [title] or chinese [title]) and (china [all fields] not veterinary[mesh subheading]). There are two major types of studies estimating the prevalence of and trends in cesarean sections in the people s republic of china: hospital - based studies and population surveys (table 1). The earliest attempts used hospital records to report trends in cesarean sections in specific hospitals, categorizing cesareans by clinical indications . A typical example was zheng et al.15 using clinical records from one of the best tertiary hospitals in beijing, they reported that the proportion of cesarean births was low in 1960 (2.0%), increasing dramatically to 50.0% in 1994 . The authors categorized clinical decisions into five groups: 1) maternal factors, including pregnancy - induced hypertension and medical complications during pregnancy; 2) fetal factors, including fetal distress and placental position abnormality; 3) cephalopelvic disproportion; 4) social factors; and 5) other factors . Interestingly, a category of social factors was included, increasing from 0% of cesareans in 1960 to 10.7% in 1994 . For example, zhao et al16 reported that cesareans increased from 25.4% of births in 1990 to 39.6% in 2002 in a secondary level hospital, and feng and yue17 reported a rise from 2.6% in 1955 to 64.7% in 2004 in a tertiary hospital in middle china . Such types of studies also appeared in english peer - reviewed journals, for example han et al18 and ma et al.19 in summary, these analyses consistently reported a substantial rise in the proportion of social factors, which has become the leading reason affecting clinical decisions to perform cesarean sections in recent years . In the second type of studies health facility surveys information is also based on hospital records; each hospital itself was required to calculate the proportion of cesarean deliveries . For example, wang et al20 surveyed 887 health facilities for six types of birth attendance procedures taken in the year 2002 . They reported a national rate of cesarean section at 38.0% and extremely low utilization of sericeps and forceps in birth attendance . While the strength of this type of research is that it could yield robust national rates, the weakness is that trends could not be arrived at due to the hardship in organizing facility surveys from academic institutions . The above two study designs based on hospital records could yield robust estimates of trends and proportions of cesarean section for births in hospitals . However, as illustrated by a systematic review based on other countries,21 information extracted from clinical records may yield non - trivial misclassifications for clinical indications on the categorization of cesarean sections . Furthermore, such types of studies ignore births that are out of health facilities, resulting in an overestimate of the rates of cesarean section at national or regional level . Hospital records also lack information on the socioeconomic characteristics of the population level, limiting the scope for further policy analysis . In 1998, cai et al22 conducted a population - based survey in a district in shanghai, one of the largest metropolitan cities in the people s republic of china . Using information on cesarean sections collected from women s recall, the authors reported, for the first time, a rise of cesarean sections from 4.7% from 19601979 to 22.5% from 19881993 at the population level . Cai et al also analyzed whether cesarean sections were associated with clinical, demographic, and socioeconomic factors . They found that medical insurance coverage, older maternal age, high birth weight, and self - reported complications were factors affecting the utilization of cesareans . Following cai et al, population - based surveys became the design of choice to estimate rates of cesarean section and their determinants (15 studies as shown in table 2). For example, sufang et al23 reported trends in cesareans in the people s republic of china between 1993 and 2002 using a national cross - sectional survey and lu et al24 reported trends in southern china between 1994 and 2005 . Repeated cross - sectional surveys were also used for the estimation of longer time trends . Using the people s republic of china s national health service surveys, tang et al25 reported trends in cesareans in urban china from 19902002, while klemetti et al26 reported such trends in rural china from 19912002 . With the same national data, feng et al27 did a comprehensive analysis on the trends in cesarean section rates in the people s republic of china from 1988 to 2008 . Using the four national surveys conducted in the years 1993, 1998, 2003, and 2008, the study estimated the people s republic of china s national cesarean section rates at 3.4% in 1988, increasing ten - fold to 39.3% in 2008 . The most extraordinary increase was witnessed in urban settings, where 64.1% of the women gave birth by cesarean section in 2008; while even in the least developed rural region, the rate rose from 0% in 1988 to 11.3% in 2008 . Both clinical factors and nonclinical factors were investigated to explain the epidemic of cesarean sections in the people s republic of china . While studies on clinical factors for choosing cesareans are relatively rare and disagreement is seldom made, the debates on nonclinical factors are quite lively and in - depth, particularly on whether the rise in cesareans in the people s republic of china are fueled by the women s own choice or the obstetricians induced demand . A comprehensive list of studies addressing the factors that affect the use of cesarean sections in the people s republic of china is shown in table 2 . In summary, there are 14 studies focusing on clinical factors and 34 studies on nonclinical factors . As early as 1989, following an observation that rising cesareans were not associated with a reduction in perinatal mortality, a national academic conference was organized in the obstetricians society to discuss clinical indications for cesarean sections.28 among the clinical indications, precious child was increasingly reported, alongside other more conventional clinical factors . There was no clear definition of what was meant by precious child, and the terminology evolved to a broader but equally undefined category of social factors.15,17 clinical records from various hospitals in the people s republic of china consistently show a rise in the proportion of cesareans performed for social factors and social factors have recently become the leading reason in some hospitals.1517 there are 11 studies that reported on the women s choice for performing cesarean sections . From in - depth interviews based on relatively small sizes, qualitative evidence shows that cesareans may in part be due to women s own choices; where convenience, perceived safety, painless birth, and choice of birth date are the main reasons for cesarean preferences . Some women even believe that a baby delivered by cesarean section may be cleverer because the baby was not squeezed in the birth canal.2931 over time, various authors have introduced a new terminology in their analyses: a cesarean delivery on maternal request (cdmr). For example, zhang et al proposed a number of criteria to define cdmr.32 the five criteria that are required to qualify as cdmr are: singleton birth, cesarean delivery based on woman s request, the fetus is alive prior to delivery, gestational age of 38 weeks or more, and cesarean section before onset of spontaneous or induced labor . The following eight criteria disqualify women from cdmr: previous cesarean delivery, malpresentation, placenta previa, antepartum placenta abruption, antepartum severe preeclampsia, abnormal fetal heart rate before labor, suspected fetal growth restriction, and suspected large - for - gestational - age fetus . Using this definition, the authors found that while cesarean section rates rose from 22% in 1994 to 60% in 2003 in southeast china, the proportion that was accounted for by cdmr rose from less than 1/20 to more than 1/3 over the decade . Since good quality clinical information is required to define a cdmr, it cannot be identified through population surveys . Long et al33 proposed a simple definition of nonemergency cesareans to be used in survey instruments . Emergency cesareans were identified by asking the woman whether she felt that her child s or her own condition were in danger such that a cesarean was necessary . With population survey data from five rural counties, the authors found that half of the nonemergency cesareans were suggested by a doctor and half by the women s own choices . First, since obstetricians are powerful in clinical decisions, the power imbalance between providers and patients during labor and delivery may mask the real decision - making, and interpretation of cdmr from clinical records therefore warrants careful attention . Second, for the emergency classification approach, women s specific expectations and experiences of labor and delivery may introduce substantial information bias . How this affects the results is uncertain, but caution is required in the interpretation of preferences . Unfortunately, more robust classification such as that proposed by robson34 to identify unnecessary cesareans has never been done, leaving a substantial literature gap . There are 29 studies on structural factors fueling rising cesarean section in the people s republic of china . Using information on cesarean sections collected from women s recollections, for the first time, the authors reported a rise of cesarean sections from 4.7% in 19601979 to 22.5% in 19881993 at the population level.22 using a population - based survey, the authors analyzed the reproductive history of 1,957 married women in 1993 . Information on delivery mode was collected for a 30-year period, and the association of cesareans with clinical, demographic, and socioeconomic factors was analyzed . The study reported that form of medical payment was associated with use of cesarean section . They found that women who were covered by the government insurance scheme had a 6 times higher odds of cesarean birth compared with those covered by cooperative medical insurance . Since the government insurance offered higher cost reimbursement, the authors argued that it was the distorted incentives within the insurance arrangements that contributed to the rise in cesarean births . They further suggested that the fee - for - service payment arrangement to hospitals may exaggerate the perverse incentives introduced for doctors, since doctors would have strong motivations for providing cesareans to make more money . With similar designs as cai et al,22 tang et al25 analyzed factors affecting rising cesarean delivery rates in urban china . Using three national cross - sectional survey databases, the authors analyzed 3,559 primiparous women s reproductive information, representing urban china in 1993, 1998, and 2003 . The authors found that rates of cesarean section tripled in urban china from 1990 to 2003, and women living in large cities had 2.4 times the odds of having a cesarean delivery compared to women living in small cities . Women s educational achievement was one of the main determinants of cesarean section in urban china, with 4.5 times higher odds of cesarean section for those who had college or higher education compared with the illiterate / primary school group . While insurance coverage seemed to be positively associated with cesarean delivery, the role of income was not statistically significant . Tang et al attributed the association between higher level of education and cesarean birth to women s own choices . They argued that women may fear pain, or want to give birth on a specific date or at a time believed to be auspicious, they may want to protect the baby s brain, and may also be concerned for their sexual life following a vaginal delivery, and this would be more pronounced amongst those who are well - educated . The authors also discussed the distorted providers incentives as a potential determinant of rising cesareans, however no clear evidence was provided in support of this hypothesis . Klemetti et al26 analyzed the factors affecting rising cesarean section in rural china, using the same data sources as tang et al25 used . However, unlike tang et al s findings for urban china, the study found that household income was a strong predictor of cesarean section in rural china, where an odds ratio (or) of 2.4 was found comparing the highest with the lowest quintiles . While the effect of education was less strong than in the urban settings, with an or of 2.6, the authors reported that higher level hospitals were more likely to provide cesareans than lower level ones (or 4.0). More interestingly, the authors found that the strongest predictor for cesarean delivery in rural china was the uptake of antenatal care, where women who had any antenatal care had 8.7 times the odds for a cesarean section compared to those who did not use such services . With this evidence, the authors argued that the increased cesarean rates cannot be explained solely by medical reasons, and there might be an overuse of unnecessary, expensive services for chinese health providers, though the underlying mechanisms were not deliberately discussed . Using the other national data source from the united nations population fund, sufang et al23 confirmed that higher level hospitals had higher rates of cesareans than lower level ones, but the rates in lower level hospitals were rising substantially, nearing those in the large hospitals . Based on a natural experiment design, bogg et al35 observed rising trends of cesarean sections in five rural counties from 20012007 and found that revenue from cesareans made up 72%85% of total delivery fee revenue . They suggested that the rapid increase in cesareans and the associated expenditures in rural china may be attributed to the introduction of the ncms, which offers more generous cost reimbursement for cesarean delivery . The authors argued that the incentives of chinese health providers are distorted due to the fee - forservice payment system, which has introduced distorted behaviors for providers, such as over - prescription of drugs and antibiotics, overuse of high - technological diagnostic tests, and a treatment pattern of expensive curative rather than basic and preventive primary care . The concerns about whether health providers distorted behavior affects the rise in cesareans in the people s republic of china have generated a lively debate . Those who support such a hypothesis justify it largely on the basis that higher income households and those who have insurance coverage are more likely to have cesarean sections, since doctors can make more money from these groups.3638 but there is also some evidence refuting this hypothesis . For example, comparing women who were covered by the ncms and those who were not, xiao et al39 found that there was no overuse of delivery services, including cesareans, among the women reimbursed by the ncms . Similarly, hong,40 separating clinically indicated and nonclinically indicated cesarean sections in 32 tertiary hospitals in beijing, found that nonmedically indicated cesarean sections were not associated with health insurance in urban settings . Long et al,33 on the other hand, found an association between insurance and nonemergency cesarean delivery; however, only when cesarean rates were at a modest level (13%82%). The choice of such thresholds was somewhat arbitrary and since the insurance coverage for intrapartum care is already universal in the people s republic of china, it is hard to believe that the comparison between women who are insured and those who are not insured are robust to substantial selection bias . The most robust evidence relating cesarean sections to financial incentives is based on randomly allocated interventions in the context of a trial . Using a community - based cluster randomized controlled trial in two provinces in the people s republic of china, hemminki et al41 found that financial interventions covered part of women s costs for prenatal and postnatal care, but they were associated with only a moderate increase in cesarean sections (or 1.17; 95% confidence interval [0.961.43]). Feng et al27 performed a trends analysis on the factors affecting rising cesarean sections in the people s republic of china . Since doctors would expect higher revenue from the families with a higher ability to pay, the authors hypothesized that, if the cesarean epidemic in the people s republic of china is fuelled by distorted financial incentives, then women who are richer and insured would have experienced a faster rise in cesarean births over recent decades . However, using data from four national cross - sectional surveys between 1988 and 2008, the authors found that although cesareans were more common among the richer, well - educated, and insured women, the rate increased alarmingly in all socioeconomic groups and had a faster rise amongst the groups with lower income, no health insurance coverage, and less educational achievement . Furthermore, this study found that the socio - economic region of residence was a more important determinant for cesarean sections than the women s individual socioeconomic characteristics, questioning the link between women s personal preference, and cesarean births . Hence, supply side factors may be more important predictors for cesarean sections than ability to pay or education . The strong regional variation in the cesarean section rate, as found in this study, points to structural factors related to the supply of services as an important driver of the increase . As an interpretation, the authors argued that it may be due to the people s republic of china s health development approach focusing on specialized care that contributes to the epidemic of cesarean sections in this country . The people s republic of china has marginalized midwifery and midwifery education was discontinued in 1993 . As a result, the density of nurses and midwives is lower than in other countries with similar income levels, and the number of doctors trained in western medicine doubled in the past 20 years . Hospitals in urban and wealthier regions are better equipped and have more qualified staff than those in more remote rural regions, making cesarean section more accessible . The contribution of specialized obstetric care to rising cesarean sections, as proposed by feng et al27 is supported by several intervention studies initiated from the clinical and midwifery disciplines . For example, runmei et al42 conducted an intervention study in a tertiary referral hospital in south - western china . With the auditing of surgeons practices as the key intervention, cesarean section rates in this hospital decreased by 20% per year between 2005 and 2011 . Cheung et al43 organized an innovative midwife - led normal birth unit in one tertiary hospital in 2008, aiming to facilitate normal birth and enhance midwifery practice . Based on a retrospective cohort design, the authors reported a 33% reduction in the rates of cesarean section for women who used midwife - led care . As a recommendation, the authors proposed a separation of obstetric care from maternity care and a revisit of midwife care as an independent discipline . Notwithstanding these findings, midwifery and normal delivery propositions seems to be out of chinese health policy makers perspective and evidence on this topic is still insufficient to influence current policy making . As a summary for nonclinical factors affecting rising cesareans in the people s republic of china, there is a lively debate on whether women s preferences or providers distorted financial incentives affected the rise in cesarean sections . Notwithstanding, recent evidence suggests that it might be the people s republic of china s health development approach focusing on specialized care and marginalizing primary care that is playing a role, though further work is warranted to strengthen the causal link . There are three types of designs used to investigate pure clinical factors affecting cesarean sections in the people s republic of china: hospital records analysis (6 studies), population surveys (2 studies), and case control studies (4 studies). By describing the proportions of various clinical indications for performing cesareans, the first type of design, hospital records analysis, generally shows that cephalopelvic disproportion, fetal distress, breech presentation, abnormal pelvis, macrosomia, dystocia, hypertension, multiple birth, premature rupture of membranes, oligohydramnios, late preterm births, and older maternal age are the most commonly reported clinical indications.1517,44,45 however, the limitation of this type of research is obvious since only proportions of each clinical indication are described, while no relative risks would be arrived at for comparisons between factors . To further strengthen the association of various risk factors with the use of cesarean section, some authors sampled out cases of deliveries from hospital records, completed them with some demographic factors, and did cross - sectional analyses on the various clinical factors affecting the utilization of cesarean section . Using such an approach, ma et al19 reported a positive association of multiple births, large for gestational age, pregnancy complications, and older maternal age with cesarean births . To accommodate wider factors, some authors generalized such an approach to the population level . For example, huang et al46 investigated the association between times of antenatal ultrasound utilization and the use of cesarean section based on population surveys and found an or of 1.36, which means that one additional antenatal ultrasound scan would increase the possibility of performing a cesarean section around 1.36 times . To strengthen the causal relationship, some authors build up this approach by using case control or nested case control designs . For example, cheng et al47 compared 6,421 vaginal and 7,650 cesarean births in 48 hospitals from three metropolitan cities in the people s republic of china and found that birth weight larger than 4,000 g, maternal obesity, cephalopelvic disproportion, fetal distress, dystocia, and placenta previa were the main determinants for having a cesarean section . Zhou et al48 conducted a similar analysis for a rural chinese population and identified hypertension, breech presentation, dystocia, preterm delivery, and older age as predictors of cesarean births . Furthermore, there are some case control studies examining whether a specific disease is association with cesarean section . Lu et al49 compared mothers who were hepatitis b surface antigen carriers with those who were not based on hospital records, and reported that such a factor is not statistically associated with cesarean procedures . Using a similar design, zhang et al50 reported that mothers with uterine anomalies have a higher probability of cesarean birth . Research on the consequences of cesareans are relatively rare and out of focus, and in general the evidence ranked weakly . Of the 30 articles identified, 13 studied clinical outcomes for cesarean birth, 9 studied child health outcomes, 7 studied maternal health outcomes, and only 1 studied health system level outcomes (table 3). In the one study addressing structural consequences, long et al37 using repeated cross - sectional survey data found that the expenditure for facility - based delivery greatly increased in rural china over 19982007 because of greater use of more cesarean deliveries . On average, the out of pocket payment for cesarean section constituted 31.8% of a poor rural household s annual income . Two studies were based on a case control design and the other eleven were cross - sectional studies . For the two case control studies, one found that cesarean sections were associated with lower cord blood plasmin activity and lower umbilical blood igg, igm, c3, and c4 compared to vaginal delivery.51 the second case control study, making the same comparisons, found no association between cesarean birth and intraventricular hemorrhage.52 the eleven cross - sectional studies consistently found that cesarean sections were associated with higher risks of venous thromboembolism, surgical site infection, and postpartum infection . However, evidence on whether women who had a cesarean section are more likely to have postpartum hemorrhage is contradictory between the two studies reporting such outcomes.53,54 for example, cai53 found that performing cesareans is associated with higher risk of postpartum hemorrhage, while jiang et al54 found no associations that were statistically significant . Cesarean births seem to have higher risks of neonatal injury as reported by cai.53 and repeated cesareans were associated with higher hysterectomy.55 however, the associations of cesarean section with other clinical outcomes were not profound; for example, overactive bladder, lower urinary tract storage symptoms, incontinence, vertical transmission of chlamydia trachomatis, intraventricular hemorrhage in preterm babies, intrapartum fetal death, neonatal respiratory distress syndrome, and low neonatal apgar scores . Studies examining the consequences of cesarean section on child health examined breastfeeding behaviors, child obesity, and physiological development . Of the 8 articles identified, only 3 were published in peer - reviewed journals, including 2 retrospective cohort studies56,57 and 1 case control design.58 in general, the findings are consistent in showing that cesarean section on maternal request is a risk factor for child obesity, which is consistent with international evidence.59 however, the link from cesareans to child physiological development is not robust . There are 5 papers published in peer - review journals on the maternal health consequences after performing a cesarean section . One was based on cross - sectional data, where no associations of breast milk zinc concentration and self - reported postpartum health with cesarean births were found.60 the other 4 were based on prospective cohort study designs, where one cohort reported that women performing cesarean births were less likely to provide exclusive breastfeeding and formula feeding was more likely to be offered to the infant,61 while another found a contrary result.62 based on a 2-week follow - up of 534 women delivering babies in two hospitals, xie et al63 found that cesarean section is associated with increased risk of postpartum depression with an adjusted relative risk near 2 . Notwithstanding, the actual or perceived safety of cesarean section in the people s republic of china is pretty rare . With a national rate near 40% and a rapid rise in the country over the past decade, there is no doubt that the rising rate of cesarean sections has become a national epidemic in the people s republic of china, warranting careful policy considerations . However, no consensus has been made on the leverage factors that drive the increase in the use of cesarean section, particularly for those nonclinical factors . While the main debate is around whether the rise in cesarean sections is fueled by women s own preferences or providers distorted financial incentives, recent evidence suggest that it might be the more macro level structural factors that are playing a part, ie, the people s republic of china s health development approach focusing on specialized care and marginalizing primary care, though further research is warranted to understand the underlying mechanisms . Compared to the lively debate analyzing the trends and factors that affect the rising number of cesarean sections, knowledge of the consequences of cesareans is quite limited in the people s republic of china . The only robust evidence is that children of cesarean births are more likely to be obese . However, research on how the uptake of cesarean section affects women s health is underdeveloped.
|
Prnp / mice (edinburgh strain)21 on an inbred c57bl6 background were obtained from dr . Chesebro of the rocky mountain laboratories and prnp / mice (zurich i)20 on a mixed strain background from the european mutant mouse archive . For binding assays, cos-7 cells were transiently transfected with cdna expression plasmids or isolated hippocampal neurons were cultured from e18 embryos . Hippocampal slices (400 m) from c57bl6j or prnp/ mice were bathed in oxygenated artificial cerebrospinal fluid . The schaffer collateral pathway was stimulated at 0.033 hz at levels that evoked less than 50% of maximal field epsps . Evoked ca1 field potentials were recorded and the slope of the epsp determined (clampfit, molecular devices). A42 or antibodies were bath applied for 2040 minutes before inducing ltp with ten 100 hz trains at five pulses delivered at 5 hz . Prnp / mice (edinburgh strain)21 on an inbred c57bl6 background were obtained from dr . Chesebro of the rocky mountain laboratories and prnp / mice (zurich i)20 on a mixed strain background from the european mutant mouse archive . A42 oligomer preparations were generated from synthetic peptide4 . For binding assays, cos-7 cells were transiently transfected with cdna expression plasmids or isolated hippocampal neurons were cultured from e18 embryos . Hippocampal slices (400 m) from c57bl6j or prnp/ mice were bathed in oxygenated artificial cerebrospinal fluid . The schaffer collateral pathway was stimulated at 0.033 hz at levels that evoked less than 50% of maximal field epsps . Evoked ca1 field potentials were recorded and the slope of the epsp determined (clampfit, molecular devices). A42 or antibodies were bath applied for 2040 minutes before inducing ltp with ten 100 hz trains at five pulses delivered at 5 hz.
|
Histopathologically, it is a neutrophilic dermatosis which presents as deep purulent ulcers with well - defined and often undermining margins with a violaceous hue . Multiple phenotypes of pyoderma gangrenosum have been described; ulcerative form is the most common type (1). The most common location of pyoderma gangrenosum is in the lower extremities (2, 3) but any part of the body can be involved . In inflammatory bowel disease, pyoderma gangrenosum is reported in about 3% patients in ulcerative colitis and more often in patients with crohn's disease (4). In the general population, it has been described both as a cutaneous disorder of uncertain etiology (5) and a cutaneous manifestation of systemic disorders . About half of the cases of pyoderma gangrenosum have an associated systemic disorder (6). Most common systemic disorders include inflammatory bowel disease, hematologic malignancies, autoimmune arthritis, and vasculitis . As a cutaneous disorder, visceral lesions are similar to cutaneous lesions (sterile neutrophilic infiltration with granuloma formation) and have been reported in lungs, liver, bone, spleen, major airway, heart, and so on (710). The most likely differential diagnosis is granulomatosis with polyangiitis . In the cases reported here, the patient had no evidence of renal or upper airway involvement and was tested negative for c - anca . The combination of lack of clinical findings and c - anca make granulomatosis with polyangiitis very unlikely in our patient . As per a literature review performed in 2011, 11 cases of pulmonary nodules with or without cavitation have been reported in pyoderma gangrenosum (11). Reported pulmonary nodules are usually subpleural, unilateral or bilateral, no predilection to upper lobe, may or may not have sterile central caseation leading to cavity formation . Lung biopsies of these lesions show non - specific necrotizing inflammatory granulomas with neutrophilic infiltration (11). A very high recurrence rate is reported (312) and about 5% of cases are refractory to glucocorticoids that have been successfully treated with cyclosporine a, tacrolimus, or a biological agent (13, 14). Our patient was continued on mesalamine; oral prednisone was being tapered down without worsening of cutaneous lesions and inflammatory changes in the lung cavity were resolved . In conclusion based on prior reports of histopathological similarity in skin and lung lesions and response to steroid treatment, pulmonary nodules could be assumed a spectrum of extraintestinal manifestation of ulcerative colitis . In clinical practice, granulomatosis with polyangiitis should be considered as differential diagnosis as up to 14% of the patients with granulomatosis with polyangiitis have cutaneous lesions (15). Lack of vasculitis in biopsy and immune deposits favor pyoderma gangrenosum, whereas c - anca is highly specific for active granulomatosis with polyangiitis (16). The authors have not received any funding or benefits from industry or elsewhere to conduct this study.
|
Congenital segmental dilatation of ureter is a rare entity in children and characterized by a giant, focal segmental dilatation of mid ureter . We report two children with segmental dilatation of ureters; one child had ipsilateral megacalycosis and contralateral vesico - ureteric reflux (vur) presenting with acute renal failure and sepsis . The other child had unilateral duplex system with segmental dilatation of both upper and lower moiety ureters with evidence of xanthogranulomatous pyelonephritis (xgp) in the lower moiety . Master bt, 7 years male presented with high fever and scanty, high - colored urine, and lethargy . A large lump his blood urea and serum creatinine values at admission were 229 mg% and 5.4 mg%, respectively . Ultrasonography (usg) showed bilateral gross hydronephrosis and a large cyst on the left side, possibly a bladder diverticulum . An intravenous pyelography (ivp) done elsewhere 2 months earlier had shown right - sided gross hydro - ureteronephrosis on right side and non - functioning left kidney . Blood urea and serum creatinine values decreased to 90 mg% and 1.7 mg%, respectively, following bilateral percutaneous nephrostomies . Exploration revealed a dilated left upper ureter (12 cm long) opening into a large cyst (10 cm 6 cm), which was thick - walled and adherent to the bladder wall [figure 1]. A 2 cm long lower ureter was seen from the cyst to the bladder neck . The dilated segment along with the lower ureter was excised, and end to side ureteroureteral anastomosis was done to the contralateral ureter . Histology of dilated segment showed damaged epithelium with infiltration of sub - epithelial layers with inflammatory cells . The patient was put on chemoprophylaxis for 6 months (co - trimoxazole and nalidixic acid alternately every 6 weeks) and has been asymptomatic for last 4 years . His blood urea and serum creatinine values on last visit were 48 mg% and 1.1 mg%, respectively . Normal - looking upper ureter opening into the dilated segment (case 1) a 14-month - old male child presented with abdominal distension and pain of 2 months duration . A thick - walled cystic structure with thick fluid inside (4 cm 3 cm) was noted on right side just above the bladder . Ivp showed right - sided hydronephrosis, as the radiologist missed the non - functioning lower moiety . Renal biochemical parameters were within normal limits . At operation, right - sided duplex kidney was noted . Normal size upper moiety ureter (8 cm long) drains into the dilated segment (3 cm 2 cm). The small lower moiety and dilated upper ureter (4 cm long) drains into a markedly dilated, thickened ureteral segment (6 cm 4 cm). The dilated segments were densely adherent to the bladder wall and extended up to the recto - vesical pouch . Partial nephroureterectomy (lower moiety) was done with excision of the dilated segment of both upper and lower moiety ureters . Normal upper moiety ureter was re - implanted into the bladder by leadbetter - politano technique . The patient had uneventful recovery and was doing well till last follow up at 18 months . Photomicrograph (h and e stain 200) showing groups of large round to oval cells with eosinophilic cytoplasm and vesicular nuclei mixed with interlacing fibrocollagenous tissue, infiltrating into the sub - epithelial stroma s / o juvenile xanthogranulomata (case 2) master bt, 7 years male presented with high fever and scanty, high - colored urine, and lethargy . A large lump his blood urea and serum creatinine values at admission were 229 mg% and 5.4 mg%, respectively . Ultrasonography (usg) showed bilateral gross hydronephrosis and a large cyst on the left side, possibly a bladder diverticulum . An intravenous pyelography (ivp) done elsewhere 2 months earlier had shown right - sided gross hydro - ureteronephrosis on right side and non - functioning left kidney . Blood urea and serum creatinine values decreased to 90 mg% and 1.7 mg%, respectively, following bilateral percutaneous nephrostomies . Exploration revealed a dilated left upper ureter (12 cm long) opening into a large cyst (10 cm 6 cm), which was thick - walled and adherent to the bladder wall [figure 1]. A 2 cm long lower ureter was seen from the cyst to the bladder neck . The dilated segment along with the lower ureter was excised, and end to side ureteroureteral anastomosis was done to the contralateral ureter . Histology of dilated segment showed damaged epithelium with infiltration of sub - epithelial layers with inflammatory cells . The patient was put on chemoprophylaxis for 6 months (co - trimoxazole and nalidixic acid alternately every 6 weeks) and has been asymptomatic for last 4 years . His blood urea and serum creatinine values on last visit were 48 mg% and 1.1 mg%, respectively . A 14-month - old male child presented with abdominal distension and pain of 2 months duration . A thick - walled cystic structure with thick fluid inside (4 cm 3 cm) was noted on right side just above the bladder . Ivp showed right - sided hydronephrosis, as the radiologist missed the non - functioning lower moiety . Renal biochemical parameters were within normal limits . At operation, right - sided duplex kidney was noted . Normal size upper moiety ureter (8 cm long) drains into the dilated segment (3 cm 2 cm). The small lower moiety and dilated upper ureter (4 cm long) drains into a markedly dilated, thickened ureteral segment (6 cm 4 cm). The dilated segments were densely adherent to the bladder wall and extended up to the recto - vesical pouch . Partial nephroureterectomy (lower moiety) was done with excision of the dilated segment of both upper and lower moiety ureters . Normal upper moiety ureter was re - implanted into the bladder by leadbetter - politano technique . The patient had uneventful recovery and was doing well till last follow up at 18 months . Photomicrograph (h and e stain 200) showing groups of large round to oval cells with eosinophilic cytoplasm and vesicular nuclei mixed with interlacing fibrocollagenous tissue, infiltrating into the sub - epithelial stroma s / o juvenile xanthogranulomata (case 2) segmental dilatation of ureter is a rare entity, and only 12 case reports are found in the english literature . This condition is characterized by giant, focal segmental ureteral dilatation producing an elongated and distorted ureter . It may be associated with megacalycosis, duplication of collecting system and hypoplastic, dysplastic or non - functioning kidney . They usually have a dysplastic or disorganized muscle coat, lined with columnar epithelial mucosa, rather than the usual transitional epithelium . The associated kidney or the moiety may be hypoplastic or the site of comparatively mild hydronephrosis associated with atrophic renal parenchyma . Ramaswamy et al . Reported a case of congenital segmental megaureter with sparing of the proximal and distal ureter . The authors suggested that attenuated nexuses and thin myofilaments might be responsible for this entity . Soler reported a case of an unilateral multicystic dysplastic kidney and contralateral megacalycosis associated with ipsilateral distal segmental megaureter . Pinter speculated abnormal recanalization of the solid ureteral duct during development as a possible cause . Xgp is an atypical form of chronic pyelonephritis characterized by diffuse, focal or segmental suppurative destruction of renal parenchyma . Urinary tract obstruction, urosepsis, renal ischemia, lymphatic obstruction, and altered immune response may be responsible for xgp . In the rare localized form, the lesion can be confined to one or other pole, as was seen in our second case . Its association with duplex kidney is known, but its association with segmental dilatation of ureter has not been reported earlier . The treatment of segmental dilatation of ureter is excision of the diseased segment with end - to - end ureteroureterostomy . A better option is to anastomose the upper ureter end - to - side to the contralateral ureter, as was done in our first case . Localized form of the disease, as in our 2 case, is rare, and a partial nephrectomy is ideal . These patients need long - term follow up as secondary amyloidosis has been reported in association with xgp.
|
In terms of symptoms, women are less likely to report snoring or witnessed apnoea but are more likely to complain of daytime fatigue, lack of energy, insomnia, morning headaches, mood disturbance and nightmares compared to men [7, 8]. In sleep studies, compared to men, women have a lower apnoea hypopnoea index (ahi), and their apnoeic episodes are shorter and less often associated with complete upper airway collapse . Women have less supine osa but clustering of apnoea during rapid eye movement (rem) sleep is common . Lower ahi in women is contrasted with higher occurrence of prolonged episodes of partial upper airway obstruction [36], which typically appear in slow - wave sleep and are associated with increased carbon dioxide levels [9, 10]. Increased carbon dioxide during sleep could be one possible reason [9, 10] why women are symptomatic at relatively low ahi and have a different symptom profile . This is supported by the finding that in women, excessive daytime sleepiness and daytime fatigue are associated with habitual snoring, independent of ahi, age, obesity, smoking or sleep parameters . Partial obstruction is related to increased respiratory resistance, which is characterised by an increase in end - tidal and transcutaneous carbon dioxide . Correcting prolonged flow limitation with continuous positive airway pressure (cpap) treatment is associated with a higher attentiveness and a higher efficiency in normalising daytime vigilance than when eliminating only apnoea, hypopnea and snoring . Furthermore, hypercapnia is associated with electroencephalography (eeg) slowing and daytime sleepiness in sdb, and cpap treatment corrects the eeg slowing together with decreased daytime sleepiness . Both progesterone and oestrogen enhance genioglossus contractility, counteracting the upper airway collapsibility during sleep . The increased respiratory drive caused by female hormones, particularly progesterone, may protect upper airway patency by enhancing upper airway dilator muscle activity . Conversely, the increased ventilatory drive associated with increased levels of progesterone [18, 22] might cause a vacuum effect and increase the risk of upper airway collapsibility . By increasing respiratory drive and decreasing arterial carbon dioxide tension carbon dioxide sensitivity is higher and upper airway resistance lower during the luteal phase (high progesterone levels) compared to the follicular phase [24, 25]. Since the hypocapnic apnoeic threshold is higher in men than women, this suggests that the increased breathing instability during sleep in men is related to the presence of testosterone . Pregnancy, polycystic ovary syndrome and menopause are female - specific and sex hormone - dependent conditions that may predispose to sdb . Progesterone and oestrogen levels increase during pregnancy and decline during menopausal transition, whereas polycystic ovary syndrome is associated with androgen excess . Prevalence of snoring in pregnant women ranges from 10% to 45% and up to 75% in pre - eclampsia . Lean women are well protected from osa even in cases of multiple pregnancy, whereas in obese women, the prevalence is estimated to increase up to 10% by the first and 27% by the third trimester . Increased minute ventilation, preference for the lateral sleeping position in late gestation and decrease in rem sleep may protect against osa, whereas gestational weight gain, oedematous nasal mucosa, decreased lung functional residual capacity (frc) and increased arousals increase the osa risk . The enlarged uterus causes diaphragmatic elevation leading to increased end - expiratory abdominal pressure, and reduced expiratory reserve volume and frc, which may result in less caudal traction of the trachea and pharynx, predisposing to increased airway collapsibility . Furthermore, the increased ventilatory drive associated with increased levels of progesterone may cause a vacuum effect and increase the risk of upper airway collapsibility . An obvious concern is that intermittent hypoxia could predispose to placental ischaemia and fetal growth retardation [30, 31]. In an animal model, gestational chronic intermittent hypoxia resulted in intrauterine growth restriction and increased the risk of the offspring for metabolic diseases in adulthood . Especially in obese women, osa may be associated with increased risk of gestational diabetes, pregnancy - induced hypertension, pre - eclampsia, intrauterine growth retardation, preterm delivery, caesarean section and neonatal intensive care [30, 31]. Conversely, pre - eclampsia might predispose to osa through fluid retention, rostral fluid shift and upper airway oedema . Potential shared pathophysiological mechanisms include oxidative stress, increased sympathetic activity, inflammation, adipokine effects and insulin resistance [30, 31]. Sdb in women with pre - eclampsia typically manifests as flow limitation with increases in nocturnal carbon dioxide levels but with low ahi despite increased frequency of oxygen desaturations, particularly during rem sleep . Blood pressure responses to episodes of obstructive apnoea are augmented in normal pregnancy and further in pre - eclampsia . The increased sympathetic activity during the third trimester contributes to the increased prevalence of osa, which in turn probably further augments sympathetic tone predisposing to pre - eclampsia . Cpap treatment reduces sleep - induced blood pressure increments and upper airway collapsibility and improves fetal movement activity in pre - eclampsia . The prevalence of sdb in females doubles after menopause [3436] independently of age and bmi, the peak being at the age of 65, 10 years later than in men . Less hyperpnoea after episodic hypoxia and more stable respiratory effort in non - rem sleep in response to hypercapnia and arousals might protect premenopausal females from osa . During menopausal transition, respiratory drive decreases . Increased arousals predispose to respiratory instability and increased soft tissue collapsibility aggravates upper airway obstruction . However, obesity may have a sex - specific impact on prevalence and type of osa . In a study of more than 20 000 patients, osa severity increased linearly with age in normal - weight and obese women and in normal - weight men, whereas in obese men, ahi increased from age 20 to 40 years and remained stable thereafter . In 233 age- and bmi - matched male female pairs, osa increased with increasing bmi only in men, whereas partial obstruction increased with moderate to morbid obesity in both sexes after the age of 65 years . Most studies have included only men and the few studies in females have had inconsistent results . Some studies have suggested higher [8, 41], some similar and some even lower cardiovascular risk [43, 44] in women with sdb compared to men . Lower risk of hypertension has been suggested in postmenopausal women with mild sdb (snoring or ahi <15 per h) and using hormone therapy or in those presenting with predominantly partial upper airway obstruction . Females with untreated osa, followed for 6.8 years, had a greater incidence of stroke and chronic heart disease than women without osa . Women seem to have a greater impairment in quality of life and higher healthcare expenditure than men with similar ahi severity . Women with osa had a two - fold increased risk of lost work days due to work disability compared to controls . Furthermore, the excess risk in women was already pronounced 5 years prior to the year of osa diagnosis, whereas in men, the highest risk was noticed 1 year before the year of diagnosis . Conventionally, the diagnosis of sdb is based on ahi, with an ahi> 5 per h being considered significant for diagnosis . A higher ahi is sometimes required for initiation of nasal cpap therapy and an ahi> 30 per h is considered severe sdb, associated with marked comorbidity and decreased quality of life . In women, mild osa may translate into as severe health consequences as osa with higher ahi in men [46, 52]. Considering increased fatigue in women with osa despite low / normal ahi, it has been suggested that symptomatic women with snoring or partial upper airway obstruction should be considered for treatment even if ahi <5 per h [5, 12]. Irrespective of sex, weight loss is the corner stone of treatment of sdb in obese patients . In women, weight loss may, however, be less efficient in decreasing osa severity . Oral appliances may work better in women than in men ., it is important to titrate the pressure to control not only osa but also episodes of partial upper airway obstruction [15, 16]. Recent female - specific autotitrating algorithms for cpap devices may reduce flow limitation more efficiently but whether this results in better treatment outcome remains to be shown . However, it is reasonable to apply similar, if not less stringent, criteria for treatment . Autoadjusting cpap devices are a feasible option responding to required pressure adjustments during pregnancy and post partum . Oral appliances may be impractical during pregnancy, since they may need multiple fitting sessions . Weight reduction or surgical procedures should be avoided until their safety in pregnant women is well - enough established . Menopause is associated with depletion of female sex hormones with concomitantly increased osa risk [34, 35]. Hormone therapy might increase genioglossal activity and apnoea threshold resulting in decreased propensity to periodic breathing and osa . However, small interventional studies using different formulas of hormone therapy have provided conflicting results in alleviating sdb severity [18, 57, 58]. The inconsistent evidence and risks of hormone therapy do not justify its use to prevent or treat osa . Larger epidemiological studies of osa prevalence and fetal outcome during normal pregnancy and pre - eclampsia are needed . This is due to the high prevalence of partial upper airway obstruction, resulting in clinically significant carbon dioxide increases during sleep . In symptomatic women with low ahi but marked partial upper airway obstruction, a cpap trial is often justified . Better understanding of the mechanisms through which different hormonal environments during a woman's life span predispose to or promote progression of osa will ultimately lead to novel therapeutic options to prevent and treat sdb in women across all ages.
|
Telemedicine is the practice of healthcare using interactive audio, visual, and data communication; this includes healthcare delivery, diagnosis, consultation, and treatment, as well as education and transfer of medical data . Telemedicine may be as simple as two health professionals discussing a case over the telephone or as complex as using satellite technology and videoconferencing equipment to conduct a real - time consultation between medical specialists in two different countries . Telemedicine generally refers to the use of communications and information technologies for the delivery of clinical care . Teledermatology as an application of telemedicine was developed in 1995: it turns out to be a gradually more ordinary mean of delivering dermatologic healthcare worldwide and will almost certainly have a greater medical function in the future . During the last years, teledermatology has gained a lot of interest among scientific community . It can deeply revolutionize the delivery of dermatology services, providing equitable services to remote areas and allowing primary care physicians to refer patients to well - equipped dermatological services at a distance . Teledermatology uses telecommunication technologies to transfer information to patients via mobile phone and images of skin lesions to clinicians via the internet . Nowadays, a reduction of morbidity and mortality of nonmelanoma and melanoma skin cancer is the most important challenge for dermatology: teledermatology can be considered a new tool that allows preventing and diagnosing skin cancers . Because solar irradiance is the reason of many dermatologic effects, a certain number of studies have tried to evaluate different methods to calculate a daily parameter of sun irradiance . These studies have tried to correlate the daily parameter with human photoexposure in order to avoid sunburns and other sun risks [47]. Nevertheless, sunscreen use is often recommended in order to prevent certain types of skin cancers and sunburns [8, 9]. From a national canadian questionnaire, it has been estimated that only a few part of population (about 20%) uses sunscreen regularly . A major cause of nonadherence to sunscreen use is oversight, but also the misunderstanding about sunscreen uses and its benefit . In order to avoid the risks of sun exposure, many educational programs are in progress to inform people about preventive measures . Many scientific agencies have calculated, under the leadership of who (world health organization), a daily index of sun irradiance to detect the cut - off value to avoid sunburn and sun risks . Sun light composes of a very wide range of electromagnetic waves of which the human eye is able to perceive light radiations . It knows that med (minimal erythemal dose) is defined as the quantity of uvb able to elicit an erythemal response . Nevertheless, to calculate skin sensitivity, a new noninvasive method is a multiband spectrophotometer (skin analyzer) with two reflectance measures, and other magnitudes which can be directly correlated to them (e.g., absorbance), a calculation unit and a data storage unit for calculating the corresponding med . This sensitivity varies from individual to individual and can be determined with different methods [6, 11, 12]. In 2006, monitored sun radiation to obtain bioclimatic parameters useful for evaluating climatic changes in order to get an adequate sun protection map, set up an experimental photodermatology service, and promote preventive devices through a system of customized uv teledosimetry using information technology such as mobile phones . A total of 450 tourists were selected in capri town, and they filled a questionnaire containing personal information as sex, age, hair colour, eye colour, phototype, sunscreen used, and sunbathing time . The med was measured by the skin analyser q tan, and, after the examination, the team of dermatologists compiled a card for each of them with information about their photosensitivity . The tourists selected in this project before sun exposure were informed by smss through their mobile phones or through a light board about the optimal uv dose for their skin and about an estimate of the residual exposure time considering the uv irradiance . More exactly, in the study, the authors correlated the uvi to the phototype of the subjects studied, thus obtaining an estimate of the maximum exposure time expressed in minutes to avoid sunburn . A software instantaneously calculates the exposure time to avoid sunburn on the basis of the effective erythemal dose (de) expressed in med / h using the following algorithm st = 60/de . Therefore, in a typically sunny august day with a uvi equal to 6 (2.6 med / h), a phototype i or ii at his / her first sun exposure would develop a sunburn after about 20 minutes, while in a moderately pigmented subject this would take some hours . Half of them received daily sms reminders through their mobile phones for 6 weeks, and the other half did not receive reminders . The smss reminder consisted of two components: a hook text detailing daily local weather information and a prompt text reminding users to apply sunscreen . This methodology showed that a simple daily reminder could maintain adherence to sunscreen application; in fact the participants who received the sms reminders were nearly twice as adherent to a regimen of daily sunscreen application respect with control participants who did not receive sms reminders . Previous studies that had just examined the use of text messaging in health care have found that text - message reminders improve outpatient clinic attendance [1519], encourage weight loss, and provide support to diabetic patients . The results of these studies confirm that text messages or smss can promote behavioural changes . In fact, smss can be used to promote preventive health behaviours or help individuals adhere to medication regimens for several reasons . The mobile phone renders the people readily available, and the sms is a simple, low cost, and immediate method of delivering reminders without using the computers, but the point more important is that text messaging may be attractive to younger people, an important target population for development of positive preventive health habits . Despite numerous recommendations, people have yet to understand the problems related to excessive sun exposure and the importance of using sunscreen . The results of these studies suggest that text - message reminders reach a large number of people at low cost . Introduction of a program that incorporates text - message reminders to a large population may be an innovative preventive health measure against the development of skin cancer . Dermoscopy is a noninvasive, in vivo technique and has the potential to improve up to 49% the diagnostic accuracy for melanoma and nonmelanoma skin cancer, if used by experts [2224]. In 1998, provost et al . Made the first step in the creation of an international teledermoscopy network, using a store - and - forward technology with dermoscopic images . The feasibility of teledermoscopy reveals a 91% consensus between the face - to - face diagnosis and the remote diagnosis . The consensus netmeeting of dermoscopy (a virtual meeting of experts from all over the world) was another evident example of the practical applicability of the use of dermoscopy via the internet . In 2003, a pilot study of the dermoscopic - pathologic approach using telediagnosis for melanocytic skin neoplasms revealed that the diagnostic accuracy reached 83% versus gold standard (conventional histopathologic diagnosis by experts). A 2-step teledermatologic approach may be feasible in managing individuals with multiple pigmented skin lesions . Teleconsultations were sent from general practitioners to the pigmented skin lesion clinic of the department of dermatology, university of seville, in seville, spain, and 49% of the patients were referred to the ftf clinic . There was agreement among the teleconsultants for both the diagnosis (k = 0.91) and for the management options (k = 0.92). Regard, tan et al . Evaluated if teledermoscopy could be considered as a triage tool of patients referred to a skin lesion clinic . Two - hundred patients referred to a dermatology skin lesion clinic were recruited, and a total of 491 lesions were seen . Digital and dermoscopic photographs were taken of skin lesions of concern, and the patients were then seen independently face - to - face by two out of three dermatologists . The digital images were evaluated 4 weeks later, as a teledermoscopy consultation, by two of these dermatologists . There was excellent agreement between teledermoscopy and face - to - face diagnosis with only 12.3% of lesions having disparate diagnoses of clinical significance . Only 12 of 491 lesions appeared to have been underreported by teledermoscopy when compared with face - to - face diagnosis . However, when histopathology became available, only one malignant lesion had been missed (a basal cell carcinoma diagnosed as solar keratosis) by teledermoscopy . Importantly, 74% of all lesions were determined to be manageable by the general practitioner without needing to be seen face - to - face by a dermatologist . Also investigated the feasibility of teleconsultation using a new generation of cellular phones in pigmented skin lesions . 18 patients were selected consecutively in the pigmented skin lesions clinic of the department of dermatology, medical university of graz, graz (austria). The face - to - face (ftf) diagnoses (16 benign lesions and 2 melanomas) were made in each case . Clinical and dermoscopic images were acquired using a sony ericsson k 750i with a built - in two - megapixel camera and a pocket dermoscopy device with a 25 mm 10x lens (dermlite ii pro hr (3gen, llc two teleconsultants reviewed the images on a specific web application where images had been uploaded in jpeg format . Compared to the face - to - face diagnoses, the two teleconsultants obtained a score of correct telediagnoses of 89% and of 91.5% reporting the clinical and dermoscopic images, respectively . Anyway, in a nhs r&d technology assessment, patients referred to a 2-week wait clinic were invited to have a series of digital photographs, with and without dermoscopy, immediately before their face - to - face consultation . A surprisingly high proportion (33%) of referrals proved to have a cutaneous malignancy or a severely dysplastic lesion, with almost 22% having a malignant melanoma or squamous cell carcinoma, possibly reflecting the rise in incidence of skin cancers reported elsewhere . If the highest level of clinician confidence had been applied, no cancers would have been missed, but only 20% of patients would have avoided an outpatient appointment . It was concluded that it is unlikely that this approach can dramatically reduce the need for conventional clinical consultations while still maintaining patient safety . Unfortunately, according to previous observations, teledermoscopy of hypopigmented or nonpigmented lesions cannot always significantly improve diagnostic accuracy . Fabbrocini et al . Focused on 44 not very common lesions in the clinical practice, characterized by poor and/or absent pigmentation, absence of regular network, and a diameter <5 mm . The 44 lesions examined by the two observers consisted of 39 melanocytic lesions (12 spitz naevi, 9 melanomas, 8 melanomas in situ, 7 clark naevi, 2 dermal naevi, and 1 spitzoid melanoma) and 5 nonmelanocytic lesions (2 seborrheic keratosis, 1 dermatofibroma, 1 haeman - gioma, and 1 bowen papulosis). They chose these kinds of lesions with high diagnosis complexity either clinically or dermoscopically to evaluate the reliability of using teledermoscopy for the diagnosis of rare and atypical lesions . The pattern analysis and the 7-point checklist were applied to all 44 skin lesions for the early detection of melanoma . The interobserver agreement and the agreement between face - to - face diagnosis and telediagnosis were assessed . The agreement was investigated using cohen's k statistics . With respect to the pattern analysis, it was observed that some features, such as leaf - like areas, milia - like cysts / comedo - like openings, blue - white structures, and blotches, are detected with the same frequency in face - to - face and teledermoscopic observations . Regarding pigment network, regression structures, and diffuse pigmentation, the results showed that they were more evident in teledermoscopic observation, whereas vascular pattern, radial streaks, and dots / globules had lower detection frequency . With respect to the 7-point checklist, it was noticed that irregular pigmentation and regression structures had a higher frequency in teledermoscopic observation; all other criteria were better detected in face - to - face observation . A significant difference in total score derived from 7-point checklist analysis was evident between face - to - face observation and teledermoscopic observation; lesions with a score equal or superior to 3 were found mostly in face - to - face observation . The agreement, evaluated through cohen's k, between the 1st and the 2nd observer on clinical diagnosis was very low (k = 0.362). Moderate agreement (k = 0.435) was detected between the 1st and the 2nd observer on dermoscopic diagnosis; this suggested that dermoscopy improved clinical diagnosis . These data showed that telediagnosis, compared with face - to - face diagnosis, presented a lower diagnostic accuracy . It can deeply revolutionize the delivery of dermatology services, providing equitable services to remote areas and allowing primary care physicians to refer patients to well - equipped dermatological services at a distance . Images can be transmitted via a virtual private network to the teledermoscopists, and those ones can be made mobile as the technology is portable, overcoming geographical barriers, and delivering service to remote areas [3537]. In particular, teledermatology can aid in the prevention and diagnosis of nonmelanoma and melanoma skin cancer . Patients seem to accept teledermatology, considering it as an excellent mean to obtain healthcare, particularly in those areas with no expert dermatologists available . The use of innovative mobile technology can improve prevention campaign, reaching young people too . Clinicians have also generally reported affirmative experiences with teledermatology, excluding for the diagnosis of pink lesion . Further studies focusing on cost effectiveness, intrinsic limits, and patient and clinician satisfaction will facilitate to delineate the potential of teledermatology as a mean of dermatologic healthcare delivery.
|
The disease often occurs spontaneously, especially in the elder population with underlying atherosclerosis, and is caused by embolic or thrombotic occlusion of colonic vessels or by conditions leading to hypoperfusion of the colonic wall (nonocclusive form). The typical clinical presentation is sudden onset of left - sided lower abdominal pain often followed by hematochezia within 24 h. in most patients the disease is self - limiting, but the severe form of ischemic colitis, colonic gangrene, is a life - threatening disease usually requiring urgent surgery . These factors include decreased cardiac output caused by shock, arrhythmias, congestive heart failure, ongoing cardiac bypass operation or aortic repair . Other reasons for colonic ischemia are coagulation disorders such as deficiency of protein c, protein s or antithrombin iii, sickle cell disease, and vasculitis disorders such as systemic lupus erythematosus, polyarteritis nodosa or thromboangiitis obliterans . Various drugs including digitalis, vasoconstrictors, antihypertensive drugs, psychotropic agents, nonsteroidal anti - inflammatory drugs, and antidiarrheal agents have been identified as precipitating factors for colonic ischemia . Antineoplastic drugs such as bevacizumab in combination with irinotecan and 5-fluorouracil or docetaxel in combination with vinorelbin may cause ischemic colitis . However, therapy for non hodgkin's lymphoma with cyclophosphamide, vincristine, doxorubicine, prednisolone and rituximab (r - chop) has not been described as a precipitating factor for ischemic colitis . Colitis occurring during antineoplastic chemotherapy is most frequently due to direct toxic effects or severe neutropenia . Both toxic effects on the colonic mucosa and neutropenic enterocolitis should be differentiated from ischemic colitis . Here we report the association of recurrent episodes of colonic ischemia in relation to standard antineoplastic chemotherapy for b - cell lymphomas . Histology taken 200 cm from incisors by double balloon enteroscopy established the diagnosis of jejunal b - cell lymphoma . Systemic antineoplastic therapy containing the monoclonal antibody rituximab 375 mg / m (day 0), combined with cyclophosphamide 750 mg / m, vincristine 2 mg, doxorubicine 50 mg / m (each given at day 1) and prednisolone 100 mg on days 1 - 5 (r - chop) was initiated . Mesna and ondansetron were given for prophylaxis of cyclophosphamide - induced cystitis and emesis, respectively . Two days after the initiation of chemotherapy the patient was admitted to the emergency department because of sudden onset of left - sided lower abdominal pain followed by hematochezia . Computed tomography of the abdomen revealed, besides the small bowel lymphoma with lymph node involvement, thickening of the descending and sigmoid colon . Laboratory tests including stool analysis for enteritis pathogens were unremarkable except for an elevation of c - reactive protein to 23.5 mg / l . Colonoscopy showed inflammation with semicircular longitudinal swelling and petechial bleeding in the descending and sigmoid colon (fig . Histology from the descending colon showed complete necrosis of the superficial epithelium and infiltration of the submucosal layer by polymorphonuclear neutrophilic leucocytes consistent with ischemic colitis . The second course of chemotherapy containing chop plus rituximab was well tolerated, but 4 days after the third course of chemotherapy, the patient presented again with sudden onset of diffuse abdominal pain . A new episode of colonic ischemia was diagnosed by a ct scan of the abdomen, which showed nearly complete regression of the lymphoma, but also marked thickening of the entire colon wall . Laboratory tests again showed no neutropenia, but a rise of c - reactive protein to 69.7 mg / l . In the present case, differential diagnosis was difficult because the patient initially presented with abdominal pain due to jejunal lymphoma . The first episode of colonic ischemia was thought to occur spontaneously in a heavy smoker, but the occurrence of two clinically typical episodes of ischemic colitis after chemotherapy argues for the association of reduced blood supply of the colon following the application of chemotherapy . Various drugs have been described as possible triggers for the nonocclusive form of ischemic colitis . However, the patient did not take drugs having a known association with ischemic colitis . Colitis associated with antineoplastic chemotherapy is usually associated with severe neutropenia 7 - 10 days after completion of the course or with a direct toxic effect . Some chemotherapeutic drugs such as bevacizumab in combination with irinotecan and 5-fluorouracil or docetaxel in combination with vinorelbin may cause colon ischemia [3, 4], but chemotherapy according to the r - chop protocol, which is a standard regime for treatment of non hodgkin's lymphoma, has not been associated with the development of ischemic colitis . After switching chemotherapy to bendamustine combined with prednisolone and rituximab, no episodes of colon ischemia occurred during the following three cycles . We therefore favour cyclophosphamide, doxorubicine or vincristine or the combination, respectively, as the cause for the two episodes of colonic ischemia . As illustrated in this case, clinicians should be aware of possible ischemic colitis in patients with abdominal pain during chemotherapy with the chop regime.
|
We used 49 purpose - bred juvenile and adult male rm (macaca mulatta) of indian genetic background in this study, including 12 rhcmv and 6 rhcmv rm inoculated with rhcmv / siv vectors, 9 rm that received a gag protein prime followed by ad5(gag) boost vaccine protocol, and 22 rhcmv rm used as unvaccinated controls . All rm were free of cercopithicine herpesvirus 1, d type simian retrovirus, simian t - lymphotrophic virus type 1 and siv infection at the start of the study, and were used with approval of the oregon national primate research center s animal care and use committee, under the standards of the nih guide for the care and use of laboratory animals . We administered rhcmv / siv vectors subcutaneously at a dose of 10 plaque - forming units (pfu). The gag protein prime / ad5(gag) boost protocol consisted of 450 g sivgag protein (protein sciences) emulsified in montanide isa-51 carrier (seppic), with or without 1 mg of poly i: c (invitrogen), 3m-12 (3 m pharmaceuticals), or class c cpg (pfizer) adjuvant, at weeks 0 and 10 followed by ad5(gag) (10 particles, from nih vaccine research center) at week 20 . We performed sivmac239 challenge by administering 300 focus - forming units (ffu) of virus weekly via the intra - rectal route for the first 8 challenges, and then, if necessary, 5 additional weekly challenges at 1000 ffu . We challenged all of the vaccinated and 12 of the control rm concurrently; the remaining 4 control rm were challenged as part of titration performed immediately prior to the primary challenge, using the same viral dose and challenge procedure . We followed plasma viral loads weekly, with challenge being discontinued the week following detection of> 30 copy eq / ml of siv gag rna . For cd8 cell depletion, we treated rm with 10, 5, 5, and 5 mg / kg of the humanized monoclonal antibody cm - t80730 on days 1, 3, 5 and 10, respectively . We prepared rhcmv constructs expressing siv proteins (designated rhcmv / siv viruses; fig . 1a) using a bacterial artificial chromosome (bac) containing the entire rhcmv strain 68 - 1 genome (prhcmv / bac - cre), as described31,32 (see supplementary fig . We confirmed the genomic integrity of the recombinant rhcmv / siv bacs by restriction enzyme digestion and southern analysis, and direct dna sequence analysis of the siv open reading frames (data not shown). We reconstituted rhcmv / siv viruses by transfection of bac dna into rhcmv permissive rhesus fibroblasts, and confirmed expression of siv antigens by western analysis of rhcmv / siv - infected cell lysates (supplementary fig multi - step growth analysis of rhcmv / siv viruses31 showed growth kinetics comparable to wildtype rhcmv (supplementary fig . Was generated by expanding the sivmac239 clone33 in rm peripheral blood mononuclear cells (pbmc), and was quantified using the smagi cell assay34 and by quantitative rt - pcr for siv genomic rna35 . We prepared at-2-inactivated sivmac239 (lot #p4146) as described36, and normalized this stock to the infectious sivmac239 stock by real - time rt - pcr quantification of siv genome copy number . We centrifuged filter - sterilized (0.4 m) urine at 16,000 g for 1 hr @ 4 c to concentrate virus for co - culture on rf . After extensive cytopathic effect or 42 days of co - culture, we prepared cell lysates and assessed rhcmv / siv vector replication based on expression of siv antigen - specific epitope tags by western immunoblot . We measured whole blood rhcmv dna, plasma siv rna, and cell - associated siv dna and rna by real - time pcr and rt - pcr assays24,35,37, with the cell - associated siv quantification using immunobead - isolated cd4 t cells, before and after 48 hrs stimulation with immobilized anti - cd3 and il-2, and including rt - pcr analysis of supernatants of the stimulated cells . We measured rhcmv- and siv - specific cd4 and cd8 t cell responses by flow cytometric intracellular cytokine analysis (fcica) of peripheral blood mononuclear cells and bal cells, as described7,24,25,38 (see supplementary methods). Neutralizing abs against sivmac239 and tissue culture adapted sivmac251 were measured in luciferase reporter gene assays using the tzm - bl and m7 luc cell lines, respectively, for sivmac239 and tissue culture adapted sivmac25140 . We assessed the significance of differences in 1) the phenotype or functional properties of rhcmv - specific t cells vs. rhcmv - vectored, siv - specific t cells vs. prime - boost - elicited siv - specific t cells using mixed effects analysis, 2) the proportion of rm within the vaccinated vs. control groups that completely controlled siv infection after repeated, limiting dose mucosal challenge using a two - sided fischer s exact test, and 3) the peak and mean plateau phase (day 42 to day 91) plasma viral loads of the control vs. vaccinated rm with progressive infection by using general linear models with log10 transformed data . In all analysis, we used a two - sided significance level (alpha) of 0.05, with correction made for multiple comparisons using the bonferroni method . We used 49 purpose - bred juvenile and adult male rm (macaca mulatta) of indian genetic background in this study, including 12 rhcmv and 6 rhcmv rm inoculated with rhcmv / siv vectors, 9 rm that received a gag protein prime followed by ad5(gag) boost vaccine protocol, and 22 rhcmv rm used as unvaccinated controls . All rm were free of cercopithicine herpesvirus 1, d type simian retrovirus, simian t - lymphotrophic virus type 1 and siv infection at the start of the study, and were used with approval of the oregon national primate research center s animal care and use committee, under the standards of the nih guide for the care and use of laboratory animals . We administered rhcmv / siv vectors subcutaneously at a dose of 10 plaque - forming units (pfu). The gag protein prime / ad5(gag) boost protocol consisted of 450 g sivgag protein (protein sciences) emulsified in montanide isa-51 carrier (seppic), with or without 1 mg of poly i: c (invitrogen), 3m-12 (3 m pharmaceuticals), or class c cpg (pfizer) adjuvant, at weeks 0 and 10 followed by ad5(gag) (10 particles, from nih vaccine research center) at week 20 . We performed sivmac239 challenge by administering 300 focus - forming units (ffu) of virus weekly via the intra - rectal route for the first 8 challenges, and then, if necessary, 5 additional weekly challenges at 1000 ffu . We challenged all of the vaccinated and 12 of the control rm concurrently; the remaining 4 control rm were challenged as part of titration performed immediately prior to the primary challenge, using the same viral dose and challenge procedure . We followed plasma viral loads weekly, with challenge being discontinued the week following detection of> 30 copy eq / ml of siv gag rna . For cd8 cell depletion, we treated rm with 10, 5, 5, and 5 mg / kg of the humanized monoclonal antibody cm - t80730 on days 1, 3, 5 and 10, respectively . We prepared rhcmv constructs expressing siv proteins (designated rhcmv / siv viruses; fig . 1a) using a bacterial artificial chromosome (bac) containing the entire rhcmv strain 68 - 1 genome (prhcmv / bac - cre), as described31,32 (see supplementary fig . We confirmed the genomic integrity of the recombinant rhcmv / siv bacs by restriction enzyme digestion and southern analysis, and direct dna sequence analysis of the siv open reading frames (data not shown). We reconstituted rhcmv / siv viruses by transfection of bac dna into rhcmv permissive rhesus fibroblasts, and confirmed expression of siv antigens by western analysis of rhcmv / siv - infected cell lysates (supplementary fig . Multi - step growth analysis of rhcmv / siv viruses31 showed growth kinetics comparable to wildtype rhcmv (supplementary fig . Was generated by expanding the sivmac239 clone33 in rm peripheral blood mononuclear cells (pbmc), and was quantified using the smagi cell assay34 and by quantitative rt - pcr for siv genomic rna35 . We prepared at-2-inactivated sivmac239 (lot #p4146) as described36, and normalized this stock to the infectious sivmac239 stock by real - time rt - pcr quantification of siv genome copy number . We centrifuged filter - sterilized (0.4 m) urine at 16,000 g for 1 hr @ 4 c to concentrate virus for co - culture on rf . After extensive cytopathic effect or 42 days of co - culture, we prepared cell lysates and assessed rhcmv / siv vector replication based on expression of siv antigen - specific epitope tags by western immunoblot . We measured whole blood rhcmv dna, plasma siv rna, and cell - associated siv dna and rna by real - time pcr and rt - pcr assays24,35,37, with the cell - associated siv quantification using immunobead - isolated cd4 t cells, before and after 48 hrs stimulation with immobilized anti - cd3 and il-2, and including rt - pcr analysis of supernatants of the stimulated cells . We measured rhcmv- and siv - specific cd4 and cd8 t cell responses by flow cytometric intracellular cytokine analysis (fcica) of peripheral blood mononuclear cells and bal cells, as described7,24,25,38 (see supplementary methods). Neutralizing abs against sivmac239 and tissue culture adapted sivmac251 were measured in luciferase reporter gene assays using the tzm - bl and m7 luc cell lines, respectively, for sivmac239 and tissue culture adapted sivmac25140 . We assessed the significance of differences in 1) the phenotype or functional properties of rhcmv - specific t cells vs. rhcmv - vectored, siv - specific t cells vs. prime - boost - elicited siv - specific t cells using mixed effects analysis, 2) the proportion of rm within the vaccinated vs. control groups that completely controlled siv infection after repeated, limiting dose mucosal challenge using a two - sided fischer s exact test, and 3) the peak and mean plateau phase (day 42 to day 91) plasma viral loads of the control vs. vaccinated rm with progressive infection by using general linear models with log10 transformed data . In all analysis, we used a two - sided significance level (alpha) of 0.05, with correction made for multiple comparisons using the bonferroni method.
|
Tissue doppler imaging (tdi) quantitatively assesses global and regional systolic function and abnormal relaxation of the heart by measuring tissue velocity, strain and strain rate . Tissue velocity directly describes wall motion, which is a tethering motion of the heart regardless of whether regional myocardium movement is active or passive . Strain is an index of the length change in a myocardial segment during the cardiac cycle, and strain rate is calculated as the time - derivative of strain . If two adjacent points in one myocardial segment show different lengths of change with respect to time, the myocardial segment shows a change in its own shape . Using this property, strain and strain rate reflect myocardial deformation and deformation rate, respectively . However, these two parameters are less affected by the tethering movement of the heart and may discriminate between passive and active cardiac motion . This disorder can cause various side effects such as steroid hepatopathy, hypertension, impaired glucose tolerance of diabetes, and hypercoagulability . The effects of hypercortisolism on cardiac function have been investigated in humans, and hypertrophy and concentric remodeling of the left ventricle (lv) and systolic and diastolic dysfunction have been suggested by conventional echocardiography and tdi studies . In particular, impairment of lv systolic dysfunction, moreover, the association between hypercortisolism and cardiac function has not yet been studied in dogs using conventional echocardiography or tdi . In this study, intra - observer within- and between - day tdi variability was assessed and lv function was investigated in dogs with iatrogenic hypercortisolism using tdi, including strain imaging, and the reliability of these methods for lv function was determined . This study protocol was approved by the institutional animal care and use committee of chonnam national university and the animals were cared for in accordance with the guidelines for animal experiments of chonnam national university . Eleven 3-year - old healthy male beagles (weight, 7.7 - 11.9 kg; median weight, 10.5 kg) were used in this study . The clinical state of every dog was determined by physical examination, systemic arterial blood pressure measured indirectly using a standard doppler method, complete blood count, biochemistry, electrolytes, adrenocorticotropic hormone (acth) stimulation with injection of 5 g / kg of synthetic acth (synacthen; dalim biotech, korea), urinalysis, heartworm occult antigen test, thoracic and abdominal radiographs, abdominal ultrasonography, conventional echocardiography and tdi . Seven dogs were then randomly selected for the iatrogenic hypercortisolism group and one dog was used for myocardium sampling for histopathologic examination . Dogs in the iatrogenic hypercortisolism group received 2 mg / kg prednisolone (solondo; yuhan medica, korea) per oral q12 h for 28 days . On day 28, body weight, blood pressure, conventional echocardiography, and tdi were repeated in the iatrogenic hypercortisolism group . Echocardiography was performed with a prosound 7 instrument (hitachi - aloka medical, japan) using a 3 to 7.5 mhz phased - array transducer according to the recommendations of the american society of echocardiography . Echocardiographic measurements were carried out by one veterinarian (ohj), and mean values from three separate cardiac cycles were used . In m - mode of the lv taken from the right parasternal short - axis view, lv internal dimension and the thicknesses of the lv free - wall (lvfw) and the interventricular septum (ivs) were measured at the end - diastole and end - systole, after which these parameters were normalized using cornell's equation to compare with prediction intervals . The diameters of the aorta (ao) and left atrium (la) were measured at the level of the aortic valve during diastole in two - dimensional mode . Lv inflow velocities in early (e) and late (a) diastoles were measured using pulsed - wave doppler mode in the left apical four - chamber view . Two - dimensional color tdi was performed in the right parasternal short - axis view to evaluate the radial motion of the lv and left apical four - chamber view for the longitudinal motion (fig . The gray scale gain setting was adjusted to optimize wall boundaries of the lvfw and ivs, the doppler velocity range was set as low as possible to avoid aliasing artifacts, and the frame rate was 150 frames / sec . The recorded tdi images were reviewed using a software program (sop - alpha7 - 13; hitachi - aloka medical). The region of interest (roi) in the diastole was determined based on the wall width and length (table 1). The peak velocities of lv myocardium were measured at systole (sm), early diastole (em), and late diastole (am). The systolic strain rate (srs), early diastolic (sre) and late diastolic strain rates (sra) of the radial motion were measured from lvfw . Strain and srs of the longitudinal motion from lvfw and ivs were measured . Before the study, within- and between - day variabilities of the tdi - derived variables six beagles were examined using tdi on three different days . On a given day, tdi examination was performed three different times . A total of 30 echocardiographic variables were measured using the same method as described above and mean values and standard deviations were used to determine the coefficient of variation using a variance component analysis . Myocardial tissues were collected from one dog each in the normal and iatrogenic hypercortisolism groups, then fixed in 10% buffered formalin for histopathological examination . Serial 3 m sections were cut, and routine histological staining was performed with hematoxylin and eosin . Statistical analysis was performed using the spss statistical program (ibm spss statistics 21; ibm, usa). All data are presented as median and ranges and a p <0.05 was considered significant . Intra - observer within- and between - day coefficient of variation values are given in table 2 . Most within - day coefficient of variation values (23/30) were <15% (range: 4.2 - 25%), except sre and sra at the radial lvfw, em at the apex of the longitudinal lvfw, am at the base and the apex of the longitudinal lvfw, and am at the apex of longitudinal ivs . Most between - day coefficient of variation values (24/30) were also <15% (range: 4.3 - 28.2%), except peak sra at the radial lvfw, em at the apex of longitudinal lfvw, am at the base and apex of longitudinal lvfw and ivs, and srs at the apex of longitudinal lvfw . Dogs in the iatrogenic hypercortisolism group had higher concentrations of basal cortisol, serum alkaline phosphatase, and alanine aminotransferase than those of dogs in the normal group (data not shown). On day 28, serum cortisol concentrations were significantly higher than baseline values on day 0, and the acth - stimulated cortisol concentration was lower than the reference range (basal cortisol concentration: 2.0 - 6.0 g / dl, acth - stimulated cortisol concentration: 5.0 - 18.0 g / dl) in the hypercortisolism group . Blood pressure in the hypercortisolism group was significantly higher than that of the normal group (p <0.05) (table 3). No abnormal blood flow was detected in any of the groups by color doppler conventional echocardiography . The normalized echocardiographic parameters of the two groups were within normal reference ranges (table 4). The diastolic thicknesses of lvfw and ivs in the hypercortisolism group were significantly higher than those in the normal group (p <0.05). The e / em ratio of the hypercortisolism group was significantly lower than that of the normal group . Table 6 shows the longitudinal lvfw variables, and table 7 shows the longitudinal ivs variables . No significant differences in the radial lvfw variables such as em or am velocities of endocardial and epicardial segments were observed, or in the em / am ratio in the epicardial segment of the two groups . Conversely, several diastolic alterations were observed in the endocardial segment of the hypercortisolism group . The em velocity and the em / am ratio of the hypercortisolism group were significantly lower (p <0.05), and the am velocity was significantly higher (p <0.05) than those in the normal group . Strain and srs in the basal and apical segments were significantly lower in the iatrogenic hypercortisolism group than in the normal group (p <0.05), but no difference in systolic velocities was observed in the segments . The em velocity and em / am ratio in the basal and apical segments significantly differed in the hypercortisolism group relative to the normal group (p <0.05). In longitudinal ivs variables, strain, the em velocity and em / am ratio in the hypercortisolism group were significantly lower than those of the normal group (p <0.05). No significant differences histopathological examination revealed no gross myocardial lesions in the myocardial sections of the normal or iatrogenic hypercortisolism groups . Examination of the arteries in the experimental dogs revealed no intimal thickening (arteriosclerosis) relative to normal dogs . No differences in fibrosis were observed upon masson's trichrome staining of the lv sections of any two dogs . A quantitative assessment of tdi in beagles with iatrogenic hypercortisolism showed subclinical systolic and diastolic dysfunction of lv myocardium, whereas conventional echocardiography could not determine myocardial dysfunction . Although the exact mechanism has not been clearly identified, excessive glucocorticoids impair conversion of cortisol to an inactive form, thereby allowing glucocorticoid - mediated mineralocorticoid effects on the heart such as increased myocardial fibrosis . Atherosclerosis with intimal thickening in coronary arteries occurs during hypercortisolism and may cause an imbalance between tissue oxygen requirements and supply, resulting in cardiac ischemia . However, fibrosis or arteriosclerosis was not found in myocardial tissues of dogs with iatrogenic hypercortisolism in this study . The discrepancy between our results and those of previous studies may be attributed to the short duration of glucocorticoid treatment . Cardiac fibrosis of this study was evaluated subjectively upon microscopic examination, not quantitatively as in previous studies; thus, mild alterations could have been missed . However, other factors that might play crucial roles in the development of fibrosis and atherosclerosis with exogenous treatment of glucocorticoids in dogs need to be investigated . Conventional echocardiography revealed that the diastolic lvfw and ivs were significantly thicker in the hypercortisolism group than in the normal group, although these parameters in the hypercortisolism group were also within the reference range . Specifically, the hypercortisolism group showed symmetrically concentric lv hypertrophy with normal fractional shortening . In humans, a positive correlation was detected between relative wall thickness and duration of the hypercortisolism . In light of the short duration of this study, this tendency for thicker lvfw and ivs might indicate that lv concentric remodeling was in progress in the hypercortisolism group . Previous human studies demonstrated that systolic and diastolic dysfunction in patients with cushing's syndrome develops independent of hypertension . Systemic hypertension can cause significant myocardial hypertrophy and myocardial dysfunction . In dogs with systemic hypertension, myocardial dysfunction, particularly for the lvfw longitudinal diastolic motion, occurred independently of the presence of myocardial hypertrophy . The effects of blood pressure on cardiac function in dogs with hypercortisolism could not be excluded in this study because the systemic blood pressure of the hypercortisolism group was significantly higher than that of the normal group . However, the effects of systemic hypertension on the myocardium depend on the degree of systemic hypertension . Since the absolute value in the hypercortisolism group was smaller than the criteria for systemic hypertension (> 160 mmhg), the effects of blood pressure on myocardial dysfunction of the hypercortisolism group may be minimal . The e / a ratio is a useful parameter for evaluating lv filling pressure . However, this ratio may not be accurate in patients with a preserved lv ejection fraction . Em velocity and the e / em ratio are more reliable indices of lv relaxation, and the e / em ratio reflects lv filling pressure, independent of lv ejection fraction . In the present study, em, em / am, and e / em in were significantly lower the hypercortisolism group than in the normal group . Increased lv filling pressure was observed in the hypercortisolism group because of the occurrence of abnormal myocardial relaxation . Human patients with hypercortisolism show tdi - derived diastolic parameter alterations, as well as decreased e velocity and e / a ratio on conventional echocardiography, while conventional echocardiographic changes may be related to the long duration and stages of hypercortisolism . Dogs with hypercortisolism showed a significant decrease in systolic strain values, similar to a human study . Sm can be used to assess lv contractile function, but the parameter depends on preload and afterload . Strain can demonstrate local dysfunction and detects the regional contractile function more precisely than sm velocity . In the present study, sm velocity did not differ between two groups, suggesting that myocardial dysfunction occurred locally and sm velocities in the affected segments were unchanged by passive movement of the adjacent normal tissue . The degree of decreased strain was more remarkable in longitudinal values than in radial values, and was compatible with the result of study in human . First, tdi variables with a coefficient of variation> 15% may have interacted with the technical aspect of this method . The tdi - derived variables obtained from the apical segment had relatively higher coefficients of variation than those in the basal segment . This may have occurred because tdi is angle - dependent and sensitive to noise . Finally, this study was performed in a relatively small population of adult dogs for a short period . Despite these limitations these changes were detected more clearly with tdi - derived variables, particularly in longitudinal motion before becoming prominent on conventional echocardiography . The results presented herein will serve as fundamental data for investigating the effects of cortisol effect on myocardial changes in a larger population of dogs with hypercortisolism.
|
Although less prevalent than trisomy 21 (1 per 800 births), they are by no means extremely rare (bundy et al ., 1986; shields et al ., 1998; fleischer et al ., 2011). Trisomy 18, also known as edwards syndrome, is the second most common autosomal trisomy with a prevalence ranging between 1:3500 and 1:8000 births . Approximately 68% of foetuses with trisomy 18 die in utero, only 10% survive the first year of life (dicke and crane, 1991). Trisomy 13, or patau syndrome, has a prevalence of 1 per 6500 births . Most foetuses with trisomy 13 die in utero or are stillborn . Of those who alive at birth, only 20% will survive the first month of life and only 5% will survive the first six months (fleischer et al ., 2011). The relationship of trisomy 13 and 18 with maternal aging is, contrary to trisomy 21, less outspoken . Overall 80% of children with a chromosomal abnormality are born to women under age 35 (savva et al ., 2010). This underlines the importance of ultrasound as a noninvasive screening tool for foetal abnormalities and associated underlying trisomies in younger women (dicke and crane, 1991). Trisomy 13 foetuses may show various brain anomalies including holoprosencephaly sometimes enabling the diagnosis made at 12 weeks of pregnancy all or not with midfacial hypoplasia (cyclopia and proboscis), ventriculomegaly, enlarged cistern magna, microcephaly, agenesis of the corpus callosum, cleft lip and palate, microphtalmia, hypotelorism, nuchal thickening or hydropichygroma, neural tube defects (ntd), omphalocele, kidney and urogenital anomalies, hyperechogenic bowel, cardial echogenic foci (resulting from echogenic chordae tendineae), cardiac defects, single umbilical artery (sua), radial aplasia, polydactyly and flexion deformity of the fingers (fig . 1). Sonographic detection in trisomy 13 is reported to have a sensitivity of 90 to 100% by benacerraf when a complete survey of the foetus, including the heart, was performed . Still, foetuses with trisomy 13 without any anomaly being observed in the second trimester have been described (benacerraf, 2008). In trisomy 18 the features may include agenesis of the corpus callosum, meningomyelocele, ventriculomegaly, chorioid plexus cysts, posterior fossa anomalies, cleft lip and palate, micrognathia, low - set ears, microphtalmia, hypertelorism, short radial ray, clenched hands with overriding index fingers, club or rocker bottom feet, omphalocele, diaphragmatic hernia, renal anomalies, cardiac defects, sua, polyhydramnios, nuchal thickening or hygroma and cryptorchidism (fig . Intra - uterine growth restriction (iugr) based on birth weight was observed as a feature both in trisomy 13 and 18 (polani, 1974). (1984) reported iugr as a feature in trisomy 18 only in a series of neonates dying from the malformation . The purpose of the present paper is to analyse which was or were the predominant appeal sign(s) leading to referral to our centre and what were the accompanying features found during specialized echographic evaluation . If the data were available, we also compared the echographic signs with the foetal pathology . It appears that both trisomy 13 and 18 are picked up by a variety of predominant echographic features . We also evaluated what was the degree of commonality in predominant signs between both syndromes and what features remained particular to either trisomy 13 or 18 . The study population consisted of all consecutive patients referred to the university hospital of gent for specialized prenatal echographic evaluation between 1980 and 2011 . One of us (pd) observed 1110 cases of foetal malformations during these echographic consultations . 47 of these cases with echographic malformations were foetuses with either trisomy 13 (15 cases) or trisomy 18 (32 cases). Echographic evaluation included standard biometry measurements of biparietal diameter, head circumference, transcerebellar diameter, abdominal circumference and femur length as well as foetal anatomic evaluation of the total foetal head, thorax, abdomen and extremities in accordance with the criteria for structural echoscopic evaluation of the flemish society of obstetrics and gynaecology (www.vvog.be). Where applicable we also attempted to evaluate the nuchal skin fold . Of the 1110 detected cases of foetal malformations, 47 were foetuses with trisomy 13 (15 cases) or trisomy 18 (32 cases). The overall mean maternal age found was 31,0 years with a range from 22 to 42 years . For trisomy 13 the mean maternal age was 30,3 years with a range from 27 to 42 years . For trisomy 18 this was 31.6 years with a range from 22 to 42 years . In our study population, 69% of the women with trisomic foetuses were younger than 35 years of age . The overall mean gestational age found at detection was 19,5 weeks, with a range from 11 to 36 weeks . For trisomy 13 the mean gestational age was 22,8 weeks, with a range from 11 to 36 weeks . For trisomy 18 this was 17,4 weeks, with a range from 11 to 33 weeks . Due to the recruitment by referral of these cases, we lack a quantitative background population and cannot make any guess as to prevalence or incidence of the syndromes in our material . In the group of foetuses diagnosed with trisomy 13 a total of 31 various malformations were observed by ultrasound . Three of a total of 15 ultrasounds were done in the first trimester, all the foetuses in this group were diagnosed with hygroma colli . In the other foetuses with trisomy 13 the most common malformations were craniofacial defects, cerebral malformations and problems with the urogenital tract (fig . Seven of these 9 cases were diagnosed with hygroma colli . In the patients evaluated after the first trimester of pregnancy the most common ultrasound findings were intestinal tract defects, malformation of the limbs and intra uterine growth restriction (iugr) (fig . 4). Figure 5 shows the overlap and difference between the predominant signs found with trisomy 13 and trisomy 18 . The number of craniofacial defects found, were equal for trisomy 13 as well as trisomy 18 . Most ultrasound findings seem to be equally predominant in trisomy 18 or 13, with the exception of defects in the urogenital tract, which we only found in foetuses with trisomy 13 . The most spectacular case was a 28-year - old turkish gravida 4 who showed up very late in pregnancy . The foetus, a cryptorchidic boy, showed an enormous multicystic mass consisting of a mega - ureter and hypertrophic bladder with prune - belly sequence in the left hemi - abdomen . The left kidney, adrenal and spleen were dislocated into the thorax through a diaphragmatic hernia . There were hypoplastic lungs with a bilateral left lobulation, an accessory left liver lobe and fallot s tetralogy . The 3320-gram baby died just after delivery (apgar score 3/1/0). Due to the recruitment by referral if the data were available, we also compared the echographic signs with the foetal pathological situation . In the group of foetuses with trisomy 13 the most common malformations found by the pathologist correlated well with the malformations found during ultrasound evaluation, namely craniofacial defects, cerebral malformations and problems with the urogenital tract (fig . The most common malformations in foetuses with trisomy 18 were hygroma colli and hydrops, problems with the intestinal tract and malformations of the limbs (fig of the 1110 detected cases of foetal malformations, 47 were foetuses with trisomy 13 (15 cases) or trisomy 18 (32 cases). The overall mean maternal age found was 31,0 years with a range from 22 to 42 years . For trisomy 13 the mean maternal age was 30,3 years with a range from 27 to 42 years . For trisomy 18 this was 31.6 years with a range from 22 to 42 years . In our study population, 69% of the women with trisomic foetuses were younger than 35 years of age . The overall mean gestational age found at detection was 19,5 weeks, with a range from 11 to 36 weeks . For trisomy 13 the mean gestational age was 22,8 weeks, with a range from 11 to 36 weeks . For trisomy 18 this was 17,4 weeks, with a range from 11 to 33 weeks . Due to the recruitment by referral of these cases, we lack a quantitative background population and cannot make any guess as to prevalence or incidence of the syndromes in our material . In the group of foetuses diagnosed with trisomy 13 a total of 31 various malformations were observed by ultrasound . Three of a total of 15 ultrasounds were done in the first trimester, all the foetuses in this group were diagnosed with hygroma colli . In the other foetuses with trisomy 13 the most common malformations were craniofacial defects, cerebral malformations and problems with the urogenital tract (fig . Seven of these 9 cases were diagnosed with hygroma colli . In the patients evaluated after the first trimester of pregnancy the most common ultrasound findings were intestinal tract defects, malformation of the limbs and intra uterine growth restriction (iugr) (fig . 4). Figure 5 shows the overlap and difference between the predominant signs found with trisomy 13 and trisomy 18 . The number of craniofacial defects found, were equal for trisomy 13 as well as trisomy 18 . Most ultrasound findings seem to be equally predominant in trisomy 18 or 13, with the exception of defects in the urogenital tract, which we only found in foetuses with trisomy 13 . The most spectacular case was a 28-year - old turkish gravida 4 who showed up very late in pregnancy . The foetus, a cryptorchidic boy, showed an enormous multicystic mass consisting of a mega - ureter and hypertrophic bladder with prune - belly sequence in the left hemi - abdomen . The left kidney, adrenal and spleen were dislocated into the thorax through a diaphragmatic hernia . There were hypoplastic lungs with a bilateral left lobulation, an accessory left liver lobe and fallot s tetralogy . The 3320-gram baby died just after delivery (apgar score 3/1/0). Due to the recruitment by referral if the data were available, we also compared the echographic signs with the foetal pathological situation . In the group of foetuses with trisomy 13 the most common malformations found by the pathologist correlated well with the malformations found during ultrasound evaluation, namely craniofacial defects, cerebral malformations and problems with the urogenital tract (fig . The most common malformations in foetuses with trisomy 18 were hygroma colli and hydrops, problems with the intestinal tract and malformations of the limbs (fig trisomy 13 as well as trisomy 18 are typified by a number of various malformations in the foetus . In our study population 69% of women with trisomic foetuses the most common ultrasound features in our study population were predominant in foetuses diagnosed with trisomy 18 . In this group we mostly saw intestinal tract defects, malformation of the limbs including clenched fists, and intra uterine growth restriction . In case of trisomy 13 we observed that all the foetuses presented with hygroma colli when referred in the first trimester . In foetuses diagnosed after the first trimester of pregnancy the predominant ultrasound features leading to referral to our centre were craniofacial defects, cerebral malformations and problems with the urogenital tract . Overall the ultrasound features correlated well with the pathology findings in both trisomy 13 and trisomy 18 cases . Our data also confirm that iugr is a specific feature of trisomy 18 and not of trisomy 13 as reported before (kirkinen et al . As expected and due to the progress of early ultrasound diagnosis in pregnancy, we observed in our chronological series a tendency to detect trisomy 13 and 18 on the occasion of chorionic villus sampling (cvs) with hygroma colli as the most important feature and no longer from more outspoken anatomic abnormalities later in pregnancy . However this secular trend was not significant, meaning that there is clearly still a field for more active exploration of early sonomarkers . Our results once more confirm the need for genetic testing to further explore foetal anatomical anomalies, especially when presenting in a cluster.
|
The human immunodeficiency virus (hiv) epidemic arose from zoonotic infections with simian immunodeficiency viruses from african primates . Since then, the global epidemiology of hiv infection has changed markedly: the prevalence of hiv has increased from 31 million in 2002 to 36.9 million in 2014, essentially due to prolonged survival caused by antiretroviral therapy, whereas the global incidence has decreased from 3.3 million in 2002 to 2 million in 2014 . Since the introduction of antiretroviral therapies, two major medical achievements have been made, allowing many couples with an hiv positive partner to consider pregnancy planning: life expectancy of infected patients as well as their life quality has dramatically improved during the last 10 years .a significant reduction in mother - to - child hiv transmission (mtct) has been observed, especially in developed countries, with transmission rates lower than 1% to 2%, compared to 14% to 42% without any intervention . This has been achieved with the use of antiretroviral drug combinations during pregnancy and labor / delivery, neonatal prophylaxis, elective caesarean delivery, and avoidance of breast feeding . Life expectancy of infected patients as well as their life quality has dramatically improved during the last 10 years . A significant reduction in mother - to - child hiv transmission (mtct) has been observed, especially in developed countries, with transmission rates lower than 1% to 2%, compared to 14% to 42% without any intervention . This has been achieved with the use of antiretroviral drug combinations during pregnancy and labor / delivery, neonatal prophylaxis, elective caesarean delivery, and avoidance of breast feeding . Over 80% of people infected with hiv reports suggest that there are currently more than 140,000 hiv serodiscordant heterosexual couples in the united states (us), approximately 50% of whom having reproductive plans . According to the national perinatal hiv hotline and clinicians network, calls pertaining to hiv serodiscordant couples and their options for safer conception have increased significantly between 2006 and 2011 . Managing hiv infected patients with a childbearing wish involves a multidisciplinary approach, ideally including maternal - fetal medicine specialists, hiv / aids specialists, neonatologists, pediatricians, psychiatrists, social workers, and reproductive endocrinologists . Preconception counseling is highly recommended among hiv serodiscordant and seroconcordant couples, allowing them to make more informed choices in order to reduce sexual transmission and improving pregnancy outcome . However, a recent survey of hiv infected women who had been or were pregnant at the time of the questionnaire showed that more than half of them did not have preconception counseling . Evaluating the need for antiretroviral therapy should be part of the initial assessment of preconception counseling . Any concurrent sexually transmitted infection should be treated and safe sexual practices should be encouraged . Infertility affects approximately 15% of the general population and hiv infected patients, both men and women, have higher rates of infertility than their hiv negative counterparts [10, 11]. In serodiscordant couples in which the male partner is infected, assisted reproductive technology (art) after the sperm - washing (sw) procedure, there are two main options to achieve a pregnancy: intrauterine insemination (iui) and in vitro fertilization (ivf)/intracytoplasmic sperm injection (icsi). In couples with a normal fertility evaluation, iui is an effective approach . If semen analysis is abnormal, then ivf / icsi is undoubtedly the treatment to be offered . Spermatozoa are isolated by sequential density gradient and swim - up techniques and are subsequently tested by pcr assays for the presence of hiv rna . A systematic review and meta - analysis summarized the experience with serodiscordant couples with an infected male partner until 2013, with 2,393 sw - iui and 780 sw - ivf treatment cycles documented . The authors concluded that hiv infected men with noninfected partners have pregnancy and live birth rates with art comparable to seronegative couples . In serodiscordant couples in which the female partner is infected, pregnancy can be achieved without the risk of sexual transmission by self - insemination around the time of ovulation . If conception does not occur after more than six cycles of self - insemination, or if a preexisting fertility problem was diagnosed, the use of art should be envisaged . Most of the reports so far published on iui or ivf treatments performed in serodiscordant couples refer to infected male partners . Very few studies have addressed ivf outcome in serodiscordant couples with an hiv infected female partner . The purpose of this review is to evaluate the effectiveness of fresh nondonor oocyte ivf / icsi treatments performed in this population . Control over variables that are traditionally known to influence ivf / icsi outcome, such as female age, ovarian reserve, race / ethnicity, body mass index (bmi), tobacco consumption, the presence of tubal disease, and the number of embryos replaced in the uterus, was ascertained in the studies found . A search of the pubmed database was performed in order to identify all studies involving art including the hiv infected population published until july 2014 . The search terms used were hiv and assisted reproduction, hiv and assisted reproductive technology, hiv and in vitro fertilization, and hiv and infertility . Inclusion criterion was studies assessing fresh nondonor oocyte ivf / icsi cycle outcomes of serodiscordant couples with an hiv infected female partner . References with abstracts that demonstrated them to be unrelated to the ivf / icsi cycle outcomes of serodiscordant couples with an hiv infected female partner were excluded without full text assessment, as were reviews and case reports . All original articles with abstracts that indicated them to be within the scope of this study were fully assessed; when this assessment was confirmed, they were included in the review . Articles in languages other than english, portuguese, spanish, or french were excluded . Figure 1 summarizes the steps involved in literature selection based on preferred reporting items for systematic reviews and meta - analyses (prisma) guidelines . Studies analyzed reported on art treatments performed in a total of 342 hiv infected women, with a mean age of 35.4 years, who underwent 516 ivf / icsi cycles (table 1).> 200 to 712 cells / mm, 48% to 100% of patients in each study had undetectable viral loads, and 44% to 95% of them were being treated with combined antiretroviral therapy . Table 1 shows baseline characteristics of study and control groups and table 2 shows the outcomes of ovarian stimulation and ivf . Among the studies included in this review, data concerning ovarian response to stimulation in hiv infected patients can be summarized as follows: some of the initial studies report the need of higher doses of gonadotropin to achieve satisfactory ovarian response (terriou et al . 2005; coll et al . 2006), while a normal response to stimulation is described in infected women who are in good general health conditions and reach egg pick - up (martinet et al . 2006). Data from most recent studies suggest that a normal ovarian response is seen in these patients (manigart et al . 2006, however, in the nine studies that assessed the cancellation rate of ovarian stimulation in hiv infected patients, although significance was observed in only one of them (15.2% versus 4.9% in the control group), in all the instances in which a comparison could be made cancellation rate was higher in the study group than in controls (table 2). In study groups, the clinical pr per stimulation cycle initiated varied from 6.7% to 24.1% and the clinical pr per embryo transfer varied from 9.1% to 63% (table 2). A summary of the conclusions of the six studies that compared the prs in hiv infected women with those from noninfected controls is (table 2) as follows: in two studies, hiv infected women had a statistically significantly lower pr (ohl et al . 2006).in three studies, the pr of hiv infected women was not statistically significantly different from that of control subjects, but lower values were observed (martinet et al . 2006, santulli 2011 et al ., and nurudeen et al . 2013).in one study, the pr of hiv infected women was not statistically significantly different from that of control subjects, but a higher value was observed (prisant et al . The pr of hiv infected women was not statistically significantly different from that of control subjects, but lower values were observed (martinet et al . 2006, santulli 2011 et al ., and nurudeen et al . 2013). In one study, the pr of hiv infected women was not statistically significantly different from that of control subjects, but a higher value was observed (prisant et al . Pr was reported per embryo transfer, with the exception of two cases of pr per cycle initiated [16, 19] and one of prs per oocyte retrieval . Noteworthy, vertical transmission of hiv infection was zero . Concerning variables that are traditionally known to influence ivf / icsi outcome, data from studies can be summarized as follows . Seven studies included in this review were age - matched . In only one study, art results were stratified by age: in both age groups (<35 and 35 years), infected and control patients had similar ivf / icsi clinical outcomes with similar clinical prs per embryo transfer . Six studies included in this review evaluated the ovarian reserve, but only five of them had a control group (table 1):(i)in one of them, the comparison between early follicular phase serum fsh of hiv infected women and controls showed a statistically significant difference (9.0 2.4 versus 7.0 2.9 iu / l, resp . 2003). (ii)in the other four studies, hiv infected women and controls had similar values for markers of ovarian reserve . Fsh and ham levels and antral follicle count (afc) were evaluated (terriou et al . 2005; douglas et al . In one of them, the comparison between early follicular phase serum fsh of hiv infected women and controls showed a statistically significant difference (9.0 2.4 versus 7.0 2.9 iu / l, resp . Fsh and ham levels and antral follicle count (afc) were evaluated (terriou et al . 2005; douglas et al . 2005; santulli et al . Only two studies documented patients' race / ethnicity [18, 23]. In both of them, the proportion of black women was significantly higher in the study group and this was mentioned as a possible source of bias . Only two of the studies analyzed evaluated bmi (table 1):(i)in one of them, hiv infected women had higher bmi than control subjects (24.2 versus 22.9, p = 0.032) (santulli et al . 2011). (ii)in the other one, hiv infected women and controls had similar bmi (nurudeen et al . 2013). In one of them, hiv infected women had higher bmi than control subjects (24.2 versus 22.9, p = 0.032) (santulli et al . 2011). In the other one, hiv infected women and controls had similar bmi (nurudeen et al . 2013). Of the studies analyzed in this review, only two controlled for tobacco consumption:(i)in the first of them, no differences were found between hiv infected women and controls (santulli et al . 2011). (ii)in the other one, in the group of women 35 years of age, infected patients smoked significantly more often than controls (16% versus 0%; p <0.05). Although parameters of ovarian reserve, the number of mature oocytes retrieved, and fertilization and clinical prs per embryo transfer were similar in hiv infected women and controls, live birth rates per embryo transfer were significantly lower for hiv infected women (6% versus 24%, p = 0.04) (nurudeen et al ., no differences were found between hiv infected women and controls (santulli et al . 2011). In the other one, in the group of women 35 years of age, infected patients smoked significantly more often than controls (16% versus 0%; p <0.05). Although parameters of ovarian reserve, the number of mature oocytes retrieved, and fertilization and clinical prs per embryo transfer were similar in hiv infected women and controls, live birth rates per embryo transfer were significantly lower for hiv infected women (6% versus 24%, p = 0.04) (nurudeen et al . 2013). Reviewed, the incidence of tubal disease could be compared between the study and control groups and in all of them a higher proportion of tubal disease in hiv infected women was documented, confirming previous reports on the literature (table 1). In two of them, a statistically significant difference was observed (santulli et al . In the studies analyzed, different criteria were adopted regarding embryo transfer (table 2). In three of them, the authors reported they were more likely to replace a lower number of embryos in infected women (terriou et al . However, documentation of a significant reduction in the mean number of embryos transferred was seen in only two of these (martinet et al . The variability of results observed in the studies analyzed can be mostly related to the small size of the samples studied, heterogeneity in study design, and methodology and incomplete control over potential confounding data . These limitations do not allow for the implementation of a statistical approach that might lead to solid conclusions, such as a meta - analysis . Variables that are traditionally known to influence ivf / icsi outcome and should therefore be controlled for are the following: female age.ovarian reserve.race/ethnicity.body mass index (bmi).tobacco consumption.tubal disease.number of embryos replaced . Body mass index (bmi). A summary of the variables controlled per study is available in table 3 and aspects to be considered regarding each of them are as follows . Population studies from areas where no consistent methods of birth control are applied show that natural fertility starts to decline after the age of 30, has its decline accelerated in the mid-30s, and ends at a mean age of 41 years . The age - related effect on female fertility has also been shown in numerous reports on the results of ivf treatments due to a progressive decline on oocyte quality and quantity . The implantation rate per embryo clearly decreases after the age of 35 and the same has been shown for the probability of a live birth in ivf . Due to this knowledge, control over female age is of paramount importance in any study on ivf treatment outcome . Seifer et al . Evaluated the markers of ovarian follicular reserve and reproductive ageing in 187 hiv infected women not diagnosed as infertile . Early follicular phase fsh, estradiol, inhibin b, and anti - mullerian hormone (amh) levels were measured . No evidence was found that hiv infection affects ovarian ageing . On the other hand, ohl et al . Measured serum fsh, inhibin b, amh, and the antral follicle count (afc) in 78 hiv infected women . Mean fsh was 36% higher than that seen in the control group, whereas mean inhibin b and amh were 57% and 23% lower, respectively . The possible influence of combined antiretroviral therapy on ovarian reserve and ovarian response to stimulation is not clear either . Side effects of the use of antiretroviral drugs such as mitochondrial dysfunction or modification in the lipid metabolism and insulin resistance could have consequences on folliculogenesis and ovulation regulatory processes [2, 30]. Oocytes from infertile hiv infected women on combined antiretroviral therapy were reported to have 32% depletion in mtdna in comparison to infertile uninfected controls (p <0.05) and depletion was even stronger in patients who failed to become pregnant in ivf treatments . A growing number of studies have investigated the association between race / ethnicity and art outcomes . Most of the studies have focused on comparisons between white caucasian and black women and some have identified that the last group is more likely to have a diagnosis of tubal factor infertility, leiomyoma / uterine factor infertility, a longer duration of infertility before art, and higher miscarriage / stillbirth rates [3236]. Race / ethnicity as a risk factor for poor art outcomes has been consistently acknowledged in recent large studies, even after adjusting for many confounding factors . Overweight and obesity are well - described risk factors for infertility, particularly as they relate to ovulation disorders . In spite of conflicting results of studies regarding the effect of high bmi on art outcome, a systematic review and meta - analysis published in 2011 showed that overweight or obese women (bmi 25) had significantly lower clinical pregnancy (rr = 0.90, 95% ci 0.850.94) and live birth rates (rr = 0.84, 95% ci 0.770.92) and a significantly higher miscarriage rate (rr = 1.31, 95% ci 1.181.45). The analysis of overweight women alone (bmi 2529.9) also showed lower clinical pregnancy (rr = 0.91, 95% ci 0.860.96) and live birth rates (rr = 0.91, 95% ci 0.850.98) and higher miscarriage rate (rr = 1.24, 95% ci 1.131.35), compared to women with bmi <25 . In conclusion, increased bmi is associated with adverse outcomes in women undergoing ivf / icsi treatment, including lower live birth rates . Increasing overweight and obesity in the hiv infected population were not seen until two decades ago . This relatively new reality has been attributed to several factors, such as better health due to combined antiretroviral therapy and improved life expectancy, which leads to obesity trends similar to those seen in the general population . This parameter was not properly controlled for in the majority of studies analyzed here . Over the last few decades, the prevalence of cigarette smoking among women of reproductive age has increased, reaching, in 2006, 33% in europe and 28% in the usa, and is highly prevalent among persons infected with hiv . Studies on ivf showed that cigarette smoking has deleterious effects on many aspects of treatment: ovarian responsiveness to gonadotropins, number of oocytes retrieved, fertilization, implantation, and early placentation . In the studies reviewed, a higher proportion of tubal disease in hiv infected women was documented, confirming previous reports on the literature . It is important to notice that many studies collected data at times during which it was still not a standard procedure to remove hydrosalpinx before ivf, which may have reduced live birth rates and constituted a source of bias . Another factor associated with tubal disease that should be considered is the personal history of pelvic inflammatory disease . This condition has been shown to reduce ovarian response to stimulation due to direct damage to the ovaries and follicle loss or due to mechanical alterations of follicular development . The rate of preterm delivery and multiple gestations after art is of particular concern for hiv infected women . Preterm labor or premature rupture of membranes may increase the risk of hiv vertical transmission . Elective single embryo transfer for hiv infected women shall be considered in order to reduce the risk of multiple gestations . A lower number of embryos replaced in hiv positive women may obviously contribute to lower pregnancy and live birth rates per transfer . Data on pr in ivf / icsi treatments performed in couples with hiv infected women are conflicting and it is still not clear if these patients display worse clinical outcomes per cycle initiated when compared to the general population . The same can be said specifically about ovarian response to stimulation, though a tendency for higher cancellation rates seems to be observed . The small size of the samples studied and heterogeneity in study design and methodology make it difficult to draw clear conclusions about the impact of hiv infection in women on ivf outcome . Incomplete control over confounding variables (such as age, race / ethnicity, bmi, tobacco consumption, tubal disease, history of pelvic inflammatory disease, duration of infertility, and the number of embryos replaced) is of special concern . Altogether, such limitations hamper the performance of a proper meta - analysis . In the future, prospective matched case - control studies are needed to understand the specific effects of hiv infection on ovarian response and art outcome . Available data suggest some impact of hiv infection on ovarian function and ivf outcome, but noncontrolled sources of bias in published studies do not allow for definitive conclusions.
|
Alexander disease (ad) is a fatal and progressive leukodystrophy of the central nervous system . The destruction of white matter in a rostrocaudal gradient is accompanied by the accumulation of abnormal deposits, known as rosenthal fibers (rfs), in astrocytes, which result in cell death . The clinical phenotype of ad has been divided into three types based on age at onset, i.e., infantile, juvenile, and adult ad . However, clinically the disease is highly variable among patients in the same disease group . Typical features of the infantile form occur before 2 yr old, and present as progressive macrocephaly, developmental delay, spasticity, and seizures . Seizure is a common clinical symptom in ad, but infantile spasms are a less well - known manifestation . Brain magnetic resonance imaging (mri) reveals predominantly frontal white matter involvement of low signal intensity on t1-weighted images and high signal intensity on t2-weighted images . Since brenner et al . (1) discovered a missense mutation in glial fibrillary acidic protein (gfap) gene in chromosome 17th in ad, dna analysis has proven to be a valuable diagnostic modality . It persisted for 30 min, and his parents observed upward eyeball fixation and tonicclonic movement of the extremities . However, treatment was not sought at the time . At his home on the day of this hospitalization, a seizure redeveloped, persisted for about an hour and then spontaneously stopped . His parents then brought the patient to our emergency room where the seizure was observed by doctors . Pupils were fixed without deviation with nictitating of eyelids, lip smacking, and stiffness of the right extremities . The patient had no relevant birth or family history . At the time of hospitalization, his body temperature was 36.6, pulse rate 128/min, and respiratory rate 28/min . In terms of body measurements, his body weight was 8.8 kg (20th percentile), height 75 cm (90th percentile), and head circumference 51 cm (more than the 97th percentile). Anterior fontanel was soft and flat, and he had macrocephaly and a projecting forehead, similar to that observed in hydrocephalus . He was unable to control his head, and his language and social skills were at the 1 - 2 month post - natal level . The complete blood count was within normal limits, and total protein / albumin was 6.2/4.3 g / dl, na / k / cl 138/4.9/104 meq / l, blood sugar 100 mg / dl, bun / cr 11/0.4 mg / dl, and ast / alt 26/22 normal finding was seen by 7.93 (4.9 - 20.5 mm / m creatinine) in n - acetylaspartic acid (naa) of urine . Brain mri showed an absence of myelination except in the frontal lobe and in a portion of the temporal lobe (fig . Dna analysis revealed that the 716th base sequence of the 4th exon of the gfap gene showed thymine substituted for guanine (c.716g> t), which led to r239l missense mutation at the 239th amino acid involving the replace of arginine by leucine . Additionally, when we examined the dna of his parents and older sister, it appeared that they had a normal base sequence (fig . Interictal waking electroencephalography (eeg) showed slow waves in the frontal lobe, but no epileptic discharge (fig . Three months later, at the age of 11 months, infantile spasms of the flexor type developed accompanied with vocalization after waking up . The spasms came under control after starting vigabatrin (40 mg / kg / day) and after the third day of this medication, no more spasm was observed . A follow - up mri at 24 months of age showed disease progression (fig . 1c, d), he is in good nutritional condition and has a relatively good cardiopulmonary function . However, he suffers from intermittent vomiting, dysphagia, irritability, easy startling, developmental retardation, slow progressive spasticity of the extremities, and seizures . W. stewart alexander, in his original description of a case in 1949 (2), reported a boy with a rapidly enlarging head, hydrocephalus, and developmental delay who died at 15 months of age following an 8-month illness . Ad is a progressive and usually fatal neurological disorder in which the destruction of white matter in the brain (3, 4). However, little information is available on the pathogenesis of ad, or on how the gfap mutation leads to leukodystrophy (5, 6). In 1976, russo et al . (7) suggested that ad could be divided into three age - dependent clinical subgroups: infantile, juvenile, and adult and most authors have adopted this classification . The infantile form of ad is most common (8 - 11), and usually becomes apparent during the first two years of life . Typically patients show both mental and physical developmental delays, followed by loss of milestones, an abnormal increase in head size, and often seizures . The average age of onset is 6 months and the average age of survival after diagnosis is 2 yr and 4 months . But wakabayashi et al . (12) reported a japanese case of infantile ad who survived at the age of 25 yr and 7 months . Thus, the clinical progress in ad may be varied by case . In our patient, although seizure occurred at age 8 months, we suggest that clinical manifestations had developed before at least age 3 months because he was unable to control his head at age 4 months . (13), seizures often appear at an early stage, whereas spastic quadriparesis is less prominent and occurs later . Our patient showed prominent macrocephaly, and developmental retardation before the seizure attacks which occurred at age 8 months . We initially observed slow waves on the frontal area on interictal sleep eeg, but there was no epileptic discharge (fig . Three months later, at age 11 months, infantile spasms developed after waking up . Infantile spasms in ad cases are a remarkable presentation, and are rare according to many reports . Although gingold et al . (14) described briefly that his ad patient developed multifocal seizures at age 11 months and eeg demonstrated hypsarrhythmia, which was recorded at the left posterior hemisphere during an ictal episode, no further description was provided . They first described an ad case accompanied by infantile spasms, and since no further cases have been published, our case is the second, which is why we consider this case valuable . We controlled these infantile spasms with vigabatrin, which has a highly effective anticonvulsant action . A definitive diagnosis was only possible by pathological examination of brain tissue, obtained either at biopsy or autopsy, for rfs until the genetic diagnostic method became available . Biochemical studies on compositions of rfs revealed that a large portion of the fibers consisted of the heat shock protein, b - crystallin (15), and lesser amounts of heat shock protein 27 and ubiquitin (16)., brain white matter degeneration appears remarkably in the frontal lobe on mri and hydrocephalus occurs infrequently (17, 18). Gfap was found to be distributed much more on astroglial cell channels comprised of intermediate filaments of diameter 7 - 11 nm and codes by gene 17q21's gfap gene . Ad can now be diagnosed in a high percentage of cases by analyzing dna obtained from peripheral blood, which obviates the need for brain biopsy . Brenner et al . (1) sequenced the gfap coding region in the dna from 11 unrelated patients who had died of ad and discovered that 10 patients had mutations in the gfap coding region . Li et al . (19) analyzed the dna of 44 ad cases and found a gfap gene mutation in 41 cases . Moreover, as studied parental dnas have also failed to reveal such mutations, it must be presumed that they are wholly spontaneous in nature . This indicates that ad is not autosomal recessive, as had previously been thought by wohlwill et al . (21), but that it is possibility due to a gonadal mosaicism . In our patient, the r239l gfap gene mutation (fig . 3) in which 716th base sequence of 4th exon showed a guanine to thymine substitution (c.716g> t), and as a result, the 239th amino acid of gfap is changed from arginine to leucine . This was determined by conducting direct base sequence analysis after amplifying all exons and intron regions of the gfap gene by pcr from peripheral blood genomic dna . However, the patient's parents and older sister had a normal base sequence . In addition, the position of the gfap gene mutation in ad which found up - to - date differs from this case . Therefore, the r239l gfap gene mutation in the present case is presumed to be a de novo mutation or gonadal mosaicism . In conclusion, the authors report a rare case of ad accompanied by infantile spasms that was diagnosed by gfap gene analysis in an 8-month - old male with seizures, psychomotor developmental retardation, macrocephaly, and spasticity of the extremities.
|
Morbidly obese women are at increased risk of obstetric complications and poor neonatal outcomes (1). The recourse to surgery to treat morbid obesity has shown a rising trend in some countries like america, where researchers have estimated that the annual number of deaths attributable to obesity is roughly 280,0001 . We report here a pregnancy with good outcome despite the short duration between gastric bypass surgery and pregnancy . A 37-year - old woman, gravida 7, parity 4 + 2 had laparoscopic roux - en - y gastric bypass surgery, as treatment for morbid obesity (height: 1.68 meters, weight: 139.6 kg, body mass index of 49.5), 6 months prior to her pregnancy . Two years previously she had been treated for deep venous thrombosis . Following the procedure she recorded a 41 kg weight loss over a period of six months . As a result, she reported that her general feeling of well being had significantly improved while her asthma had completely resolved . Also, her blood lipid profile showed a dramatic improvement . Before pregnancy she was taking daily doses of multivitamins and iron supplements . She booked for hospital care and confinement at 9 weeks and weighed 106.5 kg (body mass index 37) at booking . During the course of her pregnancy her diabetic screen was negative and close monitoring of the foetus with serial ultrasound scans showed a normal growth velocity . Her haemoglobin, mean cell volume, magnesium, calcium and serum folate levels remained normal . She remained on low molecular weight heparin (enoxaparin sodium) throughout the pregnancy for thrombo - prophylaxis and was compliant with her iron and vitamin supplements . She delivered spontaneously a healthy male baby vaginally at 37 weeks gestation that weighed 3471gms . Morbidly obese pregnant women are at an increased risk of developing adverse perinatal outcomes compared to non - obese pregnant women . These include an increased caesarean section rate (32.4% vs. 14.3%), macrosomia (30.2% vs. 11.6%), intrauterine growth retardation (8.1% vs. 0.9%), and neonatal admission to the intensive care unit (15.6% vs. 4.5%) (2). They are also more likely to have chronic hypertension (27.0% vs. 0.9%) and insulin - dependent diabetes mellitus (19.8% vs. 2.7%). It is expected that the risks of these obesity related morbidities would decrease following weight reduction . Roux - en - y gastric bypass promotes weight loss by restricting food intake as well as reducing food absorption from the gastrointestinal tract . These women may be at risk of gastrointestinal complications because of the changes associated with pregnancy . Cases of internal herniation, intussusception, small bowel ischaemia and fetal demise (due to sepsis) have been reported (3). It is particularly important not to delay surgical exploration as this might lead to devastating bowel strangulation and sepsis culminating in loss of foetus and mother . Morbidly obese patients often have nutritional deficiencies, particularly in fat - soluble vitamins, folate and zinc . Severe iron deficiency, which is refractory to oral supplementation, can result from malabsorption (5). Malabsorption of antibiotics as a result of surgery leading to difficulties in treatment of concurrent infections has been reported (6). Postponement of pregnancy, until all metabolic parameters have been returned to normal (up to 36 months) has been advised (7). However, more recent studies revealed no significant differences in pregnancy outcomes between one group of patients who became pregnant within the first year of surgery and another group who became pregnant after one year (8,9). It is likely that obstetricians will be managing more of these cases in the future . To achieve the best outcome we should be aware of the potential problems related to these cases . Careful nutritional follow up, monitoring of foetal growth and awareness of the serious gastrointestinal complications are cornerstone of management of these cases.
|
A 54-year - old man presented with acute right - sided abdominal pain and nausea . 1a) with multiple lesions of poor contrast enhancement (fig . 1b) and a mass in his pancreas . A fine needle aspirate of one of the liver lesions showed cellular smears with moderate variation in nuclear size and shape with delicate cytoplasm (fig . 2b) but synaptophysin, ck7, ck20, ttf-1, hepar-1, cd10, carcinoembryonic antigen and alpha - fetoprotein were all negative . In addition, a lutetium octreatate - positive emission tomography scan showed no accumulation of tracer activity in the multiple hepatic metastases . He was found to have multi - organ failure with abnormal renal function (creatinine 190 mol / l), deranged liver enzymes (bilirubin 36 mol / l; alkaline aminotransferase (alt) 184 u / l; gammaglutamyl transferase (ggt) 468 u / l; alkaline phosphatase (alp) 322 u / l), and no radiological evidence of biliary duct obstruction . He developed disseminated intravascular coagulation (dic) with a platelet count of 10 109/l, an international normalised ratio (inr) of 2.8, a fibrinogen level of 0.5 he showed no signs of bleeding . Over the next 3 days, the patient became anuric and dyspnoeic . He was treated with fluid resuscitation, blood products and vitamin k. he gradually improved over a period of 10 days . His renal impairment resolved (creatinine 94 mol / l), liver function tests improved (bilirubin 24 mol / l; alt 59 u / l; ggt 220 u / l; alp 247 u / l) and the coagulation profile normalised (platelet count 447 109/l; inr 1.1; fibrinogen 5.6 one week later, he received his first cycle of chemotherapy carboplatin (auc 5) and etoposide (100 mg / m) with a 20% dose reduction . Three weeks later, he presented with a 5-day history of fatigue, dyspnoea, haematuria and extensive bruising (fig . He had recurrent dic with active bleeding as evidenced by a drop of haemoglobin to 43 g / l, a platelet count of 11 109/l, an inr of 4.3, a fibrinogen level of <0.2 his renal and liver functions remained relatively stable initially (creatinine 128 mol / l; bilirubin 24 mol / l; alt 48 u / l; ggt 286 u / l; alp 254 u / l). He rapidly deteriorated with worsening dyspnoea, ischaemic chest pain and increasing blood product requirement with no improvement in his blood counts . Further chemotherapy was contemplated as it was thought that malignancy was the underlying cause of the dic . However, due to his rapid decline, this was deemed futile, hence palliative measures were implemented . He died 3 days after his second admission 2 months after his initial presentation . Neuroendocrine tumours have a wide range of clinical presentations, from the more indolent low - grade carcinoid tumours to aggressive high - grade disease similar to small cell carcinomas . They are often associated with the secretion of hormones and peptides leading to classical syndromes [2, 3, 4, 5]. The fulminant nature of the dic in this case is reminiscent of tumour lysis syndrome which is similarly associated with malignancy with a high proliferative rate, large tumour burden and high sensitivity to cytotoxic agents . In tumour lysis syndrome, massive quantities of intracellular contents, including potassium, phosphate and nucleic acid that metabolized to uric acid, are released to the systemic circulation, causing acute metabolic imbalance and renal failure . In our case, it appears that manipulation by core biopsy caused self - limiting and, later, cytotoxic agents caused fulminant dic by the release of procoagulants and cytokines from lysed tumour cells . Dic is characterised by a widespread, intravascular activation of coagulation leading to intravascular fibrin deposition and simultaneous consumption of coagulation factors and platelets . The consequence of dic depends on its cause and the rapidity with which the activating event is propagated . If the activation occurs slowly, an excess of procoagulants is produced, leading to thrombosis . The hallmark of chronic, compensated dic is that the liver can offset the consumption of clotting factors and the bone marrow maintains an adequate platelet count . If the activation is brisk, the clinical picture is dominated by intravascular coagulation leading to profound systemic bleeding diathesis . Our case was an unusual presentation as dic in cancer usually is a less fulminant presentation compared to dic associated with sepsis and trauma . Tissue factor (tf) and cancer procoagulant - mediated activation of coagulation, platelet aggregation and activation, suppression of the fibrinolytic pathway and cytokine - regulated defective anticoagulant mechanisms form pivotal roles in activating coagulation and the ensuing procoagulant state in cancer . Complications are typically related to excess procoagulants causing venous thrombosis (deep venous thrombosis, superficial migratory thrombophlebitis and, less commonly, arterial thrombosis), digital ischaemia, renal infarction and stroke . The physiological response to the exposure of tumour - specific antigens results in the release of potent inflammatory mediators such as tumour necrosis factor and interleukin-1 from activated macrophages and stimulated t cells . This further propagates the prothrombotic process as besides from being potent mediators of inflammation these cytokines can also induce tf expression, activate platelets and downregulate the protein c pathway . In addition, these cytokines induce endothelial expression of plasminogen activator inhibitor-1 and impair the protein c anticoagulant pathway by downregulating thrombomodulin and endothelial protein c receptor . As a consequence, fibrinolytic and anticoagulant activities are decreased . Laboratory evidence of coagulation activation has been documented with exposure to chemotherapy (e.g. Cyclophosphamide, methotrexate and 5-fluorouracil) and hormonal therapy (e.g. Tamoxifen), but usually the abnormalities in coagulation markers are modest and do not correlate with the development of dic . It is postulated that the release of procoagulants and cytokines from lysed tumour cells as well as endothelial cell damage are caused by cytotoxic agents rather than being a direct effect of chemotherapy itself . In addition, by direct surgical trauma of tumour blood vessels, exposure to subendothelial tf causes the release of cytokines with their procoagulant activity . Management is limited to supportive care by replacing blood products and treating the underlying malignancy . This poses a dilemma as cytotoxic agents may worsen dic and may also directly suppress bone marrow production.
|
Discarded amaranthus cruentus is a form of vegetable that cannot be consumed by humans and are ready for disposal after 48 hrs of being harvested . It serves as spices in human diets but begins to deteriorate after 48 hrs of harvest . When unsold and discarded, it becomes a total loss to the seller . Conventional protein feedstuffs such as soyabean meal, ground nut cake, and fish meal are quite expensive . The high cost of these ingredients has resulted in the inadequate / poor feeding of rabbits and other livestock species . The need to sources for alterative feedstuffs so as to reduce the high cost of livestock production cannot be overemphasized . Blood vegetable waste meal (bvwm) is obtained from processed blood and vegetable; both are waste . The blood is washed away at the abattoir, while the unsold vegetable is discarded at refuse site . Hence, bvwm is obtained free and can be fed to rabbits to reduce production cost, particularly as feed accounts for almost 70% of the cost of production . It has small body size, short gestation interval, induced ovulator, and an ability to utilize forage . Rabbits are hindgut fermenters, capable of utilizing poor quality feed, and can tolerate up to 25% dietary crude fibre . Improved rabbit production can play important role in increasing animal protein supply to under nourished populace, considering the high cost of chicken, pork, and beef . The study was aimed at investigating the effects of replacing groundnut cake with bvwm on the performance of rabbits and to also ascertain what level of bvwm that can best replace groundnut cake (gnc). Discarded amaranthus cruentus (which was not sold 48 hours after harvest; they are considered as waste and are about to be thrown away) was collected from the market and processed along with fresh bovine blood at ratio 1: 2 (w / w), that is, one of blood to two of vegetable . The discarded vegetable and blood were thoroughly mixed and cooked at 100c for about 1.5 hours . It was stirred regularly to prevent burning . The cooked mixture blood vegetable waste meal (bvwm) was later sun - dried until the moisture content was below 15% . On analysis, bvwm contained 62.35% crude protein, 6.4% crude fibre, and 3.45% ether extract . A total of 72 eight - week old weaner rabbits of both sexes were used in this study there were four treatments, with each treatment having 3 replicate groups, and there were 6 rabbits housed individually placed in each replicate . There are four experimental diets (table 1) which are such that bvwm was fed to replace dietary groundnut cake (gnc) at 0, 15, 30, and 45%, while gnc in the control was 15% . All rabbits were individually housed in metal cages throughout the feeding trial which lasted for a period of eight (8) weeks . Initial and weekly body weight records and daily feed intake record were kept . The feed to gain ratio was calculated . At the last week of feeding trial, faecal and urine samples were collected for 3 consecutive days by the total collection method to determine nitrogen digestibility . There was an increase in body weight gain by rabbits as the level of replacement with bvwm increased in their diet . The rabbits on the control diet had a body weight gain of 7.28 g / day which was comparable (p> 0.05) to the body weight gained by rabbit on the 15% . Bvwm replacement diet (7.95 g); but significantly lower (p <0.05) to the body weight gain values for the rabbits on 30 and 45% bvwm replacement diets that gained 9.69 and 9.38 g, respectively . The feed intake values were comparable (p> 0.05) for rabbits on all the diets, but these feed intake values tended to increase as the bvwm replacement level increased in the diets . The feed to gain ratio was significantly (p <0.05) affected by the treatment . The rabbits on the 30 and 45% bvwm replacement diet had significantly lower (p <0.05) feed to gain ratio values (6.89 and 6.80, resp .) Compared with the 0 and 15% bvwm diets that had feed to gain ratios of 7.85 and 7.81, respectively . Table 3 shows the results of nitrogen digestibility of rabbits when groundnut cake was replaced with bvwm . Although nitrogen intake was comparable (p> 0.05) for rabbits on all the diets, the intake seemed to have increased with the increasing levels of bvwm replacement in the fed . Faecal nitrogen values were highly comparable (p> 0.05) for all treatments except rabbits fed on the 45% bvwm replacement diet that had significantly lower (p <0.05) faecal nitrogen value of 0.37 g. the rabbits had comparable (p> 0.05) nitrogen balance values except for the rabbits on the 45% bvwm replacement diet with a higher (p <0.05) nitrogen balance of 1.76 g. nitrogen digestibility increased (p <0.05) as the level of bvwm replacement also increased in the rabbit diet . The rabbits on the control feed had a digestibility of 60.49% which kept increasing up to 76.86% for the rabbits fed 45% bvwm diet . The rabbits tended to consume more of the bvwm diets than the groundnut cake control diets . This is contrary to reports of adeniji, who reported decreased feed intake by broiler finishers as the bvwm diets increased . Rabbits as nonruminant herbivores can tolerate more of fibrous feeds than poultry; hence, the better feed consumption was obtained in this study . The increased body weight gain obtained in the study with the higher levels of bvwm in the rabbit feed implies that bvwm possessed a growth stimulating effect . Dong et al . Reported improved growth rate when water spinach was fed to rabbits . The improved feed to gain ratio at the high levels of bvwm shows that bvwm is a promising feedstuff . Bvwm can help to solve the problem of feed scarcity and reduce demand on expensive protein supplements like groundnut cake and soyabean meal . Ekenyem and madubuike reported that there are lots of tropical foliages that can be fed as based diets for rabbits . The improved digestibility with higher levels of bvwm implies that rabbits are able to effectively digest higher levels of bvwm whose could have been discarded as waste . Bvwm which monogastrics might not be able to digest well because of their high fibre level should not be discarded but converted for rabbit feed . Based on the lower feed to gain ratio and higher nitrogen digestibility, rabbits can tolerate the 45% groundnut cake replacement with bvwm . This will reduce the heavy demand for groundnut cake in livestock feeding and its high price reduced . Improved rabbit production can play on important role in increasing animal protein supply to people in the under developed countries, considering the high cost of chicken, pork, and beef.
|
It is now evident that adipose tissue not only stores excess triacylglycerols, but functions as an endocrine organ by releasing adipokines, which have important roles in the regulation of appetite, glucose and lipid metabolism, inflammation, and insulin resistance.1,2 such adipokines include adiponectin, leptin, resistin, tumor necrosis factor (tnf)-, plasminogen activator inhibitor-1 (pai-1), and interleukin (il)-6 . Tnf-, pai-1, and il-6 are all proinflammatory cytokines, although il-6 can further exert an anti - inflammatory action.1 it has also been observed that leptin, resistin, and tnf- impair insulin sensitivity and trigger atherogenesis.1 these adipokines usually increase with adiposity and can have a detrimental role on an individual s health . However, adiponectin, unlike other adipokines produced by adipose tissue, possesses antiatherogenic properties and is found to decrease with increased adiposity.1,2 several studies provide evidence of improvement in adipokine profiles with weight loss.36 however, it remains unclear as to whether changes in the circulating adipokines investigated to date contribute significantly to the beneficial effects on health associated with weight loss.7 the extent of weight loss required to elicit such changes in adipokine levels remains unclear . In addition, the method by which the weight loss is achieved may also influence the adipokine response . Varady et al8 suggest that a minimum weight loss of 5% is required to have an effect on levels of key adipokines (adiponectin, leptin, and resistin), but this differs from other studies which report the need for a 10% weight loss for modification in levels of some adipokines (eg, adiponectin) and that this varies with the degree of obesity.9 further studies are needed to clarify the relationship between changes in adipokine levels and the health benefits of weight loss, and whether specific dietary manipulations have differential effects on such changes . We hypothesized that the extent of weight loss rather than the macronutrient intake will determine the degree of change in adipokine levels . We aimed to investigate the effect of weight loss on adipokine levels in individuals receiving a low carbohydrate / high protein (lchp) diet compared with a very low calorie diet (lighterlife [ll]) diet . The present analysis is an ancillary study to that previously presented by rolland et al10 where the methods were described . Dropouts were not included in this analysis because the goal was to evaluate the effect of diet on adipokine levels and not an intention - to - treat clinical trial . In brief, patients referred to a specialist obesity clinic were entered into a randomized controlled clinical trial of differing dietary interventions in the management of obesity . Men and women older than 18 years of age and a body mass index (bmi) 35 kg / m were included . Patients with a history of hepatic or renal disease, cancer, current pregnancy / lactation, on antidepressant or antiobesity medication, or eating disorders were excluded . The study included a three - month screening period where patients were assigned to a 600 calorie - deficient diet (cdd) aiming to achieve a 5% weight loss . This was done to select patients who would not respond to a low - fat, reduced - energy approach and randomly assign them to a lchp or a ll diet in the form of a continuous method approach . Those who lost> 5% of their body weight were maintained on this approach for an additional three months . If weight loss was> 10% at this time, the cdd was continued for an additional six months . Completer data for this group were limited (n = 4) and therefore were not included in this paper . Those patients who failed to achieve the weight loss targets were randomly allocated to either a lchp or ll diet, and continued on the assigned diet for an additional nine months (figure 1). Patients on cdd who achieved a 5% weight loss at screening but did not achieve the 10% weight loss three months following screening were randomized to the ll or the lchp diet but their data were omitted from this analysis . The study was approved by the north of scotland research ethics service . Using the schofield and the harris benedict equations, the amount of energy allowed was broken down into portions from the different food groups.10 portion sizes were explained to the patients and written information was also provided . Patients were reviewed at weeks 2, 4, 8, and 12 when they were weighed, their weight loss progress was discussed, and they were provided with dietary advice . Patients randomized to the low lchp diet were restricted to 40 g of carbohydrate per day . The energy intake was 8001500 kcal where an 800 kcal diet was composed of 20% carbohydrate, 40% protein, and 40% fat . Patients were given a booklet with information about which foods to eat and which to avoid . The diet was supplemented with multivitamins and minerals (forceval, alliance pharmaceuticals, chippenham, uk). The ll diet used in this study is administered in the form of soups, shakes, and bars to replace conventional food and provides a daily average of 550 kcal (36% carbohydrate, 36% protein, 28% fat, and at least 100% of the recommended daily allowance for all micronutrients). Ll has two distinctive stages, ie, weight loss and food reintroduction . During each stage, patients attend weekly single - sex group meetings of 712 people for behavior change therapy based on cognitive behavior therapy and transactional analysis methodology delivered by a trained ll advisor . Patients were required to remain on the weight loss phase for a minimum of three months, after which they were given a choice to continue for up to another six months or were assigned to the food reintroduction phase . On average, patients who completed the study remained on the diet for 6.9 (range 49) months . For the food reintroduction phase, solid foods were reintroduced over a 12-week period where patients were slowly weaned off food packs while still receiving advice and support . All patients came monthly to the trial center to be weighed for the first three months and then every alternate month after screening, resulting in six visits in nine months . Fat mass and fat free mass was estimated using bioelectrical impedance (tanita bc-418 ma, [tanita corporation, arlington heights, il]). Body composition and waist circumference were measured prescreening, at screening, and at months 3 and 9 after screening . Blood samples were obtained after an overnight fast prescreening, at screening, and at months 3 and 9 after screening to measure fasting plasma glucose, insulin, and adipokines, including leptin, resistin, adiponectin, pai-1 (active), il-6, and tnf-. Serum samples for adipokines and insulin were measured in duplicate with commercially available immunoassay kits from millipore using the lincoplex system (st charles, mo). The protocol for measurement of insulin and all the adipokines was carried out as described by the manufacturer . High - density lipoprotein cholesterol (hdl), triacylglycerol, and fasting glucose were analyzed in the department of clinical biochemistry at nhs grampian . Insulin resistance using fasting glucose and insulin values was calculated using the homeostasis model of assessment of insulin resistance (homa - ir) where homa - ir = [insulin] [glucose]/22.5 . Any skewed data were log - transformed and subsequently assessed using parametric tests . For within group analysis, a paired t - test was used . For between - group analysis of changes, the pearson correlation was used to assess the relationship between changes in adipokines and changes in other continuous measurements . Statistical tests were carried out using the spss 15.0 for windows software program (spss inc, chicago, il). Because this is an ancillary analysis following on from a previously published study,10 the power for this analysis a p value of <0.05 (two - tailed) was considered statistically significant . Based on the mean change (31.0 kg) and standard deviation (16.4 kg) for weight loss observed at nine months,10 14 patients in each group resulted in a> 99% power for weight change . Using the schofield and the harris benedict equations, 600 kcal were removed from the patients estimated daily energy intake . The amount of energy allowed was broken down into portions from the different food groups.10 portion sizes were explained to the patients and written information was also provided . Patients were reviewed at weeks 2, 4, 8, and 12 when they were weighed, their weight loss progress was discussed, and they were provided with dietary advice . Patients randomized to the low lchp diet were restricted to 40 g of carbohydrate per day . The energy intake was 8001500 kcal where an 800 kcal diet was composed of 20% carbohydrate, 40% protein, and 40% fat . Patients were given a booklet with information about which foods to eat and which to avoid . The diet was supplemented with multivitamins and minerals (forceval, alliance pharmaceuticals, chippenham, uk). The ll diet used in this study is administered in the form of soups, shakes, and bars to replace conventional food and provides a daily average of 550 kcal (36% carbohydrate, 36% protein, 28% fat, and at least 100% of the recommended daily allowance for all micronutrients). Ll has two distinctive stages, ie, weight loss and food reintroduction . During each stage, patients attend weekly single - sex group meetings of 712 people for behavior change therapy based on cognitive behavior therapy and transactional analysis methodology delivered by a trained ll advisor . Patients were required to remain on the weight loss phase for a minimum of three months, after which they were given a choice to continue for up to another six months or were assigned to the food reintroduction phase . On average, patients who completed the study remained on the diet for 6.9 (range 49) months . For the food reintroduction phase, solid foods were reintroduced over a 12-week period where patients were slowly weaned off food packs while still receiving advice and support . All patients came monthly to the trial center to be weighed for the first three months and then every alternate month after screening, resulting in six visits in nine months . Fat mass and fat free mass was estimated using bioelectrical impedance (tanita bc-418 ma, [tanita corporation, arlington heights, il]). Body composition and waist circumference were measured prescreening, at screening, and at months 3 and 9 after screening . Blood samples were obtained after an overnight fast prescreening, at screening, and at months 3 and 9 after screening to measure fasting plasma glucose, insulin, and adipokines, including leptin, resistin, adiponectin, pai-1 (active), il-6, and tnf-. Serum samples for adipokines and insulin were measured in duplicate with commercially available immunoassay kits from millipore using the lincoplex system (st charles, mo). The protocol for measurement of insulin and all the adipokines high - density lipoprotein cholesterol (hdl), triacylglycerol, and fasting glucose were analyzed in the department of clinical biochemistry at nhs grampian . Insulin resistance using fasting glucose and insulin values was calculated using the homeostasis model of assessment of insulin resistance (homa - ir) where homa - ir = [insulin] [glucose]/22.5 . All variables were assessed for normality using the kolmogorov - smirnov test . Any skewed data were log - transformed and subsequently assessed using parametric tests . For within group analysis, a paired t - test was used . For between - group analysis of changes, the pearson correlation was used to assess the relationship between changes in adipokines and changes in other continuous measurements . Statistical tests were carried out using the spss 15.0 for windows software program (spss inc, chicago, il). Because this is an ancillary analysis following on from a previously published study,10 the power for this analysis was carried out based on weight loss . A p value of <0.05 (two - tailed) was considered statistically significant . Based on the mean change (31.0 kg) and standard deviation (16.4 kg) for weight loss observed at nine months,10 14 patients in each group resulted in a> 99% power for weight change . Data are presented as means standard deviation, and changes are expressed as the mean difference changes from baseline standard deviation . Baseline characteristics are listed in table 2 . A total of 31 (14 in ll, 17 in lchp) patients completed the study . There were significantly more men in the ll than the lchp group (n = 5 and n = 1, respectively). Weight, bmi, and fat free mass were significantly greater in the ll group than in the lchp group (table 2). When investigating the whole group, significant associations were observed between adiponectin, hdl, and pai-1 . Leptin was significantly associated with percentage body fat and tnf-, while il-6 was inversely associated with hdl (table 3). There were no significant gender differences for the adipokines with the exception of leptin, for which the levels were significantly greater in women than in men (46.7 15.5 ng / ml versus 28.2 14.6 ng / ml, p = 0.014). However, this was no longer significant after adjusting for percentage body fat (p = 0.089). At three months, percentage weight loss for the lchp group was 2.9% 4.2% and for ll was 18.4% 5.4% (p <0.0001). Weight, waist circumference, percentage body fat, fat mass, leptin, pai-1, fasting glucose, homa - ir, and triacylglycerols had improved significantly in the ll group (table 4). However, hdl and fat free mass decreased significantly from baseline in the ll group (table 4). A significant improvement from baseline to three months was observed for weight, percentage body fat, fat mass, insulin, and homa - ir in the lchp group (table 4). At nine months, the percentage weight change for the lchp group was 1.4% 1.0% and for ll was 23.8% 4.0% (p in the ll group, weight loss, waist circumference, percentage body fat, fat mass, fat free mass, leptin, pai-1, fasting glucose, and triacylglycerols were still significantly improved compared with baseline (table 4). In addition, significant improvements in circulating levels of adiponectin and hdl were observed, but homa - ir was no longer significant (table 4). Changes in adiponectin were inversely associated with changes in weight, bmi, fat mass, percentage body fat, waist circumference, il-6, and tnf-. Changes in leptin were associated with changes in weight, bmi, fat mass, waist circumference, fat free mass, and percentage body fat . Changes in tnf- were associated with changes in il-6, and inversely associated with changes in adiponectin . There were no significant changes from baseline at nine months for the lchp group (table 4). However, changes in leptin were inversely associated with changes in hdl (r = 0.573, p = 0.032). Overall, changes at nine months for weight, waist circumference, fat mass, adiponectin, leptin, fasting glucose, and hdl were significantly greater for the ll group than for the lchp group (table 4). At three months, percentage weight loss for the lchp group was 2.9% 4.2% and for ll was 18.4% 5.4% (p <0.0001). Weight, waist circumference, percentage body fat, fat mass, leptin, pai-1, fasting glucose, homa - ir, and triacylglycerols had improved significantly in the ll group (table 4). However, hdl and fat free mass decreased significantly from baseline in the ll group (table 4). A significant improvement from baseline to three months was observed for weight, percentage body fat, fat mass, insulin, and homa - ir in the lchp group (table 4). At nine months, the percentage weight change for the lchp group was 1.4% 1.0% and for ll was 23.8% 4.0% (p <0.0001). In the ll group, weight loss, waist circumference, percentage body fat, fat mass, fat free mass, leptin, pai-1, fasting glucose, and triacylglycerols were, significant improvements in circulating levels of adiponectin and hdl were observed, but homa - ir was no longer significant (table 4). Changes in adiponectin were inversely associated with changes in weight, bmi, fat mass, percentage body fat, waist circumference, il-6, and tnf-. Changes in leptin were associated with changes in weight, bmi, fat mass, waist circumference, fat free mass, and percentage body fat . Changes in tnf- were associated with changes in il-6, and inversely associated with changes in adiponectin . There were no significant changes from baseline at nine months for the lchp group (table 4). However, changes in leptin were inversely associated with changes in hdl (r = 0.573, p = 0.032). Overall, changes at nine months for weight, waist circumference, fat mass, adiponectin, leptin, fasting glucose, and hdl were significantly greater for the ll group than for the lchp group (table 4). In the present study, there was a significant weight loss at three months for patients on both ll and lchp . However, significant weight loss at nine months was only maintained in the ll group . Changes in adiponectin and leptin were significantly greater in the ll group than in the lchp group which may be due to greater weight loss and decrease in fat mass . However, changes in tnf-, il-6, pai-1, and resistin did not differ significantly between the dietary groups at nine months . At baseline, we observed a trend for adiponectin to be inversely correlated with weight and bmi, but this did not reach statistical significance, possibly due to the small sample size . Surprisingly, there was no significant inverse correlation between adiponectin and waist circumference, which was unexpected because other studies have demonstrated that waist circumference is a good correlate for adiponectemia.12,13 although the sample size was small, this may not be the reason for the lack of correlation between adiponectin, bmi, and waist circumference . . There is evidence to suggest that the incidence of metabolic syndrome decreases beyond a bmi of 37.5 kg / m.14 interestingly, our findings support the evidence presented by plaisance et al,15 who reported that baseline adiponectin levels were strongly correlated with mean hdl cholesterol . Association of moderately decreased risk of cvd with increased adiponectin is thought to be mediated in part by the effects of adiponectin on hdl, through parallel increases in both . However, how adiponectin affects hdl remains unknown.16 in the ll group, changes in adiponectin were significant at nine months but not at three months . Weight loss increased significantly from three to nine months in this group, which would suggest that a weight loss greater than 18.4% is required for statistically significant improvements in circulating adiponectin levels . Changes in adiponectin were inversely associated with fat mass, waist circumference, il-6, and tnf- at nine months, suggesting an improvement in inflammatory status with weight loss and the associated increase in adiponectin . In the present study, leptin was significantly associated with percentage body fat at baseline, which is consistent with previous findings.17 there was no significant correlation found between leptin and waist circumference in the present study at baseline . This suggests that there may be a greater release of leptin from peripheral subcutaneous adipose tissue compared with visceral adipose tissue . Studies have shown that there are variations in leptin gene expression in adipose tissue depending on the site where it is deposited, where expression is greater in subcutaneous compared with visceral adipose tissue.18,19 alternatively, the lack of association between leptin and waist circumference may have been due to issues in the measurement of waist circumference in grade iii obese patients, a difficulty which is well recognized . In addition, different protocols yield different results.20 leptin was significantly decreased at three and nine months in the ll group . The changes in leptin were significantly associated with fat mass, percentage body fat, and waist circumference . This is consistent with a number of studies in which leptin is shown to decrease in response to weight loss.2124 there was also an association between leptin change and waist circumference change at nine months, reflecting an overall loss of fat mass . In addition, despite the minimal weight loss for the lchp group, changes in leptin were inversely associated with hdl at nine months . This may suggest that even a small reduction in weight results in a beneficial trend of improvement in leptin levels which is likely to improve cardiovascular risk . Levels of pai-1 at baseline were associated with waist circumference, homa - ir, and insulin, suggesting that pai-1 is involved in insulin resistance as previously reported.25 weight loss has been found to reduce the levels of pai-1,2628 indicating the influence of adipose tissue on the levels of this protein . Our study data are in support of this evidence, where changes in pai-1 were associated with changes in fat mass for the ll group at nine months . There was no evidence from the present study to support a strong link between resistin levels and weight . Of all the adipokines examined in this study, resistin appears to be the most controversial because the evidence appears to be equivocal and inconclusive.2931 further human studies are required to confirm whether there is a relationship between resistin and obesity, including insulin resistance and type 2 diabetes mellitus . Similarly, despite the fact that il-6 has been found to be increased in obesity32,33 and reduced in response to weight loss,34 no significant differences at baseline or in response to diet were observed here . Subcutaneous adipose tissue is thought to release approximately 30% of systemic il-6, and visceral adipose tissue is thought to release even more . However, the lack of change may be explained by the fact that only about 10% of total il-6 is produced by fat cells.35 in addition, mean levels of tnf- did not correlate significantly with weight, waist circumference, or percentage body fat at baseline . These results were unexpected, because it is widely reported that tnf- is linked with obesity.36 also, tnf- did not show any significant decrease in response to weight loss or diet . However, in a study by arvidsson et al,37 circulating levels of tnf- did not show a significant difference after a mean weight loss of 7.5% at 10 weeks . These authors concluded that adipose tissue has only a minor effect on the regulation of circulating tnf- levels . Thus, tnf- seems to be produced and acts locally in human fat tissue,38 and there is no in situ release from adipose tissue into the blood.35 a number of studies have observed no changes in il-6 or tnf- after significant reductions in weight (59 kg) with dietary and exercise interventions.39,40 however, it was interesting to observe that changes in il-6 and tnf- were significantly correlated at nine months in the ll group . This could be explained by the relationship between il-6 and tnf- whereby il-6 exerts proinflammatory activity itself and increases tnf-.1 this would suggest that, despite weight loss not resulting in significant improvements in circulating levels of il-6 and tnf-, there appears to be an underlying clinically significant response whereby reduction in weight results in a decrease in inflammation . There is evidence that weight loss achieved using a very low calorie diet results in changes in adipokine levels similar to those observed in response to bariatric surgery . Mitterberger et al41 compared a group of patients for whom weight loss was achieved by dietary caloric restriction only with a group of patients in whom caloric restriction was induced by bariatric surgery (three gastric bypasses and eight gastric bands). They reported that despite the fact that only a 26% 7% weight loss was achieved in the dietary caloric restriction as compared with 43% 10% in the bariatric surgery group, changes in adipokines were not significantly different between the two groups . This may suggest an important role for the use of a weight loss approach, such as the very low calorie diet instead of bariatric surgery, which is highly invasive, expensive, and can lead to long - term vitamin and mineral deficiencies.42 although it remains unclear as to whether the adipokines investigated to date are responsible for the beneficial effects on health associated with weight loss, it is clear from this study and several others that there are important associations between weight loss, certain adipokines (such as adiponectin), leptin levels, and cardiovascular disease risk . In addition, the extent of weight loss required to elicit the benefits as well as the effects of the method by which weight loss is obtained remains unknown . However, it can be argued that there does seem to be a minimal weight loss required which was not achieved here in the lchp group and a maximal weight loss beyond which further improvements in circulating adipokine levels are no longer observed, as demonstrated in the study by mitterberg et al.41 further research would include determining if there is a ceiling effect for adipokine change in response to weight loss . This would involve directly comparing adipokine changes in response to weight loss achieved using a very low calorie diet as compared with weight loss achieved using surgical approaches . There were significantly more men on ll than on lchp, but this may not have been too limiting because there were no significant gender effects on adipokine when all patients were combined at baseline, except for leptin, but this discrepancy may have resulted in the significant differences between the two groups at baseline for weight, waist circumference, and fat free mass . In addition, although the sample size provided a> 99% power for weight loss, the sample sizes may have been too small to observe associations and changes in adipokines, which would have been expected based on the literature . Moreover, use of the multiplexed assay has been criticized in the scientific literature.43 the multiplexed bead immunoassay allows the simultaneous detection of adipokines in small blood samples which may be particularly useful when samples are difficult to obtain . The use of this approach has been validated and found to be useful for leptin, adiponectin, and insulin in the evaluation of changes in obesity markers following weight reduction.43 the relationship between the multiplexed bead immunoassay when compared with the radioimmunoassay or enzyme - linked immunoassay for other adipokines such as resistin, il-6, and tnf-, were reported to be quite weak . These differences could be explained by differences in antibody pairs and sample diluents, as well as the low effects of low concentrations of these adipokines . In addition, assay sensitivity remains an issue when compared with ultrasensitive enzyme - linked immunoassay methods.43 however, the ability of multiplexed assays to detect adipokines of a broader dynamic range than enzyme - linked immunoassays, as well as its greater cost - effectiveness, time efficiency, requirement of smaller sample volumes, and the removal of interassay variability suggest that this approach is still to be considered a powerful tool, albeit with the above limitations . It would appear that the significant weight loss of 23.8% observed on ll resulted in significant improvements in circulating levels of leptin, pai-1, and adiponectin . Changes in these adipokines possibly resulted in improvements in fasting glucose, triacylglycerols, and hdl . This is most likely due to the overall weight loss achieved rather than macronutrient intake . Further research examining the adipokine response to weight loss using a very low calorie diet in comparison with surgical interventions would be beneficial to determine if the adipokine response to weight loss has a ceiling effect.
|
Increasing experimental and clinical evidence show that thrombosis and atherosclerosis might be closely associated with an inflammatory reaction . Inflammation decreases the activity of natural anticoagulant mechanisms, initiates clotting, and impairs the fibrinolytic system . Indeed, proinflammatory molecules are involved in the activation and migration of leukocytes to sites of vascular injury and inflammation and may contribute to the release by activated cells of prothrombotic factors which, in turn, may activate platelets and other cell types [2, 3]. Recently, much attention has been driven on haemostatic disorders observed in subjects affected by immunological chronic inflammation, such as rheumatoid arthritis (ra), multiple sclerosis (ms), and inflammatory bowel disease (ibd) that may represent the cause of the increased cardiovascular risk observed in these pathologies [46]. Circulating cytokines and recruited inflammatory cells could cause endothelial activation and dysfunction leading toward a prothrombotic state [7, 8]. Interleukin-17a (il-17a) is the most widely studied member of the il-17 cytokine family . It is mainly produced by t - helper (th)-17 lymphocytes, and also by natural killer t (nkt) cells, t cells (-17), cytotoxic cd8 t cells (tc17), and neutrophils [911]. Il-17a is a proinflammatory cytokine, highly produced in patients with chronic inflammatory diseases, such as ra, ms, and ibd [1315]. Il-17a is also involved in atherosclerosis; furthermore, in humans a positive correlation has also been found between circulating il-17a levels and acute coronary syndrome [17, 18]. These findings have suggested that il-17a might play a role in the cardiovascular risk associated with systemic immunological disorders . Recently, in the attempt of finding a link between inflammatory markers and endothelial dysfunction, marder et al . Demonstrated that il-17a is an inflammatory marker that could be positively correlated with markers of impaired vascular function in subjects affected by rheumatoid arthritis . Consistent with this, it has also been shown that, on huvec, il-17a reduces cd39 mrna expression and synergistically with tumour necrosis factor (tnf) it is able to induce tissue factor (tf) expression and to downregulate thrombomodulin expression . It is known that arterial thrombosis is primarily caused by platelet adhesion to the damaged vessel and activation . Following activation thus, il-17a could activate endothelial cells toward a prothrombotic state; however, up to now there is no in vivo evidence for this . We have recently demonstrated that il-17a increases human and murine platelet response to adenosine-5-diphosphate (adp). In vitro this effect is associated with an increased exposition of p - selectin on platelet surface . Since platelets are primary involved in arterial thrombus formation and an increased platelet reactivity has been found associated with several systemic immunological disorders where also il-17a is involved [6, 7, 23], here we sought to investigate the effect of il-17a on in vivo arterial thrombus formation . Male wistar rats (300350 g; harlan nossan, correzzana, mi, italy) were used for all experiments . Animals were kept under standard conditions with food ad libitum and maintained in a 12 h/12 h light / dark cycle at 22 1c . All the in vivo procedures were in accordance with the italian legislative decree (d.l .) Number 116 of january 27, 1992, and associates guidelines in the european communities council directive of november 24, 1986 (8676097ecc). Rats were anaesthetized with urethane (10% wt / v; 10 ml / kg ip .) And placed on a surgical table . An arterial thrombus was induced by fecl3 application onto the surface of the right carotid artery, as described by kurz et al . . The effect of topical application of il-17a was also evaluated . In brief, following surgery, a piece of filter paper (whatman n1, 3 5 mm) soaked in 10 l of a solution of fecl3 (5%) or in recombinant mouse il-17a (100 g / ml in hcl 4 mm, r&d system, abingdon, uk) was applied onto the external surface of the right carotid artery for 30 minutes . Afterward the paper was removed and the vessel was left in situ for 60 minutes, to enable thrombus formation . In another set of experiments, an il-17a (100 g / ml), or vehicle (hcl 4 mm), soaked filter paper was applied on the vessel for 30 minutes before applying fecl3 (5%), as described above . At the end of 60-minute period, a piece of about 2 cm in length of the right carotid artery (and its contralateral) was excised and weighed . Thrombus size was evaluated by the difference in weight between the treated vessel and its contralateral . In another group of animals, the experiment was performed as described above and a segment (2 cm) of each treated vessel was excised, rinsed in saline to remove the blood excess, and then fixed in formalin (4% v / v; carlo erba, italy) for 24 hours . Sections (10 m thick) were then stained with haematoxylin and eosin (carlo erba, italy) in order to be morphologically analyzed . In all cases, a minimum of 5 sections per animal were analysed by using a standard light microscope (5 and 10 objective). Images were taken by a leica dfc320 video camera (leica, milan, italy) connected to a leica dm rb microscope using the leica application suite software v2.4.0 . In subsets of experiments, following local treatment with il-17a or with its vehicle (hcl 4 mm) for 30 minutes, as described above, cd39 expression was evaluated on carotid section homogenates by western blot analysis . For this purpose, following local treatment, carotids were immediately frozen in liquid nitrogen before being stored at 80c . On the day of analysis, tissues were homogenized using liquid nitrogen in the following lysis buffer: tris - hcl ph 7.5, 50 mm; nacl, 150 mm; sodium orthovanadate, 1 mm; glycerophosphate, 20 mm; edta, 2 mm; pmsf 1 mm; leupeptin, 5 g / ml; aprotinin, 5 g / ml; pepstatin, 5 g / ml . Protein concentration was determined by the bio - rad protein assay kit (bio - rad, italy). Protein samples (35 g) were subjected to electrophoresis on an sds 8% polyacrylamide gel and transferred onto a nitrocellulose transfer membrane (protran, schleicher & schuell, germany). The membranes were saturated by incubation with nonfat dry milk (5% wt / v) in pbs supplemented with 0.1% (v / v) tween 20 (pbs - t) for 1 h at room temperature and then incubated with a goat monoclonal anti - cd39 antibody (a-16, santa cruz, ca) (dilution 1: 200), overnight at 4c . Successively, membranes were washed and then incubated with the secondary antibody conjugated with horseradish peroxidase, anti - goat igg - hrp (dilution 1: 2000, dako denmark), for 2 h at room temperature . Protein bands were detected using the enhanced chemiluminescence (ecl) detection kit and image quant 400 ge healthcare software (ge healthcare, italy). Protein bands were quantified using gs 800 imaging densitometer software (biorad, italy). On carotid section homogenates, adp hydrolyzing activity was evaluated using a modification of the method described by saucedo et al . . The reaction medium used to assay adpase activity contained 120 mm nacl, 5.0 mm kcl, 60 mm glucose, 5 mm cacl2, and 50 mm tris - hcl buffer, ph 7.5 in a final volume of 200 l . A sample volume of 20 l (10 g proteins) was added to the reaction medium and preincubated for 10 minutes at 37c . The enzyme reaction was then started by the addition of adp at a final concentration of 2 mm and incubated for 40 minutes at 37c . The reaction was stopped by the addition of 200 l of trichloroacetic acid (tca) 10% . Samples were then centrifuged at 3000 rpm 10 min . As a measure of adpase activity, inorganic phosphate (pi) released was quantified by a colorimetric assay sensolyte assay kit (anaspec) and expressed as nmol pi released per g of protein . Data were expressed as mean s.e . And analysed by one way analysis of variance (anova), followed by bonferroni's test for multiple comparisons, or by unpaired two - tailed student's t - test when appropriate . In some cases, one - sample t - test was used to evaluate significance against the hypothetical zero value . The increased platelet reactivity, endothelial dysfunction, and atherosclerotic plaques instability are common features of subjects affected by systemic immunological inflammatory diseases and might represent the cause of the increased cardiovascular risk observed in these patients [1, 5, 23]. However, which factors are primarily responsible for predisposing to haemostasis disturbances and to cardiovascular events in chronic autoimmune diseases is still unknown . Recently, il-17a, which is critically involved in the pathogenesis of autoimmune diseases, has been claimed as a possible candidate to participate in endothelial dysfunction and increased cardiovascular risk [19, 20]. On these bases, our work was aimed at evaluating in vivo the effect of il-17a in a model of ferric chloride - induced arterial thrombosis . We found that application of fecl3 (5%) caused an intravascular thrombus of 1.10 0.23 mg (n = 9; p <0.01 one - sample t - test) whose mass increased significantly (1.91 0.23 mg; n = 8 . P <0.01) when carotid was pretreated with il-17a (100 g / ml), 30 minutes before fecl3 application . Application of il-17a alone on the external surface of rat carotid artery generated per se a small intravascular thrombus (0.42 0.17 mg; n = 10; p <0.05) whereas nonsignificant effects were observed after vehicle exposure (0.1 0.05 mg; n = 7) (figure 1). Morphological analysis of the vessel section evidenced that the luminal surface of carotid sections from control was covered by a continuous endothelium . Interestingly, sections obtained from il-17a plus fecl3 showed an occluding thrombus compared with il-17a (figure 2(b)) or fecl3 (figure 2(c)) treated carotids . Furthermore, the endothelium appeared damaged and vessel wall thickness extremely reduced (figure 2(d)). It is known that arterial thrombosis is primarily caused by platelet adhesion and activation to the damaged vessel . Following activation, endothelium loses its antithrombotic properties and platelets may become activated . The model of fecl3-induced thrombosis has been shown to involve platelets and several components of haemostasis, including tf . Cd39/atp diphosphohydrolase (atpdase) is largely expressed on vascular endothelial cells and by converting atp and adp to monophosphate form (amp) it represents a key modulator of vascular haemostasis and thrombogenesis . The loss of cd39 on activated endothelial cells causes platelet sequestration and tf upregulation, key events for thrombogenesis . Nonetheless, cd39 also may offer protection against myocardial ischemia - reperfusion injury since it promotes adp degradation and thus favours, in tandem with cd73 (ecto-5-nucleotidase), adenosine accumulation that represents a cardiovascular protective molecule . It was shown that mice lacking cd39 had vascular features of a prethrombotic state, characterized by fibrin deposition in several vascular beds . Recently, it has been demonstrated that il-17a reduces cd39 mrna expression in human endothelial cells in vitro and, at the same time, it increases tf expression . On these bases, and considering that cd39 plays a crucial role in maintaining the endothelium antithrombotic properties, we analysed its expression and its adp hydrolyzing activity on rat carotid artery following the in vivo exposure to il-17a . Results obtained show that following the application of il-17a on carotid surface the expression of cd39 was significantly reduced compared with the application of the only vehicle (hcl, 4 mm) (figure 3). Concomitantly, adp hydrolyzing activity was also reduced as demonstrated by a reduced inorganic phosphate production, following incubation with adp, from il17a treated carotids compared to vehicle (figure 4). Thus, through the downregulation of cd39, il-17a might contribute to priming the vessel for the effect of a minimal fecl3 concentration . Our hypothesis would be consistent with the observation that il-17a does not cause per se an intra - arterial occlusive thrombus, but it would induce those endothelial features peculiar to a prothrombotic state . Indeed, the lack of adp hydrolysis due to cd39 downregulation on endothelial cells would not be a stimulus for thrombogenesis but, most likely, for the increase of platelet aggregates at the site of vascular injury and this would facilitate the effect of a thrombotic agent . Our results give for the first time an in vivo evidence for a prothrombotic effect of il-17a that is likely related to a downregulation of cd39 expression and activity in the vascular system . Accordingly with our previous results that demonstrated in vitro the effects of this cytokine on human and murine platelets, in this study we suggest that this cytokine might be an important molecule at the interface between haemostasis and inflammation . Intriguingly, the mechanistic bases of prothrombotic effect of il-17a need further investigation.
|
Among the rats that commonly patronize human dwellings are rattus rattus (linnaeus, 1758) and r. norvegicus . The former is black and has a tail which is longer than the rest of the body axis (head- thorax - abdomen) while the latter is brownish and having a tail that is shorter than the rest of the body axis . Text books of parasitology contain reports showing house dwelling animals (domesticated and non- domesticated) serving as various kinds of hosts to parasites . Prevalence studies on parasitic infection of house rats had been conducted in several parts of the world (1 - 6). In most of the under - developed countries (which happen to be in the tropical and sub- tropical regions), the climatic factors, socio - economic status political instability and, occasionally, natural disaster, have combined to enhance human abodes to be not only frequently and easily visited, but shared with non - domesticated or peri- domesticated rodents . Animals in these groups share foods with humans, often feed on human faeces plus other dead lower animals and or their waste products and quite often get their excrements mixing (albeit accidentally) with human food items (7, 8). This study is an attempt to determine the kinds of parasites that may be originating from house rats and that may constitute a risk to human health in ile - ife, an ancient but recently rapidly developing town in nigeria . There has never been a single case report of any parasitic zoonosis in ile - ife . Nevertheless, this does not mean there are none . As a matter of fact, only a single reported case of human acanthocephalan infection in nigeria is available (9). Ile - ife is a rapidly developing town in osun state, western nigeria, it is on latitude 7 30 n and longitude 4 31 e. it has an estimated population of 356,000 inhabitants (10).with respect to basic social amenities, it can boast of two universities (oduduwa and obafemi awolowo) and the teaching hospital of the later and, incidentally, much more bigger university . Water system facility is lacking in virtually all these newly erected houses just like in several of those erected long ago . Hence, the environment looks very conducive for intermingling or high frequency visitation by bush and/ or peridomestic rats . Wire - cage traps were set up in arbitrarily selected houses and raw food sellers shops in a major market in ile - ife within a period of six months . Trapping was done during the dry season, i.e. Between the months of november of one year and april of the following year . A caught rat was carefully removed from the cage and then killed by cervical jerking . The killed rat was weighed, whole length and tail length were measured following which the rat was bled from the tail vain and thick and thin blood films were made on microscope slides . Some of these were viewed wet under x10 microscope objective lens while others were left to dry and stained . Rats were differentiated on the basis of their color, length of tail, body shape, size of the ears, eyes and shape of their snout as suggested by vinogradov and argyropulo (11). Available ectoparasites were gently removed with the aid of an artist paint brush and dissecting needle . A rat was opened up longitudinally at the mid - ventral line, from the lower jaw to the cloaca . The thoracic and abdominal cavities and the surfaces of the visceral organs were examined for spots, nodules or life parasites . The heart, lungs, liver, gall bladder, spleen and kidneys were removed separately into petri - dishes . The alimentary canal was then severed at the two extremities, completely freed from all connective tissues and placed in physiological saline (8.5 gm nacl in 1.0 liter of distilled water) in dissecting trays . One after the other and beginning from the esophagus, each portion of the tract (esophagus, stomach, small intestine, large intestine and the caecum) was slitted . Macroscopical examination for available parasites and removal of such into beakers of physiological saline was done . This was followed by a microscopical examination of the portions contents and mucosal scrapings under a dissecting microscope . Using a sharp scapel blade, thin sheets of striated muscles from the thoracic region, thighs, diaphragm and the heart were sliced and pressed between two microscope slides, then examined under the compound microscope . Smears of fecal samples in normal saline were made and observed under a compound microscope . Other smears were left to dry, stained and microscopically examined . In summary, preparations utilized are strictly the methods suggested by cable (12) for ectoparasites, blood parasites, helminths, protozoa and ova of helminths in faeces . The various parasitic worms were identified on the basis of either the morphology of whole worm (or segments of them) using as guidelines information in cable (12) or morphology of eggs, using as guidelines information (13). When more than four rats were caught, the unprocessed ones were kept in the laboratory and fed on commercial food pellets . Ile - ife is a rapidly developing town in osun state, western nigeria, it is on latitude 7 30 n and longitude 4 31 e. it has an estimated population of 356,000 inhabitants (10).with respect to basic social amenities, it can boast of two universities (oduduwa and obafemi awolowo) and the teaching hospital of the later and, incidentally, much more bigger university . Water system facility is lacking in virtually all these newly erected houses just like in several of those erected long ago . Hence, the environment looks very conducive for intermingling or high frequency visitation by bush and/ or peridomestic rats . Wire - cage traps were set up in arbitrarily selected houses and raw food sellers shops in a major market in ile - ife within a period of six months . Trapping was done during the dry season, i.e. Between the months of november of one year and april of the following year . A caught rat was carefully removed from the cage and then killed by cervical jerking . The killed rat was weighed, whole length and tail length were measured following which the rat was bled from the tail vain and thick and thin blood films were made on microscope slides . Some of these were viewed wet under x10 microscope objective lens while others were left to dry and stained . Rats were differentiated on the basis of their color, length of tail, body shape, size of the ears, eyes and shape of their snout as suggested by vinogradov and argyropulo (11). Available ectoparasites were gently removed with the aid of an artist paint brush and dissecting needle . A rat was opened up longitudinally at the mid - ventral line, from the lower jaw to the cloaca . The thoracic and abdominal cavities and the surfaces of the visceral organs were examined for spots, nodules or life parasites . The heart, lungs, liver, gall bladder, spleen and kidneys were removed separately into petri - dishes . The alimentary canal was then severed at the two extremities, completely freed from all connective tissues and placed in physiological saline (8.5 gm nacl in 1.0 liter of distilled water) in dissecting trays . One after the other and beginning from the esophagus, each portion of the tract (esophagus, stomach, small intestine, large intestine and the caecum) was slitted . Macroscopical examination for available parasites and removal of such into beakers of physiological saline was done . This was followed by a microscopical examination of the portions contents and mucosal scrapings under a dissecting microscope . Using a sharp scapel blade, thin sheets of striated muscles from the thoracic region, thighs, diaphragm and the heart were sliced and pressed between two microscope slides, then examined under the compound microscope . Smears of fecal samples in normal saline were made and observed under a compound microscope . Other smears were left to dry, stained and microscopically examined . In summary, preparations utilized are strictly the methods suggested by cable (12) for ectoparasites, blood parasites, helminths, protozoa and ova of helminths in faeces . The various parasitic worms were identified on the basis of either the morphology of whole worm (or segments of them) using as guidelines information in cable (12) or morphology of eggs, using as guidelines information (13). When more than four rats were caught, the unprocessed ones were kept in the laboratory and fed on commercial food pellets . A total of 50 rats, 35 (70%) males and 15 (30%) females were caught within the six months . The weight of the male rats ranged between 40 gm and 215 gm, with a mean of 100.8 gm . The female weights ranged between 40 gm and 145 gm and had a mean of 94.6 gm . The flea xenopsylla cheopis was found on 15 (42.9%) male rats and 3(20%) female rats . These include moniliformis moniliformis, hymenolepis diminuta, taenia taeniformis, trichuris muris and trichinella spiralis . Sex distribution of the helminths among the rats is shown in table 1 . While the anatomical distribution of the available helminths among the male and female rats is shown in table 2 . Nine genera and one genus of protozoa organisms were recovered from the gastro - intestinal tract and blood, respectively, of the rats . Entamoeba coli, entamoeba muris, retortamonas intestinalis, trichomonas muris, chilomastix bettencourti, chilomastix intestinalis (in the alimentary canal) and trypanosoma lewisi (in the blood). Sex distribution of the protozoa organisms among the rats is shown in table 3 . Rats were weighed and the parasites in those that were positive for them were counted . The number of worms per positive rats was then plotted against the weight of the rats . Considering the total number of parasites harbored by some rats, it should be expected that the parasite burden will influence the weight of a highly parasitized host . However, for helminth infected rats in this investigation there was no correlation between their weights and the parasites harbored (spearman s correlation coefficient r = -0.111), (fig 1). The tropical setting has the climate and vegetation that is all the year round conducive to habitation of many and various lives- rodents, parasites and humans inclusive . In many occasions human residential areas then on occasions whereby good or adequate environmental sanitation is either breached or compromised, the frequency of deliberate or non- deliberate contact between humans and such rodents increases . Such rodents that may be harboring parasite that are natural to them may accidentally contaminate human foods or waters in their search for food or shelter . In several of the developing countries, such observations are notable and may increase cases of zoonosis by parasites that were found in the peridomestic rats in this study . Among the parasitized rats, in respect of the anatomical habitat of the worms, majority of them these are the group of organisms that are devoid of digestive, circulatory, skeletal and respiratory systems . The ileum portion of the small intestine is where digested food is absorbed into circulatory system, being the portion housing the villi . Hence for m. moniliformis and h. diminuta, they are in the right place for their morphological built . All the 13 t. taeniformis helminths (also cestodes) were concealed in the superficial layers of the liver lobes . Since digested food materials are not expected to be stored in such sites, it is not clear how this worm derives its nutrient . However, it is known that among other functions, the liver stores digested and absorbed food macromolecules . It is therefore speculated that energy for its metabolism is absorbed at the macromolecular level . Derivation of nutrients from this source (the liver) places the organism at a higher level of advantage compared with other cestodes inhabiting the ileum . It has an alimentary canal and a complete digestive tract, but it is not certain if it takes in undigested or semi digested food per oral . Hence it could feel comfortable in either the stomach or the caecum . This study did not investigate the occurrence of lassa fever virus; however, r. rattus was one of the rodents harboring strains of lassa virus according to wulff et al ., (8). It is not known if there could have been misdiagnosis of diseases in this part of the world since signs and symptoms of lassa fever may be difficult to distinguish from diseases that are common in the tropics (14). Human infection with any of the acanthocephalan worms is rare but is most commonly caused by infection with m. moniliformis and macracanthor hyncus hirudinaeceus (15). The first case of human infection with m. moniliformis in iran was reported in 1970 (16). Since then, human infection had been reported in the united states of america (17), australia (18). While a wide range of symptoms including diarrhea, weight loss, irritability, edema and body weakness had been associated with the infection (19, 20), there has also been cases of asymptomatic passage of worms (17, 21). Beetle or cockroach serves as intermediate host . Apart from the m. moniliformis parasite found, t. spiralis is a nematode parasite that can use any mammal as the definitive host or the intermediate host . In this part of the world, it is not uncommon to trap or kill rats for human consumption . In such times, killed rats are mostly cooked, but occasionally merely roasted . Consumption of improperly cooked or roasted infected rat meat may bring about human infection . In respect of the reportedly found worms that are egg producers, i.e. H. diminuta, t. taeniformis, ascaris sp . And t. muris, faeces of infected rats is very likely to accidentally contaminate grains sold in markets . This scenario is even more likely to occur in respect of a local food item named gaari . Such is merely soaked in cold (neither hot nor boiled) water and eaten . Human infection by t. taeniformis and h. diminuta will result in cysticercosis although cases are rather rare, while, by ascaris sp . And it is not unlikely that zoonosis does occur in ile - ife; however, definitively diagnosing the condition may not be straight forward . In this part of the world, diagnostic criteria of diseases are yet to reach the advanced stage . Hence in making differential diagnosis, a clinician here who trained locally will require some knowledge of tropical diseases to think along the line of those that could be acquired from these non - human parasites but that could induce pathologies in humans . And as said earlier on, zoonosis may be occurring in ile - ife but remain either unnoticed or diagnosed.
|
Two basic considerations are necessary to identify a profession: its central area of interest and its mission . Although not the only things that identify a profession, these are necessary before other prerequisites of a profession are obtainable . Others hold that the definition of a profession pertains to its area of knowledge and boundaries of that knowledge, otherwise known as degree of abstraction . As a practical matter, identity of a profession helps guide its practitioners on scope of practice issues and informs the public on what the profession has to offer . Moreover, without a clear identity, there tends to be confusion about the profession . Moreover, the formation of a professional identity goes beyond the acquisition of certain skill sets, as it is formed mainly in social and relationship contexts . Having an identity that satisfies these descriptions still may not be satisfactory if that identity is not unique, separate, and distinct from those of other professions . One obstacle to achieving a clear and unified chiropractic identity has been that of oppression, as some in the nursing profession have observed . In the chiropractic context medical regulation was used against chiropractors, and many were arrested for practicing medicine without a license . The actions of the brave chiropractic pioneers, who went to jail for chiropractic to protest the charge (and who were practicing chiropractic, not medicine), helped bring about licensure in the united states . During the tumultuous days of harassment by organized medicine another important aspect in professional identity is obtaining trust from the public that the profession serves . This trust requires periodic renewal of a profession s social contract with the public . Without such renewal, the public will wrest the contract from the profession s control and shift it to the default model of the market . When 2 professions have identities that are the same or overlap substantially (eg, both have back pain as their area of focus), then 1 of the professions is duplicative and therefore unnecessary . Although back pain may not be the main area of interest in all medical practices, it certainly is included as 1 of their areas of interest . When chiropractors identify themselves as back pain specialists, or even spine specialists, they compete not only with medical practitioners, but also with osteopaths, physical therapists, massage therapists, and medicine cabinets in the homes of millions of potential patients . Thus, for the chiropractic profession, if its identity is based on neck and back pain, it is lost in the presence of much larger professions (eg, medicine) that also treat back and neck pain . Moreover, when the osteopathic profession merged into orthodox medicine in the late 1950s, it ceased to offer a unique service and was essentially swallowed up by the medical profession . The purpose of this paper is to discuss various statements related to chiropractic identity from d. d. palmer; selected chiropractic organizations (associations) and colleges; and attitudes and perceptions of chiropractic from chiropractic students, practitioners, and patients . The article concludes by encouraging the profession to base itself on its original intent, which is improving neurologic function by adjustment of vertebral subluxation . For the purpose of this commentary, identity of chiropractic is considered synonymous with definition or explanation of what chiropractic is . Definitions of chiropractic, or statements that at least resembled a definition, were obtained from palmer s famous 1910 book, the science, art, and philosophy of chiropractic; websites of national and international chiropractic organizations; websites of chiropractic colleges listed in english by the association of chiropractic colleges; and internet (bing, pubmed, and google scholar) searches for reported attitudes of chiropractic students, practitioners, and patients . The associations comprised the association of chiropractic colleges (acc), american chiropractic association, international chiropractors association, international federation of chiropractors and organizations (ifco), and world federation of chiropractic (wfc). Throughout palmer s 1910 textbook, he essentially stated that the main area of interest and therefore identity in chiropractic was analysis and adjustment of vertebral subluxation . Among a sample of 5 major chiropractic organizations, 2 specifically mention that chiropractic s focus is subluxation (acc) or vertebral subluxation (ifco). Another organization s statement is similar in that it mentions spinal adjustment, nervous system function, and general health, without specifically using the term subluxation (wfc) (table 1). A search of the internet was performed in february 2016 on how chiropractic colleges represent themselves and chiropractic identity to the public . Among the chiropractic colleges, 3 specifically mention subluxation in their description of chiropractic: life university, life chiropractic college west, and sherman college of chiropractic . Other colleges, such as cleveland chiropractic college, new zealand college of chiropractic, and palmer college of chiropractic, describe subluxation with statements related to chiropractic focusing on the spine and its relationship to the nervous system . A number of other colleges mention that chiropractic pertains to general health and/or musculoskeletal conditions (table 2). Survey research by gallup and palmer college indicates that the public generally considers that chiropractic pertains to neck and back pain . However, 31% of those surveyed indicated that they would like to use chiropractic care even if they were asymptomatic . This suggests that about a third of potential patients are open to a wellness approach, which is a component of the vertebral subluxation model (eg, maintenance care). Survey research by gliedt et al indicates that a majority (61.4%) of chiropractic students think that the emphasis of chiropractic intervention is to eliminate vertebral subluxations / vertebral subluxation complexes . Survey research by mcdonald et al indicated that 88.1% of practicing chiropractors in north america who responded to the survey answered yes to the question, should chiropractic retain the term vertebral subluxation complex? Currently, a consensus viewpoint regarding the identity of the chiropractic profession is lacking, evidenced by the various opinions among its associations and colleges . It is unclear how these varying viewpoints came to be, considering the stated intent and identity of chiropractic as laid down by the founder of the profession . It is possible that these differing views came about simply as a preference that was different from palmer s original intent . Academic freedom allows for various viewpoints, even with respect to a profession s identity . However, that freedom may come with a price, in the way of unintended consequences; the public may be confused as to what chiropractic is when faced with the variability of viewpoints . Moreover, a profession s identity that does not make distinctions between its identity and the identities of other professions seems to invite further confusion . To this point, the wfc has recommended that the identity of the profession should be similar in all countries . I feel that this is a worthy recommendation; however, the brand that wfc suggests may be too vague, as it has a relatively high degree of abstraction when it states that chiropractors are spinal health care experts in the health care system . The quasi - vagueness here might be considered to be at odds with wfc s call that chiropractic identity should be clear and concise . Nonetheless, common ground between the wfc and those within the subluxation model are suggested in its qualifying statements for chiropractic care:ability to improve function in the neuromusculoskeletal system and overall health, wellbeing, and quality of life;specialized approach to examination, diagnosis, and treatment, based on best available research and clinical evidence with particular emphasis on the relationship between the spine and the nervous system;tradition of effectiveness and patient satisfaction;without use of drugs and surgery, enabling patients to avoid these where possible;expertly qualified providers of spinal adjustment, manipulation and other manual treatments, exercise instruction, and patient education;collaboration with other health professionals; anda patient - centered and biopsychosocial approach, emphasizing the mind / body relationship in health, the self - healing powers of the individual, and individual responsibility for health and encouraging patient independence . Ability to improve function in the neuromusculoskeletal system and overall health, wellbeing, and quality of life; specialized approach to examination, diagnosis, and treatment, based on best available research and clinical evidence with particular emphasis on the relationship between the spine and the nervous system; tradition of effectiveness and patient satisfaction; without use of drugs and surgery, enabling patients to avoid these where possible; expertly qualified providers of spinal adjustment, manipulation and other manual treatments, exercise instruction, and patient education; collaboration with other health professionals; and a patient - centered and biopsychosocial approach, emphasizing the mind / body relationship in health, the self - healing powers of the individual, and individual responsibility for health and encouraging patient independence . I suggest that the chiropractic profession s identity should be based on what makes it unique and what the founder of chiropractic envisioned it to be, which is adjustment of vertebral subluxations to improve neurologic function in the patient . Although some in the profession have concerns with the subluxation model, there is interest in advancing the profession by addressing these issues.19, 20 for others, the problem may be with the use of the term subluxation . For example, a former president of the national university of health sciences states that the purpose of chiropractic manual care is to correct a functional articular lesion to produce (a) beneficial neurologic effect . Labeling subluxation as a functional articular lesion may not necessarily affect the qualities of the entity, if that label carries the same definition as subluxation . Still, it may reduce confusion if consistent terminology were used to describe this unique chiropractic area of interest . Nonetheless, commonality between different factions within the chiropractic profession may begin to merge perhaps on unifying expressions such as spinal adjustment and functional neurology or improving function of the patient s nervous system through spinal adjustment . To this end, in moving the argument forward, table 3 is a compilation of terms and concepts from across the profession that have at least some semblance to the subluxation model . A perceived problem with the subluxation model is that there are so many definitions for subluxation . For example, gonstead has its protocol on how to analyze for subluxation, activator methods has its own operational definition, and so on . However, there may be general agreement on the concept definition for vertebral subluxation, which essentially is a minor biomechanical dysfunction in the spine that results in a neurologic disturbance . The various operational definitions highlight the need to include them in papers on subluxation, particularly in research papers, so that other researchers who may wish to verify findings of such studies can do so given enough detail on the methods used . It simply does not suffice to say in a research paper that the spine was examined and adjusted . Another issue with the subluxation model is the validity and reliability of the methods used to identify it . This challenge though is not unique to the subluxation model, as validity of methods is a challenge in non - subluxation models in chiropractic . For example, the back pain model and the subluxation model may both use motion palpation as a diagnostic method, yet palpation has its own set of challenges regarding its validity (eg, some studies report low reliability). The remedy for such challenges is at the same time an opportunity for different factions of the profession to come together to focus on a common area to advance the profession . As president abraham lincoln said, a house divided against itself cannot stand . An example from the history of chiropractic that unity on subluxation research is possible was the study conducted at the university of colorado in the 1970s by sharpless . One last example of a challenge with the subluxation model is whether subluxation has any adverse effect on health . Because there may be only some evidence along these lines (eg, the bakris et al study on upper cervical adjustment and hypertension), it would be disingenuous to insinuate that there is none at all . Indeed, even some of the harshest critics of the subluxation model, to their credit, state that it is a legitimate, potentially testable, theoretical construct . Settling on any particular identity for the chiropractic profession will likely be met with resistance by some, given the plethora of opinions among chiropractic professionals as to what the identity of the chiropractic profession should be . Common ground between the different factions within the chiropractic profession might be found in a unifying expression such as spinal adjustment and functional neurology . A limitation to this commentary is that the colleges selected were mostly from one region, north america, the exception being the new zealand college of chiropractic . The international flavor of what chiropractic is can be viewed by the paper s inclusion of international associations (eg, wfc and ifco). Throughout palmer s 1910 textbook, he essentially stated that the main area of interest and therefore identity in chiropractic was analysis and adjustment of vertebral subluxation . Among a sample of 5 major chiropractic organizations, 2 specifically mention that chiropractic s focus is subluxation (acc) or vertebral subluxation (ifco). Another organization s statement is similar in that it mentions spinal adjustment, nervous system function, and general health, without specifically using the term subluxation (wfc) (table 1). A search of the internet was performed in february 2016 on how chiropractic colleges represent themselves and chiropractic identity to the public . Among the chiropractic colleges, 3 specifically mention subluxation in their description of chiropractic: life university, life chiropractic college west, and sherman college of chiropractic . Other colleges, such as cleveland chiropractic college, new zealand college of chiropractic, and palmer college of chiropractic, describe subluxation with statements related to chiropractic focusing on the spine and its relationship to the nervous system . A number of other colleges mention that chiropractic pertains to general health and/or musculoskeletal conditions (table 2). Survey research by gallup and palmer college indicates that the public generally considers that chiropractic pertains to neck and back pain . However, 31% of those surveyed indicated that they would like to use chiropractic care even if they were asymptomatic . This suggests that about a third of potential patients are open to a wellness approach, which is a component of the vertebral subluxation model (eg, maintenance care). Survey research by gliedt et al indicates that a majority (61.4%) of chiropractic students think that the emphasis of chiropractic intervention is to eliminate vertebral subluxations / vertebral subluxation complexes . Survey research by mcdonald et al indicated that 88.1% of practicing chiropractors in north america who responded to the survey answered yes to the question, should chiropractic retain the term vertebral subluxation complex? Currently, a consensus viewpoint regarding the identity of the chiropractic profession is lacking, evidenced by the various opinions among its associations and colleges . It is unclear how these varying viewpoints came to be, considering the stated intent and identity of chiropractic as laid down by the founder of the profession . It is possible that these differing views came about simply as a preference that was different from palmer s original intent . Academic freedom allows for various viewpoints, even with respect to a profession s identity . However, that freedom may come with a price, in the way of unintended consequences; the public may be confused as to what chiropractic is when faced with the variability of viewpoints . Moreover, a profession s identity that does not make distinctions between its identity and the identities of other professions seems to invite further confusion . To this point, the wfc has recommended that the identity of the profession should be similar in all countries . I feel that this is a worthy recommendation; however, the brand that wfc suggests may be too vague, as it has a relatively high degree of abstraction when it states that chiropractors are spinal health care experts in the health care system . The quasi - vagueness here might be considered to be at odds with wfc s call that chiropractic identity should be clear and concise . Nonetheless, common ground between the wfc and those within the subluxation model are suggested in its qualifying statements for chiropractic care:ability to improve function in the neuromusculoskeletal system and overall health, wellbeing, and quality of life;specialized approach to examination, diagnosis, and treatment, based on best available research and clinical evidence with particular emphasis on the relationship between the spine and the nervous system;tradition of effectiveness and patient satisfaction;without use of drugs and surgery, enabling patients to avoid these where possible;expertly qualified providers of spinal adjustment, manipulation and other manual treatments, exercise instruction, and patient education;collaboration with other health professionals; anda patient - centered and biopsychosocial approach, emphasizing the mind / body relationship in health, the self - healing powers of the individual, and individual responsibility for health and encouraging patient independence . Ability to improve function in the neuromusculoskeletal system and overall health, wellbeing, and quality of life; specialized approach to examination, diagnosis, and treatment, based on best available research and clinical evidence with particular emphasis on the relationship between the spine and the nervous system; tradition of effectiveness and patient satisfaction; without use of drugs and surgery, enabling patients to avoid these where possible; expertly qualified providers of spinal adjustment, manipulation and other manual treatments, exercise instruction, and patient education; collaboration with other health professionals; and a patient - centered and biopsychosocial approach, emphasizing the mind / body relationship in health, the self - healing powers of the individual, and individual responsibility for health and encouraging patient independence . I suggest that the chiropractic profession s identity should be based on what makes it unique and what the founder of chiropractic envisioned it to be, which is adjustment of vertebral subluxations to improve neurologic function in the patient . Although some in the profession have concerns with the subluxation model, there is interest in advancing the profession by addressing these issues.19, 20 for others, the problem may be with the use of the term subluxation . For example, a former president of the national university of health sciences states that the purpose of chiropractic manual care is to correct a functional articular lesion to produce (a) beneficial neurologic effect . Labeling subluxation as a functional articular lesion may not necessarily affect the qualities of the entity, if that label carries the same definition as subluxation . Still, it may reduce confusion if consistent terminology were used to describe this unique chiropractic area of interest . Nonetheless, commonality between different factions within the chiropractic profession may begin to merge perhaps on unifying expressions such as spinal adjustment and functional neurology or improving function of the patient s nervous system through spinal adjustment . To this end, in moving the argument forward, table 3 is a compilation of terms and concepts from across the profession that have at least some semblance to the subluxation model . A perceived problem with the subluxation model is that there are so many definitions for subluxation . For example, gonstead has its protocol on how to analyze for subluxation, activator methods has its own operational definition, and so on . However, there may be general agreement on the concept definition for vertebral subluxation, which essentially is a minor biomechanical dysfunction in the spine that results in a neurologic disturbance . The various operational definitions highlight the need to include them in papers on subluxation, particularly in research papers, so that other researchers who may wish to verify findings of such studies can do so given enough detail on the methods used . It simply does not suffice to say in a research paper that the spine was examined and adjusted . Another issue with the subluxation model is the validity and reliability of the methods used to identify it . This challenge though is not unique to the subluxation model, as validity of methods is a challenge in non - subluxation models in chiropractic . For example, the back pain model and the subluxation model may both use motion palpation as a diagnostic method, yet palpation has its own set of challenges regarding its validity (eg, some studies report low reliability). The remedy for such challenges is at the same time an opportunity for different factions of the profession to come together to focus on a common area to advance the profession . As president abraham lincoln said, an example from the history of chiropractic that unity on subluxation research is possible was the study conducted at the university of colorado in the 1970s by sharpless . One last example of a challenge with the subluxation model is whether subluxation has any adverse effect on health . Because there may be only some evidence along these lines (eg, the bakris et al study on upper cervical adjustment and hypertension), it would be disingenuous to insinuate that there is none at all . Indeed, even some of the harshest critics of the subluxation model, to their credit, state that it is a legitimate, potentially testable, theoretical construct . Settling on any particular identity for the chiropractic profession will likely be met with resistance by some, given the plethora of opinions among chiropractic professionals as to what the identity of the chiropractic profession should be . Common ground between the different factions within the chiropractic profession might be found in a unifying expression such as spinal adjustment and functional neurology . A limitation to this commentary is that the colleges selected were mostly from one region, north america, the exception being the new zealand college of chiropractic . The international flavor of what chiropractic is can be viewed by the paper s inclusion of international associations (eg, wfc and ifco). When a profession s identity is not clear with respect to its area of interest and mission, then the public may be less inclined to seek its services . Identifying the chiropractic profession with a focus on vertebral subluxation would give the profession uniqueness not duplicated by other health care professions and therefore might legitimatize the existence of chiropractic as a health care profession . An identity having a focus on vertebral subluxation would also be consistent with the original intent of the founding of the chiropractic profession . Supervision (provided oversight, responsible for organization and implementation, writing of the manuscript): j.h . Data collection / processing (responsible for experiments, patient management, organization, or reporting data): j.h . Analysis / interpretation (responsible for statistical analysis, evaluation, and presentation of the results): j.h . Critical review (revised manuscript for intellectual content, this does not relate to spelling and grammar checking): j.h.practical applicationsthe various identity statements within the profession tend to result in confusion about the purpose of chiropractic care.the profession should self - identify as having a unique identity and purpose.to this end, i propose that the traditional identity of the chiropractic profession should be used, namely, the location, analysis, and adjustment of vertebral subluxation . The various identity statements within the profession tend to result in confusion about the purpose of chiropractic care.the profession should self - identify as having a unique identity and purpose.to this end, i propose that the traditional identity of the chiropractic profession should be used, namely, the location, analysis, and adjustment of vertebral subluxation . The various identity statements within the profession tend to result in confusion about the purpose of chiropractic care . The profession should self - identify as having a unique identity and purpose . To this end, i propose that the traditional identity of the chiropractic profession should be used, namely, the location, analysis, and adjustment of vertebral subluxation . The various identity statements within the profession tend to result in confusion about the purpose of chiropractic care.the profession should self - identify as having a unique identity and purpose.to this end, i propose that the traditional identity of the chiropractic profession should be used, namely, the location, analysis, and adjustment of vertebral subluxation . The various identity statements within the profession tend to result in confusion about the purpose of chiropractic care . The profession should self - identify as having a unique identity and purpose . To this end, i propose that the traditional identity of the chiropractic profession should be used, namely, the location, analysis, and adjustment of vertebral subluxation.
|
Human immunodeficiency virus prevalence in the world has levelled - off in most regions in the world . Women formed about 50% of the adult population (15 years or older) infected with hiv / aids in the world . In sub - saharan africa, women living with hiv make up 59% of the adult population living with the infection . Sub saharan africa accounts for about 70% of new hiv infections . Some might be able to resume normal sexual activity others might not . In ghana, the estimated hiv prevalence is 1.5 with about 226,000 people living with hiv / aids . This is a prong of preventing mother to child transmission (pmtct). Most hiv infections in children are transmitted through mother - to - child during pregnancy, labor and breastfeeding . Condom use among women living with hiv is also important to prevent the transmission of hiv / sti to the partner . Even for those who desire to have a child,, the current contraceptive use of any method among married women (15- 49 years) in the general population is 23.5% and modern contraceptive use is 23.0% . Condom use among married women aged 15 49 years is 2.4% in the general population in ghana . The sexual behaviour and contraceptive use among women living with hiv are important in reducing the transmission of hiv . It was projected that about 10,300 mothers need prevention of mother - to - child transmission services and there would be 1,100 new hiv infections in children in 2012 in ghana . Condoms have been the main contraceptive that has been promoted for people living with hiv / aids because of its dual purpose of preventing the transmission of hiv / sti and preventing pregnancies . It is therefore important to study the contraceptive use and the factors associated with contraceptive uptake in women living with hiv in order to inform programs designed to reduce the transmission of hiv and prevent unintended pregnancies among this sub - population . This was hospital - based cross - sectional descriptive study conducted from the 10th of july 2012 to the 15th of august 2012 . The study was conducted in the kumasi metropolitan area which has a total population of 2,035,064; females constitute 52.2% of the population . For health purposes, the metropolis is divided into five sub - metropolitan areas: bantama, asokwa, manhyia north, manhyia south and subin . Two public health institutions in the metropolis with hiv / aids clinics, namely the kumasi south hospital in the asokwa sub - metropolitan health area and the suntreso government hospital in the bantama sub - metropolitan health area were used for this study . The hiv / aids clinics at the kumasi south hospital and the suntreso government hospital are the largest hiv / aids clinics of the ghana health service facilities in the metropolis and they have about 4000 and 2000 clients respectively . The hiv / aids clinics offer counselling and testing, care and treatment, and provision of antiretroviral drugs . They also serve as referral centres for other clinics that do not provide antiretroviral drugs in the metropolis . Women living with hiv / aids within the reproductive age 18 to 49 years attending clinics at the above mentioned facilities were recruited for the study . The estimated sample size for the study was 300 . To be eligible for the study, newly diagnosed hiv / aids clients were excluded in the study since they are usually emotionally unstable and not sexually active or had lost interest in sex . Individuals in the who clinical stage iv and the very sick were also excluded three hundred women living with hiv / aids were approached to be interviewed . Two hundred clients were sampled from the kumasi south hospital while one hundred clients were selected from the suntreso government hospital . We aimed to recruit all eligible hiv / aids clients presenting at the clinic within the study period . If the client agreed to participate in the study, a consent form was signed and interviewed conducted . In all two hundred and ninety five women living with hiv agreed and questionnaires were administered to them . The questionnaire covered socio - demographic characteristics, contraceptive use, haart use, reproductive history, partner s characteristics and desire for children, knowledge of pmtct and contraceptive methods discussed at the hiv / aids clinic . Hospital records were reviewed to collect information on who clinical stage and date of diagnosis of hiv of the study participant . Questions on contraceptive knowledge and use were adopted from the 2008 ghana demographic health survey . Interviews were conducted in english or translated into twi (local dialect) depending on preference of the participant, and it lasted between 10 to 15 minutes . Analysis was performed on 183 study participants who were sexually active; frequencies, percentages and odds ratio were calculated . Multivariate logistic regression model was fitted to simultaneously adjust for the effect of other covariates . Statistical significance level was set at an alpha value of 0.05 with 95% confidence interval . For inclusion of variables into the model a significance level of 0.25 was considered using the likelihood ratio test . Ethical clearance was obtained from the committee on human research, publications and ethics, school of medical sciences, kwame nkrumah university of science and technology, kumasi, ghana . This was hospital - based cross - sectional descriptive study conducted from the 10th of july 2012 to the 15th of august 2012 . The study was conducted in the kumasi metropolitan area which has a total population of 2,035,064; females constitute 52.2% of the population . For health purposes, the metropolis is divided into five sub - metropolitan areas: bantama, asokwa, manhyia north, manhyia south and subin . Two public health institutions in the metropolis with hiv / aids clinics, namely the kumasi south hospital in the asokwa sub - metropolitan health area and the suntreso government hospital in the bantama sub - metropolitan health area were used for this study . The hiv / aids clinics at the kumasi south hospital and the suntreso government hospital are the largest hiv / aids clinics of the ghana health service facilities in the metropolis and they have about 4000 and 2000 clients respectively . The hiv / aids clinics offer counselling and testing, care and treatment, and provision of antiretroviral drugs . They also serve as referral centres for other clinics that do not provide antiretroviral drugs in the metropolis . Women living with hiv / aids within the reproductive age 18 to 49 years attending clinics at the above mentioned facilities were recruited for the study . The estimated sample size for the study was 300 . To be eligible for the study, newly diagnosed hiv / aids clients were excluded in the study since they are usually emotionally unstable and not sexually active or had lost interest in sex . Individuals in the who clinical stage iv and the very sick were also excluded three hundred women living with hiv / aids were approached to be interviewed . Two hundred clients were sampled from the kumasi south hospital while one hundred clients were selected from the suntreso government hospital . We aimed to recruit all eligible hiv / aids clients presenting at the clinic within the study period . If the client agreed to participate in the study, a consent form was signed and interviewed conducted . In all two hundred and ninety five women living with hiv agreed and questionnaires were administered to them . The questionnaire covered socio - demographic characteristics, contraceptive use, haart use, reproductive history, partner s characteristics and desire for children, knowledge of pmtct and contraceptive methods discussed at the hiv / aids clinic . Hospital records were reviewed to collect information on who clinical stage and date of diagnosis of hiv of the study participant . Questions on contraceptive knowledge and use were adopted from the 2008 ghana demographic health survey . Interviews were conducted in english or translated into twi (local dialect) depending on preference of the participant, and it lasted between 10 to 15 minutes . Analysis was performed on 183 study participants who were sexually active; frequencies, percentages and odds ratio were calculated . Multivariate logistic regression model was fitted to simultaneously adjust for the effect of other covariates . Statistical significance level was set at an alpha value of 0.05 with 95% confidence interval . For inclusion of variables into the model a significance level of 0.25 was considered using the likelihood ratio test . Ethical clearance was obtained from the committee on human research, publications and ethics, school of medical sciences, kwame nkrumah university of science and technology, kumasi, ghana . This was hospital - based cross - sectional descriptive study conducted from the 10th of july 2012 to the 15th of august 2012 . The study was conducted in the kumasi metropolitan area which has a total population of 2,035,064; females constitute 52.2% of the population . For health purposes, the metropolis is divided into five sub - metropolitan areas: bantama, asokwa, manhyia north, manhyia south and subin . Two public health institutions in the metropolis with hiv / aids clinics, namely the kumasi south hospital in the asokwa sub - metropolitan health area and the suntreso government hospital in the bantama sub - metropolitan health area were used for this study . The hiv / aids clinics at the kumasi south hospital and the suntreso government hospital are the largest hiv / aids clinics of the ghana health service facilities in the metropolis and they have about 4000 and 2000 clients respectively . The hiv / aids clinics offer counselling and testing, care and treatment, and provision of antiretroviral drugs . They also serve as referral centres for other clinics that do not provide antiretroviral drugs in the metropolis . Women living with hiv / aids within the reproductive age 18 to 49 years attending clinics at the above mentioned facilities were recruited for the study . The estimated sample size for the study was 300 . To be eligible for the study newly diagnosed hiv / aids clients were excluded in the study since they are usually emotionally unstable and not sexually active or had lost interest in sex . Individuals in the who clinical stage iv and the very sick were also excluded three hundred women living with hiv / aids were approached to be interviewed . Two hundred clients were sampled from the kumasi south hospital while one hundred clients were selected from the suntreso government hospital . We aimed to recruit all eligible hiv / aids clients presenting at the clinic within the study period . If the client agreed to participate in the study, a consent form was signed and interviewed conducted . In all two hundred and ninety five women living with hiv agreed and questionnaires were administered to them . The questionnaire covered socio - demographic characteristics, contraceptive use, haart use, reproductive history, partner s characteristics and desire for children, knowledge of pmtct and contraceptive methods discussed at the hiv / aids clinic . Hospital records were reviewed to collect information on who clinical stage and date of diagnosis of hiv of the study participant . Questions on contraceptive knowledge and use were adopted from the 2008 ghana demographic health survey . Interviews were conducted in english or translated into twi (local dialect) depending on preference of the participant, and it lasted between 10 to 15 minutes . Data analysis was done using stata version eleven (stata corp ., college station, texas: statacorp lp, usa). Analysis was performed on 183 study participants who were sexually active; frequencies, percentages and odds ratio were calculated . Multivariate logistic regression model was fitted to simultaneously adjust for the effect of other covariates . Statistical significance level was set at an alpha value of 0.05 with 95% confidence interval . For inclusion of variables into the model a significance level of 0.25 was considered using the likelihood ratio test . Ethical clearance was obtained from the committee on human research, publications and ethics, school of medical sciences, kwame nkrumah university of science and technology, kumasi, ghana . The mean age of the respondents was 34.5 years with standard deviation of 5.2 . About 79% of the respondents were married and of those who were using a contraceptive 82.2% were married . Twenty percent of the respondents were unemployed whilst majority (70.5%) were self employed . The average monthly income of most of the respondents who were employed was below us$53 (ghcedi () 1.90 is equivalent to us$1.00) (see table 1). Socio - demographic and health characteristics of women living with hiv other christian= all christian organisations (methodist, presbyterian, pentecost, charismatic) except catholic, basic education = primary high education= middle / junior high school, secondary / senior high school and tertiary, among those who use contraceptive (n=125) and those who do not use contraceptive (n=21) most of the respondents (80.3%) were menstruating regularly and 94% had ever had children . Majority of the women and their partners desire to have children and about 85% of the respondents had disclosed their hiv status to their partners . About one third of the respondents did not know the hiv status of their partners . Among the women currently using contraceptive 61.2% desire to have children in the future and 59.2% of their partners also desire to have children (table 2). Reproductive characteristics and intentions of women living with hiv by contraceptive use in the univariate analysis, however, women who were cohabitating were less likely to use contraceptives (unadjusted odds ratio [or] = 0.32; 95% ci = 0.12 - 0.88, p = 0.03) compared with those who were married . Participants who did not have children were significantly less likely to use a contraceptive (unadjusted 0r = 0.17; 95% ci = 0.05 - 0.60, p = 0.02) compared with women with children . The hiv status of the partner was associated with contraceptive use; partners whose hiv status were unknown compared with those who were hiv positive were less likely to use a contraceptive (unadjusted or = 0.27; 95% ci = 0.08 - 0.86, p = 0.03). Multivariate analysis showed that, disclosure of hiv status to partner was the only variable that significantly predicted contraceptive use, suggesting that women who have not disclosed their status to their partners were less likely to use contraceptive (aor = 0.25; 95% ci = 0.07 - 0.87, p = 0.03) (table 3). Univariate and adjusted analysis of factors associated with contraceptive use among women living with hiv eighty - five percent of the respondents were using a modern contraceptive method . The distribution of the various contraceptive methods are male condom(77.0%), injectables(5.5%), female sterilisation(1.1%), female condom(0.5%), implants(0.5) and other non modern methods which is the rhythm(1.1%). Most of the respondents (80.3%) were menstruating regularly and 94% had ever had children . Majority of the women and their partners desire to have children and about 85% of the respondents had disclosed their hiv status to their partners . About one third of the respondents did not know the hiv status of their partners . Among the women currently using contraceptive 61.2% desire to have children in the future and 59.2% of their partners also desire to have children (table 2). Reproductive characteristics and intentions of women living with hiv by contraceptive use in the univariate analysis, age group and educational status were not associated with the use of contraceptives . However, women who were cohabitating were less likely to use contraceptives (unadjusted odds ratio [or] = 0.32; 95% ci = 0.12 - 0.88, p = 0.03) compared with those who were married . Participants who did not have children were significantly less likely to use a contraceptive (unadjusted 0r = 0.17; 95% ci = 0.05 - 0.60, p = 0.02) compared with women with children . The hiv status of the partner was associated with contraceptive use; partners whose hiv status were unknown compared with those who were hiv positive were less likely to use a contraceptive (unadjusted or = 0.27; 95% ci = 0.08 - 0.86, p = 0.03). Multivariate analysis showed that, disclosure of hiv status to partner was the only variable that significantly predicted contraceptive use, suggesting that women who have not disclosed their status to their partners were less likely to use contraceptive (aor = 0.25; 95% ci = 0.07 - 0.87, p = 0.03) (table 3). The distribution of the various contraceptive methods are male condom(77.0%), injectables(5.5%), female sterilisation(1.1%), female condom(0.5%), implants(0.5) and other non modern methods which is the rhythm(1.1%). This cross - sectional study serves as a pilot study on the contraceptive characteristics of women living with hiv in the kumasi metropolis, ghana . The results showed that disclosure of hiv sero - status to one s partner was a significant predictor of contraceptive use; women who had not disclosed their status to their partners were significantly less likely to use contraceptive . Similarly, a study in zambia also reported disclosure of hiv status as a predictor of contraceptive use . In uganda disclosure of hiv status was a predictor of modern contraceptive use in women living with hiv . Disclosure of one s hiv status to partner would ensure that both parties would understand the importance of using the condom and other modern contraceptives to prevent unintended pregnancies . It would be easier for couples who have completed childbearing to decide to go for a permanent contraceptive method as well as use the condom . Women living with hiv could therefore be counselled and encouraged to disclose their hiv status to their partners since it may improve their contraceptive use to prevent unintended pregnancies and the transmission of hiv / sti . Disclosure of hiv status to partner is a dilemma because of the stigma and discrimination[9, 10] associated with the infection and more so if the woman is the first to know of her status it sometimes presupposes that she is the one who got the infection first . Women in many places in africa are expected to be modest and chaste, and be with only one partner . Most hiv infection is transmitted through heterosexual intercourse in africa and if a woman is tested positive it presupposes that she is promiscuous that is why she has the infection . Interventions that promote hiv status disclosure and issues relating to non - disclosure could be assessed[11, 12] since it may improve uptake of contraceptives . Contraceptive use among women living with hiv is generally higher than the general population[8, 13]. This is mainly because of the high use of the condom which has a dual purpose of preventing the transmission of hiv and preventing unintended pregnancies . This compares with a study done in soweto, south africa were 84% women living with hiv were currently using at least one contraceptive method . A cross - sectional study in kenya reported 44.2% of respondents currently using a contraceptive method . A study in uganda, even reported as low as 25.2% of women currently using a contraceptive method and this could be due to the fact that the study was conducted in a post conflict era . Another study in uganda conducted at twelve hiv clinics reported current contraceptive use of 61.8% . In lusaka, zambia, 59.2% of women living with hiv reported current use of a modern contraceptive and this is due to the fact that more than half of the respondents had not disclosed their hiv status to their partners . The differences in the level of contraceptive use can be explained by the differences in the characteristics of the populations sampled . In the current study, more than three - out - of - four women were using the male condom . This is mainly because of its dual purpose in preventing the transmission of sti / hiv and pregnancy, and this is the main contraceptive promoted at hiv / aids clinics in kumasi . Similarly in other african countries the commonest contraceptive used by women living with hiv is the male condom[7, 8, 13]. The female condom which has the advantage of being female controlled and can be used if the man is reluctant to use the male condom was however very low (0.5%). Similarly in the general population in ghana female condom use is very low . It can be argued that the female condom has not been well promoted; it was recently re - launched by the ghana health service in october 2012 with the aim that it will help with its integration into sector wide policies as well as within hiv / aids programming . Similarly in uganda, female condom use was low (0.8%). Female condom use in kenya was higher (10.5%) unlike that in kumasi, ghana but this is still low when compared with male condom use . Further research into the low use of female condom among women living with hiv will help clarify the barriers to its use and probably improve its uptake . Dual contraceptive method use which is the male condom and any other method was low (4.4%) in the sexually active women living with hiv . Other studies however reported higher dual contraceptive use[7, 8, 13, 14]. This study recorded lower dual contraceptive method use and it may be due to the fact that much attention has not been given to the other modern contraceptive methods among women living with hiv . Dual contraceptive method use has the additional advantage of being an effective method of preventing unintended pregnancies and this is important especially for couples who have completed their families or who do not desire children . The integration of family planning services into hiv / aids clinics creates an ideal opportunity to promote dual method use and this will go a long way in the prevention of mother to child transmission and the transmission of hiv . Female sterilisation was very low and compares to other african studies[7, 8, 13]. In the united states however sterilisation was one of the commonest contraceptives (44.4%) used among women living with hiv / aids . It must however be stated that about a third of the women had sterilisation regret . In counselling women on contraceptive methods, care must be taken so as not to coerce women living with hiv to accept permanent contraceptive methods . Women living with hiv have reproductive rights to decide freely on the number of children and spacing of their children and counselling on contraceptive methods should be done in a supportive environment . Couple counselling is also another method that may improve use of other contraceptive methods in addition to condom use but further research in this area has to be done . In kumasi, about one tenth of sexually active women living with hiv used other family planning methods without condom . This was slightly lower than the 13% reported in a study in uganda . Since the condom is the only contraceptive that has the additional benefit of preventing hiv / sti transmission, its continuous promotion at hiv / aids clinics the clients attending the clinic may be compliant clients who adhere to treatment and counselling . Since these clinics are specialised, the potential to elicit high response rate for use of condoms is high . Women who were very sick or in who clinical stage iv were excluded from the study . This will affect assessing the health status and contraceptive use of all women living with hiv in general . These limitations notwithstanding the findings from this study provide a good source of information for improving the services to women living with hiv . In interpreting the results caution must however be taken . The clients attending the clinic may be compliant clients who adhere to treatment and counselling . Since these clinics are specialised, the potential to elicit high response rate for use of condoms is high . Women who were very sick or in who clinical stage iv were excluded from the study . This will affect assessing the health status and contraceptive use of all women living with hiv in general . These limitations notwithstanding the findings from this study provide a good source of information for improving the services to women living with hiv . In interpreting the results caution must however be taken . The clients attending the clinic may be compliant clients who adhere to treatment and counselling . Since these clinics are specialised, the potential to elicit high response rate for use of condoms is high . Women who were very sick or in who clinical stage iv were excluded from the study . This will affect assessing the health status and contraceptive use of all women living with hiv in general . These limitations notwithstanding the findings from this study provide a good source of information for improving the services to women living with hiv . Overall, the use of contraceptives among women living with hiv in the kumasi metropolis, ghana is high . Condom is the main contraceptive used because of its dual purpose in preventing the transmission of hiv / sti and preventing unintended pregnancy . Factors associated with contraceptive use at univariate analysis: are ever had children, desire for a child, hiv status of partner and hiv disclosure to partner . Women who have not disclosed their hiv status to their partners were less likely to use contraceptive . Women living with hiv could be encouraged to disclose their hiv status to their partners and encourage their partners to also go for hiv testing . Issues relating to non - disclosure may be assessed and interventions that promote disclosure of hiv status may be implemented . Women who had not disclosed their hiv status could be as a result of stigma and discrimination associated with the infection and they could also be lacking condom negotiation skills . There may be the need of improving the condom negotiation skills of women living with hiv . As part of the integration of family planning services into hiv / aids services in ghana, attention could be given to temporary long term and permanent contraceptives whilst emphasising condom use as well . There is however the need for much larger and longer follow - up studies in this area to be conducted in ghana.
|
We evaluated nine loci dnae, lap, reca, pgm, gyrb, cat, chi, rstr, and gmd from 96 v. cholerae o139 isolated from patients seen at the infectious diseases hospital, calcutta, from 1992 to 2000 (see appendix, online only). Each locus was amplified by using polymerase chain reaction (pcr) with primers (table 1) selected from a conserved region of the locus, as determined by aligning sequences from genbank . Our primers selectively amplified the original o139 rstr gene found in all isolates and not the additional one found in some recently inserted ctx elements (19). The purified pcr products were sequenced in both directions by using the same primers used for amplification and big dye cycle sequencing kit (abi) in accordance with manufacturer s instructions . The fluorescently labeled products were separated and detected by using either an abi 377 or 3700 automatic sequencer (abi). The trace files were read by using phred (20,21) and phrap (22). Low - quality sequence at the ends was trimmed, and the contigs from each individual isolate were aligned by using clustal x (23). Variable nucleotides were identified manually . Isolates with identical alleles were identified from a distance matrix obtained from paup (24). All point mutations were assumed to occur independently; thus, the expected number of alleles with> 2 nucleotides (nt) can be calculated, and the excess number of observed alleles was attributed to conspecific lgt of homologous genes . If one assumes that p is the probability of seeing a single mutation in an allele, the chance of seeing two mutations on the same allele is p; the probability of seeing three or more mutations is p. probability can be calculated from the data by dividing the number of alleles with a single nucleotide difference, 34, by 785, the number of alleles in which observing a point mutation is possible (the 6-bp deletion; the recombinant gmd, reca alleles; and all duplicate novel alleles were excluded). When these probabilities are multiplied by the total number of alleles, 785, the expected number of alleles containing two independent point mutations is 1.45, and the expected number containing three or more is 0.06 (figure 1). Bar graph of the number of novel alleles (y - axis) with a specific number of nucleotide differences from the ancestral allele . Each of the loci examined had a variable number of observed alleles: 9 for dnae, 20 for lap, 11 for rstr, 11 for gmd, 2 for reca, 8 for pgm, 4 for gyrb, 7 for cat, and 5 for chi . The most variable, lap with 20 alleles, was expected because it is a highly variable locus when analyzed with multilocus enzyme electrophoresis (25). The most common allele was present in 91% of isolates (n=87) for dnae, 77% (n=86) for lap, 79% (n=90) for rstr, 82% (n=87) for gmd, 99% (n=96) for reca, 90% (n=94) for pgm, 97% (n=92) for gyrb, 93% (n=88) for cat, and 94% (n=89) for chi . Thus, the pattern for each locus consists of a common or ancestral allele and a series of rare alleles, as expected for the expansion of a clone . Of the 64 less frequent alleles, some result from lgt and others from mutation . The three alleles with the largest changes are unlikely to be due to point mutations . First, a gmd allele that differed by 113 of the 360 bp sequenced, when compared with sequences in genbank using blast (available from: url: www.ncbi.nlm.nih.gov/blast/) showed greater similarity to gmd from e. coli (af061251) than gmd from v. cholerae, consistent with lgt of a homologous gene into the v. cholerae genome . Second, an alternative reca allele that differs by 24 nt is likely to be the result of lgt of a homologous gene . Although substantial, the number of nucleotide differences is not large enough for the allele to be clustered with sequences from v. mimicus, the closest sibling species to v. cholerae (8), a finding that suggests that recombination occurred within v. cholerae . Third, a lap allele had a 6-bp deletion and a single nucleotide difference that may be the result of a double - strand break repair . We calculated that at least 26 putative conspecific lgt events occurred in the 96 isolates studied . Figure 1 shows the number of nucleotide differences between each novel allele and the ancestral allele . If all point mutations are assumed to occur independently, the expected number of alleles with two or more variable nucleotides can be calculated and the excess number of observed alleles attributed to conspecific lgt of homologous genes . If all point mutations are assumed to occur independently, the expected number of alleles with two or more variable nucleotides can be calculated and the excess number of observed alleles attributed to conspecific recombination of homologous genes . The expected number of alleles containing two independent point mutations is 1.45, and the expected number containing three or more is 0.06 . Since 11 alleles were observed with 2 nt differences, 9 more than expected, and 16 were observed with> 3 differences, 16 more than expected, all of these alleles probably did not occur through mutation; more likely, these alleles are the result of lgt . Thus, we would estimate that 26 alleles (9 + 16 + reca allele above) are putatively due to conspecific lgt of homologous genes . The putative conspecific lgt alleles, although fewer in number (26 alleles) than the assumed number of mutation - derived alleles (34 alleles), provide most of the nucleotide differences between alleles . The 120 nt changes introduced by conspecific lgt events are approximately three times the 38 (34 single mutations + 4 2x2 double mutations) introduced by mutation . This calculation is conservative: the 26 conspecific lgt events may represent an underestimate of the number because some of the alleles differing by <1 nt may have resulted from lgt . The analysis of all nine loci from each isolate was based on the sequence type (st). Each isolate was defined by a 9-digit number composed of the assigned allele number at each of the nine loci in the following order: dnae, lap, rstr, gmd, reca, pgm, gyrb, cat, and chi . This assumption is conservative, minimizes the observed amount of variation, and is consistent with the preponderance of common alleles found at each locus . Fifty - one unique sts were found in the 96 isolates tested, reflecting relatively extensive genetic diversity . The overall average of 0.53 unique sts per isolate examined is similar to that seen in every year including 1992 (table 2). As expected, the ancestral st:1,1,1,1,1,1,1,1,1, found in 40 isolates, occurred in all years . Among the others, st:1,1,2,1,1,1,1,1,1 was found three times, once each in 1995, 1996, and 1997 . Since the number of sts is large (51 types), and number of samples in a collection period is small (813 samples; table 2), sts seen in multiple years must not only persist but also represent a substantial portion of the epidemic o139 v. cholerae population . Five of the novel sts are related to other novel sts by allelic change at another second or third locus . One sequence type evolved into three related types found in subsequent years (figure 2a). The starred gmd allele is one related to the e. coli sequence, and its presence in two distinct related sts in two different years demonstrates its establishment in the population . That the pattern seen in figure 2b of ancestral alleles rstr 1 and chi 1 and two variant alleles, rstr 7 and chi 5, was found in all combinations is indicative of an lgt event . Figure 2c - e shows three additional groups of related sequences . In figure 2a, b, and d, the st with the larger number of novel alleles occurred in later years . In contrast, in figure 2c and e, the st with the larger number of novel alleles occurred in the earlier years . The lack of an overall temporal relationship may result from the small sample size (813 isolates) in any year . One isolate, crc5, is unusual because it has no sequenced alleles of the ancestral type . Nevertheless, the alleles from this isolate are closely related to those of the ancestral type . Each crc5 allele differs from the ancestral allele by 7 nt for dnae, 3 nt for lap, 4 nt for rstr, 24 nt for reca, 6 nt for pgm, 10 nt for gyrb, and 4nt for chi . A comprehensive survey of the genetic distances for the data would provide insight into whether this isolate represents a second derivation of the o139 clinical type from an environmental strain or if it is a genetic outlier within the clonally related, but diversified, o139 epidemic type . The emergence and pandemic spread of v. cholerae o139 bengal represented a chance to examine evolution of a bacterial strain in the midst of a clonal expansion . Our results are consistent with clonal expansion and subsequent divergence as described by spratt and maiden (26). Putative recombinant alleles were found at all nine loci among the 96 clonally related o139 isolates . One gmd allele from v. cholerae was most similar to a gmd allele from e. coli . The number of base - pair differences among other alleles was higher than expected on the basis of a simple computation for the accumulation of independent mutations . When we applied our criteria to the novel alleles identified in a previous study (18), 11 of the 13 would be considered to have resulted from lgt, since the number of nucleotide differences to the ancestral allele varied from 4 to 19 . Thus, for v. cholerae, like neisseria, streptococcus, and other bacterial species (1114), conspecific recombination of homologous genes appears to be common and responsible for most of the alleles with multiple nucleotide differences and the majority of the nucleotide differences . The genetic variability at the nine loci alters our understanding of evolution in bacteria, showing that recombination in v. cholerae occurs frequently and most nucleotide changes occur by means of a recombination that can alter any gene . The proportion of recombinants from conspecific recombination, 3.5% (28/785) is greater than that from transgeneric recombination (0.01% from the acquisition of e. coli gmd by one isolate). One potential implication of a greater rate of conspecific recombination may be that, over time, it will maintain the species identity of each individual bacterium, despite the constant bombardment of homologous genes from other genera . Although at first glance the frequency of the novel sequence types appears to conflict between our study and an earlier study (18), the observations may be reconciled on the basis of both the observed frequencies and the timing of the observations . Both studies identified a common ancestral allele in from 77% to 99% of isolates in our study and a series of rare alleles with 119 variant alleles for each locus . These studies reported 10% novel sequence types in 29 isolates that were collected from the first epidemic period, from 1992 to 1993 (18). These data are not statistically different (chi - square test=2.4, p=0.12). However, the researchers estimate of frequency (18) is more likely to be correct because of the larger sample size . The dates of collection may also be important because our collection of isolates from 1993 began in march, when the number of o139 cases at the infectious diseases hospital rose from <10 to> 80 per month, corresponding to a rapid population expansion or flush . The genetic diversity was greater in the v. cholerae o139 isolates than in other clinically associated clones . In v. parahaemolyticus o3:k6, a pandemic strain, coli o157, all 77 isolates were identical at seven loci in spite of variation between isolates on pfge (17). Although v. parahaemolyticus and e. coli are widespread pathogens, they differ from v. cholerae o139 because their population size has expanded much more slowly . Among o139 isolates, the substantial genetic diversity found in the first year of the epidemic may reflect a i.e., a flush, any novel genotype with similar or even slightly deleterious fitness compared to the founder genotype will produce sufficient offspring to become established in the population (27). A founder flush appears to have occurred in the establishment of helicobacter pylori in a single person (28). Although other previous descriptions of this phenomenon have been limited to insects, specifically butterflies (29) and drosophilids (30), we believe that the founder flush phenomenon may become the paradigm for epidemic bacterial expansion in individual patients and populations . This founder flush phenomenon, in turn, has implications for our interpretation of clonality among epidemic isolates and for our understanding of factors that contribute to the emergence of new pathogenic strains.
|
In patients with autosomal dominant polycystic kidney disease (adpkd), urinary protein excretion is usually <1 g every 24 hour, and renal function declines at a slow rate, i.e., a 2.8 ml/(minute1.73 m / y) decrease in glomerular filtration rate . In cases of nephrotic - ranged proteinuria and rapid aggravation of renal function, performing a renal biopsy is critical because the other glomerular diseases might be superimposed on adpkd . We report on a patient with adpkd who presented with acutely aggravated renal dysfunction and nephrotic - ranged proteinuria . The patient underwent laparoscopic renal biopsy and was properly treated according to the histologic diagnosis . A woman 48 year of age visited our hospital for generalized edema and arthralgia in september 2002 . She developed swelling in multiple hand joints, arthralgia, and generalized edema in july 2002 . Hematologic tests at a local clinic showed the following results: blood urea nitrogen levels, 44 mg / dl; serum creatinine, 1.7 mg / dl; and 24-hour urine protein, 5,960 mg / day . Physical examination showed that her blood pressure was 120/80 mmhg and pulse rate was 80 beats / minute . G / l; total leukocyte count, 4,780/l; platelet count, 12510/l; erythrocyte sedimentation rate 130 mm / hour, c - reactive protein, 0.3 mg / dl; blood urea nitrogen, 59 mg / dl; creatinine, 2.3 mg / dl; albumin, 2.4 g / dl; total cholesterol, 176 mg / dl; and normal liver enzymes levels . Urinalysis showed 2 + albumin via the dipstick test,> 100 red blood cells, and 2029 leukocytes per high - power field via microscopy . Further investigations showed positive results for antinuclear antibody (ana; 1:320, homogenous pattern), an anti - dsdna antibody titre of 857 iu / ml (normal range, <25 iu / ml), and complement c3 of 22 mg / dl (83177 mg / dl) and <5 mg / dl (1647 mg / dl), respectively . The right and left kidneys were 18 cm and 19 cm in length, respectively, and the largest cyst was 6.2 cm in the left . Computed tomography (ct) confirmed the ultrasound result and diagnosis of adpkd (fig . The patient's history of arthritis, overt proteinuria, high anti - dsdna antibody titer, and positive ana results satisfied the systemic lupus erythematosus criteria . Her creatinine level, which was 1.7 mg / dl at 3 weeks before visiting our hospital, rapidly increased to 2.4 mg / dl; therefore, we decided to perform a renal biopsy . 2) 20 glomeruli in the biopsy sample, of which five (25%) exhibited global sclerosis; one exhibited (5%) segmental sclerosis; and 13 exhibited (65%) crescent formation . During immunofluorescence analysis, the glomeruli showed diffuse granular peripheral staining of immunoglobulin (ig) g, iga, c3, and c1q . The glomerular basement membrane was irregularly thick, and the epithelial foot processes showed marked effacement . Collectively, these observations were consistent with those for diffuse proliferative lupus nephritis [ln; world health organization (who) class iv]. After the patient underwent empirical methylprednisolone pulse therapy, 1 g per day for 3 days, she was put on intravenous cyclophosphamide pulse therapy, 500 mg monthly, and oral corticosteroid therapy . The cyclophosphamide pulse therapy continued for 8 months, i.e., up to may 2003, and the serum creatinine levels decreased to 1.5 mg / dl . Subsequently, an additional four cycles of cyclophosphamide pulse therapy were administered every 2 or 3 months; because the proteinuria levels increased again, seven additional cycles were administered until may 2006 . Although, no elevation in autoantibody titers and extra - renal lupus manifestation was observed, the patient's renal function gradually declined over the years (fig ., she developed uremic symptoms and orthopnea because of volume overload; therefore, hemodialysis was started . This is a rare case of ln proved in a patient with adpkd who presented with nephrotic - ranged proteinuria . To our knowledge, this patient represents the first case wherein a biopsy was performed for an adpkd patient by using a laparoscopic procedure . Proteinuria is frequently detected in adpkd patients, but nephrotic - ranged proteinuria is unusual . The presence of nephrotic - ranged proteinuria in adpkd has been reported in 21 cases among the english literatures so far . Various histologic subtypes that have been described in the literature are summarized in table 1 . The two main diseases with regard to superimposition of adpkd are focal segmental glomerulosclerosis (5/21, 23.8%) and membranous nephropathy (4/21, 19.0%). Ln is very rare in patients with adpkd, and this index case is the third reported case . As other secondary glomerular diseases might superimpose on adpkd, a biopsy should be considered when unusual manifestations such as nephrotic - ranged proteinuria are detected . Although renal biopsy is important, multiple bilateral cysts in adpkd are assumed to be a relative contraindication for percutaneous renal biopsy because of the presumed risk of complications and difficulties involved in obtaining tissue suitable for diagnosis . D'cruz and colleagues previously described a patient with adpkd biopsied by open surgical procedure and mentioned that nephrologists are reluctant to perform renal biopsy in patients with adpkd because this usually entails an open renal biopsy . In the literatures, among the 21 biopsied adpkd cases, only five cases were performed by percutaneous procedure (table 1). A renal biopsy under direct vision may be preferred, and an open renal biopsy is performed in most cases of polycystic kidney disease that need a biopsy,,,, . However, with advances in endoscopic instrumentation, the development in laparoscopic renal biopsy now provides a minimally invasive alternative to open renal biopsy, . The laparoscopic approach to kidney biopsy offers many advantages, including sufficient diagnostic sample, minimal injury risk, hemostasis under direct vision, a smaller incision, and a short hospital stay, . We performed the laparoscopic renal biopsy without complication and obtained tissue suitable for analysis . In summary, our case emphasizes the need to perform renal biopsy in patients with adpkd and nephrotic - ranged proteinuria for precise diagnosis and proper management . The laparoscopic approach for kidney biopsy was found to be safe and reliable; therefore, we suggest this method for diagnosis in similar cases.
|
Post - operative analgesia is important after surgery to avoid various complications such as venous thromboembolism, respiratory complications and prolonged hospital stay . Substantial pain and discomfort are anticipated after caesarean delivery; hence, analgesic regimen should ensure effective and safe analgesia . The transversus abdominis plane (tap) is the fascial plane between the internal oblique and transversus abdominis muscle containing the thoracolumbar nerves t10 to l1 . The introduction of local anaesthetic in this plane blocks these nerves (t10 to l1). We hypothesised that ultrasonography (usg)-guided tap block reduces requirement of opioids and provides effective and adequate analgesia . After obtaining approval from the institutional ethics committee and written informed consent, sixty american society of anesthesiologists (asa) i and ii patients posted for elective and emergency caesarean section were included in a prospective, randomised, double - blind, controlled clinical trial which was completed over a period of 6 months . Patients were excluded from the study if they refused, had contraindications to spinal anaesthesia, required general anaesthesia for the surgery, had local anaesthetic sensitivity or were morbidly obese . Patients were randomised by sealed envelope technique to undergo usg guided tap block with 0.5% ropivacaine (n = 30) 15 ml on either side group s or usg guided tap block with 0.9% normal saline (n = 30) 15 ml on either side group c. the allocation sequence was generated by random number table . All patients also received injection paracetamol 1 g intravenously (iv) at the end of the surgery . Tap block was administered by the posterior approach using the sonosite nanomaxx ultrasonography machine with a linear array transducer probe (613 mhz). Pain severity was assessed by an investigator blinded to the allotment every 2, 4, 6, 8, 12, 18 and 24 h. it was measured using visual analogue score (vas) (0 = no pain and 10 = worst possible pain). Rescue analgesia was given to patients on demand or when vas was more than 4 in the form of iv tramadol 2 mg / kg . The parameters studied and compared in both the groups were time to first request for analgesic, total tramadol requirement in 24 h and vas at 2, 4, 6, 8, 12, 18, 24 h. for sample size calculation, we considered that a clinically important reduction in 24 h tramadol consumption would be 25% absolute reduction . We calculated that 28 patients per group would be required for an experimental design incorporating two equal - sized groups, using 0.05 and 0.2 alpha and beta errors . To minimise any effect of data loss chicago: spss inc .) Demographic data were analysed using student's t - test or fisher's exact test as appropriate . The comparison of total tramadol requirement, time to first analgesic administration and vas between the two groups was done by paired t - test . Sixty patients were recruited in the study, of these thirty were randomised to undergo tap block with 0.5% ropivacaine and remaining 30 with placebo . Demographic profile, pulse, demographic data were comparable in both groups time to first analgesic administration (tramadol) was prolonged significantly in group s (mean - 9.53 h) as compared to group c (mean - 4.1 h), p = 0.0163 [figure 1]. Time for rescue analgesia in hours in patients receiving tap block with 0.5% ropivacaine (group s), the requirement for analgesic significantly reduced as compared to those who received the placebo block (group c). Mean tramadol requirement for group s was 140 mg and for the placebo group (group c) was 246.66 mg, which was statistically significant (p = 0.000000439) [figure 2]. Mean tramadol requirement in milligrams in the first 24 h after caesarean delivery vas was noted at 2, 4, 6, 8, 12, 18 and 24 h. vas was reduced after tap block with 0.5% ropivacaine for the first 810 h post - operatively as compared to patients receiving placebo block [figure 3]. The results of our study show that tap block when used as part of multimodal analgesic regimen after caesarean delivery delayed time for rescue analgesia, reduced requirement of opioid analgesic and decreased vas . Multimodal analgesia provides better results by combining various drugs with different duration, and onset of action also reduces the side effects of individual drugs . Various studies have been conducted in which opioids have been used iv, intrathecally and also epidurally . However, opioids are associated with complications such as respiratory depression, pruritus, sedation, nausea and vomiting . Non - steroidal anti - inflammatory drugs are commonly used but are associated with complications such as bleeding tendencies, uterine atony and gastrointestinal bleeding . Ketamine can also be used, but it affects interaction between the mother and the new - born . Diclofenac, indomethacin and acetaminophen suppositories have also been used for post - operative pain relief . Epidural analgesia is a good alternative for post - operative pain relief, but the gravid uterus increases the chances of dural and vascular puncture, also making it difficult to identify the space . Infiltration of local anaesthetic is also used to provide pain relief, but it is not effective for prolonged analgesia . He described it as block delivering local anaesthetics in the tap using the anatomical landmarks (iliac crest) by first identifying the lumbar triangle of petit . In 2007, hebbard et al . The usg probe was placed transverse to the abdominal wall which made the three muscle layers distinctly visible after which the probe was moved to the mid - axillary line just above the iliac crest (i.e., over the triangle of petit). Tap block has been used for various abdominal procedures other than caesarean section such as large bowel resection, open / laparoscopic appendectomy, total abdominal hysterectomy, laparoscopic cholecystectomy, open prostatectomy, abdominoplasty with or without flank liposuction, inguinal hernia and iliac crest bone graft . The tap has poor vascularity, and hence the action is prolonged and not associated with any major complications . We used the usg - guided technique to avoid complication more common with the blind approach . In addition, it gives a real - time picture and chances of failure are reduced . A study using usg - guided tap block with 0.5% ropivacaine after caesarean section was associated with reduction in total morphine use in 24 h in the active group (median 18 mg) compared with the placebo group (median 31.5 mg). Vass also reduced in the active group compared to placebo group (96 mm vs. 77 mm p = 0.008). Similarly, a study was conducted in 2008 using tap block after caesarean delivery by the blind approach, with 1.5 mg / kg ropivacaine (to a maximal dose of 150 mg) or saline on each side . The study confirmed the usefulness of tap block as seen by the reduced the vas and requirement for morphine (66 26 mg vs. 18 14 mg, p <0.001). Two similar studies of tap block were conducted in asa i and ii patients undergoing elective caesarean section under spinal anaesthesia using 20 ml of 0.25% bupivacaine or levobupivacaine . The studies revealed that pain scores were lower and time of demand for first analgesia was significantly longer in study groups compared to control (no drug) groups . Another study was conducted using 20 ml of 0.375% ropivacaine on either side, which included asa ii patients undergoing caesarean section under spinal anesthesia; reduction in mean vas score (p <0.001) and reduced opioid requirement were observed . In our study, we used usg - guided technique for tap block to avoid the complications of blind technique . We used 0.5% ropivacaine 30 ml and also took care not to exceed the toxic dose that is, 3 mg / kg . A study conducted in patients undergoing caesarean section using ropivacaine, 0.375%, 40 ml for tap block for post - operative analgesia showed that the pain scores and opioid consumption were similar between the two groups . The groups consisted of one that received tap block with ropivacaine (n = 50) and the other, placebo (n = 50). The mean (standard deviation) vas on movement at 24 h in the ropivacaine and placebo groups was 3.4 (2.4) and 3.2 (2.2) cm, respectively, p = 0.47 . Mckeen et al . In 2014 conducted a similar study using tap block and observed no significant difference in opioid consumption (p = 0.2) and vas (p = 0.61). Obese patients were excluded as the block was difficult to perform, and assessment was limited to only 24 h post - operatively (but pain severity reduced even in control group by this time). Usg - guided bilateral tap block with 0.5% ropivacaine (total 30 ml) reduces the postoperative opioid analgesic consumption in caesarean section patients.
|
Nasopharyngeal carcinoma (npc) is rarely reported in children13 and is more often of undifferentiated type . Combined chemoradiotherapy is the treatment of choice for this malignancy, and has shown promising results.35 overall survival rates of 50%77% are reported.24 however, the high radiation doses needed to provide effective treatment have resulted in long - term toxicity, with hard and soft tissue growth complications, particularly in young children who are still growing.45 maxillofacial and dental abnormalities are well - known long - term chemoradiotherapy - related complications in children with head and neck cancer.611 severity of the developmental disturbances are related to the patient s age at the time of treatment . The younger the child, the more severe the abnormalities, especially in those under six years.7 another factor influencing the severity of developmental disturbances is the radiation dose, with doses between 10 to 30 gy leading to significant bone growth disturbance and arrested tooth development.12 according to guyuron et al13 30 gy can be considered to be a harmful dosage for the development of the maxillofacial bones, and 4 gy harmful to development of the soft tissues . Xerostomia, oral mucositis, and late visual and auditory toxicity have also been reported as frequent and potentially severe complications of radiotherapy.14,15 although treatment - related skeletal and dental complications from a range of malignancies have been often reported in children, there are few published studies concerning those with npc in children.2,16 in addition, oral health after npc treatment was reported by schwarz et al17 but not for children . We report here on a 20-year - old woman with dental and maxillofacial skeletal complications six years after chemoradiotherapy for npc . The rarity of npc in children and the absence of clear data regarding the safety of the radiation dose delivered to the oral area makes this study of interest to all dentists and orthodontists involved in improving quality of life for these young patients . A 20-year - old woman was referred by radiation oncology to our orthodontics department for dental assessment and subsequent orthodontic consultation and treatment . She had a known six - year history of histologically diagnosed npc, (type ii according to who criteria, ct3cn3m0, grade i. she had been treated with chemoradiotherapy comprising concurrent cisplatin (100 mg / m on days 1, 22, and 43) chemoradiotherapy, followed by three cycles of adjuvant chemotherapy consisting of cisplatin 80 mg / m and 5-fluorouracil 500 mg / m at 28-day intervals.18 she did not receive any nonchemotherapeutic agents . The radiotherapy plan was conducted using a two - dimensional computerized treatment planning system (telemaque technos, technologies - informatiques s.a ., trappes). The primary site and bilateral upper neck received 60 gy in 33 fractions over 6.5 weeks and the lower neck and supraclavicular fossae received 40 gy in 22 fractions over 4.5 weeks . A two - phase technique was used . Following conventional simulation and using a cobalt-60 gamma ray unit, radiotherapy was initially delivered by large parallel - opposed lateral fields to a dose of 36 gy given over four weeks at 180 cgy per day . The treatment field extended superiorly to the inferior orbital margin, inferiorly to the c6 spinous process, anteriorly to the anterior border of the masseter muscle, and posteriorly to the t2 spinous process, encompassing all macroscopic disease, including that in the spinal cord . To target undetectable microscopic disease, the clinical volume included the base of the skull, posterior half of the nasal cavity, nasopharynx, sphenoid base, parapharyngeal space, and lateral pharyngeal, and posterior and upper deep cervical nodes . The brainstem, optic chiasm, and anterior half of the orbit were shielded . During the second phase of treatment, the parallel - opposed lateral fields were reduced posteriorly to exclude the spinal cord, and a further dose of 24 gy was given over 2.5 weeks, at 180 cgy per day, achieving a total dose of 60 gy in 33 fractions . In order to assess the delivered radiation dose on dental and skeletal structures in the present study, we used the central slice of the magnetic resonance imaging (mri), including the mandibular teeth (figure 1). The total radiation dose delivered was evaluated for the large parallel - opposed lateral field (phase 1, figure 2a) and for the reduced parallel - opposed lateral field (phase 2, figure 2b) in different levels representing mandibular tooth groups . Thus, the internal volume 1 (a) represents the central incisors, internal volume 2 (c) the canines, internal volume 3 (e) the second premolars, internal volume 4 (f) the first molars, internal volume 5 (g) the second molars, and internal volume 6 (h) the third molars . The isodose calculation was conducted by the two - dimensional planning system for a 11 15 cm and a 7 15 cm 1.25 mv photon beam for phase 1 and phase 2 lateral fields, respectively . The isodose curves in figure 2, which are the lines with the different colors, corresponded to different percentages of the total dose delivered during both phases of radiotherapy . Radiation dose, as a percentage of the total dose, and total irradiation delivered are shown in table 1 . According to the isodose calculation, it appears that the delivered doses decreased from level 6, the nearest to the radiation field, to level 1, the most deviated . In summary, during phase 1, the delivered dose at level 1 was 0% and at level 6 was 97%; for phase 2, at level 1 the dose was 0% and at level 6 was 98% . In total, the incisors received 0 gy and the third molars received 58.44 gy (table 1). The lower deep cervical and supraclavicular fossae lymph nodes were treated with a direct anterior photon field because of the position of the shoulders to a dose of 40 gy in 22 fractions given over 4.5 weeks . A half - beam blocking technique was used along the superior margin of the anterior field to reduce divergence, central shielding to protect the spinal cord and larynx, and bilateral shielding to protect apical parts of both lungs . Focusing on the anatomic structures of the jaw and oral cavity, the irradiated area at the midplane included the major salivary glands, mucosal surface, posterior part of the maxilla and of the body of the mandible to the anterior border of the masseter muscle, and the ramus of the mandible along with the coronoid process and the condyle . These structures received 50% of the prescribed dose at the lateral field margins, 95%104% at the center of the fields, and less than 50% at the anterior part of the jaw . In order to manage the expected xerostomia, the patient was advised to take frequent sips of water and maintain an adequate daily fluid intake . Sugar - free gums were used to stimulate saliva flow, and scrupulous oral hygiene was recommended . Moreover, amifostine, the most comprehensively tested radioprotective agent, was utilized to prevent primarily radiation - induced xerostomia and mucositis, providing protection for the salivary glands,19 as well as preventing cisplatin - induced neurotoxicity, ototoxicity, and renal toxicity . The size of the malignancy before and after treatment was estimated by mri (figures 3a, b, and c). A complete response, both of the primary tumor and locoregional lymph nodes, was achieved one month after the end of treatment (figures 3d, e, and f). Toxicity from chemotherapy was predominantly grade 2 nausea / vomiting and grade 1 hematologic toxicity . The acute toxicity of radiotherapy consisted of grade 2 mucositis and a grade 2 skin reaction . Late complications of radiotherapy were mainly grade 2 xerostomia and fibrosis in the soft tissues of the neck (figure 4). Five years after radiotherapy, the complications were edema of the eye lids requiring reconstructive surgery and hypothyroidism treated with thyroxine at a maintenance dose of 0.05 mg / day orally, respectively . Follow - up was scheduled every three months for the first two years, every six months for the next two years, and annually thereafter . The patient remained disease - free six years post - chemoradiotherapy, and extraoral examination showed no apparent signs of deformity . Facial examination showed no asymmetry in the frontal view (figure 5a) and the soft tissue profile was acceptable (figure 5b). Oral examination revealed that the patient had class ii, division 1 malocclusion in her permanent dentition . Left first molars and left and right canines showed a class i tooth relationship, while the right first molars showed a class iii tooth relationship the overjet was 7 mm, and the overbite 5 mm (figures 6a, b, and c). The maxilla was narrow anteriorly, maxillary anterior teeth were crowded, and the mandibular dental arch had spaces distal to the canines . Left maxillary and right and first left mandibular molars, as well as lower the right and third left molars, were extracted (figures 6d and e). Multiple caries lesions were found in almost all teeth, but the lesions of the canines, premolars, and molars were more significant . Maxillary and mandibular posterior teeth showed class i caries and enamel decalcification, while the anterior teeth showed proximal, distal, and mesial caries . The patient s oral hygiene was poor, with plaque accumulation, severe localized inflammatory gingivitis, and gingival hyperplasia (figure 6). Comparison of two panoramic radiographs at the end of chemoradiotherapy (figure 7a) and six years later (figure 7b) revealed that the third mandibular molars were presented initially . They were, however, extracted after chemoradiotherapy prior to the start of six - year follow - up . The extraction spaces of the left maxillary and right and left mandibular first molars were not totally closed initially (figure 7a). During the six years of follow - up, the corresponding first molars were moved forward to close the remaining spaces, but with significant mesial inclination (left maxillary and right mandibular first molar) accompanied by periodontal pockets located at the mesial aspect of their mesial roots (figure 7b). Six years after chemoradiotherapy, the right and left third maxillary molars showed good positioning in the dental arch, the pulp chamber was formed and the apex was fully closed, although the later was not evident immediately after chemoradiotherapy . It was also observed that, during the same follow - up period, six endodontic treatments were performed in a total of 27 preserved teeth . Bone density and mandible bone volume did not seem to differ from the non - irradiated bones . Furthermore, following extraction of the third molars after chemoradiotherapy, normal bone healing was observed at the corresponding extraction sites (figure 7b). Cephalometric analysis revealed maxillary protrusion in relation to the anterior skull base, mandibular retrusion, a dolichofacial growth pattern, normal lower facial height, normal mandibular length, and anterior rotation of the mandible . Lower incisors were positioned at a normal distance to the a - pog plane, but with lingual inclination . The lower lip was found in a posterior position in relation to the esthetic line, and the nose seemed pronounced (figure 8, table 2). Concomitant chemotherapy enhances the effects of radiotherapy, resulting in improved outcome in npc, but with a significant increase in acute toxicity, especially mucositis, due to the use of cisplatin as a radiosensitizer.20 direct and indirect long - term radiation effects on developing organs have been reported in long - term survivors.11,17,21 the effects of chemotherapy appear to be similar to those reported for irradiation, although generally milder.20 in our patient, long - term chemoradiotherapy - related effects on dental development were compared only in the limited area of posterior teeth, because the first panoramic radiograph was of poor quality, 9,5 of as high as 60 gy, did not significantly affect completion of their root formation . Caries development in patients treated for cancer is attributed to post - radiation xerostomia and its duration.11,17,2325 in the present patient, radiation caries was present mainly in the posterior maxillary and mandibular teeth . Minor caries was observed on the anterior teeth of both dental arches, located mainly in their proximal, mesial, and distal aspects . Cervical caries indicative of xerostomia, usually manifested as an indirect effect post - irradiation, was not evident . This difference in caries manifestation between the anterior and posterior teeth could be attributed to the difference in the radiation dose received by different tooth groups, achieved by the two - dimensional planning system . Consequently, although caries of the posterior teeth can be attributed to radiation, the corresponding caries lesions in the anterior teeth are not related to radiation - xerostomia effects for two main reasons, ie, the high radiation dose was limited in the posterior teeth, mainly on the second and third molars, and the submandibular and sublingual salivary glands were out of the radiation field and therefore were not affected by radiation, thus obtaining restricted but continuous saliva flow . It is probable that the caries present six years after chemoradiotherapy in our patient was due to poor oral hygiene . No major skeletal problems attributable to radiotherapy were found in our patient . On the contrary, a more significant degree of aberrant skeletal effects has been expected because the patient received 60 gy on the upper neck and 40 gy on the lower neck, and bone growth damage has been reported to occur at doses of 10 to 30 gy,12 and micrognathia at doses of 35 gy.26 the lack of major skeletal effects is probably due to the age of this patient at time of irradiation (14 years) when maxillary growth was almost complete and only residual mandible growth potential remained, probably leading to development of the mandibular retrusion observed six years after chemoradiotherapy . However, the patient s normal mandible sagittal linear value, symphysis morphology, and pogonion prominence six years after treatment, indicates that some compensation had occurred and that a developmental effect existed post - irradiation . Moreover, it seems that the present dental and skeletal relationships in our patient are more the result of evolution of a pre - existing malocclusion than the effect of chemoradiotherapy . Finally, at the present time, mandible bone density and volume in this patient do not seem to be adversely affected, osteoradionecrosis is not apparent, and bone regenerative capacity had been preserved after third molar extraction post - chemoradiotherapy . Use of individualized radiation fields by means of a two - dimensional computerized treatment planning system in our patient limited the severe damage to maxillofacial, dental, and skeletal structures that usually follows chemoradiotherapy . Teeth and bones were mildly affected, but with an appropriate long - term follow - up program for oral hygiene and an oral care protocol,27 orthodontic treatment could be initiated according to the needs of individual patients.
|
Trichosporon species is now emerging as an important life - threatening opportunistic systemic pathogen, especially in leukemia patients although the optimal antifungal therapy for treatment has yet to be established, voriconazole seems to be preferred as first - line antifungal agent in past decade, according to the promising effect both in clinic and in pre - clinical studies . However, recently we observed a case of breakthrough t. asahii infection while receiving voriconazole, which calls for an alternative treatment strategy . An adult with acute erythroleukemia (aml - m6) was admitted for induction chemotherapy including decitabine, idarubicin and cytarabine . During the treatment, a suspected catheter - associated infection and mucositis occurred consecutively which resulted in the administration of teicoplanin, tinidazole and fluconazole (400 mg / d) sequentially for about 2 weeks . At the first day after chemotherapy (day+1), the fever developed up to 38.2 c when teicoplanin and fluconazole were still administered . Neither ct scan nor blood culture has positive finding . Concerning the risk of serious infection during the immunosuppression period, the antibiotic strategy was empirically modified to piperacillin - tazobactam, vancomycin combined with voriconazole (6 mg / kg/12 h for the first day, followed by 4 mg / kg/12 h), and the temperature gradually returned to normal within 3 days . The granulocyte counts fell to lower than 0.510/l at day + 4 . At day + 12, the temperature rose again up to 39.2 c, while the chest ct scan revealed diffused nodular infiltrates in both of the lungs . Blood culture was performed in both peripheral and central venous catheter samples, and as a pre - emptive treatment, anti - infection regimen was switched to imipenem - cilastatin, linezolid, and liposomal amphotericin b (liposomal amb) at a target dose of 3 mg / kg everyday . Blood culture yielded t. asahii in both samples 3 days later (identification was taken by vitek 2 compact, 94% reliability index). During the first 3 days of liposomal amb administration, daily peak temperature remained around 39.0 c, whereas serum creatinine rose from 60.4 mol / l to 199.8 mol / l . Due to the progressive renal dysfunction, the dose of liposomal amb was reduced to 2 mg / kg at day + 15 . Instead, caspofungin 50 mg every day (70 mg for the first dose) was combined . Meanwhile, g - csf was administered at a dose of 300 g / d to accelerate the hematopoietic recovery . Hyperpyrexia was controlled at day + 17, and finally returned to normal at day + 19 when the neutropenia period ended . Complete remission was achieved as confirmed by bone marrow examination, and renal dysfunction was also gradually recovered later . The combination anti - fungal therapy continued for 3 weeks, until the previous nodules in chest ct completely disappeared . Blood culture was repeated for several times before the discontinuation of anti - fungal therapy, and all the results were negative . With voriconazole as secondary prophylaxis, the patient then received subsequent consolidation chemotherapy and an identical - sibling bone marrow transplant in 3 months without any manifestation of invasive fungal infection, which hinted the clearance of t. asahii . Reported risk factors of disseminated t. asahii infection include malignancies, neutropenia, chronic active hepatitis, cystic fibrosis, administration of immunosuppressive agents, use of broad - spectrum antibiotics, and disruption of the skin mucosa barrier . The route of invasion includes respiratory tract, gastrointestinal tract, central venous catheter or percutaneous interventional treatment [79]. In this case, previous infections, neutropenia after chemotherapy, and combined antibiotics might jointly result in subsequent t. asahii invasion, even if antifungal agent had been used . Several studies have demonstrated low sensitivity in vitro of t. asahii to common antifungal agents, and breakthrough trichosporonosis has been reported during the administration of various antifungal agents [1013]. The susceptibility to amb is varied, and echinocandins display low activity against trichosporon species . Voriconazole is probably the most sensitive drug against t. asahii in vitro, which has also succeeded in a number of cases, including breakthrough infections [4,1417]. However, it has been reported that the correlation between clinical and mycological resistance is poor, and cases of successful treatment with amb or echinocandins alone can be found in literatures when used alone or in combination . A joint clinical guideline for the diagnosis and management of rare invasive yeast infections was recently published by escmid / ecmm, in which the optimal option to treat trichosporon species has yet been established . Voriconazole, which is the preferred antifungal agent, is recommended in grade b strength, with level iii evidence . However, this case developed trichosponosis during the treatment of voriconazole, which led physicians into a dilemma . Amb is supposed to be an alternative option but toxicities frequently limit their dose as well as efficacy . With more acquaintance of t. asahii and the development of antifungal agents, combined administration of antifungal agents attracts more attention for obtaining better clinical results and for reducing the antifungal doses . In vivo and in vitro studies have demonstrated a better synergic effect between amb and echinocandin (either caspofungin or micafungin) not only in trichosporon species, but also in candida species, aspergillus species, fusarium species and cryptococcus neoformans . The probable mechanism of synergy is that echinocandins could enhance the penetration of amb into the cell membrane, causing an increase in the antifungal activity of amb . Firstly used liposomal amb and caspofungin to successfully treat an acute leukemia patient with t. asahii fungaemia . De vasconcelos and his colleagues cured an invasive t. asahii infection in an acute myeloid patient by amb with caspofungin . Our observation suggested that even with a lower dose, the combination therapy of liposomal amb and caspofungin may synergistically improve the antifungal activity with better tolerance . In patients with voriconazole - breakthrough trichosporonosis who cannot tolerate standard - dose amb renal dysfunction is a frequently observed feature of amb, which may limit the dose of the drug . However, our observation suggested that even if the dose of liposomal amb is reduced, the combination therapy of liposomal amb and caspofungin may synergistically improve the antifungal activity with minimum toxicity . Despite a successful treatment against disseminated t. asahii infection, subsequent chemotherapy or hematopoietic stem cell transplantation is still challenging . However, recrudescence of trichosporonosis did not occur in this case, which hinted the clearance of t. asahii . Unfortunately, the lack of susceptibility test and other post - mortem examinations did not allow us to identify this isolate further . Although the combined regimen is effective, the clinical outcome seems to also depend on the patients hematologic recovery of the underlying disease . Thus, to improve the immunosuppressive status is obligatory in the treatment strategy, and an appropriate antifungal therapy allows the patient to live through this period post - chemotherapy, which usually lasts for 2 weeks or longer . Because of the excellent activity against a broad spectrum of fungi as well as the convenience of maintenance treatment with oral products, voriconazole is widely used as empirical or pre - emptive treatment for fungal infection . To our knowledge, breakthrough disseminated infection of t. asahii during voriconazole administration has not been reported previously . Our observations in this case provide an encouraging treatment option in this special clinical setting . We concluded that liposomal amb combined with caspofungin may potentially eradicate t. asahii, and clinical experience of this combination regimen is worth to be more accumulated . This work was funded by jiangsu provincial special program of medical science (grant no . Zx201102), the priority academic program development of jiangsu higher education institutions (papd), national public health grand research foundation (no . 201202017), and the program of national clinical key subject construction.
|
The development of regenerative medicine has enthralled researchers to study and exploit its usage and therapeutic effects . Different types of stem cells exhibit a potential that has helped improving symptoms of various intractable neuronal diseases, such as stroke . Bone marrow - derived mononuclear stem cells (bm - mnc) have been used in preclinical studies suggesting increased angiogenesis in penumbral tissue following cd34 + cell transplantation, whether given systemically (intra - arterial, intravenous or intrathecal) or by the intracerebral route . Stem cells actively contribute to their environment by secreting cytokines, growth factors and extracellular matrix molecules that act either by themselves (autocrine actions) or on human body and other tissues (paracrine) for regeneration . In addition, these cells secrete angiogenic factors, antifibrotic factors, extracellular matrix homeostasis proteins such as collagens, matrix metalloproteinases and other inhibitors . Brain - derived neurotrophic growth factor (bdnf) crucially promotes the synaptic and axonal plasticity associated with learning, memory and sensorimotor recovery . It has also been used to induce neurogenesis after focal ischemia, thereby increasing the number of newborn neurons in several regions of the brain enhancing neural structural plasticity . Vascular endothelial growth factor (vegf) it has been shown to increase vascular permeability; it can induce chemotaxis in monocytes in pathological conditions as well as inhibit endothelial cell apoptosis . Recently, it was shown that both vegf and its receptor flt-1 are upregulated in both neurons and blood vessels in the penumbra after transient or permanent occlusion of the middle cerebral artery in the rat . Cell treatment or treatment with a stem cell - containing population is nascent in the current stage and has met enormous skepticism in the field of cell therapeutics . Since the realization that the beneficial effects of stem cells may be due to localized or generalized release of trophic factors, and not attributed (in part or entirely) to stem cell transdifferentiation or homing in to the lesioned cortex, many scientists have focused on harnessing the paracrine actions of stem cells to enhance therapeutic efficacy . Repair mechanisms in stroke are related to acute injury (first epoch) and they are said to occur in the initial few hours after the acute event when changes in blood flow, metabolism and ischemic cascade are most active . A second epoch is related to the upregulation of growth factors which continues for days to weeks and is referred to as endogenous repair - related events . A third epoch occurs weeks to months after stroke when spontaneous recovery mechanisms plateau representing a stable but modifiable early and late chronic phase . The objectives were (a) to study safety, feasibility and efficacy (if any) of bm - mnc infusion in chronic ischemic stroke; (b) to study early / late upregulation of serum growth factors (vegf and bdnf) after bm - mnc and neuromotor rehabilitation after stroke, and (c) to study the correlation of serum vegf and bdnf with functional recovery after stroke . Thirty patients were screened who fulfilled the inclusion criteria; among them, 5 refused to participate in the trial and 5 had deranged baseline laboratory values and were therefore excluded; hence, 20 patients were recruited in the study . Patients diagnosed with ischemic stroke 3 months to 1.5 years after the index event with medical research council (mrc) grade of power for wrist and hand muscles of at least 2, brunnstrom stage of recovery of 2 - 5, national institutes of health stroke scale (nihss) score of between 4 and 15, being conscious / comprehendible as well as 20 age - matched healthy controls were recruited . The exclusion criteria were hematological disorders, autoimmune disorders, immunocompromised subjects, chronic liver and renal failure, progressive neurological worsening, unilateral neglect, neoplasia, contraindication to mri and pregnancy . One group was infused with bm - mnc and the other group with placebo (i.e. Intravenous saline infusion). All patients were administered a neuromotor rehabilitation regime for 8 weeks . Prior to stem cell therapy, patients were screened and educated about the stem cells and bone marrow aspiration technique . Written informed consent was obtained, complete medical history, examination and baseline laboratory tests were performed . The patients were examined by a neurologist and a neurophysiotherapist for muscle strength / power (mrc grade) and tone (modified ashworth tone scale), fugl meyer (fm) scale for upper limb, the edinburgh handedness inventory and the modified barthel index (mbi). The study is a randomized placebo - controlled clinical trial which was approved by the ic - scrt (institute committee for stem cell research and therapy) and is registered with ctri (ctri/2014/09/005028). Safety and efficacy end points were assessed at 7 days, 8 weeks, 6 months and 1 year after stem cell transplantation . Serum vegf and bdnf levels were measured at baseline, 8 weeks, 6 months and 1 year . This paper presents an interim analysis of safety, feasibility and efficacy of bm - mnc in chronic ischemic stroke along with the upregulation of the serum growth factors vegf and bdnf after 2 months of cell infusion . Bone marrow (approximately 40 - 50 ml) was aspirated under aseptic conditions from the posterior superior iliac crest in 10 chronic stroke patients . Bone marrow aspirate was diluted with phosphate - buffered saline, layered over ficoll density medium and centrifuged at 1,800 rpm for 25 min . Bm - mnc layers were collected, and the number of cd34 + cells (flow cytometry method) was counted for each patient (table 1). The mean cell viability of bm - mnc at transplantation was 98%, which was performed with trypan blue stain, and the cells were sterile and endotoxin - free during culture and at transplantation . An aseptic technique of infusion was performed with collected bm - mnc in a 50-ml sterile syringe, which was directly dissolved in 250 ml of saline and infused intravenously over 3 h. samples were immediately centrifuged (1,500 g/15 min) and serum was stored at 70c until assayed . Serum vegf and bdnf levels were measured by standard quantitative sandwich elisa (quantikine) kits, obtained from r&d systems . Samples from each individual were analyzed in triplicate and subsequently used in all further statistical analysis . The lower limits of detection were 5.0 pg / ml for vegf and 3 ng / ml for bdnf (information provided by r&d systems). Motor imagery training using xbox and mirror therapy were administered to the affected upper limb with bilateral hands focusing on principles of learning . Small hand muscle exercises like ball squeezing, lifting an object, rolling a cylindrical shape, and thrust release (mass finger extension) were included in the protocol . General aerobic exercise training was administered with 10 min of static cycling and brisk walk (the extent the patient can), partial squats (hold for 7 s), and step up and down . The comparative data between the two groups were expressed as the mean / median with sd and quartiles . Parametric paired t test was used for intragroup and independent - samples t test for intergroup comparisons with statistically significant p = 0.05 . Two - way repeated - measures anova was used to compare motor function scores at different time points . Analysis was done to identify differences in growth factor expression in chronic stroke, in relation to stroke subtypes and etiology, with clinical disability, including short - term follow - up . Bone marrow (approximately 40 - 50 ml) was aspirated under aseptic conditions from the posterior superior iliac crest in 10 chronic stroke patients . Bone marrow aspirate was diluted with phosphate - buffered saline, layered over ficoll density medium and centrifuged at 1,800 rpm for 25 min . Bm - mnc layers were collected, and the number of cd34 + cells (flow cytometry method) was counted for each patient (table 1). The mean cell viability of bm - mnc at transplantation was 98%, which was performed with trypan blue stain, and the cells were sterile and endotoxin - free during culture and at transplantation . An aseptic technique of infusion was performed with collected bm - mnc in a 50-ml sterile syringe, which was directly dissolved in 250 ml of saline and infused intravenously over 3 h. samples were immediately centrifuged (1,500 g/15 min) and serum was stored at 70c until assayed . Serum vegf and bdnf levels were measured by standard quantitative sandwich elisa (quantikine) kits, obtained from r&d systems . Samples from each individual were analyzed in triplicate and subsequently used in all further statistical analysis . The lower limits of detection were 5.0 pg / ml for vegf and 3 ng / ml for bdnf (information provided by r&d systems). Motor imagery training using xbox and mirror therapy were administered to the affected upper limb with bilateral hands focusing on principles of learning . Small hand muscle exercises like ball squeezing, lifting an object, rolling a cylindrical shape, and thrust release (mass finger extension) were included in the protocol . General aerobic exercise training was administered with 10 min of static cycling and brisk walk (the extent the patient can), partial squats (hold for 7 s), and step up and down . The comparative data between the two groups were expressed as the mean / median with sd and quartiles . Parametric paired t test was used for intragroup and independent - samples t test for intergroup comparisons with statistically significant p = 0.05 . Two - way repeated - measures anova was used to compare motor function scores at different time points . The analysis was two - tailed unless otherwise specified . For correlative analysis, the spearman rank correlation coefficient (r) analysis was done to identify differences in growth factor expression in chronic stroke, in relation to stroke subtypes and etiology, with clinical disability, including short - term follow - up . Different organ systems were tested through various laboratory tests like percent hemoglobin, total leukocyte count, differential leukocyte count, platelets, prothrombin time, liver and kidney function assessed at the 1st, 3rd and 7th day after infusion . The safety outcomes included death, adverse events (fatal or nonfatal myocardial infarction), epileptiform discharges and evidence of any new growth in radiological scans . Cell viability, mononuclear stem cell surface markers, bacteria, syphilis, fungi, viral, mycoplasma, and endotoxin levels were tested in expansion process and transplantation . There were no early or late adverse reactions during and after transplantation observed until 8 weeks . As this was an amendment of our last trial, dosage was kept the same, i.e., 1 million / kg body weight . Cd34 + cells were characterized, with a mean count of 0.31% with 62.8 10 cells infused . Ischemic stroke classification yielded 8 large - artery (la), 7 small - artery (sa), 1 cardioembolic (ce) and 4 other (determined and undetermined) strokes . The risk factors were as follows: 55% hypertensive, 25% diabetics, 40% hypercholesterolemia and 4% alcoholism (table 1). In group 1 (male - to - female ratio 8:2, mean age 48.6 7.1 years), the mean fm score at baseline was 23.9 7.5 and at 8 weeks it was 39.7 10.3 (95% ci 24.341 to 7.259, p = 0.002), whereas the mean mbi was 46.7 4.3 at baseline and 65.9 10.5 at 2 months (95% ci 27 to 11.3, p = 0.009). In group 2, the male - to - female ratio was 9:1, the mean age was 48.1 9.1 years, and the mean fm score was 21.4 6.1 and 34.1 10.3 at baseline and 8 weeks, respectively (95% ci 9.7 to 4.3, p = 0.04) (table 2). The mean mbi at baseline was 46.2 7.8 and 61 9.8 at 2 months of follow - up (95% ci 11.4 to 7.8, p = 0.01). The mrc and ashworth tone scale did not show any significant improvement between baseline and 2 months in all patients . Comparing the two groups, no statistically significant difference was observed in the activities of daily living scale mbi (95% ci 14.3 - 4.5, p = 0.31) and fm score at 2 months (95% ci 15.2 - 5.35, p = 0.25) (fig . The ashworth tone scale and the mrc grade for hand muscles remained statistically nonsignificant at 2 months between groups 1 and 2 (p> 0.05). Twenty healthy age - matched controls had a mean vegf level of 257 102.3 pg / ml and a bdnf level of 16.6 3.4 ng / ml . The baseline vegf and bdnf levels were similar (p = 0.42 and p = 0.56, respectively) and hence were compared at 8 weeks . Mean vegf at baseline was 336 78.6 pg / ml in group 1 and 370 91.3 pg / ml in group 2 . All patients showed improvement within the groups at 8 weeks (p <0.05), but no statistically significant difference was observed between the two groups at 8 weeks (mean 453.5 89.1 vs. 408.4 93.3 pg / ml, 95% ci 13.3 - 6.7, p = 0.96). The median values for vegf between the groups 1 and 2 were also nonsignificant at 8 weeks (fig . 2) (442.1 vs. 400.3 pg / ml, p = 0.67). In group 1, mean bdnf at baseline was 18.7 6.6 and 16.1 7.6 ng / ml in group 2 . There was no difference observed within the groups at 8 weeks (p = 0.45 and p = 0.68 for group 1 and group 2, respectively). No statistically significant improvement was observed between the groups (mean 32.8 9.2 vs. 27.3 9.1 ng / ml; 95% ci 5.7 - 1.2, p = 0.78) after 8 weeks of cell transplantation . Out of 20 patients, all patients with la disease were found to have a mean baseline vegf of 500.9 pg / ml followed by small - vessel (sv) (p = 0.01, mann - whitney u test, one - tailed) and other stroke types, whereas 1 patient with ce stroke had a vegf level of 316.4 pg / ml . Bdnf showed the opposite, i.e, a high bdnf level was observed in stroke patients with other undetermined etiology followed by la and sa strokes, with 28.2 ng / ml in 1 ce stroke (fig . 3). There was no causal relationship observed with risk factors, infarct size, or other laboratory parameters (platelets) for both bdnf and vegf (spearman coefficient r = 0.34, p = 0.56). We divided patients according to severity: severely affected (mrc grade = 1 with an fm score 25) and moderately affected (mrc grade> 2 3 with an fm score of 25 - 45) and correlated them with the serum factors . Eleven of 20 patients were severely affected, with baseline median values of vegf and bdnf concentrations of 316.4 (interquartile range 471.8 - 166.1) and 12.5 ng / ml (interquartile range 23.7 - 4.05), respectively . On the other hand, mean concentrations of vegf in moderately affected patients at 2 months were 314.8 versus 289.8 pg / ml (95% ci 116.4 - 66.5, p = 0.45) and in the severely affected group 592.1 versus 487.6 pg / ml (p = 0.76) without any statistically significant improvement . Bdnf also showed statistically insignificant results, with the severely affected group having a mean bdnf level of 28.1 ng / ml in group 1 and 23.5 ng / ml in group 2, and the same was observed in the moderately affected group (38.1 vs. 30.4 ng / ml, p = 0.32) (fig . Different organ systems were tested through various laboratory tests like percent hemoglobin, total leukocyte count, differential leukocyte count, platelets, prothrombin time, liver and kidney function assessed at the 1st, 3rd and 7th day after infusion . The safety outcomes included death, adverse events (fatal or nonfatal myocardial infarction), epileptiform discharges and evidence of any new growth in radiological scans . Cell viability, mononuclear stem cell surface markers, bacteria, syphilis, fungi, viral, mycoplasma, and endotoxin levels were tested in expansion process and transplantation . There were no early or late adverse reactions during and after transplantation observed until 8 weeks . As this was an amendment of our last trial, dosage was kept the same, i.e., 1 million / kg body weight . Cd34 + cells were characterized, with a mean count of 0.31% with 62.8 10 cells infused . Ischemic stroke classification yielded 8 large - artery (la), 7 small - artery (sa), 1 cardioembolic (ce) and 4 other (determined and undetermined) strokes . The risk factors were as follows: 55% hypertensive, 25% diabetics, 40% hypercholesterolemia and 4% alcoholism (table 1). In group 1 (male - to - female ratio 8:2, mean age 48.6 7.1 years), the mean fm score at baseline was 23.9 7.5 and at 8 weeks it was 39.7 10.3 (95% ci 24.341 to 7.259, p = 0.002), whereas the mean mbi was 46.7 4.3 at baseline and 65.9 10.5 at 2 months (95% ci 27 to 11.3, p = 0.009). In group 2, the male - to - female ratio was 9:1, the mean age was 48.1 9.1 years, and the mean fm score was 21.4 6.1 and 34.1 10.3 at baseline and 8 weeks, respectively (95% ci 9.7 to 4.3, p = 0.04) (table 2). The mean mbi at baseline was 46.2 7.8 and 61 9.8 at 2 months of follow - up (95% ci 11.4 to 7.8, p = 0.01). The mrc and ashworth tone scale did not show any significant improvement between baseline and 2 months in all patients . Comparing the two groups, no statistically significant difference was observed in the activities of daily living scale mbi (95% ci 14.3 - 4.5, p = 0.31) and fm score at 2 months (95% ci 15.2 - 5.35, p = 0.25) (fig . The ashworth tone scale and the mrc grade for hand muscles remained statistically nonsignificant at 2 months between groups 1 and 2 (p> 0.05). Twenty healthy age - matched controls had a mean vegf level of 257 102.3 pg / ml and a bdnf level of 16.6 3.4 ng / ml . The baseline vegf and bdnf levels were similar (p = 0.42 and p = 0.56, respectively) and hence were compared at 8 weeks . Mean vegf at baseline was 336 78.6 pg / ml in group 1 and 370 91.3 pg / ml in group 2 . All patients showed improvement within the groups at 8 weeks (p <0.05), but no statistically significant difference was observed between the two groups at 8 weeks (mean 453.5 89.1 vs. 408.4 93.3 pg / ml, 95% ci 13.3 - 6.7, p = 0.96). The median values for vegf between the groups 1 and 2 were also nonsignificant at 8 weeks (fig . 2) (442.1 vs. 400.3 pg / ml, p = 0.67). In group 1, mean bdnf at baseline was 18.7 6.6 and 16.1 7.6 ng / ml in group 2 . There was no difference observed within the groups at 8 weeks (p = 0.45 and p = 0.68 for group 1 and group 2, respectively). No statistically significant improvement was observed between the groups (mean 32.8 9.2 vs. 27.3 9.1 ng / ml; 95% ci 5.7 - 1.2, p = 0.78) after 8 weeks of cell transplantation . Out of 20 patients, all patients with la disease were found to have a mean baseline vegf of 500.9 pg / ml followed by small - vessel (sv) (p = 0.01, mann - whitney u test, one - tailed) and other stroke types, whereas 1 patient with ce stroke had a vegf level of 316.4 pg / ml . Bdnf showed the opposite, i.e, a high bdnf level was observed in stroke patients with other undetermined etiology followed by la and sa strokes, with 28.2 ng / ml in 1 ce stroke (fig . 3). There was no causal relationship observed with risk factors, infarct size, or other laboratory parameters (platelets) for both bdnf and vegf (spearman coefficient r = 0.34, p = 0.56). We divided patients according to severity: severely affected (mrc grade = 1 with an fm score 25) and moderately affected (mrc grade> 2 3 with an fm score of 25 - 45) and correlated them with the serum factors . Eleven of 20 patients were severely affected, with baseline median values of vegf and bdnf concentrations of 316.4 (interquartile range 471.8 - 166.1) and 12.5 ng / ml (interquartile range 23.7 - 4.05), respectively . On the other hand, mean concentrations of vegf in moderately affected patients at 2 months were 314.8 versus 289.8 pg / ml (95% ci 116.4 - 66.5, p = 0.45) and in the severely affected group 592.1 versus 487.6 pg / ml (p = 0.76) without any statistically significant improvement . Bdnf also showed statistically insignificant results, with the severely affected group having a mean bdnf level of 28.1 ng / ml in group 1 and 23.5 ng / ml in group 2, and the same was observed in the moderately affected group (38.1 vs. 30.4 ng / ml, p = 0.32) (fig . It is defined as a communication between two different cells where one releases chemical mediators to its immediate environment, which leads to a change in behavior of a cell in its adjacent territory . Autologous intravenous stem cell therapy is safe and feasible in chronic stroke as evidenced by this report and has been established by us in our previous trials as well in which we used both naive, i.e., mononuclear, and culture - expanded, i.e., mesenchymal, stem cells . The endogeneous or intrinsic recovery mechanisms start just after an acute insult and are completed by 3 months . The exogenous recovery continues over a longer period, through cell - based therapies, gene therapy, neuromotor rehabilitation and others . We recruited patients between 3 months and 1.5 years after the index event, so that the spontaneous recovery is over . As gliosis and scarring of the brain tissue appears beyond 2 years, we had screened patients within this range . A mean of 59.9 10 mononuclear stem cells (each) were easily procured from 10 bone marrow samples in 1 - 2 h of culture procedure . Earlier studies received 50 million cells twice, 200 - 400 million cells, 34.6 million cells and 5 - 10 million cells . Compared to our last trial, savitz et al ., in a recent study, conducted autologous mononuclear stem cell transplantation in 10 subjects . Eight received 10 million cells / kg body weight, 1 received 7 million cells / kg body weight, and 1 received 8 million / kg body weight . Starting-2 collaborators have suggested autologous culture - expanded mesenchymal stem cells to a dose of 1 10 cells / kg, the equivalent human dose found to be effective in a rat stroke model (1 10 to 3 10 cells / rat) based on mean body weight . Cell - enhanced recovery has been reported with chronic delivery of cells even at 1 month after ischemia . The best route of transplantation still needs to be established although many clinical trials are opting intravenous as the mode of transplantation being safe and easily tolerable . A very recent study published by prasad et al . Investigated the safety and efficacy of intravenous mononuclear stem cell transplantation in subacute ischemic stroke in which 58 patients received a mean of 280.75 million bone marrow stem cells at a median of 18.5 days after stroke onset . There was no significant difference between the bone marrow stem cell arm and the control arm in the barthel index score (63.1 vs. 63.6, p = 0.92), modified rankin scale shift analysis (p = 0.53) or score> 3 (47.5 vs. 49.2%, p = 0.85), and nihss score (6.3 vs. 7.0, p = 0.53), which is similar to our study, as we did not observe any statistically significant improvement between both groups on ashworth tone scale, mrc grade, fm scale and mbi (95% ci 15.2 - 5.35, p = 0.25; 95% ci 14.3 - 4.5, p = 0.31, respectively) with a short follow - up until 2 months . This ongoing study was planned to examine the efficacy not only on clinical, functional and radiological outcome measures but on the release of growth factors (vegf and bdnf) after 2 months . The growth factors such as bfgf, vegf, and angiopoietin-1, and cardiac levels of angiogenic ligands are released as a consequence of neural repair after brain insult . Bdnf is involved in many facets of brain function, including neuroplastic changes that underlie motor learning . It exerts its effects on neuroplasticity by facilitating long - term potentiation, by promoting dendritic growth and remodeling . This was observed in all the patients who had been administered a neuromotor regime for 2 months . Patients in group 2 showed a statistically significant increase (baseline to 8 weeks) in bdnf as compared to vegf (p = 0.01 vs. p = 0.53) indicating that bdnf is more likely to be involved in neuroplastic changes, which is supported by the literature . Several animal studies have demonstrated significantly increased bdnf mrna levels in the rat hippocampus after a single bout of 6 h voluntary wheel running . The percent gain in bdnf was high compared to vegf (68 vs. 20%), suggesting that unlike other growth factors, bdnf is secreted in the central nervous system and blood stream through both repair initiated and an activity - dependent pathway . The activity - dependent secretion is crucial to the role of bdnf in promoting neuroplasticity in circuits activated in response to enrichened experience, i.e., stem cells along with exercise . In a related work animals exceeding this threshold exhibited forelimb recovery and showed significant increases in motor cortex bdnf levels, while rats receiving less rehabilitation did not recover and bdnf levels remained at control levels . All groups received motor imagery and aerobic form of training for 8 weeks, which was 1 h in the hospital settings and rest exercises were advised at home . These findings indicate that bdnf also plays a key role in poststroke rehabilitation and consequently bdnf may be an important target to enhance recovery in stroke patients . Serum bdnf levels rise during aerobic exercise, and quickly return to baseline levels upon exercise cessation, approximately 10 - 15 min after exercise offset . The mean concentration of both vegf and bdnf in the serum of patients with stroke was significantly higher than that of the healthy controls . Vegf is a key mediator of angiogenesis, which is an important process leading to reperfusion of ischemic brain tissue after acute stroke . An increase in vegf was observed from baseline to 2 months but did not reach statistically significant levels in both groups . Mean vegf expression was lowest in the serum of patients with sv, increasing in stroke with other origin and being the greatest in la stroke in both groups, suggesting that vegf could be a marker indicating the size of the infarct, which is supported by previous literature . It has been observed that transplantation of bone marrow mesenchymal stem cells into ischemic brain resulted in gain of coordinated function in rats due to bone marrow cell soluble factor release, resulting in inhibited scar formation, increased angiogenesis and neuronal commitment . Posited that increased plasma vegf values last for at least 90 days in all stroke subtypes, and the clinical significance varies for different stroke types . It was found that the severely affected group had a high mean vegf of 592.1 versus 487.6 pg / ml (p = 0.76), without any statistically significant improvement between groups 1 and 2 (fig . Serum vegf at baseline was higher in severely affected patients than in moderately affected patients (316.1 vs. 257.4 pg / ml), which remained high at 2 months predicting a good functional recovery, suggesting that in chronic strokes (without classification into stroke subtype and volume), vegf might have been increased already at acute onset in severely affected patients and function as an angiogenic and neuroprotective molecule . Thus, higher vegf values would attenuate neuronal death and reduce infarct volume, although infarct volumes are not depicted in this analysis . Senescence in stem cells is one phenomenon that is currently being studied and recently published data suggest that their efficacy is limited by natural aging . The impact of aging on stem cell populations differs between tissues and depends on a number of intrinsic / extrinsic factors, including systemic changes associated with immune system alterations . The mean age of patients in our study was a relatively younger population (48.6 9.6 years), so we assume that efficacy was not greatly compromised . Comorbid or risk factors like age, hypertension, or diabetes were observed in our group, but we did not find any correlation with the cell effects nor did we find a low yield in the correlation with these risk factors . The bone marrow harvest from each patient was not compromised in spite of all the risk factors . Owing to ethical concerns and rampant use of stem cells without regulation, the institute ethics committee gave approval for 10 patients initially . These patients will be followed up for up to 6 months to 2 years to gauge the efficacy in terms of serum growth factor, spectroscopic analysis and functional imaging . Both groups showed improvement with increased clinical and activity of daily living scores, which would urge the researchers to ponder over psychoimmunological / placebo effects of mononuclear stem cells . Doll et al ., in a review article, reported that an increase in the production of pro - inflammatory cytokines and a decrease in the production of anti - inflammatory cytokines are correlated with a larger infarct size and worse clinical outcome . Tnf-, il-1, il-6 and il-10 are some cytokines that are known to get upregulated after acute stroke . Il-6 is elevated in plasma during the first week after stroke, while il-1 is elevated in the cerebrospinal fluid of severe stroke patients with peak levels at 2 - 3 days . Tnf--positive neurons peak between 2 and 3 days after stroke and tnf--positive astrocytes peak between 15 h and 14 days . Pro - inflammatory cytokines after mononuclear stem cell infusion has also been reported . Since this trial studies mononuclear stem cell infusion in the chronic stage of stroke, where acute inflammatory pathways might have stabilized, cytokines released from mononuclear stem cells can be measured and may account as another outcome measure to study efficacy in future trials . There is evidence suggesting that human neural stem cells, human umbilical cord blood and bm - mncs secrete glial cell - derived neurotrophic factor and bdnf, igf-1 and vegf, which may protect dysfunctional motor neurons, thereby prolonging the lifespan of the stroke - induced animals . They are known to secrete nt-3, which supports the survival, and differentiation of existing stroke - induced damage to the brain and central nervous system caused by focal or global ischemia . The pathophysiology of stroke within the first few days includes infarct progression, active inflammation and edema formation and loss of autoregulatory control from the brain . Stem cell research is in the nascent stage and is being studied in all stages of stroke . In chronic stroke, the rationale of cell infusion is upregulation of growth factors, prevention of ongoing cell death, enhancement of synaptic connectivity between the host and graft, cell differentiation and integration acting as scaffolds and chaperons . A very small sample size, dose of cells, site / mode of transplantation, no fmri data analyzed and lack of in vivo monitoring of the intravenously transplanted cells are a few limitations which do not infer efficacy of bm - mnc in chronic stroke patients . The heterogeneity of stroke, infarct etiologies, topography, injury location and size are hurdles to prove the same . The interim analysis shows that the research may be continued as no risk was observed in both groups, which indicates that cell transplantation was safe in 10 of these patients . Novel research directions aspire to use hematopoietic stem cells as biologically active drug delivery vehicles to facilitate tissue regeneration . It is likely that the paracrine mediators are expressed / released in a temporal and spatial manner after stem cell infusion and exercise training exerting different effects depending on the microenvironment of the host after injury.
|
Atherosclerosis is a chronic condition whereby vessel walls thicken through infiltration of inflammatory cells, fat deposits and cell proliferation . Unstable atherosclerosis, resulting from apoptosis and necrosis, can lead to thrombus formation, causing myocardial infarction and stroke . Several genetic, behavioural, metabolic, environmental and nutritional factors have been linked to its pathogenesis, including familial history, obesity, diabetes mellitus, tobacco smoking, dyslipidemia and ageing . Atherosclerosis is commonly associated with intracellular stress conditions such as systemic inflammation, hyperactivation of inflammatory response through release of inflammatory cytokines and deregulated levels of m1/m2 macrophages, and oxidative stress . However, to fully appreciate mechanisms contributing to this viscous circle of molecular maladaptation between these conditions, it is necessary to understand how the different cellular players communicate between each other during pathogenesis by other ways than by secreting cytokines . Hence, we focus on the role of exosomes that are known to contain proteins and genetic material . Exosomes are bi - lipid membranous vesicles containing protein, lipid and nucleic acid contents that are excreted from cells . They are distinguished from other cell - secreted particles, collectively called microvesicles, such as shedding microvesicles (smvs) and apoptotic bodies by their smaller size [approximately 40100 nm of exosomes compared with 100 nm1 m for smv and 14 m for apoptotic bodies] and by their intracellular origin . Several cells of the vascular system can secrete exosomes such as red blood cells, platelets, endothelial cells, monocytes, lymphocytes, dendritic cells, mast cells and cells from the tumour vasculature . Exosomes are found in blood plasma, breast milk, cerebrospinal fluid, saliva and urine, and are extracted using ultracentrifugation . They are characterized and identified by integrins and tetraspanins cd63, cd89, cd81, cd9 and cd82, by maturation - related proteins flotillin and annexin, and the heat shock proteins hsp70 and hsp90 . Although originally considered as cellular debris, it now becomes clear that exosomes are not a result of casual sampling; instead, they contain selective loads via dedicated packing mechanisms, deliver these loads to targeted cells and contain unique trafficking probabilities . All these mechanisms were found to be dependent on the individual cell, their cellular state and different under physiological and pathological and stress conditions . Exosomes have been considered as means of horizontal, paracrine gene transfer, delivering microrna and mrna between cells of different origin . Transfer processes have been associated to induce gene silencing via modulation of risc - complex related proteins and microrna delivery, and activate inflammatory response within the target cells . However, the amount as to how much content is delivered remains controversial . On the one hand, it has been reported that the majority of micrornas that is detectable in serum and saliva is concentrated in exosomes and that small nucleic acid content is enriched . On the other hand, however, a previous study using state - of - the art sequencing and digital microfluidics techniques reported that only far less than one nucleotide copy of a specific microrna is present per exosome, suggesting that exosome - mediated gene transfer is dependent on a high amount of exosome trafficking . To this end, databases are emerging that aim to catalogue exosome proteins, rna and lipids, specific to secreting cell types, organisms and pathophysiological state . Apart from their role in paracrine signalling, exosomes also play an endocrine role in communication between adipocytes via vascular tissues, wherein they may act as a carrier of atherogenic content . As such, plasma exosomes were found to be modulators of the adiponectin pathway via upregulation of mir-326 and downregulation of let-7a and let-7f in type 2 diabetic patients . The role of microvesicles derived from monocytes and their cellular descendants in intercellular communication during inflammation and immune response is well established and their activation may be in part induced by exosomes from neighbouring cells in a toll - like receptor - dependent manner . Monocytes are the major progenitor cells of macrophages and dendritic cells and their activation is required for proper immune response, while pathological deregulation leads to inflammation and oxidative stress . Macrophages and macrophage - derived microvesicles are overrepresented in the vicinity of the arterial endothelium . As such, aharon et al . Found monocyte - derived exosomes to induce apoptotic effects in endothelial cells and to promote coagulatory pathways by tissue factor release . Leading to further disarrangement of the endothelium, monocyte - derived exosomes can promote endothelial cell migration by mir-150 delivery, although exosomes from macrophages have also been reported by lee et al . To suppress integrin trafficking mediated endothelial cell migration . Their study demonstrates that exosomes released from human macrophages negatively regulate endothelial cell migration through control of integrin trafficking . Specifically, macrophage - derived exosomes promote internalization of integrin 1 in primary human umbilical vein endothelial cells (huvec) and stimulate trafficking of internalized integrin 1 to lysosomal compartments, resulting in its proteolytic degradation . Exosome - mediated integrin degradation was blocked by bafilomycin a, a lysosomal degradation inhibitor . Apart from mediating integrin surface expression, macrophage - derived exosomes were also shown to effectively suppress collagen - induced activation of the mitogen - activated protein kinase / extracellular signal regulated kinase signalling pathway and huvec migration, which are both dependent on integrin 1 . These observations provide new insight into the functional significance of exosomes in the regulation of integrin trafficking . Several studies raise the possibility that exosome - mediated coregulation and common inflammatory activation of macrophages and lymphocytes may allow their wall infiltration . Macrophages are, together with lymphocytes, the first cells that enter the injury site and synergize with them in infiltration of the vessel intima . Macrophage - derived larger microvesicles may promote leukocyte rolling and adherence via elevation of intracellular adhesion molecule (icam-1) and nf-b activation . Direct exosome - mediated communication between lymphocytes and macrophages was also observed . In this study, authors found that exosomes derived from the supernatant of activated, and potentially atherogenic, cd4 t lymphocytes enhanced cholesterol load accumulation in cultured monocytes in a phosphatidylserine receptor dependent manner . Exosomes may also have a coregulatory role of both cells, as they were shown to be able to transfer exogenous sirna (against mitogen - activated protein kinase-1, which was introduced into exosomes in their setting) to both monocytes and lymphocytes (fig . Platelet - derived exosomes reduce icam-1 expression, reducing monocyte adhesion, while platelet microvesicles under hyperglycaemic conditions induce ec monocyte adhesion via decreased nadph oxidase activity and increased peroxynitrite . Several blood and vascular cells release exosomes that contain cytokines and apoptosis ligands, promoting inflammation and ec apoptosis . Dendritic cells (dc), t - lymphocytes, nk cells, and some tumour cells, directly release apoptotic ligand fas - l via exosomes, the first two cell types also in combination with trail . Exosomes from t - cells can also induce fas - l and tnf- release from monocytes . Monocytes may also release tnf- when exposed to exosomes from red blood cells . In turn, endothelial cell apoptosis and dysfunction may exacerbate inflammatory conditions, leading to further t - cell activation or sensitization . Monocyte - derived exosomes can promote endothelial cell migration by mir-150 delivery, while they, however, can also attenuate it via reduced integrin 1 action and collagen expression, suggesting a tightly regulated process . Similarly, exosomes from monocyte - derive macrophages can reduce proliferation by negatively impacting mapk - signalling . Exosomes from adipose tissue were shown to activate macrophages at the vessel wall, secreting il-6 and tnf- in a tlr4/trif - dependent way, while plasma - derived exosomes attenuated adiponectin signalling . Endothelial cells secrete exosomes containing the notch ligand dll-4 that negatively regulates notch signalling and this notch - suppression may be exacerbated by inflammation . Exosomes from different vascular cells may induce endothelial cell apoptosis and thereby contribute to vascular dysfunction . As such, platelet - derived exosomes may elevate endothelial cell apoptosis by deregulation of redox metabolism via elevated nadph activity or by peroxynitrite generation . By similar means, exosomes from red blood cells enhanced tumour necrosis factor - alpha (tnf) production in monocytes and augmented mitogen - induced cd4 and cd8 t - cell proliferation [in an antigen - presenting cell (apc)-dependent manner]. Several lines of evidence exist that elevated exosome - mediated apoptosis occur under inflammatory conditions . As such, exosomes derived from activated t - cells were shown to increase levels of the apoptosis - inducing ligand fas - l . Likewise, elevated tnf- levels were found in supernatant of human monocytes exposed to exosomes from the conditioning medium of activated cd4 lymphocytes . Degranulation of lysosome - derived, multivesicular bodies (as a means of exosome release) in activated t - lymphocytes was observed to increase fas cell surface death receptor - ligand (fas - l) and trail (tnf- related apoptosis ligand) expression in the vicinity of their cell membrane, although elevation of fas - l was observed in t - lymphocytes and natural killer (nk) cells . Likewise, exosomes from dendritic cells express on their surface apoptosis inducing ligands that may further contribute to elevated apoptosis in the endothelium . Apart from the apoptotic role of vascular cell derived exosomes as a response to inflammation, other cells may excrete exosomes that induce an inflammation - mediated apoptotic response . As an example, elevated exosome - mediated fas - l release (negatively regulated by diaglycerol kinase alpha) has been observed in tumour cells and attributed as a stress - response to immune attack . Finally, exosome - like vesicles released from adipose tissue were shown to activate macrophages at the vessel wall that can secrete il-6 and tnf- in a tlr4/trif - dependent way, mediating insulin resistance (fig . Platelet - derived microvesicles are responsible for about 70% of the microparticle content in blood serum and affect atherogenesis by activating ecs, initiating dc maturation and inducing vascular smooth muscle cell (vsmc) proliferation . Their most prominent role is, however, activation of other platelets and promoting their adherence to the vessel wall, providing a positive feedback that leads to thrombus formation . Suggest that unlike platelet - derived shedding microvesicles, platelet - derived exosomes act ratheras anticoagulants or in response to coagulation . Provided preclinical evidence that exosomes derived from platelet - rich plasma (and after removing nucleated cells by size exclusion filtering) reduced lipid loading and decreased platelet coagulation . This was mediated by decreased cd36 expression, a major mediator of the procoagulative and foam cell - inducing role of oxidized ldl in platelets . Using rna sequencing, gidlof et al . Found that platelet - derived exosomal mir-320 reduced endothelial icam-1 expression, thereby facilitating endothelial cell motility, reducing inflammation and thrombus formation, potentially as a means of protection against further injury . Exosome dependency was validated by the lysosomal inhibitor brefeldin a, which ablated microvesicles expression . They further demonstrate that mir-22, mir-185, mir-320b and mir-4235p were elevated in the supernatant of platelets upon induction of aggregation . Likewise, mast cell exosomes were found to be thrombolytic by stimulating endothelial cells to induce plasminogen activator type i, not only contributing to plaque reduction through fibrinolysis but also to their instability . Endothelial - derived exosomes and other microvesicles present only a sparse fraction of the circulating microvesicles . Yet, they have been ascribed a multifaceted role including atherosclerotic effects such as increasing arterial stiffness, inflammation and thrombosis, or atheroprotective roles such as promoting angiogenesis, endothelial cell differentiation and cell survival . Endothelial - derived microvesicles may be activated under hyperglycemic conditions to induce monocyte - adhesion in other endothelial cells via increased nadph oxidase activity . As such, the amount of endothelium - derived microparticles, considered as markers of endothelial cell (dys-)function, was positively correlated with incidence of atherosclerosis in hypercholesterolemia and with incidence of chronic kidney disease in children who also show increased arterial stiffness and atherosclerosis . Endothelial - derived exosomes may contain rna and proteins that are reflective of the undergoing specific stress conditions and have further implicated in vascular development through attenuation of notch signalling . Specifically, authors found that endothelial and tumour cells express the notch ligand delta - like 4 (dll4), which negatively regulates notch . It thereby changes endothelial cells to a tip - cell phenotype, supporting vessel branching . Likewise, as notch signalling in endothelial cells is necessary for protection of ec exposed to stress to prevent endothelial senescence and inflammation, exosomes containing dll-4 and inflammation - induced notch depression may contribute to ec dysfunction and apoptosis . Exosomes and other microparticles have been shown to play an atheroprotective or atherogenic role in several conditions accompanying atherosclerosis . Exosomes from mature dendritic cells may contribute to immune system hyperactivation during atherosclerosis, as they transfer the ability to induce naive t - cell priming in an icam-1 dependent way to b lymphocytes, potentially reducing their reactiveness to ox - ldl . Maturation of plasmacytoid dendritic cells can, in turn, occur by endothelial microvesicles, leading to t - cell stimulation and the secretion of inflammatory cytokines . Furthermore, an exosome - mediated link between systemic calcium deregulation, smooth muscle cells calcification and increased vessel stiffness has also been made by analysing data in chronic kidney disease patients . In contrast, exosome - mediated communication between endothelial and smooth muscle cells may be atheroprotective under endothelial shear stress conditions due to turbulent blood flow near bends and bifurcations by containing expression of the mir-143/145 cluster and dependent on the expression of the shear stress responsive krppel like factor 2 (klf2). We therefore expect that improvement and standardization of separation procedures and co - culturing protocols will further increase inter - study comparability and exosome role clarification . Exosome - specific labels or, likewise, of their nucleic acid content that may trace them after in - vivo re - injection may further shed light into their pathophysiological role during atherogenesis . Novel detection methods going beyond ultracentrifugation or size exclusion techniques will increase sensitivity of exosome and microparticle detection and speed up analyses cycles . These techniques will include microfluidics devices for on - chip isolation, quantification and characterization of circulating microparticles . They will further include droplet - based segmented - flow microfluidics for extraction of nucleic acids, microchip - based rna extraction, droplet digital and analogue rt - pcr for mrna and mir amplification, and plasmonics for detecting their biomarker - relevant content . As intracellular communication is complex and highly dependent on cellular context, systems biology techniques will help to generate context - specific hypotheses of the role of specific microvesicles dependent on state of the disease, the expression status of the cell, the secretion frequency and trafficking properties of microparticles, and the type and amount of content delivered . Promising methods therefore are cue - signal - response studies using partial least square regression (plsr) methods which is a statistical procedure combining multivariate regression with parameter reduction . Plsr allows us to study how signals (exosome content) translate cues from the secreting cell (its gene / protein expression state) to elicit a specific response in the recipient cells . To this end, gray et al . Demonstrated that depending on the preconditioning of cardiac progenitor cells (hypoxia vs. normoxia at different time points), different clusters of mirs were packed into exosomes derived from these cells . They then identified that these specific clusters gave rise to differential physiological responses in recipient endothelial cells such as assessing their capability for tube formation, thereby suggesting a way how changes of mir composition could be used to direct outcome in target cells . We propose here to use this method to study how hypoxic and reperfusion - induced atherogenic stress in monocytes would translate into specific endothelial cell responses mediated by specific exosome loading (fig ., we propose to determine how a physiological stress condition 1 consisting mainly of a mixture of acute and chronic hypoxia induced macrophages to release an exosome content e1 (e.g. Containing a certain combination of mir#3 and mir#4), which translates to a specific response in endothelial cells such as reactive oxygen species (ros) production, while a stress condition 2 that is mainly determined by inflammation and hyperlipidemia would lead to an exosome content e2 and induces an endothelial phenotype consisting of deregulated icam-1 expression and ec migration . (a) proposed cue - signal - response analysis to investigate how different stress conditions in macrophages translate into changes in endothelial cell phenotype using partial least square regression (plsr) similar to gray et al . . The method seeks for canonical types of exosome loadings (e1, e2, e3; each containing a certain combination of mirs) that are characteristic for in - vivo conditions wherein different combinations of stressors simultaneously apply . (b) once most important exosome content and most affected pathways in endothelial cells have been identified from (a), computational signal transduction analyses may help to assess the effect of exosome content on a detailed level . Content released from exosomes may trigger specific pathways relevant to ec function (apoptosis, dysfunction, proliferation), while further exosome content may also exacerbate or attenuate the signalling response . Computational models can assess the net effect of exosome content on signalling by including quantitative expression levels from pathway proteins and exosome content . In contrast to such large - scale systems biology approaches, targeted system models that focus on specific pathways may help to study how specific exosome content may change signal transduction processes in the target cells . Such analysis would allow further segregation of exosome bystander content from such relevant to intercellular signalling . An example therefore would be to study how exosome - delivered interleukin (il)-6, tnf- or fas - l from monocytes / macrophages would affect pathways of endothelial cell apoptosis, dysfunction and proliferation (fig . How system models can help to improve clinical diagnostics and treatment in the field of cancer therapy and apoptosis was recently reviewed by us . We thereby collected studies from translational systems biology, whereby theoretical predictions helped to design molecular interventions to re - establish impaired cancer cell apoptosis and personalized dosages of chemotherapy based on molecular profiling of apoptosis proteins . It is therefore expected that similar personalized medicine approaches may assess grade of inflammation and susceptibility to coagulation from quantifying exosome content, or allowing the design of optimal exosome - content for therapeutically attenuating these processes . Exosome - mediated intercellular signalling during atherosclerosis is a multifacet set of processes whose context - dependent roles are slowly being deciphered . Still, exosome isolation from serum and from their sister microparticles is tedious, and only a few studies are specifically focussed to study exosomes and their role in preclinical and clinical research . Nevertheless, the recent progress in the field of exosome separation and detection, the application of systems biology based data analysis to unravel the communication protocol between the involved cells and tissues, and the potential exploitation of exosome delivery for therapeutic purposes make exosome research an attractive field for complex, systemic diseases such as atherosclerosis . This work was funded by the bijzonder onderzoeksfonds of the ku leuven (pf/10/014; centre of excellence), by the interdisciplinair ontwikkelingsfonds - kennisplatform (centre of excellence kp/12/009) and by the fonds voor wetenschappelijk onderzoek - vlaanderen (g0846.11, and vascular biology network). This work was funded by the bijzonder onderzoeksfonds of the ku leuven (pf/10/014; centre of excellence), by the interdisciplinair ontwikkelingsfonds - kennisplatform (centre of excellence kp/12/009) and by the fonds voor wetenschappelijk onderzoek - vlaanderen (g0846.11, and vascular biology network). Papers of particular interest, published within the annual period of review, have been highlighted as: of special interest of outstanding interest of special interest of outstanding interest
|
Bronchopulmonary dysplasia (bpd) is a chronic lung disease that usually occurs in premature infants receiving prolonged oxygen supplementation and ventilator support . Recent improvements in the survival of very preterm infants through advances in neonatal intensive - care medicine have, therefore, made the task of protecting the extremely immature lungs against bpd increasingly challenging . Bpd remains an important cause of mortality and long - term respiratory morbidities such as airway hyperreactivity, poor lung function, and low exercise capacity (2, 3, 4, 5, 6). In addition, neurologic morbidities such as developmental delay and cerebral palsy (7) are also common . The histopathological characteristics of bpd include impaired alveolarization and interstitial fibrosis (8, 9). Prolonged oxygen exposure of newborn rat pups results in decreased alveolarization and increased lung fibrosis, thereby simulating the histopathology of human bpd (9, 10). Inflammatory responses are believed to play critical roles in the lung injury process leading to the development of bpd (1) therefore, development of new therapeutic modalities to improve the prognosis of bpd in preterm infants is an urgent priority . Recently, current literature has shown that the exogenous administration of stem cells significantly attenuated neonatal hyperoxic lung injuries (11, 12, 13, 14, 15, 16, 17, 18). These findings suggest that stem cell transplantation might be a new and promising therapeutic modality for the treatment of bpd . In this review, we summarize the recent advances in stem cell research for treatment of bpd . In particular, we focus on the preclinical data regarding the important issues for clinical translation such as the optimal cell type, route, dose, and timing of stem cell therapy . Furthermore, the successful phase i clinical trial results of stem cell therapies for bpd are discussed . Among the various stem cells, the selection of a single appropriate stem cell that ultimately exhibits the best therapeutic efficacy in protecting against bpd is a difficult challenge . Embryonic stem cells are pluripotent cells capable of generating all cell types from three germ layers . However, the high tumorigenicity and ethical concerns of destroying embryos for their acquisition have limited their availability for research and clinical applications (19). Mesenchymal stem cells (mscs) are the most extensively examined cell type used in experimental models of bpd (13, 14, 15, 16, 17, 18, 20). Mscs are broadly distributed in the body, and could be isolated from adult tissues such as the bone marrow, adipose tissue, and gestational tissues such as the placenta, wharton's jelly, and umbilical cord blood (ucb). The umbilical cord and placenta are medical wastes that are usually discarded at birth, and therefore, mscs obtained from gestational tissues seem to be particularly attractive (21). In addition to their easy attainability, mscs derived from gestational tissues showed less antigenicity (21), and higher proliferation capacity and paracrine potency compared with adult tissue - derived mscs (22). Even within the same adult tissue origin, donor age negatively impacted the expansion and differentiation potential of the mscs (23, 24). Collectively, these findings suggest that mscs derived from post - partum associated tissues such as ucb or wharton's jelly might be the optimal cell source for future clinical applications, in protecting premature infants against bpd . The therapeutic efficacy of mscs has been tested in the hyperoxia - induced neonatal rodent or murine model of bpd, and was reported to improve survival, and suppress oxidative stress and inflammation (11, 13, 14, 15, 16, 17, 18, 20). In addition, it attenuated the impaired alveolar growth, lung vascular injuries, fibrosis, and the associated pulmonary hypertension (11, 13, 14, 15, 16, 17, 18, 20). These findings support the assumption that stem cell transplantation might be a promising novel therapeutic approach for bpd . The beneficial effects were initially ascribed to the transdifferentiation of mscs into lung parenchymal cells such as type ii pneumocytes (11, 25). However, this event rarely occurs in vivo (11). The low rate of in vivo engraftment and differentiation into lung tissue suggests that the therapeutic effects of stem cell transplantation might not be primarily mediated by regeneration . An equal or better therapeutic efficacy in preventing or reversing established bpd was observed with msc - conditioned media compared with msc (13, 26, 27). More recently, lee et al . (28) have reported that microvesicles released by msc exosomes are the major paracrine anti - inflammatory and therapeutic mediators of mscs in hypoxia - induced pulmonary hypertension . Collectively, these findings suggest that the protective effects of stem cell transplantation might be predominantly mediated by paracrine, rather than regenerative, mechanisms . The use of msc secretomes rather than stem cells could be an exciting, promising new therapeutic approach for bpd, especially since it circumvents the theoretical concerns associated with live cell treatments, such as tumor formation . The specific humoral substances secreted by the transplanted mscs that are responsible for the protective paracrine activity have not yet been elucidated . In our previous experiments, we observed that significantly reduced levels of growth factors such as vascular endothelial growth factor (vegf) and hepatocyte growth factor (hgf) were significantly improved with mscs transplantation (17). Moreover, the knockdown of vegf secretion by the mscs using transfection with small interfering rna specific for human vegf abolished the protective effects of mscs in hyperoxic lung injury (18). These protective effects included the attenuation of impaired alveolarization and angiogenesis, reduction in apoptotic cells and alveolar macrophages, and downregulation of proinflammatory cytokine levels (18). Overall, these findings suggest that growth factors such as vegf, which are secreted by the transplanted mscs, are critical paracrine factors that mediate the protective effects of mscs against hyperoxic lung injuries . Determining the optimal route of msc transplantation is a critical issue that needs to be resolved for future successful clinical translation of stem cell therapies for protection against bpd . Injured lungs produce chemotactic factors that cause mscs to proliferate and migrate toward the injury (28). Furthermore, systemically administered mscs have been shown to home and localize to an injured lung (29). Local intratracheal transplantation of mscs at four times lesser doses produced more effective engraftment of donor cells and attenuation of hyperoxia - induced lung injury than with systemic intravenous or intraperitoneal administration (11). These findings suggest that the local intratracheal rather than systemic intravenous or intraperitoneal transplantation of mscs might be an optimal route of delivery for treating premature infants with bpd . Determination of the optimal dose of mscs for transplantation is another important issue that needs to be addressed for successful clinical translation . In our previous study (15), we tested the therapeutic efficacy of three different doses of human ucb - derived mscs (510, 510, and 510 cells) administered intratracheally to hyperoxic newborn rat pups (average weight, 8 g) at postnatal day (p) 5 . The intratracheal transplantation of human ucb - derived mscs attenuated the symptoms associated with hyperoxia - induced lung injury, such as decreased alveolarization, in a dose - dependent manner . The dose of 510 cells provided the best protection, while at least 510 cells were necessary for effective anti - inflammatory, anti - fibrotic, and anti - oxidative activity . In the light of these findings, further studies to determine the optimal dose of human ucb derived mscs for potential clinical benefit in human preterm neonates are planned . While the therapeutic efficacy of msc transplantation in bpd has already been shown (11), the optimal timing of administration is another critical issue that remains to be established . Therefore, we attempted to determine the optimal timing by comparing the therapeutic efficacy of early (at p3) versus late (at p10) intratracheal transplantation of mscs (17). We observed that hyperoxia - induced lung injuries such as impaired alveolarization, increased apoptosis, oxidative stress, inflammation, and fibrosis, as well as reduced vegf and hgf levels were significantly attenuated with early but not late transplantation . These findings suggest that the therapeutic time window of msc transplantation for bpd may be narrow during the early but not the late phase of inflammatory responses . (20) reported that both human umbilical cord - derived perivascular cells and mscs exerted short- and long - term (6 months) therapeutic benefits including persistent improvement in lung structure and exercise capacity, despite the low engraftment of cells . Moreover, no tumor formation was observed, and the beneficial effects of intratracheal transplantation of mscs in neonatal hyperoxic lung injuries were evident at p5 . These beneficial effects, which included improved alveolar and vascular growth, were sustained for a prolonged recovery period without any long - term adverse effects up to p70 (16). Overall, these findings support the assumption that transplantation of mscs to prevent or treat bpd in premature infants at a critical early time point might modify and improve the long - term respiratory morbidities of bpd . Among the various stem cells, the selection of a single appropriate stem cell that ultimately exhibits the best therapeutic efficacy in protecting against bpd is a difficult challenge . Embryonic stem cells are pluripotent cells capable of generating all cell types from three germ layers . However, the high tumorigenicity and ethical concerns of destroying embryos for their acquisition have limited their availability for research and clinical applications (19). Mesenchymal stem cells (mscs) are the most extensively examined cell type used in experimental models of bpd (13, 14, 15, 16, 17, 18, 20). Mscs are broadly distributed in the body, and could be isolated from adult tissues such as the bone marrow, adipose tissue, and gestational tissues such as the placenta, wharton's jelly, and umbilical cord blood (ucb). The umbilical cord and placenta are medical wastes that are usually discarded at birth, and therefore, mscs obtained from gestational tissues seem to be particularly attractive (21). In addition to their easy attainability, mscs derived from gestational tissues showed less antigenicity (21), and higher proliferation capacity and paracrine potency compared with adult tissue - derived mscs (22). Even within the same adult tissue origin, donor age negatively impacted the expansion and differentiation potential of the mscs (23, 24). Collectively, these findings suggest that mscs derived from post - partum associated tissues such as ucb or wharton's jelly might be the optimal cell source for future clinical applications, in protecting premature infants against bpd . The therapeutic efficacy of mscs has been tested in the hyperoxia - induced neonatal rodent or murine model of bpd, and was reported to improve survival, and suppress oxidative stress and inflammation (11, 13, 14, 15, 16, 17, 18, 20). In addition, it attenuated the impaired alveolar growth, lung vascular injuries, fibrosis, and the associated pulmonary hypertension (11, 13, 14, 15, 16, 17, 18, 20). These findings support the assumption that stem cell transplantation might be a promising novel therapeutic approach for bpd . The beneficial effects were initially ascribed to the transdifferentiation of mscs into lung parenchymal cells such as type ii pneumocytes (11, 25). However the low rate of in vivo engraftment and differentiation into lung tissue suggests that the therapeutic effects of stem cell transplantation might not be primarily mediated by regeneration . An equal or better therapeutic efficacy in preventing or reversing established bpd was observed with msc - conditioned media compared with msc (13, 26, 27). More recently, lee et al . (28) have reported that microvesicles released by msc exosomes are the major paracrine anti - inflammatory and therapeutic mediators of mscs in hypoxia - induced pulmonary hypertension . Collectively, these findings suggest that the protective effects of stem cell transplantation might be predominantly mediated by paracrine, rather than regenerative, mechanisms . The use of msc secretomes rather than stem cells could be an exciting, promising new therapeutic approach for bpd, especially since it circumvents the theoretical concerns associated with live cell treatments, such as tumor formation . The specific humoral substances secreted by the transplanted mscs that are responsible for the protective paracrine activity have not yet been elucidated . In our previous experiments, we observed that significantly reduced levels of growth factors such as vascular endothelial growth factor (vegf) and hepatocyte growth factor (hgf) were significantly improved with mscs transplantation (17). Moreover, the knockdown of vegf secretion by the mscs using transfection with small interfering rna specific for human vegf abolished the protective effects of mscs in hyperoxic lung injury (18). These protective effects included the attenuation of impaired alveolarization and angiogenesis, reduction in apoptotic cells and alveolar macrophages, and downregulation of proinflammatory cytokine levels (18). Overall, these findings suggest that growth factors such as vegf, which are secreted by the transplanted mscs, are critical paracrine factors that mediate the protective effects of mscs against hyperoxic lung injuries . Determining the optimal route of msc transplantation is a critical issue that needs to be resolved for future successful clinical translation of stem cell therapies for protection against bpd . Injured lungs produce chemotactic factors that cause mscs to proliferate and migrate toward the injury (28). Furthermore, systemically administered mscs have been shown to home and localize to an injured lung (29). Local intratracheal transplantation of mscs at four times lesser doses produced more effective engraftment of donor cells and attenuation of hyperoxia - induced lung injury than with systemic intravenous or intraperitoneal administration (11). These findings suggest that the local intratracheal rather than systemic intravenous or intraperitoneal transplantation of mscs might be an optimal route of delivery for treating premature infants with bpd . Determination of the optimal dose of mscs for transplantation is another important issue that needs to be addressed for successful clinical translation . In our previous study (15), we tested the therapeutic efficacy of three different doses of human ucb - derived mscs (510, 510, and 510 cells) administered intratracheally to hyperoxic newborn rat pups (average weight, 8 g) at postnatal day (p) 5 . The intratracheal transplantation of human ucb - derived mscs attenuated the symptoms associated with hyperoxia - induced lung injury, such as decreased alveolarization, in a dose - dependent manner . The dose of 510 cells provided the best protection, while at least 510 cells were necessary for effective anti - inflammatory, anti - fibrotic, and anti - oxidative activity . In the light of these findings, further studies to determine the optimal dose of human ucb derived mscs for potential clinical benefit in human preterm neonates are planned . While the therapeutic efficacy of msc transplantation in bpd has already been shown (11), the optimal timing of administration is another critical issue that remains to be established . Therefore, we attempted to determine the optimal timing by comparing the therapeutic efficacy of early (at p3) versus late (at p10) intratracheal transplantation of mscs (17). We observed that hyperoxia - induced lung injuries such as impaired alveolarization, increased apoptosis, oxidative stress, inflammation, and fibrosis, as well as reduced vegf and hgf levels were significantly attenuated with early but not late transplantation . These findings suggest that the therapeutic time window of msc transplantation for bpd may be narrow during the early but not the late phase of inflammatory responses . Peirro et al . (20) reported that both human umbilical cord - derived perivascular cells and mscs exerted short- and long - term (6 months) therapeutic benefits including persistent improvement in lung structure and exercise capacity, despite the low engraftment of cells . Moreover, no tumor formation was observed, and the beneficial effects of intratracheal transplantation of mscs in neonatal hyperoxic lung injuries were evident at p5 . These beneficial effects, which included improved alveolar and vascular growth, were sustained for a prolonged recovery period without any long - term adverse effects up to p70 (16). Overall, these findings support the assumption that transplantation of mscs to prevent or treat bpd in premature infants at a critical early time point might modify and improve the long - term respiratory morbidities of bpd . The safety and feasibility of transplanting allogeneic human ucb - derived mscs in preterm infants was assessed . Intratracheal transplantation of mscs was performed in 9 preterm infants (3 received 110 cells / kg and 6 received 210 cells / kg) who had a very high risk for developing bpd . The infants in this phase i clinical study had a mean gestational age of 25.30.9 weeks, a mean birth weight of 793127 g and a mean birth age of 10.42.6 days (30). The transplantation was well tolerated, without any serious adverse events or dose - limiting toxicity . Tracheal aspirate cytokine levels at day 7 were significantly reduced compared with the baseline levels . Moreover, bpd severity which classified as mild, moderate, and severe according to the consensus of nichd workshop (31), was significantly lower in the transplant recipients compared with the gestational age, body weight, and respiratory severity - matched control group . Overall, these findings suggest that intratracheal transplantation of allogeneic human ucb - derived mscs in very preterm infants at the highest risk for developing bpd is safe and feasible . A long - term follow - up safety study (nct01632475) on msc - treated preterm infants and a phase ii double - blind randomized controlled trial to assess the therapeutic efficacy (nct 01828957) are currently underway . In recent years, we have broadened our knowledge and understanding of stem cell therapy for neonatal lung injury . Contributions to this advancement include the various translational research studies supporting the therapeutic potential, safety profile, optimal route, optimal timing, optimal dose, and potential efficacy marker of stem cell therapies for bpd . Moreover, the first phase i clinical trial of msc transplantation for bpd was conducted successfully, proving its safety and feasibility in the preterm infants . This progress has moved human stem cell therapy for bpd one step closer to clinical translation (tables 1, 2). The first is a phase ii clinical trial to assess the therapeutic efficacy (nct01828957), and the second is a long - term follow - up safety assessment study of the msc transplant recipients (nct01897987). Conditional approval of clinical use of msc might be anticipated cautiously after the completeion of the phase ii clinical trial with favorable outcome.
|
Myasthenia gravis (mg) is an autoimmune syndrome caused by a failure of neuromuscular transmission, which results in variable muscle weakness and is exacerbated by exercise (1). Autoantibodies against the muscle nicotinic acetylcholine receptor (achr) can be detected in approximately 80 - 85% of all patients with generalized mg (2,3) and in approximately 40% of anti - achr seronegative mg patients who have antibodies against muscle - specific kinase (musk) (3,4). Recently, the novel antigen, the low - density lipoprotein receptor - related protein 4 (lrp4), has been identified as a target for the autoantibodies in mg (5), and anti - lrp4 antibodies were detected in the serum of approximately 2 - 46% of double seronegative mg (dsmg) patients (3,5 - 7). In this report, we present a case of undiagnosed mg with an acute onset of respiratory insufficiency without either ocular or limb involvement . Our study highlights the fact that making an early diagnosis of such cases can be very difficult . A 72-year - old japanese man was admitted to our department presenting with an 18-month history of dropped head . A neurological examination revealed mild neck extensor weakness (mmt 4/5), but there were no signs of weakness in the ocular, tongue, facial or limb muscles . The results of routine blood tests, including those for thyroid function and muscle enzymes, were normal . An arterial blood gas analysis of room air was paco2 55.9 mmhg and% vc (vital capacity) was 63.7% in spirometry, and he needed noninvasive positive - pressure ventilation (nppv). A chest computer tomography (ct) scan showed no definite evidence of either pneumonia or pulmonary thromboembolism . No abnormalities were observed on magnetic resonance imaging (mri) of the brain and cervical spine and cerebrospinal fluid examination . Repetitive nerve stimulation (rns) studies of the trapezius muscle showed about a 20% decrease in his compound muscle action potential, although rns studies in the orbicularis oculi and abductor digiti minimi muscles were normal . Needle electromyography of the sternocleidomastoid and cervical paraspinal muscles showed a mild, low amplitude of the motor unit potentials . A muscle biopsy from the left biceps brachii muscles showed no significant lesions . The administration of an oral cholinesterase inhibitor (pyridostigmine bromide, 60 mg three times daily) or an intravenous immunoglobulin (ivig, 400 mg / kg 5 days) did not alleviate his respiratory symptoms . Two months after admission, steroid pulse therapy (methyl prednisolone 1,000 mg 3 days) was started, and his respiratory and neck symptoms and hypercapnia thereafter markedly improved (figure). We performed the steroid pulse therapy every week for three times, which allowed him to gradually withdraw from the nppv . Subsequently, he was administered tacrolimus (3.0 mg / day), and he has since remained symptom - free for over 8 months . The patient s clinical course is shown we present the case of a dsmg patient with anti - lrp4 antibodies without a common phenotype . To the best of our knowledge, this is the first clinical report of mg with seropositivity for only anti - lrp4 antibodies showing predominantly respiratory symptoms . Several reports have described the clinical features of mg patients with anti - lrp4 antibodies . One patient presented with isolated neck extensor weakness and the other showed ocular, bulbar and cervical symptoms . Reported the clinical presentation of three dsmg patients with anti - lrp4 antibodies who showed isolated ocular symptoms and a good response to treatment with cholinesterase inhibitor and/or corticosteroids (9). Also described a case of mg presenting with bulbar symptoms and double seropositivity for anti - achr and anti - lrp4 antibodies; this patient responded to cholinesterase inhibitor and corticosteroids (7). All of these reported cases showed mild symptoms and a good response to the conventional treatments of mg . However, the typical clinical symptoms of mg patients with anti - lrp4 antibodies remain unclear because the number of detailed clinical reports is too small . Our case suggests that mg patients with anti - lrp4 antibodies could show a dropped head as an initial symptom at presentation . Studied the clinical data of over 800 mg patients and reported that the majority of dsmg patients with anti - lrp4 antibodies presented with ocular or mild generalized symptoms . They showed a positive response to cholinesterase inhibitors or corticosteroids, which was similar to the clinical features of mg patients with anti - achr antibodies (10). It was also reported that 6.6% of mg patients with anti - lrp4 antibodies demonstrated myasthenic crisis, and that double seropositive mg patients (especially anti - musk and anti - lrp4 antibodies) had more severe symptoms, such as myasthenic crisis (10). Our case suggests that seropositivity for anti - lrp4 antibodies alone (without anti - achr and/or anti - musk antibodies) can induce respiratory symptoms . In our case, corticosteroid therapy elicited a good response, which was similar to that of the previously reported cases (7,9). On the other hand, . Indicated, 9.6% of mg patients with anti - lrp4 antibodies did not respond to treatment with cholinesterase inhibitors (10). Moreover, in our case, ivig was ineffective, whereas tacrolimus was effective and prevented the recurrence of myasthenic symptoms . . Showed that 10 out of 32 mg patients with anti - lrp4 antibodies were treated with ivig, and 12 out of 28 patients were treated with azathioprine; however, the outcome of these therapies was not described in the paper (10). Further accumulation of clinical data is therefore necessary to understand the effect of ivig and immunosuppressants on mg patients with anti - lrp4 antibodies . Lrp4 is a member of the low - density lipoprotein receptor family and is known to bind directly to neural agrin (11), which is necessary for the nmj (neuromuscular junction) formation and neural agrin - induced activation of musk and achr clustering (11 - 13). Higuchi et al . Showed that anti - lrp4 sera from mg inhibited the interaction between lrp4 and neural agrin (5). Shen et al . Reported that anti - lrp4 sera decreased cell surface lrp4 levels and inhibited both agrin - induced musk activation and achr clustering (14). They also demonstrated that immunization with the extracellular domain of lrp4 causes muscle weakness in mice (14). Moreover, recent studies in mice show that the loss of muscle lrp4 alone is sufficient to cause myasthenic symptoms (15). On the other hand, because it has been also recently reported that anti - lrp4 antibodies are present in the serum and cerebrospinal fluid of patients with amyotrophic lateral sclerosis (als) (16), the specificity of the anti - lrp4 antibodies for mg remains controversial (17). Acute neuromuscular respiratory failure is caused not only by mg, but also by other diseases, such as guillain - barr syndrome, myopathies and als (18). It is often challenging to diagnose mg at an early phase because it rarely presents as isolated respiratory muscle weakness (19). This presentation suggests that neurologists should consider mg with anti - lrp4 antibodies in the differential diagnosis of patients presenting with unexplained dyspnea.
|
Vulvar and vaginal atrophy (vva) is a chronic and progressive medical condition that develops as a result of the decline of estrogen levels . The process of atrophy is universal following the decline in estrogen with physiological changes taking place in the vulval, vaginal and urogenital epithelia . These changes underlie a broad range of genital and urinary symptoms, including dryness, burning, dyspareunia, loss of vaginal secretions, leukorrhea, vulvar pruritus, feeling of pressure, itching, urethral discomfort, frequency and urgency of urination, hematuria, urinary tract infection and dysuria . Up to 50% of postmenopausal women suffer from the symptoms of vva, with the onset of these symptoms varying from one woman to another . The presence and severity of these symptoms are variable, ranging from mild discomfort to great impairment and can be influenced by age, time and type of menopause as well as sexual activity and other personal history elements . Although vva has a negative impact on sexual health and quality of life, only a minority of postmenopausal women will ever seek medical treatment for their condition . The principles of treatment in women with established vaginal atrophy are to restore urogenital physiology and to alleviate symptoms . Treatment recommendations for vva include first - line therapy with non - hormonal lubricants with intercourse and, if indicated, regular use of long - acting vaginal moisturizers . However, these approaches seldom restore premenopausal anatomy or physiology and do not provide a long - term solution . Local estrogen therapy may be used in postmenopausal women with symptomatic vva who do not respond to lubricants and moisturizers . However, long - term safety, hormone exposure and side - effects in general have been cited as concerns that women have associated with use of prescription vaginal products and a potential systemic effect of local estrogens cannot totally be excluded . Furthermore, studies have suggested that satisfaction with the available treatment options is low, with common reasons for dissatisfaction including messiness, ritual and inconvenience of administration and interference with the spontaneity of sex . Therefore, there is a need for novel pharmacological treatment options that are easy to administer by women with symptoms of vva . Recent clinical trial programs for drugs to treat vva are based on draft guidance from the us food and drug administration (fda), which specifies that a new product must demonstrate efficacy at three co - primary endpoints, namely a change in: (1) maturation index (decrease in the percentage of parabasal vaginal cells and increase in the percentage of superficial vaginal cells), (2) vaginal ph, and (3) severity of the patient - reported most bothersome symptom (mbs). The severity of mbs is based on self - assessment of the symptoms of vva by the patient and includes vaginal dryness, vaginal pain associated with sexual activity (dyspareunia), vaginal and/or vulvar irritation / itching, dysuria and vaginal bleeding associated with sexual activity . Patients are required to rate the severity of the first four symptoms as none, mild, moderate or severe and the presence of vaginal bleeding after intercourse as either present or absent . The severity score is usually given a numerical value (none = 0, mild = 1, moderate = 2 and severe = 3) enabling a mean change from baseline to be calculated . The mbs must be chosen at baseline from the symptoms rated as moderate or severe and the mean change in mbs score from baseline is used to evaluate symptomatic improvement . Although this approach is an important primary measure of efficacy and is a major step forward in standardizing measurement of self - assessed changes in the severity of vva to validate potential new treatments, it is not easy to interpret what the resulting ospemifene is a novel selective estrogen receptor modulator (serm), licensed in the usa for oral treatment of moderate to severe dyspareunia, a symptom of vva, due to menopause, and current recommendations from the north american menopause society include the use of ospemifene for treatment of these symptoms . Pivotal studies with ospemifene have demonstrated the tolerability and efficacy of 12 weeks of ospemifene treatment in improving the mbs of dyspareunia and vaginal dryness . These studies of ospemifene have reported the mean change from baseline (range: ospemifene, 1.19 to 1.5; placebo, 0.84 to 1.2). While these data are important to show the statistical significance of ospemifene treatment, it would be beneficial to have data that are applicable to everyday clinical practice to assist health - care professionals in understanding what can be expected from prescribed treatments . This will be useful for defining the patient's expectation of potential benefits and limitations of treatment . In the ospemifene clinical trial program, the majority of the symptoms reported as mbs were either vaginal dryness or dyspareunia . The objective of the current analysis was to explore clinically relevant differences in the severity of vaginal dryness or dyspareunia in postmenopausal women treated with ospemifene 60 mg / day compared with placebo, using data of the primary endpoint from the two previously published studies . The safety and tolerability profile of 12 weeks of ospemifene in postmenopausal women, including a risk benefit discussion, has been reported previously and is therefore not included in this current analysis . Furthermore, safety data on ospemifene for the treatment of vva in postmenopausal women for 52 weeks and up to 64 weeks for women without a uterus have also been reported elsewhere . The current study analyzes the results of two previously conducted trials evaluating the safety and efficacy of oral ospemifene 60 mg / day for the treatment of the symptoms of vva (nct00276094/sponsor protocol no . 1550310, referred to herein as study 310; nct00729469/sponsor protocol no . 15 - 50821, referred to herein as study 821). Both studies were multicenter, randomized, double - blind, 12-week phase - iii studies in postmenopausal women, aged 4080 years, with the following criteria of vva: (1) 5% or less superficial cells on the vaginal smear (maturation index); (2) vaginal ph> 5.0; (3) at least one moderate or severe symptom of vva (study 310), or moderate to severe vaginal dryness or vaginal pain associated with sexual activity (study 821). A total of 826 postmenopausal women were randomized (1: 1: 1) and treated with either ospemifene 30 mg / day (n = 282), ospemifene 60 mg / day (n = 276) or placebo (n = 268) for up to 12 weeks in study 310 . A total of 919 postmenopausal women with either vaginal dryness or dyspareunia as their mbs were randomized (1: 1) and treated with either ospemifene 60 mg / day (n = 463) or placebo (n = 456) for up to 12 weeks in study 821 . A four - point scoring system (none = 0; mild = 1; moderate = 2; severe = 3) was used to evaluate the severity of the co - primary endpoints of dryness and dyspareunia in these studies; the mean change from baseline, based on this scoring system for the co - primary endpoint in each study has been reported elsewhere and is shown in table 1 . In both studies, the women in all treatment groups were supplied with a non - hormonal lubricant (k - y jelly, mcneil - ppc, inc ., nj, usa) and were instructed to use as needed . Primary efficacy analysis: change from baseline to week 12 in most bothersome symptom (itt, locf) a last - observation - carried - forward (locf) approach was used for those discontinuing prematurely for the analyses of efficacy variables . Both studies were approved by the institutional review board or ethics committee for each site, the declaration of helsinki was followed, and informed consent obtained from all patients . This current analysis focuses on the women who received either ospemifene 60 mg / day or placebo in both the 310 and 821 studies . Using the data from the co - primary endpoints, analysis of clinically meaningful differences in the patient's condition was assessed by the concepts of improvement, substantial improvement and relief (figure 1) of symptoms in the 60 mg ospemifene group compared to placebo: improvement was defined as a reduction in one or more units on the four - point severity scoring system (this includes patients whose baseline score changed from severe to none, mild or moderate, from moderate to mild or none, and from mild to none). Substantial improvement was defined as a reduction in two or three units on the four - point severity scoring system (this includes patients whose baseline score changed from severe or moderate to none, or from severe to mild). Relief was defined as having a severity score at week 12 of mild or none (i.e. Does not signify a change, but records the final score). The concepts of improvement, relief and substantial improvement in symptoms of vulvar and vaginal atrophy to assess clinically meaningful differences in the patient's condition . Severity was determined using a four - point scoring system (none = 0; mild = 1; moderate = 2; severe = 3) efficacy analysis included the change from baseline to week 4 and week 12 in the severity of symptoms . Within this model, the response variables were the change from baseline to week 4/week 12; for missing values, the last observation was used (the locf). The baseline value was the covariate, and treatment and study center were the fixed effects . The relative difference of the effect of ospemifene versus placebo in improvement, substantial improvement or relief in dryness or dyspareunia was determined using the following calculation per effect: (proportion of patients (%) on ospemifene 60 mg proportion of patients (%) on placebo)/proportion of patients (%) on placebo . Change from baseline to week 4 and week 12 in the severity of symptoms was analyzed using a cochran mantel haenszel row mean scores test, controlling for uterine status (intact uterus or post - hysterectomy) and study center . Improvement, relief and substantial improvement were analyzed using the fisher's exact two - sided test . The current study analyzes the results of two previously conducted trials evaluating the safety and efficacy of oral ospemifene 60 mg / day for the treatment of the symptoms of vva (nct00276094/sponsor protocol no . 1550310, referred to herein as study 310; nct00729469/sponsor protocol no . 15 - 50821, referred to herein as study 821). Both studies were multicenter, randomized, double - blind, 12-week phase - iii studies in postmenopausal women, aged 4080 years, with the following criteria of vva: (1) 5% or less superficial cells on the vaginal smear (maturation index); (2) vaginal ph> 5.0; (3) at least one moderate or severe symptom of vva (study 310), or moderate to severe vaginal dryness or vaginal pain associated with sexual activity (study 821). A total of 826 postmenopausal women were randomized (1: 1: 1) and treated with either ospemifene 30 mg / day (n = 282), ospemifene 60 mg / day (n = 276) or placebo (n = 268) for up to 12 weeks in study 310 . A total of 919 postmenopausal women with either vaginal dryness or dyspareunia as their mbs were randomized (1: 1) and treated with either ospemifene 60 mg / day (n = 463) or placebo (n = 456) for up to 12 weeks in study 821 . A four - point scoring system (none = 0; mild = 1; moderate = 2; severe = 3) was used to evaluate the severity of the co - primary endpoints of dryness and dyspareunia in these studies; the mean change from baseline, based on this scoring system for the co - primary endpoint in each study has been reported elsewhere and is shown in table 1 . In both studies, the women in all treatment groups were supplied with a non - hormonal lubricant (k - y jelly, mcneil - ppc, inc ., nj, usa) and were instructed to use as needed . Primary efficacy analysis: change from baseline to week 12 in most bothersome symptom (itt, locf) a last - observation - carried - forward (locf) approach was used for those discontinuing prematurely for the analyses of efficacy variables . Both studies were approved by the institutional review board or ethics committee for each site, the declaration of helsinki was followed, and informed consent obtained from all patients . This current analysis focuses on the women who received either ospemifene 60 mg / day or placebo in both the 310 and 821 studies . Using the data from the co - primary endpoints, analysis of clinically meaningful differences in the patient's condition was assessed by the concepts of improvement, substantial improvement and relief (figure 1) of symptoms in the 60 mg ospemifene group compared to placebo: improvement was defined as a reduction in one or more units on the four - point severity scoring system (this includes patients whose baseline score changed from severe to none, mild or moderate, from moderate to mild or none, and from mild to none). Substantial improvement was defined as a reduction in two or three units on the four - point severity scoring system (this includes patients whose baseline score changed from severe or moderate to none, or from severe to mild). Relief was defined as having a severity score at week 12 of mild or none (i.e. Does not signify a change, but records the final score). The concepts of improvement, relief and substantial improvement in symptoms of vulvar and vaginal atrophy to assess clinically meaningful differences in the patient's condition . Severity was determined using a four - point scoring system (none = 0; mild = 1; moderate = 2; severe = 3) efficacy analysis included the change from baseline to week 4 and week 12 in the severity of symptoms . Within this model, the response variables were the change from baseline to week 4/week 12; for missing values, the last observation was used (the locf). The baseline value was the covariate, and treatment and study center were the fixed effects . The relative difference of the effect of ospemifene versus placebo in improvement, substantial improvement or relief in dryness or dyspareunia was determined using the following calculation per effect: (proportion of patients (%) on ospemifene 60 mg proportion of patients (%) on placebo)/proportion of patients (%) on placebo . Change from baseline to week 4 and week 12 in the severity of symptoms was analyzed using a cochran mantel haenszel row mean scores test, controlling for uterine status (intact uterus or post - hysterectomy) and study center . Improvement, relief and substantial improvement were analyzed using the fisher's exact two - sided test . The rate of discontinuation was low in both studies: 84.8% of women taking ospemifene 60 mg / day and 85.8% of women taking placebo completed the 12 weeks of study 310; 89.8% of women taking ospemifene 60 mg / day and 88.4% of women taking placebo completed the 12 weeks of study 821 . After 4 weeks of treatment, the frequency of lubricant application decreased slightly in the ospemifene group with no change in the placebo group (both studies), while the frequency of sexual activity remained consistent in both treatment groups (only recorded in study 821). The clinical relevance of ospemifene treatment assessed using the definitions of improvement, substantial improvement and relief of vaginal dryness associated with vva is shown in figure 2 . Clinically relevant differences based on the most bothersome symptom of vaginal dryness in study 310 (n = 222) and study 821 (n = 214) (itt, locf). P values for treatment comparisons (ospemifene 60 mg / day vs. placebo) from fisher's exact two - sided test for women with a mbs of vaginal dryness in study 310, significantly more women who received ospemifene 60 mg / day for 12 weeks reported improvement (p = 0.0101), substantial improvement (p = 0.0172) and relief (p = 0.0140) of vaginal dryness from baseline levels compared with placebo . These proportions were similar in study 821 although the only statistical difference was with women (p = 0.0385) experiencing a substantial improvement in vaginal dryness with ospemifene 60 mg / day compared with placebo (figure 2). These differences in the proportion of women responding to treatment were noticeable after 4 weeks of treatment with ospemifene 60 mg / day . The relative differences in the proportion of women with improvement, substantial improvement or relief of their mbs of vaginal dryness following treatment with ospemifene 60 mg compared with placebo are shown in table 2 . The relative differences in the proportion of women responding to treatment with ospemifene 60 mg over placebo are also apparent after 4 weeks of treatment, with a further increase in the percentage of women showing improvement, substantial improvement or relief in dryness in study 310 and substantial improvement in study 821 at week 12 . Relative differences in the proportion of women with improvement, substantial improvement or relief of vaginal dryness or dyspareunia with ospemifene 60 mg compared with placebo, calculated as (% on 60 mg ospemifene -% on placebo)/% on placebo the differences in the severity of dyspareunia associated with vva, as assessed using the definitions of improvement, substantial improvement and relief are shown in figure 3 . Clinically relevant differences based on the most bothersome symptom of dyspareunia in study 310 (n = 242) and study 821 (n = 605) (itt, locf). P values for treatment comparisons (ospemifene 60 mg / day vs. placebo) from fisher's exact two - sided test among the women reporting dyspareunia as their mbs in study 310, after 12 weeks of treatment with ospemifene 60 mg / day, there were significantly more women with improvement (p = 0.0255) and relief (p = 0.0205) in the severity of dyspareunia from baseline compared with placebo . There was also a trend towards significance in the proportion of women with substantial improvement (p = 0.0799) in the severity of dyspareunia from baseline . These proportions were similar in study 821, with significantly greater improvement (p <0.0001), substantial improvement (p = 0.0006) and relief (p = 0.0001) in the severity of symptoms after 12 weeks of treatment with ospemifene 60 mg / day compared with placebo (figure 3). The relative differences in the proportion of women with improvement, substantial improvement or relief of their mbs of dyspareunia following treatment with ospemifene 60 mg compared with placebo are shown in table 2 . The relative increases in improvement, substantial improvement or relief of treatment with ospemifene 60 mg compared with placebo are apparent after 4 weeks of treatment and continue to increase up to 12 weeks . The clinical relevance of ospemifene treatment assessed using the definitions of improvement, substantial improvement and relief of vaginal dryness associated with vva is shown in figure 2 . Clinically relevant differences based on the most bothersome symptom of vaginal dryness in study 310 (n = 222) and study 821 (n = 214) (itt, locf). P values for treatment comparisons (ospemifene 60 mg / day vs. placebo) from fisher's exact two - sided test for women with a mbs of vaginal dryness in study 310, significantly more women who received ospemifene 60 mg / day for 12 weeks reported improvement (p = 0.0101), substantial improvement (p = 0.0172) and relief (p = 0.0140) of vaginal dryness from baseline levels compared with placebo . These proportions were similar in study 821 although the only statistical difference was with women (p = 0.0385) experiencing a substantial improvement in vaginal dryness with ospemifene 60 mg / day compared with placebo (figure 2). These differences in the proportion of women responding to treatment were noticeable after 4 weeks of treatment with ospemifene 60 mg / day . The relative differences in the proportion of women with improvement, substantial improvement or relief of their mbs of vaginal dryness following treatment with ospemifene 60 mg compared with placebo are shown in table 2 . The relative differences in the proportion of women responding to treatment with ospemifene 60 mg over placebo are also apparent after 4 weeks of treatment, with a further increase in the percentage of women showing improvement, substantial improvement or relief in dryness in study 310 and substantial improvement in study 821 at week 12 . Relative differences in the proportion of women with improvement, substantial improvement or relief of vaginal dryness or dyspareunia with ospemifene 60 mg compared with placebo, calculated as (% on 60 mg ospemifene -% on placebo)/% on placebo the differences in the severity of dyspareunia associated with vva, as assessed using the definitions of improvement, substantial improvement and relief are shown in figure 3 . Clinically relevant differences based on the most bothersome symptom of dyspareunia in study 310 (n = 242) and study 821 (n = 605) (itt, locf). P values for treatment comparisons (ospemifene 60 mg / day vs. placebo) from fisher's exact two - sided test among the women reporting dyspareunia as their mbs in study 310, after 12 weeks of treatment with ospemifene 60 mg / day, there were significantly more women with improvement (p = 0.0255) and relief (p = 0.0205) in the severity of dyspareunia from baseline compared with placebo . There was also a trend towards significance in the proportion of women with substantial improvement (p = 0.0799) in the severity of dyspareunia from baseline . These proportions were similar in study 821, with significantly greater improvement (p <0.0001), substantial improvement (p = 0.0006) and relief (p = 0.0001) in the severity of symptoms after 12 weeks of treatment with ospemifene 60 mg / day compared with placebo (figure 3). The relative differences in the proportion of women with improvement, substantial improvement or relief of their mbs of dyspareunia following treatment with ospemifene 60 mg compared with placebo are shown in table 2 . The relative increases in improvement, substantial improvement or relief of treatment with ospemifene 60 mg compared with placebo are apparent after 4 weeks of treatment and continue to increase up to 12 weeks . This current analysis demonstrates that approximately three - quarters of women treated for 12 weeks with ospemifene 60 mg / day experienced improvement of vaginal dryness and dyspareunia associated with vva, compared with 5060% of those who received placebo . Although previous studies have demonstrated the efficacy of ospemifene on the mean change in vaginal dryness from baseline (range: ospemifene, 1.26 to 1.3; placebo, 0.84 to 1.1) and dyspareunia (range: ospemifene, 1.19 to 1.5; placebo, 0.89 to 1.2), this is the first analysis to show the clinical relevance of such changes . This is particularly important as numerical measures of severity are not routinely used in clinical practice and gynecologists and their patients may therefore find it difficult to apply such knowledge to understand how treatments for vva may benefit women with symptoms attributable to the condition . The data presented here therefore provide clinically meaningful information as to the proportion of women who might expect to experience improvement or relief of their symptoms with ospemifene treatment . A number of other studies investigating treatment of vva in postmenopausal women have been published in recent years using the mbs as a co - primary endpoint . However, although the concept of the clinical relevance of changes in the severity score for the mbs with treatment has been suggested through the analysis of improvement and relief of such symptoms, this is the first manuscript to report such changes in this way . First, a one - unit improvement in severity score is often spontaneous and can occur without intervention . For example, in the ospemifene pivotal efficacy trials, patients selected their mbs at screening and again at randomization (baseline). The period between screening and randomization was no more than 6 weeks, with no therapeutic intervention during this time . However, in study 821, 14.9% of patients who described their mbs as severe at screening showed improvement by randomization, but only 0.2% showed substantial improvement at this point in time . If a substantial improvement is observed, different from placebo, it is more likely to reflect a true effect of a treatment in the patient population since a change of that magnitude in severity is rare without intervention . Furthermore, in the absence of a strict definition of the degree of severity (none, mild, moderate or severe), it is possible to question the significance of a change in severity score of one unit . For example, what may be perceived as moderate one day can be perceived as severe another day . However, there is little uncertainty about a change from moderate to none or from severe to mild or none . The efficacy of ospemifene in improving objective measures of vva, i.e. Increasing the maturation index and decreasing the vaginal ph, has been shown in studies 310 and 821 . In both pivotal studies, 12 weeks of treatment with ospemifene 60 mg / day increased the percentage of superficial cells by approximately 10% compared with placebo (2%) and decreased the percentage of parabasal cells by 3040% compared with placebo (04%). Notably, in both studies, improvements in maturation index were observed after 4 weeks of treatment . The clinically relevant changes in vaginal dryness and dyspareunia with ospemifene 60 mg / day reported in this current analysis, also observed after 4 weeks of treatment, suggest that symptomatic relief follows the objective signs of improvement reported previously . Taken together, these data indicate that ospemifene is treating the cause of vaginal atrophy, not just ameliorating the associated symptoms . Furthermore, the onset of these benefits may be experienced within 4 weeks of treatment . In the current analysis, there is a substantial placebo effect, with improvement of dyspareunia and vaginal dryness associated with vva in approximately 50% of women who received placebo . However, it is important to note that the design of the two studies reported here allowed all participants to use a non - hormonal vaginal lubricant as needed and therefore the placebo effect also includes the effect of the lubricant . Indeed, in the current analysis, the placebo effect was apparent after 4 weeks of the study this early onset of the placebo effect has also been reported previously . This early placebo effect usually wears off, as demonstrated by the continuing improvement in the ospemifene 60 mg / day group compared with placebo . Not only did ospemifene 60 mg / day show efficacy over and above lubricant, but lubricant use was reduced in the ospemifene treatment group towards the end of the study . There is a need for more stringent definitions for the degree of severity for the symptoms of vva, particularly when conducting clinical trials and for comparisons of the efficacy of different products . Furthermore, while such subjective measurements are essential to ensure the clinical effectiveness of new treatments that address both the underlying physiology and symptoms experienced by postmenopausal women to improve and maintain their quality of life in older age, it would also be beneficial to include a formal assessment of quality of life in the assessment of new treatments to understand fully the impact of the symptoms of vva in women . In the absence of specific vva quality - of - life rating scales, sexual quality - of - life scales are currently used as surrogates to assess the effect of vva symptoms . Establishing a practical, validated questionnaire, which takes into account the impact of vva symptoms on personal, social and professional aspects of quality of life, should now be prioritized to assist in assessing the effectiveness of new treatment options for vva . This analysis provides a clinically meaningful analysis of the efficacy of ospemifene 60 mg / day on vaginal dryness and dyspareunia as a result of vva . Approximately three - quarters of women treated for 12 weeks with ospemifene 60 mg / day experienced improvement of dyspareunia and vaginal dryness associated with vva, compared with 5060% who received placebo . This compares favorably with previous analyses of ospemifene 60 mg / day which demonstrate significant improvements relative to placebo in the objective measurements of vva as well as the severity of vaginal dryness and dyspareunia reported as the most bothersome symptom . In conclusion, this analysis provides informative and clinically relevant data that will enable gynecologists and their patients to assess the effectiveness that patients can expect to achieve when prescribed ospemifene for the improvement of their symptoms . Conflict of interest during the past 2 years r.e.n . Has had financial relationships (lecturer, member of advisory boards and/or consultant) with bayer - schering pharma, ely lilly, gedeon - richter, hra pharma, merck sharpe & dohme, novo nordisk, pfizer inc . Has received honoraria for consultancy work and lectures from a number of pharmaceutical companies including bayer, besins, novo nordisk, pfizer, se cur and shionogi ltd . N.b . Is a consultant working for shionogi ltd . During the past 2 years c.c - b . Has had financial relationships (lecturer, member of advisory boards and/or consultant) with amgen, pierre - fabre, servier, merck sharpe & dohme, isdin, pfizer inc . V. has had financial relationships (lecturer, member of advisory boards and/or consultant) with bayer - schering pharma, merck sharpe & dohme, pfizer inc ., j.a.s . Has served (within the last year) or is currently serving as a consultant to or on the advisory boards of abbvie, inc . (thousand oaks, ca), amneal pharmaceuticals (bridgewater, nj), apotex, inc . (toronto, canada), ascend therapeutics (herndon, va), depomed, inc . (west orange, nj), lupin pharmaceuticals (baltimore, md), meda pharmaceuticals inc . (whitehouse station, nj), novartis pharmaceuticals corporation (east hanover, nj), noven pharmaceuticals, inc . (new york, ny), novo nordisk (bagsvrerd, denmark), pfizer inc . (florham park, nj), shippan point advisors llc (upper saddle river, nj), sprout pharmaceuticals (raleigh, nc), therapeuticsmd (boca raton, fl), teva pharmaceutical industries ltd (jerusalem, israel). In the last year he has received or is currently receiving grant / research support from abbvie, inc . (quebec, quebec), novo nordisk (bagsvrerd, denmark), novogyne (east hanover, nj), palatin technologies (cranbury, nj), and teva pharmaceutical industries ltd (jerusalem, israel). He has also served or is currently serving on the speakers bureaux of amgen inc . (woodcliff lake, nj), merck (whitehouse station, nj), noven pharmaceuticals, inc . (florham park, nj), and teva pharmaceutical industries ltd (jerusalem, israel). J.a.s . Was the chief medical officer for sprout pharmaceuticals (raleigh, nc) until 4 january 2013 . Editorial assistance was provided by dr marion james of apothecom scopemedical (supported by shionogi).
|
Obstructive sleep apnea syndrome (osas) is a complex clinical syndrome characterized by apnea episodes, sleep fragmentation, oxygen desaturation, and increased daytime somnolence as a result of recurrent obstructive episodes in upper airways during sleep . Previous studies have revealed that osas is related with many cardiovascular diseases including hypertension, coronary artery disease, arrhythmias, and congestive heart failure . Basic hemodynamic mechanisms responsible from cardiovascular diseases are increased negative intrathoracic pressure, hypoxemia, and increased catecholamine release . In osas both ventricles are subjected to hemodynamic stress that induces various structural changes . The electrocardiogram (ecg) represents the sum of electrical activity of all myocytes within the heart and hemodynamic changes produce various ecg changes . Qrs complexes mainly represent ventricular depolarization and morphological assessment of qrs complex may give important prognostic information . It has been shown in previous trials that qrs fragmentation is a predictor of sudden cardiac death and total mortality . In addition, a prolonged qrs duration has been implicated in cardiovascular events, sudden death, and total mortality . In this study, zonguldak uzun mehmet gs hastalklar hospital and admitted to sleep laboratory in order to undergo polysomnography test . Each of these patients were diagnosed with osas (apnea - hypopnea index [ahi] 5 events / h) and they had no previous treatment . Thirty - four consecutive participants who were shown to have no osas (ahi <5 events / h) following polysomnopgraphy test were included as our control group . Patients with following conditions were excluded from the study: chronic obstructive pulmonary disease on pulmonary function testing, previous history of continuous positive airway pressure treatment, stage 23 hypertension, a positive stress test, coronary artery disease and/or previous myocardial infarction, left ventricular (lv) dysfunction, echocardiographically proven lv hypertrophy, moderate - to - severe valve disease, renal or hepatic dysfunction, impairment of thyroid function tests, atrial fibrillation, history of dysrhythmia, patients with permanent pacemakers, bundle branch block or fascicular block, and electrolyte abnormalities, presence of infections or inflammations, hematologic disease or any known malignancy, individuals who have systemic and metabolic diseases that could adversely affect the cardiac or pulmonary structure and functions . None of the participants were taking antiarrhythmic drugs, digitalis, beta - blockers, nondihydropyridine calcium - channel blockers or any other qt prolonging medications . In this study, all of the procedures that took place were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the declaration of helsinki (1975), as revised in 2000 . Overnight polysomnography was performed in all patients by a computerized system (alice 5 diagnostic sleep system, 55 channels; respironics, usa). The test included the following variables: electrooculogram (two channels), electroencephalogram (four channels), electromyogram of submental muscles (two channels), electromyogram of the anterior tibialis muscle of both legs (two channels), thoracic and abdominal movements, pulse oximeter oxygen saturation, ecg, airflow (with a nasal cannula), body position detector, and tracheal sound . The recordings were conducted at a speed of 10 mm / s, and sleep stage was scored according to the standard criteria of rechtschaffen and kales . The ahi was obtained by dividing the total number of apneas and hypopneas by the total sleep time . Apneas were defined as complete cessation of airflow 10 s. hypopneas were defined as a reduction of> 50% in one of the three respiratory signals, airflow signal or either respiratory or abdominal signals of respiratory inductance plethysmography, with an associated decrease of 3% in oxygen saturation or an arousal . According to the recently updated international classification of sleep disorders published by the american academy of sleep medicine, a diagnosis of osas is to be made if the ahi is 15 events / h, independent of occurrence of symptoms, or whenever an ahi> 5 events / h is associated with any of the following: (1) sleep attacks or excessive daytime sleepiness, unrefreshing sleep, fatigue or (2) insomnia, or (3) witnessed heavy snoring and/or breathing pauses referred by the partner . Osas was excluded by a negative history of sleep - related symptoms (snoring, witnessed apneas, and excessive daytime sleepiness) and with an ahi <5 events / h at overnight polysomnopgraphy . Patients with sleep disorders except osas such as upper airway resistance syndrome, periodic leg movement syndrome, or narcolepsy were excluded . All standard 12-lead ecgs were obtained simultaneously using a recorder set at a 2550 mm / s paper speed and a voltage calibration of 1 mv / cm . All examinations were carried out in a quiet room during spontaneous breathing, following 10 min of rest in the supine position . The ecgs were each numbered and presented to the analyzing investigators who were blind both to patient name and group information . Ecg measurements were taken by two medically qualified observers blind to the name and group of patients . Ecg parameters were measured using a digital caliper (sensitivity: 1/100 mm) by magnifying lens . The highest value for each parameter was used . Fragmented qrs was diagnosed with the presence of an additional r wave (r') or notching in the nadir of the r wave or the s wave, or the presence of more than one r (fragmentation) in two consecutive leads, corresponding to a certain myocardial territory . Echocardiographic examination was carried out with the patient resting in a supine left lateral decubitus position . Lv dimensions and wall thickness were obtained from the parasternal long axis view with the m - mode cursor positioned just below the mitral leaflet tips, perpendicular to the long axis of the lv . Lv end - diastolic diameter and end - systolic diameter, thickness of the interventricular septum, and posterior wall of the lv were all measured using a single operator by the standards of the american society of echocardiography . Categorical data were presented as number and frequency (%). In order for the suitable analysis technique to be chosen, kolmogorov smirnov and homogeneity of variance tests were undertaken . Independent samples t - test was used for the two - group comparison of the normally distributed variables and mann whitney u - test for the two - group comparison of the variables without normal distribution . The coefficient of variation is calculated as the sd of the differences between the repeated measurements divided by the averages of the repeated measurements, and is expressed as a percentage . The intraobserver variabilities were 4.08% for pq, 5.60% for qrs, and 4.26% for qtc . The interobserver variabilities were 4.74% for pq, 6.65% for qrs, and 4.21% for qtc . Zonguldak uzun mehmet gs hastalklar hospital and admitted to sleep laboratory in order to undergo polysomnography test . Each of these patients were diagnosed with osas (apnea - hypopnea index [ahi] 5 events / h) and they had no previous treatment . Thirty - four consecutive participants who were shown to have no osas (ahi <5 events / h) following polysomnopgraphy test were included as our control group . Patients with following conditions were excluded from the study: chronic obstructive pulmonary disease on pulmonary function testing, previous history of continuous positive airway pressure treatment, stage 23 hypertension, a positive stress test, coronary artery disease and/or previous myocardial infarction, left ventricular (lv) dysfunction, echocardiographically proven lv hypertrophy, moderate - to - severe valve disease, renal or hepatic dysfunction, impairment of thyroid function tests, atrial fibrillation, history of dysrhythmia, patients with permanent pacemakers, bundle branch block or fascicular block, and electrolyte abnormalities, presence of infections or inflammations, hematologic disease or any known malignancy, individuals who have systemic and metabolic diseases that could adversely affect the cardiac or pulmonary structure and functions . None of the participants were taking antiarrhythmic drugs, digitalis, beta - blockers, nondihydropyridine calcium - channel blockers or any other qt prolonging medications . In this study, all of the procedures that took place were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the declaration of helsinki (1975), as revised in 2000 . Overnight polysomnography was performed in all patients by a computerized system (alice 5 diagnostic sleep system, 55 channels; respironics, usa). The test included the following variables: electrooculogram (two channels), electroencephalogram (four channels), electromyogram of submental muscles (two channels), electromyogram of the anterior tibialis muscle of both legs (two channels), thoracic and abdominal movements, pulse oximeter oxygen saturation, ecg, airflow (with a nasal cannula), body position detector, and tracheal sound . The recordings were conducted at a speed of 10 mm / s, and sleep stage was scored according to the standard criteria of rechtschaffen and kales . The ahi was obtained by dividing the total number of apneas and hypopneas by the total sleep time . Apneas were defined as complete cessation of airflow 10 s. hypopneas were defined as a reduction of> 50% in one of the three respiratory signals, airflow signal or either respiratory or abdominal signals of respiratory inductance plethysmography, with an associated decrease of 3% in oxygen saturation or an arousal . According to the recently updated international classification of sleep disorders published by the american academy of sleep medicine, a diagnosis of osas is to be made if the ahi is 15 events / h, independent of occurrence of symptoms, or whenever an ahi> 5 events / h is associated with any of the following: (1) sleep attacks or excessive daytime sleepiness, unrefreshing sleep, fatigue or (2) insomnia, or (3) witnessed heavy snoring and/or breathing pauses referred by the partner . Osas was excluded by a negative history of sleep - related symptoms (snoring, witnessed apneas, and excessive daytime sleepiness) and with an ahi <5 events / h at overnight polysomnopgraphy . Patients with sleep disorders except osas such as upper airway resistance syndrome, periodic leg movement syndrome, or narcolepsy were excluded . All standard 12-lead ecgs were obtained simultaneously using a recorder set at a 2550 mm / s paper speed and a voltage calibration of 1 mv / cm . All examinations were carried out in a quiet room during spontaneous breathing, following 10 min of rest in the supine position . The ecgs were each numbered and presented to the analyzing investigators who were blind both to patient name and group information . Ecg measurements were taken by two medically qualified observers blind to the name and group of patients . Ecg parameters were measured using a digital caliper (sensitivity: 1/100 mm) by magnifying lens . Fragmented qrs was diagnosed with the presence of an additional r wave (r') or notching in the nadir of the r wave or the s wave, or the presence of more than one r (fragmentation) in two consecutive leads, corresponding to a certain myocardial territory . Echocardiographic examination was carried out with the patient resting in a supine left lateral decubitus position . Lv dimensions and wall thickness were obtained from the parasternal long axis view with the m - mode cursor positioned just below the mitral leaflet tips, perpendicular to the long axis of the lv . Lv end - diastolic diameter and end - systolic diameter, thickness of the interventricular septum, and posterior wall of the lv were all measured using a single operator by the standards of the american society of echocardiography . Categorical data were presented as number and frequency (%). In order for the suitable analysis technique to be chosen, kolmogorov smirnov and homogeneity of variance tests were undertaken . Independent samples t - test was used for the two - group comparison of the normally distributed variables and mann whitney u - test for the two - group comparison of the variables without normal distribution . The coefficient of variation is calculated as the sd of the differences between the repeated measurements divided by the averages of the repeated measurements, and is expressed as a percentage . The intraobserver variabilities were 4.08% for pq, 5.60% for qrs, and 4.26% for qtc . The interobserver variabilities were 4.74% for pq, 6.65% for qrs, and 4.21% for qtc . Clinical and demographic features of both groups * independent t - test; mann whitney u - test; chi - square test . Ahi: apnea - hypopnea index; bmi: body mass index; crp: c - reactive protein; dm: diabetes mellitus; fbg: fasting blood glucose; hdl - c: high - density lipoprotein cholesterol; hl: hyperlipidemia; ht: hypertension; ldl - c: low - density lipoprotein cholesterol; nc: neck circumference; tc: total cholesterol; tg: triglycerides; tsh: thyroid stimulating hormone; wc: waist circumference; osas: obstructive sleep apnea syndrome . Fragmented qrs frequency was significantly higher in patients with osas (n = 31 [61%] vs. n = 12 [35%], fqrs frequency was 2.8 times higher in patients compared to controls after adjustment for gender [table 3]. When osas patients were grouped according to presence of fragmented qrs, it was found that the fragmented qrs group had a longer qrs duration (95.0 11.6 ms vs. 102.9 14.5 ms, p = 0.045) [table 4]. Furthermore, crp level was also higher in the fragmented qrs group (0.26 0.32 mg / dl vs. 0.39 0.36 mg / dl, p = 0.027). Comparison of the electrocardiographic and echocardiographic parameters * independent t - test; mann whitney u - test . Ci: cornell index; ef: ejection fraction; fqrs: fragmented qrs; ivs: interventricular septum; la: left atrium; lv - edd: left ventricular end - diastolic diameter; lv - esd: left ventricular end - systolic diameter; pq: pq interval duration; pw: posterior wall; qrs: qrs duration; qtc: corrected qt interval duration; sli: skolow - lyon index; osas: obstructive sleep apnea syndrome . A logistic regression model for fqrs fqrs: fragmented qrs; se: standard error; df: degree of freedom; ci: confidence interval; osas: obstructive sleep apnea syndrome . Clinical, demographic, electrocardiographic, and echocardiographic parameters for fragmented and non - fqrs * independent t - test; mann whitney u - test; chi - square test . Ahi: apnea - hypopnea index; bmi: body mass index; ci: cornell index; dm: diabetes mellitus; ef: ejection fraction; fqrs: fragmented qrs; fbg: fasting blood glucose; hdl - c: high - density lipoprotein cholesterol; hl: hyperlipidemia; ht: hypertension; ivs: interventricular septum; la: left atrium; ldl - c: low - density lipoprotein cholesterol; lv - edd: left ventricular end - diastolic diameter; lv - esd: left ventricular end - systolic diameter; nc: neck circumference; pq: pq interval duration; pw: posterior wall; qrs: qrs duration; qtc: corrected qt interval duration; sli: skolow - lyon index; tc: total cholesterol; tg: triglycerides; tsh: thyroid stimulating hormone; wc: waist circumference . Qrs and qtc durations were significantly longer in osas group compared to the control group (99.8 13.9 ms vs. 84.7 14.3 ms, p <0.0001; 411.4 26.9 ms vs. 390.1 32.2 ms, p = 0.001, respectively) [figures 1 and 2]. Qrs and qtc durations were also longer in patients compared to controls after adjustment for gender (99.7 14.4 ms vs. 84.8 14.6 ms, p <0.001; 413.3 29.1 ms vs. 387.3 29.4 ms, p <0.001, respectively). Echocardiographic parameters were within normal limits in both groups, although osas group had increased lv thickness and diameters, increased left atrial diameter, and a lower ejection fraction . Analysis of the patient and control groups combined revealed a weak - moderate correlation between ahi and qrs duration (r = 0.292, p = 0.070) and between ahi and qtc duration (r = 0.338, p = 0.020). However, there was no correlation between ahi and qrs duration (r = 0.231, p = 0.203) and between ahi and qtc duration (r = 0.004, p = 0.980) in osas group . We found an increased fragmented qrs frequency, qrs duration and qtc duration in patients with osas compared to the control group . Obstructive sleep apnea syndrome is an important public health problem since it is both prevalent and associated with disastrous outcomes including, but not limited to, cardiovascular morbidity and mortality . So far, certain causative factors have been implicated in osas's deleterious effects on myocardial structure and function . Hypoxia and hypercapnia that are common during sleep; increased negative intrathoracic pressure during the arousal phase and excessive hemodynamic changes as a result of sympathetic stimulation; oxidative stress, systemic inflammation, endothelial dysfunction, increased myocardial oxygen supply - demand mismatch all lead to myocardial injury . A study performed in rats demonstrated that chronic intermittent hypoxia as in osas was associated with lv damage in large scale and myocyte hypertrophy and cellular apoptosis at the cellular level . Another study demonstrated an increased cardiomyocyte diameter and amount of interstitial fibrosis in lv myocardium partly as a result of oxidative stress in mice subjected to intermittent hypoxic stress . Another study reported an increased amount of type iii aminoterminal peptide, a peptide used as an indirect marker of myocardial fibrosis, and suggested that its amount is related with disease severity . Myocardial scar or fibrosis does not necessarily lead to qrs prolongation, but rather they alter qrs shape without prolonging it by producing a previously absent r or a notch in either or both of r or s waves . It has been shown in previous trials that qrs fragmentation is a predictor of sudden cardiac death and total mortality . An increased fragmented qrs rate in osas patients in our study may have been related to cellular apoptosis and interstitial fibrosis in cardiac structure, which may be secondary to chronic hypoxia and other hemodynamic changes . Cetin et al ., in a study in patients with stable angina pectoris, showed that fragmented qrs and crp levels were inter - related . We also found that osas patients with fragmented qrs had higher crp levels than those without . A higher crp level in osas patients with fragmented qrs may suggest that inflammation could also play a role in the alterations of the qrs morphology in osas patients . Irrespective of its cause, lv hypertrophy is associated with increased cardiovascular morbidity and mortality . The causative factor of lv hypertrophy in osas is the increased afterload which may be due to increased negative intrathoracic pressure secondary to forceful breathing attempts against a closed upper airway or to heightened blood pressure because of sympathetic activation, hypoxemia, and arousal from sleep . In our study lv thickness was found to be increased in osas patients compared to controls despite the fact that there are a very low number of hypertensive patients and besides they had only mild hypertension . It is well - known that increased lv mural thickness may lead to prolonged qrs complexes . In the life trial qrs duration was independently predictive of cardiovascular and all - cause mortality . Desai et al . Reported that qrs duration was a significant and independent predictor of cardiovascular mortality in general medical population . Similar to the previous one, our study also found that osas patients had prolonged qrs duration . Another point to be considered was the higher numbers of male patients in the osa group . Showed that, in the adults, the principal differences were an increased qrs duration in men compared with women both in the standard and signal - averaged ecg . But qrs duration was also longer in patients compared to controls after adjustment for gender in our study . However, the osas group's qrs duration, which was within normal limits although it was prolonged as compared to the control group, may have altered secondary to above mentioned factors . Our study also showed that, although in normal limits, qtc duration was longer in patients with osas . While osa patients revealed longer qt durations similar to our study in literature, in the study of gupta et al . Secondly, in our patient group, we had more male patients than female patients . Because osas is diagnosed more frequently in male patients, and we have consecutively selected patients, we believe that our group study group supports the actual profile . Thirdly, we calculated measurements with electronic caliper by magnifying lens instead of computer - assisted calculations . Although we carefully assessed the patients for the presence of the coronary artery disease, we do not used invasive methods such as coronary angiography . Thus, it is possible that our cohort included patients with undetected coronary artery disease at entry . Furthermore, the sleep clinic population used here may not reflect the findings in the general community, and the results should be further confirmed with several longitudinal studies . In conclusion, in our study fragmented qrs frequency and qrs duration were found to increase in osas patients . Both parameters are related with increased cardiovascular mortality . Considering the prognostic importance of ecg parameters, it may be reasonable to recommend more detailed evaluation of osas patients with fragmented or prolonged qrs complexes with respect to presence of cardiovascular diseases . Secondly, in our patient group, we had more male patients than female patients . Because osas is diagnosed more frequently in male patients, and we have consecutively selected patients, we believe that our group study group supports the actual profile . Thirdly, we calculated measurements with electronic caliper by magnifying lens instead of computer - assisted calculations . Although we carefully assessed the patients for the presence of the coronary artery disease, we do not used invasive methods such as coronary angiography . Thus, it is possible that our cohort included patients with undetected coronary artery disease at entry . Furthermore, the sleep clinic population used here may not reflect the findings in the general community, and the results should be further confirmed with several longitudinal studies . In conclusion, in our study fragmented qrs frequency and qrs duration were found to increase in osas patients . Both parameters are related with increased cardiovascular mortality . Considering the prognostic importance of ecg parameters, it may be reasonable to recommend more detailed evaluation of osas patients with fragmented or prolonged qrs complexes with respect to presence of cardiovascular diseases.
|
Solution ph is one of the most important environmental variables that affects the structural and dynamic properties of biomolecules . Various biological events such as protein folding / unfolding, ligand binding, and enzyme activity heavily depend on solution ph . Solution ph affects protein denaturation, aggregation, and regulates many ph - dependent membrane proteins and channels . In cells, the ph in different compartments varies significantly; for example, the ph in the cytoplasm and nucleus is neutral (around 7.2), in vacuoles and golgi, it is acidic (between 4.8 and 6.5), and in mitochondria, it is basic (around 8.0). At the same time, the ph of each compartment is tightly regulated, and a small ph change can lead to serious diseases . Solution ph affects proteins by changing the protonation states of ionizable / titratable residues . The protonation state of an ionizable residue is a function of its pka value . However, the pka values of ionizable residues in protein environments can be shifted from the standard pka values experienced in water . The shift is especially large for groups found in protein interiors, and as a result, such buried groups can sometimes change protonation state even at physiological ph . Changes in the protonation state can be exploited for function, for example, when they are coupled to conformational reorganization, such as in the case of atp synthase, bacteriorhodopsin, cytochrome c oxidase, or the photoactive yellow protein . To understand the mechanisms of such proteins, it is essential to know the pka values of functionally important residues . Experimental determination of pka values of such residues can be a challenge, and carefully calibrated computational methods offer a possibility to obtain them . However, current computational methods have limitations when large scale structural reorganization is coupled to a change in protonation state . A widely used methodology for pka calculation is based on the solutions of the poisson the limitation of pb - based methods is that they may not properly represent the reorganization / response of protein induced by the titration of ionizable groups . Most pb - based methods use only a single conformation or allow perturbation of side - chain or hydrogen atoms . Also, the conformational response of a protein is modeled by a single value of a dielectric constant, which is dubious considering the inhomogeneous environment of the interior and surface of a protein . This approximation can also be problematic when water molecules are tightly coupled with ionizable groups of interest, which is commonly observed in many transmembrane proteins . A more accurate description of protein environment and polarizability can be achieved through quantum mechanical (qm) or mixed quantum mechanics / molecular mechanics (qm / mm) approaches . However, such calculations are computationally very expensive, and proper description of conformational changes triggered by protonation / deprotonation may not be achieved on a relevant time scale . Protein conformational changes triggered by ionization can be considered explicitly using constant ph molecular dynamics simulations . Constant ph simulation methods can be categorized into two groups: (1) discrete protonation state models, and (2) continuous protonation state models . Constant ph methods based on discrete protonation state models generally use a hybrid approach combining molecular dynamics (md) and monte carlo (mc). In the hybrid mc / md methods, a mc procedure is performed to determine the protonation states of ionizable groups at a regular interval over the course of a md simulation with either implicit or explicit water . During the mc procedure, a random walk between different protonation states is performed, and a state is determined based on the estimated free energy difference and metropolis criteria . With a continuum electrostatic model, dlugosz and antosiewicz developed a mc / md method based on the analytic continuum electrostatic method . Used a generalized born (gb) solvation model to calculate (de)protonation free energies . In contrast to the implicit solvent methods above, the md / mc method with explicit water requires a more sophisticated mc move due to solvent reorganization . Without solvent reorganization, a sudden change of charge distribution of a side - chain is likely to result in a large electrostatic penalty, which leads to an extremely low mc acceptance ratio . To increase the acceptance ratio of mc moves, for example, baptista et al . Evaluated (de)protonation free energy by pb and performed a short md run to relax the solvent . Brgi et al . Performed short thermodynamic integration (ti) calculations for mc moves, which is extremely expensive . Stern proposed a similar approach where mc moves consist of short md simulations (not free energy calculations) using a time - dependent hamiltonian that interpolates two protonation states . Most of these types of approaches require approximations that result in a loss of rigor that distorts the final ensemble . In the continuous protonation state models, a protonation state is represented as a titration variable considered as an independent dynamic variable . Baptista et al . Performed md simulations with the average charges of ionizable groups obtained by a mean field approximation . Brjesson and hnenberger devised a model in which the extent of (de)protonation is equilibrated by weak coupling to a proton bath . . Applied, and khandoghin et al . Improved the dynamics approach to constant - ph simulation with the gb solvation model the extent of protonation is parametrized by a fictitious particle in the hamiltonian, whose value fluctuates between 0 and 1 . During the postprocessing of trajectories, conformations whose value is higher or lower than a threshold value are assigned to a protonation state, and other unphysical conformations are discarded . To avoid sampling of unphysical states, this potential has to be carefully adjusted to maximize the number of transitions and minimize sampling of unphysical states, however, even with this approach, most of the sampled conformations are different from physical states . Recently this approach has been extended to perform constant - ph md simulations in explicit water . To enhance the accuracy of simulations that depend heavily on the accuracy of conformational sampling, constant ph methods with both discrete and continuous protonation states the gb - based constant ph methods have been coupled with the temperature replica exchange and accelerated md methods . A ph based replica exchange scheme has also been implemented where ph values are exchanged between replicas . To further increase sampling efficiency, the ph - exchange approach has been combined with reservoirs of conformations and protonation states within the framework of the double reservoir ph replica exchange method (work submitted for publication). In this study, we develop a new constant - ph method that yields the correct description of protonation states by combining the enveloping distribution sampling (eds) and hamiltonian replica exchange (hrex) methods . The eds method was devised to allow sampling of multiple end states from a single md simulation of a hybrid hamiltonian . Similar mixing schemes have been proposed by others . In the context of a constant ph simulation, the hybrid hamiltonian is the sum of boltzmann factors of multiple hamiltonians, each corresponding to a different protonation state . The effect of solution ph is considered by the relative free energy differences between protonation states . To ensure proper sampling of all protonation states, a smoothness parameter, s, that controls the height of energy barriers when s 0, the hybrid hamiltonian becomes highly smoothed, which makes energy barriers disappear . On the other hand, as s, no smoothing is applied to the hybrid hamiltonian, and it follows the minimum energy surface among the multiple end states, which corresponds to the physical hamiltonian . To obtain the correct ensemble of multiple protonation states while enhancing sampling efficiency, we coupled the eds simulations with different smoothness parameter through the hrex method . The hrex method, often called the bias - exchange method, facilitates diverse conformational sampling by modifying a physical hamiltonian or introducing various biasing potentials . To enhance conformational sampling efficiency, various hamiltonian modification schemes have been suggested: scaling hydrophobic, long - range, solvent - related interactions, or biasing backbone dihedral angles . In the context of the eds - hrex method, we use multiple eds potentials with different smoothness parameter, including an eds potential without smoothing that follows the minimum energy of multiple end states, and perform exchanges between them periodically . We assessed the performance of our method with titratable amino acid monomers: aspartic acid, glutamic acid, lysine, and histidine . We also tested out method with a small four - residue peptide (kaae) and snake cardiotoxin . The results show that our method can successfully and efficiently reproduce the correct distribution of different protonation states at a given ph . We briefly review the enveloping distribution sampling (eds) and hamiltonian replica exchange (hrex) methods and subsequently describe how these two methods are combined to sample the correct ensemble of different protonation states at a given ph . The free energy difference between two states a and b is given by1where z is the partition function of state and is the inverse of the thermodynamic temperature . In the eds approach, a hybrid hamiltonian enveloping both states is defined as follows,2where ea and eb are the hamiltonians of states a and b. in principle, a simulation performed on eh allows sampling of the important phase space of both state a and b, and their free energy difference can be estimated by3where however, if the energy difference between the minima of ea and eb is too large, the simulation will be trapped in the lowest energy basin of a single hamiltonian . Additionally, if the energy barrier between minima is too high, transitions between the two states will be observed rarely, which can lead to large errors in the free energy result . To alleviate these problems, a modified eds scheme with smoothing was suggested as follows,4where n is the number of end states (e.g., in the case of two states, n = 2), s is a smoothness parameter, and eioffset are energy offset parameters . The schematic representations of mixing two protonation states, ha and a, with different s values are illustrated in figure 1 . The relative energy difference between state ha and a depends on the solution ph, which can be adjusted by the energy offset parameters . The ph dependence of energy offset values will be discussed in more detail in the following section . A lower s value leads to a lower energy barrier in the hybrid hamiltonian, which can facilitate spontaneous state transitions . However, if s becomes too small, eh adopts a single energy minimum, which deviates from the original energy minima of ea and eb . A simulation on eh with such a small s value results in an ensemble comprising of only unphysical intermediate conformations . An iterative parameter optimization procedure was suggested to determine appropriate parameters for an efficient eds simulation . In this paper, we address this problem by performing simulations at multiple s values and performing hamiltonian replica between these simulations to enhance sampling of conformational transitions in the physically realistic hamiltonian . Schematic representation of eds hamiltonians (solid lines) mixing protonated (ha, blue dashed line) and deprotonated (a, green dashed line) states for constant ph simulations under various ph conditions: (a) ph = pka, (b) ph> pka, and (c) ph <pka . The difference between energy minima of each protonation state is determined by eq 8 . Five eds hamiltonians constructed with different smoothness parameters are illustrated: s = (red), s = 0.7 (cyan), s = 0.22 (purple), s = 0.15 (yellow), s = 0.08 (black). Note that a smaller s value leads to a smoother eds hamiltonian with a lower energy barrier . If s is small enough, an eds hamiltonian has a single energy minimum, which is different from the energy minima of either original end state . One goal of constant - ph simulation is to sample the equilibrium distribution of the protonated (ha) and deprotonated (a) states of a titratable group of a biomolecule at a given ph . The equilibrium distribution of the two protonation states is determined by their free energy difference . However, this free energy difference cannot be calculated by a conventional molecular mechanics (mm) approach because it cannot account for two factors: (1) the quantum mechanical energy of bond breaking and formation and (2) the contribution of proton solvation, which is affected by external ph . Following mongan et al ., we assume that the total protonation free energy of a titratable group in a protein (gprotein) consists of the molecular mechanics (gprotienmm) and nonmolecular mechanics (gprotiennon - mm) contributions:5 the non - mm component can be estimated by introducing the model compound, which has the same titratable group as the protein but with a known experimental pka value . In this study, a model compound is defined as a solvated amino acid monomer with capped termini . Based on the known pka of the model compound (pka, model), its protonation free energy istherefore, the non - mm component of the protonation free energy of the model compound is8with the assumption that the non - mm component of the model compound is identical with that of the protein, gprotiennon - mm = gmodelnon - mm, eq 5 can be expressed as9where gmodelmm can be readily obtained by conventional free energy calculation methods . For a single ionizable group, when no other ionizable groups are titrated, gproteinmm can be calculated by performing an eds simulation with hamiltonians of two protonation states, eproteinmm (ha) and eproteinmm (a). The gproteinmm gmodelmm part in eq 9 can be viewed as a shift in free energy of the model compound that is due to the change in the environment of nonbonded interactions of the ionizable group when it is transferred from the solvent to the protein environment . By using eq 9, the sampling of different protonation states of a titratable group in a protein environment is performed in a ph dependent manner . Equation 9 is practically implemented such that the protonated state is considered the reference state and is not experiencing any energy offset, while the deprotonated state is experiencing the ph dependent energy offset gmodelmm + kbt ln 10 (ph pka, model), as also depicted in figure 1 . When multiple ionizable groups in a protein are titrated, the number of states considered has to be increased, e.g. For two ionizable groups, four different states need to be considered, and for three ionizable groups, eight different states need to be considered . The advantage of this method, as opposed to free energy methods such as thermodynamic integration in which only two states are considered, is that it can estimate the ph dependent populations of multiple states in a single eds simulation . For example, in the case of two titratable groups, four states need to be considered . While one of the states (say the state in which both titratable groups are protonated) can be considered to be the model state, the ph dependent offset will be applied to the three other states . For a state in which titratable group 1 is deprotonated and group 2 is protonated, the ph dependent energy offset is gmodel1 mm + kbt ln 10 (ph pka, model1); for a state in which titratable group 1 is protonated and group 2 is deprotonated, the ph dependent energy offset is gmodel2 mm + kbt ln 10 (ph pka, model2); for a state in which both groups are deprotonated, the offset is a sum of the two offsets . If the two titratable groups are of different nature, say lys and glu, the two model compound free energies gmodelmm and pka, model values will be different, but if two groups are the same, these energies and pka, model values will be the same . In hamiltonian replica exchange (hrex) each hamiltonian corresponds to a different environmental condition or representation of a system, such as external fields in ising spin system or the strength of hydrophobic interaction in protein folding simulation . Generally, a proper exchange between different hamiltonians can enhance the sampling efficiency while preserving the boltzmann distribution . If the mth replica follows the hamiltonian em (x), its boltzmann distribution is10where zm is the partition function of em . Because replicas are noninteracting, the joint probability of having configuration x in in the mth replica and configuration x in the nth replica is defined as11we define the probability of exchanging x in mth replica with x in nth replica as w(x, em;x,en), and the probability of the reverse process is w(x,em;x, en). To satisfy the detailed balance condition, the exchange probability between the two replica must follow the relation:12combining eq 10 with eq 12 leads to13where14this condition can be satisfied by using the metropolis - type criteria for exchanges, the original eds method with smoothing (eq 4) allows sampling of parts of the important phase space of multiple states in a single simulation, and it may lead to poor sampling of physical states . The conformations sampled in the middle of potential energy minima correspond to virtual intermediates between physical states, which may be similar to conformations with fractional charges (e.g., 0.5) in -dynamics . However, these mixed states are never included in analysis of the ensemble . To increase the efficiency of simulation, residence time at intermediate states as shown in figure 1, when s is small, the corresponding eds simulation will mainly reside in an intermediate region in the phase space, which deviates substantially from the physical energy minima . To address this problem while preserving the sampling efficiency of eds, we combined the eds method with the hamiltonian exchange method (figure 2). In this study, we introduce the baseline eds hamiltonian without smoothing for conformational sampling, e(x;s =), which follows the minimum potential surface among the original states . Assume that state i with hamiltonian ei has the lowest energy at x0 among {e1,...,en},all exponential terms in eq 18 vanish as s because s(ej therefore, all conformations sampled with e exactly correspond to one of the original end states, and we denote the corresponding ensemble 0 . In other words, e connects multiple hamiltonians in a way that maximizes the correspondence to the original end states . This effect is more prominent near transition state regions, where the original potential energy surfaces are distorted most by a positive s (figure 1). In addition, e enables a more accurate sampling of equilibrium ensembles of given hamiltonians than the original eds method, which uses an effective s = 1.0 and slightly deviates from the original hamiltonians near the transition state region . The contribution of a given conformation x in to each partition function can be obtained by simply calculating a corresponding boltzmann factor . These properties make this minimum energy surface the logical choice for collecting the accurate constant ph ensemble . Generally, e has a high energy barrier in explicit solvent simulations due to solvent reorganization, which makes it impossible to observe spontaneous protonation state transitions within a computationally accessible time scale . Thus, to accelerate transitions, we introduce additional hybrid hamiltonians with smaller s, which lowers the energy barriers in transition regions (figure 2) and perform exchanges between the hamiltonians at a regular interval . At the potential with the smallest s value these nonphysical conformations will be filtered through successive exchanges with more physical hamiltonians, and eventually, only physically accessible conformations will be collected in the e trajectory . Schematic representation of the combination of eds and hamiltonian exchange methods for constant ph simulation . An eds hamiltonian with s =, e(x;s =), follows the minimum of either hamiltonian of protonated or deprotonated state, min(eprot(x),edeprot(x)). The other hybrid hamiltonians with positive s values have lower energy barriers, which enhances protonation state transitions . In this study, we used five test systems: an aspartic acid, glutamic acid, lysine monomers, a kaae peptide, and snake cardiotoxin v from naja naja atra (ctx a5, pdb i d: 1cvo). The input structures of all test systems were generated from the charmm22 topology files using the charmming server . The n - termini and c - termini of all test systems are capped with the neutral acetyl and n - methyl groups, respectively . The amino acid monomers and the kaae peptide are solvated in a 30 cubic box with explicit tip3p water molecules, and the snake cardiotoxin is solvated in a 60 cubic box . The protonated and deprotonated states only differ in the partial charges of their side chains . The deprotonated state has a dummy nonzero mass hydrogen atom without charge while keeping the bond, angle, and van der waals interactions . As discussed in the previous section, the contributions of these terms cancel out because the non - mm free energy components of the model compound and protein environment are almost identical . The eds calculation is performed with the eds command of the mscale facility, which can run simulations of multiple independent but connected systems . Their potential energy values are calculated in subprocesses and are used to calculate the eds energy and associated gradients in the main processes . The hrex calculation is performed by the repd facility . For all md simulations in this study, exchanges between replicas are attempted every 1000 md steps, and the shake algorithm is used to constrain the bond length of hydrogen atoms . A time step of 1 fs is used, and the nos hoover thermostat is employed to maintain a temperature of 300 k. a nonbonded cutoff of 15 is used, electrostatic interactions are truncated by the force shift method, and van der waals interactions are truncated with a switching function between 10 and 12 . All initial solvated systems are minimized by 200 steps of steepest descent followed by 200 steps with the adopted basis newton raphson method . After minimization, the systems are equilibrated for 1 ns with constant pressure simulations at 1 atm . The last snapshot of the equilibration run is used as the initial structure for the constant ph simulations, and the size of water box is kept constant . To carry out a constant ph simulation, the mm contribution to the protonation free energy of the model compound is required, which effectively arises from the change of electrostatic interactions . In this study, a model compound is defined as a solvated amino acid monomer with capped termini . The gmodelmm values of model compounds are obtained by ti,20where represents a coupling parameter between the protonated and deprotonated states . Eele () is defined as21where eele, prot and eele, deprot are the electrostatic potentials of protonated and deprotonated states, respectively . The value changes from 0 to 1 in increments of 0.05 at every 120 ps, using 20 ps of equilibration and 100 ps for gathering statistics . The calculated gmodelmm values are summarized in table 1 . With a given pka value, the fraction of deprotonated samples depends on the ph value and can be obtained with the hill equation:22where fd (ph) is the fraction of deprotonated states at a given ph, and n is the hill coefficient . In our method, the fd value is estimated by comparing the boltzmann factors of the protonated and deprotonated states of the conformations in 0 sampled with the baseline hamiltonian e (eq 19). The fd value can be obtained with23where n is the number of configurations in, xi, and e = e e. to assess the accuracy of eds - hrex constant - ph simulation, we estimated the pka values of several two - state systems, including aspartic acid, glutamic acid, and lysine monomers in explicit water . For each system, we performed three independent constant - ph simulations for 1 ns at different ph values . Aspartic acid was run for 5 ns to investigate the convergence of a small system with our method . Each eds - hrex simulation consists of 4 eds replicas, e to e, using s values of, 0.027, 0.020, and 0.01 . The pka values were estimated by fitting the baseline ensembles to the hill equation . The average pka values and standard deviations of all benchmark systems are summarized in table 2 . For aspartic acid, we carried out 3 independent sets of 6 eds - hrex simulations with ph values ranging from 2 to 7 with an interval of 1 . Figure 3a illustrates the average deprotonated fraction of the aspartic acid at each ph condition obtained from 3 independent eds - hrex simulations, along with the corresponding hill equation . The average pka value of the aspartic acids is estimated to be 3.92, which agrees well with the experimental pka value of 4.0 . Deprotonated fractions of (a) aspartic acid, (b) glutamic acid, and (c) lysine by eds - hrex constant ph simulation with explicit water molecules . The average deprotonated fractions of three independent 1 ns simulations are shown as red dots . The fitted titration curves are shown as solid lines . To test the convergence and accuracy of the eds - hrex method, we performed constant ph simulations of aspartic acid for 5 ns at 6 different ph conditions: 18 constant ph simulations in total . The average estimated pka values and standard deviations are calculated for 1 ns time windows (table 3). The results show that a deviation from experiment of only 0.08 pka units, corresponding to 0.11 kcal / mol, can be achieved even with a 1 ns simulation . Starting from a standard deviation of 0.094 pka unit, the value decreases to 0.032 after 2 ns . Little change in the standard deviation after 2 ns indicates that the simulations are converged within 2 ns . These results demonstrate that the eds - hrex method can give a reliable pka estimate . To verify that the exchange with smoothed eds potentials enhances the state transitions, we traced the protonation state transition of replica 0 of the aspartic acid from one simulation over time (figure 4). To determine the state of a conformation x in the smoothed eds hamiltonians, we define the likelihood of state i, i (x), that is, being protonated or deprotonated, as follows:24where e = e e, which is adopted from the zwanzig equation (eq 3). In figure 4a, if i (x) is larger than 0.9999, x is considered to be the state i. if both i (x) and j (x) are less than 0.9999, x is considered as an intermediate state, which could be unphysical . It can be observed that, after multiple exchanges between the eds potentials, replica 0 of aspartic acid returns to e and its protonation state is changed from the protonated to the deprotonated state at 350 ps . After 80 ps, replica 0 reaches the eds hamiltonian with the smallest s, e3 . At e3, intermediate states are dominantly sampled due to a lowered energy barrier . In addition, fast spontaneous protonation state transitions without hamiltonian exchange are readily observed . These results demonstrate that an eds potential with a small s facilitates state transitions through nonphysical intermediate states, as expected . (top) protonation states and the visited eds potentials of replica 0 during 1 ns eds - hrex simulation at ph = 4 . Based on the state likelihood i, the protonated (red circle), deprotonated (blue marks), and intermediate (green triangle) states are assigned . (bottom) difference between the adjusted potential energies of two protonation states, e = (eprot eprotoffset) because e follows the lower energy between (eprot eprotoffset) and (edeprot edeprotoffset), if e is negative, a configuration corresponds to the protonated state (red). The sampling efficiency of eds - hrex can be estimated from the number of protonation state transitions observed in the production ensemble 0 (figure 4b). During the 1 ns simulation of aspartic acid at ph 4, we observe an average of 83 protonation state transitions, which is comparable to previous -dynamics based approaches . Donnini et al . Observed 100 transitions during 20 ns of the titration of imidazole, corresponding to 5 transitions per ns, and goh et al . Achieved 50 transitions per ns for the titrations of adenine and cytosine . To verify that the ensemble consists only of physical states, we compare the radial distribution functions (rdfs) of water molecules around the od atoms of aspartic acid in each protonation state obtained by our constant - ph simulation with those produced by conventional md simulations with fixed charges (figure 5). The rdfs obtained by our constant - ph simulations are almost identical with those from conventional fixed - charge md simulations, which demonstrates that our method samples physical states rather than approximate states with noninteger charges obtained by -dynamics . The rdfs between the water hydrogen atoms and the od atoms of aspartic acids are significantly different depending on the protonation state . In the deprotonated state, due to the negatively charged od atoms, the water hydrogen atoms form a sharp peak of the first solvation shell at 1.8, and the second solvation shell is observed at 3.1 . However, in the protonated state, a hydrogen atom with + 0.44e charge is bonded to an od atom, which repels water hydrogen atoms and reduces the peak height of first solvation shell substantially . The first and second solvation shells are clearly observed at 2.7 and 4.8, while only the first solvation shell is observed in the protonated state . The rdfs obtained from the ensemble sampled with e (x;s = 0.01) show much less difference between the protonation states . The protonation state is determined based on the state likelihood criterion, (x)> 0.99 . The peaks of the deprotonated aspartic acid become lower, and those of the protonated state become higher, which converges to the average of the rdfs of the two protonation states . This shows that the eds sampling with a positive s leads to a significant deviation from the original states . Thus, one should be cautious when interpreting an ensemble obtained with a modified hamiltonian, such as -dynamics or an eds potential with s> 0, because the estimated thermodynamic properties can significantly diverge from the true values . Radial distribution functions (rdfs) between the od atoms of aspartic acid and water molecules obtained by eds - hrex constant ph simulation at (a) e(x;s =) and (b) e(x;s = 0.01) with a state likelihood threshold of 0.99 . The subplot c is obtained from 2 ns md simulations with the fixed charges for the protonated and deprotonated states . The rdfs of protonated and deprotonated states are shown as solid and dashed lines, respectively . To verify that our method can be extended to a chemically coupled multistate titration straightforwardly, we performed a constant ph simulation of histidine, which has two coupled titratable sites, nd1 and ne2, leading to four possible tautomeric states . The titration of histidine is one of the most important goals of constant ph simulations because its experimental pka value is in the range of physiological conditions . In this work, we consider three protonation states defined in the charmm22 force field, the doubly protonated state (residue type hsp), the nd1-protonated state (hsd), and the he2-protonated state (hse). From the given microscopic equilibrium constants, k1 and k2, for the reactions hsp hsd and hsp hse, the macroscopic equilibrium constant, k, for histidine can be derived as25by using the definition of pka, the macroscopic experimental pka value of histidine can be obtained from the microscopic pka values, pka,1 and pka,2, as follows26from the given experimental pka value of 6.5 for hsd and 7.1 for hse, the macroscopic experimental pka value is determined to be 6.4 . We carried out 1 ns constant ph simulations of histidine at 5 different ph values ranging from 5 to 9 . Because histidine has three protonation states, more state transitions are required for convergence than for the two protonation state systems . We used 6 eds potentials with s =, 0.06, 0.05, 0.04, 0.024, and 0.01 . Figure 6 shows the macroscopic and two microscopic titration curves of histidine, and the estimated pka values are listed in table 4 . The estimated macroscopic pka value is 6.24 with a standard deviation of 0.033, which agrees well with the experimental pka . The estimated microscopic pka values of hsd and hse are 6.33 and 7.20, respectively, which also agree with the experimental pka values . These results demonstrate that our method can successfully perform constant ph simulations of multiple titratable sites with chemical coupling . Titration curves of histidine obtained by eds - hrex constant ph simulation with explicit water molecules . (a) the macroscopic, the total deprotonated fraction of n and n, and two microscopic titration curves of (b) n and (c) n are illustrated . The average deprotonated fractions of three 1 ns simulations are shown as red dots . For this peptide, four different protonation states were considered: state 1, with both groups protonated, state 2 with lys-1 deprotonated and glu-4 protonated, state 3 with lys-1 protonated and glu-4 deprotonated, and state 4 with both groups deprotonated . Because the pka of a lys model compound is 10.4 and the pka value of glu model compound is 4.4, state 2 with deprotonated lys and protonated glu is improbable and could have been omitted . However, for consistency, we kept it in the calculations . Simulations of the kaae peptide were performed at ph values 2.4 to 13.4 in steps of 1 ph unit . Three different sets of simulations were performed, each with different initial velocities and using slightly different eds potentials . The first set of simulations was performed at s =, 0.027, 0.021, 0.016, and 0.012 . The acceptance ratios in replica exchange simulations between replicas 3 and 4 were 45%, that is, larger than the target acceptance ratio of 20% . Thus, the second set of simulations was performed with the same s value of the highest replica decreased from 0.012 to 0.0086 . The acceptance ratios for replica exchange between all replicas were still higher than 20% (the target acceptance ratio), except at a few ph values between replicas 0 and 1, and at one ph value between replicas 1 and 2 . Thus, we performed the third set of simulations at s =, 0.03, 0.022, 0.016, and 0.0086 . The titration curves for the peptide were determined by averaging the three simulations (figure 7). Based on the standard deviations, we conclude that the change in distribution of eds potentials had virtually no effect on the population of the four states and the calculated pka values and hill coefficients . (a) the macroscopic, the sum of deprotonated fractions of glutamic acid and lysine, and two microscopic titration curves of (b) glutamic acid and (c) lysine are illustrated . The average deprotonated fractions of three 1 ns simulations are shown as red dots . The pka value of lys-1 is 11.38; that is, it is shifted by 1 ph unit from the model compound pka value of 10.4, while the pka of glu-4 is 4.23, only 0.2 ph units lower than that of the model compound . Hydrogen bond analysis was performed with vmd for simulations at ph values 2.4, 7.4, and 13.4, which corresponded to states 1, 3, and 4, respectively, being predominately populated . As a measure of ion - pair interactions for ph values 2.4 and 13.4, these two atoms were never closer than 4 to each other, but at ph 7, they were within 4 6% of the time . In terms of hydrogen bonding interactions with the rest of the peptide, glu-4 did not engage in any, while lys-1 was hydrogen bonded 8% of the time at ph 2.4, 20% of the time at ph 7.4, and 2% of the time at ph 13.4 . These hydrogen bonding interactions may explain why the calculated pka value of lys was shifted more than that of glu . Finally, we performed a constant ph simulation of snake cardiotoxin v from naja naja atra (ctx a5, pdb i d: 1cvo). Ctx a5 has three titratable residues, glu-17, asp-42, and asp-59 that affect the stability of the protein between ph values 2 and 5 . We considered all possible protonation state combinations of these residues (8 total). Three sets of 1 ns eds - hrex simulations were performed at ph values ranging from 1 to 6 in steps of 1 ph unit . Each eds - hrex simulation consists of 6 replicas with s values of, 0.033, 0.027, 0.022, 0.018, and 0.01 corresponding to a total simulation time of 108 ns . The deprotonated fractions of titratable residues were obtained from the average of three sets of simulations, and the variables for the hill equation were obtained by fitting the average data points to the hill equation (figure 8). The calculated pka values and hill coefficients of three titratable residues titration curves of three titratable residues of snake cardiotoxin (ctx a5) are shown . The deprotonated fractions of (a) glu-17, (b) asp-42, and (c) asp-59 are illustrated . The average deprotonated fractions of three 1 ns simulations are shown as red dots . The calculated pka values, directions of the pka shifts, and hill coefficients are in accordance with the experiment . It is known that asp-59 strongly interacts with the adjacent lys-2, which results in a large shift of pka value of asp-59, from 4.0 to less than 2.3 . In our result, the pka is calculated to be 1.4, which is consistent with this . The pka of asp-42 is calculated to be 3.0, which is close to the experimental value of 3.2 . The largest error is observed in glu-17, whose calculated pka value is lower than the experiment by 1.6 pka units . One possible source of this error may be limited conformational sampling . To obtain accurate pka estimates, multiple transitions between different protonation states should be sampled . Generally, the titrations of residues are strongly coupled with protein conformational changes . Therefore, sufficient conformational sampling is important to reproduce experimental results . To check the convergence of our simulations, we counted the average number of protonation transitions of replicas sampled with the s = hamiltonian at ph 2 and ph 3 (figure 9). The protonation states of three residues, glu-17, asp-42, and asp-59, are denoted by three letters (e.g., pdd). P and d represent the protonated and deprotonated state, respectively, and thus pdd would correspond to glu-17 protonated, asp-42 deprotonated, and asp-59 deprotonated . The majority of state transitions are observed between a subset of states, while the rest of the states are rarely visited . This indicates that the simulations are not fully converged, possibly due to limited conformational sampling . At ph 2, most protonation transitions occur between states ppp, ppd, dpp, and dpd, while the transition to state ddp is sampled only once during all 3 simulations (figure 9a and b). When the external ph is 3, transitions between two pairs of states the current eds scheme lowers energy barriers caused by different energy terms between end states . In constant ph simulations, in other words, the energy barriers originating from other energy terms (i.e., van der waals or dihedral terms) are conserved after mixing by eds, which can limit the conformational sampling of titratable groups . This sampling issue may be solved by combining the current eds scheme with other accelerated sampling methods that preserve the canonical ensemble, such as self - guided langevin dynamics with reweighting or orthogonal space random walk . In addition, introducing additional dimensions of hamiltonian exchange to allow exchanges between ph values can also improve the convergence rate of simulations . Another source of error may originate from an imperfect representation of electrostatistics: using the classical mm model with fixed partial charges . For glu-17, three positively charged lysines, lys-2, lys-13, and lys-19, are located in the vicinity of glu-17 and can affect the titration behavior . Lys-2 is considered to be especially important in controlling the stability of ctx a5 through interaction with glu-17 . If electrostatic interactions between glu-17 and these three neighboring lysines are overestimated with the current mm force field, it may result in overpopulation of deprotonated glu-17 leading to a lower calculated pka value . This issue can be addressed by using polarizable force fields or qm / mm approaches, which can treat electrostatic interactions more accurately . Recently, wallace and shen have shown that a charge - leveling by simultaneous ionization or neutralization of a ion in solution can help to reproduce an experimental pka value more accurately . Summary of protonation state transitions at ph (a) 2 and (b) 3 are shown . Each node represents a protonation state and the width of the edge is proportional to the average number of transitions observed . The thinnest edge corresponds to only one transition from three sets of eds - hrex simulations . The eds - hrex method can be readily extended to titratable groups with chemically coupled moieties, such as histidine . This approach solves a problem inherent in -dynamic based approaches, where a new model or coordinate must be implemented to control the interconversion between such states . For example, histidine has two titratable sites, n and n, and their atomic charges depend on each other . This dependence cannot be represented properly by a single titration coordinate . To address this issue, khandogin and brooks introduced a tautomeric state variable in addition to, and donnini et al . Performed linear - interpolations between all possible combinations of protonation states explicitly . In the eds - hrex method, transitions between any pair of protonation states are automatically considered by performing md simulation with the hybrid hamiltonian . The eds - hrex method is compatible with any existing force field because the energy and forces of the hybrid hamiltonian can be readily obtained from those of end states, which are calculated independently . In most current force fields, an atom type and its associated force field parameters our method can consider the change of atomic parameters other than charge, such as the van der waals or generalized born solvation radius parameters . To apply the -dynamics approach to the change of general force field parameters rigorously, the parameters have to be interpolated linearly with respect to . Otherwise, this can be an inherent source of error as discussed in previous constant ph simulation with the gbsw implicit solvent model . The linear interpolation of parameters also requires the analytic derivatives of energy functions associated with, which can be highly complicated to compute . The eds - hrex method can be used for any free - energy calculation, not only those involving ph . It yields accurate free energy estimates because the e replica does not smooth the eds hamiltonian at all (s =). In the original eds method, however, this equation only converges if energy differences between the original hybrid states are small . Therefore, a trade - off must be made between efficiency of sampling (small s) and convergence of the result (achievable with large s). To address this, an iterative parameter optimization scheme has been proposed to find the ideal s value, which optimizes accuracy . However, this method still samples some number of unphysical system states . In the eds - hrex method, the e replica always has a s of, while other replicas are used to explore different conformations . Therefore, the free energy differences between states can be directly calculated by comparing their boltzmann factors from replica e because this replica only samples physical states . Another potentially significant advantage of eds - hrex is that the resultant ensemble has only discrete protonation states, and these can be coupled to a high quality quantum mechanics (qm) or qm / mm surface using a non - boltzmann bennett approach . Determining the optimal replica distribution and smoothness parameters efficiently requires further investigation . In this study, the parameters were determined by trial - and - error, using a series of short simulations . We plan to devise an automatic procedure to determine the optimal parameter set for a given problem, which is similar to an iterative procedure that optimizes parameters for a single eds simulation . As general guidelines to determine parameters, two conditions should be satisfied . First, spontaneous state transitions should be observed with highly smoothed eds potentials, as shown in figure 4a . This ensures that an eds - hrex simulation actually samples important protonation states, which is essential in constant ph simulations . Second, an average exchange rate between replicas should be in the range 2030% for an efficient sampling of various protonation state . However, this increased cost is offset by the advantage that every time step may be used to collect the final ensemble . Currently, the eds method is implemented via the mscale facility in charmm, which requires the independent energy evaluation of each end state . Therefore, the apparent cost of our method is simply proportional to the number of possible protonation states times the number of replicas used . For example, if there are x titratable groups with two protonation states, we need at most 2nr times more computational resources than a single hamiltonian simulation, where nr is the number of replicas . However, in some cases, at any given ph, the number of states considered can be reduced . For example, a histidine residue has four possible protonation states but the only three of those states need to be considered under physiological conditions; the fully deprotonated state will not contribute . In the case of the kaae peptide, the state in which glu is protonated and lys is deprotonated could have also been omitted, reducing the total number of states from four to three . Finally, ctx a5 has multiple lysines on its surface, which were assumed to be positive in this study because they are almost fully exposed and expected to experience little pka shifts . Therefore, the cost may be reduced by eliminating rarely populated charge states . On a similar note, we point out that the scalability of -dynamics may not be completely linear with the number of titratable groups . When there are n independent titratable groups, and if we assume that a probability to obtain a physical charge state of a single titratable site, that is,> 0.8 or <0.2, is p, the fraction of snapshots that all titratable groups are in physical charge states becomes p. our method focuses on obtaining accurate configurations of different protonation states . As shown in figure 5, even with a rather strict state likelihood value> 0.99, the radial distribution functions between titratable sites and water molecules obtained from a smoothed eds potential are significantly distorted . Thus, the major contribution of our method is in the improved quality of ensembles, because our method samples original end states with the s = hamiltonian . The computational cost can also be reduced with an improved eds scheme when only a few atom charges change in a large system . The eds equation only requires energy differences . Instead of calculating the full energy of each charge state, computing just the energy differences in other words, instead of calculating e1, e2, e3, and e4, we can perform an eds simulation by calculating e1, e2 the energies of different states differ only in electrostatic interactions between titratable groups and their neighboring atoms within a cutoff radius . Therefore, the energies and gradients of a subset of nonbonded pairs should be recalculated with different charge sets . We devised a new computational approach for constant - ph simulations in explicit solvent by combining the eds and hamiltonian replica exchange algorithms . We showed that this method can reproduce the correct description of multiple protonation states with frequent state transitions . A comparison of radial distribution functions between aspartic acid and water molecules demonstrates that the ensemble obtained with the baseline eds hamiltonian agrees well with those of md simulations with fixed charges . In terms of sampling efficiency, we observed over 80 protonation state transitions of blocked aspartic acid during 1 ns of simulation, which is comparable to the -dynamics based approaches . We also showed that the eds - hrex method can be easily extended to multiple protonation state cases with the titration of histidine, kaae peptide, and snake cardiotoxin . Due to the generality of the eds - hrex method, it can be applied to free energy calculations in various problems that require frequent transitions between multiple states separated by large energy barriers.
|
Although often life - threatening, the uncommon vascular infections are often clinically unsuspected and underdiagnosed . Septic thrombophlebitis represents a very rare condition, most usually reported to involve the dural sinuses, the internal jugular vein, the portal vein (during abdominal inflammatory processes), sometimes the pelvic veins as a complication of obstetric and gynaecological procedures . A 54-year - old male with history of human immunodeficiency virus (hiv) infection and intravenous drug abuse was hospitalized because of septic fever and lumbar pain . Clinically, edematous swelling of his external genitalia and left thigh, leg and ankle was appreciated, associated with mild pain and distal erythema . In the affected lower extremity, physical examination did not disclose significant dilatation of the superficial veins, absent peripheral pulses, or signs of arterial insufficiency . Laboratory tests disclosed anemia (8.7g / dl), low platelet count (84.00/mmc), and markedly raised c - reactive protein (305 u / l). Early color doppler study did not disclose acute abnormalities of both arterial and venous systems of the lower limbs . Initial clinical suspicion of infectious spondylo - diskitis was excluded by negative magnetic resonance imaging (mri) of the dorso - lumbar spine . Three days after admission, contrast - enhanced multidetector ct disclosed dilatation of the entire left femoral, external and common iliac veins with un - opacified lumen containing some gas, prominent enhancement of the venous wall and associated inflammatory stranding of the perivascular fat, findings consistent with septic thrombophlebitis [figure 1]. Unenhanced multidetector computed tomography (ct) image (a) shows dilatation of left common iliac vein with intraluminal gas and inflammatory stranding of the perivascular retroperitoneal fat . Contrast - enhanced ct scan (b) depicts dilated left iliac vein with unopacified lumen, gas bubbles and prominent enhancement of the vascular wall, findings consistent with septic thrombophlebitis . Coronal reformations (c, d) document the entire extent of the left iliaco - femoral axis thrombosis, extending cranially to the caudal most portion of the inferior vena cava intensive medical treatment including antibiotics and anticoagulation with full - dosage low - molecular - weight heparin (6000 ui enoxaparin twice daily, prescribed for 3 months) allowed clinical resolution of sepsis and normalization of laboratory inflammatory markers during three weeks . At discharge, the iliac and femoral veins appeared patent at color doppler ultrasound . Three months later, at ambulatory follow - up visit the patient was doing well and anticoagulation was discontinued . At least partly related to drug impurities, complications of recreational drug abuse may involve different organs (particularly the cardiovascular, respiratory, and musculoskeletal systems) and are increasingly encountered in emergency departments . Deep venous thrombosis in intravenous substance users occurs secondary to superinfection from non - sterile injection technique in the femoral veins that are used when injection sites in the arms are exhausted. [24] infection with the hiv further increases the risk, because of the associated coagulation system abnormalities including increased levels of fibrinogen, d - dimer, plasminogen activator inhibitor-1, and tissue - type plasminogen activator antigen . Therefore, septic thrombophlebitis should be taken in mind as a possible cause of persistent, often spiking fever despite broad - spectrum antibiotic therapy, associated with leg edema, flank and lower abdominal pain of variable intensity . Leukocytosis and abnormal inflammatory markers may vary depending on the host immune response, and hemocultures may disclose the causing organism, most usually s. aureus . As this case demonstrates, at ct the hallmark signs of septic thrombophlebitis include vein enlargement with sharp vessel wall enhancement, partial or complete luminal non - opacification, often associated with abnormal density of the surrounding fat planes consistent with inflammatory stranding; endoluminal gas bubbles may result from superinfection or may simply reflect injected . Additionally, multiplanar reformations may help to visualize the entire extent of the venous thrombosis. [24] high clinical suspicion and prompt imaging assessment with contrast - enhanced multidetector ct are imperative to diagnose this uncommon yet serious complication, to prevent further complications such as systemic embolization particularly to the lungs, brain, and musculoskeletal system . Color doppler ultrasound is often limited by meteorism and large body structure, and should be therefore reserved for monitoring treatment response . Although optimal management remain controversial in literature, improved diagnosis by means of ct and adequate antibiotic and anticoagulant treatment has dramatically reduced the traditionally high mortality rates.
|
Our modelling suggests that the use of measles, mumps, rubella, and varicella combination vaccines (mmrv) instead of measles, mumps, and rubella vaccine with varicella vaccine (mmr + v) can substantially reduce the number of hospitalisation days via higher vaccination coverage against varicella, despite the observed increased risk of febrile convulsions when mmrv is used as a first dose of measles - containing vaccine.the net result of these two opposing effects is one of the trade - offs between the two vaccination schemes that needs to be considered when making decisions on their use in immunisation programmes.this proof - of - concept analysis has demonstrated the feasibility and usefulness of quantitative modelling approaches, based on the combination of heterogeneous data sources, to provide objective, rational, and transparent information . Combination vaccines are used to simplify the recommended immunisation schedules, decrease the number of healthcare visits and injections in children, and improve vaccination coverage and compliance [1, 2]. Therefore, measles, mumps, rubella, and varicella combination vaccines (mmrv) have been developed to replace the separate administration of the trivalent measles, mumps, and rubella vaccine (mmr) with the monovalent varicella vaccine (v). As seen with other combination vaccines, mmrv has been a key driver in improving the vaccination coverage against varicella in various countries, such as germany and the usa [38]. German data suggest that v uptake was suboptimal when separate administration of mmr + v was recommended . Indeed, some parents are willing to vaccinate their child against mmr, but do not accept separate v and mmr vaccination . The main factors associated with the low acceptance rate of v vaccination by parents are the recommendations of paediatricians, who often have doubts about the benefits of varicella vaccination as they rarely observe severe complications in their practices; a negative attitude towards vaccination in general; parents doubts about vaccine safety and effectiveness; and the perception that varicella is a mild disease [5, 7, 8]. Data from germany, where mmrv was introduced in 2006, also showed that, even when mmrv was widely used, varicella vaccination coverage and timeliness of vaccination could still be improved . Data from a national sentinel network led by the robert koch institute suggested that varicella vaccination coverage in germany was 78% in 2008; however, this could be an overestimation of the real coverage since the network may not be representative of the entire country . In children, the risk of febrile convulsions (fc) is increased during the first 2 weeks following mmr vaccination [11, 12]. In addition, more recent studies have shown that this risk was about two times higher in children vaccinated with the first mmrv vaccine licensed worldwide (proquad, merck & co., inc ., whitehouse station, new jersey, usa) compared with the separate administration of mmr + v [13, 14]. Later, a study conducted by the bremen institute for epidemiology and prevention research showed that the risk of developing fc within 512 days post - vaccination was also higher in children younger than 5 years who received the other licensed mmrv vaccine (priorix - tetra, gsk, belgium) compared with separate injections of mmr + v or mmr alone . These observations suggest that both mmrv vaccines, when used as a first dose of measles - containing vaccine, are associated with an increased risk of fc . While combined mmrv vaccines can potentially increase the number of fc cases, they can decrease the number of varicella cases through increased coverage for the v component . Here, we present an attempt to assess the net result of these two opposing effects (fig . 1). This comparison would ideally be made by counting the hospitalisations for fc and varicella, and their duration, in a number of large populations randomly allocated to mmrv and mmr + v schemes, over several years, and with everything else being equal . As this is hardly feasible, we selected a modelling approach and the recent experience in germany as a starting point . In germany, a general varicella immunisation for infants from the age of 11 months was introduced in 2004, followed by the subsequent recommendation of a second vaccine dose at 1523 months of age in 2009 . Priorix - tetra was licensed in july 2006, and both vaccination schemes (mmr + v and mmrv) have been widely used; this has favoured comparison between the two vaccination regimens in a previous study conducted by the bremen institute for epidemiology and prevention research . In our analysis, we first used german data to put the increased risk of fc associated with mmrv (priorix - tetra) into perspective by comparing it with the higher risk of varicella infection associated with the mmr + v regimen . 1schematic representation of the two competing vaccination schemes and their associated risks and benefits as selected for the current analysis . * the (small) fraction of the total population who is not properly vaccinated against mmr . Fc febrile convulsions, mmr measles, mumps, and rubella vaccine, mmrv measles, mumps, rubella, and varicella vaccine, v varicella vaccine schematic representation of the two competing vaccination schemes and their associated risks and benefits as selected for the current analysis . * the (small) fraction of the total population who is not properly vaccinated against mmr . Fc febrile convulsions, mmr measles, mumps, and rubella vaccine, mmrv measles, mumps, rubella, and varicella vaccine, v varicella vaccine in this quantitative analysis, the increased risk of fc associated with mmrv (priorix - tetra) was contrasted with the higher risk of varicella infections associated with the separate mmr + v vaccination approach (fig . 1). We used a model based on several assumptions to integrate parameters from heterogeneous sources of data from germany (in the period 20062008). Statistical uncertainty was evaluated through a probabilistic uncertainty analysis by monte carlo simulations . In addition, to address the potential variability between countries or over time, structural uncertainty was assessed through a sensitivity analysis . The assumptions, as well as the point estimates for the input parameters, are described in table 1, and were selected to mimic the situation in germany in the period 20062008 . The risk estimates were derived from the post - marketing study conducted by the bremen institute for epidemiology and prevention research among children who received a first vaccination with mmrv (priorix - tetra), mmr, or mmr + v between january 2006 and december 2008 . Whereas the german vaccination programme changed to a two - dose schedule for mmrv or mmr + v in 2009, only the first doses were taken into account in this population - based analysis.table 1definitions and point estimates of the input parameters, and uncertainty of these parameters observed in the monte carlo simulationsparameterpoint estimatesourcesdistributionsimulation, median (95% ci)p1incidence of fc in days 512 after mmrv (number of fc per child)51/82,436poisson61.9 (46.178.9) p2incidence of fc in days 512 after mmr (number of fc per child)21/82,469poisson25.5 (15.836.4) p3relative probability of hospitalisation for fc as compared with the german data from 200620081.0constant1 ()p4number of hospitalisations for varicella per year (before the introduction of routine vaccination against varicella, across all age groups)1996normal1998 (13652633)p5median los for fc (number of days)1constant1 ()p6median los for varicella (number of days)5poisson5 (110)p7mmr coverage for the first dose0.9constant0.9 ()p8probability of v vaccination along with mmr vaccination0.78constant0.78 ()p9german birth cohort size (year 2005)685,795national statisticsconstant685,795 () ci confidence interval, fc febrile convulsions, los length of stay in hospital, mmr measles, mumps, and rubella vaccine, mmrv measles, mumps, rubella, and varicella vaccine, p parameter, v varicella vaccine cumulative incidence per 100,000 children definitions and point estimates of the input parameters, and uncertainty of these parameters observed in the monte carlo simulations ci confidence interval, fc febrile convulsions, los length of stay in hospital, mmr measles, mumps, and rubella vaccine, mmrv measles, mumps, rubella, and varicella vaccine, p parameter, v varicella vaccine cumulative incidence per 100,000 children the primary health outcome in this analysis was the duration of hospitalisation (median length of stay), which was chosen as a measure of the burden of both fc and varicella infection . The model was based on the following assumptions: vaccination with v occurred only in co - administration with mmr.mmr vaccination coverage and effectiveness were considered as identical between the mmr + v and the mmrv regimens.vaccination coverage of v varied between the two vaccination regimens.vaccine effectiveness of v was considered identical under both vaccination regimens [1820].one dose of v conferred identical and total protection against varicella - related hospitalisation under both vaccination regimens .the two vaccination regimens were compared as if they had been implemented for a sufficient amount of time as to reach a steady state in the dynamics of the disease, and all effects were assumed to be linear .the incidence of adverse events leading to hospitalisation, other than fc in the period of 512 days after the first dose, were considered identical under both vaccination regimens [18, 23].there were no health consequences later in life from hospitalisation for fc or varicella [24, 25].the number of hospitalisations for varicella after introduction of routine varicella vaccination was linearly proportional to the proportion of unvaccinated children . Mmr vaccination coverage and effectiveness were considered as identical between the mmr + v and the mmrv regimens . One dose of v conferred identical and total protection against varicella - related hospitalisation under both vaccination regimens . The two vaccination regimens were compared as if they had been implemented for a sufficient amount of time as to reach a steady state in the dynamics of the disease, and all effects were assumed to be linear . The incidence of adverse events leading to hospitalisation, other than fc in the period of 512 days after the first dose, were considered identical under both vaccination regimens [18, 23]. There were no health consequences later in life from hospitalisation for fc or varicella [24, 25]. The number of hospitalisations for varicella after introduction of routine varicella vaccination was linearly proportional to the proportion of unvaccinated children . To quantify the benefit, we calculated the number of hospitalisation days and the number of hospitalisations for varicella that could be averted when using mmrv instead of mmr + v. the hospitalisation rate for varicella in unvaccinated children was based on the yearly number of varicella - related hospitalisations observed in germany before the introduction of routine varicella vaccination . The yearly number of varicella - related hospitalisation days and hospitalisations attributable to mmr + v compared with mmrv were estimated as follows (table 1): (p6) (p4) (p7) [1 (p8)] and (p4) (p7) [1 (p8)], respectively . To quantify the risk, we calculated the yearly number of hospitalisation days and the number of hospitalisations for fc that were attributable to mmrv compared with mmr or mmr + v. the yearly population at risk was the fraction of the birth cohort vaccinated with mmrv . The yearly number of hospitalisation days and hospitalisations for fc attributable to mmrv compared with mmr + v were estimated from the differences between the incidence of fc under both vaccination regimens as follows (table 1): (p5) (p9) (p7) [(p1) (p2)] (p3) and (p9) (p7) [(p1) (p2)] (p3), respectively . The hospitalisation ratio (hr) was the ratio between the excess number of hospitalisation days (primary outcome) or hospitalisations (secondary outcome) attributable to varicella when vaccinating with mmr + v compared with mmrv, and the excess number of hospitalisation days (primary outcome) or hospitalisations (secondary outcome) attributable to vaccine - related fc when vaccinating with mmrv compared with mmr + v. the statistical variability of each non - constant input parameter of the model was used to evaluate the statistical uncertainty of the hr through a probabilistic analysis based on monte carlo simulations . The most relevant statistical distribution was selected for each input parameter, and 100,000 sets with randomly generated values for all input parameters were produced . The point estimate from the monte carlo simulation was defined as the median of the 100,000 values, and the 95% confidence interval (ci) was derived from the observed percentiles . Rather surprisingly, data from the bremen institute for epidemiology and prevention research indicated a median duration of hospitalisation for fc of 23 days during the first month following mmr or mmrv vaccination in 20062008, with several cases having a relatively long duration of up to 17 days . However, since the most recent german guidelines include no indication on whether children with fc should be hospitalised or not, the duration of hospitalisation for fc was based on the most recent international recommendations and set to a value of 1 day in this analysis (table 1). A study conducted in 1985 in the uk already suggested that children who had been observed for 24 h after fc could be discharged from hospital if the diagnosis of the cause of fever had been established and the children were medically fit, even if they were still febrile . With current vaccination schedules, the risk of meningitis has become extremely low, and it is not recommended anymore to carry out unnecessary investigations in most children presenting with fc . Current international recommendations for the management of fc advocate minimal intervention [2629]. In germany, the bremen institute for epidemiology and prevention research reported that hospitalisation rates for fc in 20062008 were around 60% in 9- to 17-month - old children; this estimation was based on different case definitions for hospitalised and non - hospitalised children, and did not take into account the timing of mmr or mmrv vaccination . In a study conducted in the usa, hospitalisation rates for fc were 6 and 17% during 710 days following mmrv and mmr + v vaccination, respectively . In another study, hospitalisation rates dropped significantly after implementation of updated guidelines for the management of children with fc (from 57.3 to 20.5% and from 16.9 to 3.2% in two large hospitals in france and italy, respectively). We identified the two parameters that are most likely to vary largely between countries or over time and have a large effect on the hr: rates of hospitalisation for fc and vaccination coverage for v under mmr + v. a sensitivity analysis was conducted to explore the structural uncertainty of hr in situations where the values of these two parameters were changed over their potential range . Monte carlo simulations were used to derive the different values of both the relative probability of hospitalisation for fc as compared with the german data from 20062008 (parameter p3) and the vaccination coverage for v under mmr + v (parameter p8), for which the point estimates for the hr were 1 . Statistical uncertainty was estimated as explained above . In the study of the bremen institute for epidemiology and prevention research, the probability of hospitalisation for fc was 100% by definition since only hospitalised cases were included in the analysis . However, in the german national context, the probability of hospitalisation for fc is not 100% and is considered to be close to 80% . To allow for generalisation, the model was slightly modified in order to use the national probability of hospitalisation for fc instead of the one related to the specific study of the bremen institute for epidemiology and prevention research . In order to differentiate the parameter space where the hr could be considered to be significantly higher than 1, we also derived the parameter values for which the lower limit of the 95% ci around the hr was 1 . The model was based on the following assumptions: vaccination with v occurred only in co - administration with mmr.mmr vaccination coverage and effectiveness were considered as identical between the mmr + v and the mmrv regimens.vaccination coverage of v varied between the two vaccination regimens.vaccine effectiveness of v was considered identical under both vaccination regimens [1820].one dose of v conferred identical and total protection against varicella - related hospitalisation under both vaccination regimens .the two vaccination regimens were compared as if they had been implemented for a sufficient amount of time as to reach a steady state in the dynamics of the disease, and all effects were assumed to be linear .the incidence of adverse events leading to hospitalisation, other than fc in the period of 512 days after the first dose, were considered identical under both vaccination regimens [18, 23].there were no health consequences later in life from hospitalisation for fc or varicella [24, 25].the number of hospitalisations for varicella after introduction of routine varicella vaccination was linearly proportional to the proportion of unvaccinated children . Mmr vaccination coverage and effectiveness were considered as identical between the mmr + v and the mmrv regimens . One dose of v conferred identical and total protection against varicella - related hospitalisation under both vaccination regimens . The two vaccination regimens were compared as if they had been implemented for a sufficient amount of time as to reach a steady state in the dynamics of the disease, and all effects were assumed to be linear . The incidence of adverse events leading to hospitalisation, other than fc in the period of 512 days after the first dose, were considered identical under both vaccination regimens [18, 23]. There were no health consequences later in life from hospitalisation for fc or varicella [24, 25]. The number of hospitalisations for varicella after introduction of routine varicella vaccination was linearly proportional to the proportion of unvaccinated children . To quantify the benefit, we calculated the number of hospitalisation days and the number of hospitalisations for varicella that could be averted when using mmrv instead of mmr + v. the hospitalisation rate for varicella in unvaccinated children was based on the yearly number of varicella - related hospitalisations observed in germany before the introduction of routine varicella vaccination . The yearly number of varicella - related hospitalisation days and hospitalisations attributable to mmr + v compared with mmrv were estimated as follows (table 1): (p6) (p4) (p7) [1 (p8)] and (p4) (p7) [1 (p8)], respectively . To quantify the risk, we calculated the yearly number of hospitalisation days and the number of hospitalisations for fc that were attributable to mmrv compared with mmr or mmr + v. the yearly population at risk was the fraction of the birth cohort vaccinated with mmrv . The yearly number of hospitalisation days and hospitalisations for fc attributable to mmrv compared with mmr + v were estimated from the differences between the incidence of fc under both vaccination regimens as follows (table 1): (p5) (p9) (p7) [(p1) (p2)] (p3) and (p9) (p7) [(p1) (p2)] (p3), respectively . The hospitalisation ratio (hr) was the ratio between the excess number of hospitalisation days (primary outcome) or hospitalisations (secondary outcome) attributable to varicella when vaccinating with mmr + v compared with mmrv, and the excess number of hospitalisation days (primary outcome) or hospitalisations (secondary outcome) attributable to vaccine - related fc when vaccinating with mmrv compared with mmr + v. the statistical variability of each non - constant input parameter of the model was used to evaluate the statistical uncertainty of the hr through a probabilistic analysis based on monte carlo simulations . The most relevant statistical distribution was selected for each input parameter, and 100,000 sets with randomly generated values for all input parameters were produced . The point estimate from the monte carlo simulation was defined as the median of the 100,000 values, and the 95% confidence interval (ci) was derived from the observed percentiles . Rather surprisingly, data from the bremen institute for epidemiology and prevention research indicated a median duration of hospitalisation for fc of 23 days during the first month following mmr or mmrv vaccination in 20062008, with several cases having a relatively long duration of up to 17 days . However, since the most recent german guidelines include no indication on whether children with fc should be hospitalised or not, the duration of hospitalisation for fc was based on the most recent international recommendations and set to a value of 1 day in this analysis (table 1). A study conducted in 1985 in the uk already suggested that children who had been observed for 24 h after fc could be discharged from hospital if the diagnosis of the cause of fever had been established and the children were medically fit, even if they were still febrile . With current vaccination schedules, the risk of meningitis has become extremely low, and it is not recommended anymore to carry out unnecessary investigations in most children presenting with fc . Current international recommendations for the management of fc advocate minimal intervention [2629]. In germany, the bremen institute for epidemiology and prevention research reported that hospitalisation rates for fc in 20062008 were around 60% in 9- to 17-month - old children; this estimation was based on different case definitions for hospitalised and non - hospitalised children, and did not take into account the timing of mmr or mmrv vaccination . In a study conducted in the usa, hospitalisation rates for fc were 6 and 17% during 710 days following mmrv and mmr + v vaccination, respectively . In another study, hospitalisation rates dropped significantly after implementation of updated guidelines for the management of children with fc (from 57.3 to 20.5% and from 16.9 to 3.2% in two large hospitals in france and italy, respectively). We identified the two parameters that are most likely to vary largely between countries or over time and have a large effect on the hr: rates of hospitalisation for fc and vaccination coverage for v under mmr + v. a sensitivity analysis was conducted to explore the structural uncertainty of hr in situations where the values of these two parameters were changed over their potential range . Monte carlo simulations were used to derive the different values of both the relative probability of hospitalisation for fc as compared with the german data from 20062008 (parameter p3) and the vaccination coverage for v under mmr + v (parameter p8), for which the point estimates for the hr were 1 . Statistical uncertainty was estimated as explained above . In the study of the bremen institute for epidemiology and prevention research, the probability of hospitalisation for fc was 100% by definition since only hospitalised cases were included in the analysis . However, in the german national context, the probability of hospitalisation for fc is not 100% and is considered to be close to 80% . To allow for generalisation, the model was slightly modified in order to use the national probability of hospitalisation for fc instead of the one related to the specific study of the bremen institute for epidemiology and prevention research . In order to differentiate the parameter space where the hr could be considered to be significantly higher than 1, we also derived the parameter values for which the lower limit of the 95% ci around the hr was 1 . The estimates for the different input parameters used in the model were selected from heterogeneous sources of data as described in table 1 [8, 10, 15, 24]. When using these point estimates for all parameters, the model predicted 1976 days of hospitalisation (395.4 hospitalisations) for varicella averted when the mmrv vaccination regimen was used, compared with 225 days of hospitalisation (225.0 hospitalisations) for fc attributable to mmrv . The point estimate of the hr was close to 11 in the primary analysis, which was based on the number of hospitalisation days . When the random variability of each non - constant input parameter of the model was estimated by a monte carlo probabilistic uncertainty analysis, the median hr was 8.48 (95% ci: 1.9925.22) in terms of hospitalisation days and 1.76 (0.984.02) in terms of number of hospitalisations (table 2). The difference with the point estimate presented above may be explained by the non - symmetrical distribution of the hr . In the primary analysis, the lower limit of the 95% ci around the hr was above 1, indicating that the number of hospitalisation days attributable to non - prevented varicella when using mmr + v as compared with mmrv was significantly higher than the number of hospitalisation days attributable to fc after mmrv as compared with mmr + v at a 95% ci (table 2).table 2benefit and risk estimates in terms of number of hospitalisation days in germanynamemeanmedian95% ciyearly number of hospitalisation days for fc attributable to mmrv (risk)225.0224.7104.9351.9yearly number of hospitalisation days for varicella prevented under mmrv (benefit)19891879433.44125hospitalisation ratio8.51.99525.22 ci confidence interval, fc febrile convulsions, mmrv measles, mumps, rubella, and varicella vaccine benefit and risk estimates in terms of number of hospitalisation days in germany ci confidence interval, fc febrile convulsions, mmrv measles, mumps, rubella, and varicella vaccine expected outcomes in other countries or under different scenarios were derived from a sensitivity analysis, which was based on two key parameters: the vaccination coverage of v when co - administered with mmr and the probability of being hospitalised for fc . The point estimate of the hr in terms of hospitalisation days was higher than 1 for scenarios where the probability of being hospitalised for fc was less than 40 times the probability of not receiving v along with mmr (fig . Ci confidence interval, fc febrile convulsions, hr hospitalisation ratio, mmr measles, mumps, and rubella vaccine, v varicella vaccine estimates of the hr in terms of number of hospitalisation days under different scenarios . Ci confidence interval, fc febrile convulsions, hr hospitalisation ratio, mmr measles, mumps, and rubella vaccine, v varicella vaccine in countries where the mean duration of hospitalisation for varicella was different than in germany (e.g. 3 days instead of 5 days), the slope of the discriminating line, which is shown in fig . 2, would be corrected by the same ratio (e.g. 40 3/5 = 24). When considering the line for the 95% ci limit in fig . 2, the estimates for the different input parameters used in the model were selected from heterogeneous sources of data as described in table 1 [8, 10, 15, 24]. When using these point estimates for all parameters, the model predicted 1976 days of hospitalisation (395.4 hospitalisations) for varicella averted when the mmrv vaccination regimen was used, compared with 225 days of hospitalisation (225.0 hospitalisations) for fc attributable to mmrv . The point estimate of the hr was close to 11 in the primary analysis, which was based on the number of hospitalisation days . When the random variability of each non - constant input parameter of the model was estimated by a monte carlo probabilistic uncertainty analysis, the median hr was 8.48 (95% ci: 1.9925.22) in terms of hospitalisation days and 1.76 (0.984.02) in terms of number of hospitalisations (table 2). The difference with the point estimate presented above may be explained by the non - symmetrical distribution of the hr . In the primary analysis, the lower limit of the 95% ci around the hr was above 1, indicating that the number of hospitalisation days attributable to non - prevented varicella when using mmr + v as compared with mmrv was significantly higher than the number of hospitalisation days attributable to fc after mmrv as compared with mmr + v at a 95% ci (table 2).table 2benefit and risk estimates in terms of number of hospitalisation days in germanynamemeanmedian95% ciyearly number of hospitalisation days for fc attributable to mmrv (risk)225.0224.7104.9351.9yearly number of hospitalisation days for varicella prevented under mmrv (benefit)19891879433.44125hospitalisation ratio8.51.99525.22 ci confidence interval, fc febrile convulsions, mmrv measles, mumps, rubella, and varicella vaccine benefit and risk estimates in terms of number of hospitalisation days in germany ci confidence interval, fc febrile convulsions, mmrv measles, mumps, rubella, and varicella vaccine expected outcomes in other countries or under different scenarios were derived from a sensitivity analysis, which was based on two key parameters: the vaccination coverage of v when co - administered with mmr and the probability of being hospitalised for fc . The point estimate of the hr in terms of hospitalisation days was higher than 1 for scenarios where the probability of being hospitalised for fc was less than 40 times the probability of not receiving v along with mmr (fig . Ci confidence interval, fc febrile convulsions, hr hospitalisation ratio, mmr measles, mumps, and rubella vaccine, v varicella vaccine estimates of the hr in terms of number of hospitalisation days under different scenarios . Ci confidence interval, fc febrile convulsions, hr hospitalisation ratio, mmr measles, mumps, and rubella vaccine, v varicella vaccine in countries where the mean duration of hospitalisation for varicella was different than in germany (e.g. 3 days instead of 5 days), the slope of the discriminating line, which is shown in fig . 2, would be corrected by the same ratio (e.g. 40 3/5 = 24). When considering the line for the 95% ci limit in fig . 2, the results of our analysis using german data suggested that the predicted number of hospitalisation days induced by the increase risk of fc associated with mmrv is lower than that induced by higher risk of varicella infection associated with the mmr + v regimen . The expansion of this analysis to other scenarios beyond the german experience suggested that transitioning from mmr + v to mmrv would be favourable in situations where mmrv use would significantly impact varicella vaccination uptake . For parameter values compatible with the recent experience in germany, the model suggested that transitioning from mmr + v to mmrv would reduce the yearly number of hospitalisation days; although there may be 225 hospitalisation days attributable to vaccine - related fc, at the same time, 1976 hospitalisation days due to severe varicella could be averted by using mmrv instead of mmr + v. when monte carlo simulations were used to evaluate the statistical uncertainty, the median hr was estimated to be 8.5 (95% ci 1.9925.22). Since these estimations were derived from a model based on several assumptions and using heterogeneous sources of data, this quantitative analysis should be used along with other relevant considerations for any overall benefit / risk assessment of mmrv compared with mmr + v. a sensitivity analysis was performed to estimate hr under different scenarios, which were based on existing or hypothetical situations, and could represent other countries or other times when vaccine recommendations or use were different . This modelling approach, with all its limitations, suggested that, in situations where mmrv use would significantly impact varicella vaccination uptake, the use of mmrv instead of mmr + v would be favourable . For any further use of these results, it is critical to consider the model assumptions and assess their relevance before making any decision on the use of mmrv in immunisation programmes . The results are based on a modelling approach with several limitations, including: the model did not consider situations where v was co - administered with the second mmr dose (either as mmr + v or mmrv) if it was not co - administered with the first mmr dose.the assumption of total protection against hospitalisation could have overestimated the benefit measure of the mmrv compared with the mmr + v vaccination regimen.the measures of the burden of both fc and varicella infection that were selected in this analysis (days of hospitalisation and number of hospitalisations) may not have completely captured the severity of the two medical conditions; hospitalisation for fc is generally more a measure of precaution, while hospitalisation related to varicella infection generally indicates a serious medical concern.the model did not take into account the potential impact of the recommendation to administer the first doses of mmr and v separately in germany since 2011 .the model did not take into account the effect of herd immunity, which is relevant in the context of protection against varicella . This is a conservative approach since such an effect would increase the benefit of mmrv compared with mmr + v. the model did not consider situations where v was co - administered with the second mmr dose (either as mmr + v or mmrv) if it was not co - administered with the first mmr dose . The assumption of total protection against hospitalisation could have overestimated the benefit measure of the mmrv compared with the mmr + v vaccination regimen . The measures of the burden of both fc and varicella infection that were selected in this analysis (days of hospitalisation and number of hospitalisations) may not have completely captured the severity of the two medical conditions; hospitalisation for fc is generally more a measure of precaution, while hospitalisation related to varicella infection generally indicates a serious medical concern . The model did not take into account the potential impact of the recommendation to administer the first doses of mmr and v separately in germany since 2011 . The model did not take into account the effect of herd immunity, which is relevant in the context of protection against varicella . This is a conservative approach since such an effect would increase the benefit of mmrv compared with mmr + v. a modelling approach can be used to estimate the overall impact of different vaccine regimens on some specific outcomes . The model used in this analysis suggested that transitioning from mmr + v to mmrv may substantially reduce the number of hospitalisation days, despite the observed increased risk of fc when mmrv was used as a first dose of measles - containing vaccine . This proof - of - concept analysis has demonstrated the feasibility and usefulness of quantitative modelling approaches, based on the combination of heterogeneous data sources, to provide objective, rational, and transparent information . In addition, our model only assessed one of the multiple trade - offs between the two vaccination regimens that need to be considered when making decisions on their use in immunisation programmes . In the future, more extensive research could be performed to address unanswered questions, such as analyses using quality - adjusted life - years as an outcome instead of the length and number of hospitalisations, and analyses taking into account indirect effects, such as herd immunity or increased hesitancy to accept mmrv due to knowledge of the increased risk of fc . Vincent bauchau and lionel van holle are employed by the gsk group of companies and own restricted shares in the company . Carine cohen was employed by the gsk group of companies at the time of this study and owns restricted shares in the company . Glaxosmithkline biologicals sa sponsored this analysis and was involved in all stages of the analysis . Glaxosmithkline biologicals sa also took responsibility for all costs associated with the development and publishing of the present manuscript.
|
Primary lung cancers rarely metastasize to the gastrointestinal tract and frequently present disseminated spreads at the time of the diagnosis . Although the incidence of metastasis to the gastrointestinal tract has been reported to be as high as 11% in autopsy studies according to some reports, solitary metastasis to the stomach from lung cancer is exceptionally rare . We herein report an interesting case of lung cancer with a solitary gastric metastasis which penetrated into the retroperitoneum and mimicked a small adrenal tumor . The patient described in this report was under regular follow - up for small cell carcinoma of the lung . A small tumor was found in the left adrenal area while he was stable and free of symptoms 4 years after the lung cancer had been diagnosed and treated with chemotherapy . This lesion was initially interpreted as an insignificant adrenal incidentaloma and left untreated until its rapid growth was noticed in a subsequent computed tomography check - up performed 6 months later . The patient was treated surgically firstly under the impression of lung cancer with solitary metastasis to the left adrenal gland; however, during surgery this rapidly enlarging tumor was unexpectedly found to originate from the gastric wall and not to be related to the adrenal gland . The patient tolerated postoperative chemotherapy well and had an acceptable general performance during the year after the surgery until metastatic liver tumors were found during a routine follow - up . He received further chemotherapy, and although the treatment course was complicated by several episodes of pancytopenia, he recovered and is still doing relatively well, currently following regular visits to the outpatient clinic . In the past, a patient with lung cancer and gastrointestinal metastasis might have been treated with merely chemotherapy due to poor prognosis; however, according to the experience observed in our patient and two case reports, an active management of the metastasis, such as surgical intervention along with chemotherapy, might still prolong the patient's survival significantly in selective cases of lung cancer . A 47-year - old man with a long - term heavy smoking history presented to the emergency room with an one - month history of progressive dyspnea on exertion, productive cough, marked weight loss, profuse diaphoresis at night, neck swelling and dysphagia in early october 2008 . A chest film revealed a large soft tissue density in the right upper lobe of the lung and remarkable widening of the upper mediastinum . A subsequent chest computed tomography disclosed a large space - occupying lesion in the right upper lobe of the lung encasing the superior vena cava and the right pulmonary artery (fig . Bronchoscopic examination revealed a picture consistent with external compression in the right trachea where the mucosa presented irregularities, narrowing of the orifice of the right upper lobe with suspicious tumor tissue . The pathological report of the tissue biopsy proved it to be small cell carcinoma of the lung . The patient was hospitalized and received radiotherapy to relieve the superior vena cava syndrome, and prophylactic whole brain radiation was undertaken as well . He favorably tolerated six successive courses of chemotherapy with vp-16 and cisplatin later on and had regular follow - ups in the outpatient clinic with a quite satisfactory general performance and relatively good control of the primary lung lesion in the following 4 years . In november 2011, a follow - up chest computed tomography disclosed a small, ill - defined tumor (1.8 1.4 cm) in the left adrenal area (fig . This lesion was initially interpreted as a non - functioning adrenal incidentaloma with no remarkable clinical relevance and was left for observation . However, the patient, who was free of symptoms, underwent a new chest computed tomography follow - up 6 months later (may 2012) and surprisingly a remarkable enlargement of the previously suspected left adrenal tumor was noted (3.3 2.5 cm) (fig . Was then considered and the patient was hospitalized again for surgical intervention by the urologists . Unexpectedly, the surgeons found an intact left adrenal gland, and the tumor was actually arising from the posterior wall of the gastric body and penetrating into the retroperitoneal space close to the left kidney through a defect in the posterior peritoneum, mimicking an adrenal tumor . Laparotomy was immediately undertaken instead, and wedge resection of the tumor from the stomach was performed accordingly . The pathological analysis of the resected tumor revealed identical pictures as the primary lung lesion (immunohistochemical stain positive both for ttf-1 and cd-56) (fig . 3). After the operation, the patient received further chemotherapy with etoposide and cisplatin and had a relatively good general performance in the meantime . In may 2013, exactly 1 year after the abdominal surgery, a follow - up computed tomography showed several metastatic tumors in the liver and additional chemotherapy with topotecan was instituted . Although the patient underwent an eventful clinical course with several episodes of pancytopenia, the chemotherapy could be finally completed and he currently still has regular follow - ups at the outpatient clinic 15 months after excision of the metastatic tumor in the stomach . Primary lung cancer is often asymptomatic, and 50% of patients with lung cancer already have metastases at the first diagnosis . Lung cancer usually metastasizes to the adrenal gland, bone, liver, brain and infrequently to the digestive system [2, 3]. Although most of the reports in the reviewed literature point out that patients with gastrointestinal metastases secondary to lung cancer usually have a poor prognosis and do not survive longer than 16 weeks after the diagnosis, two case reports made interesting observations on the long - term survival of lung cancer patients with metastasis to the stomach [5, 6]. These particular cases are similar to our patient in the sense that they also had solitary gastric metastasis in the absence of general cancer dissemination when the disease was diagnosed that and the solitary metastasis was resectable surgically . According to these two case reports, if these particular patients had received only chemotherapy, the life expectancy would most probably have been shorter than 6 months . It is hypothesized that metastasis to the stomach, as many metastasis, follows a hematological spread, and in these selective cases active management of the solitary gastric metastasis, instead of palliative treatment such as chemotherapy alone, along with adequate control of the primary lung tumor may yield a more favorable outcome . Autopsy studies report an incidence varying from 0.2% to as high as 11% for gastric metastasis . Active and routine screening in search of asymptomatic, early and still resectable gastric metastases is warranted as it might result in longer patient survival . In our patient, this very rare presentation was misleading the correct diagnosis, resulting in a delay of treatment, but even so an active management such as surgical resection coupled with chemotherapy was still adopted for this belatedly recognized metastasis and a remarkably favorable outcome was achieved . Finally, based on the experience with our patient, we suggest that asymptomatic solitary gastric metastasis might be latent for a long time and even belatedly identified, but still deserves to be treated actively for possible favorable patient survival.
|
Intravascular papillary endothelial hyperplasia (ivpeh) is a relatively uncommon benign neoplasm of endothelial cells that has been well described in surgical pathology literature . However, there are only a few published reports on aspiration cytology of ivpeh. [15] all the cytopathology reports underscore the difficulty in making an accurate cytological diagnosis of this entity . The markedly atypical appearance of aspirated endothelial cells, as well as the lack of cell block material for morphological and immunohistochemical evaluation has resulted in misdiagnosis of ivpeh as malignant neoplasm on cytology aspirates. [15] we present a case of ivpeh diagnosed by fine needle aspiration (fna). To the best of our knowledge, this is the first case report where a preoperative cytological diagnosis of ivpeh was rendered . A 55-year - old female patient presented with a progressively increasing swelling, of six months duration, on her left jaw . Past medical history was significant for thyroidectomy for papillary carcinoma diagnosed 2 years ago . On examination, a tender oval mass measuring 1.5 1.3 1.2 cm was noted just anterior to the left parotid gland, overlying the inferior aspect of the masseter muscle . Patient was administered a course of oral antibiotics following which the tenderness subsided; however, the swelling persisted . Ultrasound revealed a dominant soft tissue mass in the left submandibular area, measuring 2.2 1.3 1 cm . Immunohistochemical stains were performed on the cell block material using the ventana benchmark ultra automated immunohistochemistry slide staining system . The smears revealed isolated clusters of pleomorphic polygonal cells and sheets of spindle cells in a hemorrhagic background . Polygonal cells with abundant pale cytoplasm exhibited anisonucleosis, increased nuclear cytoplasmic ratio, overlapping nuclei and irregular nuclear contours [figure 1]. Spindle cells with elongated oval nuclei and scant cytoplasm surrounded metachromatic hyaline globules and hyaline stalks [figures 2 and 3]. Due to patient's prior history of papillary carcinoma, we considered the cytological findings suspicious for malignancy at the time of onsite evaluation and also raised the possibility of recurrence of papillary carcinoma with anaplastic features at the time of onsite evaluation . Subsequent cell block showed characteristic features of ivpeh characterized by papillary cores lined by plump endothelial cells, adjacent to small delicate papillae [figure 4]. Immunohistochemical stains for factor viii and cd34 performed on the cell block material outlined the endothelial cells [figure 5]. Polygonal cells with abundant pale cytoplasm with anisonucleosis, increased nuclear cytoplasmic ratio, overlapping nuclei and irregular nuclear contours (diff quik stain, 400) hyaline stalks with overlying spindle cell with elongated oval nuclei and scant cytoplasm (diff quik stain, 200) metachromatic hyaline globules (diff quik stain, 400) cell block showing anastomosing papillary cores lined by plump endothelial cells and attenuated endothelial cells overlying hyalinized cores (h and e, 200) factor viii immunostain outlined the endothelial cells in cell block sections (ihc, 200) the resected specimen measured 1.5 1.3 0.7 cm and revealed a hemorrhagic cut surface . The characteristic features of ivpeh with numerous areas of endothelial ingrowths and delicate papillae with hyalinized cores covered by attenuated endothelial cells as noted in cell block sections were seen [figure 6]. A cd34 immunohistochemical stain was performed, and it outlined the papillary structures, as well as some of the fibrous tissue at the periphery of the specimen . Histological section of resected tumor showing numerous areas of endothelial ingrowths and delicate papillae with hyalinized cores covered by attenuated endothelial cells (h and e, 200) immunohistochemical stains were performed on the cell block material using the ventana benchmark ultra automated immunohistochemistry slide staining system . The smears revealed isolated clusters of pleomorphic polygonal cells and sheets of spindle cells in a hemorrhagic background . Polygonal cells with abundant pale cytoplasm exhibited anisonucleosis, increased nuclear cytoplasmic ratio, overlapping nuclei and irregular nuclear contours [figure 1]. Spindle cells with elongated oval nuclei and scant cytoplasm surrounded metachromatic hyaline globules and hyaline stalks [figures 2 and 3]. Due to patient's prior history of papillary carcinoma, we considered the cytological findings suspicious for malignancy at the time of onsite evaluation and also raised the possibility of recurrence of papillary carcinoma with anaplastic features at the time of onsite evaluation . Subsequent cell block showed characteristic features of ivpeh characterized by papillary cores lined by plump endothelial cells, adjacent to small delicate papillae [figure 4]. Immunohistochemical stains for factor viii and cd34 performed on the cell block material outlined the endothelial cells [figure 5]. Polygonal cells with abundant pale cytoplasm with anisonucleosis, increased nuclear cytoplasmic ratio, overlapping nuclei and irregular nuclear contours (diff quik stain, 400) hyaline stalks with overlying spindle cell with elongated oval nuclei and scant cytoplasm (diff quik stain, 200) metachromatic hyaline globules (diff quik stain, 400) cell block showing anastomosing papillary cores lined by plump endothelial cells and attenuated endothelial cells overlying hyalinized cores (h and e, 200) factor viii immunostain outlined the endothelial cells in cell block sections (ihc, 200) the resected specimen measured 1.5 1.3 0.7 cm and revealed a hemorrhagic cut surface . The characteristic features of ivpeh with numerous areas of endothelial ingrowths and delicate papillae with hyalinized cores covered by attenuated endothelial cells as noted in cell block sections were seen [figure 6]. Loosely arranged bands of fibrous tissue a cd34 immunohistochemical stain was performed, and it outlined the papillary structures, as well as some of the fibrous tissue at the periphery of the specimen . Histological section of resected tumor showing numerous areas of endothelial ingrowths and delicate papillae with hyalinized cores covered by attenuated endothelial cells (h and e, 200) in 1923, masson described what he thought was a neoplastic process of papillary hyperplasia of endothelial cells and coined the term vegetant intravascular hemangioendothelioma . While the exact pathophysiology is still not understood, nowadays this entity is regarded as an exuberant form of organizing thrombus . It can present as a pure form involving an isolated dilated blood vessel; as a focal change in preexisting vascular lesions such as hemangiomas, vascular malformations and varices, or rarely in an extravascular location, in the setting of a hematoma . It is most commonly encountered in the subcutaneous tissues of the extremities (head, neck and limbs). This process has slight predilection for women and has been reported in age range of 9 months to 80 years . The patient characteristic in the prior reports of ivpeh sampled by fna and current case report are similar in terms of age, sex of the patient and location of the lesion to what has already been described in the histopathology literature [table 1]. Overview of previous case reports of ivpeh and comparison with present case the most important consideration in histological differential diagnosis includes well - differentiated angiosarcoma . In contrast to ivpeh, angiosarcoma is generally extravascular, infiltrative, and shows higher degrees of histological atypia and mitotic activity . The differential diagnosis in cytology specimens is broader and very challenging. [15] in all the prior reports, final cytological diagnosis of malignant neoplasm was rendered [table 1]. This was mainly due to the presence of worrisome cytological features on smears, together with the lack of specific findings for diagnosis . The cases reported by novak et al . And karim et al, were diagnosed as squamous cell carcinomas after fine needle aspiration biopsy (fnab) due to the presence of dense cytoplasm, hard cell borders, pleomorphic nuclei and prominent, sometimes multiple nucleoli . In the case reported by suh et al, pleomorphic polygonal cells were arranged in alveolar or glandular clusters, suggesting anaplastic carcinoma or adenocarcinoma . However, in view of patient's young age, they suggested a diagnosis of metastatic embryonal carcinoma . Jain et al, noted cords and globular forms of hyaline material surrounded by plump endothelial cells and interpreted them as diagnostic of adenoid cystic carcinoma . Garcia - macias et al ., reported two distinct populations of cells in ivpeh . One type had large nuclei, finely granular chromatin, prominent nucleoli and abundant globular cytoplasm, with occasional single cytoplasmic vacuoles . The second type of cells had spindle to oval nuclei with granular chromatin and scanty eosinophilic cytoplasm . This group identified correctly the vascular nature of the cells, but considered it to be probably malignant due to cellular atypia . Our case showed polygonal and spindle cells, as has been reported previously. [15] we also noted focal acinar and papillary morphology, with the spindle cells surrounding hyaline material and hyaline stalks, similar to the ones reported by jain et al . Similar to the prior reports, based on cytological smears alone the lesion in our case was initially suspected to be malignant . Perceived anaplasia and prior history of papillary carcinoma in our case raised the possibility of recurrence of papillary carcinoma with anaplastic features . Recurrences with anaplastic features may occur in patients with prior history of papillary carcinoma or coexisting well - differentiated papillary carcinoma . Unlike our case, the prior cases did not have any cell block material . The presence of classical papillary structures with hyalinized cores and demonstration of cd34 and factor viii positive endothelial cells in the cell block section, in our case, allowed us to reach the correct diagnosis . Surgical excision confirmed the cytological diagnosis . To our knowledge, this is the first report of an ivpeh diagnosed by preoperative fine needle aspiration cytology . Our case underscores the importance of obtaining an adequate cell block to highlight the histological and immunohistochemical features of ivpeh that can otherwise prove to be diagnostically challenging on aspiration cytology and has a significant potential for misdiagnosis as malignant based on cytology smear findings, alone.
|
Pressure ulcers represent a frequent and significant challenge for medical, nursing, and social care systems among the elderly, disabled, and other patient populations.16 deterioration of physical, psychological, and social health due to pressure ulcers within susceptible patients is often devastating7,8 and increases the risk of death.9 while prolonged skin pressure, shear stress, and/or friction are primary causal factors leading to ulcer formation, variability of pressure ulcer risk factors, prevalence, incidence, and prognosis have been observed in different patient populations.13 advanced chronic illness, defined as patients receiving supportive and palliative care,10 combined with nutritional deterioration, weakness, immobility, and skin alterations, is particularly associated with the risk of pressure ulcer development.1,3,10 excessive skin moisture, urine or fecal incontinence, and urinary catheterization are other factors that have previously been shown to increase pressure ulcer incidence in terminally ill patients.3 major surgery may contribute to increased formation of pressure ulcers in patients with colorectal cancer.11 advanced age, alterations to sensory perception, body temperature alterations, as well as poor general and mental health are conditions that can augment the individual risk for pressure ulcer development.3 pressure ulcerations may result from impaired tissue perfusion and oxygenation as sequelae of general health - related conditions12 or local factors (peripheral vascular disease, diminished skin vascular density).13 ischemia - reperfusion injury is an additional major component that participates in cutaneous necrosis.14 wound formation is followed by inflammation that may cause further perfusion deterioration15 and impair wound healing if uncontrolled.16 infection is a common, potentially serious pressure ulcer complication with local and systemic effects.17 nearly all individuals in palliative care are susceptible to pressure ulcer development; thus, risk assessment and prevention strategies are strongly recommended.3 pressure ulcer prevention is an essential component of palliative care for maintaining patient quality of life.1 prevention of pressure ulcer formation has been shown to be a cost - effective endeavor.18,19 studies have shown that treatment costs of severe pressure ulcers are significantly higher than prevention strategy implementation.2,20 in addition, the lack of effective pressure ulcer formation prevention strategies may expose providers to financial liability.21 while there is an increased understanding of the conditions associated with pressure sore development among palliative care patients, the need for further investigations on this important topic has been raised.10 many of the prevention strategies that have been previously described focus on outpatient and acute hospital settings . However, inpatient pressure ulcer prevention strategies remain critical for respite care among palliative patients.1 our objective was to analyze factors associated with the development of pressure ulcers in hospitalized patients with advanced illness . This study was a retrospective analysis of factors that influence pressure ulcers in patients with an advanced illness based on medical records of the palliative care unit of independent public healthcare railway hospital in wilkowice - bystra, poland . The analysis included 329 consecutive patients admitted to the palliative care department between july 2012 and may 2014, with a mean age (standard deviation) of 70.411.8 years (range: 3096 years, median 70.0). Patient diagnosis, treatment, and care were in accordance with hospice care standards of the ministry of health and the national health fund of poland . Prevention strategies were applied uniformly and consistently to all patients (table 1). As part of standard operating procedures, patient admissions were subject to standardized history taking, physical examination, functional assessment, and laboratory tests . In addition, assessment of nutritional status and acute and chronic pain with emphasis on cancer pain was applied . Functional assessment included the barthel index.22 blood tests included complete blood count, electrolytes, uric acid concentration, and arterial blood gas analysis . The patients were evaluated daily, and blood tests were repeated according to clinical indications ., the risk of decubitus pressure ulcer formation was assessed using the waterlow scale,23 assessed daily and the mean calculated . Waterlow scores 10 indicate increased risk of pressure ulcer development, 15 a high risk, and 20 a very high risk . Patients were classified according to decubitus pressure ulcer development: group a included patients who avoided pressure ulcer development, group b included patients admitted to the ward with pressure ulcers, and group c included patients who developed pressure ulcers in the ward . Chi - square test, v - square test, and fisher s exact test were used for categorical variables and nonparametric mann whitney u test was used for quantitative variables to compare patients who developed decubitus pressure ulcers during hospitalization with those who did not . Multivariate binary logistic regression was performed to assess measures associated with decubitus pressure ulcer development: separately for parameters assessed at admission and for mean values of parameters measured serially during hospitalization . Multivariate analysis with backward elimination included variables that yielded p - values of 0.1 or lower in the initial univariate analysis . The kaplan meier method was used to estimate probability of pressure ulcer - free hospitalization in subgroups of patients in respect to selected variables, while differences between these subgroups were assessed with the gehan s generalized wilcoxon statistic . The study protocol was registered with and approved by the bioethical committee of the regional medical chamber in bielsko since our study is a retrospective analysis, patient consent for medical record review was not required by the bioethical committee . This study was a retrospective analysis of factors that influence pressure ulcers in patients with an advanced illness based on medical records of the palliative care unit of independent public healthcare railway hospital in wilkowice - bystra, poland . The analysis included 329 consecutive patients admitted to the palliative care department between july 2012 and may 2014, with a mean age (standard deviation) of 70.411.8 years (range: 3096 years, median 70.0). Patient diagnosis, treatment, and care were in accordance with hospice care standards of the ministry of health and the national health fund of poland . Prevention strategies were applied uniformly and consistently to all patients (table 1). As part of standard operating procedures, patient admissions were subject to standardized history taking, physical examination, functional assessment, and laboratory tests . In addition, assessment of nutritional status and acute and chronic pain with emphasis on cancer pain was applied . Functional assessment included the barthel index.22 blood tests included complete blood count, electrolytes, uric acid concentration, and arterial blood gas analysis . The patients were evaluated daily, and blood tests were repeated according to clinical indications ., the risk of decubitus pressure ulcer formation was assessed using the waterlow scale,23 assessed daily and the mean calculated . Waterlow scores 10 indicate increased risk of pressure ulcer development, 15 a high risk, and 20 a very high risk . Patients were classified according to decubitus pressure ulcer development: group a included patients who avoided pressure ulcer development, group b included patients admitted to the ward with pressure ulcers, and group c included patients who developed pressure ulcers in the ward . Data were analyzed using statistica version 10 (statsoft, inc ., tulsa, ok, usa). Chi - square test, v - square test, and fisher s exact test were used for categorical variables and nonparametric mann whitney u test was used for quantitative variables to compare patients who developed decubitus pressure ulcers during hospitalization with those who did not . Multivariate binary logistic regression was performed to assess measures associated with decubitus pressure ulcer development: separately for parameters assessed at admission and for mean values of parameters measured serially during hospitalization . Multivariate analysis with backward elimination included variables that yielded p - values of 0.1 or lower in the initial univariate analysis . The kaplan meier method was used to estimate probability of pressure ulcer - free hospitalization in subgroups of patients in respect to selected variables, while differences between these subgroups were assessed with the gehan s generalized wilcoxon statistic . The study protocol was registered with and approved by the bioethical committee of the regional medical chamber in bielsko biala (komisja bioetyczna beskidzkiej izby lekarskiej w bielsku - bialej, letter no 2014/07/17/7 july 17th 2014). Since our study is a retrospective analysis, patient consent for medical record review was not required by the bioethical committee . Patients were hospitalized for a mean of 24.831.4 days, ranging from 1310 days (median 14 days). A total of 256 patients (77.8%) died in the ward, while 73 (22.2%) were discharged . In total, 313 patients (95.1%) suffered from cancer: lung cancer (21.3%), colorectal cancer (11.6%), breast cancer (6.1%), brain cancer (5.8%), stomach cancer (5.8%), and other cancer (44.5%). Sixteen patients (4.9%) were admitted because of non - oncological diseases, mostly (13 patients, 4.0%) because of severe chronic heart failure . Two hundred and six patients (62.6%) did not develop pressure ulcers during their stay in the ward (group a), 84 patients (25.5%) were admitted to the ward with pressure ulcers (group b), and 39 patients (11.9%,) developed pressure ulcers while in the ward (group c). Group c and group a (as a control) were included in further analysis (figure 1). Compared to patients who did not develop pressure ulcers during hospitalization (group a), patients who developed pressure ulcers (group c) presented more frequently with colorectal cancer, higher body mass reduction within 6 months, a longer period of physical deterioration, longer pre - admission nursing home residency, lower systolic and diastolic blood pressure, lower hemoglobin level, and higher white blood cell count at admission, as well as lower barthel index and waterlow scores at admission (table 2). Patients directly transferred from other hospital wards presented with lower barthel index scores (29.824.8 vs 40.025.6 points, p=0.001). Individuals who were not transferred directly from other hospital wards had higher probability of decubitus pressure ulcer - free hospitalization (p=0.003) as did those with systolic blood pressure 110 mmhg (p<0.001), waterlow scores <27 points (p<0.001), and barthel index scores 25 points (p=0.003) (figure 2), as well as those with a mean evening body temperature <37c, lowest recorded hemoglobin level 11.4 g / dl, highest recorded white blood cells <13.9 g / l, and lowest recorded sodium level> 134.5 mmol / l (figure 3). Four factors assessed at admission appear predictive for pressure ulcer development in a multivariate logistic regression model: waterlow score (odds ratio [or] = 1.140, 95% ci = 1.0571.229, p=0.001), patients admitted from other hospital wards (or = 2.938, 95% ci = 1.3396.448, p=0.007), hemoglobin level (or = 0.814, 95% ci = 0.6930.956, p=0.012), and systolic blood pressure (or = 0.976, 95% ci = 0.9550.997, five factors assessed during hospitalization appear to be associated with decubitus pressure ulcer development: mean evening body temperature (or = 3.830, 95% ci = 1.7298.486, p=0.001), mean waterlow score (or = 1.194, 95% ci = 1.0921.306, p<0.001), the lowest recorded sodium concentration (or = 0.880, 95% ci = 0.8140.951, p=0.001), mean systolic blood pressure (or = 0.956, 95% ci = 0.9290.984, p=0.003), and the lowest recorded hemoglobin level (or = 0.803, 95% ci = 0.6720.960, p=0.016). Our study analyzed the risk factors of pressure ulcer formation in a heterogeneous group of patients with an advanced illness, with a mean age of 70.4 years and a median age of 70.0 years, hospitalized at a palliative care unit . Most patients passed away in the unit and only a fifth of the patients were discharged . A majority of the patients suffered from advanced cancer and a minority from other advanced illnesses, mainly chronic heart failure . These conditions are associated with a risk of pressure ulcer formation.10 the waterlow scale23 was used to assess the risk of pressure ulcer development . Although its predictive value was found to be limited,24,25 it is still recommended for pressure ulcer risk assessment.26 we observed greater pressure ulcer incidence with colorectal cancer, accelerated body mass reduction during the last 6 months, longer periods of physical deterioration, and longer pre - admission nursing home residency . Further multivariate logistic regression analysis identified four independent factors predictive of pressure ulcer formation at admission: direct transfer from hospital ward, high waterlow score, low hemoglobin level, and low systolic blood pressure at admission . Pressure ulcer development and the association with direct transfer from other hospital wards may be due to the poorer general health status of such patients, who were most likely referred to the palliative care department because of an advanced illness . Low hemoglobin levels may be both a symptom of more advanced disease and a cause of diminished tissue oxygenation . Similarly, blood pressure tends to decrease with chronic disease progression,16 and hypotension may be associated with decreased peripheral tissue perfusion . It is worth noting that hypertensive patients suffering from comorbid chronic diseases are often treated with antihypertensive agents despite very low blood pressure in the context of advanced chronic diseases . Multivariate logistic regression analysis also allowed identification of five other factors assessed during hospitalization and associated with the pressure ulcer formation . We observed that elevated mean evening temperature was a measure associated with pressure ulcer formation . Hyponatremia was not previously considered a factor associated with pressure ulcer formation in patients with advanced diseases . However, there is increasing evidence that the lowest recorded serum sodium level, or hyponatremia, is associated with poorer prognosis in different groups of patients irrespective of underlying disease . Decreased sodium levels, within the normal sodium range, were associated with increased major cardiovascular events and mortality in elderly men without previously diagnosed cardiovascular disease.27 hyponatremia in patients after acute myocardial infarction was shown to be an independent predictive factor for increased long - term mortality.28 among internal medicine department inpatients, hyponatremia was associated with increased 30-day and 1-year mortality, regardless of underlying disease . In addition, a decrease of serum sodium from 139 to 132 mmol / l was shown to correlate with an increased risk of death.29 hyponatremia was also found to increase the risk of falls30 and fractures.8 our observations suggest that decreased serum sodium is a factor in increased pressure ulcer development risk . It could be assumed that hyponatremia is an index of progressive deterioration in patients with advanced illnesses, which also lowers blood pressure, skin turgor, and peripheral tissue perfusion . This finding needs further study as it may have important implications for the care of patients with advanced illness . Hyponatremia in terminal patients has been associated with a wide range of detrimental symptoms and signs.31 establishing the etiology of hyponatremia is essential for treatment . Low serum sodium levels may be caused by inadequately low sodium intake (dietary restrictions, low sodium content in intravenous fluids), excessive sodium wasting (vomitus, diarrhea, cerebral salt - wasting syndrome [csws]), and excessive water retention (syndrome of inappropriate secretion of antidiuretic hormone [siadh], heart, or renal failure).32,33 both diagnosis and treatment of disorders responsible for hyponatremia may be difficult in a palliative patient . Consequently, hyponatremia in terminal patients is frequently of complex multi - factorial and multi - etiological origin.34,35 if hypothyroidism or adrenal insufficiency is diagnosed, hormone replacement therapy is indicated . Cancer (especially of the lung, breast, head, and neck) is frequently associated with siadh or (less frequently) csws . Hyponatremia secondary to congestive heart failure, renal insufficiency, or liver cirrhosis may be resistant to treatment.32 importantly, a review of pharmacological agents, in terms of potential adverse drug reactions, is warranted . Hyponatremia and low blood pressure may be induced by multiple drugs used frequently in palliative patients, including diuretics, selective serotonin reuptake inhibitors, opioids, antiepileptic drugs, neuroleptics, and sulfonylurea derivatives.36 clinicians must practice vigilance when determining appropriate pharmacological and fluid therapy for terminal patients with multiple conditions in order to avoid the development of hyponatremia . As such, introduction of early medication and dietary (sodium intake) review such consideration may prove helpful in avoiding serious complications caused by hyponatremia in palliative care patients . The retrospective nature of this study limited the range of collected data and lacked predefined regular procedures in patient monitoring . In addition, bacteriological cultures were not taken in the patient population studied . Despite these limitations, it seems that our study added new information of potential significance for the prevention of pressure ulcer development in hospitalized patients with advanced illness . Hyponatremia and low blood pressure may contribute to pressure ulcer formation in patients with advanced illness.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.