Year of Paper int64 1.99k 2.02k | Link to PubMed Entry stringlengths 40 154 | Journals stringclasses 173
values | Journal DOI stringlengths 13 82 | Citation stringlengths 132 505 | Type of Nucleic Acid stringclasses 13
values | Name of Aptamer stringlengths 1 102 | Target stringlengths 4 128 | Aptamer Sequence stringlengths 19 316 | Sequence Length int64 15 312 | GC Content float64 0.3 0.83 | Affinity stringlengths 3 186 | Kd (nM) float64 0 208M ⌀ | Pool Type stringlengths 3 360 | Pool Random Region float64 0 120 ⌀ | Binding Buffer/Conditions stringlengths 3 291 | Divalent Salt stringclasses 4
values | Type of the buffer stringclasses 4
values | pH float64 3.6 9.6 ⌀ | Molecular weight of target stringclasses 84
values | Application as quoted in the referenced paper stringlengths 3 1.13k | Post-selex modifications to the aptamer stringclasses 134
values | Additional Information
stringlengths 3 1.22k ⌀ | Serial Number int64 10M 10M | Parent sequence serial number float64 10M 10M ⌀ | Corresponding Author Name, email address stringlengths 3 118 ⌀ | Aptagen Cross Referencing(Check Aptamer Chemistry, Affinity, Length, GC content, sequence) stringclasses 75
values |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1,996 | https://pubmed.ncbi.nlm.nih.gov/8916928/ | Biochemistry | https://doi.org/10.1021/bi961544+ | Green, L. S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C. H., & Janjic, N. (1996). Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry, 35(45), 14413–14424. https://doi.org/10.1021/bi961544+ | ssDNA | 36t | Platelet-derived growth factor (PDGF)-AA | 5'CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG3' | 40 | 0.55 | Kd: 72 ± 12 nM | 72 | 5‘-CCGAAGCTTAATACGACTCACTATAGGGATCCGCCTGATTAGCGATACT-N40-ACTTGAGCAAAATCACCTGCAGGGG-3‘ | 40 | PBSM (10.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2, pH 7.4) containing 0.01% human serum albumin (HSA) | MgCl | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " Many tumor cell lines have since been shown to produce and secrete PDGF, some of which also express the cognate PDGF receptors; paracrine effect on the tumor stroma and, in some tumor cell lines, autocrine growth stimulation by PDGF are therefore possible; These DNA ligands therefore represent lead compo... | Deduced from the knowledge of the consensus motif | [3′T] represents a 3′-3′-linked thymidine nucleotide added to reduce 3′-exonuclease-mediated degradation | 10,000,114 | null | Janjic, N, janjic@nexstar.com | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8916928/ | Biochemistry | https://doi.org/10.1021/bi961544+ | Green, L. S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C. H., & Janjic, N. (1996). Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry, 35(45), 14413–14424. https://doi.org/10.1021/bi961544+ | ssDNA | 36t | Platelet-derived growth factor (PDGF)-BB | 5'CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG3' | 40 | 0.55 | Kd: 0.093± 0.009 nM | 0.093 | 5‘-CCGAAGCTTAATACGACTCACTATAGGGATCCGCCTGATTAGCGATACT-N40-ACTTGAGCAAAATCACCTGCAGGGG-3‘ | 40 | PBSM (10.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2, pH 7.4) containing 0.01% human serum albumin (HSA) | MgCl | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " Many tumor cell lines have since been shown to produce and secrete PDGF, some of which also express the cognate PDGF receptors; paracrine effect on the tumor stroma and, in some tumor cell lines, autocrine growth stimulation by PDGF are therefore possible; These DNA ligands therefore represent lead compo... | Deduced from the knowledge of the consensus motif | [3′T] represents a 3′-3′-linked thymidine nucleotide added to reduce 3′-exonuclease-mediated degradation | 10,000,114 | null | Janjic, N, janjic@nexstar.com | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8916928/ | Biochemistry | https://doi.org/10.1021/bi961544+ | Green, L. S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C. H., & Janjic, N. (1996). Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry, 35(45), 14413–14424. https://doi.org/10.1021/bi961544+ | ssDNA | 41 | Platelet-derived growth factor (PDGF)-AB | 5'CCGAAGCTTAATACGACTCACTATAGGGATCCGCCTGATTAGCGATACTTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTAACTTGAGCAAAATCACCTGCAGGGG3' | 118 | 0.5 | Not reported | null | 5‘-CCGAAGCTTAATACGACTCACTATAGGGATCCGCCTGATTAGCGATACT-N40-ACTTGAGCAAAATCACCTGCAGGGG-3‘ | 40 | PBSM (10.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl2, pH 7.4) containing 0.01% human serum albumin (HSA) | MgCl | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " Many tumor cell lines have since been shown to produce and secrete PDGF, some of which also express the cognate PDGF receptors; paracrine effect on the tumor stroma and, in some tumor cell lines, autocrine growth stimulation by PDGF are therefore possible; These DNA ligands therefore represent lead compo... | Not applicable | [3′T] represents a 3′-3′-linked thymidine nucleotide added to reduce 3′-exonuclease-mediated degradation | 10,000,115 | null | Janjic, N, janjic@nexstar.com | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | 2'-amino-RNA | C2 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGAGGUCGACCUCGCGCGAGGAGGGUGGAGGGUCGUAGAGCGCGUAGGAGG3' | 51 | 0.705882 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,117 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C8 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUGCUAGGCAAUGUUUCGGUUGGAGUAAUCCGGUGGCUUGCCAUGAUUUACGUGAGUGCUGAUCCGUGAUGAGAUAGUAAGUGCAAUCU3' | 110 | 0.454545 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,118 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C18 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUGCUAGGCAAUGUUUCGGUUGGAGUAAUCCGGUGGCUUGCCAUGAUUUACGUGAGUGCUGAUCCGUGAUGAGAUAGUAAGUGCAAUCU3' | 110 | 0.454545 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,118 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C17 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUGUAUUCUCGGUGGUUUAAUCUGUGUAGAGGAGCUGACUCCUUUGGUUGGACUACGUGGAGGUUCUCUUAGAUAGUAAGUGCAAUCU3' | 109 | 0.431193 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,119 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C1 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUGCAGUUAACCAAGCCUGCAUACUGGAUAGACGGCUUAUCCGACUGAAUGCCUCCCGAAAGGUGCAGUUAGAUAGUAAGUGCAAUCU3' | 109 | 0.458716 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,121 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C9 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUGCGCAAACCCGAAGAAUGCCCAAAUUGAUCCAGAGCAAGUGGGAAUGAUAUAAAGUACCUGGUCCUGGAGAUAGUAAGUGCAAUCU3' | 109 | 0.440367 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies ... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,122 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C15 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUUCCAAACCCCGUUGAGAGUUGAUCCGGUCUAGGGAAUGGGAAAGAAGUAGGUAUCGAAGAGAAUGUACCCUAGAUAGUAAGUGCAAUCU3' | 112 | 0.4375 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,123 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C24 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUAGGACUCAAAUAUUCACGUUGACGUUGUCUUGGAGUGCUGAUCGGAAAACCAAUAUGAUUAAUGGGUCCUGAGAUAGUAAGUGCAAUCU3' | 112 | 0.401786 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,124 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C33 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUACGCAGCGACUGUGGUGGUGAGCGGUUGCGUAACUUGAUUUAAGCAAGUACUGCCAUGGCCGAACCUCUAAGAUAGUAAGUGCAAUCU3' | 111 | 0.468468 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,125 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C34 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUUCUAGUCAAGUUGCAAUCUCCGGUGGGGUGGUAACCGAGGAACACGUUUCGGGUGUAUAGGCUAGCGAGAUAGUAAGUGCAAUCU3' | 108 | 0.472222 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,126 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C37 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUUCUACCAGAGCGAGUGUGCUGAACGUUCUAAGGACGGGAUUGAAUCGAGAUGCGUAUACUAGGACCUUACGAGAUAGUAAGUGCAAUCU3' | 112 | 0.446429 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,127 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8755498/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.15.7475 | Xu, W., & Ellington, A. D. (1996). Anti-peptide aptamers recognize amino acid sequence and bind a protein epitope. Proceedings of the National Academy of Sciences of the United States of America, 93(15), 7475–7480. https://doi.org/10.1073/pnas.93.15.7475 | ssRNA | C52 | Human immunodeficiency virus type 1 Rev (HIV-1 Rev) | 5'GGGAGAUACCAGCUUAUUCAAUUGCUUGGUACCGAGCUCGGAUCCACGUAGUAACGGGCCGCCAGUGUCUGGAAUUCGGGUCGUUCUUGAGAUAGUAAGUGCAAUCU3' | 107 | 0.504673 | Kd: 19-36 nM | 27.5 | 5'-GGGAGAUACCAGCUUAUUCAAUU-N71-AGAUAGUAAGUGCAAUCU-3' | 71 | 500 ul of 10 mM Hepes, pH 7.4/100 mM NaCl | null | Other Buffers | 7.4 | Not reported | Diagnostic and Therapeutic: "RNA aptamers were selected to bind to the isolated Rev34_50 peptide. These results suggest that artificially selected binding cusps may have much in common with those found on natural molecules and have important implications for the development of novel diagnostic reagents and strategies f... | Not applicable | Pool was not stated, but I figured it out using the figures | 10,000,128 | null | Ellington AD, adelling@indiana.edu | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8683119/ | J Immunol | PMID: 8683119 | Wiegand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M. H., Kinet, J. P., & Tasset, D. (1996). High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. Journal of immunology (Baltimore, Md. : 1950), 157(1), 221–230. | 2'-amino-RNA | IGEL1.2 | Immunoglobulin E (IgE), Human | 5'GGGAGGACGAUGCGGGUGUGAAUGGUGUUGUGAGG3' | 35 | 0.6 | Kd: 30 nM | 30 | 5'-GGGAGGACGAUGCGG-N40/N60-CAGACGACUCGCCCGA-3' | 60 | PBS, modified to contain 1 mM of Mgz+ ions (138 mM NaCI, 2.7 mM KCI, 8.1 mM NA,HP04, 1.1 mM KH,P04, and 1 mM MgCI, pH 7.4) | MgCl | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " Using the systematic evolution of ligands by exponential enrichment (SELEX) method, we have identified oligonucleotides that bind to human IgE with high affinities and high specificity. Therefore, these oligonucleotide ligands represent a novel class of IgE inhibitors that may prove useful in the fight a... | 35-nucleotide truncate | SELEX experiments targeting human IgE were performed using 2'-NH,-modified CTP and UTP | 10,000,129 | null | Tasset, D | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8683119/ | J Immunol | PMID: 8683119 | Wiegand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M. H., Kinet, J. P., & Tasset, D. (1996). High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. Journal of immunology (Baltimore, Md. : 1950), 157(1), 221–230. | 2'-amino-RNA | IGEL2.2 | Immunoglobulin E (IgE), Human | 5'GGGAGGACGAUGCGGGUGUGGGGCG3' | 25 | 0.76 | Kd: 35 nM | 35 | 5'-GGGAGGACGAUGCGG-N40/N60-CAGACGACUCGCCCGA-3' | 40 | PBS, modified to contain 1 mM of Mgz+ ions (138 mM NaCI, 2.7 mM KCI, 8.1 mM NA,HP04, 1.1 mM KH,P04, and 1 mM MgCI, pH 7.4) | MgCl | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " Using the systematic evolution of ligands by exponential enrichment (SELEX) method, we have identified oligonucleotides that bind to human IgE with high affinities and high specificity. Therefore, these oligonucleotide ligands represent a novel class of IgE inhibitors that may prove useful in the fight a... | 25-nucleotide truncate | SELEX experiments targeting human IgE were performed using 2'-NH, RNA | 10,000,130 | null | Tasset, D | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8683119/ | J Immunol | PMID: 8683119 | Wiegand, T. W., Williams, P. B., Dreskin, S. C., Jouvin, M. H., Kinet, J. P., & Tasset, D. (1996). High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon receptor I. Journal of immunology (Baltimore, Md. : 1950), 157(1), 221–230. | ssDNA | D17.4 | Immunoglobulin E (IgE), Human | 5'GGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCC3' | 37 | 0.675676 | Kd: 10 nM | 10 | 5'-CTACCTACGATCTGACTAGC-N40-GCTTACTCTCATGTAGTTCC-3' | 40 | PBS, modified to contain 1 mM of Mgz+ ions (138 mM NaCI, 2.7 mM KCI, 8.1 mM NA,HP04, 1.1 mM KH,P04, and 1 mM MgCI, pH 7.4) | MgCl | PBS/phosphate buffers | 7.4 | Not reported | Therapeutic: " Using the systematic evolution of ligands by exponential enrichment (SELEX) method, we have identified oligonucleotides that bind to human IgE with high affinities and high specificity. Therefore, these oligonucleotide ligands represent a novel class of IgE inhibitors that may prove useful in the fight a... | 37-nucleotide truncate | Consensus sequence: TTTATCCGTTCCTCTTAGTGG | 10,000,131 | null | Wiegand, T. W | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8650187/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.12.5883 | O'Connell, D., Koenig, A., Jennings, S., Hicke, B., Han, H. L., Fitzwater, T., Chang, Y. F., Varki, N., Parma, D., & Varki, A. (1996). Calcium-dependent oligonucleotide antagonists specific for L-selectin. Proceedings of the National Academy of Sciences of the United States of America, 93(12), 5883–5887. https://doi.or... | ssRNA | 14.12 | L-selectin receptor globulin (LS-Rg) | 5'UCGGGCGAGUCGUCUGUAACAACAAUCAAGGCGGGUUCACCGCCCCAGUAUGAGUACCGCAUCGUCCUCCC3' | 71 | 0.591549 | Kd: 0.2 nM and 3 nM to soluble L-selectin at 4°C and 22°C respectively | 0.2 | 5'-TCGGGCGAGTCGTCTG-N40-CCGCATCGTCCTCCC-3' | 40 | 20 mM Hepes, pH 7.4, 150 mM NaCl, 1 mM CaCl2, 1 mM MgCl2 | MgCl/CaCl | Other Buffers | 7.4 | Not reported | Therapeutic: " The selectins are calcium-dependent C-type lectins that recognize complex anionic carbohydrate ligands, initiating many cell-cell interactions in the vascular system. Selectin blockade shows therapeutic promise in a variety of inflammatory and postischemic pathologies.SELEX against recombinant L-selectin... | null | null | 10,000,132 | null | Varki, A | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8650187/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.12.5883 | O'Connell, D., Koenig, A., Jennings, S., Hicke, B., Han, H. L., Fitzwater, T., Chang, Y. F., Varki, N., Parma, D., & Varki, A. (1996). Calcium-dependent oligonucleotide antagonists specific for L-selectin. Proceedings of the National Academy of Sciences of the United States of America, 93(12), 5883–5887. https://doi.or... | ssRNA | 13.32 | L-selectin receptor globulin (LS-Rg) | 5'UCGGGCGAGUCGUCUGCGCGUAUGUGUGAAAGCGUGUGCACGGAGGCGUCUACAAUCCGCAUCGUCCUCCC3' | 71 | 0.619718 | Kd: 4 nM and 3 nM to soluble L-selectin at 4°C and 22°C respectively | 4 | 5'-TCGGGCGAGTCGTCTG-N40-CCGCATCGTCCTCCC-3' | 40 | 20 mM Hepes, pH 7.4, 150 mM NaCl, 1 mM CaCl2, 1 mM MgCl2 | MgCl/CaCl | Other Buffers | 7.4 | Not reported | Therapeutic: " The selectins are calcium-dependent C-type lectins that recognize complex anionic carbohydrate ligands, initiating many cell-cell interactions in the vascular system. Selectin blockade shows therapeutic promise in a variety of inflammatory and postischemic pathologies.SELEX against recombinant L-selectin... | null | null | 10,000,133 | null | Varki, A | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8951376/ | J Mol Biol | https://doi.org/10.1006/jmbi.1996.0640 | Dang, C., & Jayasena, S. D. (1996). Oligonucleotide inhibitors of Taq DNA polymerase facilitate detection of low copy number targets by PCR. Journal of molecular biology, 264(2), 268–278. https://doi.org/10.1006/jmbi.1996.0640 | ssDNA | TQ30 | Thermus aquaticus DNA polymerase (Taq pol) | 5'TTCTCGGTTGGTCTCTGGCGGAGCAAGACCAGACAATGTACAGTATTGGCCTGATCTTGTGTATGATTCGCTTTTCCC3' | 78 | 0.487179 | Kd: 40 ± 1 pM | 0.04 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | 50 mMKCl, 2.5 mM MgCl2,10 mM Tris-HCl (pH 8.3 at 22°C) | MgCl | Tris Buffers | 8.3 | 94 kDa | Detection: " We show that the addition of oligonucleotide inhibitors eliminated the need for ‘‘hot start’’ conditions and improved the efficiency of detection of a low copy number target in PCR. The ability to detect very low copy number nucleic acid sequences, down to the single copy level has permitted the use of PCR... | null | null | 10,000,134 | null | Jayasena SD | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | TQ30 | DNA polymerase (Taq pol), Thermus acquaticus | 5'TTCTCGGTTGGTCTCTGGCGGAGCAAGACCAGACAATGTACAGTATTGGCCTGATCTTGTGTATGATTCGCTTTTCCC3' | 78 | 0.487179 | Kd: 40 pM, IC50: 22 nM | 0.04 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). This aptamer inhibited Tth pol. This aptamer inhibited Stoffel fragment (61 kDa)" | null | null | 10,000,134 | null | Sumedha D. Jayasena | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8981912/ | J Clin Invest | https://doi.org/10.1172/JCI119092 | Hicke, B. J., Watson, S. R., Koenig, A., Lynott, C. K., Bargatze, R. F., Chang, Y. F., Ringquist, S., Moon-McDermott, L., Jennings, S., Fitzwater, T., Han, H. L., Varki, N., Albinana, I., Willis, M. C., Varki, A., & Parma, D. (1996). DNA aptamers block L-selectin function in vivo. Inhibition of human lymphocyte traffic... | ssDNA | LD201 | L-selectin–IgG fusion protein (LS-Rg) | 5'CTACCTACGATCTGACTAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTACTCTCATGTAGTTCC3' | 79 | 0.468354 | Kd: 1.8 ± 0.2 nM | 1.8 | 5'-CTACCTACGATCTGACTAGC-N40-GCTTACTCTCATGTAGTTCC-3' | 40 | 20 mM Hepes, pH 7.5, 125 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 5 mM KCl) plus 0.01% (wt/vol) human serum albumin (Sigma Chemical Co., St. Louis, MO) | MgCl/CaCl | Other Buffers | 7.5 | Not reported | Therapeutic: " Aptamers that bind with nanomolar affinity to L-selectin's lectin domain, prevent L-selectin from binding to SLex, and function in vivo to prevent the homing of human lymphocytes to lymph nodes in severe combined immunodeficiency (SCID) mice" | Truncated at both the 5' and 3' ends (ld201t1) | null | 10,000,136 | null | Parma, D, parma@nexstar.com | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8981912/ | J Clin Invest | https://doi.org/10.1172/JCI119092 | Hicke, B. J., Watson, S. R., Koenig, A., Lynott, C. K., Bargatze, R. F., Chang, Y. F., Ringquist, S., Moon-McDermott, L., Jennings, S., Fitzwater, T., Han, H. L., Varki, N., Albinana, I., Willis, M. C., Varki, A., & Parma, D. (1996). DNA aptamers block L-selectin function in vivo. Inhibition of human lymphocyte traffic... | ssDNA | LD196 | L-selectin–IgG fusion protein (LS-Rg) | 5'CTACCTACGATCTGACTAGCTGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGAGCTTACTCTCATGTAGTTCC3' | 79 | 0.556962 | Kd: 3.1 ± 0.4 nM | 3.1 | 5'-CTACCTACGATCTGACTAGC-N40-GCTTACTCTCATGTAGTTCC-3' | 40 | 20 mM Hepes, pH 7.5, 125 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 5 mM KCl) plus 0.01% (wt/vol) human serum albumin (Sigma Chemical Co., St. Louis, MO) | MgCl/CaCl | Other Buffers | 7.5 | Not reported | Therapeutic: " Aptamers that bind with nanomolar affinity to L-selectin's lectin domain, prevent L-selectin from binding to SLex, and function in vivo to prevent the homing of human lymphocytes to lymph nodes in severe combined immunodeficiency (SCID) mice" | Truncated at both the 5' and 3' ends (ld196t1) | null | 10,000,138 | null | Parma, D, parma@nexstar.com | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8981912/ | J Clin Invest | https://doi.org/10.1172/JCI119092 | Hicke, B. J., Watson, S. R., Koenig, A., Lynott, C. K., Bargatze, R. F., Chang, Y. F., Ringquist, S., Moon-McDermott, L., Jennings, S., Fitzwater, T., Han, H. L., Varki, N., Albinana, I., Willis, M. C., Varki, A., & Parma, D. (1996). DNA aptamers block L-selectin function in vivo. Inhibition of human lymphocyte traffic... | ssDNA | LD201t1 | L-selectin–IgG fusion protein (LS-Rg) | 5'TAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTAC3' | 49 | 0.469388 | Not reported | null | 5'-CTACCTACGATCTGACTAGC-N40-GCTTACTCTCATGTAGTTCC-3' | 40 | 20 mM Hepes, pH 7.5, 125 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 5 mM KCl) plus 0.01% (wt/vol) human serum albumin (Sigma Chemical Co., St. Louis, MO) | MgCl/CaCl | Other Buffers | 7.5 | Not reported | Therapeutic: " Aptamers that bind with nanomolar affinity to L-selectin's lectin domain, prevent L-selectin from binding to SLex, and function in vivo to prevent the homing of human lymphocytes to lymph nodes in severe combined immunodeficiency (SCID) mice" | null | null | 10,000,139 | null | Parma, D, parma@nexstar.com | 5'dTpdApdGpdCpdCpdApdApdGpdGpdTpdApdApdCpdCpdApdGpdTpdApdCpdApdApdGpdGpdTpdGpdCpdTpdApdApdApdCpdGpdTpdApdApdTpdGpdGpdCpdTpdTpdCpdGpdGpdCpdTpdTpdApdCp3'
Aptamer kd is different
https://www.aptagen.com/aptamer-details/?id=407 |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8981912/ | J Clin Invest | https://doi.org/10.1172/JCI119092 | Hicke, B. J., Watson, S. R., Koenig, A., Lynott, C. K., Bargatze, R. F., Chang, Y. F., Ringquist, S., Moon-McDermott, L., Jennings, S., Fitzwater, T., Han, H. L., Varki, N., Albinana, I., Willis, M. C., Varki, A., & Parma, D. (1996). DNA aptamers block L-selectin function in vivo. Inhibition of human lymphocyte traffic... | ssDNA | LD174t1 | L-selectin–IgG fusion protein (LS-Rg) | 5'TAGCCATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTGGCTTA3' | 48 | 0.541667 | Not reported | null | 5'-CTACCTACGATCTGACTAGC-N40-GCTTACTCTCATGTAGTTCC-3' | 40 | 20 mM Hepes, pH 7.5, 125 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 5 mM KCl) plus 0.01% (wt/vol) human serum albumin (Sigma Chemical Co., St. Louis, MO) | MgCl/CaCl | Other Buffers | 7.5 | Not reported | Therapeutic: " Aptamers that bind with nanomolar affinity to L-selectin's lectin domain, prevent L-selectin from binding to SLex, and function in vivo to prevent the homing of human lymphocytes to lymph nodes in severe combined immunodeficiency (SCID) mice" | null | null | 10,000,140 | null | Parma, D, parma@nexstar.com | null |
1,996 | https://pubmed.ncbi.nlm.nih.gov/8610114/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.93.7.2755 | Hale, S. P., & Schimmel, P. (1996). Protein synthesis editing by a DNA aptamer. Proceedings of the National Academy of Sciences of the United States of America, 93(7), 2755–2758. https://doi.org/10.1073/pnas.93.7.2755 | ssDNA | DNAA | Isoleucyl-tRNA synthetase (tRNAIle) | 5'CATCGCAAGCTTCCAGAGGGGACGCTGAGGCTTCTATGGTTCCGTAGAATTCCACGCG3' | 58 | 0.568966 | Kd: 1.5 uM | 1,500 | 5'-CATCGCAAGCTTCCAGAG-N25-CGTAGAATTCCACGCGTG-3' | 25 | 20 mM Hepes, pH 7.5 / 150 mM NH4Cl / 1 mM MgCl2 / 10 ug of bovine serum albumin per ml / 1 mM 2-mercaptoethanol | MgCl | Other Buffers | 7.5 | Not reported | Detection: " Our results demonstrate that aptamers have useful applications for answering questions in mechanistic enzymology, such as the role of an acceptor hydroxyl group in the editing reaction. Although DNA aptamers have been selected to bind small molecule ligands and specific proteins such as thrombin, the exper... | Not applicable | *Pool specifies N25 but the aptamer sequence (excluding the primers) has a 26nt random region. There is an extra nucleotide | 10,000,142 | null | Schimmel, P | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9310370/ | Eur J Biochem | https://doi.org/10.1006/viro.1997.8773 | Urvil, P. T., Kakiuchi, N., Zhou, D. M., Shimotohno, K., Kumar, P. K., & Nishikawa, S. (1997). Selection of RNA aptamers that bind specifically to the NS3 protease of hepatitis C virus. European journal of biochemistry, 248(1), 130–138. https://doi.org/10.1111/j.1432-1033.1997.t01-1-00130.x | ssRNA | 10G-1 | NS3 protease of hepatitis C virus (HCV) | 5'GGGAACUCGAUGAAGCGAAUUCUGUUGGCGAACUGUACGCAAGUACACUGGAUGACAGGCCUAUCUAUCGGAUCCACG3' | 78 | 0.512821 | Kd: 650 nM | 650 | 5'-GGGAACUCGAUGAAGCGAAUUCUGU-N6-9-GUACGCAAGUAC-N6-9-ACAGGCCUAUCUAUCGGAUCCACG-3' | 12 | 50 mM Tris/HCl, pH 7.7, 30 mM NaCl, 5 mM CaCl2, 10 mM dithiothreitol | CaCl | Tris Buffers | 7.7 | 110 kDa | Drug Development: "By phosphate-modification-interference analysis we showed that the phosphate residues that are critical for the binding of 10G-1 to NS3 lie within the selected regions of the aptamer and that binding involves electrostatic contacts with the phosphates of regions G28-U34 and A47-A55. The NS3-binding r... | null | null | 10,000,145 | null | Kumar, P. K. Kumar, pkrkumar@nibh.go.jp | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-8 | Thrombin, Human | 5'AGATGCCTGTCGAGCATGCTGTGAATAGGTAGGGTCGGATGGGCTACGGTGTAGCTAAACTGCTTTGTCGACGGG3' | 75 | 0.546667 | Kd: 0.4 nM | 0.4 | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | null | null | 10,000,146 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-14 | Thrombin, Human | 5'AGATGCCTGTCGAGCATGCTGTTGTGGTAGGGTTAGGGATGGTAGCGGTTGTAGCTAAACTGCTTTGTCGACGGG3' | 75 | 0.533333 | Kd: 0.96 nM | 0.96 | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | null | null | 10,000,147 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-16 | Thrombin, Human | 5'AGATGCCTGTCGAGCATGCTGTCAGCTACCGTGGTAGGGAAGGTTGGAGTGTAGCTAAACTGCTTTGTCGACGGG3' | 75 | 0.546667 | Not reported | null | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | null | null | 10,000,148 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-16[29] | Thrombin, Human | 5'CTACCGTGGTAGGGAAGGTTGGAGTGTAG3' | 29 | 0.551724 | Kd: 30 nM | 30 | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | null | 10,000,149 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-16[27] | Thrombin, Human | 5'TACCGTGGTAGGGAAGGTTGGAGTGTA3' | 27 | 0.518519 | Kd: 126 nM | 126 | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | null | 10,000,150 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-38 | Thrombin, Human | 5'AGATGCCTGTCGAGCATGCTAGACCCGTGGTAGGGTAGGATGGGGTGGTCGTAGCTAAACTGCTTTGTCGACGGG3' | 75 | 0.573333 | Not reported | null | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | null | null | 10,000,151 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-38[29] | Thrombin, Human | 5'GACCCGTGGTAGGGTAGGATGGGGTGGTC3' | 29 | 0.655172 | Kd: 0.90 nM | 0.9 | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | null | 10,000,152 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 30-38[27] | Thrombin, Human | 5'ACCCGTGGTAGGGTAGGATGGGGTGGT3' | 27 | 0.62963 | Kd: 42 nM | 42 | 5'-AGATGCCTGTCGAGCATGCT-N30-GTAGCTAAACTGCTTTGTCGACGGG-3' | 30 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | null | 10,000,153 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 60-18 | Thrombin, Human | 5'AGATGCCTGTCGAGCATGCTCTTTGGAGACAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAAGAAGCGAGACGGTGTAGCTAAACTGCTTTGTCGACGGG3' | 105 | 0.561905 | Kd: 0.92 nM | 0.92 | 5'-AGATGCCTGTCGAGCATGCT-N60-GTAGCTAAACTGCTTTGTCGACGGG-3' | 60 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | null | null | 10,000,154 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 60-18[38] | Thrombin, Human | 5'CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA3' | 38 | 0.605263 | Kd: 0.5 nM | 0.5 | 5'-AGATGCCTGTCGAGCATGCT-N60-GTAGCTAAACTGCTTTGTCGACGGG-3' | 60 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | null | 10,000,155 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 60-18[29] | Thrombin, Human | 5′AGTCCGTGGTAGGGCAGGTTGGGGTGACT3′ | 29 | 0.62069 | Kd: 0.5 nM | 0.5 | 5'-AGATGCCTGTCGAGCATGCT-N60-GTAGCTAAACTGCTTTGTCGACGGG-3' | 60 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | The 15-nucleotide core sequence has eight highly conserved guanine residues and forms a G-quadruplex structure. A single nucleotide within the G-quadruplex structure can direct the DNA to a distinct epitope. | 10,000,156 | null | Kubik, M. F | 5'dApdGpdTpdCpdCpdGpdTpdGpdGpdTpdApdGpdGpdGpdCpdApdGpdGpdTpdTpdGpdGpdGpdGpdTpdGpdApdCpdTp3'
https://www.aptagen.com/aptamer-details/?id=315 |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9368651/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1275 | Tasset, D. M., Kubik, M. F., & Steiner, W. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. Journal of molecular biology, 272(5), 688–698. https://doi.org/10.1006/jmbi.1997.1275 | ssDNA | 60-18[27] | Thrombin, Human | 5'GTCCGTGGTAGGGCAGGTTGGGGTGAC3' | 27 | 0.666667 | Kd: 0.7 nM | 0.7 | 5'-AGATGCCTGTCGAGCATGCT-N60-GTAGCTAAACTGCTTTGTCGACGGG-3' | 60 | 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 at 37°C | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " The SELEX process has been used to isolate single-stranded DNA ligands to human thrombin. Here, a 29-nucleotide single-stranded DNA ligand to human thrombin, designated 60-18[29], with a Kd of approximately 0.5 nM is described. DNA 60-18[29] inhibits thrombin-catalyzed fibrin clot formation in vitro." | The aptamer was truncated | null | 10,000,157 | null | Kubik, M. F | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9245404/ | Biochemistry | https://doi.org/10.1021/bi9700633 | Mannironi, C., Di Nardo, A., Fruscoloni, P., & Tocchini-Valentini, G. P. (1997). In vitro selection of dopamine RNA ligands. Biochemistry, 36(32), 9726–9734. https://doi.org/10.1021/bi9700633 | ssRNA | dopa2 | Dopamine | 5'GGGAAUUCCGCGUGUGCGCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCCAGUCCGUUCGGGAUCCUC3' | 111 | 0.585586 | Kd: 2.8 µM | 2.8 | 5'-GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC-3' | 80 | 0.15 M NaCl, 50 mM Tris-HCl, pH 7.4, 5 mM MgCl2, and 0.02% ascorbic acid | MgCl | Tris Buffers | 7.4 | Not reported | Research: " Selection experiments can provide insights into RNA structure and can also be used to refine existing structures. We suggest that a structure like the one described for the dopamine aptamers could form by long-range interactions in natural RNA molecules." | The aptamer was truncated | null | 10,000,158 | null | Tocchini-Valentini GP | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9343239/ | J Virol | https://doi.org/10.1128/JVI.71.11.8790-8797.1997 | Weiss, S., Proske, D., Neumann, M., Groschup, M. H., Kretzschmar, H. A., Famulok, M., & Winnacker, E. L. (1997). RNA aptamers specifically interact with the prion protein PrP. Journal of virology, 71(11), 8790–8797. https://doi.org/10.1128/JVI.71.11.8790-8797.1997 | ssRNA | Apt2 | Prion protein rPrP23-231 (rPrPc) fused to glutathione S-transferase (GST), Recombinant Syrian golden hamster | 5'GGAGCUCAGCCUUCACUGCAGCAAUGCGUUGUGUGGGAAUUUGAGGGACGAUGGGGAAGUGGGGACGAAUGACUCAUUGCCGCGGUAGGGUUGGCACCACGGUCGGAUCC3' | 110 | 0.590909 | Not reported | null | 5'-GGAGCTCAGCCTT-CACTGC-N74-GGCACCACGGTCGGATCC-3' | 74 | 8 mM Na2HPO4–0.87 mM KH2PO4–136 mM NaCl–112.6 mM KCl–2 mM dithiothreitol–2 mM MgCl2 | MgCl | PBS/phosphate buffers | null | 33 kDa | Research: " Specificity of the aptamer-PrP interaction was further confirmed by binding assays with antisense aptamer RNA or a mutant aptamer in which the guanosine residues in the G tetrad scaffold were replaced by uridine residues. The aptamers did not recognize PrP27-30 in brain homogenates from scrapie-infected mic... | null | The aptamers did not recognize the fusion partner GST or the fusion protein GST::rPrP90-231 (rPrP27-30), which lacks 67 amino acids from the PrP N terminus; pool was reported by (Famulok et al. 1994) | 10,000,160 | null | Weiss, S, Weiss@lmb.uni-muenchen.de; Famulok, M, Famulok@lmb.unimuenchen.de; Winnacker, E. L., elw@lmb.uni-muenchen.de | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9343239/ | J Virol | https://doi.org/10.1128/JVI.71.11.8790-8797.1997 | Weiss, S., Proske, D., Neumann, M., Groschup, M. H., Kretzschmar, H. A., Famulok, M., & Winnacker, E. L. (1997). RNA aptamers specifically interact with the prion protein PrP. Journal of virology, 71(11), 8790–8797. https://doi.org/10.1128/JVI.71.11.8790-8797.1997 | ssRNA | Apt3 | Prion protein rPrP23-231 (rPrPc) fused to glutathione S-transferase (GST), Recombinant Syrian golden hamster | 5'GGAGCUCAGCCUUCACUGCUACCUUAGAGUAGGAGCGGGACGAGGGGUUGUUGGGACGUGGGUAUGAUCCAUACAUUAGGAAGCUGGUGAGCUGGCACCACGGUCGGAUCC3' | 111 | 0.576577 | Not reported | null | 5'-GGAGCTCAGCCTT-CACTGC-N74-GGCACCACGGTCGGATCC-3' | 74 | 8 mM Na2HPO4–0.87 mM KH2PO4–136 mM NaCl–112.6 mM KCl–2 mM dithiothreitol–2 mM MgCl2 | MgCl | PBS/phosphate buffers | null | 33 kDa | Research: " Specificity of the aptamer-PrP interaction was further confirmed by binding assays with antisense aptamer RNA or a mutant aptamer in which the guanosine residues in the G tetrad scaffold were replaced by uridine residues. The aptamers did not recognize PrP27-30 in brain homogenates from scrapie-infected mic... | null | The aptamers did not recognize the fusion partner GST or the fusion protein GST::rPrP90-231 (rPrP27-30), which lacks 67 amino acids from the PrP N terminus; pool was reported by (Famulok et al. 1994) | 10,000,161 | null | Weiss, S, Weiss@lmb.uni-muenchen.de; Famulok, M, Famulok@lmb.unimuenchen.de; Winnacker, E. L., elw@lmb.uni-muenchen.de | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9384530/ | Chem Biol | https://doi.org/10.1016/s1074-5521(97)90116-2 | Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L. (1997). RNA aptamers to the peptidyl transferase inhibitor chloramphenicol. Chemistry & biology, 4(11), 833–843. https://doi.org/10.1016/s1074-5521(97)90116-2 | ssRNA | 70cam6 | Chloramphenicol (Cam) | 5'GGGAAAAGCGAAUCAUACACAAGAAUGAAAAGGGCUGGCGAGACAUAUCCGCUGGGCAAUCAGAUUCGGAGCCGCACCACCCUCGAAGUAGACAGGGCAUAAGGUAUUUAAUUCCAUA3' | 118 | 0.483051 | Kd: 2.1 ± 0.3 µM | 2,100 | 5'-GGGAAAAGCGAAUCAUACACAAGA-N70-GGGCAUAAGGUAUUUAAUUCCAUA-3' | 70 | 20 mM MgCI2, 400 mM NaCI, 100 mM his-Tris pH 6.4. | MgCl | Tris Buffers | 6.4 | Not reported | Research: " Expand our understanding of molecular recognition by RNA and to facilitate ribosomal modeling. Specifically, the antibiotic chloramphenicol (Cam) naturally binds bacterial ribosomes in the ‘peptidyl transferase loop' of 23s ribosomal RNA to inhibit peptide bond formation." | null | null | 10,000,162 | null | Burke, D. H, dhburke@beagle.colorado.edu; Gold, L, Igold@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9384530/ | Chem Biol | https://doi.org/10.1016/s1074-5521(97)90116-2 | Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L. (1997). RNA aptamers to the peptidyl transferase inhibitor chloramphenicol. Chemistry & biology, 4(11), 833–843. https://doi.org/10.1016/s1074-5521(97)90116-2 | ssRNA | 70cam9 | Chloramphenicol (Cam) | 5'GGGAAAAGCGAAUCAUACACAAGAAGAGCUUGACGGUCCCGAGAGUCGAGCCCAAGCUGACACUGGACCUUUGCGGACCACGUGUUGAUCGUCGGGGCAUAAGGUAUUUAAUUCCAUA3' | 118 | 0.508475 | Kd: 8 ± 4 µM | 8,000 | 5'-GGGAAAAGCGAAUCAUACACAAGA-N70-GGGCAUAAGGUAUUUAAUUCCAUA-3' | 70 | 20 mM MgCI2, 400 mM NaCI, 100 mM his-Tris pH 6.4. | MgCl | Tris Buffers | 6.4 | Not reported | Research: " Expand our understanding of molecular recognition by RNA and to facilitate ribosomal modeling. Specifically, the antibiotic chloramphenicol (Cam) naturally binds bacterial ribosomes in the ‘peptidyl transferase loop' of 23s ribosomal RNA to inhibit peptide bond formation." | null | null | 10,000,163 | null | Burke, D. H, dhburke@beagle.colorado.edu; Gold, L, Igold@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9384530/ | Chem Biol | https://doi.org/10.1016/s1074-5521(97)90116-2 | Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L. (1997). RNA aptamers to the peptidyl transferase inhibitor chloramphenicol. Chemistry & biology, 4(11), 833–843. https://doi.org/10.1016/s1074-5521(97)90116-2 | ssRNA | 70cam53 | Chloramphenicol (Cam) | 5'GGGAAAAGCGAAUCAUACACAAGAGGCACCAAAGCUGAAGUAGCGGGAUAACUCAAAUUACUUUAGGUGUAUGAAGGUGAAACUAGCAAUGAAGGGCAUAAGGUAUUUAAUUCCAUA3' | 117 | 0.393162 | Kd: 7 ± 2 µM | 7,000 | 5'-GGGAAAAGCGAAUCAUACACAAGA-N70-GGGCAUAAGGUAUUUAAUUCCAUA-3' | 70 | 20 mM MgCI2, 400 mM NaCI, 100 mM his-Tris pH 6.4. | MgCl | Tris Buffers | 6.4 | Not reported | Research: " Expand our understanding of molecular recognition by RNA and to facilitate ribosomal modeling. Specifically, the antibiotic chloramphenicol (Cam) naturally binds bacterial ribosomes in the ‘peptidyl transferase loop' of 23s ribosomal RNA to inhibit peptide bond formation." | null | null | 10,000,164 | null | Burke, D. H, dhburke@beagle.colorado.edu; Gold, L, Igold@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9384530/ | Chem Biol | https://doi.org/10.1016/s1074-5521(97)90116-2 | Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L. (1997). RNA aptamers to the peptidyl transferase inhibitor chloramphenicol. Chemistry & biology, 4(11), 833–843. https://doi.org/10.1016/s1074-5521(97)90116-2 | ssRNA | 80Cm50* | Chloramphenicol (Cam) | 5'GGGCAUAAGGUAUUUAAUUCCAUACGGCAGACGAGCCUUGACGAGCCAAUCUACACUUGGCGAUGACCGAUGGGCCCCAGCUACUUCUGGCAGUUUCGAUUCGUUUGAUUCGGAUGCUCGGUAGCUCAACUCG3' | 133 | 0.518797 | Kd: 25 ± 3 µM | 25,000 | 5'-GGGCAUAAGGUAUUUAAUUCCAUA-N80-UUGAUUCGGAUGCUCGGUAGCUCAACUCG-3' | 80 | 20 mM MgCI2, 400 mM NaCI, 100 mM his-Tris pH 6.4. | MgCl | Tris Buffers | 6.4 | Not reported | Research: " Expand our understanding of molecular recognition by RNA and to facilitate ribosomal modeling. Specifically, the antibiotic chloramphenicol (Cam) naturally binds bacterial ribosomes in the ‘peptidyl transferase loop' of 23s ribosomal RNA to inhibit peptide bond formation." | null | null | 10,000,165 | null | Burke, D. H, dhburke@beagle.colorado.edu; Gold, L, Igold@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9111335/ | Mol Cell Biol | https://doi.org/10.1128/mcb.17.5.2649 | Shi, H., Hoffman, B. E., & Lis, J. T. (1997). A specific RNA hairpin loop structure binds the RNA recognition motifs of the Drosophila SR protein B52. Molecular and cellular biology, 17(5), 2649–2657. https://doi.org/10.1128/MCB.17.5.2649 | ssRNA | BBS #8 | B52 protein | 5'GGGAGAAUUCAACUGCCAUCUAGGCUGGUCAACCAGGCGACCGCCACCCGCGCGCGCAAUACCUAGUACUACAAGCUUCUGGACUCGGU3' | 89 | 0.58427 | Kd: 20nM | 20 | DNA Pool Version: 5'-ACCGAGTCCAGAAGCTTGTAGTACT-N40-GCCTAGATGGCAGTTGAATTCTCCCTATAGTGAGTCGTATTAC-3' & RNA Pool Version: 5'-GGGAGAAUUCAACUGCCAUCUAGGC-N40-AGUACUACAAGCUUCUGGACUCGGU-3' | 40 | 50 mM Tris-Cl [pH 7.6], 200 mM potassium acetate, 5 mM MgCl2, 2.5 mM dithiothreitol | MgCl | Tris Buffers | 7.6 | Not reported | Detection: " This has encouraged us to make use of BBS RNA as a genetic tool for dissecting B52 function in vivo, by creating Drosophila fly lines designed to overproduce BBS RNAs (40). We envision that the controlled and modulated expression of these RNA aptamers in living flies will serve as a specific, reversible, f... | null | The Drosophila SR protein B52 was cloned from an embryonic cDNA expression library by using a monoclonal antibody against a Drosophila protein associated with transcriptionally active loci on polytene chromosomes. The 59 constant sequence included a promoter for T7 RNA polymerase | 10,000,167 | null | John T. Lis, jtl10@cornell.edu | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9111335/ | Mol Cell Biol | https://doi.org/10.1128/mcb.17.5.2649 | Shi, H., Hoffman, B. E., & Lis, J. T. (1997). A specific RNA hairpin loop structure binds the RNA recognition motifs of the Drosophila SR protein B52. Molecular and cellular biology, 17(5), 2649–2657. https://doi.org/10.1128/MCB.17.5.2649 | ssRNA | BBS #11 | B52 protein | 5'GGGAGAAUUCAACUGCCAUCUAGGCUGCUCACGAGUCCAUGACCAGUACGAUCAACCAGGCGACAGUACUACAAGCUUCUGGACUCGGU3' | 89 | 0.52809 | Not reported | null | DNA Pool Version: 5'-ACCGAGTCCAGAAGCTTGTAGTACT-N40-GCCTAGATGGCAGTTGAATTCTCCCTATAGTGAGTCGTATTAC-3' & RNA Pool Version: 5'-GGGAGAAUUCAACUGCCAUCUAGGC-N40-AGUACUACAAGCUUCUGGACUCGGU-3' | 40 | 50 mM Tris-Cl [pH 7.6], 200 mM potassium acetate, 5 mM MgCl2, 2.5 mM dithiothreitol | MgCl | Tris Buffers | 7.6 | Not reported | Detection: " This has encouraged us to make use of BBS RNA as a genetic tool for dissecting B52 function in vivo, by creating Drosophila fly lines designed to overproduce BBS RNAs (40). We envision that the controlled and modulated expression of these RNA aptamers in living flies will serve as a specific, reversible, f... | null | *The Drosophila SR protein B52 was cloned from an embryonic cDNA expression library by using a monoclonal antibody against a Drosophila protein associated with transcriptionally active loci on polytene chromosomes. *The 59 constant sequence included a promoter for T7 RNA polymerase *Reproted random region is 39 | 10,000,168 | null | John T. Lis, jtl10@cornell.edu | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9111335/ | Mol Cell Biol | https://doi.org/10.1128/mcb.17.5.2649 | Shi, H., Hoffman, B. E., & Lis, J. T. (1997). A specific RNA hairpin loop structure binds the RNA recognition motifs of the Drosophila SR protein B52. Molecular and cellular biology, 17(5), 2649–2657. https://doi.org/10.1128/MCB.17.5.2649 | ssRNA | BBS #23 | B52 protein | 5'GGGAGAAUUCAACUGCCAUCUAGGCCCAACUGCUAAGAAGCAUCCUGUACGAUCAACCCGGCGACAGUACUACAAGCUUCUGGACUCGGU3' | 90 | 0.522222 | Not reported | null | DNA Pool Version: 5'-ACCGAGTCCAGAAGCTTGTAGTACT-N40-GCCTAGATGGCAGTTGAATTCTCCCTATAGTGAGTCGTATTAC-3' & RNA Pool Version: 5'-GGGAGAAUUCAACUGCCAUCUAGGC-N40-AGUACUACAAGCUUCUGGACUCGGU-3' | 40 | 50 mM Tris-Cl [pH 7.6], 200 mM potassium acetate, 5 mM MgCl2, 2.5 mM dithiothreitol | MgCl | Tris Buffers | 7.6 | Not reported | Detection: " This has encouraged us to make use of BBS RNA as a genetic tool for dissecting B52 function in vivo, by creating Drosophila fly lines designed to overproduce BBS RNAs (40). We envision that the controlled and modulated expression of these RNA aptamers in living flies will serve as a specific, reversible, f... | null | The Drosophila SR protein B52 was cloned from an embryonic cDNA expression library by using a monoclonal antibody against a Drosophila protein associated with transcriptionally active loci on polytene chromosomes. The 59 constant sequence included a promoter for T7 RNA polymerase | 10,000,169 | null | John T. Lis, jtl10@cornell.edu | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | Trnc.A-30 | DNA polymerase (Taq pol), Thermus acquaticus | 5'AAGACCAGACAATGTACAGTATTGGCCTGA3' | 30 | 0.433333 | Kd: 0.6 ± 0.1 nM, IC50: 110 nM | 0.6 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). The efficiency of inhibition of Trunc-A-30 is less than that of the full length sequence (TQ30). T... | The aptamer sequence was truncated | null | 10,000,170 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | Trnc.A-30 | Stoffel fragment | 5'AAGACCAGACAATGTACAGTATTGGCCTGA3' | 30 | 0.433333 | Kd: 7.7 nM | 7.7 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 61 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). The efficiency of inhibition of Trunc-A-30 is less than that of the full length sequence (TQ30). T... | The aptamer sequence was truncated | null | 10,000,170 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | Trnc.2-30 | DNA polymerase (Taq pol), Thermus acquaticus | 5'GCCGGCCAATGTACAGTATTGGCCGGC3' | 27 | 0.62963 | Kd: 3.1 ± 0.3 nM, IC50: 152 nM | 3.1 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). Trnc.2-30 inhibited both Taq pol and the Stoffel fragment; the latter more effectively. However, i... | The aptamer sequence was truncated | null | 10,000,171 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | Trnc.2-30 | Stoffel fragment | 5'GCCGGCCAATGTACAGTATTGGCCGGC3' | 27 | 0.62963 | Kd: 5.9 nM, IC50: 152 nM | 5.9 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 61 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). Trnc.2-30 inhibited both Taq pol and the Stoffel fragment; the latter more effectively. However, i... | The aptamer sequence was truncated | null | 10,000,171 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | Trnc-21 | DNA polymerase (Taq pol), Thermus acquaticus | 5'TGGCGGAGCGATCATCTCAGAGCATTCTTAGCGTTTTGTTCTTGTGTATGA3' | 51 | 0.45098 | Kd: 9 ± 1pM, IC50: 21nM | 0.009 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). TQ21 aptamer inhibited both Taq and Tth polymerases, but did not inhibit the Stoffel fragment." | The aptamer sequence was truncated | null | 10,000,172 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | Trnc-21 | DNA polymerase (Tth pol), Thermus thermophilus (Tth) | 5'TGGCGGAGCGATCATCTCAGAGCATTCTTAGCGTTTTGTTCTTGTGTATGA3' | 51 | 0.45098 | Kd: 40 ± 10 pM, IC50: 35 nM | 0.04 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). TQ21 aptamer inhibited both Taq and Tth polymerases, but did not inhibit the Stoffel fragment." | The aptamer sequence was truncated | null | 10,000,172 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | D.21-D.30 | DNA polymerase (Taq pol), Thermus acquaticus | 5'TGGCGGAGCGATCATCTCAGAGCATTCTTAGCGTTTTGTTCTTGTGTATGATTTGCCGGCCAATGTACAGTATTGGCCGGC3' | 81 | 0.493827 | Kd:10 pM, IC50: 30 nM | 0.01 | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). Aptamer that effectively inhibited all three polymerases and were shown to be useful in detecting ... | null | Truncated aptamers derived from two parent (Trnc.2-30 and Trnc-21) ligands from both families were combined to form a heterodimeric aptamer. | 10,000,174 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9300057/ | J Mol Biol | https://doi.org/10.1006/jmbi.1997.1165 | Lin, Y., & Jayasena, S. D. (1997). Inhibition of multiple thermostable DNA polymerases by a heterodimeric aptamer. Journal of molecular biology, 271(1), 100–111. https://doi.org/10.1006/jmbi.1997.1165 | ssDNA | D.21-D.30 | DNA polymerase (Tth pol), Thermus thermophilus (Tth) | 5'TGGCGGAGCGATCATCTCAGAGCATTCTTAGCGTTTTGTTCTTGTGTATGATTTGCCGGCCAATGTACAGTATTGGCCGGC3' | 81 | 0.493827 | IC50: 36nM | null | 5'-TTCTCGGTTGGTCTCTGGCGGAGC-N30-TCTTGTGTATGATTCGCTTTTCCC-3' | 30 | Not reported | null | Not Reported | null | 94 kDa | Research- " These aptamers have been shown to effciently inhibit the polymerase activity of Taq pol and are useful in enhancing the amplifcation effciency of low copy number targets by the polymerase chain reaction (PCR). Aptamer that effectively inhibited all three polymerases and were shown to be useful in detecting ... | null | Truncated aptamers derived from two parent (Trnc.2-30 and Trnc-21) ligands from both families were combined to form a heterodimeric aptamer. | 10,000,174 | null | Sumedha D. Jayasena | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9222504/ | Bioorg Med Chem | https://doi.org/10.1016/s0968-0896(97)00046-1 | Cho, B., Taylor, D. C., Nicholas, H. B., Jr, & Schmidt, F. J. (1997). Interacting RNA species identified by combinatorial selection. Bioorganic & medicinal chemistry, 5(6), 1107–1113. https://doi.org/10.1016/s0968-0896(97)00046-1 | ssRNA | g18_4.seq | RNA stem-loop target (5'GCACGGTGCTGCTGAGATGCCCGT3') | 5'GGGAGAAUUCCGACCAGAAGCUUCCGAAGCAUUCCGGCGUAGGGGUCUGUGCGCAAAACCAUCGGCCCUGGUGCCUAUGUGCGUCUACAUGGAUCCUCA3' | 99 | 0.575758 | Kd: 70 ± 15 nM | 70 | 5'-GGGAGAAUUCCGACCAGAAGCUU-N50-CCUAUGUGCGUCUACAUGGAUCCUCA-3' | 50 | 10 mM TrisCl, pH 8.3/25 mM MgCl2/l00 mM NaCl/165 mM KCl | MgCl | Tris Buffers | 8.3 | Not reported | Detection: " The winning aptamers described here are analogous to a conventional or monoclonal antibody in their ability to distinguish the presence of a domain in a larger molecule. They could be valuable in studies of the architecture or assembly of larger (e.g., catalytic) RNAs. The methods of combinatorial selectio... | null | null | 10,000,175 | null | Francis J. Schmidt | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov./9222505/ | Bioorg Med Chem | https://doi.org/10.1016/s0968-0896(97)00047-3 | Gilbert, B. A., Sha, M., Wathen, S. T., & Rando, R. R. (1997). RNA aptamers that specifically bind to a K Ras-derived farnesylated peptide. Bioorganic & medicinal chemistry, 5(6), 1115–1122. https://doi.org/10.1016/s0968-0896(97)00047-3 | ssRNA | G26 | Farnesylated peptide modeled after the carboxyl terminus of K ras | 5'GGGAGAAUUCCGACCAGAAGCCUGAGAUGUAUCGUUGCCGGGGAUGGGUGGGUGGUGUGAAGGCGAUCGUCAUCAGUUCGAGCCAUAUGUGCGUCUACAUGGAUCCUCA3' | 109 | 0.550459 | Kd: 0.93 ± 0.05 uM | 930 | 5'-GGGAGAAUUCCGACCAGAAGCCU-N60-CAUAUGUGCGUCUACAUGGAUCCUCA-3' | 60 | 140 mM NaCl, 5 mM KCL, 1 mM CaCl:, and 20 mM Tris acetate at pH 7.4. | CaCl | Tris Buffers | 7.4 | Not reported | Research: " Binding to the nonfarnesylated peptide was at least 10-fold weaker, showing that the aptamers can recognize the hydrophobic farnesyl moiety. High affinity aptamers could be useful in specifically interfering with oncogenic ras function in particular, and G proteins in general." | null | null | 10,000,178 | null | Rando, R. R. | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9356339/ | Virology | https://doi.org/10.1006/viro.1997.8773 | Kumar, P. K., Machida, K., Urvil, P. T., Kakiuchi, N., Vishnuvardhan, D., Shimotohno, K., Taira, K., & Nishikawa, S. (1997). Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA. Virology, 237(2), 270–282. https://doi.org/10.1006/viro.1997.8773 | ssRNA | G6–16 | NS3 Protein of Hepatitis C Virus (HCV) | 5'GGGAGAAUUCCGACCAGAAGGCUUGCUGUUGUUUCCCUGUUGUUUUGUCUCUCAACUUUAUUGUGGUAAAGAUCACUGGGUUGAUAAGGGCUAACUCUAAUUUGACUACAUGGUCGGACCAAUCAGUUCUUAUGGGAGAUGCAUAUGUGCGUCUACAUGGAUCCUCA3' | 167 | 0.437126 | Kd: 120 ± 18 nM | 120 | 5'-GGGAGAATTCCGACCAGAAGCTT-N120-CATATGTGCGTCTACATGGATCCTCA-3' | 120 | 50 mM Tris – HCl (pH 7.7), 30 mM NaCl, 5 mM CaCl2 , 10 mM dithiothreitol (DTT)] | CaCl | Tris Buffers | 7.7 | Not reported | Therapeutic " and Drug Development: We also analyzed aptamers G6 – 16 and G6 – 19 for their action with a longer protein substrate (amino acid region 2203 – 2506) and found that these aptamers efficiently inhibited the proteolytic activity of NS3. In addition, both G6 – 16 and G6 – 19 aptamers were found to inhibit the... | null | The aptamer G6 – 16 inhibited the proteotic activity in a mixed (competitive and noncompetitive). The aptamer was truncated. | 10,000,179 | null | Nishikawa, S, nisikawa@ nibh.go.jp. | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9356339/ | Virology | https://doi.org/10.1006/viro.1997.8773 | Kumar, P. K., Machida, K., Urvil, P. T., Kakiuchi, N., Vishnuvardhan, D., Shimotohno, K., Taira, K., & Nishikawa, S. (1997). Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA. Virology, 237(2), 270–282. https://doi.org/10.1006/viro.1997.8773 | ssRNA | G6–19 | NS3 Protein of Hepatitis C Virus (HCV) | 5'GGGAGAAUUCCGACCAGAAGCUUAUACUGAAUUAAUCGCUACCGUGUCAUUGUACUUGGUAGUGUUGAUGGUUUGGGUCGCAUUUGGCUUGGCUUAUGGUUUUUUCACCCUACCUCUCAUUGACGCACUAGGCUCUCAUAUGUGCGUCUACAUGGAUCCUCA3' | 162 | 0.45679 | Not reported | null | 5'-GGGAGAATTCCGACCAGAAGCTT-N120-CATATGTGCGTCTACATGGATCCTCA-3' | 120 | 50 mM Tris – HCl (pH 7.7), 30 mM NaCl, 5 mM CaCl2 , 10 mM dithiothreitol (DTT)] | CaCl | Tris Buffers | 7.7 | Not reported | Therapeutic and Drug Development: We also analyzed aptamers G6 – 16 and G6 – 19 for their action with a longer protein substrate (amino acid region 2203 – 2506) and found that these aptamers efficiently inhibited the proteolytic activity of NS3. In addition, both G6 – 16 and G6 – 19 aptamers were found to inhibit the h... | null | null | 10,000,180 | null | Nishikawa, S, nisikawa@ nibh.go.jp. | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9192624/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.94.13.6676 | Klug, S. J., Hüttenhofer, A., Kromayer, M., & Famulok, M. (1997). In vitro and in vivo characterization of novel mRNA motifs that bind special elongation factor SelB. Proceedings of the National Academy of Sciences of the United States of America, 94(13), 6676–6681. https://doi.org/10.1073/pnas.94.13.6676 | ssRNA | 945 | Special elongation factor SelB of Escherichia coli | 5′GUCAGGAUGACUGCUGCGCUCGUGUCGUCACUGACCAUCUGUCGCAGGUCUGCGCACAUCGGUCGUUCACGGCCCAUCGGUUGCAGGUCUGCACCAAUCGGUCGGUAAUGGCGCAAUGAGCAUUACGGAUUCAAGC3′ | 136 | 0.580882 | binding ratio: 2.0 | null | 5′-GTCAGGATGACTGCTGCGCTCGTGTC-N3-CACGGCCCATCGGTTGCAGGTCTGCACCAATCGGTCGGTAATGGCGCAATGAGCATTACGGATTCAAGC-3′ | 3 | 50 mM potassium phosphate, pH 7.0/5.0 mM Mg(OAc)2/0.1 mM EDTA/1.0 mM DTT/0.5 mM GTP/0.02% Tween 20/50 μg 5S rRNA | null | PBS/phosphate buffers | 7 | 17 kDa | Research: " Our in vitro selection study provides for the first time, to the best of our knowledge, SelB-binding variants of the SelB-responsive wild-type fdhF mRNA hairpin, which allow for the dissection of SelB binding from the overall biological function of this mRNA secondary structure." | null | The 39 nucleotide hairpin fragment of the fdhF mRNA was mutagenized at a level of 30% per base position and exhibited a complexity of 5 × 1014 sequences. | 10,000,181 | null | Famulok, M, Famulok@lmb.uni-muenchen.de | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9326601/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.94.21.11285 | Williams, K. P., Liu, X. H., Schumacher, T. N., Lin, H. Y., Ausiello, D. A., Kim, P. S., & Bartel, D. P. (1997). Bioactive and nuclease-resistant L-DNA ligand of vasopressin. Proceedings of the National Academy of Sciences of the United States of America, 94(21), 11285–11290. https://doi.org/10.1073/pnas.94.21.11285 | ssDNA | l-aptamer/l-VP | Peptide hormone vasopressin (vertebrate hormone arginine vasopressin (VP), a 9-residue cyclic l peptide) | 5'TCACGTGCATGATAGACGGCGAAGCCGTCGAGTTGCTGTGTGCCGATGCACGTGA3' | 55 | 0.581818 | Kd = 1.17 μM | 1,170 | 5′-TCTAACGTCAATGATAGA-N60-TTAACTTATTCGACCAAA3' | 60 | 20 mM sodium 2-[bis(2-hydroxyethyl)amino]ethane sulfonate, pH 7.3/140 mM NaCl/5 mM KCl/5 mM MgCl2/1 mM CaCl2/0.02% Triton X-100 | MgCl/CaCl | Other Buffers | 7.3 | Not reported | Research and Therapeutic: "The principle has application to a problem in biotechnology, namely, that the peptide or nucleic acid ligands generated by phage display or in vitro selection are susceptible to enzymatic degradation; for example, a DNA oligonucleotide injected i.v. is degraded with a half-life of ≈5 min (4–7... | Not applicable | This paper has identified a mirror-image single-stranded DNA that binds the peptide hormone vasopressin Pre-SELEX modification: one preparation of l-aptamer contained a 5′ tail of two d-thymidine residues; this modification had no detectable effect on binding activity. The starting pool for the second selection had 68 ... | 10,000,182 | null | Bartel, D. P, dbartel@wi.mit.edu. | 5'LdTLdCLdALdCLdGLdTLdGLdCLdALdTLdGLdALdTLdALdGLdALdCLdGLdGLdCLdGLdALdALdGLdCLdCLdGLdTLdCLdGLdALdGLdTLdTLdGLdCLdTLdGLdTLdGLdTLdGLdCLdCLdGLdALdTLdGLdCLdALdCLdGLdTLdGLdA3'
GC% content, length and kd are different; however sequences are the same
https://www.aptagen.com/aptamer-details/?id=455 |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9326601/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.94.21.11285 | Williams, K. P., Liu, X. H., Schumacher, T. N., Lin, H. Y., Ausiello, D. A., Kim, P. S., & Bartel, D. P. (1997). Bioactive and nuclease-resistant L-DNA ligand of vasopressin. Proceedings of the National Academy of Sciences of the United States of America, 94(21), 11285–11290. https://doi.org/10.1073/pnas.94.21.11285 | ssDNA | d-aptamer/d-VP | Peptide hormone vasopressin (vertebrate hormone arginine vasopressin (VP), a 9-residue cyclic l peptide) | 5'TCACGTGCATGATAGACGGCGAAGCCGTCGAGTTGCTGTGTGCCGATGCACGTGA3' | 55 | 0.581818 | Kd = 0.85 μM | 850 | 5′-TCTAACGTCAATGATAGA-N60-TTAACTTATTCGACCAAA3' | 60 | 20 mM sodium 2-[bis(2-hydroxyethyl)amino]ethane sulfonate, pH 7.3/140 mM NaCl/5 mM KCl/5 mM MgCl2/1 mM CaCl2/0.02% Triton X-100 | MgCl/CaCl | Other Buffers | 7.3 | Not reported | Research and Therapeutic: "The principle has application to a problem in biotechnology, namely, that the peptide or nucleic acid ligands generated by phage display or in vitro selection are susceptible to enzymatic degradation; for example, a DNA oligonucleotide injected i.v. is degraded with a half-life of ≈5 min (4–7... | Not applicable | This paper has identified a mirror-image single-stranded DNA that binds the peptide hormone vasopressin Pre-SELEX modification: one preparation of l-aptamer contained a 5′ tail of two d-thymidine residues; this modification had no detectable effect on binding activity. The starting pool for the second selection had 68 ... | 10,000,182 | null | Bartel, D. P, dbartel@wi.mit.edu. | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9200462/ | J Immunol | PMID: 9200462 | Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997). Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of immunology (Baltimore, Md. : 1950), 159(1), 259–267. | 2'-fluoro-RNA | 2'F-1 | Interferon-γ (IFN-γ) | 5'GGGAGGACGAUGCGGACACCGUUAAUCUGAGGCCCUGUCCUAUUCCUUCACGCCUCAGACGACUCGCCCGA3' | 71 | 0.605634 | Kd: biphasic 6.8 nM and 320 nM | 6.8 | 5'-GGGAGGACGAUGCGG-N40-CAGACGACUCGCCCGA-3' | 40 | mPBS (138 mM NaCL, 2.7 mM KCl, 8.1 mM Na2HP4, and 1.1 mM KH2PO4, pH 7.4) Modified to contin a 1mM Mg+2 ion and 0.01% human serum albumin | null | PBS/phosphate buffers | 7.4 | 34 kDa | Therapeutic and Diagnostic: "IFN-γ plays a major role in promoting inflammatory responses by stimulating macrophages, enhancing adhesion of vascular endothelial cells, and facilitating lymphocyte extravasation either alone or in synergy with other cytokines, in particular TNF-a; Oligonucleotide ligands to IFN-γ that bi... | null | all pyrimidines modified to 2'-F-CMP and 2'-F-UMP | 10,000,183 | null | Kubik MF, kubik@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9200462/ | J Immunol | PMID: 9200462 | Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997). Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of immunology (Baltimore, Md. : 1950), 159(1), 259–267. | 2'-fluoro-RNA | 2'F-27 | Interferon-γ (IFN-γ) | 5'GGGAGGACGAUGCGGAACACCCCCGGUCUGACGCUUGUUCCGAAUUCCUCCACCGUCAGACGACUCGCCCGA3' | 72 | 0.638889 | Kd: biphasic 8.8 nM and 384 nM | 8.8 | 5'-GGGAGGACGAUGCGG-N40-CAGACGACUCGCCCGA-3' | 40 | mPBS (138 mM NaCL, 2.7 mM KCl, 8.1 mM Na2HP4, and 1.1 mM KH2PO4, pH 7.4) Modified to contin a 1mM Mg+2 ion and 0.01% human serum albumin | null | PBS/phosphate buffers | 7.4 | 34 kDa | Therapeutic and Diagnostic: "IFN-γ plays a major role in promoting inflammatory responses by stimulating macrophages, enhancing adhesion of vascular endothelial cells, and facilitating lymphocyte extravasation either alone or in synergy with other cytokines, in particular TNF-a; Oligonucleotide ligands to IFN-γ that bi... | null | all pyrimidines modified to 2'-F-CMP and 2'-F-UMP | 10,000,184 | null | Kubik MF, kubik@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9200462/ | J Immunol | PMID: 9200462 | Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997). Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of immunology (Baltimore, Md. : 1950), 159(1), 259–267. | 2'-fluoro-RNA | 2'F-28 | Interferon-γ (IFN-γ) | 5'GGGAGGACGAUGCGGAGGGUUGGGAGGGGUCCUUCUUUUCGUCUGCGUGGACCGUCAGACGACUCGCCCGA3' | 71 | 0.647887 | Kd: 35 nM | 35 | 5'-GGGAGGACGAUGCGG-N40-CAGACGACUCGCCCGA-3' | 40 | mPBS (138 mM NaCL, 2.7 mM KCl, 8.1 mM Na2HP4, and 1.1 mM KH2PO4, pH 7.4) Modified to contin a 1mM Mg+2 ion and 0.01% human serum albumin | null | PBS/phosphate buffers | 7.4 | 34 kDa | Therapeutic and Diagnostic: "IFN-γ plays a major role in promoting inflammatory responses by stimulating macrophages, enhancing adhesion of vascular endothelial cells, and facilitating lymphocyte extravasation either alone or in synergy with other cytokines, in particular TNF-a; Oligonucleotide ligands to IFN-γ that bi... | null | all pyrimidines modified to 2'-F-CMP and 2'-F-UMP | 10,000,185 | null | Kubik MF, kubik@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9200462/ | J Immunol | PMID: 9200462 | Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997). Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of immunology (Baltimore, Md. : 1950), 159(1), 259–267. | 2'-amino-RNA | 2'NH2-17 | Interferon-γ (IFN-γ) | 5'GGGAGGACGAUGCGGUGGUAGCGCGAUAUAGCGCUGGUAGGGUUGCCGGUGAUCAGACGACUCGCCCGA3' | 69 | 0.637681 | Kd: biphasic 1.8 nM and 750 nM | 1.8 | 5'-GGGAGGACGAUGCGG-N40-CAGACGACUCGCCCGA-3' | 40 | mPBS (138 mM NaCL, 2.7 mM KCl, 8.1 mM Na2HP4, and 1.1 mM KH2PO4, pH 7.4) Modified to contin a 1mM Mg+2 ion and 0.01% human serum albumin | null | PBS/phosphate buffers | 7.4 | 34 kDa | Therapeutic and Diagnostic: "IFN-γ plays a major role in promoting inflammatory responses by stimulating macrophages, enhancing adhesion of vascular endothelial cells, and facilitating lymphocyte extravasation either alone or in synergy with other cytokines, in particular TNF-a; Oligonucleotide ligands to IFN-γ that b... | Truncated IFN-y ligands. | all pyrimidines modified to 2'-NH2-CMP and 2'-NH-UMP | 10,000,186 | null | Kubik MF, kubik@nexstar.com | 5'rGprGprGprAprGprGprApnCprGprApnUprGpnCprGprGpnUprGprGpnUprAprGpnCprGpnCprGprApnUprApnUprAprGpnCprGpnCpnUprGprGpnUprAprGprGprGpnUpnUprGpnCpnCprGprGpnUprGprApnUpnCprAprGprApnCprGprApnCpnUpnCprGpnCpnCpnCprGprAp3'
Aptamer kd, and length are different
https://www.aptagen.com/aptamer-details/?id=479 |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9200462/ | J Immunol | PMID: 9200462 | Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997). Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of immunology (Baltimore, Md. : 1950), 159(1), 259–267. | 2'-amino-RNA | 2'NH2-30 | Interferon-γ (IFN-γ) | 5'GGGAGGACGAUGCGGCAGGUAAUUACAUGAAGGUGGGUUAGGUACUUUCAGGGUCAGACGACUCGCCCGA3' | 70 | 0.557143 | Kd: biphasic 2.7 nM and 103 nM | 2.7 | 5'-GGGAGGACGAUGCGG-N40-CAGACGACUCGCCCGA-3' | 40 | mPBS (138 mM NaCL, 2.7 mM KCl, 8.1 mM Na2HP4, and 1.1 mM KH2PO4, pH 7.4) Modified to contin a 1mM Mg+2 ion and 0.01% human serum albumin | null | PBS/phosphate buffers | 7.4 | 34 kDa | Therapeutic " and Diagnostic: IFN-γ plays a major role in promoting inflammatory responses by stimulating macrophages, enhancing adhesion of vascular endothelial cells, and facilitating lymphocyte extravasation either alone or in synergy with other cytokines, in particular TNF-a; Oligonucleotide ligands to IFN-γ that b... | null | all pyrimidines modified to 2'-NH2-CMP and 2'-NH-UMP | 10,000,187 | null | Kubik MF, kubik@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9200462/ | J Immunol | PMID: 9200462 | Kubik, M. F., Bell, C., Fitzwater, T., Watson, S. R., & Tasset, D. M. (1997). Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. Journal of immunology (Baltimore, Md. : 1950), 159(1), 259–267. | 2'-fluoro/amino-RNA | 2'F/NH2-3 | Interferon-γ (IFN-γ) | 5'GGGAGGACGAUGCGGUUCAGAGGGUAGGUAAGUGGGAGGAAAAAUGCCGUAUCGCCUCAGACGACUCGCCCGA3' | 73 | 0.589041 | Kd: 106 nM | 106 | 5'-GGGAGGACGAUGCGG-N40-CAGACGACUCGCCCGA-3' | 40 | mPBS (138 mM NaCL, 2.7 mM KCl, 8.1 mM Na2HP4, and 1.1 mM KH2PO4, pH 7.4) Modified to contin a 1mM Mg+2 ion and 0.01% human serum albumin | null | PBS/phosphate buffers | 7.4 | 34 kDa | Therapeutic and Diagnostic: "IFN-γ plays a major role in promoting inflammatory responses by stimulating macrophages, enhancing adhesion of vascular endothelial cells, and facilitating lymphocyte extravasation either alone or in synergy with other cytokines, in particular TNF-a; Oligonucleotide ligands to IFN-γ that bi... | null | all pyrimidines modified to 2'-F-CMP and 2'-F-NH2-UMP | 10,000,188 | null | Kubik MF, kubik@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 14F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGUGGUCUCCCAAUUCUAAACUUUCUCCAUCGUAUCUGGGCAGACGACUCGCCCGA3' | 69 | 0.565217 | Kd: biphasic 0.001 nM Ki: 3.3 nM | 0.001 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,189 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 6F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGAUCCUUUGUGGGCUCUUGUUGACCCCCUCGUUGUCCCCCCCAGACGACUCGCCCGA3' | 72 | 0.652778 | Kd: biphasic 0.05 nM Ki: 1.3 nM | 0.05 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,190 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 15F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGUCAUGGUGUCUUUCCACAGCUCUUCCCAUGAUCGCCCGGCAGACGACUCGCCCGA3' | 70 | 0.628571 | Kd: biphasic 0.07 nM Ki: 6.7 nM | 0.07 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,191 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 56F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGGACAAWYAGCGGUGUCUUUUCAUUUNKAUCCUCCGACRUCCCAGACGACUCGCCCGA3' | 68 | 0.588235 | Kd: biphasic 0.07 nM Ki: 0.3 nM | 0.07 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions; R=A or G, Y=C or U, K=G or U, M=A or C, V=G or C or A, W=A or U, S=G or C, D=G or T or A, and X=any residue, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a te... | 10,000,192 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 37F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGCCCGAUCUACUGCAUUACCGAAACGAUUUCCCCACUGUCAGACGACUCGCCCGA3' | 70 | 0.6 | Kd: 0.46 nM Ki: 6.7 nM | 0.47 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
| 10,000,193 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 13F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGCACCUUAGACCUGUCCUCCAAGCGUGAGUUGCUGUGGCCCAGACGACUCGCCCGA3' | 70 | 0.642857 | Kd: biphasic 0.03 nM Ki: 10.0 nM | 0.03 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,194 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 50F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGUGAUCAAUCGGCGCUUUACUCUUGCGCUCACCGUGCCCCAGACGACUCGCCCGA3' | 69 | 0.637681 | Kd: biphasic 0.12 nM | 0.12 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,195 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 38F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGNGACUGAUUUUUCCUUGNCAGUGUAAUUUCCUGGCUGCCCCAGACGACUCGCCCGA3' | 69 | 0.57971 | Kd: 0.33 nM Ki: 0.2 nM | 0.33 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions; R=A or G, Y=C or U, K=G or U, M=A or C, V=G or C or A, W=A or U, S=G or C, D=G or T or A, and X=any residue, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a te... | 10,000,196 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 10F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGACCAGAUGGCGGAUUUUUCAGCAAUCCUCCCCCGCUGCCCAGACGACUCGCCCGA3' | 71 | 0.647887 | Kd: 0.47 nM Ki: 10.0 nM | 0.47 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,197 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-fluoro-RNA | 43F | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGUGUAGUUUCCCUGUAUGCCAGACGACUCGCCCGA3' | 49 | 0.612245 | Kd: 1.13 nM Ki: 16.7 nM | 1.13 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' fluro substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,198 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 14N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGUCCAGGGAUUGAAGUGUCGGGGUAGGAACAUAAAGGCGGCCAGACGACUCGCCCGA3' | 71 | 0.619718 | Kd: 0.4 nM Ki: 2.0 nM | 0.4 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,199 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 4N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGUGGUGAAGAGGUACCGGAAUUGCUAAAGAUACCACGGCCCAGACGACUCGCCCGA3' | 71 | 0.605634 | Kd: 0.7 nM Ki: 23.3 nM | 0.7 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,200 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 1N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGAAGGGACGAUAAAGAGGAAUCGAACAACAAGUGGCUGGCCAGACGACUCGCCCGA3' | 71 | 0.591549 | Kd: 0.5 nM Ki: 16.7 nM | 0.5 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,201 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 29N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGAGAAGAAUGCAGGAAACAGCGAAAUGCGUGUGGCCAGACGACUCGCCCGA3' | 65 | 0.6 | Kd: 0.43 nM Ki: 13.3 nM | 0.43 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,202 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 6N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGCAGGGAGCAAUGAACUCAAGUCAAGCCGGUGCACGUGGGCAGACGACUCGCCCGA3' | 71 | 0.647887 | Kd: 0.7 nM Ki: 26.7 nM | 0.7 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,203 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 2N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGCGGGAAGGUCCGAAGACCGGCGAAAGGAACGAGAUUGCCCAGACGACUCGCCCGA3' | 71 | 0.661972 | Kd: 0.8 nM Ki: 66.7 nM | 0.8 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,204 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035109/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-68 | Pagratis, N. C., Bell, C., Chang, Y. F., Jennings, S., Fitzwater, T., Jellinek, D., & Dang, C. (1997). Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nature biotechnology, 15(1), 68–73. https://doi.org/10.1038/nbt0197-68 | 2'-amino-RNA | 24N | Keratinocyte growth factor (hKGF), Human | 5'GGGAGGACGAUGCGGGUGGGAAGAUGAGCCGGUCGGCAGUAAUGUGACACUGCGGCAGACGACUCGCCCGA3' | 71 | 0.647887 | Kd: 1.2 nM | 1.2 | 5'-GGGAGGACGATGCGG-N40-CAGACGACTCGCCCGA-3' | 40 | Ca++ and Mg++ containing Dulbeco's Phosphate Buffered Saline (DPBS, Life Technologies, Gaithersburg, MD) with 0.01% human serum albumin (Sigma, St. Louis, MO) | null | PBS/phosphate buffers | 7.4 | 26-28 kDa | Research: " RNA molecules with fluoro (2'F) or amino (2'NH2) substitution at the 2' position of pyrimidines are nuclease resistant' and can be synthesized by T7 RNA polymerase. Thus, SELEX experiments with libraries carrying such modifications can lead to nuclease-resistant ligands" | null | all pyrimidines have 2' amino substitutions, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,205 | null | Pagratis NC, pagratis@nexstar.com | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9035104/ | Nat Biotechnol | https://doi.org/10.1038/nbt0197-41 | Lee, S. W., & Sullenger, B. A. (1997). Isolation of a nuclease-resistant decoy RNA that can protect human acetylcholine receptors from myasthenic antibodies. Nature biotechnology, 15(1), 41–45. https://doi.org/10.1038/nbt0197-41 | 2'-amino-RNA | SE RNA | Monoclonal antibody 198 (Mab198) | 5'GGGAGAGCGGAAGCGUGCUGGGCCGGAGGUUAGCUUGCCCAUGGCAAGCAGGGCGCCACGGACCCAUAACCCAGAGGUCGAUGGAUCCCCCC3' | 92 | 0.673913 | Kd: 60 nM | 60 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCCCC-3' | 40 | 30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM MgCI2, 2 mM dithiothreitol, and 1% BSA | MgCl | Tris Buffers | 7.5 | Not reported | Therapeutic: " Although these treatments have greatly improved medical management of the disease, the ultimate goal for therapy-the specific inhibition of the autoimmune response to AChR-has not been achieved. Therefore, because the pathogenesis of MG is largely antibody mediated, we attempted to isolate RNA decoys cap... | null | SE-RNA: 2' -amino SE RNA | 10,000,206 | null | Sullenger BA, sulle001@mc.duke.edu | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9062133/ | Biochemistry | https://doi.org/10.1021/bi962669h | Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997). Highly potent irreversible inhibitors of neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library. Biochemistry, 36(10), 3018–3026. https://doi.org/10.1021/bi962669h | ssDNA | DD18 | Neutrophil elastase (NE) | 5'CACGATGGTTAGGCGGGCCTTGAGGCTAATAATGTTGTTA3' | 40 | 0.475 | Not reported | null | 5'-GGGAGGACGATGCGG-N40-CAGACGACGAGCGGA-3' | 40 | HBSS/0.01% hSA/25mM HEPES, pH 7.5, for neutrophil SELEX, the same buffer plus 100 mM NaCl for high-salt SELEX) | null | Other Buffers | 7.5 | Not reported | Therapeutic: "The development of NE inhibitors as therapeutic agents has been pursued by a variety of strategies, including the identification and production of endogenous inhibitors and the synthesis and screening of smaller organic molecules" | Truncation:the three 5‘-terminal nucleotides were removed from all truncates, leaving intact the full 12 bp splint-fixed region double helix. No more nucleotides were removed from the 5‘ end, and progressively shorter inhibitors were synthesized by omission of 3‘ terminal nucleotides. All sequences were initially synth... | Sequence selected from high-salt SELEX | 10,000,207 | null | Smith D | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9062133/ | Biochemistry | https://doi.org/10.1021/bi962669h | Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997). Highly potent irreversible inhibitors of neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library. Biochemistry, 36(10), 3018–3026. https://doi.org/10.1021/bi962669h | ssDNA | ED1 | Neutrophil elastase (NE) | 5'CAGCGTCATTTAGGATTCGTCAGGTTCTACCCGTAGTGTG3' | 40 | 0.5 | Not reported | null | 5'-GGGAGGACGATGCGG-N40-CAGACGACGAGCGGA-3' | 40 | HBSS/0.01% hSA/25mM HEPES, pH 7.5, for neutrophil SELEX, the same buffer plus 100 mM NaCl for high-salt SELEX) | null | Other Buffers | 7.5 | Not reported | Therapeutic: "The development of NE inhibitors as therapeutic agents has been pursued by a variety of strategies, including the identification and production of endogenous inhibitors and the synthesis and screening of smaller organic molecules" | Truncation:the three 5‘-terminal nucleotides were removed from all truncates, leaving intact the full 12 bp splint-fixed region double helix. No more nucleotides were removed from the 5‘ end, and progressively shorter inhibitors were synthesized by omission of 3‘ terminal nucleotides. All sequences were initially synth... | Sequence selected from neutrophil SELEX | 10,000,208 | null | Smith D | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9062133/ | Biochemistry | https://doi.org/10.1021/bi962669h | Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997). Highly potent irreversible inhibitors of neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library. Biochemistry, 36(10), 3018–3026. https://doi.org/10.1021/bi962669h | ssDNA | ED45 | Neutrophil elastase (NE) | 5'CCTGCGTAACAACGCGGAGGAAACTTCCCTCCTATCTCT3' | 39 | 0.538462 | Not reported | null | 5'-GGGAGGACGATGCGG-N40-CAGACGACGAGCGGA-3' | 40 | HBSS/0.01% hSA/25mM HEPES, pH 7.5, for neutrophil SELEX, the same buffer plus 100 mM NaCl for high-salt SELEX) | null | Other Buffers | 7.5 | Not reported | Therapeutic: "The development of NE inhibitors as therapeutic agents has been pursued by a variety of strategies, including the identification and production of endogenous inhibitors and the synthesis and screening of smaller organic molecules" | Truncation:the three 5‘-terminal nucleotides were removed from all truncates, leaving intact the full 12 bp splint-fixed region double helix. No more nucleotides were removed from the 5‘ end, and progressively shorter inhibitors were synthesized by omission of 3‘ terminal nucleotides. All sequences were initially synth... | Sequence selected from neutrophil SELEX | 10,000,209 | null | Smith D | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9062133/ | Biochemistry | https://doi.org/10.1021/bi962669h | Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997). Highly potent irreversible inhibitors of neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library. Biochemistry, 36(10), 3018–3026. https://doi.org/10.1021/bi962669h | ssDNA | DD7 | Neutrophil elastase (NE) | 5'GACTGCGTATCAACGCGGTGAAACCTAACCTCATCTTGAT3' | 40 | 0.475 | Not reported | null | 5'-GGGAGGACGATGCGG-N40-CAGACGACGAGCGGA-3' | 40 | HBSS/0.01% hSA/25mM HEPES, pH 7.5, for neutrophil SELEX, the same buffer plus 100 mM NaCl for high-salt SELEX) | null | Other Buffers | 7.5 | Not reported | Therapeutic: "The development of NE inhibitors as therapeutic agents has been pursued by a variety of strategies, including the identification and production of endogenous inhibitors and the synthesis and screening of smaller organic molecules" | Truncation:the three 5‘-terminal nucleotides were removed from all truncates, leaving intact the full 12 bp splint-fixed region double helix. No more nucleotides were removed from the 5‘ end, and progressively shorter inhibitors were synthesized by omission of 3‘ terminal nucleotides. All sequences were initially synth... | Sequence selected from high-salt SELEX | 10,000,210 | null | Smith D | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9062133/ | Biochemistry | https://doi.org/10.1021/bi962669h | Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997). Highly potent irreversible inhibitors of neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library. Biochemistry, 36(10), 3018–3026. https://doi.org/10.1021/bi962669h | ssDNA | ED38 | Neutrophil elastase (NE) | 5'CACGGTAGTGCTACCAGATGGTTATGTTACTTCAATTCTG3' | 40 | 0.425 | Not reported | null | 5'-GGGAGGACGATGCGG-N40-CAGACGACGAGCGGA-3' | 40 | HBSS/0.01% hSA/25mM HEPES, pH 7.5, for neutrophil SELEX, the same buffer plus 100 mM NaCl for high-salt SELEX) | null | Other Buffers | 7.5 | Not reported | Therapeutic: "The development of NE inhibitors as therapeutic agents has been pursued by a variety of strategies, including the identification and production of endogenous inhibitors and the synthesis and screening of smaller organic molecules" | Truncation:the three 5‘-terminal nucleotides were removed from all truncates, leaving intact the full 12 bp splint-fixed region double helix. No more nucleotides were removed from the 5‘ end, and progressively shorter inhibitors were synthesized by omission of 3‘ terminal nucleotides. All sequences were initially synth... | Sequence selected from neutrophil SELEX | 10,000,211 | null | Smith D | null |
1,997 | https://pubmed.ncbi.nlm.nih.gov/9062133/ | Biochemistry | https://doi.org/10.1021/bi962669h | Charlton, J., Kirschenheuter, G. P., & Smith, D. (1997). Highly potent irreversible inhibitors of neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library. Biochemistry, 36(10), 3018–3026. https://doi.org/10.1021/bi962669h | ssDNA | DD25 | Neutrophil elastase (NE) | 5'CATGACAGAATGTCTGCAGAGCTAATCTTGGTCACTGAT3' | 39 | 0.435897 | Not reported | null | 5'-GGGAGGACGATGCGG-N40-CAGACGACGAGCGGA-3' | 40 | HBSS/0.01% hSA/25mM HEPES, pH 7.5, for neutrophil SELEX, the same buffer plus 100 mM NaCl for high-salt SELEX) | null | Other Buffers | 7.5 | Not reported | Therapeutic: "The development of NE inhibitors as therapeutic agents has been pursued by a variety of strategies, including the identification and production of endogenous inhibitors and the synthesis and screening of smaller organic molecules" | Truncation:the three 5‘-terminal nucleotides were removed from all truncates, leaving intact the full 12 bp splint-fixed region double helix. No more nucleotides were removed from the 5‘ end, and progressively shorter inhibitors were synthesized by omission of 3‘ terminal nucleotides. All sequences were initially synth... | Sequence selected from high-salt SELEX | 10,000,212 | null | Smith D | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9526554/ | J Med Chem | https://doi.org/10.1021/jm970579k | Bridonneau, P., Chang, Y. F., O'Connell, D., Gill, S. C., Snyder, D. W., Johnson, L., Goodson, T., Jr, Herron, D. K., & Parma, D. H. (1998). High-affinity aptamers selectively inhibit human nonpancreatic secretory phospholipase A2 (hnps-PLA2). Journal of medicinal chemistry, 41(6), 778–786. https://doi.org/10.1021/jm97... | 2'-amino-RNA | Aptamer 5 | Nonpancreatic secretory phospholipase A2 (hnps-PLA2), Human | 5‘GGGAAAAGCGAAUCAUACACAAGACGGCCGGCGCCAUAGCCGAGAUCCGAGGUGUUGAACGAUGACAACUCGGUGCUCCGCCAGAGACCAACCGAGAA3‘ | 98 | 0.571429 | Kd: 0.5 ± 0.3, Ki: 0.2 nM | 0.5 | 5′-GGGAAAAGCGAATCATACACAAG-N50-GCTCCGCCAGAGACCAACCGAGAA-3′ | 50 | 25 mM Tris, pH 7.4, 150 mM NaCl, 5 mM CaCl2 | CaCl | Tris Buffers | 7.4 | 13.9 Kda | Research: " Dramatically elevated levels of circulating hnps-PLA2 are associated with numerous disease states, such as acute pancreatitis, adult respiratory distress syndrome (ARDS), bacterial peritonitis, and septic shock; Two factors that have hindered efforts to define the role of hnps-PLA2 are the existence of mult... | The sequences of synthetic ssdnas were derived from aptamer 5 (table 1). | RNA library contains 2'-NH2-pyrimidines and 2'-OH-purines | 10,000,213 | null | Parma DH | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9526554/ | J Med Chem | https://doi.org/10.1021/jm970579k | Bridonneau, P., Chang, Y. F., O'Connell, D., Gill, S. C., Snyder, D. W., Johnson, L., Goodson, T., Jr, Herron, D. K., & Parma, D. H. (1998). High-affinity aptamers selectively inhibit human nonpancreatic secretory phospholipase A2 (hnps-PLA2). Journal of medicinal chemistry, 41(6), 778–786. https://doi.org/10.1021/jm97... | 2'-amino-RNA | Aptamer 15 | Nonpancreatic secretory phospholipase A2 (hnps-PLA2), Human | 5'GGGAAAAGAGACGGCCGGCGCCAUAGCCGAGAUCCGAGGUGUUGCCGAGAA3' | 51 | 0.627451 | Kd: 1.7 ± 0.2 nM, IC50: 4 nM, Ki: 0.14 nM | 1.7 | 5′-GGGAAAAGCGAATCATACACAAG-N50-GCTCCGCCAGAGACCAACCGAGAA-3′ | 50 | 25 mM Tris, pH 7.4, 150 mM NaCl, 5 mM CaCl2 | CaCl | Tris Buffers | 7.4 | 13.9 Kda | Research: " Dramatically elevated levels of circulating hnps-PLA2 are associated with numerous disease states, such as acute pancreatitis, adult respiratory distress syndrome (ARDS), bacterial peritonitis, and septic shock; Two factors that have hindered efforts to define the role of hnps-PLA2 are the existence of mult... | The sequences of synthetic ssdnas were derived from aptamer 5 (table 1). In turn, the sequence of aptamer 15 is determined by the synthetic template. The sequence has been trucated | RNA library contains 2'-NH2-pyrimidines and 2'-OH-purines | 10,000,214 | null | Parma DH | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9512549/ | Nucleic Acids Res | https://doi.org/10.1093/nar/26.7.1755 | Kiga, D., Futamura, Y., Sakamoto, K., & Yokoyama, S. (1998). An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition. Nucleic Acids Research, 26(7), 1755–1760. https://doi.org/10.1093/nar/26.7.1755 | ssRNA | XBA RNA | Xanthine (2,6-dioxypurine) | 5'GGCACGUGUAUUACCCUAGUGGUCGACGUGCC3' | 32 | 0.59375 | Kd: 3.3 µM | 3,300 | 5'-GGTGAGAATTCCGACCAGGATCC-N60-GTCGACGTAGAAGCTTGGGCGG-3' | 60 | 20 mM Tris–HCl, pH 7.5, 0.3 M NaCl and 5 mM MgCl2 | MgCl | Tris Buffers | 7.5 | Not reported | Research: " To further explore this ability of RNA to recognize purine bases and/or the purine base moiety of nucleosides. The special elongation factor SelB of Escherichia coli promotes selenocysteine incorporation into formate dehydrogenases. By in vitro selection, novel RNA sequences ("aptamers"), which can interact... | Turnction: We designed the 32mer RNA (designated as XBA) shown inFigure 3B, which has the common secondary structure, including the consensus sequence, of the 60mer aptamers | A single-stranded DNA (105 nt), consisting of a random sequence of 60 nt and two flanking primer-binding regions (23 and 22 nt) for PCR and reverse transcription, was chemically synthesized with a Cyclone plus DNA/RNA synthesizer (Millipore). The PCR primers, with the sequences of 5′-AGTAATACGACTCACTA_x0002_TAGGTGAGAAT... | 10,000,215 | null | Yokoyama, S, yokoyama@y-sun.biochem.s.u-tokyo.ac.jp | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9512549/ | Nucleic Acids Res | https://doi.org/10.1093/nar/26.7.1755 | Kiga, D., Futamura, Y., Sakamoto, K., & Yokoyama, S. (1998). An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition. Nucleic Acids Research, 26(7), 1755–1760. https://doi.org/10.1093/nar/26.7.1755 | ssRNA | XBA RNA | Guanine | 5'GGCACGUGUAUUACCCUAGUGGUCGACGUGCC3' | 32 | 0.59375 | Kd: 1.3 µM | 1,300 | 5'-GGTGAGAATTCCGACCAGGATCC-N60-GTCGACGTAGAAGCTTGGGCGG-3' | 60 | 20 mM Tris–HCl, pH 7.5, 0.3 M NaCl and 5 mM MgCl2 | MgCl | Tris Buffers | 7.5 | Not reported | Research: " To further explore this ability of RNA to recognize purine bases and/or the purine base moiety of nucleosides. The special elongation factor SelB of Escherichia coli promotes selenocysteine incorporation into formate dehydrogenases. By in vitro selection, novel RNA sequences ("aptamers"), which can interact... | null | A single-stranded DNA (105 nt), consisting of a random sequence of 60 nt and two flanking primer-binding regions (23 and 22 nt) for PCR and reverse transcription, was chemically synthesized with a Cyclone plus DNA/RNA synthesizer (Millipore). The PCR primers, with the sequences of 5′-AGTAATACGACTCACTA_x0002_TAGGTGAGAAT... | 10,000,215 | null | Yokoyama, S, yokoyama@y-sun.biochem.s.u-tokyo.ac.jp | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9546673/ | Eur J Biochem | https://doi.org/10.1046/j.1432-1327.1998.2520553.x | Gal, S. W., Amontov, S., Urvil, P. T., Vishnuvardhan, D., Nishikawa, F., Kumar, P. K., & Nishikawa, S. (1998). Selection of a RNA aptamer that binds to human activated protein C and inhibits its protease function. European journal of biochemistry, 252(3), 553–562. https://doi.org/10.1046/j.1432-1327.1998.2520553.x | ssRNA | APC-167 | Activated protein C (APC), Human | 5'GGGAGAAUUCCGACCAGAAGCUUGUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCUUUGGGUUUUGUGAUUUGGUCAUAUGUGCGUCUACAUGGAUCCUCA3' | 167 | 0.556886 | Ki: 83 ± 17 nM | null | 5'-AGGGAGAATTCCGACCA-N120-CATATGTGCGTCTACATGGATCCTCA-3' | 120 | 10 mM sodium citrate, 150 mM KCl pH 7.6 | null | Other Buffers | 7.6 | 62 kDa | Detection and Theraputic: "The thrombin aptamer isolated by an in vitro selection procedure showed a quite interesting structure and a significant physiological function. Human thrombin is the central enzyme of the blood coagulation cascade, while activated protein is also a key enzyme of anticoagulation cascade." | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,216 | null | Nishikawa, S., nisikawa@nibh.go.jp | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.