Year of Paper int64 1.99k 2.02k | Link to PubMed Entry stringlengths 40 154 | Journals stringclasses 173
values | Journal DOI stringlengths 13 82 | Citation stringlengths 132 505 | Type of Nucleic Acid stringclasses 13
values | Name of Aptamer stringlengths 1 102 | Target stringlengths 4 128 | Aptamer Sequence stringlengths 19 316 | Sequence Length int64 15 312 | GC Content float64 0.3 0.83 | Affinity stringlengths 3 186 | Kd (nM) float64 0 208M ⌀ | Pool Type stringlengths 3 360 | Pool Random Region float64 0 120 ⌀ | Binding Buffer/Conditions stringlengths 3 291 | Divalent Salt stringclasses 4
values | Type of the buffer stringclasses 4
values | pH float64 3.6 9.6 ⌀ | Molecular weight of target stringclasses 84
values | Application as quoted in the referenced paper stringlengths 3 1.13k | Post-selex modifications to the aptamer stringclasses 134
values | Additional Information
stringlengths 3 1.22k ⌀ | Serial Number int64 10M 10M | Parent sequence serial number float64 10M 10M ⌀ | Corresponding Author Name, email address stringlengths 3 118 ⌀ | Aptagen Cross Referencing(Check Aptamer Chemistry, Affinity, Length, GC content, sequence) stringclasses 75
values |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1,998 | https://pubmed.ncbi.nlm.nih.gov/9546673/ | Eur J Biochem | https://doi.org/10.1046/j.1432-1327.1998.2520553.x | Gal, S. W., Amontov, S., Urvil, P. T., Vishnuvardhan, D., Nishikawa, F., Kumar, P. K., & Nishikawa, S. (1998). Selection of a RNA aptamer that binds to human activated protein C and inhibits its protease function. European journal of biochemistry, 252(3), 553–562. https://doi.org/10.1046/j.1432-1327.1998.2520553.x | ssRNA | APC-99 | Activated protein C (APC), Human | 5'GUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCU3' | 99 | 0.626263 | Ki: 137 ± 14 nM | null | 5'-AGGGAGAATTCCGACCA-N120-CATATGTGCGTCTACATGGATCCTCA-3' | 120 | 10 mM sodium citrate, 150 mM KCl pH 7.6 | null | Other Buffers | 7.6 | 62 kDa | Detection and Theraputic: "The thrombin aptamer isolated by an in vitro selection procedure showed a quite interesting structure and a significant physiological function. Human thrombin is the central enzyme of the blood coagulation cascade, while activated protein is also a key enzyme of anticoagulation cascade." | null | truncated version of aptamer APC-167, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,217 | null | Nishikawa, S., nisikawa@nibh.go.jp | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9831529/ | Chem Biol | https://doi.org/10.1016/s1074-5521(98)90289-7 | Wilson, C., & Szostak, J. W. (1998). Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & biology, 5(11), 609–617. https://doi.org/10.1016/s1074-5521(98)90289-7 | ssDNA | clone 73 | Fluorophore sulforhodamine B | 5'CGGGATCCTAATGACCAAGGGTGGGAGGGAGGGGGTCATTAAATCCAGTATCAACACGCCACGATGGGATCACCGCCATGGGCCGTCCCACTGGTGCCAGTCGGATAGTGTTCCTATAGTGAGTCGTATTAGAA3' | 134 | 0.544776 | Not Reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCCCG-3' | 72 | 0.1 M KCI, 5 mM MgCI,, 10 mM Na-HEPES, pH 7.4 | null | Other Buffers | 7.4 | Not reported | Detection: " The incorporation of three-tiered G-quartet stacked on a duplex into other DNAs (e.g. PCR primers) could facilitate their in vitro labeling and detection. Mutagenesis followed by both negative and positive selection might yield specialized aptamers optimized for highly specific recognition of individual fl... | null | null | 10,000,218 | null | Szostak, J. W, wilson@biology.ucsc.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9831529/ | Chem Biol | https://doi.org/10.1016/s1074-5521(98)90289-7 | Wilson, C., & Szostak, J. W. (1998). Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & biology, 5(11), 609–617. https://doi.org/10.1016/s1074-5521(98)90289-7 | ssDNA | minimized clone 73 | Fluorophore sulforhodamine B | 5'CCGGCCAAGGGTGGGAGGGAGGGGGGCCGG3' | 30 | 0.833333 | Not Reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCCCG-3' | 72 | 0.1 M KCI, 5 mM MgCI,, 10 mM Na-HEPES, pH 7.4 | null | Other Buffers | 7.4 | Not reported | Detection: " The incorporation of three-tiered G-quartet stacked on a duplex into other DNAs (e.g. PCR primers) could facilitate their in vitro labeling and detection. Mutagenesis followed by both negative and positive selection might yield specialized aptamers optimized for highly specific recognition of individual fl... | Truncation (Sulforhodamine agarose binding by a minimal aptamer based on clone 73 with modified helix sequence was assayed under various salt conditions.) | null | 10,000,219 | null | Szostak, J. W, wilson@biology.ucsc.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9831529/ | Chem Biol | https://doi.org/10.1016/s1074-5521(98)90289-7 | Wilson, C., & Szostak, J. W. (1998). Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & biology, 5(11), 609–617. https://doi.org/10.1016/s1074-5521(98)90289-7 | ssDNA | clone 6 | Fluorophore sulforhodamine B | 5'CGGGATCCTAATGACCAAGGCCAAGGGAGGCTCCTTGTTATTCAGCAGGTACTACTATCTGGGAAAGAATCCCGAGTGTGTAGATGTTCCTGGGTGCCAGTCGGATAGTGTTCCTATAGTGAGTCGTATTAGAA3' | 134 | 0.485075 | Not Reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCCCG-3' | 72 | 0.1 M KCI, 5 mM MgCI,, 10 mM Na-HEPES, pH 7.4 | null | Other Buffers | 7.4 | Not reported | Detection: " The incorporation of three-tiered G-quartet stacked on a duplex into other DNAs (e.g. PCR primers) could facilitate their in vitro labeling and detection. Mutagenesis followed by both negative and positive selection might yield specialized aptamers optimized for highly specific recognition of individual fl... | null | null | 10,000,220 | null | Szostak, J. W, wilson@biology.ucsc.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9831529/ | Chem Biol | https://doi.org/10.1016/s1074-5521(98)90289-7 | Wilson, C., & Szostak, J. W. (1998). Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & biology, 5(11), 609–617. https://doi.org/10.1016/s1074-5521(98)90289-7 | ssDNA | clone 26 | Fluorophore sulforhodamine B | 5'CGGGATCCTAATGACCAAGGGGCGGGGGTGGTGGGAGTCGAGGTCATGGGTTCCCTGCGGTTGCGGCTCAGGCAAGACAAATCGATTAGAGCGGTGCCAGTCGGATAGTGTTCCTATAGTGAGTCGTATTAGAA3' | 134 | 0.559701 | Not Reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCCCG-3' | 72 | 0.1 M KCI, 5 mM MgCI,, 10 mM Na-HEPES, pH 7.4 | null | Other Buffers | 7.4 | Not reported | Detection: " The incorporation of three-tiered G-quartet stacked on a duplex into other DNAs (e.g. PCR primers) could facilitate their in vitro labeling and detection. Mutagenesis followed by both negative and positive selection might yield specialized aptamers optimized for highly specific recognition of individual fl... | null | null | 10,000,221 | null | Szostak, J. W, wilson@biology.ucsc.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9831529/ | Chem Biol | https://doi.org/10.1016/s1074-5521(98)90289-7 | Wilson, C., & Szostak, J. W. (1998). Isolation of a fluorophore-specific DNA aptamer with weak redox activity. Chemistry & biology, 5(11), 609–617. https://doi.org/10.1016/s1074-5521(98)90289-7 | ssDNA | clone 39 | Fluorophore sulforhodamine B | 5'CGGGATCCTAATGACCAAGGGTGGGGGGGAGTGGAGGTTATTAGGTTCAGTAGTGCCAACTGCAGTCTAAGCGCGTCGCGAGTACACCTTCTGGTGCCAGTCGGATAGTGTTCCTATAGTGAGTCGTATTAGAA3' | 134 | 0.522388 | Not Reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCCCG-3' | 72 | 0.1 M KCI, 5 mM MgCI,, 10 mM Na-HEPES, pH 7.4 | null | Other Buffers | 7.4 | Not reported | Detection: " The incorporation of three-tiered G-quartet stacked on a duplex into other DNAs (e.g. PCR primers) could facilitate their in vitro labeling and detection. Mutagenesis followed by both negative and positive selection might yield specialized aptamers optimized for highly specific recognition of individual fl... | null | null | 10,000,222 | null | Szostak, J. W, wilson@biology.ucsc.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9889155/ | Fold Des | https://doi.org/10.1016/S1359-0278(98)00059-5 | Holeman, L. A., Robinson, S. L., Szostak, J. W., & Wilson, C. (1998). Isolation and characterization of fluorophore-binding RNA aptamers. Folding & design, 3(6), 423–431. https://doi.org/10.1016/S1359-0278(98)00059-5 | ssRNA | FB-1 | Fluorescein | 5'GGACGGCACCACGGUCGGAUCCGUGAGUUGUGACAAUUUAGCGGGUGGUAUUAGAGCCUACUGCCACAGCAAUAGGAUCGAUACAGAUCU3' | 90 | 0.522222 | Not reported | null | 5'-AACACTATCCGACTGGCACC-N72-CCTTGGTCATTAGGATCCCG-3' | 72 | 100 mM KCl, 5 mM MgCl2, 10 mM Na-HEPES, pH 7.4 | MgCl | Other Buffers | 7.4 | Not reported | Detection and Diagnostic: "In addition to serving as a model system for understanding the basis of RNA folding and function, these experiments demonstrate potential applications for the aptamers in transcript double labeling or fluorescence resonance energy transfer studies. Fluorophore-specific aptamers would also ser... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,224 | null | Szostak, J. W, wilson@biology.ucsc.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9843415/ | Biochemistry | https://doi.org/10.1021/bi981780f | King, D. J., Ventura, D. A., Brasier, A. R., & Gorenstein, D. G. (1998). Novel combinatorial selection of phosphorothioate oligonucleotide aptamers. Biochemistry, 37(47), 16489–16493. https://doi.org/10.1021/bi981780f | ssDNA | clone 7 | Nuclear factor for human IL6 (NF-IL6) | 5‘CAGTGCTCTAGAGGATCCGTGACGGCCGACCGCACAGCACAACCCCGAAGCTTATCGATCCGAGCG3‘ | 66 | 0.621212 | Kobs < 2nM | null | 5‘-CAGTGCTCTAGAGGATCCGTGAC-N22-CGAAGCTTATCGATCCGAGCG-3‘ | 22 | 10 mM Tris, pH 7.5, 1 mM DTT, and 50−400 mM KCl | null | Tris Buffers | 7.5 | 18.926 Kda | Research: " These results demonstrate that oligonucleotide combinatorial methods can now be extended to selection not only of base sequence but also of phosphate (or monothiophosphate) backbones as well. Random combinatorial libraries and selection for aptamers with a much greater diversity of structures (7^N vs 4^N) a... | null | null | 10,000,225 | null | Gorenstein, D. G, david@nmr.utmb.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9843415/ | Biochemistry | https://doi.org/10.1021/bi981780f | King, D. J., Ventura, D. A., Brasier, A. R., & Gorenstein, D. G. (1998). Novel combinatorial selection of phosphorothioate oligonucleotide aptamers. Biochemistry, 37(47), 16489–16493. https://doi.org/10.1021/bi981780f | ssDNA | clone 8 | Nuclear factor for human IL6 (NF-IL6) | 5‘CAGTGCTCTAGAGGATCCGTGACGGGCCCGCTGTACATGCACACGCGAAGCTTATCGATCCGAGCG3‘ | 66 | 0.606061 | Kobs < 2nM | null | 5‘-CAGTGCTCTAGAGGATCCGTGAC-N22-CGAAGCTTATCGATCCGAGCG-3‘ | 22 | 10 mM Tris, pH 7.5, 1 mM DTT, and 50−400 mM KCl | null | Tris Buffers | 7.5 | 18.926 Kda | Research: " These results demonstrate that oligonucleotide combinatorial methods can now be extended to selection not only of base sequence but also of phosphate (or monothiophosphate) backbones as well. Random combinatorial libraries and selection for aptamers with a much greater diversity of structures (7^N vs 4^N) a... | null | null | 10,000,226 | null | Gorenstein, D. G, david@nmr.utmb.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9843415/ | Biochemistry | https://doi.org/10.1021/bi981780f | King, D. J., Ventura, D. A., Brasier, A. R., & Gorenstein, D. G. (1998). Novel combinatorial selection of phosphorothioate oligonucleotide aptamers. Biochemistry, 37(47), 16489–16493. https://doi.org/10.1021/bi981780f | ssDNA | clone 13 | Nuclear factor for human IL6 (NF-IL6) | 5‘CAGTGCTCTAGAGGATCCGTGACCCCGTTGTTGTCCCACTCCACGCGAAGCTTATCGATCCGAGCG3‘ | 66 | 0.590909 | Kobs < 2nM | null | 5‘-CAGTGCTCTAGAGGATCCGTGAC-N22-CGAAGCTTATCGATCCGAGCG-3‘ | 22 | 10 mM Tris, pH 7.5, 1 mM DTT, and 50−400 mM KCl | null | Tris Buffers | 7.5 | 18.926 Kda | Research: " These results demonstrate that oligonucleotide combinatorial methods can now be extended to selection not only of base sequence but also of phosphate (or monothiophosphate) backbones as well. Random combinatorial libraries and selection for aptamers with a much greater diversity of structures (7^N vs 4^N) a... | null | null | 10,000,227 | null | Gorenstein, D. G, david@nmr.utmb.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9576904/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.95.10.5462 | Yang, Q., Goldstein, I. J., Mei, H. Y., & Engelke, D. R. (1998). DNA ligands that bind tightly and selectively to cellobiose. Proceedings of the National Academy of Sciences of the United States of America, 95(10), 5462–5467. https://doi.org/10.1073/pnas.95.10.5462 | ssDNA | Cel#16 | Cellobiose | 5′GCGGGGTTGGGCGGGTGGGTTCGCTGGGCAGGGGGCGAGTG 3' | 41 | 0.780488 | Kd: 6 × 10−7 M | 600 | 5′-ATAGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | 40 | 20 mM Tris, pH 7.5/100 mM NaCl/5 mM MgCl2 | MgCl | Tris Buffers | 7.5 | Not reported | Detection: " The results of this study suggest it should be possible to develop specific aptamers against a wide array of carbohydrate antigens. This work demonstrates that relatively simple carbohydrate antigens are potential targets for highly selective DNA ligands, suggesting that it should be possible to select DNA... | Trunction: Only the internal variable region of three aptamers in were used: the 41 mer of Cel#16, the 40 mer of Cel#183, and the 36 mer of Cel#202 | null | 10,000,228 | null | Engelke, D. , engelke@umich.edu | 5'dGpdCpdGpdGpdGpdGpdTpdTpdGpdGpdGpdCpdGpdGpdGpdTpdGpdGpdGpdTpdTpdCpdGpdCpdTpdGpdGpdGpdCpdApdGpdGpdGpdGpdGpdCpdGpdApdGpdTpdGp3'
https://www.aptagen.com/aptamer-details/?id=82 |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9576904/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.95.10.5462 | Yang, Q., Goldstein, I. J., Mei, H. Y., & Engelke, D. R. (1998). DNA ligands that bind tightly and selectively to cellobiose. Proceedings of the National Academy of Sciences of the United States of America, 95(10), 5462–5467. https://doi.org/10.1073/pnas.95.10.5462 | ssDNA | Cel#183 | Cellobiose | 5′TAGCGGGTGTGGTGGGTGGGGGAGGCATGGTTTTTGGTAA3' | 40 | 0.575 | Kd: 10−7 to 10−5 M | 1,000 | 5′-ATAGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | 40 | 20 mM Tris, pH 7.5/100 mM NaCl/5 mM MgCl2 | MgCl | Tris Buffers | 7.5 | Not reported | Detection: " The results of this study suggest it should be possible to develop specific aptamers against a wide array of carbohydrate antigens. This work demonstrates that relatively simple carbohydrate antigens are potential targets for highly selective DNA ligands, suggesting that it should be possible to select DNA... | Trunction: Only the internal variable region of three aptamers in were used: the 41 mer of Cel#16, the 40 mer of Cel#183, and the 36 mer of Cel#203 | null | 10,000,229 | null | Engelke, D. , engelke@umich.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9603938/ | J Biol Chem | https://doi.org/10.1074/jbc.273.23.14309 | Bell, S. D., Denu, J. M., Dixon, J. E., & Ellington, A. D. (1998). RNA molecules that bind to and inhibit the active site of a tyrosine phosphatase. The Journal of biological chemistry, 273(23), 14309–14314. https://doi.org/10.1074/jbc.273.23.14309 | ssRNA | N30yc5 | Protein tyrosine phosphatases (PTPase) ( Yop51*Δ162 ), Yersinia | 5'GGGAAUGGAUCCACAUCUACGUAUUACUGCUGGUGACGAGGGCUAGACGACGUACCUUCACUGCAGACUUGACGAAGCUU3' | 80 | 0.5125 | Kd: 28 ± 12 nM | 28 | 5'-GGGAATGGATCCACATCTACGTATTA-N30-TTCACTGCAGACTTGACGAAGCTT-3' | 30 | 20 mm Tris (pH 7.6), 150 mm NaCl, 5 mm MgCl2, 1 mm dithiothreitol; 100 μl final volume | MgCl | Tris Buffers | 7.6 | Not reported | Drug Development: "The aptamers selected to bind Yop51 or other PTPase targets should prove useful for studying protein-protein interactions, dissecting the complex web of cellular signal transduction pathways, and developing novel pharmaceuticals." | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,231 | null | Ellington, A. D, andy.ellington@mail.utexas.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9603938/ | J Biol Chem | https://doi.org/10.1074/jbc.273.23.14309 | Bell, S. D., Denu, J. M., Dixon, J. E., & Ellington, A. D. (1998). RNA molecules that bind to and inhibit the active site of a tyrosine phosphatase. The Journal of biological chemistry, 273(23), 14309–14314. https://doi.org/10.1074/jbc.273.23.14309 | ssRNA | N71yc16 | Protein tyrosine phosphatases (PTPase) ( Yop51*Δ162 ), Yersinia | 5'GGGAGAUACCAGCUUAUUCAAUUCUGGCAAUGGGCUAUCCCAAGUGCUAGGCUUCAGGGAGCGAGGACCAGACGACGUACCUAACCCUAAGGUGAGAUAGUAAGUGCAAUCU3' | 112 | 0.5 | Kd: 18 ± 2.9 nM | 18 | 5'-GGGAGATACCAGCTTATTCAATT-N71-AGATAGTAAGTGCAATCT-3' | 71 | 20 mm Tris (pH 7.6), 150 mm NaCl, 5 mm MgCl2, 1 mm dithiothreitol; 100 μl final volume | MgCl | Tris Buffers | 7.6 | Not reported | Drug Development: "The aptamers selected to bind Yop51 or other PTPase targets should prove useful for studying protein-protein interactions, dissecting the complex web of cellular signal transduction pathways, and developing novel pharmaceuticals." | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,232 | null | Ellington, A. D, andy.ellington@mail.utexas.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9883908/ | FEBS Lett | https://doi.org/10.1016/s0014-5793(98)01572-5 | Kimoto, M., Sakamoto, K., Shirouzu, M., Hirao, I., & Yokoyama, S. (1998). RNA aptamers that specifically bind to the Ras-binding domain of Raf-1. FEBS letters, 441(2), 322–326. https://doi.org/10.1016/s0014-5793(98)01572-5 | ssRNA | 21.01 | Glutathione S-transferase-fused RBD (GST-RBD) Ras-binding domain (Raf-1 RBD) | 5'GGGAGAUCAGAAUAAACGCUCAACUGAUCAAUGGCGUACAAUGGAUUCGUUCUCAUAACCAAAACCCUUACCCCUUGGACUGAUUCGACAUGAGGCCCCUGCAGGGCG3' | 108 | 0.5 | Kd: 332 ± 93 nM | 332 | 5'-GGGAGAUCAGAAUAAACGCUCAA-N60-UUCGACAUGAGGCCCCUGCAGGGCG-3' | 60 | Phosphate-buffered saline containing 5 mM MgCl2, buffer A | MgCl | PBS/phosphate buffers | 7.4 | 74 kDa | Drug Delivery: "The aptamers to the Raf-1 RBD may be used to specifically inhibit the Ras-Raf interaction in the complicated signaling network in cells, without affecting other downstream effectors of Ras. The anti-Raf-1 aptamers would be delivered through the cell membrane, or transiently expressed in the cell, as rep... | null | null | 10,000,233 | null | Yokoyama, S, yokoyama@y-sun.biochem.s.u-tokyo.ac.jp | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9883908/ | FEBS Lett | https://doi.org/10.1016/s0014-5793(98)01572-5 | Kimoto, M., Sakamoto, K., Shirouzu, M., Hirao, I., & Yokoyama, S. (1998). RNA aptamers that specifically bind to the Ras-binding domain of Raf-1. FEBS letters, 441(2), 322–326. https://doi.org/10.1016/s0014-5793(98)01572-5 | ssRNA | 21.07 | Glutathione S-transferase-fused RBD (GST-RBD) Ras-binding domain (Raf-1 RBD) | 5'GGGAGAUCAGAAUAAACGCUCAAUUGACUCAAUGGCGUACAAUGGAUUCGUUCUCAUAACCAAAACCCUUACCCCUUGGACUGUUCGACAUGAGGCCCCUGCAGGGCG3' | 108 | 0.5 | Kd: 332 ± 93 nM | 332 | 5'-GGGAGAUCAGAAUAAACGCUCAA-N60-UUCGACAUGAGGCCCCUGCAGGGCG-3' | 60 | Phosphate-buffered saline containing 5 mM MgCl2, buffer A | MgCl | PBS/phosphate buffers | 7.4 | 74 kDa | Drug Delivery: "The aptamers to the Raf-1 RBD may be used to specifically inhibit the Ras-Raf interaction in the complicated signaling network in cells, without affecting other downstream effectors of Ras. The anti-Raf-1 aptamers would be delivered through the cell membrane, or transiently expressed in the cell, as rep... | null | null | 10,000,234 | null | Yokoyama, S, yokoyama@y-sun.biochem.s.u-tokyo.ac.jp | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9425088/ | Biochemistry | https://doi.org/10.1021/bi971095t | Hamasaki, K., Killian, J., Cho, J., & Rando, R. R. (1998). Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry, 37(2), 656–663. https://doi.org/10.1021/bi971095t | ssRNA | J6f1 | Tobramycin | 5'GGCUUAGUAUAGCGAGGUUUAGCUACACUCGUGCUGAGCC3' | 40 | 0.525 | Kd: 5.15 ± 1.52 nM | 5.15 | 5'-GGGAGAAUUCCGACCAGAAGCUU-N60-CAUAUGUGCGUCUACAUGGAUCCUCA-3' | 60 | Not reported | null | Not Reported | null | Not reported | Therapeutic and Research: "An understanding of the rules underlying RNA-aminoglycoside recognition would be extremely useful as a basis for the design of potent and selective antagonists of RNA function." | Truncated version of previously selected j6 aptamer against tobramycin | pool is from (Wang & Rando, 1995) | 10,000,235 | null | Rando, R. R | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9873529/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(98)00414-4 | Jhaveri, S., Olwin, B., & Ellington, A. D. (1998). In vitro selection of phosphorothiolated aptamers. Bioorganic & medicinal chemistry letters, 8(17), 2285–2290. https://doi.org/10.1016/s0960-894x(98)00414-4 | ssRNA | ps11-20 | Recombinant basic fibroblast growth factor (bFGF), Human | 5'GGGAAUGGAUCCACAUCUACGAAUUCAAUCCCAAUGGCUUGAACUGCCAACGAACGUUCACUGCAGACUUGACGAAGCUU3' | 80 | 0.475 | Kd: 1.8 ± 0.8 nM | 1.8 | 5'-GGGAATGGATCCACATCTACGAATTC-N30-TTCACTGCAGACTTGACGAAGCTT3' | 30 | PBS, phosphate buffered saline (101 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaC1, 2.7 mM KC1) pH 7.4, | null | PBS/phosphate buffers | 7.4 | Not reported | Research: " The aptamer may be able to identify related heparin binding sites and discriminate against nonrelated heparin binding sites; the basis for this discrimination may be the aptamer's mimicry of one of several different natural sulfated oligosaccharides of which heparin is a generic example." | null | *inconsistencies in reporting RNA aptamer as DNA, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection.
In particular, RNA pools that contained 2" modified p... | 10,000,236 | null | Ellington, A. D, andy.ellington@mail.utexas.edu | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9436913/ | RNA | PMCID: PMC1369601, PMID: 9436913 | Wallace, S. T., & Schroeder, R. (1998). In vitro selection and characterization of streptomycin-binding RNAs: recognition discrimination between antibiotics. RNA (New York, N.Y.), 4(1), 112–123. | ssRNA | C #128 (46 mer) | Streptomycin | 5'GGAUCGCAUUUGGACUUCUGCCCAGGGUGGCACCACGGUCGGAUCC3' | 46 | 0.630435 | Not reported | null | 5'-GGAGCUCAGCCUUCACUGC-N74-GGCACCACGGUCGGAUCCAC3' | 74 | 5 mM MgCl2, 50 mM Tris-HCl, pH 7.6, 250 mM NaCl | MgCl | Tris Buffers | 7.6 | Not reported | Drug Development: "A growing body of evidence points to RNA as a crucial target for antibacterial and antiviral drugs. For example, the aminocyclitol antibiotic streptomycin interacts with the 16S ribosomal RNA and, in addition, inhibits group I intron splicing. To understand the mode of binding of streptomycin to RNA,... | Pb21-induced cleavage of c #128 | null | 10,000,238 | null | Schroeder, R, renee@gem.univie.ac.at | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9436913/ | RNA | PMCID: PMC1369601, PMID: 9436913 | Wallace, S. T., & Schroeder, R. (1998). In vitro selection and characterization of streptomycin-binding RNAs: recognition discrimination between antibiotics. RNA (New York, N.Y.), 4(1), 112–123. | ssRNA | B # 84 | Streptomycin | 5'GGAGCUCAGCCUUCACUGCCAGACAGUAGAGGGAAGUGUGAGCUAUCACCUCAAGGAAAACGCUUCAGAAAGGGACUUAGGUGAUGAUAGUGUGGCACCACGGUCGGAUCCAC3' | 113 | 0.530973 | Not reported | null | 5'-GGAGCUCAGCCUUCACUGC-N74-GGCACCACGGUCGGAUCCAC3' | 74 | 5 mM MgCl2, 50 mM Tris-HCl, pH 7.6, 250 mM NaCl | MgCl | Tris Buffers | 7.6 | Not reported | Drug Development: "A growing body of evidence points to RNA as a crucial target for antibacterial and antiviral drugs. For example, the aminocyclitol antibiotic streptomycin interacts with the 16S ribosomal RNA and, in addition, inhibits group I intron splicing. To understand the mode of binding of streptomycin to RNA,... | null | null | 10,000,239 | null | Schroeder, R, renee@gem.univie.ac.at | null |
1,998 | https://pubmed.ncbi.nlm.nih.gov/9436913/ | RNA | PMCID: PMC1369601, PMID: 9436913 | Wallace, S. T., & Schroeder, R. (1998). In vitro selection and characterization of streptomycin-binding RNAs: recognition discrimination between antibiotics. RNA (New York, N.Y.), 4(1), 112–123. | ssRNA | B #84 (41 mer) | Streptomycin | 5'AUCACCUCAAGGAAAACGCUUCAGAAAGGGACUUAGGUGAU3' | 41 | 0.439024 | Not reported | null | 5'-GGAGCUCAGCCUUCACUGC-N74-GGCACCACGGUCGGAUCCAC3' | 74 | 5 mM MgCl2, 50 mM Tris-HCl, pH 7.6, 250 mM NaCl | MgCl | Tris Buffers | 7.6 | Not reported | Drug Development: "A growing body of evidence points to RNA as a crucial target for antibacterial and antiviral drugs. For example, the aminocyclitol antibiotic streptomycin interacts with the 16S ribosomal RNA and, in addition, inhibits group I intron splicing. To understand the mode of binding of streptomycin to RNA,... | Pb21-induced cleavage of b #84 | null | 10,000,240 | null | Schroeder, R, renee@gem.univie.ac.at | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10496219/ | RNA | https://doi.org/10.1017/s135583829999088x | Klug, S. J., Hüttenhofer, A., & Famulok, M. (1999). In vitro selection of RNA aptamers that bind special elongation factor SelB, a protein with multiple RNA-binding sites, reveals one major interaction domain at the carboxyl terminus. RNA (New York, N.Y.), 5(9), 1180–1190. https://doi.org/10.1017/s135583829999088x | ssRNA | clone 488 | SelB protein, Escherichia coli | 5'GCGCUAAGUCCUCGCUCAGCCCAUAAGUUGUCCCAAGUCUUGGGCGCAAAUACAUCCCACGCGCGACUCGGAUCCG3' | 76 | 0.592105 | Not reported | null | 5'-GCGCTAAGTCCTCGCTCA-N40-ACGCGCGACTCGGATCCG-3' | 40 | 50 mM potassium phosphate, pH 7.0, 5 mM Mg(OAc)2, 0.1 mM EDTA, 1 mM DTT, 0.5 mM GTP, 0.02% Tween 20, 400 U/mL RNAsin | null | PBS/phosphate buffers | 7 | 17 kDa | Research: " Domain mapping for SelB-binding aptamers showed that despite the different RNA-binding sites in the protein, the vast majority of aptamers bound to the ultimate C-terminus of SelB, the domain responsible for mRNA hairpin binding.Although the selected aptamers may be biologically inactive for selenocysteine ... | null | This RNA has exactly the same 59-CAAGUCUUG-39 sequence in the apical loop (AGUCU) and adjacent stem as the mRNA hairpin of the E. coli fdnG gene (Fig+ 5B)+ T, DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as... | 10,000,243 | null | Famulok M, m.famulok@uni-bonn.de | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10449422/ | EMBO J | https://doi.org/10.1093/emboj/18.16.4571 | Scarabino, D., Crisari, A., Lorenzini, S., Williams, K., & Tocchini-Valentini, G. P. (1999). tRNA prefers to kiss. The EMBO journal, 18(16), 4571–4578. https://doi.org/10.1093/emboj/18.16.4571 | ssRNA | B3 | Phenylalanine tRNA, Yeast | 5'GGGAAUUCCGCGUGUGCAAGCCUGUCGUGUGAACCUUGGUAGUCUUCAGAUACCAUUCUAGCCACGAGAGACUACGACACUGCUCCGUCGCCCGUCCGUUCGGGAUCCUC3' | 110 | 0.572727 | binding efficiency: recovery as percentage of load: 55%; Kd: 26 ± 1.4 nM | 26 | 5'-GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC-3' | 80 | 0.25 M NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 2 mM spermidine, 0.2 mM EDTA | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Six RNA aptamers that bind to yeast phenylalanine tRNA were identified by in vitro selection from a random-sequence pool. The in vitro selection approach can be employed to address experimentally how prevalent different kinds of binding partners are for various target RNAs in unbiased searches of RNA sequen... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,245 | null | Tocchini-Valentini GP, gtocchini@ibc.rm.cnr.it | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10449422/ | EMBO J | https://doi.org/10.1093/emboj/18.16.4571 | Scarabino, D., Crisari, A., Lorenzini, S., Williams, K., & Tocchini-Valentini, G. P. (1999). tRNA prefers to kiss. The EMBO journal, 18(16), 4571–4578. https://doi.org/10.1093/emboj/18.16.4571 | ssRNA | B4 | Phenylalanine tRNA, Yeast | 5'GGGAAUUCCGCGUGUGCUCGGUCACGCAUCUUCACGUCGAAAGCUACAUCGGUCUGCUGACGGUGAUGGCAUUUGCGCGGCUUACGCCGGUCGUGGUCCGUUCGGGAUCCUC3' | 112 | 0.607143 | binding efficiency: recovery as percentage of load: 40% | null | 5'-GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC-3' | 80 | 0.25 M NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 2 mM spermidine, 0.2 mM EDTA | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Six RNA aptamers that bind to yeast phenylalanine tRNA were identified by in vitro selection from a random-sequence pool. The in vitro selection approach can be employed to address experimentally how prevalent different kinds of binding partners are for various target RNAs in unbiased searches of RNA sequen... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,246 | null | Tocchini-Valentini GP, gtocchini@ibc.rm.cnr.it | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10449422/ | EMBO J | https://doi.org/10.1093/emboj/18.16.4571 | Scarabino, D., Crisari, A., Lorenzini, S., Williams, K., & Tocchini-Valentini, G. P. (1999). tRNA prefers to kiss. The EMBO journal, 18(16), 4571–4578. https://doi.org/10.1093/emboj/18.16.4571 | ssRNA | B6 | Phenylalanine tRNA, Yeast | 5'GGGAAUUCCGCGUGUGCAGAGUGGCCGGGCCUCCAUUCGGGGGUUAUCUUCACCUACGGGCCCCACGCGUUAUUUAGUGUUGUACCGUAGGGCUGUGUCCGUUCGGGAUCCUC3' | 113 | 0.60177 | binding efficiency: recovery as percentage of load: 37% | null | 5'-GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC-3' | 80 | 0.25 M NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 2 mM spermidine, 0.2 mM EDTA | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Six RNA aptamers that bind to yeast phenylalanine tRNA were identified by in vitro selection from a random-sequence pool. The in vitro selection approach can be employed to address experimentally how prevalent different kinds of binding partners are for various target RNAs in unbiased searches of RNA sequen... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,247 | null | Tocchini-Valentini GP, gtocchini@ibc.rm.cnr.it | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10449422/ | EMBO J | https://doi.org/10.1093/emboj/18.16.4571 | Scarabino, D., Crisari, A., Lorenzini, S., Williams, K., & Tocchini-Valentini, G. P. (1999). tRNA prefers to kiss. The EMBO journal, 18(16), 4571–4578. https://doi.org/10.1093/emboj/18.16.4571 | ssRNA | B7 | Phenylalanine tRNA, Yeast | 5'GGGAAUUCCGCGUGUGCGGGUCUUCACAGACUUGGCAAUUACCAGAACAUGUGCCUGGUAUACGUCAAUACGUCUGGUGGUUAAUACCGCCGUGGUCCGUUCGGGAUCCUC3' | 111 | 0.540541 | binding efficiency: recovery as percentage of load: 41% | null | 5'-GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC-3' | 80 | 0.25 M NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 2 mM spermidine, 0.2 mM EDTA | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Six RNA aptamers that bind to yeast phenylalanine tRNA were identified by in vitro selection from a random-sequence pool. The in vitro selection approach can be employed to address experimentally how prevalent different kinds of binding partners are for various target RNAs in unbiased searches of RNA sequen... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,248 | null | Tocchini-Valentini GP, gtocchini@ibc.rm.cnr.it | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10449422/ | EMBO J | https://doi.org/10.1093/emboj/18.16.4571 | Scarabino, D., Crisari, A., Lorenzini, S., Williams, K., & Tocchini-Valentini, G. P. (1999). tRNA prefers to kiss. The EMBO journal, 18(16), 4571–4578. https://doi.org/10.1093/emboj/18.16.4571 | ssRNA | B1 | Phenylalanine tRNA, Yeast | 5'GGGAAUUCCGCGUGUGCAUCACGGGUGUAUGCAAGACUCAGCAGUGGGCCAUAUGGUCGGAUCGAGGCUAGCUAAGUCUCCCAAUUGCACCUUCGUGGUCCGUUCGGGAUCCUC3' | 114 | 0.570175 | binding efficiency: recovery as percentage of load: 16% | null | 5'-GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC-3' | 80 | 0.25 M NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2, 2 mM spermidine, 0.2 mM EDTA | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Six RNA aptamers that bind to yeast phenylalanine tRNA were identified by in vitro selection from a random-sequence pool. The in vitro selection approach can be employed to address experimentally how prevalent different kinds of binding partners are for various target RNAs in unbiased searches of RNA sequen... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,249 | null | Tocchini-Valentini GP, gtocchini@ibc.rm.cnr.it | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10097084/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.96.7.3606 | Blind, M., Kolanus, W., & Famulok, M. (1999). Cytoplasmic RNA modulators of an inside-out signal-transduction cascade. Proceedings of the National Academy of Sciences of the United States of America, 96(7), 3606–3610. https://doi.org/10.1073/pnas.96.7.3606 | ssRNA | D20 | Cytoplasmic domain of CD18 | 5′GGGCGCUAAGUCCUCGCUCAUGCGCGUCCCAUGGGGUAUAGAGGGGUCGAAGUGGACGCGCGACUCGGAUCCUAC3′ | 75 | 0.64 | Kd: between 500 and 1,000 nM | 500 | 5′-TCGGCGCTAAGTCCTCGCTCA-N40-ACGCGCGACTCGGATCCT-3′ | 40 | 4.3 mM K2HPO4, 1.4 mM NaH2PO4, 150 mM NaCl, 1.0 mM MgCl2, 0.1 μM CaCl2 | MgCl/CaCl | PBS/phosphate buffers | null | Not reported | Reasearch: " the development and application of a system allowing high-level expression of aptamers within the cytoplasm of leukocytes, and investigation into their biological effects in the context of the living cell; cytoplasmic aptamers are capable of targeting receptors that are anchored in the plasma membrane comp... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,250 | null | Famulok M, Famulok@lmb.uni-muenchen.de; Waldemar Kolanus, Kolanus@lmb.uni-muenchen.de | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10097084/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.96.7.3606 | Blind, M., Kolanus, W., & Famulok, M. (1999). Cytoplasmic RNA modulators of an inside-out signal-transduction cascade. Proceedings of the National Academy of Sciences of the United States of America, 96(7), 3606–3610. https://doi.org/10.1073/pnas.96.7.3606 | ssRNA | D28 | Cytoplasmic domain of CD18 | 5′GGGCGCUAAGUCCUCGCUCAUACAACGAGGGGUCGUGUAGGGAUGUAUGGGCUUGGACACACGCGCGACUCGGAUCCUAC3′ | 80 | 0.6 | Kd: between 500 and 1,000 nM | 500 | 5′-TCGGCGCTAAGTCCTCGCTCA-N40-ACGCGCGACTCGGATCCT-3′ | 40 | 4.3 mM K2HPO4, 1.4 mM NaH2PO4, 150 mM NaCl, 1.0 mM MgCl2, 0.1 μM CaCl2 | MgCl/CaCl | PBS/phosphate buffers | null | Not reported | Reasearch: " the development and application of a system allowing high-level expression of aptamers within the cytoplasm of leukocytes, and investigation into their biological effects in the context of the living cell; cytoplasmic aptamers are capable of targeting receptors that are anchored in the plasma membrane comp... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,251 | null | Michael Famulok, Famulok@lmb.uni-muenchen.de; Kolanus W, Kolanus@lmb.uni-muenchen.de | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10097084/ | Proc Natl Acad Sci U S A | https://doi.org/10.1073/pnas.96.7.3606 | Blind, M., Kolanus, W., & Famulok, M. (1999). Cytoplasmic RNA modulators of an inside-out signal-transduction cascade. Proceedings of the National Academy of Sciences of the United States of America, 96(7), 3606–3610. https://doi.org/10.1073/pnas.96.7.3606 | ssRNA | D31 | Cytoplasmic domain of CD18 | 5′GGGCGCUAAGUCCUCGCUCACAAGGUGCAAUGCAAUAUGUGAGUGCGCCGCCCUUUCUCUCGCGCGACUCGGAUCCUAC3′ | 79 | 0.594937 | Kd: between 500 and 1,000 nM | 500 | 5′-TCGGCGCTAAGTCCTCGCTCA-N40-ACGCGCGACTCGGATCCT-3′ | 40 | 4.3 mM K2HPO4, 1.4 mM NaH2PO4, 150 mM NaCl, 1.0 mM MgCl2, 0.1 μM CaCl2 | MgCl/CaCl | PBS/phosphate buffers | null | Not reported | Reasearch: " the development and application of a system allowing high-level expression of aptamers within the cytoplasm of leukocytes, and investigation into their biological effects in the context of the living cell; cytoplasmic aptamers are capable of targeting receptors that are anchored in the plasma membrane comp... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,252 | null | Michael Famulok, Famulok@lmb.uni-muenchen.de; Kolanus W, Kolanus@lmb.uni-muenchen.de | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10348914/ | J Biochem | https://doi.org/10.1093/oxfordjournals.jbchem.a022393 | Takeno, H., Yamamoto, S., Tanaka, T., Sakano, Y., & Kikuchi, Y. (1999). Selection of an RNA molecule that specifically inhibits the protease activity of subtilisin. Journal of biochemistry, 125(6), 1115–1119. https://doi.org/10.1093/oxfordjournals.jbchem.a022393 | ssRNA | RNA-1 | Subtilisin BPN | 5'GGGCGAAUUCGAGCUCGGGCCACUCGCUCAACACGGUAAGUAGAGACCUAGUGGUACAUAAAGGACUGCAGGCAUGCAAGCU3' | 82 | 0.54878 | Ki: 2.5 µM | null | 5'-AAGCTTGCATGCCTGCAG-N47-CCGAGCTCGAATTCGCCCTATAGTGAGTCGTATTA-3' | 47 | 50 mM Tris-HCl, pH 7.5, 50 mM NaCl | null | Tris Buffers | 7.5 | Not reported | Research: " RNA ligands (RNA aptamers) to a protease subtilisin were selected from pools of random RNA by SELEX (systematic evolution of ligands by exponential enrichment) and by use of a subtilisin-immobilized Sepharose column. . After eight rounds of selection, RNA aptamers were isolated by cloning to a plasmid vecto... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,253 | null | Kikuchi Y, kikuchi@eco.tut.ac.jp | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 85 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUGAAUGAGAGAGAAGUAAAAGGUUGAUAUAAAUAGUGCCCA3′ | 57 | 0.421053 | Kd: 11 nM | 11 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,254 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 88 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUUCGAAAGAAAAGAGUAACUGGUUGAUAUAAAUAGUGCCCA3′ | 57 | 0.421053 | Kd: 10 nM | 10 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,255 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 76 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUAAGAGAAGAAGUACCCGAGCGUUGAUAUAAAUAGUGCCCA3′ | 57 | 0.473684 | Kd: 10 nM | 10 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,256 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 98 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUGAUGAAGUAAAAAGCGAUGAGUUGAUAUAAAUAGUGCCCA3′ | 57 | 0.421053 | Kd: 21 nM | 21 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,257 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 58 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUGGGAGGCAGAAAGGAAAAAGUGUUGAUAUAAAUAGUGCCCA3′ | 58 | 0.465517 | Kd: 13 nM | 13 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,258 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 77 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUAAGAAAGAACGGAACCAUGGUUGAUAUAAAUAGUGCCCA3′ | 56 | 0.446429 | Kd: 10 nM | 10 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,259 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10101203/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.8.1926 | Triqueneaux, G., Velten, M., Franzon, P., Dautry, F., & Jacquemin-Sablon, H. (1999). RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic acids research, 27(8), 1926–1934. https://doi.org/10.1093/nar/27.8.1926 | ssRNA | 78 | Unr (Upstream of N-Ras) protein, Human | 5′GGGCCACCAACGACAUUGAAAAAAAAACAAGAAGAAGGUUGAUAUAAAUAGUGCCCA3′ | 57 | 0.385965 | Kd: 8 nM | 8 | 5′-CCCGGTGGTTGCTGTAA-N20-CAACTATATTTATCACGGGT-3′ | 20 | 25 µg/ml BSA, 25 µg/ml tRNA, 5 U/ml RNAguard (Pharmacia), 1 mM PMSF, 1 mM β-mercaptoethanol and 1 µg/ml of leupeptin, antipain and aprotinin, in TNG buffer | null | Other Buffers | 7.4 | 85 kDa | Research: " In our initial characterization of the human Unr protein, we have determined that it has the capacity to interact in vitro with single-stranded RNA and DNA; To further characterize the RNA-binding specificity of Unr and eventually identify RNA ligands, we have used an in vitro selection/amplification approa... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,260 | null | Jacquemin-Sablon H, hjacque@infobiogen.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10408383/ | Immunopharmacology | https://doi.org/10.1016/s0162-3109(99)00020-x | Biesecker, G., Dihel, L., Enney, K., & Bendele, R. A. (1999). Derivation of RNA aptamer inhibitors of human complement C5. Immunopharmacology, 42(1-3), 219–230. https://doi.org/10.1016/s0162-3109(99)00020-x | 2'-fluoro-RNA | C5C6 | C5 component of human complement (serum glycoprotein) | 5'GGGAGGACGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCGUCAGACGACUCGCCCGA3' | 62 | 0.596774 | Not reported | null | 5'-GGGAGGACGATGCGG-N30-CAGACGACTCGCCCGA-3' | 30 | Phosphate-buffered saline containing 1 mM MgCl2 | MgCl | PBS/phosphate buffers | 7.4 | 210 kDa | Therapeutic: " The human and rat aptamers are being evaluated for complement inhibition in vitro and in vivo as potential therapeutics for treatment of human disease The selected C5 aptamer has the properties to make it useful as a therapeutic complement inhibitor: the aptamer inhibits both C5 pathways, and does not in... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,261 | null | Biesecker G | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10322029/ | J Bacteriol | https://doi.org/10.1128/jb.181.10.3246-3255.1999 | Goodman, S. D., Velten, N. J., Gao, Q., Robinson, S., & Segall, A. M. (1999). In vitro selection of integration host factor binding sites. Journal of bacteriology, 181(10), 3246–3255. https://doi.org/10.1128/JB.181.10.3246-3255.1999 | ssDNA | 1-5 | Integration host factor (IHF) | 5′GCCTGCTTTTTTATACTAAGTTGGCATCTGCCGCTAAGTTGTTGATTCCAATTTGTTGCAACGAACAGGTCACTA3′ | 75 | 0.413333 | IC50: 3.2 nM | null | 5′-GCCTGCTTTTTTATACTAAGTTGGCA-N21-CAATTTGTTGCAACGAACAGGTCACTA-3′ | 21 | 50 mM Tris-Cl–50 mM KCl–50 μg of bovine serum albumin (BSA) per ml–3.75 μg of salmon sperm DNA per ml–10% glycerol–1 mM EDTA at pH 7.8 | null | Tris Buffers | 7.8 | Not reported | Research: " Integration host factor (IHF) is a bacterial protein that binds and severely bends a specific DNA target. To understand the essential determinants of IHF function, a similar selection will be used with recombination as the partition selector in order to ask how efficient recombination is associated with DNA... | null | high-affinity class I site, proficient in excisive recombination and modest in integrative recombination | 10,000,264 | null | Goodman SD, sgoodman@hsc.usc.edu | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10322029/ | J Bacteriol | https://doi.org/10.1128/jb.181.10.3246-3255.1999 | Goodman, S. D., Velten, N. J., Gao, Q., Robinson, S., & Segall, A. M. (1999). In vitro selection of integration host factor binding sites. Journal of bacteriology, 181(10), 3246–3255. https://doi.org/10.1128/JB.181.10.3246-3255.1999 | ssDNA | 1-46 | Integration host factor (IHF) | 5′GCCTGCTTTTTTATACTAAGTTGGCAACCGTCGCATATGTAAGGAATTCAATTTGTTGCAACGAACAGGTCACTA3′ | 75 | 0.4 | IC50: 3.9 nM | null | 5′-GCCTGCTTTTTTATACTAAGTTGGCA-N21-CAATTTGTTGCAACGAACAGGTCACTA-3′ | 21 | 50 mM Tris-Cl–50 mM KCl–50 μg of bovine serum albumin (BSA) per ml–3.75 μg of salmon sperm DNA per ml–10% glycerol–1 mM EDTA at pH 7.8 | null | Tris Buffers | 7.8 | Not reported | Research: " Integration host factor (IHF) is a bacterial protein that binds and severely bends a specific DNA target. To understand the essential determinants of IHF function, a similar selection will be used with recombination as the partition selector in order to ask how efficient recombination is associated with DNA... | null | high-affinity class I site but recombination deficient | 10,000,265 | null | Goodman SD, sgoodman@hsc.usc.edu | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10322029/ | J Bacteriol | https://doi.org/10.1128/jb.181.10.3246-3255.1999 | Goodman, S. D., Velten, N. J., Gao, Q., Robinson, S., & Segall, A. M. (1999). In vitro selection of integration host factor binding sites. Journal of bacteriology, 181(10), 3246–3255. https://doi.org/10.1128/JB.181.10.3246-3255.1999 | ssDNA | 1-50 | Integration host factor (IHF) | 5′GCCTGCTTTTTTATACTAAGTTGGCAATGAATCTTGGATAGTCGGCAGCAATTTGTTGCAACGAACAGGTCACTA3′ | 75 | 0.413333 | IC50: 10 nM | null | 5′-GCCTGCTTTTTTATACTAAGTTGGCA-N21-CAATTTGTTGCAACGAACAGGTCACTA-3′ | 21 | 50 mM Tris-Cl–50 mM KCl–50 μg of bovine serum albumin (BSA) per ml–3.75 μg of salmon sperm DNA per ml–10% glycerol–1 mM EDTA at pH 7.8 | null | Tris Buffers | 7.8 | Not reported | Research: " Integration host factor (IHF) is a bacterial protein that binds and severely bends a specific DNA target. To understand the essential determinants of IHF function, a similar selection will be used with recombination as the partition selector in order to ask how efficient recombination is associated with DNA... | null | lowest-affinity class I site, modest in both excisive and integrative recombination and with the most accelerated migration in complexes with IHF | 10,000,266 | null | Goodman SD, sgoodman@hsc.usc.edu | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10198434/ | Nucleic Acids Res | https://doi.org/10.1093/nar/27.9.2006 | Homann, M., & Göringer, H. U. (1999). Combinatorial selection of high affinity RNA ligands to live African trypanosomes. Nucleic acids research, 27(9), 2006–2014. https://doi.org/10.1093/nar/27.9.2006 | ssRNA | 2-16 | Trypanosome variant surface glycoprotein (VSG) | 5'GAAUUCAGUCGGACAGCGUCGGGUGGCCCGUGUCUGAGCGGGGACGGCCACUUGAGCGCGAUGGACGAAUAUCGUCUCCC3' | 80 | 0.6375 | Kd: 60 ± 17 nM | 60 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | 40 | 20 mM NaxHyPO4, pH 7.4, 2 mM MgCl2, 130 mM NaCl, 5 mM KCl, 20 mM glucose, 0.2 mM β-mercaptoethanol | MgCl | PBS/phosphate buffers | 7.4 | 42 kDa | Diagnostic and Therapeutic: "The identified RNA aptamers show high affinity binding and specificity for a single protein and as such they have the potential to be used as diagnostic as well as therapeutic tools. Their ability to bind to an invariant element on the trypanosome surface opens up the possibility of side-st... | Biotinylation of aptamer 2–16 was performed by in vitro transcription | 32P-phosphate labelled RNA. DNA oligonucleotides were synthesised b automated solid suupport chemsistry using O-cyanoethyl-N,N-dissopropyl-phosphoramidites . The starting pool library was a 79mer DNA of sequence. Fluorescence labelling of aptamer 2–16 was achieved by tagging the bodipy tmr-c5 fluorophore (molecular pro... | 10,000,268 | null | Göringer HU, goeringe@biochem.mpg.de | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10606271/ | RNA | https://doi.org/10.1017/s1355838299991318 | Ducongé, F., & Toulmé, J. J. (1999). In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1. RNA (New York, N.Y.), 5(12), 1605–1614. https://doi.org/10.1017/s1355838299991318 | ssRNA | R-06 | Trans-activation responsive (TAR) RNA element of HIV-1 | 5'GGUUACCAGCCUUCACUGCGGGCCACGAUUGUCGAGUCCAUCAACAGGUCCCAGACGUGUUGAACUGGAGAUCCCCCCGCACCACGGUCGGUCACAC3' | 97 | 0.608247 | Kd: 30 nM | 30 | 5'-GGUUACCAGCCUUCACUGC-N60-GCACCACGGUCGGUCACAC-3' | 60 | R buffer (20 mM HEPES, pH 7.3, at 208C contain-ing 20 mM sodium acetate, 140 mM potassium acetate,and 3 mM magnesium acetate) | null | Other Buffers | 7.3 | Not reported | Research: " Numerous RNA structures act as regulatory domains of gene expression, generally through the binding of proteins. Tertiary RNA interactions are known to play a key role in several biological processes. A pseudo-knot is responsible for the ribosomal frame-shifting on the mRNA of the Infectious Bronchitis Viru... | null | null | 10,000,269 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10606271/ | RNA | https://doi.org/10.1017/s1355838299991318 | Ducongé, F., & Toulmé, J. J. (1999). In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1. RNA (New York, N.Y.), 5(12), 1605–1614. https://doi.org/10.1017/s1355838299991318 | ssRNA | R-42 | Trans-activation responsive (TAR) RNA element of HIV-1 | 5'GGUUACCAGCCUUCACUGCCCAGCGCAAUGACGACCCCCAGUCCCAGAUGGGAGGUCAUAGUCAUAGUCGGACUCACCGCGGCACCACGGUCGGUCACAC3' | 100 | 0.62 | Not reported | null | 5'-GGUUACCAGCCUUCACUGC-N60-GCACCACGGUCGGUCACAC-3' | 60 | R buffer (20 mM HEPES, pH 7.3, at 208C contain-ing 20 mM sodium acetate, 140 mM potassium acetate,and 3 mM magnesium acetate) | null | Other Buffers | 7.3 | Not reported | Research: " Numerous RNA structures act as regulatory domains of gene expression, generally through the binding of proteins. Tertiary RNA interactions are known to play a key role in several biological processes. A pseudo-knot is responsible for the ribosomal frame-shifting on the mRNA of the Infectious Bronchitis Viru... | null | slightly weaker binder than R-06 24 | 10,000,271 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10606271/ | RNA | https://doi.org/10.1017/s1355838299991318 | Ducongé, F., & Toulmé, J. J. (1999). In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1. RNA (New York, N.Y.), 5(12), 1605–1614. https://doi.org/10.1017/s1355838299991318 | ssRNA | R-06 24 | Trans-activation responsive (TAR) RNA element of HIV-1 | 5'UCAACACGGUCCCAGACGUGUUGA3' | 24 | 0.541667 | Kd: 32 ± 8 nM | 32 | 5'-GGUUACCAGCCUUCACUGC-N60-GCACCACGGUCGGUCACAC-3' | 60 | R buffer (20 mM HEPES, pH 7.3, at 208C contain-ing 20 mM sodium acetate, 140 mM potassium acetate,and 3 mM magnesium acetate) | null | Other Buffers | 7.3 | Not reported | Detection: " Numerous RNA structures act as regulatory domains of gene expression, generally through the binding of proteins. Tertiary RNA interactions are known to play a key role in several biological processes. A pseudo-knot is responsible for the ribosomal frame-shifting on the mRNA of the Infectious Bronchitis Vir... | 24-mer truncated aptamer derived from r-06 aptamer | null | 10,000,272 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10212256/ | J Biol Chem | https://doi.org/10.1074/jbc.274.18.12730 | Boiziau, C., Dausse, E., Yurchenko, L., & Toulmé, J. J. (1999). DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes. The Journal of biological chemistry, 274(18), 12730–12737. https://doi.org/10.1074/jbc.274.18.12730 | ssDNA | IV-04 | Human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element | 5′GCAGTCTCGTCGACACCCAGCAGCGCATGTAACTCCCATATCATGTGTGTGCTGGATCCGACGCAG3' | 66 | 0.575758 | Kd: 20 nM | 20 | 5′-GCAGTCTCGTCGACACCC-N30-GTGCTGGATCCGACGCAG-3' | 30 | 10 mmTris-HCl, pH 7.5, 10 mm MgCl2, 50 mm NaCl, and 1 mm dithioerythritol | MgCl | Tris Buffers | 7.5 | Not reported | Research: " In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. These results, which allowed the identification of a new type of complex, DNA-RNA ki... | null | null | 10,000,273 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10212256/ | J Biol Chem | https://doi.org/10.1074/jbc.274.18.12730 | Boiziau, C., Dausse, E., Yurchenko, L., & Toulmé, J. J. (1999). DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes. The Journal of biological chemistry, 274(18), 12730–12737. https://doi.org/10.1074/jbc.274.18.12730 | ssDNA | III-25 39 | Human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element | 5′CCCACGGGAGAATACTCCCATCATTGAATCCCGTGCTGG3' | 39 | 0.564103 | Kd: 50 nM | 50 | 5′-GCAGTCTCGTCGACACCC-N30-GTGCTGGATCCGACGCAG-3' | 30 | 10 mmTris-HCl, pH 7.5, 10 mm MgCl2, 50 mm NaCl, and 1 mm dithioerythritol | MgCl | Tris Buffers | 7.5 | Not reported | Research: " In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. These results, which allowed the identification of a new type of complex, DNA-RNA ki... | null | null | 10,000,274 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10212256/ | J Biol Chem | https://doi.org/10.1074/jbc.274.18.12730 | Boiziau, C., Dausse, E., Yurchenko, L., & Toulmé, J. J. (1999). DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes. The Journal of biological chemistry, 274(18), 12730–12737. https://doi.org/10.1074/jbc.274.18.12730 | ssDNA | III-33 39 | Human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element | 5′CCACAGTACGTTAACTCCCATATACACGTATGGTGCTGG3' | 39 | 0.487179 | Kd: 50 nM | 50 | 5′-GCAGTCTCGTCGACACCC-N30-GTGCTGGATCCGACGCAG-3' | 30 | 10 mmTris-HCl, pH 7.5, 10 mm MgCl2, 50 mm NaCl, and 1 mm dithioerythritol | MgCl | Tris Buffers | 7.5 | Not reported | Research: " In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. These results, which allowed the identification of a new type of complex, DNA-RNA ki... | null | null | 10,000,275 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10212256/ | J Biol Chem | https://doi.org/10.1074/jbc.274.18.12730 | Boiziau, C., Dausse, E., Yurchenko, L., & Toulmé, J. J. (1999). DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes. The Journal of biological chemistry, 274(18), 12730–12737. https://doi.org/10.1074/jbc.274.18.12730 | ssDNA | IV-04 39 | Human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element | 5′CCAGCAGCGCATGTAACTCCCATATCATGTGTGTGCTGG3' | 39 | 0.538462 | Kd: 50 nM | 50 | 5′-GCAGTCTCGTCGACACCC-N30-GTGCTGGATCCGACGCAG-3' | 30 | 10 mmTris-HCl, pH 7.5, 10 mm MgCl2, 50 mm NaCl, and 1 mm dithioerythritol | MgCl | Tris Buffers | 7.5 | Not reported | Research: " In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. These results, which allowed the identification of a new type of complex, DNA-RNA ki... | null | null | 10,000,276 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10212256/ | J Biol Chem | https://doi.org/10.1074/jbc.274.18.12730 | Boiziau, C., Dausse, E., Yurchenko, L., & Toulmé, J. J. (1999). DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes. The Journal of biological chemistry, 274(18), 12730–12737. https://doi.org/10.1074/jbc.274.18.12730 | ssDNA | IV-40 38 | Human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element | 5′CCAGTAGGACATTACTCCCACACTGATGTCCGTGCTGG3' | 38 | 0.552632 | Kd: 120 nM | 120 | 5′-GCAGTCTCGTCGACACCC-N30-GTGCTGGATCCGACGCAG-3' | 30 | 10 mmTris-HCl, pH 7.5, 10 mm MgCl2, 50 mm NaCl, and 1 mm dithioerythritol | MgCl | Tris Buffers | 7.5 | Not reported | Research: " In vitro selection was performed in a DNA library, made of oligonucleotides with a 30-nucleotide random sequence, to identify ligands of the human immunodeficiency virus type-1 trans-activation-responsive (TAR) RNA element. These results, which allowed the identification of a new type of complex, DNA-RNA ki... | null | null | 10,000,277 | null | Toulmé JJ, jean-jacques.toulme@bordeaux.inserm.fr | null |
1,999 | https://pubmed.ncbi.nlm.nih.gov/10233958/ | J Virol | https://doi.org/10.1128/jvi.73.6.4962-4971.1999 | Baskerville, S., Zapp, M., & Ellington, A. D. (1999). Anti-Rex aptamers as mimics of the Rex-binding element. Journal of virology, 73(6), 4962–4971. https://doi.org/10.1128/JVI.73.6.4962-4971.1999 | ssDNA | 8-5 aptamer | Rex fusion protein of Human T-lymphotropic virus 1 (HTLV-1) | 5'GGGAACTCGATGAAGCGAATTCTGTAGGCGACGGTACGCAAGTACTCTTGCGCCACAGGCCTATCTATCGGATCCACG3' | 78 | 0.551282 | Kapp: 25 nM & 30 nM | null | 5'-GGGAACTCGATGAAGCGAATTCTGT-N6.9-GTACGCAAGTAC-N6.9-ACAGGCCTATCTATCGGATCCACG-3' | 15 | 50 mM Tris-HCl [pH 8.0], 50 mM KCl | null | Tris Buffers | 8 | Not reported | Therapeutic and Research: "RNA molecules that bind tightly and specifically to a Rex fusion protein have been isolated from a conformationally constrained pool of random sequence RNAs. The anti-Rex aptamers can functionally substitute for the XBE in vivo, a result which supports a previously proposed model for mRNA tra... | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,279 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10908352/ | Nucleic Acids Res | https://doi.org/10.1093/nar/28.15.2902 | Tok, J. B., Cho, J., & Rando, R. R. (2000). RNA aptamers that specifically bind to a 16S ribosomal RNA decoding region construct. Nucleic acids research, 28(15), 2902–2910. https://doi.org/10.1093/nar/28.15.2902 | ssRNA | 109.1-7 | Prokaryotic 16s-rRNA region | 5'GGGAGAAUUCCGACCAGAAGCUUUUAGGGCGGGACUUUUGGCCGCAAAGGUUGGUGUGAGGGUUCUCAAUAAUGGCCCAAGCAUAUGUGCGUCUACAUGGAUCCUCA3' | 107 | 0.514019 | Kd: 1.446 ± 0.088 uM | 1.446 | 5'-GGGAGAATTCCGACCAGAAGC-N60-CATATGTGCGTCTACATGGATCCTCA-3' | 60 | 1 M NaCl, 50 mM Tris–HCl, 3 mM MgCl2, pH 7.4 | MgCl | Tris Buffers | 7.4 | Not reported | Research: " RNA-RNA recognition is a critical process in controlling many key biological events, such as translation and ribozyme functions. The recognition process governing RNA-RNA interactions can involve complementary Watson-Crick (WC) base pair binding, or can involve binding through tertiary structural interactio... | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,281 | null | Rando RR, robert_rando@hms.harvard.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10908352/ | Nucleic Acids Res | https://doi.org/10.1093/nar/28.15.2902 | Tok, J. B., Cho, J., & Rando, R. R. (2000). RNA aptamers that specifically bind to a 16S ribosomal RNA decoding region construct. Nucleic acids research, 28(15), 2902–2910. https://doi.org/10.1093/nar/28.15.2902 | ssRNA | 109.2-15 | Prokaryotic 16s-rRNA region | 5'GGGAGAAUUCCGACCAGAAGCGGCGUUCCGCAUCGGCAACUGGCGAGGAGUUGUAUUCGGCGGAAACGGGUUGAGGUCCGACAUAUGUGCGUCUACAUGGAUCCUCA3' | 107 | 0.570093 | Kd: 1.665 ± 0.101 uM | 1.665 | 5'-GGGAGAATTCCGACCAGAAGC-N60-CATATGTGCGTCTACATGGATCCTCA-3' | 60 | 1 M NaCl, 50 mM Tris–HCl, 3 mM MgCl2, pH 7.4 | MgCl | Tris Buffers | 7.4 | Not reported | Research: " RNA-RNA recognition is a critical process in controlling many key biological events, such as translation and ribozyme functions. The recognition process governing RNA-RNA interactions can involve complementary Watson-Crick (WC) base pair binding, or can involve binding through tertiary structural interactio... | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,282 | null | Rando RR, robert_rando@hms.harvard.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10908352/ | Nucleic Acids Res | https://doi.org/10.1093/nar/28.15.2902 | Tok, J. B., Cho, J., & Rando, R. R. (2000). RNA aptamers that specifically bind to a 16S ribosomal RNA decoding region construct. Nucleic acids research, 28(15), 2902–2910. https://doi.org/10.1093/nar/28.15.2902 | ssRNA | 69.1-4 | Prokaryotic 16s-rRNA region | 5'GGGAGAAUUCCGACCAGAAGCAGUGGAAGAGCCGGGUUGGGCAUAUGUGCGUCUACAUGGAUCCUCA3' | 67 | 0.552239 | Kd: 2.946 ± 0.149 uM | 2.946 | 5'-GGGAGAATTCCGACCAGAAGC-N20-CATATGTGCGTCTACATGGATCCTCA-3' | 20 | 1 M NaCl, 50 mM Tris–HCl, 3 mM MgCl2, pH 7.4 | MgCl | Tris Buffers | 7.4 | Not reported | Research: " RNA-RNA recognition is a critical process in controlling many key biological events, such as translation and ribozyme functions. The recognition process governing RNA-RNA interactions can involve complementary Watson-Crick (WC) base pair binding, or can involve binding through tertiary structural interactio... | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,283 | null | Rando RR, robert_rando@hms.harvard.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10908352/ | Nucleic Acids Res | https://doi.org/10.1093/nar/28.15.2902 | Tok, J. B., Cho, J., & Rando, R. R. (2000). RNA aptamers that specifically bind to a 16S ribosomal RNA decoding region construct. Nucleic acids research, 28(15), 2902–2910. https://doi.org/10.1093/nar/28.15.2902 | ssRNA | 69.1-11 | Prokaryotic 16s-rRNA region | 5'GGGAGAAUUCCGACCAGAAGCAGCGGAACGGCCGACUUCAACAUAUGUGCGUCUACAUGGAUCCUCA3' | 67 | 0.537313 | Kd: 2.786 ± 0.188 uM | 2.786 | 5'-GGGAGAATTCCGACCAGAAGC-N20-CATATGTGCGTCTACATGGATCCTCA-3' | 20 | 1 M NaCl, 50 mM Tris–HCl, 3 mM MgCl2, pH 7.4 | MgCl | Tris Buffers | 7.4 | Not reported | Research: " RNA-RNA recognition is a critical process in controlling many key biological events, such as translation and ribozyme functions. The recognition process governing RNA-RNA interactions can involve complementary Watson-Crick (WC) base pair binding, or can involve binding through tertiary structural interactio... | Not applicable | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,284 | null | Rando RR, robert_rando@hms.harvard.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/29711918/ | Angew Chem Int Ed Engl | https://doi.org/10.1002/1521-3773(20001201)39:23%3C4369::aid-anie4369%3E3.0.co;2-n | Piganeau, N., Jenne, A., Thuillier, V., & Famulok, M. (2000). An Allosteric Ribozyme Regulated by Doxycyline. Angewandte Chemie (International ed. in English), 39(23), 4369–4373. https://doi.org/10.1002/1521-3773(20001201)39:23<4369::AID-ANIE4369>3.0.CO;2-N | ssRNA | 1D13-01 | Doxycyline | 5'GGAGCUCGGUAGUGACGCGUUGUGUUUACGCGUCUGAUGAGUGUAUAUGACACCGAUGGGUAUUUGCUAGUAUCCUGCGUUCACGAAACUACCUCGAGACGU3' | 102 | 0.5 | Ki: 70 ± 20 nM | null | 5′‐CGCGTTGTGTTTACGCGTCTGATGAGT‐N40‐ACGAAACTACCTCGAGACGT-3' | 40 | 40 mM Tris‐HCl, pH 8, 50 mM NaCl, 10 mM spermidine, 8 mM MgCl2 | MgCl | Tris Buffers | 8 | Not reported | Inhibition: " We have applied a novel in vitro selection strategy based on allosteric inhibition of a hammerhead ribozyme fused to a chosen "switch molevule" because it represents a cell-permeable small molecule with low toxicity for higher eukaryotes. Inhibition of doxycycline for the development of conditional gene e... | Not applicable | Additional nucleotides on 5' end of aptamer sequences originate from primer sequence. The original paper reported the sequnce in DNA from and include Thymine. The nonvariable region was pulled from Figure 3. The 5' end of sequence has added nucleotides that aren't present in the pool, but they are present in primers. D... | 10,000,285 | null | Famulok M. , m.famulok@uni-bonn.de; Thuillier V, vincent.thuillier@aventis.com | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/29711918/ | Angew Chem Int Ed Engl | https://doi.org/10.1002/1521-3773(20001201)39:23%3C4369::aid-anie4369%3E3.0.co;2-n | Piganeau, N., Jenne, A., Thuillier, V., & Famulok, M. (2000). An Allosteric Ribozyme Regulated by Doxycyline. Angewandte Chemie (International ed. in English), 39(23), 4369–4373. https://doi.org/10.1002/1521-3773(20001201)39:23<4369::AID-ANIE4369>3.0.CO;2-N | ssRNA | 1D16-05 | Doxycyline | 5'GGAGCUCGGUAGUGACGCGUUGUGUUUACGCGUCUGAUGAGUGGUACAGUCCAGGGUGAAGUUCCAAUUUUGAACACCUCCACGAAACUACCUCGAGACGU3' | 101 | 0.514851 | Ki: 20 ± 5 nM | null | 5′‐CGCGTTGTGTTTACGCGTCTGATGAGT‐N40‐ACGAAACTACCTCGAGACGT-3' | 40 | 40 mM Tris‐HCl, pH 8, 50 mM NaCl, 10 mM spermidine, 8 mM MgCl2 | MgCl | Tris Buffers | 8 | Not reported | Inhibition: " We have applied a novel in vitro selection strategy based on allosteric inhibition of a hammerhead ribozyme fused to a chosen "switch molevule" because it represents a cell-permeable small molecule with low toxicity for higher eukaryotes. Inhibition of doxycycline for the development of conditional gene e... | Not applicable | Additional nucleotides on 5' end of aptamer sequences originate from primer sequence. The original paper reported the sequnce in DNA from and include Thymine. The nonvariable region was pulled from Figure 3. The 5' end of sequence has added nucleotides that aren't present in the pool, but they are present in primers. D... | 10,000,286 | null | Famulok M. , m.famulok@uni-bonn.de; Thuillier V, vincent.thuillier@aventis.com | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/29711918/ | Angew Chem Int Ed Engl | https://doi.org/10.1002/1521-3773(20001201)39:23%3C4369::aid-anie4369%3E3.0.co;2-n | Piganeau, N., Jenne, A., Thuillier, V., & Famulok, M. (2000). An Allosteric Ribozyme Regulated by Doxycyline. Angewandte Chemie (International ed. in English), 39(23), 4369–4373. https://doi.org/10.1002/1521-3773(20001201)39:23<4369::AID-ANIE4369>3.0.CO;2-N | ssRNA | 1D16-06 | Doxycyline | 5'GGAGCUCGGUAGUGACGCGUUGUGUUUACGCGUCUGAUGAGUGGUUUGACCCUUGAUUCGAUGUAUUCGAAAGUGCUUGUUGACGAAACUACCUCGAGACGU3' | 102 | 0.490196 | Ki: 25 ± 3 nM | null | 5′‐CGCGTTGTGTTTACGCGTCTGATGAGT‐N40‐ACGAAACTACCTCGAGACGT-3' | 40 | 40 mM Tris‐HCl, pH 8, 50 mM NaCl, 10 mM spermidine, 8 mM MgCl2 | MgCl | Tris Buffers | 8 | Not reported | Inhibition: " We have applied a novel in vitro selection strategy based on allosteric inhibition of a hammerhead ribozyme fused to a chosen "switch molevule" because it represents a cell-permeable small molecule with low toxicity for higher eukaryotes. Inhibition of doxycycline for the development of conditional gene e... | Not applicable | Additional nucleotides on 5' end of aptamer sequences originate from primer sequence. The original paper reported the sequnce in DNA from and include Thymine. The nonvariable region was pulled from Figure 3. The 5' end of sequence has added nucleotides that aren't present in the pool, but they are present in primers. | 10,000,287 | null | Famulok M. , m.famulok@uni-bonn.de; Thuillier V, vincent.thuillier@aventis.com | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11101810/ | Nat Biotechnol | https://doi.org/10.1038/82414 | Jhaveri, S., Rajendran, M., & Ellington, A. D. (2000). In vitro selection of signaling aptamers. Nature biotechnology, 18(12), 1293–1297. https://doi.org/10.1038/82414 | ssRNA | rafl7 | Adenosine triphosphate (ATP) | 5′GGAAGGCACGACGAAGCAAGCAGGCAACGAACACAGAAGACCGGGGGAACUACCGCGCGUGCCAGACCCAACCAGCCAGAGACC3′ | 84 | 0.630952 | Kd: 223 μM ± 20 μM | 223,000 | 5′-GGAAGGCACGAC-N51-AGACCCAACCAGCCAGAGACC-3′ | 51 | 300 mM NaCl, 20 mM Tris-Cl, pH 7.4, 5 mM MgCl2 | MgCl | Tris Buffers | 7.4 | Not reported | Biosensor: " Increase in fluorescence. Reagentless biosensors that can directly transduce molecular recognition to optical signals should potentiate the development of sensor arrays for a wide variety of analytes. We have therefore attempted to develop selection methods that couple the broad molecular recognition prope... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,288 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11101810/ | Nat Biotechnol | https://doi.org/10.1038/82414 | Jhaveri, S., Rajendran, M., & Ellington, A. D. (2000). In vitro selection of signaling aptamers. Nature biotechnology, 18(12), 1293–1297. https://doi.org/10.1038/82414 | ssRNA | rafl7-U61C | Adenosine triphosphate (ATP) | 5′GGAAGGCACGACGAAGCAAGCAGGCAACGAACACAGAAGACCGGGGGAACUACCGCGCGCGCCAGACCCAACCAGCCAGAGACC3′ | 84 | 0.642857 | Kd: 165 μM ± 10 μM | 165,000 | 5′-GGAAGGCACGAC-N51-AGACCCAACCAGCCAGAGACC-3′ | 51 | 300 mM NaCl, 20 mM Tris-Cl, pH 7.4, 5 mM MgCl2 | MgCl | Tris Buffers | 7.4 | Not reported | Biosensor: " Increase in fluorescence. Reagentless biosensors that can directly transduce molecular recognition to optical signals should potentiate the development of sensor arrays for a wide variety of analytes. We have therefore attempted to develop selection methods that couple the broad molecular recognition prope... | Mutants of rafl7 were constructed that replaced the uridine at position 61 with cytidine (rafl7-u61c). | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,289 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11101810/ | Nat Biotechnol | https://doi.org/10.1038/82414 | Jhaveri, S., Rajendran, M., & Ellington, A. D. (2000). In vitro selection of signaling aptamers. Nature biotechnology, 18(12), 1293–1297. https://doi.org/10.1038/82414 | ssRNA | rafl7s | Adenosine triphosphate (ATP) | 5′GGGCGCGACGAAGCAAGCAGGCAACGAACACAGAAGACCGGGGGAACUACCGCGCGCGCCC3′ | 61 | 0.688525 | Kd: 175 μM ± 5 μM | 175 | 5′-GGAAGGCACGAC-N51-AGACCCAACCAGCCAGAGACC-3′ | 51 | 300 mM NaCl, 20 mM Tris-Cl, pH 7.4, 5 mM MgCl2 | MgCl | Tris Buffers | 7.4 | Not reported | Biosensor: " Increase in fluorescence. Reagentless biosensors that can directly transduce molecular recognition to optical signals should potentiate the development of sensor arrays for a wide variety of analytes. We have therefore attempted to develop selection methods that couple the broad molecular recognition prope... | Truncated and mutants of rafl7 were constructed that replaced the uridine at position 61 with cytidine (rafl7-u61c). | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,290 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11101810/ | Nat Biotechnol | https://doi.org/10.1038/82414 | Jhaveri, S., Rajendran, M., & Ellington, A. D. (2000). In vitro selection of signaling aptamers. Nature biotechnology, 18(12), 1293–1297. https://doi.org/10.1038/82414 | ssRNA | rafl28 | Adenosine triphosphate (ATP) | 5′GGAAGGCACGACCGCGCAAGAUACCGCCCGACAGCGGAAGGAGGGGCAUGCGGUCCAGGGCUGAGACCCAACCAGCCAGAGACC3′ | 84 | 0.678571 | Not reported | null | 5′-GGAAGGCACGAC-N51-AGACCCAACCAGCCAGAGACC-3′ | 51 | 300 mM NaCl, 20 mM Tris-Cl, pH 7.4, 5 mM MgCl2 | MgCl | Tris Buffers | 7.4 | Not reported | Biosensor: " Increase in fluorescence. Reagentless biosensors that can directly transduce molecular recognition to optical signals should potentiate the development of sensor arrays for a wide variety of analytes. We have therefore attempted to develop selection methods that couple the broad molecular recognition prope... | null | DNA library/pool was used as a template to generate the RNA pool used in the selection. A T7 promoter sequence might be necessary to use this DNA library/pool as a template to generate the RNA pool in the selection. | 10,000,291 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/29711918/ | Angew Chem Int Ed Engl | https://doi.org/10.1002/1521-3773(20001201)39:23%3C4369::aid-anie4369%3E3.0.co;2-n | Piganeau, N., Jenne, A., Thuillier, V., & Famulok, M. (2000). An Allosteric Ribozyme Regulated by Doxycyline. Angewandte Chemie (International ed. in English), 39(23), 4369–4373. https://doi.org/10.1002/1521-3773(20001201)39:23<4369::AID-ANIE4369>3.0.CO;2-N | ssRNA | 1D16-13 | Doxycyline | 5'GGAGCUCGGUAGUGACGCGUUGUGUUUACGCGUCUGAUGAGUCCUCGGUAAUCGCCGUAUCAAAAGUCGGAAUGGAGGGUCGACGAAACUACCUCGAGACGU3' | 102 | 0.539216 | Ki: 50 ± 30 nM | null | 5′‐CGCGTTGTGTTTACGCGTCTGATGAGT‐N40‐ACGAAACTACCTCGAGACGT-3' | 40 | 40 mM Tris‐HCl, pH 8, 50 mM NaCl, 10 mM spermidine, 8 mM MgCl2 | MgCl | Tris Buffers | 8 | Not reported | Inhibition: " We have applied a novel in vitro selection strategy based on allosteric inhibition of a hammerhead ribozyme fused to a chosen "switch molevule" because it represents a cell-permeable small molecule with low toxicity for higher eukaryotes. Inhibition of doxycycline for the development of conditional gene e... | Not applicable | Additional nucleotides on 5' end of aptamer sequences originate from primer sequence. The original paper reported the sequnce in DNA from and include Thymine. The nonvariable region was pulled from Figure 3. The 5' end of sequence has added nucleotides that aren't present in the pool, but they are present in primers. D... | 10,000,292 | null | Famulok M. , m.famulok@uni-bonn.de; Thuillier V, vincent.thuillier@aventis.com | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10671532/ | J Biol Chem | https://doi.org/10.1074/jbc.275.7.4943 | Hirao, I., Madin, K., Endo, Y., Yokoyama, S., & Ellington, A. D. (2000). RNA aptamers that bind to and inhibit the ribosome-inactivating protein, pepocin. The Journal of biological chemistry, 275(7), 4943–4948. https://doi.org/10.1074/jbc.275.7.4943 | ssRNA | 9-41U22 | Pepocin | 5'GGGAGUCUGAAGUCGGACUCGAUAUCAAUUCACUUCAGACU3' | 41 | 0.463415 | Kd: 17.9 ± 2.2 nM | 17.9 | 5'-GGGAAUGGAUCCACAUCUACGUAUUC-N30-UUCACUGCAGACUUGACGAAGCUU-3' | 30 | 3 mM sodium phosphate, 3 mM MgCl2, 45 mM NaCl, 2.5 mM EDTA, 3 mM Tris-HCl (pH 7.5), 0.15 mM dithiothreitol, and 12% glycerol | MgCl | PBS/phosphate buffers | 7.5 | Not reported | Therapeutic: " bind to the Ribosome Inactivating Protein (RIP) pepocin, which acts as a toxin. The aptame rinhibit the N-glycosidase activity of pepocin on rat liver 28 S rRNA. Competitive binding experiments using aptamer variants suggest that the conserved hairpin region in the anti-pepocin aptamer binds near the cat... | Fragmented 41-mer sequence. | null | 10,000,293 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10671532/ | J Biol Chem | https://doi.org/10.1074/jbc.275.7.4943 | Hirao, I., Madin, K., Endo, Y., Yokoyama, S., & Ellington, A. D. (2000). RNA aptamers that bind to and inhibit the ribosome-inactivating protein, pepocin. The Journal of biological chemistry, 275(7), 4943–4948. https://doi.org/10.1074/jbc.275.7.4943 | ssRNA | 8-14 | Pepocin | 5'GGGAAUGGAUCCACAUCUACGUAUUCAGUCUAGGAAGCAGUCGGACUUGUUAUCAAUUCACUGCAGACUGUACGAAGCUU3' | 80 | 0.45 | Kd: 23.4 ± 2.3 nM | 23.4 | 5'-GGGAAUGGAUCCACAUCUACGUAUUC-N30-UUCACUGCAGACUUGACGAAGCUU-3' | 30 | 3 mM sodium phosphate, 3 mM MgCl2, 45 mM NaCl, 2.5 mM EDTA, 3 mM Tris-HCl (pH 7.5), 0.15 mM dithiothreitol, and 12% glycerol | MgCl | PBS/phosphate buffers | 7.5 | Not reported | Therapeutic: " bind to the Ribosome Inactivating Protein (RIP) pepocin, which acts as a toxin. The aptame rinhibit the N-glycosidase activity of pepocin on rat liver 28 S rRNA. Competitive binding experiments using aptamer variants suggest that the conserved hairpin region in the anti-pepocin aptamer binds near the cat... | Not applicable | null | 10,000,295 | null | Ellington AD, andy.ellington@mail.utexas.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 8 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCTATGAACCAAGGGAGGGGCAGGGCGGGTAGGGTTAATAACGGATTCCGAGCGCCCAGCTCCTGCAGGTCGACGCATGCGCCG3' | 104 | 0.615385 | Kd: 1.1x10^-5 M | 11,000 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,296 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 13 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCACGAAGAAACAGGGCGCTTCGAACGAACATGGGCAGGGTGGGAAGTTTTAAAGTGGTACCTGCAGGTCGACGCATGCGCCG3' | 103 | 0.563107 | Kd: 9.1x10^-6 M | 9,100 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,297 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 14 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCCAGCGTAAGGTCGTGGGTGGTTGGGTGCCTAAGCGTATACTTACAGCGATTGATTTGGTCCTGCAGGTCGACGCATGCGCCG3' | 104 | 0.567308 | Kd: 1.2x10^-4 M | 120,000 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,298 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 20 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCGGTGCGGGTAGGGATGAGGGCGGGTCGGGTTGAGTGTGAGCTTAGGGGTGGCGGATCTACCTGCAGGTCGACGCATGCGCCG3' | 104 | 0.644231 | Kd: 6.3x10^-6 M | 6,300 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,299 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 22 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCCTAGAGTAACCTGTTGGGAGGGCGGGTAGGGCCCATTGAGAGGAGGACGTATTCGTCCGCCTGCAGGTCGACGCATGCGCCG3' | 104 | 0.615385 | Kd: 1.3x10^-5 M | 13,000 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,300 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 26 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCCAATGGGGTCGGGCGGGCCGGGTGTCATGGTGGACGGAGATGGGACGTAGAGGGCGGTCTGCAGGTCGACGCATGCGCCG3' | 102 | 0.666667 | Kd: 1.6x10^-6 M | 1,600 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,301 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | 5'dTpdApdGpdGpdGpdApdApdTpdTpdCpdGpdTpdCpdGpdApdCpdGpdGpdApdTpdCpdCpdCpdApdApdTpdGpdGpdGpdGpdTpdCpdGpdGpdGpdCpdGpdGpdGpdCpdCpdGpdGpdGpdTpdGpdTpdCpdApdTpdGpdGpdTpdGpdGpdApdCpdGpdGpdApdGpdApdTpdGpdGpdGpdApdCpdGpdTpdApdGpdApdGpdGpdGpdCpdGpdGpdTpdCpdTpdGpdCpdApdGpdGpdTpdCpdGpdApdCpdGpdCpdApdTpdGpdCpdGpdCpdCpdGp3'
Aptamer ... |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 30 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCGCGGCAAATCAGCATACGAGTGTACAGGGACGGGACGGGTGGGTAAAAGGTGTCGCCTCAGCTGCAGGTCGACGCATGCGCCG3' | 105 | 0.609524 | Kd: 2.7x10^-6 M | 2,700 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,302 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 32 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCCCAACTTGGGCGGAGGGCTAACGGTGGGGGGATATTATGAGGGGTGGAGGTATTAACCATTCTGCAGGTCGACGCATGCGCCG3' | 105 | 0.580952 | Kd: 9.8x10^-6 M | 9,800 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,303 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 33 | Hematoporphyrin IX (HPIX) | 5'TAGGGAATTCGTCGACGGATCCCCGGGGATTAGAATAGTGGAGGGCCGGTGGCAAATGGGTAAGTAGGTTGAAGGGCTAAATTCTGCAGGTCGACGCATGCGCCG3' | 105 | 0.561905 | Kd: 2.2x10^-4 M | 220,000 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | Not applicable | null | 10,000,304 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11128644/ | Bioorg Med Chem Lett | https://doi.org/10.1016/s0960-894x(00)00540-0 | Okazawa, A., Maeda, H., Fukusaki, E., Katakura, Y., & Kobayashi, A. (2000). In vitro selection of hematoporphyrin binding DNA aptamers. Bioorganic & medicinal chemistry letters, 10(23), 2653–2656. https://doi.org/10.1016/s0960-894x(00)00540-0 | ssDNA | 26-3' | Hematoporphyrin IX (HPIX) | 5'ATGGTGGACGGAGATGGGACGTAG3' | 24 | 0.583333 | Not reported | null | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris±acetate pH 8.0, 200 mM sodium acetate,50 mM potassium acetate, 25 mM magnesium acetate,5% dioxane | null | Tris Buffers | 8 | Not reported | Detection: " In the present study, we selected single-stranded DNAs (ssDNAs) which were capable of binding to hematoporphyrin IX (HPIX) with μM order of dissociation constants. Structural analysis of these aptamers indicated that guanine-rich (G-rich) sequences are necessary for recognition of HPIX. From the CD spectru... | To determine which sequence is necessary to recognize hpix, these two ssdnas were synthesized for aptamer 26 and their binding affinity to hpix was analyzed. | null | 10,000,306 | null | Kobayashi, A, kobayashi@bio.eng.osaka-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10913311/ | Biochemistry | https://doi.org/10.1021/bi000149n | Koizumi, M., & Breaker, R. R. (2000). Molecular recognition of cAMP by an RNA aptamer. Biochemistry, 39(30), 8983–8992. https://doi.org/10.1021/bi000149n | ssRNA | cAMP - b (parent) | Second messenger adenosine 3',5'-cyclic monophosphate (cAMP; 1) | 5'GGAAGAGAUGGCGACUAAAACGACUUGUCGCGUGCUGCCCGCCUGUUCGCUUCUGCACCCCGGCGGUAAGCUUGGCAC3' | 78 | 0.615385 | No reported | null | 5′-GGAAGAGAUGGCGAC-N50-CGGUAAGCUUGGCAC-3' | 50 | 20 mM Tris-HCl (pH 7.5 at 23 °C), 450 mM NaCl, 100 mM KCl, 10 mM MgCl2, 1 mM MnCl2, and 5 mM CaCl2 | MgCl/CaCl | Tris Buffers | 7.5 | Not reported | Detection: " Precise molecular recognition is a hallmark of many natural biological receptors and biocatalysts. A high degree of chemical discrimination is important because receptors and enzymes need to perform biochemical functions only with cognate ligands or substrates from a complex mixture of compounds whose cons... | Not applicable | null | 10,000,307 | null | Breaker, R. R, ronald.breaker@yale.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10913311/ | Biochemistry | https://doi.org/10.1021/bi000149n | Koizumi, M., & Breaker, R. R. (2000). Molecular recognition of cAMP by an RNA aptamer. Biochemistry, 39(30), 8983–8992. https://doi.org/10.1021/bi000149n | ssRNA | cAMP - b | Second messenger adenosine 3',5'-cyclic monophosphate (cAMP; 1) | 5'GGAAGAGAUGGCGACUAAAACGACUUGUCGC3' | 31 | 0.516129 | Kd: 10 uM | 10,000 | 5′-GGAAGAGAUGGCGAC-N50-CGGUAAGCUUGGCAC-3' | 50 | 20 mM Tris-HCl (pH 7.5 at 23 °C), 450 mM NaCl, 100 mM KCl, 10 mM MgCl2, 1 mM MnCl2, and 5 mM CaCl2 | MgCl/CaCl | Tris Buffers | 7.5 | Not reported | Detection: " Precise molecular recognition is a hallmark of many natural biological receptors and biocatalysts. A high degree of chemical discrimination is important because receptors and enzymes need to perform biochemical functions only with cognate ligands or substrates from a complex mixture of compounds whose cons... | Truncation | null | 10,000,308 | null | Breaker, R. R, ronald.breaker@yale.edu | 5'rGprGprAprAprGprAprGprAprUprGprGprCprGprAprCprUprAprAprAprAprCprGprAprCprUprUprGprUprCprGprCp3'
https://www.aptagen.com/aptamer-details/?id=104 |
2,000 | https://pubmed.ncbi.nlm.nih.gov/12903331/ | Nucleic Acids Symp Ser | https://doi.org/10.1093/nass/44.1.187 | Fukusho, S., Furusawa, H., & Okahata, Y. (2000). In vitro selection and analysis of RNA aptamer recognize arginine-rich motif (ARM) model peptide on a QCM. Nucleic acids symposium series, (44), 187–188. https://doi.org/10.1093/nass/44.1.187 | ssRNA | B-2 | R5 helix peptide | 5'GGGAAACUGGAUGGAAUGGGCUCGAUGAAAAUCGACCGUGCGCUGAAAAGCACGCGAGGUCCUGCUGUAAGUGUGCCA3' | 78 | 0.551282 | Kd: 10 nM | 10 | 5'-GGGAAACUGG AUGGAAUGGGCUCG -N30-CGAGGUCCUGCUGUAAGUGUGCCA-3' | 30 | 10 mM HEPES, pH7.5, lOOmMNaCI | null | Other Buffers | null | Not reported | Drug delivery and inhibition: "RNA-binding proteins play a key role in fundamental cellular processes such as translation mRNA processing and early development, and in viral processes on infection by RNA viruses. Understanding RNA-protein interactions is important to study how RNA-binding proteins recognize specificall... | Not applicable | null | 10,000,309 | null | Okahata Y | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10989176/ | J Biotechnol | https://doi.org/10.1016/s0168-1656(00)00290-x | Golden, M. C., Collins, B. D., Willis, M. C., & Koch, T. H. (2000). Diagnostic potential of PhotoSELEX-evolved ssDNA aptamers. Journal of biotechnology, 81(2-3), 167–178. https://doi.org/10.1016/s0168-1656(00)00290-x | ssDNA | 06.50 aptamer | Basic fibroblast growth factor (bFGF(155)), Human | 5'GGGAGGACGATGCGGTGACGTAAGAGTGTAATCGATGCAGCCTGGCAGACGACGAGCGGGA3' | 61 | 0.606557 | Kd: 560 pM | 0.56 | 5'-GGGAGGACGATGCGG-N61-CAGACGACGAGCGGGA-3' | 61 | Nitrocellulose filter binding buffer: 1×PBS/2 mM MgCl2/0.01% HSA/1.0 mM dithiothreitol (DTT) | MgCl | PBS/phosphate buffers | 7.4 | 18 kDa | Diagnostic: " Here, then, is strong evidence in support of the importance of target affinity for PhotoSELEX-evolved diagnostics. These results indicate the feasibility of PhotoSELEX-evolved diagnostics, but they also indicate the importance of identifying the very best photocross-linking aptamers for use in diagnostic ... | Not applicable | null | 10,000,311 | null | Koch TH, tad.koch@colorado.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10989176/ | J Biotechnol | https://doi.org/10.1016/s0168-1656(00)00290-x | Golden, M. C., Collins, B. D., Willis, M. C., & Koch, T. H. (2000). Diagnostic potential of PhotoSELEX-evolved ssDNA aptamers. Journal of biotechnology, 81(2-3), 167–178. https://doi.org/10.1016/s0168-1656(00)00290-x | ssDNA | 06.15 aptamer | Basic fibroblast growth factor (bFGF(155)), Human | 5'GGGAGGACGATGCGGGCGAAGGCACACCGAGTTCATAGTATCCCACAGACGACGAGCGGGA3' | 61 | 0.622951 | Kd: 16 pM | 0.016 | 5'-GGGAGGACGATGCGG-N61-CAGACGACGAGCGGGA-3' | 61 | Nitrocellulose filter binding buffer: 1×PBS/2 mM MgCl2/0.01% HSA/1.0 mM dithiothreitol (DTT) | MgCl | PBS/phosphate buffers | 7.4 | 18 kDa | Diagnostic: " Here, then, is strong evidence in support of the importance of target affinity for PhotoSELEX-evolved diagnostics. These results indicate the feasibility of PhotoSELEX-evolved diagnostics, but they also indicate the importance of identifying the very best photocross-linking aptamers for use in diagnostic ... | Not applicable | null | 10,000,312 | null | Koch TH, tad.koch@colorado.edu | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10743940/ | Bioorg Med Chem Lett | https://doi.org/10.1016/S0960-894X(00)00013-5 | Fukusaki, E., Kato, T., Maeda, H., Kawazoe, N., Ito, Y., Okazawa, A., Kajiyama, S., & Kobayashi, A. (2000). DNA aptamers that bind to chitin. Bioorganic & medicinal chemistry letters, 10(5), 423–425. https://doi.org/10.1016/s0960-894x(00)00013-5 | ssDNA | Chi No 1 | Poly-beta-1,4-N-acetylglucosamine (Chitin) (poly-β-1,6-N-acetyl-D-glucosamine) | 5′TAGGGAATTCGTCGACGGATCCCCCAGCAGCACTGGTAGTGAGGCAGTTCACCGGTGGGGCGGTGAGTTTGGCTGCTATTTATCTCCAGGTCGACGCATGCGCCG3′ | 105 | 0.6 | Binding Efficiency : <1% | null | 5′-TAGGGAATTCGTCGACGGATCC-N59-CTCCAGGTCGACGC-ATGCGCCG-3′ | 59 | 100 mM NaCl, 100 mM KCl, 5 mM MgCl2, 50 mM Tris–acetate (pH 8.0) | MgCl | Tris Buffers | 8 | Not reported | Diagnostic: " Oligosaccharide antigens play essential biological roles in cellular adhesion, molecular recognition, and so on. However, little is known about the interaction concerning oligosaccharide from the viewpoints of its molecular basis. The present study demonstrated that the in vitro selection method is applic... | Not applicable | G-cluster motifs that were sandwiched with palindrome sequences. | 10,000,313 | null | Fukusaki E, fukusaki@bio.eng.osaka.u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10743940/ | Bioorg Med Chem Lett | https://doi.org/10.1016/S0960-894X(00)00013-5 | Fukusaki, E., Kato, T., Maeda, H., Kawazoe, N., Ito, Y., Okazawa, A., Kajiyama, S., & Kobayashi, A. (2000). DNA aptamers that bind to chitin. Bioorganic & medicinal chemistry letters, 10(5), 423–425. https://doi.org/10.1016/s0960-894x(00)00013-5 | ssDNA | Chi No 23 | Poly-beta-1,4-N-acetylglucosamine (Chitin) (poly-β-1,6-N-acetyl-D-glucosamine) | 5′TAGGGAATTCGTCGACGGATCCTGCGCATGTGAAAGGTTGCCTAACTGGACAGGGTTTAGGAGCGACTAGACACAGCTCCAGGTCGACGCATGCGCCG3′ | 98 | 0.571429 | Binding Efficiency : 18% | null | 5′-TAGGGAATTCGTCGACGGATCC-N59-CTCCAGGTCGACGC-ATGCGCCG-3′ | 59 | 100 mM NaCl, 100 mM KCl, 5 mM MgCl2, 50 mM Tris–acetate (pH 8.0) | MgCl | Tris Buffers | 8 | Not reported | Diagnostic: " Oligosaccharide antigens play essential biological roles in cellular adhesion, molecular recognition, and so on. However, little is known about the interaction concerning oligosaccharide from the viewpoints of its molecular basis. The present study demonstrated that the in vitro selection method is applic... | Not applicable | G-cluster motifs that were sandwiched with palindrome sequences. | 10,000,314 | null | Fukusaki E, fukusaki@bio.eng.osaka.u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10743940/ | Bioorg Med Chem Lett | https://doi.org/10.1016/S0960-894X(00)00013-5 | Fukusaki, E., Kato, T., Maeda, H., Kawazoe, N., Ito, Y., Okazawa, A., Kajiyama, S., & Kobayashi, A. (2000). DNA aptamers that bind to chitin. Bioorganic & medicinal chemistry letters, 10(5), 423–425. https://doi.org/10.1016/s0960-894x(00)00013-5 | ssDNA | Chi No 28 | Poly-beta-1,4-N-acetylglucosamine (Chitin) (poly-β-1,6-N-acetyl-D-glucosamine) | 5′TAGGGAATTCGTCGACGGATCCGGCAAGATGTGCCCAGAACAGTTGCTTGTATGGTGGGGAGCGTCCATATTGGCTTAAACCTCCAGGTCGACGCATGCGCCG3' | 103 | 0.563107 | Binding Efficiency : 6% | null | 5′-TAGGGAATTCGTCGACGGATCC-N59-CTCCAGGTCGACGC-ATGCGCCG-3′ | 59 | 100 mM NaCl, 100 mM KCl, 5 mM MgCl2, 50 mM Tris–acetate (pH 8.0) | MgCl | Tris Buffers | 8 | Not reported | Diagnostic: " Oligosaccharide antigens play essential biological roles in cellular adhesion, molecular recognition, and so on. However, little is known about the interaction concerning oligosaccharide from the viewpoints of its molecular basis. The present study demonstrated that the in vitro selection method is applic... | Not applicable | G-cluster motifs that were sandwiched with palindrome sequences. | 10,000,315 | null | Fukusaki E, fukusaki@bio.eng.osaka.u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10743940/ | Bioorg Med Chem Lett | https://doi.org/10.1016/S0960-894X(00)00013-5 | Fukusaki, E., Kato, T., Maeda, H., Kawazoe, N., Ito, Y., Okazawa, A., Kajiyama, S., & Kobayashi, A. (2000). DNA aptamers that bind to chitin. Bioorganic & medicinal chemistry letters, 10(5), 423–425. https://doi.org/10.1016/s0960-894x(00)00013-5 | ssDNA | Chi No 46 | Poly-beta-1,4-N-acetylglucosamine (Chitin) (poly-β-1,6-N-acetyl-D-glucosamine) | 5′TAGGGAATTCGTCGACGGATCCCCGTAACCCTGCGGGGGGGGGAGAAGGCAATGGGGGACAACTCGCCGGTAGCCATCCATATCTCCAGGTCGACGCATGCGCCG3′ | 105 | 0.638095 | Binding Efficiency : 52% | null | 5′-TAGGGAATTCGTCGACGGATCC-N59-CTCCAGGTCGACGC-ATGCGCCG-3′ | 59 | 100 mM NaCl, 100 mM KCl, 5 mM MgCl2, 50 mM Tris–acetate (pH 8.0) | MgCl | Tris Buffers | 8 | Not reported | Diagnostic: " Oligosaccharide antigens play essential biological roles in cellular adhesion, molecular recognition, and so on. However, little is known about the interaction concerning oligosaccharide from the viewpoints of its molecular basis. The present study demonstrated that the in vitro selection method is applic... | Not applicable | G-cluster motifs that were sandwiched with palindrome sequences. | 10,000,316 | null | Fukusaki E, fukusaki@bio.eng.osaka.u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10743940/ | Bioorg Med Chem Lett | https://doi.org/10.1016/S0960-894X(00)00013-5 | Fukusaki, E., Kato, T., Maeda, H., Kawazoe, N., Ito, Y., Okazawa, A., Kajiyama, S., & Kobayashi, A. (2000). DNA aptamers that bind to chitin. Bioorganic & medicinal chemistry letters, 10(5), 423–425. https://doi.org/10.1016/s0960-894x(00)00013-5 | ssDNA | Chi No 52 | Poly-beta-1,4-N-acetylglucosamine (Chitin) (poly-β-1,6-N-acetyl-D-glucosamine) | 5′TAGGGAATTCGTCGACGGATCCCCTAAGGGGGGACTCAGCATTTTGTGCGGGCGGCGCTAACACAATCAGATAGAGCGGGGTTCTCCAGGTCGACGCATGCGCCG3′ | 105 | 0.6 | Binding Efficiency : 73% | null | 5′-TAGGGAATTCGTCGACGGATCC-N59-CTCCAGGTCGACGC-ATGCGCCG-3′ | 59 | 100 mM NaCl, 100 mM KCl, 5 mM MgCl2, 50 mM Tris–acetate (pH 8.0) | MgCl | Tris Buffers | 8 | Not reported | Diagnostic: " Oligosaccharide antigens play essential biological roles in cellular adhesion, molecular recognition, and so on. However, little is known about the interaction concerning oligosaccharide from the viewpoints of its molecular basis. The present study demonstrated that the in vitro selection method is applic... | Not applicable | G-cluster motifs that were sandwiched with palindrome sequences. | 10,000,317 | null | Fukusaki E, fukusaki@bio.eng.osaka.u.ac.jp | 5'dTpdApdGpdGpdGpdApdApdTpdTpdCpdGpdTpdCpdGpdApdCpdGpdGpdApdTpdCpdCpdCpdCpdTpdApdApdGpdGpdGpdGpdGpdGpdApdCpdTpdCpdApdGpdCpdApdTpdTpdTpdTpdGpdTpdGpdCpdGpdGpdGpdCpdGpdGpdCpdGpdCpdTpdApdApdCpdApdCpdApdApdTpdCpdApdGpdApdTpdApdGpdApdGpdCpdGpdGpdGpdGpdTpdTpdCpdTpdCpdCpdApdGpdGpdTpdCpdGpdApdCpdGpdCpdApdTpdGpdCpdGpdCpdCpdGp3'
... |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10786843/ | RNA | https://doi.org/10.1017/s1355838200991763 | Mannironi, C., Scerch, C., Fruscoloni, P., & Tocchini-Valentini, G. P. (2000). Molecular recognition of amino acids by RNA aptamers: the evolution into an L-tyrosine binder of a dopamine-binding RNA motif. RNA (New York, N.Y.), 6(4), 520–527. https://doi.org/10.1017/s1355838200991763 | ssRNA | Tyr 1 | L-tyrosine | 5'GGGAAGCUUGUACAGGGGGCAGUCAACUCGUGCGAUCGUGAAAACGGGGCAAGAUGGCCUUACAGCGGUCAAUACGGGGGUCAUCAGAUAGGGAGGCCCUCCUGGUGGUCCGUUCGGGAUCCUC3' | 124 | 0.596774 | Kd: 35 uM | 35,000 | 5'GGGAATTCCGCGTGTGC-N80-GTCCGTTCGGGATCCTC3' | 80 | 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, and 5 mM MgCl2 | MgCl | Tris Buffers | 7.4 | N/a | Research: " Tyrosie coding triplets are not involved in dopamine recognition; instead, they are selected at the level of the tyrosine binding site, where they appear to be involved in the formation of the tyrosine-binding pocket. Tyrosine aptamer will contribute to further elucidation of the role of codons in RNA–amino... | Mutated sequence selected from a degenerate pool derived from a previous selection | Pool comes from pervious selection paper https://pubmed.ncbi.nlm.nih.gov/9245404/ | 10,000,318 | null | Tocchini-Valentini GP, gtocchini@ibc.rm.cnr.it | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10848986/ | Eur J Biochem | https://doi.org/10.1046/j.1432-1327.2000.01400.x | Fukuda, K., Vishnuvardhan, D., Sekiya, S., Hwang, J., Kakiuchi, N., Taira, K., Shimotohno, K., Kumar, P. K., & Nishikawa, S. (2000). Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease. European journal of biochemistry, 267(12), 3685–3694. https://doi.org/1... | ssRNA | G9-I | Nonstructural protein 3 (NS3) protease active site in the truncated polypeptide ΔNS3, Hepatitis C virus (HCV) | 5'GGGAGAAUUCCGACCAGAAGCUUCGGGAUUUGAGGGUAGAAUGGGACUACCUUUCCUCUCUCCUUCCUCUUCU3' | 73 | 0.506849 | Kd: 11.6 nM | 11.6 | 5'-GGGAGAAUUCCGACCAGAAG-N30-CCUUUCCUCUCUCCUUCCUCUUCU-3' | 30 | 50 mm Tris/HCl (pH 7.8), 30 mm NaCl, 5 mm CaCl2 and 10 mm dithiothreitol | CaCl | Tris Buffers | 7.8 | 25 kDa | Detection: " Nonstructural protein 3 (NS3) from hepatitis C virus (HCV) is a serine protease that provides an essential function in maturation of the virus by cleaving the nonstructural regions of the viral polyprotein. The NS3 protease activity has been identified as a potential target for anti-HCV drugs, because its ... | Not applicable | null | 10,000,319 | null | Nishikawa S, nisikawa@nibh.go.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10848986/ | Eur J Biochem | https://doi.org/10.1046/j.1432-1327.2000.01400.x | Fukuda, K., Vishnuvardhan, D., Sekiya, S., Hwang, J., Kakiuchi, N., Taira, K., Shimotohno, K., Kumar, P. K., & Nishikawa, S. (2000). Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease. European journal of biochemistry, 267(12), 3685–3694. https://doi.org/1... | ssRNA | G9-II | Nonstructural protein 3 (NS3) protease active site in the truncated polypeptide ΔNS3, Hepatitis C virus (HCV) | 5'GGGAGAAUUCCGACCAGAAGUGCUCUUAGAAUGGGACUAAGACACGGGACCCUUUCCUCUCUCCUUCCUCUUCU3' | 74 | 0.513514 | Kd: 6.3 nM | 6.3 | 5'-GGGAGAAUUCCGACCAGAAG-N30-CCUUUCCUCUCUCCUUCCUCUUCU-3' | 30 | 50 mm Tris/HCl (pH 7.8), 30 mm NaCl, 5 mm CaCl2 and 10 mm dithiothreitol | CaCl | Tris Buffers | 7.8 | 25 kDa | Detection: " Nonstructural protein 3 (NS3) from hepatitis C virus (HCV) is a serine protease that provides an essential function in maturation of the virus by cleaving the nonstructural regions of the viral polyprotein. The NS3 protease activity has been identified as a potential target for anti-HCV drugs, because its ... | Not applicable | null | 10,000,320 | null | Nishikawa S, nisikawa@nibh.go.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10848986/ | Eur J Biochem | https://doi.org/10.1046/j.1432-1327.2000.01400.x | Fukuda, K., Vishnuvardhan, D., Sekiya, S., Hwang, J., Kakiuchi, N., Taira, K., Shimotohno, K., Kumar, P. K., & Nishikawa, S. (2000). Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease. European journal of biochemistry, 267(12), 3685–3694. https://doi.org/1... | ssRNA | G9-III | Nonstructural protein 3 (NS3) protease active site in the truncated polypeptide ΔNS3, Hepatitis C virus (HCV) | 5'GGGAGAAUUCCGACCAGAAGUACGACACGAUUGGGACGUGUCUAUGGGACCCUUUCCUCUCUCCUUCCUCUUCU3' | 74 | 0.527027 | Kd: 8.9 nM | 8.9 | 5'-GGGAGAAUUCCGACCAGAAG-N30-CCUUUCCUCUCUCCUUCCUCUUCU-3' | 30 | 50 mm Tris/HCl (pH 7.8), 30 mm NaCl, 5 mm CaCl2 and 10 mm dithiothreitol | CaCl | Tris Buffers | 7.8 | 25 kDa | Detection: " Nonstructural protein 3 (NS3) from hepatitis C virus (HCV) is a serine protease that provides an essential function in maturation of the virus by cleaving the nonstructural regions of the viral polyprotein. The NS3 protease activity has been identified as a potential target for anti-HCV drugs, because its ... | Not applicable | null | 10,000,321 | null | Nishikawa S, nisikawa@nibh.go.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/11132628/ | J Inorg Biochem | https://doi.org/10.1016/s0162-0134(00)00158-6 | Kawakami, J., Imanaka, H., Yokota, Y., & Sugimoto, N. (2000). In vitro selection of aptamers that act with Zn2+. Journal of inorganic biochemistry, 82(1-4), 197–206. https://doi.org/10.1016/s0162-0134(00)00158-6 | ssRNA | clone 31 | Tat protein from HIV-1 in the presence of Zn2+ ion | 5'GGGAGAAUUCCGACCAGAAGCUUUGGUUAUCAUGUUUAUGCGUACGGGCGCCCAUAUGUGCGUCUACAUGGAUCCUCA3' | 78 | 0.5 | Kd: 0.31 uM | 0.31 | 5′-GGGAGAATTCCGACCAGAAGCTT-N30-ATATGTGCGTCTACATGGATCCTCA-3′ | 30 | 2.5 mM Tris–Cl (pH 7.6), 100 mM NaCl, and 2.0 mM MgCl2 or ZnCl2 | MgCl | Tris Buffers | 7.6 | N/a | Inhibition: " An in vitro selection was carried out with Zn2+ to isolate novel RNA molecules, zinc-dependent aptamers, that bind to HIV-1 Tat protein. If an aptamer is bound to a pathogenic protein, the ‘decoy’ aptamer would act as an inhibitor of the protein function. Proteins of AIDS virus (human immunodeficiency vir... | Not applicable | null | 10,000,322 | null | Sugimoto N, sugimoto@konan-u.ac.jp | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10882721/ | J Biol Chem | https://doi.org/10.1074/jbc.M002981200 | Rhodes, A., Deakin, A., Spaull, J., Coomber, B., Aitken, A., Life, P., & Rees, S. (2000). The generation and characterization of antagonist RNA aptamers to human oncostatin M. The Journal of biological chemistry, 275(37), 28555–28561. https://doi.org/10.1074/jbc.M002981200 | 2'-fluoro/O-Me-RNA | ADR58 | Oncostatin M (OSM), Human | 5'GGGAGGACGAUGCGGAUCGCCCUGAACCGGCCCAGCAGACUGCUGACGGCACGAUCAGACGACUCGCCCGA3' | 71 | 0.676056 | Kd: 7 nM | 7 | 5′-GGGAGGACGAUGCGG-N40-CCGCATCGTCCTCCC-3′ | 40 | SCHMK buffer (110 mM NaCl, 1 mM MgCl2, 20 mM HEPES, pH 7.0, 1 mM CaCl2, 5 mM KCl) | MgCl/CaCl | Other Buffers | 7 | 28 kDa | Detection: " Oncostatin M (OSM) is a multifunctional member of the interleukin-6 cytokine family. OSM has been implicated as a powerful proinflammatory mediator and may represent a potentially important, novel therapeutic opportunity for treatment of established rheumatoid arthritis.This aptamer may be used as a tool t... | Not applicable | 2′-Fluoropyrimidine-modified RNA. pyrimidine positions are substituted with 2′ fluorine, and 14 of 18 purine positions have been substituted with 2′ O-methyl to increase stability toward nucleases | 10,000,323 | null | Rhodes A, adr7003@glaxowellcome.co.uk | null |
2,000 | https://pubmed.ncbi.nlm.nih.gov/10882721/ | J Biol Chem | https://doi.org/10.1074/jbc.m002981200 | Rhodes, A., Deakin, A., Spaull, J., Coomber, B., Aitken, A., Life, P., & Rees, S. (2000). The generation and characterization of antagonist RNA aptamers to human oncostatin M. The Journal of biological chemistry, 275(37), 28555–28561. https://doi.org/10.1074/jbc.M002981200 | 2'-fluoro/O-Me-RNA | truncated ADR58 | Oncostatin M (OSM), Human | 5'GAACCGGCCCAGCAGACUGCUGACGGCACGAUC3' | 34 | 0.647059 | Kd: 7 nM | 7 | 5'-GGGAGGACGAUGCGG-N40-CCGCATCGTCCTCCC-3' | 40 | 110 mM NaCl, 1 mM MgCl2, 20 mM HEPES, pH 7.0, 1 mM CaCl2, 5mM KCl | MgCl/CaCl | Other Buffers | 7 | 28 kDa | Detection: " Oncostatin M (OSM) is a multifunctional member of the interleukin-6 cytokine family. OSM has been implicated as a powerful proinflammatory mediator and may represent a potentially important, novel therapeutic opportunity for treatment of established rheumatoid arthritis.This aptamer may be used as a tool t... | The truncated aptamer contains a 3'-3' thymidine cap at the 3' end | 2′-Fluoropyrimidine-modified RNA; reported no loss in affinity from full sequence. All pyrimidine positions contain a 2' fluoro modification, and all purine positions are 2' O-methyl except the 3rd position A, 22nd position G, 23rd position A, and 31st position A, which are 2' hydroxy. | 10,000,324 | null | Rhodes A, adr7003@glaxowellcome.co.uk | null |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11457319/ | J Am Chem Soc | https://doi.org/10.1021/ja0038171 | Stojanovic, M. N., de Prada, P., & Landry, D. W. (2001). Aptamer-based folding fluorescent sensor for cocaine. Journal of the American Chemical Society, 123(21), 4928–4931. https://doi.org/10.1021/ja0038171 | ssDNA | F7-9D | Cocaine | 5'GACAAGGAAAATCCTTCAATGAAGTGGGTC3' | 30 | 0.433333 | Kd ∼ 100 µM | 100,000 | Not reported | null | Selection buffer (c(TRIS) = 20 mM, pH 7.4, c(NaCl) = 140 mM, c(KCl) = 5 mM) | null | Tris Buffers | 7.4 | Not reported | Detection and Biosensor: " We engineered anti-cocaine aptamer MNS-7.9 to obtain a partially folded structure with a ligand-induced binding pocket based on terminal stem-closure. The ability of this sensor to operate in serum suggests that this design can provide a new set of analytical tools for clinical chemistry: rap... | null | All aptamers were custom-synthesized and HPLC or gel-purified by Integrated DNA Technologies, Iowa, U.S.A, and were used as received.
Sensor F7.9D signals the presence of cocaine in solution by conformational change that approximates 5′ and 3′ ends ((F fluorescein | 10,000,325 | null | Landry, D. W, E-mail: dwl1@columbia.edu, Stojanovic, M. N, E-mail: mns18@columbia.edu | null |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11457319/ | J Am Chem Soc | https://doi.org/10.1021/ja0038171 | Stojanovic, M. N., de Prada, P., & Landry, D. W. (2001). Aptamer-based folding fluorescent sensor for cocaine. Journal of the American Chemical Society, 123(21), 4928–4931. https://doi.org/10.1021/ja0038171 | ssDNA | MNS-4.1 | Cocaine | 5'GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCGACA3' | 38 | 0.473684 | Kd ∼ 20 µM | 20,000 | Not reported | null | Selection buffer (c(TRIS) = 20 mM, pH 7.4, c(NaCl) = 140 mM, c(KCl) = 5 mM) | null | Tris Buffers | 7.4 | Not reported | Detection and Biosensor: " We engineered anti-cocaine aptamer MNS-7.9 to obtain a partially folded structure with a ligand-induced binding pocket based on terminal stem-closure. The ability of this sensor to operate in serum suggests that this design can provide a new set of analytical tools for clinical chemistry: rap... | null | All aptamers were custom-synthesized and HPLC or gel-purified by Integrated DNA Technologies, Iowa, U.S.A, and were used as received.
Anti-cocaine aptamer MNS-4.1 bound to cocaine 1 (black elipsoid). | 10,000,326 | null | Landry, D. W, E-mail: dwl1@columbia.edu, Stojanovic, M. N, E-mail: mns18@columbia.edu | 5'dGpdGpdGpdApdGpdApdCpdApdApdGpdGpdApdApdApdApdTpdCpdCpdTpdTpdCpdApdApdTpdGpdApdApdGpdTpdGpdGpdGpdTpdCpdGpdApdCpdAp3'
Binding affinity is different
https://www.aptagen.com/aptamer-details/?id=418 |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11668446/ | Biotechnol Bioeng | https://doi.org/10.1002/bit.10078 | Teramoto, N., Ichinari, H., Kawazoe, N., Imanishi, Y., & Ito, Y. (2001). Peroxidase activity of in vitro-selected 2'-amino RNAs. Biotechnology and bioengineering, 75(4), 463–468. https://doi.org/10.1002/bit.10078 | 2'-amino-RNA | Clone 30 | N-methyl mesoporphyrin IX (NMM) | 5'UAGGGAAUUCGUCGACGGAUCCAGUUCACUCGACCAAGGCGUCCCAAGCGGAGGAUCGCAAGGAGGUGUAGACGUCUGCAGGUCGACGCAUGCGCCG3' | 97 | 0.608247 | Kd: 0.66 μM | 660 | 5'-TAGGGAATTCGTCGACGGATCC-N59-CTGCAGGTCGACGCATGCGCCG-3' | 59 | 100 mM Tris-acetate (pH 7.4), 200 mM NaOAc, 25 mM KOAc,10 mM Mg(OAc)2, 0.5% Triton X-100, and 5% DSMO | null | Tris Buffers | 7.4 | 580.7 | Bisosensor: " Peroxidase activities of RNAs containing 2'-amino groups, which were selected as aptamers binding to N-methylmesoporphyrin IX, were investigated. Some clones promoted the oxidation reaction of 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) with hydrogen peroxide (H(2)O(2)) in the presence of... | Not applicable | RNA is modified with 2' amino groups (2'-AmCTP) | 10,000,328 | null | Ito Y, ito@bio.tokushima-u.ac.jp | null |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11329270/ | Biochemistry | https://doi.org/10.1021/bi001941r | Zhai, G., Iskandar, M., Barilla, K., & Romaniuk, P. J. (2001). Characterization of RNA aptamer binding by the Wilms' tumor suppressor protein WT1. Biochemistry, 40(7), 2032–2040. https://doi.org/10.1021/bi001941r | ssRNA | RNA20 | WT1-ZFP & WT1[+KTS]-ZFP (two zinc finger isoforms of the WT1 DNA binding domain) | 5'GGGGCCACCAACGACAUUGACGAAUGCGUAAAUUGCUAGGUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG3' | 78 | 0.525641 | Kd: 87.4 ± 10.4 nM (WT1-ZFP) & 69.8 ± 8.4 nM (WT1[+KTS]-ZFP) | 87.4 | 5'-GGGGCCACCAACGACAUU-N20-GUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG-3' | 20 | 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 100 mM KCl, 1 mM DTT, 5 μM ZnCl2, 5 μg/mL poly[d(I-C)], and 100 μg/mL bovine serum albumin | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Wilms’ tumor is a pediatric kidney malignancy that occurs with a frequency of 1 in 10000 (1, 2). The WT1 locus on chromosome 11p13 encodes a tumor suppressor protein that is inactivated in a subtype of Wilms’ tumors. The role of RNA sequence and secondary structure in the binding of WT1-ZFP was probed by si... | Not applicable | null | 10,000,329 | null | Romaniuk PJ, pjr@uvic.ca | null |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11329270/ | Biochemistry | https://doi.org/10.1021/bi001941r | Zhai, G., Iskandar, M., Barilla, K., & Romaniuk, P. J. (2001). Characterization of RNA aptamer binding by the Wilms' tumor suppressor protein WT1. Biochemistry, 40(7), 2032–2040. https://doi.org/10.1021/bi001941r | ssRNA | RNA22 | WT1-ZFP & WT1[+KTS]-ZFP (two zinc finger isoforms of the WT1 DNA binding domain) | 5'GGGGCCACCAACGACAUUGAUAUGGUGACCACCCCGGCGUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG3' | 77 | 0.584416 | Kd: 13.8 ± 1.1 nM (WT1-ZFP) & 22.8 ± 2.3 nM (WT1[+KTS]-ZFP) | 13.8 | 5'-GGGGCCACCAACGACAUU-N20-GUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG-3' | 20 | 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 100 mM KCl, 1 mM DTT, 5 μM ZnCl2, 5 μg/mL poly[d(I-C)], and 100 μg/mL bovine serum albumin | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Wilms’ tumor is a pediatric kidney malignancy that occurs with a frequency of 1 in 10000 (1, 2). The WT1 locus on chromosome 11p13 encodes a tumor suppressor protein that is inactivated in a subtype of Wilms’ tumors. The role of RNA sequence and secondary structure in the binding of WT1-ZFP was probed by si... | Not applicable | null | 10,000,330 | null | Romaniuk PJ, pjr@uvic.ca | null |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11329270/ | Biochemistry | https://doi.org/10.1021/bi001941r | Zhai, G., Iskandar, M., Barilla, K., & Romaniuk, P. J. (2001). Characterization of RNA aptamer binding by the Wilms' tumor suppressor protein WT1. Biochemistry, 40(7), 2032–2040. https://doi.org/10.1021/bi001941r | ssRNA | RNA38 | WT1-ZFP & WT1[+KTS]-ZFP (two zinc finger isoforms of the WT1 DNA binding domain) | 5'GGGGCCACCAACGACAUUAUCACCCACCCCGAGCUGGCGUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG3' | 77 | 0.597403 | Kd: 17.8 ± 1.4 nM (WT1-ZFP) & 33.7 ± 4.4 nM (WT1[+KTS]-ZFP) | 17.8 | 5'-GGGGCCACCAACGACAUU-N20-GUUGAUAUAAAUAGUGCCCAUGGAUCCGCGGGUGUCGGG-3' | 20 | 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 100 mM KCl, 1 mM DTT, 5 μM ZnCl2, 5 μg/mL poly[d(I-C)], and 100 μg/mL bovine serum albumin | MgCl | Tris Buffers | 7.5 | Not reported | Research: " Wilms’ tumor is a pediatric kidney malignancy that occurs with a frequency of 1 in 10000 (1, 2). The WT1 locus on chromosome 11p13 encodes a tumor suppressor protein that is inactivated in a subtype of Wilms’ tumors. The role of RNA sequence and secondary structure in the binding of WT1-ZFP was probed by si... | Not applicable | null | 10,000,331 | null | Romaniuk PJ, pjr@uvic.ca | null |
2,001 | https://pubmed.ncbi.nlm.nih.gov/11478897/ | Biochemistry | https://doi.org/10.1021/bi020276e | Wen, J. D., & Gray, D. M. (2002). The Ff gene 5 single-stranded DNA-binding protein binds to the transiently folded form of an intramolecular G-quadruplex. Biochemistry, 41(38), 11438–11448. https://doi.org/10.1021/bi020276e | ssDNA | I-3 | Ff gene 5 protein (g5p) | 5‘CGGGATCCAACGTTTTGGGGTCAGGCTGGGGTTGTGCAGGTCAAGAGGCAGAATTCGC3‘ | 58 | 0.586207 | Kωapp at 10 mM NaCl: 3.0 ± 0.7 (10-5 M-1)
Kωapp at 200 mM NaCl: >300 (10-5 M-1) | null | 5‘-CGGGATCCAACGTTTT-N26-AAGAGGCAGAATTCGC-3‘ | 26 | 200 mM NaCl at 37 °C for 15 min in TE buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA) | null | Tris Buffers | 7.4 | Not reported | Research: " We present the first application of SELEX using a cooperative ssDNA binding protein, the Ff g5p. The g5p binds with a large, positive cooperativity factor, ω, so that the protein tends to saturate all nucleic acid sequences. Nevertheless, our results show that the SELEX strategy can be used to efficiently s... | Not applicable | null | 10,000,332 | null | Gray DM, dongray@utdallas.edu | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.