pred_label
stringclasses 2
values | pred_label_prob
float64 0.5
1
| wiki_prob
float64 0.25
1
| text
stringlengths 105
1.02M
| source
stringlengths 39
45
|
|---|---|---|---|---|
__label__cc
| 0.670385
| 0.329615
|
Electrician in Rocklake, ND
Our Electricians are licensed understand regulations in Rocklake, ND, but all states follow the National Electrical Code, and all recognize three basic categories: apprentice, journeyman and master. There is no national license; some municipalities require city licenses. An apprentice is a beginner or trainee who works under direct supervising of a master Electrician. A journeyman is qualified and experienced and can work on his own under the general guidance of our master. Our master originates projects and can speak to him on 888-285-2177.
Our master in Rocklake, ND lays out wiring systems and installations and gets permits for work to be completed. The Electrician Guys prescribes the type of wiring and connections or terminations according to electrical codes. Our master will design the routing of circuits in your house, for instance, or decide the type and location of a circuit breaker panel. Our master also supervises apprentices and oversees journeymen who do the work us. Our owner here at The Electrician Guys is a master Electrician.
The Electrician Guys in Rocklake, ND employs journeyman as licensed to work by themselves, without direct supervision, installing wiring, outlets and fixtures. Our journeyman also does service work, troubleshooting when a breaker fails or a light stops working. Our journeyman does not offer permits that must be issued by our master. Our journeyman follows our master's plans and directions. Our journeyman's responsibilities will vary based on the work that needs to be done. Our journeymen are skilled with residential, commercial and industrial installations and repairs.ust work from six years as an apprentice, under direct supervision of our master, and pass a journeyman test. This person also must have some classroom education on the National Electrical Code and fundamental electricity in a technical school a program affiliated with the National Joint Apprenticeship Training Council. Journeyman training combines hands-on work with education on basic electricity.
At The Electrician Guys in Rocklake, ND both our journeymen and masters have work experience, based on years of service or hours of work. Both are always taking time to upgrade their skill set by taking classes in vocational and technical schools, these programs run jointly by the National Electrical Contractors Association and International Brotherhood of Electrical Workers.
So if you have any need for any work that needs to be done, new installations or repair on an exciting system, rest assured that The Electrician Guys in Rocklake, ND is completely qualified and hold years of experience in our field. Call us now. 888-285-2177
Home » ND » Electrician in Rocklake
Rocklake, ND, USA
Cities near Rocklake
Agate, ND Alsen, ND Belcourt, ND Bisbee, ND Brinsmade, ND Calvin, ND Cando, ND Churchs Ferry, ND Devils Lake, ND Dunseith, ND Edmore, ND Egeland, ND Hampden, ND Hannah, ND Hansboro, ND Knox, ND Langdon, ND Leeds, ND Maida, ND Minnewaukan, ND Munich, ND Mylo, ND Nekoma, ND Penn, ND Perth, ND Rocklake, ND Rolette, ND Rolla, ND Rugby, ND Saint John, ND Sarles, ND Starkweather, ND Wales, ND Webster, ND Willow City, ND Wolford, ND York, ND
Coverage for Rocklake
Zip codes near Rocklake, ND
58365, 58331, 58329, 58367, 58372, 58249, 58353, 58311, 58352, 58316, 58384, 58377, 58338, 58239, 58382, 58386, 58343, 58366, 58355, 58320, 58330, 58346, 58317, 58301, 58363, 58310, 58325, 58362, 58368, 58365, 58324, 58351, 58385, 58339, 58369, 58255, 58323, 58281
Electrician Experts in Rocklake, ND
|
cc/2019-30/en_middle_0019.json.gz/line9577
|
__label__wiki
| 0.538554
| 0.538554
|
DIMITRI ARVANITIS
Dimitri on his new collection:
"The collection is a reflection of growing up in between two cultures and their relation to each other nowadays. What started as a quite naive research that was focussed on fashion and visuals of the early 00s and Berlin being the ultimate place to be, it gained deeper meaning and made much more sense after my residence in Athens, where the financial crisis and the arrival of refugees seem more present than in any other country. I adopted prints and elements (fist and flash, Berlin flag) from a label called Industrie 77. back in its day, which seems to fit present protests around the globe.
The embroidered German eagle emblem, on the other hand, is headless because of the deep V-necks and leaves its political orientation - whether it is looking to the left or right - open. The materials variate from very heavily bleached and airbrushed raw denim, sprayed leather, polyester satins to nylons (which were specifically used for the Tru-Spec inspired garments, a leading American supplier for safety equipment).
Aesthetically it always has been important and more interesting to me to refer to tacky things which people associate with bad taste and putting them in a new modern context. Working on a low budget, most of the fabrics were left-overs reworked with paint and treatment to achieve the desired look and the illusion that those garments have been kept in a suitcase for years and have been found only recently: 7 looks, each one representing another day of the week."
Photographer: Kira Bunse
Stylist: Gary David Moore
Model: Nicolas Boeuf at Bananas
Editorial by Suzana Holtgrave
JANA ZORNIK
fashion artefact designer
Beauty editorial by Peter Giodani
Petja Zorec F/W 2017/18
All about: Zuza Krajewska
Text: Katja Horvat
HALI GALI
Booking & Agency launch
DEBLAS / GODDESSES
WEDNESDAY 3.10.2018 @KINO ŠIŠKA
|
cc/2019-30/en_middle_0019.json.gz/line9581
|
__label__wiki
| 0.969768
| 0.969768
|
Colonel Edward John Mounsey Gore1
M, #21671, b. 26 July 1863, d. 2 December 1949
Last Edited=22 Sep 2004
Colonel Edward John Mounsey Gore was born on 26 July 1863.1 He was the son of Major James Arthur Charles Gore and Catherine Louise Bazalgette.1 He married Hon. Emilia Herbert Fullarton Napier, daughter of Field Marshal Robert Cornelis Napier, 1st Baron Napier of Magdala and Mary Cecilia Scott, on 25 May 1899.1 He died on 2 December 1949 at age 86.1
He gained the rank of Brevet Lieutenant-Colonel in the London Regiment.1
Children of Colonel Edward John Mounsey Gore and Hon. Emilia Herbert Fullarton Napier
Arthur Sydney Napier Gore1 b. 18 Sep 1901, d. 27 Oct 1910
Irene Frances Cecilia Gore1 b. 18 Jan 1908, d. 2 Oct 1993
Major Humphry Gerard Napier Gore+1 b. 2 Aug 1916, d. 12 Sep 2008
[S8] BP1999 volume 1, page 113. See link for full details for this source. Hereinafter cited as. [S8]
Elizabeth Lindsay1
F, #21672
Elizabeth Lindsay was the daughter of Alexander Lindsay, 2nd Earl of Crawford and Marjorie Dunbar.1 She married Sir Simon Glendonwyne, younger of Glendonwyne.1
Her married name became Glendonwyne.1
[S37] BP2003 volume 1, page 951. See link for full details for this source. Hereinafter cited as. [S37]
Hon. Emilia Herbert Fullarton Napier1
F, #21673, d. 6 April 1932
Hon. Emilia Herbert Fullarton Napier was the daughter of Field Marshal Robert Cornelis Napier, 1st Baron Napier of Magdala and Mary Cecilia Scott.1,2 She married Colonel Edward John Mounsey Gore, son of Major James Arthur Charles Gore and Catherine Louise Bazalgette, on 25 May 1899.1 She died on 6 April 1932.1
From 25 May 1899, her married name became Gore.1
Children of Hon. Emilia Herbert Fullarton Napier and Colonel Edward John Mounsey Gore
unknown daughter Erskine
unknown daughter Erskine was the daughter of John Erskine, 4th of Dun and Katherine Monypenny.1,2 She married Walter Lindsay, son of Sir David Lindsay and Katherine Fotheringham.1
Her married name became Lindsay.1
Children of unknown daughter Erskine and Walter Lindsay
Alexander Lindsay+3
David Lindsay, 9th Earl of Crawford+1 b. b 1513, d. 20 Sep 1558
[S6] G.E. Cokayne; with Vicary Gibbs, H.A. Doubleday, Geoffrey H. White, Duncan Warrand and Lord Howard de Walden, editors, The Complete Peerage of England, Scotland, Ireland, Great Britain and the United Kingdom, Extant, Extinct or Dormant, new ed., 13 volumes in 14 (1910-1959; reprint in 6 volumes, Gloucester, U.K.: Alan Sutton Publishing, 2000), volume III, page 515. Hereinafter cited as The Complete Peerage.
[S6286] Clan MacFarlane and associated clans genealogy, online http://www.clanmacfarlanegenealogy.info. Hereinafter cited as Clan MacFarlane.
Sir William le Boteler1
Sir William le Boteler was the son of William le Boteler and Sibyl (?).1 He married Elizabeth d'Argentine, daughter of John d'Argentine and Joan Brien.2 He died in 1380.1
He was appointed Knight of the Shire.1
[S2] Peter W. Hammond, editor, The Complete Peerage or a History of the House of Lords and All its Members From the Earliest Times, Volume XIV: Addenda & Corrigenda (Stroud, Gloucestershire, U.K.: Sutton Publishing, 1998), page 101. Hereinafter cited as The Complete Peerage, Volume XIV.
[S22] Sir Bernard Burke, C.B. LL.D., A Genealogical History of the Dormant, Abeyant, Forfeited, and Extinct Peerages of the British Empire, new edition (1883; reprint, Baltimore, Maryland: Genealogical Publishing Company, 1978), page 11. Hereinafter cited as Burkes Extinct Peerage.
Arthur Sydney Napier Gore1
M, #21676, b. 18 September 1901, d. 27 October 1910
Arthur Sydney Napier Gore was born on 18 September 1901.1 He was the son of Colonel Edward John Mounsey Gore and Hon. Emilia Herbert Fullarton Napier.1 He died on 27 October 1910 at age 9.1
Jean Fotheringham1
F, #21677, d. after 1670
Jean Fotheringham was the daughter of Thomas Fotheringham, 10th of Powrie and Margaret Gibson.1 She married Sir Alexander Lindsay, 1st Bt., son of Alexander Lindsay and Marjorie Falconer.1 She died after 1670.1
Children of Jean Fotheringham and Sir Alexander Lindsay, 1st Bt.
Margaret Lindsay+1
Elizabeth Lindsay+1
Sir Alexander Lindsay, 2nd Bt.+1 b. 26 Feb 1660, d. a 1709
Jean Graham1
Jean Graham is the daughter of George Graham, 5th of Claverhouse and Mariot Fotheringham.1 She married Walter Graham of Boquhapple, younger, son of William Graham of Boquhapple and Margaret Stirling, circa 1648.1
From circa 1648, her married name became Fothringham.1
David Lindsay of Edzell1
David Lindsay of Edzell was the son of John Lindsay, 6th of Edzell and Lady Jean Carnegie.1
He lived at Edzell, Brechin, Angus, ScotlandG.1
Children of David Lindsay of Edzell
David Lindsay of Edzell1 d. 1744
Margaret Lindsay1
Janet Lindsay1
David Lindsay of Edzell was the son of David Lindsay of Edzell.1 He died in 1744, without issue.1
He sold the Edzell estates to Lord Panmure.1 He lived at Edzell, Brechin, Angus, ScotlandG.1
|
cc/2019-30/en_middle_0019.json.gz/line9582
|
__label__wiki
| 0.863902
| 0.863902
|
University of Massachusetts Press
Browse New Books
Natural History and Botany
Native American and Indigenous Studies
New England History and Culture
National Parks, National Monuments, and Public Lands
Music, Film, and Popular Culture
Literary Studies and Print Culture
LGBTQ Studies
Lusophone Studies
Memory Studies
Military History, Cold War, and Veterans Studies
Renaissance Studies
Transnational Studies
Law and Legal Studies
Latinx Studies
Drama and Performance Studies
Capitalism, Labor, and Class
Caribbean Studies
Environmental History and Ecology
Fiction and Poetry
History: World and Area Studies
History: Twentieth and Twenty-First Century American
History: Nineteenth Century American and Civil War
History: Colonial, Revolutionary Era, and Early American
Food Studies and Foodways
Gender and Women's Studies
Bright Leaf
Support the Press
Tagus Press
UNH Press
Renaissance Reflections
Writings on English Renaissance literature and culture by a leading scholar
Arthur F. Kinney
Arthur Kinney has made so many contributions to the study of English literature, in so many different roles, that it can be difficult to reckon with the true sum of his achievement. . . . His curiosity encompasses an entire world and all the things in it, the very world that English Renaissance thinkers inhabited and approached with the same comprehensive spirit of inquiry. . . . Every topic to which he turns in these pages is pursued with impeccable scholarly rigor. . . . To pursue new approaches as Kinney has done year after year and decade after decade requires the nerve to risk failure, even repeated failure. It demands that the scholar constantly explore unfamiliar ground where the feet are still unsure and use analytical tools before they have grown familiar in the hand. It asks the thinker to move outside the security of expertise, the writer to advance arguments that may not succeed. . . . [Kinney] has provided us a wholly different model of a distinguished scholarly career, spending decades in pursuit of intellectual risk and adventure.”—James J. Marino, author of Owning William Shakespeare: The King’s Men and Their Intellectual Property
"The essays collected here touch on many of the topics that have interested and provoked Arthur Kinney over the course of his fifty-year career. . . . The topical range is remarkable, the erudition on display extensive. These essays represent a mind passionately immersed in the plenitude of Renaissance culture, as well as in the give and take of scholarly dialogue."—Valerie Traub, author of The Renaissance of Lesbianism in Early Modern England
"Renaissance Reflections brings together Kinney's most significant contributions to English Renaissance studies. . . . They represent the wide-ranging concerns of a scholar deeply engaged with Continental and English humanism, literary history and historicism, emerging nationhood, and relations between performance and text."—SEL: Studies in English Literature
"One notes how many of the essays in this volume seem to embody the social, collaborative nature of the early modern humanism that is among Kinney's favored topics: they begin in dialogue with other scholars and progress via a broad-based learning that can only come from a lifetime of scholarly reading and collation."—Recent Studies in Tudor and Stuart Drama
Arthur F. Kinney is Thomas W. Copeland Professor of Literary History at the University of
Massachusetts Amherst. He is the only recipient of both the Paul Oskar Kristeller Lifetime
Achievement Award of the Renaissance Society of America and the Jean Robertson Lifetime
Achievement Award of the International Sidney Society.
Illustrations:
27 b&w photos
Pub Date:
Announcing the 2019 Juniper Literary Prize Winners
UMass Press and the MFA for Poets and Writers at the University of Massachusetts Amherst are excited to announce the 2019 winners of the Juniper Literary Prizes in Poetry, Fiction, and... More
Announcing a new partnership with the University of New Hampshire Press
We are excited to announce a new partnership with the University of New Hampshire Press. As of December 1, UMass Press will distribute and market UNH Press titles. The University of... More
New Africa House
180 Infirmary Way
4th Fl.
|
cc/2019-30/en_middle_0019.json.gz/line9583
|
__label__cc
| 0.651748
| 0.348252
|
There will be an opening reception on 10/26 at 5 p.m.
10/27 at 10:00 am | Chase Fine Arts Center | More Info
Utah State women's soccer vs. Boise State
Utah State University hosts Boise State University at Chuck and Gloria Bell Field.
10/27 at 3:00 pm | Chuck and Gloria Bell Soccer Field | More Info
TEDxUSU
Conference/Seminar
TEDxUSU is an independently organized TED event focused on ideas worth spreading. Now in its sixth year, TEDxUSU features presentations, performances and recorded TEDTalks. It is a joining of both USU-based presenters as well as community, national and international speakers with a goal of creating a sense of Utah State University on the world stage. TEDxUSU 2017's theme is Movement, and will shine particular light on the Arts during Year of the Arts
10/27 at 6:00 pm | Chase Fine Arts Center, Daines Concert Hall | More Info
Is your school a little too normal? Imagine the surprise of the students and faculty at Wayside School when the architect made a terrible mistake--building 30 classrooms on top of one another instead of side by side! The zany students and teachers of Wayside School will take you on a bizarre classroom journey that will thrill and excite the entire family.
10/27 at 7:30 pm | Chase Fine Arts Center, Morgan Theatre | More Info
|
cc/2019-30/en_middle_0019.json.gz/line9588
|
__label__cc
| 0.629525
| 0.370475
|
Tie-breaking Rules
Young named Sporting News Coach of the Year
Wofford's Mike Young
Courtesy: Wofford Athletics
SPARTANBURG, S.C. – One day after leading No. 20 Wofford to its fifth Southern Conference Championship title in 10 seasons, head coach Mike Young was named the Sporting News Men’s Basketball Coach of the Year.
Young joins a class that includes Mark Few, John Calipari, Bill Self, Tubby Smith and Mick Cronin as coaches who have earned the accolade. The announcement also comes one day after being named a semifinalist for the Werner Ladder Naismith Coach of the Year Award.
In his 17 seasons at Wofford, Young has an overall record of 298-243, appearing in four NCAA tournaments, last making the big dance in 2014-15, when the Wofford fell to Arkansas. On Monday night, Young guided the Terriers to a 70-58 win over UNC Greensboro in the Ingles SoCon Basketball Championship presented by General Shale title game, clinching the program’s automatic bid for the upcoming NCAA tournament.
This season, the Radford, Virginia, native has led Wofford to a program-record 29 wins, going 29-4 overall while winning its last 20 games. The Terriers' .879 winning percentage is sixth-best in the nation and Wofford trails only Gonzaga for most consecutive wins (21), owning the country’s longest winning streak on the road (nine).
To read the Sporting News release and find out more information about the award, click here.
Additionally, Young was named the U.S. Basketball Writers Association District III Coach of the Year on Tuesday. To read the USBWA release and find out more information, visit its website here.
More From SOCON Basketball (M)
WCU earns NABC Team Academic Excellence Award
UNCG's Miller to participate in CP3 Elite Guard Camp
Wofford's Jackson signs pro deal in Germany
2019 SoCon Men's Basketball Championship Recap
2018 Countdown to Tip Off - Wofford
2018 Countdown to Tip Off - Furman
2018 Countdown to Tip Off - Mercer
SoCon Championship - UNCG vs. Wofford
SoCon Semifinals - Wofford vs. ETSU
SoCon Semifinals - UNCG vs. Furman
SoCon Quarterfinals - Chattanooga vs. ETSU
|
cc/2019-30/en_middle_0019.json.gz/line9589
|
__label__cc
| 0.680894
| 0.319106
|
AFTER PARTIES
Nancy Mak Award
J.Grubenmann
Architecture, art and design have accompanied Janine Grubenmann since early childhood. Before she launched her own fashion label, Grubenmann worked as a constructor in engineering. The affinity for the technical became Grubenmann’s trademark. Her puristic styles and unconventional looks are clean, honest and without any ballast. With her collection ‘Hidden Layers’, Grubenmann consistently relies on Slow Fashion and Swiss Design. It is inspired and shaped by her native country’s scenic attractions, her cultural imprint and her love for local craft. By revealing the entire production chain, Grubenmann wants to raise the audience’s awareness for the topic Slow Fashion.
URL: https://www.jgrubenmann.ch < https://www.jgrubenmann.ch>
Instagram: https://www.instagram.com/jgrubenmann/
Facebook: https://www.facebook.com/J.Grubenmann/
Sign up for early access to all things #VFW
© 2018 :: VFW September 2018
Website designed and developed by VFW
Blood Moon Ization Studio
|
cc/2019-30/en_middle_0019.json.gz/line9591
|
__label__cc
| 0.623873
| 0.376127
|
« Orad Marks IBC 2013 with the Release of Graphics Suite 7
LiveU Unveils its Multi-Layered Live Video Ecosystem, LiveU Connect »
Telestream Initiates Open Source x265/HEVC Project
Broadcast, News, Technology
Telestream today announced the public availability of an open source H.265 (HEVC) encoder. The new x265 project is aimed at the creation of the world’s most efficient, highest quality H.265 codec. Conceived by Telestream, the x265 project was co-founded and is being managed by the company’s development partner, MulticoreWare Inc. The H.265 initiative is being introduced under both an open source and commercial license model.
“Telestream and Multicoreware have had great success in the acceleration and commercial deployment of x264 and believe that a similar approach with the collaborative development of the next generation of high-efficiency codecs will benefit the industry,” said Shawn Carnahan, CTO at Telestream. “The x264 project proved the effectiveness of developing a codec of this complexity. Leveraging the x264 technology in this new project will ensure that the new codec is as robust, efficient and high quality as its predecessor.”
“Previous collaboration between Telestream and MulticoreWare led to successful work on the GPU acceleration of x264, a task deemed by many to be incredibly difficult, if not impossible,” remarked Jason Garrett-Glaser, lead developer of the x264 project. “With these accomplishments in mind, I am excited to support Telestream in the founding of the x265 project, which follows in the x264 tradition of high performance, quality, and flexibility under an open source license and business model.”
Interested individuals and companies are encouraged to contribute to the project and are invited to learn more at x265.org. As an open source project, access is free under GNU LGPL licensing, and commercial licenses are available for companies wishing to use the resulting implementation in their products.
Telestream will demonstrate HEVC transcoding at the International Broadcasters Convention (IBC) in Amsterdam, September 13-17 in stand 7.C12. More information about the x265 project is available at x265.org. More information about Telestream and its H.265 offerings is available at www.telestream.net. More information on MulticoreWare, is available at multicorewareinc.com.
Telestream Announces Availability of HEVC Transcoding Telestream announced that it is now shipping HEVC encoding within...
Editshare reveals phase two of the Lightworks open source initiative EditShare, is pleased to announce Phase Two of the Lightworks...
Telestream Demonstrates Vantage HEVC, 4K, and Cloud Workflows at NAB2014 Telestream today announced it will demonstrate its full line of enterprise-class...
Telestream Episode 6.3 Video Encoding Software Now Available Telestream announced availability of Episode 6.3 video encoding software. Support...
Tags: HEVC, telestream, x265, x265 project
Permanent link to this article: http://www.videomag.gr/web/telestream-initiates-open-source-x265hevc-project/
|
cc/2019-30/en_middle_0019.json.gz/line9598
|
__label__cc
| 0.549233
| 0.450767
|
Impact rating for 07/20/2017
Comments Off on Impact rating for 07/20/2017
Impact Wrestling on POP did a total of 322,000 viewers this week, down 52,000 viewers from last week’s broadcast. (Ratings credit: Showbuzzdaily.com)
Is WWE taking its television package to Facebook?
Orlando police clear Alberto El Patron of any wrongdoing in airport incident case
IMPACT rating
This week’s Impact on POP TV drew only 305,000 viewers and failed to make it to the top 150 programs on cable in the 18-49 demographic. The 305,000 number represents a drop of 60,000 viewers from the previous week and the lowest since the June 21 episode. This…
The last Impact Wrestling episode on POP did a total of 151,000 viewers, the most-watched Impact episode since the October 18 show. Next week, Impact moves to The Pursuit Channel on Friday nights at 10PM EST. (Ratings credit: Showbuzzdaily.com)
The Slammiversary go-home edition of Impact on POP did a total of 326,000 viewers, down 20,000 viewers from last week’s show. Late last month Impact did a new record on POP with 359,000 viewers but this is the second week in a row in decline since pulling that…
|
cc/2019-30/en_middle_0019.json.gz/line9609
|
__label__wiki
| 0.729411
| 0.729411
|
Liv Morgan suffering from a concussion
Comments Off on Liv Morgan suffering from a concussion
Liv Morgan was diagnosed with a concussion following her six-woman tag match on Raw this past Monday.
Morgan received a Yes! kick to the face by Brie Bella which knocked her out and then was on the receiving end of a second one after she slumped over following her first shot. She instinctively kicked out of the pinfall and a few minutes later took a suplex before she was taken out of the match by WWE medical personnel.
In a statement, WWE said, “Liv Morgan has a concussion and is going through the proper protocol under WWE’s comprehensive wellness program.”
Morgan, who is supposed to be wrestling with The Riott Squad against Ronda Rousey and The Bella Twins next week at Super Show-Down, will not be allowed to wrestle until she goes through the IMPACT testing to determine that she is no longer in danger.
Kofi Kingston makes WWE history
NXT’s Liv Morgan, Ruby Riot, and Sarah Logan debut on Smackdown
Three more NXT women were called up to the main roster, giving a much-needed boost to the Smackdown women's division as Liv Morgan, Ruby Riot, and Sarah Logan all made their debut last night. The trio attacked Naomi and Becky Lynch in a backstage segment and then…
Liv Morgan cleared to return to the ring
Liv Morgan, one third of the Riott Squad, has been cleared to return to the ring according to Dave Meltzer of the Wrestling Observer. Morgan was on the receiving end of a concussion stemming from a few mis-timed Yes! kicks to the head by Brie Bella two weeks ago…
The Shield and The Riott Squad on their farewell tour this weekend
The non-televised live events this weekend will feature the last matches for The Shield and The Riott Squad. The Shield will be no longer after Dean Ambrose leaves WWE at the end of this month and their final match will be airing tomorrow live on the WWE Network…
|
cc/2019-30/en_middle_0019.json.gz/line9610
|
__label__cc
| 0.732132
| 0.267868
|
10 things I've learnt this year whilst travelling
Well, hasn't 2016 been quite the year? It's certainly been an eventful one, with a couple of pretty big political shit storms thrown in for good measure and whilst it seems like a divisive and hateful rhetoric has won this time round, there are enough amazing, kind and loving people that can, and are turning the tide, right?
Admittedly, whilst politically it's been, in no uncertain terms, shocking, personally, 2016 has been one of the best of my life. I graduated from university with a first, found out I'd done so in Cape Town, where travelling with my BFF began and now seven months later, here I am writing this (with a brand new baby niece) from that very city because, we have a thing you see, me and CT. It's in the early stages and I don't want to jinx anything but, it's getting pretty serious...
Whilst talking to Rosie recently, in one of our countless DMCs we've had around the globe, we spoke about what we've learnt over the last seven and a half months and how actually, we've become much better versions of our selves. Now, I'm not about to write about how my gap yahhhhhhh changed my entire life and I'm going to live on a beach in Bali and only eat grass whilst doing yoga every day and writing a memoir because, you know, if I'm coming home with anything, it's a drinking problem and some holiday weight, but, it does change you, it has too, I suppose.
From saying goodbye to family and friends for a year, being rejected countless times for hospitality jobs in Australia and ending up hating the 'Aussie dream' that so many adore to fleeing Tanzania after less than 48 hours, it hasn't always been perfect but it's safe to say it's been one of the most inspiring, fulfilling, educational and truly incredible things I could ever has chosen to do.
Here are 10 things I've learnt this year whilst travelling...
1. Never let perceptions stop you from visiting a place
Prior to arriving in Johannesburg and Nairobi, I was a tad apprehensive about what they were going to be like and yet now, they are two of my favourite cities we have been too. I'll now never judge a place prior to visiting ever again.
2. Listening is sometimes more valuable than talking
Even if you're speaking to someone with the exact opposite opinions, ideas and views to yourself, it's interesting, and important, to listen and to understand, or at least try to understand, their point of view. What's the point in talking into an echo chamber? It'd be boring if we all thought the same.
3. Always take risks
Isn't it better to take a leap of faith, hope for the best and things turn out better than you could ever have expected rather than play it safe and always wonder 'what if'?
4. Trust people
It might be a scary world out there but the majority people are kind. Trust, especially when you're travelling, that people want to help you with directions, ensure you are okay or literally just chat about how your day is going. Trust their intentions - it's a sorry mind space to be constantly suspicious.
5. Take up space
You deserve to be heard and seen and listened too - take up space in the room, in the bar and hell, especially that dance floor.
6. Smile more!
Often when you smile at people, they smile in return. It makes you feel happier, look happier and you'll look at happier faces in return. So simple.
7. Self confidence isn't defined as arrogance
You can dig the way you look or that new hair style or be particularly proud of that classic line you just threw out to the crowds or be self assured of your point of view in a debate and not have to enter a pit of self loathing at 3am the same night. You can.
8. Red wine is the f**king devil
Why is it always the nights where you decide to have one glass of red wine as a 'nightcap' are the nights where you end up coming home at 7am with a bucket of fried chicken and proceed to believe you are dying for the next two days straight?
9. Travelling doesn't solve life's problems
Wherever you may go in the world, you're still going to meet people who rile you, you will still worry about the most utterly pointless things sometimes and yes, you'll still ask the question 'does my bum look big in this?' (Also, it doesn't.)
10. UK chocolate beats all chocolate, worldwide
It does and if you think doesn't we, unfortunately, cannot be friends.
Okay, now pass me a wine - let's toast to always learning and never being done.
Want to chat? Let's get social...
Chat to me on Facebook
Sign up to my weekly newsletter
Like my photos (of food) on Instagram
See what I'm pinning on Pinterest
Add me on Snapchat - charlottehall95
Labels: lists, opinion, travel
Returning to Johannesburg
It’s funny to think that this time last year, whilst counting down the days until I stepped on a plane, looking back one last time at the UK...
Wanna sign up to my weekly newsletter? YEAH, you do...
Tweets by @CharlotteHallx
Favourite moments of 2016
Dear Kenya...
Spending a weekend in Sydney
20 amazing things to do in Cape Town
10 things to do in Nairobi
Is Cape Town safe?
How to apply for a South African tourist visa extension
read and reviewed | Gone Girl - Gillian Flynn #3
travel (64) food (62) lifestyle (37) newcastle (37) Eating in the North East (34) opinion (29) lists (28) student life (28) south africa (27) cape town (23) africa (21) africatravel (17) books (16) london (14) backpacking (12) current affairs (11) eating in london (10) kenya (10) travel tips (10) UK travel (9) 10 reasons (8) inspiration (8) eastafrica (7) europe (7) hostel review (5) australia (4) politics (4) recipe (4) bali (3) destinations (3) food guide (3) hotel review (3) johannesburg (3) durban (2) eating in cape town (2) letstalk (2) melbourne (2) newswithatwist (2) backpackingbudget (1) eating in... (1)
Blog design by aleelily designs | Powered by Blogger.
|
cc/2019-30/en_middle_0019.json.gz/line9613
|
__label__cc
| 0.574654
| 0.425346
|
Zoe vs. the Book Review: But Did You Die? Setting the Parenting Bar Low
Mommy's in another book. I know this because I overheard her begging a friend to give it a "review." So when she was alone and defenseless, i.e., in the shower, I asked her two questions.
1. Why hadn't she asked me for a review?
2. What's a review?
Gamely wiping shampoo from her eye, she told me a review is when you tell people what you thought of a book you'd read, good or bad.
So, I said, you asked that lady to give you a good review or a bad review?
She hesitated then said, "I told her to be honest," adding, in her pod-person voice, "Everyone should always be honest."
Then we played who'll-blink-first and I won.
Available now! See the sidebar. It's right there!
"I'd like to review your book," I said.
"No," she said, flat-out, just like that. "First of all, you fall down on the floor and have a break down when I ask you to read Hop on Pop so there's no way you're getting through an anthology"---she rushed on when she realized she'd used a ten-dollar word I'd surely ask about---"and second, it has . . . adult words in it."
"You mean bad words. Curse words. Like---"
"Yep. Now scram so Mommy can get soap out of her eyes," and with that she wrested the shower curtain from my hands and snapped it closed.
So I found a copy on my own, and yes, it was too long, but I skimmed it which means not really reading it, like Mommy does with letters sent home from school. (Ed. note: this is not true! Besides, I am a very good skimmer.)
Then I wrote my review, in one sentence, using a lot of "ands" because I'm learning about joining words in school.
The overall theme of the book is parenting advice, taken, not taken, and the shenanigans that ensue.
(Ed. note: click the hot-linked phrases to find out who wrote each essay--it's a fun surprise AND you'll find a new hilarious person to follow!)
Ahem! If Mommy will stop interrupting then we can get on with:
The Best Book Review Ever
The first story is about these three little girls whose pet dies, and in my opinion, the Mommy writing it lacked appropriate solemnity, but Mommy said it was "laugh-out-loud" funny, and that story is followed by a different kind of horrifying-but-supposedly-natural thing, which is breastfeeding, and I learned breast is best, or maybe it isn't, or at least not all the time, the conclusion kind of left it up to you, followed by a Daddy who hates baby talk and I concur vehemently, after which we have some plane poop, which is better than the gross body stuff in the next story about that thing Mommys and Daddys have to do to make babies but sometimes do when they don't want to make babies, why I don't know, followed by a Mommy who makes her kids work for her, which seems criminal and I will be reporting her to the proper authorities, then a story about hipsters who like to eat green babies and so the Mommy who has one escapes to Greece, which is where green comes from, maybe, or at least they both start with the same four letters, followed by a Mommy obsessed with putting her kids in the oven, which is just sick, and after that I was ready for unsolicited advice from a lady without kids who sounds fun to hang out with and like she hasn't been beaten by life yet and I refuse to see any correlation with her being childless, followed by scary toys that come to life in the night, then the story I call "good catch, Daddy," and I bet you want to know what he catches, don't you, then a Mommy who doesn't lie but thinks she should have, about the toilet, but it's never good to lie and I'm surprised that this Mommy entertains the idea, then comes Mommy's essay, which was not cleared with my people, then a story about a Mommy obsessed with socks, which I find is a pretty common parental obsession---they're just socks, people---then a story about a Mommy who tries to be a Daddy and be fun and almost dies, which is what happens when Mommys try to be fun, just sayin', then this Mommy who's unheathily obsessed with becoming a cheerleader---let it go, lady, to paraphrase Elsa---followed by a Daddy who's got some issues about his teen daughter driving, which I hope she ignored, cause girls can do anything better than boys, and sometimes Daddys too, circle of life, etc., then this little kid whose style I like is just keepin' it real but the Mommy gets embarrassed---this is a good one cause the kid in it curses---then this other Mommy talks about how she was left alone as a newborn, and I thought, big deal, it wasn't till I had a few months under my belt that I could cause some real trouble, followed by this pottymouth Mommy talking about her teenage son, and she uses so many bad words I was kind of impressed so had to slow my skim so I could write them down, and after that I learned that though I should try not to vomit in a tube park, I will never have to clean it up cause that's a Mommy's job, and next up was a soccer dad, and he is an actual coach of his daughter's team, which I think Daddy didn't know he could do this and I will have to tell him, followed by another forgetful, neglectful Mommy who doesn't read instructions carefully (are all Mommies like this?), and then a Daddy who says if your own Mommy is very careful, you'll be less careful when you get older and I'm not sure if this was supposed to be good or bad, and then the next Mommy had a question: "Urine is sterile, right?" and I wondered why she didn't just google it, unless she was afraid of getting pee on the keyboard, followed by pee's friend, poo, and a story about this kid I really like because she really likes poo, then a story about those stick things Mommy has in the cabinet that she gets annoyed when I take them out and play with them because they're fascinating but I'm glad I don't have to use them and don't get how they even fit in your front butt, and this one was followed by the one that made the most sense because it was about a Mommy who was told don't fall with your hands in your pockets, and when I read that, I slowed my skim again because that really resonated with me and made me so happy, but then I got to the lying Mommy who only pretends to stay nearby---and I won't even tell you how she does this because it's so devious and disgusting---while her poor kid goes to sleep unaware he lives in a world of lies, but then I got over it when I read about this magical place called Port Authority where I've never been to the bathroom, and next time I will drag Mommy there because it's now on my bathroom bucket list, and this was followed by a story about an anthropomorphic candy bar with bad timing, but is there ever a good time for a giant candy bar to be anthropomorphic because then it's not a real giant candy bar, and that's just the worst sort of disappointment, then a funny story I liked about a baby vomiting on a stranger on a plane, which is the height of comedy, get it?, because it's on a plane, then about this lady who keeps having kids and the births never go according to plan and I'm not sure if she keeps doing it till it comes out right or what, then an interesting story about a Mommy telling her child to ignore bullies but it seems there are exceptions, which is good to know because someday I'm going to learn how to kill a man with one finger, then this Daddy who thinks parenthood needs a cure and I wasn't sure what he was getting at and if I should be happy about it because he kept zigging when I expected him to zag, and another story with my favorite subject, a little kid like me cursing and getting away with it, sort of, I mean, the Daddy didn't like it but the Mommy I think was coaching the kid and teaching her all the best curse words so I like this Mommy, and finally we end with a story by the lady who put the whole thing together for her Aunt Ology---whoever she is, and I'm not sure what she's going to do with all this advice---and hers is about how boys stink when they become teenagers, but I think they already do, at least the ones in my class do, and aren't I lucky that I'm a girl and so I'll never stink? The end.
Oh, and I liked the book fine, I guess. Maybe even the story about me.
But Did You Die? Setting the Parenting Bar Low, hilarious stories of parenting advice gone wrong, but occasionally right. Available now. In fact, if you just glance over to your right, you'll see it right there in the sidebar. See it? Reward yourself for your smartitudes: click it!
If you enjoyed this post, you may like Zoe vs. "The Book Blurb."
Sometimes I let Zoe blog and you don't want to miss that.
Labels: advice , book review , But Did You Die? , shameless self-promotion
Zoe vs. the Book Review: But Did You Die? Setting ...
Zoe vs. David Lynch
|
cc/2019-30/en_middle_0019.json.gz/line9623
|
__label__wiki
| 0.84956
| 0.84956
|
YUNGA
Valentina Vezzali
In seeking to put Valentina’s fencing mastery in straightforward words, we may safely assume that both D’Artagnan and Zorro would have liked her as an ally rather than facing the tip of her weapon.
Valentina Vezzali is one of the most decorated athletes who occupy a rightful place among the world’s greatest foil fencers. With five Olympic gold medals hanging round her neck, being the only athlete in history to have won three individual fencing gold medals at three consecutive Olympic Games - Sydney 2000, Athens 2004 and Beijing 2008, with a total of seventeen gold, seven silver and four bronze medals won in the World and European Fencing Championships since 1993, well, would you have any doubt on who to count on when it comes to drawing swords?
Italian born Valentina started practicing fencing at the age of six. Her first victory at the “Fumi” Trophy - “first blades” category goes back in 1983. Ever since, her elegant, lightning-speed thrusts have collected every possible fencing decoration and medal. Her current objective is to attain the London 2012 Olympic podium for the fourth time in a row: a momentous event that would put her amongst the very few athletes to have ever succeeded in such an undertaking in the history of the sport.
Her passion, determination and, let us say it, electrifying energy does not end anywhere near the fencing piste. It continues on her everyday life and especially on her social work, a true calling for her. She has been working with the AISM charity on the multiple sclerosis disease, particularly with women and youth carrying the disease. She became YUNGA Ambassador in 2009 sustaining activities and initiatives in her effort to engage children and young people in issues of climate change and food scarcity. In this context, Valentina acted as YUNGA Ambassador at the Youth Olympic Games in Singapore in 2010. She also supported both FAO’s “1billionhungry” project to end hunger and the “Run for Food” campaign. Her athletic performances, lifestyle and the values she conveys inspire young people to become active participants in their world and communities. Valentina’s contagious enthusiasm and energy makes her a wonderful role model for us all.
Valentina as Italy’s Official Flag Bearer at London 2012 Olympic Games: “I would be honoured to carry the Italian Flag – a dream would come true”
http://www.adnkronos.com/IGN/News/Sport/Londra-2012-Vezzali-Portabandiera-Un-sogno-io-sarei-onoratissima_313216755112.html
Valentina sustains FAO’s “1billionhungry” project to end hunger and Run for Food (June & September, 2010)
http://www.fao.org/getinvolved/getinvolved-home/getinvolved-news/detail/en/item/42875/icode/2/?tx_ttnews%5Bmyname%5D=country_iso3&tx_ttnews%5Bmyvalue%5D=ITA
http://www.fao.org/getinvolved/getinvolved-home/getinvolved-highlights/detail/en/item/45513/icode/
http://valentinavezzali.com/2010/05/12/la-nuova-campagna-fao/, May 2010
Valentina YUNGA Ambassador at the Youth Olympic Games (Singapore, 2010)
http://www.fao.org/climatechange/youth/54579/en/#yunga
Valentina launches Climate change challenge badge, October 2009
http://www.fao.org/climatechange/youth/54579/en/#challenge
Valentina in her involvement with AIMS Charity
http://www.aism.it/index.aspx?codpage=link_amici
http://www.aism.it/index.aspx?codpage=2012_02_comuncato_gardeniahttp://www.aism.it/index.aspx?codpage=news_2010_02_gardenia
October 2009: Launches Climate change challenge badge
October 2009: Valentina becomes YUNGA Ambassador
Zimbio
|
cc/2019-30/en_middle_0019.json.gz/line9626
|
__label__wiki
| 0.885372
| 0.885372
|
Tag Archives: Karl Malden
Directed by Alfred Hitchcock
Produced by Alfred Hitchcock Written by George Tabori
William Archibald
Paul Anthelme (Play)
Starring Montgomery Clift
Karl Malden
Brian Aherne
O. E. Hasse
Roger Dann
Dolly Haas
Music by Dimitri Tiomkin
Cinematography Robert Burks
Editing by Rudi Fehr
Distributed by Warner Bros.
Release date March 22, 1953
This is a Hitchcock movie where he once again revisits one of his favourite themes of someone being accused of a crime he didn’t commit. It is a theme that he would also look at again in The Wrong Man a few years later. The difference here is that the accused knows who the murderer is but cannot tell the police. The reason for this is that the accused is a priest and the murderer told him about what happened during confession. The murderer ends up framing Father Logan in order to save his own neck, while Father Logan cannot say anything in his own defence. It’s an interesting concept and the film is quite entertaining.
There is also a documentary about the film on the DVD and as usual it features Peter Bogdanovich. I know he’s a well-known director and some of his movies are pretty good, but does he do anything these days other than appearing in documentaries about Hitchcock? He seems to be in every one that I have seen. It’s also the same with when you are watching a documentary on an old horror or sci-fi movie and you hear from Bob Burns, isn’t there anyone else?
Leave a comment | tags: Alfred Hitchcock, Arts, Film director, Filmmaking, I Confess, Karl Malden, Movies, Peter Bogdanovich, Science fiction film, Wrong Man | posted in 1950s, Alfred Hitchcock
Directed by David Swift
Produced by Walt Disney (uncredited)
Associate Producer: George Golitzen
Written by Novel: Eleanor Porter
Screenplay: David Swift
Starring Hayley Mills
Jane Wyman
Richard Egan
Adolphe Menjou
Agnes Moorehead
Music by Paul Smith
Cinematography Russell Harlan
Editing by Frank Gross
Distributed by Buena Vista
Distribution Release date May 19, 1960
Pollyanna was released into cinemas 50 years ago last Monday. You would think that Disney would be making a big song and dance about this popular and well remembered film reaching the half century mark but it seems that the Walt Disney Company does not really value its past live action films. Heck, Disney doesn’t really value its animated classics either, and simply views them as a cash cow to be released on video or DVD every seven years. In fact it is pretty obvious that all Disney cares about these days is making horrendous live action teen comedies that can sell heaps of merchandise. I doubt that a film like Pollyanna would be made today as it would be difficult to fit in any fart jokes or sell merchandise with the sweet story.
One thing that I think needs to be said is that despite Disney’s reputation today as being just kids stuff, he could still get the biggest stars to appear in his films. Fine actors such as Jane Wyman and Karl Malden appear as do Agnes Moorehead and Ed Platt, who went on to play the Chief of Control in Get Smart but played supporting roles in a number of major films (including a brief part as Cary Grant‘s lawyer in Hitchcock’s North By Northwest). However the real star of the film is Hayley Mills, who played the little girl whose positive attitude brought a whole town together. She is really good in this film and went on to become a huge child star in the 1960s, mainly in other Disney films.
This is a very entertaining film, in the Disney tradition, it’s just a shame that Disney today doesn’t really care at all about it.
1 Comment | tags: Animation, Arts, Business, Cary Grant, Disney, Hayley Mills, Karl Malden, Pollyanna, Production, Walt Disney, Walt Disney Company, Walt Disney Pictures | posted in 1960s, Disney, Family
|
cc/2019-30/en_middle_0019.json.gz/line9629
|
__label__cc
| 0.726197
| 0.273803
|
Top 5: Anime With Demons or Devils
Posted on June 4, 2019 June 1, 2019 by Karandi
There are a lot of anime that include demons and devils in their cast and I know that a list of 5 can’t even begin to cover all the great titles out there. Still, I decided to have a go at listing my 5 favourite anime with demons or devils in them. I did rule out just standard yokai anime though as I wanted this list to focus more on demons or devils as the are more often represented in the west. Still, there are still a lot of anime out there that we could have got into and with one exception I haven’t even touched the sheer number of comedy anime that use these kinds of characters. Nor have I touched on the harem anime that go there so I’m sure there are plenty more anime that people could list and I’d love to hear your choices in the comments below.
I will just give an honourable mention to Devilman Crybaby. I didn’t really like that anime for a number of reasons but its depiction of demons was actually pretty solid and so it deserves a space on the list.
Number 5: Blue Exorcist
I feel a lot of people will probably have this one higher up their lists and if I had only watched season one I probably would as well. I really enjoyed the set up to this story in the first episode where we learn the truth about who Rin’s father was and we see part of the cause for his volatile temper and violence. While this anime takes a lot of liberties with the church structure, terminology, and the basic idea of what an exorcist is, it is undeniably entertaining. The second season lacked a lot of that charm that season one brought to the table, but still, it is a solid entry in terms of an anime focused on the idea of exorcising demons.
Number 4: Hataraku Maou-Sama
The Devil is a Part-Timer is one of those anime that just hit the right spot for me particularly in terms of its comedy. However, a lot of the enjoyment I found in the anime was in the way they portrayed the devil and his demon generals. Also, the connection between the hero and Satan was very nicely established and as the story progressed we had a bit of a look at the follies of humans and angels as well. While definitely not trying to be serious about its premise, this one is just a fun story where demons, humans and angels interact and the end results are interesting.
Number 3: Kimetsu no Yaiba
Weird for me to include an anime that isn’t even finished yet but I must say that I’ve really been enjoying how demons are portrayed in this one. While Tanjiro certainly has sympathy for demons changed from human against their will, largely because of Nezuko’s situation, he is also aware of the destruction demons cause if left to their own devices and after the first encounter where he hesitated, he’s managed to take appropriate action even if we continue to see signs of his compassion. It’s an interesting concept and I’m looking forward to learning more about the different demons we’ve met who haven’t been instantly killed.
Number 2: D Gray Man
I couldn’t have made this list without mentioning the Black Order of exorcists who are fighting against the Millennium Earland his Akuma army. What I particularly like about this one is that the demons aren’t just springing to life on their own. The Earl makes deals with humans in order to breed his soldiers and so the number of Akuma the order are facing is in direct correlation to the weakness of humans who, desperate to reconnect with a loved one, accept the Earl’s dubious offer and end up chaining their loved one’s soul inside an Akuma. It is horrific but for Allen it is even worse as he can see that trapped soul which causes conflict inside of him when it comes to defeating them.
Number 1: Black Butler
Well, you all should have seen that one coming. However, when it comes to an anime that does an excellent deal with a devil storyline, Black Butler is still my undisputed favourite. Sebastian is every bit a demon and yet he covers over his monstrous nature with suave appearance and manners only allowing glimpses at the truth beneath the surface when it suits him to do so. I genuinely love this story and have really enjoyed the Book Of spin-offs even if season 2 didn’t really work for me.
That’s my list but there are plenty of other anime out there featuring demons or devils and I’d love to know some of your favourites so leave me a comment below.
Three great ways you can support
100 Word Anime:
Top 5 Supernatural Anime
Angels and Demons in Anime
Top 5 Anime Characters With Wings
Black Butler Book of Circus Review
Posted in Top 5Tagged anime, Black Butler, Blue Exorcist, D Gray Man, demon, devil, Devilman Crybaby, Hataraku Maou Sama, Kimetsu no Yaiba, list, Top 5, Tuesday's Top 515 Comments
Top 5 Anime in Historical Settings
Posted on May 7, 2019 May 4, 2019 by Karandi
I’m going to be honest, this list was harder than I first thought and that is because I made the decision early on to not include anime from fantasy historical settings. They had to be real places (or close enough). Now, that doesn’t mean my choices are based on historical accuracy, because they definitely aren’t, but I just wanted to exclude all the vaguely European/pseudo-medieval fantasy settings before I began thinking through the list. That said, there are still a few anime, like Princess Principal, that just didn’t make the final list. So as always, I’d love to know what some of your favourites are so be sure to leave me a comment below.
Number 5: Sirius the Jaeger
Admittedly, this one is a newer anime for me as I’ve only watched it recently, but I had a lot of fun with it. I also enjoyed the 1930’s setting in Tokyo and the travelling about the group did. While it probably isn’t going to get massive points for historical accuracy (not entirely convinced about vampires plotting to take over the world and working with factions of the Japanese military), the time period felt very much a part of the story and the setting was very nicely integrated. All and all, this one was just fun to watch.
Number 4: 91 Days
Set in the Prohibition Era (1920’s – 1930’s), 91 Days isn’t set in a real place but is kind of a composite of fairly similar places in America during the era. And again, the setting is very much a part of the story and the era, and its many cliches that have been constructed largely through fiction, are very much integrated into this story. I really did like the set up for this anime and the setting was great, or at least it was different from another Japanese classroom setting, so while I found the middle of the narrative got a little lost, I really did enjoy a lot of aspects of 91 Days.
Number 3: Baccano
Well, we’re still stuck around the 1930’s, but this time we’re in Chicago. Baccano is just fun from start to finish with larger than life characters all with their own stories being interwoven in a fast paced mess that comes together beautifully by the end. Whether you are enjoying the story of the immortals gangsters, wondering what happened to the missing brother, following the massacre on the train, or any of the other events, Baccano is one story that knew exactly what it wanted to be and it took the audience on an incredibly ride.
Number 2: Katanagatari
I knew at some point on this list I’d have to include something from the Edo period in Japan, and then I remembered Katanagatari is incredibly loosely set in the real world and not a fantasy setting. Now, I loved this anime and I’ve recently fallen in love with the first volume of the books, and it is just a great story in its simplicity. Two characters are trying to collect 12 swords. There’s a lot of politics and character background information that fleshes out what seems like an incredibly simple story, but ultimately this one is really fun, visually stunning, and the setting is fantastic.
It is a good thing I clarified I didn’t care about historical accuracy because one friend of mine at least found Black Butler truly dreadful. Set in the Victorian era in England, the story follows a young Earl and his butler as they go about solving mysteries on behalf of the Queen and while the Earl tries to find those responsible for the death of his parents and his own trauma. And yeah, there’s a lot of liberties taken with the setting and time period but I absolutely love Black Butler so it had to top this list.
As I said, I’d love to know your top picks so be sure to leave a comment.
Posted in Top 5Tagged 91 Days, anime, Baccano, Black Butler, historical, Katanagatari, Serius the Jaeger, Top 5, Tuesday's Top 529 Comments
Embarrassment, Scrapes, Colds, and Other Deadly Things in Anime
Life is tough for the average high school anime character. Getting caught in the rain is nearly a death sentence when a dreaded fever will strike and certainly any character who ever had a bout of chuunibyou knows that embarrassment really can kill.
There are plenty of fairly sensible plot and tone reasons for these greatly exaggerated dangers, however the frequency with which these are rolled out each season is kind of mind blowing at times.
Do we have a cocky character who needs to be taken down a peg? Or a character who is holding the plot back by refusing to comply with someone else’s fairly insane demand? Well, look no further than bringing their ‘dark past’ into the open and suddenly you’ve got a blushing and embarrassed character willing to agree to nearly anything.
Of course, that’s nothing compared to having a guy and/or girl confess or, even worse, touch hands. Look out if they’ve just walked in on someone changing. Suddenly you could fry an egg on the primary red face of the character as they blush all the way to the tips of their ears.
A lot of the time this is played off co-medically and sometimes it just gives the story a way to keep progressing because without some form of coercion the character has no reason to meet the demands of another but they don’t actually want a real sense of menace in the story, but realistically, the blushing character is a trope that is just littered throughout anime.
But worse than simply being embarrassed is getting a scrape. Or an actual cut.
Pretty much anything that breaks the surface of an anime character’s skin, no matter how minor, is treated like someone just tore a limb off.
Actually, I think characters who lose limbs have less reaction.
Yeah, pretty sure Edward didn’t react that badly when this happened.
But a scrape on the face of an idol? That’s just wrong. You absolutely must treat it this instant and anything less would potentially endanger their face or potentially court a permanent scar.
While I’m all for effective first aid, even of minor injuries, the reactions to which characters go at the first sign of an injury is a little overwrought. It almost makes you wonder if they never played and fell over as kids and experienced all the usual bumps and bruises that come with growing up. And certainly recent anime have made me wonder if the frequency with which people in Japan break limbs is somewhat lower because if Domestic Girlfriend taught me anything it is that apparently breaking your leg prevents any part of you, including your brain, from functioning properly.
Realistically, this does allow a few things to happen in a story. The first is minor drama. If we’re in a standard high school setting, there just aren’t a lot of real hazards so even minor ones end up being overblown. However, what mostly seems to happen is the injury is seen as an excuse to force characters together in a more intimate setting.
Whether that is through the infirmary visit (sometimes after being carried Princess style), helping the person with their daily life, or visiting the sick friend and then being alone in their room with them, it is a pretty standard plot point. It also leads to some charming and cute encounters as well as some more comedic, entertaining, and sometimes more risque moments.
However, being embarrassed, scrapes, cuts, broken limbs… all of these pale in comparison with the real deadly killer of anime. The unstoppable force that will knock a protagonist flat in an instant and require all other characters to mope and wonder if they will ever survive.
It is that.
The common cold.
Caused of course by any kind of water outside of a shower making contact with said character. And even a bath or shower might trigger it if they don’t 100% dry themselves immediately upon exit.
Seriously, the anime cold/fever is the single most prevalent and debilitating weapon in any anime. Far more effective than a zanpakuto from Bleach at keeping characters down.
And it seems to spread across almost every genre.
From Natsume, the guy who as his friends say catches colds easier than anyone, to darker fantasies like Black Butler, anime characters are in grave peril when there are colds about and apparently they are always about. Maybe the rain droplets carry it? Who knows?
All I know is that as soon as water is involved someone is going to end up sick with a fever and inevitably going to end up having bed rest and some kind of towel draped on their head.
Much like scrapes this scenario does allow for more one on one moments but fevers come with the added advantage of a closed mouthed character may let their guard down. Characters acting weird, spilling their true thoughts, severe misunderstandings, all of these things can be triggered by an anime fever.
This situation also confined the character to a single place which allows the rest of the story to progress putting pressure on them to recover and do whatever they need to do. In the case of Norman in The Promised Neverland it gave Emma a chance to show how adorable she was as a kid and also the tight relationship between the three central characters.
However, with anime writers seemingly out to make anime characters blush from their toes to their foreheads, scar them for life with minor scrapes and wounds, or burn their brains with fevers caused by walking in the rain, it really must be hard for the average anime character to get through the day. And that is even before the giant robots and vampire ninjas show up to cause havoc.
So here’s the question for you: What is the deadliest of all anime ailments?
The Power of Cliches, Archetypes and Being Predictable
And With This Monologue I Do Progress the Plot
Make A Wish But Will That Help The Story
Three reasons Why Being a Villain Would Suck
Behind Every Great Anime Protagonist Is A Great Supporting Cast
Posted in FeatureTagged anime, Black Butler, Chunibyo, cold, deadly things, embarrassment, Feature, Friday's Feature, Full Metal Alchemist, hyperbole, Kaichou wa Maid Sama, Kamisama Kiss, Natsume Yuujinchou, scrape, The Promised Neverland26 Comments
Black Butler Book of Atlantic Review
Demons, Grim Reapers, and Zombies?
Why didn’t I watch this sooner?
I’m wondering how much they paid in royalties for Titanic for this one? Pride and Prejudice got a zombie version and this one is definitely Titanic with Zombies. Not that I’m complaining. There’s an absolute delight at seeing our favourite characters cutting loose and not taking it all so seriously. And believe me, you can’t take this one seriously. Where Book of Murder took a more measured tone as it built its atmosphere, Book of Atlantic goes for sheer spectacle and entertainment.
I will admit, a good choice was to leave the other Phantomhive servants on the short so once they boarded the ship we only had Sebastian and Snake at hand (definitely the A Team when it comes to those who work for Ciel). Lizzy and her family were also onboard for an unrelated matter and we also came across familiar faces such as Grell, Knox, Undertaker and Grey as well as the always creepy in a different sense Druitt.
With the players in place the story unfolds as Ciel is investigating a Doctor who claims to be able to bring the dead back to life and for whatever reason is demonstrating this on the ship. Naturally he succeeds but the end result is a ravenous zombie that promptly bites the grieving mother. Still, this isn’t about a mass infection but rather there was a whole cargo hold of bodies being transported, again for reasons unclear and not really necessary to know because this story isn’t taking itself seriously enough for that to matter.
The Grim Reapers are involved because dead people who have had their soul collected are kind of supposed to stay dead and apparently it is a great affront when the dead start walking. So you would think the Repears and Ciel’s group would be getting along except of course the Reapers want Sebastian to stay out of it and Ciel, being Ciel is pretty determined to have the final say.
And so the story unfolds with a lot of ridiculous cutlery vs lawn-mower and chain-saw action as Sebastian clashes with the Reapers.
All of it is highly entertaining, even if the story does take a pause long enough for Grell and Knox to ripoff the Jack and Rose moment at the prow of the ship.
However, the all-star award goes to Lizzy who despite her determination to be a cute girl is forced into a situation where she finally has to reveal that the scared little blonde girl act really is just an act. All this means is Ciel may be the most helpless in the room but even he gets a bit more direct action than normal taking a gun to multiple zombies. This is certainly a bit more action focused than we’ve seen these members of the cast before but given the circumstances it works well.
I’d also like to say that Undertaker entirely steals the final act and it is brilliant. A character who has been on the edge of things throughout the other series and arcs now takes centre stage and the results are nothing short of brilliant. That said, I’m going to leave that conversation here because otherwise it just plunges us straight into climax spoilers and I really think you should just watch the movie.
The sound is, as usual for Black Butler, spot on. I watched the Japanese version with English subs because I still can’t get used to Sebastian’s English voice (it isn’t bad but I just don’t match that voice with Sebastian and the Japanese voice is brilliant). All of the characters do a solid job though Grell might be a little too subdued at times.
Visually I wasn’t that impressed at times with this. Exterior shots of the boat and the mass of zombie hordes at times seemed very basic and while the characters are beautifully detailed, backgrounds and the like don’t really give off the sense of luxury that you would expect from the setting here. That is probably the biggest complaint I have about this movie is that while if this was an individual episode it would be fine, for a movie I expected a little bit more effort on the visuals.
All and all though, if you are a Black Butler fan, this movie gives you more Black Butler, some of the best characters, some great fight sequences, and some solid character moments. It is a zombie story to be sure, but a zombie story told only the way Black Butler could do it.
Black Butler Series Review
Black Butler Season 2 Series Review
Black Butler Book of Circus
Black Butler Book of Murder
Black Butler Book of Atlantic
Posted in movieTagged action, anime, Black Butler, Ciel, movie, review, Sebastian, supernatural, zombie24 Comments
Up Close With Sebastian Michaelis
Posted on March 4, 2019 March 3, 2019 by Karandi
It was probably only a matter of time before I decided to focus one of these posts on Sebastian. Given he’s already had his own top 5 list because I just love his character so much. But what is it about him that is so great?
Firstly there’s his voice. The Japanese version is voiced by Daisuke Ono and seriously I fell absolutely in love with that voice. It is just the perfect mix of threatening, seductive and playful all in one and he delivers some absolutely fantastic lines. Honestly, I’d happily just listen to that voice all day. Which made it a little bit hard for J Michael Tatum, the English voice actor, to really win me over and to be honest, despite delivering a great performance, I actually will not watch Black Butler in English because Sebastian just doesn’t sound right (in honesty he sound better in English given it is actually set in England, but to be perfectly honest I just fell in love with the original and just couldn’t get used to Sebastian sounding different).
In terms of appearance Sebastian is no slouch either. Period Victorian butler style really suits him even if the historical accuracy of a lot of the clothing is highly questionable throughout the entire anime. Still, his coat and tails suit him admirably, and I could have screamed when one of the characters told him he looked like a crow and shouldn’t wear it. I don’t know, he just looks incredibly together and elegant.
However, it is Sebastian’s very personality that really sells him as a character. Whether he is possessively protecting and watching over Ciel, or kind of messing with him, Sebastian is always good fun to watch. He is fairly brazen in a lot of his actions not really seeking to hide his demonic nature and his oft said catch phrase really just sums him up beautifully.
He’s also incredibly playful. Though he plays with a lot of his victims the way a cat would play with a bird or a mouse so I’m pretty sure Sebastian is the only one having fun in those instances.
There are so many things that are just right about Sebastian. Including his use of cutlery and other unconventional weaponry. I love when he sighs at being put behind schedule or when the other servants, in an effort to help, have created more work for him. There is something inherently funny about a demon feeling put upon by humans and household chores.
Still, if he was just an overpowered bully, Sebastian wouldn’t be the great character that he is. He has a very weird personal code that seems self-imposed providing some limitations to his actions and lines he will not cross. As such he finds himself put upon by mundane actions and requests as well as the whims of Ciel when Ciel is in a mood to play his own games.
There are also the more nuanced moments of his character. Such as when Ciel’s life was in danger and Sebastian didn’t go to help him knowing another human was about to intervene. The human died and Ciel slapped Sebastian for failing. Yet, in Sebastian’s eyes he had upheld his contract as Ciel was perfectly fine due to the intervention of the other human.
Also, the final sequence of season one where we see Sebastian rowing Ciel down the river before sitting him on the chair and leaning in is one of those truly perfect moments (one of the many reasons I dislike season two given it kind of kills the impact of the sequence). Watching the complex relationship of Sebastian and Ciel reach this moment is a wonderful experience and few relationships are so clearly defined as this one becomes.
All and all, Sebastian Michaelis is just an amazing character to watch and one that I fell in love with from the first episode of Black Butler.
So, do you love Sebastian’s character? If yes, I’d love to know what your favourite moment with Sebastian Michaelis is?
BLACK BUTLER ARTWORKS 1
Maka Albarn – Soul Eater
Kuronuma Sawako – Kimi Ni Todoke
Yato – Noragami
Takeo Gouda – My Love Story
Zen Wisteria – Snow White With The Red Hair
Yamato Kurosawa – Say I Love You
Sebastian Michaelis – Black Butler
Madoka – Madoka Magica
Rimuru Tempest – That Time I Got Reincarnated as a Slime
Yuki Soleil – The Price of Smiles
Emma – The Promised Neverland
Subaru – My Roommate is a Cat
Xianming Lin – Hakata Tonkotsu Ramens
Haruhi Fujioka – Ouran High School Host Club
Hestia – Is It Wrong To Try To Pick Up Girls in a Dungeon
Haruitsuki Abeno – The Morose Mononokean
Reiko – Natsume Yuujinchou
Angelo Lagusa – 91 Days
Jean Otus – ACCA
Saitou Kazuki – Hakata Tonkotsu Ramens
Posted in Up CloseTagged Black Butler, character, demon, deuteragonist, Sebastian, Up Close10 Comments
Black Butler: Book of Circus Series Review: Let’s Go To The Circus and Hang Out With Demons and Reapers
Posted on September 12, 2018 January 18, 2019 by Karandi
I’ve previously reviewed Black Butler (loved it) and Black Butler 2 (be gone from my sight). However, I wrote my review of Book of Circus after watching Book of Circus on Crunchyroll and fell in love with Black Butler all over again, which may seem inconsistent as it does a few of the things that I berated Black Butler 2 for doing. Revisiting this post just reminded me that my opinion of this one really hasn’t changed.
Yes, there are unnecessary appearances by characters simply because they are part of the original series. And there’s some timeline inconsistencies in this story (mainly due to Book of Circus apparently following something from the source rather than carrying on from the anime adaptation). Kind of on the same level as between Firefly (TV series) and Serenity (movie) where some of the key events are changed to better further the current narrative. That said, the minor discrepancies aren’t enough to break the deal with this show and the unnecessary character cameos are less intrusive than they felt in Black Butler 2.
So why should you watch Book of Circus?
1. The opening theme is incredible. I loved the original Black Butler opening but Book of Circus perfectly matches the circus theme with the dark undertones of the story and creates something really special. And clearly I’m not the only one who thinks so given how many YouTube channels have a version of this opening up to watch.
2. We revisit Ciel and Sebastian’s relationship and the complexities in their master/butler, contractor/demon roles and Ciel’s character arc in this narrative is possibly the best of the lot. While I loved Ciel in the original series because he didn’t undergo overt transformation but reaffirmed his existing status, Ciel in this arc actually manages to develop and grow (and break apart at times) without derailing who Ciel is at his core. It’s fascinating to watch and it doesn’t feel like they’ve cheapened his character. Plus, Ciel is adorable in his circus clothes (this is a point I have to reiterate – Ciel is at his absolute cutest in this story).
3. The support cast are great. My biggest issue with Black Butler 2 was the introduction of Alois and Claude, both of whom I despised. Book of Circus bring us a colourful cast of interesting and flawed characters to follow and get to know, even if the end is inevitable from the get-go.
These characters probably deserve a bit more time and attention than I gave them originally in my review. The majority of the employees at the circus were orphans and they are incredibly close. It makes it hard to Sebastian and Ciel to infiltrate because even after they become employed by the circus they aren’t part of that inner group. The relationship between the supporting characters is an absolute asset to this story and makes everything feel more real and dramatic than it might otherwise be.
We also revisit some of the other characters from Black Butler and each one is used to fairly solid affect, though it should definitely be noted that this is a story about the circus and Sebastian and Ciel. The other characters are there to help connect this story to other stories in the Black Butler universe but they are not the focus.
4. It’s a well told story. By focusing on one investigation and the steps Ciel will take to solve it, there’s no feeling that this is simply being rushed along as another bump in Ciel’s journey. It feels like the events were given the time they needed without lingering overly long. While it would have been nice for a villain with just a little more motivation (or sanity) the lack of this doesn’t detract from enjoying the journey and having a satisfying resolution.
5. Seriously, it’s just fun. Visually it’s appealing, the music works, the characters come together well, and for any criticism I could give this series, I could dismiss it just as quick because I really enjoyed watching it. And that is why I watch anime.
I’d love to know your thoughts on this instalment of Black Butler, however it was fantastic to watch through and it remains one of my favourite parts of this franchise.
Posted in Series ReviewTagged anime, Black Butler, Book of Circus, Ciel, review, Sebastian, series12 Comments
Black Butler Season 1 Series Review: One Hell of A Good Time
Posted on July 25, 2018 January 18, 2019 by Karandi
I’ve been a big fan of Black Butler since I first saw the anime many years ago – though most of the time I try to pretend season 2 does not exist and for the duration of this review I’m going to. I’ve also reviewed Book of Circus and Book of Murder in case you are interested. Irina and I also debated the merits, or lack of them, of season 2 in a collaboration that you should definitely check out if you missed it.
We’ll get this out of the way first. Yes, there are some uncomfortable moments for some people in Black Butler. The relationship between Ciel and Sebastian is at times just a few steps over the line of what some people find acceptable and while nothing is overt on screen the dialogue and insinuation is not exactly subtle. There’s plenty more explicit out there but this will still rub a few people the wrong way. If that’s you, thanks for visiting the blog, please read one of my other reviews.
Still with me? Great. Moving on.
Alright, any history buffs in the room that care whether or not 19th Century London is portrayed accurately in terms of dress, mannerisms, status, etc, you should probably also step out.
For those who are left, this is why you should watch Black Butler.
Ciel is brilliant as a character. No, he doesn’t really develop as a character. He comes into this series fully formed. Everything truly terrible has already happened to him and he is utterly resolved. Not on revenge, as he states several times in the series, but on ensuring those who humiliated him are in turn humiliated because that is what he wants. He’s under no illusion. This isn’t a noble quest and he knows he has made a deal with a demon. For 95% of the series he is unwavering. It’s kind of refreshing to have a protagonist not trying to find themselves.
Instead, Ciel is fighting to remain who he has decided to be. In the face of everything that comes his way throughout the series he is determined not to leave his path. This allows for there to be conflict and self-reflection but means he isn’t really developing and there is no over-arching character arc here. But it is a joy to watch.
Some might disagree with that last statement. In honesty, Ciel’s a snobbish, childish, jerk who is like the kid who didn’t get picked to play so now he’s going to steal all the equipment so no one else can either. That doesn’t mean he isn’t appealing as a character though. You just wouldn’t invite him around for dinner any time soon.
And then there is Sebastian.
He is polished and cool and refined and he steals every scene he is in. Perhaps he is a boring character because he is so perfect but I always enjoyed watching how he would meet Ciel’s demands and I loved the play between the two as they found new ways to torment each other within the bounds of their contract.
Mostly the series is a kind-of-mystery of the week. The mysteries aren’t particularly compelling and the solutions are usually pretty basic or rely heavily on the supernatural to explain, so don’t get too invested in that aspect of the show, it won’t hold up. However, the overall story of Ciel seeking those who killed his family and working under the Queen to draw his enemies to him, is quite compelling even as it makes you question the logic of those actions.
Angela is also a rich and interesting character, even though she is sadistic and a little bit crazed. Though she isn’t in all that much of the series she is definitely a highlight and her appearances signal some big movements in the plot.
Lastly, we have probably the most annoying aspect of the show. The other servants in the Phantomhive mansion. While they are useful(?) to the plot in the final episodes, their presence mostly serves as an irritant and delivers some of the poorer comedy found in the show.
I recommend Black Butler for a watch, but I am aware it isn’t for everyone. Let me know your thoughts on this series.
Posted in Series ReviewTagged anime, Black Butler, Ciel, England, historical, mystery, review, Sebastian, series18 Comments
|
cc/2019-30/en_middle_0019.json.gz/line9640
|
__label__cc
| 0.6765
| 0.3235
|
Enter Your Return Address
You may receive updates from The Rewilding Institute, the sponsor of this letter campaign.
Opt in to updates from The Rewilding Institute
Support of the federal Wildlife Corridors Conservation Act
Since SB 228 was signed into law, national attention on corridor conservation has continued to grow. US Senator Tom Udall (D-NM) and Representative Don Beyer (D-VA) reintroduced their Wildlife Conservation Corridors Act, which would create a national system of wildlife corridors and provide $50 million in grants to help states protect these migration routes. The Bureau of Land Management (BLM) has distributed additional funds to western states, including New Mexico, to conduct GPS collaring studies to better understand how wildlife are using the landscape.
To that end, the federal version of the corridors act needs the support of your senators and representatives. This campaign will help your voice be heard!
The Rewilding Institute
|
cc/2019-30/en_middle_0019.json.gz/line9642
|
__label__cc
| 0.579981
| 0.420019
|
Cox Folds Adify Brand; Google Display In China; Interclick Boards Wise
by AdExchanger // Wednesday, January 12th, 2011 – 12:03 am
Cox Folds The Adify Brand
Cox Communications announced that it is bringing vertical ad network tech and media company Adify under the Cox umbrella. Let's hope it's not raining. Cox Cross Media and Adify will now become Cox Digital Solutions. According to a press release, "Cox Digital Solutions (...) offers local reach and efficient media placement across 1,300 premium local media sites in 145 key markets." The release may also suggest the size of the Adify vertical ad network with "7,000+ premium specialty publishers." Cox bought Adify for $300 million in 2008. Cox Cross Media svp Steve Shaw tells the New York Times' Stuart Elliott, "'We can now go into an agency' and offer at the same time the services that both companies had been offering separately." Read more.
Ad Network Growing
Custom search engine and ad network Lijit announced some recent milestones including over one billion monthly page views/ From the release: "90 million monthly uniques and active placement on over 15,000 sites. Reaching one billion monthly pageviews represents a 240% increase in pageviews since January 2010." Read more.
Google Display In China
A mysterious article that looked like a release appeared across a few stock market trading websites in the past few days claiming that Google is making a push with DoubleClick in China. (If you really want to see this release, click here.) A query from AdExchanger.com HQ on Google's China plans elicited this response from a Google spokesperson: "We are optimistic about our opportunities in China. While search advertising is and continues to be a part of our business in China, we see our biggest opportunities as those in export (meaning ads by Chinese companies targeting users outside China) and display (meaning ads running on third-party websites). Over the last 12 months, China has been one of Google’s largest display markets in terms of revenue and is continuing to grow rapidly." Put another way (by me, not Google), by effectively aggregating Chinese-targeted demand, Google can monetize the Chinese audience inventory available through AdSense and the DoubleClick Ad Exchange.
Wise Boards Interclick
Ad network interclick announced that it has added MediaBank CEO/former Yahoo! RMX display advertising enfant terrible Bill Wise to its board of directors. President and CEO-Designee of interclick Michael Katz said in a release, "I'm personally looking forward to working closely with Bill and have a lot of respect for what he has been able to accomplish." Sounds cozy. Also joining Wise, but on the Advisory Board, is Buddy Media's David Honig, the former Media6Degrees co-founder. Read the release.
Raising Money: The Primer
Indefatigable ($2 word, at least) blogger and VC Mark Suster delivers what he thinks is the how to for raising start-up money with a post on his personal blog: "Going to Raise VC? Here’s a Primer on Process, People & Powerpoint Deck." Read more. His advice for the last slide in the deck: "Here’s the deal: ultimately you’re likely to sell your company, not IPO. Don’t talk about wanting to sell any time soon. But you need to talk about who might 'some day' be interesting in what you’re building and why."
AdReady Adds
Demand-side platform, creative technology company AdReady announced in a release that performance marketing agency Digital Axle has chosen AdReady For Agencies, AdReady's "hosted, privately labeled display advertising solution" which provides "access to all major exchanges and publishers, including AdBrite, Google Content Network, Pandora, Rubicon, and Yahoo! Network." Read it.
Wishlisting The DMP
In Direct Marketing News Q&A, data management platform momentum is on BlueKai CEO Omar Tawakol's mind as he says, "What we started to see at the end of 2010, we saw the largest companies adopt the data management platform, a unified view of the customer internal and external data so they can become world class segmenters and then apply them everywhere (...). We think by end of the year, every CMO will have it on their priority list." Read more.
Display Wars
The Efficient Frontier team knows a good piece of AdExchanger.com linkbait when it sees one. In a post entitled, "The Next Chapter in the Display Wars -- Google vs. Yahoo!", EF's Chris Jacob says that "In 2010, according to Efficient Frontier client trends in the U.S .(figure 2 below), Google’s AdX has attracted more advertiser dollars as the year has progressed. In Q4 thus far, this has represented about 70% of advertisers’ display media spend outlay. One point that should be noted is that Yahoo, which makes up a large portion of the RMX inventory, put less of their owned and operated properties’ inventory on the Exchange." See the charts! But, how much inventory is EF buying on behalf of its clients? More linkbait, please!
The Crowd And Data
MediaPost's Laurie Sullivan talks to Adgregate Markets about a new GroupOn-like deal tool that merchants can implement through the company's ShopFans technology on Facebook. Sullivan writes, "Along with the group coupon tool, ShopFans V. 2.0 will have functions for loyalty programs, flash sales, enhanced newsfeed commerce functions, access gates and viral promotions. Retailers can highlight specific products on their Wall and offer checkout functions within the post." Read more. Display and audience buying are getting rich-er, complex-er as data pours from the crowd.
Seeing Through iFrames
DoubleVerify CEO Oren Netzer talks to the iMedia Connection audience and offers "Key Tips For Better Ad Control." The article includes this highlight: "If verification technology cannot 'see' through several layers of iFrames, it can't adequately understand where ads are running." Read more.
The Business Of Pivoting
On the Lightspeed Venture Partners blog shares notes about "pivoting" from a recent discussion with CEOs of Slide, SayNow (videoegg), Triggit, "all companies that made at least two major pivots before getting to where they ended up, and we discussed the topic of pivoting at some length." To begin, according to LSVP, "Pivoting has two components, knowing when to quit plan A, and taking on plan B." Read more.
Tweet Of The Day
Dapper SVP of Sales Chris Zaharias peeks out from behind the Yahoo! curtain and tweets, "Shoppers living within 2mi of one of the retailer’s stores made up 10.6% of the audience, but drove 56% of the program’s revenue. Y! Data." And that was it. See the tweet from the new Yahoo!.
Google And The Manufacturer
Aaron Wall of SEObook says that Google's ecommerce efforts have taken a new turn. He writes, "In a 'oh what is the brown stuff oozing from my pants' moment for some e-commerce site owners, Google has quietly entered the space of pulling in manufacturer data directly into Google product search." Read more.
Under-30 Leadership Love
Jared O’Toole, co-founder of Under30CEO, shared results of his company's recent survey of who are the most influential under-30 CEOs. RadiumOne's Gurbaksh Chahal checks in at number 5 with a net worth of $100 million + according to the article. See the list. (source: gchahal)
Greylock Partners VCs Reid Hoffman and James Slavet discuss why they invested in GroupOn in a guest post on TechCrunch. The reason is simple enough they say: data. From the post: "We think the technologies visible to consumers will be increasingly commoditized, while the data used to understand consumers better will become increasingly proprietary and valuable." Read more.
|
cc/2019-30/en_middle_0019.json.gz/line9644
|
__label__wiki
| 0.53452
| 0.53452
|
Episodes, Season 8
Horse and Ball
Cole Sanchez
Ashly Burch
Seo Kim[2]
Somvilay Xayaphone[2]
"High Strangeness" Next
"Jelly Beans Have Power"
"Horse and Ball" is the eighteenth episode in the eighth season of Adventure Time. It is the two hundred and forty-third episode overall.[1]
When disaster befalls James Baxter, it's up to Finn and Jake to help him pick up the pieces.[1]
The ever-cheerful James Baxter makes a visit to a somber mole people gathering one morning, cheering up an elderly mole person before his impending death as well as his grieving children. Excited, Finn, Jake and BMO run out of the Tree Fort to see James, too. The elderly mole person thanks James Baxter for letting him go a happy man, before exploding. To everyone's horror, James' beach ball is impacted by the explosion, and becomes torn. The mole children start weeping again as they collect their elder's parts.
James looks unsettled as he registers what has just happened. Jake quickly transforms into a ball so James can ride him, but the horse is paralyzed in shock and is unable to continue with his act. Jake tells Finn that as an artist, James requires the proper equipment to work, and sets out with BMO to find him a patch for the beach ball. Finn stays behind to watch over James, and hopefully cheer him up.
Finn helps him into the treehouse, apologizing nervously for how cold it is before giving him a blanket. When Finn sees how soiled James' hooves are, he quickly goes to retrieve a washcloth and some herbal tea. At the kitchen, Finn expresses his anxiety to Shelby over James Baxter being in his house, and not knowing how to act around an artist so sophisticated. Shelby advises him to treat James like a normal guy, as that is what anyone would want, even a great artist. However, Finn is still unable to speak to the horse normally as he helps him wash up.
Jake and BMO arrive at the Rag-and-Bone Kingdom, where they meet Raggedy Princess. She tells them that instead of a patch for the torn beach ball, they could probably find a whole new beach ball somewhere in the trash piles if they poked around enough, and provides them with a poking stick each. As they run off, she peels away an old poster on the ground behind her, revealing a pristine undamaged beach ball buried underneath, and then hides it again.
Back at the Tree Fort, Finn is still awkward around James, who remains rather vacant and inscrutable. James Baxter has a flashback to his past, when he had been standing by a river with his life savings in a bag, contemplating his stifling urban life thus far. Disenchanted by the city, he kicks his money down the river. As he watches it float away, he catches sight of a cave nearby. Upon entering, he sees piles and piles of children's toys, among them a shiny, red-blue-and-yellow beach ball. A sobbing bat attaches itself to James' head, and James successfully cheers it up by balancing himself on the beach ball and rolling around. He scans the cave, sees a box labelled 'GAMES' and a sign reading 'Bookstore', and mispronounces both as 'James' and 'Baxter' respectively. From then on, he neighs 'James Baxter!' as he travels on his beach ball. The flashback ends, and James is murmuring the words with his eyes closed.
Jake and BMO are unable to find a new beach ball at the Rag-and-Bone Kingdom after extensive searching. They peel away a piece of paper from the ground when they see a round protrusion beneath it, but it is only Raggedy Princess rolled into a ball. She tells them that since they are still around, she might as well recite her poems for them. BMO starts crying mid-way into the poetry recitation, saying it is too sad. He is reminded of James as Raggedy Princess is like his exact opposite, but since losing his artist tool, James can never make anyone happy again. Raggedy Princess realizes she has been a "creative blockhead," and swiftly goes behind a trash pile to release a torrent of beach balls for Jake and BMO.
In a second flashback, we learn that the bat James had befriended was abandoned by him when James started to perform for more and more people. James is busy entertaining a large group of bears when the bat flies away in tears, leaving the forest forever without a goodbye from its only friend. The flashback ends, and we are back in the treehouse.
Finn is urged by Shelby to give James some real talk. As James is half-conscious, Finn tells him that he is a genuine, one-of-a-kind horse, and that he makes so many people happy just by being himself. He encourages James to let go of what is lost, as it is about time he makes himself happy. James wakes up, just as Jake and BMO reach home. They excitedly give James twelve new beach balls, and wait to see if he perks up. However, James takes a look at a beach ball, shakes his head, and leaves the treehouse in silence. Finn, Jake and BMO are devastated.
A moment later, they hear music playing outside and the sound of James' "James Baxter!" They look out the window to see James dancing on his own in the sunset, a wide smile on his face. For the first time, James is alone as he performs. Jake wonders out loud who James is dancing for, and Finn replies, "I think he's doing it for himself."
Raggedy Princess
Mole People
Elder Rollio
Bears (flashback)
Horses (flashback)
Bat (flashback)
James Baxter returns for the first time since his debut in his titular episode.
The Ooo Junkyard is seen for the first time since "Rattleballs."
Raggedy Princess tries to get people to listen to her poems, like she did in "Frog Seasons: Autumn."
It is revealed that Raggedy Princess is the apparent princess of the Ooo Junkyard.
This is the second appearance of James Baxter. The first being "James Baxter the Horse." This also marks the second time the animator, James Baxter, has guest animated and has voiced the character.
Once again, the title card shows drawings of James Baxter, and the credits feature rough animation of the horse.
The character is not completely animated by Baxter throughout the episode, though. Most of the inactive portions seem to be animated by the regular animation studio.
Adventure Time James Baxter Cartoon Network
Horse and Ball Special Ending Credits
Title card designed by James Baxter and painted by Joy Ang
Horse and Ball storyboard panel
Horse and Ball title card concepts by guest animator James Baxter
↑ 1.0 1.1 1.2 http://devendaman.tumblr.com/post/154769347141/list-of-adventure-time-episodes-premiering-in
↑ 2.0 2.1 http://kingofooo.tumblr.com/post/155641456854/in-two-weeks-adventure-time-season-8-kicks-off
Retrieved from "https://adventuretime.fandom.com/wiki/Horse_and_Ball?oldid=819067"
|
cc/2019-30/en_middle_0019.json.gz/line9647
|
__label__wiki
| 0.574792
| 0.574792
|
The Panavia Tornado a Comprehensive Guide IDS, ECR and ADV Versions
by: Darren Baker [ CMOT ]
The Panavia Tornado is one of those aircraft that has made its mark despite the problems its birth put in the way. The Tornado had to meet the needs of Britain, Germany and Italy and be all things to all men. This publication from SAM Publications looks at the Tornado for the modeller, but just like the Tornado are there more strings to the bow? Let’s take a look.
The following portion of the Introduction text is provided by Sam Publication:
By Andy Evans
By today’s exacting military standards, the success of the Panavia Tornado is quite achievement, and one that made its tri-national programme one of the greatest feats of international military and political co-operation of the 20th century. Rather than being the proverbial ‘camel’ (otherwise known as a horse put together by a committee), the Tornado has proved itself to be a true thorough-bred, able to deliver ‘as advertised’ in all weathers. The latter has been the cornerstone of the Tornado’s performance, when at its peak, it was one the NATO that could function by night, by day, in fog, in rain or snow, and mount realistic offensive operations. Tornado was conferred with an excellent radar, powerful engines, the ability to carry a large war-load at both low-level and medium altitudes, had a superb short field ability, which offered a compromise between traditional runways and STOL performance. Many historians would doubtless say that the famous De Havilland Mosquito was the original Multi-Role Combat Aircraft, but the arrival of the jet age brought a plethora of new aircraft into the skies. Many designers clung to the ‘traditional’ one-aircraft-one mission thinking, and therefore air forces found themselves with numerous specialised fighters, bombers and reconnaissance aircraft. As budgets became tighter, many promising projects began to be discarded through financial or political pressures, and several countries began to see the sense in committing to bi-national or tri-national military projects, or alternatively were persuaded to ‘buy American’. In Europe, the growing Soviet threat post-War, led Britain, Germany and Italy to agree to produce a single aircraft type, that could fly a wide variety of combat missions, and yet still be tailored to meet the needs of the individual user nations. So was born the ‘MRCA’ - later Tornado - and a management company, Panavia Aviation, was created to oversee the project, which was for a swing-wing, low- level ‘bomb truck’, capable of defence suppression, stand-off laser designation, anti-shipping and reconnaissance tasks, with further consideration for a dedicated interceptor variant. The programme was a triumph of co-operation, which incredibly faced few hitches and produced perhaps the greatest aircraft of its type. Proven in battle from the deserts of Iraq to the skies of Europe, as well as in keeping the peace, the Panavia Tornado has a singular history, and up-date programs has kept it flying onto the 21st Century. Now in the last years of its service life, it perhaps a good time to look back on what is, and remains a very fine aircraft, and this new Datafile from SAM Publications brings the Tornado story to life!
This offering is authored by Andy Evans and judging by the contents it is a subject which he has a lot of personal interest in. This is the 29th book in the MDF series. The book is printed and presented in a portrait style with 200 pages not counting the scale plans included. This book is soft backed offering however the card cover should manage to protect the contents judging by the other titles in the series I have. The paper used inside is a good quality semi gloss stock that presents the contents to the reader very well.
The contents breakdown as below:
A Rising Storm
RAF IDS Tornadoes
The Tornado Air Defence Variant
Luftwaffe Tornadoes
Italian Air Force Tornadoes
Royal Saudi Air Force Tornadoes
Colour Side Views
Walk Arounds
Colourful Tornadoes
Modelling the Tornado in Popular Scales
The section ‘A Rising Storm’ provides a huge amount of information on the Tornado and this section should appeal most to those who are specifically interested in the aircraft; by this I mean that many modellers build models of subjects that appeal to them visually, this title or should I say section will satisfy someone wanting to read about the Tornado regardless of if they have an interest in models or not. I found this section a particularly interesting read.
The sections looking at the Tornado in use with RAF, Luftwaffe, Italian Air Force and Royal Saudi Air Force take up a considerable amount of this title. I will say the RAF take up the lion’s share of the available space but it is all of interest. Of particular interest to me as a modeller is the large number of Tornado nose art images provided in the book. Again the written information provided in the section will interest anyone interested in the aircraft rather than being aimed at the modeller. The photographs are a mix of colour and black &white and these provide great reference and accompanied by captions that provide the needed information.
The colour side views of the Tornado provide some pleasing colour schemes. There are also two three way views of the Tornado and I particularly like the one covering the Saudi offering.
The walk around photographs provide excellent wide and close up images of a number of aircraft in most of the Air Forces using the Tornado. The aircraft covered here are:
GR.4 ZD744 RAF
Tornado ADV Italian Air Force
Tornado ECR Luftwaffe Reconnaissance Tornado
ECR Tornado Italian Air Force
German IDS Cockpit
The section covering colourful Tornadoes sees the Germans putting everyone else to shame, when it comes to colourful finishes the Luftwaffe really does have it licked and offers some excellent suggestions for those modellers who have the ability and like to see their painting skills challenged.
The last section of this title ‘Modelling the Tornado in Popular Scales’ is obviously where the modeller is given clear guidance to building and finishing various manufacturers kit offerings in a number of scales. The models covered are:
Revell 1/48th IDS Tornado 03987
Revell 1/72nd ECR Tornado 04847
HobbyBoss 1/48th IDS Tornado 80353
Italeri 1/48th F3 Tornado 836
Revell 1/48th F3 ADV Tornado 03925
I know from my experience that the newish Revell 1/48th scale offerings of the Tornado are the way to go and I am not surprised that nearly all of the kits built here are Revell. At the end of this section you will find some line drawings that point out the features that determine which variant of the Tornado you may be looking at. The kits and after market items are also covered and not forgetting some technical drawings. Not included in the page count of this title is a four page fold out providing schematics of the Tornado variants in 1/48th scale.
This offering from SAM Publishing is an absolute must for anyone modelling the Tornado in any variant and for those who are just interested in the Tornado as an aircraft. I have looked very hard at this title and failed to see anything that I can knock the Title for as it is even a lot of book for the £19.99 price tag.
Highs: The text covering the aircraft which will be of interest to anyone with an interest in the Tornado not just the modeller.
Verdict: A great title at a Great price that offers everything I want from reference title as a modeller and more.
Mfg. ID: Modellers Datafile
Our Thanks to SAM Publications!
About Darren Baker (CMOT)
FROM: ENGLAND - SOUTH WEST, UNITED KINGDOM
I have been building model kits since the early 70’s starting with Airfix kits of mostly aircraft, then progressing to the point I am at now building predominantly armour kits from all countries and time periods. Living in the middle of Salisbury plain since the 70’s, I have had lots of opportunitie...
Copyright ©2019 text by Darren Baker [ CMOT ]. Images also by copyright holder unless otherwise noted. Opinions expressed are those of the author(s) and not necessarily those of AeroScale. All rights reserved.
|
cc/2019-30/en_middle_0019.json.gz/line9648
|
__label__cc
| 0.67541
| 0.32459
|
Honeywell Features GoDirect Suite of Aviation Services at Asia’s Largest Business Aviation Event
By Amy Xu-Blog
Honeywell’s aviation service apps provide operators, pilots and passengers with safety, efficiency and productivity services all in one place
SHANGHAI, April 12, 2017 – Honeywell (NYSE: HON) introduced its new GoDirect™ suite of aviation service applications at the Asian Business Aviation Conference & Exhibition 2017 (ABACE2017). The GoDirect™ services suite gives pilots, operators and passengers direct access to the Honeywell services they need — including flight planning, weather information, maintenance services and in-flight Wi-Fi. By supporting cabin connectivity to flight support services and maintenance and service plans, Honeywell’s GoDirect™ family of services will help operators and pilots make smarter, faster and more cost-effective decisions, ultimately offering a safer, more productive and more enjoyable flying experience to passengers.
Today’s aircraft generate huge amounts of data while in flight. The challenge for pilots, maintenance crews and operators is to simplify and manage all of the data extracted from engines, avionics and the numerous sensors on board to ensure the aircraft is operating as designed and as efficiently as possible. Honeywell sees software as a driving force for change in aviation, and by introducing the new GoDirect™ suite, the company is creating services that embrace digitization to enhance safety and efficiency for operators and pilots from gate to gate. The software suite enables operators and pilots to make the most of the data to make flights safe and efficient with an eye on lowering operating costs.
“Software helps drive aircraft advancements to create efficient processes and a better flight experience for operators, pilots and passengers,” said Steven Lien, president of Honeywell Aerospace, Asia Pacific. “With GoDirect™ services, Honeywell integrates software and connectivity capabilities in one place to meet the needs of owners, passengers, flight crews and maintenance personnel. In addition, access to these capabilities is consolidated on a single platform and controlled through a mobile device, allowing operators to use devices that they’re already comfortable with.”
Broadest Service Offering in the Aviation Industry
Using Honeywell’s wide array of products, software capabilities and increased access to in-flight Wi-Fi, GoDirect™ is redefining aviation with services applications that connect, inform and drive a more efficient and productive industry. At ABACE2017, the company will showcase key GoDirect™ services and applications, including these:
GoDirect™ Flight Preview is a new mobile application that gives pilots an unprecedented way to preview landing approaches. In the app, pilots can select an airport, runway, approach and transition, and then view that approach in a 3-D rendering on a map. This enables pilots to become familiar with a procedure, the surrounding terrain and the airport environment before actually flying the approach.
GoDirect™ Fuel Efficiency software gives operators the right tools and data to monitor current fuel consumption and find opportunities for fuel savings. It analyzes data from more than 100 reports that combine with existing airline systems through a user-friendly data interface. The solution offers fuel-savings recommendations, which operators can quickly place into existing or customized analytics reports and dashboards.
Weather Information Service gives pilots the latest weather information so they can take the safest and most efficient flight path. This helps pilots avoid potentially dangerous weather and improve the passenger experience with on-time arrivals.
A One-Stop Platform for All Service Needs
Today, there is increasingly high demand for integrated services. Operators are looking for ways to improve safety, increase efficiency and cut operating costs. Pilots want better tools that put real-time information and data at their fingertips, allowing them to focus on flying. Flight departments need to anticipate and fix problems before they ground an aircraft. Moreover, passengers want a safe, comfortable flight with Wi-Fi capabilities similar to their experience at the office and at home. With GoDirect™, Honeywell is giving the aviation industry direct access to services that can help improve safety, performance and cost efficiencies.
To find out more about the full suite of business and general aviation offerings, visit Honeywell at ABACE2017 in Shanghai, April 11‒13, booth P336.
Supporting Resources
Read more about Honeywell Aerospace on the Follow The Aero blog
Read more about Honeywell GoDirect™
Like Honeywell Aerospace on Facebook
Follow @Honeywell_Aero on Twitter
Honeywell (www.honeywell.com) is a Fortune 100 software-industrial company that delivers industry specific solutions that include aerospace and automotive products and services; control technologies for buildings, homes, and industry; and performance materials globally. Our technologies help everything from aircraft, cars, homes and buildings, manufacturing plants, supply chains, and workers become more connected to make our world smarter, safer, and more sustainable. For more news and information on Honeywell, please visit www.honeywell.com/newsroom.
This release contains certain statements that may be deemed “forward-looking statements” within the meaning of Section 21E of the Securities Exchange Act of 1934. All statements, other than statements of historical fact, that address activities, events or developments that we or our management intends, expects, projects, believes or anticipates will or may occur in the future are forward-looking statements. Such statements are based upon certain assumptions and assessments made by our management in light of their experience and their perception of historical trends, current economic and industry conditions, expected future developments and other factors they believe to be appropriate. The forward-looking statements included in this release are also subject to a number of material risks and uncertainties, including but not limited to economic, competitive, governmental, and technological factors affecting our operations, markets, products, services and prices. Such forward-looking statements are not guarantees of future performance, and actual results, developments and business decisions may differ from those envisaged by such forward-looking statements. We identify the principal risks and uncertainties that affect our performance in our Form 10-K and other filings with the Securities and Exchange Commission.
Amy Xu
External Communications Manager
|
cc/2019-30/en_middle_0019.json.gz/line9649
|
__label__wiki
| 0.973687
| 0.973687
|
Main » 2018 » April » 26 » Jam City Launches Harry Potter: Hogwarts Mystery On the App Store and Google Play
Jam City Launches Harry Potter: Hogwarts Mystery On the App Store and Google Play
New Mobile Game Allows Players to Experience the Magic of Hogwarts School of Witchcraft and Wizardry First-Hand as Students
LOS ANGELES -Wednesday, April 25th 2018 [ AETOS Wire ]
(BUSINESS WIRE)-- Jam City, a Los Angeles based mobile games studio, announced today that the new mobile game Harry Potter: Hogwarts Mystery is available to download now on the App Store and Google Play. Developed by Jam City in partnership with Warner Bros. Interactive Entertainment, Harry Potter: Hogwarts Mystery is the first mobile game where players create their own character and experience life as a Hogwarts student. The game will launch under Warner Bros. Interactive Entertainment's Portkey Games, a label dedicated to creating new mobile and videogame experiences that place the player at the center of their own adventure, inspired by J.K. Rowling’s original stories.
“There are so few moments where a mobile entertainment company has the chance to truly bring magic into the world and we’ve been thrilled by the amazing response our game has already received from Harry Potter fans everywhere,” said Chris DeWolfe, co-founder and CEO of Jam City. “We at Jam City have been working hard to ensure that any aspiring witch or wizard can enter Hogwarts through their smartphones and tablets and begin their magical journeys.”
The story of Harry Potter: Hogwarts Mystery is set in the 1980s. In the game, players will progress as a student through Hogwarts, joining one of its four houses. Players will be able to create and upgrade personalized characters using an avatar customization system, learn an arsenal of magical skills, and form relationships with other students. They will also be able to master everything from crafting potions under Snape’s critical eye, to Transfiguration with Professor McGonagall. Along with interactive spellcasting, the game features an encounter system where narrative choices impact parts of the story.
"Being involved in the making of the Harry Potter: Hogwarts Mystery mobile game will give great pleasure to my grandchildren,” said Dame Maggie Smith, voice of Professor McGonagall in the game.
Players will also be introduced to some original game characters like Penny, a popular Hufflepuff potions expert, Tulip, a rebellious Ravenclaw prankster, and Merula, a Slytherin with a dark past. As players unravel the Hogwarts mystery, they will explore familiar locations like Diagon Alley and Hogsmeade.
Harry Potter: Hogwarts Mystery is free to play and is available NOW on mobile devices via the App Store and Google Play. For more details on Harry Potter: Hogwarts Mystery, and to connect with other Harry Potter fans, visit www.facebook.com/HPHogwartsMystery/, www.twitter.com/HogwartsMystery, and for more information visit www.HarryPotterHogwartsMystery.com/.
About Jam City:
Jam City is a global leader in mobile entertainment, providing social gaming experiences for millions of players around the world. Jam City was founded in 2010 by MySpace cofounders Chris DeWolfe and Aber Whitcomb, and former 20th Century Fox executive Josh Yguado. Jam City is the creative powerhouse behind some of the highest grossing and most enduring social gaming franchises for mobile, including Cookie Jam (Facebook “Game of the Year” winner) and Panda Pop. Jam City is the go-to studio for Hollywood, having developed immersive, narrative rich mobile games around iconic entertainment brands including Harry Potter, Family Guy and Marvel Avengers. Jam City has 500 employees across studios in Los Angeles (HQ), San Francisco, San Diego, Bogota and Buenos Aires. The Jam City team is known for its creative excellence and technological innovation in key areas including storytelling, data science and consumer insights.
About Warner Bros. Interactive Entertainment:
Warner Bros. Interactive Entertainment, a division of Warner Bros. Home Entertainment, Inc., is a premier worldwide publisher, developer, licensor and distributor of entertainment content for the interactive space across all platforms, including console, handheld, mobile and PC-based gaming for both internal and third party game titles.
About Portkey Games:
Portkey Games, from Warner Bros. Interactive Entertainment, is the games label dedicated to creating new Wizarding World mobile and videogame experiences that place the player at the center of their own adventure, inspired by J.K. Rowling’s original stories. Portkey Games offers players the opportunity to make their own narrative choices and engage with the Wizarding World setting to discover new and unique experiences. The label was created to bring gamers and fans new gaming experiences that allow them to delve into the Wizarding World in immersive ways where they can create their own magical story.
About the Harry Potter Series:
Harry Potter continues to be a global phenomenon. Each of the seven books by author J.K. Rowling has broken sales records, with the series to date having sold over 500 million copies worldwide and translated into over 80 languages. The Harry Potter films, produced by Warner Bros. Pictures, have grossed more than $7.7 billion to date worldwide at the box office, making Harry Potter one of the largest-grossing film franchise in history.
HARRY POTTER: HOGWARTS MYSTERY software © 2018 Jam City, Inc. Developed by Jam City. Jam City® and the Jam City Logo are registered and/or unregistered trademarks of Jam City, Inc. WIZARDING WORLD, HARRY POTTER and FANTASTIC BEASTS Publishing Rights © J.K. Rowling. PORTKEY GAMES, HARRY POTTER: HOGWARTS MYSTERY, WIZARDING WORLD, HARRY POTTER and FANTASTIC BEASTS characters, names and related indicia © and ™ Warner Bros. Entertainment Inc. All Rights Reserved.
WB GAMES LOGO, WB SHIELD: ™ & © Warner Bros. Entertainment Inc. (s18)
To download assets for Harry Potter: Hogwarts Mystery, please visit: https://app.box.com/v/HPHogwartsMystery-Assets
To view or embed the new Harry Potter: Hogwarts Mystery launch trailer, visit: https://youtu.be/ehixbGzOZ_M
60 SECOND VIDEO NEWS RELEASE - HIGH RESOLUTION VIDEO
VNR 60 FINAL (Hightail Download): https://spaces.hightail.com/receive/U9rhF6TuD5
VNR 60 (Dropbox Download): https://www.dropbox.com/s/z0yplfmctvzcole/4036%20Harry%20Potter%20VNR%2060%20v7.mp4?dl=0
60 Second Video News Release (YouTube): https://www.youtube.com/watch?v=zp8wk6IMAUs&feature=youtu.be
VNR 90 FINAL (Hightail Download): https://spaces.hightail.com/receive/SkqfFtLpMA
VNR 90 (Dropbox Download): https://www.dropbox.com/s/6if8b0tdzb8c8bt/4032%20Harry%20Potter%20VNR%2090%20v7.mp4?dl=0
90 Second Video News Release (YouTube): https://www.youtube.com/watch?v=nvivyi6D6U0&feature=youtu.be
B-ROLL PACKAGE - HIGH RESOLUTION VIDEO
EPK (Hightail Download): https://spaces.hightail.com/receive/34AYAaC1zE
EPK (Dropbox Download): https://www.dropbox.com/s/3w1kc5qixie7kwt/4031%20Harry%20Potter%20EPK%20v7.mp4?dl=0
EPK (YouTube): https://www.youtube.com/watch?v=onmEX8FFkj0&feature=youtu.be
for Jam City
Sarah Ross, 310-924-1404
sarahr@jamcity.com
Jam City
Kenny Johnston, 602-999-1890
KJohnston@jamcity.com
ONE PR Studio (for Jam City in the US)
Kjell Vistad | Gilberto Williams-Gamboa
jamcity@oneprstudio.com
Permalink : http://aetoswire.com/news/jam-city-launches-harry-potter-hogwarts-mystery-on-the-app-store-and-google-play/en
Views: 53 | Added by: africanewsline | Rating: 0.0/0
|
cc/2019-30/en_middle_0019.json.gz/line9650
|
__label__wiki
| 0.658266
| 0.658266
|
Main » 2016 » July » 21 » The Republic of Mali Chooses OT to Supply Its Latest Generation Electronic Passport
The Republic of Mali Chooses OT to Supply Its Latest Generation Electronic Passport
COLOMBES, France - Thursday, July 21st 2016 [ME NewsWire]
(BUSINESS WIRE)-- OT (Oberthur Technologies), a leading global provider of embedded security software products and services, has signed a contract with the Government of the Republic of Mali, following an invitation to tender, to supply a complete solution for issuing electronic passports which meet the strictest international security standards.
The Public-Private Partnership (PPP) grants OT a contract for 10 years, during which time the Republic of Mali will benefit from a comprehensive and innovative hi-tech industrial solution for its latest generation passport. The Republic of Mali has given OT, via Mali Solutions Numériques (MSN), and its partner Afritek, complete responsibility for Malian passports, from collection of payment from citizens to registration and validation of applications, through to production, personalization and distribution of the passports. The implementation of its Identity Management System (IDMS) solution reinforces OT's position as a world leader in the market of high-security identification solutions.
The Republic of Mali is providing its citizens with the ability to identify themselves and travel in complete security. Mali's new electronic passport features the latest security innovations and now includes fingerprints, further increasing the passport's level of security.
OT's expertise will improve the quality of the passport issuing process and biometric verification when collecting information and during border checks, while ensuring the quality of the service offered to Malian citizens, including the practicality of payment methods and the speed of the passport issuing process, which can take less than 24 hours.
This puts the Republic of Mali among the most advanced countries in terms of security of travel documents and improves its citizen's mobility.
"Our association with the Republic of Mali is historic. During our initial partnership, we delivered traditional passports. Fifteen years on, we are delighted and proud to have reinforced our relationship by providing the Malian Government and citizens with our expertise in fraud prevention using a comprehensive solution enabling the production and issuing of reliable and effective latest-generation biometric documents" says Christophe Fontaine, Managing Director of the Citizen Access and Identity business at OT.
Mr Salif Traoré, Minister of Internal Security, says: "We wanted to have access to the latest technologies for Mali's new electronic passport and that was made possible thanks to our trusted partner, OT, which was capable of investing and making this project a reality. OT's investment not only gives us an identity document which is simple to authenticate and effective at combating all attempts at fraud, but also allows our fellow citizens to travel with ease and assurance, in complete confidence".
ABOUT OBERTHUR TECHNOLOGIES
OT is a world leader in embedded digital security that protects you when you connect, authenticate or pay.
OT is strategically positioned in high growth markets and offers embedded security software solutions for “end-point” devices as well as associated remote management solutions to a huge portfolio of international clients, including banks and financial institutions, mobile operators, authorities and governments, as well as manufacturers of connected objects and equipment.
OT employs over 6 500 employees worldwide, including almost 700 R&D people. With a global footprint of 4 regional secure manufacturing hubs and 39 secure service centers, OT’s international network serves clients in 169 countries. For more information: www.oberthur.com
Download The M World,
All you need to know about the latest trends of the Mobility world, available on AppStore and Google Play
www.oberthur.com/themworld
Oberthur Technologies
Audrey Besnardeau, Tél. : +33-1-78-14-76-75
a.besnardeau@oberthur.com
Elan-Edelman
Chloé Tisseuil / Elise Cognacq, Tél. : +33-1-86-21-50-54 / +33-1-86-21-50-67
chloe.tisseuil@elanedelman.com / elise.cognacq@elanedelman.com
|
cc/2019-30/en_middle_0019.json.gz/line9651
|
__label__wiki
| 0.599442
| 0.599442
|
Has there ever been a strike of peer reviewers?
I know peer reviewing is done freely and voluntarily, at least I think for the most part, so I am not sure strike is the best way of calling it, but it gives the idea. With all the recent discussion about open access and overworked researchers that relate to the publishing cycle, I was wondering if there has been any protest, or strike, or talks for a strike by peer reviewers.
peer-review publishers
Herman ToothrotHerman Toothrot
Considering how long it takes to review a paper, I believed peer reviewers were always on strike... ;-) – gented Feb 6 '18 at 13:53
Not en masse. If researchers refused to review en masse, the system would break down and no papers would be published (or they'd be published without review) and the impact would be very visible.
On smaller scales there has been a Cost of Knowledge boycott of Elsevier, an individual publishing house. This was initiated by Timothy Gowers in 2012, in protest of Elsevier's perceived high prices and gross margins. The target is Elsevier because it is the "worst offender" - Elsevier's margins are very high, above 20%. The boycott allows the signatories to say if they're not willing to publish with, to do editorial work, or to referee for Elsevier. It's had minimal impact: as of time of writing, there are 16,946 signatories, a tiny fraction of the number of academics in the world (millions). It did, however, lead to Elsevier lowering its prices slightly for mathematics journals as well as making some old papers available for free.
On an even smaller scale, I've seen researchers decline to review papers because they don't review for non-OA journals, or because they don't work for free. This is a very small fraction however: I've invited hundreds of reviewers, and the number who decline for these reasons can be counted on one hand.
AllureAllure
I don't think it's fair to dismiss the Cost of Knowledge boycott's impact so readily. Within the mathematics community, there have been some significant impacts. At a minimum, many Elsevier mathematics journals have improved access for non-subscribers as a direct response to the boycott. – Zach H Feb 6 '18 at 3:29
True, I'll amend the answer. – Allure Feb 6 '18 at 4:28
Elsevier is "an individual publishing house" the same way that Facebook is "an individual social network". It is a humongous publishing house, that publishes a rather significant part of scientific journals. And if 16,946 signatories is such a small number, how come it made Elsevier budge? – user9646 Feb 6 '18 at 8:30
Facebook is an individual social network. There are other networks with hundreds of millions of users, such as Google+, Twitter, LinkedIn, Sina Weibo and RenRen. As for why 16,946 signatories made Elsevier budge, they did it as an act of goodwill. If you think it's a significant number, check Elsevier's annual reports for how much the boycott affected their top and bottom lines. – Allure Feb 6 '18 at 9:30
Researchers have refused to review for Elsevier, as part of the Cost of Knowledge boycott, which
Objects to exorbitantly high prices; and
Objects to measures that restrict free information.
The initial success of the boycott was summarised in 2014 by Sir Timothy Gowers (Fields Medal recipient):
A little over two years ago, the Cost of Knowledge boycott of Elsevier journals began. Initially, it seemed to be highly successful, with the number of signatories rapidly reaching 10,000 and including some very high-profile researchers, and Elsevier making a number of concessions, such as dropping support for the Research Works Act and making papers over four years old from several mathematics journals freely available online. It has also contributed to an increased awareness of the issues related to high journal prices and the locking up of articles behind paywalls.
Missing in your enumeration of reasons is the (highly relevant) fact that Elsevier is exploiting its de-facto cartel position. – Konrad Rudolph Feb 6 '18 at 10:43
@KonradRudolph I've only listed the reasons that appear on the front page of thecostofknowledge.com The detailed statement of purpose may provide further reasons. – user2768 Feb 6 '18 at 10:51
@user2768 No, that reason is from that page — it’s point 2. Compare: your list only has two points, whereas the list on the Cost of Knowledge front page has three. – Konrad Rudolph Feb 6 '18 at 10:52
@Konrad Any reference to "exploiting its de-facto cartel position" is buried. On the front page, the first point is about "charg[ing] exorbitantly high prices for subscriptions to individual journals." The second point reiterates the first for "bundles." These two points compress into "exorbitantly high prices." I appreciate that I'm oversimplifying, but I didn't want to go into details of Elsevier's business model. – user2768 Feb 6 '18 at 11:32
@user2768 Right: the “bundling” is another way of saying that they exploit a cartel position. – Konrad Rudolph Feb 6 '18 at 11:34
Apart from the Cost of Knowledge, which was a while ago now and had a broader scope than just reviewing, more recently there was No Deal No Review by Finnish researchers. They boycotted the task of peer reviewing for traditional publishers in order to put pressure on them while they negotiated with the Finnish universities.
Since the result of those negotiations are widely met with disappointment, it's not clear yet what will happen with the boycott.
VincentVincent
@Haz That just says the negotiations have been concluded, which I mentioned already as well... – Vincent Feb 8 '18 at 7:28
Not the answer you're looking for? Browse other questions tagged peer-review publishers or ask your own question.
Why do universities/research agencies allow their employees to do free peer reviewing which financially benefits a third party?
Are there any measures to ensure “academic honesty”?
When peer reviewers are public/open, are they less likely to be critical of a manuscript?
How to deal with corresponding authors not sharing submission steps? (E.g. Peer reviews & Decisions)
Should startup-company founder accept peer-review requests?
Is your peer-reviewing service ever important for career advancement?
|
cc/2019-30/en_middle_0019.json.gz/line9660
|
__label__wiki
| 0.968445
| 0.968445
|
AHRP in the News
Alliance for Human Research Protection in the Press
Feb 17, 2005: FDA Critics Slam Plan for Safety Reform – Nature
“This is smoke and mirrors and musical chairs,” says Vera Sharav, president of the New York-based Alliance for Human Research Protection. “They will be using the very same officials that are the problem.”
Feb 12, 2005: Drug Regulators Are Trying to Quash Study, Senator Says – NY Times
Vera Sharav, president of the Alliance for Human Research Protection, said that the Vioxx story demonstrated that “the F.D.A. has abandoned its public responsibility to protect us from unsafe drugs and is standing by as drug companies market lethal drugs.”
Feb 11, 2005: 14 deaths force halt to drug in Canada – Hyperactivity remedy called threat to kids – Star-Ledger
“Why is the American public entitled to less safety than Canadians?” asked Vera Hassner Sharav, president of the Alliance for Human Research Protection, a non-profit group based in New York. “If you’ve got these deaths and strokes, even in children, who generally don’t get heart attacks and strokes, you should pull the drug off the market until the manufacturer can prove it’s safe.”
Feb 3, 2005: Suicide Rate Down in the Era of Prozac – LA Times
But Vera Sharav, president of the Alliance for Human Research Protection, said the conclusions of the analysis might not be valid because the decline could just as easily be explained by laws introduced around the same time reducing access to firearms – a common means of committing suicide.
Feb 3, 2005: Antidepressant warnings make experts nervous – San Antonio Express-News
In comments on Tuesday, Vera Hassner Sharav, a sharp critic of FDA regulators and drug companies and president of the New York-based Alliance for Human Research Protection, called Licinio’s causal connection between antidepressants and falling suicide rates “fallacious” and urged the drugs be used as a “last resort.”
” If you examine the Brady Bill (on handgun control) and when it was enacted (1993) with the restrictions on firearms, that’s when you see the reduction in homicides and suicides,” she said.
Feb 2, 2005: Fewer Kids Prescribed Drugs for Depression – Sharp Decrease Seen After Reports of Risks – Washington Post
“When parents and physicians were kept in the dark about the scientific evidence, they trusted the drug advertisements that promised wonderful results with no risk,” said Vera Hassner Sharav, founder of the Alliance for Human Research Protection, a patients’ rights organization.
“When given an opportunity to weigh the risks and benefits after learning the facts, parents are making responsible choices for their children,” she said. “They are being cautious and skeptical, as they should be.”
Jan 24, 2005: Sometimes the drugs designed to help people battling depression do more harm than good – News Tribune
Re SSRI induced akathisia: “People cannot take it and will do anything to make it stop,” said Vera Sharav, a patient safety advocate who heads the Manhattan-based Alliance for Human Research Protection.
Jul 21, 2004: Hearing on Antidepressants Canceled – Washington Post
AHRP President Vera Sharav quoted re Rep Greenwood’s retirement & job offer from Biotechnology Industry Organization
Jun 21, 2004: Antidepressants – USA Today Editorial / AHRP OpEd/ WSJ Editorial Bashes Spitzer
USA Today Invited OpEd by AHRP
Jun 14, 2004: Guardian Reports: MHRA to Issue New SSRI Restrictions
Vera Sharav of AHRP quoted in the Guardian: “Given the concern about evidence of a suicide link to Prozac and the other antidepressants, it is an affront to the public that the MHRA would even consider approving Prozac for children.”
A cover story interview with AHRP Board member, Dr. Loren Mosher, appeared in the January 9 issue of San Diego Reader. Still Crazy After All These Years by Jeannette De Wyze vol. 32, no. 2, p. 26 et. Seq.
The Washington Post. Artificial Heart Implant Leads to Suit Over Consent Process by Debbie Goldberg. p. A-3 “Vera Hassner Sharav, president of the New York-based Alliance for Human Research Protection, said the informed-consent process for many trials is a sham. Clinical trials are “set up in such a way that patients are misinformed and misled,” she said. “Patients and families are not told what the actual and foreseeable risks are, and what they may expect in the way of pain and suffering.”
Boston Globe. Institute of Medicine worries that public trust is threatened by deaths. By Michael Kranish and Alice Dembner.
The IOM report did not satisfy some longtime observers. ”The IOM committee, headed by a Harvard University dean, disingenuously recommended entrusting `the responsibility for ensuring that protective rules are followed’ to `the leadership of the organization doing the study,’ Vera Hassner Sharav, president of the Alliance for Human Research Protection, said in a statement. ”That is an example of conflicts of interest.”
George Annas, chairman of the health law department at Boston University’s School of Public Health, said ”We need a lot more reform than the IOM seems to recognize. This is but another voice crying in the wilderness. All their major recommendations have been made over and over again.”
Do the Ends Justify the Means in Human Research?
Medical Science Violating Children – 450 healthy children targeted – redflagsweekly
Some partient advocates are suspicious. “This is like a grab for more power” by UC, said Vera Hassner Sharav, president of the Alliance for Human Research Protection. “In fact, they haven’t earned it at all. They haven’t complied with the existing regulations and law.” She and other critics said the UC system has a history of violating the rights of patients involved in research.
http://www.latimes.com/features/health/medicine/la-me-uc7aug07.story?coll=la%2Dhealth%2Dmedicine
“Though critics find flaws with both oversight systems, they say it’s the university professors, not the industry profit-seekers, who have more lax rules on human safety.”
“Academics don’t have to meet a payroll or meet a bottom line, so they’re removed from real responsibility, said Vera Hassner Sharav, an East Coast activist who helped expose the UCSF experiment.”
http://sfgate.com/cgi-bin/article.cgi?f=/c/a/2002/08/05/MN47420.DTL
"Vera Sharav of the Alliance for Human Research Protection based in New York said the UCSF violations show that informal methods of proxy consent are prone to abuse. ‘I think it demonstrates why you must not have this back-door approval process,’ Sharav said. ‘It invites exploitation of incapacitated people.’"
University of California, San Francisco: Patients Rights Violated
Redflaggsweekly
PRESCRIBING UNTESTED DRUGS TO CHILDREN
By Nicholas Regush
According to Vera Hassner Sharav of the Alliance for Human Research Protection, the 1997 federal rule should have required the FDA or the Department of Health and Human Services to conduct an impact study "to determine whether, and how, children would be affected adversely" by entering clinical drug tests. Hassner says that, "It is most disturbing that neither the administration nor Congress has seen fit to request an annual report detailing information about pediatric research in order to ensure that children are not being harmed or exploited. Congress does mandate detailed annual reports about the conduct of animal research. Animals are protected under the Animal Welfare Act of 1966; children who are recruited into clinical trials – with cash payments to parents – are unprotected." http://www.redflagsweekly.com/regush/untested_drugs.html
The Boston Globe.
FDA Rule Changes: Benefits, Dangers.
By Jeffrey Krasner,
Vera Hassner Sharav, president of the Alliance for Human Research Protection, a nonprofit that seeks to prevent dangerous drugs from hurting people during and after development, said the effort highlights deficiencies in testing before drugs are approved.
”They’re speeding up the drug approval process knowing that there may be some safety hazards, and so they’re post-facto allowing for some tracking of hazards that are likely to follow,” she said. ”They’re pretty much expecting problems because drugs are being approved too quickly.”
Another potentially divisive issue is a new rule under which the FDA could use outside experts to help it review the design of a company’s clinical trials. The company could provide a list of experts for the agency to choose from.
http://www.annieappleseedproject.org/fdarulchanbe.html
March 11, 2002.
American Medical Association News:
Victoria Stagg Elliott
"If the NIH would fund more studies untainted by industry influence, we are likely to find out that other ‘disorders’ are not valid either," said Vera Hassner Sharav, president of the Alliance for Human Research Protection. http://www.ama-assn.org/sci-pubs/amnews/pick_02/hlsc0311.htm
2002: National Center for Dissemination of Disability Research,
Research Exchange: Volume 7, Number 1.
What Do Professional and Consumer Organizations Have to Say?
AHRP is the first organization listed, our mission statement posted. http://www.ncddr.org/du/researchexchange/v07n01/7c_consumersay.html
Death in test haunts Hopkins researcher By Tom Pelton
Scientist: Friends say the doctor nearly quit after a fatal experiment but hopes to get back to healing. "Vera Hassner Sharav, president of the Alliance for Human Research Protection, which is based in New York, said there is no excuse to let researchers experiment on people and then not hold them accountable when they fail to take action to avoid tragedies." http://www.sunspot.net/news/health/bal-te.md.togias27jan27.story?coll=bal%2Dhome%2Dheadlines
The Washington Post.
A Death During Research By Susan Okie
Although OHRP officials apparently knew of her death while investigating the Hopkins case last summer, university and hospital officials did not publicly announce that a volunteer had died in the Cleveland study until December. In the preceding month, OHRP informed officials at the two institutions that it had found "no evidence to substantiate" concerns that researchers had failed to minimize the risks to participants. Holden-Able’s death was first reported in December by the Cleveland Plain Dealer.
"OHRP knew about it. Nobody was told anything," said Vera Hassner Sharav, president of the Alliance for Human Research Protection. "Now they’re saying, ‘Oh, but everything is fine.’ The major issues are left out." Posted by PHARMACY FORUM. http://www.pharmacyforum.com/Jan2002Articles/a_death_during_research.htm
The Washington Post Magazine.
Informed Consent By Jennifer Washburn
The drive to speed up clinical trials has induced many companies to "replace careful patient screening practices with a crude reward system," says Vera Hassner Sharav, president of the Alliance for Human Research Protection, a nonprofit group based in New York. Industry now commonly pays doctors financial incentives ranging from $1,000 to $6,000 for each new patient recruited; top recruiters earn somewhere between $500,000 and $1 million a year. http://www.washingtonpost.com/wp-dyn/articles/A14726-2001Dec21.html
December 20, 2001.
Pediatric testing program extended By Alice Dembner
”Congress should have imposed mandatory monitoring of pediatric trials, including unannounced inspections,” said Vera Sharav, president of the Alliance for Human Research Protection. ”The extension of this legislation is a bonanza for the drug industry, and in some cases it may be a real threat to children’s health.” http://www.boston.com/dailyglobe2/354/nation/Pediatric_testing_program_extended+.shtml
STUDIES ON RITALIN ARE CHILD ABUSE By Douglas Montero
"They want to see how much these children can tolerate," said Vera Hassner Sharav, who heads the New York-based Alliance for Human Research Protection. "The research is absolutely child abuse." http://www.nypost.com/cgi-bin/printfriendly.pl
Johns Hopkins Faults Researcher in Human Drug Trial. By Shankar Vedantam
Vera Hassner Sharav, president of the patient advocacy group Alliance for Human Research Protections, said the university report ignored the institution’s own role in permitting the research. She called for an independent investigation. "Internal self-investigation and self-regulation does not work," she said. "The public trust will not be restored with this kind of self-serving finding." http://www.washingtonpost.com/wp-dyn/articles/A18596-2001Nov12.html
Daily Record.
Risk, research and the ripple effect By JOE SURKIEWICZ
"It’s a landmark decision," said Howard Fishman, a member of the steering committee of the Alliance for Human Research Protection, a self-funded advocacy group concerned with protecting the rights of human research participants and the director of continuing medical education at Harvard Medical School. "Much to my relief, the court has intervened with a broad and sweeping statement of ethical requirements."
"It’s generally believed that medical science is an unalloyed boon to mankind, and we tend not to be skeptical of medical research."
Yet history shows that science is "ethically neutral" and gives "little consideration" to the application of new knowledge,
the Court of Appeals addressed head-on, Fishman said: "The Johns Hopkins IRB became accomplices to the researchers with the intent of circumventing ethical standards."
For a fuller understanding of the ethical debates over human-subject research, Fishman suggested following the "money trail."
"Federal funding and research funding by major pharmaceutical manufacturers determine the research agenda," Fishman said. "Major academic institutions have found themselves to be dependent on these funding streams.
Particularly in this era of deconstructionism [a term Fishman defined as the perceived right to reinterpret the author’s original intent], moral relativism and muticulturalism," he said, "it’s easy for institutional stakeholders’ to succumb to the temptation to blur ethical rules.
"One sees repeatedly an effort to obfuscate facts and the use of rhetorical devices to justify otherwise unacceptable procedures," he added.
An example: "Kennedy Krieger seems to suggest the risks to medical research are analogous to the everyday risks of life," Fishman said. "These kinds of statements raise our concern that research institutions view ethical
safeguards as inconveniences that should be circumvented."
Fishman praised the Court of Appeals for another aspect of its August opinion. "A related concern expressed by the court is the need to provide protection Îspecifically for the poor and less educated who bear most of the
research burden,’" Fishman said, quoting the opinion. "Research harms are visited disproportionately on poor and minority children."
http://www.mddailyrecord.com/cgi-bin/udt/im.print.story?client=dailyrecord&storyid=60140
American Medical Association News.
Ruling Bans Research Where Children Are At "Any Risk." By Andis Robeznieks
Just as the institute has its allies, the other side has its supporters as well – including Vera Hassner Sharav with the Alliance for Human Research Protection, who hailed the appellate court’s decision. "The Maryland court opinion is a powerful reaffirmation of the rights of children not to be exploited as laboratory animals." http://www.ama-assn.org/sci-pubs/amnews/pick_01/prsd1008.htm
THE BALTIMORE SUN.
Lead paint rule could limit research in Md. By Tom Pelton
Vera Sharav, president of the New York-based Alliance for Human Research Protection, said it’s important that the court’s decision remain in place. "The court opinion is a powerful reaffirmation of the rights of children not to be exploited as laboratory animals," said Sharav. http://www.sunspot.net/news/local/bal-md.research20sep20.story?coll=bal%2Dlocal%2Dheadlines
September 8, 2001.
IHF: Institute for Health FREEDOM.
Federal Research "Protections" Committee Recommends Waiving Parental Consent Before Enrolling Teenagers in Drug Trials.
"One member of the NHRPAC working group opposed waiving parental consent. Vera Sharav of the Alliance for Human Research Protection asked, "What happens when a child is harmed? Do you bring the parent back [into the decision-making process]?" It’s also important to consider whether teenagers really understand the future implications of sharing their genetic information for research purposes and whether they are capable of deciding the risks versus benefits of enrolling in genetic-based studies." http://forhealthfreedom.org/Publications/Children/TeenDrugTrials.html
ASSOCIATED PRESS.
Johns Hopkins Under Fire Over Ethics. By JOHN BIEMER
"It’s unfortunate that the premier medical research institute in the U.S. has all of these problems conducting basic peer review and review of the ethical component of the research it’s conducting," said John H. Noble, a Catholic University health policy professor and member of the Alliance for Human Research Protection. "We need checks and balances, and that’s the fundamental flaw in the system."
Noble said the review boards are not just stretched thin, but also suffer conflicts of interest rooted in doing "business as sub-units of the very institution that gets them funded." The review boards may even rubber-stamp approval if a researcher’s reputation is well-established, he said. http://news.excite.com/news/ap/010828/16/hopkins-struggles
‘MY KIDS WERE USED AS GUINEA PIGS’ By Manuel Roig-Franzia
"There is a culture that has grown up among researchers; it puts science
above human beings — and that’s a very dangerous thing," said Vera Hassner
Sharav, of the Alliance for Human Research Protection, a privately funded
New York advocacy group.
http://www.washingtonpost.com/wp-dyn/articles/A59479-2001Aug24.html
The Scientist 15[16]:20, Aug. 20, 2001
News Notes
New Panel to Police Human Research By Bob Roehr
A group of patient and social justice advocates plan to form an Alliance for Human Research Protection to provide oversight on clinical research from laypersons’ point of view, says John H. Noble Jr., a founder and professor of social justice at the Catholic University of America. He lambastes internal review boards (IRBs) designed to protect human subjects as agents of institutions "who are hustling the bucks" from industry and other sources. Noble says IRBs need to be "severed from research institutions" and provided adequate resources as part of the accepted overhead costs of conducting clinical trials. Government commitment to patient protection "without the [funding] is just a sham," he says. Greg Koski, director of the federal Office of Human Research Protections (OHRP), which grants authority to the IRBs, acknowledges that concern over IRB members’ financial ties to industry can be valid. "But I don’t think it’s fair to call [the system] a sham," he says. "While there are legitimate reasons to be concerned about conflicts, it’s also fair to say institutions have an interest in making sure things are done right. We have to work toward ensuring that conflicts do not exist." Koski says he welcomes the creation of any group that broadens public participation in and understanding of research oversight. Comprising lay people, researchers, and ethicists, the alliance would have no regulatory authority, but its founders aim to use public censure to help enforce legal guidelines.
July 31, 2001.
FDA Urged to Broaden Study Rules By Susan Okie
Waiving parental consent for research participation could subject children to increased risks, said Vera H. Sharav of the Alliance for Human Research Protection. "Why is there such a rush to accommodate research by diminishing the protections that children now have?" asked Sharav, a member of the NHRPAC working group who dissented from the majority position. http://www.washingtonpost.com/wp-dyn/articles/A8479-2001Jul30.html
WebMD.
Johns Hopkins Works to Repair Patient Safety Problems:
Patient’s Death Led to Shutdown of Human Experiments.
By Jeff Levine
Vera Hassner Sharav, president of the Alliance for Human Research Protections, a New York-based advocacy group, says the message is that it’s time for a tougher approach to ensuring patient safety. "There’s no incentive [for research institutions] to comply with safety requirements, because we don’t have the legal restraints. We don’t have the independent oversight to make sure that these rules are enforced," Sharav tells WebMD. http://webmd.lycos.com/content/article/1728.84413
THE WASHINTON POST.
Johns Hopkins Halts ALL Medical Volunteer Trials – What Can We Learn From This Tragedy? By Susan Levine and Rick Weiss
The action against Hopkins, said Vera Hassner Sharav, of the Alliance for Human Research Protections in New York, "shows that this is not about an individual aberrant researcher that violated research rules, but about institutional shortcomings. The system is not working if you actually have to shut down an entire research center."
In fact, just two years ago, the HHS inspector general released a report that warned of an imminent breakdown in the nation’s system for overseeing the safety of research participants. In particular, it found that universities’ and medical centers’ institutional review boards, which judge the scientific and ethical merit of human research studies, are severely overburdened, staffed by insufficiently trained people and open to conflicts of interest — all problems raised in the Hopkins closure. http://www.washingtonpost.com/wp-dyn/articles/A23208-2001Jul19.html
Prior to July 15, 2001, Vera Hassner Sharav headed Circare (Citizens for Responsible Care and Reasearch), on whose behalf she spoke, testified, and issued "Veracare Infomails" (news clippings) via e-mail to a wide audience.
THE NEW YORK POST.
ELECTROSHOCK TURNS HILLSIDE TO HELLSIDE By Douglas Montero
A WATCHDOG group says mental patients at Hillside Hospital in Queens are being abused – mentally.
Vera Hassner-Sharav, the president of the city’s Citizens for Responsible Care and Research, called the alleged coercion practice at Hillside "unconscionable."
She said the only recognized use of electroshock is for patients with severe clinical depression who haven’t responded to any other form of treatment.
Zapping Nina Hernandez, who doesn’t suffer from depression, is "contrary to accepted medical standards put forth by the American Psychiatric Association" and, therefore, "that makes it experimental," Hassner-Sharav said.
http://www.nypost.com/commentary/33318.htm
Asthma Study Death Spurs Inquiry. BY Paul Smaglick,
"The exploratory focus of the asthma experiment has already attracted criticism. Vera Sharav, President of the New York based Citizens for Responsible Care, calls it "a fishing expedition" best reserved for animals, not people. "People should be protected from this kind of experiment," she said." http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v411/n6840/full/411873b0_fs.html
Researchers’ Use of Questionable Tactics to Attract Children into Medical Studies on the Rise. By Alice Dembner
Patient advocates and ethicists have also challenged a study at Yale involving a population whose majority is healthy children and adults. The study is designed to test whether the potent antipsychotic drug Zyprexa can prevent schizophrenia. The crux of the problem in this case deals with the ethicality of exposing normal, healthy children and adults to the potential dangers and side effects of the powerful drug. The study is sponsored in part by Eli Lilly, which through Zyprexa earned more than $2 billion in revenue last year.
Speaking to the Yale case, Vera H. Sharav, president of Citizens for Responsible Care & Research, is quoted by The Globe as asserting that, "A clinical trial involves risk and, if a child doesn’t have a condition, they shouldn’t be put at risk just because they’re helpless and accessible The biggest question is whose children are being sought as subjects. Do those who profit from research volunteer their own children?" http://hsc.unm.edu/resp/news_children.html
Salon.com.
Your heart has been recalled: In the brave new world of body-part implants, what happens when you get a lemon of a ticker? By Dawn MacKeen
"What we’re seeing is that harmful products, be they drugs or devices, are being approved, and then introduced into unwitting people who think they have been thoroughly tested for their safety when obviously they have not," says Vera Sharav, president of Citizens for Responsible Care (CIRCARE), a human rights organization. http://www.salon.com/mwt/feature/2001/03/02/body_parts/index.html
CBS News / HeathWatch.
Scientific Study? No One Told Me" By Eric Sabo
"Patients are being encouraged to enter clinical trials with false promises of access to ‘cutting edge, free treatment,’" claims Vera Sharav of Citizens for Responsible Care & Research. "Physicians are earning more money recruiting their patients for clinical trials than treating them with proven treatments."
Informed consent remains the Miranda rule for those entering a clinical trial: Researchers must explain the reasonable benefits and risks that subjects can expect from participating. But how good is this information, and do patients really understand what they’re getting into?
..In fact, withholding relevant information from study volunteers is a major source of trouble. Documents from the National Institutes of Health show that informed-consent problems accounted for 34% of government crackdowns on clinical trials over the past 10 years, making this the second leading reason why researchers were cited for violations. A similar pattern of bad advice is also alleged in several recent lawsuits. http://cbsnews.com/now/story/0,1597,282816-412,00.shtml ;
Child Research Study Halted By Rick Weiss
Vera Hassner Sharav,
president of Citizens for Responsible Care & Research, a New York-based human subjects advocacy group, said the experiment was just one of a growing number of inappropriate studies involving healthy children.
"There’s a feeding frenzy for children in research now," Sharav said. "And now the federal government has contributed to the erosion of research ethics by giving its seal of approval to experiments that inflict pain on helpless children and by putting them in harm’s way." http://washingtonpost.com/wp-dyn/articles/A27805-2000Nov6.html
Washington FAX
FASEB working with AAU, AAMC on protection of human subjects in research
By Vincent J. Swanson
AAU recommendations don’t get to the heart of the problem, say patient advocates
although academics appear ready to improve their protection of human subjects, some patient advocacy groups say the self-regulatory aspect of human subjects research–the Institutional Review Boards–is the central flaw in the system. They would prefer to see external overseers, contending AAU’s recommendations and even congressional proposals fail to fully protect human subjects.
"The only gate-keepers safe guarding human subjects are the IRB’s, and IRB’s are all in the pockets of special-interests," said Vera Sharav, president of Citizens for Responsible Care and Research (CIRCARE), a group advocating for human subjects’ rights. "Human subjects research is a two-tier system," she told Washington Fax. "Those conducting the research and the subjects who are participating in the trials. No one is protecting the subjects."
Sharav also asserted that most of the human subjects in research are low-income and have no access to health insurance. "The conflict of interest in research is overwhelming," she explained, "IRBs are groups of an elite class of academicians who have vested interests, and the research is being conducted on an underclass." Without oversight by the Inspector General, "there will be no safety in research," Sharav argues.
Sharav has been vocal on the issue of patient’s rights since 1993. Sharav has testified several times and appeared before the National Bioethics Advisory Commission in 1997.
"We are not anti-science," she told Washington Fax. "We want human subject trials to continue, but, we want more disclosure on the adverse effects of trials." http://www.washingtonfax.com/samples/2000/20000725.html
Earlier Gene Test Deaths Not Reported NIH Was Unaware Of ‘Adverse Events’
By Deborah Nelson and Rick Weiss
"You have to find out what it is before you can rule out what it’s not. That’s
just logic," said Vera Hassner Sharav of Citizens for Responsible Care and
Research in New York. "Otherwise it’s basically a denial of responsibility."
http://www.unmc.edu/irb/news/Washington%20Post%20re%20gene%20therapy%20deaths%20(1-31-00).txt
ABC News.
Risky Research Duke Suspension Sheds Light on Bigger Problems
By Jonathan Dube
Hamsters Yes, Humans No
Vera Sharav, the director of Citizens for Responsible Care and Research, a New York City-based advocacy group, says that the safeguards in place for clinical trials involving animals are better than those for human subjects.
"No one knows how many humans have been harmed by trials, or even how many people are in clinical trials," Sharav says. "Yet if you want to know the number of hamsters in clinical trials between June and December, you can get a very detailed printout."
Sharav also echoes the DHHS complaint that the institutional review panels, which consist mainly of university officials and researchers evaluating the work of their peers, face potential conflicts of interest.
"It’s a community that has an interest in the research and in the research dollars continuing to flow," Sharav says. "No one on the boards looks out for the interests of the patients. http://abcnews.go.com/sections/living/DailyNews/duke_irbs990512.html
U.S. Halts Human Research at Duke By Rick Weiss
Historically, it has not been unusual for the OPRR to exchange letters with research centers for three to five years until problems are resolved, said Vera Sharav, head of Citizens for Responsible Care and Research, a New York City-based advocacy group. Nonetheless, if the OPRR’s vigor is representative of a new, more aggressive attitude by the agency, including cracking down on bureaucratic lapses as well as on frank abuses of patients, then citizens can only benefit, Sharav said. "If no one does anything," she said, "then the violations get greater." http://www.washingtonpost.com/wp-srv/national/daily/may99/duke12.htm
The Los Angeles Times.
Feds crack down on drug facilities’ research in L.A. By Terence Monmaney
The recent actions represent a growing awareness that "researchers working with vulnerable populations do not always adhere to requirements for overseeing the well being of human subjects," said Vera Hassner Sharav, head of Citizens for Responsible Care and Research, a New York City-based advocacy group. "Vulnerable populations are at risk of having their conditions worsened in order to afford researchers the opportunity to study their illnesses." http://voice.bloomu.edu/4-22-1999/Nation-World/Nation-World2.html
Mental illness studies checked: Policy group weighs formal review of several practices By Dolores Kong
The Institute of Medicine, a leading US health policy group, is seriously considering launching a review of studies that induce psychotic symptoms or that withdraw medication from people with mental illness, a top official said yesterday.
”It’s something we are very interested in trying to be helpful on,” said Susanne Stoiber, executive officer of the private nonprofit institute, created to serve as a health policy adviser under a congressional charter granted to the National Academy of Sciences.
The institute’s interest coincides with a recommendation that the institute review the studies, made in November by a presidentially appointed bioethics commission. In making that recommendation, the commission cited a Globe series highlighting the ethical concerns raised by the research.
But some critics of the research questioned whether the institute is the right organization to review the psychosis-inducing and medication-withdrawal studies.
”It can’t in any way be even a semblance of independent investigation,” said Vera Hassner Sharav, president and co-founder of the Citizens for Care in Psychiatry and Research, a leading critic of such studies. ”That is so cynical. The very people who conduct these kinds of illness-exacerbation experiments are members of the IOM.” http://caringonline.com/eatdis/misc/mntlillness.htm
Study harmed mentally ill, agency reports By Dolores Kong
The agency found that while that study, published in 1987, resulted in no long-term adverse effects, people ”suffered at least some short-term harm or discomfort as evidenced by documentation of schizophrenia relapse in all 28 patients.”
For instance, one of the patients in that study, after being off medication for four weeks, ”became violent and struck a doctor. Another patient … expressed suicidal ideation; and another patient’s symptoms worsened significantly after only one day of being off medication,” according to the agency, citing documents it reviewed as part of its investigation.
The agency’s finding comes five years after a New York-based mental health advocate first filed a complaint with the agency about the 1987 study and raised concerns in the media.
”I really am questioning why it took them so long. What kind of obstacles were there that prevented them from investigating it and determining it sooner?” said Vera Hassner Sharav, president and co-founder of Citizens for Responsible Care in Psychiatry and Research. http://www.kersur.net/~mhci/studyharmed.html
Volume 283, Number 5401, pp. 464 – 465
BIOETHICS: NIMH to Screen Studies for Science and Human Risks
Eliot Marshall
link to text of article
For more than a year, patient activists and ethicists have been calling for a revolution in the way clinical studies in psychiatry are monitored. They argue that studies of psychiatric disorders, especially trials that exacerbate symptoms or withdraw medication, expose subjects to needless risks. And they have been demanding a more critical, independent review of protocols. These ideas have circulated widely in the press and dominated the work of a national bioethics commission in 1998.
Posted by Vera Sharav | Thursday, October 26, 2006 | Categorized Miscellaneous | Tagged John H. Noble, FDA, DHHS, Peer Review, Informed Consent, OHRP, Homicide, psychosis, Guinea Pigs, MHRA, unsafe drugs, Los Angeles Times, drug trials, Zyprexa, Psychiatry, Harvard, Vioxx, Johns Hopkins, SSRI, Bioethics, The Wall Street Journal, Eli Lilly, Child Abuse, schizophrenia, Ritalin, The Boston Globe Bookmark the permalink.
When you think of the long and gloomy history of man, you find more hideous crimes have been committed in the name of obedience than have ever been committed in the name of rebellion.
— C.P. Snow
|
cc/2019-30/en_middle_0019.json.gz/line9666
|
__label__cc
| 0.677314
| 0.322686
|
Airline S7 Airlines
IATA / ICAO: S7 / SBI
Alliance: OneWorld
Fleet size: 65
Fleet age: 9.3 year.
Base airport: Moscow Domodedovo Airport (DME)
Airline S7 Airlines is an airline from Russia. Airline founded in 1992. S7 Airlines is a member of the OneWorld alliance. Base airport is Moscow Domodedovo Airport (DME). Airlines operates flights to more than 143 destinations.
S7 Airlines fleet consisted of 65 aircraft, average age of aircraft 9.3 year.
Popular routes by last week
Flights by week
Moscow Domodedovo Airport (DME) Pulkovo Airport (LED) 70
Pulkovo Airport (LED) Moscow Domodedovo Airport (DME) 64
Moscow Domodedovo Airport (DME) Kazan International Airport (KZN) 28
Moscow Domodedovo Airport (DME) Voronezh Airport (VOZ) 28
Voronezh Airport (VOZ) Moscow Domodedovo Airport (DME) 27
Moscow Domodedovo Airport (DME) Kurumoch International Airport (KUF) 27
Moscow Domodedovo Airport (DME) Sochi International Airport (AER) 27
Saratov Airport (RTW) Moscow Domodedovo Airport (DME) 25
Moscow Domodedovo Airport (DME) Krasnodar International Airport (KRR) 24
Moscow Domodedovo Airport (DME) Anapa Airport (AAQ) 24
Enroute flight
S75035 Novosibirsk Tolmachevo Airport (OVB) Kazan International Airport (KZN) 0 feet. 0 knots. E170
S76366 Ulan-Ude Airport (UUD) Irkutsk International Airport (IKT) 0 feet. 0 knots. E170
S75565 Novosibirsk Tolmachevo Airport (OVB) Tashkent International Airport (TAS) 0 feet. 0 knots. 32N
S75031 Novosibirsk Tolmachevo Airport (OVB) Kurumoch International Airport (KUF) 0 feet. 0 knots. E170
S75354 Surgut Airport (SGC) Novosibirsk Tolmachevo Airport (OVB) 0 feet. 0 knots. E170
S75524 Ust-Kamenogorsk Airport (UKK) Novosibirsk Tolmachevo Airport (OVB) 0 feet. 0 knots. E170
S7232 Voronezh Airport (VOZ) Moscow Domodedovo Airport (DME) 1100 feet. 125 knots. A319
S748 Pulkovo Airport (LED) Moscow Domodedovo Airport (DME) 1300 feet. 139 knots. A319
S762 Kazan International Airport (KZN) Moscow Domodedovo Airport (DME) 8000 feet. 294 knots. A319
S7274 Penza Airport (PEZ) Moscow Domodedovo Airport (DME) 9600 feet. 220 knots. E170
S76321 Irkutsk International Airport (IKT) Hong Kong International Airport (HKG) 13300 feet. 278 knots. 32N
S75545 Novosibirsk Tolmachevo Airport (OVB) Osh Airport (OSS) 16600 feet. 283 knots. E170
S76272 Incheon International Airport (ICN) Vladivostok International Airport (VVO) 18300 feet. 434 knots. A320
S71026 Sochi International Airport (AER) Moscow Domodedovo Airport (DME) 23800 feet. 407 knots. A319
S7623 Moscow Domodedovo Airport (DME) Cagliari Elmas Airport (CAG) 26400 feet. 414 knots. A320
|
cc/2019-30/en_middle_0019.json.gz/line9668
|
__label__cc
| 0.732588
| 0.267412
|
2020 Honda Talon 1000R
New Utility Vehicles • SxS: Sport
2020 Honda Talon 1000R • Get Price Get Price
SXS10S2RLL
WIDE-OPEN FUN HAS JUST BEGUN.
East to west, north to south, America’s a big country with a lot of variety. Which is why our Talon family of sport side-by-sides just keeps growing. Our Honda Talons are available in both two- and four-seat models—probably the most anticipated side-by-sides ever. All share the same powerful, Talon-specific high-output engine, quick-shifting Automatic DCT Transmission, and exclusive I-4WD technology. Rider comfort? Nobody does it like Honda. Performance? We’ve built our reputation on it. The key differences between our two-seaters? The Talon 1000R has a longer wheelbase, a wider vehicle track, and more suspension travel than the Talon 1000X. It’s a perfect match for riders who tackle rugged, high-speed terrain. Proof positive that life is better, side by side.
Chassis Features
CHASSIS AND SUSPENSION: The Talon 1000R’s refined, high-performance chassis forms the basis for its superior handling and stability. From there we add long-travel independent front and rear suspension and generous ground clearance. Plus, the Talon 1000R gets premium, FOX Podium 2.5 shocks with QS3 quick adjustors on all four corners.
4+ LINK REAR SUSPENSION: On the Talon 1000R, Honda’s 4+ link rear suspension is one of the secrets to its superior handling. Controlling wheel geometry is difficult with so much travel, but with the Talon 1000R’s suspension, even with 20 inches of travel, the rear-wheels’ toe varies only 0.3 degree throughout entire stroke for better chassis stability under extreme suspension deflection.
HIGH-PERFORMANCE DISC BRAKES: A high-performance side-by-side needs high-performance brakes. The Talon 1000R’s power, chassis and suspension travel helps take these side-by-sides to the next level. Front and rear the Talon 1000R features 250mm discs, with 34mm twin-piston calipers in front and 34mm single-piston calipers in the rear. Electronic Brakeforce Distribution (EBD) optimizes front and rear braking power under dynamic chassis conditions in two-wheel drive.
INDEPENDENT FRONT SUSPENSION: Dual A-arm suspension gives you 17.7 inches of travel in the front. Pair that with stellar ground clearance and you begin to understand two reasons why the Talon 1000R handles so well and is so comfortable in rough terrain.
LONG WHEELBASE: The Talon 1000R’s 92.7-inch wheelbase contributes to this sport side-by-side’s tracking, and also gives you a super-smooth ride. A bit longer than the Talon 1000X’s, it places an emphasis on high-speed tracking and gives excellent control in whoops and rough terrain.
FRONT / REAR WEIGHT BALANCE: Exhaustive testing shows that for serious sport driving, a slight rear weight bias is best. That’s why we set the Talon 1000R up with 44 percent of its weight over the front, and 56 percent over the rear. Uphill, downhill, over whoops and in g-outs, the Talon 1000R just flat-out works.
DUAL-RATE SPRINGS: The Talon 1000R’s suspension springs offer soft initial travel, yet resist bottoming for both comfortable ride and control—the best of both worlds.
SKID PLATES: Off-road driving is a tough pursuit, and Mother Nature can be harsh. Not to worry—we have your Talon 1000R covered. Literally. Generous skid protection armors vulnerable undercarriage and suspension components. Want even more? Check out our accessories lineup.
FRONT BUMPER: Here’s something you can see and experience for yourself. The Talon 1000R’s standard front bumper offers a degree of vehicle protection some other side-by-sides lack. But this smart design doesn’t compromise performance, because it’s designed to slide smoothly over obstacles in rough approach conditions, enhancing off-road clearance and maneuverability while still offering good protection.
RECOVERY HOOK POINT: Built in to the Talon 1000R’s chassis design, this attaching point makes it easy to secure your Talon 1000R for transport, and also makes it easy to hook up a recovery strap when your buddy on some other brand of side-by-side gets stuck. Make him buy you lunch as a payback.
DRIVER / PASSENGER PROTECTION: The Talon 1000R’s Occupant Protection Structure uses large-diameter tubing, and meets ROHVA’s rollover protection standard. The standard-equipment hard doors and quick-clip side nets help keep debris from entering the cabin. Auto-style three-point seatbelts are equipped with an emergency locking retractor mechanism, to help optimize passenger security. (The Talon 1000R’s seats are also four-point compatible for competition use.)
ADJUSTABLE DRIVER’S SEAT: Honda has a ton of data and experience on seats, thanks to our auto division. And while just about every sport side-by-side has an adjustable driver’s seat, only the Talon gets it this right. Designed to fit a wide range of operators, it also locks positively in position without wobble, helping make you feel more connected to the vehicle.
PAINTED BODY: Why paint and not color-molded plastic? Because the Talon 1000R’s painted body parts resist scratching better, and we know that where you’re going to be driving this side-by-side, you won’t want to slow down for a little brush by the side of the trail. Plus, they just look better—the first time you see a new Talon 1000R in person, we’re sure you’ll agree.
TILT WHEEL: With a tilt steering wheel, you’re ensured an even more comfortable experience, especially under high-performance driving conditions. The tilt-wheel function can also make getting in and out of the Talon easier.
PASSENGER “T” GRAB HANDLE: Your passenger needs a solid way to hold on, but it took the Talon 1000R to get this feature right. The passenger “T” handle is quick adjustable, but just as important it adjusts solidly and rattle free.
LCD DISPLAY: The multi-function LCD dash display is large enough to host loads of information, in an easy-to-read way, like speed and fuel level. RPM and transmission mode. Fuel gauge, coolant temperature, trip information and more. It even includes a clock, so you’ll always know when it’s time for some fun.
HARD DOORS: The Talon 1000R's wide doors (standard equipment) make entry and exit easier. Plus, the doors use an automotive-style double-latch design that provides a secure, rattle-free feel.
ROOF: Typical of Honda’s attention to detail, the Talon 1000R’s roof is specially designed to divert rainwater away from occupants. And unlike some others, it’s also designed to be aerodynamically cooperative when transporting the vehicle, whether you’re trailering it forward or backward. Standard equipment.
TWIN-LEVEL PASSENGER FOOTRESTS: Some side-by-sides treat their occupants like they’re flying in economy class. Not the Talon 1000R. You’ve got acres of legroom here, even for six-foot-plus passengers wearing bulky boots. The special two-level passenger footrests let you brace yourself solidly over rough terrain, and stretch out when just cruising along. Designed to accommodate a wide range of passengers in comfort.
COMFORTABLE SEATS: The Talon 1000R’s seats have been designed to be the most comfortable in the industry. They feature a wide 530mm seatback that’s 800mm high, and an even wider 540mm seat bottom. They don’t rattle. They don’t hold water. They offer tons of lateral support. And the driver’s side is positively adjustable to fit a wide variety of operator heights. They’re even compatible with four-point harnesses for competition use. Your connection to your side-by-side starts here, and even before you start moving, you’ll know the Talon 1000R is the right ride for you.
INTEGRATED DOOR HANDLE: Another “small” detail, but one you and especially your passenger will come to appreciate. The vertically-inclined, integrated inner door handle style is another example of the premium the Talon 1000R puts on comfort and convenience. You’ll use it dozens of times each weekend, and wonder why all side-by-sides aren’t built this way.
LARGE CARGO BED: Lunchtime? We’re on it. The Talon 1000R’s cargo bed sits up high, out of harm’s way and where it’s easily accessible. Big enough to easily hold a large 45-quart cooler with room to spare, it has a 299-pound capacity (that’s a lot of burgers) and features six strong tie-down points.
DOOR NETS: A small detail? Not when you’ve wrestled with some other designs or aftermarket add-ons out there. On the Talon, our door nets are standard equipment. They latch and unlatch quickly and easily. Performance counts, and we’ve made it easier to protect yourself from the elements.
GENEROUS, SECURE CUP HOLDERS: Hey, we’re out here to have a good time, and who wants to be thirsty? And that means taking a beverage with you. The Talon 1000R’s twin cup holders securely hold the off-road standard, a 30-ounce tumbler, as well as plenty of other travel cups.
FLAG MOUNT: On other side-by-sides, things like a flag mount are an afterthought. Not on the new Talon. No detail escapes our designers’ full attention. The Talon’s flag mount is fully integrated into the design, and easy to use.
BUILT IN THE U.S.A.: The Talon 1000R is purpose-built for the American market, right in America. Domestically and globally sourced parts are all assembled at our plant in Timmonsville, South Carolina, and once these side-by-sides roll off the line, they’re ready to explore every corner of the country.
Drivetrain Features
AUTOMATIC SIX-SPEED DCT TRANSMISSION: he convenience of an automatic with the strength, control, and efficiency of a manual, Honda’s DCT lets you drive the way you want. Choose between manual mode or fully automatic. Plus, the addition of Sport Mode increases the fun, shifting at higher RPMs for a spirited, full-performance driving experience. DCT puts you in control as to what engine speed you want, and what gear ratio. Or you can let it do all the thinking for you. In addition, you also get genuine compression braking and a more efficient power delivery than a belt-driven CVT.
I-4WD: The new Honda Talon 1000R showcases the second generation of our exclusive I-4WD system, specifically tuned to respond quicker and capable of delivering even more drive force. Think “I” for “Intelligent,” because that’s exactly what it is. An industry-first brake-traction control system for side-by-sides, it simplifies operation, increases drivability and optimizes traction. Using proven, advanced technology from Honda’s automotive division, you get the benefits associated with a locked front differential with none of the downsides. That means it maintains front-wheel traction even if one wheel wants to spin on ice or mud or if it’s in a hole. But at the same time, you get the lighter steering, better tracking at high speeds, tighter turning radius, and reduced kickback associated with unlocked front differentials. Special software tunes the I-4WD system for sport use.
RELENTLESS DURABILITY: When it comes to strength and toughness, the Talon 1000R leads the way. The oversized 87mm CV joints, beefy 39.7mm propshafts and strong U-joints are all built to survive the loads that low-speed rockcrawling can generate—and which cause driveline failures in so many other side-by-sides.
PADDLE SHIFTING: Steering column-mounted paddle shifters add a serious dose of performance in every drive. In Manual mode, they let you shift without ever taking your hands off the steering wheel, and in Automatic mode, they let you override the current gear with a quick up or downshift, holding that gear for several seconds before returning to Automatic mode.
HIGH / LOW SUBTRANSMISSION: With a full 42-percent gear reduction between High and Low, you get the torque you need in all six gears. That’s sure to come in handy when driving over difficult terrain, scaling hills or rock crawling.
HILL START ASSIST: Need to stop on a steep uphill? Honda’s Hill Start Assist automatically holds your Talon 1000R in position while you move your foot from the brake pedal to the accelerator—there’s no roll-back drama. It even works on the downhills, too!
2WD / 4WD / SHIFT ON THE FLY: Want to access as much traction as possible? Put it in I-4WD. Need maximum power at all four wheels? I-4WD eliminates the need for traditional locking differentials. Want to use 2WD for lighter steering or specific terrain? The Talon 1000R lets you do it all, and the best part is, you can do it all with the push of a button.
CV JOINT BOOT PROTECTION: Tear a CV boot, and it’s only a matter of time until you’ll be making a costly replacement. That’s why we give the Talon 1000R’s CV joints double protection: First, we design them to tuck up tight covered by the suspension arms. Second, the CV joints themselves get a special guard to offer even more protection.
SPIRAL RING AND PINION FINAL DRIVE: Spiral-cut gears in your Talon 1000R’s final drive mean the load is shared over several teeth, not just one, and that means they’re quieter and produce less vibration too.
CONNECTED DRIVE FEELING: Compared to a CVT transmission, the Talon 1000R’s positive automatic DCT gearbox gives you a far more connected feel with your side-by-side. Combine that with the Talon 1000R’s responsive engine, and you’ll see why a Talon 1000R gives you a superior sense of control.
ENGINE LOCATION: Balance is the key to great handling, and that’s why we put the Talon 1000R’s engine where we do. Mounted behind the cab, it results in an excellent, neutral weight distribution.
LOW-EXPANSION BRAKE HOSES: By fitting the Talon with low expansion brake hoses, you get better pedal feel and rock-solid braking performance.
ELECTRIC POWER STEERING: Standard equipment on all Talon models, our Electric Power Steering system helps eliminate bump steer through rocky and rutted terrain, which reduces fatigue. What makes it even better is the added assist you get when you need it most, like when you’re in 4WD, driving at lower speeds, or maneuvering over rough conditions. And on the Talon 1000R, the system is specially tuned to give you the right amount of feedback for sport-driving.
POWERFUL 999CC TWIN-CYLINDER ENGINE: Sport side-by-sides need power, and you’re sure to find the new Talon 1000R offers plenty of it. The Talon 1000R’s 999cc liquid-cooled inline twin delivers the kind of powerful torque and quick-revving horsepower you’d expect from a flagship sport model, but is equally responsive in lower revs and in the critical midrange too. Set longitudinally in the chassis and managed by Honda’s sophisticated PGM-FI engine-mapping system, it delivers the kind of refinement no other side-by-side can match.
UNICAM CYLINDER HEAD DESIGN: The Talon 1000R’s 999cc liquid-cooled inline twin uses the same proven Unicam® cylinder head design found in our championship-winning CRF450R motocrosser. That helps make the engine more compact, which lets us position it for optimal weight distribution and ground clearance.
ROLLER ROCKER ARMS: Roller-tip rocker arms in the Talon 1000R’s valve train help reduce engine friction, facilitate higher, faster revs, and contribute to more efficient engine operation and power. They’re another example of Honda refinement you may not see, but that you’ll feel with every ride.
HIGH LIFT, LONG DURATION CAMSHAFT: Giving the Talon 1000R’s engine a camshaft with high lift and long duration helps transform the engine. Better breathing helps the Talon 1000 make more power, and keeps that power coming all the way to redline.
INCREASED THROTTLE BORE SIZE: Complementing the Talon 1000R’s potent camshaft specs, our engineers also gave the engine twin 46mm bores for more airflow and better breathing. You’ll feel it the first time you floor the throttle, and you’ll hear it too, with the Talon 1000R’s throaty intake roar.
HIGH-FLOW FUEL INJECTORS: Here’s a math lesson that’s anything but boring: More air plus more fuel equals more power. With the hot cam, throttle body and high-flow fuel injectors, the Talon 1000R’s engine is the total package for total off-road performance.
OFFSET DUAL-PIN CRANKSHAFT: The crankshaft seems such a simple part, but it’s here that so much of the engine’s character is determined. By offsetting the cylinders’ two crankpins by 270 degrees, the Talon 1000R’s engine delivers a wide powerband and abundant torque. Counterbalancers keep everything running smooth.
TUNED EXHAUST: The final part of the Talon 1000R’s balanced power equation: better breathing and more fuel delivery require an equally tuned exhaust system. The Talon 1000R delivers. Not only does it deliver some beautiful mechanical music, but it helps the engine deliver smooth, even power from partial throttle to wide-open running.
HIGH CAPACITY COOLING SYSTEM: RRock crawling, deserts, dunes, and high-altitude operation can all challenge your side-by-side’s cooling system. That’s why we gave all our Talons a high-capacity system. Tested under the most arduous conditions we could find, you can rest assured your engine will remain cool, calm, and collected when the going gets tough.
OIL-JET PISTONS: Another invisible example of Honda’s race-winning engineering. Squirting oil up onto the underside of the Talon’s pistons help them run cooler and seal better. The combination makes for longer piston life, and more power. The design also lets us use lighter pistons, for a faster-revving engine.
10MM CYLINDER OFFSET: By building the Talon 1000R’s engine with the cylinder bore 10mm in front of the crankshaft, we change the thrust forces on the pistons’ skirts and faces. That helps the rings seal better. It’s all part of the Honda story—numbers only tell a small part; design details like these make your Talon 1000R the best in class.
SPINY SLEEVE CYLINDER LINER: Another example of Honda’s attention to detail and unmatched engineering. This unique system positively locks the steel cylinder liner and the aluminum cylinder block together. The result is more contact surface area, and that means better engine cooling and heat transfer for superior engine performance.
SEMI-DRY-SUMP LUBRICATION: Proven in Honda’s racing engines, keeping engine oil away from the crankshaft helps eliminate windage losses. The semi-dry-sump design also helps ensure more positive oiling under the extreme driving conditions a Talon 1000R driver can experience. Better engine lubrication and longer engine life are the result.
ENGINE AIR INTAKE: To get the most out of your engine, you need the best air going into it. That’s why we positioned the air filter up high over the engine in the rear, and the air intake off to the side. It helps ensure a clean air supply, even at deeper fording depths.
RUBBER-MOUNT ENGINE AND EXHAUST: Some of the most impressive Talon 1000R features are those you’ll never see. In addition to the suspension and ground clearance, we rubber-mounted the engine and exhaust system to insulate the cabin against excessive vibration. We also gave them four engine mounts to add strength under high-performance driving operation.
POWER: Because Honda’s all-gear Automatic DCT Transmission is so efficient, it has more rear-wheel horsepower than some of the competitors in the class.
1,548 lb. (Includes all standard equipment, required fluids and full tank of fuel)
Six-speed automatic Dual-Clutch Transmission (DCT) with high/low subtransmission. Two drive modes with 2WD and I-4WD. Three shift modes (standard, sport, manual w/ paddle shifters)
Unicam® OHC longitudinally mounted parallel-twin four-stroke; four valves per cylinder
7.3 gal. (including 1.1-gal. reserve)
1 Year, Transferable limited warranty; extended coverage available with a Honda Protection Plan
|
cc/2019-30/en_middle_0019.json.gz/line9670
|
__label__wiki
| 0.639998
| 0.639998
|
Gekijō-ban Mahō Shōjo Madoka Magica Zenpen: Hajimari no Monogatari
[edit/review] [links] [se index log]
[series:3050]
Title: Gekijō-ban Mahō Shōjo Madoka Magica Zenpen: Hajimari no Monogatari
Puella Magi Madoka Magica the Movie Part I: The Beginning Story
劇場版 魔法少女まどか☆マギカ 前編: 始まりの物語
Overall: Buy
2012, Action, Dark, Drama, Fantasy, Mahou Shoujo, Middle School, Movie, Reboot, Surreal
Notables:
Animation - Shaft
R1 License - Aniplex of America
In the city of Mitakihara, a girl named Madoka Kaname, along with her friend, Sayaka Miki, encounter a creature named Kyubey and are saved from witches by a magical girl named Mami Tomoe. Kyubey offers Madoka and Sayaka the chance to have any one wish granted in exchange for becoming a magical girl and fighting witches, whilst Homura Akemi, another magical girl who recently transferred into Madoka's class, is strongly against Madoka becoming one. Before Madoka can make a decision, however, Mami is killed by a witch, leaving Madoka too afraid to become a magical girl. Sayaka, however, decides to become a magical girl herself in order to heal the hand of her childhood friend, Kyosuke Kamijou. As Sayaka soon comes into conflict with another magical girl named Kyouko Sakura, they, along with Madoka, learn the shocking truth that their soul gems, the source of their magical powers, literally contain their souls.
(Summary Courtesy of Anime News Network)
130-minute compilated film released on October 6, 2012 that covers events from the first eight episodes of Puella Magi Madoka Magica (TV).
Animated by Shaft.
Licensed by Aniplex of America.
[edit] The ↗Puella Magi Madoka Magica franchise:
(2011) Puella Magi Madoka Magica (TV) (TV series, 12 episodes)
(2012) Gekijō-ban Mahō Shōjo Madoka Magica Zenpen: Hajimari no Monogatari (first movie, 130 minutes)
(2012) Gekijō-ban Mahō Shōjo Madoka Magica Kōhen: Eien no Monogatari (second movie, 109 minutes)
(2013) Gekijō-ban Mahō Shōjo Madoka Magica Shinpen: Hangyaku no Monogatari (third movie, 116 minutes)
Series Story
Episode Story
Buy 4 9 9 8 7 8 Ggultra2764 [series:3050#1552]
Gekijō-ban Mahō Shōjo Madoka Magica Zenpen: Hajimari no Monogatari Really surprising I'd actually like what is essentially a compilated take on Madoka Magica. In most instances, films that adapt events from their TV anime source alter or compress events to fit into a two hour running time and this tends to kill much of the plot buildup and character exploration that such anime were afforded in TV anime form, this being notable in stuff like a decent number of Gundam titles that are notable for having 50+ episode runs. Since Madoka Magica's TV run was only 12 episodes, not as much stuff gets cut out in the transition between TV and movie format. The movie still takes its time to build up events, more is revealed over time about the twisted nature of being a magical girl in the world of Madoka Magica and many of the major players still get fleshed out (Mami is still underdeveloped compared to the other girls). The movie version sports a higher animation budget thus key scenes from the series sport more details and fluid animation compared to the TV anime, though the suspenseful soundtrack that contributed to Madoka Magica's dark developments isn't utilized as heavily compared to the TV series. Since Beginnings is based on the first eight episodes to the TV anime, it is obviously left open-ended for the second film in the trilogy that covers events from the final four episodes called Eternal. Still, I'm surprisingly loving this movie take as much as the TV anime and look forward to reliving events with Madoka Magica in its second film.
Last updated Sunday, June 21 2015. Created Sunday, June 21 2015.
Community Anime Reviews
Reviewer Profiles
Active connections[?]: 4 Reviewers logged in[?]: 1
reviewers.
series reviewed.
Login to chat
Carole and Tuesday
Rurouni Kenshin: …
Full Metal Panic …
Koukaku Kidoutai …
Vampire Hunter D …
FLCL
Slayers Next
Majo no Takkyuubin
Most visited this month…
Gokudo-kun Manyuki
Mobile Suit Gund …
Shin Seiki Evang …
Serial Experimen …
Tenkuu no Escaflowne
Clicking below will send you to a 404 page that we use as a honeypot to ban non-compliant robots.
Don't click here
|
cc/2019-30/en_middle_0019.json.gz/line9682
|
__label__cc
| 0.643112
| 0.356888
|
Home > News > AECO – Jun 14, 2016 3:07 pm
Autodesk and Trimble Sign Interoperability Agreement—Customers Need Flexibility
Autodesk and Trimble sign interoperability agreement that covers both IFC and API and developer tools exchange.
This morning Autodesk and Trimble, the two largest AECO (architecture, engineering, construction and operations) software companies in the world, announced a significant agreement on increasing interoperability for the sake of their common customers.
The aims of the agreement are in reducing project costs associated with workflow inefficiency across different supplier technologies (or tool chains). This will benefit all stakeholders in AECO but particularly project building owners who will have more freedom to optimize technology workflows needed in today’s growingly complex work environments.
IFC and Exchanging APIs
Under the terms of the agreement, both companies have agreed to shared goals in meeting the evolving needs of the building and infrastructure industries. This requires excellent transfer of data in applications among various tool chains. Both companies are committed to supporting open industry standards such as the Industry Foundation Classes (IFC) and the Construction Operations Building Information Exchange (COBie), and can enable current and prospective Autodesk and Trimble customers working on the same project to work together seamlessly and through optimized file compatibility across applications.
01 – Autodesk and Trimble sign significant interoperability agreement.
The agreement says that both companies have agreed to exchange Application Programming Interfaces (APIs). And both companies have agreed to share developer tools to build and market interoperable products. This allows both companies to improve upon existing data exchanges, as well as open up new workflows between their products. Tighter product-to-product (as in Autodesk to Trimble products) integration can enable design and construction professionals to share models, project files, and other data between select Autodesk and Trimble solutions both in the office and the field, and allow for the reuse of information during design and construction throughout all phases of the project.
Commitment to Openness
“The strength of a company is best measured by its willingness to do what it is right for its customers and the industry and large. This interoperability agreement, like others we’ve signed, speaks to Autodesk’s commitment to openness,” said Amar Hanspal, senior vice president, Autodesk. “This collaboration with Trimble speaks to our shared dedication to making the building process more efficient and productive for all involved.”
“This collaboration demonstrates our mutual commitment to provide design and construction professionals with a seamless experience from both Autodesk and Trimble design-build-operate solutions,” said Bryn Fosburgh vice president at Trimble. “As a result all stakeholders across the construction lifecycle can optimize their workflow efficiency.”
Architosh Analysis
A key word in this interesting agreement is the word “select” used in the press release. This meaning applying to which applications the companies will be willing to share APIs. Overall, this is a big announcement and continues the dialog Autodesk in particular has been having about “openness” and recognizing that the AECO world is too large for one single vendor to provide best-in-class software solutions. When an Autodesk VP says that it is not uncommon to see large projects require the use of up to 40-50 applications, today or in the future in particular, it means a recognition that “interoperability” is now a killer feature when comparing a company’s positions and capacity with working with, and accommodating, toolchains from rival software firms.
This is why Autodesk A360 was awarded a BEST of SHOW this year at AIA, due to is stellar positioning and technical capacity to work across platforms and interoperate with so many software file formats.
Filed under: AECO, Editor's Pick, News
Story tags: AEC, AECO, Autodesk, interoperability, Trimble
4DanielPana
– June 14, 2016 04:10 pm EDT
RT @architosh: Autodesk and Trimble Sign Interoperability Agreement—Customers Need Flexibility: This morning Autodesk and… https://t.co/2…
randersonrla
Still will not be as efficient as one workflow of Vectorworks. Autodesk & Trimble sign Interoperability agreement
https://t.co/gK9Ylz3jgE
|
cc/2019-30/en_middle_0019.json.gz/line9683
|
__label__wiki
| 0.69645
| 0.69645
|
Official: This Website Compiles Local, State & Federal Public Record Resources That Enable The Public To Conduct Do-It-Yourself Background Checks.
First Name: Please enter first name
Last Name: Please enter last name
City (optional): Please enter city
State: Select StateAlabamaAlaskaArizonaArkansasCaliforniaColoradoConnecticutDelawareDistrict of ColumbiaFloridaGeorgiaHawaiiIdahoIllinoisIndianaIowaKansasKentuckyLouisianaMaineMarylandMassachusettsMichiganMinnesotaMississippiMissouriMontanaNebraskaNevadaNew HampshireNew JerseyNew MexicoNew YorkNorth CarolinaNorth DakotaOhioOklahomaOregonPennsylvaniaRhode IslandSouth CarolinaSouth DakotaTennesseeTexasUtahVermontVirginiaWashingtonWest VirginiaWisconsinWyoming Please select a state
Check Someone's Background In Minutes
Court Cases, Contact Information, Assets, Police Records and Much More!
New Mexico Criminal Background Check
Bernalillo County Inmate List – Find out if someone is in jail. Look to see who was recently arrested. Search for someone arrested for murder, charge d with assault with a deadly weapon, and find people charged with crimes committed against women and children. Located in Albuquerque, New Mexico.
Cibola County Inmate Search – Search for inmates in the Cibola County jail. Look up who is in jail by first name or last name. Find out what charges they are facing, find the date someone was arrested, and see how many days somone has been in jail. Located in Grants, New Mexico.
De Baca County
Dona Ana County Inmate Search – Search the Dona Ana county jail inmate roster to find arrest information for all inmates currently detained. Look through the inmate mugshots, find out if there are any felony charges filed, look to to see if the charge is a misdemeanor, and find out when someone was arrested. Located in Las Cruces, New Mexico.
Los Alamos County
Otero County Detention Center – Find all important information and contact information for all the inmates currently in custody at the Otero County jail. Review the rules and guidelines for all things and matters pertaining to inmates currently in jail. Located in Alamogordo, New Mexico.
Quay County
Rio Arriba County Jail Inmates – Look at the most current list of inmates and search for inmates that have been recently released. See if you know someone in jail and see if there is someone you know that has been released. Find out when someone was arrested and see the inmate mugshots and filed charges. Located in Amarilla, New Mexico.
Sandoval County Inmate Lookup – Look up someone in jail. Find out who was arrested in Bernalillo, New Mexico. Look through the list of charges filed against the people in jail. See if there are any charges for violent crimes and how severe the charges are. Find out if someone has committed a felony. Located in Bernalillo, New Mexico.
San Juan County Detention Center – Find all the important information you need for inmates being detained in San Juan county jail. Search through the list of recommended guidelines for visitation, sending inmates money, and the contact information for the sheriff’s office. Located in Aztec, New Mexico.
San Miguel County Jail Inmate Log – Us the Sna Miguel county jail log to see who has been recently arrested and to find out who is currently in jail. Look through the inmate names and charges. See if there are charges that are filed as felonies, look for misdemeanor charges. See the inmate booking numbers and holding pod location. Located in Las Vegas, New Mexico.
Santa Fe County Jail Roster – Search the Santa Fe county jail inmates list and see who is in jail. Find all available arrest details. Look through all the charges, find out if someone has been sentenced, look for bond amounts, and see if there is a chance of someone getting released. Located in Santa Fe, New Mexico.
Sierra County Inmate Roster – Review the list of names for the inmates in custody at the Sierra County jail. Find out if someone has been charged with murder, see if there is anyone charged with selling heroine and other drugs, look up the inmates arrest details and see how many felons are in jail. Located in Truth or Consequences, New Mexico.
Socorro County Jail Inmate List – Look through all the inmate rosters. Find all the arrests and inmates detained over the years. Updated weekly by the county sheriff’s office, you can find weekly arrest reports and inmate arrest information. Located in Socorro, New Mexico.
Find an inmate or family member currently in custody of New Mexico Department of Corrections.
New Mexico Licensure Background Check Information – Find out more information on how to obtain a background check in New Mexico. Find out what is on your record and if you follow all laws and procedures then you can look at someone else’s background to ensure the hiring and or licensing process.
New Mexico Court Case Lookup – View electronic court case records online. Find the results of a court case and if someone was convicted of a crime. Search criminal court records, civil, probate and more.
New Mexico Sex Offender Search – Find sex offenders near you in New Mexico. Search by location, zip code, area and find registered sexual offenders by name. Find out if someone is a sex offender or not.
Locate the whereabouts of a federal inmate incarcerated from 1982 to the present.
https://www.bop.gov/inmateloc/
© Copyright 2019 Arrests.us. All Rights Reserved.
|
cc/2019-30/en_middle_0019.json.gz/line9687
|
__label__wiki
| 0.882442
| 0.882442
|
Governor creates group to focus on cruise industry
Guam Pacific Daily News
Guam currently receives about five cruise ship visits per year, the next in October, when a ship carrying about 5,000 passengers is scheduled to dock for about 12 hours.
The goal is for Guam to gain a larger share of the growing cruise industry, including homeporting a small cruise ship here, which would create more
"There's a lot of work ahead of us,"
Properly plan, follow through on cruise ship industry
The Sea Princess cruise ship sailed into Guam's harbor on April 5, 2012, bringing in more than 2,700 passengers and crew members to the island for a one-day visit. At the...
Guam Pacific Daily News 2019-07-09
Discovery Pier calls to cruise lines
GREILICKVILLE — Transformation of the former coal dock into the publicly accessible Discovery Pier is smoothing the way for more passenger-carrying cruise ships to visit...
Port hires new legal counsel; closes $1.8M budget gap
The Port Authority board of directors meets on Tuesday, July 9. Anumita Kaur/PDN The Port Authority of Guam hired Joseph McDonald, former chief prosecutor, as its new...
Ceremony honors thousands who died during war, promotes peace
The Guam Chinkon Shrine that sits seaside at Adelup has a small structure that looks like a house, sitting atop a sturdy brick pillar. Inside the structure is a small...
Governor separates library, CAHA from CHamoru Affairs and reorganizes cultural agencies
Guma' Ininan I Saina-ta cultural group members perform during the opening ceremony of the Guam Micronesia Island Fair held at Plaza de España on May 29, 2019. Dominic Cawili/PDN Gov. Lou Leon Guerrero starts working on reorganizing government agencies to improve efficiency, beginning with the separation of the Guam Public Library System and the Guam Council on the Arts and...
Every spring and summer, travelers from around the country and across the world flock to the Seattle waterfront to board cruise ships bound for Alaska. They’re drawn to the promise of relaxation and adventure alongside unforgettable scenery. But for many, the adventure starts before their trip begins. They marvel at the beauty of our region, spend money in our local businesses,...
Belleview Reporter
Cruise Critic Names the World\'s Most Popular Cruise Destinations Based on Consumer Reviews
EWING, N.J., July 17, 2019 /PRNewswire/ -- Cruise Critic®, the world's leading cruise reviews site and online cruise community, has announced the winners of its fourth annual Cruisers' Choice Destination Awards, naming the world's most popular cruise destinations, based entirely on consumer ratings submitted with reviews on Cruise Critic. The awards name the top cruise...
Samoa 2019 XVI Pacific Games: Guam spikers short on height, big on quickness
Guam's volleyball representatives to the Samoa 2019 XVI Pacific Games are relying on their attitudes as much as their skills on the courts of the National University of Samoa. Guam's men's team had a frustrating tournament the last time they were in action at last year's Micronesian Games. They arrived with high hopes but didn't make the medal round. Guam's women, however,...
As cruise ships come and go, a scramble to get ready
GALVESTON At the Port of Galveston, cruise ships are coming and going more often than ever. Nearly 300 times this year, cruise ships operated by Carnival, Royal Caribbean and Disney will dock at one of Galveston's two cruise terminals, back from the Caribbean or Mexico, and release their passengers back to their post-vacation lives. There's a controlled chaos around a ship's...
The Galveston Daily News
Speaker, senators to visit live-fire training range complex
Speaker Tina Muña Barnes and nine senators are scheduled to visit the live-fire training range complex on July 12. The speaker sent a letter on June 26 to Rear Adm. Shoshana Chatfield, commander of Joint Region Marianas, requesting the visit for her and fellow members of the 35th Guam Legislature. Chatfield responded, finalizing July 12 as the date for the site visit. More:...
|
cc/2019-30/en_middle_0019.json.gz/line9688
|
__label__cc
| 0.582945
| 0.417055
|
Luxury Safaris In The Serengeti
Where exactly does one go for a Serengeti safari? Well, on a map of Africa, Serengeti National Park can be found just to the north of every bucket list. There’s simply no more iconic wildlife experience than a safari in the Serengeti…
One of the highlights of a luxury Serengeti safari is the Great Wildebeest Migration. Crossing plains both green and dusty, antelope follow the hypnotic cycle of the rains. You might catch up with the wildebeest in the southern Serengeti as calving takes place, and wobbly new legs try to outrun predators. Or in the central Serengeti, with the herd moving through areas that also offer exceptional year-round game viewing.
Witnessing a Grumeti River crossing in the western Serengeti will stay with you forever, as you’ll inevitably find yourself rooting for antelope over crocodile. The reptiles get a second bite of the cherry when the herds return from Kenya, and must ford rivers anew.
The Serengeti also contains Olduvai Gorge – one of the places where man began – and the black volcanic dunes of the Shifting Sands. Could their magnetic properties explain why people are drawn back to the Serengeti, and the ceaseless circling of the wildebeest?
Celebrate your bipedalism on a walking safari, or the triumph of human ingenuity as you float over the herds in a hot-air balloon – from campfires to gas burners in just a few thousand generations!
Your pulse will slow and quicken with the rhythms of the migration, whether it’s the spectacle of multiple births, crocodile snapping at heels or scenes of serene grazing. The Serengeti is Africa’s beating heart, and a masterpiece of circulation.
Jun–Oct
Dec–Mar
Apr–May | Nov
The dry season opens with a high point of the Great Wildebeest Migration: the herds mustering on the banks of the Grumeti River around June, before attempting the crossing. Weatherwise, temperatures are cooler and very manageable now. At first the plains are lush and green after the rains, but soon the grass dies back, meaning that game in general is easier to observe. These factors combine to make this the peak season for safari in the Serengeti, so prices usually rise and availability can become tight in the lodges.
The short November rains bring a lovely green flush to the savannah, which slowly fades along with the memories of thunder and showers. As the new year starts, wildlife begins to congregate at the few remaining waterholes that provide a lifeline, but also prime ambush opportunities for predators. The short grass plains of the southern Serengeti are transformed into a giant wildebeest maternity ward as synchronised birthing takes place in January and February – an event which signals a bonanza for big cats and wild dog alike.
The Serengeti is essentially a year-round destination, although these months represent the peaks of the long and short rains respectively, so come prepared for heavy showers. Going on a luxury Serengeti safari during either of the wet seasons means you’ll be sharing all that space with significantly fewer fellow visitors, but arriving with you will be the massed herds. They move north through the central Serengeti towards the western Serengeti in April and May, while November sees the return journey from Kenya’s Masai Mara southwards into the northeastern Serengeti.
What to see and do in The Serengeti
A stay in a private concession in the greater Serengeti allows you the opportunity to explore the wilderness on foot. As well as seeing some of the details often missed from a game-drive vehicle, a Serengeti walking safari gives you a chance to appreciate the scale, and experience the freedom…
Tanzania | Savannah, Crater & Wilds | 9 Nights
This luxury Tanzania safari is a journey in many senses: from witnessing wildebeest calves in the Serengeti begin their own voyage, to journeying into the Earth at the Ngorongoro Crater, back in time at Olduvai Gorge, or off the map in Ruaha National Park. Every day is truly an exploration.
Tanzania Honeymoon Safari | Wildebeest Calving, Crater Romance & Beach Fever | 12 Nights
This Tanzania honeymoon safari uncovers the romance of three uniquely beautiful destinations: a mobile tented camp in the Serengeti plains that moves with the migration, a stilted cottage perched on the rim of the Ngorongoro Crater, and a beachside chalet nestled in tropical forest on Mnemba Island.
Uganda & Tanzania | Gorilla, Wildebeest Migration & Crater | 9 Nights
This Tanzania and Uganda luxury safari places you in the heart of the action for two very different, but equally remarkable, kinds of wildlife experiences. The intimacy of a mountain gorilla encounter in Bwindi Impenetrable Forest is matched for impact only by seeing the herds in Serengeti National Park and…
Tanzania | Treetops, Manor, Serengeti & Island | 11 Nights
Northern Tanzania contains the greatest concentration of safari hotspots found anywhere in Africa: Tarangire, the Serengeti and the Ngorongoro Crater add up to an unmissable wildlife experience. Factor in the pristine beaches and warm waters of Zanzibar, and you have a luxury Tanzania safari that encompasses the very best this…
Tanzania | Rift Valley Lake, Serengeti & Crater | 8 Nights
Northern Tanzania was shaped by incredible natural forces, and the evidence of their actions can still be seen in the spectacular scenery. Today, it’s living things which are having more of an impact on these ancient cliffs and craters, but their allure remains irresistible – to wildlife, and to spellbound…
Tanzania | Baobabs, Serengeti & Chimps | 11 Nights
This luxury Tanzania safari effortlessly combines famous locations with less well-known, but equally fascinating destinations. Spend time in both the sea of land that is the Serengeti, and on the shores of the ‘great plain-like lake’, Tanganyika. Comfort and service are recurrent themes, set against pristine natural habitats that invite…
Kenya & Tanzania | Mountaintop, Maasai & Migration | 10 Nights
This luxury safari in Tanzania and Kenya is a great reflection of what the two countries have to offer. While enjoying the craggy landscapes of Samburu and the boundless savannah of the Serengeti-Masai Mara ecosystem, you’ll see the Samburu Special Five, migrating wildebeest and more.
Kenya & Tanzania | Mara, Migration, Flamingos & Crater | 11 Nights
While Tanzania and Kenya differ in important ways, they enjoy many strong bonds, from their shared Maasai culture to the Great Wildebeest Migration. This 11-night luxury safari encompasses the very best of each country, going back in time to the places where man began, and working towards conserving the future.
Luxury Safari Lodges in The Serengeti
Serengeti Safari Camp | Serengeti National Park
The Serengeti is a place in perpetual motion, with breezes blowing through the sea of grass and the endless journeying of the herds. So it’s entirely fitting that there’s a luxury Tanzania safari camp that’s also on the move: Serengeti Safari Camp changes location several times a year, for optimum…
Mara River Tented Camp | Serengeti National Park
On a U-bend of the Mara River in Tanzania, Mara River Tented Camp gives you front-row seats to multiple river crossings of the Great Wildebeest Migration. Boasting incredible Serengeti views, abundant wildlife and uncrowded game drives, this luxury Tanzania safari lodge is remote, exclusive and incredibly special.
Lamai Serengeti | Serengeti National Park
Hidden among the Kogakuria Kopje rocks, the open-fronted suites at Lamai Serengeti offer commanding views over Tanzania’s Serengeti plains. While you’ll see the Great Wildebeest Migration cross the nearby Mara River in season, this luxury Tanzania safari lodge is good for wildlife action any time of year.
Legendary Serengeti Mobile Camp | Serengeti National Park
Moving between the north, south and west Serengeti throughout the year, a stay at Legendary Serengeti Mobile Camp – a luxury Tanzania safari lodge with just 11 tents – guarantees viewings of the Great Wildebeest Migration, including wildebeest calvings, river crossings and hundreds of thousands of animals in the grass…
Serengeti Pioneer Camp | Serengeti National Park
Discover what it was like to stay in the safari camps of the 1930s at Serengeti Pioneer Camp, which has all the style of an almost forgotten era. Here you can enjoy unparalleled views of the Moru Kopjes and Lake Magadi in Tanzania, and get close to Great Wildebeest Migration.
Serengeti Under Canvas | Serengeti National Park
Moving to different Serengeti campsites along the Great Wildebeest Migration path in Tanzania, Serengeti Under Canvas makes sure to offer the best possible sightings of this spectacular event. Here, you’ll experience an authentic mobile safari with luxury tents, exceptional game viewing and even hot-air ballooning.
Grumeti Serengeti Tented Camp | Serengeti National Park
Set in a forest overlooking Tanzania’s Grumeti River, which snakes through the western Serengeti National Park, you’ll find Grumeti Serengeti Tented Camp. Enjoy spectacular wildlife sightings year round, or come during migration and watch scores of wildebeest evading the jaws of some of Africa’s biggest crocodile to cross the waterway.
|
cc/2019-30/en_middle_0019.json.gz/line9691
|
__label__wiki
| 0.533748
| 0.533748
|
You are here: Publications Film Reviews 2015 Reviews July 2015 Kafkas Der Bau (The Burrow)
Kafkas Der Bau (The Burrow)
Starts July 9, 2015
Directed by: Jochen Alexander Freydank
Writing credits: Jochen Alexander Freydank, Franz Kafka
Principle actors: Axel Prahl, Josef Hader, Roeland Wiesnekker, Kristina Klebe
At the beginning of the new century, there is fear, paranoia, isolation. Unseen forces threaten to destroy everything we hold dear – our privacy, our safety, our family. This undefined something gnaws away at us as we dig ourselves ever deeper into our burrows, taking measures meant to make us feel more secure. We surround ourselves with cameras, locks, guards, guns. But our paranoia only increases. What is it that threatens us? Poverty, darkness, and extremism lurk outside the sturdy walls of our ingeniously-constructed fortresses, and insidious sounds can be heard echoing from within. No matter how closely we press our ears against our walls though, they elude our understanding. Perhaps we don’t have the control over our well-laid-out lives that we imagine we do. Slowly, the outside begins to leak in, despite our careful preparations…
These thoughts, these fears, this descent from smug self-satisfaction to nervousness and despair, have their roots not in the cyber-terrorist-immigrant paranoia of 2015, but in the Weltanschauung of 1923, when the insecurities of post-war society and financial disaster led the great Czech author Franz Kafka to write the story on which DER BAU is based. It’s a tour de force of existential angst; the astonishing actor Axel Prahl embodies Kafka’s worried Everyman, voicing the writer’s stream of consciousness while he struggles to justify his behavior to himself.
A successful businessman with a picture-perfect family and an expensive car moves into a gleaming new apartment tower. Good things await. Like so many of us, Franz captures all his accomplishments on camera, narrating his own fortunate story. But his new soulless surroundings fail to provide him with the feeling of security he seeks. His new neighbor is less than welcoming. The building security guards seem to be laughing at him behind his back. His colleagues at work exchange glances when he arrives. And are those hoboes living in the basement? Franz starts working on improvements to his new living place, designed to cocoon his family and barricade out the unhappiness. But soon his constructions take on a life of their own. Franz – or is it the viewer? - seems to be losing his grip on reality.
Jochen Alexander Freydank’s SPIELZEUGLAND (Toyland) won the 2009 Oscar® for best live action short film. DER BAU, which took him ten years to complete, is a rare work of art that captures the terror of the unknown - and uncontrollable - in grey-green hallucinatory tones. Freydank’s visual style, loaded with mind-blowingly creepy CGI effects, is a welcome respite from the sameness of most contemporary film storytelling. Kudos especially to cinematographer Egon Werdin and the ambitious sound crew. (Brenda B.)
|
cc/2019-30/en_middle_0019.json.gz/line9698
|
__label__wiki
| 0.840792
| 0.840792
|
Resolution tabled in Punjab assembly to pay tribute to APS martyrs
Web Desk On Dec 13, 2018
LAHORE: In a move to pay rich tribute to martyrs of Army Public School (APS) Peshawar, a resolution was tabled in Punjab Assembly, on Thursday to declare December 16, as National Day against terrorism and extremism.
As per details, a resolution to pay homage to APS Peshawar victims was submitted by Pakistan Muslim League-Nawaz (PML-N) MPA, Hina Pervez Butt in Punjab assembly.
“The house shows solidarity with the heirs of the victims, who laid their lives in a brutal assault at Army Public School Peshawar on December 16, 2014,” the resolution reads.
The resolution demands from the house to declare December 16, as a National Day against terrorism and extremism.
On December 16 back in 2014, six terrorists stormed the school and martyred around 150 students and teachers. The security forces swiftly responded to the attack and killed all the terrorists.
The tragedy that shook the nation brought unity among Pakistan’s political stakeholders who set aside their differences and sat together to chalk out a counter-terrorism strategy.
After the incident, the government chalked out the National Action Plan (NAP) to eliminate terrorism and extremism from the country.
Pakistan Army had launched its Zarb-e-Azb operation against militants’ infested North Waziristan tribal region, which was considered as the nerve centre of militancy in the country. The Army had claimed major successes in this tribal region, which is bordering Afghanistan.
PM Khan to use PAF’s small aircraft for US visit
ECC meeting reviews economic situation of country
Luggage-wrapping rates reduced to Rs50 at all Pakistani airports
PM reaffirms Govt’s commitment to go all-out in facilitating investors
|
cc/2019-30/en_middle_0019.json.gz/line9706
|
__label__wiki
| 0.625069
| 0.625069
|
AWR Blog
Take Action Early and Often in the Year of the Roadless Area
Nov 25, 2000 | AWR, bears, roads
by Mike Bader, Executive Director, Alliance for the Wild Rockies
For the modern conservation era, barely a century old, the calendar changeover to the year 2000 represents an opportunity to consolidate momentum and establish lasting conservation policies to guide us into the next century.
Therefore, I feel it appropriate to declare this the Year of the Roadless Area. When one digs through all the buzzwords and lexicon of conservation biology and gets down to the bedrock, it is the roadless area upon which the future of our wild ecosystems rests.
The Rocky Mountain Front contains vast areas of roadless
lands critical to the future of the grizzly bear.
Two proposals – one national and one bioregional – are crucial to the future of roadless areas and our wild ecosystems. The National Forest roadless initiative may represent a turning point in our nation’s conservation history. It has the potential to protect more than 50 million acres, and in an important move, Senator Max Baucus (D-MT) and other northwest senators support it. Its outcome, however, is far from certain, and the once-stagnant remnants of the Sagebrush Rebellion are using opposition to the roadless initiative as their war cry. They seek to reverse the progress of the last decade and turn the clock back to when land management decisions were unfettered by concerns for endangered species, clean water, big trees, and ecosystem protection.
For conservationists in our region, The Northern Rockies Ecosystem Protection Act (NREPA) represents a keystone proposal that could well set the course for a more holistic, enduring conservation policy for America, and a positive example for the world. The Wilderness Society, the oldest conservation organization dedicated to protection of wilderness, has recently joined the ranks of NREPA proponents. The past year ended with approximately 80 sponsors, well on the way to the goal of conservationists of 100-plus in this session of Congress.
AWR members can expect a steady stream of reports, alerts, and calls to action from us throughout this year. Wilderness preservation is a battle that the silent majority will not win. In our participatory democracy, if you do not speak, you will not be heard.
In the year 2000, let us resolve to push very hard for continuing progress on NREPA and the National Forest roadless initiative. Help chart the course for a new and enduring conservation vision and policy. Make the Year of the Roadless Area a reality. Write or call your representatives today and urge them to sponsor NREPA and to support the National Forest roadless initiative.
Learn about our track record in fighting to protect the Northern Rockies, what we use donations for, and other actions you can take.
Success! Please check your email to confirm.
|
cc/2019-30/en_middle_0019.json.gz/line9713
|
__label__cc
| 0.618024
| 0.381976
|
The cruelest anti-Kavanaugh argument yet.
From "How This Brutal Confirmation Process Could Shape Brett Kavanaugh as a Supreme Court Justice" (Time):
Even if Brett Kavanaugh is confirmed as a Supreme Court justice, he will carry scars from the brutal process to get him there.... [A]s he limps over the finish line... the question could soon shift from whether he will be confirmed to what kind of justice he will be.
Will Kavanaugh... dig in on the far right, radicalized by the experience? Will he swing the other way towards the middle, determined to improve his reputation among women? Or will he be able to move past it entirely?...
“What [Kavanaugh said at the hearing] was so explicitly partisan, so permanently political, so grudge-bearing, that I don’t see how somebody puts on a new robe, goes to a new court and forgets about that,” says John Q. Barrett, professor at St. John’s University School of Law. “The public will never forget about that. This guy, if he’s going to be confirmed, will now be heckled and protested and a pariah for the rest of his life for a segment of the country.”...
“It will raise questions about whether he could ever view any issue that touched on questions of sexual misconduct fairly, given what has happened,” says Melissa Murray, professor at New York University School of Law.
The linked article doesn't come out and make this argument, but it caused me to see it: Kavanaugh should be rejected because the confirmation experienced has ruined his mind. He's damaged now and can no longer think in the properly judicial way that was once within his capacity. A moderated version of that argument is that people will worry that he's now damaged and skewed and that's reason enough to keep him off the Court, to preserve the belief in the legitimacy of the institution.
I'm not making these arguments. I'm just seeing them and finding them horrendously perverse and cruel. Why not devise a confirmation process that is such an ordeal that it will drive out the very qualities we want in a judge? First, it would be torture, and second, you could never confirm a nominee. It's an inherently self-defeating process.
Tags: Kavanaugh, Senate, things that won't work
Dickin'Bimbos@Home said...
Time(D) speaks.
It's the Menendez brothers sobbing about being orphans.
“It’s an inherently self defeating process”
That’s the point of what the Dems did. Let’s move on to perjury indictments for all the folks who lied to the FBI or the senate investigators.
Mr Wibble said...
I keep saying, I will laugh when Kavanaugh is on the Supreme Court, and a challenge to Sullivan comes up.
rich hahn said...
I had considered that situation a few days ago and came to this conclusion. Kavanaugh is not going to change who he is, but he will be extremely cautious on any case that involves any type of discrimination.
Get the television cameras out of there. This is a representative democracy; we elect people to make these decisions in a deliberative manner. Enough with the clown show and the drive-by shootings.
Your choice of 'news' sources leaves much to be desired.
"Why not devise a confirmation process that is such an ordeal that it will drive out the very qualities we want in a judge?" -- Althouse
Because the Democrats and the media will not allow it.
SDaly said...
It's not self-defeating if it only applies to one side. If you think that a liberal nominee would face this, or that any mainstream media outlet would make this argumetn against a liberal nominee, you are delusional.
Lewis Wetzel said...
Why are the two people quoted law professors? We are talking about personality, not the law. They have no special expertise about how the confirmation process is affecting Kavanaugh's prejudices.
... or, the Democrats and the media will allow it when they have the Presidency and Congress.
Original Mike said...
”I'm just seeing them and finding them horrendously perverse and cruel. Why not devise a confirmation process that is such an ordeal that it will drive out the very qualities we want in a judge? First, it would be torture, and second, you could never confirm a nominee. It's an inherently self-defeating process.”
You’re missing half the picture. It will only be applied to the Republican half of the universe.
Lucien said...
This is the argument that says that if someone has been falsely accused and imprisoned at Guantanamo Bay for years,then he should not be let go, because after such unjust treatment he must surely hate the U.S.
Now the left has repurposed it for Judge Kavanaugh.
The counter example is that Justce Thomas was wrongly accused and pilloried, and his tenure on the bench has worked out just fine.
If the tables were turned, the narrative would be, "this experience will make the nominee a better justice, because s/he will be more attentive and understanding of the due process rights of the poor and oppressed criminally-accused [who are really just victims of the prison-industrial complex.]"
Nonapod said...
What [Kavanaugh said at the hearing] was so explicitly partisan, so permanently political, so grudge-bearing, that I don’t see how somebody puts on a new robe, goes to a new court and forgets about that
So if you're being vicously attacked by one side, fighting back "partisan"?
That means the credibility of witnesses is diminishing rapidly, and the media is moving away from stopping/stalling the confirmation. Soon, they will be trying to influence the judge to be more left leaning, and this looks like a segue to that.
Professional lady said...
What about the counter argument that his experience would give him a deeper appreciation of the due process rights afforded by the Constitution?
chickenlittle said...
What you and others seem to want is ultimate veto power with no Constitutional mechanism for countering that. You want to abort Kavanaugh because you think he’s an unfit Justice.
Lucid-ides said...
"I'm just seeing them and finding them horrendously perverse and cruel."
So what, no more "cruel neutrality" Ann?
But yeah, I'm on board. Perverse. "Cruely perverse" infact.
Personally I hope he goes scorched earth....if you know what I'm saying.
Crazy Jane said...
Heads, the antagonists win; tails, Kavanaugh loses.
No wonder the guy's angry.
WisRich said...
First, it would be torture, and second, you could never confirm a nominee.
Oh I disagree Ann. The Republicans roll over for any Dem nominee. Only Republican nominees wouldn't get through.
This is one reason why non-credible charges should not be given a platform. But noooo, we must hear “the survivors”, giving no thought as to whether or not the person has likely “survived” anything at all. It amazes me that people can’t see that. Or maybe, it’s finally sinking in for some.
Isn't that the strongest argument yet for the Judiciary Committee to pursue and punish vigorously any false testimony and to vindicate Kavanaugh?
Wasn't that what simple "justice required" anyway in all matter, great and small, only a short time ago?
Great point -- I've always thought the best argument against Kavanaugh stems from his overly deferential jurisprudence regarding the 4th Amendment. After this experience, he might rethink his position about the importance of due process.
Otto said...
Note the game AA is playing. She is trotting out all anti-kavanaugh accusations and "punnishly" states " hey i am not saying it is right, but it is out there". C'mon AA your beginning to act childishly.
Shorter D-Time:
The left GET to trash you - and you must acquiesce to their trashing of you.
Prof. John Q. Barrett is a sanctimonious asshole.
St. John's should be ashamed to employ him. But, of course, it's all about #Resistance.
Mattman26 said...
The funny (not ha-ha way) thing is that if you're a red-meat conservative, Kavanaugh was sort of a "meh" pick for Trump. Safe, not radical. And he would be just the sort of guy who conservatives worry would be ripe for plucking and charming by the Georgetown cocktail party set, like his hero Anthony Kennedy.
I'm thinking the prospects for that are greatly diminished now, and the left will have no one to blame but itself.
Much the same could be said for Trump; none of us had the remotest reason to think he would govern as a conservative, and many conservatives were worried that Chuck and Nancy et al. would co-opt him into a liberal tool. But they chose early on to vilify 24/7, perhaps because that's best for fundraising, and lo and behold, he's governing as (easily) the most conservative president since Reagan.
I'm not making these arguments. I'm just seeing them and finding them horrendously perverse and cruel.
Your commenters saw them coming as soon as CBF's letter was leaked.
They are shocked- shocked- to find the politics of personal destruction going on in here!
"The linked article doesn't come out and make this argument, but it caused me to see it: Kavanaugh should be rejected because the confirmation experienced has ruined his mind. He's damaged now and can no longer think in the properly judicial way that was once within his capacity."
I take exactly the opposite view, that Kavenaugh needs to be confirmed because the Democrats were so egregious here in their unfounded, libelous, scurrilous, underhanded attacks that they need to be slapped down, because if they get away with this, they will just step it up another notch for the next nominee that they don't want confirmed. Remember, Feinstein sat on the Ford letter and supporting information for better than six weeks, up through the close of the official hearings, then popped them in order to delay the actual confirmation vote, hopefully until after the election, when Trump state Dems up for reelection this time could safely vote against confirmation. In short, this whole Ford thing was a massive cheat by Feinstein and the Democrats. She has been in the Senate for most of 2 decades now, and knows the rules. She cheated with the late hit, and the Dems cheated by putting up obvious liers to keep an honorable, bright, talented man off the Supreme Court just because he is a male Republican Roman Catholic. We all know human nature, and esp dealing with kids (and, in our case, a very young cat), that you need to set limits, then enforce them. Every time they get away with this sh**, they will up the ante, just as every time we don't remove the kitten from the dinner table or counters increases the problems getting them to conform later.
Kavanaugh needed this experience to toughen him. He was a Toy-boy Constitutionalist, like many NeverTrumpers: autists with their ideological toy cars lined up just so and cursed be anyone who adjusts one of them.
That was the old Kavanaugh. The new Kavanaugh has learned a valuable lesson about reality. He’ll be a Gorsuch level justice.
Professional Lady & Mr. D. -
Thanks for making my point. There are two, diametrically opposed narratives that one could string together, the positive one would be pushed by the media if it were a liberal nominee, the negative for a conservative one -- EVERY TIME.
Here's the real truth, Kavanaugh has been damaged for life whether he gets on the court or not.
To pretend that it would somehow be better for him to not be confirmed is civility bullshit.
His only path back to coaching his daughter's basketball team is the destruction of Ford's testimony and the people behind the scenes who enabled it. Both sides will end this long before that can happen.
"For the good of the country."
Maryland Geezer said...
Who will write the book:
The Great Democratic Christine Blasey Ford Scam of 2018
gahrie said...
It's an inherently self-defeating process.
Not if it's only used by the Left to destroy nominees from the Right...then it's the same old effective tactic used since Bork.
Amadeus 48 said...
This Time hack attack is pure speculation. A rational person would look at the sort of judge BK has been for the past ten years (fair and gentlemanly) and say that is his baseline. A more interesting question is how this will affect his friends on the Court—Roberts, Kagan, Gorsuch—as well as on the DC Circuit, such as Merrick Garland.
Some big mistakes were made here by BK ‘s opponents.
Perhaps trial by ordeal has proven him fit to serve.
Process as punishment. How dare you be an accomplished White male with a "too perfect" reputation?
Shouting Thomas said...
Althouse's Marxist feminism is and always has been a bullshit lie.
Yeah, I'm guessing the judge is seeing that.
Blogger M Jordan said...
How do you know this experience has changed him? Maybe he was tough enough to start with and this just proved it.
Limited blogger said...
Another win for Trump, no matter how this all settles out.
Look carefully, men.
Kavanaugh is a careerist drone who, quite obviously, sought to immunize himself by checking off all the boxes that made it appear that he was a paragon of feminist virtue.
Didn't mean shit in crunch time, did it?
Tell women no. It's time.
Freeman Hunt said...
Would they make the same argument about a victim of sexual assault?
We can't have a supreme court justice wasting his time coaching girls' basketball.
This guy, if he’s going to be confirmed, will now be heckled and protested and a pariah for the rest of his life for a segment of the country.”...It will raise questions about whether he could ever view any issue that touched on questions of sexual misconduct fairly, given what has happened,” says Melissa Murray, professor at New York University School of Law.
This quote was created long ago. They kept it in the same box as the protest signs with the blank space for the name. It read, "______, if he's going to be confirmed..." Somebody clever spotted it and inserted 'This guy'. Evergreen.
Personally, I think the cruelest accusation was accusing Kavanagh of rape.
Jay Vogt said...
Sometimes having your attitudes, sensibilities and analytical framework altered by by real life experiences is seen as a good thing.
How could he not be affected by how he sees the state wielding its enormous powers and in matters of how much power the state should have over an individual? Much of what he'll be working on bear directly on such questions.
Dr. Frankenstien wasn't pleased by what he'd created either.
Hubris kinda works like that.
It's not a bug, it's a feature! Basically this entire process has been designed from the get go as a Kafkaesque trap:
1) Hey, there are some terrible accusations and if you don't withdraw, they are going to come out and it's going to be embarrassing for you and your family. You should withdraw.
2) Okay, you deny the accusations and aren't withdrawing? Well we're going to draw this out so that all the crazies can come out of the woodwork and accuse you of being a closet horrific criminal. Don't make us have a hearing - you don't want that.
3) Okay, you're going to cause us to have a hearing? We're going to make sure the salaciousness of every accusation is stretched out in loving detail on TV.
4) Oh, this makes you angry? Well that's clearly a sign that you lack the temperament to be on the court.
5) You point out how partisan this has been? Clearly you're not going to be a fair umpire on the court. We, who were never going to vote for your confirmation anyway, are shocked that any potential justice would consider these obviously partisan attacks as partisan.
6) Does this process make you angry bro? Well, by the way you're acting, it's possible to see that this has damaged your mind and you're probably no longer fit to be on the court.
7) Oh, you got confirmed anyway? Nearly half the country is going to think of you as a rapist for the rest of your life. It'll be mentioned in every biography ever written about you and will be one of the only thing that anyone remembers about you in the future.
I cannot wait to see who wants to go through this process in the future. And boy, howdy, I cannot wait for the next time a Democratic president tries to get someone confirmed. It's gonna be lit!
When Kavanaugh is confirmed, he (along with the four other right-leaning Justices), should quietly let Yale (and possibly Harvard) know that there are now 20 clerkship positions that are no longer available for their graduates.
TV is making everything as crazy as women.
It's curious that Kafka wrote his humor before TV existed.
@Unknown: Maybe he was tough enough to start with and this just proved it.
True. But he was a frat boy, did the Federalist thing, is a sports junkie, hired too many women to prove he wasn’t sexist. There’s some fragility there,
You make the confirmation process sound like bootcamp. we lost about 20% of our platoon during training. cruel and heartless but everyone respects the outcome. just because this guy is an elite entitled ivy-league college professor, he needs to survive the crucible.
Dems did the impossible: they brought the Bush crowd into the corner of the Trump tent.
Before all this I was sort of ambivalent about Kavanaugh. I mean, I was prefectly happy to have him nominated but I would've been perfectly happy with a lot of other potential nominees. I also believed that even if he didn't get in, it seemed highly likely thatwe'd still have plenty of opportunities to get someone else in... so no big deal one way or the other.
After this circus though, I now believe it's vital that Kavanaugh gets in. The reason? Bad behavoir should never be rewared, otherwise you get more of it. The Democrats have behaved badly. If they're rewared for it, they'll keep it up. If you didn't like this whole episode, if you found it appalling and you want to ensure that something like this doesn't happen again, you must not encourage it.
Good for you.
But the cruelty has been aided and abetted by people like you.
When you speciously speculate about the dark side of a good man with an excellent professional record, and grant credibility to a baseless accusation because it is made by a woman who displayed an emotional state to her husband, and refuse to oppose the Dems' abuse of the process as a matter of principle, and argue in bad faith about the relative strengths of the accusation and the rebuttal, you are part of the problem.
So, does this perversity and cruelty of the anti-Kavanaugh forces, which was obviously obvious to anyone watching from the outset, lead you to say that the left has crossed a line that makes you resist them as the detestable scum they are?
Fernandistein said...
One could adopt a "no 'survivors'" policy based on the same, er, logic.
And judging by how some 'survivors' are acting, it would make more sense.
Joshua Barker said...
Ann, why have you not yet addressed the myriad of lies and "mis-truths" that Ford has been caught in and apply your cruel-neutrality to determine that she is a lying whack-job and this entire thing was a coordinated, political hit-job from the start? Are you able to acknowledge when you're wrong and say you're sorry for taking part in destroying this innocent man's name? What is it going to take for you to admit your error and maybe spend some time in self-reflection about these ideological blind spots of your's?
Blogger Shouting Thomas said...
Thomas had his chance to fight Marxist commie bastards in 1968, but he banged coeds instead. That is why he doth protests too much.
A wholly specious argument given the long documented professional behavior of the man.
Kafka was more bureaucratic humor than soap opera thinking.
There's some of that now in every claim to seriousness. Kafka is less broad about the comedy though.
buwaya said...
As above, by many people, this sort of argument is not generally applicable, as the tactics behind it are only available to one side. I don't think the conservatives will be in a position to retaliate in kind, because the conflict will have evolved beyond these things by the time turnabout is possible. At that point we may find the Kavanaugh business a quaint episode of gentler days.
Taking a broader view, this whole business is just an episode in an ongoing power struggle that is increasing in intensity and revealing the rot in every formal and informal institution as it goes on. In this conflict there are casualties, like Kavanaugh, and there will be many more.
AMDG said...
Nonapod + + + +
This experience also ensures that we will never (not in my lifetime anyway) see the nomination of a gay or trans person to the supreme court. The redefinition of what questions are legitimate in the confirmation process ensures that no President would nominate such a person, and no potential nominee would agree to answer in a public forum the kinds of questions that are now part of the new normal.
Ignorance is Bliss said...
What [Kavanaugh said at the hearing] was so explicitly partisan, so permanently political...
This is a decent argument for why RGB must recuse herself from all cases related to the Trump administration.
If you do not wish to go there, then kindly fuck off about Kavanaugh.
Bruce Hayden, I agree with you 100%. I also think there are a lot of voters like me who reluctantly voted for Trump in the hope that he would keep his promises regarding his Supreme Court appointments. He has. I am thoroughly disgusted by the behavior of the Democrats.
Richard Dolan said...
I'm seeing them as BS, as well as perverse and cruel. It's coming from lawprofs, so you know it's the view from lefty looney land (present company being a conspicuous and rare exception).
BJM said...
Looks like the FBI stall isn't working out for the Dems/Ford, so now the Dem/media establishment changes tactics. Do they really think we out here in normal America don't see the bait & switch?
I bet internal polling is not looking good on the Kavanaugh debacle and the Dems will pivot to confirming him this week to mount another midterm tactic. It would be too delicious if the Kavanaugh dog & pony show energized conservatives and cost them dearly in the midterms.
David-2 said...
One could ask if the current election for Senator in California with Feinstein getting attacked from the far left with a credible challenger is so explicitly partisan, so permanently political, so grudge-bearing, that Feinstein, already driven to nakedly partisan and unfair actions just to stay in the game, would be permanently mentally damaged while in office, should she win.
The matter of Kavanaugh is just a skirmish between two great powers that are in the process of coalescing into unified and disciplined "nations". Their identity, and their self-definition as opposites, is still being formed. Kavanaugh helped that pricess along. As the edges harden, there will be many more Kavanaughs, but with less confusion each time.
Some of Howard's friends exposed.
Perhaps because the women expressed such raw emotion, few media outlets dug into their political activism. Archila is an executive director of the Center for Popular Democracy; she had spent the previous week in Washington engaged in protests against Kavanaugh. Gallagher is a 23-year-old activist with the group. The Center is a left-wing group that is heavily funded by George Soros’s Open Society Foundations. Indeed, as of 2014, the Open Society was one of the three largest donors to the group.
Those were the two women who cornered Jeff Flake in a Senators only elevator and breathed the wimp in front of CNN cameras.
Why is rewarded, you get more of.
I'm kind of agreeing with ST.
gspencer said...
BK can get back at what was done to him via the certiorari process. Four votes are needed to grant cert; with BK on board, the Court will arguably have 5 sorta conservative votes (Roberts doesn't especially impress me). So BK, with Alito, Gorsuch, Thomas, can shape the Court's agenda. That'll piss the left off, and please me.
This sounds like a good idea, but then those schools will lose their few remaining non-prog students.
PackerBronco said...
Having experience first hand how unfettered power can be wielded by those in power, I think this process will reinforce for Kavanaugh the wisdom of the Constitution in limiting the power of government to manage and ultimately destroy lives.
Blogger Bruce Hayden said...”I take exactly the opposite view, that Kavenaugh needs to be confirmed because the Democrats were so egregious here in their unfounded, libelous, scurrilous, underhanded attacks that they need to be slapped down, because if they get away with this, they will just step it up another notch for the next nominee that they don't want confirmed.”
This, a thousand times over.
It’s like the “no need for due process” in this matter argument. If unfounded allegations are allowed to derail a nomination the process is over. It just floors me that Althouse does not see this.
Jupiter said...
'“It will raise questions about whether he could ever view any issue that touched on questions of sexual misconduct fairly, given what has happened,” says Melissa Murray, professor at New York University School of Law.'
I don't really see how a person with that viewpoint could possibly hope to be a good professor of Law. She should be fired immediately.
mccullough said...
Buwaya, good point.
These Anti-Kavanaugh Law Professors are just pawns, anyway. Doing the bidding of their Dem masters.
If Kavanaugh gets confirmed or if he doesn’t, the standard of Smacking Back at Senators is now in place.
It was great when Klobuchar’s mask slipped. After shutting on her Daddy for being a drunk, Kavanaugh pushes her buttons. “I don’t have a drinking problem,” she said. Bullshit. Klobuchar is a souse.
Trump fundamentally transformed presidential politics. Kavanaugh is a roadmap to take down the bullshit fake seriousness of the Senate. Actually, Trump is doing a good job of it. But when the next nominee addresses Blumenthal as Da Nag Dick or Warren as Fauxcohantas then the transformation will be complete.
Trumpit said...
Mark Judge is not going to say anything about the attempted rape or assault because that would implicate himself in the crime. Clarence Thomas was and is a beast of a man with limited intellect; let's remind ourselves of that obvious and sad fact. He had the advantage of being a po' black boy. The brilliant Richard Wright wrote about his own sad personal experiences growing up in the Jim Crow racist South in Black Boy. Kavanaugh is a rich white boy out of touch with the lives of ordinary, hardworking, struggling folks. He wants lots of beer and sex. Clarence just wanted nasty bump and grind. The world doesn't owe him a spot on the Supreme Court. KEEP RICH WHITE MEN OFF THE SUPREME COURT, especially perverted Yalies. One rich perverted male, i.e., Schlump, mustn't be allowed to stack the Supreme Court with his fellow pampered perverts. Amen.
He's a professional. No problem.
It will raise questions about whether he could ever view any issue that touched on questions of sexual misconduct fairly, given what has happened
Because he would have learned first hand that women do lie? Hmmmm ... can't have that.
I looked at the law profs that signed that letter. None from Creighton or Nebraska. Therefore, meaningless. Radicals are just expressing their radical opinions.
I predicted this argument over two weeks ago:
I also am thinking of what Dr. K has said -- that this experience may certainly color Kavanaugh's outlook going forward.
Which means: we will soon hear the argument that he should not be confirmed because this experience has made him unable to judge future cases clearly.
I am Laslo. 9/23/18, 10:38 AM
The Notorious RBG popped off about Trump before the election.
So the henpecked men and shrews of the Legal Academy can spare us The Law Professor Concerns.
And Larry Tribe is a fucking loon. The Elder Statesman of the Legal Academy is the worst of a rotten bunch.
"Clarence Thomas was and is a beast of a man with limited intellect;"
Thomas was Alpha Sigma Nu at Holy Cross and he graduated from Yale. He was a DC Circuit judge before SCOTUS. Yeah, limited intellect.
I bet internal polling is not looking good on the Kavanaugh debacle and the Dems will pivot to confirming him this week to mount another midterm tactic.
No presumption of innocence for charges of rape was a bridge too far for most Americans.
The Dems, once again, couldn't help themselves.
I think the evidence for that is the shift to alcohol stories. The Dims are too deeply committed to the crazies to vote for him, though.
As the edges harden, there will be many more Kavanaughs, but with less confusion each time.
I expect the next USSC nomination will not involve public hearings using this circus as a reason.
The ricin episode will be repeated.
Even Jonah Goldberg is starting to get a clue.
He includes the ritual TDS phrases but he is getting the message,.
Democratic senators who announced they would never vote for Kavanaugh under any circumstance keep getting asked if the FBI investigation they demanded will be “enough for them.” Enough for what? To still vote no? I’m not criticizing the Democrats themselves — though I obviously could — I’m criticizing the people who interview these senators. Time and again, these journalists interview the Democrats as if they were open-minded about this investigation when in every breath they insist that the investigation will be illegitimate if it doesn’t prove what they want it to prove.
He is still reluctant to agree with Trump about the media but it is obvious that he sees it.
Bad Lieutenant said...
Chutzpah: killing your parents and then throwing yourself upon the mercy of the court because you're an orphan. If this is what happened, they would deserve it. In fact, I would go so far as to call it... Justice!
Ken B said...
"Cruel perversity" sounds like just the motto you've been looking for.
I am stuck on training cats right now because we are experiencing it right now. My partner keeps saying that parenting cats and kids is very similar. You have to set limits and enforce them. Decades ago, she visited an older maybe sister who was college kid nag her signature dish (lasagna?). After seeing her sister's longhair cat walking unimpeded across the counters, my partner demurred from eating the dish at the time, ostensibly took some home instead, only to throw it away at her first opportunity. The problem is that no matter how cute, that cat routinely walked in his litter box, which means that he was tracking those germs onto the counter her sister was preparing food on. Our mini cat can get up on the dinner table now, despite his tiny size, but not yet onto the counter. He loves the table because that is where our food is. So every night, for awhile, we had him jumping from our laps, or our shoulders, onto the table. Nope. Not acceptable. So, it is now every couple days between tries. No doubt, this is going to continue, but we are determined to extinguish this behavior. And, with him trained to stay off the table keeping him off the counters hopefully is going to be easier. I see not pushing back and penalizing the Democrats here for their egregious, personally destructive, behavior as similar to where we would be with keeping our cat off the kitchen counter, if we had not kept him off the table.
bleh said...
That's pretty much exactly what the anti-Kavanaugh types are saying. He fought back hard and with some emotion after falsely being accused of sex crimes, therefore he's not fit to be on the Supreme Court. As you say, this rewards and incentivizes the horrible tactics and lies used by Democrats, the media and sewer dwellers like Avenatti ... but I repeat myself thrice.
If Kavanaugh kept his cool like they say he should have, he would have been called robotic or psychopathic ... or "unempathetic" to use a wise Latina's words.
Kavanaugh must be confirmed and it would be wonderful if the Democrats paid dearly in November. This nonsense should be punished. Unfortunately, the Democrats will still do well enough in the mid-terms that no good lessons will be learned. This entire process will be repeated, but only by Democrats of course.
If crazy trumpit doesn't like Thomas that is a big plus for the Justice.
People have friends. I’ll say it again: Roberts, Kagan, Gorsuch, and members of the DC Circuit who know Kavanaugh well have to be deeply affected by this circus.
Browndog said...
Democrats care about the Kavanaugh polling the same way they cared about the Obamacare polling.
Sacrificing yourself to further a political agenda. There's a word for that-
FleetUSA said...
Justice Thomas has done rather well. Kavanaugh should do well too.
With the press and the internet we've had too much in the "what if" vein. People should get on with their lives.
JPS said...
So basically, the argument is, This guy is damaged goods. You need to withdraw the nomination and put up someone else (to whom we will do exactly the same thing).
Joshua Barker,
Are you able to acknowledge when you're wrong
No. Never. Die first.
First, it would be torture, and second, you could never confirm a nominee. It's an inherently self-defeating process.
Mr. Barret (John Q!) makes a possibly valid argument incredibly poorly.
The better argument is what you might call the Flannery O'Connor test of the grotesque:
In ... grotesque works, we find that the writer has made alive some experience which we are not accustomed to observe every day, or which the ordinary man may never experience in his ordinary life.... [T]here are strange skips and gaps which anyone trying to describe manners and customs would certainly not have left. Yet the characters have an inner coherence, if not always a coherence to their social framework. Their fictional qualities lean away from typical social patterns, toward mystery and the unexpected....
[For my kind of writer], the meaning of a story does not begin except at a depth where adequate motivation and adequate psychology and the various determinations have been exhausted. Such a writer will be interested in what we don't understand rather than in what we do. He will be interested in possibility rather than in probability. He will be interested in characters who are forced out to meet evil and grace and who act on a trust beyond themselves–whether they know very clearly what it is they act upon or not. (my emphasis)
In this framework, what the character reveals in extremity reveals something closer to the core of character than carefully scripted answers in formal appearance.
I will add that it is a fundamentally unfair test. O'Conner is a writer, not a judge.
I am always having it pointed out to me that life in Georgia is not at all the way I picture it, that escaped criminals do not roam the roads exterminating families, nor Bible salesmen prowl about looking for girls with wooden legs... [I]n the public mind the deeper kinds of realism are less and less understandable.
cruel and heartless but everyone respects the outcome.
Not really. You made it, didn't you?
She drowned. Guess she wasn't a witch after all. NEXT!
One side is far better organized and equipped for propaganda wars.
That incident with the two women confronting Flake to generate agitprop is just one of a constant stream of these things. They were available, they knew what to do (they had a prepared script), they were precisely timed, they had the press in attendance
They are available, and indoctrinated/trained, to execute their roles in agitprop.
They come from an intellectual/social milieu where many such are available.
They have social/institutional protection for their activities.
They are under the umbrella of larger coordinating bodies.
The MSM is likewise coordinated to expand the reach of their agitprop.
Our Senate does incline toward the grotesque:
O'Connor is so sedulous an observer of Chekhov's gun rule that if a family discusses a newspaper story about a killer on the loose, there is no doubt that he'll massacre them; if a bull is roaming the fields, its horn will soon be buried in someone's gut ("Greenleaf"); if a grandfather has bred his own obstinacy into a beloved granddaughter, he will beat her to death when she is obstinate towards him ("A View of the Woods"). The inexorability of O'Connor's plots can, as in these cases, invest her stories with the awful power of Greek tragedy, and indeed before giving readings of "A Good Man is Hard to Find" she'd say that, "like the Greeks you should know what is going to happen in this story so that any element of suspense in it will be transferred from its surface to its interior". If someone's first experience of O'Connor was "The Displaced Person" (1954), at the denouement of which three people passively watch a tractor roll down a slope and crush a fourth, the event would be unexpected and shocking. But the story is arguably more powerful when a familiarity with O'Connor's work makes this ending an awaited inevitability. The tangible menace that her stories exude isn't about "what", but "when".
If an accusation is made anonymously, there is not doubt that it will be flung upon the public before the hearings conclude.
Cacimbo Cacimbo said...
So the partisanship possibly resulting from the ugly confirmation process is supposed to be bad - while the partisanship by the "notorious RBG" is okay because it was arrived at via a different route.
Mr. Majestyk said...
The rule for confirmation hearings going forward has to be: we will reopen a completed hearing only if serious, material (ie, would change the outcome if true), and highly credible evidence that was not known at the time of the hearing -- and could not reasonably have been known before then -- arises after the hearing. And even the, we will investigate in confidence and not turn the proceeding into a circus.
Jerry said...
The process was designed to 'ruin' Kavanaugh. If he didn't back away from the massive onslaught of scurrilous accusations, it would 'corrupt his mind' and make him impartial.
I'm at the point where I'm willing to have him seated today. The Ds on the committee weren't intending the process to be fair and bipartisan, they intended to make it as cruel and destructive as possible to discourage the next round of applicants, when RGB retires or kicks the bucket.
And watching the antics of the media and the Dems - it's amazing that anyone would think that they want what's best for the country. They want power - and they'll destroy anyone or anything that gets in their way if we let them. I don't foresee ever voting for another Democratic candidate - their actions are far too poisonous for a society that depends on the rule of law being applied impartially, and they've clearly shown they consider themselves above the law itself.
... make him PARTIAL, I meant to say above...
It takes a lot of chutzpah, since the people making these arguments about how Kavanaugh might be scarred, damaged, or driven to displays of improper emotion are the same people who organized the harassment campaign, against him and others, that led to these outbursts.
But hopefully time heals most wounds. Kavanaugh's presence on the bench is likely be at least as decorous and sober as Thomas's, whom no reasonable person has accused of bad temper or undignified behavior for many years now, in spite of an extremely vehement speech during the confirmation hearings.
I have refuse to follow others by going after our honorable hostess, It's her playground, she leaves the gate open for us, so I try not to liter and tear things up.
The process is in place. Senator Diane Feinstein blew it up, took a shit in the middle of it, and pissed in the mouth of every member on the committee.
A report came to her. "the process" was for the ranking member to walk it over to the chairman and ask that the investigative teams of both the ranking member and the Chairman, investigate the contents of the letter. Anonymously. Without alerting the media. Investigate. Follow up, clarify. Gather documents, like the psychologists notes, Building permits concerning the 2 front doors, the Polygraph results and protocols along with interviewing the person that administered the test. Chasing down all close friends, like old boyfriends etc. All of this done in the quiet, anonymously.
Ann you have to see the plain fact that the Democrats had no intention of wanting an investigation and fact finding mission. The only goal was to delay, and if done right, get Kavanaugh to withdraw.
They gambled, went all in, and lost.
You are intelligent, so you understand the process is 100% fine. If the committee uses the process in good faith.
There is nothing to protect us from actors, acting in bad faith.
Yeah, regrettably Ann is correct. This black cloud will hover over BK for a while -- every NYT article will mention the "charges," just as they conveniently always mention that Clarence Thomas never asks any questions at oral argument - to imply that he's dumb.
My thought is that BK should continue to press on towards confirmation. Once confirmed, he can then figure out some kind of anti-propaganda campaign. Maybe, he can challenge Ford to make the charges on tv, where there's no litigation privilege, and he could sue her for defamation. Something like that.
Jerry said...”I'm at the point where I'm willing to have him seated today. The Ds on the committee weren't intending the process to be fair and bipartisan, they intended to make it as cruel and destructive as possible to discourage the next round of applicants, when RGB retires or kicks the bucket.”
Kavanaugh needs to be confirmed and the public hearing process needs to be abandoned for the RGC replacement.
Tom said...
Well, a ticked off, defiant Kavanaugh as Justice is exactly what we deserve as a people for how we've treated him.
We don't get to wrongfully call someone a serial gang rapist in a senate confirmation hearing and then also be offended when that person gets really mad.
Imagine if Hillary Clinton was accused of being a bitch? No one would stand for that, even if people have made accusations. She would be, rightfully, angry. #himtoo
That's convenient. "We were such dicks, you may never be able to treat us fairly, so we shouldn't confirm you as a judge."
Kavanaugh's demeanor on the court of appeals has been as good, and probably better, than most of the 100+ state and federal appellate court judges I have appeared before as an appellate advocate. How do I know? I appeared before Kavanaugh himself. He is truly a humble and decent judge on the bench. Not all of them are. I guarantee you that.
robother said...
Self-defeating, if unsuccessful. But the Left has bullied its way to enough victories in the Culture War that it cannot step back. Even the losses are justified, as "heightening the contradictions."
Brett Kavanaugh, like Clarence Thomas before him, has seen the true face of the Left. They know we are in a fight with a foe that means to destroy the very culture of American democracy, that sees law and tradition, moderation and compromise as mere tools of an oppressive system.. That makes them dangerous.
Honestly, if Kavanaugh is kept off the court because of credible claims, fine. But, for ones that are not credible? That just encourages people to bring them against other nominees later. But... if you can disqualify someone *because the other side was too mean to them,* all we're going to have is clown shows like this all the time.
Screw that. Give him an up or down vote and let's #MoveOn
If Kavanaugh is confirmed I’m hoping this ordeal short-circuits the tendency of conservative Justices to be co-opted by the liberal milieu.
Agree that the process will change if the majority party controls the senate (by enough votes) and the president is of the same party.
If the GOP got to 54 Senators after the midterms and the Notorious RBG drops dread, then just submit Barret’s name for a floor vote. She was recently confirmed to an appellate court. There’s nothing new to learn by “the process.” She’ll be in her seat before RBG gets buried.
That’s how this should be done.
I wouldn't believe anything in TIME.
Also, the GOP needs to take a few political scalps in retaliation for Kavanaugh.
Too narrow. The media, Democrats, and these protesters are ALL pawns.
The same people buying Flake right now fund all of this and control all of this.
Schumer and Pelosi take orders. They are nothing in the real game but tools.
You know, there's no requirement to be a lawyer on the Supreme Court.
Therefore, I think we should support Laslo Spatula to be the next nominee, if Kavanaugh goes down (no pun intended).
Laslo could be the Long Dong Silver of constitutional jurisprudence.
On the other hand, Crazy Blasey, is a pawn for some really awful, leftwing assholes. Alas, that's what we gotta deal with these days.
Blogger buwaya said...
Agreed but I think they overplayed their hand. If even Jonah Goldberg, whoever reluctantly, acknowledges the press is an arm of the DNC, public opinion will shift away.
I think of the "Samizdat" in the USSR. We are getting close.
The 2004 Bush AWOL story was the beginning fo the end for the media. The left can make a movie they call "Truth" but we know it's a lie
They can even give it awards like:
Cinema for Peace Awards 2016
Cinema for Peace Award Most Valuable Movie of the Year
James Vanderbilt
But we know it's a lie. Pretty soon everybody does. The soap opera women will be last, of course.
Yes, I think that is what will happen.
IF, of course,
"I have refuse to follow others by going after our honorable hostess, It's her playground, she leaves the gate open for us, so I try not to liter and tear things up. "
I met in the middle: I have pointedly spoken my view in regards to her writings on this matter, but I have been more gentle in my remarks than I would've been if her posts had been written by an adult male.
n.n said...
I would argue that Kavanaugh DID keep his cool, under great pressure, and the toughest questioning that any SCOTUS nominee ever underwent, and he did it for two long days. 30+ hours of that. And then, those hearings were concluded and no one had laid a glove on him.
Only when he was getting attacked from coast to coast, and national broadcast networks were running stories about "gang rapes" that were no doubt seen by Kavanaugh's daughters and girls' basketball team members, did Kavanaugh react. And his "reaction"? Calling out the transparent political animus against him. Returning the fire of hostile cross-examination by -- GASP! -- asking questions of his Democratic questioners, all of whom had decided to vote against him before he ever opened his mouth. By not agreeing with loaded, leading questions. Some kinda outrage, alright.
So, we can understand that K is legally and likely factually a good man, and that Time et al have yelled bloody abortion one too many times to remain credible. As a wise white man, with the experience of a warlock trial, he should be confirmed to the Court, so that we can know The Constitution by the dawn’s early light what so proudly we hailed at the twilight’s last gleaming.
Kavanaugh should be rejected because the confirmation experienced has ruined his mind. He's damaged now.
I said this before and I will say it again: suffering doesn't tell us anything about the person who is suffering. All we know is they are suffering. It is entirely possible the suffering will make them stronger people, better people, amazing people. See for instance, Ann Althouse.
On the other hand, suffering can make you bitter, angry, vengeful. See, for instance, Christine Fair.
My take on it is that Brett Kavanaugh is way more like the former than the latter. He's a class act. For instance, his unwillingness to hate on somebody who was falsely accusing him of sexual assault. And the story he told about his daughter wanting to pray for Ford.
As for his anger, it was mostly directed at the lack of due process and the evil directed at both him and Ford. How in essence they are both being used for political ends, and scapegoated.
I acknowledge the possibility that Brett Kavanaugh might be damaged. He said so himself! But damn if I would reward the people who damaged him.
Nor do I think such speculation is appropriate at all. That would be like firing a rape victim because she might be angry at her students down the road.
"I shouldn't marry that girl. She was raped. She's ruined."
I dunno, Vaclav Havel was a good sport after taking political office. So was Nelson Mandela (his heirs, not so much).
The mark of being and adult is the ability to acknowledge your mistakes, apologize for them, hopefully change your behavior, and then fucking move on... Something that Democrats, leftists and bat-shit crazy liberal female professors seem incapable of... exampled by the crying, stomping, child-like temper-tantrums and scream-at-the-sky hissy-fits they've been throwing since 2016
tim in vermont said...
Returning the fire of hostile cross-examination by -- GASP! -- asking questions of his Democratic questioners, all of whom had decided to vote against him before he ever opened his mouth. By not agreeing with loaded, leading questions. Some kinda outrage, alright. - Chuck
He almost understands now why we wanted Trump when they tried to ram Hillary down our throats.
In short, K was psychologically raped, and the damaged goods should be discarded. Said another way, after a woman is rape-raped, she is no longer a viable Person, and should be forgotten. Time is presenting an apology for Pro-Choice.
With regard to "fitness" or "fairness", I'm trying to imagine a Federal courtroom where the parties begin their opening statements by accusing the bench of being sexual predators. See, there the writers might have a point.
Anyone help!
I'm looking for a video Ann posted a few weeks ago (months ago?) with Hillary Clinton repeating a word loop with Diane Sawyer. (I think?) I cannot remember the word but it had to do with mocking Bill's accusers.
The Cracker Emcee Rampant said...
"One could ask if the current election for Senator in California with Feinstein getting attacked from the far left with a credible challenger is so explicitly partisan, so permanently political, so grudge-bearing, that Feinstein, already driven to nakedly partisan and unfair actions just to stay in the game, would be permanently mentally damaged while in office, should she win."
I have wondered if this whole farce wasn't about Feinstein getting in front of any challenge from her left. Democrats were clearly going batshit about Kavanaugh well before anyone had heard about CBF. CBF's letter may well have looked like a golden opportunity for Feinstein personally.
He should counter sue the students and the school and state that they're creating a hostile working environment for him with their sexist, racist, and gender-oriented accusations. They have hurt feelings. He actually has compensible damages.
Yancey Ward said...
"I met in the middle: I have pointedly spoken my view in regards to her writings on this matter, but I have been more gentle in my remarks than I would've been if her posts had been written by an adult male."
Yikes! That was a needle the length and width of a butcher's knife.
It is entirely possible the suffering will make them stronger people, better people, amazing people.
What doesn't kill you may leave you broken. What doesn't break you may leave you stronger. It's the wisdom of the crucible.
Instead of bitter and resentful, the experience will confirm his principles and conviction to uphold The Constitution to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defence, promote the general Welfare, and secure the Blessings of Liberty to ourselves and our Posterity.
It is one thing to agree/disagree with someone about an issue.
It is another to support insect politics.
We will not retaliate with insect politics. We will wipe out the insects.
People who choose to act a certain way should know what is coming for them.
I don't think that Kavanaugh suing Ford for defamation is a good move. She would get to take discovery into his personal life from the time he was born. The results would be leaked to the press which would distort them. Best just to put it behind him.
Hey, I can imagine that! I appear in federal courts. Not as much as some litigators since my work is mostly tort law in state courts. But I've been there. With a wide variety of U.S. District Judges and in one U.S. Circuit Court of Appeal (the Sixth, in Cincinnati).
And I can tell you how that would work; when you start asking a federal judge about his drinking in high school and suggesting that he was a gang rapist. First, there is the contempt citation. Then, there are the U.S Marshals. Then, the handcuffs and a ride in a freshly washed late model black Ford Econoline.
It will be very stressful. He will enjoy it.
And BK surprised by countering with trial by combat.
Melissa Murray, professor at New York University School of Law.
Good lord, a woman teaching law? Men all know that you can't trust a woman to be fair when looking at whether or not a man may be innocent of a charge of sexual impropriety! Everyone knows that now, except women. A teacher of law who is a woman will only infect her students with the same prejudices her sex brings to the profession. Good golly, Miss Molly!
Good heavens, Althouse! Get real!
Personally, I think it was the USA Today opinion piece saying he shouldn't coach his daughter's basketball team anymore. That's one stain that never washes out.
The tide may be begging to turn on these fake sexual assault accusation.s
A year and a half later, Cornell and Doe have reached a settlement where the Ivy League university will pay him $125,000 to drop the litigation. This is before attorney’s fees, which have yet to be assessed and which Cornell will pay to Doe’s lawyers once the judge approves them.
Brooklyn College Prof. KC Johnson, who closely tracks Title IX litigation, says the settlement occurred before the presiding judge had handed down any order.
Cornell’s options for responding to the suit were limited from the start because of its federal appeals court, Johnson told The College Fix in an email. It could have filed a motion to dismiss, “but it would have had no chance of prevailing” under the 2nd Circuit’s precedent against Columbia University, which involved similar factual allegations.
I doubt Kavanaugh would sue Blasey Ford unless he is voted down on false charges.
Still the tide, and the worm, may be turning.
tim maguire said...
The only way to know if Kavanaugh has been damaged is to wait and see. So what we have here is yet another "who cares if he's guilty?" attack on good man.
Agree. Defamation is the wrong vehicle.
Ford however committed at least 3 counts of perjury in her senate testimony.
Not like remembered things differently perjury.
Blatant, Obvious, Calculated and undeniable Perjury.
#walkaway is exploding by the way.
Facebook banned them, but they can't stop them. #walkaway will be around long after Facebook.
BrianE said...
As a Christian, Kavanaugh is commanded to "do good to those that spitefully use you". The Lords prayer asks God to "forgive our debts as we also have forgiven our debtors".
The old adage, "forgive and forget" is probably rarely possible, given our minds ability to lock onto offenses, but forgiveness can mean that we give up the right to use those offenses against that person.
It means consciously deciding not to use 'remember when you did this' against a person.
So no, Judge Kavanaugh isn't damaged goods-- and will have the opportunity to be an example of Christ's forgiveness.
The Democrats will rue this. Once Kavanaugh is on the court he rule as he please no matter what the communists scream. I suspect they made him into a far more conservative than he was prior to this with trial. Next nomination that Trump gets and with two eighty somethings on the court he probably will get at least one if not two more Trump will nominate openly activist judges from the right. And the Senate that will still be Republican controlled will just confirm them without giving the Democrats much room for theatrics and character assassination. If it appears to be that Mitch McConnell has finally got a spine, after the elections he will change the Senate rules and simply hammer through all of Trump's nominees for the courts and to replace all of the Obama holdovers in one fell swoop.
"This guy, if he’s going to be confirmed, will now be heckled and protested and a pariah for the rest of his life for a segment of the country."
By "segment of the country," you mean law professors who run left-leaning clinics and their most outspoken students. I'm sure he's going to be devastated.
I will wait forever for WaPoo to headline: “Christine Blasey Ford asserts without evidence that Judge Brett Kavanaugh assaulted her in 1982.”
Yet, those are the facts.
It will be fun to watch democrats in the senate not even be able to filibuster.
Also, for what it's worth, I think years and years of being called a "baby-killer" damaged Harry Blackmun's mind. He was very, very emotional about his opinion in Roe v. Wade. See, for instance, his opinion in Webster v. Reproductive Health Services.
"I fear for the future."
If Kavanaugh is to be denied a seat because of his fear for the future, why was it okay for the fearful Blackmun to have a seat? And it's not just that Blackmun was emotional about abortion. Millions of pro-lifers and pro-choice people are emotional about abortion. In fact I believe this clusterfuck of a confirmation hearing is inspired by anger and fear about Roe v. Wade.
What was so awful was when Blackmun started saying things like how his opinion could never be overturned, or it would "cast into darkness the hopes and visions of every woman in this country." Justice O'Connor, who was overruling part of his opinion, was sitting at the same table! And yet Blackmun had the delusional belief that only he could speak for the hopes and visions of every woman in this country. That's a ridiculous thing to assert.
In Planned Parenthood v. Casey, Blackmun wrote…
I am 83 years old. I cannot remain on this Court forever.
Did he imagine that anybody (other than himself) would want Harry Blackmun to sit on the Supreme Court "forever"? He talks about it like it's a great tragedy that one day he will have to leave. Presumably most people on the Supreme Court feel that way, which is why so many of them cling to power for as long as they can. But that doesn't mean you should say it out loud!
Notice too that Brett Kavanaugh has a huge amount of self-awareness and honesty. He's talking about the process and how it's damaged him. He's worried about it. Blackmun had very little self-awareness. All the letters from ordinary citizens calling him a baby-killer affected his jurisprudence. He's comparing his opinion to a "light" and overruling it will cast the world into "darkness." That's a rather stupid metaphor from somebody who relied on secrecy and privacy for abortions to happen, and relies upon censorship in the media for the violence to remain unseen.
Comanche Voter said...
You mean to say that after a guy has been pummeled, reviled, rebuked, and sucker punched, he might hold a grudge? I'm shocked that such might occur. Shocked I say.
Lloyd W. Robertson said...
Things that have surprised me in recent months:
1. Rampant puritanism. Behaviour that nice women disapprove of should probably be banned--or at least, participation in it should disqualify a man from holding a position of responsibility. Not only crimes such as assault, but the kind of social milieu in which rudeness, crimes, and things that are somewhere in between seem to be encouraged or more likely. If you don't agree, you are basically saying women will have to carry smelling salts at all times.
2. The U.S. Senate getting close to saying "No Irish need apply." Or at least, no old-fashioned Irish Catholics unless they can prove they have gone through a full treatment or rehab. Wasn't the view, even recently, that the Kennedys were charming and lovable?
To his immense credit, BK fought back.
It woulda been much worse, if he withdrew. It woulda been much worse, if he had stayed in boy-scout, choir-boy, robot mode.
Mitt Romney has already established this. He let Candy Crowley of CNN quash all his political momentum, in one televised debate.
If someone falsely accuses you of rape, you have to fight back, even if you don't want to, or were not prepared to. You can't just shrug it off. It's too toxic. You have a wife and two daughters. You can't let the lie stand.
Note the physical similarities between Kavanaugh and Flake. They look alike, they sound alike, they probably vote alike. Flake is a pussy, though. He would join the Vichy, when the Nazi tanks roll in, out of fear, out of self-preservation.
Kavanaugh fought back, called the Clintons out, handled every Democrat on the Committee with ease. It's a tougher time, though, handling all the slings and arrows from the NYT, CNN, MSNBC, SNL, Harvard Law, George Soros, etc, etc.
He will soon learn who is allies are and who is allies were.
You ever read "The Visit" by Friedrich Dürrenmatt? Once all the money and the power and the vendetta is arrayed against you, you're in a tough spot.
So, whatever happens with the vote (I still think he wins 50-50 with Pence tiebreaker), I think BK has stood tall. A little awkward at times, Yes, but he did his duty.
I think he will survive this.
Eric the Fruit Bat said...
The Orcs started out as Elves before they were cruelly tortured, so I guess that makes the Democrats on the Senate Judiciary Committee something along the lines of Melkor, the first Dark Lord, and the primordial source of evil in Eä.
readering said...
Althouse trying to win back disaffected commenters by mischaracterizing these articles, reading something into them they don't say. After so many commenters mischaracterized her earlier Kavanaugh statements. Huh.
They are 100% right. It's not smart to try to destroy a man with Kavanaugh's sharp mind and legal writing talent and miss. And the new Justice K has already spit in their evil eye and told them he has no doubt that the weapons used against him and his loved ones came from Hillary's revenge as a hit just like the ones done to Seth Rich and Vince Foster.
It's not Trump the Dems should fear now. It's Kavanaugh's pen.
Althouse trying to win back disaffected commenters by mischaracterizing these articles, reading something into them they don’t say.
What’s stopping you from straightening it out for us, do us all a service?
"While Murray is only teaching one class during her visit to NYU Law, The Commentator still wanted to give students the chance to get to know more about one of Berkeley Law’s most beloved professors. Over the summer, Professor Murray answered our questions about her relationship with New York City, her family’s Hamilton obsession, and what she’ll miss most about Berkeley (spoiler alert: she doesn’t like socks very much).
The Commentator: We are excited to have you join us at NYU Law for the semester. In what ways are you hoping to engage with communities here in New York City? Are there things you’re looking forward to working on while you’re here? Some non-law related activities you’re looking forward to doing while you’re here?
MM: I love New York City—I was born in Brooklyn and lived in the city after law school. I’m looking forward to learning from the terrific faculty at NYU, as well as faculty at the area law schools. I’m also excited about having more opportunities to collaborate with organizations like the Center for Reproductive Rights and the National Women’s Law Center—it’s so much easier when you’re on the same coast!"
https://nyulawcommentator.org/2017/09/13/professor-profile-a-conversation-with-visiting-professor-melissa-murray/
Judge Kavanaugh has ruled repeatedly against women seeking to make their own reproductive health decisions.
His record shows a cramped reading of the right to liberty and personal decision
making that distorts or ignores existing precedent. If Judge Kavanaugh were to join the Supreme Court, his record suggests that he would overturn or eviscerate
these critical rights.
https://www.judiciary.senate.gov/imo/media/doc/Murray%20Testimony.pdf
Like I said, they came on so strong they burned Kavanaugh’s bridges and left him no retreat. If this stuff is true, he has to be impeached from his current job and utterly disgraced. He has to fight it out. The Democrats made a strategic error, and at a minimum, he is going to force some people who absolutely do not want to vote on this to vote on it.
If a vote fails, that’s one thing, if there is no vote, then Schumer is basically the leader of the Senate.
I see not pushing back and penalizing the Democrats here for their egregious, personally destructive, behavior as similar to where we would be with keeping our cat off the kitchen counter, if we had not kept him off the table.
Well, that and Democrats do track fecal matter wherever they go.
"Democratic jackals on the Senate Judiciary Committee, aided and abetted by their loyal public relations firms — the mainstream media — and hectoring unpleasant people funded by George Soros heap mud on Brett Kavanaugh for weeks and then step back and say: “He’s got mud all over him! Let’s move on to a more pristine victim." "
--Roger Kimball
If anybody asks Kavanaugh if he is going to withdraw, my suggestion to him would be to say “Nuts!”
Trumpit,
"Clarence Thomas was and is a beast of a man with limited intellect; let's remind ourselves of that obvious and sad fact. He had the advantage of being a po' black boy."
Thank you for reminding me how blatantly racist some leftists permit themselves to be toward a black man who forfeits their protection by the sin of seeing the world differently than they do. Sometimes I forget, and I shouldn't.
In general, your ilk are freer with the homophobic slurs toward gays who step out of line, and with the misogyny toward women who fail to get with the program, but I still think blacks get the worst of it. The threat to your power, if they ever stop voting for the Democrats by Enver-Hoxha-sized majorities, is just too great to tolerate.
The collective left are all mostly liars. The idea that they will be rewarded for their lies is repulsive.
@Chuck, A credible woman accused him of partaking in a gangbang. So you find it incredible. Quack, quack. He had a penchant for female alumnii. Sure he was a virgin as he lied to the Judicial Committee. If it walks like a duck and quacks like a duck, and furiously flaps its wings like a duck, it would make a good roast DUCK. Kavanebriated can't duck the questions or his obvious involvement in youthful, disqualifying excesses. He's a bad liar like Schlump. He's no sitting duck; He's more like you, Chuck, a quacking duck who's had bad luck with the ladies.
The U.S. Senate getting close to saying "No Irish need apply." Or at least, no old-fashioned Irish Catholics unless they can prove they have gone through a full treatment or rehab. Wasn't the view, even recently, that the Kennedys were charming and lovable?
This will be the attack on Amy Barrett. I wonder if there are enough Catholics to stand up with her ?
I'm sure we will hear a lot about priest pedophiles, even thought that is a result of the left taking over seminaries in the 60s.
hombre said...
Leave it to the ever-faithful leftist law professors to devise a last ditch chickenshit argument against Kavanaugh. If these political pimps had any integrity, they would be pointing out the holes in Ford’s “case” and the perversion of the process by Democrat Senators and Party operatives.
I Kavanaugh is confirmed, let’s hope that his education is complete and he can view his judicial responsibilities through a lens that clearly shows the danger to the Republic presented by Democrats, their consorts and their immoral agenda.
Trumpito - If you think Julie Swetnick is credible - that tells us everything we need to know about you.
lawyapalooza said...
The guy was sanctioned for dishonesty and poor temperament well before the hearings. He is not fit.
Trumpit - loyal leftwing douche and RACIST.
It seems obvious to me there will be a heavy personal cost to Judge Kavanaugh and his family if he is confirmed.
It appears he has evaluated this and wants to proceed.
The left has already said his confirmation won't be the end of this-- and I don't think the left will honor the geneva convention of American politics that children are off limits.
I suspect they made him into a far more conservative than he was prior to this with trial.
I'm not sure about that but he definitively knows he has no friends on the left. His first appearance, he impressed as a squish like Kennedy, eager to make new friends. That, I think is over forever,
mezzrow said...
Not to go all Jordan Peterson, except that I will. One of his greatest insights is that the postmodern left is in a war against what can best be defined as competence. The need for hierarchy (that thing that we feel and share with the lobster) is defined by them as an exercise in power, when in reality it is an exercise in competence. The first to go are the most competent, hence after the revolution the kulaks go into the trains to the gulag, if they survive at all. Going into this, find me a more respected or competent jurist than Kavanaugh, irrespective of judicial philosophy.
This is exactly the point. Their great message is that your competence and reputation cannot save you. They have control of the organs of personal destruction, and they will use them to the maximum extent they can conceive. They are very cruel and clever in this exercise, and the argument seen the OP is a prime example.
Blogger Dickin'Bimbos@Home said...
No, trumpit is just crazy. Not worth reading its tripe.
mikee said...
How dare a judge remember the smear campaign against him by one political party, and keep it in mind when reviewing supposedly factual arguments by that same political party for or against the constitutionality of laws in the future? Why, one might look at that party's claims a bit more closely, to determine if they have any factual basis to them or are made up of imaginary pleadings.
Wasn't it Sid Blumenthal who dragged out the hoary "False in one thing, false in everything" doctrine to impugn Kavanaugh over high school yearbook idioms? Kavanaugh knows the truth of the claims against him. Why should Kavanaugh NOT suspect these same people to present false arguments in mere court cases, when they have lied to his face about his own life?
It is just and proper to look askance at the people who smeared you, when they come to you with a plea for anything else.
The left will pay for their insect politics.
One way or another.
Smart people will separate themselves.
His record shows a cramped reading of the right to liberty and personal decision making that distorts or ignores existing precedent. If Judge Kavanaugh were to join the Supreme Court, his record suggests that he would overturn or eviscerate these critical rights.
Is this supposed to be some kind of justification for the evisceration of other more fundamental rights that have been steamrollered? If Roe is overturned, Abortion will remain legal nearly everywhere, and will be subject to democratic processes, if the fundamental agreed on rules of our democracy are destroyed, that’s a far bigger issue.
The U.S. Senate getting close to saying "No Irish need apply."
NTTAWWI, but isn't SCOTUS now 7-2 Catholic/Jewish and all Ivy? A little, um, concentrated, couldn't one say?
Qwinn said...
I'm so old I remember when the word "credible" applied to evidence, not people. People were called "trustworthy", something that in Ford's case would be pretty darn hard to establish. But by applying "credible" to the person in a way that isn't much different from "possibly plausible", they convey the fraudulent impression that the evidence is actually credible, rather than utterly non existent except when it is in BK's favor.
Trumpit is a moby.
Performance art.
Mikee,
"Wasn't it Sid Blumenthal who dragged out the hoary "False in one thing, false in everything" doctrine to impugn Kavanaugh over high school yearbook idioms?"
No, it was Dick Blumenthal.
The Dems haven't reached quite the level of chutzpah needed to have Sid say that, but just wait awhile.
continued Murray testimony
"In 2017, Kavanaugh voted in Garza v. Hargan to allow the Trump Administration to continue blocking Jane Doe, a seventeen year-old immigrant woman who came to the United States without her parents, from obtaining an abortion.
In September 2017, Jane Doe came to the U.S. and was placed in the custody of the Office of Refugee Resettlement (ORR). While in custody, she learned she was pregnant and decided to have an abortion. Jane Doe met all of the requirements of Texas
law before obtaining an abortion, including, because she was under 18 at
the time, going before a judge to “bypass” the state’s parental consent law to obtain an order granting her the right to consent to the abortion on her own.
Throughout all of this, Jane Doe had a guardian ad litem and an attorney ad litem who were available to advise and support her; the cost of the abortion procedure would have been paid for by private funds; and the government did not need to arrange her transportation to the clinic.
gg6 said...
It's "cruel"? Well, duh...that's simply business as usual then, yes? 'Crude' would strike me as a better word in this case - in other/more words, typical and expected but badly executed. ....as if on a new comment: I am mostly struck with how 'frightened' it sounds. Has this wheel actually turned so far the canaries in the tunnel - like TIME mag - are starting to send alarm signals?! Good.
We are all just straight men to Trumpit.
"lawyapalooza said...
The guy was sanctioned for dishonesty and poor temperament well before the hearings. He is not fit."
Could you elaborate, please?
FRANZ KAFKA YOU MAGNIFICENT BASTARD!
K has two paths available, victory or revenge, both require that a vote happen, it’s overdetermined, the vote will happen.
Real American said...
This argument is utter bullshit. It basically means no other partisan person could ever sit on the court - no senator, no former president, no cabinet official, no governor - they've all made partisan remarks in their careers, particularly while campaigning - that they'd be disqualified under this standard.
Moreover, such a standard only incentivizes the next slander campaign against the next nominee. And why stop at SCOTUS? Appellate judges don't typically get this type of scrutiny, but why not? Democrats opposed Miguel Estrada because he was Hispanic and made a big deal of stopping Patricia Owen and Janice Rogers Brown. Lindsey Graham is right - allowing the smear campaign against Kavanaugh to succeed only means we will see more, not less, of this type of personal destruction and no decent person will be willing to go through it. That's not good for our country.
Francisco D said...
No, it was Dick Blumenthal. The Dems haven't reached quite the level of chutzpah needed to have Sid say that, but just wait awhile.
I think we have reached peak chutzpah.
Judge Kavanaugh's judicial temperament is well known because he has been a judge for more than a decade. Had he been found wanting, we would have heard about it in his confirmation hearing.
Also, judicial temperament matters most at the trial court level, where an asshole judge can make life miserable for attorneys appearing before her (or him), and there is no one in the room to moderate such tendencies. At the appellate level, there are far fewer opportunities for abuse, and there are always at least two other judges in the room to rein in the bad actors.
walk don't run said...
I haven't posted since AA highlighted my last post since I wanted to see where the discussions would proceed. In the meantime we have learned that AA sadly (and I mean that sincerely) suffered from sexual abuse in her teens and that BK was not such a paragon of virtue as he appeared and enjoyed more than his fair share of beer (albeit allegedly with ice!) while in college. In my experience, everyone is damaged goods in one way or another. Certainly I am in ways that I can acknowledge and probably in other more significant ways that I really dont want to face up to.
In my last post I told the story of a fellow juror who insisted on voting for a conviction in a rape case in large part because she had been raped when she was young. The rest of us on the jury did not try to change her vote in large part because we had a small sense of how painful this matter was to her. The fact was, it didn't change the outcome of the case. But it did remind me that events can be so painful that they will affect people's perception and bias in matters of great importance. The fact is that we are rarely very rational at the best of times in large part because we are an emotional animal. We have seen that with AA and her "cruel neutrality" stance that appears to have become unwound in this situation. I think it is time to stop harping on this and give her a break. She has been cruelly neutral through many situations where I could not have been and in the process I have learnt something helpful. That's why I come back to this blog. Let's give her a break recognising that the sexual abuse she faced was probably sufficiently painful and confusing that "cruel neutrality" is out of the question.
Idiot take on Irish-Catholics and Catholics as nominees. Gorsuch I-C on mother's side. Roberts ancestry includes I-C. Thomas, Alito and Sotomayor not Irish, but....
As Irish-Catholic glad to see bigotry of pre-Vatican 2 America largely vanished (although for sure Vatican not doing us any favors by handling of abuse scandals in clergy).
|
cc/2019-30/en_middle_0019.json.gz/line9716
|
__label__wiki
| 0.815172
| 0.815172
|
29 Aug TELLING NEW INDIGENOUS STORIES – BELVOIR AWARDS BALNAVES FOUNDATION ABORIGINAL AND TORRES STRAIT ISLANDER FELLOWSHIP
Posted at 22:57h in Latest News by balnaves-login
Press Release, 29 August 2018
Belvoir has announced Kodie Bedford as the recipient of the Balnaves Foundation Aboriginal and Torres Strait Islander Fellowship, an evolution of the Balnaves Foundation Indigenous Playwright Award, which has long been recognised as one of the most prestigious playwriting awards in Australia.
The Fellowship includes a $25,000 paid residency at Belvoir, working across production, programming and development in 2019 as she develops her new play, CURSED!.
Ms. Bedford has extensive experience in network television, having worked for SBS (WORLD NEWS AUSTRALIA, LIVING BLACK) and ABC TV (MESSAGE STICKS, NAIDOC Special), and has most recently written for MYSTERY ROAD, GRACE BESIDE ME, THE SLOT and is a writer of numerous projects in development.
Selected from a pool of 13 submissions, Ms. Bedford has been awarded the fellowship by a panel comprising of Kylie Bracknell [Kaarljilba Kaardn], Guy Simon, and Belvoir’s Artistic Director Eamon Flack, Head of New Work, Louise Gough and Artistic Associate Dom Mercer.
Ms. Bedford’s new play CURSED!, is about death, family and mental illness through inappropriate anecdotes and black comedy. An estranged family is called and gathers in Geraldton WA, when their Grandmother is in the final days of her life. Three siblings from a blended family face family secrets and revelations while understanding the legacy of mental illness – all through a rich dark humour, laced with real pain and a serious subject. A story for everyone with a “crazy” family.
“I am so honoured and humbled to receive the Balnaves Foundation Aboriginal and Torres Strait Islander Fellowship” said Kodie Bedford.
“This fellowship is so important in the Australian narrative. I look at the list of past winners, the legacy they have created and the stories they have shared. I thank the Balnaves Foundation and Belvoir Theatre for their commitment to help project the voices of Indigenous storytellers”.
Eamon Flack, Belvoir Artistic Director said “Belvoir is deeply passionate in its commitment to stories from Aboriginal and Torres Strait Islander Artists and we are appreciative of the Balnaves Foundation support for this commitment”.
“The range and depth of the submissions for the Fellowship in 2018 was strong and reaffirms our commitment to working meaningfully with Indigenous Artists and the depth of talent and scope of ideas. We are thrilled that Kodie Bedford will be joining Belvoir in 2019 as a Fellow, we cannot wait to work with her, support her story and have her presence at Belvoir”.
The Balnaves Foundation has given over $1 million dollars towards the creation of Indigenous theatre at Belvoir to date. Hamish Balnaves, CEO of the Foundation, said “Since 2012, the Balnaves Award has been attracting entrants of the highest calibre including Leah Purcell, Nakkiah Lui, Jada Alberts, Megan Wilding, Katie Beckett and Ursula Yovich. The vision of the award is to elevate Indigenous story-telling in the arts which is critically important in fostering understanding and reconciliation between Indigenous and non-Indigenous Australians.
“In 2018, the Award has taken an exciting new shape, expanding to become a Fellowship to enable greater exposure to the talents and support at Belvoir. We would like to congratulate Kodie on the award and are excited to see how she will use the prize to further her exceptional work to date”.
Balnaves Fellowship assessment panel members Kylie Bracknell [Kaarljilba Kaardn] and Guy Simon said “The opportunity to be a part of the process of selecting the 2018 Balnaves Fellow with Belvoir is deeply heartening. It is tremendous to see where new Indigenous writing is heading. There are so many stories that represent our mob each with a unique fingerprint. The future of our storytelling on stage is bright”.
|
cc/2019-30/en_middle_0019.json.gz/line9722
|
__label__cc
| 0.687028
| 0.312972
|
Corvair-Powered 5 Window: 1936 Ford Deluxe
This is something you don’t see every day: a 1936 Ford Deluxe 5-window coupe converted to a rear-engined configuration with a flat-six from a Chevy Corvair on board. Normally, a Ford of this vintage would be significantly hot-rodded if it were to be modified, so I’m sure there’s a good story about the inspiration behind this build. Find the ’36 Ford here on eBay with bidding over $15K and no reserve.
Despite looking like brand new, what makes this Ford so cool is that the build was completed sometime in the late 70s / early 80s. Considering hot rod never stopped being popular, you have to wonder who thought a wicked custom like this would be better suited to a smaller engine mounted in the rear versus the traditional school of thought that would jam an even larger engine in up front.
But man, what a clean install it is. There’s no denying someone put in the legwork to make this engine swap look practically factory. Other features include independent suspension, front and rear; automatic transmission; A/C (though the compressor is currently missing); bucket seats with a powered driver’s seat; all steel body with numerous custom touches; Corvair Spyder custom dash; AM/FM + CB radio; and more.
The interior is straight out of the 1980s, and still looks mint today. Obviously, the now-vacant space under the hood has been converted into a fully-finished trunk, giving you a sense of just how extensive this build was when originally completed. While it may not be for everyone, it’s hard to deny the ingenuity on display, and for a no reserve auction, there’s a lot of potential value here that cannot be duplicated for the price.
More: Chevrolet / Ford
Dcowan
Honestly I think it is a fantastic build. It nice to see something different now and again.
Very cool. It’s different ofcourse and commenters find things to complain about, but it was a vision made real.
Jack M.
This looks like a really cool build. I wonder if there is enough airflow into and out of the engine compartment. I don’t see any scoops or louvers back there.
BlondeUXB Member
Think of it as a Tucker with two headlights…
Brakeservo
Is this the apogee or nadir of ’36 Ford customs??
Ian C
I love it! Only thing I would change would be to swap it to a 4 spd. I also noticed the VA inspection sticker on the windshield. So, it was in VA, title is from IA, and the car is in CA. Looks like this has traveled the country.
DavidL
I agree w/ Dcowan. It’s a fantastic build but I’m having a hard time wrapping my head around it. First question is why? Great work on the body and apparently on the engine installation. But why? Is the engine on the Corvair enough to power a car this heavy w/ the steel construction and all? And all the Corvair components, dash, AM/FM, CB(?) radios, etc. Looks like the work of a Corvair enthusiast/classic Ford enthusiast who was trying to have the best of both worlds. Best of luck to him and congrats on a beautiful build but not on my list of ‘Lotto cars’.
Fred W
Based on the curb weights I found online for ’36 Ford and ’66 Corvair, the ’36 is lighter- by as much as 600 pounds depending on who you believe. I have to admire all the engineering that went into this, assuming it drives well. But I wonder why it still has a hot water heater under the dash.
DayDreamBeliever Member
Interestingly, the weights don’t seem that far apart, as originally spec’d. The 2nd generation Corvair was right around #2600. Depending on the configuration, the Ford was listed as being between #2500 and #2800. So, close, except this car likely has many things which add weight, due to the mods and upgrades. If this weighs less than a ton and a half, I’d be really surprised.
One thing which has me curious… Does it have heat? Corvair passenger compartments were heated by air drawn off of the engine cooling system (problematic when oil leaks were present). Some early models had a gasoline-fired heater mounted in the front trunk, which could heat up so rapidly in winter weather that it could break the windshield with the sudden temperature rise. I assumed that the device seen in the right footwell was part of the AC setup….
Info I ran across said ’66 Corvair was 3400 lbs- can’t believe everything you find on the ‘net! 2600 seems more realistic.
Duaney Member
Looks like a south wind gasoline heater
DavidL- the 1936 Ford V-8 was rated at 85 horsepower and 144 ft-lbs of torque. The naturally aspirated Corvair flat 6 is rated from 80 hp and 128 tq all the way up to 110 hp and 160 tq. So the performance should be similar if not better with the Corvair drivetrain.
How do you think it would handle? It looks to me like a lot of the weight has been shifted to the rear of the car. I’m wondering if it would tend to oversteer. If it’s going to be a street cruiser it probably wouldn’t matter too much. Just wondering.
Regardless I love the look of the car but still curious as to the why of the Corvair engine.
The Corvair engine in this build is 140 hp. Note the 4 carbs, but also stated in the description on the eBay ad.
Frank Sumatra
Great looking car and a really cool idea to do something different. I challenge all Negative Neds to please post an image of your project if you have a bone to pick with this gem.
This just has me scratching my head, wondering why it was done.
The Glenn Pray Cord cars were FWD with Corvair drivetrains, neat and a great use of the power system. But this car, while certainly well done as far as the engineering and installation goes… So many issues crop up when considering taking it anywhere. There is carpet in the engine compartment. And there are a huge number of louvers in what would now be the front trunk. Not surprised that the AC system is incomplete, mounting the compressor in the available space would be challenging, and rob from the less than optimal power for a car this big.
What I see is a great looking car, which can be cruised but not really used. Easy to see why the Powerglide was chosen, much easier than to hook up a manual linkage.
There are some great cars around with complete driveline changes, but for practicality, this isn’t one of them.
BTW, many years ago I saw in a magazine a hotrod, perhaps a T-bucket, which won the “Best Engineered” trophy at a major meet. It had a Corvair engine mounted in the front, but with I think a rear drive setup. Totally unique car, drew lots of attention. But it wasn’t a closed car, and practicality wasn’t expected to be a part of the equation. With a ride like this ’36, it should be.
So far bid to $15K+, so someone wants it.
Anyone know what that bluish box on the passenger is? A battery maybe?
Gaspumpchas
That is a Southwind heater, used them much in early cars. Runs on gasoline. To me having a heater that runs on gasoline in the passenger compartment is a really bad idea. The craftsmanship is amazing. Something different. I’d love to know how it runs and handles. Also wonder if it has the early or late swing arm setup? Good luck to the new owner!!
Thanks gaspump
That’s the 1965+ IRS setup.
Finished out at $17,600
Both of my Tatra 603’s had gas powered heaters under the front seat – I would joke that it was a factory installed firebomb!
Chevy Guy
They did the right thing. Out with the Ford, in with the Chevy.
Unsafe at any speed!
Bob McK Member
BSM, How do you know it is unsafe?
CanuckCarGuy
Very cool showcase of creativity and engineering – I really enjoy seeing something different, and this is very cool. Now, let’s update this beauty by swapping that Corvair mill out for a modern Subaru WRX sti intercooled and turbocharged flat four…
PDXBryan
I was thinking the same thing! Or just go completely bonkers with a Porsche 3.6 flat six or some such craziness!
I believe in being different but a corvair motor in this heavy old car!! It seems like it would be a little underpowered to me!!! The being different thing is cool but being in an underpowered hot rod is not!!!
Similar weight, almost double the HP.
IkeyHeyman Member
It would be fun popping the hood at a “cars ‘n coffee” when somebody says, “What kinda engine does this here thing have, pal?”
corvair engines have powered many an odd vehicle.
https://www.corvair.org/chapters/ultravan/
Cover over, and provide drainage, for the louvers to keep your luggage and groceries dry. Well, ditch the 80-90s interior and redo. Otherwise, I love it! Very unique and well designed. Go to the original eBay ad and look at the original construction photos, especially the frame with the engine installed.
Morley Brown Member
This guy went the other way
Steven Ramos
I know somebody that put a V8 on the FRONT of a Corvair…He also did that with a VW beetle
Bo Bohannon
I cant believe that someone with this nice a build would put a Corvair engine into it. My neighbor bought a new Corvair when I was a kid and that thing was a problem and they worked on it all the time, trying to get faster and more productive RPS. This was true Chevy guy that has drag race Chevy’s. It would really chap him when my Dad’s slant six dodge pickup would beat him in a quarter, of course the slant six had a little work performed on it.
newfieldscarnut
Joe Haska
Had to see it to believe it! My first reaction was how stupid it was, then you look at it and read the comments, and I just don’t know what I think. I would really like to see it in person. I am almost afraid I might like it with out the valour interior.
Steve S
The corvair engine also had a problem throwing the belt off since the belt had to twist itself to go through the pulleys around the edge of the engine block to the driveshaft
ACZ
Not if you used the correct belt, tensioned properly.
Chevy fixed that within the first few weeks of production
This would be a blast at a car show. Open the hood – no engine. Open the trunk – can’t see an engine from behind. Move the spare tire cover – there it is!
Kudos to whomever had the engineering skills to put this all together and still have a great looking car.
Todd Fitch Staff
Love the vision and execution. Not perfect but sharp looking and it works. Very unique! Years ago a friend of a friend had a Corvair-swapped VW bus (much simpler). Good power and smooth as silk. Thanks, Jeff!
MOOSIE Member
very nice car with or without the corvair drivetrain, looks pretty much thought out and very nice workmanship. i once was thinking about putting 4 harley 80″ v-twins in a row to power a early ford hot rod but that dream never materialized.
Just a useless tidbit u guys might dig.> When the engineers were building the corvair, they wanted to make sure the mill didn’t make its way into a Volkswagen, so they designed the ‘vair windmill to run in the opposite diredtion as the VW.. Not to worry, Hotrodders found that you could flop the ring gear in a vw transaxle to the other side of the case and Volla..Never underestimate the power of an American gearhead! TRue or not still a great story. Happy Motoring!!
It’s a tall tale.
Mount a little 3.5 horse Brigg’s & Stratton under the front hood and watch people’s reactions!!
xrotaryguy
The Corvair transaxle can be driven from the front or from the back. in the Pontiac Tempest it is driven from the front with a clockwise rotating engine. In the Corvair it is driven from the back. This is why the Corvair engine must rotate counterclockwise.
That’s the whole principle behind the Crown Corv8 kit.
Second time I have seen this swap. I neighbor had a model A ford pickup with a corvair setup in it. This was back in the late eighties and was an older build even then. I think his was the turbo version if I remember correctly, and was also really well done. Denver/Lancaster Pa area, wonder if its still around.
Somebody, despite the shortcomings, got it already. Surprised it lasted this long. Beautifully done!
Why was it done? So he wouldn’t need power steering of course! 🤣
Love the early Corvair Spyder dash!
Ed P
This gives new meaning to Small Block Chevy!
Beautifully executed and beautifully engineered. This is what hot rodding is really about.
Dave S.
I love it ! What amazing workmanship !
Hows about a schematic of the drive train and packaging?
Miata Swap? 1971 Lotus Elan Project
French Connection: 1973 Citroen Ami 8 Break
Basic Needs: 1973 Plymouth Satellite Sebring Plus
One Owner Wagon: 1989 Chevrolet Caprice
|
cc/2019-30/en_middle_0019.json.gz/line9723
|
__label__cc
| 0.547146
| 0.452854
|
← Am I gonna have to learn to spell "Iguodala"?
Agree 100% →
Cleveland 105, Memphis 89
Domination, pure domination. Normally, whooping the Grizzlies at home isn’t all that impressive, but this Memphis team is pretty good; they beat the Lakers on Monday and they’re 25-14 after their 1-8 start. But the Cavs just dominated. Cleveland’s defense was fantastic (Memphis shot 38% from the floor) and their offense was equally impressive (the Cavs shot 49% and had 27 assists). I think that this extended home stand (and the extra practices that go with it) is really going to help the Cavs, especially offensively. Guys were moving without the ball, the offense didn’t stagnate and the Cavs seemed to get whatever they wanted. Yes, Memphis was on their fourth game in five nights, but they’re a good team and this game was never close.
LeBron looks like he’s toying with people. James led the Cavaliers with 22 points and he easily could’ve had much more. James ran the offense to perfection; he set up his teammates for easy hoops, collecting 15 assists in the process, and picked his spots to score the ball. There were no instances of Le-Iso that I can remember and the game felt like one giant highlight reel. LeBron finished with 22 points, 6 boards, 15 assists, a steal and a ridiculous chase down block on O.J. Mayo. His layup at the end of the half is gonna be what people talk about (he switched hands mid-air, like Mike) but my favorite plays were his two hook shots off the low block. That’s right, LeBron had two running hooks and they were beautiful. I’m telling you, this extended mid-season home stand could be the worst thing to happen to the rest of the league. The offense is clicking and Bron-Bron is showing off hook shots. Awesome.
Shaq seems to be rounding into shape. The big fella finished with 13 points and 13 boards in just 21 minutes. He shot 6-10 from the floor and he even dominated the game for a stretch in the second quarter, scoring 7 straight points and setting up LeBron for an easy dunk. He seems to have found his touch from the floor, he’s not missing those bunnies like he did early on. Defensively, Shaq was great. O’Neal had 4 blocks and he was a big reason why Zach Randolph shot just 3-14 to finish with 8 points.
Another solid game by Boobie. I have to say, I had some concerns with Gibson taking over the point guard duties for a few weeks, but things have gone pretty well (if ‘they haven’t lost since Mo got hurt’ counts as ‘pretty well). Gibson has scored in double figures every night since his insertion into the starting lineup and his 16 points Tuesday night was a season high. Boobie finished with 16 points (6-11 FG, 2-6 3pt), 1 board, 3 assists and a steal. However, as good as his scoring has been, over these six starts, Gibson has a total of 14 assists (or one less than LeBron had on Tuesday). Of course, since Mo has been out, LeBron has been conducting the offense (Tuesday was a perfect example) and has averaged 10 assists over those seven games, allowing Gibson to focus on what he does best- shoot.
Solid night from the big men. J.J. Hickson had a nice game, going for 15 and 8 with an assist and two steals. He played good defense early on (leading to some points) and his spacing at the offensive end looks really good. Varejao continued his strong play, netting 8 and 6 in 25 minutes off the bench and I’m continually amazed at how well he finishes while moving (reverses, bank shots, etc). Finally, Z shot 6-10 from the floor and finished with 14 and 5 in 21 minutes. The Cavs got 27 and 18 out of their center spot, with neither guy playing more than 21 minutes. Me gusta.
I thought Mike Brown had a good night. First of all, he’s got to get a little credit for all the passing and cutting, no? I really think that we’ll see the offense improve throughout this home stand. It was nice seeing the Cavs not give away their 18 point halftime lead (Cleveland’s highest scoring quarter was the third) and the Cavs never let up. Brown also led the arena in a standing ovation for Shaq after the big fella protected the rim with one of his four blocks. I really liked some of the lineups Brown used, particularly the five of LeBron-Jawad-Moon-Varejao-Shaq/Z. That’s a big effing group right there. You could take that group, move Varejao to center, add Delonte and go ‘small’ and run while still playing great defense. This team is versatile and I love it.
Rough night for Memphis. I feel for any team that is playing its fourth game in five nights but playing the Lakers and Cavs back-to-back… ugh. Randolph was 3-14, O.J. Mayo went 4-15, Mike Conley (who hit the game winning shot earlier this year in Memphis) finished just 1-6 and while Rudy Gay shot a respectable 7-14, he never seemed comfortable out there (at one point shoving Varejao into a shooting Jawad Williams, which ended up in a four-point play). The Cavs had the extra rest and they used their energy to harass the Grizzlies shooters at every opportunity. The Cavs never took their foot off the gas and the Grizzlies just wilted (there wasn’t even a token ‘get the lead down to 10’ third quarter run).
Sweet, we get to watch LeBron vs Wade again. The Cavs face the Heat this Thursday night on TNT and lord knows what to expect. I love watching Wade and Bron-Bron go against each other I’m sure a nationally televised game won’t hurt matters (though it could if they go into Hero Mode too early). The Cavs follow Miami with the Knicks on Saturday, the Nets on Tuesday and head into the All-Star break after facing the Magic in Cleveland next Thursday.
|
cc/2019-30/en_middle_0019.json.gz/line9724
|
__label__wiki
| 0.835137
| 0.835137
|
Soundtrack, 2018 (vol. 6)
December 21, 2018 December 29, 2018 bentaylorblogs
Last year, I started writing for DJBooth, a publication that covers hip hop and which I deeply revere. I wrote three articles in 2017 and set a personal goal to double that in 2018. I’m now ending the year with 14 articles written for DJBooth in 2018, in addition to my first academic article on hip hop and religion going live in Black Theology: An International Journal.
That said, I am here to honor my annual tradition of sharing my favorite albums of 2018, in hopes that you might find something you like and might tell me about something I missed. This was a year marked for changes in my personal life: it was my first full year of marriage, I earned my Master’s degree, and I returned to teaching this fall. I also found my music choices transitioning, as older favorites began to disappoint and new favorites replaced them.
Ravyn Lenae — Crush EP
tobi lou — tobi lou and the Juice
Cautious Clay — Blood Type
Black Thought — Streams of Thought,vols. 1 and 2
Bobby Sessions — RVLTN, chs. 1 and 2
20. Kids See Ghosts — Kids See Ghosts
19. Kali Uchis — Isolation
18. Smino — NOIR
17. Jean Grae and Quelle Chris — Everything’s Fine
16. Four Fists — 6666
15. Kendrick Lamar and Various Artists — Black Panther Original Soundtrack
14. Joey Purp — QUARTERTHING
13. Pusha T — Daytona
12. J.I.D — DiCaprio 2
11. 6lack — East Atlanta Love Letter
10. Big Red Machine — Big Red Machine
Of Justin Vernon’s many side projects, Big Red Machine became my favorite this year. In collaboration with The National’s Aaron Dessner, the pair made anthemic, heavy music filled with psalms of openness to life. “I will lay laid open,” Vernon croons, and I can’t describe a better feeling for this album’s effect.
9. Travis Scott — ASTROWORLD
I’ve been a Travis devotee since 2015’s Rodeo, and 2018 was his year to convert every skeptic. ASTROWORLD easily had the year’s best bangers, but its quieter moments (see “Coffee Bean”) prove Travis is more than just a hitmaker. Named after his hometown of Houston’s closed theme park, Travis takes listeners through the highs and lows of his own rollercoaster life.
8. Earl Sweatshirt — Some Rap Songs
Earl Sweatshirt returned from a three-year hiatus with a concise, focused effort that tracks his depression and growth both in sound and word. Earl is one of the finest examples of evolution in hip hop, and this 24-minute album is proof. As someone once famous for conflict with his mother and father, Some Rap Songs finds him grieving his father’s death earlier this year while also reconciling their relationship in subtle and beautiful form: “Mama said she used to see my father in me/said I was not offended.” Closing with a 3-song sweep that begins with Earl’s mother thanking him in a speech and his father reading one of his poems, and ends with his late uncle’s instrumental solo, Some Rap Songs is mourning and resolution all at once.
7. Vince Staples — FM!
Although just a teaser before a more official album next year, Vince Staples’ FM! delivers every punch I’ve come to expect from my favorite rapper since last year’s Big Fish Theory. Taking on a radio conceit to make a searing comment on the consumption of Black death in entertainment, Staples uses a sunny radio DJ set to undergird a much starker picture of the world as he sees it. “Do you really wanna know about some gangsta shit?” he accuses the audience, all the while trying to process his own grief over the loss of family and friends every direction he turns.
6. Tierra Whack — Whack World
Tierra Whack came out of nowhere to deliver the most exciting release of 2018. With 15 songs each running only 1-minute long, Whack capitalized on our short attention spans, singing and rapping herself in circles, only to cut songs off when she knew she has us. Watch the accompanying 15-minute music video, then see how quickly you press replay.
5. Noname — Room 25
Only two years after her Telefone debut swept me away, Noname returns with Room 25, a jazzier album full of lullaby raps. On first listens I felt relaxed by the music, but on repeat spins I found myself trying to catch—and hang onto—every word the poet spits. Room 25 is full of verses sacred and saccharine, and nothing is more beautiful than her reflection on her own name that closes the album and enfolds listeners into her vision of a better world: “No name for people to call small or colonize optimism/no name for inmate registries that they put me in prison.” Amen, Noname, amen.
4. Janelle Monáe — Dirty Computer
“We don’t need another ruler, all of my friends are kings,” Janelle Monáe sings on Dirty Computer. As America increasingly reveals how far it is from the vision of equality it proclaims, Monáe casts her optimism across every track, clear-eyed about issues of racism, sexism, and homophobia that persist, but hopeful that each of us can be a torch for progress by embracing who we are and who we might become. Blurring the lines between the personal and the political, Dirty Computer is the most timely album of 2018.
3. The Carters — EVERYTHING IS LOVE
I’ve been waiting a long time for JAY-Z and Beyoncé to turn their collaborative efforts into a full-length album, and EVERYTHING IS LOVE did not disappoint. The final album in a supposed trilogy that began with Bey’s LEMONADE and continued with 4:44, the resolution of EVERYTHING IS LOVE was hard-earned. Beyoncé is only getting better, and JAY-Z is leaning into the post-retirement dad raps that prove you’re never too old to out-rap your peers and protégés alike. This is an album full of joy that does not forget the pair’s increasingly critical political eye, nor does it allow you to doubt that this power couple’s place was ever in question.
2. Saba — CARE FOR ME
After the passing of his cousin John Walt in 2017, Saba set out to put his grief and depression on wax, and CARE FOR ME is what happens when therapeutic music reaches outside of a private moment to help a lot of people. The opening track “BUSY / SIRENS,” finds Saba mourning the ways that relationships fall apart while people are alive (“asking me how tour was/knowing I’ve been home like two months”), then transitions to a tragic vignette where a young Black man’s mere existence is a threat (“They don’t know me but they fear me”). From there, the album is full of more grey, grey moments detailing mental health struggles (“I’m not mad at God/I just can’t get out of bed”), mourning (“I tell Death to keep a distance, I think he obsessed with me”), and the search for the other side of pain. The closing tracks, “PROM / KING” and “Heaven All Around Me,” find Saba narrating the story of his relationship with his cousin, building to Walt’s tragic passing, and finally ending with Walt’s perspective, not a ghost but a spirit that lives on. It’s the most heartbreaking and beautiful ending to any album I’ve ever heard, and this album has already and will continue to carry me through life’s many greys.
1. Mac Miller — Swimming
Before Mac Miller passed away in September, I spent a month listening to Swimming every day, often multiple times. I don’t mention this to say that Swimming was my favorite album this year before Mac passed, but to say that this album was helping me understand a lot of things about my own seasons of depression and the struggle to swim after it felt like I might drown. “I just need a way out of my head,” he sings on the first track, and I let that line twist its way through my brain and live inside of my soul because I really understood it, deep down. Throughout the album, the lush production provides the perfect backdrop for Mac to narrate his downward spirals and slow climbs. The truth is I’m really quite speechless about what this album does for my brain and my heart and my soul. I want to quote every lyric and explain what it means to me, or describe the feeling I have when I listen to Swimming, but it’s hard. I guess there’s nothing really to say except, “Wish I could say thank you to Malcolm.”
Although a Tidal loyalist, I’ve made a Spotify playlist of my favorite albums and other songs from this year. Check it out.
Music, Year End Listsalbums, best of, beyonce, big red machine, earl sweatshirt, janelle monae, jay z, mac miller, music, noname, saba, the carters, tierra whack, travis scott, vince staples
Previous Article My 2018 Bookshelf
Next Article nonsermon #1: my religion
|
cc/2019-30/en_middle_0019.json.gz/line9727
|
__label__cc
| 0.513646
| 0.486354
|
In new spot, Gillette says rejoice birth of a girl, even she can change a family’s fortunes
The recently launched digital campaign #ShavingStereotypes is an extension of the global campaign ‘The Best A Man Can Be’. Conceptualised by Grey India, it aims to redefine the brand for gender stereotypes prevalent in most rigid societies
BestMediaInfo Bureau Delhi, May 03, 2019
Click on the Image to watch the Film.
Why can’t women wrestle? The Salman Khan-Anushka Sharma starrer ‘Sultan’ and Aamir Khan’s ‘Dangal’ prove otherwise. Why can’t women shave a man’s beard and run a barber shop? The recently launched digital campaign by P&G’s personal grooming brand Gillette discredits such a belief.
The #BarbershopGirls campaign launched by Gillette India is an extension of the brand’s global campaign ‘The Best A Man Can Be.’ Remember the ad on toxic masculinity?
Also known as the #ShavingStereotypes campaign, the recent Indian campaign of Gillette aims to redefine the brand for gender stereotypes prevalent in most rigid societies.
Put in place by Grey India, the digital film is based on a true story of two barbershop girls, Jyoti and Neha, from the village of Banwari Tola in Uttar Pradesh. The film shows the everyday village life from an eight-year-old boy’s perspective, wherein he forms an opinion that men work to earn a living and take part in sports, whereas women are the home caretakers. His thoughts keep coming back to something that his dad told him — children always learn from what they see. We see the prejudiced effect, of how subliminal patriarchy galvanises his mind.
When the little one walks into a barber shop with his father, he is surprised to see two girls ready to shave his father. He asks if they could actually do that. The father, who takes a moment to respond, states that a razor wouldn’t know the difference between a boy and a girl.
In the concluding shots, we see how Jyoti and Neha Narayan have challenged gender stereotypes prevalent in Indian villages by running their father’s barbershop, with their father and the entire village of Banwari Tola by their side.
Discussing the story, Karthik Srivatsan, Associate Director and Country Category Leader, Shave Care, Indian Sub-Continent at P&G, said that Neha and Jyoti and the entire village of Banwari Tola are an example of how when we take positive actions, we create meaningful change and set the right example for the next generation.
“Gillette is proud to further enable their dream through our Safalta Apni Mutthi Mein programme. It’s time we acknowledge that brands, like ours, play a role in influencing culture. Our actions need to inspire us all to be better every day, and to help create a new standard for boys to admire and for men to achieve. Because the boys of today are the men of tomorrow,’’ he said.
Sandipan Bhattacharyya
Commenting on the campaign, Sandipan Bhattacharyya, Chief Creative Officer, Grey Group, pointed out, “Gillette, as a progressive man’s brand, believes in and propagates topics that are relevant to raising and inspiring the future generation of men. And with this campaign and a powerful message like #ShavingStereotypes, Gillette drives home a point that has utmost relevance in the times we live in. The boys watching today need inspiring role models so that they grow up to be better men.”
The soundtrack in the film is inspired by Sohar, a traditional folk song sung in celebration at the birth of a boy. However, there is a twist in the lyrics towards the end, which urges people to equally rejoice the birth of a girl, for even she can change the family’s fortune.
The Campaign:
Tags: Gillette #ShavingStereotypes The Best A Man Can Be Grey India
Coca-Cola rides on cricket to engage with consumers, both online and offline
|
cc/2019-30/en_middle_0019.json.gz/line9731
|
__label__wiki
| 0.717294
| 0.717294
|
Best Libraries around Belgrade, MN
Appleton Public Library
322 W. Schlieman Avenue
Appleton, MN
History: The Appleton Public Library was established on November 2, 1895. Originally housed in what is today Pioneer Public Television, the librar...
Belgrade Top Searches
Benson Public Library
200 Thirteenth Street South
Benson, MN
Hours Monday, Tuesday & Thursday 10:00 7:00 Wednesday & Friday 10:00 6:00 Saturday 10:00 4:00 Sunday Closed
416 South Fifth Street
History The Brainerd Public Library was established in 1904 and was a founding member of the Kitchigami Regional Library system in 1969. Origi...
Carnegie Library
108 NorthEast 3rd Street
Little Falls, MN
About Us: In 1904 construction on the Little Falls Carnegie Library began. The Library opened its doors on Tuesday, February 7, 1905. The Carnegie...
Chippewa County Public Library
224 South First Street
Montevideo, MN
The local Montevideo Public Library was established in 1879 by nine individuals. Each member contributed three dollars. Annual dues were $1.00. ...
Clara City Public Library
42 West Center Avenue
Clara City, MN
Cokato Public Library
175 Fourth Street West
Cokato, MN
Cosmos Public Library
209 Milkyway Street South
Cosmos, MN
Dassel Public Library
460 3rd Street North
Dassel, MN
Hours: Monday 2:00 - 6:00 Tuesday 2:00 - 6:00 &nb...
Dawson Public Library
Dawson, MN
Hours Monday & Thursday 10:00 6:00 Tuesday, Wednesday & Friday 10:00 5:30 Saturday 10:00 2:00 Sunday Closed
Delano Library
160 Railroad Avenue East
Hours Monday - Thursday - Friday: 10:00am - 6:00pm Tuesday - Wednesday: 10:00am - 8:00pm Saturday: 10:00am - 1:00pm Sunday: Closed
Douglas County Library
720 Fillmore Street
Alexandria, MN
Mission Statement : The mission of the Douglas County Library is to provide for the informational, educational, cultural and recreational needs o...
More on Belgrade, MN
|
cc/2019-30/en_middle_0019.json.gz/line9732
|
__label__wiki
| 0.514467
| 0.514467
|
I am Feeling Good that at least RTI is becoming Strong…
Afroz Alam Sahil for BeyondHeadlines
New Delhi: In a historic decision, the Central Information Commission (CIC) has held that political parties will also be covered under Right to Information Act, 2005 along with various government departments. The CIC held that now all political parties have to appoint public information officers and the appellate authorities, which will be responsible for providing the requested information to the people.
This decision came in a matters filed before CIC by Subhash Chandra Aggarwal and Anil Bairwal of Association for Democratic Reforms. The hearings in these matters were completed on 26th September, 2012 and 1st November, 2012, but the decision was lying pending since then. On 3rd June, 2013 CIC came up with the decision after almost six months. The decision regarding disclosure of information by political parties will go a long way in making the political system more transparent and accountable. Now the things will become more transparent as far as funding-raising by political parties and allotment of land to them are concerned.
CIC observed in its decision that “…we hold that INC, BJP, CPI(M), CPIO, NCP and BSP have been substantially financed by the Central Government under section 2(h)(ii) of the RTI Act. The criticality of the role being played by these Political Parties in our democratic set up and the nature of duties performed by them also point towards their public character, bringing them in the ambit of section 2(h).The constitutional and legal provisions discussed herein above also point towards their character as public authorities. The order of the Single Bench of this Commission in Complaint No. CIC/MISC/2009/0001 and CIC/MISC/2009/0002 is hereby set aside and it is held that AICC/INC, BJP, CPI(M), CPI, NCP and BSP are public authorities under section 2(h) of the RTI Act”.
After this historic decision, on one hand I am feeling good that at least RTI is becoming strong with each passing day and on the other hand I fear that political parties might develop some tricks to hide their crucial information regarding funds etc from the general public. These political parties used tactics to hide true information regarding amounts incurred on the elections and the same tactics will be employed by them to hide their information from the general public.
But one thing is sure that now the gap between the ruler and ruled will get reduced. This decision will help in exposing the real face of the so-called servants of the people.
I can recall that in 2006, Election Commission of India was approached through RTI to disclose the information regarding sources of funding of political parties. And we got this information from the Election Commission. The documents accessed through RTI by us revealed that most of the public schools are giving funds to political parties. The news became the headlines of many newspapers in India at that time.
This news came at a time when these public schools were behaving arbitrarily and this arbitrariness came to a halt for sometimes to revive again within a short span of time. And it’s not that they stopped giving funds to political parties. The only difference the RTI made was that now they do not maintain the records of their fund giving activities on papers.
Around 2007, it was disclosed through a RTI that party with a difference- BJP got funds from Dow Chemicals (earlier Union Carbide). The Union Carbide Company was responsible for the Bhopal Gas Leak disaster in December, 1984. This matter of getting funds by BJP from Dow Chmicals came in spotlight and the then leader of opposition in Madhya Pradesh Jamuna Devi demanded that BJP be de-registered. The Election Commission and the Courts were also approached in this regard. But nothing concrete came out of this. Many mining companies, real estate companies, trusts, resident welfare associations, exporters, MNCs and educational institutions were found to fund various political parties. We have been revealing from time to time all this.
We have been disclosing all these stories constantly (The link to all these stories is given below. Beyondheadlines filed many RTIs in this regard. Facts revealed by us were made the headlines of various newspapers and news channels since 2011). Prior to this decision of CIC, the information about political parties could be collected from Election Commission even before enactment of the RTI. Through an amendment in Representation of People Act, 1951 in 2003, it was provided that through form 24-A under section 29-C (1) all political parties have to give information about the sources of fund-raising and the amounts collected to the Election Commission of India. But under this law, only amounts above than Rs. 20,000 have to be disclosed. But now, with this present decision of CIC, we may now know through RTI the funds collected by any political party below Rs. 20,000 also.
The relevant question is whether we would be able to know that what benefits accrue to the fund-giver by funding the political parties. I think no. But, yes, we can reach to some conclusion by analyzing the funds given. The timing of the funds, given to the political parties, may provide crucial information as to why a candidate got a ticket etc or some concession by government etc. This decision is important but lots of information about political parties will still be far from the reach of the common people.
We know how government offices treat RTI applications. There is a resistance to the whole movement for transparency and accountability in the government offices. Even in the present case of disclosure of information by political parties, it took 3 years for CIC to come to the culmination of this case. Does a common man have such a patience and energy to wait for such a long period of time? Many a times, people get disappointment from Information Commissions also. I have many such experiences with Information Commissions. Cutting a long story short, there are many unanswered questions, which my experience with RTI poses to me. But I am of the view that at least some information is reaching to the people and in view of this, decisions like this, should be welcomed.
I wish Media could also be brought within the purview of RTI. Our struggle for this still continues.
BeyondHeadlines’s Political Parties Funding Story:
Year Wise Funding of Political Parties
45 Crores ‘Corporate Fund’ Financed Congress
Queen Elizabeth Donated to Indian National Congress!
Congress Lost to BJP in Collecting Funds
Vegetable Companies Fund BJP to Cry Against FDI!
Canadian Funding for CPI?
Gujarat Government Donated to Modi’s BJP
Most Parties Shy Away From Sharing Funding Details
Didi and Behenji Ignore Rules to Hide ‘MAYA’
Ramdev’s Patanjali Ayurveda Ltd. Donated Rs 11 Lakh to BJP
BH Investigation Impact: Acharya Balkrishna of Patanjali Ayurved Kendra Pvt. Ltd. Clarifies
Ramdev Saga: Ripples in Political Circle After BH Exposé
Ramdev’s Politics: BJP Gives in to Pressure Generated by BH Exposé
Related Items:I am Feeling Good that at least RTI is becoming Strong…
आर.डी. निमेष कमीशन रिपोर्ट पीसीपीटी द्वारा जनहित में जारी
राज्यद्रोही पुलिस अधिकारियों को सरकार क्यों नहीं जेल भेज रही है?
|
cc/2019-30/en_middle_0019.json.gz/line9733
|
__label__cc
| 0.737074
| 0.262926
|
All Things Tack
Schockemoehle: For a Better Ride
It's super easy to get lost researching various tack and bridle brands, especially when brands are constantly releasing new features that are supposedly better or more comfortable for the horse. These days, "anatomic" bridles are all the rave, and while they're supposed to be more comfortable for the horse, many of us only have a surface level understanding of why. If you're like us, you want to know exactly how these features work and why they translate to a happier horse. Schockemöhle Sports, renowned for Anatomic Line of bridles, does this and much more. Tune in as we dive into the functionality, purpose, and design behind Schockemöhle's Anatomic bridles and discuss how that translates to a better ride.
Schockemöhle Anatomic Line
Schockemöhle has 4 lines of bridles: the Anatomic Line, Premium Line, Classic Line, and Neo Line. We are focusing on the best-selling Anatomic Line, as these were specially designed with the horse's complex face and neck anatomy in mind, making them hands down the most comfortable.
Before we dive in, a little background on the buttery soft leather (because we're all obsessed with leather here). ALL of Schockemöhle's bridles are vegetable tanned. As opposed to the conventional methods of using heavy metals and salts, vegetable tanning conserves raw hides and turns them into durable, exquisite leather products with the help of vegetable ingredients and other natural tannins. While this process is much more labor intensive, it produces superior leather that's full of character, and it's far more eco-friendly, too!
Now, on to the good stuff. Below we discuss the key features shared by all bridles of Schockemöhle's Anatomic Line and how this company's deep understanding of the horse's facial anatomy leads to the highest degree of comfort for our four legged friends.
One of the key features of Schockemöhle's Anatomic Line of bridles is the pressure reducing crown piece. The forward cut allows for freedom of movement around the neck and ears and relieves pressure on the Nuchal Ligament.
Schockemöhle Sports also prides itself on its attention to detail. For example, all throat latches are uniquely angled and designed to sit where they belong instead of falling forward along the cheek bone.
Bridles from the Anatomic Line also feature tapered zones on the noseband as it passes over the cheekbones to avoid pinching.
Nosebands on the Anatomic bridles are also uniquely angled so that the straps of the nose band do not close over the throat latch area as they do in traditionally designed bridles. This allows for undisturbed circulation to the head, as the main facial veins and arteries pass through this area (shown by the red and blue lines).
We currently carry 4 bridles from Schockemöhle's Anatomic Line, including the top-selling Equitus Alpha, Stanford, Tokyo, and Montreal. All of these bridles come with matching Schockemöhle reins (they are sold separately on most other sites), but you may still be wondering if the Anatomic Line is worth the price. Read on as we analyze the engineering behind the Equitus Alpha (and give a little lesson in equine head anatomy, too), discussing exactly how this translates to maximum comfort and a better ride.
Spotlight Design: Equitus Alpha
The design patented Equitus Alpha is one of Schockemöhle's newest and most innovative models. Part of the best-selling Anatomic Line, the Equitus Alpha focuses on avoiding the most sensitive areas on the horse's head. Check out the diagram and corresponding bridle features below to learn how specific design choices of the Equitus Alpha minimize pressure and maximize comfort for your horse during your ride.
Anatomy of the horse's face, including key ligaments, nerves, veins, and arteries. Read on to learn about the features corresponding to each number.
1) Softly padded headpiece: the anatomical, forward cut shape of the headpiece allows for freedom of movement for the neck and ears and avoids irritating the Nuchal Ligament and Poll-Atlas Junction. This may not seem like a big deal, but the Nuchal Ligament, which attaches to the poll at the occipital bone, travels along the top of the neck until it turns into the Supraspinous Ligament over the back, so we can begin to understand that the poll is already coming under a lot of pressure just from its connectivity to the spine. Plus, the head alone accounts for 10% of the horse's body weight!
Bottom line, anything we as riders can do to alleviate this downward pressure in our tack decisions translates to more comfort for our horses.
Closeup of the unique forward cut shape of the crown piece on the Equitus Alpha
2) Unique browband shape: the wide design and curved shape of the browband avoids pinching by the sensitive veins and nerves around the eyes and ears.
3) Curved caveson: the curved shape of the caveson strategically bypasses the largest and most sensitive facial nerve, the Nervus Fascialis, and minimizes pressure on the nasal bone.
4) Fixed button rivets: multiple fixed rivets along the cheekpiece allow for quick and easy adjustment to fit multiple horses.
5) Positioning of flash strap: the sideways positioning of the flash strap allows for unrestricted breathing without constricting the respiratory tract.
Closeup of the noseband and cheekpiece design of the Equitus Alpha, pointing out the fixed button rivets on the cheekpieces, curved shape of the noseband to avoid the Nervus Fascialis, and uniquely angled flash strap.
6) Cheek pieces mounted directly on noseband: because the cheek pieces are mounted directly onto the noseband, the bit is stabilized in the mouth, making the contact more comfortable for your horse and allowing for a better connection between horse and rider. Additionally, the aids applied through contact with the bit lead to a gentle pressure on the horse's nose, better optimizing communication between horse and rider.
7) Closure of noseband straps: the straps of the noseband are angled in such a way that they do not close underneath the throat latch (as they do in traditional bridles), meaning they strategically avoid pinching on the main veins and arteries on the face and as a result do not disturb circulation to the horse's head.
The Equitus Alpha was designed so that the noseband does not close right underneath the throat latch area, where the main veins and arteries of the face circulate blood around the horse's head as shown in the diagram above.
Who would've known that the horse's vascular face anatomy was so complicated? With bridles especially, a lot of the nifty features are often for visual appeal only, which is why we have such a deep respect for Schockemöhle Sports' design process. Every single design choice on their bridles is backed by science and reasoning, helping us as riders understand why a particular feature translates to more comfort for our horses. To us, nothing is more important than this. Yes, Schockemöhle bridles are expensive. There's no denying that. However, it is hard to name another brand that puts as much innovation and care into the design process as Schockemöhle Sports. You simply cannot beat the impeccable quality and comfort they offer for your horse, and a happier horse translates to a better, more connected ride!
As always, thank you for tuning in! To see all the apparel and tack we carry by Schockemöhle Sports, be sure to check us out online.
|
cc/2019-30/en_middle_0019.json.gz/line9748
|
__label__wiki
| 0.514073
| 0.514073
|
iPhone XR Review: All you want to know about iPhone XR
iPhone XR — never mind what the R means, it’s just a new letter for Apple, one before S, “racing” if you’re into cars, “reflex” if you’re into cameras, cool-sounding either way. It’s everything you need in a next-as-in-X-generation iPhone, minus some bells and whistles… and the higher price tag.
LCD instead of OLED display. Single instead of dual camera system. Haptic touch instead of 3D Touch. LTE Advanced and 2×2 MIMO instead of Gigabit and 4×4. Aluminum instead of steel bands. Back glass that’s stronger than iPhone X but not quite as strong as iPhone XS.
It does come in a range of fancy new finishes though: black, white, blue, yellow, coral orange, and Product (RED). And at that lower price — $250 lower — starting at $749.
It does have the new edge-to-curved-edge design language, Face ID and the True Depth camera up front, the latest 12 megapixel, Smart HDR camera on the back, the industry-leading A12 Bionic chipset inside, wide stereo speakers on both ends, and dual SIM card support if one carrier and one number just isn’t enough.
That Apple is testing the upper elasticity of iPhone pricing with the XS and XS Max while at the same time making some of their most compelling, could-easily-have-been-exclusive features available to lower-priced XR is fascinating.
Apple says it’s doing it to make those technologies more accessible to more people in more places, which is kinda cool… if really odd for a company Wall Street seems to judge solely based on the year-over-year rise of ASP — average selling price.
So, what are you getting with iPhone XR and what are you giving up? I’ve spent the last week with a black iPhone XR, and here’s what I’ve found.
How to Free Make Ringtones on iPhone XS Max
3 Ways to Download and Import Streaming Music to iPhone XS/iPhone XS Max
Two Ways to Transfer Photos between iPhone XS and PC
6 Ways to Transfer Data from iPhone 5/6/7/8/X to iPhone XS
Two Ways to Transfer Samsung Data to iPhone XS
iPhone XR in Brief
For people who want:
Edge-to-edge design with gesture navigation.
Optically stabilized ƒ/1.8 single camera system.
Depth-aware front-facing camera.
Face ID biometrics.
A 6.1-inch display.
Colors!
Not for people who want:
Classic iPhone design with Home button.
Optically stabilized ƒ/1.8 and ƒ/2.4 dual-camera system.
No notch.
Fingerprint identity biometrics.
An OLED display.
iPhone XR Design
iPhone XR looks like… an iPhone X. It’s got the same glass and metal modern design that curves around every corner, and the same notch that cuts it out the top. You know, the one Apple debuted last year as a way to kick-start its next 10 years of iPhone.
There are some differences, though. The bezels, for example, are a little thicker around the display. It reduces the screen-to-casing ratio and the full-screen effect, but it’s really only something you notice when you’re an XR next to an X or XS. Compared to an iPhone 8 or previous, again, it’s like the entire device got a shave and a haircut.
Just with a number 3 clippers instead of number 2.
The notch is the notch. Until Apple can engineer all the TrueDepth sensors under the display, it’s the compromise the company has made in order to avoid an even bigger, uglier forehead along the entire top of the phone, which would cost some screen or cause some additional casing. Neither, Apple believes, are better solutions.
That there’s no “chin”, even on iPhone XR, is remarkable.
Other phone makers can’t or simply don’t want to spend the money and engineering resources to do that regardless of the display technology they’re using. And Apple’s just repeated it right out of the gate with LCD.
Given how great the new wide stereo audio effect is, which XR shares with the XSes, it also makes me wonder if front-facing speakers on the Pixels were less about causing a chin and more about covering it up. I guess we’ll find out next year.
To handle the curves around the corners and the notch, which we’ve now seen replicated across the industry with varying degrees of quality, consistency, and artistry, Apple is using sub-pixel anti-aliasing and what the company calls “advanced” masking, which results in a crisper, cleaner look than the resolution itself has any right to.
In other words, Apple flowed the display into every rounded nook and super-elliptical cranny in a way that manages to look super smooth even when I take off my glasses, slap on a macro lens, and peer into the parallax wallpaper effect.
Impressive. (Most impressive.)
The structural band around the sides is Apple’s custom 7000 series aircraft or spacecraft or shift-ship craft or whatever quality aluminum alloy the company has been working on since iPhone 6s.
For iPhone XR, Apple offers them au natural to complement the white version, or in black, blue, yellow, coral — which is just off orange — and (PRODUCT) RED, which supports the charity of the same name.
My understanding is that gold remains the easiest color to anodize and it gets harder through the blues, greens, and black. There’s no green this year or, much to my and Samual L. Jackson’s lightsaber or Thanos’ Power Stone sadness, purple. Also, no multi-colors like Huawei has been doing recently.
But, for the colors that are, Apple has nailed them. Even the ones I’m usually less fond of, like yellow, or the mixes, like coral. They all look great IRL.
And they carry through the glass backs as well, which have one of those overly complex Apple Industrial Design Studios 7-layers treatments that give them amazing visual depth, richness, and range, depending on the light source.
I liked the unabashedly pop-art plastic of the 5c colors and loved the Apple-chromatic aluminum of the iPod touch and RED iPhone 7.
The glass is somewhere in-between for me, but giving up the metal for inductive charging, which now has the new, improved off-axis support of iPhone XS, is a huge win. Especially since, while back glass might not be quite as strong as this year’s XS, it’s still stronger than on either last year’s 8 or the X.
So, yeah, add that to your bill-of-materials savings, but the true test will come over time to see how well Apple and Corning have figured out the age-old challenge of balancing scratch, scuff, chip, and crack resistance all in one chemistry.
(The front glass is the same extra-strong Apple and Corning collab as on the iPhone XS and XS Max if you were wondering, which they call the most durable on a phone, ever.)
It’s all microscopically sealed, so iPhone XR enjoys the same water and dust resistance as iPhone X — IP67 for up to 1 meter for up to 30 minutes. And that includes splashes of soft drinks, hot beverages, and even dunks in salt water, though you’ll want to wash it off and leave it to dry for half-an-hour before plugging it into anything afterward.
iPhone XR still has Lightning instead of USB-C, because Lightning came out years before USB-C, is still slimmer, and Apple can do whatever it wants with it without waiting for a standards body to rubber stamp or reject it
That’s irksome to geeks like me who have otherwise gone almost all-in on USB-C. Not quite as irksome as the lack of an adapter or better than 5-watt charger in the box, but probably still fine for the mass market that’s been amassing Lightning accessories going back to iPhone 5.
Less fine is the sudden loss of z-axis asymmetry thanks to the shoved down Lightning port on iPhone XR. Again, yes, this is only something I.D. nerds like myself care about, but after iPhone XS broke x-axis symmetry to fit a 4×4 MiMo antenna on the bottom, iPhone XR has gone and broken the Z by top aligning instead of middle aligning Lightning to the screws and grills, probably to make room for the not-as-thin-as-self-illuminating-OLED edge-to-edge LCD.
I still haven’t gotten used to the steel screws and ports not always being vapor coated to match the aluminum anodization, now this?
I know it bugs the designers and engineers even more than it does me. And while it’s still not as rando as some other companies seem to be by tossing elements into the casing like drunken darts at a board, and as nit-picky (and I’m sure eye-rolling) as I’m sure it is for some of you, I’ve given Samsung shit about it for years, so I’m not going to stop just because, this time, my eyes are bleeding courtesy of Apple.
iPhone XR Liquid Retina Display
iPhone XR eschews the new OLED of X and XS for the LCD of iPhones past. But in a way that’s decidedly futuristic. It goes corner to rounded corner, like the OLEDs, using all those masking and sub-pixel anti-aliasing skills I mentioned before, and an all-new LED back-light that’s probably not only responsible for the Lightning depression but for the loss of 3D Touch for Haptic Touch, which I’ll cover in a few minutes.
It’s 6.1 inches on the projected diagonal, which is larger than the 5.8-inch iPhone X and iPhone XS, but not quite as large as the 6.5-inch iPhone XS Max. And, like Goldilocks, I find this middle size to be just right. I’d get an XS in this size in a hot second.
I know some people still equate less expensive with smaller, like with iPhone SE, but the reality is iPhone has grown so much that it’s not safe making any assumptions anymore, not about what size most people prefer, or which sizes might be appropriate for which genders or cultures.
Big phones have eaten tiny tablets and bigger, more independent watches may one day eat the need for smaller, after-work and weekend phone.
For now, as phones have increasingly become primary computing devices for an increasingly large number of people of all sizes, in all areas, the trend has been towards bigger screens for greater productivity and creativity.
That’s why iPhone XR offers many of the advantages of the Max, including the terrifically accessible Display Zoom option that makes everything on screen bigger and easier to see, touch, and interact with, and the iPad-like split view controllers in landscape mode that let you see lists next to details so you can navigate faster. Though like the Max, they’re still less consistent than the old Plus versions, and there’s still no side-by-side or picture-in-picture options to be found. In 2018. Yeah…
Reachability, which lets you get to the top of the screen from the middle of the screen, is in full effect, as is the X-style gesture navigation system, which, once you get used to it, will make Home buttons feel like the dark ages of interface.
Where iPhone XR does take a theoretical hit is on resolution and density.
It’s 1792×828 at 326 ppi compared to XS and XS Max, which are 2436×1125 and 2688×1942 at 458 ppi respectively.
Comparing LCD to OLED is problematic, though, since they’re fundamentally different technologies. While I believe Apple uses RBG stripe OLED on the Watch, it’s using diamond-configuration PenTile on iPhone, and that means the subpixel math is a bit of a brain-boggler.
So are the relative advantages and disadvantages of LCD vs. OLED. Apple has done a ton of work to mitigate the worst OLED attributes, including off-axis color shift and burn-in, but some things, like black smearing, just aren’t as possible to mitigate.
LCD doesn’t suffer from any of that. But it also doesn’t have some of the characteristics that make OLED so desirable, including the deep blacks and high contrast range.
But Apple has once again done a great job making LCD all it can be. It’s not high dynamic range — HDR — but the color calibration is ridiculous. Individual, at the factory, like all iPhones have been since Apple moved to the wider DCI-P3 color space, side by side with the XS, it still matches almost perfectly.
Given all the differences I just outlined, that’s a staggering achievement.
Regarding the “it’s not 1080p” criticism that’s been floating around since Apple posted the spec sheet, that’s fair. I mean, 1080p is a 16:9 aspect ratio standard and this display is not 16:9, but if you play 1080p content on it, it’ll be scaled down to fit 828p. Which is absolutely less P, and absolutely different than the previous plus-sized iPhones that could fit 1080p at native resolution, though it downscaled an @3x — 9 pixels square per point instead of @2x or 4 pixels per square — like XR. And, while it never bothered me, some people found the single pixel flicker it caused apparent and annoying.
I did a whole explainer on @2x vs. @3x interfaces and HiDPI displays before and I’ll be updating it with a lot more on the XR now, so keep an eye out for it.
Suffice it to say, unless you’re doing VR, where you want 4K if not 8K per eye, Apple’s 326 ppi — the same density as every non-plus iPhone from 4 to 8, is fine at normal viewing distances for the vast majority of people not wearing a loupe or worrying about arc-light-minutes.
For everything else and everyone else, you probably won’t notice a difference. It looks terrific and is yet another example of the overall experience being far more important than any one spec read off any one sheet.
iPhone XR Haptic Touch
Apple has deployed several different types of pressure sensitivity over the years. There are the electrodes circling the display of Apple Watch, the quad corner sensors of the MacBooks, the Pencil tip that transmits to iPad Pro, and the deformation of the glass as measured by the LED backlight on older LCD iPhones. (OLED iPhones use an entirely new touch layer for that.)
Though iPhone XR is LCD, like iPhones 6s through 8, Apple hasn’t brought over their 3D Touch implementation at all.
My best guess is that spreading out the LCD corner-to-corner, and the new backlight Apple had to use to make it possible, precluded the traditional 3D touch.
So, instead of that or a potentially more expensive touch layer, Apple has come up with something new, if much less pervasive: Haptic Touch.
When and where it works, it feels enough like 3D Touch that I sometimes find myself forgetting it’s not 3D Touch. Until I try to use 3D Touch in other places — which I’ve gotten used to using fairly often over the last few years. Yeah, I’m the one. You’re welcome.
It uses a system closer to the MacBook Trackpad, but with the Taptic Engine that still makes most competing haptics seem totally crude by comparison, but it only works on the Lock screen icons for Flashlight and Camera, the Control Center icons that spring up additional options, and the keyboard when you long-press the space bar to switch to trackpad mode.
Everything else, from Live Photos on the Lock screen to shortcuts on the Home screen to peek and pop… are simply not there. Like you might as well be using an iPhone 6 or iPhone SE or, yeah, iPad, not there.
It’s probably fine for most people but, for anyone like me who uses 3D Touch a lot, Haptic Touch will end up being more of a Taptic tease.
iPhone XR Face ID
I don’t typically cover features that debuted in previous models because, well, I covered those features when they debuted in those previous models. But, since iPhone XR may be many people’s first experience with Face ID, here’s the TL;DR.
Touch ID was never an end to a means. It was a means to an end: A way to make security more convenient. Face ID, Apple believes, makes even better security even more convenient. One day, I hope it too is replaced by an even more transparent, passive, ambient set of biometric sensors.
Face ID, like Touch ID, has some limitations you should know about: Just like Touch ID didn’t work if your finger was moist or wet, Face ID doesn’t work if the camera is being blinded by direct sunlight. Just like Touch ID didn’t work with gloves, Face ID doesn’t work with infrared-blocking sunglasses — though all other types, including polarized, are just fine.
It doesn’t work in landscape mode or for multiple people, though you can now train an alternate appearance if you regularly make yourself look more significantly different, for personal or professional reasons.
You also lose the ability to unlock your phone by just reaching out and touching it, but you gain the ability to unlock it when you’re wearing gloves or it’s connected to a mount or dock you can see but less easily touch.
Protip: If you regularly wear glasses, hold it a little further away when you’re not wearing them — for example, when you’re in bed — since the camera needs normal, not short-sighted range to see you.
In many cases though, Face ID is so fast you forget it’s even there. That’s especially true with the new password autofill feature in iOS 12.
iPhone XR enjoys the newer, speedier Face ID system as well. The same one as iPhone XS. It leverages faster algorithms and a faster secure enclave. But it’s only a part of the improved TrueDepth camera system.
iPhone XR True Depth Camera System
Crammed into the notch, around the speaker and ambient light sensor, are the infrared and RGB cameras, flood illuminator, and dot projector that make up the True Depth camera system.
You can use TrueDepth for Animoji and Memoji in Messages and FaceTime and augmented reality apps whenever and wherever the mood strikes you. You can also use it for Portrait Mode and Portrait Lighting selfies.
All of it exactly the same way, and with exactly the same quality, as iPhone XS.
That includes the new Smart HDR that interleaves brightness detail and adds long exposure for shadow detail to produce the best dynamic range possible, and the new depth control feature that lets you adjust the computational bokeh from f/1.2 to f16 after you’ve taken the shot. (Apple will add the ability to do it in the live view as well in a soon-to-be-released update.)
I covered all of that, front camera and back, in my iPhone XS review, and I’ll be posting a more detailed iPhone XR camera review soon.
But there is something new that’s more than worth covering here and now.
Single-Camera system
The biggest difference with iPhone XR, at least for me and for how I use my iPhone, is the new single camera system. Apple’s been doing single cameras since the original iPhone, and kept doing them on iPhone 6, 6s, 7, and 8 even as it moved to dual camera systems on all the Pluses and the original X.
But the Plusses were so much better I never really bothered with the single cameras. And to be honest, I still won’t now. As much as I love the colors and the size, and don’t have any problem with the LCD, I went dual camera years ago and I’ll never go back. Not for a Pixel and not even for an iPhone XR. If anything, I look forward to a three camera system with an even wider angle in the future.
If you don’t care about the depth data that can be pulled from a dual camera system for everything beyond just photography, or the 2x optical zoom, — which no digital zoom, no matter how much you shake and fuse, can really match — then the single XR camera might be more than just good enough for you. It may be great for you for stills and especially for video.
iPhone XR video, 2x optical aside, has exactly the same improved image stabilization and extended dynamic range as iPhone XS. That’s in video modes up to 4K 30 fps, and everything but the extended dynamic range up to 4K 60fps.
You often hear about which phone camera is best only in the context of stills, not videos, but it’s amazing just how much Apple does with video on iPhone XR and XS. Including now, stereo audio recording through a quad microphone system. Because a lot of it is driven by dedicated encoders and decoders that are part of Apple’s custom A12 Bionic chipset, these are frame rates and audio capabilities some competing camera systems simply don’t offer. (Trying really hard not to look at the Pixel 3 I have on order…)
While there’s no telephoto camera, the wide-angle camera on iPhone XR is the same as the iPhone XS. It’s got bigger pixels and deeper pixels, to take in more light with less cross-talk.
That means better low light, again, and with Smart HDR, even better detail in light and shadows. And, yeah, if you don’t like it, you can turn it off or keep both the Smart HDR and the original photo, in Settings.
Because there’s no dual camera system or True Depth on the back, Apple is going all-in on computational photography to deliver Portrait Mode on iPhone XR.
It’s a similar approach to what Google did last year with the Pixel 2, using the parallax from the phase detect autofocus system — what Apple calls Focus Pixels — and machine learning to create a segmentation mask between the subject and the background.
Last year, I had some issues with Google’s version. The colors were a bit cool, the segmentation mask looked more like a paper cut-out, and biggest issue of all, it wasn’t actual portrait mode — at least in the live view. You had to take the photo then wait a few seconds for the depth effect to be applied afterward … in post … like a filter.
(If you’re surprised by that, you’re not alone: Almost no reviews or reviewers bothered to mention it.)
Some will say it’s the end results that matter. And that’s fine. Personally, I love and care about taking photos as much as I do having the want and need to frame based on what I see. Anything less is a deal-breaker for me. As great as my Pixel 2 XL was for photography in general, I basically stopped using it for Portraits.
Pixel 3 fixes the coolness and the cut-out effect but not the live view, not really. I don’t know if that’s Google’s problem or Qualcomm’s, but ultimate, as a user, it ends up being my problem. And, when Apple first announced what it was doing something similar with the single-camera iPhone XR, I imagined it would be my problem there as well.
Turns out, I was terribly happily wrong. Apple is pushing the depth effect into the live view on iPhone XR as well so what you see, again, is what you shoot.
And I’m super glad it is because framing Portrait Mode on the iPhone XR wide-angle camera is completely different than framing it on previous Plus and X telephotos fusion cameras.
You’re much further away, for starters, so if all you want is the face, you’ll have to sneaker zoom in instead of out. And the kind of shots you get end up being different because of it. It’s also much faster, so you can get brighter, better shots in lower light than you can the f/2.4 of the telephoto.
But it comes at a cost, which might also be a deal-breaker for some: Instead of going shallow and broad for this, the first iteration, Apple has gone narrow and deep. iPhone XR portrait mode only works when it detects human faces.
And, unlike iPhone 7 Plus when it first shipped, where Portrait mode was optimized for human faces but would do its best with everything else — and now with iOS 12 does amazingly well on an incredibly diverse set of subjects and objects — iPhone XR literally won’t engage Portrait Mode if it can’t detect a human face.
Now, it’s pretty good at engaging when it does. It uses a Face ID-like neural network to not only identify human faces but identify them even if they’re partially obscured by glasses, hats, scarves, and other forms of clothing. Apple trained and tested it on an incredibly diverse and varied pool of people and things that people usually have on their heads and faces.
But that does mean no coffee or cocktail cups with a deep blur, and not even pets get the depth effect. So, if that’s what you want and need to take, it’s something you can only get past by moving up to an iPhone XS or Max or down to an iPhone 8 or iPhone 7 Plus.
If you’re fine with just faces, Apple has done something remarkable here: Just like with iPhone XS, the camera team spent time studying a number of high-end cameras and lenses and came up with a unique, specific computational model for iPhone XR depth effect. One very different than iPhone XS.
Instead of just slapping on a custom gaussian or disc blur over the background and calling it a day, Apple has created a model based on the virtual lens, which renders everything, including lights, overlapping lights, and even the typical distortions you get with real camera glass, to fit that model.
And, when you slide the new Depth Control back and forth between f/1.4 and f.16, it re-models and re-renders the virtual lens model.
The difference between iPhone XS and its effective 52mm telephoto Portrait Mode and iPhone XR and its effective 26mm wide-angle Portrait mode is significant. It’s like swapping lenses on a DSLR. You get an entirely different look. So much so, I wish Apple had enabled both on iPhone XS so I could switch between them on one phone instead of, fun as it may be right now, switching between phones.
We’ve known for a while now that computational photography was the future but XS and XR show that we don’t have to fully abandon the past to get there.
Theoretically, computer cameras have no limits. They can do anything and everything. Perfectly. All the time. Which would be all scientific and sterile in the worst possible ways. Like, stop-motion before motion blur. By imposing some of the constraints of real-world physics and lenses, you get the real world character and creativity that go with them.
iPhone XR A12 Bionic
It’s so interesting to see what Apple chose to bring to the less expensive iPhone XR and what it chose to keep for the more expensive iPhone XS. No dual cameras, but the same True Depth camera. No OLED, but A12 Bionic.
I think it boils down to this: Apple wanted everything in iPhone XR that made for an iPhone X-series experience. OLED is nice but Face ID is a must. 2x optical zoom is cool but Portrait Mode is table stakes.
For A12 Bionic, though, I think it’s less about being able to run the most demanding AR and computational photo filters in the here and now, and more about being able to run iOS for many, many years to come.
Just like iPhone 5s and iPhone SE can run iOS 12 today, Apple wants anyone who buys an iPhone XR to know they’ll be able to run iOS 16 or whatever well into the next decade.
I covered A12 Bionic in my iPhone XS review, but iPhone XR on A12 feels almost lighter, like super lighter, and faster. It’s not dissimilar to how iPhone SE felt on top of that iPhone 6s Engine. There is one difference, though: Where iPhone XS and iPhone XS Max have 4 GB of memory, iPhone XR has 3. That it “only” has to push around @2x instead of @3x pixels and content makes a direct comparison more difficult than it seems. In my week with the XR so far, I didn’t nothing any slowdown or any apps or tabs being jettisoned any faster than they would be on any iPhone, including XS and XS Max.
Time, though will be the only way to tell.
That might also be why it gets slightly better battery life and why, yeah, reading specs off of sheets and complaining about pixels or milliamps is effectively meaningless these days.
It’s not just about the quantity any more — it’s about the quality and how much you can get out of how little. That’s how and why everything from miniaturization to computation works.
I stress-tested iPhone XR alongside iPhone XS and iPhone XS Max during Pokémon GO’s Community Day event this weekend. That’s three plus hours of a nearly constant-on screen, GPS, GPU, and data. And it held up aces.
iPhone XS: 79% to 4%
iPhone XS Max: 84% to 12%
iPhone XR: 85% to 15%
As always, though, it’ll take me a few more weeks of regular use to come to a real opinion, and likely a full year to see how well it deals with charge cycles and aging over time.
iPhone XR ships with iOS 12, Apple latest-generation mobile operating system. (My review unit specifically came with iOS 12.0.1 which included bug-fixes for Lightning charging, among other things.)
It also contains foundational performance enhancements designed to make iOS software age as well as iPhone and iPad hardware; a giant leap forward in persistent, multi-person AR; proactive suggestions and voice-trigger-able workflows not just for core features but for any action in any app; much-needed improvements to notifications and the do-not-disturb system; full-on self and parental controls; fun new features for Messages like Memoji, which put you not just into the emoji but into a new AR world
iPhone XR Pricing and Availability
iPhone XR starts at $749 for the 64GB version in black, white, yellow, blue, coral, or Product (RED). That should be enough for anyone who streams media and uses a lot of cloud services. If you want to store more locally, you’ll want to check out the 128GB or 256GB option. Unlike XS, there’s no 512GB option.
That can still be a lot of money, especially up-front, but upgrade programs, including Apple’s and those of U.S. carriers, break it up into monthly payments that make it, essentially, zero percent financing with a new phone trade-in every year.
Many places, Apple Retail, and AppleCare offer in-store, online, and over-the-phone support. Apple Retail also offers an ever-expanding lineup of free educational courses, workshops, and events.
It’s part of the overall value of the Apple ecosystem I mentioned before, and absolutely should be considered part of the value of the purchase.
Standard Apple Care covers you against the usual issues for a year. Apple Care+, which costs $129 for iPhone XR, covers you for two years, including up to two $29 screen or $99 water/other repairs/replacements.
New this year are monthly payment options for AppleCare+ and new Theft and Loss Protection. Thanks to Find my iPhone, which you have to turn on at time of purchase, Apple can digitally verify a stolen and wiped iPhone and so doesn’t need to make you jump through hoops, including filling out police reports, to get a replacement. There is, however, a $229 deductible.
If like me, you’re not always as careful with your technology as you should be, then you, like me, might extract significant value from AppleCare+ over the course of a couple years.
Since I’m both clumsy and paranoid, I always get AppleCare+ and I’ve made use of it.
iPhone XR Conclusion
Most years, Apple price-drops the previous iPhone by $100 and offers it up as a less-expensive option to the latest, greatest flagship iPhone. Once before, though, Apple dropped an expensive-to-produce previous iPhone completely and, instead, offered up a second completely new iPhone at a lower price point, and in a variety of new colors.
But iPhone XR is no iPhone 5c. It’s got colors, yeah, but it’s also a full $250 cheaper, and it isn’t packaged up like an iPod — it’s being given the full iPhone treatment.
I think Apple learned from the 5c and applied those lessons to the XR. It tested, tasted, seasoned, and stirred.
Will the second time be the charm? It comes down to what I said at the beginning: Give people the option to get what they need, especially popular features like the new design, even bigger display, Face ID, and dual-SIM support, even if it doesn’t have all the bells and whistles of the full-on flagship.
At $750. iPhone XR certainly isn’t a budget or even a midrange phone. It’s just on the lower end of high. But, thanks to Apple’s top-of-the-line hardware engineering and the headroom afforded by A12 Bionic, it’ll last you or anyone you sell or hand it down to a good long while to come, maybe as long as a couple of phones that are half the price.
Personally, I’m going to be sticking with the XS. Because I have no life and literally nothing else to save up for, plus the whole “it’s my job” excuse, I have the luxury of going all out every year.
It’s not the OLED or the Gigabit or the steel, and I like the size and colors, maybe more than the other XS options.
For me, it’s the camera. I just use the 2x optical zoom so always, and find the depth data so cool, that I don’t want to give it up. If anything, I want more.
For a lot of people, though, I think the combination of flagship features, colored casings, and the lower price point will make iPhone XR compelling. Maybe even more compelling than iPhone XS.
I don’t know what that’ll mean for Apple’s revenue numbers but I know what it will mean for its customers, and I think it’s exactly what Apple is hoping for: All the new, more modern technology, all now available to a wider range of people in a wider range of places than ever before.
If you have any iPhone up to and including iPhone 7, iPhone XR is a terrific update. If you have an iPhone 8, you have to want a next-as-in-X-generation iPhone, but not want the XS price that would otherwise come with it. If you have an iPhone 7 Plus or 8 Plus, you have to be willing to give up that second, telephoto lens, to do it. If not, check out the XS.
If you’re switching to iPhone, and OLED isn’t a must-have for you, also check out the XR, it has almost everything you’d want in a flagship phone for 2018, minus the price tag that’s typically coming with them these days.
How to Backup/Import/Delete Photos on iPhone XS/XS Max/XR
How to Transfer Photos from iPad/iPad Pro/iPad mini to iPhone X
How to Transfer Contacts from iPhone 5/5s 6/6s 7/7 Plus to iPhone X
How to Transfer DCIM Photos from iPhone 5/5s 6/6s 7/7 Plus to iPhone X
How to Restore iTunes / iCloud Backup to iPhone X?
Tags: iPhone reviewiPhone XR
Next How to Find iPhone XS and iPhone XS Max UDID
Previous How to remove Activation Lock and turn off Find My iPhone on iPhone or iPad
|
cc/2019-30/en_middle_0019.json.gz/line9750
|
__label__wiki
| 0.605698
| 0.605698
|
Left Alive Launches March 5, Gets New Mech Edition
Square Enix offers first details on the Day One Edition and the ultra-limited Mech Edition of their new survival shooter, out March 5 on PS4.
Francis Santos Product Manager, Square Enix
We’re excited to announce that Left Alive is coming to PS4 on March 5, 2019! You may be thinking: “The game is called Left Alive huh? I’m guessing I’ll have to… survive?” The answer… is yes.
Left Alive takes place in the fictional location of Novo Slava in 2127 after a devastating surprise invasion leaves the city swarming with enemy troops, towering mechs, and in burning wintery ruins. If that description isn’t painting a picture yet, take a look at this:
You’ll play as three different characters with three different paths, all seeking salvation from war that has erupted in the city. As each of those characters, you will have to make difficult choices in your escape that sometimes are a matter of life and death. The choices you make and the routes you take will all have an effect on how the story unfolds.
What does that mean? Let’s say you’re avoiding enemy patrols and trying to sneak your way out of the warzone, but you come across a pair of soldiers who are holding a group of refugees at gunpoint. What do you do? You have a few options. The heroic thing to do would be to run in, take the soldiers out and save the civilians, but that comes at the cost of risking your own safety and supplies. You also have the option to take a more strategic stealth approach, or even to bypass the confrontation in order to not to risk your life or your resources on a deadly rescue mission. Your choice will affect your characters’ story in different ways.
Speaking of characters specifically, we’ll dive into each character’s story and how they were caught up in this war in due time. For now, we can relish in the fact that the look and feel of these characters come from the great mind of Yoji Shinkawa from Kojima Productions!
A couple more things we’re excited to share:
The Wanzers (mechs) were designed by Yoji Shinkawa and Takayuki Yanase (Xenoblade Chronicles X).
The game is directed by Toshifumi Nabeshima (Armored Core series).
We’re also excited to announce a Square Enix e-Store exclusive “Mech Edition” that includes some pretty sweet items. We’re selling extremely limited quantities of these so you’ll definitely want to grab one if you’re into having awesome, limited things that people will be jealous of. The “Mech Edition” includes:
Day One Edition: Includes the full game and the Day One ‘Survival Pack’ DLC containing:
Ammo Pack
Light Body Armor
Recovery Pack
Klyuch Weapon (exclusive)
Grenade Pack (exclusive)
Volk Action Figure: Specially designed by Takayuki Yanase, this Wanzer figure features interchangeable accessories, weapons and hands
Hardback Art Collection: An 80-page art book featuring character & mech designs, and concept art for the game
Steelbook Case: Featuring mech designs from Yoji Shinkawa and Takayuki Yanase
If you miss out on the Mech Edition, you can still pre-order to receive the Day One box edition which will have the same “Survival Pack” DLC items.
If you’re of the digital persuasion, or enjoy theming out your home screen, you can preorder the digital Day One Edition now at PlayStation Store to receive:
Full digital version of the game
PS4 Static Theme (exclusive)
The Tactical DLC Pack which includes:
Slava Weapon (exclusive)
Material Pack (exclusive)
There’s a lot more information about the game we’re excited to share in the future, but for the time being, let’s breathe deeply and take in the awesomeness thus far. Left Alive is something brand-new for Square Enix and we’re thrilled to see how fans will embrace the challenge of surviving the deadly war in Novo Slava. Until next time!
left aliveplaystation gamesps4square-enix
cusman
Sounds interesting but I’ll have to wait for reviews or word of mouth for this one
I was really excited for this game until I saw the gameplay, it just looks awful. Almost looks like a game that was made 2 generations ago.
supervegi21
This game looks like it’s gonna be good looking forward to it
ERGOPROXY-DECAY
Having a huge MGS vibe….even that cover art is screaming it.
|
cc/2019-30/en_middle_0019.json.gz/line9751
|
__label__cc
| 0.74984
| 0.25016
|
How not to run a wine panel: Saying nothing at the International Chardonnay Symposium
"What was the question again?" Also, that's not actually Larry Hyde; it's his son Chris
I want to support the International Chardonnay Symposium. California has at least eight annual major Pinot Noir gatherings, but only this one on Chardonnay. Yet Chardonnay is California's most planted grape and its most sold wine, plus I think cool-climate Chardonnay is one of the most exciting wines being made here.
I want to support the Chardonnay symposium, but I'm going to get meta here: I attended two of the most worthless wine panels of my life.
This is not to say that there aren't, at every symposium, worthless panels. There's the ever-popular "pairing wine with cheese" panel, which is usually just an excuse to drink good wine and eat (hopefully) good cheese. That's fine; I'm not talking about that. And I'm not talking about weekend consumer-focused panels (great Russian River Zinfandels!) that the media has no business attending. I'm talking about weekday panels with an interesting-sounding topic that come off so poorly that you learn nothing at all.
Now, I've moderated some wine panels and people who were in the audience at those can jump in here if you like. But I like to think that when I run a panel, that panel will say something.
Here are the two panels I attended: "Wente Clone Comparative Tasting," and "Taste the Difference: Exploring California's Distinct Chardonnay Regions."
Both of those sound like they will provide information, right? Like, one could learn something about what the Wente clone tastes like, or how it is treated by different vintners. And that second one sounds like a surefire blog post at least: Santa Barbara County Chardonnay tastes like this, while Carneros Chardonnay tastes like that.
Instead, we were treated at each seminar to lecturing on how nobody can say anything definitive about either topic. In that case, what is the point of having a seminar?
The real Wente clonal selections: Karl and his father Eric
Longtime readers will know I've been writing about wine for a while. I'm well aware there's an exception to every rule. If you write that generally Sauvignon Blanc doesn't improve with age, somebody will pipe up with the exception.
But the important point for wine communicators, especially when talking to beginning consumers, is not the exceptions, but the rules, or perhaps better stated, principles. People want guidance. When you tell people "it doesn't matter what wine you drink with what food," you aren't helping them. We don't want to be as rigid as "Carneros Chardonnay with chicken breast in lemon-pepper beurre blanc," but "chicken is generally better with white wine" is helpful.
At the second seminar, I asked three times, "Can you tell me some regional differences in California Chardonnay?" I mean, the panel was called "Taste the Difference: Exploring California's Distinct Chardonnay Regions." A PR person I know told me that he couldn't see me at the front of the room, but, "When I heard somebody say, 'Let me ask the same question a different way,' I knew it was you."
What I got was a lecture from the moderator on how winemakers make a variety of choices that are more important than the region: barrel regimen and picking date and commercial yeast and when to dump in which additives and blah blah blah and there's just no way blah blah blah and all these Chardonnays are a product of their individual sites and blah blah blah.
Yes, this is all true. But I didn't sign up for a panel called "Reasons Why Nobody Can Make Any Statement At All About the Regional Character of California Chardonnay."
If you go to Burgundy, the Burgundians will tell you Puligny-Montrachet is like this, and Rully, just a few miles away, is like that. Is it possible to make a Rully that tastes like Puligny-Montrachet, or vice versa? Of course! (Actually, a Burgundian might argue that it's not possible.) In any case, that isn't the point of making Chardonnay in Rully. The point is to make a wine that is a distinct product of its region, not to deny that regional character exists.
Moreover, it undermines the purpose of having artisanal producers speak, and I believe that's what all of the speakers would like to be called. If the region doesn't matter, what matters is the producer, which in California equals brand. The new owners of The Prisoner would be happy with the message of this panel; why not just buy Prisoner Chardonnay, if it's all about the winemaker?
The Wente Clone panel was significantly better, as Randy Caparoso and Karl Wente gave us an interesting history of how the Wentes planted Chardonnay in Livermore Valley in 1912 and the grape spread out from there. Unfortunately that's where the story gets complicated.
There is no actual Wente Clone as we understand the term. The Wentes brought in a "trunk full of cuttings from Montpellier," Karl Wente said, and planted them all. Not all survived but the ones that did were essentially a field blend of Chardonnay clones. Karl Wente said that farmers tended to favor the vines that looked healthy, so there was some selection process, but many people looking for vine material to graft chose Chardonnay Musqué clones for the aromatic qualities, while others didn't.
Then UC Davis applied heat treatments to "Wente clones" that were infected with leafroll virus, creating virus-free Clone 4, Clone 5 and Clone 6 and maybe others I'm not listing. Without very productive Clone 4, good supermarket Chardonnay would not exist. Is it a Wente clone? If so, Caporoso says that 75% of the Chardonnay in California originated in some way from the Wente ranch.
Now that's an interesting story, but about that comparative tasting ... I beat my head against the same wall with this panel as I did with the other. So what does the Wente clone taste like? Compared to Dijon clones?
The best answer anyone could come up with was Eric Wente saying, "There's a reason why the industry has consistently selected it. It works in California. If it didn't work, you wouldn't do it." It's a good answer. It's an accurate answer. It's just not a particularly helpful answer if you want to know what Wente Clone Chardonnay might taste like.
There were some excellent wines at these two panels. A quick note on the links: All of these wines are new releases, so the Wine-Searcher links below will work for the actual vintages I tasted when they reach the market, which should be soon. Until then, just earlier vintages, sorry.
My favorite, LaFollette Lorenzo Vineyard Russian River Valley Chardonnay 2014 ($50) is earthy, complex, toasty, changing with air through a long finish. I wanted to make love to this wine but you have to be careful saying such a thing around Greg LaFollette because he's always bragging about his big Pinot. (You can buy earlier vintages here.)
The Wentes held an internal contest of all their winemakers and enologists to make the best Chardonnay. Most used French oak, long lees contact, etc. Karl's father Eric Wente, who wasn't there at harvest time, gave instructions. "My father said pick it at 21 brix, ferment it cold in stainless steel, leave it on the lees for two months, rack it, and make sure it's in the bottle by April."
The result, Wente Small Lot Eric's Livermore Valley Chardonnay 2015 ($20), was deliciously atypical: juicy lemony fruit, balanced, with good texture and a long finish. Karl compared it to Chablis, and while I won't go that far, the idea is similar, something you don't see enough of in California. (You can buy the 2014 here.)
Always interesting Jim Clendenen made a dull panel on regional differences tolerable with anecdotes on other topics (without him, I would have had no Wine Searcher story from this symposium, so thanks Jim), as well as a fine wine. Au Bon Climat Los Alamos Vineyard Santa Barbara County Chardonnay 2014 ($28) is moderately rich, earthy, and not fruit-driven, though there is citrus. (You can buy earlier vintages here.)
DeLoach Vineyards Hawk Hill Vineyard Green Valley of Russian River Valley Chardonnay 2013 ($50) is "the most Burgundian wine we make," said vineyard manager Eric Pooler. Hah: If we can't say what a Santa Barbara County Chardonnay is, or a Green Valley Chardonnay, how the hell can we say what a Burgundy Chardonnay is? Is it Chablis? Maconnais? What about the barrel regimen? The winemaker's personal expression?
I digress. The DeLoach wine is all about the toast, with good freshness and length, and it blossoms with air. (You can buy the 2012 here.) I wish I had spent more time drinking it and less time listening.
guren said...
Thanks for the interesting post. It's indeed strange that the panel did not want to describe any of the regional differences. Aren't certain AVAs supposed to have their own distinct characteristics that they promote? The panel could have at least spoken in generalities about that.
I basically agree with your statement that the point when guiding consumers, "is not the exceptions, but the rules, or perhaps better stated, principles."However, this consumer (am I referring to myself in the third person?) really appreciates it when reviewers are very specific when mentioning pairings. For example, I would love to read notes such as the following: "The 2012 Ramey Hyde Vineyard Carneros Chardonnay was a perfect match with the chicken breast in lemon-pepper beurre blanc, as the richness and texture of the wine elevated the tanginess of the beurre blanc and brought out the best in both. The chardonnay was excellent on its own, but developed another piquant layer of flavor after a bite of the sauced chicken that also added several seconds to its length."
I likely will never experience the exact pairing mentioned by the reviewer, but specific and detailed descriptions can help me envision how other combinations will work. Plus, it's just fun to read about times when a food/wine pairing went especially well. I think Twitter is a great medium for this type of information.
I read your story with interest, because I went to a similar panel at the Chardonnay Symposium a few years back regarding regional Chardonnay differences. In that particular panel, winemakers made wines, or were chosen because, they didn't do a lot to the chardonnays to change the end result (ie, lots of fining with tannin, gums, strong toasted new barrels, etc). Someone had even done their chardonnay in a concrete egg to minimize any change to the varietal characteristics.
It sounds like they just picked wines that where not "kept pure" for lack of a better term, so the 'virgin' characteristics could show through. Room for growth!
Samantha: Though this panel had some good wines, I wish I'd gone to the one you attended.
I haven't attended this symposium before. It was lightly attended by the public and I don't know why. Some of the problem might be location: Pismo Beach is far from population centers. This year's symposium didn't inspire me to want to attend next year, and I wonder if that has been the case in the past as well, but about that I can't say.
Prince of Pinot said...
Describing regional differences in Chardonnay is challenging because you are dealing with multiple Wente selections on different rootstocks of varying age vs multiple Dijon clones, wide differences in harvest Brix, vinification and a number of other factors. Chardonnay is not a particularly terroir driven variety and is very adaptable to many climats unlike Pinot Noir. Heck, you can grow Chardonnay in a parking lot in Fresno. Warmer regions like the Russian River Valley exhibit more ripe and luscious fruit and tropical fruit flavors, cooler regions like Santa Cruz Mountains and Sonoma Coast are more austere, citrus and acid driven and more "minerally" for want of a better word. The use of oak in Chardonnay would make a better panel subject. Better to hitch your wagon to a producer than a region.
Prince, in your third sentence you gave more regional information than the 90-minute panel. See, it can be done. Thanks!
Bob Henry said...
Blake,
The panel members comprised one wine writer (Randy Caparoso) and three winemakers (Karl Wente and Jim Clenenden and Chris Hyde).
(Too bad you didn’t have anyone from Stony Hill and Kalin Cellars – which, if memory serves me correctly, both make Chardonnays from the “Wente clone.”)
And you tasted these wines – among others:
LaFollette Lorenzo Vineyard Russian River Valley Chardonnay 2014
Wente Small Lot Eric's Livermore Valley Chardonnay 2015
Au Bon Climat Los Alamos Vineyard Santa Barbara County Chardonnay 2014
DeLoach Vineyards Hawk Hill Vineyard Green Valley of Russian River Valley Chardonnay 2013
And the balance of wines in the tasting line-up were . . .?
Seems like slim pickings.
~~ Bob
Wine anecdote.
I organize wine cellars in Los Angeles.
One collector client engaged me to spend multiple consecutive Saturdays "auditing" his collection.
On my inaugural visit to his home, he asked me to cart out to the curbside trash cans unwanted boxes of California white wines. Inside were old vintages of Stony Hill Chardonnay.
"Wait. What?," I decried. "I will take home a representative bottle of each vintage Chardonnay, sample it, and report back my observations when we assemble for my next work session."
And so I did.
The following day I chilled and sampled the 1976 and 1996 and 2002 vintage Stony Hill Chards.
Each was in sound condition. But the 1976 -- from a notorious drought year (perhaps even worse than our current El Niño condition) -- was magnificent: light straw in color, vibrant apple aroma, almost no hint of apple cider aged bottle bouquet, lively acidity (this is a non-ML wine), and fresh flavors. Showed better than the younger 1996 and 2002 bottlings.
Apprised of my findings, the owner said "let's taste them together after our work session."
And so we did. To great acclaim.
He rescinded his edict to kick the wines to the curb, and dutifully returned them to their place of honor in the collection.
I got a relevant email after this post from Bill Hanna, who grows Chardonnay in Napa Valley, and he agreed to let me post this part of it here:
Our first vineyard, my dad's, was a selection from Stoney Hill that was in turn selected from Wente. That fruit was in Chateau Montelena's 1973 that won the "Judgement of Paris" 40 years ago. At this time we have two small vineyards that contain vines from wood selected from that original vineyard plus other clones. We also have pure blocks of clone 17 from Robert Young Vineyards in Alexander Valley (a "virus free" selection from a Wente selection), clone 4 from Jaeger Vyds, and a selection from Monticello Vyds which is high in muscat aroma but I think was originally clone 4. All comments relate to our little area of the world NE of Napa.
1) The old clone (Wente/California) had a distinct minerality and the aromas did not come out until at least a year in the bottle. Also, the fruit did not taste ripe until sugars were above 23 brix.
2) Clone 4 tasted ripe at lower sugar and had a fruity nose from the get-go. That fruit tended to decrease with bottle age.
3) The Monticello selection works nicely as a blend with the previous two to make a nicely structured chard
4) We planted three blocks for a client just to the north of dad's original vineyard - across the road but otherwise contiguous. All were on St. George rootstock and all were selections from the original vineyard. At one point Chateau Montelena bought them all and I had a chance to taste them throughout the process as each was vinified separately. There were two different soil types and varying soil structure occurring within each block and between blocks. Slopes, exposure, spacing, and farming were all very close to the same. Interestingly, you could taste differences between each block. I don't recall the specific characteristics of the differences but I was blown away that even my untrained palate could taste it.
5) It seems to me that most wineries have their "style" and process the fruit to meet that rather than letting the fruit dictate the style. We have sold fruit from the same vineyard to different wineries and the wines tasted totally different.
Randy Caparoso: said...
Hey, Blake... "ouch" again. On one hand you say you attended two of the most "worthless" wine seminars attended in your life, and on the other you're saying that the "Wente Clone" seminar was "significantly better." Perhaps not all that "significantly?"
Anyhow, at the risk of coming across as defensive, I thought I should say that the panel I moderated was meant to simply illustrate the multi-faceted history of clonal material that originated out of Wente's Livermore Valley estate planted early in the last century. It wasn't meant to illustrate sensory differences between Chardonnays produced from, say, Dijon as opposed to various Wente selections. That would be a different kind of seminar; which, in fact, I would love to help organize in a future time and place.
But I would submit: if anyone attending actually learned something they didn't previously know about the history of Wente Chardonnay clones, or things like the differences between U.C. Davis/FPS treated clones and non-treated "Old Wente" field selections, then I would say that we were successful in our endeavor. The objective was intellectual, not sensory. Of course, as to the "worth" of that knowledge, that would be something every individual attending would need to determine.
I confess that I'm a geeky sort of guy,, so I find this kind of thing extremely fascinating; same as I do about clonal variations of Zinfandel, Pinot Noir, Cabernet Sauvignon, Muscat, Sauvignon Blanc, Sangiovese, etc. Thing is, factors like terroir, vineyard practices, winemaker choices, vintages, ad infinitum *always* effect or even trump factors like clonal variation; not just for Chardonnay, but for all major grape varieties. Having to apologize for not being able to demonstrate clear-cut sensory distinctions between clonal variants would be a waste of breath. In the case of the Wente clone seminar, that was never our objective in the first place.
But thanks for attending anyway, my friend!
Randy, I did learn something, and you were prepared, and you were significantly better than the other moderator, who I haven't named but who was really, really bad.
Problem is, the panel was called "Wente Clone Comparative Tasting." Not history.
Why does this matter? Personally, I drove down to Pismo Beach because of those two panels. I wouldn't have been anywhere near as jazzed about a panel called "Wente Clone History."
Is it fair of me to complain because the symposium didn't deliver on its promises? Yes, I think so. In this case I was a consumer of the symposium. I expected a burger and in your panel's case I got a hot dog. At the other panel, I got an empty bun.
How not to run a wine panel: Saying nothing at the...
Endorsements for San Francisco, June 2016 Democrat...
What I like and dislike about Donald Trump
Grower Champagne is highly overrated
12 things I learned about Bulgarian wine and food
|
cc/2019-30/en_middle_0019.json.gz/line9753
|
__label__wiki
| 0.746597
| 0.746597
|
Blog of the Dragon
Game of Thrones/Song of Ice and Fire news, theories, and other nerdy goodness
The Tower of Joy – What is it and Why Does it Matter? (Potential Spoilers)
By vkcole277
In Game of Thrones news
If you have seen the previews for Sunday’s episode of Game of Thrones, then you are aware it will include a vision of a young Ned Stark’s confrontation with some Targaryen soldiers. The soldiers were members of the Kingsguard tasked with guarding Ned’s sister Lyanna, who was being held at the “Tower of Joy” at the end of Robert’s Rebellion.
The story goes that Rhaegar abducted Lyanna sometime after the Tourney at Harrenhal, in which Rhaegar was victorious and crowned Lyanna the Queen of Love and Beauty. He supposedly fell upon her in the riverlands and carried her off to the tower. There are reasons to doubt this tale, however.
Rhaegar was perceived as an honorable man by all who knew him (with the exception of Robert Baratheon who never forgave him for stealing Lyanna from him). Lyanna was independent and impulsive, and she was not happy about being betrothed to a womanizer like Robert. She could have gone with Rhaegar willingly, and one theory (detailed here) suggests Rhaegar may even have rescued her from an increasingly paranoid King Aerys.
Why is any of this important to the current story? Well, the theory commonly called R+L=J suggests that Rhaegar and Lyanna had a child together, and that child is Jon Snow. When Ned finds Lyanna in the tower, she is lying in a “bed of blood,” which is used throughout the A Song of Ice and Fire novels to describe the birthing bed. She then makes Ned promise her something, which many people believe was a promise to keep Jon’s identity a secret and raise him as Ned’s own child.
Now that Jon is indeed back from the dead, his heritage matters more than ever. With Stannis gone, Melisandre needs a new champion. Jon could possibly be Azor Ahai reborn or the Prince That Was Promised – legendary figures who are prophesied to defeat the White Walkers/Others and stop the Long Night (more information on that here).
Jon Snow may not even be a bastard. It’s possible that Rhaegar and Lyanna married in secret (Targaryens had practiced polygamy in the past), which would make him an heir to the Iron Throne. There are numerous hints in the novels about Jon being a king, which are catalogued here. In short, Bran’s vision on Sunday could confirm a theory that has been discussed for almost 2 decades by book readers, and which could have enormous implications for the future of Westeros.
I am incredibly excited to see how this plays out on screen. Do you think we will find out the truth about Jon this Sunday?
Game of ThronesGame of Thrones Season 6Jon SnowTower of Joy
Game of Thrones Episode 2 Play by Play (Here Be Spoilers!)
Kit Harington on Jon Snow’s “Biggest Season” (Spoilers and Speculation)
patricksponaugle
I am so so so excited to see this.
“He dreamed an old dream, of three knights in white cloaks…”
Dayne: Now it begins.
Ned: No, now it ends.
SO EXCITED!!!!!!!!!!!
Kit Harington on Jon Snow’s “Biggest Season” (Spoilers and Speculation) | Blog of the Dragon
Will We Ever Know the Truth about Rhaegar and Lyanna?
5 Game of Thrones Theories That Need to Die a Horrible Death in Season 7
Surviving the Long Night
Five Cool Shows to Fill the Current “Game of Thrones” Void
Game of Thrones Season 6 Predictions – The Good, the Bad, and the Completely Wrong
Algorithm Predicts Game of Thrones Season 6 Deaths: Is Your Favorite on the List?
tawfiq atia
"شكرا لك عزيزي من رأي اجمل موقع مشاهدة اونلاين هو Roz Nm Video | ..."
Anthony Castillo
"It would make sense then, that Brandon rode to King's Landing so quickly ..."
Surviving the Long Night – Blog of the Dragon
"[…] week, my guest poster Caroline had some good suggestions for filler shows, ..."
junk car for cash
"junk car for cash You can certainly see your expertise in the work you ..."
Five Cool Shows to Fill the Current “Game of Thrones” Void – Blog of the Dragon
"[…] season seven of “Game of Thrones” airs, so fans will be waiting ..."
A Song of Ice and Fire news
Character predictions
Game of Thrones reviews
View blogofthedragon’s profile on Facebook
View @blogofthedragon’s profile on Twitter
|
cc/2019-30/en_middle_0019.json.gz/line9755
|
__label__cc
| 0.512353
| 0.487647
|
Volunteer Centre
>> LSE Careers home
‘Bad, Sad, Glad’: Masterclass in Crisis Communications
As part of Creative industries week, veteran communications expert and LSE alum Sheree Dodd gave a masterclass on crisis communications to LSE students hoping to work in communications and the media themselves.
Sheree shared her own background and her experiences coming largely from, as she put it, “the university of life”. After completing a BA in Political Science at LSE, she trained as a journalist and worked for the Sunday Mirror – a challenging position, especially at a time when women were not necessarily welcomed in newsrooms. As a journalist, she was an industrial correspondent and reported on miner’s strikes, then became a political correspondent and spent 13 years covering Westminster. In 1998, she went to work for the British government as Head of the news office and has dealt with many high-profile crises, including the MPs expenses scandals and the McCann abduction. She now trains civil servants and MP staff on how to work with the media.
Crisis communications can also be referred to as reputation management – and as Warren Buffett’s quote goes, “it takes years to build a good reputation, and it takes minutes to ruin it.” Students were invited to reflect on recent real-world crises that were well or badly handled.
Whilst every crisis is different and might give rise to different responses, a few golden rules of crisis management still emerge: Communicating with people is important, as is reacting with speed but not without thinking, and being prepared for the long-run.
The Trio of crisis communications messaging must take place in three different stages: ‘Bad, Sad, Glad’. When faced with a ‘reputation issue’, organisations should:
First, acknowledge the bad, and recognise that there has been a mistake;
Apologise to the people affected and express their sadness over the negative impacts of their actions;
Highlight what the organisation is doing to fix the mistake and move on.
Every organisation should design a risk plan before a crisis arises, as it is very hard to make level-headed decisions when a crisis is upon you. Crisis planning includes identifying potential risks that could befall an organisation, relevant stakeholders that need to be reached out to, and spokespeople within the organisation that are media trained and can be relied on to convey the right message in times of crisis.
In the last hour of the workshop, Sheree gave the students, assembled in groups, a crisis simulation to work on: putting themselves in the shoes of professionals working for a major hospital, hosting a minister expected to make big announcement, they had to come up with a communications plan and then react as the situation developed and new elements were introduced. The masterclass was topped off by a press conference where ‘journalists’ and ‘spokespeople’ could put into practice the principles learned in the past few hours.
This 3 hours masterclass tested students’ stamina and presented them with many theoretical principles of crisis communications, as well as the opportunity to apply them in practice – the perfect preparation for a career in this field, and a great taster to understand the stakes and realities of reputation management!
If you’re interested in learning more about careers in media and communications, have a look at our employment sector guides!
Guest Blog by Jeanette Lee: Crisis at Christmas
Starting again: an ‘emerging scholar’ at 50-odd?
Making the transition from a PhD to a permanent role
13 June 2019|LSE Careers|0 Comments
The Value of Volunteering during your PhD
10 reasons to work for a smaller/newer organisation
Securing your first job in the USA
LinkedIn tips for career changers
Tips on securing a job abroad
5 ways to write great speculative applications
Steps into International Development 601 views
10 tips for master’s applications 559 views
Online Volunteering – How to Get Started? 483 views
International Development…explained! 354 views
Succeeding at strengths based interviewing 277 views
10 things you should know about working in international development 225 views
LSE Careers
Saw Swee Hock Student Centre
1 Sheffield Street
WC2A 2AP
careers@lse.ac.uk
9:30am - 5pm (Monday-Wednesday and Friday)
9:30am - 8pm (Thursday)
Open during term time and vacations
(except when LSE is closed)
Latest opportunities on CareerHub
LSE Graduate Internship - Geography & Environment - 09 months
LSE Graduate Internship - Teaching & Learning Centre - 09 months
Associate Consultant - Digital Strategy & Marketing
Trainee Researcher – BBC Education
Junior Research Analyst - EMEA Regional Research
Latest events on CareerHub
Huawei 'Seeds for the Future' Programme 2019
Results resilience
Graduating - what next?
Copyright © 2014 LSE Careers
|
cc/2019-30/en_middle_0019.json.gz/line9757
|
__label__wiki
| 0.958015
| 0.958015
|
MPR News Notes on the news from the Twin Cities
Testimony: Man shot daughter’s ex-boyfriend then called police
Brandt Williams December 18, 2013, 6:14 PM Dec 18, 2013
In the wee hours of the morning on Feb. 3, Amos McGhee, 56, was roused from a deep sleep by his 21-year-old daughter Amy who came into his room crying and screaming. McGhee said it sounded like his daughter’s abusive boyfriend was in the house. So he got dressed, grabbed a loaded .22 caliber pistol and walked downstairs. A few minutes later, McGhee shot and wounded Chase Dent-Wells, 25, in the basement of McGhee’s Brooklyn Park home.
That’s according to testimony today in the trial of Dent-Wells, who is charged with stalking, illegal possession of a firearm, terroristic threats and two counts of assault. On the witness stand in Hennepin County District Court, McGhee testified that before he fired, he asked Dent-Wells to leave several times. “What are you doing here? And didn’t I tell you not to come to my house?” McGhee said he told the defendant, with his gun pointed toward the floor. McGhee said he even fired a warning shot near Dent-Wells that struck a lamp.
McGhee said he knew his daughter, who lived with him, had a volatile relationship with Dent-Wells. And he testified he’d seen his daughter with scratches on her face and a black eye from violent encounters with Dent-Wells. McGhee said he saw Dent-Wells take a silver gun out of his waistband. “I thought he was going to shoot me,” said McGhee.
The court heard a different account from defense attorney Bobby Joe Champion. In his opening statement, Champion said Amy McGhee let Dent-Wells into the house so they could talk. The couple had recently split up and Champion says Dent-Wells was unarmed when he took a taxi to see Amy McGhee. Champion said Dent-Wells told the taxi driver not to leave until he got in the house, because he wasn’t sure Amy McGhee would let him in.
“If you really don’t want someone at your house, call the police or get a restraining order,” said Champion. But no one in the house called 911 until after the shooting.
Amos McGhee is legally prohibited from possessing a firearm because of past criminal convictions; however, he was not charged for possessing a gun on Feb. 3rd. Nor was he charged for shooting Dent-Wells. Champion raised the possibility that the 9 mm pistol McGhee alleges was pointed at him by Dent-Wells may have actually come from McGhee. Police searched McGhee’s home two days after the shooting and found 9 mm ammunition in a bag in his bedroom. McGhee denied ownership of that 9mm gun.
McGhee did admit to buying the .22 caliber pistol he used to shoot Dent-Wells, even though he knows he’s legally prohibited from possessing it. He testified he bought the gun for protection and he got it “off the street. From a personal owner,” said McGhee. “I got the receipt for it.”
Champion said evidence in the trial will show Dent-Wells was the victim, not the aggressor. Dent-Wells was struck three times by bullets fired from McGhee’s gun. Champion says all shots hit him in the back of his body: one bullet hit Dent-Wells in the back of his head, another in his shoulder and the third struck his leg. He said that shows Dent-Wells was trying to get away when he was shot.
The trial continues this week.
Courts Crime firearms
‹ Older Twin Cities realtor ad spoof goes viral
Newer › Venerable St. Paul fabric store could fold
Browse by category Minnesota Sounds and Voices Minneapolis mayoral candidate profiles
Brandt Williams
bwilliams@mpr.org
Brandt Williams is a reporter with MPR News’ Metro Unit. At MPR, Brandt has extensively covered city government, public safety and courts; race and justice; and livability issues in the city of Minneapolis. Brandt grew up in Minneapolis and graduated from the University of Minnesota with a degree in Speech Communications in 1991.
Man suing for wrongful imprisonment behind bars again
Catch this vandal, never go hungry again
The numbers: police lethal force in MN
The location of the wounds also suggest that McGhee has terrible aim, lucky for the young man.
|
cc/2019-30/en_middle_0019.json.gz/line9758
|
__label__cc
| 0.598126
| 0.401874
|
Microsoft Office (In)security, OpenXML and unsafe content
Today I was reading the WinInfo UPDATE by Paul Thurrot, and he came up with the following comments:
The first tool, the Microsoft Office Isolated Conversion Environment (MOICE), uses the file type converters that first debuted in Office 2007 to convert Office 2007 and Office 2003 binary documents to the new Open XML file formats in an isolated environment, Microsoft says. In this way, potentially unsafe Office documents can be converted into safe XML-based documents that can’t succumb to the various electronic attacks currently targeting binary documents.
I think I am missing something here when Paul says electronic attacks currently targeting binary documents. What attacks are targeting binary documents? I thought there were malicious (binary) documents targetting Office, and not the other way around. Also, although not so common nowadays, I can’t stop thinking of those VBScript viruses that plagued Office documents some years ago. I don’t see how taking malicious VBScript code embedded into a binary document (like a Microsoft Word document) and converting that document into an XML-document can make that document magically safe. I’m sorry, but I think I’m missing something here.
Being a conspiracy-oriented and paranoid guy, this sounds to me like a try to trick people into moving to OpenXML to put some pressure over the already-standardized and open OpenDocument format from OASIS.
The second tool, the File Block Functionality for Microsoft Office, allows administrators to restrict which file types that Microsoft Excel, PowerPoint and Word 2007 and 2003 can open using registry settings or Group Policy. This gives corporate environments a quick way to shut down access to potentially dangerous Office binary file types in the event of an emerging electronic attack.
In theory, and to be safe, the administrator should block any kind of files (Microsoft Word, Microsoft PowerPoint, and so on), so basically the outcome doesn’t sound extremely useful to me. But that’s a beginning. Ideally, Microsoft will one day get things right and favor security over features. I’m still looking for that day, but who knows!
Although these tools are certainly welcome, I’m curious whether Microsoft will use the recent spate of Office document attacks as a new rationale for moving its customers over to the new Open XML document formats it introduced with Office 2007. Because these XML-based formats are immune to the vulnerabilities that afflict the older Office formats, customers suddenly have another reason to migrate to Microsoft’s latest Office version.
I’m still pretty sure that even if OpenXML documents are not vulnerable to old, plain attacks, new attacks are coming our way. The fact that Microsoft Office is used so much means that malware developers and crackers will keep targeting Office and exploiting it. Microsoft Office has proven to have nice, but insecure features, and it doesn’t seem to me like Microsoft is removing them (I’m sure they can’t) or even fixing them. Moving to a different document storage format doesn’t sound like an effective solution to me, but to me it looks like a placebo to fool people into thinking that OpenXML is the solution to all of their pain.
I think the solution is far more easy. Move away from insecure, closed-source software to open standards, open source than can be audited by anyone.
← Microsoft y Extremadura
iTunes Plus: Is DRM dead, finally? →
One thought on “Microsoft Office (In)security, OpenXML and unsafe content”
Pingback: Beats Programming Timbaland Style Javascript Tutorial J2ee
|
cc/2019-30/en_middle_0019.json.gz/line9769
|
__label__cc
| 0.647979
| 0.352021
|
10 Good News Stories to Rebound from Mercury Retrograde
Posted by Arden Fanning Andrews on April 20, 2018 April 20, 2018 in inspiration, lifestyle
Your healthy dose of feel-good current events in pop culture, fashion, travel, science, and everything in between…
And like a toasty breeze, the latest round of carefree weekly updates has arrived, showcasing 10 topical reports cherry-picked to deliver an opportuuunity to chill out and deeply breathe in that soon-to-be-Saturday scent of easy spring times that lie so very directly ahead.
Take the chance to unapologetically recline, perhaps in a petal-soft robe, and lounge with some harmless (yet fascinating) stories selected to give you some clickable, likeable current events that are finally worth sharing with your favorites.
Peruse, ponder, audibly “awww,” lol a little, and enjoy the good news you might have missed:
“I had completely filled a suitcase with pepperoni for my friends,” Nick Burchill told the Fairmont Empress staff of that fateful night he stayed at their hotel in 2001. After leaving a satchel filled to the brim with the pizza topping next to an open window, Burchill went out for a 5-ish hour walk only to return to a suite swarming with seagulls. “There must have been 40 and they had been in my room, eating pepperoni for a long time,” he wrote after witnessing the flock “flying around, the curtains are falling down, the lamps are falling down.” After being banned from the Fairmont Empress for nearly two decades, Burchill returned with an apology and a peace offering in the form of one pound of pepperoni the hotel welcomed him home.
Flipping through his wife’s old pictures to see who looked more like their twin daughters, Mr Ye saw something that gave him “goosebumps all over”: a photo of her taken at the May Fourth Square in Qingdao 11 years before they met and fell in love. In the forefront of the snapshot she sits sweetly in a white dress, while in the background Mr Ye himself poses for another picture being taken at the exact same time. Both sent to the square that day by the guidance of their mothers, the coincidence has all of the makings for a modern Serendipity.
Lose yourself in these extreme slo-mo videos of majestic mid-flight hummingbirds. Filmed inside of a wind tunnel filled with fog while sipping sweet nectar, one tiny fairy beauty may be the first you’ve ever witnessed blinking, but surely the first with noticeably dreamy bedroom eyes. And another, when shown to FP’s most illustrious editor, sparked the response: “THE HUMMINGBIRD SHAKES WATER FROM ITS BODY THE SAME WAY A DOG DOES. Do you really need anything else in life? I dare you to say yes.”
The unofficial footwear of Dolly Parton, Clint Eastwood, and 2000-present Britney Spears is back on the table, with modern adaptations hitting shelves after a wave of Westernwear mania struck the Spring 18 shows. Vogue’s Brooke Bobb showcases the new wave of cowboy boots in all of their city slicker glory, primed to pair with your favorite fancy bolo and embroidered denim pearl snap.
Living up to its reputation as Scotland’s largest, wildest carnivore, a “very angry badger” took over a historic castle last week. Closing the Cellar Tunnel to the public until a proper plan of extraction could be formed, the tourism staff announced in a tweet: “We’re trying to entice it out with cat food & send it home to #chilloot.”
For under $20, you, too, can purchase an all-day pass to Inflatable Island. The unicorn-and-rainbow-sprinkled paradise floats casually off of Subic Bay in the Philippines and covers over 43,000 square feet of water. Even those of us who avoid Instagram traps at all costs can’t help but gaze upon the candy-colored catnip, posing in front of a serene mountain skyline, and wonder…
A new enzyme that feeds on plastic has been accidentally created by a team of international scientists. The mutant bacteria can break down notoriously stubborn PET (polyethylene terephthalate), which typically takes 450 years to naturally degrade, in just a few days. If harnessed safely, the accident could allow us to finally recycle plastic completely, for the first time ever.
In Garage magazine’s “Dogs That Look Like Their Owners — But Make It Fashion” piece, old-school and new-school models unite to make a friendly statement about the industry’s anti-fur debate. Take a spin through photographer Platon’s images and pause at Dree and her Doberman-descended best friend. Two. Of. A. Kind.
Radiating from the constellation Lyra, the Lyrid meteor shower that started on Monday will hit its peak this weekend. With meteors streaking across the sky at random, the light show will be best visible in the hours before dawn this Sunday, April 22nd. Under a clear sky and atop a fluffy blankets, showgoers will be dazzled by tens of meteors per hour during the height of action.
Never not laughing at the storyboard timeline of this cockatiel making its way to a full-bodied chocolate bath.
+ Arden on IG. Do it. And make some good news of your own this week!
TAGS: arden andrews, arden fanning, feel good, good news, good vibes, happiness, mercury retrograde rebound, news roundup, stories with a happy ending
Simper Goods: Soap Gems & Simple Pleasures
Serene Saturday: Finding Courage In Stillness
Really enjoying this week’s stories! Loved that link on the married couple – so sweet! ❤️
Ewa Macherowska
Love this post! :)
alyssa mattison
Was so inspired by this post (& everything on the site / blog, tbh)! Check out my own collection of feel-good stories on my blog, The Fit Nurse:
https://thefitnurse.blog/2018/06/11/monday-mood-5-feel-good-stories-to-start-your-week-right/
|
cc/2019-30/en_middle_0019.json.gz/line9770
|
__label__cc
| 0.5518
| 0.4482
|
Visit a Place
Archives and Research
What Mary did next
Written by: Andrew Burnet
Tue 15 May 2018
On this day 450 years ago Mary Queen of Scots arrived at Dundrennan Abbey on the run and on the brink of collapse…
Join us as we continue to follow in the fateful steps of Mary Queen of Scots. In Andrew’s last blog, we saw Mary escape from Lochleven Castle. Two weeks later, a fresh disaster has driven her to a make or break decision …
A peaceful retreat
If you’ve visited Dundrennan Abbey in Dumfries and Galloway, you’ll have been struck by the awesome scale of the surviving church architecture, the elegance and complexity of the stone-carving, the lush serenity of the setting.
What you may not have noticed is a much-depleted ruin beside the cloister, where the commendator’s house once stood.
The cloisters at Dundrennan Abbey where the commendator’s house once stood.
It may seem a bleak and unwelcoming structure now, but try placing yourself in the battered shoes of Mary Queen of Scots, who was here 450 years ago today, on the run and on the brink of collapse…
Comeback queen
Two weeks ago, your heart bounded with excitement as you were welcomed ashore from Lochleven Castle, your prison for nearly a year. George Douglas had successfully sprung you from his brother’s stronghold.
At last, you were among friends. By the end of the next day, you had arrived safely at Niddry Castle in West Lothian, seat of your loyal ally George, Lord Seton. You were on the way to overthrowing your enemies and recovering your kingdom.
At Niddry Castle Mary was among friends
From Niddry, you rode south-west into Hamilton territory, gaining confidence and followers as you went. The powerful Hamiltons were close relatives, and now declared allegiance to your cause. You spent an exhilarating week in their castles at Hamilton and Craignethan, and by the end of it you had about 6,000 followers: a viable army!
Best man for the job?
One prominent new recruit was Archibald Campbell, 5th Earl of Argyll, a defector from your enemies the Confederate Lords. He was one of the most powerful men in Scotland, and you gave him command of your new army.
You were in a strong position now. Your treacherous half-brother James, Earl of Moray, now governing Scotland as Regent, was caught off-guard. His army was smaller, weaker and less determined.
But you decided to consolidate your position. You headed further west, towards Dumbarton Castle, an impregnable royal fortress where you had spent time as a child, waiting for the right winds to carry you to France.
Mary never reached the strong fortress of Dumbarton Castle.
From Dumbarton, you might summon assistance from the French. You had been their queen, after all. You had grown up with the current king, your brother-in-law Charles IX. And France was a Catholic country, which could be expected to support you, a deposed Catholic queen, against your Protestant usurpers.
Ah, but you never reached Dumbarton.
Langside, bloody Langside
Your route took you close to Langside, just south of Glasgow. And that is where disaster struck, three days ago, on 13 May. Moray’s army had begun to assemble there, and hotheaded Claud Hamilton, Lord Paisley, seized the chance to launch a surprise attack. He led a party of his men into what amounted to an ambush.
If your army had responded quickly and effectively, the day might have been saved. But at this point your fortunes suffered an almost farcical blow. Your new military commander, the Earl of Argyll, suffered a seizure and collapsed, at exactly the moment when you needed his leadership and resolve.
Moray’s army was not slow to take advantage. Within an hour, your army was routed and scattered. Your campaign had fallen apart before your eyes. You fled south, through Hamilton lands into the south-west, where support for you was still strong.
Running scared
Those three days, you lived like an escaped convict. To avoid being recognised, you had your famous russet hair cut short. You rode without stopping, sleeping rough and – as you wrote bitterly in one letter – living on oats and sour milk.
In this way, you made your way to Terregles, near Dumfries, owned your allies the Maxwells. From there you rode nearly 30 miles overnight, south-west to Dundrennan Abbey. Here you were welcomed by the commendator, Edward Maxwell.
Like most commendators, Maxwell did not have a background in the church: your grandfather James IV began appointing people like him in place of abbots in the early 1500s. The post was more administrative than spiritual, mainly relating to an abbey’s considerable financial affairs.
Maxwell’s residence at Dundrennan would have been relatively small but handsomely built and comfortably furnished. After your days on the lam, it seems almost luxurious.
Edward Maxwell’s residence was in the grounds of Dundrennan Abbey.
How long will you stay at Dundrennan, warming your battered toes at Maxwell’s fire and restoring your spirits with a square meal? We don’t know. Possibly you’ll sleep here for one night; perhaps you can only bear to stay put for a few hours, always mindful of your pursuers.
But by now you have decided: you’ll sail for England and throw yourself on the mercy of your cousin, Queen Elizabeth. She has the power to help you: surely she will not deny assistance to a fellow queen – a queen who shares her Tudor blood.
From here, you will ride the short distance to the Solway coast, board a boat and cross to Cumbria, setting foot in England for the first time in your life. What you cannot guess, as you steel yourself for the journey, is that you will never see your homeland again.
Andrew Burnet
Andrew Burnet works in the Interpretation Unit at Historic Environment Scotland and was the main author of Mary Was Here, about the travels of Mary Queen of Scots. His epic poem for children about Picts and Vikings has yet to find a publisher. View all posts by Andrew Burnet
« Scotland from the Sky
Global connections and our collections »
National Fraud Initiative Scotland
Historic Environment Scotland Head offices:
Longmore House
Salisbury Place
EH9 1SH
John Sinclair House
16 Bernard Terrace
EH8 9NX
Visitor app
Our app is your one-stop shop for information on Scotland’s iconic historic attractions.
Historic Environment Scotland is the lead public body established to investigate, care for and promote Scotland’s historic environment.
© Historic Environment Scotland - Scottish Charity No. SC045925
|
cc/2019-30/en_middle_0019.json.gz/line9773
|
__label__wiki
| 0.766308
| 0.766308
|
Email Recipient:
Type what you see in the image:
Jared Mees Takes Gold in Harley-Davidson Flat Track Racing at X Games Minneapolis 2018
Don't Miss Stories on Motorcycle.com
By Press Release July 23, 2018 0
Flat Track is currently the fastest growing sport on two wheels, so much so that it’s even become one of the center focal events at X Games, and all the sport’s top guys are coming out to race. Indian Factory Racing’ Jared Mees took the overall win followed by Briar Bauman and Jake Johnson. The whole event is a one-off exhibition race, but it brings awareness of the sport to homes and viewers nationwide, and we’re pretty excited about that.
Monster Energy:
MINNEAPOLIS, MN – July 23, 2018 – Monster Energy congratulates team rider Jared “Jammer” Mees on winning gold in the Harley-Davidson Flat Track event at X Games Minneapolis 2018 today. In front of a high-energy crowd, the 32-year-old from Clio, Minnesota won his second career gold in a field of 24 elite flat track racers.
The high-octane Flat Track race marked the final motorized event at the world’s premier action sports spectacle – supported by Monster Energy as the official drink sponsor for the fifth consecutive year – at U.S. Bank Stadium in downtown Minneapolis.
For the first time in event history, the Harley-Davidson Flat Track race was brought indoors at U.S. Bank Stadium today. The construction crew had worked all night to transform yesterday’s motocross freestyle course into a flat track at one-eighth of a mile length. The relatively short track with its tight turns presented a challenge to even the most seasoned riders, plus the dry and slick surface punished even the slightest mishaps.
No stranger to tight courses, Mees coasted through the quarter- and semi-final that eliminated a few podium favorites to secure a spot in the final eight. Facing the short and difficult course, the winning strategy was to secure an early lead – and never look back until the finish line. At least that was the theory…
But straight out the starting gate, Mees found himself trailing behind Jeffery Carver Jr., the only racer to beat him on the Flat Track circuit this year. Looking for an inroad to make a pass, Mees finally found one on the fifth lap, when Carver’s mistake created a loophole.
From there, Mees clinched the top position and defended it on his Indian Motorcycle Racing bike until the end, trailed by Briar Bauman on his heels. By the time the field hit the 17th lap, Mees had cemented his lead into over three seconds. When the checkered flag came down, the decorated racer ended the 20-lap race with an impressive 4:00.747 overall time to claim his second career Flat Track gold medal.
“This kind of indoor short track is what I grew up on,” said Mees. My bike was running flawless, I felt really good, and it is awesome to get a gold medal today. This is such a unique race and it is a great honor to keep getting invited back,” continued Mees on winning gold today.
Unfortunately, Mees’ Monster Energy teammate and last year’s bronze medalist Brad “The Bullet” Baker had to pull out of the competition today.
Today’s gold medal brings Mees’ X Games medal count to three (two gold, one silver). Having won silver at last year’s X Games Minneapolis, Mees is a dominant force on the American Flat Track series, where he won nine out of 11 races this season. Married to pro Flat Track racer Nicole Mees, the multiple AMA Pro Flat-Track Grand Champion started racing at the tender age of six and ranges among the most successful athletes in the sport today.
ESPN and ABC will televise a combined 19 hours of live X Games Minneapolis 2018 coverage, reaching more than 500 million homes and viewers in 192 countries and territories. X Games Minneapolis coverage will also be accessible via the ESPN App to viewers who receive their video subscription from an affiliated provider.
Don’t miss out on the action in the Twin Cities. Score all the exclusive updates from X Games Minneapolis 2018 including photos and contest results as they happen visit http://www.monsterenergy.com. Follow Monster Energy on YouTube, Facebook, Instagram & Twitter and watch the official Monster Energy hashtag #unleashedatx on social media.
Indian Clinches Second Consecutive AFT Twins Manufacturer’s Championship
“King Henry” Wiles Goes for Unprecedented 14th Straight Peoria TT Win this Saturday
“King Henry” Wiles Reigns Again at Peoria TT – 14 Consecutive Wins!
2019 Strider Cup Race Cities Announced
Ride to the VBR in Fresh Cotton Riding Shorts
Exciting Video from Peoria TT Flat Track Races
Get Motorcycle.com in your Inbox
|
cc/2019-30/en_middle_0019.json.gz/line9779
|
__label__wiki
| 0.941945
| 0.941945
|
Raoul Björkenheim
Finnish guitar-wriggler Raoul Björkenheim is a man who likes to stay busy. Over the course of a career spanning two continents (he was born and raised in the U.S., decamped to Finland for thirty years, and moved to New York in 2001) and four decades, his restless imagination has led him in some very unexpected directions. As might be expected from his cross-Atlantic wanderings, he’s picked up Janus-faced influences that guide his own music: he’s firmly grounded in the European avant-garde that developed in the 1970s, but his work also displays liberal doses of American free jazz of the Ornette Coleman variety as well as slices of the Chicago style, and lately he’s formed kinship ties with the New York improvised music scene via an association with the likes of William Parker and Hamid Drake. Combine this with a love of fiery blues-tinged rock guitar and you’ve got a player whose catalogue reads like the work of a man who’s never quite satisfied.
The irritatingly stylized eCsTaSy is the name of both his latest quartet and their new album. (Buy it from Amazon.) After a number of years with the appropriately named Scorch Trio, which features some of Björkenheim’s most raucous and daring guitar work, he’s back on the Cuneiform label (where he last featured with Blixt, alongside bassist Bill Laswell and drummer Morgen Ågren), and this time he’s in the company of multifarious sax man Pauli Lyytinin and the rhythm section of bassist Jori Huhtala, a young player he met at the Sibelius Academy, and veteran drummer (and former sideman of Lee Konitz and Kenny Wheeler) Markku Ounaskari. All three are improv veterans at home and abroad, and seem well-equipped to keep up with an imagination as darting as that of their boss.
The album starts off with “Un Pueblo Unido,” a surprising number that finds Lyytinin creating a wall of unified sax sound behind which Björkenheim’s guitar peeks out at opportune moments to riff solidly along a spine of calculated feedback. Ounaskari and Huhtala (who sounds a bit muted at times before pushing to the fore about halfway through the song) provide a busy background, but the track manages, in its early and later passages, to sound like nothing so much as Frank Zappa in some of his jazzier moments from the early 1970s. While it’s less playful and more uplifting, particularly as it soars to a surprisingly emotional close, it still recalls Zappa’s affinity for straddling the edge of rock and jazz forms.
“SOS,” the next track, is considerably harder and stranger, and altogether the work of the Björkenheim heard with the Scorch Trio. The rhythm section tightens up considerably, providing rock-solid stabs and stomps as Lyytinin plays blasting stings and blistering jabs that could be the sounds of a fistfight in a particularly nasty and low-budget boxing movie. Björkenheim gives Lyytinin the spotlight here, contenting himself to shoot bracing waves of slightly off-kilter chords and matching the horn in the moments where they’ll do the most good. It’s a terrific track, reminiscent of some of his best material but entirely original and never less than compelling.
The appropriately titled “Deeper” starts out all eerie ambience, chilly snake-in-the-grass drum riffs and quirky distorted noise from the guitar and sax creating an almost minimalist drone. The most subdued and creeping track on the album, it insinuates and never explodes. “No Delay” follows, a return to Euro-style adventurousness with Björkenheim’s guitar cleanly skittering around Huhtala’s wandering bass and letting the sax wander off in its own directions before jumping to the front for a feverish workout. It’s the most explicitly free-sounding track on eCsTaSy, unrestrained but not quite over the edge.
“Through the Looking Glass” is the album’s weirdest joint, a goofily experimental bit of guitar/sax insanity that finds Björkenheim fiddling around with heavily treated guitar that sounds like it should be some galactic invader’s evil henchman. This segues quickly enough into the entirely different “As Luck Would Have It,” which begins as a showpiece for Huhtala’s acoustic bass skills and then develops into a hard-hitting and funky exercise that’s one of the album’s nastiest and most skillfully delivered compositions.
The least Latin thing imaginable, “Subterranean Samba’ features Ounaskari holding down a skiffling beat while Björkenheim’s guitar and Huhtala’s menacing bass get filtered through some monster effect that keeps the whole thing on edge while Lyytinin’s sax floats over the proceedings like a warning bird. “Threshold” brings everything back down to earth, with the disjointed guitar providing a dissonant background to Lyytinin in a downright smoky mood; it’s almost torchy to start, before the group inescapably leads it down an avant-garde path and then steers it right back to jazz at the last moment.
“The Sky is Ruby” closes out eCsTaSy, and it’s the longest track at around six and a half minutes. It’s no coincidence that its big sound and clever guitar-sax echoing draw the listener in early on, because the whole thing leads up to Björkenheim’s most ferocious soloing of the album. It’s a powerful closer to a set of songs that’s unpredictable at every turn.
Eclectic and rambling, but never quite to a fault, eCsTaSy likewise avoids the trap of overstaying its welcome; most of these tracks are under five minutes, and would likely lose their focus and intensity if allowed to blunder into suite-length pieces. Björkenheim shows admirable control, only letting loose when the occasion dictates, and a keen eye for properly utilizing the talent he’s assembled. There are only rare moments when Lyytinin, Huhtala or Ounaskari sound like they’re not being used to the fullest in the context of the song. Now in his 50s and facing down a past that had him fronting incendiary groups like Scorch Trio and Krakatau and re-interpreting Miles Davis’ electric period, Raoul Björkenheim seems just as energized as ever.
Stream “El Pueblo Unido”:
Buy eCsTaSy from Amazon
Posted in Features
blixt
hamid drake
jori huhtala
kenny wheeler
lee konitz
markku ounaskari
morgen agren
pauli lyytinin
scorch trio
william parker
Previous Post Interview: Sarah Manning
Next Post Arthur Doyle 1944-2014
One Comment on “Raoul Björkenheim”
Pingback: Eero Koivistoinen | burning ambulance
|
cc/2019-30/en_middle_0019.json.gz/line9781
|
__label__wiki
| 0.87374
| 0.87374
|
Home ecomonists Wall Street Faces More Tumult If China Is Labeled an FX Manipulator
Robert Rosenkranz of Delphi Financial warns agains labeling China a currency manipulator.
Wall Street Faces More Tumult If China Is Labeled an FX Manipulator
Wall Street is bracing for the prospect that the U.S. uses this month’s semiannual foreign-exchange report to label China a currency manipulator, escalating the trade standoff between the two nations at a time when rising bond yields are already denting riskier assets.
The scenario is viewed as possible — though not probable — given the yuan has tumbled more than 9 percent against the dollar over the past six months, raising speculation that China has been deliberately weakening the currency. The Trump administration is concerned about the yuan’s depreciation, according to a senior Treasury official who spoke Monday on the condition of anonymity, and U.S. Treasury Secretary Steven Mnuchin is facing pressure from the White House to formally impose the designation on China for the first time since 1994.
Such a decision would likely unleash fresh turmoil in global markets just as a surge in Treasury yields has helped spur the biggest selloff in U.S. stocks since February. The strife is compounding weakness in the yuan, with bets mounting that 7 per dollar is around the corner, a level unseen since the financial crisis. With trade relations between Washington and Beijing souring, investors would be remiss to ignore the risks, according to Goldman Sachs Group Inc.
“There’s a higher risk that the Treasury uses the report to reflect its broader trade goals,” said Zach Pandl, co-head of global FX strategy at the New York-based bank. Such an outcome is not his base case, he said. “Markets would interpret it as a further escalation of the bilateral trade dispute, and for the FX market, that has so far been interpreted as a new source of downside risk to global growth.”
Such a move by the Treasury would hit Australia’s dollar particularly hard, given the nation’s close ties to the Chinese economy, according to Pandl. The Aussie has slid more than 9 percent against the greenback in 2018, and is currently trading near its weakest level since early 2016.
Goldman is far from alone sounding the alarm. Ahead of the Treasury’s decision, Citigroup Inc. recommends protecting against further Australian-dollar weakness against the yen, which often strengthens amid acute market stress.
While China doesn’t meet the three official criteria the U.S. currently uses to judge whether a country is a currency manipulator, the Treasury could change the threshold, according to Todd Elmer, Citigroup’s head of Group-of-10 foreign-exchange strategy for Europe, the Middle East and Africa. In August, President Donald Trump said the U.S. was studying its currency manipulation formula.
“There is probably a 50-50 chance that the U.S. will go so far as to outright name China a ‘manipulator’,” Elmer wrote in a report Wednesday. “There is nothing to stop officials from either reverting to earlier criteria, which provide room for more discretion, or introducing new language entirely.”
A formal designation carries no immediate consequences, but the administration may use the label as justification for a fresh round of tariffs, Elmer wrote.
Obvious Tool
A Treasury spokesperson didn’t immediately respond to requests for comment.
The impact of such a designation could reach beyond markets as well. Given China’s relatively modest current-account surplus and lack of intervention in FX markets, there is no basis to name the country a manipulator, according to former U.S. Treasury official Mark Sobel. Doing so could further sour ongoing U.S-China negotiations, he cautioned.
“Lacking merit, it would undermine the longstanding integrity and rigor of the FX report,” said Sobel, U.S. chairman of the Official Monetary and Financial Institutions Forum. “Furthermore, it could very well complicate Secretary Mnuchin’s welcome and laudable efforts to maintain a dialog with senior Chinese leadership.”
While the Treasury has refrained from labeling the Asian nation a manipulator three times under Trump, the U.S.-China trade relationship has deteriorated since the report’s last release in April. The U.S. imposed tariffs of 10 percent on $200 billion of Chinese goods last month, with a promise to increase the levy near year-end. Beijing retaliated, imposing duties on $60 billion of U.S. imports.
“Tensions between the U.S. and China have gone up and you’ve seen Trump utilize other avenues in this ongoing escalation, so I think the use of this as a tool seems obvious,” said Daniel Hui, an analyst at JPMorgan Chase & Co. “Given where we are now in this relationship, I don’t think it’s controversial to say there’s a higher probability that he’ll take this step, this time.”
By Katherine Greifeld
— With assistance by Liz McCormick, and Saleha Mohsin
Chinese currency
Previous articleIn New Slap at China, U.S. Expands Power to Block Foreign Investments
Next articleU.S. Warns China on Weakening Currency as Trade Relations Worsen
China is choosing a different approach to stimulus — is the world ready?
China is blocking World Bank report that calls for state-owned enterprise reform
China to Davos: Stop freaking out about our economy
China’s HNA continues buying spree, purchases 17% stake in Swiss duty-free operator Dufry
Chinese conglomerate HNA ‘will be a good owner’ of UDC after the planned $660...
Chinese Conglomerate HNA Got Ultra-flashy Private Jet
Wanda’s deal for Golden Globe firm collapses
|
cc/2019-30/en_middle_0019.json.gz/line9782
|
__label__cc
| 0.719788
| 0.280212
|
If you like ass, then this model I’m reviewing today is right up your alley! Liliith Carter is her name and she’s absolutely stunning (with a big booty to boot). With close for 9,000 followers on Camsoda.com, there’s no reason why you wouldn’t want to check her out. I’m telling you, you’re going to love her if you’re an ass man.
Big Booty Ass Play w/ Liliith Carter
Liliith Carter is many things, but chief among them is an ass girl. It’s not that she dislikes other body parts, she just loves asses the most. When she sees a hot girl, all she can do is stare at her butt. It’s touching it and kissing it that she thinks about when she goes home to touch herself. She just can’t help herself.
Of course, that also means that she loves to show off her own ass. She wants you to love her ass just as much as she loves the asses on other girls. It’s just her fetish and there’s nothing at all wrong with it. Her hair is black and her eyes are a super sexy brown and perfect I might add. Her body is a perfect hourglass and she knows just how to touch it to make it feel good. Her tits are perfectly small at a 36 A cup and always ready to be sucked on.
Her Ass Is Always Being Used
Her love of asses doesn’t end at the outside. She also really loves to have her taboo hole played with by anyone who loves anal. She’ll shove anything up there that she can. It doesn’t matter how big it is. She’s going to try to make it all fit. It’s one of her favorite things to do. If she’s not actively fucking her own ass, then she’s wearing a thick butt plug.
Liliith always wants to feel like its being stretched out. It makes her feel sexy and ready to accept any man inside of it. She’s had a few times when it was just too tight to get a dick inside. She never wants that to happen again. If someone loves her ass enough to fuck it, then she wants it to happen over and over again for them.
She Can Also Squirt
That’s not to say that her pussy doesn’t get any attention. In fact, she’s taught it how to squirt every single time she plays with it. It’s never question of whether or not it will happen. It’s just a question of how many times she wants to do it.
If she had her way, she’d be making herself squirt all day and night long. It feels amazing and she loves covering her entire room in her own essences. It’s just a way to make sure that a part of her will always be there, no matter what happens.
Conclusion: Check Out The Ass On Liliith Carter Today
Liliith Carter is in her room and just waiting to hear how sexy and perfect her ass is. You need to get in there right now and tell her. She won’t do anything until she hears that it makes you hard just to stare at it. She needs to know that you want to shove your dick into it because you love it so much. Don’t let the opportunity pass you by. Head in right now and see what a perfect ass can do for you.
If you’re interested in checking out Liliith Carter then you can do so right here – visit her profile.
Models anal, big ass, booty, lovely
BBW Real Diamond Doll Nude On Cam
Who’s up for some serious big ass fun? Well, that’s exactly what you’re going to get when you opt for the real diamond doll on the one and only Camsoda.com. As far as I know, this is the only cam site that @realdiamonddoll performs on and if you’re looking for big booty hoes then she’s the one for you. Here’s what you need to know about this hottie. For starters, I’ve been on a huge kick tracking down BBW models for the last week or so.
At any rate, here’s what you need to know about this big girl and why her ass is fantastic.
My Review Of BBW Model Real Diamond Doll
Here’s what I learned after jerking off to this big beautiful woman for more than a week.
When a pretty face, curvy as hell BBW goddess is what you want, you don’t have to look any further than real diamond doll! She is just one of those girls who you can never get enough of. She has an insatiable appetite for sex and there’s nothing she loves more than to be watched and worshipped by adoring fans.
She’s a curvy bombshell that knows how to get you harder than ever until you’re ready to burst! She loves shaking her fat ass for the camera and provides a variety of non-fully nude ass worship videos. You can catch her bending over, doing sexy walk away videos, and having her ass oiled up by a big booty friend (Ms. Alottabootie)!
She’s Amazing!
Diamond doll is such an amazing performer because she has a genuine bond with her fans and she is sexy as fuck while also being relatable! She has a great presence and infectious personality, and is known to chat a lot with her fans! She often brings other big booty girls on cam with her and does strip down quite a bit for a girl who does not do nudes.
You can still see her play with her pussy and even stick a Hitachi in, but diamond loves to be a tease and that’s what her fans come for!
Stripper Pole + Ass Jiggles = Winning
They know they can watch her play with her nipples or grind up and down a stripper pole, all while getting to watch that huge ass shake and jiggle. She knows what her fans like, and she makes sure to spread her cheeks when she’s in a doggy style position so you can see the outline of her pretty asshole.
She loves to play with her tits in the shower, but nothing gets her wet like clapping her ass inside a bubble bath. When you see that big booty all wet and glistening, you’ll instantly understand why she has such a loyal fan base.
Curves, Curves, Curves
This girl has curves for days, with an ass you just want to stuff your face inside of. Dynamite bitches like her are not everywhere in the cam world, and they don’t always have incredible shows like her, so don’t waste your time with little booty girls who don’t even know how to twerk!
Diamond is a mocha-skinned BBW beauty that you won’t soon forget after you lay your eyes on her. She’s seductive, playful, and eager to make new fans, so she’s great for people trying to get into the cam world who love bigger girls.
Conclusion: Real Diamond Doll Is The Bomb
If you’re truly into the big girls and huge asses, then a nude diamond doll show is all that you need. I’m dead serious, that’s literally all that you need. Give her a try exclusively on Camsoda.com. You’ll be glad that you did, trust me on this one. See more of her here.
Models bbw, big ass, huge ass, monster booty
Allison Parker The Cam Model With A Perfect Ass
Allison Parker, my, oh my, perhaps the sweetest looking ass I’ve ever laid eyes on. No, but seriously, it’s absolutely delightful and it moves me to the core! There is absolutely no denying that she’s got an ass that will not quit and a perfect pussy too! She’s a top cam model in my eyes and one that I’ve been spending way too much time with if you think that’s even possible.
Find out everything that I know about this delicious webcam model and why you need her in your life – STAT!
My Review Of Allison Parker – She’s Fantastic To Fap All Over!
Allison is a dark-haired beauty that combines charm with an over eagerness for sex! She’s down for anything and always open to exploring, and her mesmerizing scenes makes her a worthy watch every time!
She has been able to amass all types of fans because she spends time connecting with her audience, and she proves over and over again that she’s the perfect little slut of your dreams! Featuring a slim frame and a perky set of tits, Allison will be sure to have you coming back for more when you get a load of her getting down and dirty.
Love Her Solo Shows
Allison Parker has always provided an excellent solo show experience and many of her fans first come to her this way. She’s an intimate and expressive performer who loves to show it all to the camera. Whether she’s using her fingers or an array of toys, Allison cums hard every time, and you get a front row seat! She loves to rub her clit as she pinches her nipples, and she always tells you when she’s close to catching that nut so you can join in on the fun!
She regularly utilizes a Hitachi, which allows you to truly become part of the sexual experience through the tipping system! Allison Parker is always incredibly appreciative of her fans and is eager to please. There’s nothing she loves more than to bend over doggy style so the cam can get an up-close shot of her cumming again and again!
She Loves Girls
Her solo shows are just the tip of the iceberg as Allison truly is a full-service freak. She loves girl on girl action, and she routinely features other hot girls in her performances, where they spend time licking and fingering each other until they both orgasm. Allison is great at being dominant or surrendering control, and this leads to her always having natural and fun scenes that are a joy to watch.
She loves to eat pussy, and nothing makes her wetter than having a throbbing clit in between her lips! Allison shows the boys some love too, as you can catch her deep throating a cock like a champ when she needs a break from the box! She loves to be throat fucked, choked, and have her hair pulled as she gags on a big dick, and her fans love the look on her face every time she swallows a load!
Perfect Pussy To Pound!
Allison is a great girl to follow because she switches up her content, is often on cam, and approaches every show with enthusiasm and nastiness! She loves fucking girls just as much as she does guys, and her passion for sex shines through every time she performs. You’d be hard pressed to find such a down to earth girl who still manages to be a nasty little whore, but Allison is the best of both worlds and she never disappoints!
Conclusion: I Love Her, End Of Story
There’s not much more to be said other than the fact that I absolutely love this girl to no end. I’ve seen her cum dozens of times on webcam and it never gets old. You won’t understand until you jump the gun and do the right thing with her, by that I mean get her live on webcam naked! Check out her profile – click here!
Models amazing, big ass, booty, perfect ten, top 10
Ms. Alottabootie Has The Biggest Ass Ever
Who likes big asses besides me? Anyone at all? You might be a little confused here and before I get down and dirty, I want to let you know that both Ms. Alottabootie and Melyssa Milan are the same girl. She operates under different aliases depending on what she’s doing and when. What I can tell you is that regardless of what she’s doing, she’s amazing! Here’s the story behind this model and everything you need to know about her.
Ms.Alottabootie And Why You Need Her In Your Cam Life
There are big booty girls, and then there’s Ms. Alotta Bootie! A premiere model in the big booty genre, Ms. Alotta Bootie has garnered a loyal fan base because of her infectious personality and incredible assets!
Hailing from Philly, this down to earth girl has a fifty-inch ass that’s just made to smother your face. She loves to strip down and twerk for the camera, and there’s no better twerk show than when sexy Alotta Bootie bends over and busts it open!
Trust me on this one. I’ve seen it more times than you can even imagine. You will not be disappointed, my friend!
No Dildos, No Problem!
Though she does not perform with sex toys, she has such an engaged fan base because she’s so accessible and easy to talk to. If you want to build a relationship with her, all you have to do is be an avid fan and supporter and it will guarantee you get personal time and affection from this chocolate goddess. She has a body type that is coveted all over the world, and it’s one hundred percent natural!
This girl doesn’t need any surgery or ass shots to deliver her earth-shaking booty drops, and you know if it doesn’t jiggle it’s not the real thing. Ms. Alotta Bootie has got the jiggles for days.
Twerk City Baby
She provides content for true big ass lovers and twerking connoisseurs, and you can watch her in a variety of walk away, bouncing, and twerking vids. She loves to do full splits and spread her huge cheeks so you can get the best view of her goodies!
She will provide you with a dazzling ass performance that people usually have to go to the strip club and pay top dollar for, and you can enjoy it all on your own time and in your personal space.
Conclusion: Ms. Alottabootie Is Delightful, Trust Me!
It’s rare to find a girl who is as stacked as she is but still remains grounded, and that combination is what makes her so intoxicating. Her charm and wit is only outmatched by the size of that ass! Her 34D tits are a perfect combination that gives her that hourglass figure that you can worship for days on end.
Once you see her content you will keep coming back for more! Don’t waste your time with those little booty babes who can’t twerk worth a damn. Go with a true full booty bad bitch and experience the real thing!
If you’re still on the hunt for more big ass babes, then you need to check out these cam girls:
Austyn Monroe
Models 34D tits, big ass, black girl, booty
Ebony Babe PrettyAngelEyez On Webcam Live!
If there’s one thing that gets me going it’s beautiful eyes (like the ones that Jenna Sativa has). Not all cam models have eyes that rope you in and get you into the money spending zone. However, some of them do, like PrettyAngelEyez. I know, you’re probably wondering who and what I’m talking about. Well, I’ll be the first to tell you all about this new cam model and why you might consider chatting it up with her.
I had no idea who she was when I first saw her, so I started doing searches online for her. The topics I was searching for were things like “prettyangeleyez naked” and “angel eyez on cam,” which eventually drove me to want to pay to play with her on webcam. Now I’m here to share everything I learned about her and my experience as well!
@PrettyAngelEyez – The Best Eyes On Webcam
Pretty Angel Eyez is one of those girls who you can never get enough of. She has an insatiable appetite for sex and there’s nothing she loves more than to be watched and worshipped by adoring fans. She’s a curvy bombshell that knows how to get you rock hard until you’re ready to burst!
Big Booty, Yes Please!
She loves shaking her fat ass for the camera while playing with her pussy, and you will fall in love with her when you see the faces she makes when she busts a nut! There’s nothing she loves more than playing with her toys for your viewing pleasure, and whether it’s a dildo or a vibrator, Pretty Angel Eyez will take it in any hole until she creams all over herself!
Ebony Skin To Die For
This brown skin baddie is a sex maniac, but nothing turns her on quite like fucking herself. She’s consistently in front of the cam making herself come for anyone who wants to watch, and you haven’t seen a real show until you watch Angel Eyez flip that fat ass around and come all over her dildo!
Whether she’s finger fucking herself in the shower or spreading herself wide in a missionary position on a bed, you will always get the perfect view of her for your cumming pleasure! She loves to spank her clit with her dildo just after she comes, and multiple orgasms are always her goal!
She’s more than just a hot body, as her sensual personality and a great sense of humor have made her a long time fan favorite. The best part of her shows is that she makes everyone feel comfortable and always delivers the intimacy of a private performance to the masses!
Close To 40k Fans
Angel Eyez is such an amazing performer because she has a genuine bond with her fans and is sexy as fuck while also being relatable! Best of all, she loves to use interactive toys with her shows, which lets you have a personal connection with her as she works her way to orgasm!
She loves it when she gets a bunch of tips at once that send her into a vibrating frenzy! I know for a fact that PrettyAngelEyez loves to be dominated and controlled sexually, and with her cam show, her audience has the ability to do just that! She’s such an obedient little slut, and you’ll be amazed at the mess she makes every time she cums for you!
Conclusion: Worth The Time And Money!
If you want to see a bad bitch really get nasty, there’s no better girl that Angel Eyez. She has a perfect pair of tits and a huge round ass that you’re just gonna want to stick your face inside of! Her pretty pink pussy gets wet at the sound of tips, and she will be your little slut because it turns her on!
Dynamite bitches like her are not everywhere in the cam world and they don’t always have incredible shows like her, so don’t waste your time with those other lazy girls who won’t bust it open for you on command! Trust a real nasty slut for your sexual pleasure and join Angel Eyez at her next show!
If you want to take a peek into what she has to offer, then give this a click here!
Models big ass, black girl, ebony, love her, perfect
Alexis Texas Live On Webcam
You know what they say, everything is bigger in Texas! Well, that holds true given the assets that Alexis Texas has to share with the world. This blonde bombshell has the biggest and best booty on the planet. Her ass and pussy are famous AF. If you don’t believe me, just do a quick search on the Internet and you’ll soon realize that she’s uber famous. You’ll find millions of search results which showcase her ass bouncing up and down on some dick. Now, the real bread and butter here is seeing her live in action on webcam. If you haven’t had the chance to spend time with Alexis Texas on cam then you’re not living life to the fullest. Trust me on that! Here’s everything I know about Alexis Texas and why you should think about paying her to do an exclusive cam session with you.
My Experience Chatting With Alexis Texas
Before I get started, I just want to say that I ended up spending time with Alexis at Déjà vu in Nashville when she was dancing their one year. She’s perfect and you’ll quickly understand why…
Alexis Texas is a tight blonde who can make all of your dreams come true on her cam. There’s very little that she won’t do, as long as it ends in an orgasm. She knows her body inside and out and is never shy about making it feel good in front of an audience.
In fact, the things that she does to herself always feel better when someone’s watching her. That’s why she got into camming in the first place. When it comes to making herself cum, she always wants it to be as intense as she can possibly make it.
Twerk, Twerk, Twerk, Twerk, and More Twerking!
If you catch her in the right mood, you might just be able to see her twerk her ass all over her vibrator. It’s one of her favorite things to do and she always has a smile on her face. Seeing her perfect ass bouncing up and down is something that tends to stay on the mind for weeks afterward. It has just the right amount of cushion and can hypnotize within a few seconds.
The fact that she’s also getting herself closer and closer to an orgasm just makes it even better. By the time she cums, every single person in her room is always going to be satisfied.
Perfect Masturbation Sessions
The simple fact of the matter is that she’s a girl who loves to touch herself. Even when she’s not on her cam, she’s usually locked away in her bedroom. It’s all that she can do not to constantly masturbate right out in public. It’s her passion and she never lets an opportunity to enjoy it pass her by. One look at the way she uses her toys is more than enough to see that she’s an expert. She knows exactly where they’re supposed to go and how they’re supposed to feel.
Fetish Fun
Her body is always hot and she loves having it on display. Even more so, she loves getting fucked six ways to Sunday. There’s no telling how much of it she’s going to have exposed at any moment. She loves to be naked, but she also loves to wear her sexy fetish gear.
If it’s leather and looks hot, then she wants it on her body. It’s never a problem, though. It’s only a matter of time before she gets herself completely naked. That’s when you can take in her perfectly shaped tits and her tight little body. She keeps it nice because she wants you to be staring at it. It makes her feel sexy.
Conclusion: Alexis Texas Is Worth Camming With!
There are plenty of girls on cam, but Alexis Texas is one of the best and that’s all there really is to it. Her body is hot and her blonde hair means that she’s always going to be having fun. There are never any limits when it comes to making herself cum. She can play her pussy like an instrument and get exactly what she wants out of it. If you really enjoy seeing orgasms, then she’s the girl for you. Check her out and see how long it takes her orgasm.
Want to chat with Alexis Texas? Great, then do so now by getting started here.
Want more booty? Then read this review on Julie Cash today!
Models Alexis Texas, big ass, blonde, porn star
Busty Big Booty Austyn Monroe Live On Webcam
I have a confession to make, I absolutely love huge tits. I’m talking triple Ds baby! Guess who packs that mean punch? The sexy Austyn Monroe and she’s damn near perfect. Seriously, the most perfect cam girl that I’ve ever seen even. She’s got big tits, booty, brains, and more! Find out why I love her so damn much…
Busty and Booty: Austyn Monroe Cam Girl Review
Austyn Monroe is a traveling girl from Texas who never passes up an opportunity for fun. She’s never above flying across the country for a good time and there’s nothing wrong with that. There’s just way too much sex to be had to ever stop seeking it out.
As long as there are willing men and women in the area, she can spend as much time as she wants with them, camming whenever she feels it. Naturally, these friends are never shy about joining in on these shows. It’s all just more fun and pleasure when there are hundreds of eyes on the fun.
She has blonde hair and blue eyes that make her look a lot more innocent than she really is. It’s kind of a shame, too. There are so many people out there who would proposition her if they knew what she was really like.
Maybe that’s why she spends so much time on her cam. The more people who know how dirty she really is, the more chance she’ll have to show them in person. There’s never any sense in letting a good time pass you by if there’s anything at all that you can do about it.
Best Body Ever!
Her body is slim thick and always up for a good time. She’s got plenty of toys to make sure that it’s always having a good time No matter how you want her to make herself feel good, she’s always able to do it.
For a 23-year-old, she’s already more than an expert at getting herself off. If practice makes perfect, then she is the pinnacle of perfection. She even makes sure to practice when she’s not on her cam. As long as she has the time, she’s going to be playing with herself and she makes no excuses for it.
She’s also no stranger to having sex with couples. That’s something that makes her very special. You can always see her with a man and woman who really like to have naughty fun. Sometimes they share the cock and sometimes they share the pussy, but they always make sure to cum together.
She knows herself so well that she can always figure out another girl. It’s some of the most fun that she can have when she gets on her cam. As soon as it turns on, she’s all about making the other people feel just as good as she does.
Conclusion: Austyn Monroe is a badass big titted babe!
Austyn Monroe is one of the hottest cam girls around. There’s no way that she’s ever going to fail to show you a good time. It’s what she does. She knows her body and she loves to share it with people.
No matter how many people are in the room with her, she always wants more people watching them. It adds a whole new level of excitement to what they’re doing. She’s always just a click away and she’ll be more than happy to take you on a tour of her body to show herself off.
Now, if you like big tits and big booty girls, then you’ll be glad to find out that there are a ton of other girls out there with assets like Austyn Monroe. Take, for example, busty Jenna Shea, she’s an absolute dime piece and you’d be a fool not to try and chat it up with her.
Ready to take that big booty and perfect tits down? Send her a message by clicking here and get things started!
Models Austyn Monroe, big ass, big tits, blonde, perfect
Julie Cash Confesses To Loving Big Dick And Booty Worshipping
We love all porn stars, but when it comes to girls with a big booty, Julie Cash immediately comes to mind. No doubt about it, we love her and that big ass she’s sporting. We had a chance to interview her in the latest Camsoda Confessional. Here’s what she had to share with us. Trust me, you’ll want to watch the video below. She’s beyond perfect and if you like asses, then she’s the one you need to chat with!
Before getting started, I can tell you that she’s been in active on just about every social media platform out there. For example, you’ll find her posting on Instagram, Twitter, YouTube, Facebook and more. She’s 28 years old and measures up as 36D-30-48. Yes, her body is banging and unless you hate big tits and a big ass, then you’ll love what she’s got to offer. As far as porn videos are concerned, she’s shot with lots of people like Brazzers, Reality Kings, MOFOS and more. Check out the video below to learn everything about her!
Julie Cash Shares Her Love For Big Dick And Booty Clapping
The infamous Julie Cash has been in porn since 2010. She took a break for 2.5 years, and then eventually got back into it. Julie just wasn’t ready to give up doing porn. She wanted to leave a bigger mark in the industry and the only way to do that was to get right back on the horse and start shooting porn again. She didn’t want to quit and then come back when she’s 40 years old.
As you know, when you get older, it gets much tougher to shoot. That’s just the nature of it and she knows that if she wants to make a big splash in the the adult industry, now’s the time to do so! Get it while the getting is good!
She’s done LOTS of porn.
Favorite Type Of Porn
We had to ask Julie Cash what her favorite type of porn is to shoot. Believe it or not, she’s not into anything too freaky. Her favorite type of porn to shoot is booty porn. You know, that ass worshipping type stuff. She doesn’t like crazy rough stuff. Instead, she’s all about booty rubs, sensual sex scenes and things of that nature. Julie also loves giving nice sloppy blowjobs to guys.
Favorite Sex Position Shooting Porn
For her fans, she’s only about that doggy style, but camera wise, she likes to shoot using reverse cowgirl too. Since her booty is the main attraction, she likes to show it off like crazy. She loves seeing her own booty bounce up and down.
She loves being openly sexual and loves pleasing guys each and every time she’s fucking. It’s all about the mental aspect of it and she’s extremely comfortable shooting scenes with the guys because she is so close with them.
She loves the entire porn scene – seriously.
Favorite Porn Scene
We got to discussing various porn scenes with Julie Cash, trying to determine which of those that she’s done are her favorite. Based on what we know, her favorite porn scenes that she’s shot are the Million Dollar Booty scene and one that she shot with Reality Kings. It was a sensual and sexy scene that she absolutely loved filming. The male talent loved it just as much as she did.
Passionate Sex vs BDSM
Julie Cash actually does a lot of dom and fetish work with. For the most part, she plays the dominant role on camera more than the submissive role. However, in her personal life she likes to play the submissive role for the most part.
She doesn’t like getting slapped or spanked. So don’t try that or she’ll be turned off for sure.
In fact, she doesn’t really have much of a personal sex life (according to her) and it’s not because she doesn’t like sex. In fact, it’s because she has so much sex while working and the fact that she’s always working, she doesn’t have time to fuck while off camera.
Ideal Dick Size
We always ask what the ideal dick size is for each cam girl we interview. Julie Cash admitted to wanting nine to ten inches of rock hard dick to satisfy her. Anything too big isn’t going to do it for her. There is such thing as a dick being crazy big.
Anal / Oral / Vag
We asked Julie Cash whether she preferred anal sex, oral sex or just straight vaginal sex. She said that she really likes giving oral but isn’t into receiving it. She doesn’t do anal, so that’s out of the question, sorry guys. Her booty is big and beautiful but her butt hole is very tiny and it’s not gonna happen folks.
We hit Julie with the tiny orgasms all the time vs one big orgasm and she had a lot to say about it. She decided to opt for the tiny orgasms all day long. She’s big on masturbating and loves doing it all the time. That Hitachi Magic Wand has seen a lot, that’s for sure! There are lots of porn stars that love this toy, like this one here.
Girl/Girl vs Boy/Girl
Julie mentioned to us that she’s a huge fan of doing Girl/Girl/Boy scenes. She isn’t a big fan of doing just Girl/Girl because she doesn’t really know what to do. It’s complicated and tough to shoot. She wants dick in there, period.
Ultimate Fantasy
Julie Cash doesn’t have any fantasy that she hasn’t fulfilled. She’s all about being a woman in a man’s world and she hasn’t done a gang bang or a double penetration scene as of yet so one of those things might be something she wants to do.
She’s shooting porn like crazy these days and has recently done some scenes for RK. Julie has her own website as well called MyJulieCash.com. However, the best place to see her is none other than Camsoda.com. She is always online and ready to chat one on one with her fans. My suggestion would be to check out her profile page. You’ll be glad that you did, trust me!
Models ass worshipping, big ass, blonde, booty, fat ass
Kakey XXX Does It All Live On Webcam! (My Personal Review)
Are you into connecting with busty black girls? If so, then there’s a good chance that you’re going to adore Kakey XXX. She’s my latest and greatest when it comes to cam girls. I’ve been on quite a kick lately with these black hotties. I don’t know what it is that makes me yearn for them, no lie.
At any rate, I can tell you that I’ve once again fallen in love with a webcam model. In fact, it seems like every single day I’m falling in love with some new girl that I discover. Hell no I’m not complaining! I’m just thinking out loud right now. Enough about that though, let’s get down to business. Time for me to share the good stuff that I experienced while chatting with Kakeyxxx.
My Adventure Chatting With Kakey XXX
So, like I said, I am completely obsessed with Kakey XXX and for a ton of reasons. Let me share the back story on how I discovered this girl. Last Thursday I hit the bar with a group of work friends after a long day at the office. We ended up at a local bar and I pounded down four beers and three shots. Now, since I’m not much of a heavy drinker, that was quite a bit of alcohol for me. At any rate, I found myself home alone on my laptop browsing through Camsoda.com late night. Kakey popped up as being live in the second or third refresh of the site.
I was instantly turned on when I saw her making this big dildo disappear while her huge cans were bouncing up and down. I thought to myself, if this is the feeling that I get just seeing her at first glance, the cam show must be amazing.
IT WAS!
I ended up on Kakeyxxx’s profile page and soon found myself taking her into a one on one chat session. At that point, I had this mixed babe all to myself. See what I quickly found out was that her talents stretch far beyond my imagination.
Kakey did everything I requested and then some. I’m not too picky but I do often request a ton of dirty talk and big dildos. Well, she was able to supply and in a big way!
After spending about 15 minutes with her on cam in a chat session I got off and minutes later found myself wanting more. Instead of taking her into a private chat again, I went for the videos that she’s recorded. Unlocking the clip of her sucking a big black cock was all I needed to cum once again. Kakeyxxx made it happen for the second time in one evening. That was the first night I had with her and I’ll never forget it.
More About Kakey XXX
Okay, so you probably want to learn more about KakeyXXX which is exactly why I’m still sharing information on her right here, right now.
I’ll start with the number of followers that she has. Seriously, it’s a lot! She’s got 23,367 followers on Camsoda.com alone. Which means exactly what you think it means…23K Camsoda members love this girl.
She’s from the New York/New Jersey area but moves around the country to try and meet up with fanatics. My guess is that she gives them live strip shows and things of that nature. No doubt about it, Kakeyxxx is a boss lady that you need to spend time with.
As for her body, it’s about as legit as it gets. She’s got curves that won’t quit, a tiny waist, big giant 34DD tits and a nice big booty.
Wanna know what turns her on? Nothing more than tokens and BBC!
If you want to take that down to china town and jizz all over that booty then hit her up for sure. Check out her profile right here on Camsoda.com.
Models 34DD, big ass, black booty, mixed girls
Mandy Kay Cam Show & Videos (Model Review)
Okay, so on normal occasions, I’d never say to you that I live videos, but the Mandy Kay videos I saw were legit AF! In fact, they were so legit that I’ve thoroughly enjoyed spending the last four three nights camming with her and getting off to all her clips. Doing so was the highlight of my weekend, no doubt about that! In fact, she’s so dope, I’ve written a complete review about here and why I love everything that she does.
My Personal Review of Mandy Kay On Cam
I’ve held nothing back, gone full blown dirty birdie here for you, sharing everything I know about Mandy Kay and her perfect body. Here’s everything you need to know before taking her live for a one on one cam session.
Mandy Kay has the kind of body that drives people crazy. She’s slim with a thick ass that she loves to twerk on camera. As long as you’re into perfect asses and pretty faces, then she’s going to be a good cam girl for you.
Her hair and eyes are brown, and she’s got a pair of C cup tits that have never been touched by a surgeon’s scalpel. They’re all natural and they’re always on display for anyone who wants to check them out. She was raised in Texas, so she’s a firm believer in bigger always being better and that extends to her taste in sex toys.
Anything Really Does Go
She’s an “anything goes” kind of girl, so both of her holes are always wide open for business. Nothing is going to get in the way of her having a good time, not even the trouble she has filling those tight things.
Sometimes it’s just a challenge to slide her butt plug into her tiny ass, but she always manages. She’ll take as much time as she needs to get it as deep as it will go. Then it’s time for the real fun that her cam friends have for her.
Toys For Dayz
She loves to keep things interactive, so she’s got more than enough toys that respond to your tips. You can send her as much or as little as you want and still get a reaction out of it. You get to choose how much pleasure you give her and she wouldn’t have it any other way. She wants you to be in charge and give her those delicious orgasms when you choose.
She’ll always have one on and she’ll always ask to cum, but it’s ultimately up to you to get her off. One look at her naked body, though, and you’ll probably want nothing more than to make it happen.
Doggy Style Babe
Mandy Kay will take it any way she can get it, but her favorite is to take it from behind. Climbing up on top of her thick dildo is more than enough to get her wet enough to take the entire thing inside her. She’ll ride it like a champ and make sure to fill your head with every single fantasy that’s running through hers. Live cock is always best, but her favorite toy always comes in as a close second and gets the job done when she needs it done.
That’s not to say she only uses one at a time, though. When she really needs a satisfying experience, there’s only one way to get it. She mounts that rubber cock and shoves her interactive vibrator as deep up her ass as it will go. She’ll do the riding, but you have to do the vibrating to give her the best orgasms she’s ever had in her life. They need to be hard to satisfy a girl like her, so she’ll take as much as you want to give her. Just be nice and let her cum.
Mandy Kay is the cat’s meow and her pussy purrs like no other. Give her some of your time and you will not be sorry, I promise you that! Click here now to chat with her today.
Models big ass, booty, busty, perfect, sex toys, tits
|
cc/2019-30/en_middle_0019.json.gz/line9789
|
__label__wiki
| 0.818002
| 0.818002
|
Verax : the true history of whistleblowers, drone warfare, and mass surveillance
Chatterjee, Pratap, author.
New York : Metropolitan Books/Henry Holt and Company, 2017.
229 pages : chiefly illustrations ; 24 cm
"9/11 not only marked the worst domestic terror attack in U.S. history, but also unleashed electronic spying by the government on a massive worldwide scale. In a wholly original and engaging telling, Verax ("truth-teller" and one of Edward Snowden's code names) recounts the full story of American electronic surveillance post 9/11, in brilliant comics form"-- Provided by publisher.
Intelligence service -- United States -- History -- 21st century -- Comic books, strips, etc.
Electronic surveillance -- United States -- History -- 21st century -- Comic books, strips, etc.
Whistle blowing -- United States -- History -- 21st century -- Comic books, strips, etc.
Nonfiction comics.
Added Author:
Khalil,
Prescott Public Library
Book GRAPHIC CHATTERJEE 1
Prescott Public Library 1 Received on 11/29/17
From a prize-winning journalist and the co-author of the best-selling Zahra's Paradise , a sweeping graphic history of electronic surveillance from 9/11 to the latest drone strike
9/11 not only marked the worst domestic terror attack in U.S. history, but also unleashed electronic spying by the government on a massive worldwide scale. In a wholly original and engaging telling, Verax ("truth-teller" and one of Edward Snowden's code names) recounts the full story of American electronic surveillance post 9/11, in brilliant comics form.
We follow Pratap Chatterjee, journalist sleuth, as he dives deep into the world of electronic surveillance and introduces its cast of characters: developers, companies, users, government agencies, whistleblowers, journalists, and, in a leading role, the devices themselves. He explains the complex ways governments follow the movements and interactions of individuals and countries, whether by tracking the players of Angry Birds, deploying "Stingrays" that listen in on phone calls or "deep packet inspection" that mines email, or by weaponizing programs with names like Howlermonkey and Godsurge to attack the infrastructure of states such as Iran and remotely guide the U.S. missiles used in drone killings. He chronicles the complicity of corporations like Apple, Verizon, and Google, and the daring of the journalists and whistleblowers--from Snowden to Julian Assange to the lesser-known NSA Four--who made sure that the world would know. Finally, he gives a prognosis for the future of electronic surveillance, and for the fortunes of those who resist it.
By condensing a crucial event of the 21st century and a broad, complex history into a compact, engaging, and vivid work, Verax is a significant contribution that is certain to last.
Publisher's Weekly Review
Investigative journalist Chatterjee (The Earth Brokers) and graphic novelist Khalil (Zahra's Paradise) collaborate on this pointed examination of the controversies and ethical quandaries of drone warfare and the surveillance state. The first half of the book is a tense recounting of the all-stars of government surveillance whistleblowing, with Wikileaks' Julian Assange, journalist Glenn Greenwald, filmmaker Laura Poitras, and former CIA employee Edward Snowden all playing their parts. The second half follows Chatterjee's own investigations into the drone warfare that relies on this surveillance, even when the vaunted, supposedly precise intel is known to be unreliable, resulting in the deaths of innocents. Khalil's sketchy figures fall somewhere between caricature and realism, while the diagrams scattered throughout help clarify the tech-heavy narrative. Though Chatterjee lays most of the blame for drone killing at the feet of the Obama administration, he also devotes a chapter to the state of surveillance intel under Trump, including the disastrous January 2017 raid and drone strike in Yemen and the increase in strikes since Trump has taken office, ensuring the continued relevance of this troubling work. (Oct.) © Copyright PWxyz, LLC. All rights reserved.
A graphic indictment of American surveillance and drone malfeasance.International investigative reporter Chatterjee (Halliburton's Army: How a Well-Connected Texas Oil Company Revolutionized the Way America Makes War, 2009, etc.) and political cartoonist Khalil (Mission Accomplished: Wicked Cartoons by America's Most Wanted Political Cartoonist, 2007, etc.) join forces for an account that eliminates nearly all ambiguity from the tale of how Edward Snowden, Julian Assange, and a small group of concerned journalists alerted the world to the massive scale of "tracking, hacking and mass surveillance" that American security forces had undertaken. Chatterjee was initially employed by the Bureau of Investigative Journalism, but as he was making headway into the National Security Agency's security reach, he saw his job eliminated because it was costing too much for too little payoff. He stayed on the case, however, often digging into his own pocket to do so, and the main result of his work was to show how the government had mistargeted innocent victims for drone attack, how it deceived the public during the coverup, and how often those responsible for inflicting those attacks suffered from PTSD. The moral conclusions here are clear, but the narrative seeks equal clarity where conclusions have been mixed and murky. Take the case of Snowden, who was forced to flee to Russia after he made classified information public. "The U.S. Congress was sharply divided on Snowden," writes the author. "Some called him a hero, others a traitor." Chatterjee and Khalil leave no doubt that they side with the former, and they never really explain much of a case for the latter. In fact, the very title of the book is in tribute to the heroism of Snowden and others who have brought such information out of the darkness. In Latin, the text informs, Verax means "truth teller." The narrative effectively blends first-person prose with journalistic reporting and presents a complex story with cohesion. However, some of the subtleties might require more than a comic book. An accessible book that sounds the alarm on how modern technology can be used by the government against its citizenry. Copyright Kirkus Reviews, used with permission.
Booklist Review
An investigative journalist who helped break the revelations of Edward Snowden, Chatterjee is an ideal author for this nonfiction graphic novel. And acidic Arab American political cartoonist Bendib has only to trade caricature for portraiture to be its ideal artist. They open with a wordless prologue: a drone seeks its human target in Afghanistan, a man sitting downcast in a doorway. But a mother and baby are inside. The last, full-page panel hovers over a roomful of technicians tracking the drone's mission from far away. The dialogue-laden narrative that follows views events from Chatterjee's perspective as he tracks down whistleblowers, discovers the magnitude of surveillance the U.S. government is conducting, and demonstrates the significance of particular elements as they enter the story. He also introduces one helluva MacGuffin-that-isn't in the first chapter and keeps its secret until the eleventh, well more than halfway through. Altogether, the book is chockablock with events and information, exposition and explanation a fine first book on a subject that couldn't be more important.--Olson, Ray Copyright 2017 Booklist
Library Journal Review
In what becomes a gripping murder mystery, journalist Chatterjee (Halliburton's Army) spins out a chronicle of U.S. surveillance since 9/11 and focuses on accidental drone killings of civilians. Who or what killed Tariq, a soccer-crazed teen from Waziristan whom Chatterjee met while in Pakistan researching drone warfare? It's a cast of thousands in a Peter Jackson-scale tragedy. Some 17 U.S. governmental agencies conduct high-tech surveillance, the drone program alone requires several hundred remotely located people per individual drone, and how things can go wrong appears equally baroque. -Chatterjee also introduces the groups and individuals pushing back against mass surveillance and drone warfare. Khalil's (Zahra's Paradise) illustrations render real people recognizable in clean black-and-white line art; he does a fantastic job with the numerous charts, diagrams, and visual metaphors. The forthcoming website VeraxComic.org will supply resource links. VERDICT A compelling and necessary read for both supporters and nonsupporters of U.S. surveillance programs. Written for adults but excellent classroom fodder for younger audiences.-MC © Copyright 2017. Library Journals LLC, a wholly owned subsidiary of Media Source, Inc. No redistribution permitted.
Book - Graphic Novel
|
cc/2019-30/en_middle_0019.json.gz/line9798
|
__label__wiki
| 0.948792
| 0.948792
|
ced News - December 19, 2012
Hong Kong Businessman Honors Father, Woo Hon Fai, With Major Gift to UC Berkeley
David Woo, who began his career in 1967 as an architect working on the UCB Art Museum and Pacific Film Archive, has chosen to honor his late father, Woo Hon Fai, and to celebrate the museum structure, with a major gift to the UC Berkeley campus
Professor Greig Crysler Appointed Arcus Chair
UC Berkeley Associate Professor of Architecture C. Greig Crysler has been appointed the Arcus Chair in Gender, Sexuality, and the Built Environment
Deborah Berke Awarded New Berkeley-Rupp Prize
Deborah Berke has been selected as the first recipient of CED's Berkeley-Rupp Architecture Professorship and Prize.
Professor Robert B. Cervero Appointed Carmel P. Friesen Chair in Urban Studies
The Friesens, both Cal alumni, have donated generously to Cal and have actively supported the undergraduate urban studies program in the Department of City and Regional Planning.
Ananya Roy Named Blum Center Distinguished Chair in Global Poverty and Practice
Dr. Ananya Roy, Professor in the Department of City and Regional Planning, has been appointed the inaugural chairholder of the Blum Center Distinguished Chair in Global Poverty and Practice.
city News - June 01, 2012
Professor Michael Dear Co-Curates Exhibition on Evolution of Mexican-American Border Development
Partnering with Baja California;s Heritage Department, Michael Dear co-curates an exhibit on the Mexican-American border.
Professor Teresa Caldeira Awarded 2012 Guggenheim and UC President’s Faculty Research Fellowships
DCRP Professor Teresa Caldeira has recently been named a 2012 Fellow of the John Simon Guggenheim Memorial Foundation. In addition, she has been honored with the UC President's Faculty Research Fellowship in the Humanities for the academic year 2012-2013
CED Alumni Works Featured in Buckminster Fuller Exhibit at SFMOMA
In addition to iconic works by Fuller, the exhibit also includes items from the UC Berkeley CED Archives and works from CED professors and alumni among other Bay Area designers
Professor Paz Gutierrez Named Fulbright NEXUS Scholar
María-Paz Gutierrez has been named to the 2011-2012 Fulbright Regional Network for Applied Research Scholar Program as part of a 20-member team working to promote best practices in fighting poverty and inequality in the Western Hemisphere
UC Berkeley Team is Top Finalist in 2012 ULI Gerald D. Hines Student Urban Design Competition
A redevelopment scheme by a team of graduate students from the University of California Berkeley was honored as a finalist in the 2012 Urban Land Institute/ULI Gerald D. Hines Student Urban Design Competition
|
cc/2019-30/en_middle_0019.json.gz/line9801
|
__label__wiki
| 0.995333
| 0.995333
|
ARIA Awards 2017: Song of the Year nominees include Sia, Jessica Mauboy, and Guy Sebastian
By Julia Naughton| 2 years ago
Nominees for Song of the Year are in!
The 2017 ARIA Awards are just over a month away, and the nominees for the coveted Apple Music Song of the Year are finally out!
TODAY's Richard Wilkins exclusively revealed the contenders including some of Australia's biggest music stars, from Sia andJessica Mauboy, to Guy Sebastian and Pnau.
Sia, who scooped up the gong for Best Female Artist at last year's awards, has been nominated for her hit 'The Greatest' with Kendrick Lamar. While former Australian Idol alum Guy and Jess have been nominated for their songs, 'Set In Stone' and 'Fallin' respectively.
Veteran Australian rap group Bliss N Esso scored a nomination for their track 'Moments', and they were joined by fellow rapper Illy for his song 'Catch-22', which followed his platinum hit 'Papercuts' that earnt him six ARIA nods last year.
Gold Coast singer Amy Shark -- who was discovered on triple j's Unearthed platform -- has also been nominated for her track 'Adore.' Her debut EP Night Thinker was an instant chart hit, and the newcomer has spent the best part of the year touring the country playing sold out shows.
A post shared by Amy Shark (@amysharkmusic) on Oct 1, 2017 at 10:57pm PDT
As was the case last year, electronic pop continues to dominate the music landscape with Peking Duck, Dean Lewis, and Starley also scoring nominations.
Last year, Troye Sivan's track 'Youth' took home Song of the Year.
The full list of nominees will be announced later today.
The 2017 ARIA Awards will take place on November 29, tune in exclusively on Channel Nine.
ARIAs 2016: The best in Aussie music brave the rain to hit the red carpet
Aria Awards
|
cc/2019-30/en_middle_0019.json.gz/line9802
|
__label__cc
| 0.698984
| 0.301016
|
XC_CM_2014MTVVideoMusicAwards-PressRoom_Jessie J_091.JPG
INGLEWOOD, CA, USA - AUGUST 24: Recording artist Jessie J poses in the press room at the 2014 MTV Video Music Awards held at The Forum on August 24, 2014 in the Inglewood, California, United States. (Photo by Xavier Collin/Celebrity Monitor)
Copyright: Xavier Collin/Celebrity Monitor
USA, United States, United States Of America, California, CA, Los Angeles, Los Angeles - California, City Of Los Angeles, Inglewood, Inglewood - California, Event, Red Carpet, Arts Culture and Entertainment, Red Carpet Event, Editorial, Press Room, Attending, Celebrities, Arts, Culture, Entertainment, Full Length, Headshot, Posing, Portrait, Smiling, Eye Contact, Fashion, Looking At Camera, 2014, Annual Event, Awards, Award Show, MTV, MTV Video Music Awards, VMA, Video Music Awards, Music Industry, The Forum, MTVN Music Group, Music, Video, People, Vertical, Three Quarter Length, Long Hair, Black Hair, Musician, Smiling, USA, Black, California, One Person, Adult, Music, Sequin, Award, Press Room, One Woman Only, Halter Top, Fashion, Red Carpet Event, Hair Part, Crop Top, Adults Only, Inglewood, Arts Culture and Entertainment, High Waist, The Forum - Inglewood, Celebrities, MTV Video Music Awards, Jessie J, Red Lipstick, People, Topics, Vertical, Full Length, Black Hair, Musician, USA, Black, California, One Person, Adult, Pants, Music, Sequin, Award, Press Room, One Woman Only, Flare Pants, Portrait, Halter Top, Red Carpet Event, Hair Part, Crop Top, Hair Back, Adults Only, Inglewood, Arts Culture and Entertainment, The Forum - Inglewood, Celebrities, MTV Video Music Awards, Wide Leg Pants, High Waist Pants, Topix, Bestof, Jessie J, Black Pants, Red Lipstick
|
cc/2019-30/en_middle_0019.json.gz/line9803
|
__label__cc
| 0.746548
| 0.253452
|
cstnprapp11.centerstone.lan
Crisis and Urgent Care
Forensic Evaluation
Therapeutic Foster Care
Vocational and Workplace
Centerstone – Facebook
Centerstone – Instagram
Centerstone – Twitter
Centerstone – YouTube
Centerstone - Facebook Centerstone - Instagram Centerstone - Twitter Centerstone - YouTube
Home / Florida
Centerstone cares for more than 15,000 people a year throughout our five locations in Florida, including our Behavioral Hospital and Addiction Center.
Our staff of more than 450 doctors, nurses, counselors, case workers, leaders and support staff serves one out of every thirty families in our community.
Financial Assistance Policy (FAP)
FAP Plain Language Summary
Financial Assistance Application
Políticas y Procedimientos Clínicos y Administrativos
Resumen de Ayuda Financiera en Lenguaje Comprensible
Solicitud de Ayuda Financiera
About Locations Programs News Events Leadership Careers
Situated in the Bradenton/Sarasota area – approximately 40 miles from the Tampa International Airport and less than 10 miles from the Sarasota-Bradenton International Airport – Centerstone has more than 450 physicians, nurses, counselors, case workers, leaders and support staff who serve one out of every 30 families in our community.
See our treatment locations. Find exactly the care you’re looking for:
We accept most insurances – including Medicaid, Medicare, Tricare and many commercial insurance plans. If you don’t have insurance, ask us about payment assistance.
Behavioral Hospital and Addiction Center
Florida is home to Centerstone’s Behavioral Hospital and Addiction Center, where we help people from all over the country suffering from drug and alcohol addiction 24 hours per day, seven days per week. We even accept out-of-state Medicare patients.
Learn more about the Behavioral Hospital and Addiction Center.
Outpatient – (941) 782-4150
Inpatient – (941) 782-4610
Crisis and Addictions – (941) 782-4617
Can I Afford Treatment?
Centerstone Addiction Center offers treatment options that are affordable and accessible for you. We are IN NETWORK with most major insurance providers, which means that access to care is just a phone call away. Our caring finance team will handle all of the necessary steps with your insurance provider and help you determine the right options for you.
Most major insurances accepted
Medicare and TRICARE are accepted
Tailored private pay financial options
If you have questions about how your insurance applies, you may discuss your options by contacting 941-782-4150 or email: CFLCentral.Info@centerstone.org or with the Addiction Center Liaison (941-782-4617) or email: CFLCentral.AddictionsInfo@centerstone.org. Centerstone partners with financing companies willing to underwrite your care. Payment plans are also available. To contact our Billing and Collections office, call (941) 782-4318.
Paying for health and wellness, even under the best of circumstances, can be a major challenge. But when a family loses their way due to addiction or behavioral health issues, the financial demands can become even more daunting. The Centerstone Scholarship Program was established to assist families/individuals in their quest for a better future because everyone deserves a chance for health and wellness no matter what their financial status.
To qualify for financial aid, applicants must meet one or more of the following criteria:
Income – Priority is given to low-to-middle-income applicants, as defined by the federal poverty guidelines from the Department of Health and Human Services with little or no means to pay for behavioral health or addiction care.
Household Size – Consideration will be given to households with two or more individuals requiring services or with more than six dependents in a household
Crisis Level Behavior – Consideration will be given to individuals that self-harm; exhibit hurtful aggression on self, others or property; have a life-threatening health risk; cause high-level disruption; or demonstrate other crisis level behavior.
Other – Centerstone will follow any additional requirements or criteria for the distribution of awards as designated by the donor(s) providing the scholarship funds.
Centerstone Hospital Financial Information
Pursuant to Florida Statute 395.301, quality information and pricing information on payments made for service bundles and procedures can be found at the following links:
www.floridahealthfinder.gov
https://pricing.floridahealthfinder.gov
Information on average payments and the payment ranges is an estimate of costs that may be incurred. Actual costs will be based on the services actually provided to the patient. A more personalized estimate of service charges and information is available upon request. Prospective patients may pay less for service at another facility and may contact his or her health insurer or health maintenance organization for additional information on cost sharing responsibilities.
Centerstone contracts with the following health insurers in Florida:
Amerigroup
Beacon/Psychcare
Managed Health Net
Mental Health Net
Sunshine Health
Tricare East
Value Options
WebTPA
How can I access and afford my medications?
We can offer a variety of solutions to meet your medication needs. We offer in-house specialty pharmacy services through Genoa. Our skilled pharmacists can discuss all of your options including assistance programs for which you may qualify. These programs include assistance through the Florida Alcohol and Drug Association and the Vivitrol Co-pay Savings program. Additionally many insurances cover the costs of medications.
If you have questions, please call us at (941) 782-4600.
Centerstone Hospital Pricing Effective 1/1/19
Room and Board – Hospital Psychiatric $900.00
Room and Board – Detox $900.00
Room and Board – Hospital SA Rehab $900.00
X-Ray other than Chest $175.00
X-Ray – Chest $175.00
Occupational Therapy $80.00
Therapy Individual (Inpatient Only) $75.00
Group (Inpatient Only) $40.00
Therapy Family (Inpatient Only) $100.00
Hospital Care Initial – Level 1 $219.00
Hospital Care Subsequent – Level 1 $80.00
Hospital Care Subsequent – Level 2 $109.00
Hospital Discharge – Less than 30 min. $109.00
Hospital Discharge – greater than 30 min $219.00
If you’ve never visited Centerstone before, please call us at (941) 782-4150. If you have questions about our services, contact us today.
Community Needs Health Assessment 2019
Auxiliary Aid Plan for Clients with Special Communication Needs
Find services in all our locations
Centerstone Bradenton – Florida Administration
371 6th Avenue West
Initial Appointments : (941) 782-4150
Main : (941) 782-4150
Centerstone
helpnow@centerstone.org
Bradenton , FL , 34205 United States
Centerstone Bradenton – Hospital and Addiction Center
Centerstone Bradenton – Sixth Avenue West
Centerstone Bradenton – State Road 64
5216 4th Avenue Circle East
Centerstone Sarasota – Sawyer Road
4010 Sawyer Road
Sarasota , FL , 34233 United States
To request counseling services outside of Tennessee or to join our national provider network, please call us at (866) 726-4560
Programs Topic
Crisis/Urgent Care
Vocational/Workplace
Show Programs
Ages: Adults, All Ages, Children, Older Adults, Teens
Topics: Crisis/Urgent Care
Counties: Manatee
States: Florida
Access Center is the designated mental health receiving facility and accepts clients on a voluntary and involuntary (Baker Act)..
Adult Crisis Center
Ages: Adults
If you or your loved one is in a crisis situation, the Adult Crisis Center is a temporary and..
Centerstone Access Center
Topics: Addiction Recovery, Children/Family, Crisis/Urgent Care, Psychiatric Care
The Centerstone Access Center provides assessment and screening services 24 hours per day, 7 days per week for both..
Centerstone Crisis Center
Topics: Children/Family, Psychiatric Care
The Centerstone Children’s Crisis Center provides intensive treatment for children and adolescents who have emotional disorders. Schooling and recreation..
Children’s Community Action Treatment (CAT) Team
Ages: Children, Teens
Topics: Addiction Recovery, Children/Family, Counseling
Specifically, the Children’s Community Action Treatment (CAT) Team serves families with children 11-18, with expanded services to age 21...
Children’s Crisis Center
If your child or teen is in a crisis situation, the Children’s Crisis Center provides intensive treatment for children..
Ages: Adults, Older Adults
Topics: Vocational/Workplace
Centerstone Florida’s Employee Assistance Program (EAP) offers employers solutions for off-the-job problems affecting the work place. Savvy employers contract..
Family Concierge Support
Topics: Children/Family
When a family needs hope and healing Centerstone is ready to assist with Family Concierge Support services to those..
Ages: Adults, Older Adults, Teens
Topics: Addiction Recovery, Psychiatric Care
Medication-assisted therapy is provided for support in recovery from pain pill and opioid addiction. Detox services are also provided..
Outpatient Practices
Topics: Counseling
If in-patient is not determined to be the best avenue of care, outpatient services are also available through the..
Topics: Children/Family, Primary Care
When a physician or faculty refers a patient to Centerstone, he or she can be assured that their patients..
Regional Children’s Community Action Treatment (CAT) Team
The Regional Children’s Community Action Treatment (CAT) Team is a self-contained multi-disciplinary clinical team that provides comprehensive, intensive community-based..
Residential Addiction Treatment
Topics: Addiction Recovery, Counseling
The Addiction Center Residential Treatment Program treats individuals suffering from substance use disorders. We provide therapy, support, and tools..
Sexual Assault and Trauma Services
Ages: Adults, Teens
Sexual Assault and Trauma Services provides crisis intervention and support services to survivors of sexual assault and to their..
Sexual Assault Nurse Examiner (SANE)
The Sexual Assault Nurse Examiner (SANE) Program which provides forensic exams for sexual assault victims as an alternative to..
Substance Use Outpatient
Topics: Addiction Recovery
In all of our areas of service, Centerstone provides a specialized professional team focused on your care. A traditional..
Walk-In Center
Walk-In Center provides immediate crisis intervention assessment and referral, and short-term counseling services for individuals who are experiencing personal..
Youth Addiction Services
Ages: Teens
Centerstone addresses the challenges youth face in growing up alcohol and drug free. Youth learn they are not alone...
Registration kicks off for 17th annual Life;Story 5K/10K Run/Walk for depression awareness and suicide prevention
Centerstone’s 17th annual Life;Story a 5K/10K run/walk will be held on Saturday, September 21, 2019 at 7:30 a.m. at Nathan Benderson Park in Sarasota, Fla. Centerstone’s Life;Story 5K/10K event is held to increase depression awareness and share the message that suicide is preventable. The run/walk is chip timed by Fit2Time and is included in the ...
Florida Department of Labor Grant for Trainings and New Hires
The opioid crisis affects millions of Americans and continues to take a huge toll. Thanks to a $500,000 grant from the Department of Labor, recovery is becoming more of an option. Centerstone will offer temp jobs and hire LPNs who’ve completed school thanks to the grant. Doing so will help others who’ve been impacted by addiction ...
Kathryn Graber Honored as Child Advocate of the Year
Centerstone’s Kathryn Graber was recently honored by Manatee Children’s Services as the James Wischer Child Advocate of the Year! Kathryn is a behavioral health consultant, located at the Child Protective Office in Florida and works to provide education, consultation and assessments to those detectives investigating an abuse report. Her important work and experience as a ...
Roger Johnson Named COO in Florida
Centerstone has announced the promotion of Roger Johnson to chief operating officer in Florida. Johnson previously served as regional chief administrative officer. In his new role, Johnson will oversee Centerstone’s operations in Florida, including medical, outpatient, and residential services. He will also oversee facilities management, help lead business development and marketing, and implement Centerstone’s strategies ...
Art Emboldens Sexual Assault Survivors
Centerstone Resource and Recovery Center’s Sexual Assault and Trauma Services held a Sexual Assault Awareness Day Rally on April 4 at its 6th Avenue West location in Bradenton, Fla. While the event was a success, the statistics surrounding sexual assault remain staggering. According to the National Sexual Violence Resource Center, one in five women will ...
Florida Staffers Named Red Ribbon Champions
Two Centerstone staffers were named Drug Free Manatee Red Ribbon Champion awards this morning. Congratulations to both of them. ...
Larkin-Skinner Named to Commission
Centerstone’s Melissa Larkin-Skinner, Regional CEO, Florida, has been appointed to serve on the newly-formed Marjory Stoneman Douglas High School Public Safety Commission. Florida’s legislative body formed the Commission to specifically analyze information from the school shooting and other mass violence incidents in the state and address recommendations and system improvements. Marjory Stoneman Douglas High ...
Roger Johnson Promoted to CAO for Centerstone Florida
Melissa Larkin-Skinner, Chief Executive Officer at Centerstone Florida, recently announced the promotion of Roger Johnson to Chief Administrative Officer. Johnson previously served as Senior Vice President of Medical Services and Managed Care. In his new role, Johnson will take on additional responsibilities for leading and promoting growth for Centerstone’s medical records and facilities. Since joining ...
Centerstone Internship Program Accredited
The Centerstone Doctoral Psychology Internship Consortium has been accredited by the American Psychological Association. Centerstone is the only private, not-for-profit adult hospital internship program in the Southeastern United States with this accreditation. Centerstone also is one of only two not-for-profit hospital internships in the Southeast serving children and one of only 50 APA-accredited consortiums in the world. The ...
There are no current events in this state. Please check back soon. If you can’t find what you’re looking for. Perhaps searching can help.
Melissa Larkin-Skinner, MA, MBA, LMHC – Regional Chief Executive Officer
Melissa Larkin-Skinner is the regional chief executive officer serving Florida. Overseeing all inpatient and outpatient services and programs, she is responsible for significant organizational growth since becoming CEO, expanding Centerstone’s presence from three to six counties.
As a licensed mental health counselor with 25 years of experience in all aspects of behavioral health, Larkin-Skinner has worked with children and adults of all ages in diverse treatment programs including inpatient, outpatient, crisis intervention, intensive community-based and child welfare. She has designed and operated innovative programs to meet community needs, including the first children’s Community Action Team (CAT) in 2004. CAT has been adopted as Florida’s statewide model serving youth who are struggling with severe mental health, behavioral and co-occurring disorders, along with their families.
A persistent voice bringing attention to the opioid epidemic, Larkin-Skinner is an authority on the disease of addiction and its devastating effects on communities. She regularly provides state and federal policy feedback and engages in legislative advocacy as a subject-matter expert in Tallahassee and Washington, D.C. She has led Centerstone in the rapid expansion of treatment services for individuals fighting opioid addiction, including Medication Assisted Treatment (MAT) in hospital, clinic and jail-based sites. In August 2016, she received the Florida Alcohol and Drug Abuse Association Administrator of the Year for her efforts toward combating the opioid epidemic. Larkin-Skinner currently serves as the only behavioral health provider on the Marjory Stoneman Douglas High School Public Safety Commission.
She received an MBA in Healthcare Administration from Saint Leo University and an MA in Rehabilitation Counseling from the University of South Florida. She serves on Centerstone’s Executive Cabinet, contributing to enterprise mission, vision and growth.
Roger Johnson – Regional Chief Operating Officer
Roger Johnson is Regional Chief Operating Officer, responsible for operations in Florida including medical, outpatient and residential services. He also oversees facilities management and implements strategies for high quality care delivery and growth.
Roger has lived in Bradenton for over 45 years and has been employed by Centerstone since 1994. He has a bachelor’s degree in business.
Sean Gingras – Chief Financial Officer
Sean Gingras is Chief Financial Officer in Florida. After college, Sean began as an audit intern for a big five accounting firm and within three years became an audit supervisor at a local firm. In 2007, he became a Certified Public Accountant (CPA). Sean joined Centerstone as the Director of Finance in early 2010.
Sean is a current member of the American Institute of CPAs, the Florida Institute of CPAs, the Government Finance Officers Association, the Florida Government Finance Officers Association, the Healthcare Financial Management Association and the Manatee Young Professionals. He is also a current finance committee member for the Humane Society of Manatee County, a finance committee member for the Central Florida Behavioral Health Network and a board member of the Pinnacle Plaza Condo Association.
He studied accounting at both the University of Florida, where he received a BA, and at the University of Central Florida, where he received his MBA in accounting.
Jane Roseboro, MA, MCAP – Vice President of Community Alignment
Jane Roseboro is Vice President of Community Alignment at Centerstone. With Centerstone since 2009, Jane has been working to help those with mental health and substance abuse issues for more than 18 years.
She started with Centerstone as a counselor in the children’s substance abuse and mental health program. After less than a year, she was promoted to supervisor over the children’s substance abuse program to include outpatient counseling and prevention services and the Manatee County Drug Court Program. As Centerstone continued to grow, she began managing all of the new Centerstone treatment courts in Sarasota County. Jane was then promoted to Director of Forensic Services, where she oversaw the drug court and jail programming in Manatee and Sarasota counties, the Comprehensive Treatment Court Jail Diversion Program in Sarasota, homeless and forensic outreach in Manatee County and integrated care at the Department of Health in Sarasota and North Port.
As Vice President of Community Alignment, Jane added the four FACT teams in Manatee, Sarasota and Lee counties to her oversight. She serves on several community workgroups and boards, forensics and integrated care, focusing on growth of programs.
Jane has a BA in psychology and a MA in sociology with dual concentrations in addiction and family.
Michelle Abercrombie, Facilities Director
Michelle Abercrombie is the Facilities Director in Florida. She directly oversees the maintenance, housekeeping, dietary and transportation departments. She is also responsible for the entire physical plant operation, as well as all of Centerstone’s outpatient facilities. Her priorities are maintaining a safe, secure and healing environment for clients and staff, as well as keeping Centerstone audit-ready for all agencies.
Michelle also serves as the safety officer and chairperson of the Environment of Care Committee, dedicated to identifying and resolving safety issues for staff and clients and conducting internal drills. She also represents Centerstone on the ESF8, Manatee County Emergency Operations Center, and Organizations Active in Disaster. She has studied at Manatee Community College, Texas A&M Engineering, Department of Homeland Security, and FEMA, and has been certified with Emergency Management Institute, completing ICS 100 for health care and hospitals.
Michelle grew up in Manatee County, working in the community for over 25 years with Volunteers of America, as owner/operator of Abercrombie Painting LLC. and with her family’s businesses, which included landscape architect and design.
Marilyn Agee, RN, BSN – Director of Nursing
Marilyn Agee is the Director of Nursing at Florida’s mental health and addiction hospital. She has 27 years of experience with Centerstone in supervising nursing care for adults, children and families seeking mental health and addictions services.
Marilyn received a BS in nursing from Millikin University and certified as a master manager in 1995.
Robert Boxley, Ph.D. – Director of Clinical Training
Bob Boxley is the Director of Clinical Training for Florida’s psychiatry residency and doctoral psychology programs. He has been involved with the training of the next generation of doctors since 2001; nearly 200 doctors have received training under Dr. Boxley since that time.
Dr. Boxley has a Ph.D. in clinical psychology and has been licensed as a psychologist for 20 years. During that time, he has worked with adults, children and adolescents in a variety of behavioral health areas. Prior to becoming a psychologist, he worked as a therapist in hospital and clinic settings for 17 years, working predominantly with children, adolescents and young adults. Dr. Boxley has a number of professional and research interests, including trauma, co-occurring disorders, positive psychology, childhood disorders.
Samantha Kolb, LCSW – Director of Addiction Center
Samantha Kolb is the Director of Addiction Center in Florida. She graduated from Florida State University with both a BA and an MA in social work.
Samantha is a licensed clinical social worker with nearly 10 years of experience in behavioral health. She specializes in addictions treatment and currently manages the adult addiction continuum that includes inpatient, residential, outpatient, medication-assisted treatment, HIV and community-based family programs.
Suzanne Santangelo – Director, Marketing and Business Development
Suzanne Santangelo is the director of marketing and business development in Florida. She develops and executes strategic communication and marketing plans that influence brand awareness and referral source goals. With extensive experience in healthcare marketing, public relations and community outreach, she focuses on relationship development and operational enhancements that further Centerstone’s mission.
Santangelo received a BA in mass communications from the University of South Florida and an MBA in Healthcare Management from Western Governors University.
Linda K Transue, CPHQ, LHRM, RHIT – Performance Improvement Director
Linda Transue is the Performance Improvement Director in Florida. She is a certified professional in health care quality, a licensed health care risk manager and a registered health information technician.
Linda has over 20 years of experience in performance improvement and has been Centerstone’s corporate risk manager since March 2006. She has also been Centerstone’s Joint Commission coordinator since 1999.
Charles Whitfield, M.Ed., CLC – Director of Community Care
Charles Whitfield, M.Ed., is a certified life coach and Director of Community Care in Florida.
He graduated with a BA in business administration and an MA in elementary education from Temple University in Philadelphia.
Charles has been working for Centerstone since 2008, managing multiple programs including the Walk-in Center, homeless outreach, the family safety intervention program, the children’s substance abuse prevention and intervention teams, the community paramedicine program and the Employee Assistance Program (EAP).
Jennifer Bencie, MD, Chair
Rev. James Golden, Vice-Chair
Colleen Thayer, Secretary
Timothy Knowles, Immediate Past Chair
Melissa Larkin-Smith, CEO
Linda Agresta
Edward Viltz
Captain Lorenzo Waiters
Subscribe to Health + Wellness You, our monthly newsletter
44 Vantage Way
Nashville , TN , 37228 United States
|
cc/2019-30/en_middle_0019.json.gz/line9805
|
__label__cc
| 0.534388
| 0.465612
|
Home / ceramic science
ceramic science
JACerS celebrates 100 years of excellence in 2017
By Stephanie Liverani / November 25, 2016
It’s a centennial achievement for the Journal of the American Ceramic Society—next year it will celebrate its 100th year as a top source for ceramic materials science research, providing scientists, engineers, and students with critically assessed, original research.
Charting the future by mapping the past: Visualizing the evolution of ceramic research
By April Gocha / July 8, 2015
In a new paper published in the Journal of the American Ceramic Society, authors Sylvain Deville and Adam J. Stevenson provide a visual evolution of ceramics research through data mining of bibliographic records.
Materials stories that may also be of interest
By / November 19, 2010
At the end of each week, we end up with a list of stories I started to write about, or started to investigate or didn’t even get that far even though the topic looked intriguing, but, I had a meeting to go to … Rather than have these stories evaporate into the ether, here are…
Doreen Edwards: Ceramic and Materials Education at Alfred University
By / June 24, 2009
Doreen Edwards, the associated dean of engineering at Alfred University, discusses the state of ceramics and material science higher education at Alfred and the trends she sees unfolding in universities across the United States.
|
cc/2019-30/en_middle_0019.json.gz/line9807
|
__label__cc
| 0.530716
| 0.469284
|
Home » Blackview BV9700 Pro is deemed to be ideal for game and battery rugged phone
Blackview BV9700 Pro is deemed to be ideal for game and battery rugged phone
Surely, the BV9700 Pro isn’t only tough on the outside, also deliver a better overall gaming experience.
On the technical side of things, the BV9700 Pro uses an octa-core system with four ARM Cortex A73 processors clocked at 2.1GHz. Along with that, there are another four Cortex A53 chips 2.0GHz and a Mali-G72 MP3 system that can be used up to 900MHz (a performance boost of 13% compared to the Helio P60). It’s optimized to reduce frame-rate jitter and improve latency for touch controls and display visuals for a smooth, fluid gaming experience.
Let’s have a look at the actual operation, they took fully charged Blackview BV9700 Pro (4380mAh) and put it through rigorous activity including several very popular games. After playing multiple games for almost 2 hours, the phone total battery actually only consumes 25% of electricity.
The BV9700 Pro is more power-efficient and runs at a lower temperature, along with algorithms to pipe power to the apps and features being used most, so really pretty solid result. And the good news, which Blackview claims takes a full charge in just 2.5 hours at 9V2A.
Gaming and battery are also becoming more important on mobile, Blackview hope to bring us the best user experience. So, as we’ve just seen in the video the BV9700 Pro is able various games and running 12.5 hours.
The smartphone performed as expected with relatively smooth gameplay. That’s because the BV9700 Pro is equipped a 2019 flagship-class processor MTK P70 processor that delivers 13% more performance than its predecessor, the P60. This reduces power consumption by 30% and cooling efficiency increases by 20%. The AI processing efficiency is 10% to 30% higher than the previous generation’s P60, that can support more complex AI applications.
BV9700 Pro boasts an enhanced Artificial Intelligence Processing Unit (APU) of MediaTek Helio P70 for peak performance, including a power boost for gaming. Provides multi-threaded optimization for games and reduces picture latency for important usage scenarios to provide a faster responsive gaming experience. Plus, it’s superpower efficient so you can do more and charge less. What is more, the handset also comes with 6GB RAM and 128GB ROM which also help when running games, other than providing smooth user experience.
Great technology should be smart, not expensive and connect you to what matters in life. BV9700 Pro does it all. Now it will be officially launched on the official website and AliExpress soon and can be purchased by users all over the world.
So if you are looking for a solid rugged phone with decent specs, good price, and very good battery endurance, then look no further and take action now.
|
cc/2019-30/en_middle_0019.json.gz/line9809
|
__label__wiki
| 0.918415
| 0.918415
|
Union Finance
Punjab National Bank
Digital payment the future of financial transactions: Arun Jaitley
"In future, the proportion of hard currencies in India is set to become less just like the other developed nations.ANI | November 29, 2016, 09:12 IST
NEW DELHI: Asserting that hard cash in India would become obsolete in the near future, Union Finance Minister Arun Jaitley on Monday said that digital payments like e-wallet system and mobile banking would rule the roost which would immensely benefit the people.
"In future, the proportion of hard currencies in India is set to become less just like the other developed nations. Digital payments are the future of financial transactions," Jaitley said at the Punjab National Bank app launching ceremony held here.
He also said that there is a room for cutting the service charge on the use of debit and credit cards once it's volume of usage increases.
"The payments made by cards where service charge is currently high, which has been waived off till 31st December, would consequently become low once the volume of debit cards usage increases," Jaitley said.
The renewed push for digital payments from the government came after Prime Minister Narendra Modi directed his senior ministers to enlighten the people about merits of using e-wallets and other digital payment methods.
According to government sources, the Prime Minister asked his ministers to start the promotion of cashless economy with their own staffs followed by their ministry and then constituency to appeal to larger masses.
Finance Minister Arun Jaitley also spoke to Bihar Chief Minister Nitish Kumar amongst the others to form a sub-committee to give impetus to a cashless economy.
In the 26th edition of Mann Ki Baat programme, Prime Minister Modi said, "I know cashless economy is different. Why not move towards a cashless society? Need your physical support in this. I took this decision for the country's poor, farmer, labour, deprived and for those who are suffering. I reiterate that I need your support; I am positive that you will help me in this; take a pledge that you will be a part of this cashless economy."
Tags : Policy, Arun Jaitley, Union Finance, Punjab National Bank, policy, E-wallets, Digital Payment, demonetisation, Bihar, Banking, New Delhi
Face recognition technology a double-edged sword for India
Decision on Huawei's participation in 5G trials based on security and economic interests: MEA
PMO panel seeks multinational companies' inputs on making India electronics hub
Foreign, Indian global firms in a fix over likely ban of two audit biggies
Skill India to be expanded to include AI, IoT
Budget 2019: No clarity on SEZ benefits extension in Budget 'missed' opportunity for India, says Nasscom
Parliament passes Aadhaar bill, government to bring law on data protection
|
cc/2019-30/en_middle_0019.json.gz/line9816
|
__label__cc
| 0.603114
| 0.396886
|
The Great Tray-Con: America Manipulated to Miss the Real Story
Initial reports that stoked the fury of the masses said Zimmerman was never even taken in for questioning. Of course, that turned out to be a lie. He was taken in in handcuffs, as a matter of fact, as video shows. How many other lies were there? Can we count them all? Needless to say, if the story was initially reported consistent with what the facts bore out, it wouldn’t have been much of a sensation.
One of the key lies that stoked the embers of racial tension was when NBC released a tape of Zimmerman saying, “This guy looks like he’s up to no good. He looks black,” for seemingly no reason other than to profile a black kid as a potential criminal. However, the alleged news stations (we probably should call them propaganda stations), conveniently deleted out several seconds of audio which showed the operator had asked the race of the youth, so police could identify him.
Oh, just a small detail. He answered a question, for crying out loud, he didn’t smear the kid with a racial insult!
Then WABC puts out a video it claims showed Zimmerman suffered no damage to his head or face in the fight with Trayvon. Only problem is, instead of looking for wounds, they were hoping not to see any. As we know from police footage, Zimmerman did have a busted nose, lacerations on the back of his head and blood spilling out of him.
It wasn’t tremendous physical damage done to him in the fight, but it wouldn’t have been fun to be on the receiving end of those blows either. But alas, the experts at WABC couldn’t be bothered to get an accurate look at his head, anxious instead to see what they wanted.
And another station was caught turning the word “cold” into “coon.” No wonder everybody got riled up, it would be outrageous if a watch volunteer casually referred to someone as a coon on a 911 tape! But again, none of it was real, and when it was revealed as being non-real, for some reason few changed their initial reaction of outrage. It’s as if we’re in a state of mass hypnosis.
Then there’s the trick of showing the pre-teen photo of the victim to stoke empathy, while making the “bad guy” look, well, bad. It’s just a show like any TV or movie.
The bigger story that Trayvon vs. Zimmerman provides, is the inexcusable and unethical practices of our national news media.
It does seem following the vast number of inaccurate reports disseminated during and after the Boston bombings and the Newtown massacre, there is some growing awareness that working in this field of media we journalists should try to, you know, get the facts at least mostly straight, before running with a story.
As much as the Internet has grown and we try to deny the power of TV and the big networks and newspapers to ourselves, we’re lying if we can’t admit, for the biggest stories that really move the world, the old establishment news media still has us in their grip. Even when we know they’re advancing an agenda, it’s hard to break free 100 percent.
The mass media drives story-lines that end up creating our political destiny, and we follow even when we know the stories aren’t really legit. Once they inflame emotions, their job is already done.
It’s like we’re in an abusive relationship with the lying news media, making excuses for them. If you are a media critic, you are not exempt. More people must be stubborn when we learn a story is bull.
Kick the habit! You didn’t feel that. The media made it happen.
Dylan Skriloff is the editor-in-chief of the Rockland County Times and is a local supervisor candidate in Stony Point, Rockland County, and a member of the New York State Conservative Party. Check out his newspaper at www.rocklandtimes. com or look him up on Facebook.
Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Excepteur sint occaecat cupidatat non proident.
← Back To Video 12
|
cc/2019-30/en_middle_0019.json.gz/line9820
|
__label__cc
| 0.617188
| 0.382812
|
Systemic Secrets In Blackfish City
June 19, 2018 by Fraser Simons in postcyberpunk, Solarpunk
“Do not talk about the past here. Do not ask your neighbor why they left wherever they are from; do not expect your newfound friends to wax nostalgic for homes that no longer exist. Perhaps the past holds more than merely pain for you, but you can't assume that this is true for anyone else. We want to smell it, taste it, hear its songs, feel its desert heat or summer rain, but we do not want to talk about it. The things we've been through cannot hurt us here, unless we let them. The Fallen cities, the nations drowned in blood. The cries of our loves ones. Those stories we lock away. We will need new ones.”
A woman arrives in Qaanaaq, a city made possible with advanced technologies iterated from oil rigs; she arrives with an orca and a polar bear and is called an "orcamancer". Her arrival is the impetus that drives together the characters. In this post-climate collapse, each character is an intersectional lens used to critique cyberpunk tropes and showcase how much fiction with characters of diversity and queer identities can enrich fiction with established tropes.
“Slums are always a marvel; how human desperation can seem to warp the very laws of physics.”
Kaev is a veteran fighter used for the express purposes of launching other fighters' careers, manipulated by his ex-lover and crime boss; Soq, a slide messenger (think Jet Set Radio, using installed rails that cross the various "arms" of the city to navigate to their destinations) with a non-binary gender identity (using they/them pronouns), living in poverty, and ostensibly, wishing to dismantle the city entirely. Fill, on the other hand, is the other side of the coin. Born into a high-status life that is lacking a purpose. Ankit, a government worker who is struggling with her purpose as bureaucracy proves that her wish to help citizens must continually go unanswered.
As disparate as they all are, both in social status as well as identities, the narrative serves them well. Bringing them together in unexpected and nuanced ways as the story drives toward the climax and conclusion. Interspersing the orcamancer's story throughout their narratives, colliding the narratives together.
Qaanaaq has a rich history. One that is spotlighted throughout in chapters labeled "A City Without A Map", how it was developed and how human the problems are there, even in a society having lived through multiple crisis points in human history. These chapters are broadcasted to the denizens, highlighting people and places, hopeful in nature and with a goal to bring the inhabitants together despite stratification resulting in a city filled with advanced technology, such as the A.I that literally runs the entire city. Cramped quarters as real estate means that most folks don't have the space they need and hunger for. It's a cyberpunk setup that gets subverted in delightful ways.
“Multicolored pipes vein the outside of every building in a dense varicose web: crimson chrome for heat, dark olive for potable water, mirror black for sewage. And then the bootleg ones, the off-color reds for hijacked heat, the green plastics for stolen water.”
The city already being ravaged by "The Breaks" when the orcamancer arrives. Little is known about this viral disease plaguing the city. But it feels very much framed as the AIDS epidemic. Ostensibly transmitted through body fluids that causes neurological degradation, opening the mind to thoughts and even memories of others... until it ultimately kills the person. This is an outbreak the city seems incapable of dealing with, or unwilling, as the city's multiple A.I can't seem to figure out what to do even years after an initial diagnosis.
“Bodybreaking, they called it. What happened when the breaks finally killed you. The moment your mind's hold on the here and now finally ruptured forever and you broke free from your body.”
This, together with the different character lenses' at work regarding the crisis and the upheaval the orcamancer causes, are a major upset in the status quo. When she begins carving a bloody path through the city searching for a truth the city has long since attempted to bury, we also get chapters that reveal her own past and what she is doing in the city, along with what it means for the main characters.
“Wood smells like wealth”
As snippets of the city's own sordid past are revealed via people with The Breaks, the author does a masterful job weaving a cohesive story between all the characters. Targeting the wealth gap and the corruption that is all but inevitable in political structures based on class, and the importance of questioning anything systemic, even when it's your own family. There is no easy decision. No dark, simple evil to combat in these villains.
Instead, there are contemporary, powerful, and meaningful subjects tackled from many perspectives, all colored in shades of gray. It feels like the subject matter was tackled with respect, including indigenous aspects brought into the text. Pairing the crisis of The Breaks with what is revealed of the orcamancer's past is an emotional and impactful choice. And conjoining that plot with the meta-structure of the book makes for a cyclical, satisfying ending.
“...the most myth-shrouded story of all is that of the nanobonded. A whole community of people who were either deliberately or accidentally exposed to the experimental wireless nanomachines that established one-to-one networks between individuals, and who, through years of training and imprinting, could "network" themselves to animals, forming primal emotional connections so that they could control their animals through thought alone.”
Everyone and everything matters. It's got traces of solarpunk in its surprising hope. It's subverting cyberpunk by injecting multiple, intersectional, and marginalized identities while being both sex-positive and framing embodiment in an affirmative light. The primary advanced technology in nanites and their purpose and how they are used, and the choice to frame technology in a neutral relationship along with the depiction of villains, all work together to craft a unique experience.
I'm going to call Blackfish City a post-cyberpunk novel and recommend you not miss it.
“You are bound to your body.
Your body is shaped by its DNA, your parents' decisions, historic hate and hunger, contested elections, the rise and fall of the stars in the sky. Maybe your body is an awful place. Maybe, like me, you are there through no fault of your own.
One day, you will break free of your body. Every one of us will. Until that Great Liberation comes, we must be content with the little liberations. The Shivers up the spine--the telltale tingle of a beautiful song. Great sex; a good story.”
June 19, 2018 /Fraser Simons
LGBTQ+, Sam J. Miller, cli-fi, Sci-Fi, Blackfish City, analysis, review
postcyberpunk, Solarpunk
|
cc/2019-30/en_middle_0019.json.gz/line9828
|
__label__wiki
| 0.596512
| 0.596512
|
23 February, 2017 | New apartments coming to Universal Boulevard, Orlando Business Journal
A new apartment complex is getting closer to breaking ground on Universal Boulevard. Altamonte Springs-based ContraVest Development Partners LLC’s related entity, Northington Orlando Investors Inc., on Feb. 21 spent $7.1 million on two parcels north of the intersection of Universal Boulevard and Destination Parkway from Atlanta-based Orlando Equity Partners LLC. The land appears to be for the development of Contravest’s next new apartment complex, The Addison at Universal Boulevard. ContraVest applied for a permit on Feb. 17 to build a multifamily development on the site. Here’s a rendering of the Addison on Millenia project, the residential piece of an $85 million mixed-use development. Contravest’s next project is the Addison at Universal Boulevard. Charlan Brock & Associates Inc. The 12.17-acre complex is the second phase of the $32.1 million, 344,322-square-foot The Courtney at Universal Boulevard Apartments, as previously reported by Orlando Business Journal. Altamonte Springs-based ContraVest Development Partners LLC’s Central Florida apartment development portfolio also includes The Addison on Millenia now under construction, The Addison at Windermere now under construction and The Addison at Clermont. The Addison on Millenia features 292 one-, two- and three-bedroom units ranging from 780 to 1,141 square feet, as previously reported by OBJ. Read Full Article located on www.buzjournals.com
|
cc/2019-30/en_middle_0019.json.gz/line9830
|
__label__cc
| 0.6897
| 0.3103
|
Hong Kong Wants STO Investing To Be Reserved for the Super Rich
The Hong Kong Securities and Futures Commission (SFC) will no longer let its citizens invest in STOs–unless they have at least $1 million.
STOs for ‘Professional Investors’ Only in Hong Kong
In what they call a move to protect investors, Hong Kong’s financial watchdog clarified its position on STOs yesterday. The Hong Kong Securities and Futures Commission (SFC) reminded investors that digital assets are still highly risky. This means they should be in the realm of ‘professional investors’ only.
To be clear, it doesn’t matter if savvy investors have made the right call on the market or sharpened their trading skills. If they don’t have a portfolio of at least $1 million (HK $8 million), STOs are off the table for them.
The announcement comes after the SFC launched its regulatory sandbox for cryptocurrency companies in November 2018. In a statement on Thursday, the SFC said that security tokens fall into the same category as securities, which meant that they were subject to the same existing laws.
Foreign Entities Can No Longer Freely Target Hong Kong Investors
The latest crackdown on STOs, which have become a compliant replacement to ICOs in just about every corner of the world, is not limited to companies based in the region. According to the SFC statement, anyone marketing or distributing security tokens targeting Hong Kong investors must obtain a local license.
Moreover, digital asset providers must comply with three key requirements laid out by the SFC. They must restrict their offerings to professional investors only. They must provide clear and comprehensive investment advice and guidelines, and must encourage investors to carry out their own due diligence.
If they fail to do this, they will either lose their license or trigger “disciplinary action” from the financial watchdog. According to the statement:
It is a criminal offence for any person to engage in regulated activities without a licence unless an exemption applies.
SFC: Not an Outright Ban But Almost as Bad
ICOs are all but dead. This time last year, ICOs raised $1.74 billion. This year the figure is bearly making the chart at just $46 million.
token funding is trending toward zero, via @fundstrat pic.twitter.com/XTqaT29LuL
— Rebecca Ungarino (@ungarino) March 17, 2019
STOs have emerged as a more secure and regulated way to invest in cryptocurrency companies. Unlike ICOs, they bear most of the hallmarks of IPOs, depending on the jurisdiction.
However, even in the United States, with its 70-year-old rules, not all STOs are reserved for the super wealthy. Hong Kong may not be outright banning STOs like mainland China. But they’re moving a step further to strangling innovation here–and leaving retail investors at the gates.
Should and will STOs be reserved for wealthy investors? Share your thoughts below!
Images via Shutterstock
STOs–unless
PREVIOUS POST Previous post: Bitcoin On-Chain Daily Transactions Spike to 15-Month High – Bitcoinist.com
NEXT POST Next post: Learning Data Science In 6 Weeks — How You Can Do It?
|
cc/2019-30/en_middle_0019.json.gz/line9836
|
__label__wiki
| 0.7333
| 0.7333
|
Folger
The Collation
Research and Exploration at the Folger
Come Hither, Actors / Textuality
February 14, 2019 | By Guest Author
A guest post by Barbara Bono, Arlynda Boyer, Eric Brinkman, Musa Gurnis, Maria S. Horne, Emily MacLeod, Deborah Payne, Melanie Rio, Joseph Roach, Kirara Sato, Katherine Schaap Williams, and Gretchen York
The actors are come hither, my lord.
(Hamlet, 2.2.416)
The twelve members of the recently-concluded Folger Institute seminar “What Acting Is” worked together for ten weeks to develop an actor-centered criticism of Shakespeare. Participants had the opportunity to study and discuss actors and acting not only through the Shakespearean theatre history resources of the library itself, but also the first-hand testimony of actors of several generations, all of them currently working in Shakespearean productions. In the artists’ analyses of their encounters with the Bard’s characters, situations, and words—representing over 100 years of combined stage experience among them—we found a living archive for our research.
Lisa Harrow, who in 1969, when she was only 26, played Olivia opposite Judi Dench as Viola at the Royal Shakespeare Company, visited the seminar first. In the 1980s she was a member of the powerful cluster of RSC actors—Dench, Ben Kingsley, Jane Lapotaire, Ian McKellen, Patrick Stewart, and David Suchet among them—who under John Barton’s leadership produced the famous Playing Shakespeare television series and book. Harrow’s career continues to encompass stage, film and television, but she spent an intense and detailed session with us voicing passages from Twelfth Night.
Four actors from the cast of the Folger Theatre production of King John—Kate Eastwood Norris, who played the Bastard Faulconbridge; Holly Twyford, who played Constance; Akeem Davis, who played Louis, the Dauphin; and Brian Dykstra, who played King John himself—then joined us over three seminar sessions. They listened patiently to our probing questions about their craft, and their thoughtful answers, collated with Harrow’s, now constitute the core of our findings. They helped us to understand what acting is by explaining what actors do.
Folger Theatre’s King John, 2018/19 season; opening tableau
Our indebtedness to the actors is large and our gratitude proportionate. But their insights inspired our further engagements with books, documents, images, and objects from the Folger collections, returning us ultimately to the texts of the plays with new perspectives on the art of a dramatist, who, as an actor himself, wrote expressly for his contemporary actor-colleagues and, as it turned out, for actors in every generation since. Attending to the implications of that authorizing premise, we organized the wide-ranging topics of our inquiry into four main headings: Textuality, Temporality, Mentality, and Physicality. Subtopics from these separate categories inevitably overlap and intertwine, but the following summary approaches them as discrete nodal points in a conceptual network that provides the theoretical basis for an actor-centered criticism of Shakespeare, other early modern playwrights, and, by methodological implication, dramatists representing other periods and styles.
Textuality
Practitioners of an actor-centered criticism of Shakespeare hold this truth to be self-evident: both literary scholars and classical actors devote their attention primarily to a play’s language. The important difference, however, is that critics are free to select phrases and images from any part of the text, whereas actors cannot ignore inconvenient lines they must speak or the sequence in which they appear in the script. This practical constraint invites actors to attend closely to internal contradictions in individual parts and the unfolding of meaning in time.
Academics often assume that actors conceptualize their roles in naively essentialist terms, as if they thought of their performances as the theatrical equivalent of a nineteenth-century essay in character criticism. However, to a classical actor, Lady Macbeth is not a static set of abstractions (not “a monster” or “ambitious”); she is what she is speaking now (perhaps “Yet who would have thought the old man to have had so much blood in him?”). To be sure, the injunction to play a sequence of thoughts rather than a fixed quality is acting advice widely shared among various schools of training. Nevertheless, in classical text and voice work, the understanding of character as mobile and social, changing from moment to moment, seems particularly rooted in attention to character as an effect of language, a mind made by moving through each successive syllable.
Like others trained in the contemporary verse techniques articulated by John Barton, Lisa Harrow warns against playing “mood” or an “emotional wash” rather than “inventing” specific ideas and images as they are spoken as if thinking each new thought for the first time: “Generalization is deadly. Abstractions don’t solve acting problems. The actor’s job is not to superimpose preconceived ideas of a character, but to come as a blank slate and let the language shape you. The character is language. And the contradictions are the character.” Savoring Shakespeare’s liberal use of poetic and rhetorical antitheses to create complex character-effects, Harrow thus crystalized for us what we are calling “textuality.”
On this crucial matter, but not always otherwise, we found a measure of trans-Atlantic agreement on principle. Kate Eastwood Norris, speaking of her Faulconbridge in the Folger Theatre King John as well as her long experience of playing other Shakespearean roles, put it succinctly: “I am defined by the text.” The textual work that she then went on to describe resembles the long tradition of actors’ “parts” or “sides,” which, containing only the lines spoken by the character assigned to the actor and short cues to prompt them, were rehearsed mainly by the actor alone in private “study.”
J. P. Kemble’s “side” for the role of King John (1783), Autograph Manuscript of Kemble’s Parts in 34 Plays in the hand of John Philip Kemble. Act 4, scene 2: “My Mother dead!” Image from Shakespeare in Performance, an Adam Matthew digital database.
Character comes to Norris in the varied repetition of the scripted lines, testing them on her tongue “at rehearsal, at home, or at the beach.” In practical terms, classical actors create subjectivity and social relationships out of sounds in time. Hours and hours of study are devoted to developing “relish” for individual words, mining each syllable for the subtle, precise, emotional, and intellectual onomatopoeia that is pervasive in all human speech; or to dissecting the rhetorical structure of dialogue to find the shape and speed of thoughts.
Common exercises through which classical actors now privately prepare themselves for group rehearsal include: beating the scansion, walking the punctuation, running the length of a verse line, throwing a ball upward at the last strong stress of a line, savoring all the vowels, biting and chewing all the consonants, moving on the key word in each line, moving on each verb, moving on each noun, raising a hand on each multisyllabic word, vocally marking antitheses, and distinguishing items in lists. The relentless specificity of formal analysis in classical voice work is unmatched in literary criticism except perhaps in work such as Roland Barthes’ S/Z or Stanley Fish’s early demonstrations of the phenomenology of reading.
While scholars sometimes take actors’ willingness to talk about trans-historical “human emotion” as indicative of a crudely essentialist understanding of subjectivity, in fact the practice of classical text-work aligns with poststructuralist theories of subject formation through language. As in Althusser’s account of interpellation, the classical actor absorbs language so fully that the words of the received script come from her mouth as if they were her own thoughts spoken for the first time.
As an introduction to our exploration of textuality in the practice of an actor-centered criticism, we turned first to Shakespeare’s sonnets. Barton’s Playing Shakespeare presents them to the actor as a series of compact preparatory exercises. “They are like little self-contained scenes,” he writes, “fourteen lines long. Yet they have the same basic ingredients as all scenes or long speeches.”1 We approached them as dramatic monologues, serving as practical tests for close reading and, we hoped, expressive delivery. But careful textual analysis shows that whole or partial sonnets also show up frequently in the plays as well. They lie embedded in the dialogue, hiding more or less in plain sight, revealing their presence to the informed eye and, with work, the practiced tongue.
The first play we studied was Richard III, whose famous opening soliloquy can be understood in part as a chain of sonnet-like forms: unrhymed, of course, but its dominantly iambic pentameter verse at first organized into quatrains and tercets marked by the anaphora on “Now” (the octave “Now is the winter of our discontent,” “Now are our brows,” followed by the more twisted and indirect ninth through thirteenth lines that voice the problem of warfare turned to courtship, “And now, instead of mounting barbed steeds . . . He capers nimbly in a lady’s chamber/ To the lascivious pleasing of a lute”).
This sonnet-like beginning aborts after the thirteenth line, gives birth to another bitter poem, a fourteen-line “descant” (technically a voice or cantus above or removed from other voices) on Richard’s deformity (he delivers a catalogue of nine ways in which he is deformed, a virtual lexicon of an actor’s body language) and then tumbles into fourteen lines on his—and the play’s—plot. No surprise, then, that his first target as he hews his way to the throne is the beautiful widow Lady Anne, from the Lancastrian dynasty whose King and husband-heir he has just slain, and that his “method” is the sonnet forms and metaphors he now masters and deploys as he moves from angry stichomythia to a seductive slower method through the crucial pun on “lie,” and tempts her by claiming “‘twas your beauty that provoked me”) and that his deepest adversaries are a veritable chorus of women, one of whom is his own mother.
So when Lisa Harrow came to our class, having asked us to work up a short speech from Twelfth Night, that anagrammatic text, that story of desire, of “O” (Orsino, Olivia, Viola/Cesario, where Malvolio is invited to insert his imagination and the garbled letters of his name obscenely into Olivia’s Cs, her Us, and her Ts—“O, O, O” indeed), we hoped that she would help us with at least one of three sonnet-style pieces we had prepared: Viola’s resonant expression of and incitement to desire (“Make me a willow cabin at your gate” 1.5.222-30); Antonio’s expression of his “filed” desire for Sebastian (3.3.1-13); or Orsino’s great speech of recognition and reversal of his desire at the crisis of the plot (“Why should I not, had I the heart to do it,/ Like to the Egyptian thief at point of death,/Kill what I love?” 5.1.106-8).
“The character is language.” Judi Dench as Viola and Lisa Harrow as Olivia from the 1969 RSC Twelfth Night directed by John Barton
Coming to a consensus that Orsino is the least well-understood and the most poorly-played character in many of today’s productions, we chose his speech for special coaching. We educed the allusion to Thyamis, the conflicted character in Heliodorus’s Ǣthiopean Historie, which already marks the surprised, dangerously violent turn in Orsino’s affection from Olivia to Cesario. Then we highlighted the bitter sonnet language—“nonregardance cast my faith,” “true place in your favor,” “marble-breasted tyrant,” “your minion,” “tender dearly,” “cruel eye,” “spite”—that graphs and punctuates the transition thoroughly. Although we had scanned and marked the passage carefully and tried to deliver it pointedly and well, our emphases went awry as our breath control faltered, so Harrow had to help us “land” it, including the epigrammatic closing couplet: “I’ll sacrifice the lamb that I do love/ To spite a raven’s heart within a dove.” Knowing what to target, we learned, must coincide with knowing when to breathe while taking aim. Launched into the air with the aid of her steadying hand, Orsino’s words leapt to our intentions and, even if only for a few brief, thrilling lines, flew in the direction they were pointed.
John Barton, Playing Shakespeare: An Actor’s Guide (1984; New York: Anchor Books, 2001), 129.
Filed Under: What Acting Is
Summer Retrospective
By: The Collation
"What's in a Name?" or, Going Sideways
By: Elizabeth DeBold
Guest Author is the byline used for guests at The Collation, including Folger fellows, program participants, and readers who wish to share their research on collection items. Please see the end of each post for information about that author.
Categories Select Category acquisitions art books cataloging collections conservation crocodile mystery digital resources exhibitions fellows manuscripts programs research aids staff profiles Uncategorized
Richard Murian on Summer Retrospective
Cliff Webb on Engraved to Sell
Stephen Grant on “What manner o’ thing is your crocodile?”: April 2016
Elizabeth DeBold on “What’s in a Name?” or, Going Sideways
Brian McMullin on “What’s in a Name?” or, Going Sideways
Folger Links
Digital Image Collection
Folgerpedia
Research at the Folger
Become a Reader
Folger Institute
Images and Permissions
|
cc/2019-30/en_middle_0019.json.gz/line9837
|
__label__cc
| 0.505626
| 0.494374
|
Making communities A Part of their own Development
By CSRBOX
VESTAS
While building wind farms, VESTAS also build relationships, positively engage with communities and other stakeholders, and support their efforts to improve their lives, even if in a limited way. VESTAS’ CSR team worked with the local community in Taralkatti, Karnataka whilst installing the 100MW Taralkatti wind farm and brought about a difference in their lives.
‘VESTAS is very conscious of the community it operates in and endeavors to create shared value through business operations as well as CSR programmes by understanding local priorities and needs.’ – says Mr. M Rajendra, CSR Head, VESTAS India.
VESTAS projects, CSR activities were implemented by Navodaya Education and Environment Development Society (NEEDS) in Koppal district, Karnataka. They installed wind turbines in the surrounding villages. The villagers weren’t sure how this will be beneficial to them, but VESTAS exceeded their expectations and brought about change in education and social development of neighborhood villages.
Community Water Resource Development –
At Chikkamyageri village, VESTAS regenerated water resources which spread around 20 hectares by desilting the pond through community participatory approach. Almost 62% of farmers are dependent on rain-fed agriculture as their only source of livelihood in their village. The pond was desilted after 20 years. De-siltation of the pond helped in providing a water source for the animals and importantly, recharging of bore wells to mitigate drought.
Amruthappa Desai, Village Key Person says – ‘In this area, rain is very scarce. Desilting this pond has recharged the bore wells and it is very helpful to the farmer.’
The village mobilized the community who contributed with physical labor and the tractors for transportation of silt, establishing the community ownership and effective water governance at the village level has improved water security and agriculture productivity in the area. With the mentality that, running water should flow slowly; flowing water should be saved and saved water should seep into the ground. So for the next generation will have enough groundwater.
2,07,1000 liters of surface water capacity increased, benefitting more than 500 farmers from 3 villages.
Promoting Education through Digital platform –
VESTAS in partnership with SELCO implemented the digital education programs in the rural villages. The children are explained English grammar with examples and meanings which are easy to grasp. They are taught about the plant, animal and human cells. Textbooks only contain pictures whereas, in the smart class, it is explained with detailed videos. Due to visual learning, knowledge retention is increased and they face exams with confidence.
The digital education content of maths and science in Kannada and English grammar for grade 5th to 10th is matched to the Karnataka government syllabus. This solar-powered technology provides students with the much-required learning lifts and helps students to have a better comprehension of their lessons.
‘After implementing these projects, we found that there is an increase in the attendance of the student and level of knowledge of the student also went up tremendously.’ – says Mr. Girish Kumar, Selco Solar.
School infrastructure –
Big rocks and boulders were removed from the premises of a government school to make a playground for the children. The boulders were so huge; they couldn’t be moved by people. Even a tractor was damaged in the process. Villagers and VESTAS co-operated well to work together. Today, the children are very much enjoying their new playground. A podium was also constructed with the VESTAS supplying building material and community contributing to manual work.
A simple intervention like reusing wood waste from VESTAS tool yard to make bookshelves, grain storage unit, boards of environmental quotes were done as per school requirement.
Skill Development –
The industrial training institute at Yelburga Taluk is now installed with a lathe machine and a welding machine, a projector system for classroom learning and a computer center. Currently, 80 youth have enrolled for fitter and electrician courses and are benefitting from the equipment.
For women in Taralkatti, a three-month training program on tailoring is carried out. The certificates provided after the completion of the course helps them in acquiring loans for buying a sewing machine or work as a sewing teacher. The beneficiaries were identified by the village committee. To strengthen the village committees, they are further linked with specific Government department; relevant government officers spread awareness of various schemes that benefit rural people.
Through linkages with line departments like horticulture, agriculture, legal aid, etc; useful information is made available in the community. Farmers were given coconut, mango saplings and grape cuttings for subsidized rates.
If the story resonated with you, please share
Impact-Story is a series on development and CSR interventions leading to some impacts on the ground. If you have a project, innovation or intervention that has changed the lives of a few people or a community, please share a brief note at csr@ngobox.org. Our Team will get back to you after validating the information for a detailed coverage. For more information, please visit indiacsrsummit.in
Water and CSR Education CSR Skill Development CSR CSR in India
CSRBOX.org is the single largest CSR information dashboard for CSR heads, board members of companies, nonprofit leaders, fundraisers, government agencies and social businesses to find latest updates in CSR domain in India. The platform is powered by India's largest social sector platform NGOBOX.
Suggest a Story: If you have similar story to refer, please fill in the form
More Stories Total Impact Stories (119)
Pinky Markam: The unstoppable
Bringing about a wave of Parivartan
Empowering the Differently Abled with Opportunities for Progress
Creating an inclusive road for the underprivileged community
Changing the fate of Dhakrani- the largest village in Uttarakhand
Happy. Graceful. Focused and molded stories of Progress.
|
cc/2019-30/en_middle_0019.json.gz/line9843
|
__label__wiki
| 0.760838
| 0.760838
|
Armed School Resource Officer Engages Maryland High School Shooter
Christian Datoc Audience Development Manager
March 20, 2018 10:45 AM ET
The Great Mills High School student who injured two others Tuesday morning was stopped by the school’s armed resource officer.
According to St. Mary’s County Sheriff Tim Cameron, the school resource officer (SRO) fired a round at the shooter, who fired a round in return. The shooter is now dead, Cameron confirmed Tuesday morning, and an investigation will determine whether the SRO’s bullet struck the shooter.
The incident is now over, though the shooter managed to injure two students. One of them is in critical condition in the hospital, Cameron said. The SRO was not injured during the incident.
“When the shooting took place, our school resource officer who was stationed inside the school was alerted to the event and the shots being fired,” Cameron said. “He pursued the shooter, engaged the shooter, during which that engagement he fired a round at the shooter.”
“Simultaneously, the shooter fired a round as well.”
St. Mary Co. Sheriff Tim Cameron on shooting at Great Mills HS: shooting happened in hallway; shooter, a student, fired at a female student, another was student hit. Armed school resource ofc, a deputy, exchanged shots w/ shooter; shooter & female student in critical condition
— Peggy Fox (@PeggyTV) March 20, 2018
St. Mary’s Co. Sheriff: 3 students injured at Great Mills HS have been taken to hospitals in DC, Prince George’s County & St. Mary’s Co. Shooter & female student in critical, another student taken to MedSTAR is critical but stable. SRO who stopped shooter was not hurt. @wusa9
Following the horrific tragedy in Parkland, Florida, President Trump has repeatedly called for arming up to 20 percent of school staff members as a means to safeguard students and prevent future mass shootings. (RELATED: Trump – Arm Teachers, Shootings Take Place In ‘Gun Free Zones’)
President Donald Trump smiles during his meeting with his Kazakh counterpart Nursultan Nazarbayev in the Oval office at the White House in Washington, D.C., on January 16, 2018 (NICHOLAS KAMM/AFP/Getty Images)
“If schools are mandated to be gun free zones, violence and danger are given an open invitation to enter,” POTUS has maintained. “Almost all school shootings are in gun free zones. Cowards will only go where there is no deterrent!”
WATCH – CNN Speculates On Maryland Shooting:
Tags : donald trump
Christian Datoc
Follow Christian on Twitter and Facebook
|
cc/2019-30/en_middle_0019.json.gz/line9846
|
__label__wiki
| 0.70552
| 0.70552
|
Woman Fires Gun After ‘Ridiculous’ Wait At DMV
Platte County Sheriff Department
Whitney Tipton Reporter
July 10, 2019 3:50 PM ET
The long wait at a Department of Motor Vehicles (DMV) prompted a woman to storm into the parking lot, grab her gun and fire it into nearby landscaping, police say.
Vanessa Richey, 34, was taken into custody Tuesday after police officers responded to a report of shots fired at the Parkville DMV Office in Kansas City, Missouri, the Daily Mail reported.
“We’re still early on in the investigation, but it is to my understanding that she didn’t make it into the DMV,” Maj. Eric Holland, spokesperson for the Platte County Sheriff’s Office, told the Kansas City Star.
Woman at Kansas City DMV started shooting because line was too slow, police say The @KCStar‘s @GRicekcstar is at the scene gathering information. https://t.co/YTjkdZsMFi
— Bob Cronkleton (@cronkb) July 9, 2019
The woman reportedly entered the DMV office and became “loud and obnoxious,” using foul language and announcing that the “wait time is ridiculous.”
Patricia Zick, a witness who was renewing her driver’s license, said the woman was extremely belligerent and muttering that the “president’s security was in danger,” she told the Star.
“Something was wrong, I don’t know what it is — drugs, mental or whatever — but she just insisted on getting taken care of immediately,” Zick added.
A woman was transported away from the scene in a police van after firing her gun in the parking lot of a Kansas City DMV, police reported. July 9, 2019. Photo Youtube screenshot courtesy of the Kansas City Star.
DMV staff reportedly told her to leave or they would call the police. The woman then said she was going to get her gun, Kansas City Police Officer Darin Snapp told a Fox affiliate. (RELATED: Canadian Woman Goes Ballistic On The Bus. The Video Is Absurd)
Witnesses report she went into the parking lot, took out her gun and fired it a couple of times into nearby landscaping. An off-duty police officer approached her and ordered her to stop. Police arrived shortly afterward and took her into custody.
Richey was reportedly transported to the hospital for evaluation. Richey has been charged with unlawful use of a weapon and is currently being held under bond.
“She just wasn’t very happy about the wait at the DMV,” Snapp told Fox.
Tags : department of motor vehicles kansas city missouri
Whitney Tipton
Follow Whitney Tipton on Twitter
|
cc/2019-30/en_middle_0019.json.gz/line9847
|
__label__cc
| 0.716414
| 0.283586
|
Home > About > Locations and Visitor Information
The Arthur A. Dugoni School of Dentistry, located in San Francisco’s South of Market (SoMa) neighborhood, is part of the University of the Pacific. The main University campus is in Stockton, California, and its McGeorge School of Law is located in Sacramento near the State Capitol. Each are approximately two hours away by car from the dental school.
Dental students and residents serve a diverse population of patients during clinical rotations at sites in San Francisco, Union City and Stockton, in addition to several extramural sites and outreach programs throughout Northern California.
The Arthur A. Dugoni School of Dentistry's San Francisco campus is located in the SoMa district of downtown San Francisco at the corner of Fifth Street and Minna Street. The facility boasts high-tech classrooms, a state-of-the-art simulation laboratory and modern clinics offering a variety of oral health services to the public.
One of the most vibrant and diverse cities of the West Coast, San Francisco is a thriving center for the arts and culture, as well as a hub for innovation and entrepreneurship. Its natural beauty, cosmopolitan environment, diverse population and quaint neighborhoods make this Bay Area gem a favorite among locals and visitors.
Across the Bay Bridge and approximately 45 minutes away by car are the Arthur A. Dugoni School of Dentistry's East Bay clinics. The school operates the Union City Dental Care Center in Union City, and also has a program, the Division of Oral and Maxillofacial Surgery, housed in Oakland's Highland Hospital.
Dean's Blog
Clinical Excellence
Three-Year DDS Program
Arthur A. Dugoni in His Own Words
San Francisco: The City
Getting Around San Francisco
Map, Directions & Parking
Student Community Outreach for Public Education (SCOPE)
SCOPE Goals & Leadership
Pacific Center for Special Care
Pediatric Outreach Programs
Central Valley Outreach
Outreach Abroad
Project Homeless Connect
Dental Pipeline Program
Anthoula Vlachos
Beniel Tamraz
Marwa Elkharsity
Hannah Fox
Allen Abrishami
Juan Ramirez
Marilyn Nguyen
Joanne Fox
Kimberly LaRocca
Chrystle Cu
Melanie and Richard Lundquist
Sam Christensen
Daniel Nam
Mark Booth
Arthur A. Dugoni
Nader Nadershahi
William Sands
|
cc/2019-30/en_middle_0019.json.gz/line9854
|
__label__cc
| 0.666526
| 0.333474
|
About Ruby
Being a Blogger
Submit Your Guest Post
Brexit-inspired inflation applies brake to services sector growth in November
Ruby Harrison
The dominant services sector lost momentum in November, while the prices charged by companies are rising at the fastest pace in nearly a decade.
The purchasing managers’ index for services dropped to a balance of 53.8 in November, down from 55.6 in October. However, the sector is still growing: any reading above 50 indicates expansion, while anything below represents contraction. The sector has remained above the 50 watershed for 16 consecutive months.
The services sector makes up 80 per cent of economic output in Britain and covers everything from restaurants, hotels and hairdressers to finance and banking. The monthly PMI surveys cover about 400 companies and topics such as business activity, new business, prices charged, input prices, employment and expectations for activity. Weak expansion in the sector has a big impact on overall economic growth.
Uncertainty about the economic outlook, linked with Brexit worries, “continued to permeate the business mood” last month, while stretched budgets among customers was acting as a brake on growth, the research found.
The survey had little impact on the value of the pound, as markets focused on Brexit developments. Sterling fell by 0.3 per cent against the US dollar to $1.3451. Against the euro, sterling rebounded from a six-day low to trade flat on the day at €1.1380.
The survey showed that while companies were still reporting a solid upturn in new work, the rate of new business growth had eased since October to weaker than the average so far this year.
A jump in inflation since the Brexit vote has dampened consumer spending, which is affecting the services sector. People are spending more on basics and are paring back discretionary spending. A survey published yesterday by the British Retail Consortium and KPMG found that last month shoppers spent an increasing share of their budgets on the rising cost of food.
The headline rate of inflation was at a five-year high of 3 per cent in October. The Bank of England thinks that it will peak at about 3.2 per cent before the end of the year, then start to fall again.
The PMI survey also showed a jump in the prices being charged by companies. Prices rose at their fastest rate since February 2008 and were at their second highest since the survey began in 1996.
Companies said they were having to battle higher expenses for energy, food, fuel, imported items and staff salaries. The fall in sterling since the Brexit vote has pushed up the price of imports, while the rise in the national living wage to £7.50 since April has affected the margins of smaller companies.
Chris Williamson, chief business economist at IHS Markit, which compiled the survey, said that price increases suggested that inflation would rise further.
“Rising oil prices were again to blame in November, with firms also reporting the need to pass higher costs of a wide variety of other inputs on to customers. As such, the survey data suggest that inflationary pressures have yet to peak,” he said. The survey was lower than economists had expected, but came after strong gains in the manufacturing and construction sectors.
• Businesses in the 19-nation eurozone had a bumper November, according to a key survey (Tom Knowles writes). The composite purchasing managers’ index for the eurozone, which includes responses from both the manufacturing and services sectors, rose to 57.5 from 56 in October, the highest level since April 2011. A reading above 50 indicates growth. Growth was led by manufacturing, where production rose at its fastest pace in almost seven years in November.
Chris Williamson, chief economist at IHS Markit, which compiles the survey, said that the PMI surveys for the past two months suggested that the eurozone economy would expand by 0.8 per cent in the final quarter of the year.
Ruby HarrisonFollow
Ruby Harrison@diamondzruby·
A lot of those “complex” things people don’t get in college or high school just need another chance.
Can you believe that I hated math and econ once? But it’s true. Simply couldn’t get any of it.
I always loved finance and how the world of money works. It’s so humane, no matter what they say.
If you can spare just 30 minutes a day to learn something new, do it. Always do it, no matter what.
I quit a lot of bad things. That doesn’t mean drinking, but shaming myself, being bad to others, etc.
© Copyright 2017 DiamondsRuby.com
|
cc/2019-30/en_middle_0019.json.gz/line9858
|
__label__wiki
| 0.621854
| 0.621854
|
Charter of the Internet Architecture Board (IAB)
RFC - Informational (March 1994; No errata)
Obsoleted by RFC 2850
Obsoletes RFC 1358
Legacy state
RFC Editor Note
RFC 1601 (Informational)
Email authors IPR References Referenced by Nits
Network Working Group C. Huitema
Request for Comments: 1601 Internet Architecture Board
Obsoletes: 1358 March 1994
Category: Informational
This memo provides information for the Internet community. This memo
does not specify an Internet standard of any kind. Distribution of
this memo is unlimited.
This memo documents the composition, selection, roles, and
organization of the Internet Architecture Board and its subsidiary
organizations.
1. IAB Membership
The Internet Architecture Board (IAB) shall consist of 13 voting
members, composed of the IETF chair and 12 full members. The IETF
chair, who is also the chair of the IESG, may vote on all official
IAB actions except the approval of IESG members. Ex-officio members
and a liaison from the IESG may also attend IAB meetings but shall
have no vote on official actions.
Voting IAB members shall serve for a term of two years, but may serve
any number of terms.
Members of the IAB shall serve as individuals, and not as
representatives of any company, agency, or other organization.
1.1 Selection of voting IAB members
Voting IAB members shall be nominated by the nominating committee
of the IETF and appointed by an appropriate group. The 12 full
members shall be approved by vote of the Board of Trustees of the
Internet Society (ISOC), while the IETF chair shall be approved by
vote of the 12 full IAB members then sitting. Normally, six new
full members are nominated each year.
The IETF nomination committee is formed every year and consists of
a non-voting chair designated by the Internet Society and seven
members picked at random from a pool of volunteers. Any person
who took part in two IETF meetings in the last two years may
Huitema [Page 1]
RFC 1601 IAB Charter March 1994
volunteer for this pool. The nomination committee also includes
four non-voting liaison members, one designated by each of the
Board of Trustees of the Internet Society, the IAB, the IESG, and
the IRSG.
New IAB members shall be selected each year to replace those whose
terms have expired or been vacated. The nomination committee
shall prepare a list containing at least one candidate for each
open position, and present this list to the ISOC Board of
Trustees. The Board of Trustees will by a vote appoint IAB
members from the list of nominees to fill the open positions.
There is no limit to the number of terms that a member of the IAB
may serve. A member that wishes to be re-nominated at the end of
a term simply notifies the nomination committee. However, there
is no obligation for renomination.
1.2 Ex-Officio Members
The IRSG chair and the RFC Editor shall be Ex-officio members of
the IAB, with no vote in official actions. An ex-officio position
may be held by a voting member.
2. The Role of the IAB:
The IAB was chartered as a component of the Internet Society in June
of 1992. Its responsibilities under this charter include:
(a) IESG Selection
The IAB appoints a new IETF chair and all other IESG candidates,
from a list provided by the IETF nominating committee.
(b) Architectural Oversight
The IAB provides oversight of the architecture for the protocols
and procedures used by the Internet.
(c) Standards Process Oversight and Appeal
The IAB provides oversight of the process used to create Internet
The IAB serves as an appeal board for complaints of improper
execution of the standards process.
(d) RFC Series and IANA
The IAB is responsible for editorial management and publication of
the Request for Comments (RFC) document series, and for
administration of the various Internet assigned numbers.
(e) External Liaison
The IAB acts as representative of the interests of the Internet
Society in liaison relationships with other organizations
concerned with standards and other technical and organizational
issues relevant to the world-wide Internet.
(f) Advice to ISOC
The IAB acts as a source of advice and guidance to the Board of
Trustees and Officers of the Internet Society concerning
technical, architectural, procedural, and (where appropriate)
policy matters pertaining to the Internet and its enabling
technologies.
The following is an expanded discussion of these IAB functions.
|
cc/2019-30/en_middle_0019.json.gz/line9869
|
__label__cc
| 0.696535
| 0.303465
|
Ersatzteile Mac MacBook Pro 13" Retina Late 2012 Headphone Jacks
MacBook Pro 13" Retina Late 2012 Headphone Jacks
Ersatzteile für MacBook Pro 13" Retina Late 2012:
MacBook Pro 13" Retina Headphone Jack
Replace a dirty, corroded, or damaged 3.5 mm headphone jack in a 13" MacBook Pro with Retina Display.
On October 23, 2012 Apple announced the new 13" MacBook Pro with Retina display. Similar to its larger cousin, the 15" MacBook Pro with Retina display introduced earlier in 2012, this new 13" MacBook Pro features a high resolution LED-backlit display. An integrated Intel HD Graphics 4000 graphics processor takes full advantage of the 2560-by-1600 resolution at 227 pixels per inch. The MBP Retina 13" has two USB 3 ports, an SDXC card slot, an HDMI port, and two ThunderBolt ports. It does not have Ethernet or Firewire ports, although adapters are available. The MagSafe Port has also been replaced with the MagSafe 2 port allowing for a thinner case design.
The most common repairs with the 13" Late 2012 model MacBook Pro with Retina Display laptops are replacing a dead battery or a damaged display assembly.
The battery in a MacBook Pro 13" Retina Late 2012 is adhered to the inside of the upper case. Our battery repair kits include the needed adhesive.
The MacBook Pro 13" Retina Display models require a P5 Pentalobe Screwdriver to remove the the lower case to begin any internal repairs. Our battery kits include all the needed tools.
Once you've bought your parts and tools, check out iFixit's MacBook Pro 13" Retina Display Late 2012 repair guides for step-by-step instructions on how to make the fix.
The MacBook Pro 13" Retina Display Late 2012 earned a 2 out of 10 in iFixit's repairability assessment.
|
cc/2019-30/en_middle_0019.json.gz/line9873
|
__label__cc
| 0.557112
| 0.442888
|
Richfield Mayor Debbie Goettel To Run for Hennepin County Commissioner
Home Press Releases Richfield Mayor Debbie Goettel To Run for Hennepin County Commissioner
18.05.2016 Webmaster 0
(Richfield) - Mayor Debbie Goettel thanks Randy Johnson for his dedicated service, and announces her candidacy for Hennepin County Commissioner, District 5, including Bloomington, Richfield, and a large part of Eden Prairie.
"I want offer my heartfelt thanks to Commissioner Johnson for his public service. Randy has been a leader on so many issues during his career. He's done and seen it all but perhaps his greatest legacy is collaboration. Randy has been effective because he put political partisanship aside and got things done."
Debbie is a civil engineer with graduate studies at the University of Minnesota and Harvard University, and has extensive business management experience. She works in the environmental, health, safety and sustainability fields, and has worked for Medtronic, Nestle and Cummins NPower.
Tim Carter, General Manager of Richfield Bloomington Honda had this to say, "Mayor Goettel is a great partner. During my tenure as Chair of the Richfield Chamber, we worked together to increase involvement. During redevelopment of our campus, she helped us create a nationally-recognized design that is exclusive to Richfield and the state." Brent Wade, Manager of Richfield Bloomington Mitsubishi said, "Debbie is absolutely a business supporter. She was an integral part of helping us get our new building up and the approvals for all the permits."
As mayor of Richfield, she sought and won state and county funding for the 77th Street underpass that will transform that area, she led the "Do Town" initiative with the cities of Bloomington, Edina, and Richfield to improve public health and wellness and the environment, and worked tirelessly to redevelop Richfield's new downtown.
"Debbie is a leader with a regional vision. She works effectively with the business community, government, and all stakeholders to get things done," said Andrew Carlson, Bloomington City Council Debbie has the vision, experience, and energy to make Bloomington, Eden Prairie and Richfield the regional leaders in economic development, environmental health, and quality of life.
Debbie has been endorsed by Representative Linda Slocum, Senator Patricia Torres Ray, Eden Prairie City Council Member Ron Case, Bloomington Council Member Andrew Carlson, Richfield Council Members Edwina Garcia and Pat Elliott, and many other business and community leaders.
Next article Sun-Current: Richfield mayor seeks to replace Randy Johnson on county board
Debbie Goettel for Hennepin County
Interested in getting email updates from Debbie? Sign up below:
Debbie Goettel for Hennepin County committee, 6525 James Ave S, Richfield, MN 55423.
|
cc/2019-30/en_middle_0019.json.gz/line9874
|
__label__cc
| 0.636877
| 0.363123
|
10 interesting digital marketing statistics we’ve seen this week
By David Moth November 28th 2013 15:27
It’s Friday again, so here is a collection of statistics for you to enjoy.
This week it includes click-and-collect, live chat, online travel bookings, mobile privacy, Facebook ads, and ecommerce this Christmas.
And for more digital marketing stats, check out our Internet Statistics Compendium.
19% of multichannel sales come through click-and-collect
New research shows that one-in-five (19%) multichannel sales now comes from click-and-collect, up from 13% in the same period in 2012.
The figures are taken from IMRG/Capgemini sales data in Q3 2013 and show the importance of offering a click-and-collect service in the run up to Christmas.
Consumers prefer live chat for customer service
Live chat has the highest satisfaction levels for any customer service channel, with 73%, compared with 61% for email and 44% for phone.
The stats come from eDigital’s Customer Service Benchmark which surveyed 2,000 consumers on their experiences of various customer service channels.
There are only a smaller number of customers using this method (just 24% said they have used live chat in the past year), 73% of those that have are pretty happy with their experience.
Satisfaction with different customer service channels
113m visits to online retail sites predicted for Cyber Monday
Visits to UK retail websites are expected to reach 113m on Monday 2 December – known as the UK’s Cyber Monday.
Experian Hitwise has predicted that this December 400m hours will be spent shopping online by the UK internet population, a 7.5% year-on-year increase on December 2012 (372m hours)
The average consumer will spend 8 hours browsing, researching and buying Christmas presents online this December again a 7.5% year-on-year increase.
3bn visits will go to online retail websites in December 2013, representing 7% growth year-on-year – and the first time the UK will have reached this benchmark.
Consumers can save £30 a night on hotels by booking via online travel agents
Consumers can save an average of £30 a night by booking hotels through an online travel agent rather than directly through the hotel, according to research carried out by Top10.com.
Top10.com analysed a random sample of 100 three to five star hotels across the UK, Europe and the rest of the world, looking at the cost of booking a one-night stay on Saturday 7 December 2013.
The results revealed that consumers could make an average saving of 15% by booking through online travel agents such as Booking.com, Expedia.co.uk, Hotels.com and LateRooms.com.
And of the 100 hotels sampled in the survey, the online price was cheaper than the direct booking price 71% of the time. Only one hotel offered a cheaper rate by going direct.
Tablets double share of ad impressions and iPads surge ahead
Data from Q3 2013 released by Adfonic has shown that tablets have doubled their share of mobile ad impressions over the past year, and that within the tablet format, Apple’s iPad in particular gained share.
Tablets’ share of overall impressions grew from 14% in Q4 2012 to 28% in Q3 2013, while the iPad’s share of tablet impressions grew from 58% to 76% over the same period. This indicates growing iPad dominance within a growing format.
Adfonic also found that Apple increased its dominance over other manufacturers, with 41% share of mobile ad impressions in Q4 2012 growing to 63% in Q3 2013.
UK online retailers could lose £8.3bn in sales in 2013 due to slow websites
Websites that are slow to load pages will cost UK online retail £8.5bn in 2013, according to new research by Summit.
Looking at 230 of the leading retailers trading online shows that over 92% are failing to meet the industry’s three second page load benchmark, while some are running as high as eight seconds or more. For a retailer turning over £10m online, that means lost revenue of as much as £1m.
Average load times for all retailers across all pages were 4.11 seconds for the homepage, 4.08 seconds for site search, 4.25 seconds for category pages and 5.20 seconds for product pages.
Consumers concerned over mobile privacy
An IAB survey of 2,000 UK smartphone owners has found that nearly half (46%) of respondents feel concerned about their privacy when using the internet on their mobile phone.
However, the survey revealed that privacy concerns around advertising were secondary to concerns over companies having access to the content of personal text messages and financial information.
When asked, over half (54%) claimed to have taken steps to protect their personal data on their mobile phone. Measures such as deleting text messages (50%) and browser history (45%) are much more commonplace than those related to advertising – such as opting out of sharing data with 3rd party companies (23%) or opting out of tailored marketing messages (29%).
Ecommerce set to trump the high street this Christmas
According to a survey of 2025 people from ICM Research, more presents will be bought online than in stores this year, with online scooping more than half of anticipated gift spend (55%).
There are some differences by age group, with 25-54 year olds doing more of their shopping via the web than in stores. In fact only the 65+ age group will do more of their shopping in stores, and even for this group the figures are close: 48% of their expenditure on presents will be online, and 53% in shops.
Study shows that Facebook ads can boost paid search
Facebook advertising can help increase the impact of paid search campaigns by up to 30% according to new research from Kenshoo.
The study, which analysed recent paid search results for a leading retailer with more than 2,500 stores in the US, found that the combination of channels drove a 24% higher average value order and 7% higher CTR.
Digital predicted to lead UK ad recovery
UK advertising expenditure is forecast to rise 7% in 2013 according to new data from GroupM, twice as fast as its earlier projection in May.
Adspend for 2014 is anticipated to rise 6%, taking it to a total of £14.8bn, though that’s probably not very accurate based on GroupM’s previous success with predictions.
Digital spending is set to continue to increase its share of measured ad investment and would reach 44% in 2013, up from 40% a year earlier. Overall digital was forecast to rise 17% to £6.1bn.
Blog Advertising Christmas click and collect Customer Experience Ecommerce Facebook ads live chat mobile privacy Mobile online travel bookings Social
Blog Email
20 retailers integrating Pinterest into their email marketing
It’s not just casual Pinterest users making their own boards and pinning images, brands are fast discovering that sharing and adding pins to their own products can be an effective way to drive users to their ecommerce sites.
As of September 2013, the three year-old social channel has over 70m users, and according to a recent study Pinterest is driving more traffic to publishers than Twitter, LinkedIn, Reddit and Google+ combined.
Pinterest’s aesthetic style is also seeping into most corners of ecommerce. From eBay’s recent homepage overhaul, to Etsy’s vintage, bespoke world of homemade trinkets.
It’s this visual style that brands are realising is the key attraction for users on Pinterest. So how do brands let consumers know about their own presence on this burgeoning and increasingly integral channel?
Sony has recently began sending out dedicated emails highlighting Pinterest; integrating its own boards and pins into the email and driving traffic to its Pinterest page. Integrating Pinterest has led to a 70% higher average open rate for Sony, and an average 18% higher click-through rate.
How are other brands integrating Pinterest with their emails? Here are 20 examples:
Blog Copywriting
Marriott edges out Hilton and Accor in hotel site UX survey
Marriot International has come top in a usability report that includes eight of the world’s top hotel brands.
The report also looks at the onsite effectiveness and brand awareness of Holiday Inn, Radisson, Hilton Hotels, Best Western, Choice Hotels, Accor Hotels and Starwood Hotels.
As mentioned, Marriott International was the top performing hotel with an average score of 83%. Hilton came second with 81% while Accor came third with 78%. The overall average among all eight hotels was 64%.
Why brands and digital media owners must collaborate on creative
There’s huge creative potential when brand advertisers and media owners choose to collaborate. It’s astonishing how scarcely it seems to happen, especially given just how memorable such collaborations have typically been.
Take the first episode of zombie thriller The Returned on Channel 4 earlier this year. The programme was aired in its original French, with English subtitles, a first for mainstream drama on television.
With a brilliant touch, the first commercial break was also in French with English subtitles, and included spots by French brands such as Renault, Boursin and L’Oreal.
|
cc/2019-30/en_middle_0019.json.gz/line9887
|
__label__cc
| 0.588282
| 0.411718
|
How to achieve what QR codes promised, but couldn’t deliver
By Peter Tanham November 29th 2013 00:07
What was the year? 2009? 2010? QR codes were ‘the next big thing’. They had such great promise. Turn any print advertisement, packaging or promotional experience into a digital touchpoint.
Richer engagement. Richer analytics. But they never delivered. (Some people perpetually say ‘next year’ is the year for mass adoption).
But there is one technology that comes pre-installed on 100% of handsets and which can exceed both the engagement and analytics that QR codes promised.
The problem with QR codes
The biggest barrier is ubiquity. A majority of smartphones don’t come with QR code readers pre-installed.
Even for consumers who go get the app, the steps involved have massive drop off rates: finding the app, loading it and lining up the image to get it in focus.
Let’s face it, no real person knows what a QR code is or how to use it. You and I might, but we’re digital marketers.
Real people don’t.
Poor old QR codes.
How to achieve what QR codes promised
Luckily for us marketers, there is a great alternative technology out there that real people know how to use. That technology? SMS.
You’re about to press the back button or close the tab, but trust me on this one, this is SMS like you haven’t seen it before.
Imagine any use case you’ve ever seen for a QR code, but with an SMS call to action instead.
Like O2 Telefonica uses in its TV ad below.
(It’s worth noting that almost every mobile carrier uses SMS as their direct response call to action. They know a thing or two about mobile marketing)
But where SMS really excels these days is in auto-responding to SMS with a branded message and web link.
These links deliver the two key promises of QR codes (this is the most important part of the article):
Rich Experiences: SMS responses can link to signup forms, surveys, competitions, videos, maps, social sharing, click-to-call buttons and much much more. By adding an SMS call to action (instead of a QR code), every type of web engagement you can think of can now be delivered through print, outdoor, TV and radio.
Rich Analytics: With rich web experiences comes rich web analytics. Individual responses (for follow up and re-marketing) and real time location and device data can be tracked.
Don’t underestimate SMS
It may not be “the next big thing”, but here’s a quick refresher on SMS as a marketing too.
6bn text messages are sent every single day in the United States alone.
100% of smartphones sold today have the SMS app pre-installed.
The average American teenager sends a staggering 2,000 text messages sent every month.
When compared to a traditional web based call to action, SMS Direct Response campaigns received 325% more responses from consumers.
Attract TV viewers to your website
This case study shows how one business tried two calls to action on their TV ads.
One said “visit our website to enter the competition” and the other said “send an SMS to enter the competition”.
The SMS call to action generated 325% more entries than the web-based call-to-action, making up 52% of the total entries, though it ran in only 25% of the ads.
Now imagine that response rate on any future campaign you run.
Every single customer could get an SMS reply with a link to a signup form, an ecommerce purchase page, a PayPal donation button, a Facebook page.
Companies like SparkPage Media, Text Local and Mobile Commons make it very easy to set up campaigns like this.
SMS 2.0
When I first saw QR codes I was excited. They had a lot of promise. But, as is so often the case, they fell down at the details.
SMS was exciting too. It was widely adopted and had huge response rates. But with only 160 characters of text it was a limited channel.
The smartphone age is about to marry the promise of these two technologies.
That should make us very, very excited.
Blog Advertising analytics connected TV Data and Analytics Ecommerce Email and eCRM media Mobile qr codes shortcodes sms Video Advertising
Blog Conversion Rate Optimisation
Six common conversion killers from ecommerce sites
The wrong strategic approach can be costly for ecommerce sites, but many still make some fairly basic errors.
Try to avoid these six common errorss in your ecommerce site to avoid deterring customers and generate more conversions.
Blog Data and Analytics
How to create a custom report in Google Analytics
Custom reports are perhaps the most useful feature in Google Analytics, as they enable you to find the data and presentation that best suits your business goals.
I’m no big Google Analytics expert, instead I’ve picked it up and figured things out as I’ve gone along, mainly with the aim of understanding our users’ behaviour and improving this blog.
I explain more of my approach to measuring and optimising this blog here, but I wanted to provide a beginner’s guide to creating custom reports.
If this is too basic for you, or I’ve made any glaring errors, please forgive me (and put me right in the comments), but I hope this will be useful for you.
So here’s how to create a basic custom report from scratch…
ASOS nails Pinterest this Christmas
In the run up to Christmas 2013, it seems that online fashion retailer ASOS is the top UK brand on Pinterest, generating 1,728 shares per week.
These findings come from the latest study by Searchmetrics, based on the top ten UK retail sites.
Every company in the top 10 has set up its own official Pinterest page, largely as a result of the image based platform becoming the third biggest social network globally and increasingly responsible for driving traffic towards ecommerce.
ASOS has recently redesigned its homepage to put added emphasis on content marketing, and already has a strong cross-platform strategy when it comes to social.
Here’s some more stats that highlight ASOS’s success on Pinterest.
|
cc/2019-30/en_middle_0019.json.gz/line9888
|
__label__wiki
| 0.915945
| 0.915945
|
Millar Western closes northern Alberta lumber mill affecting 91 workers
The Edmonton-based, family-owned forest products company said current market conditions and the Boyle mill's cost structure have made the dimension lumber plant uneconomical to keep operating.
Bill Mah
About 50 km northwest of Wandering River, tree planters thrust White Spruce seedlings into the ground to replenish the forest harvested two years ago by Millar Western Forest Products. May 15, 2015. Video by Shaughn Butts
In the latest blow to Alberta’s resource economy, Millar Western Forest Products Ltd. is shutting down its Boyle sawmill indefinitely.
The Edmonton-based, family-owned forest products company said Friday current weak market conditions and the Boyle mill’s high cost structure made the dimension lumber plant uneconomical to keep operating. It plans to begin a phased closure, beginning in December and to be completed in February.
Ninety-one employees were given notice and will be offered severance compensation and other support.
“We recognize the impact this closure will have on our people, whose dedicated service has been very highly valued, as well as on our contractors, suppliers and the community of Boyle, whose support over the years has been greatly appreciated,” Millar Western president and CEO Craig Armstrong said.
The mill will gradually wind down operations gradually, Millar Western communications director Janet Millar said.
“The facility will continue to operate using existing log inventories and we will continue to process existing lumber inventories until both of those inventories are completed,” she said.
“Based on the existing log inventory at the Boyle facility now, they will continue to run the sawmill until late December. The planer mill portion of the facility will continue to run until late January and we’ll continue to sell product from the site probably until late February, if not early March.”
The company said it will monitor market conditions and reconsider the closure if circumstances warrant. Its Whitecourt and Fox Creek lumber and pulp operations continue to operate at full capacity. But the Boyle mill will be closed for at least a year because the company has suspended its log harvesting for the plant. “We’ll continue to look at every opportunity to secure Boyle’s future, but the seasonal nature of our business is that you determine if you can go and do the harvesting, which is a winter-based activity,” Millar said.
“We had to decide under current market conditions that it would not be viable to bring in a log supply for this year, so that means that the shutdown would have to last for a minimum of a year because there will be no timber supply brought on-site for the mill.”
Operating costs at the Boyle facility are higher than Millar Western’s other plants because of a longer hauling distance between the mill and its timber supply. “Right now, lumber markets are weak. It’s something that lower-cost facilities like our Whitecourt and Fox Creek operations can sustain,” Millar said.
“We do anticipate better times ahead, but unfortunately it’s not something that the Boyle operation was able to get through at this time.”
The plant produces dimension lumber such as two-by-fours, two-by-sixes, two-by-10s used in residential and commercial construction.
Meet the ‘industrial athletes’ who replant Alberta’s forests
Bob Clark, mayor of the Village of Boyle, said the community of 950 will be hit hard by the closure of the area’s biggest employer.
“It’s 10 per cent of our population,” Clark said.
“It’s going to not only impact the village as far as taxes and utility purchases, but it will impact every store in town as well because those folks that work there will have to make adjustments in their lives and lifestyle. They’ll have less dollars to spend and it will impact every facet of the community.”
The mill closure could cost the municipality a quarter of a million dollars over a year in lost property taxes and other revenues, he said. Many residents in the Boyle area, 145 km northeast of Edmonton, commute to work in Fort McMurray, which is itself grappling with the toll of low oil prices.
“There’s going to be whole lot of people sitting back wondering about their future over the holidays, that’s for sure,” Clark said.
Paul Whittaker, president and CEO of the Alberta Forest Products Association, said the closure of the Boyle mill is likely an isolated case and he doesn’t foresee more shutdowns.
“There’s nothing in the market fundamentals that would suggest that any mill is in trouble whatsoever,” Whittaker said. “I think this company would tell you that this is a unique set of circumstances attached to this one particular mill and their wood supply.
The Alberta forestry industry has been doing relatively well in recent years, but “we have seen a bit of a stall-out in the last few months. The prices aren’t where they could be or should be, particularly in our key US market,” Whittaker said.
An anticipated surge in demand from the U. S. hasn’t materialized, he said. “We’ve been strong and we have long-range strength in the industry, but at the moment, the markets are soft.”
Millar Western announced an $8-million modernization of the lumber mill in Boyle in 2004. The company acquired the plant from Weyerhaeuser Canada Ltd. in 1993.
bmah@edmontonjournal.com
twitter.com/mahspace
Gary Lamphier: Without Alberta, where will Canada's new jobs come from? Nova ordered to cease drilling at northern Alberta river site
FP Watchlist & Alerts
Never miss a beat on stocks, mutual funds, and ETFs with customized Watchlist and Email Alerts. Sign up now.
Set up your Watchlist now
Adjust your FP Email Alerts
|
cc/2019-30/en_middle_0019.json.gz/line9889
|
__label__wiki
| 0.796155
| 0.796155
|
Boeing’s Autonomous Electric Passenger Drone Completes First Flight
Boeing has officially released a statement reporting the successful flight of its prototype autonomous passenger air vehicle which completed a controlled takeoff, hover and landing during the test conducted in Manassas, Virginia, about 30 miles southwest of Washington D.C.
Boeing also revealed that the model is designed for fully autonomous flight, with a range of as much as 50 miles and is propelled by electricity. Boeing’s flying car designed to whisk passengers over congested city streets and dodge skyscrapers completed its first test flight offering a peek into the future of urban transportation the aerospace giant and others are seeking to reshape air mobility.
Boeing’s urban air mobility arm, Boeing NeXt, enlisted their subsidiary Aurora Flight Science to design and develop the prototype. Projects of Aurora Flight Sciences include a new flying taxi it is developing with Uber Technologies. Boeing NeXt’s portfolio also includes a fully electric cargo air vehicle – designed to transport as much as 500 pounds – which completed its first indoor flight last year and is scheduled for outdoor testing this year.
The Boeing statement also mentioned future flights of the 30-feet-long and 28-feet-wide PAV prototype and the transition phase between vertical and forward-flight modes. The company will continue testing to advance safety and reliability of the aircraft, the statement further added.
BREAKING: It’s another first for us. Along with @AuroraFlightSci we’ve successfully tested our passenger air vehicle. We continue our progress towards a safe and sustainable urban mobility ecosystem. #TheFutureIsBuiltHere pic.twitter.com/hwuw4d5jmz
— The Boeing Company (@Boeing) January 23, 2019
Describing the Premiere as a milestone Boeing’s chief technology officer Greg Hyslop stated, “Within a year, we came from the concept Design to a flying prototype.” The US group acknowledged that the biggest challenge with the Transition to the application of various kinds of Flight was imminent.
This development has definitely heated up the competition for other players in the field. For instance- Vahana, the self-piloting air taxi developed by A3, Airbus’s tech-centric Silicon Valley outpost, completed its first test flight last year. Intel and EHang are also testing their flying vehicles. Also arch rival Airbus or a helicopter, specialist Bell, as well as German Start-ups such as Volocopter and Lilium are working on concepts for Autonomous passenger aircraft.
Most of the air taxi prototypes which are currently being researched resemble over-sized drones that are capable of carrying only a few passengers. Skeptics maintain opportunities are limited given high regulatory hurdles. However market analyses from Morgan Stanley’s most optimistic estimate predict that air transport technology could lead to a $2.9 trillion industry by 2040, while their most pessimistic view pegs the value at about $615 billion.
It is still unclear when flight taxis will be allowed and whether they could assert themselves ever in public transport. But given the extensive ongoing trials and projected market growth, these air taxis are not far from becoming a reality and a common sight in traffic congested cities across the globe.
Cite this article as: Phillip Smith, "Boeing’s Autonomous Electric Passenger Drone Completes First Flight," in DroneBelow.com, January 25, 2019, https://dronebelow.com/2019/01/25/boeings-autonomous-electric-passenger-drone-completes-first-flight/.
Singapore Gets Tough on Drones
A Drone Fueled Industry and Agricultural Revolution
Related Topics:Aurora Flight Sciences, autonomous, Aviation, Boeing, Electric, Electric Vehicle, Featured, Passenger Drone
More in Autonomous
New App to Guide Drones via SMS
According to a press release a unique Smartphone app is being developed by researchers at Cranfield...
Wing Launches OpenSky Drone Flying Platform
By Phillip Smith July 10, 2019
After graduating from Google X last year, drone delivery service Project Wing has come a long...
Advances in Robotics, AI, and Data Science are affecting the human journey as never before. Several...
Uber and Volvo Cars Unveil New Self-Driving XC90 Car
By Vidi Nene June 14, 2019
Sweden-based automotive manufacturer Volvo and California-based ride-hailing giant Uber have unveiled its production vehicles ready for...
|
cc/2019-30/en_middle_0019.json.gz/line9893
|
__label__cc
| 0.746047
| 0.253953
|
Microsatellite markers for Eucalyptus pilularis (Subgenus Eucalyptus); sourcing genetic markers outside the subgenus
Mervyn Shepherd, Southern Cross UniversityFollow
C Bihua
Robert J. Henry, Southern Cross UniversityFollow
Shepherd, m, Bihua, C & Henry, RJ 2013, 'Microsatellite markers for Eucalyptus pilularis (Subgenus Eucalyptus); sourcing genetic markers outside the subgenus', Silvae Genetica, vol. 62, no. 4-5, pp. 246-256.
Microsatellite markers remain the most broadly used molecular marker in eucalypt genetics. A major advantage of microsatellite markers is that they often transfer readily between related taxa circumventing the need to develop new markers de novo in each species. Markers have been developed for a number of species of major economic importance, mainly from the Subgenus Symphyomyrtus, but these may also be available for use in species of lesser economic importance from other subgenera. Here we report on the sourcing of microsatellite markers for E. pilularis (Subgenus Eucalyptus (Formerly Monocalyptus)) from species outside the subgenus. Ninety-seven precent (60 out of 62) of loci that amplified in the source taxon (E. grandis) also amplified in the target taxon E. pilularis. By characterising them on a diversity panel (n=24) and a pedigree, a subset of 41 loci were distilled out that could be scored reliably and were polymorphic (Mean unbiased heterozygosity= 0.81). Predictions of efficient microsatellite marker transfer among eucalypts based on low evolutionary divergence have largely been borne out and are congruent with accumulating evidence of low sequence divergence within Eucalyptus. Upon this favourable background for microsatellite marker transfer, this study indicates highly efficient transfer is possible by identifying loci with broad PCR optima and adoption of approaches that favour cross-species transfer.
|
cc/2019-30/en_middle_0019.json.gz/line9897
|
__label__wiki
| 0.976663
| 0.976663
|
Faith & Spirit
Lifestyled By April Watts
Interactive One Women
Copyright © 2019 Interactive One Women, LLC.
Jamie Foxx Cast As Black Panther Leader Geronimo Pratt In New Film
The film reunites Foxx with his "Ray" director Taylor Hackford.
Danielle Jennings
Jamie Foxx has big shoes to fill with his next film role, as the Academy Award-winning actor is set to portray Black Panther leader Geronimo Pratt in a new film.
Source: Gilbert Carrasquillo / Getty
Fresh off executive-producing the Showtime comedy series White Famous, Jamie Foxx has added another job to his resume with a starring role in the upcoming as-yet-untitled drama film centering on the Signal Hill police brutality court case.
Foxx will portray controversial Black Panther leader Geronimo Pratt, the cast also features Anthony Mackie as Johnnie Cochran and Elizabeth Banks as investigative reporter Mary Neiswender, as reported by Shadow and Act.
The details about the events portrayed in the film are below:
Years before he represented the likes of O.J. Simpson, Cochran represented Pratt, a Black Panther party leader and Vietnam vet. He helped overturn a conviction that would have sent him to jail for 27 years, including settling a false imprisonment suit.
The Signal Hill case revolves around Ron Settles, a Cal Star Long Beach football standout who was picked up for speeding and after his arrest, was found hanging in his cell. While the police called suicide, an autopsy showed that was choked to death. It is unknown who will portray Settles.
The film is still in the early stages, so there is no release date scheduled. The project also reunites Jamie Foxx with his Ray director Taylor Hackford, who will serve as the producer and director of this drama.
Check out today’s Top Stories here:
Laverne Cox Gives Us Perfect Prep Chic At The CFDA/Vogue Fashion Fund Show And Tea Party
Massachusetts Mother Outraged After School Shaves Daughter’s Hair Off Without Permission
Jamie Foxx Cast As Black Panther Leader Geronimo Pratt In New Film was originally published on hellobeautiful.com
Also On Elev8:
SIGN UP FOR THE ELEV8 NEWSLETTER
|
cc/2019-30/en_middle_0019.json.gz/line9904
|
__label__wiki
| 0.743205
| 0.743205
|
Limit my search to Chromosomes and Gene Expression
Dissecting the sharp response of a canonical developmental enhancer reveals multiple sources of cooperativity
Jeehae Park,
Javier Estrada,
Gemma Johnson,
Ben J Vincent,
Chiara Ricci-Tam,
Meghan DJ Bragdon,
Yekaterina Shulgina,
Anna Cha,
Zeba Wunderlich,
Jeremy Gunawardena,
Angela H DePace ,
Harvard Medical School, United States;
Developmental enhancers integrate graded concentrations of transcription factors (TFs) to create sharp gene expression boundaries. Here we examine the hunchback P2 (HbP2) enhancer which drives a sharp expression pattern in the Drosophila blastoderm embryo in response to the transcriptional activator Bicoid (Bcd). We systematically interrogate cis and trans factors that influence the shape and position of expression driven by HbP2, and find that the prevailing model, based on pairwise cooperative binding of Bcd to HbP2 is not adequate. We demonstrate that other proteins, such as pioneer factors, Mediator and histone modifiers influence the shape and position of the HbP2 expression pattern. Comparing our results to theory reveals how higher-order cooperativity and energy expenditure impact boundary location and sharpness. Our results emphasize that the bacterial view of transcription regulation, where pairwise interactions between regulatory proteins dominate, must be reexamined in animals, where multiple molecular mechanisms collaborate to shape the gene regulatory function.
Building an organism from scratch requires genes to be switched on or off at precisely the right time, in the right place, and at the right level. Enhancers are stretches of DNA that work as switches to turn on target genes. For instance, in the front part of fruit fly embryos, the P2 enhancer switches on a gene called Hunchback, which is crucial for development.
A number of molecular actors, including proteins called transcription factors, work together to turn on genes by interacting with enhancers. Genes like Hunchback can turn on suddenly, even though they are controlled by transcription factors whose levels are changing gradually: in other words, if Hunchback were controlled by a light switch with a dimmer, the light would suddenly come on as the dimmer was gradually moved up. For enhancers, the question is how transcription factors interact with DNA to convert a gradual input into an abrupt, sharp switch. A commonly accepted view is that Hunchback is turned on when molecules of a transcription factor called Bicoid help each other to bind to multiple binding sites on the P2 enhancer.
Park et al. investigated this mechanism by examining how the Hunchback gene responded to changes in the sequence of the P2 enhancer, and to changes in the levels of regulatory proteins that bind to it. The resulting observations were then compared to mathematical models that simulate turning on Hunchback under different conditions. The experiments revealed that, in fact, switching on Hunchback requires more than Bicoid proteins helping each other to bind on the P2 enhancers. Molecules other than Bicoid were also needed, and the cell also potentially had to burn energy.
Variations in the sequence of enhancers are linked to evolution of new species but also to problems in development or even diseases such as cancer. Understanding precisely how these sequences turn on genes will give us insight into which types of changes are important for disease and evolution.
During development, multicellular organisms control cell differentiation by expressing genes in intricate patterns in space and time. These patterns are achieved by interactions between regulatory proteins and DNA, which convert incoming signals into transcription of mRNA; we refer to the quantitative relationship between the concentrations of transcription factors and the rate of mRNA, or protein, expression in steady state as the Gene Regulatory Function (GRF). Many GRFs for developmental genes are highly non-linear; they convert graded inputs to sharp, step-like outputs. A key mechanistic question is therefore how a sharp GRF is encoded in the regulatory DNA sequence and the interactions of proteins that regulate it.
In animals, gene expression patterns are controlled by enhancers, regulatory DNA comprised of multiple binding sites for transcription factors (TFs) (Long et al., 2016; Spitz and Furlong, 2012). The canonical model of how an enhancer gives rise to a non-linear GRF focuses on pairwise cooperative TF binding to these sites (De Val et al., 2008; Jolma et al., 2015; Panne et al., 2007; Rodda et al., 2005; Struhl, 2001), an idea that first emerged to explain gene regulation in phage lambda (Johnson et al., 1979) and has since been widely applied to other systems including eukaryotes. For example, the Drosophila melanogaster Hunchback P2 enhancer (HbP2) drives a highly nonlinear GRF in response to the transcriptional activator Bicoid (Bcd) in the early embryo; it has long been thought that the nonlinearity arises from pairwise cooperative binding of Bcd to six DNA binding sites in the enhancer (Burz et al., 1998; Driever et al., 1989; Ma et al., 1996; Struhl et al., 1989). Eukaryotic TFs can indeed influence each other’s binding through direct protein-protein interactions (for Bcd examples include (Burz et al., 1998; Burz and Hanes, 2001; Lebrecht et al., 2005), and this observation led to substantial efforts to find a ‘cis-regulatory code’ where the position, orientation and affinity of TF binding sites can predict the output of a given enhancer (Yáñez-Cuna et al., 2013). However, such a code has remained elusive (Catarino and Stark, 2018), indicating that there are likely additional molecular mechanisms contributing to non-linear GRF formation.
In addition to direct protein-protein interactions between TFs, there are many ways that TFs can cooperate indirectly, especially in eukaryotes (Gertz et al., 2009; Spitz and Furlong, 2012). The eukaryotic transcriptional machinery involves not only TFs, but also chromatin remodeling machinery, and cofactors that relay information about TF binding to the basal transcriptional machinery (Allen and Taatjes, 2015; Hargreaves and Crabtree, 2011; Levine, 2010; Wang et al., 2013; Zentner and Henikoff, 2013). Thus cooperativity between TFs can potentially arise indirectly through any mechanism that facilitates subsequent TF binding, or through synergistic activation of the basal transcriptional machinery. Indirect mechanisms that can affect TF binding include collaborative cooperativity, where TFs each affect nucleosome binding or modification state (Mirny, 2010; Voss et al., 2011), TFs co-binding to a co-factor complex (Allen and Taatjes, 2015; Borggrefe and Yue, 2011; Wang et al., 2013), TFs altering the topology of DNA (Courey, 2001) or TFs increasing the effective local concentration of other proteins (Landman et al., 2017). Indirect mechanisms that do not rely on facilitating TF binding include synergistic activation of the basal transcriptional machinery through multiple allosteric interactions (Nussinov et al., 2013), or synergy through activation of multiple steps in the transcription cycle (Coulon et al., 2013; Duarte et al., 2016; Govind et al., 2005; Herschlag and Johnson, 1993; Scholes et al., 2017).
We recently used mathematical theory, grounded in molecular biophysics, to explore the mechanisms underlying nonlinear GRFs generated by a single activating TF, inspired by the example of HbP2 activation by Bcd (Estrada et al., 2016b). GRFs are often characterized by fitting experimental data to a Hill function, which parameterizes the shape of a GRF in terms of three parameters (below) but does not give any mechanistic or biophysical insight into how the GRF arises (Engel, 2012; Weiss, 1997). The GRF of early anterior Hunchback expression with respect to Bcd fits a Hill function with coefficient 5–6. It is often informally assumed that this can be explained in terms of pairwise cooperative binding of Bcd to six sites in HbP2, with the Hill coefficient matching the number of sites (Burz et al., 1998; Driever et al., 1989; Gregor et al., 2007; Lopes et al., 2005; Ma et al., 1996). We used our mathematical theory to prove that this assumption is unfounded, providing further evidence that additional mechanisms are required to fully explain the response of HbP2 (Xu et al., 2014; Singh et al., 2005; Fu et al., 2004). We showed that if there are n binding sites for a transcriptional activator, the GRF can reach a Hill coefficient of nearly n only through two non-exclusive mechanisms: either there is ‘higher-order’ cooperativity, through which binding of a TF to one site can be influenced by multiple other sites, or there is energy expenditure which maintains the regulatory system away from thermodynamic equilibrium.
In this study, we experimentally probe the mechanisms underlying the shape of the HbP2 GRF using quantitative experiments and compare the results to our previously developed theory. We created a number of variants of HbP2, where we changed the number of Bcd binding sites and the background sequence of HbP2; we measured the resulting GRFs using quantitative imaging of reporter constructs in embryos. A synthetic version of HbP2 containing only Bcd binding sites indicates that other TFs play a role in determining the anterior/posterior position of the GRF. We perturbed the concentration of multiple transcriptional cofactors using RNAi and found that cofactors can also affect the shape of the HbP2 GRF, both in terms of the anterior/posterior position of expression and the steepness of the curve. Finally, we compared our experimental results to theoretical predictions for HbP2 and its variants; this comparison confirms our previous conclusion that higher cooperativity and/or energy expenditure are required to achieve the sharp response of HbP2 to Bcd. Together, our results demonstrate that the shape of the non-linear HbP2 GRF is determined by multiple underlying molecular mechanisms which can be regulated independently and collectively by distinct inputs.
The HbP2 reporter system
Our study focuses on a canonical developmental enhancer, HbP2, that drives expression of hunchback (hb) in the Drosophila melanogaster blastoderm embryo. The anterior expression of hb is set by three enhancers: HbP2, which is promoter-proximal, a distal shadow enhancer and a distal stripe enhancer (Figure 1). HbP2 drives early expression of hb at nuclear cycle 14, while the shadow enhancer and stripe enhancer contribute to expression at later times (Perry et al., 2012; Perry et al., 2011). Many studies have correlated in vivo hb expression (using either hb mRNA or protein) to HbP2 sequence features without accounting for these other enhancers (Gregor et al., 2007; Duarte et al., 2016; Lopes et al., 2012); this approach is only valid when analysing early timepoints when HbP2 is active and the others are not, and even then may suffer from errors. To control for this complexity, we isolated HbP2 in a reporter construct consisting of HbP2 and the native hunchback promoter driving expression of lacZ (hereafter called WTHbP2). This construct is the basis for our permuted enhancers, including Bcd binding site deletions and synthetic hbP2 constructs (SynHbP2 plus variants thereof). We inserted all reporter constructs into the attP2 landing site on chromosome 3LT via PhiC31 integrase-mediated transgenesis (see Materials and Methods).
The WTHbP2 enhancer directs a sharp expression pattern in the Drosophila blastoderm embryo.
(A) Schematics of the hunchback (hb) gene locus showing the three enhancers active in the blastoderm (top) and our reporter construct designed to express lacZ mRNA from the proximal enhancer (HbP2) and hb native promoter. HbP2 has six foot-printed Bicoid binding sites (bottom). (B) (top) A Drosophila melanogaster blastoderm embryo at nuclear cycle 14 stained for Bicoid (Bcd) protein and hb mRNA; image is a maximum projection of z-stack. (bottom) The average Bcd protein and hb expression profiles along anterior-posterior (AP) axis measured at midsagittal plane; data from six embryos. Average is represented by the thick line, standard deviation is shown by the shaded area. (C) GRFs for hb mRNA and WTHbP2-reporter expression profiles. Expression of hb or LacZ along the anterior posterior axis is plotted on the left; hb or LacZ expression relative to Bcd concentration is shown on the right. Colors represent individual embryos. Lines on the left are extracted expression traces. On the right, each dot is a measured mRNA level and lines represent fits to the Hill function. From these data, we computed the Hill coefficient (nH), which reflects the shape of the curve, and generalised Michaelis-Menten constant (gMM) which reflects the location of the expression boundary along the anterior/posterior axis.
To visualize the activity of our reporter constructs via expression of LacZ, we fluorescently stained fixed embryos using in situ hybridization against LacZ (see Materials and Methods). We measured the Bcd expression profile using fluorescent immunostaining, both separately and in embryos co-stained for LacZ mRNA (see Materials and Methods). We imaged entire embryos using 2-photon microscopy and parsed image stacks into cellular resolution pointclouds using a semi-automated pipeline (see (Fowlkes et al., 2011; Fowlkes et al., 2008) and Materials and Methods). Full 3D images of embryos are particularly useful for alignment, which reduces error due to dorsal ventral variation in the hb expression pattern. We gathered data from the earliest stages of nuclear cycle 14 when HbP2 is active. In subsequent figures, we present a subset of this full 3D dataset for simplicity; we show a lateral trace along the anterior-posterior (AP) axis (Figure 1A). Full cellular resolution data are available for download from Figshare (https://doi.org/10.6084/m9.figshare.8235491.v1 [1]).
To analyze the relationship between Bcd concentration and transcription driven by HbP2, we extract the gene regulatory function (GRF) relating these two quantities. The Bcd gradient is highly reproducible from embryo to embryo (Gregor et al., 2007); we therefore plot the average Bcd protein profile from six embryos against the LacZ expression profile from individual embryos stained for LacZ mRNA driven by the HbP2 reporters. We chose to analyze individual reporter output against the average Bcd profile for two reasons. First, by obtaining an average Bcd profile once and using it as a standard, our embryos can be stained either for protein or RNA, but not both; incompatibilities between in situ hybridization (to detect LacZ) and immunostaining (to detect Bcd protein) lead to noisier data than staining for either alone. Second, we can detect if our perturbations affect variability in expression pattern between individual embryos, which would otherwise be masked in average to average fitting which is commonly used (Gregor et al., 2007; Lopes et al., 2012).
For convenience of analysis, we will describe the shape of our GRFs by fitting lateral traces to a Hill function of the form,
E = Emax [Bcd]nH/ (KanH+[Bcd]nH)
Here, E is the hb mRNA expression level in steady state, in arbitrary units, with Emax being its maximal value. The Hill coefficient, nH, is a measure of how sharply the GRF changes, while the parameter Ka gives the concentration at which the expression level becomes half-maximal and determines the location of the GRF on the anterior-posterior (AP) axis of the embryo. We will refer to Ka as the ‘generalised Michaelis-Menten constant’ (gMM constant), as it reduces to the well-known Michaelis-Menten constant when the GRF becomes a hyperbolic function with a Hill coefficient of 1. As noted above, the Hill function gives little biophysical insight but it offers a widely-used measure of shape. We will later interpret the shape of the GRF in terms of the mathematical theory that we introduced previously, from which we will draw more mechanistic conclusions.
We measure a Hill coefficient for the endogenous hb mRNA expression pattern of 6.2 +/- 1.1, which corresponds with other reports in the literature (Gregor et al., 2007; He et al., 2011; Lopes et al., 2012). For WTHbP2, the Hill coefficient is 5.2+/- 0.3, indicating that HbP2 enhancer alone can drive sharp expression comparable to expression from native hb locus. The boundary position for the HbP2 pattern (gMM = 0.072 ± 0.011) is also comparable to that of the endogenous hb (gMM = 0.063 ±0.011).
HbP2 variants do not adhere to the classical hill function model
A common assumption based on Hill fits to the endogenous Hb mRNA pattern is that Bcd binds cooperatively to 6 Bcd binding sites in HbP2 and that this gives rise to a Hill coefficient of ~6; more generally this model states that cooperative binding at n sites gives rise to a Hill function with coefficient nH = n. A concrete test of this hypothesis is to measure the GRF when Bcd binding sites are removed from WTHbP2 where this ‘classical Hill function model’ predicts two outcomes. First, removing all Bcd binding sites from HbP2 should eliminate expression. Second, deleting individual Bcd binding sites should lead to a progressive, integral decrease in the Hill coefficient. We tested the classical Hill function model by mutating individual Bcd binding sites in the WTHbP2 reporter and measuring LacZ expression. We deleted each Bcd binding site in series starting from the distal end relative to the promoter (Figure 2A).
Sequence variants of HbP2 contradict the classical Hill function model.
(A) (left) Schematics of hbP2-reporter constructs with Bcd binding sites sequentially removed by mutation to preserve the length of the construct. (center) mRNA expression profiles obtained from embryos that carry transgenic reporter constructs shown on the left. (right) GRF of Bcd to LacZ level from each constructs. Dots represent measured mRNA value and lines show a fit to Hill function. (B) From these data, we computed the Hill coefficient (nH), which reflects the shape of the curve, and generalised Michaelis-Menten constant (gMM) which reflects the location of the expression boundary along the anterior/posterior axis. The mRNA expression level at maximum (Emax) was measured for subsets of constructs using a co-stain method (Wunderlich et al., 2014). These quantities are plotted against the number of Bcd binding sites in each construct. (C) (left) Schematics of mutant hbP2 constructs where 1, 2, or 3 Bcd binding sites were removed at different positions. (center) Average expression profiles for each construct on the left. Colors are as indicated. Average is represented by the thick line, standard deviation is shown by the shaded area. We extracted both gMM and nH from these data by comparing Bcd input to the LacZ expression profile for each reporter construct. These analyses reveal that different Bcd binding sites have roughly equal contributions to the HbP2 GRF.
First, eliminating all 6 Bcd binding sites does not abolish expression. This indicates that other binding sites, either for Bcd or other TFs, contribute to HbP2 expression, which has been previously argued in the literature (Chen et al., 2012; Holloway and Spirov, 2015; Liu and Ma, 2013; Mito et al., 2006; Xu et al., 2014). We analyzed the sequence of HbP2 and hb native promoter and found two predicted binding sites for Bcd. Removing these additional sites further reduced gene expression level, however it did not completely abolish it (Figure 2—figure supplement 1). Second, while the Hill coefficient does decrease as Bcd sites are removed, it only decreases by ~0.5 for each site removed. Removing Bcd binding sites also decreases the gMM constant and shifts the expression of HbP2 toward the anterior. Together, these results indicate that the assumption that Hill coefficient follows a one-to-one relationship with the number of binding sites in the enhancer is wrong, as we would have predicted from our biophysical model.
A common question is whether individual Bcd binding sites contribute differently to the WTHbP2 GRF. Of the six Bicoid binding sites, three are strong affinity sites (sTFBSs) and three weak affinity sites (wTFBSs). wTFBSs are clustered together at the center of WTHbP2 while sTFBS are located on the flanks with varying distance to the nearest Bcd binding site (13 bp to 106 bp, center to center). The role of these individual sites has been investigated in terms of pairwise interactions between Bcd molecules in vitro (Ma et al., 1996) and in yeast (Burz and Hanes, 2001), where binding is influenced by the location and orientation of the sites. The role of individual binding sites in embryos has been explored, but without quantitative imaging (Driever et al., 1989), making the effects difficult to discern.
We also did limited experiments to test whether the affinity or location of the weak and strong Bcd binding sites influences the WTHbP2 GRF in our reporter construct. To compare the effect of weak and strong Bcd binding sites, we deleted single binding sites with different affinities (Figure 2C). In all cases, removing a Bcd binding site decreased the Hill coefficient by ~0.5 indicating that this parameter was not disproportionately affected by any particular site. The gMM constant also decreased sequentially upon TFBS removal without distinctive dependence on any particular single site. To test whether the cluster of weak Bcd binding sites has a disproportionate effect on sharpness, we deleted sets of two and three binding sites, either all in the central cluster or not. We found removing Bcd binding sites from the central cluster differentially affects both the gMM constant and the Hill coefficient, with the central cluster having a moderately larger effect on the gMM but the differences are within error (Figure 2C). Together, these results indicate that all six binding sites contribute roughly equally to GRF shape, despite variations in affinity and position, which was also observed in other work (Smith, 2015).
Bcd and other transcription factors contribute to expression driven by HbP2
HbP2 contains predicted binding motifs for TFs other than Bcd, including Hb itself and the pioneer factor Zelda (Figure 3A). To test if these other binding sites contribute to the WTHbP2 GRF, we created a synthetic HbP2 enhancer (synHbP2). This sequence maintains the endogenous Bcd binding sites in place but replaces the intervening sequences with computationally designed ‘neutral sequences’; these neutral spacers are devoid of motifs for 11 TFs known to regulate even-skipped that are expressed in the blastoderm (Bcd, Cad, dStat, D, Gt, Hb, Kni, Kr, Nub, Tll, Zld) (Estrada et al., 2016a). We chose this limited list because designing sequences lacking motifs for all 37 TFs expressed in the blastoderm is technically intractable and often results in highly repetitive sequences. Bcd is a homeodomain protein and these are sensitive to DNA shape dictated by sequence outside of the core binding motif (Dror et al., 2014). We therefore made constructs with various amounts of endogenous sequence flanking each Bcd site. Robust expression requires 7 bp of endogenous sequence flanking each Bcd binding site; using only the 7 bp core Bcd binding motif, or motifs flanked by 2 bp did not drive robust expression (Figure 3A, right).
Synthetic HbP2 enhancer reveals the contribution of Bicoid and other transcription factors to the shape and location of expression.
(A) Schematics of WTHbP2 illustrating the location and affinity of predicted binding sites for Bicoid (Bcd, dark blue), Hunchback (Hb, green), Zelda (Zld, red), Tailless (tll, grey) and Krüppel (Kr, light blue), and SynHbP2 where these other sites have been replaced by a computationally designed synthetic DNA backbone. In SynHbP2, Bcd binding sites are preserved in their native position and flanked by differing amounts of endogenous DNA. SynHbP2 constructs containing Bcd binding sites without endogenous flanking sequences did not express (data not shown); adding back native sequence (+2 bp or +7 bp) flanking Bicoid TFBS restored expression (right). (B) SynHbP2 expresses in an anteriorly shifted position, but with a comparable shape. On the left, we compare the expression driven by WTHbP2 to expression driven by SynHbP2 with 7 bp flanks (hereafter SynHbP2) along the anterior posterior axis. On the right, we convert the data into the Bcd/LacZ GRF and extract nH and gMM as previously described. (C) We depleted Hunchback and Zelda from blastoderm embryos using RNAi to test their role in regulating WTHbP2. We show the average LacZ expression profiles from RNAi treated embryos (left column, thick line is the average over eight embryos, shaded area indicates standard deviation), the Bcd/LacZ GRF (center column), and the fit of the GRF to a Hill function to extract nH and gMM (right column). For reference, nH and gMM for WTHbP2 are 5.2 ± 0.3 and 0.072 ± 0.011, respectively.
SynHbP2 drives expression comparable to WTHbP2, with a similar Hill coefficient but at an anteriorly shifted location in the embryo, corresponding to an increased gMM constant (Figure 3B). These results indicate that Bcd alone can mediate sharp expression but that other TFs, such as Hb and Zelda may affect the gMM constant and the location of the GRF along the AP axis. To further test the role of Hb and Zelda in mediating a sharp response from HbP2, we knocked down expression of Hb and Zelda in trans using RNAi (Figure 3C). Our RNAi strategy specifically knocks down the maternal contribution of these proteins (see Materials and Methods) (Staller et al., 2013). If SynHbP2’s anterior shift is due to missing activity from Hb or Zelda, we expect similar anterior shifts in WTHbP2 expression when depleting these proteins in trans. Indeed, knock-down of hb and Zelda shifted the location of expression by 8% and 5% anteriorly along the AP axis without distinctive changes in the steepness of the response (nH(hbRNAi)=5.9 ± 0.6, nH(Zelda RNAi)=5.8 ± 0.9). Previous studies have noted an anterior shift in HbP2 expression when Zelda or Hb are perturbed, although the GRF was not quantitatively analysed (Xu et al., 2014). Our results confirm and quantitate this anterior shift, and reveal the differential influence of these perturbations on the steepness and location of the boundary.
To test how the GRF depends on the number of Bcd binding sites in SynHbP2, we deleted Bcd binding sites individually from the distal end, as we did for WTHbP2 (Figure 3—figure supplement 1). Removing Bcd binding sites from SynHbP2 shifted the boundary position further toward the anterior and reduced boundary steepness as observed with WTHbP2, demonstrating that the individual Bcd binding sites are functionally contributing to the GRF when in the synthetic background.
Mediator and chromatin remodelers influence the shape of the HbP2 gene regulatory function.
Cooperativity can arise through a wide variety of potential molecular mechanisms, including chromatin remodeling or modification, or binding to a multi-valent cofactor such as Mediator. We therefore perturbed the expression of 12 transcriptional cofactors and known (or potential) interactors of Bcd using RNAi, and measured the effect on the WTHbP2 GRF (Table 1, Table 2). We knocked down the maternal expression of these factors using shRNAs available through TRiP (https://fgr.hms.harvard.edu/fly-in-vivo-rnai), and using the Gal4/UAS system (Staller et al., 2013). We observed significant effects for 5 of 12 target genes, see Materials and Methods and described below. Note that negative results in this experiment are not necessarily informative, as RNAi lines may not result in sufficient knockdown to observe a phenotype.
List of shRNA lines
Target gene name
TRiP ID
# of embryos
Nejire (CBP) HMS01570 8
Bin1/SAP18 GL00127 8
Sin3A HMS00359 13
HDAC6 HMS00077 2
Mediator complex subunit 1 HMS01139 9
Mediator complex subunit 11 HMS01094 7
Mediator complex subunit 20 HMS01051 12
Vielfaltig (Zld) HMS02441 7
hunchback GL01321 11
Number of Embryos Imaged
Reporter contructs
Endogeous hb 6
WThbP2 6
WThbP2 (5TFBS) 10
WThbP2 (3TFBS) 7
WThbP2 (Δ1b) 11
SynHbP2 (2 bp) 4
SynHbP2 (7 bp) 15
SynHbP2 (12 bp) 10
SynHbP2 (12 bp, 4TFBS) 15
We hypothesized that chromatin remodelers might modulate the accessibility of regulatory DNA, and therefore influence the sensitivity of the WTHbP2 GRF to Bcd concentration and thus to the location of expression along the AP axis. For example, Creb Binding Protein (CBP) a histone acetyl transferase and the Drosophila ortholog of p300 (Fu et al., 2004), is known to destabilize chromatin and facilitate chromatin opening (Chan and La Thangue, 2001). CBP is also reported to be an enhancer-dependent co-activator of Bcd, facilitating its activation in S2 cells (Fu et al., 2004). Indeed, we found that knocking down CBP or HDAC6, both proteins involved in histone acetylation, results in a distinctive shift in location of expression toward the anterior (34 ± 2.5 %AP, 40 ± 1.5%AP respectively) without much change to the Hill coefficient (nH = 4.5 ± 0.53 and nH = 6.22 ± 0.03 respectively) (Figure 4, Table 1).
Chromatin remodelers and histone modifiers influence the WTHbP2 GRF.
We knocked down the maternal contribution of multiple trans factors using RNAi in embryos harboring the WTHbP2 reporter. We stained for LacZ expression and present the average expression profile (left), the expression traces from individual embryos (center), and the Hill function fits of Bcd/LacZ GRFs from individual embryos (right). The number of embryos imaged is listed in Table 2. We present three proteins whose knockdown had a significant effect on the location of WTHbP2 expression. CBP is a histone acetylase that coactivates Bcd (Fu et al., 2004). SAP18 and Sin3A are cofactors of Bicoid that have histone deacetylase activity (Singh et al., 2005). For reference, nH and gMM for WTHbP2 are 5.2 ± 0.3 and 0.072 ± 0.011, respectively.
We also hypothesized that multi-valent cofactors, such as Mediator, might influence the shape of the WTHbP2 GRF by facilitating interactions between Bcd molecules. We found that knocking down Mediator subunits had three types of effects on the WTHbP2 GRF. First, some subunits, such as MED14, reduce the overall expression level. Second, some subunits, such as MED20 and MED22, do not affect the Hill coefficient, but do affect the gMM constant. Finally, some subunits, such as MED11 and MED27, decrease the Hill coefficient, but do not affect the gMM constant (Figure 5).
Mediator subunits affect the shape of the WTHbP2 GRF.
Mediator subunits were knocked down using RNAi (see Materials and Methods). The number of embryos imaged is listed in Table 2. (Left column) Average gene expression profiles from hbP2-reporter construct in embryos with respective trans-factors depleted using RNAi; bold line is the average, shadow is the standard deviation. (Middle column) Individual gene expression profiles from each embryo; each color represents a separate embryo. (Right column) Bcd/LacZ mRNA GRF fit to the Hill function. Hill coefficient (nH) reflects the shape of the curve, generalized Michaelis Menten coefficient (gMM) reflects the location along the anterior posterior axis. For reference, nH and gMM for WTHbP2 are 5.2 ± 0.3 and 0.072 ± 0.011, respectively.
Comparing expression driven by variants of WTHbP2 and SynHbP2 to theory indicates multiple molecular mechanisms underlie the GRF
Fitting GRFs to Hill functions is a convenient way to characterize the shape of the response, but doesn’t give any molecular insights. We developed a theoretical framework, rooted in molecular biophysics, to explore how individual TFs contribute to the GRF (Estrada et al., 2016b). If energy is not being expended to regulate transcription, so that regulation may be assumed to take place at thermodynamic equilibrium, our theory allows for arbitrary forms of ‘higher-order’ cooperativity (HOC), through which the affinity of binding at a site can be influenced by binding at multiple other sites. Such HOC allows any form of information integration which can be accomplished at thermodynamic equilibrium to be accommodated in a model. The molecular mechanisms that give rise to such higher-order effects may include chromatin, nucleosomes or co-regulators like Mediator. To assess the shape and location of the GRF, we introduced two non-dimensional parameters, called ‘steepness’ and ‘position’, which correspond to the maximal derivative and the location of the maximal derivative, respectively, of the normalised GRF. These intrinsic measures of shape are more biophysically informative than the nH and gMM constant of a fitted Hill function.
Higher order effects have rarely been considered previously. An exception is a series of quantitative studies of regulation of the Drosophila even-skipped gene, which are notable for their predictive accuracy (Janssens et al., 2006; Kim et al., 2013). The model underlying these studies, described in detail in (Reinitz et al., 2003), allows for higher order interactions of multiple binding sites, assuming thermodynamic equilibrium. These higher order effects seem important for the accuracy of the model. However, the effects are treated in a phenomenological way, which makes it difficult to draw quantitative comparisons with the biophysical model that we use.
In our previous work, mRNA expression was treated as an average over different TF binding microstates (Estrada et al., 2016b). For the present paper, we introduced a more refined model in which RNA polymerase is explicitly recruited to the promoter. In effect, RNA polymerase was treated as another molecular entity which can bind to DNA at a single site. The rate of mRNA expression was then taken to be proportional to the probability of RNA polymerase being bound. This model more accurately represents the behavior of TFs, which include domains that bind specifically to DNA, as well as domains which interact directly or indirectly with RNA polymerase. Accordingly, higher-order cooperativities may arise between TF binding sites (TF-TF HOC) as well as between TF sites and RNA polymerase (TF-Pol HOC).
Here, we compare our model with various numbers of TF binding sites to our experimental data from deletions of WTHbP2 and SynHbP2 (Figure 6). In our model, we created GRFs by randomly choosing HOCs, for both TF-TF and TF-Pol, within a plausible range and determined the boundary of the position-steepness region occupied by any of such GRFs. This allows us to ask whether the position and steepness of the experimentally determined GRF is found within this biophysically plausible region. Note that this approach does not require fitting the GRF to experimental data. Instead, we mathematically determine the region of position and steepness in which the data should fall. We find that the WTHbP2 and SynHbP2 GRFs lie on the boundary of the position-steepness region, and that pairwise cooperativities, either TF-TF or TF-Pol, are inadequate to explain the data. Moreover, the deletion constructs yield GRFs whose steepness is higher than the model can accommodate, especially for low numbers of TF binding sites.
Deleting binding sites from WTHbP2 and SynHbP2 reveals discrepancies between experimentally measured GRFs and a model at thermodynamic equilibrium.
(A) Using an updated version of the mathematical model in Estrada et al., we calculated the boundaries of the steepness and position for GRFs that can be generated by six transcription factor binding sites, either including higher-order cooperativities (solid grey line), pairwise TF-TF cooperativities (dashed grey line, lower left) or pairwise TF-Pol cooperativities (dashed grey line, lower right). For comparison, the Hill line, consisting of the position and steepness points for varying values of the Hill coefficient, nH, is plotted in magenta with the points corresponding to integer values of nH marked by crosses. Experimental data from WTHbP2 (individual embryos are shown as small red circles; the average is shown as a largered disc with a black surround) and SynHbP2 (individual embryos are shown as small orange circles; the average is shown as a large orange disc with a black surround). (B) We plotted the data from WTHbP2 variants where Bcd sites have been removed, described in Figure 2, in terms of steepness and position and compared it to the model with corresponding numbers of TF binding sites. The boundaries of the model for 2, 3, 4, 5 and 6 sites are shown in nested solid grey lines. The model corresponding to the number of remaining Bcd binding sites is shown in dashed black. Individual embryos are shown as small black circles; the average is shown as a red disc. P-values correspond to the probability of finding the GRFs inside the thermodynamic equilibrium region (see Materials and methods). (C) Data from two variants of SynHbP2 are plotted as in B, except the average is shown as an orange disc. In these constructs, the Bcd binding sites are flanked by 12 bp of endogenous sequence rather than 7 bp, as is shown in panel A. See supplementary data for the construct schematics and sequence details.
These discrepancies between our model and experiments indicate that additional features not included in our model must contribute to the steepness of the HbP2 GRF. For example, there may be cryptic Bcd binding sites that contribute to HbP2 expression. Alternatively, because our model accommodates all thermodynamically feasible mechanisms for a single transcriptional activator, additional regulators may play a crucial role. However, we attempted to control for this possibility by creating SynHbP2, which consists of only Bcd binding sites and still generates expression patterns with position and steepness beyond the limits of our model. We are left to consider whether non-equilibrium models requiring energy dissipation are central to generating the HbP2 GRF. We address these various possibilities further in the Discussion.
In 1989, Driever and Nusslein-Volhard proposed that Bcd binds cooperatively to the HbP2 enhancer to generate a sharp response from a graded input (Driever et al., 1989). Fitting the sigmoidal output of an HbP2 reporter construct to a Hill function revealed a Hill coefficient of 5 to 6, and this was interpreted to mean that Bcd bound cooperatively to HbP2, resulting in a GRF where n binding sites give rise to a Hill coefficient of n; this idea has been persistent in the Drosophila literature (Gregor et al., 2007; He et al., 2010a; He et al., 2011; Lopes et al., 2012; Xu et al., 2015). Here we test this model directly by making mutations in the HbP2 enhancer and measuring the consequences quantitatively. We first demonstrate that predicted relationship between binding site number and Hill coefficient does not hold. Then, we put forward data to support an alternative model where Bcd, other TFs and co-factors such as Mediator and CBP work together to shape the GRF through two largely separable properties - the steepness and position of the response. Finally, by comparing our results to theory, we propose that either unrecognized Bcd binding sites contribute to HbP2 expression, or that activation by a single TF at thermodynamic equilibrium may not be adequate to explain the response of HbP2, even when accounting for higher order cooperativities between TFs.
Experimental distinctions between our work and previous studies
Our results agree qualitatively with previous studies, including those by Driever and Nusslein-Volhard. Upon removal of Bcd binding sites from HbP2, the expression boundary shifts toward the anterior and the sharpness decreases. However, our constructs do differ from that previous study in some important respects. Driever and Nusslein-Volhard removed Bcd TFBS by truncating WTHbP2 to shorter pieces. This strategy not only removes Bcd TFBS but also other neighboring sequences and it changes the distance of binding sites relative to the promoter. In contrast, our series of HbP2 variants preserve enhancer length, binding site positions and inter-motif sequences. All of our reporters used the native Hb promoter (Perry et al., 2012) rather than using the HSP 70 promoter (Driever et al., 1989) or a smaller fragment of the Hb promoter (+1 to+107) (Driever et al., 1989). But most significantly, we used quantitative imaging methods to measure the output of our HbP2 variants; this allows us to interpret our data differently. We find that the changes to the GRF upon binding site removal do not conform to the simple model where n binding sites can produce a GRF with a Hill coefficient of n. Instead, the Hill coefficient decreases by 0.5 with each site removed (rather than by one as would be predicted).
Our work also differs from recent quantitative studies on the Bcd/Hb GRF. In (Gregor et al., 2007; He et al., 2010a; Lopes et al., 2012), the authors measured the endogenous Hb protein expression profile, whereas we measured mRNA from an HbP2 reporter construct. In (He et al., 2011), the authors compared Bcd to endogenous hb mRNA expression using in situ hybridization. Importantly, all of these studies, including ours, largely agree, measuring Hill coefficients between 5 and 6. However endogenous hb mRNA (and endogenous Hb protein) cannot be directly interpreted as the output of the HbP2 GRF because it is difficult to exclude outputs from other hb enhancers that are known to contribute to anterior hb gene expression (Perry et al., 2012). For the purpose of deciphering the molecular details of an enhancer, our reporter designs and assays provide the most direct experimental tests. Lastly, we note that a recent quantitative fluorescence in situ hybridization study showed evidence of ~6 Bicoid molecules bound to the hb locus of earlier stage embryos (Xu et al., 2015). Our results suggest that either more than 6 Bcd molecules are interacting on HbP2, or energy is being spent to maintain the system away from equilibrium.
Multiple studies have focused on identifying interactions between Bcd molecules that could help explain cooperative binding. The studies used synthetic DNA sequences and mutated proteins in cell culture assays, and came to varied conclusions about the role of distance and clustering between Bcd binding sites (Driever et al., 1989; Ochoa-Espinosa et al., 2005). In our study using the endogenous enhancer in embryos, the arrangement, position, orientation, clustering and affinity of Bcd binding sites were not distinctive features for the degree of cooperativity. However, the number of perturbations we did to explore these parameters is limited, and it remains possible that they contribute partially to the degree of sharpness in the Bcd/HbP2 GRF.
Flanking sequence influences bcd binding site efficacy
Bcd belongs to the homeodomain protein family, which recognize a common -TAAT- motif. While some homeodomain proteins have a degenerate specificity (Berger et al., 2008; Christensen et al., 2012; Noyes et al., 2008a), Bcd binds to the specific TAATCC motif (Bergman et al., 2005; Noyes et al., 2008a, Noyes et al., 2008b). Bcd has some unique structural features that allow this specificity, including recognition of -CC by direct contact with K50/R54 (Baird-Titus et al., 2006), and recognition of a weak binding motif (-TAAGCT-, X1) by the ‘recognition helix’ that harbors R54 (Adhikary et al., 2017; Dave et al., 2000; Zhao et al., 2000). This degree of specific binding makes it reasonable to assume that the core motif would be sufficient for Bcd binding and activity in vivo; however, here we show that including 7 bp of endogenous flanking sequence around each core Bcd motif dramatically increases the activity of a synthetic HbP2 enhancer. When we increased the flanking sequence to 12 bp, we didn’t observe any additional effect. These flanking sequences do not have any obvious similarity to one another, though the number we have is far too small to analyze bioinformatically. We hypothesize that the flanks form a specific DNA shape that is favorable for Bcd recognition, as has been shown for other homeodomain proteins (Dror et al., 2014).
Additional bcd binding sites outside HbP2
Even after all six known binding sites are removed from WTHbP2, we still observe gene expression with a sigmoidal, non-linear response. WTHbP2 does not express at all when Bcd is removed by RNAi (data not shown), indicating that some Bcd responsive element remains even after removing the canonical six sites. In our constructs, WTHbP2 is conjugated with its native hb promoter which is ~500 bp in length. The WTHbP2 sequence contains one additional predicted Bcd binding site in addition to the canonical six which overlaps with a weak binding site, and the native hb promoter also contains an additional predicted Bcd binding site. These two sites are obvious candidates for the residual Bcd responsive activity. We deleted these two additional sites and measured expression; expression is lowered further but still detectable (see Figure 2—figure supplement 1). We also calculated the limits of steepness and position assuming 7 or 8 TFBS and compared the boundaries to the experimental data from our TFBS deletion series. As expected, including 1 or two additional sites broadened the boundary of the steepness/position space. However, experimental data still often fall on the edge of the boundary and at lower number of TFBS, experimental data is outside the the boundary (see Figure 6—figure supplement 1). Because of the complexity of the native WTHbP2 enhancer sequence, we believe that synthetic constructs with defined binding site content such as the one we present here will be an important tool for dissecting the role of individual TF binding sites in dictating a response. In future studies, coupling our SynHbP2 to a synthetic promoter could also prove to be useful. We also note that promoters and enhancers have similar abilities to recruit PolII (Henriques et al., 2018), and especially in systems like ours where the enhancer is immediately adjacent to the promoter, may need to be considered as a single functional unit.
Importantly, our conclusion that pairwise cooperative binding of Bcd is inadequate to produce the observed expression from HbP2 is unaffected by how many Bcd sites there are (Estrada et al., 2016b). However, when considering the role of higher order cooperativity, additional binding sites allow the theory and experiment to be within range of one another. We therefore conclude that future efforts to understand the mechanism of cooperativity for WTHbP2 should focus on how higher order cooperativity can be achieved, or non-equilibrium mechanisms.
Modulating the position of expression through effective concentration of Bcd
Multiple perturbations shifted the anterior/posterior location of expression driven by WTHbP2, reflecting a change in the sensitivity to Bcd concentration. We hypothesize that these perturbations all influence the accessibility of WTHbP2, and thus the ability of Bcd to bind. For example, removing binding sites for the pioneer factor Zelda may result in decreased accessibility of WTHbP2, a requirement for higher levels of Bcd to activate expression, and an anterior shift in expression. Similarly, Hb may also facilitate Bcd binding through collaborative cooperativity, and CBP may be necessary to modify nucleosomes. This hypothesis is consistent with previous studies where modulating Bcd concentrations influences the location of expression without altering the steepness (Liu et al., 2013; Struhl et al., 1989).
Cofactors shape the gene regulatory function
Because of their central role in regulating transcription, TFs have been the primary focus of research to determine the molecular mechanisms underlying the shape of gene regulatory functions (Janssens et al., 2006; Junion et al., 2012; Kazemian et al., 2010; Segal and Widom, 2009; Zinzen et al., 2009). Specifically, pairwise cooperative binding between TFs has been widely proposed to underlie sharp responses to graded inputs (He et al., 2010b; Segal et al., 2008), though a series of models from the Reinitz group allow for higher-order cooperativity between TFs and other components (Reinitz et al., 2003; Janssens et al., 2006; Kim et al., 2013). In the scenario where cooperative binding between TFs dominates, the many cofactors crucial for eukaryotic gene regulation serve as ‘cogs in the machine’ to relay decisions from TFs to the basal transcriptional machinery.
Our work calls the TF-centric view into question using both theory and experiment. We show that theory grounded in physics must include higher order cooperativity between TFs to generate GRFs with sufficient steepness and position to compare to in vivo measurements; this assumes that the regulatory mechanism is operating at thermodynamic equilibrium, which may still be inadequate to capture experimental data, indicating that energy dissipation may be required. Cofactors are prime candidates for implementing higher-order cooperativity or energy dissipation through binding directly to multiple TFs or by facilitating their binding through indirect processes such as chromatin remodeling or modification. Indeed, we present experimental evidence that perturbing some cofactors changes the WTHbP2 GRF by altering either the anterior/posterior position or shape of expression. A role for cofactors in shaping the GRF is consistent with in vitro studies where purified Bcd protein binds to HbP2 but yields a Hill coefficient of only 3–4 (Ma et al., 1996). In independent work, we have shown that allosteric interactions arising from dynamically changing conformations can give rise to higher-order cooperativities (Biddle et al., submitted) and it is conceivable that cofactors may employ this mechanism at HbP2. We hope to investigate this in future studies. Together, these results argue that cofactors do not simply execute the decisions made by TFs; they collaborate with TFs to shape the quantitative features of the gene regulatory function.
Cooperativity between TFs mediated by cofactors may help to explain the rapid evolution of regulatory DNA. Because cooperative binding requires direct TF-TF contact, it should be a strong constraint on regulatory evolution. However, the number, position and affinity of WTHbP2 binding sites varies over evolutionary time. We speculate that cooperativity through cofactors may enable rapid evolution of regulatory sequence as motifs at disparate locations can still be integrated into the output of the enhancer.
Broader implications
The shape of a gene regulatory function reflects the underlying molecular mechanisms of transcription. Coupling quantitative measurements to mechanistically meaningful biophysical models is a powerful strategy to decipher the individual role of such mechanisms, and how they collaborate to influence gene expression. This strategy has been enormously successful in bacteria (Belliveau et al., 2018; Landman et al., 2017; Razo-Mejia et al., 2018), and the toolbox for applying this strategy in animals is rapidly growing. Drosophila embryos are becoming a flagship system for this strategy due to key strengths developed by the community over time: the transcriptional network is well studied (Levine, 2008; Nüsslein-Volhard and Wieschaus, 1980), high resolution imaging of mRNA and protein is tractable (Fowlkes et al., 2008; Gregor et al., 2014; Pisarev et al., 2009), and genetic and optogenetic perturbations are possible (Huang et al., 2017). Controlled synthetic systems, like the one we develop here and others that are emerging (Crocker et al., 2017), will be another crucial tool to harness the molecular complexity of animal transcription. As we show, coupling measurements to models has the power to reveal fundamental features of transcription that differ between animals and bacteria. As models improve, they will be a valuable tool in predicting the activity of animal enhancers and their variants and in engineering enhancers with desired activities, both of which are central goals of precision medicine.
Reagent type
(species) or
Strain, strain
(Drosophila melanogaster) Nejire (CBP) RNAi Bloomington Drosophila
Stock Center BDSC Cat# 36682,
RRID:BDSC_36682
(D. melanogaster) Bin1/SAP18 RNAi Bloomington Drosophila
(D. melanogaster) Sin3A RNAi Bloomington Drosophila
(D. melanogaster) HDAC6 RNAi Bloomington Drosophila
(D. melanogaster) MED1 RNAi Bloomington Drosophila
(D. melanogaster) MED11 RNAi Bloomington Drosophila
(D. melanogaster) Vielfaltig
(Zld) RNAi Bloomington Drosophila
(D. melanogaster) hunchback
(hb) RNAi Bloomington Drosophila
Creating transgenic fly lines
The D. mel hb proximal enhancers (hbP2) and hb proximal promoter used were as previously defined (Perry et al., 2012). The proximal promoter was cloned with the following primers: Pfwd: cagtcagtcacgagtttgttac, Prev:cttggcggctctagacg. The HbP2 enhancer (−321 to +22), and HbP2 mutants were synthesized by Integrated DNA Technologies, Inc. For removing Bcd TFBS, the core Bcd binding sequence was modified as follows; A1, A2 and A3 (TAATC) were mutated to CCGAG; X1 and X2 (TAAGC) were mutated to CCGAG, and X3 (TCATC) was mutated to CCGAG (A1,A2,A3, X1,X2,X3 notations are from (Driever et al., 1989). The resulting sequences were checked for possible new binding motifs of AP patterning TFs (Bcd, Cad, dStat, D, Gt, Hb, Kni, Kr, Nub, Tll, Zld) using Patser (http://stormo.wustl.edu/software.html) with a p value of 0.001; the PWMs we used for these TFs (Voss et al., 2011; Noyes et al., 2008a) can be downloaded from Figshare (https://doi.org/10.6084/m9.figshare.8235587.v1).[2] Gibson assembly was used to replace the eve basal promoter of pBΦY with the hb proximal promoter. All other elements such as the LacZ reporter, Amp and mini-white marker genes, and an attB site for site-specific integration remained identical (Groth et al., 2004; Hare et al., 2008). Constructs were injected by Genetic Services and BestGene Inc, into the attP2 landing site. Flies were made homozygous using the mini-white marker.
Creating synthetic enhancer constructs
To create SynHbP2, SiteOut was used to remove motifs of interest (Estrada et al., 2016a). First the sequence of WThbP2 was scrambled to remove known motifs of TFs (Bcd, Cad, dStat, D, Gt, Hb, Kni, Kr, Nub, Tll, Zld) involved in AP patterning of the blastoderm embryo. Then Bcd TFBS were restored to their native locations and the resultant sequence checked for any newly created motifs around the restored Bcd TFBS using PATSER (http://stormo.wustl.edu/software.html). The binding motifs are from FlyFactorSurvey (http://pgfe.umassmed.edu/ffs/; Noyes et al., 2008b), and a pseudocount of 0.1 and a GC (guanine and cytosine) content of 0.406 when generating position weight matrices from these count matrices was used. Full sequences for the resulting synthetic enhancers can be downloaded from Figshare (https://doi.org/10.6084/m9.figshare.8235614.v1). [3]
RNAi screening
To measure reporter expression in RNAi backgrounds, we followed the protocol developed in (Staller et al., 2013). Briefly, virgin females with a maternal-tubulin-Gal4 driver were crossed to males with a UAS-short hairpin RNA (shRNA) construct. We then collected virgin female offspring and crossed them to males bearing hbP2-reporter constructs. The resulting embryos were collected and fixed for in situ hybridization. The UAS-shRNA line for each gene can be found in supplementary information with Transgenic RNAi Research Project [TRiP] number.
In situ Hybridization
In situ hybridizations were performed as previously described (Luengo Hendriks et al., 2006). Flies were raised at 25°C and embryos aged 0- to 4-hr-old were collected and fixed. Embryos were incubated at 56°C for 2 days with 2,4-dinitrophenyl (DNP)-labeled probes for lacZ and hkb and digoxigenin (DIG)-labeled probes for ftz. For the expression level comparison among transgenic reporter lines, hkb was costained for normalization as described in (Wunderlich et al., 2014). Probes were sequentially detected with anti-DIG HRP (horseradish peroxidase) antibody (Roche) plus coumarin-tyramide color reaction (PerkinElmer) and anti-DNP HRP (PerkinElmer) antibody plus Cy3-tyramide color reaction (PerkinElmer). Embryos were treated with RNase A and then nuclei stained with Sytox Green (Life Technologies). Embryos were mounted in DePex (Electron Microscopy Sciences), using a bridge of #1 coverslips to preserve embryo morphology.
Image acquisition, Processing, and Analysis
A two-photon laser scanning microscope (Zeiss LSM 710) with a plan-apochromat 20 × 0.8 NA objective was used to acquired z-stacks of each embryo. Each stack was converted into a PointCloud; a text file that includes the location and levels of gene expression for each nucleus (Luengo Hendriks et al., 2006). Embryos were imaged in the early blastoderm stage (0%–4% membrane invagination). LacZ levels were normalised to the 95% quantile of hkb expression in the posterior 10% of each embryo. (Wunderlich et al., 2014). Importantly lacZ levels were only compared between other embryos stained within the same batch to avoid extraneous sources of noise in the normalization. Line traces of embryos were generated using the extractpattern command in the PointCloud toolbox (http://bdtnp.lbl.gov/Fly-Net/bioimaging.jsp?w=analysis). This divides the embryo into 16 strips along the AP axis of the embryo and, for each strip, calculates the mean expression level in 100 bins along the AP axis. Strips were extracted along the right lateral sides of the embryos and subtracted the minimum value along the axis to remove background noise.
Estimating position and steepness from experimental data
For each embryo, the expression level driven by the corresponding reporter construct is measured as described above. The Bcd expression profile is estimated from a single sample of six embryos stained with Bcd antibody. This allows an estimate of a gene regulatory function (GRF) for each reporter construct, where expression level is expressed as a function of Bcd concentration. Normalized position (P) and normalized steepness (S) are estimated from an averaged GRF obtained by averaging over a random subsample of half the number of embryos in a particular condition. Given an averaged GRF, we estimate normalized steepness and position by: 1) Computing Bcd05: Bcd concentration for which expression level is half its maximum value 2) Computing the maximum derivative of the GRF (raw steepness: rS) and the Bcd concentration for which it is found (raw position: rP) 3) Normalizing the raw steepness and raw position using Bcd05: p=rP/Bcd05 and S = rS*Bcd05. 100 random subsamples per condition are taken, allowing to compute a distribution of possible positions and steepnesses for a given condition. Kernel Density Estimation is used to estimate a probability distribution for the particular reporter construct to exhibit a particular combination of steepness and position. A gaussian basis is used, where the bandwidth is estimated using Silverman's rule of thumb (Silverman, 2018), which is optimal, provided the underlying distribution is, in fact, Gaussian. A p-value for the probability of finding GRFs inside the thermodynamic equilibrium region is estimated by computing the proportion of the estimated kernel density that lies within the equilibrium boundary (Figure 6—figure supplement 2).
Model of gene regulation
The biophysical approach to gene regulation used in (Estrada et al., 2016b) was introduced in (Ahsendorf, Wong, Eils, Gunawardena, ‘A framework for modelling gene regulation which accommodates non-equilibrium mechanisms’, BMC Biology 12:102 2014). It allows for multiple molecular entities interacting with DNA, giving rise to ‘microstates’, corresponding to the various molecular patterns which can arise on DNA, and transitions between these microstates, corresponding, for instance, to binding and unbinding. This specifies in a graphical way the master equation of the underlying Markov process, from which the steady-state probabilities of the microstates can be calculated algebraically, without having to know the numerical values of the transition rates. If the steady-state is one of thermodynamic equilibrium, then the model can be parameterised by association constants, corresponding to ratios of on-rates to off-rates, along with the concentrations of the interacting molecular entities. The steady-state probabilities are identical to those given by equilibrium statistical mechanics for the grand canonical formalism. The parameterisation by association constants is more convenient for representing biochemical mechanisms than the conventional formulation in terms of free energies of microstates. The treatment accommodates any form of information integration that is achievable without energy expenditure.
The mathematical foundations for this approach were developed in previous work on the graph-based ‘linear framework’ (see Estrada et al., 2016a for references) and are summarised for the specific application to gene regulation in Section 1 of the Supplementary Information of (Estrada et al., 2016b). We provide sufficient information here to reproduce the results of the present paper, based on these previously published results. This general approach to gene regulation was applied to the Hb-Bcd system in (Estrada et al., 2016a), assuming a single activating transcription factor (TF) binding at any number of sites, with mRNA synthesis given by averaging over the steady-state probabilities of the microstates. Higher-order cooperativites (HOCs), defined as ratios of association constants, were introduced as non-dimensional parameters which measure information integration.
For the present paper, we followed the same approach with a slightly extended model, in which RNA polymerase was introduced as a molecular entity with a single binding site, corresponding to the transcription start site (Figure 6—figure supplement 3). Higher-order cooperativity can now arise from subsets of TF sites acting on a TF site (TF-TF HOC) and between subsets of TF sites acting on RNA polymerase (TF-Pol HOC) (Figure 6—figure supplement 3, bottom inset). The mRNA synthesis rate is assumed to be proportional to the steady-state probability of RNA polymerase being bound and the steady-state amount of mRNA is then determined as the balance between synthesis and linear degradation (Estrada et al., 2016a, SI, Section 5). Using the rules described in (Estrada et al., 2016b, SI, Section 1), the normalised mRNA amount can be calculated algebraically in terms of the concentration of the TF and the HOCs, giving thereby a fully specified gene regulation function (GRF).
To measure the sharpness of this GRF, we follow the method in (Estrada et al., 2016b) by using ‘steepness’ (maximum of the derivative of the GRF) and ‘position’ (normalised concentration at which the maximum is achieved). To compare these biophysically defined GRFs to data, we do not fit them but, instead, we plot the region of position and steepness which is accessible, assuming that the HOC parameters are independently chosen as 10 u, where u is drawn at random from the uniform distribution on [−3, 3]. This range seems plausible on biophysical grounds but the boundaries of the position-steepness regions stabilise rapidly as the parameter range is increased (Estrada et al., 2016a). Changing the range from [−3, 3] to [−4,4] changes the boundary only slightly, indicating that the boundary has nearly stabilized, and does not affect our results (Figure 6—figure supplement 4).
Conformational heterogeneity and DNA recognition by the morphogen bicoid
R Adhikary
YX Tan
J Liu
J Zimmermann
M Holcomb
C Yvellez
PE Dawson
FE Romesberg
Biochemistry 56:2787–2793.
https://doi.org/10.1021/acs.biochem.7b00255
The Mediator complex: a central integrator of transcription
BL Allen
DJ Taatjes
Nature Reviews Molecular Cell Biology 16:155–166.
The solution structure of the native K50 Bicoid homeodomain bound to the consensus TAATCC DNA-binding site
JM Baird-Titus
K Clark-Baldwin
V Dave
CA Caperelli
J Ma
M Rance
Journal of Molecular Biology 356:1137–1151.
https://doi.org/10.1016/j.jmb.2005.12.007
Systematic approach for dissecting the molecular mechanisms of transcriptional regulation in bacteria
NM Belliveau
SL Barnes
WT Ireland
DL Jones
MJ Sweredoski
A Moradian
S Hess
JB Kinney
R Phillips
Variation in homeodomain DNA binding revealed by high-resolution analysis of sequence preferences
MF Berger
G Badis
AR Gehrke
S Talukder
AA Philippakis
L Peña-Castillo
TM Alleyne
S Mnaimneh
OB Botvinnik
ET Chan
F Khalid
W Zhang
D Newburger
SA Jaeger
QD Morris
ML Bulyk
TR Hughes
Drosophila DNase I footprint database: a systematic genome annotation of transcription factor binding sites in the fruitfly, Drosophila melanogaster
CM Bergman
JW Carlson
SE Celniker
Bioinformatics 21:1747–1749.
https://doi.org/10.1093/bioinformatics/bti173
Interactions between subunits of the mediator complex with gene-specific transcription factors
T Borggrefe
X Yue
Seminars in Cell & Developmental Biology 22:759–768.
https://doi.org/10.1016/j.semcdb.2011.07.022
Cooperative DNA-binding by Bicoid provides a mechanism for threshold-dependent gene activation in the Drosophila embryo
DS Burz
R Rivera-Pomar
H Jäckle
SD Hanes
https://doi.org/10.1093/emboj/17.20.5998
Isolation of mutations that disrupt cooperative DNA binding by the Drosophila bicoid protein
Journal of Molecular Biology 305:219–230.
https://doi.org/10.1006/jmbi.2000.4287
Assessing sufficiency and necessity of enhancer activities for gene expression and the mechanisms of transcription activation
RR Catarino
A Stark
Genes & Development 32:202–223.
https://doi.org/10.1101/gad.310367.117
p300/CBP proteins: hats for transcriptional bridges and scaffolds
HM Chan
NB La Thangue
Journal of Cell Science 114:2363–2373.
A system of repressor gradients spatially organizes the boundaries of Bicoid-dependent target genes
Z Xu
C Mei
D Yu
S Small
Recognition models to predict DNA-binding specificities of homeodomain proteins
RG Christensen
MS Enuameh
MB Noyes
MH Brodsky
SA Wolfe
GD Stormo
Bioinformatics 28:i84–i89.
https://doi.org/10.1093/bioinformatics/bts202
Eukaryotic transcriptional dynamics: from single molecules to cell populations
A Coulon
CC Chow
RH Singer
DR Larson
Nature Reviews Genetics 14:572–584.
https://doi.org/10.1038/nrg3484
Cooperativity in transcriptional control
AJ Courey
Current Biology 11:R250–R252.
A Fully Synthetic Transcriptional Platform for a Multicellular Eukaryote
J Crocker
A Tsai
DL Stern
Reprogrammable recognition codes in bicoid homeodomain-DNA interaction
C Zhao
F Yang
CS Tung
https://doi.org/10.1128/MCB.20.20.7673-7684.2000
Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors
S De Val
NC Chi
SM Meadows
S Minovitsky
JP Anderson
IS Harris
ML Ehlers
P Agarwal
A Visel
SM Xu
LA Pennacchio
I Dubchak
PA Krieg
DY Stainier
BL Black
Determination of spatial domains of zygotic gene expression in the Drosophila embryo by the affinity of binding sites for the bicoid morphogen
W Driever
G Thoma
C Nüsslein-Volhard
https://doi.org/10.1038/340363a0
Covariation between homeodomain transcription factors and the shape of their DNA binding sites
I Dror
T Zhou
Y Mandel-Gutfreund
R Rohs
Nucleic Acids Research 42:430–441.
https://doi.org/10.1093/nar/gkt862
Transcription factors GAF and HSF act at distinct regulatory steps to modulate stress-induced gene activation
FM Duarte
NJ Fuda
DB Mahat
LJ Core
MJ Guertin
JT Lis
Genes & Development 30:1731–1746.
A hundred years of the hill equation
PC Engel
The Biochemical Journal 2013:1–4.
https://doi.org/10.1042/BJ20131164
SiteOut: an online tool to design binding Site-Free DNA sequences
J Estrada
T Ruiz-Herrero
C Scholes
Z Wunderlich
AH DePace
(2016a)
Plos One 11:e0151740.
Information integration and energy expenditure in gene regulation
F Wong
A DePace
J Gunawardena
(2016b)
A quantitative spatiotemporal atlas of gene expression in the Drosophila blastoderm
CC Fowlkes
CL Hendriks
SV Keränen
GH Weber
O Rübel
MY Huang
S Chatoor
L Simirenko
C Henriquez
A Beaton
R Weiszmann
S Celniker
B Hamann
DW Knowles
MD Biggin
MB Eisen
J Malik
A conserved developmental patterning network produces quantitatively different output in multiple species of Drosophila
KB Eckenrode
MD Bragdon
M Meyer
CL Luengo Hendriks
PLoS Genetics 7:e1002346.
https://doi.org/10.1371/journal.pgen.1002346
The co-activator CREB-binding protein participates in enhancer-dependent activities of bicoid
D Fu
Y Wen
Journal of Biological Chemistry 279:48725–48733.
https://doi.org/10.1074/jbc.M407066200
Analysis of combinatorial cis-regulation in synthetic and genomic promoters
J Gertz
ED Siggia
BA Cohen
Simultaneous recruitment of coactivators by Gcn4p stimulates multiple steps of transcription in vivo
CK Govind
S Yoon
H Qiu
S Govind
AG Hinnebusch
Probing the limits to positional information
T Gregor
DW Tank
EF Wieschaus
W Bialek
The embryo as a laboratory: quantifying transcription in Drosophila
HG Garcia
SC Little
Trends in Genetics 30:364–375.
https://doi.org/10.1016/j.tig.2014.06.002
Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31
AC Groth
M Fish
R Nusse
MP Calos
Genetics 166:1775–1782.
https://doi.org/10.1534/genetics.166.4.1775
Sepsid even-skipped enhancers are functionally conserved in Drosophila despite lack of sequence conservation
EE Hare
BK Peterson
VN Iyer
R Meier
ATP-dependent chromatin remodeling: genetics, genomics and mechanisms
DC Hargreaves
GR Crabtree
Cell Research 21:396–420.
https://doi.org/10.1038/cr.2011.32
Distance measurements via the morphogen gradient of Bicoid in Drosophila embryos
F He
D Cheung
J Deng
LJ Lu
R Jiao
BMC Developmental Biology 10:80.
https://doi.org/10.1186/1471-213X-10-80
Thermodynamics-based models of transcriptional regulation by enhancers: the roles of synergistic activation, cooperative binding and short-range repression
X He
MA Samee
C Blatti
S Sinha
PLoS Computational Biology 6:e1000935.
https://doi.org/10.1371/journal.pcbi.1000935
A multiscale investigation of bicoid-dependent transcriptional events in Drosophila embryos
J Ren
W Wang
PLoS One 6:e19122.
Widespread transcriptional pausing and elongation control at enhancers
T Henriques
BS Scruggs
MO Inouye
GW Muse
LH Williams
AB Burkholder
CA Lavender
DC Fargo
K Adelman
Genes & Development 32:26–41.
Synergism in transcriptional activation: a kinetic view
D Herschlag
FB Johnson
Genes & Development 7:173–179.
https://doi.org/10.1101/gad.7.2.173
Mid-embryo patterning and precision in Drosophila segmentation: Krüppel dual regulation of hunchback
DM Holloway
AV Spirov
Decoding temporal interpretation of the morphogen bicoid in the early Drosophila embryo
A Huang
C Amourda
S Zhang
NS Tolwinski
TE Saunders
Quantitative and predictive model of transcriptional control of the Drosophila melanogaster even skipped gene
H Janssens
S Hou
J Jaeger
AR Kim
E Myasnikova
D Sharp
J Reinitz
Nature Genetics 38:1159–1165.
https://doi.org/10.1038/ng1886
Interactions between DNA-bound repressors govern regulation by the lambda phage repressor
AD Johnson
BJ Meyer
M Ptashne
PNAS 76:5061–5065.
https://doi.org/10.1073/pnas.76.10.5061
DNA-dependent formation of transcription factor pairs alters their binding specificity
A Jolma
Y Yin
KR Nitta
K Dave
A Popov
M Taipale
M Enge
T Kivioja
E Morgunova
J Taipale
A transcription factor collective defines cardiac cell fate and reflects lineage history
G Junion
C Girardot
M Braun
EH Gustafson
E Birney
EE Furlong
Quantitative analysis of the Drosophila segmentation regulatory network using pattern generating potentials
M Kazemian
A Richards
M McCutchan
N Wakabayashi-Ito
AS Hammonds
S Kumar
Rearrangements of 2.5 kilobases of noncoding DNA from the Drosophila even-skipped locus define predictive rules of genomic cis-regulatory logic
C Martinez
J Ionides
AF Ramos
MZ Ludwig
N Ogawa
DH Sharp
Self-consistent theory of transcriptional control in complex regulatory architectures
J Landman
RC Brewster
FM Weinert
WK Kegel
Bicoid cooperative DNA binding is critical for embryonic patterning in Drosophila
D Lebrecht
M Foehr
E Smith
FJ Lopes
CE Vanario-Alonso
A systems view of Drosophila segmentation
M Levine
Genome Biology 9:207.
https://doi.org/10.1186/gb-2008-9-2-207
Transcriptional enhancers in animal development and evolution
Dynamic interpretation of maternal inputs by the Drosophila segmentation gene network
F Liu
AH Morrison
Dampened regulates the activating potency of Bicoid and the embryonic patterning outcome in Drosophila
Ever-Changing Landscapes: Transcriptional Enhancers in Development and Evolution
HK Long
SL Prescott
J Wysocka
A kinetic mechanism for Drosophila bicoid cooperative binding
PM Bisch
FM Vieira
Journal of Theoretical Biology 235:185–198.
https://doi.org/10.1016/j.jtbi.2005.01.002
The role of Bicoid cooperative binding in the patterning of sharp borders in Drosophila melanogaster
Three-dimensional morphology and gene expression in the Drosophila blastoderm at cellular resolution I: data acquisition pipeline
DW Kaszuba
D Sudar
Genome Biology 7:R123.
https://doi.org/10.1186/gb-2006-7-12-r123
The Drosophila morphogenetic protein Bicoid binds DNA cooperatively
X Ma
D Yuan
K Diepold
T Scarborough
Development 122:1195–1206.
Nucleosome-mediated cooperativity between transcription factors
Krüppel acts as a gap gene regulating expression of hunchback and even-skipped in the intermediate germ cricket Gryllus bimaculatus
T Mito
H Okamoto
W Shinahara
Y Shinmyo
K Miyawaki
H Ohuchi
S Noji
Analysis of homeodomain specificities allows the family-wide prediction of preferred recognition sites
A Wakabayashi
A systematic characterization of factors that regulate Drosophila segmentation via a bacterial one-hybrid system
X Meng
https://doi.org/10.1093/nar/gkn048
The underappreciated role of allostery in the cellular network
R Nussinov
CJ Tsai
B Ma
Annual Review of Biophysics 42:169–189.
https://doi.org/10.1146/annurev-biophys-083012-130257
Mutations affecting segment number and polarity in Drosophila
E Wieschaus
The role of binding site cluster strength in Bicoid-dependent patterning in Drosophila
A Ochoa-Espinosa
G Yucel
L Kaplan
A Pare
N Pura
A Oberstein
D Papatsenko
An atomic model of the interferon-beta enhanceosome
D Panne
SC Harrison
Multiple enhancers ensure precision of gap gene-expression patterns in the Drosophila embryo
MW Perry
Precision of hunchback expression in the Drosophila embryo
JP Bothma
RD Luu
FlyEx, the quantitative atlas on segmentation gene expression at cellular resolution
A Pisarev
E Poustelnikova
M Samsonova
Tuning Transcriptional Regulation through Signaling: A Predictive Theory of Allosteric Induction
M Razo-Mejia
G Chure
T Einav
M Lewis
Cell Systems 6:456–469.
https://doi.org/10.1016/j.cels.2018.02.004
Transcriptional control in Drosophila
ComPlexUs 1:54–64.
https://doi.org/10.1159/000070462
Transcriptional regulation of nanog by OCT4 and SOX2
DJ Rodda
JL Chew
LH Lim
YH Loh
B Wang
HH Ng
P Robson
Combinatorial gene regulation through kinetic control of the transcription cycle
Á Sánchez
Cell Systems 4:97–108.
Predicting expression patterns from regulatory sequence in Drosophila segmentation
E Segal
T Raveh-Sadka
M Schroeder
U Unnerstall
U Gaul
From DNA sequence to transcriptional behaviour: a quantitative approach
J Widom
Density Estimation for Statistics and Data Analysis
BW Silverman
New York: Chapman and Hall/CRC.
Sap18 is required for the maternal gene bicoid to direct anterior patterning in Drosophila melanogaster
N Singh
W Zhu
Scaling and Regulation of Gene Expression in the Developing Fly Embryo
EM Smith
Princeton, NJ: Princeton University.
Transcription factors: from enhancer binding to developmental control
Depleting gene activities in early Drosophila embryos with the "maternal-Gal4-shRNA" system
MV Staller
D Yan
S Randklev
ZB Wunderlich
R Tao
LA Perkins
N Perrimon
Genetics 193:51–61.
The gradient morphogen bicoid is a concentration-dependent transcriptional activator
G Struhl
K Struhl
PM Macdonald
Cell 57:1259–1273.
Gene regulation. A paradigm for precision
Science 293:1054–1055.
Dynamic exchange at regulatory elements during chromatin remodeling underlies assisted loading mechanism
TC Voss
RL Schiltz
MH Sung
PM Yen
JA Stamatoyannopoulos
SC Biddie
TA Johnson
TB Miranda
S John
GL Hager
Transcriptional/epigenetic regulator CBP/p300 in tumorigenesis: structural and functional versatility in target recognition
F Wang
CB Marshall
M Ikura
Cellular and Molecular Life Sciences 70:3989–4008.
The Hill equation revisited: uses and misuses
JN Weiss
The FASEB Journal 11:835–841.
https://doi.org/10.1096/fasebj.11.11.9285481
Comparing mRNA levels using in situ hybridization of a target gene and co-stain
Methods 68:233–241.
https://doi.org/10.1016/j.ymeth.2014.01.003
Impacts of the ubiquitous factor Zelda on Bicoid-dependent DNA binding and transcription in Drosophila
J Ling
P Struffi
Combining protein and mRNA quantification to decipher transcriptional regulation
H Xu
LA Sepúlveda
L Figard
AM Sokac
I Golding
Nature Methods 12:739–742.
Deciphering the transcriptional cis-regulatory code
EZ Kvon
Trends in Genetics 29:11–22.
Regulation of nucleosome dynamics by histone modifications
GE Zentner
S Henikoff
Target selectivity of bicoid is dependent on nonconsensus site recognition and protein-protein interaction
Combinatorial binding predicts spatio-temporal cis-regulatory activity
RP Zinzen
David N Arnosti
Reviewing Editor; Michigan State University, United States
Patricia J Wittkopp
Senior Editor; University of Michigan, United States
Thank you for submitting your article "Dissecting the sharp response of a canonical developmental enhancer reveals multiple sources of cooperativity" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a guest Reviewing Editor and Patricia Wittkopp as the Senior Editor. The reviewers have opted to remain anonymous.
In this manuscript, the authors have quantitatively assessed the in vivo activity of the Drosophila hunchback regulatory element controlled by Bicoid binding sites in the embryo. Simple cooperative binding models do not reproduce the effects of perturbations, suggesting that either the thermodynamic equilibrium assumption is invalid for these types of elements, or that the cooperativities are more complex, possibly involving the influence of cofactors, chromatin, or DNA shape. The authors test the influence of additional transcriptional regulators by cis-element mutations and RNAi knockdowns. Previous studies showed that Zld and Hb are involved in Bcd-dependent activation, and these effects are confirmed using shRNA interference of each gene. The perturbations also include disruption of the general transcriptional machinery as well (i.e. Mediator). The reviewers found worth in the quantitative assessments and modeling for the gene regulatory output function of the hunchback promoter. Although the main points were to rule out the simplest models, the work points to a productive path forward and provide valuable quantitative data for modeling.
In a number of places, the authors oversimplify current and past discussions about sources of cooperativity, function of cofactors, and neglect earlier efforts to incorporate some of the additional layers of interactions in cooperative models (e.g. Reinitz, (2003) Complexus; Janssens et al., 2006, Kim et al. (PLoS Genetics) 2013].).
Regarding the number of Bicoid sites and Hill coefficients, among the papers that the authors cited for the sentences above, only Gregor et al., 2007, mention the matching relationship between Hill coefficients (nH = 5) and the number of Bcd molecules (n=5, but not the number of sites, Gregor mentioned 7 binding sites in the paper). Furthermore, many previous studies including ones the authors cited mentioned that additional or unknown factors or mechanisms might be required to fully explain the measured Hill coefficients or transcriptional response of Hb promoters.
It would be important to understand how the PWMs used here for Bcd impact model sensitivity, selectivity, specificity. The quality of PWMs can significantly affect its accuracy in predicting TF binding and because HbP2 mutant sequences used in this study were made based on the PWMs, the test of predictive capability of the PWMs can strongly support the author's arguments in relation to the mutants.
The Hill Equation given in the subsection “The HbP2 reporter system”, is an incredibly simple model of regulation. This model assumes that Bcd is the only mechanism through which HbP2 is being activated. The model also assumes all sites are 'equal', without considering relative spacing, affinity, etc. Therefore, it is not surprising at all that the HbP2 variants tested do not adhere to this model framework. This limitation should be addressed in the Discussion.
A more complex model involves post-binding cooperative interactions with the basal machinery; details of this model must be presented. In the subsection “Comparing expression driven by variants of WTHbP2 and SynHbP2 to theory indicates multiple molecular mechanisms underlie the GRF”, the authors introduce a more refined model. However, the model itself (full description, equations, etc.) is not presented. This should be included in the Materials and methods section, as well as all parameter values used in the model and specifically which higher-order terms were included during parameter fitting. It is very hard to assess whether the expression patterns are "beyond the limits" of their model without this information.
Thank you for pointing out this oversight. We have modified the manuscript to discuss these earlier modeling efforts (see Results section “Comparing expression driven by variants of WTHbP2 and SynHbP2 to theory indicates multiple mechanisms underlie the GRF”).
We have tempered our claim that Hill coefficient = binding site number is commonly accepted, to indicate this important complexity in the literature (Introduction, fourth paragraph).
The reviewers are right to point out that the quality of Position Weight Matrices (PWMs) impacts their ability to accurately predict TF binding. PWMs do not impact our models (which do not explicitly contain DNA sequence), but they do impact the design of the SynHbP2 construct. For our experiments on WTHbP2, we manipulated the footprinted Bcd binding sites, which does not require the use of PWMs. For SynHbP2, we used PWMs to predict binding sites for other TFs to screen against the creation of those sites in our neutral backbone. To explore the possibility that additional Bcd binding sites exist, outside of the footprinted sites, we also used a PWM for Bcd, and we now include a supplemental figure addressing that possibility. Note that it does not substantively alter our conclusions. We added full information on PWMs we used in the Materials and methods (subsection “Creating Transgenic Fly Lines”) with link to Figshare (https://doi.org/10.6084/m9.figshare.8235587.v1) .
We agree that the Hill equation is simple, but nonetheless it is a persistent tool in the literature, and therefore must be investigated as we do here. We discuss the simplicity of this model in the paper (“As noted above, the Hill function gives little biophysical insight but it offers a widelyused measure of shape. We will later interpret the shape of the GRF in terms of the mathematical theory that we introducedpreviously, from which we will draw more mechanistic conclusions.”), and do not claim that it is surprising that it doesn’t fit. Instead, we use the lack of agreement with the predictions of the Hill equation to justify more complex and mechanistically insightful models. We now reference other such mechanistic models, even though they were developed for other enhancers, in the Results section as described above.
In regards to the equivalence of sites, we tested this explicitly in the paper (Figure 2), and found that they were indeed roughly equal contributors. This is consistent with work from Thomas Gregor’s lab (Smith, 2015).
We absolutely agree that this information is necessary, and apologize that it was not included in the initial submission. We have revised the main text (see subsection “Comparing expression driven by variants of WTHbP2 and SynHbP2 to theory indicates multiple molecular mechanisms underlie the GRF”) and added a description to the Materials and methods, including a new supplementary figure describing the graph that we use, which indicates the notation, and describes the rules for calculating steady states (see Figure 6—figure supplement 3 and Figure 6—figure supplement 4). These rules are extensively described in the supplement to Estrada et al., 2016, so we do not reproduce them here. This information is sufficient to reconstruct our model, but does not delineate every equation and parameter. We are happy to elaborate in further detail if the reviewers deem it necessary.
Jeehae Park
Department of Systems Biology, Harvard Medical School, Boston, United States
Conceptualization, Investigation, Formal Analysis, Writing-original draft
Javier Estrada
Novartis Institutes for Biomedical Research, Cambridge, United States
Gemma Johnson
Ben J Vincent
Department of Biological Sciences, University of Pittsburgh, Pittsburgh, United States
Chiara Ricci-Tam
Meghan DJ Bragdon
Yekaterina Shulgina
Investigation, Formal Analysis
Anna Cha
Zeba Wunderlich
Department of Developmental and Cell Biology, University of California Irvine, Irvine, United States
Jeremy Gunawardena
Conceptualization, Resources, Supervision, Funding acquisition, Project administration, Writing-review and editing
Angela H DePace
Angela_DePace@hms.harvard.edu
National Institutes of Health (5K99HD073191-02)
National Institutes of Health (R01GM122928)
Giovanni Armenise-Harvard Foundation
The authors wish to acknowledge all members of the DePace and Gunawardena groups, for their helpful feedback on the work and manuscript. In particular, we wish to thank Ed Pym for his help with finalizing the manuscript, and Clarissa Scholes for her help in making the first HbP2 reporter constructs. We also wish to thank former DePace lab members Tara Lydiard-Martin and Max Staller for their technical help and insightful discussions in the early stages of this work.
Patricia J Wittkopp, University of Michigan, United States
David N Arnosti, Michigan State University, United States
Received: August 20, 2018
Accepted: March 4, 2019
Version of Record published: June 21, 2019 (version 1)
© 2019, Park et al.
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Acetylation of BMAL1 by TIP60 controls BRD4-P-TEFb recruitment to circadian promoters
Nikolai Petkau et al.
Multi-enhancer transcriptional hubs confer phenotypic robustness
Albert Tsai et al.
Research Advance Jul 11, 2019
|
cc/2019-30/en_middle_0019.json.gz/line9905
|
__label__wiki
| 0.953266
| 0.953266
|
Ford veterans' mission: Rejuvenate Land Rover
Bradford Wernle
LONDON - Ford Motor Co. has named a team of Ford veterans to run Land Rover, the sport-utility brand it bought from BMW AG on May 24.
The team's mission will be to:
Reconstruct Land Rover as a quasi-independent business unit
Re-establish the brand as the world's leading sport-utility maker
Restore quality
Grow sales.
Robert Dover, 55, now chairman of Ford's Aston Martin Lagonda unit, will become chairman and CEO of Land Rover. Dover will report to Wolfgang Reitzle, chairman and chief executive of Ford's Premier Automotive Group of luxury brands.
Dover and his team will be faced with the task of turning Land Rover into a profitable operation in two years.
Separating Land Rover from BMW and from the ailing Rover Cars unit - where it was grouped with Rover and MG - helped make the purchase difficult, Reitzle said.
'This was by definition one of the most difficult deals ever,' said Reitzle. 'Land Rover had almost no organization left. It was all rolled into BMW. To pull it out is not so easy.
'BMW didn't know what they wanted to sell and we didn't know what we wanted to buy.'
Land Rover built about 180,000 units in 1999 and Reitzle wants that figure to grow. He declined to set a target but said 300,000 units a year might be a reasonable long-term goal.
Land Rover will be added to Premier Automotive Group retail sites in selected markets. The Premier brands include Jaguar, Volvo, Aston Martin and Lincoln. Reitzle said there will be eight Premier 'flagship stores' in the USA opening this year.
The sale of Land Rover to Ford was praised by off-road enthusiasts.
When told of the appointment of Dover and the new Ford team, Ken Slavin, co-author of Land Rover: The Unbeatable 4X4, said: 'It's like taking a step back in time. With his (Dover's) experience we may get back to basics and get some good quality. That's been lacking.'
The Land Rover brand had been damaged under BMW, Slavin said. BMW failed to get a full understanding of either the manufacturing or marketing side of the Land Rover business, he added.
The Ford negotiating team was headed by Premier Automotive Group Chief Financial Officer William Cosgrove. He also led the working team that completed Ford's purchase of Volvo in 1999.
When BMW announced the sale of Land Rover to Ford in March, the two parties agreed a price of A3 billion. But by the time the deal was sealed at the end of May, the euro's depreciation against the US dollar saved Ford about $248 million. But, John Lawson, analyst for Salomon Smith Barney in London, said BMW did not lose anything since most of its expenses are in euros.
|
cc/2019-30/en_middle_0019.json.gz/line9910
|
__label__cc
| 0.719215
| 0.280785
|
Click "OK" to return to Yinxiang.com
Evernote uses cookies to enable the Evernote service and to improve your experience with us. To learn more, check out our cookie policy. By clicking OK or continuing to use our site, you agree that we can place these cookies.
Take great notes
Unclutter your life
Bring your team together
Find the Evernote solution that fits your needs
A save button for the web
Make better notes, faster
Notes Sync
Keep your notes handy
PDF & Doc Search
Find information anywhere
Search Handwriting
Find text in any note
Go paperless with Evernote
Notebooks & Tags
Organize your own way
Connect your favorite apps
Learn about the company
Evernote in the news
Discover our values
Save, sync and share it all
Opportunities at Evernote
Effective Date: May 25, 2018 – What’s New >>
Return to Privacy Center
As we state in our 3 Laws of Data Protection, we are committed to protecting the privacy of your data. This Privacy Policy explains more specifically what information Evernote Corporation and its Group Companies (together, “Evernote,” “we” or “us”) collect from Account Holders and End Users (“you”) through Evernote’s websites and applications, which we refer to collectively as “the Service.” The Service includes the Evernote Software.
Please note, if you use Evernote Basic, Plus, or Premium, you are both the Account Holder and End User of an Evernote service account. If you use Evernote Business, the Account Holder is the Customer who has contracted with Evernote as defined in our Evernote Business Agreement and the End Users are the individuals whose user accounts are linked to that Evernote Business account. You can find these and other defined terms used in this policy in our Glossary at the end of this page.
Although significant changes are rare, this policy may be amended as new features, technology, or legal requirements arise, so please check back from time to time. We’ll notify you if we make a significant change and, where required, seek your consent.
What information does Evernote collect?
We built Evernote to help you remember and organize your ideas, thoughts, and memories. That means you can input, upload, or store in Evernote any text, images, and other data that you choose—we refer to that information as“Content”. We also collect and receive the following types of information:
Basic subscriber information. To open your account and process payments, we collect and receive basic information like your email address and, depending on how you purchase a subscription to Evernote Plus, Evernote Premium or Evernote Business (each a “Paid Service”), your billing address and other payment information.
Usage data. We collect and log data on how you and others access and use Evernote, for example, the act of creating a note or sharing a note. Usage data may be collected through cookies, and similar technologies. For more information, including how to opt-out, visit our Cookie Information page.
Location information. We collect the IP address you use to connect to the Service, and — if you choose to share it — your location information from a mobile device.
Device information. We collect information about the number and type of devices you use to connect to the Service, as well as information about the operating systems on those devices (e.g., iOS, Android, Windows). Learn more about information our applications collect from your device on our Data Usage page.
We also may link your subscriber information with data we receive from our partners and other third parties to help understand your needs and provide you with a better experience. For example, if you create or log into an Evernote account using your Google Apps credentials via single sign-on, we will have access to certain information such as your name and email address as authorized in your Google Apps profile settings.
We’ve listed the types of information we collect and receive more specifically in the chart below. Generally, we collect this information to support your account and to help us understand how you use the Service so we can make it better. We have noted which types of information are not collected unless you choose to provide it.
If you register for or maintain an Evernote service account:
We collect
Your username, email address, and contact preferences
To create and support your Evernote Service account.
To communicate with you.
To enable other users to collaborate with you through Collaboration Features (such as shared Notes and Notebooks).
In accordance with your communication preferences, to send you information about Evernote features, products, and services that can enhance your use of the Service.
To verify your email address to help prevent spam, fraud, and abuse.
Your name, image, and other personal information, if you choose to share it
To display in your user profile, which may be visible to those with whom you share Content.
The geographic area from which your computing devices interact with the Service, your preferred language, and, if you select the option to share it, your mobile device location information
To localize your interaction with the Service by, for example, displaying web pages or user interfaces in your preferred language, showing you website content or pricing information appropriate to your location, and improving search by filtering results by location.
To help you monitor use of your account: We make recent IP address history available to you through your account settings.
To assist us in complying with legal restrictions that may limit the permissible use of the Service.
To enhance your Content with location information.
To help you discover relevant content.
Your device information
To show you (on your account’s Access History page) which of your devices you have authorized to access your Evernote service account and when you last accessed the Service from each device.
To inform our product development and marketing efforts, including our targeted advertising as described on our Cookie Information page.
To allow you to redeem a promotional offer.
To provide account support.
Together with purchase information, to help us comply with export laws.
Your telephone number, if you choose to share it
To help prevent spam, fraud, and abuse.
To enable two-step verification to provide an additional layer of security for your account.
To enable other users to communicate with you through Collaboration Features.
To show in your user profile, if you choose.
Your calendar information, only if you select the option to share it
To enhance your notes with calendar information.
To show you relevant Content to which you have access.
Actions you perform when using the Service (e.g., creating a note or sharing a note)
To administer the Service and to improve the features and usability of the Service.
To suggest Evernote features, products, and services that can enhance your use of the Service.
Whether your account was created or referred through a reseller or other partner who helps distribute or promote Evernote accounts
To determine the amount of revenue share payments to make to partners with whom we might have such arrangements and to provide aggregated and anonymized revenue share reports. These partners could include resellers or distribution partners.
Your payment information, if you purchase a subscription To process your payment.
In addition to the information above, there are certain cases where we receive or collect supplemental information, as outlined below.
Additional information we collect in connection with Evernote Business accounts:
We collect Why we collect it
Organization name and email address of Account Holder and End Users
To create and support the Evernote Business account.
To communicate with the Account Holder and End Users of the Business account in accordance with communication preferences.
To enable Account Holder and End Users of a Business account to use Collaboration Features.
To verify Account Holder’s and End Users’ email addresses to help prevent spam, fraud, and abuse.
Billing information (e.g., postal address, email address, and telephone number)
To communicate with the Billing Contact on the account and provide account support.
Employment-related personal information (e.g., your business title) – if you elect to share it
To show in your Evernote Business account user profile if you choose.
If you use our Web Clipper browser extension or "Save to Evernote" button:
A record of the source website from which you save Content
To record in the note created by the Web Clipper the source of the material you’ve chosen to clip (e.g., the URL) for your future reference. This source-recording functionality will not be affected by your browser’s do-not-track settings.
If you have installed the Web Clipper, when you visit certain websites the Web Clipper may notify you of available integrations with the Service or about products, services or features that we think will help you get more out of the Service. The Web Clipper does not track or create a record of your browsing activity.
If you visit an Evernote website:
Your email address (if you provide it)
To help you create an Evernote service account.
Please see our Cookie Information page
How does Evernote use my information?
We have specific rules for how and when we use the information we collect and receive. We describe these below.
What does Evernote do with my information?
We are committed to protecting the privacy of your information. Below, we describe the ways in which we use the information we collect and receive to provide, maintain, and improve the Service; to provide troubleshooting and customer support; to protect the Service for all our users; to contact you; and to administer Evernote Business accounts.
We use a number of technologies to help you get the most out of the Service. Our systems automatically analyze your data to power Evernote features and to continually improve the Service for you in a way that does not require anyone to look at your Content. This may include, for example:
Making sure you find what you’re looking for when you search your account.
Showing you information most relevant to how you are or could be using the Service at a specific time or location.
Suggesting actions for you to take based on information you’ve stored.
Suggesting Evernote service features or products to you that we think will help you get the most out of our Service.
For Evernote Business users, recommending people for you to collaborate with.
To provide troubleshooting and customer support, our Customer Support team may need to access your information, such as your account email address and information about the Evernote application you are using, subject to the protections described below.
As part of our efforts to protect your account and the functionality of the Service, our systems may analyze the emails you send to and from your Evernote account and the notes you share to detect spam, malware, or other potential security concerns. If we determine that such material constitutes a Terms of Service or User Guidelines violation, we may block delivery of or unshare the problematic material, much like a spam filter works for your email inbox.
Learn more about steps you can take to protect your account, such as using strong passwords, two-step verification, and encryption.
In accordance with your communication preferences, we’ll occasionally contact you to announce new products and features we build for you, share tips for using Evernote to get more done, make special offers, and provide information about how Evernote works with products and services from our business partners.
You may opt out of promotional communications at any time by following the opt-out or “unsubscribe” instructions provided in emails or by logging into your Evernote service account via our web site at www.evernote.com and going to Settings > Personal Settings > Contact Preferences to change your contact preferences. You can also change your in-app notification preferences through your device settings. You will continue to receive essential Service-related and account-related information (such as notification that your paid subscription is about to expire), even if you unsubscribe from promotional emails or turn off in-app notifications. Evernote Business users will also continue to receive a daily summary of activity associated with their Business account.
Similarly, if we learn of a security system breach, we may attempt to notify you and provide information on protective steps, if available, through the email address, phone number or other contact information that you have provided to us or by posting a notice on our web site and/or via other communication platforms. Depending on where you live, you may have a legal right to receive such notices in writing.
If you are an End User of an Evernote Business account, please note that the Account Holder of your Evernote Business account (such as your employer or organization) may have established its own rules regarding End Users’ access, use, disclosure, or retention of data stored in that account. Also note that while an Administrator of an Evernote Business account has access to the End User accounts linked to that Evernote Business account, an Administrator cannot access an End User’s personal Evernote account. You can find more information on how your personal Evernote service account works with your Evernote Business account here.
Would someone at Evernote ever view my Content?
You have control over who sees your Content. We limit the use of your Content to make sure that no one at Evernote can view it unless you expressly give us permission or it’s necessary to comply with our legal obligations. Specifically:
To help refine or improve the technology, we may ask you for permission to review portions of your Content. For example, if a new feature suggests related notes that are relevant to your Content, we may give you an opportunity to provide us feedback on how well the feature is performing along with a sample of the Content in question, so we can make sure this feature provides appropriately tailored suggestions. Such access to your Content is done only with your express permission and is subject to strict confidentiality rules and data access controls. Choosing to give us such permission is completely voluntary.
If you contact our Customer Support team for help with specific pieces of Content in your account (for example, if you can’t find a note you believe should be in your account), we may ask for your temporary permission to look at your Content. This permission terminates when the issue is resolved.
If you send Evernote an error report and choose to attach application activity logs, please note that such logs may contain Content (for example, the title of a note or notebook). You may edit Content out of your activity logs before you send them to us.
If we become aware of a potential violation of our a Terms of Service or User Guidelines, we may suspend or close your account until the problematic material is removed. Under such a circumstance, we would only look at the Content in your account if you give us consent or if necessary to comply with our legal obligations, including to protect the safety of you or any other person.
To test and improve our product offerings for our users, we use aggregated data that does not contain any personal information, does not identify any person, and cannot be connected to any specific user. This policy is not intended to apply to such anonymized/de-identified data.
How does Evernote share or disclose my information?
Evernote is not in the business of selling or renting your information. Here are instances when we may disclose your information — and then only the minimum information necessary:
We share your information with Service Providers who process data on our behalf, such as credit card processors and customer management systems. For example, these Service Providers help us:
Operate, develop, and improve the features and functionality of the Service
Complete your payment transactions
Fulfill your sales and support requests
Communicate with you as described elsewhere in this policy
We require these providers to agree to strict data protection requirements in keeping with our privacy policy standards, the European Union's General Data Protection Regulation ("GDPR"), and our commitments under our EU-US Privacy Shield and Swiss-US Privacy Shield certifications as discussed below. You can view the vendors we use to help us provide the Service on our Vendors page.
We do not share your information with any third parties for their own advertising purposes.
Examples of our service providers include PayPal and Adyen for processing payments from our paid users, Salesforce for helping us with our email communications and Evernote Business sales outreach, and analytics providers like Google Analytics. Other service providers include resellers that we work with to help distribute Evernote. If you purchase a Paid Service from a reseller instead of directly from Evernote, we may need to share limited information with the reseller to ensure accuracy in payment, account management, and delivery of services to you.
Your Content is private unless you decide you want to share it. You may choose to share using public links or through any of the Service’s features that allow you to share or collaborate on Content (“Collaboration Features”). If you choose to share, we may need to take steps to facilitate your collaboration.
There are features in Evernote that allow you to publish and share some of your notes and notebooks publicly, but these are optional. Any information that you post in these locations, or in our user forum, can be read, collected, and used by anyone and could enable others to send you unsolicited messages. Evernote enables you to determine whether to post personal or otherwise sensitive information to publicly accessible areas of our site, so you should carefully consider how you use the Service. Evernote is not responsible for any publication or use of any information you choose to post in these locations.
When you use Collaboration Features, people you share with may see your user profile.
If you have not added any profile information, then you will be identified by the email address associated with your Evernote service account.
If you are an Evernote Business user, other members of your Evernote Business account will see your full Evernote Business account profile. Evernote service users who are not in your Evernote Business account will only see your profile name and image.
In addition, when you use Collaboration Features, the information you share is no longer private to you. For example, by publishing or sharing any portion of your Content, you may be enabling each recipient of the shared material to access, use, display, perform, distribute, and modify that material. In addition, Evernote enables you to use a variety of third-party services and applications that interact with the Service, and you should review the access rights you provide to those services or applications, as you may enable them to access or extract your Content through your agreements with those parties. More information on the nature of these permissions may be found on our Third Party App Permissions page.
Depending on the permission levels you set when sharing Content, anyone who has access to the shared material may be able to see the Content, information about where and when the Content was created, as well as the note history, tags, and reminders associated with a particular note.
In the event of a merger, sale, or reorganization of all or part of our business, information covered by this policy may be transferred in connection with that deal.
As described on our Cookie Information page, we contract with third-party advertising networks in order to deliver relevant Evernote advertisements to you across the Internet and to manage our communications with you. We do not use your Content for these purposes. In addition, we may share with partners or Service Providers a hashed identifier to serve you relevant Evernote ads when you visit partners’ and providers’ websites, applications or platforms. We may, for instance, participate in the Google Adwords Remarketing, Twitter Tailored Audience and Facebook Custom Audience services. To learn more about the privacy controls that Google, Twitter and Facebook offer and honor for those respective services, please visit here for Google, here for Twitter, and here for Facebook. You may opt out of certain ad targeting and retargeting services by visiting the Digital Advertising Alliance’s opt-out page, or the Network Advertising Initiative’s opt-out page.
We also may share information about you with third parties whenever you consent to or direct such sharing. This includes, for example, if you connect your Evernote account with a third-party app in our App Center.
Evernote works with a number of third-party applications and services. In some cases, Evernote will partner with another company to provide an integration. In addition, in our App Center, you can find a number of third-party applications and services that work with Evernote. If you connect your Evernote account to these third-party services, you may be giving the partner access to some or all of your data, including, in some cases, your Content.
Providing such access is entirely voluntary, and you’ll receive notice and must consent before such access is granted. You’ll always be able to check which applications or services are authorized to access your account by visiting the applications page in your account. You’ll also be able to turn off access from connected applications and services whenever you want.
Please consider your selection of such applications and services, and your permissions, carefully. We encourage you to review each party’s contract terms and privacy policy. To learn more about third-party applications and what data they may access, visit our Third Party Application Permissions page.
How does Evernote respond to legal requests for my information?
We vigilantly protect the privacy of your account. We will not disclose your information to law enforcement or other governmental authorities unless we believe it is required to comply with warrants, court orders, subpoenas, or other lawful government requests. This may include responding to legal requests from jurisdictions outside of the United States where we have a good faith belief that the response is required by law in that jurisdiction, affects users in that jurisdiction, and is consistent with internationally recognized standards of due process.
We narrowly interpret all information requests, and we only disclose Content in your account that is specifically responsive to a government warrant or where you have provided your explicit consent. In accordance with our user notice policy, we will notify you if we believe we are compelled to comply with a third party’s legal demand for your information, and we routinely push back on government orders to delay user notice that we view as overly broad. You can find more information in our current Transparency Report.
In addition, in rare cases, we may share your information as necessary to investigate or take action regarding illegal activities, suspected fraud, or potential threats against persons, property or the systems on which we operate the Service, or as otherwise necessary to comply with our legal obligations.
How can I manage my information stored in Evernote?
Consistent with our first law of data protection—your data is yours—in most cases, you can manage your information simply by logging into your account and editing your information directly within the Evernote service.
However, if you prefer, you can contact us at compliance@evernote.com to ask us to provide access to, correct, update, or delete your personal information. Please note that we may ask you for proof of account ownership and/or identity before fulfilling your request. We will comply with such requests to the extent required by applicable law or the US-Swiss Privacy Shield and US-EU Privacy Shield.
A Note for our European Users about our Data Processing Grounds and Data Access Rights
The European Union's GDPR requires that we provide notice in a specific way to our European users about their privacy rights. We process Account Holder or End User personal information on one of three grounds, depending on the circumstances: (i) your affirmative consent, in which case you will have the right to withdraw consent at any time; (ii) contractual necessity; or (iii) our legitimate interest in providing the Service. In addition, we are required to list the data access right available to all users in a specific way.
WHAT DOES IT MEAN FOR YOU?
Right to access
You can request Evernote to provide you with information on how we collect, use, and store your personal information, including provide you with a copy of your personal information we store in Evernote.
You can request that we correct certain inaccurate information if you are no longer using the Service. For more information, see the section: "What happens if I want to stop using Evernote?"
You can export your information from Evernote to a competing service. See our Third Law of Data Protection for more information.
You can object to the processing of your information in certain cases, as well as request that Evernote not use your personal information for direct marketing purposes. Direct marketing includes emails which help us keep you informed about the latest improvements to our Service. See our Help and Learning page on opting-out for more information.
How long does Evernote store my information?
Evernote's mission is to help you remember everything important in your life. In order to do that, we make the Content you store in Evernote readily accessible to you, until you make the decision to delete it.
If you delete your Content and then sync, it will no longer be accessible to you or others who may access the Service. The Evernote service’s back-up systems may retain residual copies of your deleted Content for up to one year due to the nature of those systems’ operations.
Evernote provides you with features that allow you to communicate and collaborate with other users. Please note that deleting your copy of these communications (such as messages) won't delete copies existing in the accounts of people you were interacting with.
For users who are inactive for extended periods of time, we may close your account to satisfy our obligations under applicable law, and in accordance with our data retention policy. If that happens, we will try to notify you before taking any action.
What happens if I want to stop using Evernote?
As described above, you can delete your Content at any time, and you can stop using the Evernote service at any time. And as we promise in our third law of data protection, your data is portable. You can export your notes at any time, as explained here.
What happens if Evernote closes my account?
If Evernote deactivates your account due to a TOS violation, then you may contact us to request deletion of your Content, and we will evaluate such requests on a case by case basis, pursuant to our legal obligations.
Where does Evernote store my information?
When you use Evernote Software on your computing device, such as by using one of our downloadable applications, some of your data will be stored locally on that device.
When you sync your computing device with the Service, that data will be replicated on servers maintained in the United States. This means that if you store information in or submit data to the Evernote website or Evernote Software and sync such Evernote Software with the Evernote service, you acknowledge your personal information will be transmitted to, hosted, and accessed in the United States.
Data privacy laws or regulations in your home country may differ from, or be more protective than, those in the United States. We will collect, store, and use your personal information in accordance with this Privacy Policy and applicable laws, wherever it is processed.
Which Evernote company is my data controller?
If you live in Brazil, your data controller is Evernote do Brasil Serviços de Aplicaçōes Ltda. (“Evernote Brasil”). If you live in the United States and Canada, your data controller is Evernote Corporation (headquartered in California). If you live anywhere else, your data controller is Switzerland-based Evernote GmbH.
How does Evernote comply with data transfer rules?
If you are a resident of the European Economic Area (“EEA”) or Switzerland, please note that we use standard contractual clauses approved by the European Commission to transfer your personal Information from the EEA or Switzerland to the United States and other countries.
In addition, Evernote Corporation has certified its compliance with the EU-US Privacy Shield Framework and the Swiss-US Privacy Shield Framework as set forth by the U.S. Department of Commerce regarding the collection, use, and retention of personal information from EU member countries and Switzerland.
The following statements apply to both the personal information Evernote Corporation receives from individuals or data controllers in the European Union and Switzerland, and the procedures discussed may be used by individuals from the EU and Switzerland.
The Evernote Corporation has certified that in respect of all personal information it receives from the European Union and Switzerland in reliance on the Shield, it will adhere to the Privacy Shield Principles of Notice, Choice, Accountability for Onward Transfers, Security, Data Integrity & Purpose Limitation, Access, and Recourse, Enforcement and Liability. To access the Privacy Shield List and to find details of our certification, please visit: https://www.privacyshield.gov/list.
If we ever need to use your personal information for a purpose that is materially different to the purposes we collected it for or that you later authorize, we will notify you and provide you with the opportunity to opt-out.
Under the Privacy Shield, Evernote Corporation will remain liable if its third-party service providers process your personal information in a manner inconsistent with the Privacy Shield Principles, unless we prove that we are not responsible for the event giving rise to the damage.
Residents of the European Union or Switzerland who believe that their personal information has not been processed in compliance with the Privacy Shield Principles may raise their complaint in the following ways:
You can contact Evernote Corporation directly using the details in the "How can I contact Evernote?" section in our Privacy Policy. We will respond to your complaint within 45 days of receipt.
We have further committed to refer unresolved privacy complaints under the Privacy Shield to JAMS, an alternative dispute resolution provider located in the United States. If you do not receive a timely acknowledgment of your complaint, or if your complaint is not satisfactorily addressed by us, please visit https://www.jamsadr.com/eu-us-privacy-shield for more information about the scheme. This JAMS service will be provided to complainants free of charge. To file a complaint directly with JAMS, go here: https://www.jamsadr.com/file-an-eu-us-privacy-shield-or-safe-harbor-claim
For residual disputes that cannot be resolved by the methods above, you may be able to invoke a binding arbitration process under certain conditions. To find out more about the Privacy Shield's binding arbitration scheme, please see: https://www.privacyshield.gov/article?id=ANNEX-I-introduction.
You may have the right to access personal information that we hold about you and request that we correct, amend, or delete it if it is inaccurate or processed in violation of Privacy Shield. Please contact us, as provided above, to make such a request and we will consider it in accordance with the Privacy Shield's Principles.
The Federal Trade Commission has investigation and enforcement authority over our compliance with the Privacy Shield.
Please note that we may disclose personal information to respond to subpoenas, court orders, legal process, or government requests (including in response to public authorities to meet national security or law enforcement requirements).
How can I contact Evernote?
Evernote welcomes your feedback regarding this Privacy Policy. If you have questions, comments or concerns about this Policy, please contact us by email at privacy@evernote.com or postal mail at:
EVERNOTE CORPORATION
Redwood City, California 94063 USA
Attention: Privacy Team
EVERNOTE GMBH
Walchestrasse 9
8006 Zurich, Switzerland
EVERNOTE DO BRASIL SERVIÇOS DE APLICAÇÕES LTDA.
Avenida Paulista, no 2.300
Andar Pilotis
Edifício São Luís Gonzaga
CEP: 01310-300 São Paulo/SP
Account Holder means the person or entity who has contracted with Evernote as either an individual Basic, Plus, or Premium user or as a Customer as defined in our Evernote Business Agreement.
Collaboration Features means any of the Service’s features that allow you to share or collaborate on Content.
Content means the text, images, and other data you choose to input, upload, and store in Evernote.
End User means the individual who uses an account on the Evernote service.
Evernote (or sometimes “we” or “us”) means Evernote Corporation and its affiliated companies that also act as data controllers: Evernote GmbH and Evernote Do Brasil Servicos de Aplicaçōes Ltda.
Evernote Service means the Evernote Software (as defined below) and other products, services and websites hosted or made available by Evernote, including our downloadable applications, App Center, User Forum, and Help & Learning pages.
Evernote Software means the software hosted on Evernote’s servers and the software we make available to be deployed by you or a third party to enable capturing of Content originating outside the Service, such as Evernote Scannable or Evernote Web Clipper or any of the Evernote software applications for compatible computing devices that enable access and use of the Service through such device
Group Companies means Evernote Corporation and its wholly owned subsidiaries, which include Evernote GmbH and Evernote do Brasil Serviços de Aplicaçōes Ltda.
Paid Service means Evernote Plus, Evernote Premium, Evernote Business, and any other Evernote offering for which we collect payment (in the form of currency, Evernote points, coupon codes).
In the event of a conflict, the English language version shall govern.
Choose a language: Bahasa Melayu
© 2019 Evernote Corporation. Hak cipta terpelihara.
|
cc/2019-30/en_middle_0019.json.gz/line9913
|
__label__wiki
| 0.746381
| 0.746381
|
ILTV Live
Editorials by Joey Gaskin
Liberty CEO bemoans performance of BTC employees July 17, 2019
Parker-Edgecombe: Liberty exec’s criticisms of BTC “distasteful and disturbing” July 17, 2019
Davis: We are off the reefs now, SS PLP July 17, 2019
Man dies in house fire July 17, 2019
Young man drowns in Eleuthera July 17, 2019
Part owner of Marvin Gaye song sues Ed Sheeran over hit song
Entertainment, Music July 2, 2018 Eyewitness News
FILE - In this Feb. 15, 2016, file photo, Ed Sheeran accepts the award for best pop solo performance for “Thinking Out Loud” at the 58th annual Grammy Awards in Los Angeles. A part owner of Marvin Gaye’s 1978 release “Let’s Get It On,” is suing British singer Ed Sheeran for $100 million for copyrights infringement after getting blocked from a similar lawsuit brought by other copyright owners. (Photo by Matt Sayles/Invision/AP, File)
NEW YORK (AP) — A part owner of Marvin Gaye’s “Let’s Get It On” is suing Ed Sheeran for $100 million after getting blocked from a similar lawsuit brought by other copyright owners.
Both lawsuits say the British songwriter copied parts of the soul classic for his Grammy-winning hit “Thinking Out Loud.”
A lawyer for Structured Asset Sales said the new lawsuit’s Thursday filing was necessary because a judge refused to let the company join a 2016 lawsuit by the family of a co-writer of Gaye’s song.
That lawsuit, which is still pending in Manhattan federal court, seeks unspecified damages.
A lawyer for Sheeran and other defendants said in a letter to the judge in the original lawsuit that he will seek to have both lawsuits tossed out. He said they were baseless.
Always a headline ahead, Bahamas news, Eyewitness News, www.ewnews.com
About Eyewitness News
View all posts by Eyewitness News →
BREAKING: PM confirms Cabinet, PS shuffle!
BREAKING: Cabinet shuffle list revealed
After 46 years as an independent, democratic nation, do you feel The Bahamas has sufficiently progressed?
Emancipation Day 2019
BEYOND THE HEADLINES JULY 16 2019
Copyright © 2019 by EyeWitness News. | Privacy Policy
|
cc/2019-30/en_middle_0019.json.gz/line9915
|
__label__wiki
| 0.668213
| 0.668213
|
< Back to ID Dunedin Fashion Week 2016
Emilia Wickstead to Show at iD Dunedin Fashion Week
Thursday, 14 Jan 2016
Emilia Wickstead’s Fall 2015 collection on the runway at London Fashion Week.
Dunedin’s iD Fashion Week will add another successful international name to its rollcall of judges and designers this year when London-based designer Emilia Wickstead touches down in March for the 2016 event. Wickstead is Auckland-born but moved to Milan at 14 and later to London where she studied fashion at prestigious university Central Saint Martins which has many famous fashion alumni including Alexander McQueen and Stella McCartney. Post graduation, she worked at Giorgio Armani, Proenza Schouler, Narciso Rodriguez and Vogue in New York and Milan before founding her own London-based label in 2008.
What began as a made-to-measure business has gone on to develop a major following and her feminine designs have been worn by Alexa Chung, Poppy Delevingne, Laura Bailey, Suki Waterhouse and Samantha Cameron, not to mention Wickstead’s most famous client – the Duchess of Cambridge, who wore Emilia Wickstead outfits during her New Zealand tour in 2014.
Since its inception in 2000, iD Fashion Week has hosted many of fashion’s greatest names including Zandra Rhodes, Hilary Alexander, Stephen Jones, Akira Isogawa, Lutz Huelle, Martin Grant and last year’s Queen of Vintage, Doris Raymond. iD Dunedin Fashion Week chair, Cherry Lucas, is thrilled to be bringing Wickstead to iD, with the support of sponsor airline Air New Zealand. “Emilia Wickstead’s chic and elegant designs have created an international following and we’re delighted to have her back in her home country showing at iD. From her very latest pieces from London Fashion Week to couture garments worn on the world’s red carpets, iD audiences will enjoy a spectacular fashion experience.”
Tickets for the iD International Emerging Designer Awards on Thursday 17 March and the iD Fashion Show on Friday 18 March and Saturday 19 March go on sale on Monday January 18 from Ticket Direct.
Image from SIPA/WENN
ID Dunedin Fashion Week 2016
The iD Dunedin Fashion Show 2016
The iD Dunedin Fashion Week Emerging Designer Awards 2016
What to do at iD Dunedin Fashion Week
Kate Sylvester Joins iD Dunedin Judging Panel
Finalists Named for iD Dunedin 2016
|
cc/2019-30/en_middle_0019.json.gz/line9921
|
__label__cc
| 0.500539
| 0.499461
|
Home Health Tips Creativity Comedy Central's Clusterfest tackled mental health this year—here are 5 wellness tips from the – Fast Company
Creativity Comedy Central's Clusterfest tackled mental health this year—here are 5 wellness tips from the – Fast Company
Comedy Central’s Clusterfest tackled mental health this year—here are 5 wellness tips from the panel
Comedians know a lot about mental health, or lack thereof. Tig Notaro, Neal Brennan, Michelle Buteau, and Jeffrey Ross took the stage at Comedy Central’s Clusterfest to talk about it over the weekend.
(Left to right) Jeff Ross, Neal Brennan, Tig Notaro, and Michelle Buteau. [Photo: courtesy of Clusterfest]
By Joe Berkowitz 4 minute Read
“How are you doing?” comic and scene-stealer Michelle Buteau asked Neal Brennan.
“Clinically depressed but not bad,” Hollywood’s Secret Comic Whisperer responded, with the kind of tossed-off nonchalance that suggests this is a joke but also not a joke.
It’s hard to imagine a more natural kickoff for the star-studded panel “Comedy and Mental Health: A Hilarious Conversation.”
The event took place over the weekend at Comedy Central’s Clusterfest, which sounds not so much like a three-day comedy festival as what an oncologist privately calls a clump of polyps. Comedy Central partnered with Mental Health First Aid, part of the National Council for Behavioral Health, to address mental health in the comedy community (and beyond!) during the festival. As tired as the sad clown trope has become—“but doctor, I am Pagliacci”—it still holds truth. The people whose jobs consist of making other people laugh all too often have tangled with depression. Earlier this year, for instance, beloved comic Brody Stevens joined an unfortunately growing list of comedians whose depression led them to take their own lives. This panel provided an opportunity for comedians to not only open up about the mental health risks endemic to their own lives, but to translate them in a universal way.
Buteau hosted the hour-long panel, which in addition to Brennan included Tig Notaro and Jeffrey Ross, with Rainn Wilson Skyping in briefly to do a pre-taped promo for his upcoming comedy/mental health documentary, It’s Not That Funny. Although the conversation was refreshingly non-preachy, here are five tips for mental wellness that emerged during it:
1. Remember: It’s not just you
“I feel like everyone’s depressed and comedians just have a microphone,” Tig Notaro said at one point. “But if you gave a microphone to anyone—a mail carrier, next-door neighbor, possibly someone in this audience—you’d find that everyone’s struggling.”
Everyone on the panel certainly copped to having struggled at one point or another. Brennan devoted a large chunk of his Netflix special 3 Mics to his battle with depression.
“I realized [I was depressed] early in life, but didn’t start medicating until age 24,” he revealed during the panel. “Back then, I just thought I had a New York attitude. Then I realized, no, I need medicine for this.”
2. Literally fake it until you make it
“A fake smile, I know this sounds corny, but I’ve experienced this sometimes visiting very sick people in hospitals: A fake smile, for five seconds, turns into a real one,” Ross suggests. “You almost have to trick yourself.”
Sometimes the most clichéd advice becomes a cliché for a reason, and this panel seems to agree.
“Fake it ’til you make it,” Buteau says.
“That’s biologically proven, by the way,” adds Brennan. “If you fake-smile, your body will be like, ‘Wait, I guess we’re happy. Fuck it: Release some endorphins real quick.’”
3. Provide a holding space for a friend in crisis
What made this panel so effective wasn’t just that the participants seem so authoritative on the topic—which they do—but that they are able to build laughs into such morbid, taboo subject matter. In the middle of a long discussion on suicide, Brennan advocates for the idea of “holding space” for an at-risk friend, just being there, physically and mentally present, to take some of the burden off of them in a crucial moment. It’s a nice thought, which immediately gets some of the air drained from it.
“I’m doing a show at the Holding Space at 4:30 p.m.,” Ross said.
“Holding Space is the nickname for my vagina,” Buteau chimed in, before adding, “Tig, your turn.”
“I don’t get it,” Tig declared, in her signature deadpan.
4. Struggle makes you stronger
When failure, rejection, or tragedy darken your door, it’s tempting to let them weigh you down entirely. Ross suggests, however, that simply keeping moving is the antidote to letting your misfortune consume you.
“I think you take everything that happens to you with you, and you have to carry it,” he said. “And it’s not that it gets lighter, but you get stronger. I can carry all that shit with me now, and sometimes I can carry Neal’s shit, too.
“What the fuck does that mean?” Neal Brennan responded.
F—ing stay off social media
For anyone trying to ward off negative emotions by curling up with an iPhone for some Insta-stalking, Brennan had a word of advice: Don’t.
“I’ve started thinking of social media as like, we’ve all become like a lifestyle brand,” he said. “That’s especially what Instagram has done. We’re all individual lifestyle brands, and we’re looking at other people’s lifestyle brands, so it’s not even fun, it’s just opposition research. So just fucking stay off it. I’ve never seen someone go like, ‘You look great, what’s your secret?’ ‘Isn’t it obvious? I’ve just been online for 9 straight hours.’ It’s not good for us. It’s not healthy. It’s not productive, and at this point, it’s got so little upside. Social media is basically like cutting.”
“Fuck,” Buteau replied. “Put that on a magnet.”
Previous article Coffee may help in battle against obesity, diabetes, researchers say – NBC2 News
Next article Experts Agree — This Is How Often You Should Run to Lose Weight – POPSUGAR
7 patients at new Ohio hospital diagnosed with Legionnaires' form of pneumonia – AOL
Weight loss is more successful when doctors offer specific tips – ConsumerAffairs
Hundreds more reported ill in salmonella outbreaks tied to backyard poultry – CNN
Heart healthy eating habits over the summer – UpperMichigansSource.com
A Franklin health care company purchased Nutrisystem – Brentwood Home Page
|
cc/2019-30/en_middle_0019.json.gz/line9922
|
__label__cc
| 0.601009
| 0.398991
|
39 logo fonts everyone should know
Logo fonts can make or break your logo design. Choosing the right typography can help to tell your brand story and amplify the impact of your logo whenever and wherever people see it. But the wrong font could spell trouble. There are thousands of fonts out there, and that’s exactly why we’ve we’ve put together this list the most notable, game-changing logo fonts of all time.
Many of these fonts are dazzling as is, but don’t forget that they are also a great way to get inspired about your logo design. They can be altered and modified in a multitude of ways to give your brand a unique feel.
Start selecting a logo font by determining your brand personality (how your brand sounds and feels to your audience), and then choose fonts that evoke those ideas and feelings. There are several types of fonts to chose from, and each one tells a different brand story.
Serif logo fonts have decorative “feet” at the ends of each letterform and evoke a polished, classic feeling.
1. Bodoni
2. Garamond
3. FF Avance
4. Didot
5. Neue Swift
6. Big Caslon
7. Canilari
8. Modesto
9. Rufina
10. Revista
Slab serif logo fonts are bolder, louder serifs with large letterforms designed to be seen from a long distance.
11. Rockwell
12. Bodoni Egyptian Pro
13. Baltica
14. Grenale Slab
15. ITC Lubalin Graph
Script logo fonts are both formal and casual typefaces that have the loops and flourishes of script handwriting.
16. Bambusa Pro
17. Steak
Sans-serif logo fonts lack the “feet” at the ends of each letterform and are considered more modern than their serif counterparts.
18. Futura
19. Univers
20. Helvetica
21. Frutiger
22. ITC Bauhaus
23. FF Meta
24. FF Blur
26. Sackers Gothic
27. FF Din
28. Sassoon
29. Neo Sans
30. Proxima Nova
31. Foco
32. Tondo
33. Museo Sans
34. Uni Sans
35. Brandon Grotesque
36. Amsi Pro
37. Posterama
38. Docu
39. Rational TW
Check out the best logo fonts for your next design:
Year created: 1700s (late)
Foundry/Designer: Giambattista Bodoni
Style: Modern (Didone), serif
The Bodoni typeface surfaced during a time when typeface designers were experimenting with the contrast between thick and thin type characteristics. Giambattista Bodoni took that experiment to an extreme, creating this dramatic font. It has resonated through time in famous logos like Vogue and Calvin Klein, and is a great font to consider for mainstream fashion brands.
As you’ll see below, Bodoni has a lot in common with the Didot family of typefaces because it was created around the same time in history. Regardless, the Bodoni typeface has its own style.
Consider this logo font for fashion industries that are pushing the extremes on the runway!
Year created: 16th century
Foundry/Designer: Claude Garamond, Jean Jannon
Style: Old-style serif
Garamond is more of an umbrella term for typefaces than a single typeface. Many of the iterations we see in recent decades are interpretations of alphabets designed by Claude Garamond and Jean Jannon in the 16th century.
We've just sent you your free logo ebook.
Get the free logo ebook and learn how to build the perfect logo for your brand.
Enter your email to get the ebook, along with creative tips, trends, resources and the occasional promo (which you can opt-out of anytime).
Get the ebook!
Interestingly, the Garamond typeface became one of the first “famous” typefaces when it was presented at the Paris World’s Fair in the 1900, and dozens of variations soon followed. This fame has continued into later decades, as seen in the examples above.
Garamond has an elegant appearance. The serifs on each letter are carefully crafted to convey their own personality, most notably the ones on the capital “T”. Because the serifs are so expressive, they can easily be used in a playful context—as seen in the early Apple branding. The refined letterforms also allow this font to be taken in a sophisticated direction—like in the American Eagle logo.
Consider this font for a professional and timeless logo with a flair of personality
Year created: 2000
Foundry/Designer: Evert Bloemsma
Style: Serif
FF Avance is special typeface that pushes the envelope on asymmetrical serifs. The lower serifs of the capital “A” point to the right, while the upper serifs on the lowercase “v” point to the left.
Consider this logo font if you are looking to portray motion and energy. It’s a great choice for sports, automotive, and action-based industries.
Foundry/Designer: Didot
Style: Didone, serif
Before Didot became known as a typeface, it was the name of a family composed of French printers, punch cutters and publishers in the late 1700s. They created many versions of Didot, one of which is used in the Giorgio Armani logo. Similar to Bodoni, the high contrast in line thickness creates drama. This font is also commonly seen in the fashion world. Didot works best when used simply, with careful kerning and high contrast colors.
Consider this font for a less dramatic fashion logo: one that is mature and classy.
Foundry/Designer: Linotype/Gerarad Unger
Neue Swift was designed to generate a horizontal flow, helping words and lines look separated and to read. This makes Neue Swift a great choice for wordy logos! The typeface also has distinct sloping serifs and “busy” angles.
Consider this font for financial, health or non-profit industries.
Foundry/Designer: Matthew Carter
Style: Old-style, serif
Big Caslon is a revival from a group of serif typefaces from the 1600s by William Caslon I. This typeface is a great example of classic typeface styles entering the realm of digital typography. Most of the serifs feel sharp and pointy, while some, such as on the uppercase “G” and “S” are slightly geometric. Overall, Big Caslon feels bold and strong—perfect for making a big point.
Consider this font if you want your logo to feel loud yet retain a refined and elegant side.
Foundry/Designer: Latinotype/Patricio Truenos
Country: Chili
Style: Post-modern, serif
Canilari could be considered somewhat of an outcast typeface. It’s hard to pinpoint where exactly it fits into the context of typographic history, and that’s great for inspiring creativity.
Sometimes a strange typeface is what a logo designer needs to take a brand out of the box.
Consider this font if you simply can’t quite put your finger on the right font for your business. This font’s thick and crude cuts could work well for a modern butcher shop or could add a homemade touch to packaged goods. Use your imagination!
Foundry/Designer: Jim Parkinson
Modesto has a very interesting history from 19th and 20th century circuses and hand-painted typography. This digital iteration takes those analog forms and perfects them into a usable type family containing 23 fonts.
Consider this font for your business if you feel inspired by vintage circus styles, classic wooden crate branding or cigar box designs.
Foundry/Designer: TipoType/Martin Sommaruga
Country: Uruguay
Style: Stencil-Serif
Rufina applies classic typography standards to stencil design. Where Rufina departs, however, is in the placement of the character breaks. Rather than looking like a stencil, it almost looks more like an artistic puzzle, with contrast and perceived texture. This technique allows Rufina to go in stylistic directions that other stencil fonts can’t.
Consider this font if you own an art gallery, an art-related business, or if you need to merge an artistic sensibility with a utilitarian aesthetic.
Foundry/Designer: Latinotype/Paula Nazal Selaive, Marcelo Quiroz, Daniel Hernández
Style: Stencil, serif
No font list would be complete without a stencil typeface, and Revista is an exceptional example. It brings the elegance of a classic serif face and merges it with the utility of a stencil font. The broken letter forms lend a down to earth, DIY vibe and makes a fashion-oriented font accessible to everyone.
Consider this font if your disruptive business aims to break—nay set!—trends.
Foundry/Designer: Monotype
Style: Slab serif
While Rockwell hasn’t been in the limelight recently, it’s a standout typeface from the 1930s. This is a classic slab serif face, which means that the serifs are unbracketed and of similar weight to the balance of each character.
Rockwell’s letterforms are pleasing in their simplicity. The shapes don’t feel overwhelming, even though they are complex.
Consider this font as the signature look of a business dealing in utility, construction or no-nonsense clothing.
Foundry/Designer: Shinn Type/Nick Shinn
Bodoni Egyptian Pro is a typeface which aims to subvert typographic norms. It accomplishes this by taking Bodoni and reducing it to a single stroke weight design. There are eight weights, all of which are exciting—especially the lightest weight, which seems to be composed of single pixel lines.
Consider this font if your business has a classical and robust aesthetic, or even an electronic and modern feel. That’s the beauty of such a versatile font!
Foundry/Designer: Paratype/Vera Chiminova, Isay Slutsker
While Baltica fits the criteria for a slab serif, it looks very similar to a simple sans-serif. The slabs are bracketed and of different width from the letterforms, which is unusual for a slab-serif. These qualities are ultimately what set Baltica apart, giving it a signature look that helps define a brand like Winston.
Consider this font for a classic brands that want to be seen as trustworthy, or that espouse old-fashioned values.
Foundry/Designer: insigne/Jeremy Dooley
While you won’t read this anywhere else, Grenale Slab has a lot in common with Sassoon. The whimsical curls and bouncy rhythms are given a bold style that works well in display and fonts.
Consider this font if your company relates to health, gardening or storytelling, or seeks a robust yet playful aesthetic.
Foundry/Designer: ITC/Herb Lubalin, Antonio DiSpigna, Joe Sundwall, Edward Benguiat
Style: Neo-grotesque slab-serif
A quiet standout from the past is ITC Lubalin Graph. This font is full of life, as seen in the steeply angled elbow on the lowercase “e”, the asymmetrical upper serif of the capital “A”, and the unforgettable sweeping tail of the uppercase “Q”.
This typeface was made in several different weights, and it’s said that the IBM logo by Paul Rand was an elaboration on one of the heavier weights.
Consider this font for brand names containing the letter “Q” and/or brands needing an energetic and outgoing slab serif!
Foundry/Designer: Fontforecast/Hanneke Classen
Style: Script
Script typefaces eluded digital capability for decades. That’s because the letters are unpredictable in handwritten cursive letterforms—no one knows where one character will end and another will begin. With the evolution of font files and new methods for making sure each letter connects properly, script fonts have become more popular than ever.
Consider this font if your business aims to feel natural and beautiful.
Foundry/Designer: Alejandro Paul
Style: Cursive
Here’s a gorgeous typeface that can definitely make it in today’s market. Steak is a quirky cursive font that speaks to the handmade artisan aesthetic.
Consider this logo font if your business might exist alongside a hip flower shop, an artisanal ice cream maker or a cool silkscreen shop
Foundry/Designer: Paul Renner
Style: Geometric, sans-serif
Futura might be one of the most successful and most used typefaces of the 20th century. The unusual, geometric letterforms project an optimistic modernism. The style is reflective of the radical artistic experimentation in Germany at the time, especially at the Bauhaus art school, whose values revolved around functionality and order. They also believed that the individual artistic spirit could coexist with mass production.
In the end, Futura is a classic sans-serif that holds its own against other typefaces of any era. FedEx and Swissair are two companies who have built strong brand identities with the modern—yet friendly—letterforms.
Consider this font for your logo if you are looking to create an internationally recognizable brand with a slightly unconventional and personable character.
Foundry/Designer: Adrian Frutiger
Style: Neo-grotesque sans-serif
Univers was one of the first typeface styles to present the idea of a consistent font family. The Univers family includes a wide range of weights, widths and positions. Its designer, Frutiger, was not the biggest fan of purely geometric fonts and described Univers as having “visual sensitivity between thick and thin strokes, avoiding perfect geometry.” This attention to detail gives the letterforms a deep nuance.
Looking at the examples above, the cover to Europa/America creates an international and utilitarian look through its use of Univers uppercase letterforms. Meanwhile, the eBay logo shows a lot of personality. The arm of the lowercase “e” has a slightly lighter stroke than the rest of the character, the inner edge of the bowl of the “b” is shifted slightly to the left—creating interesting stroke variation—and the “a” and “y” feature delightfully unexpected shapes and cutoffs.
Consider this font for a logo with international appeal and universal accessibility.
Foundry/Designer: Max Miedinger
Many people don’t know that Univers was famous before Helvetica and inspired designer Max Miedinger to form a type family. Both fonts were of somewhat similar fame until the 70s and 80s, when Helvetica was licensed to Xerox, Adobe and Apple, to be one of the core fonts of the PostScript detection language.
Since then, Helvetica has gained international fame, as shown in the expansive usage above! That’s because the typeface is simple and utilitarian, with quirky touches—like the rounded square tail of the “R”, the narrow “t” and “f”, and the bracketed top flag of the “1”.
Consider this font for a tried-and-true appearance that feels familiar to new customers and seasoned design observers alike.
Style: Humanist, sans-serif
Remember Adrian Frutiger, the designer of the typeface Univers? Here’s another big one from him. Frutiger designed this typeface to be practical and useful for any purpose. The typeface is crafted for legibility at small sizes or at a distance. It’s no surprise that this font has been used on Swiss passports since 1985.
Consider this font for your logo when looking for a basic and utilitarian appearance that reads well in both small and large applications.
Foundry/Designer: ITC/Ed Benguiat and Victor Caruso
Style: sans-serif
Bauhaus, and its many iterations, are reinterpretations of the forgotten 1925 font Universal. The typeface ITC Bauhaus takes inspiration from Universal and builds on it with the inclusion of upper and lowercase characters, and an overall refinement. The strokes are all the same weight and evenly geometric, yet somehow wacky in their swooping curves and slivers of negative space. The font has a retro feel and is perfect for logo designs looking to capture an old-school feel.
Consider this font for your logo design which seeks a nostalgic or retro feel.
Foundry/Designer: Erik Spiekermann
According to font designer Spiekermann, FF Meta was intended to be the antithesis of Helvetica. Where Helvetica is more rigid, FF Meta is curved and fluid. The dot on the “i” is circular, the bends are unusual and a visual rhythm comes through when scanning your eyes across text set in this font.
Ironically, because of its popularity, FF Meta was considered to be the Helvetica of the 90s! It is used in the Herman Miller logo and The Weather Channel logo.
Consider this font for your logo if you are a Helvetica fan but want something a little different and more fresh!
Foundry/Designer: Neville Brody
Style: Experimental, sans-serif
In the 1990s there were two main transformations in typography. One was a decreased interest in legibility, and the other was the introduction of computers. FF Blur embodies both of these trends.
Neville Brody created this font by processing an iteration of Akzidenz-Grotesk through the Photoshop blur filter three times to create the three corresponding weights. The result is not particularly readable, but it does have an exciting look that was especially groundbreaking to those working in the early 90s.
Consider this font for your logo which seeks to break out of the norm and into the strange!
Foundry/Designer: Bitstream
Style: Experimental/geometric, sans-serif
Horizon takes inspiration from the typography used in the original Star Trek series. Quite fittingly, this font was used 21 years later in the film Star Trek: Into Darkness. In keeping with the digital experimentation of the 90s, Horizon has a space-age look—with sharp, unexpected angles that were achieved sharply with digital tools.
Consider this font for for futuristic and science-fiction-based brands.
Sackers Gothic is one of those fonts that feels so human you have to love it. The curves in the “S” are perfectly imperfect, the proportions of the “E”, R” and “C” produce a visceral impact and the typeface as a whole feels warm and beautiful. Sackers Gothic would do well for wine bottle design, vintage signage, or farm to table restaurants.
Consider this font for an old-school vintage vibe that is also sensitive and classy.
Foundry/Designer: FontFont/Albert-Jan Pool
FF Din was created for the foundry FontFont by Erik Spiekermann (also the creator of FF Meta) and ended up becoming their best-selling typeface. It modernized san-serif design by extending circular elements into geometric ovals, cutting off letterforms in unexpected (but pleasing) ways and creating nuanced curves through advanced geometry.
Consider this font as another alternative to Helvetica. It’s a font that still has that positive, welcoming feel yet looks more modern and current.
Foundry/Designer: Rosemary Sassoon
Sassoon was designed by one of the few renowned female type designers in recent history, Rosemary Sassoon. This typeface is whimsical and friendly as a result of the swoops and curls in each letterform. It is also highly utilitarian because of its simplicity. The example above shows how Sassoon adds to the environment when used in signs throughout a children’s’ museum.
Consider this logo font in children’s applications or brands that aim to be whimsical and imaginative.
Foundry/Designer: Monotype/Sebastion Lester
Neo Sans has become somewhat of a touchstone for sans-serif typefaces with curved corners. It was one of the first typefaces to use the technique in such a subtle and sophisticated way. It decreases the intensity of the font and creates a friendlier energy. This font was famously used by Intel, as seen in the example above, on the right.
Consider this font if you want to send an approachable, friendly vibe that is collected, clear and organized at the same time.
Foundry/Designer: Mark Simonson
According to the designer, Proxima Nova is a font that bridges the gap between fonts like Futura and Akzidenz-Grotesk. Based on broad spectrum of typography styles, a bridge between those extremes was welcome.
Proxima Nova is a typeface that balances classic geometry and modern proportions. It is used by major companies like Spotify and Twitter music.
Consider this logo font if your business is heavily connected with social media or is going for a hip internet presence.
Foundry/Designer: Veronika Burian, Fabio Haag
Everything comes full circle. Foco is unique because reintroduces the legibility that was lost in 1990s digital experimentation. This typeface experiments with the balance between soft corners with “quick” radii and “slow” corners with wide radii. In that respect, it displays creativity and personality.
At the same time, the character spacing and weights were carefully planned to boost readability and multi-functional use. This font reads well as the main face of a logo, a subtitle or tagline.
Consider this logo font if you want your business to feel cute, fun or tasty!
Foundry/Designer: Veronika Burian
Country: Germany/Austria
Style: Rounded, sans-serif
Veronika Burian (also one of the collaborators on the font Foco) is truly worth highlighting for her work on Tondo, one of the early fonts to take rounded corners to an extreme. The result is cute, fresh and healthy, which may be why it became part of the branding for the London marathon.
Consider this font if you (or your brand) have a bubbly personality!
Foundry/Designer: Jos Buivenga
Museo Sans is a more user-friendly version of Museo, a bizarre serif font. In contrast, Museo Sans is simplified and minimal, giving the letterforms room to breath.
The letter “Q” gives a wonderful surprise—it breaks down the barrier between letterforms and abstract shapes by rendering the letter as a simple circle with a line through it. A true delight for us typographic nerds!
Consider this font if your business takes a minimal approach and needs a simplified aesthetic.
Foundry/Designer: Fontfabric/Svet Simov, Ani Petrova, Vasil Stanev
The defining characteristic of Uni Sans is the way certain letterforms, such as the “N” and “M,” have extended wedges cut out of the joints. It’s unusual and opens the door for designers to play creatively with this unusual element.
Since this font pairs well with bold colors, it would do well with industries that honor strength, like fitness brands or advertising agencies. Best of all, Fontfabric has released four weights for free, so you can play with which suits your needs best.
Consider this font if you want your logo to stand out and “shout” in marketing materials.
Foundry/Designer: HVD Fonts/Hannes von Döhren
Brandon Grotesque stands apart from other sans-serifs with its low x-height, a characteristic that gives the typeface a certain compactness and warmth. Some of you may recognize it from the Comedy Central branding.
Consider this font if your logo will be used regularly on stylish packaging or modern label designs.
Foundry/Designer: Stawix/Stawix Ruecha
Style: San serif
Amsi brings the classic 1900s Block Berthold typeface into the present by utilizing the subtle corner rounding of typefaces like Neo Sans, and adding three separate weights ranging from very thin to very thick.
In drawing on so many fonts that came before and combining techniques in a new way, this typeface has created a novel “comic book” style.
Consider this font for logos which need a font that reaches the extremes of thin and thick stroke widths.
Foundry/Designer: Monotype/Jim Ford
The Posterama font family contains 63 fonts that take “a journey through space and type!” This family touches on Art Nouveau, the Armory Show, the 1913 Exhibition of Modern Art, the year of Metropolis, the Art Deco period and more.
It’s well worth checking out the full font family and as seen from the example above, each face has unique character.
Consider this font if your logo aims to reference a well known artistic period from the past yet needs to feel modern and current simultaneously.
Foundry/Designer: Wiescher design/Gert Wiescher
As explained in the type example above, Docu is a thin typeface and combats overly-wide logo designs.
Defining characteristics include the inward curves of the “C”, the odd curvature of the “S” and turned-in tail of the “y”.
Consider this font if your business needs an officious or legal look (or if your business has long name that could use a thinner font).
Foundry/Designer: Rene Bieder
Style: Monospace, sans-serif
The “TW” in Rational TW stands for typewriter, meaning that this is the typewriter addition to the Rational type family. According to the designer, Rational TW combines Swiss and American gothic elements with a modern aesthetic.
This is a monospaced font, which makes it extremely legible and versatile. Extra attention was given to modifying each character to appropriately occupy equal space. This can be seen in the fun curls of the “t”, “i” and “l”.
Consider this logo font for a computer-related business targeting computer lovers and design nerds alike!
Logo fonts make the logo
Now that you’ve got a much better grasp on the variety of typography styles, you’ll be able to make better decisions for your logo fonts. With a keen eye, you can find the perfect typographic match for your brand. If you want to go deeper, check out these beautiful typographic logos and get inspired!
Have these logo fonts inspired you to get a new logo?
A logo design contest can get you dozens of ideas from professional designers around the world.
This article was originally written and published in 2016. It’s been updated with new information and examples.
31 consulting logos that’ll put your brand on the path to success
31 amazing nightclub and bar logos to inspire you
15 interior design and decorator logo ideas for well-furnished success
Ben Truelove
There’s a few misidentified typefaces here. Microsoft’s logotype is in Segoe, Pro to be exact, for starters. I’m also not convinced that Swissair is Univers. The “s” looks too rounded at top and bottom.
Algustionesa Yoshi
Does microsoft really use frutiger? it not look like frutiger.
Clipping Solution
Amazing logo collection. I am impressed. Thanks for the Tutorial.
This article is poorly written and misinformed.
Giorgio Armani does not use Didot in this logo, but a different one. Microsoft does not use Frutiger, but their proprietary font Segoe (this should be obvious even if you can’t recognize the font). There are also several variants of Garamond (Adobe Garamond, Garamond Premier, Stempel Garamond, etc.) but the article does not clarify which one it is. Also, the IBM logo typeface is custom made.
Many of these typefaces are not even some of the “have to know” ones, and the important ones have been missed out.
Firoz patel
Is all the font you mention are free for commercial use..??
Welerson Ferreira
I think there were some missing from the list:
Roboto, Ubuntu, Gotham and Myriad.
What’s the font for this article? Thanks!
Atlas Grotesk web sans-serif!
Beerz
All good. Maybe a couple I disagree with. But most importantly, where is Gotham HTF? …Also, that Georgia Armani logo here is not Didot. Not to be a buzz kill 😉
I did some digging the consensus (according to google) is that it is a modified version of Didot
|
cc/2019-30/en_middle_0019.json.gz/line9924
|
__label__cc
| 0.702914
| 0.297086
|
CTD arrests JuD chief Hafiz Saeed
Emir of Qatar to arrive in Pakistan today
11:52 AM, 21 Jun, 2019
Islamabad (Staff Report): Qatari Emir Sheikh Tamim bin Hamad Al Thani will arrive in Pakistan today for a two-day official visit.
The Emir is visiting on the invitation of Prime Minister Imran Khan. He will be accompanied by a high-level delegation comprising key ministers and senior officials.
The Qatari Emir will hold talks with Prime Minister Imran Khan and President Arif Alvi during his visit. The two sides will discuss ways and means of building a robust and mutually beneficial economic partnership.
During the visit, Pakistan and Qatar will sign MoUs for enhanced bilateral cooperation in different areas.
In a statement released by Pakistan’s ambassador to Qatar to Pakistan Saqar Bin Mubarak Al Mansouri said the visit of Qatari Emir to Pakistan will contribute in strengthening the bilateral relations.
He added the visit will establish a future partnership based relationship between the two countries.
The ambassador further said the Emir Al Thani will discuss bilateral relations between the two countries as well as a number of regional and international issues of mutual concern with the prime minister and the president.
The ambassador highlighted that Qatar and Pakistan have good relations and there is a common vision to strengthen them in various fields
Tagged emir qatar visit pakistan sunday neo tv Pm imran
Panama JIT reaches Doha to record Qatari prince Hamad bin Jassim's ...
Qatari Emir in Pakistan on two-day visit, 3 MoUs signed
09:42 PM, 22 Jun, 2019
|
cc/2019-30/en_middle_0019.json.gz/line9926
|
__label__cc
| 0.537709
| 0.462291
|
Dragoș Bucur
Romanian actor
(1977-06-13) 13 June 1977 (age 42)
Actor, TV personality
Dragoș Bucur (Romanian pronunciation: [ˈdraɡoʃ ˈbukur]; born 13 June 1977) is a Romanian actor, ambassador for the program Youth of the Move involved by the European Commission,[1] and TV presenter for the show Extreme Makeover: Home Edition/Visuri la cheie broadcast on Pro TV.[2]
Dragoș Bucur received the Shooting Stars Award, the annual acting award for up-and-coming actors by European Film Promotion, at the Berlin International Film Festival 2010.[3]
He holds an acting degree from Caragiale Academy of Theatrical Arts and Cinematography in Bucharest, Romania. He became known through his roles in "Police, Adjective" elogiated by The Washington Post,[4][5] "The Way Back",[6] or "Boogie", The Guardian notes about Dragoș character : "Dragoș plays Bogdan or "Boogie", a hardworking guy who has been prevailed upon to take his partner Smaranda (Anamaria Marinca) and their child to the seaside."[7] Also he stars in "The Paper Will Be Blue" and many more productions.
Apart from being an actor he has also hosted several Romanian TV shows like "Jurnal de călătorie", "Faci Pariu?", "Marfă",[8] "Câștigi fără să știi", etc..
1 Awards and honours
Awards and honours[edit]
For his acting talent he has received many awards in the recent years. In 2002 and 2009 he won the UCIN award for Best Actor for the films The Rage and Boogie,[9] while in 2009 and 2010 he won the GOPO award for Best Actor again for Boogie and Police, he also received the Actor Award at Buenos Aires Intl. Festival of Independent Film (BAFICI) writes Variety.[10]
He currently resides in Bucharest, Romania, together with his wife, Romanian singer Dana Nălbaru and their daughter Sofia, who was born in 2007. In March 2010, Dragos Bucur, Dorian Boguţă and Alexandru Papadopol founded Actoriedefilm.ro - acting school and production company.[11]
Filmography[edit]
2001 Stuff and Dough[12] Vali
2002 The Rage[13]
2003 The Tank Police Officer
2004 My Name Is Modesty Janos
2004 Out of Season Clown
2004 Liviu's Dream[14] Liviu
2005 Băieți buni \ Good Guys[15] Inspector Călin Boboc TV series aired on Pro TV
2005 Crash Test Dummies[16] Rumäne mit Uhr
2005 The Death of Mr. Lazarescu (Romanian: Moartea domnului Lăzărescu) (2005) - Misu Mișu An accountant with a quick wit says Washington Post
2006 The Paper Will Be Blue Dragoș
2007 After her Ștefan Robescu
2007 Youth Without Youth Tapster
2008 Boogie Bogdan Ciocazanu
2009 Police, Adjective Cristi A seasoned police detective who has just gotten married to Anca (Irina Saulescu) and wants to keep his superiors happy.[17]
2010 Toy Story 3 Ken (Romanian Dubbing)[18] Voice
2010 Tuesday, After Christmas Cristi
2010 The Way Back Zoran[19] A funny Yugoslav named Zoran (Dragos Bucur) round out the gang according to Time[20]
2011 The Godmother Radu Prodan Romanian film
2011 Even horses are green on walls PC Instructor Romanian film
2012 Titanic Peter Lubov A "police-killer" Peter Lubov who is being sought by the London police according to ABC
2014 Ride Along Marko[21] Serbian mobster
2014 Mirage Kokas Western movie
2014 A Gift for You Sebastian Post-production
2014 The Missing Martin (Episode 1) Post-production
2015 Bargain Anton Pre-production
2016 Dogs
2017 Hawaii Andrei Florescu
2019 Bloody Marie
^ "Dragos Bucur –". Retrieved 10 October 2014.
^ "Echipa Visuri la Cheie este pregatita sa schimbe destinele romanilor". Retrieved 10 October 2014.
^ "Screen Daily: EFP reveals line-up for 2010 Shooting Stars talent showcase". Retrieved 10 October 2014.
^ "Police, Adjective – IFC Entertainment". Archived from the original on 6 October 2014. Retrieved 10 October 2014.
^ Hornaday, Ann (15 January 2010). "Movie review: 'Police, Adjective,' an arresting tale of morality". The Washington Post. Retrieved 10 October 2014.
^ "Washington Post despre Dragos Bucur: Un actor exceptional". stirileprotv.ro. Retrieved 10 October 2014.
^ "Film review: Boogie - Film - The Guardian". the Guardian. Retrieved 10 October 2014.
^ "Marfă - Marean: Realitatea TV, 2006". Vimeo. Retrieved 10 October 2014.
^ "Aarc.ro - Dragoș Bucur". Retrieved 10 October 2014.
^ Newbery, Charles (19 April 2010). "'Sea' makes splash at Buenos Aires fest". Variety. Retrieved 10 October 2014.
^ "Actorie de film". Retrieved 10 October 2014.
^ "Stuff and Dough (Marfa si banii)". 23 April 2008. Retrieved 10 October 2014.
^ "Furia (2002)". IMDb. 29 November 2002. Retrieved 10 October 2014.
^ "The New Romanian Cinema". Harvard Film Archive. Harvard College Library. Retrieved 18 September 2016.
^ "Good Guys". Retrieved 10 October 2014.
^ snatcho (11 November 2005). "Crash Test Dummies (2005)". IMDb. Retrieved 10 October 2014.
^ "Police, Adjective". 22 December 2009. Retrieved 10 October 2014.
^ "Dragoș Bucur și Dana Rogoz dau voce personajelor Ken și Barbie, în "Povestea jucăriilor 3"". Mediafax.ro. Retrieved 10 October 2014.
^ Dargis, Manohla (20 January 2011). "'The Way Back,' by Peter Weir, About Gulag Escapees". The New York Times.
^ "Review: Peter Weir's The Way Back, a Good Walk Almost Spoiled - TIME.com". TIME.com. 21 January 2011. Retrieved 10 October 2014.
^ "Hollywood action comedy Ride Along, including Romanian actor tops box office in the US". Romania-Insider.com. Retrieved 10 October 2014.
Dragoș Bucur at www.shooting-stars.eu
Dragoș Bucur on IMDb
Film in the United States portal
Romania portal
Retrieved from "https://en.wikipedia.org/w/index.php?title=Dragoș_Bucur&oldid=906192991"
Romanian male film actors
People from Bucharest
Romanian male television actors
20th-century Romanian male actors
21st-century Romanian male actors
Caragiale Academy of Theatrical Arts and Cinematography alumni
Articles containing Romanian-language text
|
cc/2019-30/en_middle_0019.json.gz/line9927
|
__label__wiki
| 0.520619
| 0.520619
|
Matt Tremont
Matt Tremont in 2013
Matthew Tremont
Atlantic City, New Jersey[1]
Professional wrestling career
Ring name(s)
The Bulldozer
Father Matthew Tremont[1]
Billed height
Billed weight
250 lb (110 kg)
Billed from
Trained by
Pryme Tyne Amy Lee
Matthew Tremont[1] is an American professional wrestler and promoter, who currently works for Game Changer Wrestling (GCW) where he is a former GCW World Heavyweight Championship, and Hardcore Hustle Organisation (H2O) where he is the promoter. He previously worked for Combat Zone Wrestling (CZW) - where he is a former CZW World Heavyweight Champion - and Westside Xtreme Wrestling (wXw).[1] In addition he has appeared in IWA Mid-South, IWA Deep-South and IWA East Coast where he is the winner of Masters of Pain in 2012. He also owns a store in the Berlin Farmers Market called Bulldozer's Collectibles and owns and operates his own independent wrestling company called Hardcore Hustle Organization or H2O. He is the only death match wrestler to win all the American Death Match tournaments. He is referred to as “The Grandslam Champion” of deathmatch wrestling. He also has started his own heel stable called The Awakening. Which consists of himself “Father Matthew”, Joe Stockade and G-Raver.[1]
1 Professional wrestling career
1.1 Combat Zone Wrestling (2011–2018)
1.2 Other promotions
2 Championships and accomplishments
Professional wrestling career[edit]
Combat Zone Wrestling (2011–2018)[edit]
Tremont made his Combat Zone Wrestling debut at Prelude to Violence defeating Pinkie Sanchez in a Tournament of Death X Qualifying Ultraviolent Rules on June 11, 2011.[2][3][4] Tremont made his first CZW Tournament of Death debut at TOD X, defeating Necro Butcher in a "Water Jugs, Bats & Anything Else you Can Swing Match" in the quarterfinals.[5][6] He was eliminated by MASADA in the semifinals in a "Kenzans, Whips & Anything Else we Can F***ing Find Match".[7] Tremont began a small feud with Danny Havoc at Cage of Death 13 in a Ultraviolent Pits deathmatch which soon culminated at CZW Super Saturday when Havoc defeated Tremont in a Ultraviolent Rules match.[8][9] Tremont made his second Tournament of Death appearance at CZW Tournament of Death XI, losing to Abdullah Kobayashi in the first round in a "Ultraviolent Bats" match.[10]
Tremont began to feud with CZW Owner DJ Hyde throughout 2012 beginning at Tangled Web V between the two as Hyde was the victor.[11][12] He was subsequently fired at Down With The Sickness 2012 after defeating Solo with a very stiff chair shot to the head, ending the bout at 35 seconds.[13] Tremont got back on the microphone and repeated "Redemption" over and over again.[14] At CZW Night of Infamy, DJ Hyde cut a promo on not reinstating Tremont. Prompting the locker room to walk out and quit if Tremont is not reinstated, but Hyde insisted if Tremont wins a match he could be reinstated.[15] He would team up with New Jack the same night to a winning effort, defeating Joe Gacy and Ron Mathis. Tremont had a successful victory at Cage of Death XIV.[16] Winning with a Death Valley driver off the top of the cage through 3 levels of panes of glass and a stage setup on the outside. After the match the entire locker room congratulated Tremont for his efforts.[16][17]
He later feuded with Devon Moore and The Nation Of Intoxication leading to several matches between the two. At Tangled Web 7, Tremont defeated Moore in the Tangled Web Match after knocking him off the scaffolding into the ring below.
In early 2015, Tremont began teaming with newcomer Stockade. They fought The Nation Of Intoxication at To Live Is To Die in January, they lost after Tremont accidentally struck Stockade with a chair. After the match, Stockade and Tremont came to blows then Tremont challenged Stockade to a Ultraviolent Match at Sixteen on February 21.[18]
On August 8, 2015, Tremont defeated BLK Jeez for the CZW World Heavyweight Championship.
At Down with the Sickness 2016, after a 399-day reign as champion, Tremont lost the title in a four way deathmatch to Jonathan Gresham which also featured Greg Excellent and Joe Gacy.
Tremont would turn heel at Cage of Death 18, by attacking his own teammate Joey Janela during the Cage of Death match, costing his team the match in the process. He later rechristened himself as "Father" Matthew Tremont and reformed his alliance with Stockade. They would go on to attack Janela and even his girlfriend Penelope.
On August 5, 2017 Tremont had a No Ropes Barbed Wire Exploding Baseball Bats match against Japanese deathmatch wrestler, Atsushi Onita. The match would end in a No Contest.
On November 26, 2018 Tremont was challenged by DJ Hyde in the CZW Cage of Death that will happen on December 9. He accepted a tag team match. He took Onita's help, while DJ will bring Masada as his partner.
Other promotions[edit]
Tremont debuted for Beyond Wrestling debut at night one of` Beyond Wrestling Miracle Workers losing to Devon Moore.[19] He defeated TJ Marconi at Beyond Wrestling Ring Leaders - Tag 2.[20] He now wrestles sporadically for Beyond Wrestling.
Tremont made his IWA Mid-South debut at the 2011 annual King of the Deathmatch, defeating MASADA in a Barbed Wire Board, Taipei Death & Sandpaper Kickpads match in the first round. He lost in the finals the second night to Drake Younger, other competitors were Devon Moore and Simon Sezz.[21][22]
Tremont won his first biggest accomplishment by winning the 2012 Masters of Pain defeating MASADA in the finals in a Double Hell Deathmatch in Charleston, West Virginia.[23][24][25]
On June 7, 2014 Tremont defeated Patrick Hayes in Connellsville, Pennsylvania to win the Vicious Outcast Wrestling (VOW) Anarchy Championship.[26]
In New Albany, Indiana, USA 28.06.2014 Tremont won the IWA Mid South King Of The Death Matches defeating Jesse Amato in a Best Of Seven Log Cabin Match, John Wayne Murdoch and Ron Mathis in a Semi Final Three Way Fans Bring The Weapons Spider Net Match and in the finals, Josh Crane in a No Rope Barbed Wire, Panes Of Glass, Barbed Wire Board, Casket And Fans Bring The Weapons Match after putting Crane through a flaming pane of Glass.
On July 21, 2018, Tremont became the first-ever Synergy Pro Wrestling Champion by defeating KTB in the finals of the promotion's inaugural Championship Tournament in Manville, New Jersey. Tremont held the Synergy Pro Wrestling Championship for 196 days, losing the title to Frightmare in a Triple Threat Match (that also included Drake Chambers) at Synergy Pro Wrestling 8 in Hillsborough, New Jersey.[27]
Championships and accomplishments[edit]
CZW World Heavyweight Championship (1 time)
CZW Tournament Of Death 14 (2015)
GCW World Heavyweight Championship (1 time)
GCW Nick Gage Invitational 2 (2017)
IWA East Coast
Masters of Pain (2012)
IWA Deep South
Carnage Cup 9 (2013)
IWA Mid-South
King of the Deathmatch (2014, 2015)
Pro Wrestling Illustrated
PWI ranked him #244 of the top 500 singles wrestlers in the PWI 500 in 2015[28]
Synergy Professional Wrestling
Synergy Pro Wrestling Champion (1 time)[29]
Superstars of Wrestling Federation
SWF Hardcore Championship (1 time)[30]
Tier 1 Wrestling
Tier 1 Tag Team Championship (1 time, current) – with Stockade[31]
Vicious Outcast Wrestling
VOW Anarchy Championship (2 times)[32]
VOW Lord Of Anarchy (2015)
VOW Hyper Sonic Championship (1 times)
Women Superstars Uncensored
Queen and King of the Ring (2014) – with Mickie Knuckles[33]
^ a b c d e f g "Matt Tremont's profile at Cagematch.net". Cagematch. Retrieved December 9, 2012.
^ "CZW Prelude To Violence 2 @ Asylum Arena in Philadelphia, Pennsylvania, USA". Cagematch. Retrieved December 9, 2012.
^ "CZW Prelude to Violence 2 on 2011/06/11 @ Asylum Arena in Philadelphia, Pennsylvania". Wrestlingdata. Retrieved December 9, 2012.
^ "CZW Prelude to Violence 2". Profightdb. Retrieved December 9, 2012.
^ "CZW Tournament Of Death X @ Ultraviolent Underground in Townsend, Delaware, USA". Wrestlingdata. Retrieved December 9, 2012.
^ "CZW Tournament Of Death X @ Ultraviolent Underground in Townsend, Delaware, USA". CAGEMATCH. Retrieved December 9, 2012.
^ "CZW Tournament of Death X". Internet Wrestling Database. Retrieved December 9, 2012.
^ "CZW Cage Of Death XIII @ Asylum Arena in Philadelphia, Pennsylvania, USA". CAGEMATCH. Retrieved December 9, 2012.
^ "CZW Super Saturday @ The Fountain Square Salvation Army Community Center in Indianapolis, Indiana, USA". CAGEMATCH. Retrieved December 9, 2012.
^ "CZW Tournament Of Death XI @ Ultraviolent Underground in Townsend, Delaware, USA". CAGEMATCH. Retrieved December 9, 2012.
^ "CZW A Tangled Web V @ Flyers Skate Zone in Voorhees, New Jersey, USA". CAGEMATCH. Retrieved December 9, 2012.
^ "CZW A Tangled Web 4 @ Asylum Arena in Philadelphia, Pennsylvania, USA". Retrieved December 9, 2012.
^ "CZW Down With the Sickness 2012". CAGEMATCH. Retrieved December 9, 2012.
^ "411's CZW Down With The Sickness iPPV Review 9.21.12". 411mania. Retrieved December 9, 2012.
^ "CZW Night Of Infamy 11 @ Flyers Skate Zone in Voorhees, New Jersey, USA". CAGEMATCH. Retrieved December 9, 2012.
^ a b "CZW Cage of Death 14 iPPV Results 12.08.12". Retrieved December 9, 2012.
^ "CZW Cage Of Death 14 @ Flyers Skate Zone in Voorhees, New Jersey, USA". CAGEMATCH. Retrieved December 9, 2012.
^ http://www.czwrestling.com/news.php/results_for_saturdays_to_live_is_to_die_streamczwcom_event.html
^ "Beyond Wrestling Miracle Workers - Tag 1". Cagematch. Retrieved December 9, 2012.
^ "IWA Mid-South King Of The Death Matches 2011 - Tag 1 @ Bellevue Plaza in Bellevue, Illinois, USA". Cagematch. Retrieved December 9, 2012.
^ "IWA East Coast Masters of Pain". IWA East Coast. Retrieved December 9, 2012.
^ "Awards and Championships". CAGEMATCH. Retrieved December 9, 2012.
^ "IWA East Coast Masters of Pain results". Wrestling-News. Retrieved December 9, 2012. [unreliable source]
^ http://www.cagematch.net/?id=5&nr=2233 Retrieved 13 June 2014
^ "Synergy Pro Wrestling | Past Results". synergy-wrestling. Retrieved 2019-03-08.
^ "Pro Wrestling Illustrated (PWI) 500 for 2015". The Internet Wrestling Database. Retrieved September 1, 2017.
^ "Synergy Pro Wrestling | Roster". synergy-wrestling. Retrieved 2019-03-08.
^ http://www.cagematch.net/?id=5&nr=3306
^ https://www.cagematch.net/?id=5&nr=3103
^ Namako, Jason (2014-05-10). "5/10 WSU iPPV Results: Voorhees, NJ (New WSU Champion crowned)". Wrestleview. Retrieved 2014-05-11.
Matt Tremont: Profile and Match Listing
Profile at Wrestlingdata
Profile at CAGEMATCH
Combat Zone Wrestling employees
Male wrestlers
AR Fox
Danny Havoc
David Starr
DJ Hyde
Father Matthew Tremont
Jonathan Gresham
Shane Strickland
Tim Donst
Female wrestlers
Tag teams/stables
Ohio is 4 Killers
CZW World Heavyweight Champions
Nick Gage
John Zandig
Wifebeater
Nick Berk
Yoshihiro Tajiri
Super Dragon
Chris Hero
Eddie Kingston
Drake Younger
Jon Moxley
Robert Anthony
Scotty Vortekz
Biff Busick
BLK Jeez
Joe Gacy
Davey Richards
Rickey Shane Page
Maxwell Jacob Friedman
Mance Warner
Anthony Greene
John Silver (current)
CZW Tournament of Death winners
Wifebeater (I, III)
Nick Mondo (II)
Necro Butcher (IV)
Nick Gage (V, vs. Gorefest)
Drake Younger (VI)
Brain Damage (Fast Forward)
Danny Havoc (VII, 12)
DJ Hyde (VIII)
Thumbtack Jack (Rewind)
Scotty Vortekz (IX)
Masada (X, XI, Europe)
Jun Kasai (13)
Matt Tremont (14)
Rickey Shane Page (15)
Jimmy Havoc (16)
Jimmy Lloyd (17)
Retrieved from "https://en.wikipedia.org/w/index.php?title=Matt_Tremont&oldid=906496912"
American male professional wrestlers
Sportspeople from Atlantic City, New Jersey
Professional wrestlers from New Jersey
Articles lacking reliable references from September 2014
|
cc/2019-30/en_middle_0019.json.gz/line9928
|
__label__cc
| 0.529724
| 0.470276
|
Shaw Trust
Find sources: "Shaw Trust" – news · newspapers · books · scholar · JSTOR (June 2015) (Learn how and when to remove this template message)
This article reads like a press release or a news article or is largely based on routine coverage or sensationalism. Please expand this article with properly sourced content to meet Wikipedia's quality standards, event notability guideline, or encyclopedic content policy. (April 2016)
Bristol, England, UK
England, Wales, Scotland, Poland, Romania
www.shaw-trust.org.uk
Shaw Trust is a charity in the UK which helps disabled and disadvantaged people into employment and independent living. It was formed in the village of Shaw in Wiltshire in 1982.[1]
Shaw Trust has been a registered charity since 1982, and is one of the country's largest third-sector providers of employment services for people with a disability or at disadvantage.
The charity employs nearly 1,600 people at over 200 locations. They are supported by over 600 volunteers and deliver contracts for major funding agencies including the European Social Fund, the Department for Work and Pensions and the Big Lottery Fund.[2]
1 Areas of work
2 Community enterprises and projects
3 Shops
4 Shaw Education Trust
4.1 Shaw Education Trust schools
5 Justice services
6 Mergers
6.1 Careers Development Group
Areas of work[edit]
The Trust delivers both mainstream (Work Programme) and specialist (Work Choice) employment support schemes across Britain. The charity helps people gain skills and find work via a wide range of activities including education and skills contracts, 49 shops and a national volunteering programme as well as health and social enterprise projects.
Shaw Trust helps people gain qualifications through specialised programmes, and helps people seeking work through support in job search skills, interview practice and practical help to enter employment.
Shaw Trust is also an Approved Sponsor for Academies, and sponsors the Shaw Education Trust.
Community enterprises and projects[edit]
Shaw Trust runs a range of enterprises and projects – many of which are open to the public – across sectors including catering, recycling and horticulture. These initiatives are firmly embedded in the local communities and provide clients with a broad range of learning and skills development as well as employment opportunities.
People taking part benefit from a range of initiatives including accredited on-site training, work experience and employment, supervisory roles and core learning such as numeracy, literacy and IT skills.
In 2010/11 the horticulture social enterprises provided employment and training opportunities for over 1000 young people and adults with challenging barriers to employment. Locations include:
Clamp Hill, Stanmore
Palmer Gardens, Trowbridge – a garden centre
Westbank Enterprises
Wood recycling
Shaw Trust offers wood recycling services at Scadbury Park, Chislehurst, South London.
Shaw Trust Industries (Doncaster) is a factory run as a social enterprise by the Trust. They manufacture the following products:
Plastic protective edging
Electromagnetic powder coating
Shaw Trust has catering services ranging from cafes to a 'tuck by truck' snack delivery business.
Shops[edit]
Shaw Trust has 49 charity shops across England and Wales, stocking a wide range of items that have been donated for resale. All shops are staffed by volunteers and Shaw Trust staff. The income raised from shops goes to projects that support disabled and disadvantaged people in local communities.
Their shops also help develop clients’ employability skills through work experience and work placements. They provide a safe and supportive environment for clients to develop confidence, learning and skills.
Shaw Education Trust[edit]
In 2014, the Department for Education awarded Approved Sponsor of Academy status to the Trust. A multi-academy trust, Shaw Education Trust, was created to support special schools and mainstream schools serving disadvantaged communities.
Shaw Education Trust schools[edit]
Blackfriars Academy, Newcastle-under-Lyme
Coppice Academy, Newcastle-under-Lyme
Walton Hall Academy, Eccleshall
Wolstanton High School, Newcastle-under-Lyme
Saxon Hill Community School, Lichfield
Justice services[edit]
Since January 2010, the NOMS European Social Fund Co-financing programme has been working with offenders across England. National Offender Management Service (NOMS) is an executive agency of the Ministry of Justice, which brings together the Probation Service and Prison Service. A key objective for NOMS is the reduction of re-offending.
In 2015, the government announced the outcome of the latest NOMS tender opportunities to work with offenders. Shaw Trust formed an alliance with Crime Reduction Initiatives for a number of the tender opportunities and will work with offenders in the East of England, London, West Midlands, North East and the South West.
Mergers[edit]
Careers Development Group[edit]
The Careers Development Group was a workfare organisation and Work Programme provider in the United Kingdom.[3]
Pursuing a goal of providing a helping hand to needy and jobless people, Careers Development Group had been working for over three decades. According to their records, in 2011/12, the organization helped over 30,000 people into jobs. As well as their work programme, young people from South London had been getting support from the organization in job placement in social and charity enterprises.[4]
CDG group advocated: "A society in which everyone has the opportunity for employment, inclusion and independence". Hence, CDG not only provided jobs but also prepared people by imparting training for better placements. Their charity work included support for those with disabilities, health problems and lack of experience.[5]
In 2012, CDG merged with Shaw Trust.[6]
^ "Shaw Trust website Official Site". shaw-trust.org.uk. Retrieved 2015-05-29.
^ "Finding a job when you're disabled is a postcode lottery". The Guardian. 13 August 2014. Retrieved 7 March 2017.
^ http://www.cdguk.org/work-programme
^ "Careers Development Group". British Association for Supported Employment. Retrieved 23 May 2013.
^ "Careers Development Group". Team London. Retrieved 23 May 2013.
^ Holt, Andrew (8 August 2012). "Shaw Trust and Careers Development Group confirm merger". Charity Times. Retrieved 9 February 2019.
Shaw Education Trust
Charity Commission. The Shaw Trust Limited, registered charity no. 287785.
Workfare in the United Kingdom
Workfare Programmes
Community Action Programme
Mandatory Work Activity
Sector Based Work Academies
Steps to Work
Day One Support for Young People Trailblazer
'Derbyshire “Trailblazer” Mandatory Youth Activity Programme'
Help to Work
Community work placements
Workfare Providers ('Primes')
Careers Development Group
Employment and Skills Group
Ingeus
Prospects Services
Serco
Working Links
Workfare Companies
List of British organisations who have participated in workfare programmes
Boycott Workfare
Solidarity Federation
R v Secretary of State for Work and Pensions, ex p Reilly
Department for Work and Pensions v Information Commissioner
Jobseekers (Back to Work Schemes) Act 2013
Retrieved from "https://en.wikipedia.org/w/index.php?title=Shaw_Trust&oldid=889246896"
Charities for disabled people based in the United Kingdom
Social welfare charities based in the United Kingdom
Organizations established in 1981
Charities based in Bristol
Articles with a promotional tone from April 2016
All articles with a promotional tone
Pages using infobox organization with unknown parameters
|
cc/2019-30/en_middle_0019.json.gz/line9929
|
__label__wiki
| 0.737363
| 0.737363
|
Tubantes
Altar stone found close to Hadrian's wall, containing the oldest known mention of the Tubantes/Tuihanti
The Tubantes were a Germanic tribe, living in the eastern part of the Netherlands, north of the Rhine river. They are often equated to the Tuihanti, who are known from two inscriptions found near Hadrian's Wall. The modern name Twente derives from the word Tuihanti.
2 Archeology
Little is known about the Tubantes. They are first mentioned in a description of the first expedition of Germanicus against the Marsi in 14 AD,[1] when they, in coalition with the Bructeri and Usipetes, ambushed the Roman forces returning to their winter-quarters, probably somewhere in the Münsterland.
In 17 AD, the Tubantes are apparently referred to as the Tubattii, in Strabo's in a list of Germanic peoples defeated by Rome under Germanicus.[2][3] After being vanquished by the Romans, some Tubantes were prisoners of Germanicus' triumphal procession.[2]
In 58 AD, Tacitus reports in his Annals that the Ampsivarii, in their plea to the Romans concerning some land north of the Rhine reserved by the Roman military, that it had belonged in sequence to the Chamavi, Tubantes, and then the Usipii.[4] (The Usipii are known to have moved into the Rhine region around the time of Caesar (55 BC), but not yet to have found permanent settlement in that time, and to have been resident at the afore-mentioned northern bank of the Rhine by the time of Drusus around 11 AD.)
In 69 AD, they provided a cohort during the Batavian Revolt, which was destroyed by the Ubii.
Claudius Ptolemy in his Geographia (2.10), appears to describe a north to south series starting with the Chamavi "under" whom are the Chatti and Tubanti, and then between these and the Sudetes mountains, thought to be the Erzgebirge, the Teuriochaemae (an otherwise unknown name, but in the place previously inhabited by the Hermanduri and later by the Thuringii, with these three names often thought to be equivalent).[5] But the position of the Chamavi and Tubantes so far to the southeast does not match other sources, and Chamavi also seem to be mentioned under another name in a more expected place, south of the coastal Chauci, and north of the Bructeri, in between Ems and Weser. Confusingly, other tribes normally from the region of the Tubantes, the Chattuari and Chasuarii, are also described as if they are in southern Germany in this passage.[6]
Two third-century sacral inscriptions found near Hadrian's Wall make mention of Tuihanti serving in an auxiliary unit of the Roman army, the Cuneus Frisiorum.[3] (The Frisii was a name applied to all or most tribes north of the Rhine in Roman times, in the same general area of the Tubantes.) The inscriptions say:
"To the god Mars and the two Alaisiagae, and to the divine power of the Emperor, the German tribesmen of Tuihantis of the formation of Frisians of Vercovicium, Severus Alexanders's own, willingly and deservedly fulfilled their vow."
"To the god Mars Thinescus and the two Alaisiagae, Beda and Fimmilena, and the divine power of the Emperor, Germans tribemen from Tuihantis willingly and deservedly fulfilled their vow."[7]
"Mars Thingsus" is understood as referring to the Germanic God "Tyr", who was often considered equivalent to Roman Mars, and was associated with the Germanic traditions of assemblies called "Things".
In 308 AD the Tubantes joined the alliance against Constantine the Great during his campaign against the Bructeri.[8]
The name reappears as Tuianti and Tueanti in two acts from 797 and 799 AD concerning the donation of some farms in Twente and Salland to the church of Wichmond, Gelderland.[3]
Archeology[edit]
Archeology shows that the region associated with the Tubantes was inhabited more or less continuously since the last ice-age. The region is very fertile and will support agriculture and cattle. The countryside is marked by artificial hills, called es or esch, which were formed by depositing dung mixed with dirt. Prime examples include the Fleringer Esch, near Fleringen and the Usseler Es, also known as the Usseler Esch, near Usselo.
There is archeological evidence of (relatively) large scale iron production in the region, specifically near Heeten, indicating that the locals understood the process of producing steel, with a carbon content of 2% [1]. The ore used was the abundant bog iron. The production sites can be dated to 280-350 AD.[9][10]
Ancient Germanic culture portal
List of Germanic peoples
^ Tacitus, Annales 1.51.
^ a b "Strabo, Geography, BOOK VII., CHAPTER I". Perseus.tufts.edu. Retrieved 2016-11-29.
^ a b c Lanting; van der Plicht (2010). "De 14C-chronologie van de Nederlandse Pre- en Protohistorie VI: Romeinse tijd en Merovingische periode, deel A: historische bronnen en chronologische schema's". Palaeohistoria. 51/52: 61.
^ "Cornelius Tacitus, The Annals, BOOK XIII, chapter 55". Perseus.tufts.edu. Retrieved 2016-11-29.
^ "Dictionary of Greek and Roman Geography (1854), TEURIOCHAEMAE". Perseus.tufts.edu. Retrieved 2016-11-29.
^ "Ptolemy's maps of northern Europe, a reconstruction of the prototypes : Schütte, Gudmund, 1872- : Free Download & Streaming : Internet Archive". Archive.org. Retrieved 2016-11-29.
^ Attema, P. A. J.; Lanting, J. N.; Los-Weijns, M. A. (15 December 2008). Palaeohistoria 49/50 (2007/2008). Barkhuis. p. 701. ISBN 978-90-77922-44-6. Retrieved 13 December 2012. In Latin: 1. Deo / Marti / Thincso / et duabus / Alaisiagis / Bed(a)e et Fi/mmilen(a)e / et n(umini) Aug(usti) Ger/m(ani) cives Tu/ihanti / v(otum) s(olverunt) l(ibentes) m(erito). 2. Deo / Marti et duabus / Alaisiagis et n(umini) Aug(usti) / Ger(mani) cives Tuihanti / cunei Frisiorum / Ver(covicianorum) Se(ve)r(iani) Alexand/riani votum / solverunt / libent[es] / m(erito).
^ Nazarius, Panegyric of Constantine, 18 (C.E.V. Nixon & B.S. Rogers, In praise of later Roman emperors. The Panegyrici Latini. Introduction, translation, and historical commentary, with the Latin text of R.A.B. Mynors. Berkeley: University of California Press, 1994, p. 363).
^ Keulemans, Maarten (13 May 2004). "Overijsselaren toch geen barbaren - Stukje staal geeft de doorslag". Nieuws. Noorderlicht. Retrieved 23 August 2010.
^ Rincon, Paul (12 May 2004). "Iron Age tool marks move to steel". BBC News. BBC. Retrieved 23 August 2010.
History of the Germanic peoples
Indo-European ethnolinguistic group of Northern European origin identified by their use of the Germanic languages, and related history
Prehistory,
Nordic Bronze Age
Pre-Roman Iron Age in Northern Europe
Battle axe culture
House Urns culture
Funnelbeaker culture
Jastorf culture
Nordwestblock
Przeworsk culture
Oksywie culture
Tribes of
(ca. 2nd C. B.C.
-476 A.D.)
Germanic Heroic Age
Alemanni
Ambrones
Ampsivarii
Angrivarii
Bructeri
Burgundians
Cananefates
Chamavi
Chasuarii
Chattuarii
Chauci
Chernyakhov culture
Cugerni
Dulgubnii
Fosi
Gepids
Harii
Heruli
Hasdingi
Helisii
Hermunduri
Irminones
Ingaevones
Istvaeones
Lacringi
Lemovii
Lombards
Nahanarvali
Nemetes
North Germanic peoples
Geats
Gutes
Jutes
Swedes
Scirii
Semnones
Silingi
Sitones
Sicambri
Tencteri
Toxandri
Triboci
Usipetes
Vangiones
Wielbark culture
Germani cisrhenani
Caeroesi
Condrusi
Eburones
Paemani
Tribal unions
Roman Iron Age
Magna Germania
Germanic Wars
Teutoburg
Marcomannic
Visigothic
Fall of the Roman Empire
Notable migrations
Visigoths
Ostrogoths
Vagoth
Early Middle Ages
(ca. 476-1066)
Germanic Iron Age
(ca. 476-793),
Vendel Period (ca. 550-790)
Realms and
hegemonies
Alamannian Kingdom
Anglo-Saxon Heptarchy
Austrasia
Bavarian Duchy
Burgundian Kingdom
Carolingian Empire
Duchy of Cantabria
Frankish Kingdom
Frisian Kingdom
Gepid Kingdom
Geatish Kingdom (mythological)
Herulian Kingdom
Odoacer's Kingdom
Lombard Kingdom
North Sea Empire
Petty kingdoms of Norway
Suebian Kingdom (Danube)
Suebian Kingdom (Gallaecia)
Swedish realm (mythological)
Ostrogothic Kingdom
Rugian Kingdom
Rus' Khaganate
Saxonian Duchy
Scirian Kingdom
Thuringii Kingdom
Vandal Kingdom
Visigothic Kingdom
Viking Age (793–1066)
Norwegians
Rus'
Varangians
Germanic parent language
Proto-Germanic language
North Germanic languages
Ingvaeonic languages
South Germanic
Northwest Germanic
East Germanic languages
Gothic language
Pre-Christian
Pagan society
(until about
Early Middle Ages)
Mead hall
Alliterative verse
Furor Teutonicus
Migration Period art
Viking art
Runic calendar
Sippe
Ancient Germanic law
Lawspeaker
Norse clans
Romano-Germanic culture
Germanic calendar
Germanic kingship
Germanic name
Numbers in Norse mythology
Bracteates
Suebian knot
Nerthus
Veleda
Tuisto
Mannus
Sacred trees and groves
Continental Germanic
Old Norse religion
Burial practices
Tumulus
Ship burial
Norse funeral
Alemannic grave fields
Sutton Hoo
Spong Hill
Gothic and Vandal warfare
Anglo-Saxon warfare
Viking Age arms and armour
Migration Period spear
Migration Period sword
Christianisation
From Paganism to Christianity:
Anglo-Saxon England/Christianity
Franks and Alamanni
Kievan Rus'/Rus' Khaganate
Retrieved from "https://en.wikipedia.org/w/index.php?title=Tubantes&oldid=889537296"
Historical Germanic peoples
CS1: long volume value
|
cc/2019-30/en_middle_0019.json.gz/line9930
|
__label__wiki
| 0.765198
| 0.765198
|
UFC on Fox: Alvarez vs. Poirier 2
The poster for UFC on Fox: Alvarez vs. Poirier 2.
July 28, 2018 (2018-07-28)
$1.300,000[1]
UFC Fight Night: Shogun vs. Smith UFC on Fox: Alvarez vs. Poirier 2 UFC 227: Dillashaw vs. Garbrandt 2
UFC on Fox: Alvarez vs. Poirier 2 (also known as UFC on Fox 30) was a mixed martial arts event produced by the Ultimate Fighting Championship held on July 28, 2018 at the Scotiabank Saddledome in Calgary, Alberta, Canada.[2]
The event was the second that the promotion has contested in Calgary, following UFC 149 in July 2012.[3]
A lightweight rematch between former two-time Bellator Lightweight Champion and former UFC Lightweight Champion Eddie Alvarez and Dustin Poirier was the main event of the card.[4][5] Their first bout at UFC 211 in May 2017 was ruled a no contest after Alvarez hit a downed Poirier with illegal knees in the second round.[6]
A light heavyweight bout between Gadzhimurad Antigulov and Ion Cuțelaba was previously scheduled for UFC 217. However, Antigulov pulled out of the fight due to injury and the bout was scrapped.[7] The matchup eventually happened at this event.[8]
Main card (Fox)
Lightweight Dustin Poirier def. Eddie Alvarez TKO (punches and elbow) 2 4:05
Featherweight José Aldo def. Jeremy Stephens TKO (body shot and punches) 1 4:19
Women's Strawweight Joanna Jędrzejczyk def. Tecia Torres Decision (unanimous) (30-27, 30-27, 30-27) 3 5:00
Lightweight Alexander Hernandez def. Olivier Aubin-Mercier Decision (unanimous) (30-27, 29-28, 29-28) 3 5:00
Preliminary card (Fox)
Welterweight Jordan Mein def. Alex Morono Decision (unanimous) (29-28, 29-28, 29-28) 3 5:00
Featherweight Hakeem Dawodu def. Austin Arnett Decision (unanimous) (30-27, 30-27, 30-27) 3 5:00
Lightweight Islam Makhachev def. Kajan Johnson Submission (armbar) 1 4:43
Light Heavyweight Ion Cuțelaba def. Gadzhimurad Antigulov TKO (punches and elbows) 1 4:25
Lightweight John Makdessi def. Ross Pearson Decision (unanimous) (30-26, 29-27, 29-28) 3 5:00
Women's Flyweight Katlyn Chookagian def. Alexis Davis Decision (unanimous) (29-28, 29-28, 30-27) 3 5:00
Flyweight Dustin Ortiz def. Matheus Nicolau KO (head kick and punches) 1 3:49
Women's Strawweight Nina Ansaroff def. Randa Markos Decision (unanimous) (29-28, 29-28, 29-28) 3 5:00
Lightweight Devin Powell def. Álvaro Herrera TKO (body kicks and punches) 1 1:52
Fight of the Night: John Makdessi vs. Ross Pearson
Performance of the Night: Dustin Poirier and José Aldo
^ a b Staff (2018-07-29). "UFC on FOX 30 draws announced 10,603 attendance for $1.3 million gate in Calgary". mmajunkie.com. Retrieved 2018-07-29.
^ Staff (2018-04-27). "UFC on FOX 30 official for Calgary, eight fights added to lineup including Jose Aldo vs. Jeremy Stephens". mmajunkie.com. Retrieved 2018-04-27.
^ Daniel Austin (2018-04-27). "UFC returning to Calgary, fight card set for July 28". calgarysun.com. Retrieved 2018-04-27.
^ Staff (2018-05-14). "Dustin Poirier vs. Eddie Alvarez rematch official for UFC on FOX 30 headliner in Calgary". mmajunkie.com. Retrieved 2018-05-14.
^ Thomas Gerbasi (2018-05-14). "Poirier, Alvarez to meet again in Calgary main event". ufc.com. Retrieved 2018-05-14.
^ Brian Campbell (2017-05-14). "UFC 211 results: Eddie Alvarez-Dustin Poirier ruled no contest after illegal knees". cbssports.com. Retrieved 2018-05-01.
^ Marcel Dorff (2017-09-26). "Gadzhimurad Antigulov injured, fight against Ion Cutelaba canceled" (in Dutch). mmadna.nl. Retrieved 2018-07-23.
^ Staff (2018-04-27). "UFC on FOX 30 official for Calgary, eight fights added to lineup". mmajunkie.com. Retrieved 2018-07-23.
^ "UFC on Fox: Alvarez vs. Poirier". Ultimate Fighting Championship. Retrieved 2018-04-27.
^ Staff (2018-07-29). "UFC on FOX 30 bonuses: Dustin Poirier, Jose Aldo among $50,000 winners in Calgary". mmajunkie.com. Retrieved 2018-07-29.
This article related to mixed martial arts is a stub. You can help Wikipedia by expanding it.
Retrieved from "https://en.wikipedia.org/w/index.php?title=UFC_on_Fox:_Alvarez_vs._Poirier_2&oldid=904210021"
Sports competitions in Calgary
July 2018 sports events in North America
Mixed martial arts stubs
|
cc/2019-30/en_middle_0019.json.gz/line9931
|
__label__wiki
| 0.99392
| 0.99392
|
1 Samuel (Bible)
(Redirected from Bible/1 Samuel)
For works with similar titles, see 1 Samuel.
←Christian canon: Ruth
Jewish canon: Judges
English-language translations of
Shmuel 1 (1 Samuel)
Anonymous; traditionally attributed to Samuel
2 Samuel→
sister projects: Wikipedia article, Commons category, quotes, Wikidata item.
1 Samuel is a book of the Christian and Hebrew Bibles. It is universally accepted across all Jewish and Christian biblical canons. In Eastern Orthodox bibles it is named 1 Kingdoms. In older bibles based on the Vulgate, it was named 1 Kings.
1056842English-language translations of
Shmuel 1 (1 Samuel)Anonymous; traditionally attributed to Samuel
English-language translations of Shmuel 1 include:
"I. Kyngis" in the Wycliffe version (first printing, c. 1384)
"1 Kings" in the Wycliffe version (revised by Purvey et al., c. 1394)
"I. Regum" in the Coverdale version (1535)
"1 Samuel" in the Geneva version (1560)
"1 Kings" in the Bishops' version (1568)
"1 Samuel" in the Douay-Rheims version (first printing, 1582-1610)
"1 Samuel" in the King James version (first printing, 1611)
"1 Samuel" in the Douay-Rheims version (illustrated version, 1633-1635)
"1 Samuel" in the Douay-Rheims version (Challoner's revision, 1749-1952)
"1 Samuel" in the King James version (Oxford text, 1769)
"1 Samuel" in the Thomson version (1808)
"1 Samuel" in the Webster's version (1833)
"1 Samuel" in the Leeser version (1853)
"1 Samuel" in the English Revised version (1885)
"1 Samuel" in the Young's Literal Translation version (1898)
"1 Samuel" in the American Standard version (1901)
"I. Samuel" in the King James version (tercentenary printing, 1911)
"1 Samuel" in the Emphasised Bible version (1916)
"I Samuel" in the Jewish Publication Society version (third impression, 1919)
"1 Samuel" in the Basic English version (1941–9)
"1 Samuel" in the World English version (in progress since 1997)
"Shmuel 1" in the Jewish Publication Society version (Mechon Mamre edition, 2002)
"1 Samuel" in the Wikisource edition (in progress since 2006)
Retrieved from "https://en.wikisource.org/w/index.php?title=1_Samuel_(Bible)&oldid=7179821"
Works by unknown authors
Translations pages
Pages with override author
|
cc/2019-30/en_middle_0019.json.gz/line9932
|
__label__cc
| 0.513407
| 0.486593
|
Birthright/Chapter XV
< Birthright
←Chapter XIV
Birthright by Thomas Sigismund Stribling
Chapter XVI→
1716454Birthright — Chapter XVThomas Sigismund Stribling
CISSIE DILDINE'S conviction that marriage would cure Peter of his mission persisted in the mulatto's mind long after the glamour of the girl had faded and his room had regained the bleak emptiness of a bachelor's bedchamber.
Cissie had been so brief and positive in her statement that Peter, who had not thought on the point at all, grew more than half convinced she was right.
Now that he pondered over it, it seemed there was a difference between the outlook of a bachelor and that of a married man. The former considered humanity as a balloonist surveys a throng,—immediately and without perspective,—but the latter always sees mankind through the frame of his family. A single man tends naturally to philosophy and reform; a married man to administration and statesmanship. There have been no great unmarried statesmen; there have been no great married philosophers or reformers.
Now that Cissie had pointed out this universal rule, Peter saw it very clearly. And Peter suspected that beneath this rough classification, and conditioning it, lay a plexus of obscure mental and physical reactions set up by the relations between husband and wife. It might very well be there was a difference between the actual cerebral and nervous structure of a married man and that of a single man.
At any rate, after these reflections, Peter now felt sure that marriage would cure him of his mission; but how had Cissie known it? How had she struck out so involved a theory, one might say, in the toss of a head? The more Peter thought it over the more extraordinary it became. It was another one of those explosive ideas which Cissie, apparently, had the faculty of creating out of a pure mental vacuum.
All this philosophy aside, Cissie's appearance just in the nick of his inspiration, her surprising proposal of marriage, and his refusal, had accomplished one thing: it had committed Peter to the program he had outlined to the girl.
Indeed, there seemed something fatalistic in such a concatenation of events. Siner wondered whether or not he would have obeyed his vision without this added impulse from Cissie. He did not know; but now, since it had all come about just as it had, he suspected he would have been neglectful. He felt as if a dangerous but splendid channel had been opened before his eyes, and almost at the same instant a hand had reached down and directed his life into it. This fancy moved the mulatto. As he got himself ready for bed, he kept thinking:
“Well, my life is settled at last. There is nothing else for me to do. Even if this should end terribly for me, as Cissie imagines, my life won't be wasted.”
Next morning Peter Siner was awakened by old Rose Hobbett thrusting her head in at his door, staring around, and finally, seeing Peter in bed, grumbling:
“Why is you still heah, black man?”
The secretary opened his eyes in astonishment.
“Why shouldn't I be here?”
“Nobody wuz 'speckin' you to be heah.” The crone withdrew her head and vanished.
Peter wondered at this unaccustomed interest of Rose, then hurried out of bed, supposing himself late for breakfast.
A dense fog had come up from the river, and the moisture floating into his open windows had dampened his whole room. Peter stepped briskly to the screen and began splashing himself. It was only in the midst of his ablutions that he remembered his inspiration and resolve of the previous evening. As he squeezed the water over his powerfully molded body, he recalled it almost impersonally. It might have happened to some third person. He did not even recall distinctly the threads of the logic which had lifted him to such a Pisgah, and showed him the whole South as a new and promised land. However, he knew that he could start his train of thought again, and again ascend the mountain.
Floating through the fog into his open window came the noises of the village as it set about living another day, precisely as it had lived innumerable days in the past. The blast of the six-o'clock whistle from the planing-mill made the loose sashes of his windows rattle. Came a lowing of cows and a clucking of hens, a woman's calling. The voices of men in conversation came so distinctly through the pall that it seemed a number of persons must be moving about their morning work, talking and shouting, right in the Renfrew yard.
But the thing that impressed Peter most was the solidity and stability of this Southern village that he could hear moving around him, and its certainty to go on in the future precisely as it had gone on in the past. It was a tremendous force. The very old manor about him seemed huge and intrenched in long traditions, while he, Peter Siner, was just a brown man, naked behind a screen and rather cold from the fog and damp of the morning.
He listened to old Rose clashing the kitchen utensils. As he drew on his damp underwear, he wondered what he could say to old Rose that would persuade her into a little kindliness and tolerance for the white people. As he listened he felt hopeless; he could never explain to the old creature that her own happiness depended upon the charity she extended to others. She could never understand it. She would live and die precisely the same bitter old beldam that she was, and nothing could ever assuage her.
While Peter was thinking of the old creature, she came shuffling along the back piazza with his breakfast. She let herself in by lifting one knee to a horizontal, balancing the tray on it, then opening the door with her freed hand.
When the shutter swung open, it displayed the crone standing on one foot, wearing a man's grimy sock, which had fallen down over a broken, run-down shoe.
In Peter's mood the thought of this wretched old woman putting on such garments morning after morning was unspeakably pathetic. He thought of his own mother, who had lived and died only a shade or two removed from the old crone's condition.
Rose put down her foot, and entered the room with her lips poked out, ready to make instant attack if Peter mentioned his lack of supper the night before.
“Aunt Rose,” asked the secretary, with his friendly intent in his tones, “how came you to look in this morning and say you didn't expect to find me in my room?”
She gave an unintelligible grunt, pushed the lamp to one side, and eased her tray to the table.
Peter finished touching his tie before one of those old-fashioned mirrors, not of cut-glass, yet perfectly true. He came from the mirror and moved his chair, out of force of habit, so he could look up the street toward the Arkwrights'.
“Aunt Rose,” said the young man, wistfully, “why are you always angry?”
She bridled at this extraordinary inquiry.
“Me?”
“Yes, you.”
She hesitated a moment, thinking how she could make her reply a personal assault on Peter.
"'Cause you come heah, 'sputin' my rights, da' 's' why.”
“No,” demurred Peter, “you were quarreling in the kitchen the first morning I came here, and you didn't know I was on the place.”
“Well—I got my tribulations,” she snapped, staring suspiciously at these unusual questions.
There was a pause; then Peter said placatingly:
“I was just thinking, Aunt Rose, you might forget your tribulations if you didn't ride them all the time.”
“Hoccum! What you mean, ridin' my tribulations?”
“Thinking about them. The old Captain, for instance; you are no happier always abusing the old Captain.”
The old virago gave a sniff, tossed her head, but kept her eyes rolled suspiciously on Peter.
“Very often the way we think and act makes us happy or unhappy,” moralized Peter, broadly.
“Look heah, nigger, you ain't no preacher sont out by de Lawd to me!”
“Anyway, I am sure you would feel more friendly toward the Captain if you acted openly with him; for instance, if you didn't take off all his cold victuals, and handkerchiefs and socks, soap, kitchenware—”
The cook snorted.
“I'd feel dat much mo' nekked an' hongry, dat's how I'd feel.”
“Perhaps, if you'd start over, he might give you a better wage.”
“Huh!” she snorted in an access of irony. “I see dat skinflint gib'n' me a better wage. Puuh!” The suddenly she realized where the conversation had wandered, and stared at the secretary with widening eyes “Good Lawd! Did dat fool Cap'n set up a nigger in dis bedroom winder jes to ketch ole Rose packin' off a few ole lef'-overs?” Peter began a hurried denial, but she rushed on: “'Fo' Gawd, I hopes his viddles chokes him! I hope his ole smoke-house falls down on his ole haid. I hope to Jesus—”
Peter pleaded with her not to think the Captain was behind his observations, but the hag rushed out of the bedroom, swinging her head from side to side, uttering the most terrible maledictions. She would show him! She wouldn't put another foot in his old kitchen. Wild horses couldn't drag her into his smoke-house again.
Peter ran to the door and called after her down the piazza, trying to exonerate the Captain: but she either did not or would not hear, and vanished into the kitchen, still furious.
Old Rose made Peter so uneasy that he deserted his breakfast midway and hurried to the library. In the solemn old room he found the Captain alone and in rather a pleased mood. The old gentleman stood patting and alining a pile of manuscript. As the mulatto entered he exclaimed:
“Well, here's Peter again!” as if his secretary had been off on a long journey. Immediately afterward he added, “Peter, guess what I did last night.” His voice was full of triumph.
Peter was thinking about Aunt Rose, and stood looking at the Captain without the slightest idea.
“I wrote all of this,”—he indicated his manuscript,—“over a hundred pages.”
Peter considered the work without much enthusiasm.
“You must have worked all night.”
The old attorney rubbed his hands.
“I think I may claim a touch of inspiration last night, Peter. Reminiscences rippled from under my pen, propitious words, prosperous sentences. Er—the fact is, Peter, you will see, when you begin copying, I had come to a matter—a—a matter of some moment in my life. Every life contains such moments, Peter. I had meant to write something in the nature of a defen—an explanation, Peter. But after you left the library last night it suddenly occurred to me just to give each fact as it took place, quite frankly. So I did that—not—not what I meant to write, at all—ah. As you copy it, you may find it not entirely without some interest to yourself, Peter.”
“To me?” repeated Peter, after the fashion of the unattentative.
“Yes, to yourself.” The Captain was oddly moved. He took his hands off the script, walked a little away from the table, came back to it. “It— ah—may explain a good many things that—er—may have puzzled you.” He cleared his throat and shifted his subject briskly. “We ought to be thinking about a publisher. What publisher shall we have publish these reminiscences? Make some stir in Tennessee's political circles, Peter; tremendous sales; clear up questions everybody is interested in. H-m—well, I'll walk down town and you”—he motioned to the script—“begin copying—”
“By the way, Captain,” said Peter as the old gentleman turned for the door, “has Rose said anything to you yet?”
The old man detached his mind from his script with an obvious effort.
“About leaving your service.”
“No-o, not especially; she's always leaving my service.”
“But in this case it was my fault; at least I brought it about. I remonstrated with her about taking your left-over victuals and socks and handkerchiefs and things. She was quite offended.”
“Yes, it always offends her,” agreed the old man, impatiently. “I never mention it myself unless I catch her red-handed; then I storm a little to keep her in bounds.”
Naturally, Peter knew of this extraordinary system of service in the South; nevertheless he was shocked at its implications.
“Captain,” suggested Peter, “wouldn't you find it to your own interest to give old Rose a full cash payment for her services and allow her to buy her own things?”
The Captain dismissed the subject with a wave of his hand. “She's a nigger, Peter; you can't hire a nigger not to steal. Born in 'em. Then I'm not sure but what it would be compounding a felony, hiring a person not to steal; might be so construed. Well, now, there's the script. Read it carefully, my boy, and remember that in order to gain a certain status quo certain antecedents are—are absolutely necessary, Peter. Without them my—my life would have been quite empty, Peter. It's—it's very strange—amazing. You will understand as you read. I'll be back to dinner, so good-by.” In the strangest agitation the old Captain walked out of the library. The last glimpse Peter had of him was his meager old figure silhouetted against the cold gray fog that filled the compound.
Neither the Captain's agitation nor his obvious desire that Peter should at once read the new manuscript really got past the threshold of the mulatto's consciousness. Peter's thoughts still hovered about old Rose, and from that point spread to the whole system of colored service in the South. For Rose's case was typical. The wage of cooks in small Southern villages is a pittance—and what they can steal. The tragedy of the mothers of a whole race working for their board and thievings came over Peter with a rising grimness. And there was no public sentiment against such practice. It was accepted everywhere as natural and inevitable. The negresses were never prosecuted; no effort was made to regain the stolen goods. The employers realized that what they paid would not keep soul and body together; that it was steal or perish.
It was a fantastic truth that for any colored girl to hire into domestic service in Hooker's Bend was more or less entering an apprenticeship in peculation. What she could steal was the major portion of her wage, if two such anomalous terms may be used in conjunction.
Yet, strange to say, the negro women of the village were quite honest in other matters. They paid their small debts. They took their mistresses' pocket-books to market and brought back the correct change. And if a mistress grew too indignant about something they had stolen, they would bring it back and say: “Here is a new one. I'd rather buy you a new one than have you think I would take anything.”
The whole system was the lees of slavery, and was surely the most demoralizing, the most grotesque method of hiring service in the whole civilized world. It was so absurd that its mere relation lapses into humor, that bane of black folk.
Such painful thoughts filled the gloomy library and harassed Peter in his copying. He took his work to the window and tried to concentrate upon it, but his mind kept playing away.
Indeed, it seemed to Peter that to sit in this old room and rewrite the wordy meanderings of the old gentleman's book was the very height of emptiness. How utterly futile, when all around him, on every hand, girls like Cissie Dildine were being indentured to corruption! And, as far as Peter knew, he was the only person in the South who saw it or felt it or cared anything at all about it.
When Cissie Dildine came to the surface of Peter's mind she remained there, whirling around and around in his chaotic thoughts. He began talking to her image, after a certain dramatic trick of his mind, and she began offering her environment as an excuse for what had come between them and estranged them. She stole, but she had been trained to steal. She was a thief, the victim of an immense immorality. The charm of Cissie, her queer, swift-working intuition, the candor of her confession, her voluptuousness—all came rushing down on Peter, harassing him with anger and love and desire. To copy any more script became impossible. He lost his place; he hardly knew what he was writing.
He flung aside the whole work, got to his feet with the imperative need of an athlete for the open. He started out of the room, but as an afterthought scribbled a nervous line, telling the Captain he might not be back for dinner. Then he found his hat and coat and walked briskly around the piazza to the front gate.
The trees and shrubs were dripping, but the fog had almost cleared away, leaving only a haze in the air. A pale, level line of it cut across the scarp of the Big Hill. The sun shone with a peculiar soft light through the vapors.
As Peter passed out at the gate, the fancy came to him that he might very well be starting on his mission. It came with a sort of surprise. He wondered how other men had set about reforms. With unpremeditation? He wondered to whom Jesus of Nazareth preached his first sermon. The thought of that young Galilean, sensitive, compassionate, inexperienced, speaking to his first hearer, filled Peter with a strange trembling tenderness. He looked about the familiar street of Hooker's Bend, the old trees over the pavement, the shabby village houses, and it all held a strangeness when thus juxtaposed to the thought of Nazareth nineteen hundred years before.
The mulatto started down the street with his footsteps quickened by a sense of spiritual adventure.
Retrieved from "https://en.wikisource.org/w/index.php?title=Birthright/Chapter_XV&oldid=5074948"
|
cc/2019-30/en_middle_0019.json.gz/line9933
|
__label__wiki
| 0.623623
| 0.623623
|
The Master Mind of Mars/Chapter 4
< The Master Mind of Mars
The Master Mind of Mars by Edgar Rice Burroughs
Chapter IV: VALLA DIA
611559The Master Mind of Mars — Chapter IV: VALLA DIAEdgar Rice Burroughs
I lay awake a long time that night thinking of 4296-E-2631-H, the beautiful girl whose perfect body had been stolen to furnish a gorgeous setting for the cruel brain of a tyrant. It seemed such a horrid crime that I could not rid my mind of it and I think that contemplation of it sowed the first seed of my hatred and loathing for Ras Thavas. I could not conjure a creature so utterly devoid of bowels of compassion as to even consider for a moment the frightful ravishing of that sweet and lovely body for even the holiest of purposes, much less one that could have been induced to do so for filthy pelf.
So much did I think upon the girl that night that her image was the first to impinge upon my returning consciousness at dawn, and after I had eaten, Ras Thavas not having appeared, I went directly to the storage room where the poor thing was. Here she lay, identified only by a small panel, bearing a number: 4296-E-2631-H. The body of an old woman with a disfigured face lay before me in the rigid immobility of death; yet that was not the figure that I saw, but instead, a vision of radiant loveliness whose imprisoned soul lay dormant beneath those greying locks.
The creature here with the face and form of Xaxa was not Xaxa at all, for all that made the other what she was had been transferred to this cold corpse. How frightful would be the awakening, should awakening ever come! I shuddered to think of the horror that must overwhelm the girl when first she realized the horrid crime that had been perpetrated upon her. Who was she? What story lay locked in that dead and silent brain? What loves must have been hers whose beauty was so great and upon whose fair face had lain the indelible imprint of graciousness! Would Ras Thavas ever arouse her from this happy semblance of death? --far happier than any quickening ever could be for her. I shrank from the thought of her awakening and yet I longed to hear her speak, to know that that brain lived again, to learn her name, to listen to the story of this gentle life that had been so rudely snatched from its proper environment and so cruelly handled by the hand of Fate. And suppose she were awakened! Suppose she were awakened and that I--A hand was laid upon my shoulder and I turned to look into the face of Ras Thavas.
You seem interested in this subject," he said.
"I was wondering," I replied, "what the reaction this girl's brain would be were she to awaken to the discovery that she had become an old, disfigured woman."
He stroked his chin and eyed me narrowly. "An interesting experiment," he mused.
"I am gratified to discover that you are taking a scientific interest in the labours that I am carrying on. The psychological phases of my work I have, I must confess, rather neglected during the past hundred years or so, though I formerly gave them a great deal of attention. It would be interesting to observe and study several of these cases. This one, especially, might prove of value to you as an initial study, it being simple and regular. Later we will let you examine into a case where a man's brain has been transferred to a woman's skull, and a woman's brain to a man's. There are also the interesting cases where a portion of diseased or injured brain has been replaced by a portion of the brain from another subject, and, for experimental purposes alone, those human brains that have been transplanted to the craniums of beasts, and vice versa, offer tremendous opportunities for observation. I have in mind one case in which I transferred half the brain of an ape to the skull of a man, after having removed half of his brain, which I grafted upon the remaining part of the brain in the ape's skull. That was a matter of several years ago and I have often thought that I should like to recall these two subjects and note the results. I shall have to have a look at them--as I recall it they are in vault L-42-X, beneath building 4-J-21. We shall have to have a look at them someday soon--it has been years since I have been below. There must be some very interesting specimens there that have escaped my mind. But come! let us recall 4296-E-2631-H.
"No!" I exclaimed, laying a hand upon his arm. "It would be horrible."
He turned a surprised look upon me and then a nasty, sneering smile curled his lips. "Maudlin, sentimental fool!" he cried. "Who dare say no to me?"
I laid a hand upon the hilt of my long-sword and looked him steadily in the eye.
"Ras Thavas," I said, "you are master in your own house; but while I am your guest treat me with courtesy."
He returned my look for a moment but his eyes wavered. "I was hasty," he said.
"Let it pass." That, I let answer for an apology--really it was more than I had expected--but the event was not unfortunate. I think he treated me with far greater respect thereafter; but now he turned immediately to the slab bearing the mortal remains of 4296-E-2631-H.
"Prepare the subject for revivification," he said, "and make what study you can of all its reactions." With that he left the room.
I was now fairly adept at this work which I set about with some misgivings but with the assurance that I was doing right in obeying Ras Thavas while I remained a member of his entourage. The blood that had once flowed through the veins of the beautiful body that Ras Thavas had sold to Xaxa reposed in an hermetically sealed vessel upon the shelf above the corpse. As I had before done in other cases beneath the watchful eyes of the old surgeon I now did for the first time alone. The blood heated, the incisions made, the tubes attached and the few drops of life-giving solution added to the blood, I was now ready to restore life to that delicate brain that had lain dead for ten years. As my finger rested upon the little button that actuated the motor that was to send the revivifying liquid into those dormant veins, I experienced such a sensation as I imagined no mortal man has ever felt.
I had become master of life and death, and yet at this moment that I stood there upon the point of resurrecting the dead I felt more like a murderer than a saviour. I tried to view the procedure dispassionately through the cold eye of science, but I failed miserably. I could only see a stricken girl grieving for her lost beauties. With a muffled oath I turned away. I could not do it! And then, as though an outside force had seized upon me, my finger moved unerringly to the button and pressed it. I cannot explain it, unless upon the theory of dual mentality, which may explain many things. Perhaps my subjective mind directed the act. I do not know. Only I know that I did it, the motor started, the level of the blood in the container commenced gradually to lower.
Spell-bound, I stood watching. Presently the vessel was empty. I shut off the motor, removed the tubes, sealed the openings with tape. The red glow of life tinged the body, replacing the sallow, purplish hue of death. The breasts rose and fell regularly, the head turned slightly and the eyelids moved. A faint sigh issued from between the parting lips. For a long time there was no other sign of life, then, suddenly, the eyes opened. They were dull at first, but presently they commenced to fill with questioning wonderment. They rested on me and then passed on about that portion of the room that was visible from the position of the body. Then they came back to me and remained steadily fixed upon my countenance after having once surveyed me up and down. There was still the questioning in them, but there was no fear.
"Where am I?" she asked. The voice was that of an old woman--high and harsh. A startled expression filled her eyes. "What is the matter with me? What is wrong with my voice? What has happened?"
I laid a hand upon her forehead. "Don't bother about it now," I said, soothingly. "Wait until sometime when you are stronger. Then I will tell you."
She sat up. "I am strong," she said, and then her eyes swept her lower body and limbs and a look of utter horror crossed her face. "What has happened to me? In the name of my first ancestor, what has happened to me?"
The shrill, harsh voice grated upon me. It was the voice of Xaxa and Xaxa now must possess the sweet musical tones that alone would have harmonized with the beautiful face she had stolen. I tried to forget those strident notes and think only of the pulchritude of the envelope that had once graced the soul within this old and withered carcass.
She extended a hand and laid it gently upon mine. The act was beautiful, the movements graceful. The brain of the girl directed the muscles, but the old, rough vocal cords of Xaxa could give forth no sweeter notes. "Tell me, please!" she begged. There were tears in the old eyes, I'll venture for the first time in many years. "Tell me! You do not seem unkind."
And so I told her. She listened intently and when I was through she sighed.
"After all," she said, "it is not so dreadful, now that I really know. It is better than being dead." That made me glad that I had pressed the button. She was glad to be alive, even draped in the hideous carcass of Xaxa. I told her as much.
"You were so beautiful," I told her.
"And now I am so ugly?" I made no answer.
"After all, what difference does it make?" she inquired presently. "This old body cannot change me, or make me different from what I have always been. The good in me remains and whatever of sweetness and kindness, and I can be happy to be alive and perhaps to do some good. I was terrified at first, because I did not know what had happened to me. I thought that maybe I had contracted some terrible disease that had so altered me--that horrified me; but now that I know--pouf! what of it?"
"You are wonderful," I said. "Most women would have gone mad with the horror and grief of it--to lose such wondrous beauty as was yours-- and you do not care."
"Oh, yes, I care, my friend," she corrected me, "but I do not care enough to ruin my life in all other respects because of it, or to cast a shadow upon the lives of those around me. I have had my beauty and enjoyed it. It is not an unalloyed happiness I can assure you. Men killed one another because of it; two great nations went to war because of it; and perhaps my father lost his throne or his life--I do not know, for I was captured by the enemy while the war still raged. It may be raging yet and men dying because I was too beautiful. No one will fight for me now, though," she added, with a rueful smile.
"Do you know how long you have been here?" I asked.
"Yes," she replied. "It was the day before yesterday that they brought me hither."
"It was ten years ago," I told her.
"Ten years! Impossible."
I pointed to the corpses around us. "You have lain like this for ten years," I explained. "There are subjects here who have lain thus for fifty, Ras Thavas tells me."
"Ten years! Ten years! What may not have happened in ten years! It is better thus. I should fear to go back now. I should not want to know that my father, my mother too, perhaps, were gone. It is better thus. Perhaps you will let me sleep again? May I not?"
"That remains with Ras Thavas," I replied; "but for a while I am to observe you."
"Observe me?"
"Study you--your reactions."
"Ah! and what good will that do?"
"It may do some good in the world."
"It may give this horrid Ras Thavas some new ideas for his torture chamber--some new scheme for coining money from the suffering of his victims," she said, her harsh voice saddened.
"Some of his works are good," I told her. "The money he makes permits him to maintain this wonderful establishment where he constantly carries on countless experiments. Many of his operations are beneficent. Yesterday a warrior was brought in whose arm was crushed beyond repair. Ras Thavas gave him a new arm. A demented child was brought. Ras Thavas gave her a new brain. The arm and the brain were taken from two who had met violent deaths. Through Ras Thavas they were permitted, after death, to give life and happiness to others."
She thought for a moment. "I am content," she said. "I only hope that you will always be the observer."
Presently Ras Thavas came and examined her. "A good subject," he said. He looked at the chart where I had made a very brief record following the other entries relative to the history of Case No. 4296-E-2631-H. Of course this is, naturally, a rather free translation of this particular identification number. The Barsoomians have no alphabet such as ours and their numbering system is quite different. The thirteen characters above were represented by four Toonolian characters, yet the meaning was quite the same--they represented, in contracted form, the case number, the room, the table and the building.
"The subject will be quartered near you where you may regularly observe it," continued Ras Thavas. "There is a chamber adjoining yours. I will see that it is unlocked. Take the subject there. When not under your observation, lock it in."
It was only another case to him.
I took the girl, if I may so call her, to her quarters. On the way I asked her her name, for it seemed to me an unnecessary discourtesy always to address her and refer to her as 4296-E-2631-H, and this I explained to her.
"It is considerate of you to think of that," she said, "but really that is all that I am here--just another subject for vivisection."
"You are more than that to me," I told her. "You are friendless and helpless. I want to be of service to you--to make your lot easier if I can."
"Thank you again," she said. "My name is Valla Dia, and yours?"
"Ras Thavas calls me Vad Varo," I told her.
But that is not your name?"
"My name is Ulysses Paxton."
"It is a strange name, unlike any that I have ever heard, but you are unlike any man I have ever seen--you do not seem Barsoomian. Your colour is unlike that of any race."
"I am not of Barsoom, but from Earth, the planet you sometimes call Jasoom. That is why I differ in appearance from any you have known before."
"Jasoom! There is another Jasoomian here whose fame has reached to the remotest corners of Barsoom, but I never have seen him."
"John Carter?" I asked.
"Yes, The War Lord. He was of Helium and my people were not friendly with those of Helium. I never could understand how he came here. And now there is another from Jasoom--how can it be? How did you cross the great void?"
I shook my head. "I cannot even guess," I told her.
"Jasoom must be peopled with wonderful men," she said. It was a pretty compliment.
"As Barsoom is with beautiful women," I replied.
She glanced down ruefully at her old and wrinkled body.
"I have seen the real you," I said gently.
"I hate to think of my face," she said. "I know it is a frightful thing."
"It is not you, remember that when you see it and do not feel too bad."
"Is it as bad as that?" she asked.
I did not reply.
"Never mind," she said presently. "If I had not beauty of the soul, I was not beautiful, no matter how perfect my features may have been; but if I possessed beauty of soul then I have it now. So I can think beautiful thoughts and perform beautiful deeds and that, I think, is the real test of beauty, after all."
"And there is hope," I added, almost in a whisper.
"Hope? No, there is no hope, if what you mean to suggest is that I may some time regain my lost self. You have told me enough to convince me that that can never be."
"We will not speak of it," I said, "but we may think of it and sometimes thinking a great deal of a thing helps us to find a way to get it, if we want it badly enough."
"I do not want to hope," she said, "for it will but mean disappointment for me. I shall be happy as I am. Hoping, I should always be unhappy."
I had ordered food for her and after it was brought Ras Thavas sent for me and I left her, locking the door of her chamber as the old surgeon had instructed. I found Ras Thavas in his office, a small room which adjoined a very large one in which were a score of clerks arranging and classifying reports from various departments of the great laboratory. He arose as I entered.
"Come with me, Vad Varo," he directed. "We will have a look at the two cases in L-42-X, the two of which I spoke."
"The man with half a simian brain and the ape with a half human brain?" I asked.
He nodded and preceded me towards the runway that led to the vaults beneath the building. As we descended, the corridors and passageways indicated long disuse.
The floors were covered with an impalpable dust, long undisturbed; the tiny radium bulbs that faintly illuminated the sub-Barsoomian depths were likewise coated. As we proceeded, we passed many doorways on either side, each marked with its descriptive hieroglyphic. Several of the openings had been tightly sealed with masonry. What gruesome secrets were hid within? At last we came to L-42-X. Here the bodies were arranged on shelves, several rows of which almost completely filled the room from floor to ceiling, except for a rectangular space in the centre of the chamber, which accommodated an ersite-topped operating table with its array of surgical instruments, its motor and other laboratory equipment.
Ras Thavas searched out the subjects of his strange experiment and together we carried the human body to the table. While Ras Thavas attached the tubes I returned for the vessel of blood which reposed upon the same shelf with the corpse. The now familiar method of revivification was soon accomplished and presently we were watching the return of consciousness to the subject.
The man sat up and looked at us, then he cast a quick glance about the chamber; there was a savage light in his eyes as they returned to us. Slowly he backed from the table to the floor, keeping the former between us.
"We will not harm you," said Ras Thavas.
The man attempted to reply, but his words were unintelligible gibberish, then he shook his head and growled. Ras Thavas took a step towards him and the man dropped to all fours, his knuckles resting on the floor, and backed away, growling.
"Come!" cried Ras Thavas. "We will not harm you." Again he attempted to approach the subject, but the man only backed quickly away, growling more fiercely; and then suddenly he wheeled and climbed quickly to the top of the highest shelf, where he squatted upon a corpse and gibbered at us.
"We shall have to have help," said Ras Thavas and, going to the doorway, he blew a signal upon his whistle.
"What are you blowing that for?" demanded the man suddenly. "Who are you? What am I doing here? What has happened to me?"
"Come down," said Ras Thavas. "We are friends."
Slowly the man descended to the floor and came towards us, but he still moved with his knuckles to the pavement He looked about at the corpses and a new light entered his eyes.
"I am hungry!" he cried. "I will eat!" and with that he seized the nearest corpse and dragged it to the floor.
"Stop! Stop!" cried Ras Thavas, leaping forward. "You will ruin the subject," but the man only backed away, dragging the corpse along the floor after him. It was then that the attendants came and with their help we subdued and bound the poor creature. Then Ras Thavas had the attendants bring the body of the ape and he told them to remain, as we might need them.
The subject was a large specimen of the Barsoomian white ape, one of the most savage and fearsome denizens of the Red Planet, and because of the creature's great strength and ferocity Ras Thavas took the precaution to see that it was securely bound before resurgence.
It was a colossal creature about ten or fifteen feet tall, standing erect, and had an intermediary set of arms or legs midway between its upper and lower limbs. The eyes were close together and nonprotruding; the ears were high set, while its snout and teeth were strikingly like those of our African gorilla.
With returning consciousness the creature eyed us questioningly. Several times it seemed to essay to speak but only inarticulate sounds issued from its throat.
Then it lay still for a period.
Ras Thavas spoke to it. "If you understand my words, nod your head." The creature nodded.
"Would you like to be freed of your bonds?" asked the surgeon.
Again the creature nodded an affirmative.
"I fear that you will attempt to injure us, or escape," said Ras Thavas.
The ape was apparently trying very hard to articulate and at last there issued from its lips a sound that could not be misunderstood. It was the single word no.
"You will not harm us or try to escape?" Ras Thavas repeated his question.
"No," said the ape, and this time the word was clearly enunciated.
"We shall see," said Ras Thavas. "But remember that with our weapons we may dispatch you quickly if you attack us."
The ape nodded, and then, very laboriously: "I will not harm you."
At a sign from Ras Thavas the attendants removed the bonds and the creature sat up. It stretched its limbs and slid easily to the floor, where it stood erect upon two feet, which was not surprising, since the white ape goes more often upon two feet than six; a fact of which I was not cognizant at the time, but which Ras Thavas explained to we later in commenting upon the fact that the human subject had gone upon all fours, which, to Ras Thavas, indicated a reversion to type in the fractional ape-brain transplanted to the human skull.
Ras Thavas examined the subject at considerable length and then resumed his examination of the human subject which continued to evince more simian characteristics than human, though it spoke more easily than the ape, because, undoubtedly, of its more perfect vocal organs. It was only by exerting the closest attention that the diction of the ape became understandable at all.
"There is nothing remarkable about these subjects," said Ras Thavas, after devoting half a day to them. "They bear out what I had already determined years ago in the transplanting of entire brains; that the act of transplanting stimulates growth and activity of brain cells. You will note that in each subject the transplanted portions of the brains are more active--they, in a considerable measure, control. That is why we have the human subject displaying distinctly simian characteristics, while the ape behaves in a more human manner; though if longer and closer observation were desirable you would doubtless find that each reverted at times to his own nature--that is the ape would be more wholly an ape and the human more manlike--but it is not worth the time, of which I have already given too much to a rather unprofitable forenoon. I shall leave you now to restore the subjects to anaesthesia while I return to the laboratories above. The attendants will remain here to assist you, if required."
The ape, who had been an interested listener, now stepped forward. "Oh, please, I pray you," it mumbled, "do not again condemn me to these horrid shelves. I recall the day that I was brought here securely bound, and though I have no recollection of what has transpired since I can but guess from the appearance of my own skin and that of these dusty corpses that I have lain here long. I beg that you will permit me to live and either restore me to my fellows or allow me to serve in some capacity in this establishment, of which I saw something between the time of my capture and the day that I was carried into this laboratory, bound and helpless, to one of your cold, ersite slabs."
Ras Thavas made a gesture of impatience. "Nonsense!" he cried. "You are better off here, where you can be preserved in the interests of science."
"Accede to his request," I begged, "and I will myself take over all responsibility for him while I profit by the study that he will afford me."
"Do as you are directed," snapped Ras Thavas as he quit the room.
I shrugged my shoulders. "There is nothing for it, then," I said.
"I might dispatch you all and escape," mused the ape, aloud, "but you would have helped me. I could not kill one who would have befriended me --yet I shrink from the thought of another death. How long have I lain here?"
I referred to the history of his case that had been brought and suspended at the head of the table. "Twelve years," I told him.
"And yet, why not?" he demanded of himself. "This man would slay me-- why should I not slay him first."
"It would do you no good," I assured him, "for you could never escape. Instead you would be really killed, dying a death from which Ras Thavas would probably think it not worth while ever to recall you, while I, who might find the opportunity at some later date and who have the inclination, would be dead at your hands and thus incapable of saving you."
I had been speaking in a low voice, close to his ear, that the attendants might not overhear me. The ape listened intently.
"You will do as you suggest?" he asked.
"At the first opportunity that presents itself," I assured him.
"Very well," he said, "I will submit, trusting to you."
A half hour later both subjects had been returned to their shelves.
Retrieved from "https://en.wikisource.org/w/index.php?title=The_Master_Mind_of_Mars/Chapter_4&oldid=6700661"
|
cc/2019-30/en_middle_0019.json.gz/line9934
|
__label__cc
| 0.555106
| 0.444894
|
Teen >
Where I Found You
On a humanitarian mission in Indonesia, seventeen-year-old Sienna falls for Deni, a mysterious—and off-limits—tsunami survivor who makes her want to live again.
Sea Series, Book 1
By Heidi R. Kling
After her mother's plane went missing over the Indian Ocean, seventeen-year-old Sienna Jones gave up everything she loved about living in California. No more surfing. No more swimming. No more ocean, period. Playing it safe, hiding from the world, is the best call.
Until her dad throws down the challenge of a lifetime: spend a week with his humanitarian team in Indonesia, working with orphans who lost everything in a massive tsunami.
The day they arrive, Sienna meets a mysterious boy named Deni, whose dark, intense eyes make her heart race. Their stolen nights force her to open up and live in a way she thought she couldn't anymore. When she’s with Deni, she remembers the girl she used to be…and starts to feel like the woman he sees in her.
A woman he wants for his own.
But when Deni’s past comes looking for him, Sienna’s faced with losing another person she loves. She can’t do it. Not again.
Fortunately, this time, she has a plan.
5 stars: "...a richly woven story as turbulent and beautiful as the sea itself..." –Sarah Ockler, author of Twenty Boy Summer
5 stars: "All in all, this book is one of the best I've ever read and undoubtedly qualifies to get a five star review from myself." –Junming Guan
4.5 stars: "[N]ow the author has written a sequel. As much as I was okay with the ending of this book, now I can't wait to see what happens next with these wonderful characters." –Terrill Rosado, Goodreads Reviewer
4 stars: "Very different from anything I've read!" –Whitney Atkinson, Whitty Novels
5 stars: "One word: Extraordinary. I have never loved a book so much, I have never been so amazed by an author, and I have never been so moved by a story." –Andye, Reading Teen
5 stars: "it’s difficult to explain what is at the heart of Sienna’s journey. What it means when you read it. How it sort of reshapes your insides and makes you feel different after finishing the last page." –Novel Novice
4 stars: "I also loved that my religion (Islam) was actually quite a focal point and there were no discriminations against it so kudos to the author for capturing it so perfectly."––Husnaa Hassam, Goodreads Reviewer
5 stars: "Sweet, sweet sweet! Wasn't ashamed to shed a few tears...." –Jen Bigheart, I Read Banned Books
5 stars: "Bottom line, I am so glad that I have finally read this book, but I am sad that I have gotten to the ending. This book deserves all the stars in the world. Terima kasih, Heidi Kling." –Aisha Khairi, Goodreads Reviewer
4 stars: "I have never read from this author before but this book was really good!" –Joshualyn Prater, Goodreads Reviewer
5 stars: "Beautifully written, wonderful characters. Fast-paced story that flowed effortlessly. I cried. I actually cried." –Kindaslick, Goodreads Reviewer
5 stars: "Love!" –Nikki, Goodreads Reviewer
4 stars: "It has a heartfelt storyline with an element of truth. It's about finding yourself and moving forward with life." –Danielle, Chapters Through Life
5 stars: "The story is full of heart and feeling and I'm so glad I chose to read it. Definitely one of my favorites I've read this year." –Jo-Jo, Goodreads Reviewer
5 stars: "I cried and I laughed and I fell in love. It was completely amazing." –Gabie, Owl Eyes Reviews
When the boy Sienna loved and lost two years ago shows up on her doorstep, her world shifts. Her heart can’t take losing him again, but that’s exactly what might happen....
Series: Sea, Book 1
Release Date: Dec 4, 2017
Imprint: teen
Genre: contemporary, multi-cultural, young adult
Tropes: coming of age/family/social issues, forbidden love/off limits
By Heidi December 02, 2009
What I Learned From This Book
1. A book takes a long time to write.
2. Most of writing is revising.
3. I'm grateful and happy I have a book coming out.
4. I hope people like it.
My rating system: A star for each year I worked on SEA: 2005-2010. =)
By Kristy November 29, 2010
"The seaweed is always greener in sombody else's lake, you dream about going up there but that is a big mistake. Just look at the world around you, right here on the ocean floor. Under the sea......."
And, here we have yet another book that 100% shocked me...
I thought this was going to be either:
a... ...more
By Nic June 27, 2010
"I wanted to tell him that you can meet someone and they can change your life forever, even if you have only known him for a short while, that when you leave, you're a different person than before you meet him....."
This is the story of Sienna who's mother disappeared in a plane crash overseas wh... ...more
By D.M. November 23, 2017
Sienna stopped living the day her mother died. She stopped loving everything and became distant from the life she once knew. On her birthday her dad gives her the opportunity to turn her life around and get back on track with her dreams. Her dream was to follow in her parents footsteps, but this... ...more
By Whitney December 09, 2014
Very different from anything I've read! I only knocked a star off because it was a little bit angsty. ...more
By Erica February 04, 2010
Heidi R Kling has written a breath-taking debut with Sea! Readers are plunged head first into a heartbreaking story of loss, hope, and new experiences. Sea is a book that speaks to everyone, but everyone can take something a little different away.
Sea is a touching story that helps a person conne... ...more
By ~Tina~ July 19, 2010
Sea is a story about a girl named Sienna Jones, once she lived her life large, but her mothers death made her fearful and so she became distant and lost.
Her father, who also feels the weight of lost wants to help others to feel useful again and wants Sienna to join him on Team Hope to Indonesia,... ...more
By April May 19, 2010
Imagine, if you will, a book that will melt your heart simultaneously reminding you of a 1940s black and white film, despite it being set in the present. Are you picturing? Picture an exotic location, such as say, Indonesian. Now, add in a large smattering of romance and you have Sea by Heidi R.... ...more
By Miranda (MrsLeif's Two Fangs About It) November 29, 2017
3.5 / 5 Fangs
I did not know what to expect going into this book, but I was pleasantly surprised! This story was full of romance, self-discovery, loss, angst, and hope. The author tied in so many different elements to this story, which kept the plot refreshing and interesting. The angst in this bo... ...more
By Nicole January 21, 2018
First things first: I received this book through NetGalley.
Where, oh where, do I start. I wasn't prepared for all the emotions that I would go through while reading this story. But I loved it. I truly loved the story and I loved that I got to feel all the feels.
Summary: After her mother's plane w... ...more
By Mundie Moms & Mundie Kids December 01, 2010
It's hard to believe that Sea is Heidi Kling's debut book. Sea is a richly written story that will capture the readers attention and pull them right into the wonderful world Heidi has created. It's both real and captivating. Woven with a beautiful, sweet summer love story, Sea is one read I highl... ...more
By Sandy January 29, 2011
Sea is unlike anything else I've read this past year. The story is rich and unique--I can't fathom the amount of research that must have gone into this beautiful tale. The characters were compelling and believable--you could feel their emotions, feel their heartache, pain, and love. Seeing the in... ...more
By Elaine June 04, 2018
I'm so glad I had the opportunity to read this book first! It definitely sets the stage for 'The Sea Takes Me' is an insightful look at how one teenage girl reacted to her mother's disappearance. When her father challenges her to spend part of her summer working in an orphanage in Indonesia she r... ...more
By Liz September 24, 2010
Between the fanatical reviews posted by several bloggers and Sea’s gorgeous cover, I had to have this book for myself. Even though I knew a large part of the plot was about tsunami relief, part of my brain expected this book to have lots of idyllic romantic scenes where the characters work throug... ...more
By Steph Su August 05, 2010
SEA is a wonderfully solid, emotional, and un-put-downable debut by a highly talented YA novelist.
Heidi Kling writes her characters with assured realness. Sienna thinks and sounds like a 15-year-old with a tragic past: she has the fears and (occasionally petty) concerns appropriate for her age an... ...more
By Erica (storybookend) October 31, 2015
Sea is a luscious, intriguing tale that was beautiful and dreamy. I was pulled straight under the waves from the beginning. It was expertly written and researched. Kling captured the allure and fascination of the Indonesian culture, and the desperation and tragedy of the tsunami perfectly.
Kling... ...more
By Sophie October 06, 2009
I know this one will come as a shocker to most of you. What? I read a book that had no paranormal character in it whatsoever?? *pauses for your still processing brain to catch up*
I did. Furthermore, I gave it FIVE shiny stars. Pinky swear.
Until I read SEA, I'd forgotten what it was like to read a... ...more
By Zoe January 30, 2010
I just finished this book. I am blown away. Heidi Kling wrote one of my favorite novels. Sea was thrilling, sweet, adventurous, while still having that feel where everything seems like it’s going to be ok. I fell in love with these characters, they were written wonderfully.
Some people think that... ...more
By Angie February 06, 2010
What a fantastic and original book! Addictive from the very first page, Sienna's story was one I could not get enough of. Her reluctant adventure into the aftermath of the 2004 Indonesian tsunami to try and help heal orphans who lost loved ones, ends up being a journey to her own healing. Sienna... ...more
By Jenni June 11, 2010
Sea was a fascinating little adventure/romance that I very much enjoyed. I applaud Heidi for writing it, and wanting to give the Young Adult world a different taste of literature, as its definitely unique. It was not my typical genre that I read, so for me to like it as much as I did was quite br... ...more
By Sarah July 16, 2010
Love, Love, Love it! I love books with romance, but sometimes the romance genre feels oversaturated with paranormal or new girl falls for hot guy who finally notices her storylines. Sea stands out among these romances and is a breath of fresh air. In Sea, you'll find a wonderfully lovely story ab... ...more
By Sam July 18, 2010
It's funny, I find it really hard to write reviews of books that I enjoyed. In books that were just so-so, it's a lot easier because I can focus on both the good and the bad things, but books I like? I get a little fan-girly about them.
Sea was definitely one of those books. I read it in practical... ...more
By Jessica (Jess Hearts Books) June 30, 2010
I first noticed this book on a lot of people’s book blogs. It has rave reviews so without really knowing that much about it I added it to my wish list to be brought at a later date. However I kept seeing this book everywhere! So intrigued I decided to read what it was about and after finding out... ...more
By Katie November 18, 2010
This book was incredible. It had been sitting at the top of my TBR pile for months when I finally picked it up two days ago. I have no idea what I was waiting for.
What was so great for me was the realistic quality. I've been to Southeast Asia 5 times, and Kling captured the culture beautifully. W... ...more
By Alyson (Kid Lit Frenzy) May 08, 2010
Sienna "Sea" Jones lost her mother to a plane accident three years ago. Her father, a psychiatrist who does relief work in underdeveloped countries, decides that maybe a trip to Indonesia to help with children victims of the Tsunami will help her heal from her own loss.
I have to say I truly love... ...more
Heidi R. Kling
Heidi R. Kling is the bestselling author of novels about relatable girls in fantastic situations— books that beg the question: what would YOU do in her shoes? Her latest, WHERE THE SEA TAKES ME, is the sequel to her award-winning debut novel Sea #1 WHERE I FOUND YOU. A native Californian, she relocated to New York to earn her MFA in Creative Writing from The New School and is now living her dream writing full time in a tiny town on the Cali coast with her husband, two kids, their Sailor dog and a guinea pig named Llama Llama. Visit her on the web at http://heidirkling.com and follow Heidi R. Kling (Facebook/Twitter/Instagram)
They think I'm next. That I'll be the seventh kid to step in front of a train and end my life. I've been shipped off to my dad's failing Wyoming ranch for “my own safety,” but I wasn't expecting him to be so sick, or for Jake—the boy I knew years ago—to...
Hazel McCallister loves her life...until her boyfriend cheats on her with her best friend.Felix James can’t stand by when his sister steals her best friend’s boyfriend. So Felix vows to help turn Hazel into a girl her ex can’t resist—so then she can break...
My dad’s company is sponsoring a Survivor-like scholarship competition, and I’ve been roped into assisting the interns. Interns like Carlos, who is very distracting…until an anonymous informant takes aim at the company. ...
Ava Pegg isn’t sure exactly what her parents were thinking when they bought a vacation home in dull-as-dirt Glenview. Then the cute-but-really-annoying boy next door shows up at her place in a panic...hollering something about flesh-eating zombies attacking the...
The last thing she needs is a distraction in the form of falling in love. But when an impossible evil is unleashed, love might be the only thing left to help Gia save the world....
Salome left humankind behind to be with Gareth in the Kingdom of Summer. But dark forces are rising, her happily-ever-after is coming apart, and the Kingdom is on the brink of war. When she sends a frantic PLEASE HURRY message to her bestie, Kadie Byers is ripped...
When life changes overnight for Ava, she’ll have to fight harder than she’s ever done to keep the family and love she never thought she could have....
When Dylan Kennedy sees a girl in white in the woods behind his grandparents’ farm, he knows he’s seen her before...in his dreams. Only he can save her world from an evil lord. Where they’re going is full of creatures he’s only read about in horror stories....
New school. Cross-country move. Broken heart. On top of all of that, Emma Guthrie must pretend she's completely over her ex, Cooper Beaumont, and battle a trio of enemies—human and spectral—who may be targeting everyone she loves. But when the fight escalates,...
When Dante is given his first liberator mission to save the soul of Aspen, she reminds him of his former rebellious life. Though Dante is committed to living clean for his girlfriend, this dude’s been a playboy for far too long…and old demons die hard...
Darcy Covington never had to worry about money, until her father’s business hit the skids, and Dad bailed on his family. Fortunately, Darcy’s uncle owns a thrift shop. There’s also Lucas, the wickedly hot fix-it guy she can’t stop crushing on...
Rinnie Noelle would rather kick butt than go on a date. As a Psi Fighter, she can’t be distracted by emotion. Her nemesis, Nicolaitin, is manipulating students to carry out his new evil plan. People’s lives are depending on Rinnie’s ultimate focus. But Mason...
Regan Flay is following her control-freak mother's “plan” for high school success, until everything goes horribly wrong. Every bitchy text or email is printed out and taped to every locker in the school. Now Regan's gone from popular princess to total pariah....
Maggie Raynard is a semi-god, descended from Aphrodite. Sounds cool in theory, but when she accidentally puts her ex-boyfriend in a coma, things go downhill pretty fast. Now some new guy named Mac Finnegan has made it his mission to teach her how to use her new...
Jules knows exactly what’s in store at her new job at castle-turned-dinner-theater Tudor Times—secretly drooling over her crush. Except that it’s not quite what she imagined. There’s the dead body she finds that just kind of…well, disappears...
Sixteen-year-old Ellie Cox is losing time. It started out small...forgetting a drive home or a conversation with a friend. But her blackouts are getting worse, more difficult to disguise as forgetfulness. When Ellie goes missing for three days, waking up in the...
It's Callie’s seventeenth birthday and she's awaiting her vision?a memory sent back in time to sculpt each citizen into the person they're meant to be. In her vision, she sees herself murdering her gifted younger sister. Before she can process what it means,...
Life is hell. Demons attacking. Cheerleaders screaming. Vampires and werewolves asking where the bathroom is. Just another day here at St. Michael’s Guardian Training Academy. If I can survive Luc’s deadly Sovereign Trials and keep my evil twin sister from...
Wilmont Academy’s been living in the Dark Ages when it comes to sex ed, so I used my kick-ass coding skills to create a totally anonymous blog where teens can come to get real sex advice....
Valiant was supposed to save us. Instead, it triggered the end of the world. Now it’s up to me and my best friend-turned-more, Justin, to save us from aliens determined to kill us all....
Know your enemy if you want to survive…
Alessandra D’Angeli is in need of an adventure. Tired of her sixteenth-century life in Italy and homesick for her time-traveling cousin, Cat, Alessandra is lost. Until the stars hear her plea...
By day, I'm just another high school girl who likes lip gloss. But by night I'm a Psi Fighter—a secret guardian with a decade of training in the Mental Arts. And I go to your school. And I'm about to test those skills in my first battle against evil. Unfortunately,...
I knew the moment Katy Swartz moved in next door, there was going to be trouble. Lots of it. If there’s one thing I know, it’s that humans can’t be trusted. We scare them. We can do things they only dream about, and honestly, we make them look weak as hell....
The kingdom of Nerissette is finally at peace. After multiple battles, Queen Allie just might have the time to start building a relationship with the dragon next door, Winston, before her sixteenth birthday...
A simple but forgotten truth: Where harbingers of death appear, the morgues will soon be full......
Copyright © 2017 by Heidi R. Kling. All rights reserved, including the right to reproduce, distribute, or transmit in any form or by any means. For information regarding subsidiary rights, please contact the Publisher.
Four Weeks After
I’m alone on the other side of the world talking to a sea turtle that might be the reincarnation of my mom. The boy I love is with the girl he loves, and the girl he loves may not be me.
If I was halfway to Crazy before, I’ve crash-landed now.
Squinting through the sun, I watch the turtle as the sapphire sea froths into a thickening brown. I don’t trust my ears, but I swear, in the lapping waves, I hear echoes of drowning cries of a thousand ghosts. Some sort of flying dragon buzzes around my neck. Too late I slap it away, knowing full well it left a swollen bite. Flash on his smile instead, the clench of his fist, the haunted look in his eyes when he says my name.
How long am I supposed to wait for him?
Fire ants swim over soggy debris and snake across the broken beach like tiny demons. I’m too hot to move out of their way. Hot and dizzy. Dizzy from the tropical heat, dizzy from the spice-wet air, dizzy from everything. When the sea turtle waves her flipper and stares me right in the eye, I startle at my desperate question, and the fact I think a turtle may have the answer.
“What am I supposed to do now?”
Four Weeks Before
It’s always the same dream, but it’s not her plane. It’s mine.
The downward spiral of the airplane thundering toward the sea like the death-drop roller coaster at the beach boardwalk but worse, because there’s no happy ending to the ride—no cotton candy waiting once the scary part is over. Just a deafening crash and seaweed. Freezing water and foreseeable death. I float down, down, down, and then land with a silent thud on the ocean’s murky floor. My eyes are open, but I can’t see. Drowning in darkness, I scream bubbles until someone shakes me awake.
“Sienna, can you hear me? Sweetie? Wake up.”
I jerked upright, gasping for air, grabbing for my dad. “Did I scream? I’m sorry.”
Dad nodded, his glasses framing worried eyes. “It was just a dream. No harm done,” he said, patting my arm. “When you get dressed, come on downstairs. I have a surprise for you, birthday girl.”
Birthday girl. Great.
“Okay. I’ll be right down,” I said, knowing I had no other choice.
For a motherless girl, birthdays were the worst, but I went through the motions for Dad, blowing out the candles, feigning smiles.
I yanked on the nearest clothes and twisted my blond hair into a ponytail. What did my dad have planned? Obviously there wouldn’t be a surprise party at 8 a.m.—my friends were still sleeping, enjoying their first day of summer vacation. Nobody but my best friend, Bev, would come this early, but she was on a road trip with her parents, likely driving most of the way to Yosemite herself. Her parents weren’t overly protective. She’d gotten her license the day she turned sixteen, unlike me, who still only had a permit.
Such a joke.
I made my way down the stairs, my fingertips skimming along the chipping banister. I carefully skipped the uneven bottom step that Dad swore he’d fix years ago and headed for the breakfast nook.
“Here she comes. Siennnnnaaaamerica!” a familiar voice boomed as I rounded the corner.
Imagine Hagrid from Harry Potter with red hair. Now add an MD and faded Hawaiian clothes, and you get my dad’s best friend, Big Doctor Tom.
My groans turned into awkward laughter as my godfather pulled me into a bear hug. “Stop. Please. Can’t. Breathe.”
“Seventeen years old. Mama mia!” Tom rubbed my hair like he was trying to start a fire. I slapped his giant hand away and plopped into my usual seat around the farm table, retying my ponytail. Maybe he had my present? Please be a car, please be a car.
“All grown up.” Tom shook his head. “Can’t believe how fast the time goes. You’re the spitting image of her now.”
Her. Mom. Any hope for a normal morning crashed to the ground.
“Where’s Oma?” I asked.
As if on cue, the sliding glass door opened and my grandmother slipped into the house, bringing the usual California coast morning fog with her. Oma moved into our granny unit three years ago to help Dad with me, or, like she insists, “To keep us company.”
My grandmother smelled like pink jasmine as her silver hair grazed my cheek. “Happy birthday, sweet Sienna,” she said, giving me a kiss.
My grandmother caught sight of Tom and eyed him suspiciously. “I’m surprised to see you here, Thomas. I thought you were in Africa,” she said, something deeper than curiosity stretching across her brow.
Tom shifted in his seat. He’d been scared of Oma since he and Dad were fifteen and he crashed his mom’s station wagon into Oma’s garage door.
Glancing at Dad, Tom said quickly, “I was in Africa, Mrs. Jones. Just in last night.”
Then everything got quiet.
Talking about Tom’s continuing international mental health relief work was sort of like talking about Mom. You could do it, but you’d regret the silence that followed.
I tapped on my juice glass, looking around the room to avoid making eye contact with anyone. No decorations. Nothing to remotely hint that it was my birthday celebration. Just some silverware and plates stacked on the counter buffet style. Everyone knew birthdays reminded me my mom was gone, so they toned it down.
Dad cleared his throat and asked Tom, “Jet lag bad, old man?”
Tom thumped his chest. “Nah. I’m made of steel.” His voice lowered a tad. “Like falling off a horse, Andy. Gotta jump back in the saddle if you’re gonna relearn to ride.”
I rolled my eyes. It was way too early in the morning for clichéd horse metaphors.
Oma frowned, stirring a mint tea bag into her mug. I watched it swirl around and around as the lines on my grandmother’s face deepened. I guessed what she was thinking.
After Mom’s plane disappeared somewhere over the ocean, Dad stopped working abroad to stay home with me. He joined a private psychiatric practice here in El Angel Miguel, our little beach town south of San Francisco. I guessed he thought I couldn’t handle the chance of him vanishing, too. But I was fine now. Or at least sort of. I spent a lot of time pretending I was, anyway.
“How was the beach, Mom?” Dad asked, his eyes dodgy.
“Lovely,” she said. Her voice was crisp and curt as she wiped her hands on her jeans. “The fog’s starting to break,” she added. “And I found many new birthday shells for my favorite girl.”
Oma set a bowl filled with sandy seashells in front of me. I eyed the stairs, considering going back to bed. No offense to Oma—I did love shells—but this was my surprise? Shells?
Then she walked through the door.
The insides of my stomach stretched like a rubber band about to snap.
Why in the world would Dad invite Vera to my birthday celebration?
“Morning, everyone. Sorry I’m late. I stopped for bagels!” Vera, dressed from head to toe in a hot pink tracksuit, strode into the kitchen, holding up a white bag. “Please tell me you have coffee, Andy. I have the worst headache coming on!”
“You addict,” Dad deadpanned, but his eyes were smiling. “Let me put on a fresh pot.”
“My hero,” Vera cooed before turning to me. “Happy birthday, Sienna.”
Vera was my former therapist. Key word: former. I quit after five sessions.
“Thanks,” I mumbled into my juice. “Can I grab a mug, too, Dad?”
“You drink coffee, kiddo?”
I blinked at him. Really? “I have for a few years, but who’s counting?”
Leaning over me in her typically intrusive fashion, Vera grabbed a handful of blueberries off the table and popped them into her mouth. I tried not to stare at the white stripe running down the middle of her frizzy brown hair.
“How are you doing, Sienna?” she asked, laying a manicured hand on my shoulder.
Vera’s words transported me back after Mom’s plane went missing: Me sitting across from her in her office. That same practiced, compassionate voice asking me the same. Exact. Thing. How are you doing, Sienna?
I remembered my twelve-year-old self, desperate for her mother, staring at the banana tree in the corner, counting its waxy leaves, trying not to cry.
“I’m fine,” I said, after a beat.
I’m fine. I repeated in my head. The same lie I told her then.
It wasn’t until Dad handed her a steaming cup of coffee in the mug I gave him last Christmas that she smiled. And then it was an overly grateful display—bleached white teeth and all. I mean, it was just coffee. Then she took an unnecessarily long sip to prove how much she appreciated it.
“Great blend, Andy. Ethiopian?”
“Fair trade Indonesian, actually,” Dad said with a wink.
“Ahhh. To mark the occasion,” Vera singsonged back.
Icy chills ran down my spine. What occasion? My birthday? Fair trade coffee hardly seemed like a birthday thing.
“Can you believe it, Andy?” Tom said, redirecting the conversation. “Our girl, all grown up.”
At five-five, I was the same height as my mom had been. I had her light blond hair and blue-green eyes, too. What I didn’t have was her.
Dad set a plate of fluffy pancakes on the table. They were sprinkled with powdered sugar, exactly how I liked them, but I wasn’t hungry anymore. Something strange was going on, and I didn’t like it.
“Birthday girl gets first pick,” Dad said, but his mouth sat at a strange angle. Seriously, what was going on? I examined him more closely. Somehow I’d missed that he was sporting a dress shirt tucked into ironed pants, looking more like a prep-school kid than the ancient hippie that he was. He usually wandered around on Saturday mornings in Mom’s old robe clutching a cup of coffee, looking sort of lost.
I liked that old robe.
“What’s going on?” I asked.
“I was going to wait until after breakfast, but . . .” He smiled broadly. “Happy birthday, sweetie.” Dad reached inside a drawer and handed me a white envelope with a big red bow on the top. “It’s really from the whole group. We’re so happy to invite you onto the team!”
The team? What could possibly be in an envelope that had anything to do with “the team”? Unless it was a pink slip for a car—maybe even the old Jeep I wanted—I couldn’t imagine what they’d given me.
Heart racing, I slowly opened the envelope.
Instead of anything car related, an airplane ticket slipped out.
I scanned the type in disbelief.
PASSENGER: Ms. Sienna Hope Jones
Flight 13003 departs San Francisco International Airport (SFO) to Yogyakarta (JOG)
June 10, 12:00 a.m. Arrives 5:00 p.m.
CHINA AIR connect in Taipei, Jakarta
But my eyes weren’t reading anymore. The words blurred together.
Everyone stared at me.
“It’s a plane ticket. For you,” Dad said. He rubbed his temple, watching me with what looked like fear. Like I was teetering on the edge of a cliff and he wasn’t sure which way I’d fall.
Oma pushed her chair back from the table and leaned in to read the ticket over my shoulder. “What is this about, Andrew?”
Dad cleared his throat again. “We’d like Sienna to join us for two weeks at an Indonesian orphanage.” He turned back to me. “We think you could really help us with the kids who survived the tsunami, honey. Many of them suffer from nightmares and other symptoms of post-traumatic stress disorder, and our goal—well, one of our goals—is to restructure the dormitories into a family-style system, with an older girl acting as a ‘mother’ or ‘big sister’ figure for the younger trauma survivors to improve their well-being . . .”
His words spun into gibberish.
Tsunami?
Dad wanted me to go on a plane?
A plane over the ocean.
This was my big birthday surprise?
I dropped the ticket like it was on fire.
“You should have talked to me about this first,” Oma said, slicing through the silence. “You think that’s an appropriate place to take Sienna? Aceh, a dangerous disaster zone.” Oma’s usually calm face flushed, her eyes angrier than I’d ever seen them. “You know how afraid she is of flying. I’m shocked you would do this.”
“Especially after the way Hope was killed.”
I tried to shove away from the table but only managed to knock my mug over. Coffee spilled all over the table, dripped over the edge, and splattered onto my lap. I didn’t flinch until I felt the burn.
Vera quickly grabbed a dishrag and wiped up the mess. Tom handed me a napkin. I tried to mop up my lap with that and failed miserably.
As if there wasn’t coffee everywhere, Dad glared at Oma. “Sienna’s my daughter, Mother. I know what’s best for her. And Banda Aceh was the epicenter of the tsunami. We aren’t going there. We’re traveling to Java. We’ll be perfectly safe.”
Safe?
How could Dad promise we’d be safe? He’d said the same thing five years ago.
He came home and Mom didn’t.
Safe.
All the air got sucked out of the room. How dare he make that promise again?
“Sienna, are you okay?” Oma asked. “Andrew, get her some water! She looks like she’s going to faint.”
Their voices drifted into echoes, like they were arguing from opposite ends of a tunnel. A horrible knot grew in my throat that I couldn’t swallow away. My hands shook. My heart raced faster than I knew it could. I could not go on a plane over the ocean. No way. Zero chance.
“I… I’m not thirsty. I’m not going. I’m not going anywhere with you…” The bright kitchen morphed into black and then dotted with flashes of white spots like a psychedelic planetarium show. Alternating shocks of heat and chills coursed through my body. I had to get out of there.
Stumbling up the broken stairs, I headed toward the only thing I needed to see. My hands shook as I held the worn postcard and leaned against my locked bathroom door, watching the sea turtles swim carefree in blue-green water. Gently outlining their hard shells, I dared to flip the card over and read the familiar handwriting, faded and streaked from my old tears.
Dear Sweet Sienna,
I hope you and Spider are having a great time at surf camp! We can’t wait to see your new moves when we get home. Daddy and I miss you so much. We spotted two giant sea turtles today that looked just like the ones on this card. They are two of the ancient ones that live to be a hundred. We swam together, the four of us, wishing you were with us. See you soon to celebrate your birthday!
Mom (and Daddy)
I swallowed back tears. The postcard had arrived five years ago on my twelfth birthday in a mix of other cards and junk mail. A week after Dad came home from Thailand without her.
I never even told my dad I got it, because it was ours. Hers and mine. The last secret I shared with my mom.
Carefully, I tucked the card back into my old journal and splashed cold water on my face. I stared at myself in the mirror, the counter cool marble on my palms. The glass was clear. But five years later, I still didn’t look like me.
|
cc/2019-30/en_middle_0019.json.gz/line9939
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.