Unnamed: 0 int64 0 350k | level_0 int64 0 351k | ApplicationNumber int64 9.75M 96.1M | ArtUnit int64 1.6k 3.99k | Abstract stringlengths 1 8.37k | Claims stringlengths 3 292k | abstract-claims stringlengths 68 293k | TechCenter int64 1.6k 3.9k |
|---|---|---|---|---|---|---|---|
343,300 | 344,174 | 16,755,227 | 1,746 | A method for controlling a liftgate of a motor vehicle in order to automatically move the liftgate from a closed position into an open position or from the open position into the closed position, wherein to move the liftgate a first and a second drive unit are activated, which each couple the liftgate to a motor vehicl... | 1. A method for controlling a liftgate of a motor vehicle in order to automatically move the liftgate from a closed position into an open position or from the open position into the closed position, wherein to move the liftgate a first and a second drive unit are activated, which each couple the liftgate to a motor veh... | A method for controlling a liftgate of a motor vehicle in order to automatically move the liftgate from a closed position into an open position or from the open position into the closed position, wherein to move the liftgate a first and a second drive unit are activated, which each couple the liftgate to a motor vehicl... | 1,700 |
343,301 | 344,175 | 16,755,226 | 1,746 | The present invention relates to methods for increasing the concentration of anthranilic acid tolerated by a given microbial cell by limiting the concentration of ammonia in the culture medium. | 1.-13. (canceled) 14. A method for cultivating at least one microbial cell capable of converting a fermentable substrate into oAB in the presence of the fermentable substrate while maintaining its metabolic activity, wherein the culture medium has a concentration of ammonia which does not exceed 200 mM and a concentrat... | The present invention relates to methods for increasing the concentration of anthranilic acid tolerated by a given microbial cell by limiting the concentration of ammonia in the culture medium.1.-13. (canceled) 14. A method for cultivating at least one microbial cell capable of converting a fermentable substrate into o... | 1,700 |
343,302 | 344,176 | 16,755,239 | 1,746 | This photovoltaic system is composed of a plurality of units of photovoltaic apparatuses collected together, each performing an operation of tracking the sun during daytime. The system includes: drive control units provided so as to correspond to the respective units of photovoltaic apparatuses; inverters provided so a... | 1. A photovoltaic system composed of a plurality of units of photovoltaic apparatuses collected together, each apparatus performing an operation of tracking the sun during daytime, the system comprising:
drive control units provided so as to correspond to the respective units of photovoltaic apparatuses; inverters prov... | This photovoltaic system is composed of a plurality of units of photovoltaic apparatuses collected together, each performing an operation of tracking the sun during daytime. The system includes: drive control units provided so as to correspond to the respective units of photovoltaic apparatuses; inverters provided so a... | 1,700 |
343,303 | 344,177 | 16,755,241 | 1,746 | The production method includes arranging, on an inner surface of a lower mold 3, a fiber-reinforced resin base material 1 obtained by impregnating a matrix resin into reinforcing fibers; filling a core space 5 of the mold, in which the fiber-reinforced resin base material 1 is arranged, with a powder mixture 2a that ha... | 1. A production method for a fiber-reinforced resin molded object, the method comprising:
arranging, on an inner surface of a mold, a fiber-reinforced resin base material obtained by impregnating reinforcing fibers with a matrix resin; filling a core space of the mold, in which the fiber-reinforced resin base material ... | The production method includes arranging, on an inner surface of a lower mold 3, a fiber-reinforced resin base material 1 obtained by impregnating a matrix resin into reinforcing fibers; filling a core space 5 of the mold, in which the fiber-reinforced resin base material 1 is arranged, with a powder mixture 2a that ha... | 1,700 |
343,304 | 344,178 | 16,755,229 | 1,746 | A method for producing silica-coated spherical silicone elastomer particles which includes a step in which a tetraalkoxysilane (E) is added to a liquid comprising spherical silicone elastomer particles (A), an alkaline substance (B), one or more ingredients (C) selected from among cationic surfactants and cationic wate... | 1. A method for producing silica-coated spherical silicone elastomer particles that have a volume-mean particle size of from 0.1 to 100 μm and are made of spherical silicone elastomer particles coated on surfaces thereof with silica in a ratio of from 0.5 to 200 parts by weight of the silica per 100 parts by weight of ... | A method for producing silica-coated spherical silicone elastomer particles which includes a step in which a tetraalkoxysilane (E) is added to a liquid comprising spherical silicone elastomer particles (A), an alkaline substance (B), one or more ingredients (C) selected from among cationic surfactants and cationic wate... | 1,700 |
343,305 | 344,179 | 16,755,231 | 1,746 | A method for manufacturing a crosslinked polyolefin separator and a separator are provided. The method includes putting a polyolefin and a polyolefin elastomer into an extruder first, and putting an alkoxy silane containing a carbon-carbon double bond functional group, an initiator and a crosslinking catalyst to form t... | 1. A method for manufacturing a crosslinked polyolefin separator, comprising:
(S1) introducing a polyolefin, a polyolefin elastomer and a first diluent into an extruder; (S2) introducing a second diluent, an alkoxy silane containing a carbon-carbon double bond functional group, an initiator and a crosslinking catalyst ... | A method for manufacturing a crosslinked polyolefin separator and a separator are provided. The method includes putting a polyolefin and a polyolefin elastomer into an extruder first, and putting an alkoxy silane containing a carbon-carbon double bond functional group, an initiator and a crosslinking catalyst to form t... | 1,700 |
343,306 | 344,180 | 16,755,250 | 1,647 | Provided is a method of combination therapy for prevention or treatment of cancer bone metastasis comprising administering to a patient in need thereof a therapeutically effective amount of an anti-Jagged1 antibody or an antigen-binding fragment thereof and a chemotherapeutic agent. The combination therapy achieves an ... | 1. A method of treating cancer bone metastases comprising administering to a patient in need thereof a therapeutically effective amount of an anti-Jagged1 antibody or antigen-binding fragment thereof and a chemotherapeutic agent, wherein the anti-Jagged1 antibody or antigen-binding fragment thereof targets both tumor-d... | Provided is a method of combination therapy for prevention or treatment of cancer bone metastasis comprising administering to a patient in need thereof a therapeutically effective amount of an anti-Jagged1 antibody or an antigen-binding fragment thereof and a chemotherapeutic agent. The combination therapy achieves an ... | 1,600 |
343,307 | 344,181 | 16,755,238 | 1,647 | The followings are included: a capacitive sensor (101) having a detection region that extends in a parallel direction with respect to an operation surface (301) for accepting a 3D gesture by an operation body, the detection region being in an area close to the operation surface (301); and an infrared sensor (102) havin... | 1. A proximity detection device comprising:
at least one capacitive sensor having a detection region that extends in a parallel direction with respect to an operation surface for accepting a 3D gesture by an operation body, the detection region being in an area close to the operation surface; and at least one infrared ... | The followings are included: a capacitive sensor (101) having a detection region that extends in a parallel direction with respect to an operation surface (301) for accepting a 3D gesture by an operation body, the detection region being in an area close to the operation surface (301); and an infrared sensor (102) havin... | 1,600 |
343,308 | 344,182 | 16,755,223 | 1,647 | The present invention is concerned with a garment revival product comprising: a garment revival composition; and a hand-held spray device which is manually operable to produce a spray of said composition; said composition comprising one or more fabric tactility modifiers. | 1. A garment revival product comprising: a garment revival composition contained in a hand-held spray device, the device being manually operable to produce a spray of the composition; the composition comprising one or more fabric tactility modifiers characterised in that, following actuation the spray has a duration in... | The present invention is concerned with a garment revival product comprising: a garment revival composition; and a hand-held spray device which is manually operable to produce a spray of said composition; said composition comprising one or more fabric tactility modifiers.1. A garment revival product comprising: a garme... | 1,600 |
343,309 | 344,183 | 16,755,196 | 1,647 | The invention relates to a door lock with a locking element (1) for locking the door (3) in a closed state and a fastening element (2) for fastening the locking element (1) to the door (3), wherein that the fastening element (2) has an adjustable adjustment device (4) to compensate for different door thicknesses. | 1-12. (canceled) 13. A door lock with a locking element for locking the door in a closed state and a fastening element for fastening the locking element to the door, wherein the fastening element has an adjustable adjustment device to compensate for different door thicknesses, wherein the adjustment device has at least... | The invention relates to a door lock with a locking element (1) for locking the door (3) in a closed state and a fastening element (2) for fastening the locking element (1) to the door (3), wherein that the fastening element (2) has an adjustable adjustment device (4) to compensate for different door thicknesses.1-12. ... | 1,600 |
343,310 | 344,184 | 16,755,208 | 2,814 | A highly reliable semiconductor device is provided. The semiconductor device includes a first insulator; a first oxide provided over the first insulator; a second oxide provided over the first oxide; a first conductor and a second conductor provided apart from each other over the second oxide; a third oxide provided ov... | 1. A semiconductor device comprising:
a first insulator; a first oxide provided over the first insulator; a second oxide provided over the first oxide; a first conductor and a second conductor provided apart from each other over the second oxide; a third oxide provided over the second oxide, the first conductor, and th... | A highly reliable semiconductor device is provided. The semiconductor device includes a first insulator; a first oxide provided over the first insulator; a second oxide provided over the first oxide; a first conductor and a second conductor provided apart from each other over the second oxide; a third oxide provided ov... | 2,800 |
343,311 | 344,185 | 16,755,230 | 2,814 | An information update apparatus that updates first information stored in a vehicle control apparatus to second information. The information update apparatus includes: a download control unit that receives an update package including an update body that is a difference between the first information and the second inform... | 1. An information update apparatus that updates first information stored in a vehicle control apparatus to second information, the information update apparatus comprising:
a download control unit that receives an update package including an update body that is a difference between the first information and the second i... | An information update apparatus that updates first information stored in a vehicle control apparatus to second information. The information update apparatus includes: a download control unit that receives an update package including an update body that is a difference between the first information and the second inform... | 2,800 |
343,312 | 344,186 | 16,755,258 | 2,814 | An oxide superconducting wire connection structure includes: a connection target wire including a first oxide superconducting wire that includes a first superconducting layer on a first substrate; and a connection superconducting wire including a second superconducting wire that includes a second superconducting layer ... | 1. An oxide superconducting wire connection structure, comprising:
a connection target wire comprising a first oxide superconducting wire that comprises a first superconducting layer on a first substrate; and a connection superconducting wire comprising a second superconducting wire that comprises a second superconduct... | An oxide superconducting wire connection structure includes: a connection target wire including a first oxide superconducting wire that includes a first superconducting layer on a first substrate; and a connection superconducting wire including a second superconducting wire that includes a second superconducting layer ... | 2,800 |
343,313 | 344,187 | 16,755,267 | 2,814 | A single-wheel drive component for a motor vehicle, having a drive assembly and a wheel carrier, on which a wheel hub, which can be driven by the drive assembly, is rotatably mounted by a wheel bearing. At least one assembly support for mounting the drive assembly on a body of the motor vehicle originates from the driv... | 1-10. (canceled) 11. A single-wheel drive component for a motor vehicle, comprising:
a drive assembly and a wheel carrier, on which a wheel hub, which can be driven by the drive assembly, is rotatably mounted by a wheel bearing, wherein at least one assembly support for mounting the drive assembly on a body of the moto... | A single-wheel drive component for a motor vehicle, having a drive assembly and a wheel carrier, on which a wheel hub, which can be driven by the drive assembly, is rotatably mounted by a wheel bearing. At least one assembly support for mounting the drive assembly on a body of the motor vehicle originates from the driv... | 2,800 |
343,314 | 344,188 | 16,755,257 | 1,648 | Disclosed herein is a composition comprising a nucleic acid sequence encoding a Mayaro Virus antigen that elicits an immune response in a mammal. Also disclosed herein is a nucleic acid sequence encoding an anti-Mayaro Virus antibody, a fragment thereof, a variant thereof. Also disclosed herein is a method of generatin... | 1. An immunological composition comprising a nucleic acid molecule comprising a nucleotide sequence encoding a Mayaro virus (MAYV) antigen. 2. The immunological composition of claim 1, wherein the MAYV antigen comprises an antigen selected from the group consisting of MAYV-E1, MAYV-E2, MAYV-E3, MAYV-6K and MAYV-Capsid ... | Disclosed herein is a composition comprising a nucleic acid sequence encoding a Mayaro Virus antigen that elicits an immune response in a mammal. Also disclosed herein is a nucleic acid sequence encoding an anti-Mayaro Virus antibody, a fragment thereof, a variant thereof. Also disclosed herein is a method of generatin... | 1,600 |
343,315 | 344,189 | 16,755,275 | 1,615 | A solid antimicrobial hydrogel comprising a first amphiphilic component. The first amphiphilic component, in its chemically cross-linked state, being a lyotropic liquid crystal and having an ordered nanostructure of hydrophobic and hydrophilic domains, the composition further comprising an antimicrobial agent being cov... | 1. A solid antimicrobial hydrogel comprising a first cross-linkable amphiphilic component, said first amphiphilic component, in its chemically cross-linked state, being a lyotropic liquid crystal and having an ordered nanostructure of hydrophobic and hydrophilic domains, the hydrogel comprising an antimicrobial agent c... | A solid antimicrobial hydrogel comprising a first amphiphilic component. The first amphiphilic component, in its chemically cross-linked state, being a lyotropic liquid crystal and having an ordered nanostructure of hydrophobic and hydrophilic domains, the composition further comprising an antimicrobial agent being cov... | 1,600 |
343,316 | 344,190 | 16,755,265 | 1,615 | A pharmaceutical composition comprising cloxacillin for use as a medicament for the prevention of bacterial biofilm formation. Use of cloxacillin for the prevention and/or inhibition of bacterial biofilm formation on a surface. | 1. A method for inhibiting the formation and/or development of a biofilm on a surface, the method comprising:
applying cloxacillin at a concentration from 25 mg/kg on the surface. 2. The method of claim 1, wherein the concentration is from 25 mg/kg to 100 mg/kg. 3. The method of claim 1, wherein the surface is an abiot... | A pharmaceutical composition comprising cloxacillin for use as a medicament for the prevention of bacterial biofilm formation. Use of cloxacillin for the prevention and/or inhibition of bacterial biofilm formation on a surface.1. A method for inhibiting the formation and/or development of a biofilm on a surface, the me... | 1,600 |
343,317 | 344,191 | 16,755,276 | 1,615 | A method of generating a centroid set of mutually repulsing centroids for segmenting a vast social graph is disclosed. Each object of a collection of tracked objects of the social graph is characterized by a respective descriptor vector of multiple descriptor types. Starting with an empty centroid set, an object joins ... | 1-4. (canceled) 5. A method of generating centroids of a plurality of objects comprising:
specifying an affinity threshold and employing a processor to execute instructions for:
acquiring a descriptor vector of v variables, v>1, for each object of said plurality of objects;
initializing a centroid set to include an obj... | A method of generating a centroid set of mutually repulsing centroids for segmenting a vast social graph is disclosed. Each object of a collection of tracked objects of the social graph is characterized by a respective descriptor vector of multiple descriptor types. Starting with an empty centroid set, an object joins ... | 1,600 |
343,318 | 344,192 | 16,755,294 | 1,615 | A separator for a lithium battery having (a) a porous polymeric layer, such as a polyethylene layer; and (b) a nanoporous inorganic particle/polymer layer on both sides of the polymeric layer, the nanoporous layer having an inorganic oxide and one or more polymers; the volume fraction of the polymers in the nanoporous ... | 1-16. (canceled) 17. A separator for use in a lithium battery comprising:
(a) a porous polymeric layer comprising a polyolefin, and (b) a nanoporous layer adjacent at least one of two opposing sides of said porous polymeric layer, said nanoporous layer comprising inorganic oxide particles and one or more polymers, wher... | A separator for a lithium battery having (a) a porous polymeric layer, such as a polyethylene layer; and (b) a nanoporous inorganic particle/polymer layer on both sides of the polymeric layer, the nanoporous layer having an inorganic oxide and one or more polymers; the volume fraction of the polymers in the nanoporous ... | 1,600 |
343,319 | 344,193 | 16,755,273 | 1,615 | The present invention relates to unmanned aerial vehicle for agricultural field assessment. It is described to fly (210) an unmanned aerial vehicle to a location in a field containing a crop. A camera is mounted on the unmanned aerial vehicle at a location vertically separated from a body of the unmanned aerial vehicle... | 1. An unmanned aerial vehicle (10) for agricultural field assessment, comprising:
a control unit (20); and a camera (30); wherein, the camera is mounted on the unmanned aerial vehicle at a location vertically separated from a body (40) of the unmanned aerial vehicle, and wherein the vertical separation between the came... | The present invention relates to unmanned aerial vehicle for agricultural field assessment. It is described to fly (210) an unmanned aerial vehicle to a location in a field containing a crop. A camera is mounted on the unmanned aerial vehicle at a location vertically separated from a body of the unmanned aerial vehicle... | 1,600 |
343,320 | 344,194 | 16,755,283 | 1,615 | The invention generally concerns the production of defective Adenovirus helper viruses for producing a recombinant adeno-associated virus (rAAV), wherein the Adenovirus helper virus contains at least one mutation selected from (a) an inactivating mutation in the transcription unit coding for the L4-100K protein; (b) an... | 1. A method for producing a recombinant adeno-associated virus (rAAV), said method comprising the steps of:
(1) providing a suitable host cell containing at least one rAAV construct, (2) infecting said host cell with a life-cycle-defective Adenovirus helper virus selected from
(a) an Adenovirus helper virus containing ... | The invention generally concerns the production of defective Adenovirus helper viruses for producing a recombinant adeno-associated virus (rAAV), wherein the Adenovirus helper virus contains at least one mutation selected from (a) an inactivating mutation in the transcription unit coding for the L4-100K protein; (b) an... | 1,600 |
343,321 | 344,195 | 16,755,270 | 1,615 | The present invention relates to the production of o-aminobenzoic acid from fermentable substrates using microbial cells and alkali-containing bases during fermentation | 1.-14. (canceled) 15. A method for cultivating a microbial cell in the presence of at least 30 g/l ortho-aminobenzoate (oAB) comprising the step of adding ions of alkali metals to the culture medium so that the molar ratio of alkali metal ions and oAB is in the range between 0.75 and 1.25. 16. The method of claim 15, w... | The present invention relates to the production of o-aminobenzoic acid from fermentable substrates using microbial cells and alkali-containing bases during fermentation1.-14. (canceled) 15. A method for cultivating a microbial cell in the presence of at least 30 g/l ortho-aminobenzoate (oAB) comprising the step of addi... | 1,600 |
343,322 | 344,196 | 16,755,307 | 1,615 | Provided herein are methods, therapeutic agents and composition for treating a CNS-related disorder. | 1. A method for treating a CNS-related condition or disorder in a subject in need thereof, the method comprising administering to the subject a membrane progesterone receptor (mPR) agonist, wherein the mPR agonist is not progesterone, 5α-DHP, allopregnanolone or testosterone. 2. The method of claim 1, wherein the mPR a... | Provided herein are methods, therapeutic agents and composition for treating a CNS-related disorder.1. A method for treating a CNS-related condition or disorder in a subject in need thereof, the method comprising administering to the subject a membrane progesterone receptor (mPR) agonist, wherein the mPR agonist is not... | 1,600 |
343,323 | 344,197 | 16,755,295 | 1,615 | The deployable solar tracker system comprises a single-axis solar tracker (1) including a plurality of foldable panel array sections (10, 10 a). Each foldable panel array section (10, 10 a) comprises a shaft section (11), a plurality of support ribs (12) hinged to the shaft section (11), a plurality of solar panels (13... | 1. A deployable solar tracker system comprising a single-axis solar tracker including a plurality of foldable panel array sections, each foldable panel array section comprising:
a shaft section; a plurality of paired support ribs arranged at opposite sides of said shaft section (11) and hinged to the shaft section; and... | The deployable solar tracker system comprises a single-axis solar tracker (1) including a plurality of foldable panel array sections (10, 10 a). Each foldable panel array section (10, 10 a) comprises a shaft section (11), a plurality of support ribs (12) hinged to the shaft section (11), a plurality of solar panels (13... | 1,600 |
343,324 | 344,198 | 16,755,302 | 1,615 | A collapsible shower cubicle (1) comprises a ceiling unit (23), a base unit (24), and a linking mechanism (40). The ceiling unit (23) is rotatable about an upper axis (9) between a raised extended position and a lowered retracted position, the ceiling unit (23) substantially extending horizontally from the upper axis (... | 1. A collapsible shower cubicle comprising:
a ceiling unit rotatable about an upper axis between a raised extended position and a lowered retracted position, the ceiling unit substantially extending horizontally from the upper axis when the ceiling unit is in its extended position; a base unit rotatable about a lower a... | A collapsible shower cubicle (1) comprises a ceiling unit (23), a base unit (24), and a linking mechanism (40). The ceiling unit (23) is rotatable about an upper axis (9) between a raised extended position and a lowered retracted position, the ceiling unit (23) substantially extending horizontally from the upper axis (... | 1,600 |
343,325 | 344,199 | 16,755,300 | 1,615 | A signal processing device according to an exemplary aspect of the present invention includes: at least one memory storing a set of instructions; and at least one processor configured to execute the set of instructions to: extract, from a target signal, a feature amount of the target signal; repeatedly calculate, based... | 1. A signal processing device comprising:
at least one memory storing a set of instructions; and at least one processor configured to execute the set of instructions to: extract, from a target signal, a feature amount representing a feature of the target signal; repeatedly calculate, based on the extracted feature amou... | A signal processing device according to an exemplary aspect of the present invention includes: at least one memory storing a set of instructions; and at least one processor configured to execute the set of instructions to: extract, from a target signal, a feature amount of the target signal; repeatedly calculate, based... | 1,600 |
343,326 | 344,200 | 16,755,306 | 1,649 | The present invention belongs to the field of medicinal preparations, and more particularly relates to preparation and application of a natural nanoparticle-drug composition for Alzheimer's disease (AD) therapy. A technical problem solved by the present invention is to construct the natural nanoparticle-drug compositio... | 1. A natural nanoparticle-drug composition for treating Alzheimer's disease, wherein the natural nanoparticle-drug composition for treating Alzheimer's disease has brain targeting ability and amyloid protein targeting ability, and by a total mass of a prescription, content of natural nanoparticles accounts for 50-99% o... | The present invention belongs to the field of medicinal preparations, and more particularly relates to preparation and application of a natural nanoparticle-drug composition for Alzheimer's disease (AD) therapy. A technical problem solved by the present invention is to construct the natural nanoparticle-drug compositio... | 1,600 |
343,327 | 344,201 | 16,755,260 | 1,649 | Embodiments of the present disclosure provide methods, apparatus and computer program products for network function service discovery. A method implemented at a second network node in a wireless core network with service based architecture comprises: receiving a registration request for network function instance from a... | 1. A method implemented at a second network node in a wireless core network with service based architecture, comprising:
receiving a registration request for network function instance from a network function, the registration request comprising information identifying a subscriber group to which the network function in... | Embodiments of the present disclosure provide methods, apparatus and computer program products for network function service discovery. A method implemented at a second network node in a wireless core network with service based architecture comprises: receiving a registration request for network function instance from a... | 1,600 |
343,328 | 344,202 | 16,755,289 | 2,467 | To consider a structure in which a radio module of a separate base station is extended/designed to have upper layer processing functions, as well as an RF processing function, the present invention defines a new fronthaul interface to reduce the fronthaul capacity required for transmitting data and a signal by a radio ... | 1. A base station device comprising:
a radio module configured to perform an RF processing function and a processing function in a physical layer (PHY layer); and a communication module connected to the radio module and configured to perform a higher layer processing function with respect to the processing function per... | To consider a structure in which a radio module of a separate base station is extended/designed to have upper layer processing functions, as well as an RF processing function, the present invention defines a new fronthaul interface to reduce the fronthaul capacity required for transmitting data and a signal by a radio ... | 2,400 |
343,329 | 344,203 | 16,755,287 | 2,467 | An information processing apparatus (2000) acquires state information representing states of persons, for a first person and a second person associated with the first person. The information processing apparatus (2000) determines whether a predetermined condition regarding states of the first person and the second pers... | 1. An information processing apparatus comprising:
determination unit acquiring state information representing states of persons regarding a first person and a second person, and determining whether a predetermined condition regarding states of the first person and the second person is satisfied by using state informat... | An information processing apparatus (2000) acquires state information representing states of persons, for a first person and a second person associated with the first person. The information processing apparatus (2000) determines whether a predetermined condition regarding states of the first person and the second pers... | 2,400 |
343,330 | 344,204 | 16,755,256 | 2,467 | To optimize content of a webpage in a manner that depends on whether or not a user has linked accounts to each other. The solving means is an information processing apparatus including a storage unit, a communication unit, and a control unit. The storage unit stores information regarding a first account of each of a pl... | 1. An information processing apparatus, comprising:
a storage configured to store
information regarding a first account of each of a plurality of users and
first content and second content to be placed on a webpage;
communication circuitry configured to communicate with a user terminal of the user; and control circuit... | To optimize content of a webpage in a manner that depends on whether or not a user has linked accounts to each other. The solving means is an information processing apparatus including a storage unit, a communication unit, and a control unit. The storage unit stores information regarding a first account of each of a pl... | 2,400 |
343,331 | 344,205 | 16,755,305 | 2,467 | One embodiment provides method comprising forecasting energy consumption of a consumer located in a first geographical location utilizing an artificial intelligence (AI) smart device, forecasting energy production in an environment of the consumer utilizing the AI smart device, and balancing the energy consumption with... | 1. A method comprising:
at an artificial intelligence (AI) smart device:
receiving, via one or more sensor units, context information related to an environment of a consumer located in a first geographical location;
forecasting energy consumption of the consumer based in part on the context information;
forecasting ene... | One embodiment provides method comprising forecasting energy consumption of a consumer located in a first geographical location utilizing an artificial intelligence (AI) smart device, forecasting energy production in an environment of the consumer utilizing the AI smart device, and balancing the energy consumption with... | 2,400 |
343,332 | 344,206 | 16,755,309 | 2,185 | Disclosed herein is a laboratory equipment interface comprising at least one communication interface for receiving information from a plurality of animal laboratory device. The laboratory equipment interface comprises a communications interface for communicating with a remote data store. The laboratory equipment interf... | 1. A laboratory equipment interface comprising:
at least one communication interface for receiving information from an animal laboratory device; a communications interface for communicating with a remote data store; and a processor configured to generate an information transmission unit comprising empirical information... | Disclosed herein is a laboratory equipment interface comprising at least one communication interface for receiving information from a plurality of animal laboratory device. The laboratory equipment interface comprises a communications interface for communicating with a remote data store. The laboratory equipment interf... | 2,100 |
343,333 | 344,207 | 16,755,255 | 2,185 | The disclosure is directed to dantrolene prodrugs, compositions thereof, and methods of their use in the treatment of disease. | 1. A compound of formula I 2. The compound of claim 1, wherein R is —P(O)(OH)2. 3. The compound of claim 1, wherein R is P(O)(OR1)(OR2). 4. The compound of claim 3, wherein R1 is H. 5. The compound of claim 3, wherein R1 is —C1-26alkyl. 6. The compound of claim 3, wherein R1 is aryl. 7. The compound of claim 3, wherein... | The disclosure is directed to dantrolene prodrugs, compositions thereof, and methods of their use in the treatment of disease.1. A compound of formula I 2. The compound of claim 1, wherein R is —P(O)(OH)2. 3. The compound of claim 1, wherein R is P(O)(OR1)(OR2). 4. The compound of claim 3, wherein R1 is H. 5. The compo... | 2,100 |
343,334 | 344,208 | 16,755,312 | 1,649 | Retinal progenitors and mature photoreceptor cells can be produced by differentiating human embryonic stem cells on a surface having a laminin matrix thereon made of two laminins One laminin is laminin-521, and the other laminin is either laminin-323 or laminin-523. Stem cells plated on this substrate can be differenti... | 1. A photoreceptor progenitor cell, wherein a Day 26-34 gene profile indicates that:
(A) at least one of genes CRX, C11orf96, NXPH4, NTS, DCT, PRDM1, NEUROD4, S100A13, RCVRN, FAM57B, SYT4, DLL3, SSTR2, CHRNA5, and ROBO2 is expressed; or (B) at least one of genes STMN2, ONECUT2, ATOH7, ELAVL4, and GAP43 is expressed; or... | Retinal progenitors and mature photoreceptor cells can be produced by differentiating human embryonic stem cells on a surface having a laminin matrix thereon made of two laminins One laminin is laminin-521, and the other laminin is either laminin-323 or laminin-523. Stem cells plated on this substrate can be differenti... | 1,600 |
343,335 | 344,209 | 16,755,323 | 2,684 | Disclosed herein is a system (10) for storing a plurality of information items on a radio frequency identification (RFID) tag (12). In this but not all embodiments, the RFID tag (12) is attached to an animal (15). The system (10) comprises a processor (12). The processor (12) comprises non-transitory processor readable... | 1. A method comprising the steps of:
electronically selecting a plurality of information items from an electronic data store; electronically determining a plurality of compressed code values for the electronically selected plurality of information items; and sending, for writing to a memory of a radio frequency identif... | Disclosed herein is a system (10) for storing a plurality of information items on a radio frequency identification (RFID) tag (12). In this but not all embodiments, the RFID tag (12) is attached to an animal (15). The system (10) comprises a processor (12). The processor (12) comprises non-transitory processor readable... | 2,600 |
343,336 | 344,210 | 16,755,337 | 2,684 | A culture chamber for a rotary bioreactor includes a central chamber and an elongate channel having a channel entrance configured to receive bubbles from the central chamber. The elongate channel surrounds a majority of the central chamber. A method for removing bubbles from a cell culture is also disclosed. | 1. A culture chamber for a rotary bioreactor comprising:
a central chamber; an elongate channel comprising a channel entrance configured to receive bubbles from the central chamber; wherein the elongate channel surrounds a majority of the central chamber. 2. The culture chamber of claim 1, wherein the channel entrance ... | A culture chamber for a rotary bioreactor includes a central chamber and an elongate channel having a channel entrance configured to receive bubbles from the central chamber. The elongate channel surrounds a majority of the central chamber. A method for removing bubbles from a cell culture is also disclosed.1. A cultur... | 2,600 |
343,337 | 344,211 | 16,755,321 | 2,684 | A label strip is provided including a first band and a second band, a label which is optionally provided with a protrusion at each end of the length thereof, wherein each of the first and second bands is provided with a cut out, wherein the first and second bands are located parallel to each other with a gap therebetwe... | 1. A label strip, comprising:
a first band and a second band, wherein the first band has a width and a thickness and the second band has a width and a thickness, and wherein the thicknesses of the first and second bands are substantially the same; a label, wherein the label has a width, a length and a thickness; wherei... | A label strip is provided including a first band and a second band, a label which is optionally provided with a protrusion at each end of the length thereof, wherein each of the first and second bands is provided with a cut out, wherein the first and second bands are located parallel to each other with a gap therebetwe... | 2,600 |
343,338 | 344,212 | 16,755,327 | 2,684 | A fuel treatment system for effecting reduced emissions when combusting the fuel comprises a fuel treatment device comprising an inlet connectable to a main fuel tank and an outlet for supplying treated fuel. The fuel treatment device comprises a treatment section between said inlet and outlet, and a pump for pumping t... | 1. A fuel treatment system for effecting reduced emissions when combusting the fuel, the fuel treatment system comprising:
a fuel treatment device comprising an inlet configured to be in fluid communication with a main fuel tank for receiving original fuel from the main fuel tank, an outlet for supplying treated fuel, ... | A fuel treatment system for effecting reduced emissions when combusting the fuel comprises a fuel treatment device comprising an inlet connectable to a main fuel tank and an outlet for supplying treated fuel. The fuel treatment device comprises a treatment section between said inlet and outlet, and a pump for pumping t... | 2,600 |
343,339 | 344,213 | 16,755,313 | 2,684 | The invention relates to a method for partial hardening of a steel sheet by cold deformation, where the partial hardening of a steel is done by a cold deformation with a multi-step rolling and annealing process and in order to have a steel sheet with a homogeneous thickness steel sheet is used with at least two areas h... | 1. Method for partial hardening of a steel by cold deformation characterized in that a multi-step rolling and annealing process in order to have a steel sheet with a homogeneous thickness is used with at least two areas having different values in mechanical and/or physical properties in longitudinal direction of the ma... | The invention relates to a method for partial hardening of a steel sheet by cold deformation, where the partial hardening of a steel is done by a cold deformation with a multi-step rolling and annealing process and in order to have a steel sheet with a homogeneous thickness steel sheet is used with at least two areas h... | 2,600 |
343,340 | 344,214 | 16,755,317 | 2,684 | Fluid mixing and distribution device for a downflow catalytic reactor, the said device comprising a mixing zone comprising at least one fluid-mixing space of length L1′ and a fluid-exchange space of length L2′, situated underneath and superposed with said mixing space, it being understood that the length L2′ of the sai... | 1. A device for mixing and distributing fluids for a downflow catalytic reactor, said device comprising:
at least one collecting zone (A) comprising at least one collecting means (5); at least one substantially vertical collecting pipe (7) that is able to receive a reaction fluid collected by said collecting means (5) ... | Fluid mixing and distribution device for a downflow catalytic reactor, the said device comprising a mixing zone comprising at least one fluid-mixing space of length L1′ and a fluid-exchange space of length L2′, situated underneath and superposed with said mixing space, it being understood that the length L2′ of the sai... | 2,600 |
343,341 | 344,215 | 16,755,322 | 2,684 | The present invention relates to the use of pea starch to replace egg white in texturised seafood analogue products. The invention also relates to a texturised seafood analogue product substantially free of egg white comprising pea starch and potato starch. The invention further relates to a method of preparation of sa... | 1. A texturised seafood analogue product substantially free of egg white comprising from 0.5 to 10 wt. % of pea starch and from 0.5 to 10 wt. % of potato starch, based on the total weight of the product, wherein the egg white is present in less than 1 wt. % based on the total weight of the product. 2. The texturised se... | The present invention relates to the use of pea starch to replace egg white in texturised seafood analogue products. The invention also relates to a texturised seafood analogue product substantially free of egg white comprising pea starch and potato starch. The invention further relates to a method of preparation of sa... | 2,600 |
343,342 | 344,216 | 16,755,331 | 2,684 | Disclosed herein are polymeric products, along with masterbatches and methods of making polymeric films, sheets, and extruded articles from the masterbatches, in which the films and polymeric products exhibit layer-like morphology and retain good barrier properties to a permeant of interest. The masterbatches include o... | 1. A method of forming a polymeric body having enhanced barrier properties to a permeant of interest, comprising:
providing a masterbatch comprising from 30 to 70 weight percent of a structural polymer, from 30 to 70 weight percent of a barrier polymer for the permeant of interest, and from about 3 to about 10 weight p... | Disclosed herein are polymeric products, along with masterbatches and methods of making polymeric films, sheets, and extruded articles from the masterbatches, in which the films and polymeric products exhibit layer-like morphology and retain good barrier properties to a permeant of interest. The masterbatches include o... | 2,600 |
343,343 | 344,217 | 16,755,370 | 1,644 | The present invention relates to a method of screening highly efficiently stem cells using the protein marker GRP78, and more particularly, to a method of removing old stem cells with decreased expression of GRP78 and isolating only highly efficient stem cells. The use of the protein marker GRP78 according to the prese... | 1. A method of isolating highly efficient stem cells using an antibody or aptamer specific for GRP78. 2. The method of claim 1, comprising steps of:
(a) binding a GRP78-specific primary antibody to stem cells; (b) binding a secondary antibody-immobilized magnetic bead to the primary antibody; and (c) isolating GRP78-ex... | The present invention relates to a method of screening highly efficiently stem cells using the protein marker GRP78, and more particularly, to a method of removing old stem cells with decreased expression of GRP78 and isolating only highly efficient stem cells. The use of the protein marker GRP78 according to the prese... | 1,600 |
343,344 | 344,218 | 16,755,365 | 1,644 | Coated inorganic expanding agent particles comprise a core of an inorganic expanding agent and a sol/gel-formed coating comprising a mixed oxide of two or more metals and/or metalloids, in particular a mixed oxide of silicon and at least one metal and/or metalloid selected from aluminum, boron, titanium, zirconium and ... | 1. Coated inorganic expanding agent particles comprising a core or a plurality of cores of an inorganic expanding agent and a sol/gel-formed coating comprising a mixed oxide of two or more metals and/or metalloids. 2. The coated inorganic expanding agent particles of claim 1, wherein the inorganic expanding agent accou... | Coated inorganic expanding agent particles comprise a core of an inorganic expanding agent and a sol/gel-formed coating comprising a mixed oxide of two or more metals and/or metalloids, in particular a mixed oxide of silicon and at least one metal and/or metalloid selected from aluminum, boron, titanium, zirconium and ... | 1,600 |
343,345 | 344,219 | 16,755,352 | 1,644 | A support housing for use in distributing fuel in a gas turbine engine includes a main body defining an inlet aperture, a plurality of outlet apertures, and a substantially planar mounting surface. A first fuel channel has a wall that defines a first flow space and a support member extends across the first flow space a... | 1. A support housing for use in distributing fuel in a gas turbine engine, the support housing comprising:
a main body defining an inlet aperture, a plurality of outlet apertures, and a substantially planar mounting surface; a first fuel channel having a wall that defines a first flow space; and a support member extend... | A support housing for use in distributing fuel in a gas turbine engine includes a main body defining an inlet aperture, a plurality of outlet apertures, and a substantially planar mounting surface. A first fuel channel has a wall that defines a first flow space and a support member extends across the first flow space a... | 1,600 |
343,346 | 344,220 | 16,755,361 | 1,644 | A method for disinfecting surfaces within a volumetric space using a peracid. The peracid is formed in a reaction layer in situ on the surface by sequentially dispersing a first composition comprising a peroxide compound and a first composition comprising an organic acid compound onto the surface, thereby preventing th... | 1. A method of disinfecting a surface in need of disinfecting within a volumetric space, comprising the steps of:
a) dispensing onto the surface a first aqueous composition comprising a first peracid reactant compound that is either a peroxide compound or an organic acid compound capable of reacting with a peroxide com... | A method for disinfecting surfaces within a volumetric space using a peracid. The peracid is formed in a reaction layer in situ on the surface by sequentially dispersing a first composition comprising a peroxide compound and a first composition comprising an organic acid compound onto the surface, thereby preventing th... | 1,600 |
343,347 | 344,221 | 16,755,347 | 1,644 | Driving an electromotor and a brushed electromotor in particular results in ripples in the supply current. The amount of pulses is proportional to the amount of revolutions of the rotor of the electromotor. With a flawless motor, the amount of pulses is the same with each revolution. Flaws of the electromotor, in brush... | 1. A methods of providing information on an annular position of a DC electromotor, the method comprising:
monitoring electrical supply parameters including a supply current for the DC electromotor and obtaining at least one value of at least one monitored parameter; determining an expected pulse moment at which a pulse... | Driving an electromotor and a brushed electromotor in particular results in ripples in the supply current. The amount of pulses is proportional to the amount of revolutions of the rotor of the electromotor. With a flawless motor, the amount of pulses is the same with each revolution. Flaws of the electromotor, in brush... | 1,600 |
343,348 | 344,222 | 16,755,342 | 1,644 | This disclosure relates to oligonucleotides, compositions and methods useful for reducing LDHA expression, particularly in hepatocytes. | 1. An oligonucleotide for reducing expression of LDHA, the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sense strand having a sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 2). 2. The oligonucleotide of claim 1, wherein... | This disclosure relates to oligonucleotides, compositions and methods useful for reducing LDHA expression, particularly in hepatocytes.1. An oligonucleotide for reducing expression of LDHA, the oligonucleotide comprising an antisense strand having a sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 1) and a sens... | 1,600 |
343,349 | 344,223 | 16,755,359 | 1,644 | The present invention provides an epidermal penetration type ink composition comprising: a fluorescent colorant containing at least one selected from the group consisting of indocyanine green (ICG), cyanine, phthalocyanine, oxazine, rhodamine, and a mixture thereof; a binder resin containing at least one of polyvinylpy... | 1. An epidermal penetration type ink composition comprising:
a fluorescent colorant including at least one selected form the group consisting of indocyanine green (ICG), cyanine, phthalocyanine, oxazine, rhodamine, and a mixture thereof; a binder resin including at least one of polyvinylpyrrolidone (PVP) and polyvinyl ... | The present invention provides an epidermal penetration type ink composition comprising: a fluorescent colorant containing at least one selected from the group consisting of indocyanine green (ICG), cyanine, phthalocyanine, oxazine, rhodamine, and a mixture thereof; a binder resin containing at least one of polyvinylpy... | 1,600 |
343,350 | 344,224 | 16,755,371 | 1,644 | The invention relates to a solid dosage form comprising a core-shell structure comprising two or more different active agents, wherein the core-shell structure comprises (1) a core comprising a first matrix formulation, the first matrix formulation comprising at least one active agent selected from the group of an acti... | 1. A solid oral extended release dosage form comprising a core-shell structure comprising an active agent (A) and an active agent (B), wherein the core-shell structure comprises
(1) a core comprising a first matrix formulation, the first matrix formulation comprising at least one active agent selected from active agent... | The invention relates to a solid dosage form comprising a core-shell structure comprising two or more different active agents, wherein the core-shell structure comprises (1) a core comprising a first matrix formulation, the first matrix formulation comprising at least one active agent selected from the group of an acti... | 1,600 |
343,351 | 344,225 | 16,755,357 | 1,644 | The disclosure relates to a heat transfer assembly for a rotary regenerative heat exchanger. The assembly includes a rotor arranged between at least two separated fluid flow passages passing flow axially through the rotor, where each flow passage is connected to a sector part of the rotor. The assembly further includes... | 1. A heat transfer assembly for a rotary regenerative heat exchanger, comprising:
a rotor arranged between at least two separated fluid flow passages passing flow axially through the rotor, each flow passage connected to a sector part of the rotor; and a plurality of channels in said rotor for flowing a fluid through s... | The disclosure relates to a heat transfer assembly for a rotary regenerative heat exchanger. The assembly includes a rotor arranged between at least two separated fluid flow passages passing flow axially through the rotor, where each flow passage is connected to a sector part of the rotor. The assembly further includes... | 1,600 |
343,352 | 344,226 | 16,755,329 | 1,644 | Disclosed herein is an RFID tag insertion cartridge comprising a hollow needle in which an RFID tag is disposed. The cartridge comprises an optional housing in the form of a shell that is shown transparently. The cartridge comprises a carriage that is movably mounted and to which the hollow needle is attached for withd... | 1. An RFID tag insertion cartridge comprising:
a hollow needle in which an RFID tag is disposed; a carriage that is movably mounted and to which the hollow needle is attached for withdrawing the needle; and a stop pin disposed in the hollow needle for stopping an inward movement of the RFID tag when the needle is withd... | Disclosed herein is an RFID tag insertion cartridge comprising a hollow needle in which an RFID tag is disposed. The cartridge comprises an optional housing in the form of a shell that is shown transparently. The cartridge comprises a carriage that is movably mounted and to which the hollow needle is attached for withd... | 1,600 |
343,353 | 344,227 | 16,755,387 | 1,748 | The present invention relates to a process for improving the strechability of films comprising high amounts of microfibrillated cellulose (MFC) without negatively impacting the oxygen barrier properties. According to the present invention, a film is formed from a suspension comprising microfibrillated cellulose having ... | 1. A method of manufacturing an oxygen barrier film comprising:
providing an MFC suspension comprising at least 75 weight % microfibrillated cellulose (MFC), as calculated on the total solid content of said suspension, which MFC has a particle size distribution based on volume exhibiting a D50 value of between 25-40 μm... | The present invention relates to a process for improving the strechability of films comprising high amounts of microfibrillated cellulose (MFC) without negatively impacting the oxygen barrier properties. According to the present invention, a film is formed from a suspension comprising microfibrillated cellulose having ... | 1,700 |
343,354 | 344,228 | 16,755,364 | 1,748 | The present disclosure relates to a primer coating material composition, obtainable by combining at least two components (A) and (B) of a coating material system, which are different from one another and present separately from one another, with component (B) being nonaqueous and including at least one polyisocyanate h... | 1. A method of at least partial application of a primer coating material composition, the method comprising at least partially applying the primary coating material composition to at least one optionally pretreated surface of a plastics substrate, the primer coating material composition obtainable by combining at least... | The present disclosure relates to a primer coating material composition, obtainable by combining at least two components (A) and (B) of a coating material system, which are different from one another and present separately from one another, with component (B) being nonaqueous and including at least one polyisocyanate h... | 1,700 |
343,355 | 344,229 | 16,755,388 | 1,748 | A motor vehicle fastening system for fastening a first motor vehicle component to a second motor vehicle component by a fastening device is provided. The fastening device includes a bolt element, a screw-on element and a tolerance element. The bolt element is connected to the second motor vehicle component in a rotatio... | 1. A motor vehicle fastening system comprising:
a first motor vehicle component; a second motor vehicle component including at least one threaded bore; and at least one fastening device detachably fastening the first motor vehicle component to the second motor vehicle component, the at least one fastening device includ... | A motor vehicle fastening system for fastening a first motor vehicle component to a second motor vehicle component by a fastening device is provided. The fastening device includes a bolt element, a screw-on element and a tolerance element. The bolt element is connected to the second motor vehicle component in a rotatio... | 1,700 |
343,356 | 344,230 | 16,755,389 | 1,748 | A subassembly includes a belt reel for a seat belt retractor and a drive wheel on which a belt tensioner can act to drive the belt reel in a winding direction of the seat belt, wherein between the drive wheel and the belt reel there is provided an overload clutch which includes plural shear elements, especially shear p... | 1. A subassembly comprising:
a belt reel for a seat belt retractor; and a drive wheel on which a belt tensioner can act to drive the belt reel in a winding direction of the seat belt, wherein between the drive wheel and the belt reel there is provided an overload clutch which includes plural shear elements, especially ... | A subassembly includes a belt reel for a seat belt retractor and a drive wheel on which a belt tensioner can act to drive the belt reel in a winding direction of the seat belt, wherein between the drive wheel and the belt reel there is provided an overload clutch which includes plural shear elements, especially shear p... | 1,700 |
343,357 | 344,231 | 16,755,348 | 2,483 | The present disclosure relates to an imaging device, an image processing apparatus, an image processing method, and a program by which the versatility of an imaging device is improved. The imaging device includes a semiconductor substrate, a plurality of directive pixel output units formed on the semiconductor substrat... | 1. An imaging device comprising:
a semiconductor substrate; a plurality of directive pixel output units formed on the semiconductor substrate and having a configuration for receiving incident light from an imaging target entering without intervention of any of an imaging lens and a pinhole, the configuration being oper... | The present disclosure relates to an imaging device, an image processing apparatus, an image processing method, and a program by which the versatility of an imaging device is improved. The imaging device includes a semiconductor substrate, a plurality of directive pixel output units formed on the semiconductor substrat... | 2,400 |
343,358 | 344,232 | 16,755,375 | 2,483 | An optical semiconductor device of the invention includes: a semiconductor substrate; an optical communication unit that is provided on the semiconductor substrate, as a light receiving unit for receiving an optical signal or a light emitting unit for emitting an optical signal; an interlayer film that covers the semic... | 1-16. (canceled) 17. An optical semiconductor device which comprises a first light transceiver provided with a first semiconductor substrate and a second light transceiver provided with a second semiconductor substrate, and in which optical signal communication is established mutually between these transceivers,
said f... | An optical semiconductor device of the invention includes: a semiconductor substrate; an optical communication unit that is provided on the semiconductor substrate, as a light receiving unit for receiving an optical signal or a light emitting unit for emitting an optical signal; an interlayer film that covers the semic... | 2,400 |
343,359 | 344,233 | 16,755,376 | 2,483 | High performance modules for use in System-in-Package (SIP) devices, and methods of manufacture for such modules and SIPs. The modules employ one or more interposer substrates on which high performance components and/or devices are operatively mounted and interconnected. | 1. A high performance module for a System-in-Package, SIP, device comprising:
an interposer substrate having a top surface and a bottom surface; a first high speed component mounted on said top surface; and a second high speed component mounted on said bottom surface; wherein said first and second high speed components... | High performance modules for use in System-in-Package (SIP) devices, and methods of manufacture for such modules and SIPs. The modules employ one or more interposer substrates on which high performance components and/or devices are operatively mounted and interconnected.1. A high performance module for a System-in-Pack... | 2,400 |
343,360 | 344,234 | 16,755,381 | 2,483 | The present disclosure relates to a process for preparing polyurethane moldings, including the steps of providing a reaction mixture (M), including at least one polyisocyanate, and at least one component with two functional groups which are reactive towards isocyanates, introducing the reaction mixture (M) into a mold ... | 1. A process for preparing polyurethane moldings, comprising the steps
(i) providing a reaction mixture (M), comprising at least one polyisocyanate, and at least one component with two functional groups which are reactive towards isocyanates, (ii) introducing the reaction mixture (M) into a mold; (iii) allowing the rea... | The present disclosure relates to a process for preparing polyurethane moldings, including the steps of providing a reaction mixture (M), including at least one polyisocyanate, and at least one component with two functional groups which are reactive towards isocyanates, introducing the reaction mixture (M) into a mold ... | 2,400 |
343,361 | 344,235 | 16,755,368 | 2,697 | An imaging section 121 (221) includes a plurality of pixel output units that receive subject light that enters without going through an imaging lens and a pinhole. Output pixels of at least two of the plurality of pixel output units differ in incident angle directivity as a result of modulation of the incident angle di... | 1. An information processing apparatus comprising:
an image conversion section adapted to generate a restored image by using pixel outputs other than that of a defective pixel output unit, the pixel outputs being produced by an imaging device that includes a plurality of pixel output units that receive subject light th... | An imaging section 121 (221) includes a plurality of pixel output units that receive subject light that enters without going through an imaging lens and a pinhole. Output pixels of at least two of the plurality of pixel output units differ in incident angle directivity as a result of modulation of the incident angle di... | 2,600 |
343,362 | 344,236 | 16,755,374 | 2,697 | A cooking apparatus includes a cooking plate including a cooking area divided into a plurality of sub-areas; a plurality of induction heating coil groups installed at a bottom of the cooking plate to correspond to the plurality of sub-areas; and a plurality of drive assemblies configured to supply a driving current to ... | 1. A cooking apparatus comprising:
a cooking plate including a cooking area divided into a plurality of sub-areas; a plurality of induction heating coil groups installed at a bottom of the cooking plate so as to correspond to each of the plurality of sub-areas; a plurality of drive assemblies configured to supply a dri... | A cooking apparatus includes a cooking plate including a cooking area divided into a plurality of sub-areas; a plurality of induction heating coil groups installed at a bottom of the cooking plate to correspond to the plurality of sub-areas; and a plurality of drive assemblies configured to supply a driving current to ... | 2,600 |
343,363 | 344,237 | 16,755,345 | 2,697 | The present embodiment relates to a device for driving pixels arranged on a display panel, and a data driving device according to the present embodiment can transmit image data to a plurality of channel groups by including two or more mapping units for mapping the image data to a channel link or by using one data mappi... | 1. A data driving device for driving pixels arranged on a display panel, comprising:
a data receiving circuit to receive image data through one communication link and to distribute the image data to transmit it through N (N is a natural number, which is 2 or higher) internal links; a first data mapping circuit to recei... | The present embodiment relates to a device for driving pixels arranged on a display panel, and a data driving device according to the present embodiment can transmit image data to a plurality of channel groups by including two or more mapping units for mapping the image data to a channel link or by using one data mappi... | 2,600 |
343,364 | 344,238 | 16,755,333 | 2,697 | A friction material composition containing a binder, an organic filler, an inorganic filler and a fibrous base material, wherein the friction material composition either contains no copper as an element or has a content of copper as an element that does not exceed 0.5% by mass, contains α-alumina and γ-alumina in a mas... | 1. A friction material composition comprising a binder, an organic filler, an inorganic filler and a fibrous base material, wherein:
the friction material composition either comprises no copper as an element or has a content of copper as an element that does not exceed 0.5% by mass, the friction material composition co... | A friction material composition containing a binder, an organic filler, an inorganic filler and a fibrous base material, wherein the friction material composition either contains no copper as an element or has a content of copper as an element that does not exceed 0.5% by mass, contains α-alumina and γ-alumina in a mas... | 2,600 |
343,365 | 344,239 | 16,755,332 | 2,697 | A chemical analysis machine comprising a liquid phase chromatograph comprising, in turn, a chromatography nano-column with an inner diameter that is smaller than or equal to 100 μm, a mass spectrometer with an electronic ionization source, and a joining assembly interposed between the liquid phase chromatograph and the... | 1. A chemical analysis machine comprising a liquid phase chromatograph comprising, in turn, a chromatography nano-column with an inner diameter that is smaller than or equal to 100 μm, an electronic ionization mass spectrometer, and a joining assembly interposed between the liquid phase chromatograph and the electronic... | A chemical analysis machine comprising a liquid phase chromatograph comprising, in turn, a chromatography nano-column with an inner diameter that is smaller than or equal to 100 μm, a mass spectrometer with an electronic ionization source, and a joining assembly interposed between the liquid phase chromatograph and the... | 2,600 |
343,366 | 344,240 | 16,755,366 | 2,697 | A method and a device are provided for installing a wire guide on a torch head, which is used in a coating system that applies thermal coatings, in a positionally accurate manner while also simplifying and making reproducible the adjustment of the position of the wire guide, thereby reducing the work effort that is nee... | 1. A method for installing a wire guide on a torch head for a coating system for thermal coating in a positionally accurate manner, including:
using an image capture device that is disposed in a first predetermined spatial relationship with respect to the torch head to capture an image that includes at least one portio... | A method and a device are provided for installing a wire guide on a torch head, which is used in a coating system that applies thermal coatings, in a positionally accurate manner while also simplifying and making reproducible the adjustment of the position of the wire guide, thereby reducing the work effort that is nee... | 2,600 |
343,367 | 344,241 | 16,755,343 | 2,697 | A control method is provided, including: obtaining input information, where the input information includes a capacitance signal and report point coordinates generated when a user performs an operation on a terminal screen; using report point coordinates in a previous frame as report point coordinates in a current frame... | 1. A control method comprising:
obtaining input information, wherein the input information comprises a capacitance signal and report point coordinates that are generated based on a user operation on a terminal screen; and using report point coordinates in a previous frame as report point coordinates in a current frame ... | A control method is provided, including: obtaining input information, where the input information includes a capacitance signal and report point coordinates generated when a user performs an operation on a terminal screen; using report point coordinates in a previous frame as report point coordinates in a current frame... | 2,600 |
343,368 | 344,242 | 16,755,397 | 2,697 | An imaging apparatus of the present disclosure includes: a first switch that couples a first light-receiving device and a first charge accumulation section to each other; a second switch that couples a predetermined node and the first charge accumulation section to each other; a third switch that applies a predetermine... | 1. An imaging apparatus comprising:
a first light-receiving device and a second light-receiving device; a first charge accumulation section and a second charge accumulation section; a first switch that is turned to an on state to couple the first light-receiving device and the first charge accumulation section to each ... | An imaging apparatus of the present disclosure includes: a first switch that couples a first light-receiving device and a first charge accumulation section to each other; a second switch that couples a predetermined node and the first charge accumulation section to each other; a third switch that applies a predetermine... | 2,600 |
343,369 | 344,243 | 16,755,398 | 2,697 | Method and apparatus for producing RFID transponders (400) arranged on a carrying substrate, comprising:providing a first substrate (100), the first substrate having at least one antenna element (101) arranged thereon, and preferably several antenna elements arranged sequentially thereon along a longitudinal extension ... | 1. A method for producing radio-frequency identification (RFID) transponders arranged on a carrying substrate, comprising:
providing a first substrate, the first substrate having one or more antenna elements arranged sequentially thereon along a longitudinal extension of the first substrate, each antenna element being ... | Method and apparatus for producing RFID transponders (400) arranged on a carrying substrate, comprising:providing a first substrate (100), the first substrate having at least one antenna element (101) arranged thereon, and preferably several antenna elements arranged sequentially thereon along a longitudinal extension ... | 2,600 |
343,370 | 344,244 | 16,755,356 | 2,697 | In accordance with the present invention there is provided an antidegradant blend, comprising: a metal carboxylate; an inorganic phosphite; and a phenolic antioxidant. | 1. An antidegradant blend, comprising:
at least one metal carboxylate; at least one inorganic phosphite; and at least one phenolic antioxidant. 2. The antidegradant blend according to claim 1, wherein the metal carboxylate is a metal stearate, a metal lactate, a metal benzoate, or a combination thereof. 3. The antidegr... | In accordance with the present invention there is provided an antidegradant blend, comprising: a metal carboxylate; an inorganic phosphite; and a phenolic antioxidant.1. An antidegradant blend, comprising:
at least one metal carboxylate; at least one inorganic phosphite; and at least one phenolic antioxidant. 2. The an... | 2,600 |
343,371 | 344,245 | 16,755,391 | 2,697 | Movement data characterizing the movement of a vehicle in which electronic smartglasses are used, are sent by a portable apparatus from a data output to the electronic smartglasses for reducing simulator-sickness-induced impairments. The electronic smartglasses display data taking into account the movement data. | 1-11. (canceled) 12. A portable apparatus for reducing simulator-sickness-induced impairments when using electronic smartglasses in a vehicle, comprising:
an enclosure; and a data output configured to transmit movement data characterizing movement of the vehicle to the electronic smartglasses. 13. The portable apparatu... | Movement data characterizing the movement of a vehicle in which electronic smartglasses are used, are sent by a portable apparatus from a data output to the electronic smartglasses for reducing simulator-sickness-induced impairments. The electronic smartglasses display data taking into account the movement data.1-11. (... | 2,600 |
343,372 | 344,246 | 16,755,358 | 2,697 | A method for refining a titanium material, in which oxygen contained in a titanium material made of a pure titanium, a titanium alloy or an intermetallic compound containing titanium as one of main components is removed, the method includes: a first melting step of melting the titanium material under a noble gas atmosp... | 1. A method for refining a titanium material, in which oxygen contained in a titanium material made of a pure titanium, a titanium alloy or an intermetallic compound containing titanium as one of main components is removed, the method comprising:
a first melting step of melting the titanium material under a noble gas a... | A method for refining a titanium material, in which oxygen contained in a titanium material made of a pure titanium, a titanium alloy or an intermetallic compound containing titanium as one of main components is removed, the method includes: a first melting step of melting the titanium material under a noble gas atmosp... | 2,600 |
343,373 | 344,247 | 16,755,384 | 2,697 | Relative movement, in relation to a vehicle interior, of an electronic display device worn on the head is ascertained by an acquisition device arranged on the electronic display device. A virtual perspective of a wearer of the electronic display device, located in the vehicle interior, of displayed virtual content is a... | 1-10. (canceled) 11. A method for operating an electronic display device wearable on a head of a user, comprising:
ascertaining a relative movement of the electronic display device, configured as virtual-reality glasses, in relation to a vehicle interior of a vehicle by an acquisition device arranged on the electronic ... | Relative movement, in relation to a vehicle interior, of an electronic display device worn on the head is ascertained by an acquisition device arranged on the electronic display device. A virtual perspective of a wearer of the electronic display device, located in the vehicle interior, of displayed virtual content is a... | 2,600 |
343,374 | 344,248 | 16,755,395 | 1,732 | The present invention relates to an ambient ion based method of making free-standing 2D metal sheets made of bare NPs, at the air-liquid interface. An electro-hydrodynamic flow field was generated by electrospray deposition on the liquid surface, which in turn assisted the assembly of the NPs. The NP-NSs were made unde... | 1. A method of making nanometer thin, <100 nm free standing 2D metal sheets made of bare nanoparticles at air-liquid interface, wherein the method comprises;
Electrospraying of at least one metal salt precursor solution in acetonitrile over a water reservoir, wherein the electrospray is produced at a voltage 1000-2000 ... | The present invention relates to an ambient ion based method of making free-standing 2D metal sheets made of bare NPs, at the air-liquid interface. An electro-hydrodynamic flow field was generated by electrospray deposition on the liquid surface, which in turn assisted the assembly of the NPs. The NP-NSs were made unde... | 1,700 |
343,375 | 344,249 | 16,755,373 | 1,732 | The present invention relates to a GRP78-derived peptide for screening highly efficient stem cells and the use thereof, and more particularly, to screening highly efficient stem cells using, as a marker, a GRP78-derived peptide capable of binding to the binding domain of GRP78 protein on the cell surface. According to ... | 1. A peptide for screening highly efficient stem cells, the peptide being represented by an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 18. 2. The peptide of claim 1, wherein the peptide is derived from GRP78. 3. The peptide of claim 1, wherein the peptides represented by the amino acid s... | The present invention relates to a GRP78-derived peptide for screening highly efficient stem cells and the use thereof, and more particularly, to screening highly efficient stem cells using, as a marker, a GRP78-derived peptide capable of binding to the binding domain of GRP78 protein on the cell surface. According to ... | 1,700 |
343,376 | 344,250 | 16,755,379 | 1,732 | Described herein is a two-component polyurethane adhesive that exhibits a glass transition temperature (Tg) of ≥70° C. and an open time in the range of ≥45 to ≤90 minutes at a temperature of ≥70° C. and a relative humidity of 50%. Also described is a method of producing the two-component polyurethane adhesive having a ... | 1. A two-component polyurethane adhesive comprising:
i. at least one polyol component (C1) comprising: a) ≥8 to ≤30 wt. % of at least one polyether polyol (P1) having a functionality of 4; wherein the at least one polyether polyol (P1) is represented by the following formula (I); 2. The two-component polyurethane adhes... | Described herein is a two-component polyurethane adhesive that exhibits a glass transition temperature (Tg) of ≥70° C. and an open time in the range of ≥45 to ≤90 minutes at a temperature of ≥70° C. and a relative humidity of 50%. Also described is a method of producing the two-component polyurethane adhesive having a ... | 1,700 |
343,377 | 344,251 | 16,755,392 | 1,732 | A wheelchair comprises a base assembly and a tilt assembly supported on the base assembly. The base assembly has a wheelbase and a wheel track. Each of the wheelbase and wheel track is independently adjustable. The tilt assembly is unchanged when either the wheelbase or wheel track is adjusted. | 1. A wheelchair comprising:
a base assembly having spaced-apart first and second side frames, the first and second side frames defining mounting points; a front cross member having mounting arms extending therefrom, the front mounting arms adjustably supported by the first and second side frame mounting points; a rear ... | A wheelchair comprises a base assembly and a tilt assembly supported on the base assembly. The base assembly has a wheelbase and a wheel track. Each of the wheelbase and wheel track is independently adjustable. The tilt assembly is unchanged when either the wheelbase or wheel track is adjusted.1. A wheelchair comprisin... | 1,700 |
343,378 | 344,252 | 16,755,330 | 1,732 | The disclosure describes the preparation and use of reactive carbonates containing a metal carbonate bound to a reactive compound, wherein the reactive compound comprises a mineral binding group and a polymer reactive group connected together by a linking group. Such reactive carbonates are useful as reagents in proces... | 1. A mineral-bound elastomeric material, comprising:
a polymer; a polymer matrix unit comprising at least one connecting group and a mineral binding group; and inclusions of a metal carbonate bound to the polymer matrix unit via the mineral binding group, wherein the polymer is covalently bound to the polymer matrix un... | The disclosure describes the preparation and use of reactive carbonates containing a metal carbonate bound to a reactive compound, wherein the reactive compound comprises a mineral binding group and a polymer reactive group connected together by a linking group. Such reactive carbonates are useful as reagents in proces... | 1,700 |
343,379 | 344,253 | 16,755,396 | 1,732 | The present invention relates to substituted benzimidazoles and related compounds which are of use in the field of agriculture as fungicides. | 1. A compound of formula (I): 2. A compound of claim 1, wherein compound of formula (I) is a compound of formula (VI): 3. A compound of claim 1, wherein the compound of formula (I) is a compound of formula (X): 4. A compound of claim 1, wherein each of X1, X2 and X3 are carbon. 5. A compound of claim 1, wherein R4 is a... | The present invention relates to substituted benzimidazoles and related compounds which are of use in the field of agriculture as fungicides.1. A compound of formula (I): 2. A compound of claim 1, wherein compound of formula (I) is a compound of formula (VI): 3. A compound of claim 1, wherein the compound of formula (I... | 1,700 |
343,380 | 344,254 | 16,755,353 | 1,732 | An aqueous fabric spray composition, comprising: a. 1-10 w.t. % silicone, wherein the silicone is in the form of an emulsion b. 0.01-1.5 w.t. % setting polymer. | 1. An fabric spray composition, comprising:
a. 1 to 10 w.t. % silicone,
wherein the silicone is in the form of an emulsion, and
b. 0.01 to 1.5 w.t. % setting polymer wherein the fabric spray composition is aqueous. 2. The composition according to claim 1, wherein the composition further comprises 0.0001 to 10 w.t. % f... | An aqueous fabric spray composition, comprising: a. 1-10 w.t. % silicone, wherein the silicone is in the form of an emulsion b. 0.01-1.5 w.t. % setting polymer.1. An fabric spray composition, comprising:
a. 1 to 10 w.t. % silicone,
wherein the silicone is in the form of an emulsion, and
b. 0.01 to 1.5 w.t. % setting p... | 1,700 |
343,381 | 344,255 | 16,755,418 | 1,732 | Provided are an NFC configuration method, a mobile terminal and a computer-readable storage medium. The method includes following steps: when a preset NFC module is configured as an NFC card, current position information of the mobile terminal is acquired, and a static parameter in all of operating parameters of the NF... | 1. A near field communication (NFC) configuration method, applied to a mobile terminal, comprising:
in a case where a preset NFC module is configured as an NFC card, acquiring current position information of the mobile terminal, and setting a static parameter in all of operating parameters of the NFC module as a first ... | Provided are an NFC configuration method, a mobile terminal and a computer-readable storage medium. The method includes following steps: when a preset NFC module is configured as an NFC card, current position information of the mobile terminal is acquired, and a static parameter in all of operating parameters of the NF... | 1,700 |
343,382 | 344,256 | 16,755,372 | 1,732 | The present matter relates to compositions comprising a Teneurin C-terminal Associated Peptide-1 (TCAP-1) peptide and methods and uses of same for preventing and/or treating post-traumatic stress disorder (“PTSD”). | 1. A method for preventing and/or treating post-traumatic stress disorder in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a teneurin c-terminal associated peptide-1 (a TCAP-1 peptide), or a pharmaceutically acceptable salt or ester thereof or a pharmaceutical c... | The present matter relates to compositions comprising a Teneurin C-terminal Associated Peptide-1 (TCAP-1) peptide and methods and uses of same for preventing and/or treating post-traumatic stress disorder (“PTSD”).1. A method for preventing and/or treating post-traumatic stress disorder in a subject in need thereof com... | 1,700 |
343,383 | 344,257 | 16,755,406 | 1,732 | The present invention relates to an induction heating apparatus. In order to cope with various types of containers without increasing an operating frequency of an induction heating apparatus, the present invention compares a resistance value of a container with a predetermined reference resistance value, and determines... | 1. An induction heating apparatus, comprising:
a rectifying unit configured to rectify an AC voltage from a power source and to output the rectified AC voltage; a smoothing unit configured to smooth the rectified AC voltage and to output a DC voltage; an inverter unit including a plurality of switching devices, and a v... | The present invention relates to an induction heating apparatus. In order to cope with various types of containers without increasing an operating frequency of an induction heating apparatus, the present invention compares a resistance value of a container with a predetermined reference resistance value, and determines... | 1,700 |
343,384 | 344,258 | 16,755,408 | 1,732 | Disclosed is an image processing method. The method includes: determining that an original image is to be displayed on a dividing line between two display screens; acquiring a complete display picture of the original image, and calculating distances from boundaries of the original image to the dividing line; and adjust... | 1. An image processing method, comprising:
determining that an original image is to be displayed on a dividing line between two display screens; acquiring a complete display picture of the original image, and calculating distances from boundaries of the original image to the dividing line; and adjusting a display posit... | Disclosed is an image processing method. The method includes: determining that an original image is to be displayed on a dividing line between two display screens; acquiring a complete display picture of the original image, and calculating distances from boundaries of the original image to the dividing line; and adjust... | 1,700 |
343,385 | 344,259 | 16,755,409 | 1,732 | A method and an arrangement for forming a label with an electrically conductive pattern (201′), comprising the steps: providing a first roll (102) of a face material web (200); forming a conductive material (201) in a pattern corresponding to said electrically conductive pattern on a surface of the face material web; p... | 1. A method for forming a label with an electrically conductive pattern in a roll-to-roll process, comprising the steps:
providing a first roll of a face material web; forming a conductive material in a pattern corresponding to said electrically conductive pattern on a surface of the face material web; providing a seco... | A method and an arrangement for forming a label with an electrically conductive pattern (201′), comprising the steps: providing a first roll (102) of a face material web (200); forming a conductive material (201) in a pattern corresponding to said electrically conductive pattern on a surface of the face material web; p... | 1,700 |
343,386 | 344,260 | 16,755,386 | 1,732 | A crystal form of a compound 1 and a method for preparing the same, further comprising an application of the crystal form in the preparation of a drug for treating diseases associated with fibrosis. | 1. A crystal form A of Compound 1, wherein the crystal form A has an X-ray powder diffraction pattern comprising characteristic peaks at diffraction angle 2θ of 7.87±0.2°, 15.69±0.2° and 16.58±0.2°; 2. The crystal form A of Compound 1 as defined in claim 1, wherein the X-ray powder diffraction pattern comprises charact... | A crystal form of a compound 1 and a method for preparing the same, further comprising an application of the crystal form in the preparation of a drug for treating diseases associated with fibrosis.1. A crystal form A of Compound 1, wherein the crystal form A has an X-ray powder diffraction pattern comprising character... | 1,700 |
343,387 | 344,261 | 16,755,416 | 1,732 | Provided is a solid-state imaging element configured to automatically extend dynamic range for each unit pixel. A solid-state imaging element includes, for a unit pixel, a first photoelectric conversion element, a first accumulation portion that accumulates electric charge obtained by photoelectric conversion by the fi... | 1. A solid-state imaging element comprising, for a unit pixel:
a first photoelectric conversion element; a first accumulation portion that accumulates electric charge obtained by photoelectric conversion by the first photoelectric conversion element; and a first film that is electrically connected to the first accumula... | Provided is a solid-state imaging element configured to automatically extend dynamic range for each unit pixel. A solid-state imaging element includes, for a unit pixel, a first photoelectric conversion element, a first accumulation portion that accumulates electric charge obtained by photoelectric conversion by the fi... | 1,700 |
343,388 | 344,262 | 16,755,407 | 1,732 | An electronic impedance measurement device: | 1. An electronic impedance measurement device comprising:
a branch, called measurement branch, comprising an impedance to be measured (Zm); and at least one branch, called reference branch, comprising an impedance (Zr), called reference impedance; electronics (called detection electronics, configured to provide an erro... | An electronic impedance measurement device:1. An electronic impedance measurement device comprising:
a branch, called measurement branch, comprising an impedance to be measured (Zm); and at least one branch, called reference branch, comprising an impedance (Zr), called reference impedance; electronics (called detection... | 1,700 |
343,389 | 344,263 | 16,755,400 | 1,732 | A fluid dispenser device having a dispenser head; an air expeller; and a reservoir containing a single dose of fluid. The reservoir includes a proximal axial end and a distal axial end, and is removably mounted so that after the device has been actuated, the empty reservoir can be removed from the device and replaced b... | 1. A fluid dispenser device comprising: a dispenser head provided with a dispenser orifice; an air expeller for generating a flow of air while the device is being actuated; and a reservoir containing a single dose of fluid, said reservoir including a proximal axial end and a distal axial end, and being mounted in remov... | A fluid dispenser device having a dispenser head; an air expeller; and a reservoir containing a single dose of fluid. The reservoir includes a proximal axial end and a distal axial end, and is removably mounted so that after the device has been actuated, the empty reservoir can be removed from the device and replaced b... | 1,700 |
343,390 | 344,264 | 16,755,385 | 1,732 | Disclosed by the present disclosure are a context identification indication method, an acquisition method, a user equipment (UE), a base station and a computer storage medium. The method comprising: carrying, in an MSG3 message, part of UE context identification information and related information of identification inf... | 1. A method of context identification indication, applied to a User Equipment (UE), and the method comprising:
carrying part of UE context identification information and related information of identification information for a second base station in an MSG3 message; and sending the MSG3 message to a first base station. ... | Disclosed by the present disclosure are a context identification indication method, an acquisition method, a user equipment (UE), a base station and a computer storage medium. The method comprising: carrying, in an MSG3 message, part of UE context identification information and related information of identification inf... | 1,700 |
343,391 | 344,265 | 16,755,412 | 1,732 | The present invention concerns a system for allowing the restoration of a first interconnection of a die of a power module connecting the die to an electric circuit. The system comprises: at least one other interconnection of the power module, a periodic current source that is connected to the at least one other interc... | 1-9. (canceled) 10. A system for allowing the restoration of a first interconnection of a die of a power module connecting the die to an electric circuit, characterized in that the system comprises:
at least one other interconnection of the power module, a periodic current source that is connected to the at least one o... | The present invention concerns a system for allowing the restoration of a first interconnection of a die of a power module connecting the die to an electric circuit. The system comprises: at least one other interconnection of the power module, a periodic current source that is connected to the at least one other interc... | 1,700 |
343,392 | 344,266 | 16,755,405 | 1,732 | A method is provided for determining a unique identifier of a device, the device including a quantum tunnelling barrier unique to the device. The method comprises applying a potential difference across the quantum tunnelling barrier, the potential difference sufficient to enable tunnelling of charge carriers through th... | 1. A method for determining a unique identifier of a device, the device including a quantum tunnelling barrier unique to the device, the method comprising:
applying a potential difference across the quantum tunnelling barrier, the potential difference sufficient to enable tunnelling of charge carriers through the quant... | A method is provided for determining a unique identifier of a device, the device including a quantum tunnelling barrier unique to the device. The method comprises applying a potential difference across the quantum tunnelling barrier, the potential difference sufficient to enable tunnelling of charge carriers through th... | 1,700 |
343,393 | 344,267 | 16,755,442 | 1,732 | A device for use in the treatment of hemorrhoids. The device includes an elongated tube-shaped element that includes a forward end and an aft end. The aft end provides access to the interior of the tube-shaped element. The tube-shaped element extends along a longitudinal axis L and includes at least one opening formed ... | 1. A device for use in the treatment of hemorrhoids, said device comprising:
an elongated tube-shaped element comprising a forward end and an aft end, said aft end is open providing access to such that the interior of the tube-shaped element, said tube-shaped element extending along a longitudinal axis L and comprising... | A device for use in the treatment of hemorrhoids. The device includes an elongated tube-shaped element that includes a forward end and an aft end. The aft end provides access to the interior of the tube-shaped element. The tube-shaped element extends along a longitudinal axis L and includes at least one opening formed ... | 1,700 |
343,394 | 344,268 | 16,755,401 | 1,732 | A method for joining hot slabs, which can be fed in succession to at least one roll stand. Joining sides of the hot slabs facing each other are, by pendular friction welding and/or vibration friction welding, simultaneously integrally bonded to a single metal intermediate piece arranged between the joining sides, by os... | 1-6. (canceled) 7. A method for joining hot slabs which are fed in succession to at least one roll stand, comprising the steps of:
separating in advance a single metallic intermediate piece from one of the hot slabs or using an existing slab remnant as the single metallic intermediate piece; disposing the single metall... | A method for joining hot slabs, which can be fed in succession to at least one roll stand. Joining sides of the hot slabs facing each other are, by pendular friction welding and/or vibration friction welding, simultaneously integrally bonded to a single metal intermediate piece arranged between the joining sides, by os... | 1,700 |
343,395 | 344,269 | 16,755,410 | 1,623 | The present invention relates to the field of viral disorders, and in particular to the use of natural compounds to inhibit viruses and viral infection. Compositions comprising NANA are provided for treating or preventing viral infections, such as those causing the common cold. | 1. A method for preventing, inhibiting or treating ailments of the upper respiratory tract, inhibiting or treating viral infection of the upper respiratory tract, reducing sick leave or days away from work due to upper respiratory infections, and/or reducing viral infection of the upper respiratory tract during public ... | The present invention relates to the field of viral disorders, and in particular to the use of natural compounds to inhibit viruses and viral infection. Compositions comprising NANA are provided for treating or preventing viral infections, such as those causing the common cold.1. A method for preventing, inhibiting or ... | 1,600 |
343,396 | 344,270 | 16,755,399 | 1,623 | Devices, systems, and methods for monitoring musculoskeletal (MSK) health conditions of an individual, including joint flexibility, strength, and endurance as part of their overall care plan are described here. The overall system includes: a sensor that can be worn anywhere on the human body, an engaging app on a mobil... | 1. A monitoring system for detecting improvement to strength and range of motion for a portion of a body, the monitoring system comprising:
a sensor system wearable on or around a portion of an individual's body and configured to obtain measurements for a plurality of parameters of the body portion over a period of tim... | Devices, systems, and methods for monitoring musculoskeletal (MSK) health conditions of an individual, including joint flexibility, strength, and endurance as part of their overall care plan are described here. The overall system includes: a sensor that can be worn anywhere on the human body, an engaging app on a mobil... | 1,600 |
343,397 | 344,271 | 16,755,446 | 2,684 | An RFID magnet including an RFID label or tag applied onto a magnetized or magnetizable sheet or strip. | 1. A radio-frequency identification (RFID) magnet, comprising:
a magnetized or magnetizable material layer; a magnetic interference blocking layer adhered or laminated onto the magnetized or magnetizable material layer; and an RFID label or tag adhered or laminated onto the magnetic interference blocking layer, the RFI... | An RFID magnet including an RFID label or tag applied onto a magnetized or magnetizable sheet or strip.1. A radio-frequency identification (RFID) magnet, comprising:
a magnetized or magnetizable material layer; a magnetic interference blocking layer adhered or laminated onto the magnetized or magnetizable material laye... | 2,600 |
343,398 | 344,272 | 16,755,421 | 2,684 | A fuel line for use in a fuel-carrying vehicle designed as a one-piece multi-chamber line having at least two separate fuel-carrying lines each forming a chamber. A first chamber carries fuel in a first flow direction and a second chamber carries fuel in the first or a second flow direction. Also proposed is a correspo... | 1-7. (canceled) 8. A connection piece configured to join a multi-chamber line of a fuel-carrying vehicle, comprising:
a common connection piece base section in which there are formed at least two mutually separated fuel-carrying lines comprising at least two mutually separated fuel-carrying lines; a first fuel-carrying... | A fuel line for use in a fuel-carrying vehicle designed as a one-piece multi-chamber line having at least two separate fuel-carrying lines each forming a chamber. A first chamber carries fuel in a first flow direction and a second chamber carries fuel in the first or a second flow direction. Also proposed is a correspo... | 2,600 |
343,399 | 344,273 | 16,755,424 | 2,684 | A device for reinforcing, sealing or damping a structural element in a motor vehicle includes: a support with a fastening element for prefixing the device in the structural element; and an expandable adhesive arranged on the support for connecting the support to the structural element; wherein the fastening element is ... | 1. A device for reinforcing, sealing or damping a structural element in a motor vehicle, comprising:
a support with a fastening element for prefixing the device in the structural element; and an expandable adhesive arranged on the support for connecting the support to the structural element; wherein the fastening eleme... | A device for reinforcing, sealing or damping a structural element in a motor vehicle includes: a support with a fastening element for prefixing the device in the structural element; and an expandable adhesive arranged on the support for connecting the support to the structural element; wherein the fastening element is ... | 2,600 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.