id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,500
|
https://bio-protocol.org/exchange/protocoldetail?id=1500&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generating Isogenic Deletions (Knockouts) in Francisella tularensis, a Highly-infectious and Fastidious Gram-negative Bacterium
Xiaojun Wu*
GR Guoping Ren*
Jason F. Huntley
*Contributed equally to this work
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1500 Views: 9632
Edited by: Fanglian He
Reviewed by: Manuela Roggiani
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Generating bacterial gene deletion mutants, also known as knockouts (KOs), is a powerful tool to investigate individual gene functions. However, fastidious bacteria such as Francisella tularensis (F. tularensis) often are difficult to genetically manipulate. Indeed, many different approaches have been tested to generate F. tularensis mutants. First, Tn5-based EZ::TN transposons have been successfully used to generate transposon libraries in F. tularensis (Qin and Mann, 2006; Weiss et al., 2007). However, creating a comprehensive transposon library with saturating mutations can be laborious, screening for gene disruption requires high-throughput assays where known phenotypes can be measured, and transposons may not completely inactivate the gene of interest or may alter downstream gene expression. Second, group II introns (also referred to as Targetron) have been used to inactivate F. tularensis genes of interest (Rodriguez et al., 2008; Rodriguez et al., 2009). Targetron functions by forming a complex between plasmid-encoded RNA and chromosomal DNA, followed by group II intron insertion into the gene of interest. The main advantage of Targetron is that it does not require an antibiotic resistance marker. However, as noted for transposons, targetron gene insertions may not eliminate all gene functions or may affect downstream gene expression. Third, homologous recombination can be used to completely replace the chromosomal target gene with a selectable marker, such as an antibiotic resistance marker. This classical genetic technique has been used in many F. tularensis studies (Ramakrishnan et al., 2008; Ren et al., 2014; Mohapatra et al., 2008; Robertson et al., 2013). To accomplish this, a suicide plasmid is engineered to include a selectable marker flanked by regions upstream and downstream of the gene of interest. This KO plasmid can be delivered into host bacteria by many methods, including electroporation, chemical transformation, or conjugation. Here, we describe an optimized procedure to generate KO plasmid constructs, use E. coli to conjugatively transfer the plasmid into F. tularensis, select for F. tularensis KOs using a series of kanamycin-, hygromycin-, and sucrose-resistance steps, and confirm that the gene of interest has been deleted (general overview of the knockout protocol diagramed in Figure 1). This optimized procedure is relatively simple, rapid, and, more importantly, includes a series of both positive and negative selection steps to increase the chances of deleting a target gene from F. tularensis.
Keywords: Francisella tularensis Tularemia Mutant Gene deletion Microbiology
Figure 1. General overview of knockout protocol
Materials and Reagents
Francisella tularensis, including subsp. tularensis (Type A; e.g. SchuS4) or subsp. holarctica (Type B; e.g. LVS)
Note: This protocol has been demonstrated to work in F. tularensis strains SchuS4, LVS, and OR96-0246 (Type B). All strains available from BEI Resources.
Trizol (Life Technologies, catalog number: 15596018 )
Platinum Taq DNA Polymerase High Fidelity (Life Technologies, catalog number: 11304-011 )
pLG66a (Gallagher et al., 2008)
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106 )
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28706 )
Agarose (Lonza, catalog number: 50004 )
Ethidium bromide, 1% solution (Fisher BioReagents, catalog number: BP1302-10 )
pTP163 (suicide KO plasmid; Robertson et al., 2013)
LB broth (Fisher BioReagents, catalog number: BP1426-2 )
Glycerol (Fisher BioReagents, catalog number: BP2291 )
Bacto agar (Becton Dickinson, catalog number: 214010 )
Hygromycin B solution (50 mg/ml) (Corning, catalog number: 30-240-CR )
QIAprep Spin Miniprep Kit (QIAGEN, catalog number: 27106 )
Apa I restriction endonuclease (New England Biolabs, catalog number: R0114L )
Antarctic Phosphatase (New England Biolabs, catalog number: M0289S )
T4 DNA ligase (New England Biolabs, catalog number: M0202S )
NEB-10 beta chemically competent E. coli (New England Biolabs, catalog number: C3019I )
Kanamycin monosulfate (MP Biomedicals, catalog number: 194531 )
GoTaq Green Master Mix (Promega Corporation, catalog number: M7128-C )
Molecular Biology Grade Water, DNase-, RNase-, and Protease-free (Corning, catalog number: 46-000-CM )
E. coli strain S17-1 (Simon et al., 1983; generous gift from Drs. Michael Norgard and Greg Robertson, U.T. Southwestern Medical Center, Dallas, TX)
Calcium chloride dehydrate (Fisher BioReagents, catalog number: BP510-100 )
Mueller Hinton Broth powder (Becton Dickinson, catalog number: 211443 )
Tryptone (Fisher BioReagents, catalog number: BP1421-500 )
Sodium chloride (Fisher BioReagents, catalog number: BP358-212 )
IsoVitaleX Enrichment (BD, catalog number: 211876 )
Glucose (Fisher BioReagents, catalog number: BP350-1 )
Iron(III) pyrophosphate (Sigma-Aldrich, catalog number: P6526-100G )
Phosphate-buffered saline (PBS) 1x, without calcium and magnesium (Corning, Mediatech, catalog number: 21040CV )
Membrane filters, 0.025 µm, 25 mm (EMD Millipore, catalog number: VSWP02500 )
Hemoglobin powder (Neogen Acumedia, catalog number: 7195 )
Polymyxin B sulfate (MP Biomedicals, catalog number: 100565 )
Magnesium chloride hexahydrate (Fisher BioReagents, catalog number: BP214-500 )
D-Sucrose (Fisher BioReagents, catalog number: BP220-212 )
Sodium hydroxide (Fisher BioReagents, catalog number: BP359-500 )
LB broth (see Recipes)
LB agar (see Recipes)
Supplemented Mueller Hinton Broth (sMHB) (see Recipes)
Supplemented Mueller Hinton Agar (sMHA) (see Recipes)
Chocolate agar plates containing hygromycin and polymyxin B (see Recipes)
sMHA containing 10 mg/L kanamycin and 8% sucrose (sMHA-kan10-suc) (see Recipes)
Equipment
Applied Biosystems Veriti 96-Well Thermal Cycler or thermal cycler with ramp rate > 3 °C/sec
Thermo Scientific MaxQ 6000 Incubated/Refrigerated Stackable Shakers
Thermo Scientific Forma Steri-Cycle CO2 Incubators
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Wu, X., Ren, G. and Huntley, J. F. (2015). Generating Isogenic Deletions (Knockouts) in Francisella tularensis, a Highly-infectious and Fastidious Gram-negative Bacterium. Bio-protocol 5(12): e1500. DOI: 10.21769/BioProtoc.1500.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,501
|
https://bio-protocol.org/exchange/protocoldetail?id=1501&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Ex vivo Human Natural Killer (NK) Cell Stimulation and Intracellular IFNγ and CD107a Cytokine Staining
VY Vanessa A. York
Jeffrey M. Milush
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1501 Views: 17634
Reviewed by: Thomas J. Bartosh
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Natural killer (NK) cells comprise 5–20% of peripheral blood mononuclear cells (PBMC) in humans. In addition to their fundamental roles in the defense against viral infections and tumor surveillance, NK cells help shape adaptive immune responses through their production of cytokines. NK cells are traditionally identified as CD3neg, CD14neg, CD19neg lymphocytes expressing CD56. Using a combination of markers that includes CD56 and CD7 greatly increases the ability to define the phenotype and function of NK cell subsets. Two key markers of NK cell function are the production of IFNγ and the release of cytotoxic granules measured by the expression of CD107a. Here we describe a method to assess IFNγ and CD107a expression in NK cells following stimulation with target cells or cytokines. This method can be used to assess the general functional capacity of NK cells in peripheral blood mononuclear cells from a wide range of study participants.
Keywords: NK cell Natural Killer Cell Degranulation Cytokine staining CD7
Materials and Reagents
Alexa700-conjugated mouse anti-human CD7 clone 124-1D1 (eBioscience, catalog number: 56-0079-42 )
K562 cell line (Kindly provided by Dr. Lewis L. Lanier, University of California, San Francisco, USA)
Note: These can also be purchased from ATCC, catalog number CCL-243 .
Phycoerythrin (PE)-Texas Red (ECD)-conjugated mouse anti-human CD3 clone UCHT1 (Beckman Coulter, catalog number: IM2705U )
ECD-conjugated mouse anti-human CD14 clone RMO52 (Beckman Coulter, catalog number: IM2707U )
PE-Cy7-conjugated mouse anti-human CD56 clone NCAM16.2 (BD Biosciences, catalog number: 335791 )
Pacific Blue-conjugated mouse anti-human CD16 clone 3G8 (BD Biosciences, catalog number: 558122 )
APC-Cy7-conjugated mouse anti-human CD19 clone SJ25C1 (BD Biosciences, catalog number: 557791 )
Fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD107a clone H4A3 (BD Biosciences, catalog number: 555800 )
APC-conjugated mouse anti-human IFNγ clone B27 (BD Biosciences, catalog number: 554702 )
Human IgG (Sigma-Aldrich, catalog number: I4506 )
Anti–mouse immunoglobulin G–coated compensation beads (BD Biosciences, catalog number: 552843 )
Amine Aqua Reactive Dye (AARD) (Life Technologies, catalog number: L34957 )
96 well U bottom plate (Corning, catalog number: 353077 )
96 well V bottom plate (Corning, catalog number: 3894 )
RPMI (Life technologies, catalog number: 11875)
L-Glutamine 200 mM (100x) (Life technologies, catalog number: 25030 )
Penicillin (10,000 Units/ml)-Streptomycin (10,000 μg/ml) (Life technologies, catalog number: 15140 )
Fetal bovine serum (Hyclone, catalog number: SH30071 )
Buffy coats from Stanford Blood Center used to obtain Peripheral Blood Mononuclear Cells (PBMC)
Ficoll-Paque Premium (GE Healthcare, catalog number: 17-5442-03 )
Cryopreserved PBMC samples from San Francisco based HIV-1 infected cohorts SCOPE and OPTIONS
Recombinant IL-12 (Peprotech, catalog number: 200-12 )
Recombinant IL-18 (MBL & Biological Laboratories, catalog number: B001-5 )
Brefeldin A from Penicilium brefeldianum (Sigma-Aldrich, catalog number: B7651 )
BD golgi stop protein transport inhibitor containing monensin (BD Biosciences, catalog number: 554724 )
Phosphate buffered saline (PBS) (Corning, catalog number: 21-040-CV )
Ethylenediaminetetraacetic Acid (EDTA) (Teknova, catalog number: E0306 )
Bovine Serum Albumin (BSA) (Gemini BioProducts, catalog number: 700-100P )
16% Paraformaldehyde (PFA) (Electron Microscopy Science, catalog number: 15710 )
BD FACS Permeabilizing solution 2 (BD Biosciences, catalog number: 340973 )
Cell Culture Grade Water (HyClone, catalog number: SH30529.02 )
Deoxyribonuclease (DNase) I (Sigma-Aldrich, catalog number: DN25 )
15 ml conicals (Thermo Fisher Scientific, catalog number: 05-539-5 )
Trypan blue in PBS (0.4% w/v) (Corning, catalog number: 25-900-CI )
Complete media (see Recipes)
FACS buffer (see Recipes)
Paraformaldehyde recipe (see Recipes)
Equipment
Biosafety cabinet (Nuaire, model: 407FM600 )
37 °C water bath (Cole Parmer)
Calibrated single-channel and multi-channel pipettes
Pipet-aid
Tips (10 μl, 20 μl, 200 μl, 1,000 μl)
Centrifuge (Beckman Coulter, Allegra 6R , rotor GH-3.8)
37° Celsius Incubator (Thermo Forma, model: 3110 )
Nikon Optiphot microscope for counting cells
Hemacytometer for counting cells (Hausser Scientific, catalog number: 1490 )
4-laser (405 nm, 488 nm, 532 nm and 633 nm) BD LSR-II
Software
FlowJo Single Cell Analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:York, V. A. and Milush, J. M. (2015). Ex vivo Human Natural Killer (NK) Cell Stimulation and Intracellular IFNγ and CD107a Cytokine Staining. Bio-protocol 5(12): e1501. DOI: 10.21769/BioProtoc.1501.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Immunology > Immune cell function > Cytotoxicity
Immunology > Immune cell staining > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,502
|
https://bio-protocol.org/exchange/protocoldetail?id=1502&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Simple Protocol for the Immunolabelling of Arabidopsis Pollen Tube Membranes and Cell Wall Polymers
Marie Dumont
CC Céline Cataye
AL Arnaud Lehner
EM Eric Maréchal
PL Patrice Lerouge
Denis Falconet
Jean-Claude Mollet
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1502 Views: 10673
Edited by: Samik Bhattacharya
Reviewed by: Igor Cesarino Cindy Ast
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
The pollen tube, a fast tip-growing cell, is an excellent model to study membrane and cell wall biosynthesis. Here, we describe a simple protocol using an easy to use device to perform immunofluorescence labelling of pollen tube membrane and cell wall. The use of the NucleoSpin column to perform all the steps of the immunolabelling procedure results in obtaining more intact pollen tubes.
Keywords: Pollen tube Cell wall Membrane Immunolabelling
Materials and Reagents
Arabidopsis day-0 flowers according to Boavida and McCormick (2007)
Note: Choose the last inflorescence buds opened at the top of the inflorescence stem. The stamen must not be higher than the stigma.
Fetal Bovine Serum (FBS) (Sigma-Aldrich, catalog number: F0804 )
Goat serum (Sigma-Aldrich, catalog number: G9023 )
Saponin (Sigma-Aldrich, catalog number: S4521 )
Primary antibody against plant cell wall polysaccharides/glycoproteins (http://www.plantprobes.net or http://www.ccrc.uga.edu/~carbosource) or digalactosyldiacylglycerol (DGDG) prepared in the laboratory using purified DGDG as antigen
Secondary antibodies conjugated to Alexa Fluor 488 (Life Technology, catalog number: A-11008 ) or Fluorescein isothiocyanate (FITC) (Sigma-Aldrich, catalog number: F0382 )
Arabidopsis pollen germination medium (PGM) (see Recipes)
1x Tris-buffered saline (TBS) (see Recipes)
Fixation solution (see Recipes)
Calcium- and magnesium-free Dulbecco's phosphate-buffered saline (CMF-DPBS) (see Recipes)
Blocking buffer 1 (see Recipes)
Blocking buffer 2 (see Recipes)
Equipment
Pair of tweezers
Olympus CK2 inverted microscope
Microscope Zeiss AxiObserver Z1
Syringe Filter PVDF 33 mm 0.2 µm
Microcentrifuge (VWRTM Galaxy 14D)
NucleoSpin® Plasmid Binding Columns (Macherey-Nagel, catalog number: 740588.50 ), but columns of any other kits (Genejet or PureLink) may be used.
Incubators at 22 °C and 30 °C
Parafilm®
Confocal Microscope TCS-SP2 operating system (Leica) and microscope Leica DMI6000B with a DFC450 C camera with FITC filter (absorption, 485-520 nm; emission, 520-560 nm wavelengths
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Dumont, M., Cataye, C., Lehner, A., Maréchal, E., Lerouge, P., Falconet, D. and Mollet, J. (2015). A Simple Protocol for the Immunolabelling of Arabidopsis Pollen Tube Membranes and Cell Wall Polymers. Bio-protocol 5(12): e1502. DOI: 10.21769/BioProtoc.1502.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell staining
Cell Biology > Cell imaging > Fixed-tissue imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,503
|
https://bio-protocol.org/exchange/protocoldetail?id=1503&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Sugar Component of a Hot Water Extract from Arabidopsis thaliana Pollen Tubes Using GC-EI-MS
Marie Dumont
AL Arnaud Lehner
CL Corinne Loutelier-Bourhis
Jean-Claude Mollet
PL Patrice Lerouge
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1503 Views: 8052
Edited by: Samik Bhattacharya
Reviewed by: Feng Li
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Extraction with hot water is the oldest and simplest method used to recover pectin from an alcohol insoluble residue extract, although this method has not been widely used for the cell wall analysis of pollen tube, a model used to study cell wall. This protocol described this method applied for pectin extraction from 6 h-old Arabidopsis pollen tubes followed by a sugar composition analysis by gas chromatography mass spectrometry.
Keywords: Pollen tube Cell wall Monosaccharide composition GC-MS
Materials and Reagents
Arabidopsis day-0 flowers according to Boavida and McCormick (2007)
Absolute ethanol (EtOH) for analysis (Merck Millipore, catalog number: 107017 )
Trifluoroacetic acid 12.93N (TFA) (Sigma-Aldrich, catalog number: T62200 )
Myo-inositol 2 mM (Sigma-Aldrich, catalog number: I5125 )
Methanolic-HCl 3N (Sigma-Aldrich, catalog number: 33051 Supelco )
Methanol (Thermo Fisher Scientific, catalog number: 10010280 )
Silylation reagent (HMDS:TMCS:Pyridine, 3:1:9 SylonTM HTP) (Sigma-Aldrich, catalog number: 33038 Supelco )
Cyclohexane (Acros Organics, catalog number: 279590010 )
Monosaccharides standards
Arabinose (Sigma-Aldrich, catalog number: A3256 )
Fucose (Sigma-Aldrich, catalog number: F8150 )
Galactose (Sigma-Aldrich, catalog number: G0750 )
Galacturonic acid (Sigma-Aldrich, catalog number: 857289 )
Glucose (Merck Millipore, catalog number: 8337.0250 )
Glucuronic acid (Sigma-Aldrich, catalog number: G8645 )
Mannose (Sigma-Aldrich, catalog number: M4625 )
Rhamnose (Sigma-Aldrich, catalog number: R3875 )
Xylose (Sigma-Aldrich, catalog number: X2126 )
Arabidopsis pollen germination medium (see Recipes)
Trifluoroacetic acid (2 N) (see Recipes)
Equipment
Inverted microscope Olympus CK2
Centrifuge Allegra® X-15R Beckmann Coulter
Hot-water bath (70 °C and 90 °C)
40-ml glass potter homogenizer
Freeze-dryer
Incubator (22 °C, 80 °C and 110 °C)
Sample concentrator under air flow (Techne, catalog number: FSC400D )
GC-EI-MS instrument is composed of a Zebron Z5-MSi (30 m, 0.25 mm id, 0.25 µm film thickness, Phenomenex) capillary column for chromatographic separations, a Hewlett-Packard 6890 series gas chromatograph coupled to an Autospec mass spectrometer of EBE geometry (Micromass, Manchester, UK) equipped with a Opus 3.1 data system
1.5 ml Eppendorf tube
Vortex
Pair of tweezers
50-ml Falcon
Microliter syringe (10 µl, Hamilton)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,504
|
https://bio-protocol.org/exchange/protocoldetail?id=1504&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Non-invasive Intratracheal Instillation in Mice
GO Guadalupe Ortiz-Muñoz
ML Mark R. Looney
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1504 Views: 18871
Reviewed by: Andrea PuharMaureen Wirschell
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
The intratracheal instillation technique is used to deliver a variety of agents to the lungs ranging from pathogens (bacteria, viruses), toxins, to therapeutic agents. To model lung inflammation and injury, LPS can be administrated via intranasal, intratracheal, or aerosol approaches. Each technique has its limitations. The intratracheal technique can involve the non-invasive instillation method (via the oro-tracheal route) or a direct injection into the trachea. Here, we describe an optimized method for direct visual instillation of LPS via the non-invasive oro-tracheal route.
Keywords: Non-invasive Intratracheal instillation Mice
Materials and Reagents
Lipopolysaccharide (LPS) (Sigma-Aldrich, catalog number: L2880 )
Ketamine (Henry Schein, catalog number: 010177 ) and Xylazine (Henry Schein, catalog number: 033198 ) for mouse anesthesia
Phosphate buffered saline (PBS) (see Recipes)
Equipment
Intubating platform (Figure 1), which can be constructed using 0.5 inch (1.3 cm) boards. The longer board should be roughly 6 inches (15 cm) wide x 14 inches (36 cm) long. The smaller supporting board should be roughly 6 inches (15 cm) wide x 7 inches (18 cm) long. On the back side of the longer board, nail two rectangular pieces of wood that are roughly 2.5 inches (6.4 cm) x 1.5 inches (3.8 cm) in size, rendering a groove that is slightly wider than 0.5 inches (1.3 cm). The smaller board fits into this groove, thus producing the 45 degree angle of the intubating platform. Finally, cut a V-shaped groove on the top of the platform, and string suture (3-0 or larger) between 2 pushpins (or nails). Alternatively, a rodent intubation stand can be purchased (Braintree Scientific, Inc., catalog number RIS 100).
Figure 1. Representative Model of Intubating Platform
Fiber-optic illuminator (Cole Parmer Fiber-Lite, model: 9745-00 )
Curved blunt-ended forceps
Polyethylene tubing PE-10 (Intramedic, catalog number: 427401 )
Insulin syringe with attached needle (sterile)
Hands-free binocular magnifiers
Warming pad (Gaymar T/Pump Classic, model: TP650 ) @ 38 °C setting
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Ortiz-Muñoz, G. and Looney, M. R. (2015). Non-invasive Intratracheal Instillation in Mice. Bio-protocol 5(12): e1504. DOI: 10.21769/BioProtoc.1504.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,505
|
https://bio-protocol.org/exchange/protocoldetail?id=1505&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Two-event Transfusion-related Acute Lung Injury Mouse Model
GO Guadalupe Ortiz-Muñoz
ML Mark R. Looney
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1505 Views: 8844
Reviewed by: Andrea PuharMaureen Wirschell
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Transfusion-related acute lung injury (TRALI) is defined as acute lung injury that occurs within 6 hours of a blood product transfusion. TRALI continues to be a leading cause of transfusion-related mortality and we have developed a mouse model of TRALI to better understand the mechanisms by which injury occurs and to test therapeutic approaches. Our model is a two-event model based on immune priming and the challenge of BALB/c wild-type mice with cognate MHC Class I monoclonal antibody (MHC I mAb). Immune priming with LPS mimics the primed state of recipients (first event) that is important for the development of TRALI. Donor HLA antibodies are frequently implicated in TRALI reactions, and cognate MHC Class I antibody (second event) produces acute lung injury in primed animals. Here, we describe a detailed protocol with high reproducibility within animals.
Keywords: Transfusions Acute lung injury Two-event model
Materials and Reagents
BALB/c WT mice (male, age 8-12 weeks)
MHC Class I mAb (H2Kd, IgG2a,κ; stock concentration 0.65 mg/ml) is purified from a hybridoma (ATCC, catalog number: 34-1-2S ) using standard protein A affinity chromatography.
Isotype-matched mAb (IgG2a,κ, stock concentration 1 mg/ml) (BD, catalog number: 553453 )
LPS (Sigma-Aldrich, catalog number: L2880 )
Ketamine (Henry Schein, catalog number: 010177 ) and Xylazine (Henry Schein, catalog number: 033198 ) for mouse anesthesia
Heparin Sodium Injection (Sagent Pharmaceuticals, NDC number: 25021 )
Phosphate buffered saline (PBS) (see Recipes)
Equipment
Surgical scissors
Curved blunt-ended forceps
25 gauge and 28G sterile needles
Insulin syringe (0.5 ml) and attached needle (sterile)
1 ml sterile syringes
30-gauge sterile needle for jugular vein cannulation
Polyethylene tubing PE-10 (Intramedic, catalog number: 427401 )
Cotton tipped applicator
6-0 silk suture
Warming pad
Tape
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Animal model > Mouse
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,506
|
https://bio-protocol.org/exchange/protocoldetail?id=1506&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virus-induced Gene Silencing (VIGS) in Barley Seedling Leaves
LG Lokanadha R. Gunupuru
SA Shahin S. Ali
Fiona M. Doohan
SS Steven R. Scofield
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1506 Views: 12922
Edited by: Samik Bhattacharya
Reviewed by: Pablo Bolanos-VillegasSollapura J. Vishwanath
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Virus induced gene silencing (VIGS) is one of the most potent reverse genetics technologies for gene functional characterisation. This method exploits a dsRNA-mediated antiviral defence mechanism in plants. Using this method allows researchers to generate rapid phenotypic data in a relatively rapid time frame as compared to the generation of stable transformants. Here we describe a simple method for silencing a target gene in barley seedling leaves using vectors based on the Barley Stripe Mosaic Virus (BSMV).
Materials and Reagents
Bacterial strain: Escherichia coli strain DH5 α
Taq DNA polymerase (Life Technologies, InvitrogenTM, catalog number: 11304-011 )
pGEM-T easy cloning kit (Promega Corporation, catalog number: A1380 )
QIAGEN QIAprep Centrifuge Miniprep Kit (QIAGEN, catalog number: 27106 )
Recombinant Taq DNA polymerase (Life Technologies, InvitrogenTM, catalog number: 10342-020 )
Plasmid vectors: pα42 (pα), pβ42.sp1 (pβ), pSL038-1 (pγ), pSL038-PDS (pγ-PDS).
Note: See Scofield and Brandt (2012) for the plasmid maps (provided by Prof. Steven R. Scofield, https://link.springer.com/protocol/10.1007/978-1-61779-882-5_7/figures/1).
Luria-Bertani (LB) liquid broth (Sigma-Aldrich L3152) and solid media containing 1.2% (w/v) agar (OXOID, catalog number: LP0013 )
Ampicillin (100 mg/l working concentration) (Sigma-Aldrich, catalog number: A0166-5G )
Restriction enzymes:
PacI (New England Biolabs, catalog number: R0547S )
MluI (New England Biolabs, catalog number: R0198S )
SpeI (New England Biolabs, catalog number: R0133S )
Ethanol (Sigma-Aldrich, catalog number: 459844 )
sodium acetate (Sigma-Aldrich, catalog number: S2889 )
mMessage mMachine T7 in vitro transcription kit (Ambion Sigma-Aldrich, catalog number: AM1344 )
John Innes compost No 2 (Westland Horticulture)
Glycine (Sigma-Aldrich, catalog number: 410225 )
K2HPO4 dibasic (Sigma-Aldrich, catalog number: P3786 )
Sodium pyrophosphate decahydrate (Sigma-Aldrich, catalog number: 221368 )
Bentonite (Aldrich, catalog number: 28,523-4 )
Celite (Fluka, catalog number: 22141 )
5x GP buffer (see Recipes)
FES buffer (see Recipes)
Equipment
Plant growth chambers (24 °C, 16/8 photoperiod and 55% humidity) (CambridgeHOK containment glasshouse)
Sterile culture tubes (Falcon, catalog number: 352057 )
Centrifuge tubes (SARSTEDT AG, catalog number: 72.695.500 )
Filter paper (Whatman, catalog number: 1001-090 )
Cooled centrifuge (Eppendorf)
Shaking incubators for cultures (New Brunswick Scientific)
Gel apparatus (Helixx Mupid-exU) and image system (Fusion Fx vilber lourmat)
Thermal cycler (MJ Research PTC200)
Gel electrophoresis chamber (Helixx Mupid-exU)
Autoclave (Priorclave)
Software
Primer3 software (version 0.4.0; http://frodo.wi.mit.edu/primer3/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Gunupuru, L. R., Ali, S. S., Doohan, F. M. and Scofield, S. R. (2015). Virus-induced Gene Silencing (VIGS) in Barley Seedling Leaves. Bio-protocol 5(12): e1506. DOI: 10.21769/BioProtoc.1506.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Plant Science > Plant immunity > Disease bioassay
Molecular Biology > RNA > RNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,507
|
https://bio-protocol.org/exchange/protocoldetail?id=1507&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visual Assessment of the Severity of Fusarium Seedling Blight (FSB) and Fusarium Head Blight (FHB) Disease in Barley
SA Shahin S. Ali
LG Lokanadha R. Gunupuru
Fiona M. Doohan
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1507 Views: 9524
Edited by: Samik Bhattacharya
Reviewed by: Pablo Bolanos-VillegasSollapura J. Vishwanath
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Fusarium pathogens are among the most damaging pathogens of cereals. These pathogens have the ability to attack the roots, seedlings, and flowering heads of barley and wheat plants (Simpson et al., 2004). Resulting in yield loss and head blight disease and also resulting in the contamination of grain with mycotoxins harmful to human and animal health (McMulen et al., 1997; Walter et al., 2010; Agostinelli et al., 2012). The study of Fusarium diseases, including host disease resistance and the effect of exogenous agents (chemicals, biocontrol agents, etc.), requires robust and effective methods for the assessment and quantification of visual disease symptoms. Here we describe the methods commonly used for the assessment and quantification of the severity of Fusarium seedling blight and Fusarium head blight disease.
Materials and Reagents
Fusarium culmorum strain FCF 200 (Courtesy of Paul Nicholson, https://www.jic.ac.uk/directory/paul-nicholson/)
Potato dextrose agar (Difco, catalog number: 213400 )
Mung bean (any grocery store)
John Innes compost No 2 (Westland Horticulture)
Tween 20 (Sigma-Aldrich, catalog number: P2287 )
Fertiliser NPK 10-10-20 (Agrifert)
Agar (OXOID, catalog number: LP0013 )
Filter paper (Whatman, catalog number: 1001-090 )
Mung bean broth (see Recipes)
Equipment
KOVA Glasstic Slide 10 (KOVA International Inc., catalog number: 87144 )
Silicon tubing (0.5 cm diameter)
Plant growth room
-70 °C freezer (Thermo Scientific Revco PLUS)
Shaking incubator (New Brunswick Scientific, model: I26 )
Light microscope (Leica Microsystems, model: DM3000 )
Glasshouse (CambridgeHOK containment glasshouse) [22 °C; maximum temperature of 27 °C and minimum light intensity of 700 μmol/m2/s under a 16 h/8 h day (700 μmol/m/s)/night regime or a contained environment room with an optimal 16 h/8 h day (700 μmol/m/s)/night at 20/12 °C]
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbe-host interactions > Fungus
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,508
|
https://bio-protocol.org/exchange/protocoldetail?id=1508&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mismatched Primer Extension Assays
Vasudevan Achuthan
JD Jeffrey J. DeStefano
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1508 Views: 7224
Reviewed by: Yu ChenChang Ho Lee
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Steady state kinetic assays have been a reliable way to estimate fidelity of several polymerases (Menendez-Arias, 2009; Rezende and Prasad, 2004; Svarovskaia et al., 2003). The ability to analyze the extension of primers with specific mismatches at the 3ʹ end is a major strength of the mismatched primer extension assays. Recently, we used the mismatched primer extension assays to show that the fidelity of HIV RT increases dramatically when concentration of Mg2+ is reduced to a physiologically relevant concentration (~0.25 mM) (Achuthan et al., 2014). Here, we describe in detail how to perform the mismatched primer extension assay to measure the standard extension efficiency using human immunodeficiency virus reverse transcriptase (HIV RT) at 2 mM Mg2+. The relative fidelity of the polymerase can then be estimated using the standard extension efficiency. The assay described here is based on the method published in Mendelman et al. (1990).
Materials and Reagents
Deoxynucleoside triphosphate (Roche Diagnostics, catalog number: 11969064001 )
Gamma [γ-32P] ATP (PerkinElmer, catalog number: Blu502A001MC )
G-25 Macro spin columns (best suited for volumes of 75-150 μl) (Harvard Apparatus, catalog number: 74-3901 )
40% Acrylamide-Bisacrylamide (19:1) solution (VWR International, catalog number: JT4969-0 )
T4 polynucleotide kinase (PNK) (New England Biolabs, catalog number: M0201L )
10X T4 polynucleotide kinase buffer (New England Biolabs, catalog number: B0201S )
Urea (VWR International, catalog number: 97061-926 )
Ammonium Persulfate (VWR International, catalog number: 97064-594 )
HIV Reverse Transcriptase, purified as described in Hou et al. (2004)
DNA oligonucleotides from Integrated DNA Technologies
Template:
5'-GGGCGAATTTAG[G/C]TTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTG G-3’. The underlined nucleotides in brackets indicate that templates with either a G or C at this position can be used depending on the type of mismatch examined.
Primer:
5ʹ-TAACCCTCACTAAAGGGAACAAAAX-3ʹ. “X” at the 3ʹ end of the primer denotes A, T, or C depending on the mismatch examined. “X” in the case of a matched primer is G.
1 M MgCl2
Extension reaction buffer (see Recipes)
2x loading dye (see Recipes)
Equipment
Eppendorf tubes
Micropipette
Table top centrifuge
Incubator
Gel apparatus
Software
Sigmaplot Version 10.0 (Sysstat Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Achuthan, V. and DeStefano, J. J. (2015). Mismatched Primer Extension Assays. Bio-protocol 5(12): e1508. DOI: 10.21769/BioProtoc.1508.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,509
|
https://bio-protocol.org/exchange/protocoldetail?id=1509&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primer Extension Reactions for the PCR- based α- complementation Assay
Vasudevan Achuthan
JD Jeffrey J. DeStefano
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1509 Views: 10209
Reviewed by: Yu ChenChang Ho Lee
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
The PCR- based- α- complementation assay is an effective technique to measure the fidelity of polymerases, especially RNA-dependent RNA polymerases (RDRP) and Reverse Transcriptases (RT). It has been successfully employed to determine the fidelity of the poliovirus polymerase 3D-pol (DeStefano, 2010) as well as the human immunodeficiency virus Reverse Transcriptase (HIV RT) (Achuthan et al., 2014). A major advantage of the assay is that since the PCR step is involved, even the low yield of products obtained after two rounds of low yield of RNA synthesis (for RDRP) or reverse transcription (for RT) can be measured using the assay. The assay also mimics the reverse transcription process, since both RNA- and DNA- directed RT synthesis steps are performed. We recently used this assay to show that the HIV RT, at physiologically relevant magnesium concentration, has accuracy in the same range as other reverse transcriptases (Achuthan et al., 2014). Here, we describe in detail how to prepare the inserts using the primer extension reactions. The prepared inserts are then processed further in the PCR- based- α- complementation assay.
Materials and Reagents
pBSM13+ (Stratagene)
T3 RNA polymerase (Roche Diagnostics, catalog number: P2083 )
10x transcription buffer (Roche Diagnostics, catalog number: P2083 )
High-fidelity PvuII (PvuII-HF) (New England Biolabs, catalog number: R3151L )
High-fidelity EcoRI (EcoRI-HF) (New England Biolabs, catalog number: R3101L )
10x CutSmart buffer (New England Biolabs, catalog number: R3101L)
6x gel loading dye (New England Biolabs, catalog number: R3101L)
NdeI (New England Biolabs, catalog number: R0111L )
T4 polynucleotide kinase (PNK) (New England Biolabs, catalog number: M0201L )
10x T4 polynucleotide kinase buffer (New England Biolabs, catalog Number: B0201S )
RNasin (RNase inhibitor) (New England Biolabs, catalog number: M0307L )
RNase (DNase-free) (Roche Diagnostics, catalog number: 11119915001 )
RNase-free DNase I (Affymetrix, catalog number: 784111000 )
Pfu DNA polymerase (Agilent Technologies, catalog number: 600353 )
10x Pfu buffer (Agilent Technologies, catalog number: 600353)
Ribonucleoside triphosphate set (Roche Diagnostics, catalog number: 11277057001 )
Deoxynucleoside triphosphate (dNTP) (Roche Diagnostics, catalog number: 11969064001 )
Gamma [γ-32P] ATP (PerkinElmer, catalog number: Blu502A001MC )
G-25 Macro spin columns (best suited for volumes of 75-150 μl) (Harvard Apparatus, catalog number: 74-3901 )
RNeasy RNA purification kit (QIAGEN, catalog number: 74104 )
Phenol: Chloroform: Isoamyl alcohol (25:24:1) (Amresco, catalog number: K169-400ML )
Ethanol (VWR Lifesciences, catalog number: EM1.00967.4003 )
3M Sodium Acetate (Amresco, catalog number: E521-100ML )
Isopropyl alcohol (J.T.Baker®, catalog number: 9037-03 )
40% Acrylamide-Bisacrylamide (19:1) solution (VWR International, catalog number: JT4968-0 )
40% Acrylamide-Bisacrylamide (29:1) solution (VWR International, catalog number: JT4968-0 )
Urea (VWR International, catalog number: 97061-926 )
Ammonium Persulfate (VWR International, catalog number: 97064-594 )
HIV Reverse Transcriptase, [purified as described in Hou et al. (2004)]
Milli-Q quality [RNase, DNase free water (dH2O)]
DNA oligonucleotides were obtained from Integrated DNA Technologies
Extension reaction buffer (see Recipes)
Elution buffer (see Recipes)
2x SDS loading buffer (see Recipes)
Equipment
Eppendorf tubes
Micropipette
Petri plates
Table top centrifuge
Incubator
Gel apparatus
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Achuthan, V. and DeStefano, J. J. (2015). Primer Extension Reactions for the PCR- based α- complementation Assay. Bio-protocol 5(12): e1509. DOI: 10.21769/BioProtoc.1509.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
151
|
https://bio-protocol.org/exchange/protocoldetail?id=151&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Neuron-enriched Cultures (Method 1)
HG Huiming Gao
Published: Nov 5, 2011
DOI: 10.21769/BioProtoc.151 Views: 10982
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol will guide you through the process for generating midbrain neuronal cultures from late embryo mouse brain. These cultures serve as a useful tool to study molecular pathways during neuronal death in various neurological disorders. This method uses cytosine β-D-arabinofuranoside in the cultures to suppress the proliferation of glial cells. Seven days after the seeding, the neuron-enriched cultures prepared following this protocol will contain less than 10% glia cultures. The concentrations of β-D-arabinofuranoside should be adjusted according to your culture condition. This protocol has been developed and improved over the years by various researchers in Dr. Hong’s lab, especially Dr. Bin Liu.
Materials and Reagents
Poly-D-lysine (Sigma-Aldrich, catalog number: P7280 )
MEM (Life Technologies, Gibco®, catalog number: 11090-08 )
D-Glucose
Sterile PBS
Trypan blue dye
Heat-inactivated fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 16000-044 )
Heat-inactivated horse serum (HS) (Life Technologies, Gibco®, catalog number: 26050-088 )
Non-essential amino acids (100 ml) (Life Technologies, Gibco®, catalog number: 11140-050 )
Sodium pyruvate (100 ml) (Sigma-Aldrich, catalog number: S8636 )
200 mM L-glutamine (100 ml) (Life Technologies, Gibco®, catalog number: 25030-081 )
Penicillin/streptomycin (100 ml) (Sigma-Aldrich, catalog number: P0781 )
Neurobasal medium (Life Technologies, InvitrogenTM, catalog number: 12348-017 )
50x B27 serum-free supplement (10 ml) (Life Technologies, InvitrogenTM/ Gibco®, catalog number: 21103-049 )
Poly-D-lysine solution (see Recipes)
Maintenance culture medium (see Recipes)
Treatment medium (see Recipes)
Equipment
Cell culture incubator
Centrifuges
Dissection microscope
Scissors and forceps
Laminar hood
24-well plates
50 ml tube
10-ml pipet
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Gao, H. (2011). Generation of Neuron-enriched Cultures (Method 1). Bio-101: e151. DOI: 10.21769/BioProtoc.151.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,510
|
https://bio-protocol.org/exchange/protocoldetail?id=1510&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Development and Implementation of an in vitro Culture System for Intact Detached Grape Berries
Zhanwu Dai
MM Messa Meddar
SD Serge Delrot
EG Eric Gomès
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1510 Views: 10953
Edited by: Arsalan Daudi
Reviewed by: Kabin Xie
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Grape composition depends on the metabolites accumulated and synthesized during grape development. It is of paramount importance for grape growers because of its major role in shaping wine quality. Therefore, understanding the regulation mechanisms that control the accumulation of quality-related metabolites in grape is of both scientific and agronomical interests. The composition of grape berry at harvest is under complex regulation and can be affected by many factors (Conde et al., 2007). The study of the effects of these factors on berries still attached to intact plants can be highly challenging because of the large size of the plants, interplant, intercluster and interberry variability; and because it is complicated to precisely control the nutrients and hormones imported by the berries, and the environment. Therefore, in vitro cultured grape berries are a good model system, which better represents berry anatomy structure (skin and flesh) than grape cell suspensions and nevertheless largely reduces the system complexity compared to whole plant (Bravdo et al., 1990; Pérez et al., 2000; Gambetta et al., 2010). To this end, an in vitro culture system of intact detached grape berries has been developed by coupling greenhouse fruiting-cuttings production and in vitro organ culture techniques (Dai et al., 2014). The cultured berries are able to actively absorb and utilize carbon and nitrogen from the culture medium, and exhibit fruit ripening features such as color changing and softening. This in vitro system may serve to investigate the response of berry composition to environmental and nutrient factors.
Keywords: Vitis Grape quality In vitro Fruit quality Fleshy fruit
Materials and Reagents
Grapevine berries from greenhouse-grown fruiting-cuttings of Vitis vinifera L. cv. Cabernet Sauvignon at various developmental stages (e.g. pea size, green berry, veraison, or later stages). The fruiting-cuttings (i.e. only one primary shoot axis with a single cluster per plant) were prepared as described in Mullins and Rajasekaran (1981) and grown in a naturally illuminated and semi-regulated greenhouse (mean seasonal temperature amplitude 20-35 °C) with fungicide treatments every two weeks (Figure 1).
Note: Efficient fungicide treatments are essential to maximally exclude pathogen infection to grape berries and minimize the sterilization step for the in vitro culture. For example, we continuously provide sulfur contained in sulfur diffusion hotbox (Nivola Sulphur fl 220 v 3 m, Figure 1B) in the greenhouse and treated the vines with armicarb® at 5 g/L every two weeks.
Figure 1. Fruit-bearing cuttings grown in a semi-controlled greenhouse (A) and the sulfur diffusion hotbox (B)
70% ethanol
NaClO with available chlorine 2% (Sigma-Aldrich, catalog number: 425044-1L )
MS (Murashige & Skoog) medium (Duchefa Biochemie, catalog number: M 0221 )
Sucrose (Duchefa Biochemie, catalog number: S0809 )
N-Z-Amine A (Sigma-Aldrich, catalog number: C7290 )
Vitamines
Myo-inositol 100 mg/L (Sigma-Aldrich, catalog number: I5125 )
Nicotinic acid 1 mg/L (Sigma-Aldrich, catalog number: N0765 )
Pantothenic acid 1 mg/L (Duchefa Biochemie, catalog number: C0604 )
Biotin 0.01 mg/L (Sigma-Aldrich, catalog number: B4639 )
Pyridoxine HCl 1 mg/L (Sigma-Aldrich, catalog number: P9755 )
Thiamine HCl 1 mg/L (Sigma-Aldrich, catalog number: T4625 )
0.5 M NaOH
Agar (Kalys, catalog number: HP 696 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
Sterile water
MS medium with sucrose and vitamins (see Recipes)
200x vitamin (see Recipes)
20 mM EDTA (see Recipes)
Equipment
Laminar flow cabinet (Steril-Helios, Figure 2A)
Shaker (Dragon lab, sk-330-pro, Figure 2A)
Autoclave machine
Growth room with constant temperature of 26 ± 0.5 °C, light period 16 h/8 h day/night, and light ~50 μmol m-2 s-1 (Figure 4H)
Sterilized 6-well plates (Dutscher, catalog number: 353046 , Figure 5B)
Sterilized plastic boxes with filter (Dutscher, catalog number: E 1650 , Figures 3F, 4G, and 5A)
Tip plate (Figure 3A)
Polystyrene (Figure 3C)
Culture dish (145/20 mm, Greiner Bio-One GmbH, Figure 4E)
Sterilization solution container (Figure 2C-D)
Colander, forceps, scissors, and blade (Figure 2B)
Figure 2. Equipment used in grape berry culture. A. Laminar flow cabinet with a shaker. B. colander, forceps, scissors, and blade. C. solution container, culture boxes, and small materials just after autoclave. D. Sterilized containers for ethanol and NaClO.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Dai, Z., Meddar, M., Delrot, S. and Gomès, E. (2015). Development and Implementation of an in vitro Culture System for Intact Detached Grape Berries. Bio-protocol 5(12): e1510. DOI: 10.21769/BioProtoc.1510.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,511
|
https://bio-protocol.org/exchange/protocoldetail?id=1511&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Metabolic Assays for Detection of Neutral Fat Stores
JB Jan M. Baumann
LK Leila Kokabee
XW Xianhiu Wang
YS Yan Sun
JW Jason Wong
DC Douglas S. Conklin
Published: Vol 5, Iss 12, Jun 20, 2015
DOI: 10.21769/BioProtoc.1511 Views: 14690
Edited by: HongLok Lung
Reviewed by: Justine MarsolierKate Hannan
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Lipid droplets (LDs) are ubiquitous intracellular structures whose formation, growth, and maintenance are highly regulated (Wang et al., 2013; Ranall et al., 2011; Goodman, 2009). Lipid metabolism and droplet dynamics are of considerable interest to agriculture, biofuel production, viral pathology, nutrition, and cancer biology (Walther and Farese, 2009; Liu et al., 2010). Accumulation of fatty acids and neutral lipids in nonadipose tissues is cytotoxic (Kourtidis et al., 2009). BODIPY 493/503 (4,4-Difluoro-1,3,5,7,8-Pentamethyl-4-Bora-3a,4a-Diaza-s-Indacene) is the standard dye to study LDs within adipocytes. BODIPY 493/503 contains a nonpolar structure that, upon binding to neutral lipid, emits a green fluorescence signal with a narrow wavelength range, making it an ideal fluorophore for multi-labeling experiments. The hydrophobic nature of the dye molecules promotes rapid entry into the nonpolar environment of LDs (Listenberge and Brown, 2007). Gocze and Freeman showed that the lipid fluorescent variability is significantly lower when using BODIPY493/503 compared to Nile Red, suggesting that it may be more specific for the LD (Gocze and Freeman, 1994). Here, we describe a BODIPY 493/503 assay for the detection of neural fat stores in cultured cells (Figure 1) (Wang et al., 2013).
Figure 1. MCF7 cells were treated with 250 μM palmitate or vehicle control for 24 h. A number of breast cancer cells possess a lipogenic metabolic phenotype that makes them especially sensitive to the addition of physiological concentrations of exogenous saturated fatty acids, such as palmitate. Although palmitate supplementation induces cell death in HER2/neu-positive cells, other breast cancer sub-types, including MCF-7 cells, accumulate the fatty acid which leads to significant increases in intracellular triglyceride fat stores. Cells were fixed and stained for fat stores with BODIPY 493/503 (green). Hoechst 33342 (blue) was used for nuclei staining.
Materials and Reagents
Cell line suitable for testing, MCF7 (ATCC, catalog number: HTB-22 TM) cells perform well as a staining control
Dulbecco’s Modified Eagle’s Medium (DMEM) (high glucose with L-glutamine) (Thermo Fisher Scientific, catalog number: SH3024301 ) or other media appropriate for MCF7 cell culture
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F4135 )
Phosphate buffered saline (PBS) (e.g. HyClone, catalog number: SH30258-02 ) or Dulbecco's phosphate buffered saline (with Ca2+ and Mg2+) (DPBS) (e.g. Sigma-Aldrich, catalog number: D1283 )
Sodium palmitate, (used as positive control) (Sigma-Aldrich, catalog number: P9767 )
Dimethyl sulfoxide (Sigma-Aldrich, catalog number: D8418 )
BODIPY 493/503 (4,4-Difluoro-1,3,5,7,8-Pentamethyl-4-Bora-3a,4a-Diaza-s-Indacene) (Life Technologies, catalog number: D-3922 )
37% formaldehyde (Thermo Fisher Scientific, catalog number: F79 )
Hoechst 33342 (Life Technologies, catalog number: H21492 )
500x BODIPY 493/503 stock solution (see Recipes)
10,000x Hoechst 33342 stock solution (see Recipes)
Equipment
96-well tissue culture plate suitable for imaging, (e.g. Corning, Costar®, catalog number: 3603 )
Cell culture incubator at 37 °C with 5% CO2
Fluorescence microscope or automated imaging system (e.g. IN Cell Analyzer, GE Healthcare)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Baumann, J. M., Kokabee, L., Wang, X., Sun, Y., Wong, J. and Conklin, D. S. (2015). Metabolic Assays for Detection of Neutral Fat Stores. Bio-protocol 5(12): e1511. DOI: 10.21769/BioProtoc.1511.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Cell biology assays
Biochemistry > Lipid > Lipid measurement
Cell Biology > Cell staining > Lipid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,512
|
https://bio-protocol.org/exchange/protocoldetail?id=1512&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Trichoderma harzianum Root Colonization in Arabidopsis
AA Ana Alonso-Ramírez
JP Jorge Poveda
IM Ignacio Martín
RH Rosa Hermosa
EM Enrique Monte
Carlos Nicolás
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1512 Views: 9366
Edited by: Arsalan Daudi
Reviewed by: Kanika GeraMalou Fraiture
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Trichoderma is a soil-borne fungal genus that includes species with a significant impact on agriculture and industrial processes. In this article we show a detailed protocol of Trichoderma harzianum (T. harzianum) root invasion procedure described by Alonso-Ramírez et al. (2014). Some Trichoderma strains exert beneficial effects in plants through root colonization. They promote growth and development, modify root architecture, facilitate efficient nutrient use, or stimulate defenses against pathogens, although little is known about how this interaction takes place. For this purpose, Trichoderma-Arabidopsis hydroponic cultures were grown inside Phytatray II boxes, using mycelia obtained from spores of T. harzianum and Arabidopsis thaliana (A. thaliana) seedlings. In this way changes in root architecture, such as callose deposition, promoted by the fungus can be analyzed.
Materials and Reagents
Arabidopsis thaliana Col-0 ecotype seeds from Arabidopsis Information Service Collection (www.arabidopsis.info)
Trichoderma harzianum CECT 2413 (Spanish Type Culture Collection, Valencia, Spain) [referred to as T34 along the paper is the strain used in this work. T. harzianum T34 is grown on Potato Dextrose Agar (PDA) and spores are maintained at -80 °C in a 30% glycerol solution]
Murashige & Skoog medium (MS), including B5 vitamins (Duchefa Biochemia, catalog number: M0255.0050 )
Sucrose (Applichem Panreac, catalog number: 141621.1211 )
85% potassium hydroxide pellets (KOH) (Applichem Panreac, catalog number: 141515.1210 )
0.15% agarose (Conda Pronadisa, catalog number: 8016 )
0.39% potato dextrose agar (PDA) (Sigma-Aldrich, catalog number: P2182 )
0.24% potato dextrose broth (PDB) (Sigma-Aldrich, catalog number: P6685 )
Potato dextrose agar (PDA) (Conda, catalog number: 1022.00 )
Potato dextrose broth (PDB) (Difco, catalog number: 254920 )
Glass wool washed QP (Panreac, catalog number: 211376.1208 )
Resma filter paper (420 x 500 mm) (Auxilab S.L, catalog number: 80250452 )
Liquid nitrogen (Air Liquide)
Ethanol (Panreac, catalog number: 161086 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Sodium hypochlorite
Sterilization solution (see Recipes)
MS Medium (see Recipes)
Washing solution (see Recipes)
Equipment
Sterile distilled water purification system (EMD Millipore, model: ELIX35 )
Brand cotton roving (Sigma-Aldrich, catalog number: BR28205 )
Sterile stainless steel screen (Alunet, catalog number: 174562 )
Surgical Micropore tape (3M, catalog number: 1530-0 )
1.5 ml microtubes (Deltalab, catalog number: 200400P )
Cold chamber
Phytatray II boxes [114 mm, 86 mm, 102 mm (W x D x H)] (Sigma-Aldrich, catalog number: P5929 )
Laminar flow cabinet (Telstar, model: AV-100 )
Plant Growth Chamber AGP-1400-HR (Radiber SA)
Shaker Certomat® R (B. Braun, model: 986302/4 )
Petri dishes (90 x 14 mm) (Deltalab, catalog number: 200209 )
Surgeon carbon steel (surgical blade sterile) (Jai Surgicals, catalog number: 0835147 )
1.5 ml microtubes with glass wool (homemade)
15 ml Tubes (Deltalab, catalog number: 401402 )
Thoma cell counting chamber (BRAND, catalog number: 7180 05 )
Coverslip EUROTUBO (22 x 22 mm) (Deltalab, catalog number: D102222 )
Optical microscope (Leica Microsystems AG, model: DC300F; catalog number: 10447115 )
Erlenmeyer flask (Thermo Fischer Scientific, catalog number: 11972233 )
Kühner shaker (Thermo Fisher Scientific, model: ISF-1-W )
Vacuum/pressure pump PALL (Life Sciences, model: DOA-P730-BN )
Safety glass (vacuum flask, 10 ml pipette and gums) (homemade)
X5 Graduated pipette (type1, class B, ISO 835) (Thermo Fisher Scientific, catalog number: 11912178 )
Medical grade silicone tubing (1x 1.5, internal diameter x external diameter) (Deltalab, catalog number: 3500115 )
Rubber plugs (VWR International, catalog number: 217-9463 )
Forceps (stainless, L= 105 mm) (Thermo Fisher Scientific, catalog number: 10458242 )
Vacuum flask pirex (1,000 ml) (Thermo Fisher Scientific, catalog number: 12693182 )
Magnetic filter funnel (VWR International, catalog number: 516-7590 )
Scissors stainless 170 mm (Thermo Fisher Scientific, catalog number: 12693182)
Lyophilizer Virtis Advantage (SP Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Alonso-Ramírez, A., Poveda, J., Martín, I., Hermosa, R., Monte, E. and Nicolás, C. (2015). Trichoderma harzianum Root Colonization in Arabidopsis. Bio-protocol 5(13): e1512. DOI: 10.21769/BioProtoc.1512.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Host-microbe interactions
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,513
|
https://bio-protocol.org/exchange/protocoldetail?id=1513&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Axenic Cultivation of Mycelium of the Lichenized Fungus, Lobaria pulmonaria (Peltigerales, Ascomycota)
Carolina Cornejo
CS Christoph Scheidegger
Rosmarie Honegger
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1513 Views: 9916
Edited by: Fanglian He
Reviewed by: Chong He
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Lichens are symbiotic organisms consisting of a fungal partner (the mycobiont) and one or more algal or cyanobacterial partners (the photobiont); moreover lichen thalli comprise a plethora of epi- and endobiotic bacteria and non-lichenized fungi. Genetic markers are the most promising tools for the study of fungal diversity. However, applying genetic methods to intimately admixed symbiotic organisms typically requires the development of species-specific genetic markers, since DNA extraction from environmental specimens implicates the acquirement of total DNA of all symbionts and their cohabitants. While the cultivation of the alga is straight forward, the axenic cultivation of lichen-forming fungi is more difficult due to their very slow growth, as compared with the majority of non-lichenized taxa, and the presence of saprophytic, endophytic and parasitic fungi within the lichen thallus. Moreover, lichen-forming fungi (predominantly ascomycetes, few basidiomycetes) are oligotrophic organisms and thus adapted to nutrient poor conditions; in axenic culture on nutrient-rich media, as normally used for mass production of fast-growing saprophytic fungi, they often autointoxicate. Most lichen-forming fungi are not obligately biotrophic and thus can be cultured in the non-symbiotic state.
Here, we present a protocol for the isolation of the lichen-forming ascomycete Lobaria pulmonaria into axenic culture and for mycelial mass culture as a source of pure fungal DNA. We describe the initiation of axenic cultures on agar plates from germinating ascospores and explain the optimization of the in vitro growth in liquid medium. By grinding the few dense, only centrifugally growing fungal colonies with a homogenizer we obtain lots of smaller, well growing colonies and thus higher amounts of mycelium for DNA or RNA isolation (Honegger and Bartnicki-Garcia, 1991).
Materials and Reagents
Freshly collected lichen thalli of Lobaria pulmonaria bearing apothecia
Alpha-cyclodextrin (Sigma-Aldrich, catalog number: C4642 )
BBLTM cornmeal agar (BD, catalog number: 211132 )
BactoTM casamino acids (BD, catalog number: 228830 )
BactoTM malt extract (BD, catalog number: 218630 )
BactoTM peptone (BD, catalog number: 211677 )
BactoTM yeast extract (BD, catalog number: 212750 )
CaCl2.2H2O (Merck, catalog number: 102382 )
Co(NO3).6H2O (Sigma-Aldrich, catalog number: 60832 )
CuSO4.5H2O (Sigma-Aldrich, catalog number: RES10395 )
EDTA (Sigma-Aldrich, catalog number: ED2SS )
FeSO4.7H2O (Sigma-Aldrich, catalog number: F7002 )
Glucose (Fluka, catalog number: 49159 )
H3BO3 (Sigma-Aldrich, catalog number: 31146 )
KH2PO4 (Merck, catalog number: 1.04873 )
K2HPO4 (Merck, catalog number: 1.05104 )
KOH (Fluka, catalog number: 60369 )
NaCl (Sigma-Aldrich, catalog number: 71376 )
NaNO3 (Sigma-Aldrich, catalog number: S5506 )
MgSO4.7H2O (Merck, catalog number: 5856 )
MnCl2.4H2O (Merck, catalog number: 105927 )
MoO3 (Sigma-Aldrich, catalog number: M0753 )
ZnSO4.7H2O (Sigma-Aldrich, catalog number: Z4750 )
Aluminum foil
Bidistilled water
Sterilized tap water
Liquid nitrogen
Sterilization agent for hands
Germination medium (see Recipes)
Lichen medium (see Recipes)
Bold’s basal medium (BBM) (see Recipes)
Equipment
Double edge razor blades (any brand)
Platinum inoculation needles (flame-resistant)
Dissection forceps, stainless steel (flame-resistant)
Spatula, stainless steel (flame-resistant)
Filter paper circles (ø 45-55 mm) (Schleicher & Schuell 589/2)
Petri dishes (ø 100 mm, sterile) (plastic, plus 1-2 autoclavable glass dishes) (any brand)
Perforated bar spoons, ca. 30 cm long, stainless steel (flame-resistant)
Laboratory bottles (SCHOTT DURAN® 100 ml, 500 ml, and 1,000 ml)
Erlenmeyer flasks (SCHOTT DURAN® 200 ml, wide neck)
Plugs for Erlenmeyer flasks, cellulose
Two glass beakers (500 ml and 200 ml)
Glass pipets (20 ml, 10 ml, and 1 ml)
Rubber pipet filler up to 100 ml
Falcon tubes (50 ml, sterile, nonpyrogenic and DNase-/RNase-free, cryo-resistent) (liquid nitrogen)
Racks for Falcon tubes (cryo-resistant) (liquid nitrogen)
Dissecting microscope with an objective lens capable of resolving ascospores (10-30 µm)
Precision balance with milligram resolution range
Sterile Bench, ideally with UV radiation
Bunsen burner
Autoclave for liquid and solid material
Homogenizer (either a IKA DI 18 basic or Ultraturrax T 18), mounted on a plate stand with a boss head clamp
Autoclavable homogenizer rods (made from stainless steel, IKA S 18 N-19G)
Cryogenic vessel big enough to contain a rack with Falcon tubes
Growth chamber with (continuous) 15-16 °C±1 °C and 12 h light/12 h dark regime
Note: The humidity must not be controlled but ensure dry conditions within the chamber.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Cornejo, C., Scheidegger, C. and Honegger, R. (2015). Axenic Cultivation of Mycelium of the Lichenized Fungus, Lobaria pulmonaria (Peltigerales, Ascomycota). Bio-protocol 5(13): e1513. DOI: 10.21769/BioProtoc.1513.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,514
|
https://bio-protocol.org/exchange/protocoldetail?id=1514&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Models of Uncomplicated and Fatal Malaria
BH Brian W. Huang*
EP Emily Pearman*
Charles C. Kim
*Contributed equally to this work
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1514 Views: 14938
Reviewed by: Migla Miskinyte
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Mouse models have demonstrated utility in delineating the mechanisms underlying many aspects of malaria immunology and physiology. The most common mouse models of malaria employ the rodent-specific parasite species Plasmodium berghei, P. yoelii, and P. chabaudi, which elicit distinct pathologies and immune responses and are used to model different manifestations of human disease. In vitro culture methods are not well developed for rodent Plasmodium parasites, which thus require in vivo maintenance. Moreover, physiologically relevant immunological processes are best studied in vivo. Here, we detail the processes of infecting mice with Plasmodium, maintaining the parasite in vivo, and monitoring parasite levels and health parameters throughout infection.
Keywords: Mouse Malaria Plasmodium Infection Immunology
Materials and Reagents
Mice. We perform most of our work in C57BL/6 mice due to the wide availability of transgenic and knockout strains on this genetic background. Slight differences in vendor-specific sub-strains exist, so it is preferable to obtain the mice from the same source throughout a given study. The majority of our studies use 9-12 week old females, since males have higher parasite loads and mortality with P. chabaudi infection in many mouse strains (Laroque et al., 2012).
Plasmodium parasites. Plasmodium parasites can be obtained from the Malaria Research and Reference Reagent Resource (MR4). The most commonly used rodent malaria strains include P. chabaudi AS (MRA-429; used to model uncomplicated malaria), P. berghei ANKA (MRA-311; fatal cerebral malaria), P. yoelii 17XNL (MRA-593; uncomplicated malaria; resolves late relative to P. chabaudi), and P. yoelii YM (MRA-755; lethal malaria without cerebral pathology).
Immersion oil Type A (Cargille, catalog number: 16482 )
Methanol (Thermo Fisher Scientific, catalog number: A412P4 )
Giemsa stain (Acros Organics, catalog number: 295591000 )
1x PBS (Mediatech Inc., catalog number: 21-040 CV )
Alsever’s solution (MP Biomedicals, catalog number: 092801154 ) (see Recipes) (Note 1)
Equipment
1 ml syringes (BD, catalog number: 309628 )
25 g ⅝” needles (BD, catalog number: 305122 )
25 mm x 75 mm x 1 mm unfrosted glass slides (Premiere, catalog number: 9101-E )
25 mm x 75 mm x 1 mm frosted glass slides (Globe Scientific Inc., catalog number: 1324W )
Slide staining rack and chamber (Electron Microscopy Sciences, catalog number: 62543-06 and 62541-01 )
Glass cutter (optional) (General, catalog number: 06637383 )
1.5 ml microfuge tubes (Thermo Fisher Scientific, catalog number: 50809238 )
Sharp surgical scissors
Brightfield microscope equipped with 100x objective
Lens paper (Thermo Fisher Scientific, catalog number: 11-995 )
Lamellar flow hood (optional; if working in a pathogen-free animal facility)
Scale with cup for weighing mice (OHAUS, catalog number: SB36853M )
Software
VersaCount (Kim and DeRisi, 2010)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Huang, B. W., Pearman, E. and Kim, C. C. (2015). Mouse Models of Uncomplicated and Fatal Malaria. Bio-protocol 5(13): e1514. DOI: 10.21769/BioProtoc.1514.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,515
|
https://bio-protocol.org/exchange/protocoldetail?id=1515&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Alternative Oxidase Expression in Arabidopsis thaliana Protoplasts Treated with Aluminium
Jian Liu
Zhe Li
DX Da Xing
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1515 Views: 9028
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Aluminium (Al), a non-essential metal widespread in the environment that is known to be toxic to humans as well as to plants, can cause damage not only to the roots but also to the aerial parts of plants. Its toxicity has been recognized as one of the major factors that limit crop production on acid soil. Alternative oxidase, the respiratory terminal oxidase in plants, which contributes to maintain the electron flux and reduce mitochondrial ROS levels, is often dramatically induced to make plants to adapt better to stress conditions like Al stress. In this protocol, the expression of alternative oxidase induced by Al treatment was detected in Arabidopsis protoplasts using an adaptation of previous methods (Yamamoto et al., 2002; Li et al., 2011; Liu et al., 2014), which contribute to research on the mechanism of alternative oxidase in Al treatment.
Materials and Reagents
Rosette leaves of Arabidopsis (Columbia, 3 weeks)
AlCl3 (Sigma-Aldrich, catalog number: 237051 )
CaCl2 (Sigma-Aldrich, catalog number: C7902 )
HCl (Sigma-Aldrich, catalog number: 258148 )
FDA (Sigma-Aldrich, catalog number: 596-09-8 )
TRI reagent (Sigma-Aldrich, catalog number: 93289 )
Cellulase R10 (Yakult Honsha, catalog number: C6260 )
Macerozyme R10 (Yakult Honsha, catalog number: 8032-75-1 )
Mannitol (Sigma-Aldrich, catalog number: M4125 )
MES (Sigma-Aldrich, catalog number: M8250 )
KCl (Sigma-Aldrich, catalog number: P3911 )
Bovine serum albumin (Sigma-Aldrich, catalog number: A-6793 )
NaCl (Sigma-Aldrich, catalog number: S6150 )
Glucose (Sigma-Aldrich, catalog number: G7528 )
Trition X-100 (Sigma-Aldrich, catalog number: T-8787 )
Phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: P7626 )
Tris (Sigma-Aldrich, catalog number: T1378 )
SDS (Sigma-Aldrich, catalog number: L6026 )
(NH4)2S2O8 (Sigma-Aldrich, catalog number: A3426 )
TEMED (Sigma-Aldrich, catalog number: T9281 )
Tween-20 (Sigma-Aldrich, catalog number: P9416 )
SuperScript II first-strand synthesis system (Life Technologies, InvitrogenTM, catalog number: 11904-018 )
SYBR Premix Ex Taq (Takara, catalog number: RR420A )
Bio-Rad protein assay kit (Bio-Rad Laboratories, catalog number: 500-0001 )
Anti-AOX antibody (Agrisera, catalog number: AS10699 )
Anti-Rubisco antibody (Agrisera, catalog number: AS03037 )
Anti-rabbit IgG (DylightTM 800 4x PEG Conjugate) secondary antibody (CST, catalog number: 5151 )
Anti-mouse IgG (DylightTM 800 Conjugate) secondary antibody (CST, catalog number: 5257 )
Enzyme solution (see Recipes)
W5 solution (see Recipes)
5 mM AlCl3 solution in Ca medium
Real time PCR reaction solution (see Recipes)
Lysis buffer (see Recipes)
10 ml separating gel (see Recipes)
6 ml stacking gels (see Recipes)
TBST (see Recipes)
Equipment
pH meter
Thermal Cycler (Roche, model: Light cycler 2.0 )
Confocal laser-scanning microscope (Carl-Zeiss, model: LSM510/ConfoCor2 )
Auto microplate reader (Tecan Trading AG, model: infinite M200 )
Two-color infrared imaging system (Odyssey, model: 9120 )
Centrifuge
Orbital shaker
PVDF membranes (Bio-Rad Laboratories, catalog number: 162-0177 )
Nylon mesh
96-well plates
1.5 ml microcentrifuge tube
Generic razor blade
Vacuum pump (Vacuubrand, model: MZ 2C )
BioPhotometer (Eppendorf, model: AG 22331 )
Software
Image J 1.43 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Abiotic stress
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,516
|
https://bio-protocol.org/exchange/protocoldetail?id=1516&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Animal Models of Corneal Injury
Matilda F. Chan
Zena Werb
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1516 Views: 10104
Edited by: Jia Li
Reviewed by: Andrea IntroiniAlka Mehra
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
The cornea is an excellent model system to use for the analysis of wound repair because of its accessibility, lack of vascularization, and simple anatomy. Corneal injuries may involve only the superficial epithelial layer or may penetrate deeper to involve both the epithelial and stromal layers. Here we describe two well-established in vivo corneal wound models: a mechanical wound model that allows for the study of re-epithelialization and a chemical wound model that may be used to study stromal activation in response to injury (Stepp et al., 2014; Carlson et al., 2003).
Keywords: Cornea Mouse Wound Epithelium Stroma
Materials and Reagents
Note: All reagents may be maintained at room temperature.
FVB mouse (5-10 weeks old)
Isoflurane (Abbott Laboratories, catalog number: 5260-04-05 )
Proparacaine hydrochloride ophthalmic solution (0.5%) (Bausch & Lomb, NDC: 24208-730- 06 )
Fluorescein sodium and benoxinate hydrochloride ophthalmic solution (0.25%/0.4%) (Akorn, NDC: 17478-640-10 )
Weck-cel cellulose eye spears (Medtronic, catalog number: 0008680 )
NaOH solution (see Recipes)
Chemical injury
Sterile water
1x sterile phosphate buffered saline buffer (1x PBS)
Sodium hydroxide (NaOH) 1.0 N (normal) solution (Sigma-Aldrich, catalog number: S2770 )
Fluorescein solution (see Recipes)
Equipment
Heating pad for mouse
Algerbrush II with 0.5 mm Burr (Katena, catalog number: K 2-4900 )
Trephine with handle (1.5 mm) (Beaver-visitec, catalog number: 9748 )
Alcohol swabs - isopropyl alcohol 70% (BD, catalog number: 326895 )
Filter paper (Thermo Fisher Scientific, catalog number: 09-795AA )
Ear punch (Roboz, catalog number: 65-9902 )
Forceps (Dumont #5)
Pipette with tips (1 ml)
Timer
Stereo microscope (for scratch/epithelial injury, need filter set to visualize GFP; for both injuries, camera attachment is optional) (Leica, catalog number: MZ16F )
Anesthesia machine with nose cone attachment appropriate for mice (Summit Anesthesia Solutions, catalog number: AS-01-0007 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Chan, M. F. and Werb, Z. (2015). Animal Models of Corneal Injury. Bio-protocol 5(13): e1516. DOI: 10.21769/BioProtoc.1516.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,517
|
https://bio-protocol.org/exchange/protocoldetail?id=1517&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Confocal Imaging of Myeloid Cells in the Corneal Stroma of Live Mice
Matilda F. Chan
Zena Werb
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1517 Views: 11514
Edited by: Jia Li
Reviewed by: Andrea IntroiniAlka Mehra
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
The accessibility and transparency of the cornea makes it a good tissue model for monitoring immunological responses using in vivo real time imaging analysis (Lee et al., 2010; Tan et al., 2013). These corneal qualities have also allowed for high-resolution in vivo imaging of non-ocular tissue transplanted into the anterior chamber of the mouse eye (Speier et al., 2008a; Speier et al., 2008b). This protocol was adapted from Speier (2008) to successfully assess real-time in vivo myeloid cell dynamics in wounded corneas of c-fms-EGFP mice (Chan et al., 2013). Macrophage colony-stimulating factor (CSF-1) regulates the differentiation and proliferation of cells of the mononuclear phagocyte system. The activity of CSF-1 is mediated by the CSF-1 receptor that is encoded by c-fms (Csf1r) protooncogene. The c-fms gene is expressed in macrophage, trophoblast cell lineages, and to some extent granulocytes. In the c-fms-EGFP mice EGFP, enhanced green fluorescent protein, is driven under the Csf1r, colony stimulating factor 1 receptor, promoter and highlights myeloid cells (Sasmono et al., 2003). This protocol can be further adapted to image other transgenic mice expressing fluorescent proteins.
Materials and Reagents
c-fms-EGFP mouse whose cornea was wounded by chemical injury 1 day prior (Chan and Werb, 2015)
Avertin (Sigma-Aldrich, catalog number: T4, 840-2 )
15.5 ml tert-amyl alcohol (2-methyl-2-butanol) (Thermo Fisher Scientific, catalog number: A730-1 )
Saline 0.9%
GenTeal gel (0.3%, eye gel) (Novartis, NDC: 0078-0429-47 )
Avertin stock solution (see Recipes)
Avertin working solution (1.2%) (see Recipes)
Equipment
25 Gauge needle
5 ml and 50 ml syringes
1.5 ml microcentrifuge tubes
0.22 micron filter
Head-holding adapter (Narishige, catalog number: SG-4N )
Dumont no. 5 forceps (Fine Science Tools, catalog number: 11251-10 )
UST-2 Solid Universal Joint (Narishige, catalog number: UST-2)
Polyethylene tubing (0.28 mm i.d., 0.61 mm o.d.) (Warner Instruments, catalog number: 64- 0750 )
Heating pad
Nikon Spectral Confocal (C1Si) equipped with a GFP filter, an argon laser, a 40x objective (NIR/ 0.8 NA W lens) and camera (Nikon D-eclipse C1Si) (Figure 1)
Figure 1. Confocal setup. The imaging setup includes a confocal microscope, camera, argon laser, and computer.
Software
Nikon Confocal Software (Nikon, Ez-C1 Gold version 3.8)
Imaris Software (Bitplane, version 7.3.1 for Windows X64)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell imaging > Confocal microscopy
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,518
|
https://bio-protocol.org/exchange/protocoldetail?id=1518&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessment of Olfactory Behavior in Mice: Odorant Detection and Habituation-Dishabituation Tests
Ana Perez-Villalba
MP Mª José Palop
Francisco Pérez-Sánchez
Isabel Fariñas
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1518 Views: 12038
Edited by: Soyun Kim
Reviewed by: Yatang Li
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Olfaction has adaptive value for rodents as it is essential for feeding and mating, the establishment of social and territorial relationships, or the detection of potential predators, among others (Apfelbach et al., 2005). Sensory input from the olfactory mucosa is first processed in the main olfactory bulb (MOB), a telencephalic structure that exhibits neurogenesis during the lifespan of the animal. Changes in MOB circuitry due to neuronal dysfunction or changes in interneuron turnover rate affect olfactory performance in different ways (Fleming et al., 2008; Breton-Provencher et al., 2009; Attems et al., 2014). Alterations in adult MOB neurogenesis, in particular, result in changes in odorant discrimination which can be assayed in habituation-dishabituation behavioral paradigms (Mouret et al., 2009; Delgado et al., 2014). Here, we present a simple protocol for the quantitative assessment of two olfactory tasks that can be used to detect neurogenic alterations in the MOB (Delgado et al., 2014). The procedure has been optimized to require little time and can, therefore, be used to analyze genetically modified mice that are housed in an isolated specific pathogen-free (SPF) mouse facility.
Materials and Reagents
Animals
Laboratory-bred experimentally-naïve male mice. Both CD1 and C57BL/6J strains have been successfully tested. Male mice are housed in groups of 4-5 per cage, kept in an environment with controlled temperature (23 ± 2 °C) and humidity under a 12-12 h light-dark cycle with food and water ad libitum. The use of only one gender reduces inter-individual variation. Males are used instead of females to avoid cycling hormone effects associated to oestrus (Jemiolo et al., 1986).
Note: All mice must be of equal or similar age (i.e. always less than two weeks apart, as the rate of neurogenesis is age-dependent). When this is not possible, cohorts of similar sizes for each experimental condition can be tested separately at different times, but this schedule results in greater variability and will, therefore, require a higher total number of animals. In most of our experiments a minimum of 7 mice were required to reach statistical significance. However, 10-12 mice per group are recommended to minimize the effects of inter-individual variation.
Odorants
Odorants must have non-emotional value. We use two synthetic odorants: citralva (geranonitrile, 3,7-dimethyl-2,6-octadien-1-nitrile), a lemon-like citrus smell, and geraniol (3,7-dimethyl-2,6-octadien-1-ol), a sweet rose-like scent, at dilutions that range between 1:160 to 1:10. Both odorants have been tested before in olfactory experiments (Luo et al., 2002; Delgado et al., 2014) although others, i.e. banana odor (isoamyl acetate), almond odor (benzaldehyde), or hexanal, have also been used in similar tests (see, for example, Mandairon et al., 2006; Fleming et al., 2008). Odorants can be obtained from different suppliers, such as Ventós S.A (dealer of International Flavors and Fragrances Inc. Barcelona, Spain). Because synthetic fragrances are usually available in an oleic format, we use mineral oil for their dilution. It is important to keep them always in tightly sealed containers to minimize their evaporation.
Other materials
1.Mineral oil (Sigma-Aldrich, catalog number: M5904 )
Equipment
Olfactory experiments are performed in a dedicated lab room with positive pressure (10-15 gauges) and frequent air reposition (no less than 20 times per hour) for fast removal of odors. Indirect dim lighting is recommended for testing. Essence dilutions should be prepared in a different, not connected room.
The materials used (see Figure 1) are:
A 22.5 x 22.5 x 29.5 cm open Plexiglas box with solid light green walls and a hole of 1 cm of diameter in one of the sides, located at 8 cm above the box ground and at 11.2 cm from the lateral corners of the box. A transparent methyl methacrylate solid cover is advisable to avoid essence dissipation during the tests. The video recording system is fixed above the exploration box at a distance of 30-40 cm from the transparent cover in order to video-tape at good resolution without interfering with the test.
Note: The olfactory exploration box can be custom-made following the description. The box is thoroughly wiped clean with 10% alcohol and dried before and after the experiment, as well as between animals. After each test, the used soiled bedding has to be carefully removed with a household vacuum cleaner and replaced by fresh bedding. Use odorless disposable paper towels and nitrile gloves for cleaning and drying.
Regular cotton sticks bought in any drugstore
Lab timer
Micropipette (2-20 or 20-200 µl-range) and appropriate disposable tips
Adhesive tape
1.5 ml microcentrifuge tubes to preserve the essences and a microcentrifuge tube rack to avoid fluid-containing tubes from tipping over
A sealed container (optional if the garbage bag is sealed) can be used for disposal of any objects that are impregnated with essences.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Cognition
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,519
|
https://bio-protocol.org/exchange/protocoldetail?id=1519&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Chemical Genetic Screening Procedure for Arabidopsis thaliana Seedlings
Marta Bjornson
XS Xingshun Song
AD Abhaya Dandekar
AF Annaliese Franz
GD Georgia Drakakaki
Katayoon Dehesh
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1519 Views: 11456
Edited by: Tie Liu
Reviewed by: Teresa Lenser
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Unbiased screening approaches are powerful tools enabling identification of novel players in biological processes. Chemical genetic screening refers to the technique of using a reporter response, such as expression of luciferase driven by a promoter of interest, to discover small molecules that affect a given process when applied to plants. These chemicals then act as tools for identification of regulatory components that could not otherwise be detected by forward genetic screens due to gene family redundancy or mutant lethality.
This protocol describes a chemical genetic screen using Arabidopsis thaliana seedlings, which has led to recognition of novel players in the plant general stress response.
Materials and Reagents
Reporter line seeds (this protocol was developed using luciferase under control of a minimal promoter containing four copies of the rapid stress response element - 4xRSRE:LUCIFERASE)
Murashige and Skoog basal medium (Sigma-Aldrich, catalog number: M0404 )
Phytoagar (PlantMedia, catalog number: 40100072-2 )
Sterile disposable reagent reservoir (Corning, catalog number: 07-200-128 )
Bleach (Clorox concentrated, 8.25% sodium hypochlorite)
Hydrochloric acid (HCl)
Chemical library (source may vary)
Potassium luciferin (Gold Biotechnology, model: LUCK-1G )
¼ strength MS media (see Recipes)
1 mM luciferin (see Recipes)
Equipment
Micropore surgical tape (3M, model: 1530-0 )
1.5 ml tubes (SealRite, catalog number: 1615-5500 )
96 well plates with lid: Flat bottom, sterile but not tissue culture treated (SARSTEDT AG, catalog number: 82.1571.001 )
Filter paper (here used Whatman 1440 125, pore size does not matter)
Toothpicks
Laminar flow hood or biosafety cabinet (here used SterilGARD ii, the Baker Company)
Chemical fume hood (here used St. Charles)
Vacuum chamber
Multichannel pipette (2-20 and 20-200 µl) (Rainin)
Temperature-controlled growth cabinet (here used Conviron, model: GR48 )
Charge-Couple Device camera (CCD camera; Andor DU434-BV CCD)
Dehesh lab Perl scripts (http://www-plb.ucdavis.edu/labs/dehesh/dehesh-lab-code.html)
Software
ANDOR Solis analysis software (Andor technology, v15, http://www.andor.com/scientific-software)
ImageJ image analysis software (http://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bjornson, M., Song, X., Dandekar, A. M., Franz, A., Drakakaki, G. and Dehesh, K. (2015). A Chemical Genetic Screening Procedure for Arabidopsis thaliana Seedlings. Bio-protocol 5(13): e1519. DOI: 10.21769/BioProtoc.1519.
Bjornson, M., Benn, G., Song, X., Comai, L., Franz, A. K., Dandekar, A. M., Drakakaki, G. and Dehesh, K. (2014). Distinct roles for mitogen-activated protein kinase signaling and CALMODULIN-BINDING TRANSCRIPTIONAL ACTIVATOR3 in regulating the peak time and amplitude of the plant general stress response. Plant Physiol 166(2): 988-996.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant immunity > Perception and signaling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
152
|
https://bio-protocol.org/exchange/protocoldetail?id=152&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stereotaxic Infusion of LPS into Rat Substantia Nigra via Osmotic Minipump
HG Huiming Gao
Published: Vol 2, Iss 8, Apr 20, 2012
DOI: 10.21769/BioProtoc.152 Views: 11949
Original Research Article:
The authors used this protocol in Jun 2002
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2002
Abstract
Stereotaxic infusion of LPS or your reagent of choice is an invaluable tool for the creation of chronic site-targeted lesions. Stereotaxic infusion of LPS has been used to establish chronic animal model of Parkinson’s disease, the most common neurodegenerative movement disorder. This protocol is especially useful to established chronic disease models and to study mechanisms of chronic central nervous system diseases.
Materials and Reagents
Eight-week-old male F344 rats, body weight 220–250 g
Nembutal
Carprofen
Betadine
70% ethanol
Phosphate buffered saline (PBS)
4% paraformaldehyde
Ocular lubricant (Puralube)
LPS (Escherichia coli 0111: B4) (Sigma-Aldrich)
0.9% sterile normal saline or other vehicle for your reagents
LPS stock solution (see Recipes)
Equipment
Small-animal stereotaxic apparatus (rat stereotaxic apparatus)
Osmotic minipump (Alza Corporation)
Dental drill and #1 burrs
Dental cement
Stereotaxic frame
Cannula (stainless steel with cap)
Microknife
Scalpel (#10)
Tissue forceps
Gauze
Autoclips/suture materials
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Gao, H. (2012). Stereotaxic Infusion of LPS into Rat Substantia Nigra via Osmotic Minipump. Bio-protocol 2(8): e152. DOI: 10.21769/BioProtoc.152.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,520
|
https://bio-protocol.org/exchange/protocoldetail?id=1520&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Immunoprecipitation Using Nicotiana benthamiana Transient Expression System
Fang Xu
Charles Copeland
XL Xin Li
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1520 Views: 21844
Edited by: Fanglian He
Reviewed by: Cindy Ast
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Nicotiana benthamiana (N. benthamiana) is a useful model system to transiently express protein at high level. This protocol describes in detail how to transiently express protein in N. benthamiana and how to carry out protein immunoprecipitation in this expression system. This protocol can be broadly used for investigation on protein-protein interaction, protein purification and other related protein assay.
Materials and Reagents
Nicotiana benthamiana seeds
Agrobacterium strains harboring binary vector (e.g. pCambia1300, pBIN19) with the targeted gene fused with protein purification tag
Note: In this protocol, we use 3x FLAG tag as an example.
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
MES (pH 5.6) (Sigma-Aldrich, catalog number: M8250 )
Protease Inhibitor (Roche, catalog number: 04693132001 )
Nonidet P 40 substitute (Fluka, catalog number: 74385 )
Induction medium (see Recipes)
Infiltration solution (see Recipes)
Extraction buffer (see Recipes)
TBS (see Recipes)
4x SDS (see Recipes)
Equipment
Anti-FLAG beads (Sigma-Aldrich, catalog number: A2220 )
3x FLAG peptides (Sigma-Aldrich, catalog number: F3290 )
Protein G sepharose beads (GE healthcare, catalog number: 17-0618-01 )
Test tubes, flask and shaker machine for culturing Agrobacterium
Centrifuge
1 ml blunt syringe (BD, catalog number: 309659 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Xu, F., Copeland, C. and Li, X. (2015). Protein Immunoprecipitation Using Nicotiana benthamiana Transient Expression System. Bio-protocol 5(13): e1520. DOI: 10.21769/BioProtoc.1520.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,521
|
https://bio-protocol.org/exchange/protocoldetail?id=1521&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Complex in vivo Ligation Using Homologous Recombination and High-efficiency Plasmid Rescue from Saccharomyces cerevisiae
Gregory C. Finnigan
Jeremy Thorner
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1521 Views: 12935
Edited by: Fanglian He
Reviewed by: Andreea Daraba
Original Research Article:
The authors used this protocol in Sep 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2011
Abstract
The protocols presented here allow for the facile generation of a wide variety of complex multipart DNA constructs (tagged gene products, gene fusions, chimeric proteins, and other variants) using homologous recombination and in vivo ligation in budding yeast (Saccharomyces cerevisiae). This method is straightforward, efficient and cost-effective, and can be used both for vector creation and for subsequent one-step, high frequency integration into a chromosomal locus in yeast. The procedure utilizes PCR with extended oligonucleotide “tails” of homology between multiple fragments to allow for reassembly in yeast in a single transformation followed by a method for highly efficient plasmid extraction from yeast (for transformation into bacteria). The latter is an improvement on existing methods of yeast plasmid extraction, which, historically, has been a limiting step in recovery of desired constructs. We describe the utility and convenience of our techniques, and provide several examples.
[Introduction] Homologous recombination (HR) in S. cerevisiae has long been recognized as an extremely convenient method for assembling DNA fragments in vivo (Szostak et al., 1983; Ma et al., 1987; Oldenburg et al., 1997). Given the efficiency of HR in yeast, it has been exploited in ways that have both increased its utility, enhanced its versatility, and permitted its application to a broad range of experimental objectives. Improvements to this general approach include using in vivo ligation as a platform for directed mutagenesis (Muhlrad et al., 1992), introducing counterselection to aid in plasmid creation (Gunyuzlu et al., 2001; Anderson and Haj-Ahmad, 2003), and adapting in vivo assembly to vectors that cannot be propagated in yeast (Iizasa and Nagano, 2006; Joska et al., 2014). However, previous studies have not fully harnessed the power and utility of HR. We have found that HR in vivo allows for very efficient assembly and recovery of plasmids containing numerous (>5 separate pieces) fragments of DNA in a single transformation step. Thereby, we have been readily able to construct a wide variety of gene disruption cassettes and integration cassettes, to clone exceptionally large genes, to assemble multi-part chimeric genes, and to generate multiply-tagged gene products. The primary utility and power of our methods are the capability to correctly and efficiently assemble multiple DNA fragments transformed into yeast in a single step. Our approach (Figure 1A) has been used successfully: (i) to assemble in-frame chimeras between two or more different genes; (ii) to fuse gene products to fluorescent probes and/or epitope tags at either their N- and/or C-termini, or both; (iii) to create gene deletion cassettes with large amounts of untranslated flanking sequence; (iv) to introduce one or more short linker sequences or epitope tag(s) between assembled genes or gene fragments; (v) to utilize a variety of transcriptional promoters and terminators; and, importantly, (vi) in one step, to generate constructs marked with a drug resistance gene cassette or a selectable nutritional gene cassette that integrate into the genome at the desired locus. Because HR in the yeast cell carries out the in vivo construction process (and subsequent integration, if desired), no kit or proprietary system is required and the assembly of collections of plasmids can be done in a massively parallel manner. In this regard, our system is considerably less expensive than the in vitro enzyme-driven “Gibson cloning” (Gibson, 2011) procedure, yet still remarkably efficient. Also, our system (unlike those requiring restriction enzyme digests to insert gene fragments) does not result in the insertion (or loss) of any nucleotides, which can sometimes occur in classical restriction site cloning. In our method, precise control over both the coding sequence and the flanking untranslated regions (UTRs) can be achieved. Lastly, constructs generated using this system can be coupled with the haploid yeast genome deletion collection (Winzeler et al., 1999; Giaever et al., 2002) to allow for simple and efficient one-step integration at any designed locus. The only rate-limiting factor in our method is the need for the transformed yeast cells to grow for a few days before the construct (or genetically altered cell) can be recovered.
Although similar overall methods may exist (Andersen, 2011), in our protocol, we developed several important improvements, which greatly enhance efficient recovery of the DNA constructs from yeast cells, including: (i) a specific yeast genotype that is much easier to lyse than standard laboratory strains, such as S288C (and its derivatives, e.g. BY4741); (ii) a spheroplasting step (to destroy the yeast cell wall); (iii) glass bead beating for better nucleic acid extraction; and, (iv) bacteria chemically treated for ultra-efficient DNA transformation.
Keywords: Homologous recombination Plasmid assembly In vivo ligation Yeast Plasmid rescue
Materials and Reagents
Yeast strains: SF838-1Dα (MATα ura3-52 leu2-3,122 his4-519 ade6 pep4-3 gal2; Rothman and Stevens, 1986) and THS4218 (SF838-1Dα; HIS4 his3Δ::HygR)
KOD Hot Start DNA Polymerase (EMD Millipore, distributed by VWR International, catalog number: 80511-384 )
DNA oligonucleotide primers (Integrated DNA Technologies, Inc.)
DpnI restriction enzyme (New England Biolabs, catalog number: R0176S )
Appropriate restriction enzyme(s) for digestion (New England Biolabs)
PEG: Poly (ethylene glycol), BioXtra avg. molecular weight 3,350 (Sigma-Aldrich, catalog number: P4388-1KG )
Lithium acetate dihydrate (Sigma-Aldrich, catalog number: L6883-1KG )
ssDNA: Deoxyribonucleic acid sodium salt from salmon testes (Sigma-Aldrich, catalog number: D1626-1G )
GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific, catalog number: K0503 )
Zymolyase® 100T from Arthrobacter leuteus (Amsbio LLC, catalog number: 120493-1 )
One Shot® TOP10 chemically competent E. coli (Life Technologies, InvitrogenTM, catalog number: C4040-03 )
Note: These serve as the seed cultures for further chemically competent procedure using CCMB80 buffer. Our competent cells are prepared by inoculating a 1 L culture of SOB medium (Hanahan et al., 1991) with One Shot® TOP10 cells and growing them to A600 nm~0.3 at 23 °C. After harvesting, the TOP10 cells were made chemically competent by treating them, as described (Hanahan et al., 1991), with “CCMB80 buffer” (10 mM KOAc, pH 7.0, 80 mM CaCl2.2H2O, 20 mM MnCl2.4H2O, 10 mM MgCl2.6H2O, 10% glycerol), which was adjusted to pH 6.4 with 0.1 N HCl (if necessary), filter sterilized, and stored at 4 °C. After treatment, the competent cells were stored in aliquots at -80 °C. (Different ultra-chemically competent E. coli strains may be used in place of TOP10 for this procedure).
Ampicillin (final concentration of 100 μg/ml; Research Products International Corp., catalog number: A40040-100.0 ) and Kanamycin (final concentration of 50 μg/ml; Life Technologies, catalog number: 11815-024 )
1 M sorbitol, 0.1 M Na2EDTA (see Recipes)
YPD liquid media (see Recipes)
SOB medium (see Recipes)
SOC medium (see Recipes)
LB plates (with appropriate drug included) (see Recipes)
Equipment
0.5 mm glass beads (BioSpec Products, catalog number: 11079105 )
Centrifuge (Eppendorf microcentrifuge model: 5415D , catalog number: 022621408 ; Eppendorf rotor, model: F-45-24-11 for 24 x 1.5/2 ml, catalog number: 022636502 )
Petri dish (100 x 15 mm size; VWR International, catalog number: 25384-088 )
Tube (Axygen Microtubes 1.5 ml clear, homo-polymer, boil-proof, catalog number: MCT-150-C )
Vortexing adaptor (Microtube foam insert for Fisher Vortex Genie 2 mixer, Scientific Industries, Inc.; catalog number: 504-0234-00 )
PCR machine (MJ Research PTC-200 Peltier Thermo Cycler, dual 30-well alpha blocks)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Finnigan, G. C. and Thorner, J. (2015). Complex in vivo Ligation Using Homologous Recombination and High-efficiency Plasmid Rescue from Saccharomyces cerevisiae. Bio-protocol 5(13): e1521. DOI: 10.21769/BioProtoc.1521.
Finnigan, G. C., Hanson-Smith, V., Houser, B. D., Park, H. J. and Stevens, T. H. (2011). The reconstructed ancestral subunit a functions as both V-ATPase isoforms Vph1p and Stv1p in Saccharomyces cerevisiae. Mol Biol Cell 22(17): 3176-3191.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,522
|
https://bio-protocol.org/exchange/protocoldetail?id=1522&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assays to Assess Virulence of Xanthomonas axonopodis pv. manihotis on Cassava
MC Megan Cohn*
MS Mikel Shybut*
DD Douglas Dahlbeck
BS Brian Staskawicz
*Contributed equally to this work
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1522 Views: 9180
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Cassava (Manihot esculenta) is a root crop that provides calories for people living in more than 100 tropical and subtropical countries and serves as a raw material for processing into starch and biofuels as well as feed for livestock (Howeler et al., 2013). Xanthomonas axonopodis pv. manihotis (Xam), the causal agent of cassava bacterial blight (CBB), can cause extensive crop damage (reviewed in Lopez et al., 2012; Lozano, 1986). Bacterial movement, growth in planta and the ability to cause disease symptoms are all important measures of bacterial fitness and plant susceptibility to CBB. Here we present a protocol for visualizing the movement of Xam within the plant. We also provide a detailed method of assaying bacterial growth in the cassava leaf midvein, and bacterial growth and disease symptom development in the leaf apoplast. These methods will be important tools for determining Xam strain pathogenicity and for developing cassava varieties that are resistant to CBB.
Keywords: Cassava Xanthomonas axonopodis Growth assay Bacteria Plant disease
Materials and Reagents
Cassava plants, cultivar TMS60444 (see Note 1)
Xam strains (grown 48 h on NYGA plates + antibiotic selection)
MgCl2
Peptone (Thermo Fisher Scientific, catalog number: BP1420-500 )
Yeast extract (Thermo Fisher Scientific, catalog number: BP1422-500 )
Glycerine
Agar (Thermo Fisher Scientific, catalog number: BP1423-500 )
NYGA (see Recipes)
Equipment
28 °C incubator
5 ¾” glass disposable Pasteur pipet (Thermo Fisher Scientific, catalog number: 13-678-20B ), with the tip broken and filed to make a smooth 2 mm diameter tip (Figure 3A)
2 in. x 4 in. cardboard covered with Parafilm
Mini-Beadbeater-96 (Biospec Products, catalog number: 1001 )
3 mm glass beads (Thermo Fisher Scientific, catalog number: 11-312A )
100 x 15 mm petri dishes
Spectrophotometer (Pharmacia Biotech Ultrospec 3000 )
Approximately 0.6 cm2 cork borer
1.7 ml Posi-Click tubes (Denville, catalog number: C-2170 )
Single edge razor blade (Garvey Products Inc., catalog number: 40475 )
1 ml needleless syringe (BD, catalog number: 309659 )
96 well plate reader for measuring luminescence (PerkinElmer, catalog number: 2104-0010 )
96 well OptiPlate, black (PerkinElmer, catalog number: 6005270 )
Dark room, x-ray imaging cassettes with film, ring stand
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Cohn, M., Shybut, M., Dahlbeck, D. and Staskawicz, B. (2015). Assays to Assess Virulence of Xanthomonas axonopodis pv. manihotis on Cassava . Bio-protocol 5(13): e1522. DOI: 10.21769/BioProtoc.1522.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,523
|
https://bio-protocol.org/exchange/protocoldetail?id=1523&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Uric Acid or Xanthine in Plant Samples
OH Oliver K. Hauck
CW Claus-Peter Witte
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1523 Views: 7621
Edited by: Ru Zhang
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
We developed this protocol to assay and quantify the content of uric acid or xanthine in various tissues of Arabidopsis thaliana mutant lines with defective urate oxidase or xanthine dehydrogenase1 and in their complementation and suppressor lines (Hauck et al., 2014).
The protocol is based on a method developed by Invitrogen Life Technologies for measuring uric acid or xanthine in human serum (see References 2 and 3). That protocol though required two adaptions for its use in plant science. Firstly by heating the plant samples, the activity of urate oxidase and xanthine dehydrogenase in the wild type samples is eliminated. Wild type extracts always serve as the proper pigmentation background when calculating the standard curves of uric acid and xanthine. Secondly, all samples are measured with and without the addition of urate oxidase or xanthine dehydrogenase to correct for any H2O2 in the samples induced by previous stress.
The assay is based on the following pair of coupled reactions:
1) Uric acid + O2 → Hydroxyisourate + H2O2 (urate oxidase reaction)
2) AR + H2O2 → Resorufin + O2 (horse radish peroxidase reaction)
Accordingly for Xanthine:
1) Xanthine + H2O + O2 → Uric acid + H2O2 (xanthine oxidase reaction)
2) AR + H2O2 → Resorufin + O2 (horse radish peroxidase reaction)
Materials and Reagents
Sea sand (e.g. Merck, catalog number: 107711 ) to facilitate mechanically homogenizing the samples
Liquid nitrogen
Horse radish peroxidase (HRP) (e.g. Sigma-Aldrich, catalog number: P8375 )
Urate oxidase (UOX) (e.g. Sigma-Aldrich, catalog number: U0880 )
Xanthine oxidase (XO) (e.g. SERVA Electrophoresis GmbH, catalog number: 38418 )
Amplex® ultra red (AR) (Life Technologies, InvitrogenTM, catalog number: A36006 )
Uric acid (e.g. Sigma-Aldrich, catalog number: U2625 )
Xanthine (e.g. Sigma-Aldrich, catalog number: X7375 )
Dimethylsulfoxide (DMSO) (e.g. Sigma-Aldrich, catalog number: D4540 )
Prepare 10 mM AR-stocks (see Recipes)
Prepare stocks of HRP, UOX and XO (see Recipes)
Equipment
Standard flat-bottom microplates (e.g. Greiner, catalog number: 655161 )
Spectrophotometer equipped for reading multiwell plates (e.g. MultiSkan Go, Thermo Fisher Scientific)
Heating block with shaker function
Ultracentrifuges for 20,000 x g (and ideally for 40,000 x g)
Rotator for grinding samples (e.g. Heidolph RZR 2020, but a simpler device may also do) with a tissue-grinder which fits neatly into a conically-tapered 1.5 ml tube (see Figure 1).
Figure 1. Tissue grinder for microtubes (Taylor Scientific)
Precision analytic balance, e.g. Mettler Toledo XS series, ideally equipped with an ErgoClip holder for 1.5 ml tubes
Heated magnetic stirrer
Micropipettes (1,000, 200, 100, 20 µl)
Multi-channel micropipette (range 50-200 µl)
1.5 ml reaction tubes
0.5 ml reaction tubes
15 ml tubes (if dilutions of extracts become necessary)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Hauck, O. K. and Witte, C. (2015). Quantification of Uric Acid or Xanthine in Plant Samples. Bio-protocol 5(13): e1523. DOI: 10.21769/BioProtoc.1523.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,524
|
https://bio-protocol.org/exchange/protocoldetail?id=1524&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Bean Pod Mottle Virus (BPMV) Viral Inoculation Procedure in Common Bean (Phaseolus vulgaris L.)
Stéphanie Pflieger
Sophie Blanchet
Chouaib Meziadi
Manon M.S. Richard
Valérie Geffroy
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1524 Views: 17169
Edited by: Arsalan Daudi
Reviewed by: Shyam SolankiMarisa Rosa
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Viral vectors derived from the Bean pod mottle virus (BPMV) were shown to be highly efficient tools for functional studies in soybean (Glycine max) and common bean (Phaseolus vulgaris) (Zhang et al., 2010; Diaz-Camino et al., 2011; Pflieger et al., 2013; Pflieger et al., 2014). Indeed, BPMV-derived vectors enable successful foreign gene expression analysis as well as virus-induced gene silencing (VIGS) but the delivery procedure of the viral vector into plants (i.e. primary inoculation) is a critical step. It can be achieved by various techniques such as Agrobacterium-mediated infiltration (agro-inoculation), mechanical inoculation of in vitro transcribed RNA, or biolistic delivery of infectious plasmid DNA (i.e. a DNA plasmid carrying a cDNA copy of the modified viral genome under the control of a 35S promoter). These delivery methods may be incompatible with large-scale functional studies (Pflieger et al., 2013). Here, we present the protocol for rapid, cheap and simple mechanical inoculation of BPMV vectors by direct rubbing of infectious plasmid DNA (direct DNA rubbing). Once infected plants are obtained, we used a classical protocol of mechanical inoculation using infected leaf sap to inoculate new healthy common bean plants (i.e. secondary inoculation).
Materials and Reagents
Phaseolus vulgaris (P. vulgaris) seeds
Notes:
Seeds of common bean genotypes can be obtained from the Centro Internacional de Agricultura Tropical (CIAT, Colombia).
‘Black Valentine’ is recommended for primary inoculation to generate infected leaf sap used for further inoculation of any other genotypes. For secondary inoculation, any other genotype of interest can be used.
Vermiculite 1-4 mm (Agrena Rungis, catalog number: VERMOYS100 )
Carborundum 0.037 mm (used as an abrasive) (VWR, catalog number: 22540.298 )
Recombinant BPMV RNA1 plasmid (pBPMV-IA-R1M) (Zhang et al., 2010) (Note 1)
Recombinant BPMV RNA2 plasmid (pBPMV-IA-V1, as a BPMV wild-type control) (Zhang et al., 2010) (Note 1)
Recombinant BPMV RNA2 plasmid (pBPMV-GFP2) (green fluorescence protein) [as a gene expression positive control (Zhang et al., 2010) (Note 1)]
Recombinant BPMV RNA2 plasmid, (pBPMV-PvPDS391bp) (phytoene desaturase) [as a VIGS positive control (Pflieger et al., 2014) (Note 1)]
Miracloth (Calbiochem®, catalog number: 475855-1R )
K2HPO4 (Sigma-Aldrich, catalog number: P3786 )
KH2PO4 (Sigma-Aldrich, catalog number: P0662 )
MilliQ water
Absorbant paper 1500F (Argos, catalog number: 106 )
Liquid nitrogen
Qiagen kit “Plasmid Maxi Kit” (QIAGEN, catalog number: 12163 )
Fertilizer Plant-Prod 14-12-32 (Puteaux SA)
Fertilizer Fertiligo L (Fertil International SA)
Nutritive solution (see Recipes)
0.1 M potassium phosphate buffer (see Recipes)
50 mM potassium phosphate buffer (see Recipes)
Equipment
Greenhouse or growth chamber for plant growth
Greenhouse or growth chamber for phytopathological tests (Note 2)
Pipetmans (Gilson, model: p1000 , p200 , p100 , p20 and p10 ) and tips
-20 °C refrigerator
-80 °C refrigerator
Vortex
Plastic pots (7 x 7 x 6 cm pots and 20 cm diameter pots of 4 L)
Growth chamber
Latex gloves
Surgical masks
Microcentrifuge
Eppendorf microfuge tube
1.5 ml microfuge tubes
Mortar (9 cm diameter) and pestle (12 mm diameter)
UV lamp for GFP detection (High intensity 100-Watt long-wave UV lamp, UVP®)
UV face shield (Thermo Fisher Scientific, catalog number: 6355 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Pflieger, S., Blanchet, S., Meziadi, C., Richard, M. M. and Geffroy, V. (2015). Bean Pod Mottle Virus (BPMV) Viral Inoculation Procedure in Common Bean (Phaseolus vulgaris L.). Bio-protocol 5(13): e1524. DOI: 10.21769/BioProtoc.1524.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,525
|
https://bio-protocol.org/exchange/protocoldetail?id=1525&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Identification of Factors in Regulating a Protein Ubiquitination by Immunoprecipitation: a Case Study of TRF2 on Human REST4 Ubiquitination
WC Wei Cui
Patrick Ovando-Roche
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1525 Views: 11611
Reviewed by: Vivien Jane Coulson-Thomas
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Ubiquitination is the first step of the ubiquitin-proteasome pathway that regulates cells for their homeostatic functions and is an enzymatic, protein post-translational modification process in which ubiquitin is transferred to a target protein substrate by a set of three ubiquitin enzymes (Weissman et al., 2011; Bhattacharyya et al., 2014; Ristic et al., 2014). Given the importance of this process, it is plausible that ubiquitination is under strict control by many factors and that the regulatory machineries are protein-specific. An assay for the detection of a specific protein ubiquitination will enable us to examine whether a factor has a function to regulate the ubiquitination of this protein. Here we describe a protocol that detects the ubiquitination status of the human REST4 protein in cultured cells, a neural alternative splicing isoform of REST (RE-1 silencing transcription factor), that antagonizes the repressive function of REST on neural differentiation and neuron formation. Using this protocol, we show that the telomere binding protein TRF2 stabilizes the expression of the human REST4 by inhibiting its ubiquitination. This indicates that TRF2 plays a positive role in neural differentiation (Ovando-Roche et al., 2014). This protocol is also useful for the detection of ubiquitination of other proteins of interest.
Keywords: TRF2 Immunoprecipitation REST
Materials and Reagents
Cells and plasmid
TRF2-HEK293T cells: 293T cells (ATCC, catalog number: CRL-3216 ) that have been stably transfected with TRF2 expressing vector
Control-HEK-293T cells: 293T cells (ATCC, catalog number: CRL-3216) that have been stably transfected with empty control vector
Myc-REST4 expressing vector: generated by modifying the Myc-REST plasmid (Huang et al., 2011) as detailed in Ovando-Roche et al. (2014)
HA-ubiquitin expressing vector: (Addgene, catalog number: 17608 )
Antibodies
Anti-TRF2 antibody (EMD Millipore, catalog number: 05-521 )
Anti-HA antibody (Sigma-Aldrich, catalog number: H6908 )
Anti β-Actin antibody (Sigma-Aldrich, catalog number: A5441 )
C-Myc antibody (Santa Cruz, catalog number: SC-40 )
Goat anti-mouse light chain specific (Jackson ImmunoResearch Laboratories, catalog number: 115-035-174 )
Mouse anti-rabbit light chain specific (Jackson ImmunoResearch Laboratories, catalog number: 211-032-171 )
Normal mouse IgG (Santa Cruz, catalog number: SC-2025 )
Reagents
Dulbeccos modified eagles medium (DMEM) (Sigma-Aldrich, catalog number: D5671 )
Fetal bovine serum (FBS) (Sigma-Aldrich, catalog number: F7524 )
Calcium phosphate transfection kit (Sigma-Aldrich, catalog number: CAPHOS )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 161-0404 )
CaCl2 (VWR International, catalog number: 22317.297 )
Dynabeads protein G (Life Technologies, catalog number: 10003D )
EDTA (Sigma-Aldrich, catalog number: ED-1KG )
EGTA (Sigma-Aldrich, catalog number: E4378 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
KCl (VWR International, catalog number: JT3040-1 )
MG132 (Calbiochem, catalog number: 474791 )
MgCl2 (Sigma-Aldrich, catalog number: 63063 )
NaCl (Sigma-Aldrich, catalog number: s-3014 )
NaOH (VWR International, catalog number: 28244.263 )
Nonidet P40 (VWR International, catalog number: E109-100ML )
Phenylmethanesulfonyl fluoride (Sigma-Aldrich, catalog number: 93482 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
SDS (Sigma-Aldrich, catalog number: 71725 )
Tris-HCl (Sigma-Aldrich, catalog number: T3253 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Ubiquitin aldehyde (Boston Biochem, catalog number: U-201 )
Buffers
Antibody binding buffer (see Recipes)
HEPES lysis buffer (see Recipes)
2x electrophoresis sample buffer (see Recipes)
Equipment
100 mm cell culture dish (Corning, catalog number: 430167 )
Cell scraper (Corning, catalog number: 3010 )
1.5 ml Eppendorf tubes (StarLab, catalog number: S1615-5500 )
BD Microlance 3 21G needle (BD, catalog number: 301156 )
37 °C, 5% CO2 forced-air incubator (Binder, model: C150 )
Microcentrifuge (Hettich, model: 200R )
Thermomixer compact (Eppendorf, model: 5350 )
Rotator (Stuart, model: SB3 )
Dynamag 2 magnet (Life Technologies, catalog number: 12321D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Cui, W. and Ovando-Roche, P. (2015). Identification of Factors in Regulating a Protein Ubiquitination by Immunoprecipitation: a Case Study of TRF2 on Human REST4 Ubiquitination. Bio-protocol 5(13): e1525. DOI: 10.21769/BioProtoc.1525.
Download Citation in RIS Format
Category
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,526
|
https://bio-protocol.org/exchange/protocoldetail?id=1526&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Mouse Model of Preterm Brain Injury after Hypoxia-Ischemia
Anna-Maj Albertsson
XW Xiaoyang Wang
Published: Vol 5, Iss 13, Jul 5, 2015
DOI: 10.21769/BioProtoc.1526 Views: 11151
Edited by: Soyun Kim
Reviewed by: Edgar Soria-Gomez
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
The rodent hypoxia-ischemia (HI) model, referred to as the Vannucci model, is the most commonly used model for studying perinatal hypoxic-ischemic brain injury (Zhu et al., 2009; Vannucci and Hagberg, 2004). In the Vannucci model, brain injury is acquired by combining a permanent unilateral common carotid artery ligation with subsequent exposure to hypoxia (Rice et al., 1981). The Vannucci model was originally developed in rat pups at postnatal day (PND)7 (Rice et al., 1981), an age at which the development of the rat brain corresponds to that of the human infant at gestational weeks 32-34 (Zhu et al., 2009; Vannucci et al., 2009). The Vannucci HI model has since been adapted to mouse models of perinatal brain injury, and this has allowed the technique to be used with a broader array of genetically modified animals. Mice at PND9 have been the most commonly used, and these correspond to the human near-term infant (Zhu et al., 2009). In the present protocol, the Vannucci model has been adapted to serve as a model of preterm brain injury in C57bl/6J mice at PND5, an age where the development of the mouse brain corresponds to the brain of a human preterm infant (Zhu et al., 2009; Albertsson et al., 2014). The injury acquired with this protocol is characterized by local white matter injury combined with small areas of focal cortical injury and hippocampal atrophy (Albertsson et al., 2014).
Keywords: Mouse Newborn Brain Hypoxia Ischemia
Materials and Reagents
Animals
C57bl/6J mice (Charles River Laboratories) at PND4-5
The day of birth is defined as PND1
The body weight of PND 5 pups should be 2.0 ± 0.2 g
Anesthetics
Isoflurane (Vetflurane, catalog number: 137317 )
Xylocain (local anesthetic) (AstraZeneca, catalog number: 153270 )
Equipment
Suture
6-0 silk suture attached to a needle for skin closure (Vömel, catalog number: 14719 )
7-0 silk suture cut into 1.0 cm–1.5 cm pieces for artery ligation (Ethicon, Johnson & Johnson, catalog number: EH7464G )
Needle for skin suture
Micropore surgical tape (Sollentuna, catalog number: 1530-0, 3 M )
Syringe, 1 ml (B. Braun, Omnifix® 100 Solo)
Heating plate (Labotect, model: Hot plate 062 )
Forceps (Figure 1):
Fine-tipped curved forceps for dissecting the artery (Dumont, tweezer style 7, catalog number: 0302-7-CO )
Fine-tipped straight forceps for dissecting the artery (Nopa instruments, catalog number: AB 501/05 )
Hooked forceps for lifting the artery (Dimeda Instrumente GmbH, catalog number: 42.883.07 )
Fine-tipped scissors (sharp) (Dimeda Instrumente GmbH, catalog number: 08.340.09 )
Nasal mask for administering anesthetic gas (Simtec Engineering, catalog number: 10025 )
Anesthetic vaporizer (Ohmeda Isotec Isoflurane Vaporizer)
Surgical microscope (Carl Zeiss, model: S100/OPMI pico )
Water bath with adjustable temperature (Grant, model: W14 )
Hypoxic chamber with controlled temperature, humidified airflow, and variable oxygen level (Figure 2)
Note: In this protocol, a Dräger transport incubator 5400 and a Gant type W14 water bath (Figure 2A) were used to keep the ambient temperature at 36 °C. A smaller customized incubator, the hypoxia chamber, was kept inside the transport incubator (Figure 2B). Pups were placed inside the hypoxia chamber during the hypoxia procedure. The air and the 10% oxygen were introduced into the bottom of the customized incubator and vented from the top of the incubator. Before being introduced in the hypoxia chamber, the air and the 10% oxygen mixture were humidified and heated to 36 °C with the heated water bath. The customized hypoxia chamber was 19 cm in diameter and 19 cm in length (Figure 2C).
Figure 1. Surgical tools. Hooked fine-tipped forceps for lifting up the artery (A), fine-tipped straight forceps (B) and curved forceps (C) for dissecting the artery, and fine-tipped scissors for the skin incision (D).
Figure 2. Equipment used for hypoxia treatment. A. Water bath and transport incubator containing the hypoxia camber. B. The hypoxia chamber inside the transport incubator, and (C) the dimensions of the customized hypoxia chamber.
Figure 3. Hypoxia-Ischemia procedure time line
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Albertsson, A. and Wang, X. (2015). A Mouse Model of Preterm Brain Injury after Hypoxia-Ischemia. Bio-protocol 5(13): e1526. DOI: 10.21769/BioProtoc.1526.
Download Citation in RIS Format
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,527
|
https://bio-protocol.org/exchange/protocoldetail?id=1527&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Phosphopeptide Purification Protocol for the Moss Physcomitrella paten
XW Xiaoqin Wang
YH Yikun He
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1527 Views: 8894
Edited by: Arsalan Daudi
Reviewed by: Valentine V Trotter
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Protein phosphorylation is one of the most common post-translational modifications in eukaryotic cells and plays a critical role in a vast array of cellular processes. Efficient methods of protein extraction and phosphopeptide purification are required to ensure the detection of high quality of proteins. In our hands, phenol extraction of proteins and TiO2 chromatography enrich phosphorylated peptides more efficiently than other methods in the moss Physcomitrlla patens (P. patens).
Materials and Reagents
Seven-day old protonemata of the moss P. patens
Liquid nitrogen
Tris-HCl (pH 7.5)-saturated phenol (AMRESCO, catalog number: K168 )
Ammonium acetate (Sigma-Aldrich, catalog number: A1542 )
Methanol (Sigma-Aldrich, catalog number: 34860 )
DTT (Promega Corporation, catalog number: V3155 )
Acetone (Sigma-Aldrich, catalog number: 650501 )
Iodoacetamide (Sigma-Aldrich, catalog number: I6125 )
Ammonium bicarbonate (pH 8.5) (Sigma-Aldrich, catalog number: 40867 )
Trypsin (Promega Corporation, catalog number: V5111 )
Sucrose (Sigma-Aldrich, catalog number: S5390 )
Tris (Sigma-Aldrich, catalog number: T1378 )
EDTA (Sigma-Aldrich, catalog number: E6635 )
1,4-dithiothreitol (DTT) (Promega Corporation, catalog number: V3155)
Protease inhibitors cocktail (Sigma-Aldrich, catalog number: P9599 )
Phosphatase inhibitors cocktail 2 (Sigma-Aldrich, catalog number: P0044 )
NH4OH (Sigma-Aldrich, catalog number: 320145 )
Urea (Sigma-Aldrich, catalog number: U6504 )
CHAPS (Sigma-Aldrich, catalog number: C9426 )
Acetonitrile (ACN) (Sigma-Aldrich, catalog number: 34851 )
Trifluoroacetic acid (TFA) (Sigma-Aldrich, catalog number: 302031 )
Glutamic acid (Sigma-Aldrich, catalog number: G0355000 )
Protein extraction buffer (see Recipes)
Protein resuspension buffer (see Recipes)
Loading buffer (see Recipes)
Washing buffer I (see Recipes)
Washing buffer II (see Recipes)
Elution buffer (see Recipes)
Equipment
Porcelain Mortar and Pestle (90 mm)
Tubes and tube holder (2 ml)
Titanium dioxide micro-columns (320 µm x 50 mm) (Column Technology, Freemont)
Centrifuge
Vortex
Freeze dryer (Christ, model: Alpha 1-4 LSC )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Protein
Systems Biology > Proteomics > Phosphoproteomics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,528
|
https://bio-protocol.org/exchange/protocoldetail?id=1528&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genetic Transformation of Candida glabrata by Electroporation
FI Fabian Istel*
TS Tobias Schwarzmüller*
Michael Tscherner
Karl Kuchler
*Contributed equally to this work
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1528 Views: 7798
Edited by: Fanglian He
Reviewed by: Emmanuel Zavalza
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Here, we report a method for the transformation by electroporation of the human fungal pathogen Candida glabrata (C. glabrata). The protocol can be used for transformations in single well or in 96-well microtiter plates. It has been extensively used to generate a genome-scale gene deletion library using the C. glabrata background recipient strain ATCC2001 (Schwarzmüller et al., 2014).
Keywords: Candida glabrata Transformation High-Throughput Gene deletion Dominant selection
Materials and Reagents
Recipient strain [ATCC2001, HTL or clinical isolates (Schwarzmuller et al., 2014)]
DNA deletion construct / transforming DNA (highly purified)
Electroporation cuvette (Life Technologies, InvitrogenTM, catalog number: P51050 )
This product has been discontinued.
Deep well plate (96-well) (Nunc®, catalog number: 7322662 )
Reservoir (autoclavable) (VWR International, catalog number: 6130466 )
Multichannel pipette (200 µl) (BrandTech Scientific)
Sterile water (double-distilled)
Bacto™ peptone (BD Biosciences, catalog number: 211820 )
Bacto™ yeast extract (BD Biosciences, catalog number: 212720 )
Bacto™ agar (BD Biosciences, catalog number: 214030 )
Glucose (Merck KGaA, catalog number: 108337)
Tris base (Sigma-Aldrich, catalog number: T1503 )
EDTA (Sigma-Aldrich, catalog number: E6758 )
Lithium acetate dihydrate (Sigma-Aldrich, catalog number: L6883 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Nourseothricin-dihydrogen sulfate (Werner BioAgents, catalog number: 5.0 )
TE buffer (see Recipes)
DTT solution (see Recipes)
YPD media (see Recipes)
Solid selective media (see Recipes)
Equipment
96-wel electroporation plate (2 mm gap) (Harvard Apparatus, catalog number: HTP962450450 )
Electroporation cuvettes (1 mm gap) (Life Technologies, InvitrogenTM, catalog number: P51050 )
This product (catalog P51050 ) has been discontinued.
Culture flasks with baffles
Centrifuge for tubes (50 ml) (Eppendorf, catalog number: 5702R )
Centrifuge for tubes (1.5 ml) (Eppendorf, catalog number: 5417R )
Rotary shaker for culture flasks (New Brunswick Scientific, catalog number: innova44 )
Stratagene Stratalinker 2400 UV Crosslinker (Artisan Technology Group®, catalog number: 532741 )
Single-well scaleTransfection apparatus consisting of capacitance extender, pulse controller and gene pulser (Bio-Rad Laboratories, AbD Serotec®, catalog numbers: 165-2087 ; 165-2098 ; 165-2077 )
96-well microtiter plates
96-well electroporation device (BTX The Electroporation Experts, catalog number: ECM63 or Harvard Apparatus, catalog number: 450422 )
Plate handler (BTX The Electroporation Experts, catalog number: HT-100 or Harvard Apparatus, catalog number: 450400 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,529
|
https://bio-protocol.org/exchange/protocoldetail?id=1529&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genetic Transformation of Candida glabrata by Heat Shock
FI Fabian Istel*
TS Tobias Schwarzmüller*
Michael Tscherner
Karl Kuchler
*Contributed equally to this work
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1529 Views: 8566
Edited by: Fanglian He
Reviewed by: Emmanuel Zavalza
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Here, we report a method for the transformation of Candida glabrata using a heat shock method. The protocol can be used for transformations in single well or in 96-well scale. It has been employed as an alternative method to the electroporation protocol to construct a genome-scale gene deletion collection in the human fungal pathogen Candida glabrata ATCC2001 and related strains. Furthermore, the protocol can be used to generate gene deletions in clinical isolates of Candida glabrata (C. glabrata).
Keywords: Candida glabrata Transformation Heat Shock Knock-Out Dominant Selection
Materials and Reagents
Recipient strain [ATCC2001, HTL or clinical isolates (Schwarzmuller et al., 2014)]
DNA deletion construct/transforming DNA
Sterile water (double distilled)
Bacto™ peptone (BD Biosciences, catalog number: 211820 )
Bacto™ yeast extract (BD Biosciences, catalog number: 212720 )
Bacto™ agar (BD Biosciences, catalog number: 214030 )
Glucose (Merck KGaA, catalog number: 108337 )
Lithium acetate dehydrate (LiAc) (Sigma-Aldrich, catalog number: L6883 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: 472301 )
Polyethylene glycol (PEG 3350) (Sigma-Aldrich, catalog number: P4338 )
Nourseothricin-dihydrogen sulfate (Werner BioAgents, catalog number: 5.0 )
ssDNA (Sigma-Aldrich, catalog number: D1626 )
YPD media (see Recipes)
Solid selective media (see Recipes)
Equipment
Deep well plate (96-well) (Nunc®, catalog number: 732-2662 )
Reservoir (autoclavable) (VWR International, catalog number: 6130466 )
Multichannel pipette (200 µl) (Brandt Transferpette, WU2160016)
Culture flasks with baffles
Centrifuge (50 ml tubes) (Eppendorf, catalog number: 5702R )
Centrifuge (1.5 ml tubes) (Eppendorf, catalog number: 5417R )
Rotary shaker for culture flasks (New Brunswick Scientific, catalog number: innova44 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
153
|
https://bio-protocol.org/exchange/protocoldetail?id=153&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stereotaxic Injection of LPS into Mouse Substantia Nigra
HG Huiming Gao
Published: Vol 2, Iss 8, Apr 20, 2012
DOI: 10.21769/BioProtoc.153 Views: 21430
Original Research Article:
The authors used this protocol in Jul 2008
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2008
Abstract
Stereotaxic injection is an attractive approach for studying genetic, cellular and circuit functions in the brain. Injection of anatomical tracers, site-targeted lesions and gene delivery by recombinant adeno-associated viruses and lentiviruses in mice are powerful tools to study nervous system development and disease mechanisms. Stereotaxic injection of LPS or 6-hydroxydopamine has been used to establish animal models of Parkinson’s disease, the most common neurodegenerative movement disorder. Importantly, this protocol allows the manipulation of gene expression in the targeted rodent brain regions and even targeted cell types or a subpopulation of cells in the injected region at any postnatal developmental stage up to adulthood.
Materials and Reagents
Eight-week-old male C57 mice or a variety of transgenic/knockout mice, body weight 20-25 g
Nembutal
Buprenorphine
LPS (Escherichia coli 0111: B4) (Sigma-Aldrich)
Sterile normal saline (0.9%) or other vehicle for your reagents
Ocular lubricant (Puralube)
70% ethanol
4% paraformaldehyde
Betadine
Phosphate buffered saline (PBS)
LPS stock solution (see Recipes)
Equipment
Motorized microinjection pump
Small-animal stereotaxic apparatus (mouse stereotaxic apparatus)
Microinjection apparatus
Dental drill and #1 burrs
Microknife
Scalpel (#10)
Tissue forceps
Gauze
Autoclips/suture materials
Stereotaxic frame
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Nervous system disorders
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,530
|
https://bio-protocol.org/exchange/protocoldetail?id=1530&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Large-scale Phenotypic Profiling of Gene Deletion Mutants in Candida glabrata
FI Fabian Istel*
TS Tobias Schwarzmüller*
Michael Tscherner
Karl Kuchler
*Contributed equally to this work
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1530 Views: 9862
Edited by: Fanglian He
Reviewed by: Sadri Znaidi
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Here, we describe a method enabling the phenotypic profiling of genome-scale deletion collections of fungal mutants to detect phenotypes for various stress conditions. These stress conditions include among many others antifungal drug susceptibility, temperature-induced and osmotic as well as heavy metal or oxidative stress. The protocol was extensively used to phenotype a collection of gene deletion mutants in the human fungal pathogen Candida glabrata (C. glabrata) (Schwarzmüller et al., 2014).
Keywords: Phenotyping Antifungal Drug Susceptiility Stress Phenotypes Morphology Robotic Screening
Materials and Reagents
C. glabrata strain (ATCC2001, clinical isolates)
Sterile water (double distilled)
Bacto™ peptone (BD Biosciences, catalog number: 211820 )
Bacto™ yeast extract (BD Biosciences, catalog number: 212720 )
Bacto™ agar (BD Biosciences, catalog number: 214030 )
Difco™ yeast nitrogen base (YNB) (BD Biosciences, catalog number: 233520 )
Glucose (Merck KGaA, catalog number: 108337 )
Adenine (Sigma-Aldrich, catalog number: A8626 )
L-arginine (Sigma-Aldrich, catalog number: A5006 )
L-tyrosine (Sigma-Aldrich, catalog number: T3754 )
L-isoleucine (Sigma-Aldrich, catalog number: I2752 )
L-phenylalanine (Sigma-Aldrich, catalog number: P2126 )
L-glutamic acid(Sigma-Aldrich, catalog number: G1251 )
L-aspartic acid (Sigma-Aldrich, catalog number: A9256 )
L-threonine (Sigma-Aldrich, catalog number: T8625 )
L-serine (Sigma-Aldrich, catalog number: S4500 )
L-valine (Sigma-Aldrich, catalog number: V0500 )
L-methionine (Sigma-Aldrich, catalog number: M9625 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
YPD media (see Recipes)
Solid YPD media (see Recipes)
2x YPD media (see Recipes)
SC media (see Recipes)
Solid SC media (see Recipes)
Amino acid mix (see Recipes)
15% glycerol solution (see Recipes)
Equipment
Square plates (PlusPlate) (40 ml/plate) (Singer Instruments, catalog number: PLU-001 )
Pin Pad (RePad 96 Long) (Singer Instruments, catalog number: REP-001 )
96-well plates (200 µl/well) (Starlab, catalog number: CC76827596 )
Petri dishes (92 mm) (SARSTEDT AG, catalog number: 82.1473 )
Culture tubes (Starlab, catalog number: I14850810 )
Yeast replica robot (Singer Instruments, catalog number: RoToR HDA )
Plate reader (Victor3V) (PerkinElmer, catalog number: 1420040 )
48-well replica stamp (V&P Scientific, catalog number: VP 408H )
96-well replica stamp (V&P Scientific, catalog number: VP 407 )
Library copier (guide for stamps) (V&P Scientific, model: VP 381 )
Plate mixer (Eppendorf, catalog number: 5353000014 )
Rotary shaker for culture flasks (innova44) (New Brunswick Scientific, catalog number: M1282-0002 )
Incubator (Heraeus Instruments, catalog number: B6120 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Antimicrobial assay > Antifungal assay
Systems Biology > Genomics > Functional genomics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,531
|
https://bio-protocol.org/exchange/protocoldetail?id=1531&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Simple Method to Generate Gene Knockout Clones in Human Cells Using Transcription Activator-Like Effector Nuclease (TALEN)
CH Christy Hammack
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1531 Views: 9458
Reviewed by: Pinchas Tsukerman
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Transcription activator-like effectors (TALEs) are naturally occurring proteins secreted by the plant pathogen, Xanthomonas, and fused to the Fok1 endonuclease to generate TALE nucleases (TALENs). TALEN pairs bind to specific DNA sequences initiating Fok1 dimerization and double-stand cleavage of DNA within the TALEN target site. This cleavage event triggers cellular repair mechanisms that result in insertions and/or deletions (indels), which enable gene knockout. The high specificity and efficiency of TALENs makes them important tools for genome editing. Here, we describe a method for the generation of single-cell clones with targeted gene knockout by TALEN using co-transfection and FACS with a fluorescent reporter. This protocol was designed to knockout cell death-inducing DFFA-like effector b, CIDEB, in Huh7.5 cells; however, this protocol can be applied to a wide range of cell types and genes of interest.
Materials and Reagents
Huh7.5 cells (Charles Rice lab, Rockefeller University)
Dulbecco’s modified Eagle’s medium (DMEM high glucose) (HyClone, catalog number: SH30243.02 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10437-028 )
Antibiotic Antimycotic solution (10,000 U/ml penicillin G, 10,000 µg/ml streptomycin, 25 µg/ml amphotericin B) (HyClone, catalog number: SV30079.01 )
MEM nonessential amino acids (NEAA) (Corning Incorporated, catalog number: 25025CI )
Phosphate buffered saline (PBS) (Thermo Fisher Scientific, catalog number: BP39920 )
Trypsin, 0.05% (HyClone, catalog number: SH30236.02 )
TALEN Sure KO plasmids (Cellectis)
Note: It is custom designed to target the gene of interest and includes right and left TALEN plasmids to bind both sequences of DNA flanking the target site.
pcDNA3-EGFP expression plasmid (Addgene, plasmid number: 13031 )
Lipofectamine 2000 Transfection Reagent (Life Technologies, InvitrogenTM, catalog number: 11668019 )
Opti-MEM I Reduced-Serum Medium (Life Technologies, Gibco®, catalog number: 31985070 )
QuickExtract DNA Extraction Solution (Epicentre, catalog number: QE09050 )
Platinum PCR SuperMix High Fidelity (Life Technologies, InvitrogenTM, catalog number: 12532016 )
Primers flanking the TALEN target site (custom DNA nucleotides) (Integrated DNA Technologies)
QIAquick Gel Extraction Kit (QIAGEN, catalog number: 28704 )
Tris-HCl buffer (pH 6.8, 0.5 M) (Bio-Rad Laboratories, AbD Serotec®, catalog number: 1610799 )
Sodium dodecyl sulfate (20% solution) (Thermo Fisher Scientific, catalog number: BP13111 )
Glycerol (Fisher Scientific, catalog number: BP2291 )
Bromophenol blue (Thermo Fisher Scientific, catalog number: B3925 )
2-mercaptoethanol (Thermo Fisher Scientific, catalog number: O3446I100 )
10% DMEM culture media (see Recipes)
20% DMEM culture media (see Recipes)
FACS buffer (see Recipes)
2x SDS loading buffer (see Recipes)
Equipment
Cell culture incubator at 37 °C and 5% CO2
Cell culture-treated polystyrene plates (100 mm, 6 well, 12 well, 24 well, 48 well, 96 well) (Corning Incorporated)
Polystyrene Round-Bottom Tube (5 ml FACS tubes) (BD Biosciences, Falcon®, catalog number: 352008 )
Round-Bottom Tube Cap (5 ml) (BD Biosciences, Falcon®, catalog number: 352032 )
40 micron cell strainer (Falcon®, catalog number: 352340 )
Fluorescence microscope
Table top centrifuge
FACSAria cell sorter (BD Biosciences, catalog number: 656700 )
Multi-channel pipette
Western blotting equipment (Bio-Rad Laboratories, AbD Serotec®)
Heat block (VWR international)
PCR thermocycler (Bio-Rad Laboratories, AbD Serotec®)
Agarose gel electrophoresis system
3730 DNA analyzer (Life Technologies, Applied Biosystems®, catalog number: 3730S )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Hammack, C. (2015). A Simple Method to Generate Gene Knockout Clones in Human Cells Using Transcription Activator-Like Effector Nuclease (TALEN). Bio-protocol 5(14): e1531. DOI: 10.21769/BioProtoc.1531.
Download Citation in RIS Format
Category
Cell Biology > Cell engineering > TALEN
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,532
|
https://bio-protocol.org/exchange/protocoldetail?id=1532&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chlorophyll Fluorescence Measurements in Arabidopsis Wild-type and Photosystem II Mutant Leaves
IS Iris Steinberger
Felix Egidi
Anja Schneider
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1532 Views: 11673
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Chlorophyll fluorescence measurement is a widely used technique to determine photosynthetic performance. Light energy absorbed by a chlorophyll molecule can be dissipated by driving photochemical energy conversion, as heat in non-photochemical quenching processes, or it is re-emitted as fluorescence. The loss of light energy as chlorophyll fluorescence is primarily derived from photosystem II. Photosystem II is a thylakoid-embedded multiprotein complex which provides the high redox potential needed to oxidize water. Within photosystem II photons of light are captured and used to energize electrons. Energized electrons are fed into the linear electron transport chain and photosystem II replenishes lost electrons with electrons from splitting of water. Chlorophyll fluorescence yield can be quantified using a modulated fluorometer device. In such a device, a modulated measuring light beam (switched on and off at a high frequency) and the parallel detection of fluorescence exclusively excited by the measuring light allows chlorophyll fluorescence measurements in the presence of photosynthetic (actinic) light. In addition, high intensity, but short duration light flashes (saturating pulses) are used to determine maximum fluorescence yields in dark and light adapted leaves. In this protocol the procedure to receive a typical fluorescence graph of Arabidopsis wild-type leaves is given. Furthermore, this procedure can be used to identify Arabidopsis mutant plants affecting photosystem II, on the basis of the respective fluorescence graphs and values.
Keywords: Arabidopsis Phtotosynthesis Photosystem II Chlorophyll fluorescence Pulse Amplitude Modulation PAM
Materials and Reagents
Arabidopsis wild-type plants (Ecotype: Col-0)
Arabidopsis mutant plant of interest (Ecotype: Col-0)
Stender Vermehrungssubstrat A210, 70 potting soil (Stender AG)
Planting pots (7 x 6 x 6 cm)
Plant tray and plastic wrap
Tweezers (not sterile)
Equipment
Cold room or refrigerator (4 °C)
Growth chamber (12 h light/12 h dark with 21 °C/18 °C and a PFD of ~ 100 µmol/m2/s)
Dual-PAM-100 for measuring chlorophyll fluorescence (Heinz Walz GmbH, model: Dual-PAM-100) connected to a PC and operated by the Dual-PAM software (see Note 1)
Dark room
Software
Dual-PAM software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Steinberger, I., Egidi, F. and Schneider, A. (2015). Chlorophyll Fluorescence Measurements in Arabidopsis Wild-type and Photosystem II Mutant Leaves. Bio-protocol 5(14): e1532. DOI: 10.21769/BioProtoc.1532.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Photosynthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,533
|
https://bio-protocol.org/exchange/protocoldetail?id=1533&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Circular RT-PCR Assay Using Arabidopsis Samples
Runlai Hang
XD Xian Deng
CL Chunyan Liu
BM Beixin Mo
XC Xiaofeng Cao
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1533 Views: 16198
Edited by: Arsalan Daudi
Reviewed by: Yuan Chen
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Post-transcriptional processing is critical for RNA biogenesis, in which conventional functional RNA transcripts are generated, such as messenger RNAs (mRNAs), transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs) for translation as well as emerging non-coding RNAs with known or unknown regulatory functions. To determine the precise termini of an RNA molecule during or after processing, the primer extension and Rapid Amplification of cDNA Ends (RACE) methods have been routinely utilized for the precise mapping of 5’ or 3’ ends. Different from these assays, which are designed to detect only one end of a specific target RNA at a time, circular Reverse Transcription-Polymerase Chain Reaction (cRT-PCR) is able to simultaneously determine both the 5’ and 3’ ends of the target RNA. In Arabidopsis thaliana, cRT-PCR has been wildly applied to identify both the 5’ and 3’ extremities of the ribosomal RNA precursors, or to assess the length or post-transcriptional extensions at the 3’ end of a matured mRNA. In this protocol, we summarize and present a detailed procedure of the cRT-PCR assay in Arabidopsis thaliana, which is also successfully used in our previously published work (Hang et al., 2014).
Keywords: Circular RT-PCR Post-transcriptional processing Pre-rRNA processing Ribosome biogenesis PRMT3
Materials and Reagents
Arabidopsis thaliana 14-day-old seedlings
M13F: 5′-TGTAAAACGACGGCCAGT-3′ and M13R: 5’-CAGGAAACAGCTATGAC-3’
TRNzol Reagent (TIANGEN®, catalog number: DP40502 )
Dynabeads® mRNA Purification Kit (Life Technologies, catalog number: 61006 )
FirstChoice® RLM-RACE Kit (Life Technologies, catalog number: AM1700 )
RNA 5’ Polyphosphatase (Epicentre, catalog number: RP8092H )
T4 RNA Ligase 1 (New England Biolabs, catalog number: M0204S )
T4 RNA Ligase Reaction Buffer (New England Biolabs, catalog number: B0216L )
Adenosine 5'-Triphosphate (New England Biolabs, catalog number: P0756S )
RNasin® Plus RNase Inhibitor (Promega Corporation, catalog number: N2615 )
Glycogen (RNA grade) (Thermo Fisher Scientific, catalog number: R0551 )
TransScript® II First-Strand cDNA Synthesis SuperMix (TransGen Biotech, catalog number: AH301 )
TaKaRa ExTaq® DNA Polymerase (Takara Bio Company, catalog number: RR001B )
pEASY® -T1 Cloning Kit (TransGen Biotech, catalog number: CT10102 )
Trans2K® Plus II DNA Marker (TransGen Biotech, catalog number: BM121-01 )
Diethyl pyrocarbonate/DEPC (Sigma-Aldrich, catalog number: D5758 )
TIANgel Midi Purification Kit (TransGen Biotech, catalog number: DP209 )
UltraPureTM Agarose (Life Technologies, catalog number: 75510019 )
DEPC-treated deionized water (see Recipes)
3 M sodium acetate (see Recipes)
70%, 100% ethanol (see Recipes)
50x TAE buffer (see Recipes)
Equipment
MaxyClear Microtubes (1.5 ml) (Corning Incorporated, Axygen®, catalog number: MCT150C )
NanoDropTM 1000 Spectrophotometer (Thermo Fisher Scientific, catalog number: ND-1000 )
Thermomixer comfort (Eppendorf, catalog number: 5362.000.019 )
Eppendorf Centrifuge (Eppendorf, catalog number: 5417R )
PCR system (Eastwin Life Science, catalog number: EDC-810 )
Other standard laboratory equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > qRT-PCR
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,534
|
https://bio-protocol.org/exchange/protocoldetail?id=1534&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Atomic Force Microscopy (AFM) Analysis of Cell Wall Structural Glycoproteins in vitro
Yuning Chen
LC Liwei Chen
MK Marcia J. Kieliszewsk
MC Maura C. Cannon
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1534 Views: 8490
Edited by: Fanglian He
Reviewed by: Renate Weizbauer
Original Research Article:
The authors used this protocol in Feb 2008
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2008
Abstract
Hydroxyproline-rich glycoproteins (HRGPs) are major protein components in dicot primary cell walls and generally account for more than 10% of the wall dry weight. As essential members of the HRGP superfamily, extensins (EXTs) presumably function in the cell wall by assembling into positively charged protein scaffolds (Cannon et al., 2008) that direct the proper deposition of other wall polysaccharides, especially pectins, to ensure correct cell wall assembly (Hall and Cannon, 2002; Lamport et al., 2011a). Extensins are recalcitrant to purification as they are rapidly cross-linked into a covalent network after entering the cell wall but there exists a short time window in which newly synthesized extensin monomers can be extracted (Smith et al., 1984; Smith et al., 1986) by salt elution. A detailed protocol for extraction of extensin and other wall structural proteins has been described earlier (Lamport et al., 2011b). The protocol elaborated here provides an approach to studying the self-assembly of extensins and potentially of other cell wall components in vitro using AFM.
Keywords: Plant cell wall Structural glycoprotein Extensin Self-assembly Atomic force microscope
Materials and Reagents
Monomeric extensin proteins extracted from different plant cell suspension culture lines. For a detailed extensin extraction protocol see Lamport et al. (2011b).
Bovine serum albumin (BSA, lyophilized powder, crystallized, purity ≥ 98.0%) (Sigma-Aldrich, catalog number: 05470 )
Sodium acetate (NaOAc, anhydrous, purity ≥ 99.0%) (Sigma-Aldrich, catalog number: S8750 )
Acetic acid (HOAc, ACS reagent, purity ≥ 99.7%) (Sigma-Aldrich, catalog number: 320099 )
Deionized-distilled water (ddH2O)
75% ethanol (prepared from 100% ethanol, ACS reagent, purity ≥ 99.5%) (Sigma-Aldrich, catalog number: 459844 )
Loctite® Epoxy instant mix glue
50 mM NaOAc buffer (see Recipes)
75% ethanol (see Recipes)
Equipment
Highly ordered pyrolytic graphite (square shape 5 mm (L) x 5 mm (W) x 1 mm (H) in dimension) (Structure Probe, catalog number: 476HPAB )
Kimwipes (VWR International, catalog number: 470173498 )
Plastic petri dishes (100 x 15 mm dimension) (VWR International, catalog number: 25384302 )
NCS18 silicon probe (75 kHz, 3.5 N/m) (Mikromasch, catalog number: HQ:NSC18/Cr-Au-15)
Scotch tape (single sided Scotch® MagicTMTape 810)
Note: Available from office supply stores like Staples.
10 ml sterile syringes (BD Biosciences, catalog number: 309659 )
0.2 µm syringe filters (Whatman, catalog number: 6896-2502 )
20 ml disposable scintillation glass vials (VWR International, catalog number: 66022065 )
Eppendorf tubes(1.5 ml) (Eppendorf, catalog number: 022431081 )
Regular microscope slides (dimension 25 x 75 x 1mm)
MFP-3D-SA AFM (Asylum Research, model: MFP-3D-SA AFM )
Stainless steel tweezers (Sigma-Aldrich, catalog number: T5415 )
Cylinder of nitrogen gas with a pressure regulator and nozzle
Vortex mixer
Centrifuge (to fit Eppendorf 1.5 ml tubes)
Software
IGOR Pro 6 (WaveMetrics, Portland, OR)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant cell biology > Cell structure
Cell Biology > Cell imaging > Atomic force microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,535
|
https://bio-protocol.org/exchange/protocoldetail?id=1535&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Evaluation of Cellulose Degradation Affected by Dutch Elm Disease
Jaroslav Ďurkovič
FK František Kačík
DO Dušan Olčák
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1535 Views: 8127
Edited by: Arsalan Daudi
Reviewed by: Renate Weizbauer
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
The pathogenic fungus Ophiostoma novo-ulmi spreads within the secondary xylem vessels of infected elm trees, causing the formation of vessel plugs due to tyloses and gels, which ultimately result in Dutch elm disease. Foliage discoloration, wilting and falling from the tree are typical external leaf symptoms of the disease followed by the subsequent death of sensitive trees. Cellulolytic enzymes produced by the fungus are responsible for the degradation of medium molecular weight macromolecules of cellulose, resulting in the occurrence of secondary cell wall ruptures and cracks in the vessels but rarely in the fibers (Ďurkovič et al., 2014). The goal of this procedure is to evaluate the extent of cellulose degradation by a highly aggressive strain of O. novo-ulmi ssp. americana × novo-ulmi. Size-exclusion chromatography (SEC) compares molecular weight distributions of cellulose between the infected and the non-infected elm trees, and reveals changes in the macromolecular traits of cellulose, including molecular weights, degree of polymerization, and polydispersity index. 13C magic angle spinning nuclear magnetic resonance (13C MAS NMR) spectra help to identify and also to quantify the loss of both crystalline and non-crystalline cellulose regions due to degradation. The procedure described herein can also be easily used for other woody plants infected with various cellulose-degrading fungi.
Keywords: Ophiostoma novo-ulmi Ulmus spp. Crystalline cellulose Size-exclusion chromatography Nuclear magnetic resonance
Materials and Reagents
Absolute ethanol (99.5%) (EMD Millipore, catalog number: 107017 )
Toluene (99.5%) (Merck KGaA, catalog number: 107019 )
Acetylacetone (99%) (Merck KGaA, catalog number: 109600 )
Dioxane (99.5%) (Merck KGaA, catalog number: 109671 )
Fuming hydrochloric acid (37%) (Merck KGaA, catalog number: 101834 )
Methanol (99.8%) Merck KGaA, catalog number: 107018 )
Ultrapure water
Note: It is produced by Millipore Simplicity® 185 (UV) ultrapure water purification system (EMD Millipore).
Pyridine (99.5%) (Merck KGaA, catalog number: 109728 )
Phenyl isocyanate (99%) (Merck KGaA, catalog number: 107255 )
Tetrahydrofuran (99.8%) (Merck KGaA, catalog number: 109731 )
Equipment
Chainsaw, bandsaw, abrasive belt machine and woodworking lathe
Analytical balance (accurate to 1 mg or 0.1 mg)
Desiccator and oven for drying of samples (set to 50 ± 3 °C, 70 ± 3 °C, and to 105 ± 3 °C)
Polymix (Kinematica, model: PX-MFC 90D )
Analysette 3 vibratory sieve shaker (Fritsch)
Soxhlet extraction apparatus (Sigma–Aldrich, catalog number: 64825 )
Boiling flasks (50 ml) (Sigma–Aldrich, catalog number: Z418773 )
Water bath (Harry Gestigkeit Gmbh, model: W 16 )
Fritted-glass filtering crucible of medium porosity (16–40 µm) (VWR International, catalog number: 511-2403 )
Dropping flasks (50 ml) (Smith Scientific Limited, catalog number: 8029/50 )
High performance liquid chromatography system (degasser, pump, autosampler, heater and diode-array ) (Agilent Technologies, model: 1200 series )
Captiva Premium Syringe Filter (0.45 mm PTFE membrane, 15 mm) (Agilent Technologies, catalog number: 5190-5085 )
PLgel (10 μm, 7.5 x 300 mm, two pieces) (Agilent Technologies, model: MIXED-B column )
PLgel (10 μm, 7.5 x 50 mm) (Agilent Technologies, model : Guard-column )
Solid-state NMR spectrometer (Varian, model: 400-MHz ) with the following assembly (Figure 1):
Magnet: superconducting actively shielded magnet, B = 9.4 T, wide bore – 89 mm
Console: three high-power linear RF channels, all with spin lock and decoupling capability, output power up to 1000 W,
channel – high band RF, narrow band amplifier 375–400 MHz
channel – broad band amplifier 18–240 MHz
channel – broad band amplifier 10–130 MHz
Probes:
a: 1H – 19F / 31P – 79Br / 23Na – 15N , 4 mm T3-HXY for solids, double and triple resonance, MAS up to 18 kHz
b: 1H – 19F / 31P – 79Br / 23Na – 15N, 7.5 mm T3-HXY for solids, double and triple resonance, MAS up to 7 kHz
c: Double channels goniometric static HX probe
X channel – 5, 10 mm coils, resonance from 31P to 15N
Accessories:
Variable temperature control unit, range –150 °C ↔ +250 °C
Accessory for low-band measurements – down from 15N
Accessories for sample preparation and measurements:
a.ZrO rotors with diameters of 4 and 7.5 mm
b. Rotor packing and cleaning tools, isopropyl alcohol, liquid nitrogen
c. Assembly for hydration and dehydration of samples
d. Primary and secondary standards for calibration of NMR ppm scale
Figure 1. Solid-state 13C MAS NMR equipment
Software
ChemStation for LC 3D systems (Agilent Technologies)
Clarity, GPC module, version 5.0.3.180 (DataApex)
VnmrJ 3.2 (Varian)
Mnova 8.1, or a higher version (Mestrelab Research)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Ďurkovič, J., Kačík, F. and Olčák, D. (2015). An Evaluation of Cellulose Degradation Affected by Dutch Elm Disease. Bio-protocol 5(14): e1535. DOI: 10.21769/BioProtoc.1535.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Plant Science > Plant immunity > Perception and signaling
Plant Science > Plant metabolism > Carbohydrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,536
|
https://bio-protocol.org/exchange/protocoldetail?id=1536&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Mammalian Host-adapted Leptospira interrogans by Cultivation in Peritoneal Dialysis Membrane Chamber Implantation in Rats
André Alex Grassmann
Alan John Alexander McBride
Jarlath E. Nally
Melissa J. Caimano
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1536 Views: 8284
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Leptospira interrogans can infect a myriad of mammalian hosts, including humans (Bharti et al., 2003; Ko et al., 2009). Following acquisition by a suitable host, leptospires disseminate via the bloodstream to multiple tissues, including the kidneys, where they adhere to and colonize the proximal convoluted renal tubules (Athanazio et al., 2008). Infected hosts shed large number of spirochetes in their urine and the leptospires can survive in different environmental conditions before transmission to another host. Differential gene expression by Leptospira spp. permits adaption to these new conditions. Here we describe a protocol for the cultivation of Leptospira interrogans within Dialysis Membrane Chambers (DMCs) implanted into the peritoneal cavities of Sprague-Dawley rats (Caimano et al., 2014). This technique was originally developed to study mammalian adaption by the Lyme disease spirochete, Borrelia burgdorferi (Akins et al., 1998; Caimano, 2005). The small pore size (8,000 MWCO) of the dialysis membrane tubing used for this procedure permits access to host nutrients but excludes host antibodies and immune effector cells. Given the physiological and environmental similarities between DMCs and the proximal convoluted renal tubule, we reasoned that the DMC model would be suitable for studying in vivo gene expression by L. interrogans. In a 20 to 30 min procedure, DMCs containing virulent leptospires are surgically-implanted into the rat peritoneal cavity. Nine to 11 days post-implantation, DMCs are explanted and organisms recovered. Typically, a single DMC yields ~109 mammalian host-adapted leptospires (Caimano et al., 2014). In addition to providing a facile system for studying the transcriptional and physiologic changes pathogenic L. interrogans undergo within the mammal, the DMC model also provides a rationale basis for selecting new targets for mutagenesis and the identification of novel virulence determinants.
Caution: Leptospira interrogans is a BSL-2 level pathogen and known to be excreted in the urine of infected animals. Animals should be handled and disposed of using recommended Animal Biosafety Levels (ABSL) for infectious agents using vertebrate animal guidelines.
Note: All protocols using live animals must conform to governmental regulations regarding the care and use of laboratory animals. The success of this protocol is dependent on the proper use of aseptic techniques during all stages of both dialysis membrane chamber preparation and animal surgery.
Keywords: Spirochetes Leptospirosis Mammalian host adaptation Gene expression Virulence
Materials and Reagents
Adult female Sprague-Dawley rats (175-200 g)
EMJH medium (prepared as described in Supplementary data)
Bovine serum albumin (BSA)
EMJH+BSA (10 mg/ml BSA, BSA concentration 20 mg/ml) (Millipore, catalog number: 810037 )
Note: The quality of the albumin used for the cultivation of leptospires is critical. Please verify that the albumin used for DMC implantation supports the growth of virulent leptospires under standard in vitro growth conditions. Other sources of BSA were tested (e.g., Millipore, catalog number: 840644 and Sigma-Aldrich, catalog number: A-9647 ) with similar results.
Leptospira interrogans, logarithmic phase, grown under standard in vitro conditions (28-30 °C) (Zuerner, 2005)
Ultrapure water (deionized, distilled) (e.g., Milli-Q)
1 mM EDTA (pH 8.0)
Regenerated cellulose dialysis membrane tubing (SpectrumTM Spectra/PorTM 1 RC, 6,000 to 8,000 MWCO, 32 mm width) (Spectrum Labs, catalog number: 132655 )
Filter units (0.22 µm, 250 ml, sterile) (e.g., Millipore Stericup® filter unit)
Ketamine/xylazine anesthetic cocktail (40-80 mg per kg/ 5-10 mg per kg, administered intramuscularly)
Ophthalmic ointment (e.g., Puralube)
Betadine® surgical scrub solution
Carprofen (5-10 mg per kg, administered subcutaneously)
Ethanol (70%)
Ketamine/xylazine anesthetic cocktail (see Recipes)
EMJH + BSA medium (see Recipes)
Equipment
Surgical gloves (individually wrapped, sterile)
Disposable serological pipets (10 ml sterile, individually-wrapped)
Surgical drape (cut into 12 in (46 cm) squares, sterile)
Gauze (4 x 4 in sterile)
Microscope equipped with a dark field condenser (e.g., Olympus, model: BX40 )
Three 2-L Pyrex beakers (each containing a magnetic stir bar)
Hot plate with stirring option
Extra-long blunt end forceps (sterile)
Pipet filler (e.g., Drummond Scientific, model: Pipet-Aid )
Surgical instrument pack, one per animal, sterilized prior to use and kept within sterile package:
Scalpel blades (No. 10)
Scalpel blade holder
Scissors, iris, 4 in (~10.2-cm)
Tissue forceps, 5 ½ in (~14 cm) (1x 2-tooth dissecting or Adson-Brown)
Tissue forceps, 5 ½ in (~14 cm) (blunt-end)
Needle holder forceps with built-in scissors (e.g., Olsen Hegar) (5 ½ in)
(~14 cm)
Suture, Ethicon 40, SH 1, 27 in (~68.6 cm) coated Vicryl, violet-braided suture
Autoclip® 9-mm stainless steel wound closure clips and applicator
Biological safety cabinet (Biosafety Level 2, model: BSL2 )
Circulating warm-water blanket and pump
Electric hair/fur clippers
Glass bead sterilizer (e.g., Braintree Scientific, model: Germinator 500 ) (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Grassmann, A. A., McBride, A. J. A., Nally, J. E. and Caimano, M. J. (2015). Generation of Mammalian Host-adapted Leptospira interrogans by Cultivation in Peritoneal Dialysis Membrane Chamber Implantation in Rats. Bio-protocol 5(14): e1536. DOI: 10.21769/BioProtoc.1536.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,537
|
https://bio-protocol.org/exchange/protocoldetail?id=1537&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Nanofluidic Proteomic Immunoassay
HG Huifang Guo
Philip L Lorenzi
ZD Zhiyong Ding
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1537 Views: 8031
Reviewed by: Pia Giovannelli
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Nanofluidic proteomic immunoassay (NIA), consisting of isoelectric focusing followed by sensitive chemiluminescence detection, has the potential to quantitatively characterize protein post-translational modifications that cause shifts in isoelectric point (pI). This protocol details the NIA analysis of protein phosphorylation using AKT as an example.
This protocol can be used for two platforms, NanoPro 1000 and Peggy Sue, from ProteinSimple Company. NanoPro 1000 separates proteins based on charge. Peggy Sue separates proteins based on either charge or size. The platforms can analyze up to 96 samples at a time with lysates from as few as 25 cells per assay. Detailed information of the platforms is available on ProteinSimple’s website (http://www.proteinsimple.com).
Keywords: Immunoassay Antibody AKT NIA Phosphorylation
Materials and Reagents
Reagents from ProteinSimple
25x aqueous protease/phosphatase inhibitor mix (ProteinSimple, catalog number: 040482 )
50x DMSO protease/phosphatase inhibitor mix (ProteinSimple, catalog number: 040510 )
Premix G2 (Servalyt pH 5-8 separation gradient) (ProteinSimple, catalog number: 040974 )
Premix G2 (pH 5-6 separation gradient) (ProteinSimple, catalog number: 040971 )
PI standard 5.5 (ProteinSimple, catalog number: 040028 )
PI standard ladder 3 (ProteinSimple, catalog number: 040646 )
Anolyte refill (ProteinSimple, catalog number: 040337 )
Catholyte refill (ProteinSimple, catalog number: 040338 )
Wash concentrate refill (ProteinSimple, catalog number: 041108 )
Amplified rabbit secondary antibody detection kit (ProteinSimple, catalog number: 041126 )
Peroxide XDR (ProteinSimple, catalog number: 041084 )
Amplified rabbit secondary antibody detection kit (includes SA-HRP conjugate, secondary goat-anti-rabbit-biotin conjugate and antibody diluent) (ProteinSimple, catalog number: 041126 )
RIPA lysis buffer (ProteinSimple, catalog number: 040483 ) (see Recipes)
Bicine/CHAPS lysis buffer and sample diluent (ProteinSimple, catalog number: 040764 ) (see Recipes)
Anolyte (10 mM Phosphoric Acid) (see Recipes)
Catholyte (100 mM Sodium Hydroxide) (see Recipes)
Antibodies for AKT analysis
AKT (pan) antibody (Cell Signaling Technology, catalog number: 4691 )
AKT1 antibody (BD Biosciences, catalog number: 610861 )
AKT2 antibody (Cell Signaling Technology, catalog number: 3063 )
Phospho-AKT (Thr308) (Cell Signaling Technology, catalog number: 2965 )
Phospho-AKT (Thr450) (Cell Signaling Technology, catalog number: 9267 )
Phospho-AKT (Ser473) (Cell Signaling Technology, catalog number: 9271 )
Other materials
BCA protein assay kit (Pierce Antibodies, catalog number: 23225 )
Dulbecco’s Modification of Eagle’s Medium (DMEM) with 4.5 g/L glucose & L-glutamine without pyruvate (Mediatech, catalog number: 10017CV )
McCoy’s 5A (1x, with L-glutamine) (Mediatech, catalog number: 10050CV )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10438026 )
Equipment
NP1000 or Peggy (ProteinSimple, model: 004800 )
Centrifuge for microplates (Thermo Fisher Scientific, model: Sorvall Legend XTR )
Capillaries Charge Separation (ProteinSimple, catalog number: CBS701 )
Assay Plate/Lid Kit (ProteinSimple, catalog number: 040663 )
Sponge Pack (ProteinSimple, catalog number: 041528 )
Tissue culture dish (100 mm) (Corning Incorporated, catalog number: 430167 )
Microcentrifuge tube (Denville Scientific, catalog number: C2170 )
Software
Compass version 2.5.11 (ProteinSimple)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Guo, H., Lorenzi, P. L. and Ding, Z. (2015). Nanofluidic Proteomic Immunoassay. Bio-protocol 5(14): e1537. DOI: 10.21769/BioProtoc.1537.
Download Citation in RIS Format
Category
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,538
|
https://bio-protocol.org/exchange/protocoldetail?id=1538&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro DNA Protection Assay Using Oxidative Stress
YU Yuri Ushijima
RO Ryosuke L. Ohniwa
KM Kazuya Morikawa
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1538 Views: 9420
Edited by: Maria Sinetova
Reviewed by: Christian RothLionel Schiavolin
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
A wide range of stresses such as oxidative stress, acid, alkaline, UV, and metal can damage DNA. Here, we describe a protocol to measure the DNA nicking damage by Fenton reaction-mediated oxidative stress. Fenton reaction (Fe2+ + H2O2 → Fe3+ + OH- + ∙OH) produces the highly deleterious hydroxyl radicals that damage the cellular components such as DNA, lipid and proteins.
Keywords: DNA damage DNA protection Oxidative stress Fenton reaction
Materials and Reagents
300 ng/µl plasmid DNA
We used 7.2 kbp pMK 3 plasmid purified from E. coli JM109 by QIA filterWe used 7.2 kbp pMK3 plasmid purified from E. coli JM109 by QIA filterTM (Plasmid Midi kit). The high quality plasmid abundant in supercoiled form is required to monitor the reduction of the supercoiled form.
Proteins to be tested on their DNA protection ability
a. BSA (Wako Pure Chemical Industries, catalog number: 01317843 )
b. Lysozyme (Wako Pure Chemical Industries, catalog number: 12202673 )
Agarose
Ethidium bromide (EtBr) (Invitrogen, catalog number: 15585011 )
Caution: Ethidium bromide is toxic and strong mutagen. Use appropriate gloves, safety goggles and lab coat
Ferrous ammonium sulfate (1.5 mM) (Wako Pure Chemical Industries, catalog number: 01412172 )
Note: The solution must be prepared just prior to the experiment.
200 mM hydrogen peroxide (Wako Pure Chemical Industries, catalog number: 08104215 )
NaCl (Wako Pure Chemical Industries, catalog number: 19101665 )
Sodium dodecyl sulfate (SDS) (Wako Pure Chemical Industries, catalog number: 08104215)
Tris (Nacalai tesque, catalog number: 3543421 )
Acetic acid (Nacalai tesque, catalog number: 0021243 )
EDTA (Nacalai tesque, catalog number: 15111 )
CIA (chloroform:isoamyl alcohol = 24:1) (Nacalai tesque, catalog number: 0840255 )
Caution: Chloroform is suspect mutagen and harmful if inhaled. Avoid breathing vapor and prolonged contact with skin, using fume food and safety gloves. Follow the safety rule in your institute.
300 ng/µl plasmid DNA (pMK3) (see Recipes)
1 µg/µl bovine serum albumin (BSA) (see Recipes)
1 µg/µl lysozyme (see Recipes)
Protein/binding buffer (see Recipes)
1.5 mM ferrous ammonium sulfate (see Recipes)
200 mM hydrogen peroxide (see Recipes)
10% sodium dodecyl sulfate (SDS) (see Recipes)
1x TAE buffer (see Recipes)
50x TAE buffer (see Recipes)
Equipment
Eppendorf tubes (1.5 ml)
Eppendorf tubes (2.0 ml)
Tips
Thermostat bath
Centrifuge machine
Electrophoresis apparatus
UV Trans illuminator and recording system (Nippon Genetics, model: e.g. FAS III system )
Software
Image J (NIH) (http://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,539
|
https://bio-protocol.org/exchange/protocoldetail?id=1539&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Micro-scale NMR Experiments for Monitoring the Optimization of Membrane Protein Solutions for Structural Biology
RH Reto Horst
KW Kurt Wüthrich
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1539 Views: 7136
Edited by: Arsalan Daudi
Reviewed by: Marc-Antoine Sani
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Reconstitution of integral membrane proteins (IMP) in aqueous solutions of detergent micelles has been extensively used in structural biology, using either X-ray crystallography or NMR in solution. Further progress could be achieved by establishing a rational basis for the selection of detergent and buffer conditions, since the stringent bottleneck that slows down the structural biology of IMPs is the preparation of diffracting crystals or concentrated solutions of stable isotope labeled IMPs. Here, we describe procedures to monitor the quality of aqueous solutions of [2H, 15N]-labeled IMPs reconstituted in detergent micelles. This approach has been developed for studies of β-barrel IMPs, where it was successfully applied for numerous NMR structure determinations, and it has also been adapted for use with α-helical IMPs, in particular GPCRs, in guiding crystallization trials and optimizing samples for NMR studies (Horst et al., 2013). 2D [15N, 1H]-correlation maps are used as “fingerprints” to assess the foldedness of the IMP in solution. For promising samples, these “inexpensive” data are then supplemented with measurements of the translational and rotational diffusion coefficients, which give information on the shape and size of the IMP/detergent mixed micelles. Using microcoil equipment for these NMR experiments enables data collection with only micrograms of protein and detergent. This makes serial screens of variable solution conditions viable, enabling the optimization of parameters such as the detergent concentration, sample temperature, pH and the composition of the buffer.
Keywords: Micro-scale NMR Structural Biology Integral Membrane Proteins Transverse relaxation optimized spectroscopy (TROSY) NMR sample optimization
Materials and Reagents
Studies of IMPs
Phosphocholine-detergents (Avanti Polar Lipids)
Tris Base (Thermo Fisher Scientific, catalog number: BP1521 )
HCl (Thermo Fisher Scientific, catalog number: A144212 )
Urea (Thermo Fisher Scientific, catalog number: BP169212 )
Ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, catalog number: BP1201 )
L-Arginine (L-Arg) (Sigma-Aldrich, catalog number: A5131100G )
Phosphate buffer (Sigma-Aldrich, catalog number: P7994 )
Sodium Azide (NaN3) (Sigma-Aldrich, catalog number: S803225G )
NaCl (Thermo Fisher Scientific, catalog number: BP358212 )
Stock solutions of unfolded protein (see Recipes)
Refolding buffer (see Recipes)
NMR buffer (see Recipes)
Equipment
NMR data collection
NMR experiment set-ups used in this protocol are either part of the Bruker standard pulse sequence library or are described in the Appendix. These experiments were implemented on a Bruker DRX spectrometer equipped with microprobes (Bruker Corporation,model:1 mm TXI, 1.7 mm TXI )
The following experiments were used to monitor the quality of aqueous solutions of [2H, 15N]-labeled IMPs: 2D [15N, 1H]-TROSY experiments (Pervushin et al., 1997), 1H-TRO-STE (Horst et al., 2011) and TRACT (Lee et al., 2006).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Horst, R. and Wüthrich, K. (2015). Micro-scale NMR Experiments for Monitoring the Optimization of Membrane Protein Solutions for Structural Biology. Bio-protocol 5(14): e1539. DOI: 10.21769/BioProtoc.1539.
Download Citation in RIS Format
Category
Biochemistry > Protein > Structure
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
154
|
https://bio-protocol.org/exchange/protocoldetail?id=154&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stereotaxic Injection of LPS or Your Reagents of Choice into Rat Substantia Nigra
HG Huiming Gao
Published: Nov 20, 2011
DOI: 10.21769/BioProtoc.154 Views: 12197
Download PDF
Ask a question
Favorite
Cited by
Abstract
Stereotaxic injection is an invaluable tool for the creation of site-targeted lesions, injection of anatomical tracers, gene delivery by recombinant adeno-associated viruses and lentiviruses in mice and rats. Stereotaxic injection of LPS or 6-hydroxydopamine has been used to establish animal models of Parkinson’s disease, the most common neurodegenerative movement disorder. This protocol allows the investigation of central nervous system development and disease mechanisms. This protocol has been developed and improved over the years by various researchers in Dr. Hong’s lab, especially Dr. Bin Liu.
Materials and Reagents
Two-month-old male F344 rats, body weight 220-250 g
Nembutal
Carprofen
Betadine
70% ethanol
Phosphate buffered saline (PBS)
4% paraformaldehyde
Ocular lubricant (Puralube)
LPS (Escherichia coli 0111: B4) (Sigma-Aldrich)
Sterile normal saline (0.9%) or other vehicle for your reagents
LPS stock solution (see Recipes)
Equipment
Motorized microinjection pump
Small-animal stereotaxic apparatus (rat stereotaxic apparatus)
Sicroinjection apparatus
Dental drill and #1 burrs
Microknife
Scalpel (#10)
Tissue forceps
Gauze
Stereotaxic frame
Autoclips/suture materials
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Nervous system disorders
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,540
|
https://bio-protocol.org/exchange/protocoldetail?id=1540&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phakopsora pachyrhizi Infection Bioassay in Detached Soybean Transgenic Leaves for Candidate Gene Validation
Beatriz Wiebke-Strohm
Ciliana Rechenmacher
Luisa Abruzzi de Oliveira
Cláudia Vieira Godoy
Maria Helena Bodanese Zanettini
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1540 Views: 8463
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Soybean (Glycine max) is one of the most important crops in the world. Phakopsora pachyrhizi is a plant pathogenic basidiomycete fungus that infects soybean, causing Asian Soybean Rust (ASR) disease and affecting production. Here, we describe how to prepare the plant material and the uredospore suspension (from spores harvested from leaves exhibiting sporulating uredinia) for in vitro leaf infection. Plant material is sprayed with the uredospore suspension and incubated for 12 days. During the incubation period, the presence of lesions and pustules is visually verified. After this incubation period, the leaves are classified according to the lesion type. The number of uredospores per CM2 of leaf was also estimated. The detached-leaf assay is routinely used to test fungicide efficiency (Scherb and Mehl, 2006). Detached-leaf, greenhouse and field results have been shown to be significantly correlated (Twizeyimana et al., 2007). The present protocol was adapted from the two publications cited above. The usefulness of this approach for studying P. pachyrhyzi infection on transgenic soybean was previously demonstrated by our research team (Wiebke-Strohm et al., 2012; Bencke-Malato et al., 2014).
Materials and Reagents
Soybean transgenic and non-transgenic plants of similar age
Leaves infected with Phakopsora pachyrhizi uredospores (Figure 1A)
Tween 20 (Labsynth)
Uredospore suspension (see Recipes)
Figure 1. Soybean response to rust infection on the abaxial leaf surface. A. Tan, B. reddish brown and (C) immune.
Equipment
Petri dish (Ø 9 cm)
Hand sprayer that can be adjusted for spraying 1 ml volume (Figure 2A and 2B, Video 1)
Plant culture room
Growth chamber
Stereomicroscope
Laminar flow sterile cabinet
Neubauer chamber
Figure 2. Hand sprayer
Video 1. Hand sprayer adjusted for spraying 1 ml volume
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Wiebke-Strohm, B., Rechenmacher, C., Oliveira, L. A. D., Godoy, C. V. and Zanettini, M. H. B. (2015). Phakopsora pachyrhizi Infection Bioassay in Detached Soybean Transgenic Leaves for Candidate Gene Validation. Bio-protocol 5(14): e1540. DOI: 10.21769/BioProtoc.1540.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > Fungus
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,541
|
https://bio-protocol.org/exchange/protocoldetail?id=1541&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Rat Model of Intracerebral Hemorrhage Induced by Collagenase IV
Qin Lu
LiJie Huang
QiChuan ZhuGe
Published: Vol 5, Iss 14, Jul 20, 2015
DOI: 10.21769/BioProtoc.1541 Views: 10969
Edited by: Soyun Kim
Reviewed by: Manuel D. GaheteShai Berlin
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Stroke, the second leading cause of death worldwide (Ingall, 2004), is one of the major causes of morbidity and mortality. Intracerebral hemorrhage (ICH), a lethal type of stroke, accounts for 20% of all strokes (Qureshi et al., 2001), and occurs in about 50-60% of Asians (Inagawa, 2002). In order to understand the disease process, three animal model of ICH have been used to study the pathophysiology and treatment of ICH, including the microballoon model, the bacterial collagenase injection model (Rosenberg et al., 1990) and the autologous blood injection model (Andaluz et al., 2002; Belayev et al., 2003). In the collagenase injection model, the hemorrhage size is controllable which was induced by small vessel breakdown. This model also can mimic the onset of spontaneous intraparenchymal bleeding and the expansion of continuous bleeding in ICH patients (Kazui et al., 1996; MacLellan et al., 2008; James et al., 2008). In the past several years, our previous studies have proven that our modified collagenase IV injection model is a reliable and reproducible model of ICH in rat (Lu et al., 2014; Gao et al., 2014; Wang et al., 2011). We hereby introduce our model of ICH as following.
Keywords: Intracerebral hemorrhage Model Collagenase IV
Materials and Reagents
About 2 months old male Sprague-Dawley rats(280~320 g)
Isoflurane
Collagenase IV (Sigma-Aldrich, catalog number: C5138 )
4-0 monocryl
Equipment
Sterile iodophor wipes
Sterile bone wax
Induction chamber
Stereotactic apparatus (KOPF®, model: 900 Small Animal Stereotaxic Instrument)
Stereotaxic drill (KOPF®, model: 1474 High Speed Stereotaxic Drill)
The animal gas anesthesia system (RDW Life Science)
Temperature controller and temperature sensor system (RDW Life Science, model: 69001)
Microinjection pump (KD Scientific, model: KDS310 )
Hamilton syringe 26 G (5 μl)
Magnetic Resonance Imaging (MRI)
Brain matrix (RDW Life Science, catalog number: 68710 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,542
|
https://bio-protocol.org/exchange/protocoldetail?id=1542&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assessing Mitochondrial Transport via Cytoplasmic Nanotubular Bridges in Cells
Shravani Mukherjee
TA Tanveer Ahmad
Anurag Agrawal
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1542 Views: 8303
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
This protocol aims to study intercellular transport of mitochondria, dynamic cellular organelles via tunnelling nanotubes (TNT), a cell membrane extension of cytoskeletal elements. The nanotubular bridges or the tunnelling nanotube highways are one of the emerging new cell-to-cell communication systems which mediates exchange of cellular materials, most importantly as in our observation, mitochondria. Mesenchymal stem cells (MSC) have been well studied to be endowed with a highly efficient intercellular mitochondrial donation ability and this property is now proven crucial to its functional role of rescue in cellular therapy.
Keywords: Mitochondrial transfer Nanotube Intercellular transport Miro1
Materials and Reagents
Cells
Mesenchymal stem cells (Human or Mouse derived in passage 3-7), any fibroblasts cell lines (HSMC, 3T3) or primary cells. Even epithelial [BEAS-2b (ATCC, catalog number: CRL-9609 ), NHBE (Lonza, catalog number: CC-2540 ), A549, LA-4, MLE- 12] and endothelial cells (HUVEC) also show such capacity but at comparatively minimal efficiency.
Reagents
CellLight® Mitochondria-GFP, BacMam 2.0 (Life Technologies, catalog number: C10600 )
CellLight® Mitochondria-RFP, BacMam 2.0 (Life Technologies, catalog number: C10505 )
MitoTracker® Green FM (Life Technologies, catalog number: M7514 )
MitoTracker® Deep Red FM (Life Technologies, catalog number: M22426 )
Alexa Fluor® 594 phalloidin (Life Technologies, catalog number: A12381 ) or fluorescein phalloidin (Life Technologies, catalog number: F432 )
Alexa Fluor® 488 phalloidin (Life Technologies, catalog number: A12379 )
2% paraformaldehyde (SigmaAldrich, catalog number: P6148 ) diluted in 1x PBS
ProLong® Gold Antifade Mountant with DAPI (Life Technologies, catalog number: P36931 )
Respective cell culture media
DMEM (Sigma-Aldrich, catalog number: D5523 ) + 10% FBS for Human MSC (HuMSC), Fibroblasts 3T3, A549
Mouse MesenCult™ (STEMCELL Technologies, catalog number: 05512 ) for mouse MSC
Ham’s-F 12 (Sigma-Aldrich, catalog number: N6760 ) + 15% FBS for LA-4, MLE- 12
BEGM (Lonza, catalog number: CC3170 ) for NHBE and BEAS-2b
M-199 (Sigma-Aldrich, catalog number: M2520 ) + 15% FBS (Life Technologies, InvitrogenTM, catalog number: 10270 ) for HUVECs (primary cultured)
TritonX-100 (Sigma-Aldrich, catalog number: T9284 )
1x phosphate buffer saline (PBS)
Equipment
Lab-tek II Chambered Coverglass w/cover #1.5 Borosilicate Sterile (Sigma-Aldrich)
75 x 25 mm microscope slides (J. Melvin Freed Brand)
22 x 22 Esco microscope square cover glass with no. 1 thickness (Erie Scientific Company)
Live cell fluorescent microscope (Leica Microsystems, model: DMI6000 )
Confocal microscope (Leica Microsystems, model: TCSSP5 )
BD FACS Aria (BD Biosciences)
BD FACS Calibur (BD Biosciences)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Mukherjee, S., Ahmad, T. and Agrawal, A. (2015). Assessing Mitochondrial Transport via Cytoplasmic Nanotubular Bridges in Cells. Bio-protocol 5(15): e1542. DOI: 10.21769/BioProtoc.1542.
Ahmad, T., Mukherjee, S., Pattnaik, B., Kumar, M., Singh, S., Kumar, M., Rehman, R., Tiwari, B. K., Jha, K. A., Barhanpurkar, A. P., Wani, M. R., Roy, S. S., Mabalirajan, U., Ghosh, B. and Agrawal, A. (2014). Miro1 regulates intercellular mitochondrial transport & enhances mesenchymal stem cell rescue efficacy. EMBO J 33(9): 994-1010.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell staining > Organelle
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,543
|
https://bio-protocol.org/exchange/protocoldetail?id=1543&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
XTT Assay of Antifungal Activity
Flávio V. Loures
Stuart M. Levitz
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1543 Views: 10169
Edited by: Fanglian He
Reviewed by: Emilia Krypotou Belen Sanz
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
XTT assay is a colorimetric method that uses the tetrazolium dye, 2,3-bis-(2-methoxy-4-nitro-5-sulphenyl)-(2H)-tetrazolium-5-carboxanilide (XTT) to quantify cell-mediated damage to fungi. Actively respiring fungal cells convert the water-soluble XTT to a water-soluble, orange colored formazan product (Meshulam et al., 1995). Here, we describe the protocol that measures the ability of plasmacytoid dendritic cells (pDCs) to exert antifungal activity. This approach was first established with human polymorphonuclear cells (PMN) by Meshulam et al. (1995) and then adapted to pDC by Ramirez-Ortiz et al. (2011) and Loures et al. (2015). It can be modified for use with other effector cells and to test compounds for antifungal activity.
Keywords: Aspergillus fumigatus XTT assay antifungal activity Plasmacytoid dendritic cell
Materials and Reagents
Aspergillus fumigatus (A. fumigatus) clinical isolate Af293 (Nierman et al., 2005)
Human pDCs obtained from healthy donors
RPMI-1640 medium without phenol red (Life Technologies, Gibco®, catalog number: 11875119 )
Penicillin G/ streptomycin sulfate (Life Technologies, Gibco®, catalog number: 15140122 )
L-glutamine (Life Technologies, Gibco®, catalog number: 25030081 )
Sodium pyruvate (Life Technologies, Gibco®, catalog number: 11360070 )
Sterile distilled water (Life Technologies, Gibco®, catalog number: 10977015 )
Sterile PBS (Corning Incorporated, catalog number: 21040CM )
96 well half area plates (Corning, Costar®, catalog number: 07200309 )
Tips
15 ml Centrifuge tube (Falcon®,catalog number: 352059 )
XTT (Sigma-Aldrich, catalog number: X4251 )
Coenzyme Q (Sigma-Aldrich, catalog number: D9150 )
Tween 20 (Thermo Fisher Scientific, catalog number: BP337500 )
Sabouraud dextrose agar (Thermo Fisher Scientific, catalog number: R454472 )
Supplemented media (see Recipes)
Slants (see Recipes)
Equipment
30 μm Nylon mesh (Genesee Scientific Corporation, catalog number: 57105 )
10 ml Syringe (BD Bioscience, catalog number: 305482 )
Inverted microscope (Nikon)
Pipettes
Multichannel pipette
Neubauer chamber
Reagents reservoir (Corning, Costar®, catalog number: 07200127 )
Microplate reader with capacity to measure OD450 and OD650 (Versamax)
Water bath (Thermo Fisher Scientific)
CO2 Incubator (37 °C)
Vortex (Fisher Vortex Genie 2) (Scientisfic Industries, Inc., catalog number: 12812 )
Autoclavec
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Loures, F. V. and Levitz, S. M. (2015). XTT Assay of Antifungal Activity. Bio-protocol 5(15): e1543. DOI: 10.21769/BioProtoc.1543.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antifungal assay
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Antimicrobial
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,544
|
https://bio-protocol.org/exchange/protocoldetail?id=1544&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of the Arabidopsis E4 SUMO Ligases PIAL1 and PIAL2
KT Konstantin Tomanov
Andreas Bachmair
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1544 Views: 6875
Edited by: Arsalan Daudi
Reviewed by: Tzvetina Brumbarova
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
The proteins PIAL1 (At1g08910) and PIAL2 (At5g41580) are members of the recently discovered group of plant E4 SUMO ligases. This protocol allows quick and simple expression of the recombinant proteins in Escherichia coli (E. coli) and subsequent affinity purification using a maltose binding protein (MBP) tag. The proteins can be used in SUMOylation reactions, where the MBP part of the protein can be detected with a commercially available antibody, or additional purification steps can be applied.
Keywords: Small ubiquitin-related modifier SUMO Protein modification Plant proteins SUMO chain formation
Materials and Reagents
Rosetta DE3 pLysS strain (Merck KGaA, catalog number: 70956 )
Vector pMAL-c2X (New England Biolabs, catalog number: N8076S ; the current version of the vector sold by NEB is pMAL-c5X, catalog number: N8108S )
Peptone (ForMedium, catalog number: PEP03 )
Yeast extract (ForMedium, catalog number: YEM03 )
NaCl (Sigma-Aldrich, catalog number: S3014 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
Ampicillin (Sigma-Aldrich, catalog number: A9518 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (GERBU Biotechnik GmbH, catalog number: 1010 )
KCl (Sigma-Aldrich, catalog number: P5405 )
Na2HPO4 (Sigma-Aldrich, catalog number: 71505 )
KH2PO4 (Sigma-Aldrich, catalog number: P3786 )
Aprotinin (Sigma-Aldrich, catalog number: A6279 ) (solution stored at 4 °C)
Leupeptin (Sigma-Aldrich, catalog number: L2884 ) (stock solution of 1 mg/ml stored in aliquots at -20 °C)
Amylose resin (New England Biolabs, catalog number: E8021S )
DNase I (Roche Diagnostics, catalog number: 10104159001 )
Glycerol (GERBU Biotechnik GmbH, catalog number: 2006 )
Ethylenediamine tetraacetic acid (EDTA) (GERBU Biotechnik GmbH, catalog number: 1034 )
Tris (GERBU Biotechnik GmbH, catalog number: 1018 )
Maltose (Merck KGaA, catalog number: 105911 )
Ultrapure water (18.2 MΩ)
Lysogeny broth (LB) (see Recipes)
Phosphate buffered saline (PBS) (see Recipes)
Column buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Orbital shaker at 37 °C
Spectrophotometer
Cooled centrifuge
Bandelin Sonoplus sonicator with an MS 73 tapered probe (BANDELIN electronic GmbH & Co., model: GM70HD )
PolyPrep Chromatography Columns (Bio-Rad Laboratories, AbD Serotec®, catalog number: 7311550 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,545
|
https://bio-protocol.org/exchange/protocoldetail?id=1545&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Genomic DNA Extraction and Genotyping of Dictyochloropsis Green Algae Strains
Francesco Dal Grande
Carolina Cornejo
CS Christoph Scheidegger
Andreas Beck
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1545 Views: 12348
Edited by: Arsalan Daudi
Reviewed by: Antoine DanonClaudia Catalanotti
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Dictyochloropsis is an ecologically important genus of free-living and symbiotic green algae. Representatives of this genus are horizontally transmitted among several fungi of the family Lobariaceae, thus forming photobiont-mediated guilds. This protocol is suitable for extracting DNA from algal cultures and lichen samples and for genotyping seven unlinked Dictyochloropsis reticulata microsatellite markers in a single PCR multiplex.
Figure 1. Schematic representation of the analysis pipeline
Materials and Reagents
Qiagen Type-it Microsatellite PCR kit (QIAGEN, catalog number: 206243 )
1x TE buffer (10 mM Tris, bring to pH 8.0 with HCl, 1 mM EDTA)
GelRed (Biotium, catalog number: 41003 )
1 kb DNA ladder (GeneRuler 1 kb DNA Ladder) (Thermo Fisher Scientific, catalog number: SM0313 )
Nuclease-free water
Pure molecular biology grade ethanol (96–100%)
2 ml tubes
DNeasy 96 Plant Kit (QIAGEN, catalog number: 69181 )
Hi-Di™ formamide (Life Technologies, catalog number: 4311320 )
GeneScan 500 LIZ size standard (Life Technologies, catalog number: 4322682 )
Ice
Glucose (BD Biosciences, catalog number: 215510 )
Proteose pepton (BD Biosciences, catalog number: 212230 )
Agar (BD Biosciences, catalog number: 214883 )
2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) (Life Technologies, Gibco®, catalog number: 11330032 )
Laboratory wipes (e.g., KimWipes, Kimberly-Clark, catalog number: TW31KWPBX )
4 mm steel balls (e.g., Spex Certiprep, catalog number: 12145950 )
Pipette tips
Pipette (0.1-2 μl), pipette tips
Processing plate: 96-well plate (e.g., MicroAmp Optical 96-Well Reaction Plate) and 96-well plate (Septa)
0.22 µm sterile polyethersulfon syringe filter (Merck Millipore, catalog number: P/N SLMP025SS )
Algal medium (see Recipes)
Algal culture medium preparation for growing Dictyochloropsis and other trebouxiophycean algal strains (see Recipes)
Vitamin solution (see Recipes)
Equipment
Multi-channel pipettes (0.1-10, 10-100, 100-1000 μl), with extended tips
Microcentrifuge with rotor for 2 ml tubes
Centrifuge for 96-well plates
BioRad Gel casting tray, running tray, power pack etc. (Bio-Rad Laboratories, catalog number: 164-0305 )
Incubator (65 °C)
Freezer or cold room at -20 °C
PCR Thermal cycler
ABI3130/ 3130xl/3730/3730xl DNA Analyzer (Applied Biosystems)
Ball Mill MM 400 (Retsch®, catalog number: 20.745.0001 )
Lyophilizer (e.g., FreeZone 4.5 Liter Benchtop Freeze Dry System, Labconco, catalog number: 7750021 )
Software
GeneMapper® (Software v4.1, Applied Biosystems, catalog number: 4366925)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Grande, F. D., Cornejo, C., Scheidegger, C. and Beck, A. (2015). Genomic DNA Extraction and Genotyping of Dictyochloropsis Green Algae Strains. Bio-protocol 5(15): e1545. DOI: 10.21769/BioProtoc.1545.
Download Citation in RIS Format
Category
Plant Science > Phycology > DNA
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,546
|
https://bio-protocol.org/exchange/protocoldetail?id=1546&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mouse Retinal Whole Mounts and Quantification of Vasculature Protocol
Irit Adini
Kaustabh Ghosh
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1546 Views: 16452
Reviewed by: Shai BerlinSoyun Kim
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Angiogenesis is the formation of new blood vessels from a pre-existing vascular bed. It is a multi-step process beginning with enzymatic degradation of the capillary basement membrane, followed by endothelial cell (EC) proliferation, migration, tube formation, assembly of a new basement membrane, and pericyte stabilization. Aberrant angiogenesis plays a major role in the pathogenesis of many diseases. The regulation of this complex process is an important therapeutic target. Success in this pursuit, however, requires the development of in vivo angiogenesis models that provide a reliable and facile platform for mechanistic studies of angiogenic regulation as well as drug development and testing (Carmeliet and Jain, 2011).
Postnatal development of mouse retinal vasculature offers a unique and powerful in vivo angiogenesis model because, unlike other species, mice undergo extensive angiogenesis-dependent maturation of their retinal vessels after birth. As such, this model is also very useful for the mechanistic study of embryonic vascularization (Stahl et al., 2010; Adini et al., 2003).
This protocol describes the steps involved in the whole mount processing of mouse eyes for visualization of the retinal vasculature.
Keywords: Retinal Vessels Whole mount Mice Angiogenesis
Materials and Reagents
10% Formalin solution (Sigma-Aldrich, catalog number: HT5011284L ) or Paraformaldehyde (PFA) (Electron Microscopy Sciences, catalog number: 15710 )
Triton X-100 (Sigma-Aldrich, catalog number: 93443 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Goat serum (Sigma-Aldrich, catalog number: G9023 )
Phosphate buffer saline (PBS) (Sigma-Aldrich, catalog number: P3813 )
Antibody: Bandeiraea simplicifolia BS-1 (LEC)-TRIC (Sigma-Aldrich, catalog number: L-5264 ) diluted 1:200
Mounting medium: ProLong Gold antifade reagents (Life Technologies, catalog number: P36934 )
Blocking buffer (see Recipes)
Equipment
Razor Blade
Shaker-2 min maximum velocity
Epifluorescence microscope fitted with camera
Student Dumont #5 Forceps (Fine Science Tools, catalog number: 9115020 )
Curve Dumont #7 Fine Forceps (Fine Science Tools, catalog number: 1127420 )
Micro dissecting scissors (Fine Science Tools, catalog number: 1501810 )
Microscope cover glasses (Thermo Fisher Scientific, Menzel-Gläser, catalog number: 9161028 )
Microscope glass slides (Thermo Fisher Scientific, Menzel-Gläser, catalog number: 9161145 )
CCD camera (Leica Microsystems, model: DC500 )
Microscope: Nikon Eclipse TE-2000-E fluorescence microscope or Zeiss Inverted Tissue Culture Fluorescence Microscope.
Software
Software Angio Tool (Zudaire et al., 2011) (https://ccrod.cancer.gov/confluence/display/ROB2/Home) or ImageJ software (http://imagej.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Adini, I. and Ghosh, K. (2015). Mouse Retinal Whole Mounts and Quantification of Vasculature Protocol. Bio-protocol 5(15): e1546. DOI: 10.21769/BioProtoc.1546.
Download Citation in RIS Format
Category
Developmental Biology > Cell growth and fate > Angiogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,547
|
https://bio-protocol.org/exchange/protocoldetail?id=1547&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for the Generation of a Transcription Factor Open Reading Frame Collection (TFome)
JG John Gray*
BB Brett Burdo*
MG Mary P. Goetting-Minesky
BW Bettina Wittler
MH Matthew Hunt
TL Tai Li
DV David Velliquette
JT Julie Thomas
TA Tina Agarwal
KK Kasey Key
IG Irene Gentzel
MB Michael dos Santos Brito
MM Maria Katherine Mejía-Guerra
LC Layne N. Connolly
DQ Dalya Qaisi
WL Wei Li
MC Maria I. Casas
AD Andrea I. Doseff
EG Erich Grotewold
*Contributed equally to this work
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1547 Views: 14792
Edited by: Arsalan Daudi
Reviewed by: Vinay Panwar
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
The construction of a physical collection of open reading frames (ORFeomes) for genes of any model organism is a useful tool for the exploration of gene function, gene regulation, and protein-protein interaction. Here we describe in detail a protocol that has been used to develop the first collection of transcription factor (TF) and co-regulator (CR) open reading frames (TFome) in maize (Burdo et al., 2014). This TFome is being used to establish the architecture of gene regulatory networks (GRNs) responsible for the control of transcription of all genes in an organism. The protocol outlined here describes how to proceed when only an incomplete genome with partial annotation is available. TFome clones are made in a recombination-ready vector of the Gateway? system, allowing for the facile transfer of the ORFs to other Gateway?-compatible vectors, such as those suitable for expression in other host species. Although this protocol was developed for the maize TFome it can readily be applied to the generation of complete ORFeome collections in other eukaryotic species.
[Protocol overview] An important aspect of successful TFome generation is the initial effort spent to establish a reliable set of gene models so that they can be subsequently amplified or synthesized. An actual TFome construction protocol for a particular species will depend on available resources such as a full-length cDNA (flcDNA) collection and a reliable reference genome (Figure 1).
In the case of maize, a flcDNA collection and a draft genome was available, but the former provided only 30% of the needed clones, and the latter contained gaps and some erroneous gene models. In order to develop a near-complete set of target gene models for maize TFs, a bioinformatics pipeline was developed as described by Yilmaz et al. (2009). In brief, a two-pronged search process was developed. The first involved making a collection of protein sequences of TFs in other species and available from databases such as PlantTFDB, PlnTFDB and DBDTF. These sequences were then used to search gene models from the draft maize genome using BLASTP. The second process involved developing a collection of domains that define TF families and that are mostly annotated in the PFAM database (Finn et al., 2014). These domains were then used to search the draft maize genome using BLASTX. The number of TF families that exist and their naming is subject to change as new members are discovered and studied. Table 1 provides a list of known TF families with alternative names along with the respective PFAM domains whose presence or absence defines each TF family. HMM models for each domain can be obtained from the PFAM database (pfam.xfam.org). Following the BLAST search, redundant models are eliminated and then based on the TF motifs present in each gene model, gene models are assigned to a TF or Co-Regulator (CR) family according to the criteria specified in Table 1. Lastly, it is recommended to set up a database to store information on each TF family. The GRASSIUS (www.grassius.org) website was established to access the stored information on TF gene models for maize, sorghum, rice, Brachypodium, sugarcane and other grasses (Burdo et al., 2014). In the following section, an assumption is made that at least a draft genome or draft transcriptome is available and that a set of gene models is available that have been determined ab initio or with additional manual annotation. Familiarity with the use of PERL scripts is advantageous for the gene model assembly phase.
Figure 1. Flowchart for the generation of a TFome project. Flowchart outlining the general strategy for template identification, PCR amplification and cloning of transcription factor (TF) full length (FL) open reading frames (ORFs). (modified from Burdo et al., 2014)
Materials and Reagents
The main starting materials for embarking upon a large TFome project are the assembly of gene models and a collection of plasmid templates from existing cDNA collections. In this section, processes to develop these are outlined.
Assembly of gene models and TF domain databases
Assemble a collection of gene models from the available target genome. For plant genomes, the Phytozome database (phytozome.jgi.doe.gov) and EnsemblPlants (http://plants.ensembl.org/index.html) permit the downloading of all predicted protein models for a species as a single multi-sequence FASTA formatted file. For example, at the Phytozome website the BioMart tool permits one to select the genome dataset for a particular plant species. Once the genome is selected then attributes of the sequences to be downloaded can be specified such as peptide sequences or coding sequences only. By default all gene models are selected and then these can be downloaded as a single FASTA file that is the input file for subsequent steps below.
Assuming the draft quality of the transcript annotation it would be desirable to eliminate redundant gene models in a multiseq FASTA file. The GRASSIUS website provides the custom perl script “IdentifySeqRedundancy.pl” (http://grassius.org/tools.html) for this purpose. This script also requires the perl module “Digest::MD5” which is available from the Comprehensive Perl Archive Network (CPAN) website (http://search.cpan.org/dist/Digest-MD5/MD5.pm). One can also eliminate redundant models within the species using BLAST searches. Proteins were arbitrarily considered duplicated if they are found in the same species, with a query coverage ≥ 90%, or have a query identity ≥ 90% and the query alignment starts less than 9 residues from the start codon. Alternatively, more complex criteria such as those of Gu et al., 2002, may be employed to identify duplicate proteins in a genome. If these conditions are satisfied, the longest protein is kept and the eliminated proteins were classified as identical or splicing variants. If there is access to RNA-Seq datasets they may be used to corroborate target TF gene models, but such an approach is not outlined here. Targeting the longest splice variant which is supported by EST or RNA-Seq data provides the maximum protein interaction space for identifying the protein-DNA and protein-protein interactions that gene regulatory networks are comprised of.
Scanning the non-redundant multifasta file against a collection of protein domains as hidden Markov models (HMMs) such as provided by PFAM or Interpro provides a protein domain annotation of the putative proteome. For this particular step the software HMMER is required. In brief HMMER is a set of tools implementing the profile hidden Markov models to find similarity across protein sequences and is necessary to search the PFAM HMM models in a group of protein sequences. It is possible to call HMMER from a variety of scripting languages such as perl or python, using pre-build HMMER wrappers. PFAM provides one of those scripts written in perl (pfamscan.pl) with a set of PFAM pre-established parameters. Source code may be downloaded from the following website ftp://ftp.sanger.ac.uk/pub/databases/Pfam/Tools/PfamScan.tar.gz. Table 1 is a compilation of protein domains that have been used to define TF and CR families in plants (Buitrago-Florez et al., 2014; Burdo et al., 2014; Perez-Rodriguez et al., 2010; Yilmaz et al., 2009). This table describes 62 TF and 26 CR families that were used in defining gene models for inclusion in the maize TFome. Twelve of these families do not have ascribed PFAM domains but can be defined using “in house” HMMs as previously described (Buitrago-Florez et al., 2014; Perez-Rodriguez et al., 2010). The HMMs for the CCAAT-Hap2, 3, and 5 TF families can be obtained from the AGRIS database (http://arabidopsis.med.ohio-state.edu) (Yilmaz et al., 2011).
Once the primary list of gene models are annotated with protein domains, they are assigned to TF or CR families using the criteria outlined in Table 1. The criteria include identifying the presence of one or more motifs and the absence of other (forbidden) motifs (Buitrago-Florez et al., 2014; Perez-Rodriguez et al., 2010; Yilmaz et al., 2009). The annotation involves a custom perl script “get_InterProScanDomains.pl” to sort proteins into TF families based on the interproscan output and is available at the GRASSIUS website (http://grassius.org/tools.html). The script keeps only significant hits with e-value ≤ 0.001 and verifies that the rules as defined in Table 1 are fulfilled. When the rules are only partially fulfilled then the protein is assigned into “Orphan” TFs. This can be the largest class of TFs for a species (~11.7% of the maize TFome), until Orphan members are assigned to families.
Searches can be conducted with local computation resources or when not available using the iPlant Collaborative Discovery Environment public resource (http://www.iplantcollaborative.org).
Screening of EST or flcDNA collections for plasmid templates
Identify which cDNA resources are available for the target genome (see Note 1). Most genome projects for model species include generating an EST library, although many libraries are not publically available. For the maize TFome, extensive use of the maize flcDNA collection (http://www.maizecdna.org) was made (Soderlund et al., 2009). Individual cDNA clones for this library and many other plant species are available through the Arizona Genomics Institute (http://www.genome.arizona.edu).
Using the coding sequence of a gene model as a query sequence, ESTs or flcDNAs were then identified using BLASTP or BLASTX, for which the amino terminus, including the start codon, was present and the sequence alignment was >99%. Alignments that are not 100% identical may occur because EST sequences are not high fidelity due to sequencing errors particularly at the 3’ end of sequences (Soderlund et al., 2009). Alternatively spliced isoforms not represented by a transcript model may also be targeted, as long as they maintain the reading frame of the original transcript.
Once a likely flcDNA template is located, then the plasmid is acquired, isolated and sequenced from each end to confirm that: a) it is the correct template, and b) it is full length. Some cDNA libraries utilize enzymes during their construction that cut within the coding sequence leading to partial clones, which would be unsuitable for amplification of the entire coding sequence.
Once a suitable target plasmid template is identified for a target gene, then a sample is diluted to 1 ng/µl and 1 ng is sufficient as template in a PCR reaction.
Other reagents
One Shot® TOP10 chemically competent cells (Life Technologies, catalog number: C404003 )
PureLink® Plant RNA Reagent (Life Technologies, catalog number: 2322-012 )
Turbo DNA-free™ kit (Life Technologies, Ambion®, catalog number: AM1907 )
Thermo Scientific Maxima H minus 1st strand synthesis kit (Thermo Fisher Scientific, catalog number: K1652 )
Ribolock® RNase inhibitor (Thermo Fisher Scientific, catalog number: EO0382 )
EmeraldAmp® MAX PCR Master Mix (Takara Bio Company, catalog number: RR320A )
Phusion® high fidelity polymerase (New England Biolabs, catalog number: M0530S )
Gateway® pENTR™/D-TOPO® or pENTR™/SD/D-TOPO® vectors (Life Technologies, catalog numbers: K243520 and K242020 respectively)
Genscript® Taq Polymerase (GenScript USA Inc., catalog number: E000071000 )
EmeraldAmp® MAX PCR Master Mix (Takara Bio Company, catalog number: RR320A)
1 kb ladder molecular weight size standards (Thermo Fisher Scientific, catalog number: SM0311 )
RNA extraction buffer I (see Recipes)
RNA extraction buffer II stock solutions (see Recipes)
RNA extraction buffer II (working solution) (see Recipes)
Carlson lysis buffer (see Recipes)
Freezing medium (see Recipes)
Equipment
Note: Most equipment listed here is standard molecular biology instrumentation present in most laboratories. A large TFome project would also benefit from the use of multichannel pippetters and 96 well plate formatted experimentation.
Microcentrifuge
High speed centrifuge
Gradient thermocycler
Gel electrophoresis equipment
Water baths
-80 °C freezer for the storage of stocks
Aerosol pipette tips recommended for all DNA manipulation and cloning experiments
Wizard® SV 96 Plasmid DNA Purification System (Promega Corporation, catalog number: A2255 )
Wizard® Plus SV Minipreps DNA Purification System (Promega Corporation, catalog number: A1330 )
Wizard® SV Gel and PCR Clean-Up System (Promega Corporation, catalog number: A9281 )
Gene synthesis (Life Technologies)
2 ml 96 well culture dish (Thermo Fisher Scientific, catalog number: 12566121 )
Breathable plate seal (Thermo Fisher Scientific, catalog number: AB0718 )
0.5 ml plates (USA Scientific, catalog number: 18965000 )
7 mm sized silicone seal that can be re-autoclaved (Thermo Fisher Scientific, catalog number: 0339649 )
Matrix sample storage system (matrixtechcorp.com, Thermo Fisher Scientific, catalog numbers: 4111MAT ) (Capit-All® Capper/Decapper), 3740 (Barcoded screw cap tubes), and 4477 (Screw cap tray)
(Optional) Vac-Man® 96 Vacuum Manifold (Promega Corporation, catalog number: A2291 ) for 96 well plasmid preparation
(Optional) Vacuum pump capable of generating 38-51 cm of Hg or equivalent
Software
OligoAnalyzer 3.1 software (www.idtdna.com)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Gray, J., Burdo, B., Goetting-Minesky, M. P., Wittler, B., Hunt, M., Li, T., Velliquette, D., Thomas, J., Agarwal, T., Key, K., Gentzel, I., Brito, M. D. S., Mejía-Guerra, M. K., Connolly, L. N., Qaisi, D., Li, W., Casas, M. I., Doseff, A. I. and Grotewold, E. (2015). Protocol for the Generation of a Transcription Factor Open Reading Frame Collection (TFome). Bio-protocol 5(15): e1547. DOI: 10.21769/BioProtoc.1547.
Download Citation in RIS Format
Category
Systems Biology > Genomics > Exome capture
Systems Biology > Genomics > Sequencing
Plant Science > Plant molecular biology > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,548
|
https://bio-protocol.org/exchange/protocoldetail?id=1548&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Blood-brain-barrier Permeability Using Evans Blue in Mice
JY Jun-Xia Yang
YJ Yan-Yu Jiang
YG Yu-Bai Guo
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1548 Views: 23857
Edited by: Soyun Kim
Reviewed by: Tifany DesprezEmmanuelle Berret
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
The blood–brain barrier (BBB) is a highly selective permeability barrier that separates the circulating blood from the brain extracellular fluid in the central nervous system. The blood–brain barrier allows the passage of water, some gases, and lipid soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are crucial to neural function. This protocol provides a full, detailed method for measuring blood-brain-barrier permeability of mice with Evans blue (EB), that leakage was used to assess blood-brain barrier (BBB) permeability (sample: Anterior Cingulate Cortex, ACC).
Materials and Reagents
Adult male Kunming mice (the Experimental Animal Center of Xuzhou Medical College, 20-22 g, 5-7 weeks old)
Evans blue (EB) (Sigma-Aldrich, catalog number: E2129-10G )
Trichloroacetic acid (Sigma-Aldrich, catalog number: T6399-100G )
Chloral hydrate (Sigma-Aldrich, catalog number: 15307-500G-R )
Paraformaldehyde (Sigma-Aldrich, catalog number: 158127-500G )
NaCl (Sigma-Aldrich, catalog number: S7653-1KG )
10% chloral hydrate (see Recipes)
4% paraformaldehyde-freshly-prepared (see Recipes)
0.9% NaCl (see Recipes)
100% trichloroacetic acid solution (see Recipes)
Equipment
Spectrophotometer (Thermo Fisher Scientific, catalog number: 1510 )
96-well plate (Corning Incorporated, catalog number: 3599 )
1 and 20 ml syringe (local drugstore)
Infusion apparatus (local drugstore)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yang, J., Jiang, Y. and Guo, Y. (2015). Measuring Blood-brain-barrier Permeability Using Evans Blue in Mice. Bio-protocol 5(15): e1548. DOI: 10.21769/BioProtoc.1548.
Yang, J. X., Hua, L., Li, Y. Q., Jiang, Y. Y., Han, D., Liu, H., Tang, Q. Q., Yang, X. N., Yin, C., Hao, L. Y., Yu, L., Wu, P., Shao, C. J., Ding, H. L., Zhang, Y. M. and Cao, J. L. (2015). Caveolin-1 in the anterior cingulate cortex modulates chronic neuropathic pain via regulation of NMDA receptor 2B subunit. J Neurosci 35(1): 36-52.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,549
|
https://bio-protocol.org/exchange/protocoldetail?id=1549&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of ex vivo Neutrophil Extracellular Traps
Koji Tanaka
MO Masato Okigami
YT Yuji Toiyama
YO Yoshinaga Okugawa
YI Yasuhiro Inoue
TA Toshimitsu Araki
YM Yasuhiko Mohri
AM Akira Mizoguchi
MK Masato Kusunoki
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1549 Views: 11024
Edited by: Ivan Zanoni
Reviewed by: Achille BroggiMarco Di Gioia
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Neutrophil extracellular traps (NETs) are fibrous mesh-like, web-like, or string-like structures which are composed of DNA, histones, and granule proteins such as neutrophil elastase or myeloperoxidase. When activated by phorbol myristate acetate, interleukin-8, lipopolysaccharide (LPS), and various pathogens, neutrophils release NETs. We reported that NETs were classified as two distinct forms; cell-free NETs that were released away from neutrophils and anchored NETs that were anchored to neutrophils. In general, extracellular DNAs are used as a surrogate marker of NETs. Here, we describe a protocol regarding quantitative procedures of extracellular DNAs released from ex vivo neutrophils activated by LPS using fluorometric double-stranded DNA (dsDNA) quantification assay.
Materials and Reagents
Whole blood from wild-type C57/BL6 mice (Japan SLC)
Whole blood from human volunteers
LPS (Escherichia coli, serotype 0111:B4) (Sigma-Aldrich, catalog number: L4391 )
PolymorphprepTM (Axis Shield PoC AS, catalog number: 1114683 )
RPMI 1640 medium (no phenol red) (Life Technologies, catalog number: 32404-014 )
Fetal bovine serum (Life Technologies, catalog number: 12483-020 )
ACK (Ammonium-chloride-potassium) lysing buffer (Lonza, catalog number: 10-548E )
Quant-iTTM PicoGreen dsDNA Assay Kit (Life Technologies, InvitrogenTM, catalog number: P11496 )
Equipment
Glass Pasteur pipets (Iwaki brand, Asahi Techno Glass Corporation)
96-well plates (TPP Techno Plastic Products AG)
CO2 Incubator (SANYO)
Fluorescence microplate reader (Perkin Elmer, model: 2030ARVOX )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Tanaka, K., Okigami, M., Toiyama, Y., Okugawa, Y., Inoue, Y., Araki, T., Mohri, Y., Mizoguchi, A. and Kusunoki, M. (2015). Quantification of ex vivo Neutrophil Extracellular Traps. Bio-protocol 5(15): e1549. DOI: 10.21769/BioProtoc.1549.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Neutrophil
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
155
|
https://bio-protocol.org/exchange/protocoldetail?id=155&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Superoxide Measurement
HG Huiming Gao
Published: Nov 20, 2011
DOI: 10.21769/BioProtoc.155 Views: 13519
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Superoxide dismutase (SOD)-inhibitable reduction of tetrazolium salt, WST-1, is used to measure extracellular superoxide free radical release from various immune cells such as macrophage, neutrophils, microglia (brain macrophage) after stimulation. This protocol has been developed and improved over the years by various researchers in Dr. Hong’s lab, especially Dr. Bin Liu.
Materials and Reagents
Phenol red-free HBSS (Life Technologies, InvitrogenTM, catalog number: 14175-095 )
Superoxide dismutase from bovine erythrocytes (Sigma-Aldrich, catalog number: S7571-30KU )
Phorbol 12-myristate 13-acetate (PMA)
Lipopolysaccharide (LPS)
Fresh WST-1 solution (see Recipes)
SOD stock solution (see Recipes)
Equipment
Microplate spectrophotometer (SpectraMax Plus)
96-well plates
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Gao, H. (2011). Superoxide Measurement. Bio-101: e155. DOI: 10.21769/BioProtoc.155.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,550
|
https://bio-protocol.org/exchange/protocoldetail?id=1550&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualization of ex vivo Neutrophil Extracellular Traps by Fluorescence Microscopy
Koji Tanaka
TS Tadanobu Shimura
YT Yuji Toiyama
YO Yoshinaga Okugawa
YI Yasuhiro Inoue
TA Toshimitsu Araki
YM Yasuhiko Mohri
AM Akira Mizoguchi
MK Masato Kusunoki
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1550 Views: 11156
Edited by: Ivan Zanoni
Reviewed by: Achille BroggiMarco Di Gioia
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Neutrophil extracellular traps (NETs) are extracellular DNAs decorated with nuclear and granular proteins such as histones, neutrophil elastase or myeloperoxidase. They exhibit fibrous mesh-like, web-like, or string-like structures. Here, we describe our protocol regarding visualization of ex vivo NETs released from neutrophils activated by lipopolysaccharide (LPS) using fluorescence microscopy.
Materials and Reagents
Whole blood from wild-type C57/BL6 mice (Japan SLC, Inc.)
Whole blood from human volunteers
LPS (Escherichia coli, serotype 0111:B4) (Sigma-Aldrich, catalog number: L4391 )
PolymorphprepTM (Axis Shield PoC AS, catalog number: 1114683 )
RPMI 1640 medium (no phenol red) (Life Technologies, catalog number: 32404-014 )
Fetal bovine serum (Life Technologies, catalog number: 12483-020 )
ACK (Ammonium-chloride-potassium) lysing buffer (Lonza, catalog number: 10-548E )
SYTOX Green (Life Technologies, InvitrogenTM, catalog number: S7020 )
Equipment
Glass Pasteur pipets (Iwaki brand, Asahi Techno Glass Corporation)
96-well plates (TPP Techno Plastic Products AG)
CO2 Incubator (SANYO)
Fluorescence microscopy (Olympus, model: IX71 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Tanaka, K., Shimura, T., Toiyama, Y., Okugawa, Y., Inoue, Y., Araki, T., Mohri, Y., Mizoguchi, A. and Kusunoki, M. (2015). Visualization of ex vivo Neutrophil Extracellular Traps by Fluorescence Microscopy. Bio-protocol 5(15): e1550. DOI: 10.21769/BioProtoc.1550.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Neutrophil
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,551
|
https://bio-protocol.org/exchange/protocoldetail?id=1551&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of HBV C Protein Phosphorylation in the Cell
JJ Jaesung Jung
Kyongmin Kim
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1551 Views: 7736
Reviewed by: Smita NairVarpu Marjomaki
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Among the seven serines and one threonine in the carboxyl-terminus of HBV C protein, all but one (serine 183) appear in the context of RxxS/T consensus phosphoacceptor motifs and also overlap with other consensus motifs, such as S/TP, RS, SPRRR, RRRS/T, or RRxS/T, suggesting that various cellular kinases phosphorylate these residues. To determine whether threonine and/or serine (serines 157, 164, 170, 172, 178, and 180, and threonine 162, adw subtype) of HBV C protein are indeed phosphoacceptor residues in cells, Huh7 were transfected with a series of C-protein-expressing mutants, labeled with 32P-orthophosphate for 14 h, and then lysed. The 32Pi-labeled lysates were immunoprecipitated with anti-HBc antibody, and the 32Pi-labeled immunoprecipitated C proteins were detected by autoradiography.
Materials and Reagents
Huh7 hepatoma cells (Japanese Collection of Research Bioresources Cell Bank, catalog number: JCRB0403 )
Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies, Gibco®, catalog number: 12800-017 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 16000-044 )
Penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
Plasmid; HBV WT C protein (STSSSS) in plasmid HBV-P-def of pcDNA3 backbone, phosphoacceptor-site mutants (ATAAAA, AAAAAA, SSSSSS, and ASAAAA) in plasmid HBV-P-def in pcDNA3 backbone, pcDNA3-GFP
Polyethylenimine (Polysciences, catalog number: 23966 )
Opti-MEM (Life Technologies, Gibco®, catalog number: 31985-062 )
OptiMEM (Life Technologies, Gibco®, catalog number: 31985-070 )
Dialyzed FBS (Life Technologies, Gibco®, catalog number: 26400044 )
1 mCi orthophosphate [32Pi] (PerkinElmer Inc., catalog number: NEX053 )
Polyclonal rabbit anti-HBc antibody (home-made, Jung et al., 2012)
Protein A/G Plus agarose beads (Calbiochem®, catalog number: IP05 )
Tris-HCl (pH 8.5) (Sigma-Aldrich, catalog number: T6066 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
Nonidet P-40 (Sigma-Aldrich, catalog number: CA630 )
NaF (Sigma-Aldrich, catalog number: 201154 )
β-glycerophosphate (USB, catalog number: 155-56-2 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: s6508 )
Protease inhibitors (Calbiochem®, catalog number: 535142 )
Tris-HCl (pH 6.8) (Sigma-Aldrich, catalog number: T6066)
SDS (Sigma-Aldrich, catalog number: L-3771 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Bromophenol blue (Sigma-Aldrich, catalog number: 114391 )
Glycerol (USB, catalog number: 16374 )
Lysis buffer (see Recipes)
2x sample buffer (see Recipes)
Equipment
10-cm dishes (Corning Incorporated, catalog number: 430167 )
PVDF membranes (Bio-Rad Laboratories, AbD Serotec®, catalog number: 162-0177 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Jung, J. and Kim, K. (2015). Detection of HBV C Protein Phosphorylation in the Cell. Bio-protocol 5(15): e1551. DOI: 10.21769/BioProtoc.1551.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,552
|
https://bio-protocol.org/exchange/protocoldetail?id=1552&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Primer Extension Analysis of HBV DNA with Strand-Specific Primers
JJ Jaesung Jung
Kyongmin Kim
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1552 Views: 7632
Reviewed by: Smita NairVarpu Marjomaki
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
We performed primer extension assay to determine which steps of HBV DNA synthesis (i.e., minus- and plus-strand DNA synthesis and circularization of RC DNA) are affected by phosphoacceptor site mutations in C protein. In these experiments, we used several specific oligonucleotide primers. For quantitation, the level of extended DNA (ED) was normalized to the level of a single internal standard (IS) DNA.
Materials and Reagents
Huh7 hepatoma cells (Japanese Collection of Research Bioresources Cell Bank, catalog number: JCRB0403 )
Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies, Gibco®, catalog number: 12800-017 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 16000-044 )
Penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
OptiMEM (Life Technologies, Gibco®, catalog number: 31985-062 )
500 μl Opti-MEM (Life Technologies, Gibco®, catalog number: 31985-062 )
PEG (USB, catalog number: 19959 )
NaCl (Sigma-Aldrich, catalog number: S3014 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
Polyethylenimine (Polysciences, catalog number: 23966 )
Vent Exo (-) polymerase (New England Biolabs, catalog number: M0257S )
Micrococcal nuclease 1 μl (45 unit/μl) (Worthington Biochemical, I.U.B.: 3.1.31.1, catalog number: LS004798 )
γ -32P-ATP (PerkinElmer Inc., catalog number: NEG035C )
T4 polynucleotide kinase (New England Biolabs, catalog number: M0201s )
Internal standard (IS) DNA (from HBV WT DNA Sac II/Xho I digested fragment) 1ng/1μl
2.5 mM dNTP mixture (Takara Bio Company, catalog number: BH7901 )
RNase A (Fermentas, catalog number: EN05331 )
Tris-HCl (pH 8.8) (Sigma-Aldrich, catalog number: T6066 )
(NH4)2SO4 (Sigma-Aldrich, catalog number: T6066)
KCl (Sigma-Aldrich, catalog number: P9541 )
MgSO4 (Sigma-Aldrich, catalog number: 230391 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Polyacrylamide (SERVA Electrophoresis GmbH, catalog number: 10687 )
UREA (Duksan Hi-Metal, catalog number: CAS 57-13-6 )
APS(Sigma-Aldrich, catalog number: A3678 )
TEMED (Sigma-Aldrich, catalog number: T9281 )
Boric Acid(Sigma-Aldrich, catalog number: B0394 )
EDTA (Sigma-Aldrich, catalog number: E5134)
1x DNA-containing reaction buffer (see Recipes)
5% polyacrylamide gel (see Recipes)
5x TBE (see Recipes)
Equipment
10 cm dishes (Corning Incorporated, catalog number: 430167 )
Software
Fujifilm Image Gauge software (version 4.0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > DNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,553
|
https://bio-protocol.org/exchange/protocoldetail?id=1553&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA in situ Hybridizations for VEGFA Gene Locus (6p12) in Human Tumor Tissue
MA Mariacarla Andreozzi
LQ Luca Quagliata
KB Katharina Burmeister
LA Leila Arabi
SS Sandra Schneider
LT Luigi Tornillo
LT Luigi Terracciano
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1553 Views: 8802
Edited by: HongLok Lung
Reviewed by: Martin V KolevOmar Akil
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Over the last decades numerous regulators of angiogenesis have been identified and characterized. Among the others the vascular endothelial growth factor (VEGFA) appears undoubtedly important in several pathophysiological processes. Moreover, VEGFA represents one of the most attractive targets of anticancer therapy, given its major role in the growth and development of different tumor types. Here we describe a method to detect the copy number variation (CNV) status of the VEGFA gene by fluorescence in situ hybridization (FISH). FISH analysis is a reliable method for investigating VEGFA amplification or increased gene copy number and may represent an alternative method to immunohistochemical analysis for investigating the deregulation of VEGFA expression levels.
Keywords: VEGFA TMA FISH 6p12 CNV
Materials and Reagents
BAC clone No. RPCIB753M0921Q (GenomeCUBE)
LB medium (Sigma-Aldrich, catalog number: L3522-250G )
Large-construct kit (QIAGEN, catalog number: 12462 )
SP6 (EuroFins MGW Operon LLC A Eurofins Genomics Company, catalog number: SP050-1 ) and T7 (EuroFins MGW Operon LLC A Eurofins Genomics Company, catalog number: SP401 ) primers
AluI restriction enzyme (Life Technologies, InvitrogenTM, catalog number: 45200-029 )
Cy3-dUTP (GE Healthcare Dharmacon, catalog number: 45-000-738 )
BioPrime array CGH kit (module) (Life Technologies, InvitrogenTM, catalog number: 18095-012 ) (it includes 2.5 Random primers solution, 10x dUTP nucleotide mix, Exo-Klenow fragment)
Amicon Ultra-0.5 centrifugal filter unit with Ultracel-30 membrane (Merck KGaA, catalog number: UFC503096 )
Human Cot-1 DNA (Life Technologies, InvitrogenTM, catalog number: 15279-011 )
DAPI solution (1 µg/ml) (Abbott Laboratories, catalog number: 06J49-001 )
Spectrum Green-labeled Chr6 centromeric probe (CEP6) and hybridization buffer (Abbott Laboratories, catalog number: 06J37-016 and 07J36-001 )
Micron-centrifugal filters (Merck KGaA, catalog number: MRCF0R030 )
TE Buffer, 1x Solution 500 ml (USB, catalog number: 75893 )
20x SSC (Abbott Laboratories, catalog number: 02J10-032 )
0.3 % NP40 (Abbott Laboratories, catalog number: 07J05-001 )
Pretreatment reagent VP 2000 (Abbott Laboratories, catalog number: 02J06-030 )
Protease 1 (250 mg) (Abbott Laboratories, catalog number: 02J08-032 )
Ethanol (Sigma- Aldrich, catalog number: 0 2860 )
Rubber cement (Carfa AG, catalog number: 00494 )
Protease 1 (250 mg in 500 ml protease buffer) (Sauter et al., 1995)
Wash buffer (0.4 SSC + 0.3% NP40-pH 7-7.5) (Sauter et al., 1995)
Equipment
Incubator for slides (Memmert GmbH + Co.KG, Mode: ll IPP 300 )
Pipette (Eppendorf)
Nanodrop spectrophotometer assay (Thermo Fisher Scientific, model: NanoDrop 2000 )
Slide (Thermo Fisher Scientific, catalog number: No. 10143352 )
Cover slide (Biosystem 24 x 50 mm, catalog number: 14071135638 and R. Langenbrinck 21 x 26 mm, catalog number: 01-2126 )
Hotplate for denaturation (Medax GmbH & Co.KG, catalog number: 12895 )
Zeiss fluorescence microscope using a 63x objective (Carl Zeiss AG, model: Axioskop 40 )
AxioVision software (Carl Zeiss AG, model: SE64 Rel.4.9 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Andreozzi, M., Quagliata, L., Burmeister, K., Arabi, L., Schneider, S., Tornillo, L. and Terracciano, L. (2015). DNA in situ Hybridizations for VEGFA Gene Locus (6p12) in Human Tumor Tissue. Bio-protocol 5(15): e1553. DOI: 10.21769/BioProtoc.1553.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Genetics
Cell Biology > Cell staining > Nucleic acid
Molecular Biology > DNA > DNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,554
|
https://bio-protocol.org/exchange/protocoldetail?id=1554&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evaluation of Nodulation Speed by Sinorhizobium Strains
MN Matthew S. Nelson
CC Chan Lan Chun
Michael J. Sadowksy
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1554 Views: 8740
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Rhizobia interact symbiotically with legumes to form root nodules, where by rhizobia fix atmospheric dinitrogen into ammonia in exchange for carbon produced via photosynthesis. The symbiotic interaction is agriculturally important by reducing the need for fertilizer containing nitrogen. The root and stem nodule bacteria commonly include bacteria in the genera Rhizobium, Mesorhizobium, Sinorhizobium (Ensifer), and Bradyrhizobium, although other genera of bacteria have now been shown to form root nodule symbioses with several legume species (Weir, 2012). Different rhizobial strains form different numbers of nodules on specific legume plant varieties (or cultivars), and the nitrogen fixing effectiveness of each rhizobial strain, its ability to fix nitrogen and transfer it to the plant, is also highly variable (Toro, 1996). Some native rhizobia are ineffective at fixing nitrogen yet form a majority of nodules in filed grown plants. This is referred to as the competition for nodulation problem (Triplett and Sadowsky, 1992). Competition studies are not feasible when evaluating a large number of different native strains. However, nodulation speed of individual strains correlates well with overall competiveness and can be used to identify native strains that overcome the competition problem (De Oliveira and Graham, 1990; Bhuvaneswari et al., 1980).
Materials and Reagents
Sinorhizobium meliloti strains
Medicago truncatula seeds
Sodium chloride (MACRON CHEMICAL, catalog number: 7581-06 )
Sodium hypochlorite
Ethanol (Decon Labs, catalog number: 2701 )
CYG growth pouches (Mega International Inc.)
Concentrated sulfuric acid (Thermo Fisher Scientific, catalog number: A300-212 )
Tryptone (BD Bioscience, catalog number: 211699 )
Yeast extract (Thermo Fisher Scientific, catalog number: DF0127071 )
CaCl2.6 H2O (Thermo Fisher Scientific, catalog number: C79-3 )
Agar (Sigma-Aldrich, catalog number: A1296 )
CaCl2.6 H2O (Thermo Fisher Scientific, catalog number: C79-3 )
MgSO4.7 H2O (JT Baker, catalog number: 2504 )
KH2PO4 (JT Baker, catalog number: 3246-01 )
Na2HPO4.2 H2O (Sigma-Aldrich, catalog number: S9763 )
Fe-citrate (Sigma-Aldrich, catalog number: F3388 )
MnCl2.4 H2O (Thermo Fisher Scientific, catalog number: M33-500 )
CuSo4.5 H2O (Thermo Fisher Scientific, catalog number: C-493 )
ZnCl2 (JT Baker, catalog number: 4326-01 )
H3BO3 (Mallinckrodt, catalog number: 2549 )
Na2MoO4.2 H2O (Sigma-Aldrich, catalog number: S6646 )
TY medium (see Recipes)
Fahraeus medium (see Recipes)
Equipment
P5 filter paper (Thermo Fisher Scientific, catalog number: 09-801C )
Aluminum foil
Plant growth chamber
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Nelson, M. S., Chun, C. L. and Sadowksy, M. J. (2015). Evaluation of Nodulation Speed by Sinorhizobium Strains. Bio-protocol 5(15): e1554. DOI: 10.21769/BioProtoc.1554.
Download Citation in RIS Format
Category
Microbiology > in vivo model > Bacterium
Plant Science > Plant physiology > Nodulation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,555
|
https://bio-protocol.org/exchange/protocoldetail?id=1555&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Evaluation of Competitive Nodulation among Different Sinorhizobium Strains
CC Chan Lan Chun
MN Matthew S. Nelson
Michael J. Sadowksy
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1555 Views: 7080
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Legumes play a vital role in global food supply because they are uniquely capable of fixing atmospheric nitrogen (N) through symbioses with root and stem nodule bacteria, collectively called the rhizobia. These commonly include bacteria in the genera Rhizobium, Mesorhizobium, Sinorhizobium (Ensifer), and Bradyrhizobium, although other genera of bacteria have now been shown to form root nodule symbioses with several legume species (Weir, 2012). The symbiotic interaction is important for agricultural productivity, especially in less developed countries where nitrogen fertilizer is expensive. However, nodulation ability and competitiveness have practical importance in agricultural production, because the inoculation of efficient rhizobia is often unsuccessful, due to large part to the presence of competitive populations of ineffective indigenous rhizobia in soils (Toro, 1996; Triplett and Sadowsky, 1992). This protocol allows one us to quantitatively evaluate the relative nodulation competitiveness of Sinorhizobium strains.
Materials and Reagents
Two Sinorhizobium meliloti (S. medicae) strains (strain A and B) with different intrinsic antibiotic resistance (e.g. Strain A is neomycin sensitive and strain B is neomycin resistant at a certain concentration of neomycin)
Note: Alternately, strains can be differentiated by using gfp and rfp, antisera, or other marker genes (Triplett and Sadowsky, 1992).
Medicago truncatula seeds
Sodium hypochlorite
Sodium chloride (Macron Chemical, catalog number: 7581-06 )
Concentrated sulfuric acid (Thermo Fisher Scientific, catalog number: A300-212 )
Ethanol (Decon Labs, catalog number: 2701 )
Antibiotics
Sunshine mix #5:Turface mixture at 1: 1 ratio (SunGro Horticulture)
Turface MVP (Profile Product LLC)
Tryptone (BD, catalog number: 211699 )
Yeast extract (Thermo Fisher Scientific, catalog number: DF0127071 )
CaCl2.2H2O (Thermo Fisher Scientific, catalog number: C79-3 )
Agar (Sigma-Aldrich, catalog number: A1296 )
KNO3 (Thermo Fisher Scientific, catalog number: P263-500 )
Ca(NO3)2.4H2O (Acros, catalog number: 423535000 )
Ca(H2PO4)2 (Spectrum, catalog number: C1145 )
MgSO4.7H2O (J.T.Baker®, catalog number: 2504 )
Fe-EDTA (Sigma-Aldrich, catalog number: E6760-5000 )
MnCl2 (Thermo Fisher Scientific, catalog number: M33-500 )
H3BO3 (Mallinckrodt, catalog number: 2549 )
ZnSO4.7H2O (J.T.Baker®, catalog number: 4382 )
NaMoO4 (Sigma-Aldrich, catalog number: S6646 )
CuSO4.5H2O (Thermo Fisher Scientific, catalog number: C-493 )
K2SO4 (EMD Millipore, catalog number: PX1595-1 )
CaSO4.2H2O (Sigma-Aldrich, catalog number: C3771 )
Paraffin (Thermo Fisher Scientific, catalog number: P-21 hard )
TY medium (see Recipes)
N2-free nutrient solution (see Recipes)
Sterile paraffin coated sands (see Recipes)
Equipment
MAGENTA® vessel GA-7 (Sigma-Aldrich, catalog number: V8505 ) and cotton rope (diameter ¼ inch) for Leonard jar assemblies
Filter paper P5 (Thermo Fisher Scientific, catalog number: 09-801C )
Plant growth chamber (TC2, Environmental Growth Chambers as an example but other plant growth chambers can be used)
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Chun, C. L., Nelson, M. S. and Sadowksy, M. J. (2015). Quantitative Evaluation of Competitive Nodulation among Different Sinorhizobium Strains. Bio-protocol 5(15): e1555. DOI: 10.21769/BioProtoc.1555.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial cell biology > Cell isolation and culture
Plant Science > Plant metabolism > Nitrogen
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,556
|
https://bio-protocol.org/exchange/protocoldetail?id=1556&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tissue Culturing and Harvesting of Protonemata from the Moss Physcomitrella patens
XW Xiaoqin Wang
YH Yikun He
Published: Vol 5, Iss 15, Aug 5, 2015
DOI: 10.21769/BioProtoc.1556 Views: 9891
Edited by: Arsalan Daudi
Reviewed by: Tie Liu
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Moss spores germinate to form an alga-like filamentous structure called the protonemata. Protonemata are the earliest stage (the haploid phase) of a bryophyte life cycle and eventually give rise to a mature gametophyte. Protonemata of the moss Physcomitrella patens (P. patens) are important not only in their life cycle, but also for research. Protonemata are used for various things such as RNA/DNA extractions and protoplast isolation. We can obtain high yield of intact protoplasts from protonemata. Protoplasts can be used to study a variety of cellular processes, such as subcellular localization of proteins, isolation and analyses of intact organelles and DNA transformation. In addition, the completed sequence of the P. patens genome facilitates the use of genetic and molecular approaches to identify genes and the ability of the moss to undergo homologous recombination at appreciable frequency offers a powerful way to determine gene function. Therefore, culture of P. patens protonemata is critical.
Materials and Reagents
A vigorously growing tissue which is about 10 d old (the earliest stage of gametophyte; Physcomitrella patens subspecies patens (Gransden) was used as the tissue and it was obtained from Ralph S. Quatrano (Department of Biology, Washington University in St. Louis, MO 63130, USA)
200 ml sterile distilled water
70% alcohol in a spray bottle (for surface sterilization)
Growth medium (see Recipes)
Equipment
1 L flask in which to prepare the growth medium
Sterile petri dishes (90-mm)
Sterile cellophane discs
Sterile tweezers
Sterile test tubes (25 x 150 mm)
Micropore surgical tape
Sterile pipettes (1 ml)
Sterile tips (1 ml)
Dispensing instrument (e.g., IKA T 10 basic ULTRA-TURRAX®)
Laminar flow cabinet
Autoclave (e.g., Sanyo, model: MLS-3780 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Wang, X. and He, Y. (2015). Tissue Culturing and Harvesting of Protonemata from the Moss Physcomitrella patens. Bio-protocol 5(15): e1556. DOI: 10.21769/BioProtoc.1556.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant physiology > Plant growth
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,557
|
https://bio-protocol.org/exchange/protocoldetail?id=1557&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adoptive Transfer of Myeloid-Derived Suppressor Cells and T Cells in a Prostate Cancer Model
LY Libo Yan
Yan Xu
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1557 Views: 8793
Edited by: HongLok Lung
Reviewed by: Salma Hasan
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
The adoptive transfer of immune cells for cancer, chronic infection, and autoimmunity is an emerging field that has shown promise in recent trials. The transgenic adenocarcinoma mouse prostate (TRAMP) is a classical mouse model of prostate cancer (PCa) and TRAMP cell lines were derived from a TRAMP mouse tumor. TRAMP-C2 is tumorigenic when (subcutaneously) s.c. grafted into syngeneic C57BL/6 host mice (Foster et al., 1997). This protocol will describe the adoptive transfer of purified CD11b+Gr1+ double positive (DP) myeloid-derived suppressor cells (MDSC) and CD3+ T cells in the TRAMP-C2 prostate cancer mouse model in order to establish the intrinsic functionality of these immune cells and to determine their role in tumorigenesis in vivo (Yan et al., 2014).
Materials and Reagents
RPMI 1640 (Life Technologies, Gibco®, catalog number: 22400-089 )
Trypan blue 0.4% solution (Lonza, catalog number: 17-942E )
Myeloid-Derived Suppressor Cell Isolation Kit (mouse) (Miltenyi Biotec, catalog number: 130-094-538 )
Pan T Cell Isolation Kit II, mouse (Miltenyi Biotec, catalog number: 130-095-130 )
Antibodies for flow cytometry: Ly-6G-FITC (Gr1, RB6-8C5), CD11b-PE (M1/70), and CD3-FITC (17A2) (Biolegend, catalog numbers: 108405 , 01207 , and 100203 respectively)
MACS® BSA Stock Solution (Miltenyi Biotec, catalog number: 130-091-376 )
AutoMACS® Rinsing Solution (Miltenyi Biotec, catalog number: 130-091-222 )
Phosphate buffer saline (PBS) (see Recipes)
Sterile red blood cell lysis buffer (RBC lysis buffer) (see Recipes)
MACS buffer (see Recipes)
Equipment
LS column (Miltenyi Biotec, catalog number: 130-042-401 )
MidiMACS Separator (Miltenyi Biotec, catalog number: 130-042-302 )
MACS MultiStand (Miltenyi Biotec, catalog number: 130-042-303 )
Wide field microscope (Nikon Diaphot Phase Contrast Inverted Laboratory Microscope, catalog number: 805426 )
Sterile forceps and scissors
Flow cytometer
1 ml syringes (29 G) (BD Biosciences, catalog number: 329410 )
Sterile Cell strainers 70 μm (BD Biosciences, catalog number: 352350 )
15 ml conical tubes (BD Biosciences, catalog number: 352095 )
Tabletop centifuge
Cell culture centrifuge
Sterile culture hood
Hemocytometer
60 mm cell culture dish
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Yan, L. and Xu, Y. (2015). Adoptive Transfer of Myeloid-Derived Suppressor Cells and T Cells in a Prostate Cancer Model. Bio-protocol 5(16): e1557. DOI: 10.21769/BioProtoc.1557.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Animal models
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,558
|
https://bio-protocol.org/exchange/protocoldetail?id=1558&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
FACS-based Satellite Cell Isolation From Mouse Hind Limb Muscles
Anastasia Gromova
Matthew T Tierney
Alessandra Sacco
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1558 Views: 12362
Reviewed by: Jalaj Gupta
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Fluorescence Activated Cell Sorting (FACS) is a sensitive and accurate method for purifying satellite cells, or muscle stem cells, from adult mouse skeletal muscle (Liu et al., 2013; Sacco et al., 2008; Tierney et al., 2014). Mechanical and enzymatic digestion of hind limb muscles releases mononuclear muscle cells into suspension. This protocol employs fractionation strategies to deplete cells expressing the cell surface markers CD45, CD31, CD11b and Ly-6A/E-Sca1, both by magnetic separation and FACS-based exclusion, and positively select for cells expressing a7-integrin and CD34. This enables the researcher to successfully enrich satellite cells that uniformly express the paired-box transcription factor Pax7 and are capable of long-term self-renewal, skeletal muscle repair and muscle stem cell pool repopulation.
Materials and Reagents
Laboratory mice, C57BL/6 strain, 2-4 months of age
Note: All protocols have been approved by the Sanford-Burnham Medical Research Institute Animal Care and Use Committee.
Isoflurane (Santa Cruz Biotechnology, catalog number: sc-363629Rx )
Ham’s F-10 media (Life Technologies, Gibco®, catalog number: 11550-043 )
Horse serum (Life Technologies, Gibco®, catalog number: 16050-122 )
Collagenase type II (Life Technologies, Gibco®, catalog number: 17101-015 )
Dispase II (Roche Diagnostics, catalog number: 04942078001 )
Phosphate buffered saline (PBS) (pH 7.4) (Life Technologies, catalog number: 10010-023 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
Goat serum (Life Technologies, Gibco®, catalog number: 16210-072 )
Antibodies
Biotin CD45 (clone 30-F11, 0.5 mg/ml) (BD Biosciences, catalog number: 553078 )
Biotin CD31 (clone 390, 0.5 mg/ml) (eBioscience, catalog number: 13-0311-85 )
Biotin CD11b (clone M1/70, 0.5 mg/ml) (BD Biosciences, catalog number: 553309 )
Biotin Ly-6A/E-Sca1 (clone E13-161.7, 0.5 mg/ml) (BD Biosciences, catalog number: 553334 )
7-integrin/PE or FITC (clone R2F2, 1 mg/ml) (AbLabs, catalog number: 53-0010-01 )
CD34/Alexa Fluor 647 (clone RAM34, 0.2 mg/ml) (BD Biosciences, catalog number: 560230 )
Streptavidin APC-Cy7 (0.2 mg/ml) (BD Biosciences, catalog number: 554063 )
Streptavidin microbeads (Miltenyi Biotec, catalog number: 130-048-101 )
FxCycle Violet stain (DAPI, 0.5 mg/ml) (Life Technologies, InvitrogenTM, catalog number: F10347 )
Media (see Recipes)
Stock collagenase type II solution (see Recipes)
Digestion media I (see Recipes)
Digestion media II (see Recipes)
FACS buffer (see Recipes)
Equipment
Isoflurane vaporizer, supply gas (oxygen), flowmeter and induction chamber
TC-treated culture dish (10 cm) (Corning Incorporated, catalog number: 430167 )
Polypropylene centrifuge tubes, sterile (50 ml) (BD Biosciences, catalog number: 352098 )
Polypropylene centrifuge tubes, sterile (15 ml) (BD Biosciences, catalog number: 352096 )
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Cell strainers (70 μm) (Thermo Fisher Scientific, catalog number: 22363548 )
Syringes with 20G x 1’’ needles (BD Biosciences, catalog number: 309644 )
5 ml FACS round-bottom tubes (BD Biosciences, Falcon®, catalog number: 352063 )
Tools for muscle dissection and mincing: Razor blades and/or small scissors, forceps
Tissue culture laminar flow hood
Shaking water bath
Standard temperature-controlled table-top centrifuge
MACS magnetic separator and multi-stand (Miltenyi Biotec, catalog number: 130-042-302 and 130-042-303 )
Flow cytometer [, (FACSAria cell sorter equipped with 488, 405 and 633 nm lasers) (BD Biosciences)
Note: Color combinations can be adjusted to match the laser combinations available.
Software
FlowJo software (Tree Star, optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Gromova, A., Tierney, M. T. and Sacco, A. (2015). FACS-based Satellite Cell Isolation From Mouse Hind Limb Muscles. Bio-protocol 5(16): e1558. DOI: 10.21769/BioProtoc.1558.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Muscle stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,559
|
https://bio-protocol.org/exchange/protocoldetail?id=1559&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
High-throughput Quantification of Ammonium Content in Arabidopsis
Izargi Vega-Mas
Asier Sarasketa
DM Daniel Marino
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1559 Views: 10586
Edited by: Arsalan Daudi
Reviewed by: Samik BhattacharyaSaminathan Thangasamy
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
This protocol is a simple colorimetric assay for internal ammonium quantification in aqueous extracts from plant tissues. The method is based on the phenol hypochlorite assay (Berthelot reaction):
NH4+ + hypochlorite + OH- + phenol → indophenol
The oxidation of indophenol caused by phenol oxidation is a blue dye that is quantified at 635 nm in a spectrophotometer. Per ammonium molecule one molecule of indophenol is formed. The protocol described here is for Arabidopsis thaliana (A. thaliana) leaves and roots, although it is also valid for other plants species.
Keywords: Ammonium Indophenol blue Spectrophotometry Plant
Materials and Reagents
4-weak old A. thaliana leaves and roots
Ultrapure water (MilliQ) (EMD Millipore)
Ice
Liquid N2
4 mm diameter glass beads (Glaswarenfabrik Karl Hecht) (VWR International, catalog number: 201-0278 )
EVA Capband for capping 8 tubes (Micronic, catalog number: MP227B1 )
Flat bottom spectrophotometer microplates (Deltalab, catalog number: 900011.1 )
1.2 ml 96-well storage plate (Thermo Fisher Scientific, catalog number: AB-0564 )
Sodium phenolate or sodium phenoxide trihydrate (Sigma-Aldrich, catalog number: 318191 )
Sodium nitroprusside dihydrate (Sigma-Aldrich, catalog number: s0501 )
Commercial bleach or Sodium Hypochlorite solution 10% (Panreac Applichem, catalog number: 211921 )
Solution A (see Recipes)
Solution B (see Recipes)
Solution C (see Recipes)
10 mM NH4+ stock (for standard curve) (see Recipes)
Equipment
TissueLyser (Retsch, model: MM400 )
TissueLyser Adapter Set 2 x 96 (QIAGEN, catalog number: 69984 )
Plate centrifuge (Sigma, model: 2-16K )
Drying oven
Absorbance microplate reader (Biotek PowerWave X 340 Microplate Spectrophometer)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Vega-Mas, I., Sarasketa, A. and Marino, D. (2015). High-throughput Quantification of Ammonium Content in Arabidopsis. Bio-protocol 5(16): e1559. DOI: 10.21769/BioProtoc.1559.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Nitrogen
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
156
|
https://bio-protocol.org/exchange/protocoldetail?id=156&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Naïve T Lymphocyte Infection by Murine Stem Cell Virus (MSCV) Protocol
Jia Li
Published: Nov 20, 2011
DOI: 10.21769/BioProtoc.156 Views: 12583
Download PDF
Ask a question
Favorite
Cited by
Abstract
This assay can be used for studying genes related to lymphocyte proliferation and differentiation in vitro. Stimulating lymphocytes to proliferate is important for the infection efficiency of MSCV. After overnight culture, if naïve cells proliferate extensively, the following spin infection will have high efficiency. After infection, cells are ready for the following assay as they will be undergoing proliferation or differentiation.
Materials and Reagents
Mouse
Fetal bovine serum (FBS)
Anti-CD3 and Anti-CD28 antibody (Ab) (Biolegend, catalog number: 100302 , 102102 )
IL-2 (R&D systems, catalog number: 402-ML-020 )
Polybrene (Hexadimethrine bromide) (Sigma-Aldrich, catalog number: H9268 )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 900-108 )
Penicillin/streptomycin solution (Life Technologies, Gibco®, catalog number: 15140-122 )
2-mercaptoethanol (Life Technologies, InvitrogenTM, catalog number: 21985-023 )
PBS solution (1x phosphate buffered saline) (Life Technologies, Gibco®, catalog number: 10010-023 )
MSCV (Clontech, catalog number: 634401 )
RPMI-1640 medium (Life Technologies, Gibco®, catalog number: 11875-093 ) (see Recipes)
Equipment
Centrifuges
24-well plate
Water bath
Parafilm
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,560
|
https://bio-protocol.org/exchange/protocoldetail?id=1560&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Colorimetric Method to Measure Plant Glutamate Dehydrogenase Enzyme Activity
Asier Sarasketa
Izargi Vega-Mas
DM Daniel Marino
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1560 Views: 11230
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Glutamate dehydrogenase (GDH) is an NAD(H) dependent enzyme that catalyzes, in vitro, the reversible amination of glutamate. Here we describe how to determine spectrophotometrically GDH activity monitoring NADH evolution. This protocol is described here for Arabidopsis thaliana (A. thaliana) although it is also valid for other plant species. GDH protein is a hexamer composed, in the case of Arabidopsis, of a combination of GDHα, GDHβ and GDHγ subunits. Every combination of subunits is possible; however, it is still barely known whether different combinations affect the enzymatic properties of the hexamers. In other species, hexamers are a combination of GDHα and GDHβ but it cannot be discarded the existence of other genes since for instance GDHγ subunit in Arabidopsis was described in Fontaine et al. (2012).
Glutamate + NAD+ + H+ → 2-Oxoglutarate + NADH + NH4+
Keywords: Glutamate dehydrogenase Enzyme activity Spectrophotometry
Materials and Reagents
4-weak old Arabidopsis thaliana leaves and roots
Ultrapure water
Liquid N2
Ice
Flat bottom microplates (Deltalab, catalog number: 900011.1 )
4 mm diameter glass beads (Glaswarenfabrik Karl Hecht) (VWR International, catalog number: 201-0278 )
1.2 ml deep well storage plate (Thermo Fisher Scientific, catalog number: AB-0564 )
EVA Capband for capping 8 tubes (Micronic, catalog number: MP227B1 )
Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, AbD Serotec®, catalog number: 500-006 )
NADH (Sigma-Aldrich, catalog number: 43420 )
PVPP (Sigma-Aldrich, catalog number: 77627 )
Glycerol (EMD Millipore Corporation, catalog number: 104092 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Triton X-100 (Sigma-Aldrich, catalog number: T-9284 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
KOH (EMD Millipore Corporation, catalog number: 105029 )
MnCl2 (Sigma-Aldrich, catalog number: M8266 )
EDTA (Sigma-Aldrich, catalog number: ED255 )
EGTA (Sigma-Aldrich, catalog number: E4378 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Delta-aminocaproic acid (Sigma-Aldrich, catalog number: A2504 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
Tricine (Sigma-Aldrich, catalog number: T0377 )
CaCl2 (Panreac Applichem, catalog number: 131232 )
2-Oxogutarate (Merck KGaA, catalog number: 5194 )
(NH4)2SO4 (Panreac Applichem, catalog number: 131140 )
Extraction buffer (see Recipes)
Reaction buffer (see Recipes)
Bradford solution (see Recipes)
Equipment
TissueLyser (RETSCH, model: MM400 )
Plate centrifuge (Sigma, model: 2-16K )
Absorbance microplate reader (Biotek Powerwave X 384 Microplate spectrophotometer)
TissueLyser Adapter Set 2 x 96 (QIAGEN, catalog number: 69984 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Sarasketa, A., Vega-Mas, I. and Marino, D. (2015). In vitro Colorimetric Method to Measure Plant Glutamate Dehydrogenase Enzyme Activity. Bio-protocol 5(16): e1560. DOI: 10.21769/BioProtoc.1560.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant metabolism > Nitrogen
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,561
|
https://bio-protocol.org/exchange/protocoldetail?id=1561&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNase H Polymerase-independent Cleavage Assay for Evaluation of RNase H Activity of Reverse Transcriptase Enzymes
Angela Corona
ET Enzo Tramontano
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1561 Views: 12630
Reviewed by: Modesto Redrejo-RodriguezToshitsugu Fujita
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
The ribonuclease H (RNase H) polymerase-independent cleavage assay allows detection and quantification of RNase H activity of reverse transcriptase (RT) enzymes with a hybrid substrate formed by a fluorescein labeled RNA annealed with Dabcyl DNA (Figure 1). Here we describe a protocol that we have adapted for HIV-1 RT expressed from a p(His)6-tagged p66/p51 HIV-1HXB2 RT-prot plasmid and for RT of the prototype foamy virus (PFV RT).
Figure 1. Scheme of the principle of the experiment. The RNA substrate (blue) labeled with the fluorophore fluorescein (F, yellow) is annealed with complementary DNA strand (green) labeled with a quencher molecule Dabcyl (D, red). Panel A. In the intact substrate the quencher is so close to the fluorophore that it can quench the fluorescence emitted after excitation. Panel B. After the RNA substrate is cut by the RNase H a few ribonucleotides oligo labeled with the fluorescein is free to escape from the quencher, and to release fluorescence after excitation.
Keywords: RNase H assay Drug Screening Ribonuclease activity RNase H inhibitors HIV-1 RT RNase H
Materials and Reagents
Reverse transcriptase enzyme (HIV-1 RT or PFV RT). HIV-1 RT expressed and purified from p(His)6-tagged p66/p51 HIV-1HXB2 RT-prot plasmid (Corona et al., 2014a), PFV RT provided by Birgitta M. Wöhrl from Universität Bayreuth, Lehrstuhl Biopolymere, Bayreuth, Germany (Corona et al., 2014b).
Distilled water (DNase/RNase-free UltraPureTM) (Life Technologies, InvitrogenTM, catalog number: 10977-015 )
5'-GAUCUGAGCCUGGGAGCU-FLUORESCEIN-3' (HPLC, dry, QC: Mass Check) (Metabion)
5'-DABCYL-AGCTCCCAGGCTCAGATC-3' (HPLC, dry, QC: Mass Check) (Metabion)
1 M KCl solution (Sigma-Aldrich, catalog number: 60142-100ML-F )
1 M MgCl2 solution (Sigma-Aldrich, catalog number: 63069-100ML )
1 M Dithiothreitol (DTT) solution (Life Technologies, InvitrogenTM, catalog number: P2375 )
1 M Tris-HCl Solution (pH 7.8) prepared from Trizma base® (Sigma-Aldrich, catalog number 93352 )
1 M Tris-HCl Solution (pH 8.1) prepared from Trizma base® (Sigma-Aldrich, catalog number: 93352)
5 M NaCl solution (Life Technologies, InvitrogenTM, catalog number: AM9760G )
EDTA (0.5 M, pH 8.0) UltraPureTM (Life Technologies, InvitrogenTM, catalog number: 15575-020 )
Dimethyl sulfoxide (DMSO) >=99.5% (Sigma-Aldrich, catalog number: D5879-1 L )
Microcentrifuge tubes, extended capacity, volume 0.65 ml, graduated, siliconized polypropylene (Sigma-Aldrich, catalog number: T3406-250EA )
OPTIPLATE-96 F /50B (PerkinElmer, catalog number: 6005270 )
HIV-1 RT reaction mix (1.25x) (see Recipes)
PFV RT reaction mix (1.25x) (see Recipes)
Equipment
Thermal cycler
Refrigerated tabletop microcentrifuge
Sonicator Bath (Elma Ultrasonic bath Transonic T 310)
Vortex mixer
Multi Thermo-Shaker for microplates (Bionics)
Multilabel counter plate reader Victor 3 (PerkinElmer, model: 1420-051 ) equipped with filters for fluorescein fluorophore 490/528 nm (excitation/emission wavelength)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Corona, A. and Tramontano, E. (2015). RNase H Polymerase-independent Cleavage Assay for Evaluation of RNase H Activity of Reverse Transcriptase Enzymes. Bio-protocol 5(16): e1561. DOI: 10.21769/BioProtoc.1561.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antiviral assay
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,562
|
https://bio-protocol.org/exchange/protocoldetail?id=1562&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Glucosinolates Determination in Tissues of Horseradish Plant
Filomena Lelario
Susanna De Maria
Rosa Agneta
CM Christian Mӧllers
SB Sabino Aurelio Bufo
Anna Rita Rivelli
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1562 Views: 8112
Edited by: Arsalan Daudi
Reviewed by: Fernanda Salvato
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
Glucosinolates (GLS) are secondary metabolites mainly found in plants belonging to the Brassicaceae family, including also horseradish (Armoracia rusticana G. Gaertn., B. Mey. & Scherb), a popular spice with a characteristic pungent flavor due to the abundance of GLS. Such compounds exhibit antibacterial, antifungal, and insecticidal activities, as well as human health properties. Therefore, it is very important to have a full understanding of their levels and profiles in plants. However, the characterization of GLS from horseradish crude extracts is a tough task, due to the complexity of the vegetal matrix and the occurrence of many GLS in trace amounts. Here we describe two alternative effective and rapid methods for GLS characterization in horseradish plants: Liquid chromatography coupled to high resolution mass spectrometry (LC-MS) for determination of intact GLS and HPLC-UV for determination of desulfo-GLS.
Materials and Reagents
Horseradish tissue (hypogeous and epigeous portion) (see Note 1)
Methanol (MeOH) (LC/MS grade) (Carlo Erba Reagents, catalog number: 414831 )
Acetonitrile (ACN) (LC/MS grade) (Carlo Erba Reagents, catalog number: 412342 )
Ultrapure Milli-Q water
Liquid nitrogen
Sinigrin hydrate from horseradish (99%) (Sigma-Aldrich, catalog number: S1647 )
Rapeseed ERM certified Reference Material containing gluconapin, 4-hydroxyglucobrassicin, glucobrassicanapin, glucobrassicin and gluconaturtiin (Sigma-Aldrich, catalog number: ERMBC367 )
Glucoiberin (C2 Bioengineering, catalog number: 10-JS 12-05-02 )
Glucobarbarin (C2 Bioengineering, catalog number: 18-DM 19-10-99 )
Glucotrapeolin (C2 Bioengineering, catalog number: 16-PM 19-10-99 )
70% MeOH (see Recipes)
In addition only for intact GLS determination
Formic acid (gradient grade) (Sigma-Aldrich, catalog number: F0507 )
0.1% Formic acid (HCOOH) (see Recipes)
In addition only for desulfo-method
DEAE-Sephadex A-25 (formiate form) obtained by using DEAE-Sephadex A-25 (chloride form) (Sigma-Aldrich, catalog number: A25120 ) and imidazole (Sigma-Aldrich, catalog number: 56750 )
Sulfatase type H-1 (Sigma-Aldrich, catalog number: S-9626 )
Sulfatase type H-1 (1 to 2.5) (see Recipes)
DEAE-Sephadex A-25 (formiate form) (see Recipes)
Equipment
Freeze Dry Systems (e.g. Labconco, model: Freezone 4.5 )
Laboratory mill
Disposable 50 ml and 15 ml polypropylene tubes
2 ml sample vials
Water bath: beaker filled with water and placed on a heating device (electric hotplate or similar device).
Thermometer
Vortex mixer
Refrigerated centrifuge (50 ml tubes) (e.g. Heraeus, model: Varifuge F )
Glass Pasteur pipettes
0.22 µm nylon filter (Whatman)
HPLC system with a photodiode array detector (e.g. Agilent, model: Agilent 1200 HPLC Liquid Chromatrography System)
HPLC 2 ml glass vials (Phenomenex, model: AR1-3910-12 ) with caps (Phenomenex, model: AR0-8959-13-B )
Liquid chromatography (LC) coupled with electrospray ionization (ESI) and high resolution mass spectrometry (MS) (e.g. Thermo Fisher Scientific, model: LC-ESI-FTICR MS )
Intact glucosinolates Discovery C18 column, 250 x 4.6 mm, 5 µm particle size (pore size, 180Å) (Sigma-Aldrich, catalog number: 504971 ), with a Discovery C18 20 x 4 mm security guard cartridge (Sigma-Aldrich, catalog number: 505129 )
Desulfoglucosinolates (Nucleodur C18 column, 125 mm x 3 mm) (MACHEREY-NAGEL, catalog number: MN760051.30 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Lelario, F., De Maria, S., Agneta, R., Mӧllers, C., Bufo, S. A. and Rivelli, A. R. (2015). Glucosinolates Determination in Tissues of Horseradish Plant. Bio-protocol 5(16): e1562. DOI: 10.21769/BioProtoc.1562.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,563
|
https://bio-protocol.org/exchange/protocoldetail?id=1563&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adoptive Transfer of Memory B Cells
Griselda Zuccarino-Catania
MS Mark Shlomchik
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1563 Views: 10050
Reviewed by: Achille Broggi
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
The adoptive transfer of antigen-specific B cells into mice that cannot recognize that specific antigen has two main advantages. The first is determining exactly when the B cells were transferred and exposed to antigen. The second is that all B cells that can bind that antigen are the ones that were transferred; no new antigen-specific B cells will emerge from the bone marrow. Thus all B cells that were exposed to the antigen and still alive after at least 4 weeks (8 weeks or more is ideal), are memory B cells.
Splenic B cells from B1-8 mice were prepared with an EasySep Mouse B Cell Enrichment Kit according to the manufacturer’s protocol. Single-cell suspensions were transferred intravenously into tail veins of recipient mice. Approximately 1 million NP+ B cells were transferred per mouse. Approximately 12-24 h after transfer, mice were immunized intra-peritoneally with 50 µg of NP-CGG precipitated in alum.
Materials and Reagents
Mice
Any donor mice can be used, as long as the donor and recipients have the same background strain (i.e. BALB/C into BALB/c or Bl/6 into Bl/6) to prevent rejection issues. We selected transgenic donor mice that had an increased frequency of B cells specific for our antigen of interest, NP. This way we could be certain of the number of B cells specific for our antigen and these would be easy to identify by flow cytometry and elispot. However, wild-type mice will also respond to NP, just at a lower frequency.
B1.8+/-Jκ +/- BALB/c mice
Note: B1.8 KI BALB/c mice were generated as described (Sonoda et al., 1997) and maintained on the Jκ KO strain (Chen et al., 1993) to enrich the frequency of λ+ NP-specific B cells. B1-8 KI +/+ Jκ KO -/- mice were crossed to BALB/c mice from The Jackson Laboratory (Bar Harbor, ME) to generate B1.8+/-Jκ +/- BALB/c mice, which were used for naïve controls and for transfers of NP+ B cells used to generate MBCs.
AM14 Tg x Vκ8R KI BALB/c mice were generated as described (Shlomchik et al., 1993; Hannum et al., 1996; Prak and Weigert, 1995), which were used as recipient mice for primary immunization
Note: All mice were maintained under specific pathogen-free conditions. The Yale Institutional Animal Care and Use Committee approved all animal experiments.
Immunizations
For generating memory B cells in a primary response, mice were immunized intra-peritoneally with 50 µg of 4-hydroxy-3-nitrophenyl acetyl (NP)-Chicken Gamma Globulin (CGG) precipitated in alum. The ratio of NP to CGG ranged between 26 and 33. All mice were immunized at 6-12 week of age
Isolation of B cells from donor mice
2 pairs sterile scissor and forceps
Sterile frosted slides
Sterile Petri dishes
Autoclaved Pasteur pipettes
70% ethanol
Sterile ACK (RBC lysing buffer) (Lonza, catalog number: 10-548E )
100 µM filter (BD Biosciences, catalog number: 340615 )
Ice
Conical tubes (14 ml v-bottom) (BD Biosciences, Falcon®)
Falcon 14 ml polystyrene round-bottom tubes (BD Biosciences, catalog number: 352057 )
Trypan blue solution (0.4%) (Life Technologies, catalog number: 15250-061 )
EasySep™ Mouse B Cell Enrichment Kit (STEMCELL Technologies, catalog number: 19754 ). Components of kit:
EasySep™ (Negative Selection) Mouse B Enrichment Cocktail, 0.5 ml
EasySep™ Biotin Selection Cocktail, 1 ml (store at 4 °C)
EasySep™ Magnetic Particles, 1 ml (store at 4 °C; turn centrifuge on and cool to 4 °C)
Normal Rat serum, 1 ml (store at -20 °C)
RPMI-1640 with L-glutamine (Sigma-Aldrich, catalog number: R8758 )
Fetal Calf Serum (GE Healthcare HyCloneTM)
HEPES 1 M (Corning Incorporated, catalog number: 25-060-Cl )
Streptomycin/penicillin, 10,000 U/ml (Life Technologies, Gibco®, Catalog number 15140-122 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M3128 )
PBS without Ca2+/Mg2+ (Life Technologies, Gibco®, catalog number: 10010-023 )
Ethylenediaminetetraacetic Acid (EDTA) 0.5 M Solution (pH 8) (Thermo Fisher Scientific, catalog number: 25783 )
2.5% Anticoagulant citrate dextrose solution [ACD(A)] (Polymed, catalog number: 7300 )
ACDA was from the blood bank (http://www.polymedicure.com/?wpcproduct=acd-bag). Each 100 ml of ACD solution-A contains 2.2 g sodium citrate, 0.73 g citric acid, 2.45 g dextrose and 100 ml water.
NP-binding reagents: NP-allophycocyanin (APC) (Shlomchik lab)
Anti-CD4 (GK1.5) (Shlomchik lab)
anti-Fc gamma RIII/II (2.4G2) (Shlomchik lab)
anti-CD19 (1D3.2) (Shlomchik lab)
27 G needle, 1 ml syringe
Ethidium Monoazide (EMA) 2 mg/ml (Molecular Probes)
Complete media (see Recipes)
EasySep media (see Recipes)
Transfer buffer (see Recipes)
Staining Media (see Recipes)
Equipment
Sterile hood
Refrigerated table top centrifuge
Hemocytometer
“EasySep” magnet (max vol 8 ml; min vol 250 µl) (STEMCELL Technologies, catalog number: 18001 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Zuccarino-Catania, G. and Shlomchik, M. (2015). Adoptive Transfer of Memory B Cells. Bio-protocol 5(16): e1563. DOI: 10.21769/BioProtoc.1563.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Immunology > Immune cell function > Antigen-specific response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,564
|
https://bio-protocol.org/exchange/protocoldetail?id=1564&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Labeling of the Intestinal Lumen of Caenorhabditis elegans by Texas Red-dextran Feeding
Keiko Saegusa
KS Ken Sato
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1564 Views: 9890
Edited by: Peichuan Zhang
Reviewed by: Jyotiska Chaudhuri
Original Research Article:
The authors used this protocol in Oct 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2014
Abstract
In this method, the intestinal lumen of Caenorhabditis elegans (C. elegans) is labeled with a fluorescent fluid-phase marker, Texas Red-dextran. Since dextran conjugates are membrane impermeable, animals fed with it show a red fluorescent signal in the lumen of the intestine. Texas Red-dextran in the lumen is not efficiently endocytosed by intestinal cells and is not effectively transported to the body cavity paracellularly. It is useful to determine whether round-shaped membrane structures are invaginations from the apical membrane or cytoplasmic vesicles. If the barrier function of the intestinal epithelium is impaired, Texas Red-dextran can leak from the intestinal lumen to the body cavity. Therefore, this method can be used to visualize apical membrane morphology in intestinal cells and to investigate the barrier properties of the intestinal epithelium.
Keywords: C. elegans Intestine Apical membrane
Materials and Reagents
C. elegans strain
GK70 unc-119 (ed3) III; dkIs37[Pact-5-GFP-pgp-1;unc-119(+)]
Escherichia coli OP50 strain (obtained from the Caenorhabditis Genetics Center)
Texas Red-dextran (40,000 MW) (Life Technologies, Molecular Probes®, catalog number: D-1829 )
Levamisole hydrochloride (Sigma-Aldrich, catalog number: L9756 )
Agarose (Nacalai Tesque, catalog number: 01158-85 )
Egg buffer (see Recipes)
M9 buffer (see Recipes)
Agarose pads (see Recipes)
Equipment
Siliconized tubes (1.7 ml) (National Scientific Supply, catalog number: 20172-945 )
Tabletop centrifuge (Hitachi Koki, model: CT15RE )
Confocal laser scanning microscopy system (Olympus, model: FV1000 )
Four clean glass slides and a coverslip
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,565
|
https://bio-protocol.org/exchange/protocoldetail?id=1565&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Sample Preparation of Telomerase Subunits for Crystallization
JH Jing Huang
CB Christopher J. Bley
DR Dustin P. Rand
JC Julian J.-L. Chen
Ming Lei
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1565 Views: 7916
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Telomerase is a large ribonucleoprotein complex that replicates the linear chromosome ends in most eukaryotes. Large-scale preparation of the telomerase core components in vitro has long been a big challenge in this field, hindering the understanding of the catalytic mechanism of telomerase, as well as slowing down the development of telomerase inhibitors for cancer therapy. We have successfully developed a protocol for large-scale preparation of the TRBD-CR4/5 complex of the medaka telomerase in vitro, and used this method to study the high-resolution structure of the TRBD-CR4/5 complex by X-ray crystallography. This procedure may be also adapted to purify other protein-RNA complexes for structural studies.
Materials and Reagents
pMAL-C2X vector (New England Biolabs, catalog number: N8076S ) with an insertion of the protease 3C recognition site between MBP and the fusion protein
Escherichia coli (E. coli) strain ScarabXpress T7lac cells (Scarab Genomics, catalog number: C-1709-05K )
LB (Luria-Bertani) medium (BD Bioscience, catalog number: 214906 ) and LB agar (BD Bioscience, catalog number: 244520 )
Ampicillin (AMRESCO, catalog number: 0339 )
Glucose (AMRESCO, catalog number: 0188 )
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (AMRESCO, catalog number: 0487 )
Phenylmethylsulfonyl fluoride (PMSF) (Roche Diagnostics, catalog number: 11359061001 )
Tris(2-carboxyethyl)phosphine (TCEP) (AMRESCO, catalog number: K831 )
Benzamidine (Sigma-Aldrich, catalog number: 12072 )
Leupeptin (Sigma-Aldrich, catalog number: 62070 )
Pepstatin (Sigma-Aldrich, catalog number: 77170 )
Amylose resin (New England Biolabs, catalog number: E8021S )
Ammonium sulfate (Sigma-Aldrich, catalog number: A4418 )
Sodium chloride (Sigma-Aldrich, catalog number: S3014 )
Magnesium Chloride (Sigma-Aldrich, catalog number: 63068 )
Tris-HCl (Amresco, catalog number: 0 497 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Maltose (Sigma-Aldrich, catalog number: 1B1184 )
HEPES-KOH (Sigma-Aldrich, catalog number: 54457 )
Spermidine (Sigma-Aldrich, catalog number: 85558 )
Dithiothreitol (DTT) (Roche Diagnostics, catalog number: 10708984001 )
Recombinant RNasin Ribonuclease Inhibitor (Promega Corporation, catalog number: N2511 )
Nuclease-Free Water (Promega Corporation, catalog number: P1193 )
T7 RNA polymerase (New England Biolabs, catalog number: M0251S )
Pyrophosphatase (New England Biolabs, catalog number: M0361S )
Glucosamine-6-phosphoate (Sigma-Aldrich, catalog number: G5509 )
Lysis buffer (see Recipes)
Column buffer (see Recipes)
RNA buffer (see Recipes)
5x transcription buffer (see Recipes)
Equipment
Incubator shaker (Eppendorf, model: New BrunswickTM Innova 44 )
Centrifuge (Eppendorf, model: 5810R )
Ultracentrifuge (Beckman Coulter, model: Optima TM)
45Ti rotor (Beckman Coulter)
Sonicator (Branson Sonifier)
AKTA purifier (GE)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > RNA > RNA-protein interaction
Biochemistry > Protein > Structure
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,566
|
https://bio-protocol.org/exchange/protocoldetail?id=1566&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Character-State Reconstruction to Infer Ancestral Protein-Protein Interaction Patterns
FR Florian Rümpler
GT Günter Theißen
Rainer Melzer
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1566 Views: 12313
Edited by: Arsalan Daudi
Reviewed by: Prashanth Suravajhala
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Protein-protein interactions are at the core of a plethora of developmental, physiological and biochemical processes. Consequently, insights into the origin and evolutionary dynamics of protein-protein interactions may provide information on the constraints and dynamics of specific biomolecular circuits and their impact on the organismal phenotype.
This protocol describes how ancestral protein-protein interaction patterns can be inferred using a set of known protein interactions from phylogenetically informative species. Although this protocol focuses on protein-protein interaction data, character-state reconstructions can in general be performed with other kinds of binary data in the same way.
Keywords: Protein-protein interaction Phylogeny Character-state reconstruction Mesquite Markov model
Data
Protein-protein interaction data
A comprehensive list of interactions for the protein family under study should be compiled. As interaction data are typically generated only for proteins whose sequences have been deposited in databases, a recently published comprehensive phylogeny of the protein family under study may yield an upper estimate of the number and phylogenetic breadth of interaction data to be expected. In many cases recently published phylogenetic relationships need to be extracted from the publications itself, however a growing number of phylogenies are being uploaded in online databases such as TreeBASE (http://treebase.org/treebase-web/home.html) or Dryad (http://datadryad.org/).
For obtaining data on protein-protein interactions, databases might be used. Prominent examples of such databases include BioGRID (http://thebiogrid.org/) (Chatr-Aryamontri et al., 2013), the Database of Interacting Proteins (http://dip.doe-mbi.ucla.edu/) (Salwinski et al., 2004), IntAct (http://www.ebi.ac.uk/intact/) (Orchard et al., 2014) and String (http://string-db.org/) (Franceschini et al., 2013), to mention but a few. Above all, UniProt (http://www.uniprot.org/) (UniProt 2015) provides cross-references to a number of these database, thus facilitating searches for potential interaction partners.
Whereas database searches provide a good starting point, they very often do not capture all of the information available. It is therefore advisable to undertake a literature search. Special emphasize should be put on obtaining information from phylogenetically informative proteins, i.e. from proteins that occupy a position in the phylogeny that is critical for resolving the state of a particular trait (i.e. the character-state). Very often these are the early-diverging lineages, as their inclusion (together with more derived taxa) ensures that the whole phylogenetic breadth of a taxonomic group is captured. It might prove useful to obtain new experimental data for proteins that are phylogenetically especially informative. Indeed, generation of new protein-protein interaction data is often combined with character-state reconstruction to better understand the evolution of protein-protein interactions (Liu et al., 2010; Melzer et al., 2014; Li et al., 2015).
Sequence retrieval
Protein or nucleotide sequences for phylogenetic reconstructions can be retrieved from the NCBI nucleotide collection (http://www.ncbi.nlm.nih.gov/nuccore) or the NCBI protein collection (http://www.ncbi.nlm.nih.gov/protein).
Software
For sequence alignment and subsequent phylogenetic reconstructions one or several of the following programs may be used:
Table 1. Programs for sequence alignments and phylogenetic reconstructions
Program
Purpose
Reference
ExPASy translate
Translation of nucleotide sequences into amino acid sequences.
(Artimo et al., 2012)
http://web.expasy.org/translate/
Clustal 2
Sequence alignment. Suited especially for closely related sequences.
(Larkin et al., 2007)
http://www.clustal.org/clustal2/
MAFFT7
Sequence alignment. Suited for closely as well as more distantly related sequences.
(Katoh and Standley, 2013)
http://mafft.cbrc.jp/alignment/software/
RevTrans 1.4
Converting amino acid alignment into codon alignment.
(Wernersson and Pedersen, 2003)
http://www.cbs.dtu.dk/services/RevTrans/
MEGA 6
Sequence alignment and phylogenetic reconstruction.
(Tamura et al., 2013) http://www.megasoftware.net/
MrBayes 3
Phylogenetic reconstruction.
(Ronquist and Huelsenbeck, 2003)
http://mrbayes.sourceforge.net/index.php
To collate the character matrix
Microsoft Excel or a similar spreadsheet application
For character-state reconstruction:
Mesquite 3.02 (Maddison and Maddison, 2015) (http://mesquiteproject.org/)
Mesquite also provides extensive documentation: (http://mesquiteproject.wikispaces.com/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Rümpler, F., Theißen, G. and Melzer, R. (2015). Character-State Reconstruction to Infer Ancestral Protein-Protein Interaction Patterns. Bio-protocol 5(16): e1566. DOI: 10.21769/BioProtoc.1566.
Download Citation in RIS Format
Category
Systems Biology > Interactome > Protein-protein interaction
Systems Biology > Proteomics > Whole organism
Systems Biology > Genomics > Phylogenetics
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,567
|
https://bio-protocol.org/exchange/protocoldetail?id=1567&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determining Leukocyte Origins Using Parabiosis in the PyMT Breast Tumor Model
Ruth A. Franklin
ML Ming O. Li
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1567 Views: 9619
Reviewed by: Mario Cioce
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Tumors develop in a complex microenvironment alongside numerous cell types that impact their survival. Immune cells make up a large proportion of these accessory cells and many are known to promote tumor progression. Macrophages, in particular, are associated with poor patient prognosis and are therefore potential candidates for therapeutic targeting in cancer. However, to develop successful strategies to target macrophages, it is important to clarify whether these cells are derived from blood-borne precursors or a tissue-resident population. Parabiosis, or the surgical connection of two mice resulting in a shared blood circulation, allows the distinction between these two cellular sources. Here, we describe the use of parabiosis to define cell ontogeny in a mouse model of breast cancer.
Keywords: Tumor-associated macrophages Monocytes Breast cancer Oncogene-driven tumor model
Materials and Reagents
Mice: Female age- and weight-matched congenically-marked MMTV-PyMT mice [see Franklin et al. (2014) for specific strain information]
Injectable anesthesia (ketamine/xylazine cocktail: 150 mg/kg/15 mg/kg)
Antiseptic solution (Betadine)
70% ethanol
Ophthalmic ointment (Paralube)
Analgesic (Buprenorphine, 0.1 mg/kg)
Non-wetting sterile water (HydroGel)
Sterile saline solution (0.9% NaCl)
1x PBS
10x PBS
Bovine serum albumin (Sigma-Aldrich, catalog number: A2153 )
Sodium azide (Sigma-Aldrich, catalog number: S2002 )
Collagenase Type III (Worthington Biochemicals, catalog number: LS004182 )
Percoll (Sigma-Aldrich, catalog number: P1644 )
HBSS + calcium chloride + magnesium chloride (Life Technologies, Gibco®, catalog number: 14025 )
Deoxyribonuclease I from bovine pancreas (Sigma-Aldrich, catalog number: DN25 )
CD45.1 APC-eFluor® 780 (eBioscience, catalog number: 47-0453-82 )
CD45.2 PerCP-Cyanine5.5 (eBioscience, catalog number: 45-0454-82 )
MHC Class II (I-A/I-E) FITC (eBioscience, catalog number: 11-5321-82 )
CD11b Pacific Blue™ (Life Technologies, InvitrogenTM, catalog number: RM2828 )
Ly-6C APC (BD Pharmingen, catalog number: 560595 )
Ly-6G PE (BD Pharmingen, catalog number: 551461 )
Fc block (2.4G2), (BD Pharmingen, catalog number: 553142 )
RPMI 1640 (Life Technologies, Gibco®, catalog number: 11875-093 )
Digestion buffer (see Recipes)
100% Percoll (see Recipes)
44% Percoll (see Recipes)
66% Percoll (see Recipes)
FACS buffer (see Recipes)
Equipment
Non-absorbable black nylon suture (4-0, 13mm, 3/8 circle) (Ethicon, catalog number: 1854G )
Wound clip applier, wound clip remover, wound clips (Autoclip, 9 mm) (Braintree Scientific, catalog number: ACS KIT )
Cotton-tipped applicators (3 inch, wood shaft) (Fisherbrand, catalog number: 23-400-105 )
Sterile gauze (Fisherbrand, catalog number: 22-028-558 )
Needle holder with locking mechanism (Fine Science Tools)
Scissors (Fine Science Tools)
Curved forceps (2 pairs) (Fine Science Tools)
Razor blades
Slides (Corning Incorporated, catalog number: 2948-75X25 )
Heating lamp
Heating pads
Electrical shaver
Surgical drapes/sterile pads (Fisherbrand)
6 well non-tissue culture treated plates (Falcon®)
70 micron cell strainers (Falcon®, catalog number: 352350 )
50 ml conical tubes (Falcon®)
15 ml conical tubes (Falcon®)
3 ml syringe (BD Bioscience)
U-bottom 96 well plates (Falcon®)
Desktop centrifuge (Sorvall)
37 °C water bath
Flow cytometer (BD LSR II or similar)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Franklin, R. A. and Li, M. O. (2015). Determining Leukocyte Origins Using Parabiosis in the PyMT Breast Tumor Model. Bio-protocol 5(16): e1567. DOI: 10.21769/BioProtoc.1567.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Animal models
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,568
|
https://bio-protocol.org/exchange/protocoldetail?id=1568&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol to Treat Seedlings with Brassinazole and Measure Hypocotyl Length in Arabidopsis thaliana
Ana Espinosa-Ruiz
CM Cristina Martínez
SP Salomé Prat
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1568 Views: 12467
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
The plant hormones brassinosteroids (BR) promote hypocotyl elongation of Arabidopsis thaliana (A. thaliana) seedlings both under light and dark (etiolated) conditions. A common assay to determine if a mutant or transgenic line is affected in BR biosynthesis or response is a sensitivity assay to brassinazole (BRZ), an inhibitor of P450 cytochromes specific to BR biosynthesis.
Here we provide a protocol to compare BRZ sensitivity of different A. thaliana genotypes in terms of hypocotyl elongation (Bernardo-García et al., 2014).
Keywords: Brassinosteroid response Hypocotyl elongation Brassinazole
Materials and Reagents
A. thaliana seeds (background ecotype and mutant or transgenic line to be analysed)
Note: Seeds should be collected at the same time to avoid problems of differential germination rate.
Murashige and Skoog (MS) media including vitamins and MES buffer (Duchefa M0255.0050)
Sucrose
Potassium hydroxide (KOH)
Bacto Agar (BD Bioscience, catalog number: 214010 )
Ethanol
Tween-20
Brassinazole (TCI America, catalog number: B2829 )
Note: Stock solution is prepared at 2 mM in DMSO and kept at -20 °C. The appropriate volume of BRZ stock solution should be added in the fume hood to autoclaved media. The media should not be too hot (let it cool down to 55-65 °C before adding BRZ). BRZ concentration should range from 0.1 to 2 µM. We routinely use 0.1, 0.2, 0.4, 0.8 and 1.6 µM as a starting point.
Growth media (see Recipes)
Sterilization solution (see Recipes)
Equipment
Plant growth chamber
Sterile fume hood
Autoclave
Round (9 x 9 cm) and square (12 x 12 cm) polystyrene sterile Petri dishes
Software
ImageJ software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Espinosa-Ruiz, A., Martínez, C. and Prat, S. (2015). Protocol to Treat Seedlings with Brassinazole and Measure Hypocotyl Length in Arabidopsis thaliana. Bio-protocol 5(16): e1568. DOI: 10.21769/BioProtoc.1568.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,569
|
https://bio-protocol.org/exchange/protocoldetail?id=1569&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Rhizosphere Bacterial Communities from Soil
LW Laura J. White
Volker S. Brözel
Senthil Subramanian
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1569 Views: 25551
Edited by: Zhaohui Liu
Reviewed by: Yurong Xie
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Rhizosphere bacterial communities have become a major focal point of research in recent years, especially regarding how they affect plants and vice versa (Philippot et al., 2013). Changes in microbial density and diversity within the rhizosphere occur in a spatial temporal manner. The soil zone closest to the plant roots has the most density and diversity of microbes (Clark, 1940). The lack of methods to consistently isolate rhizosphere samples in a spatially defined manner is a major bottleneck in rhizosphere microbiology. We hypothesized that microbes with increasing affinities to and distance from the plant root can be isolated using increasing strengths of physical disruption. Sonication is an excellent choice due to the ability to gently remove rhizosphere soil and bacterial biofilms without damaging plant roots (Doi T et al., 2007; Bulgarelli et al., 2012; Lundberg et al., 2012). In addition, simply increasing the time of sonication can increase the amount of physical force. We used such an approach to consistently isolate microbial communities with different affinities to the soybean roots (White et al., 2014). This article describes the use of successive sonication to isolate distal, middle, and proximal soil from the rhizosphere of soybean roots.
Materials and Reagents
Soybean seedlings (Glycine max) in the vegetative stage (~ V3 to V5 period)
Soil with a history of soybean cultivation
dH2O
K2HPO4 (VWR International, catalog number: BDH0266-500 g )
KH2PO4 (VWR International, catalog number: BDH0268-500 g )
NaCl (Sigma-Aldrich, catalog number: S7653-1 kg )
Tween-20 (Sigma-Aldrich, catalog number: P9416-100 ml )
Phosphate buffered saline Tween 20 (PBST) (see Recipes)
Equipment
Razor blade
Tweezers
15 ml conical-bottom polypropylene centrifuge tubes (3 per sample) (VWR International, catalog number: 89039-670 )
50 ml conical-bottom polypropylene centrifuge tubes (3 per sample) (VWR International, catalog number: 21008-940 )
Note: Needed if plant roots are too large for 15 ml centrifuge tubes.
Styrofoam raft to suspend centrifuge tubes in sonicator (homemade)
Sonicator (Input: 117 V-50-60HZ 1ϕ, Output: 70 W 42KHZ +/-6%) (Thermo Fisher Scientific, model: FS20 )
Centrifuge with a fixed angle rotor for 15 and 50 ml conical bottom tubes at 4 °C capable of at least 5,000 x g relative centrifugal force (120 V 12 A 60 Hz 1,300 W) (Example: Eppendorf, model: 5804R 15 amp version)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:White, L. J., Brözel, V. S. and Subramanian, S. (2015). Isolation of Rhizosphere Bacterial Communities from Soil. Bio-protocol 5(16): e1569. DOI: 10.21769/BioProtoc.1569.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
157
|
https://bio-protocol.org/exchange/protocoldetail?id=157&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Differentiation of Mouse Th0, Th1 and Th2 from Naïve CD4 T Cells
Jia Li
Published: Nov 20, 2011
DOI: 10.21769/BioProtoc.157 Views: 56293
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
In vitro differentiation of helper T cells of various lineages is frequently used in T helper cell study. Naïve CD4 T cells can differentiate into certain lineage of T help cells in vitro in the presence of specific stimulatory cytokines and inhibition of cytokines that are essential for the differentiation of other lineages.
Materials and Reagents
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 900-108 )
Penicillin/streptomycin solution (Life Technologies, Gibco®, catalog number: 15140-122 )
2-mercaptoethanol (Life Technologies, InvitrogenTM, catalog number: 21985-023 )
IL-2 (R&D systems, catalog number: 402-ML-020 )
IL-4 (Biolegend, catalog number: 574302 )
IL-12 (R&D systems, catalog number: 419-ML-010 )
Anti-CD3 (Biolegend, catalog number: 100302 )
Anti-CD28 (Biolegend, catalog number: 102102 )
Anti-IL-4 (Biolegend, catalog number: 504102 )
Anti-IL-12 (Biolegend, catalog number: 505303 )
Anti-IFNg (Biolegend, catalog number: 505702 )
Phorbol 12-myristate-13-acetate (PMA) (Sigma-Aldrich, catalog number: 79346 )
Ionomycin (Sigma-Aldrich, catalog number: 19657 )
Monensin (ebioscience, catalog number: 00-4505-51 )
Easysep CD4+ T cell enrichment Kit (STEMCELL Technologies, catalog number: 19752 )
RPMI-1640 medium (Life Technologies, Gibco®, catalog number: 11875-093 ) (see Recipes)
Equipment
48, 96-Well plate
Centrifuges
Water bath
Fluorescence activated cell sortor (FACS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Li, J. (2011). In vitro Differentiation of Mouse Th0, Th1 and Th2 from Naïve CD4 T Cells. Bio-101: e157. DOI: 10.21769/BioProtoc.157.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,570
|
https://bio-protocol.org/exchange/protocoldetail?id=1570&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Sodium Accumulation in Arabidopsis thaliana Using Inductively Coupled Plasma Optical Emission Spectrometery (ICP-OES)
Won-Gyu Choi
Simon Gilroy
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1570 Views: 8392
Edited by: Tie Liu
Reviewed by: Dušan Veličković
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Salt stress is a major issue for plants growing in both natural and agricultural settings (Deinlein et al., 2014). For example, irrigation can lead to the build up of salts in the soil as the irrigation water evaporates, leading to salinization, inhibition of plant growth, reduced productivity and eventually to loss of agriculturally usable land. One key element in trying to understand how salt stress impacts plant growth and development, in defining plant salt sensing and response mechanisms and eventually in the breeding or engineering of plants resistant to this stress is monitoring their salt uptake and redistribution. Methods such as imaging Na-sensitive fluorescent probes (Kader and Lindberg, 2005) and use of Na-ion selective microelectrodes (Shabala et al., 2005) offer the potential to follow Na levels in the plant in a non-destructive manner but are technically demanding and not applicable to field, or even many laboratory, conditions. However, tissue sampling followed by inductively coupled plasma spectroscopy (ICP) represents a simple, quantitative assay to monitor total Na levels in plant samples. ICP analysis is also applicable to plants in any environment where samples can be harvested. The approach uses tissue digestion in acid solutions, followed by injection of the resulting sample into an inductively coupled plasma spectrometer and monitoring the characteristic emitted spectrum from Na. As Na is stable, no complex sample preservation is required. Care needs to be taken with possible Na contamination in standards and samples from the water used for sample preparation and from glassware but otherwise, the approach is simple and robust.
Materials and Reagents
Plant tissues
60% (vol/vol) Perchloric acid (HClO4) (Sigma-Aldrich, catalog number: 244252 )
Nitric acid (HNO3) (Sigma-Aldrich, catalog number: 225711 )
18 megaohms (MΩ)-cm deionized water (DI water)
NaCl standards, see Recipes for two methods of preparing Na standards
ICP-OES calibration standard (Agilent, catalog number: 6610030700 )
Kimwipe strip, W x H: 30 x 5 mm (manually prepared by cutting a single layer of Kimwipe) (Kimtech Science Kimwipers, catalog number: 34120 )
NaCl standards (see Recipes)
Alternative method of preparing Na standards from 1 M NaCl standard (see Recipes)
Composition of plant growth medium (see Recipes)
Equipment
Perkin-Elmer Optima 2000DV inductively coupled plasma optical emission spectrometer (ICP-OES) or similar machine
Fume hood
Heat block for heating glass test tubes
Disposable borosilicate glass tubes with plain ends (O.D. x L: 16 x 125 mm) (Thermo Fisher Scientific, catalog number: 14-961-30 )
Sterile square Petri dish with grid (L x W x H: 100 mm x 100 x 15 mm, grid of thirty-six 13 x 13 mm squares) (Thermo Fisher Scientific, catalog number: 08-757-11A )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Choi, W. and Gilroy, S. (2015). Quantification of Sodium Accumulation in Arabidopsis thaliana Using Inductively Coupled Plasma Optical Emission Spectrometery (ICP-OES). Bio-protocol 5(16): e1570. DOI: 10.21769/BioProtoc.1570.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Abiotic stress
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,571
|
https://bio-protocol.org/exchange/protocoldetail?id=1571&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Separation of Intracellular Vesicles for Immunoassays
TK Toshihiko Kobayashi
TT Tsubasa Tanaka
NT Noriko Toyama-Sorimachi
Published: Vol 5, Iss 16, Aug 20, 2015
DOI: 10.21769/BioProtoc.1571 Views: 11393
Edited by: Jia Li
Reviewed by: Hsin-Yi ChangLee-Hwa Tai
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
The endosome/lysosome systems play important roles in immune cell functions as signaling platforms. Immune cells utilize these endosome/lysosome for signal transduction or intercellular communication to elicit the proper immune responses, regulating the localization or the association of the signaling complexes. Here we introduce the procedures to separate the intracellular vesicles such as endosomes or lysosomes, which could be useful to identify the subcellular localization of the signaling complexes.
Materials and Reagents
Cells (e.g. RAW264.7, Raji, mouse naïve B cells)
Trypan blue staining (0.4% solution) (Life Technologies, catalog number: 15250-061 )
CD43-microbeads (Miltenyi Biotec, catalog number: 130-049-801 )
Blocking One (Nacalai tesque, catalog number: 03953-95 )
Anti-mouse LAMP1 (eBioscience, catalog number: 1D4B )
Anti-GM130 (BD biosciences, catalog number: 35/GM130 )
Anti-Rab5 (Santa Cruz Biotechnologies, catalog number: D-11 )
Anti-Calnexin (Enzo Life Sciences, catalog number: ADI-SPA-860 )
Anti-COX IV (Cell Signaling Technology, catalog number: 4844 )
Anti-rat Ig(H+L)-HRP (Jackson ImmunoResearch Laboratories, catalog number: 712-036-153 )
Anti-mouse Ig(H+L)-HRP (Jackson ImmunoResearch Laboratories, catalog number: 115-035-062 )
Anti-rabbit Ig(H+L)-HRP (Jackson ImmunoResearch Laboratories, catalog number: 111-035-144 )
ECL substrate (Thermo Fisher Scientific, catalog number: 34095 )
Protease Inhibitor Cocktail (Thermo Fisher Scientific, catalog number: 87785 )
Halt Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific, catalog number: 78420 )
60% OptiPrep (Axis-Shield plc, catalog number: 1114542 )
Solution A (see Recipes)
Solution B (see Recipes)
Solution C (see Recipes)
Solution D (see Recipes)
Solution E (see Recipes)
30%, 23%, 17%, 11%, and 5% Optiprep (2 ml each) (see Recipes)
TBS-T (see Recipes)
Equipment
10 cm dish
Centrifuge tube (Beckman Coulter, catalog number: 347357 )
Hemocytometer
Centrifuge (with cooling function will be recommended)
1 ml syringe with 29-gauge needle
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Kobayashi, T., Tanaka, T. and Toyama-Sorimachi, N. (2015). Separation of Intracellular Vesicles for Immunoassays. Bio-protocol 5(16): e1571. DOI: 10.21769/BioProtoc.1571.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Cell Biology > Organelle isolation > Outer membrane vesicles
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,572
|
https://bio-protocol.org/exchange/protocoldetail?id=1572&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Partial Purification of His-tagged Proteins in a Plant System
AS Amancio de Souza
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1572 Views: 13309
Edited by: Arsalan Daudi
Reviewed by: Shyam Solanki
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Plant protein expression can be a challenging enterprise in any biochemical or molecular biology research project. Several heterologous systems like bacteria, yeast, insect cells and cell free systems have been used to produce plant proteins for in vitro experiments and structural characterization. However, due to particularities of plant proteins, for example the specific type and abundance of post-translational modifications (e.g. glycosylation), a plant system to express plant proteins is extremely desirable. The use of Nicotiana benthamiana (N. benthamiana) plants for protein expression has proven to be quick and reliable. To illustrate the robustness and rapidity of this system, recent efforts to produce the first protein based drug against the Ebola virus was conducted in N. benthamiana protein expression systems (Choi et al., 2015).
This protocol describes a simple system for the expression and enrichment (affinity purification) of plant apoplastic proteins in N. benthamiana leaves, which was successfully used in the characterization of the Arabidopsis thaliana pectin acetylesterases, PAE8 and PAE9 (de Souza et al., 2014).
Materials and Reagents
Nicotiana benthamiana seeds
Agrobacterium strain GV3101 (obtained from the Lab of Dr. Markus Pauly at UC Berkeley’s Plant and Microbial Biology departmenty)
PRO-MIX® HP MYCORRHIZAE™ soil mix (Promix, catalog number: 20381RG )
Miracle-Gro® Water Soluble All Purpose Plant Food (Scotts)
pART27 expression vector (Gleave, 1992)
Tryptone (MP Biomedicals, catalog number: 1010817 )
Yeast extract (U.S. Biotech Sources, catalog number: Y01PD-500 )
NaCl (Thermo Fisher Scientific, catalog number: S271-3 )
4'-Hydroxy-3', 5'-dimethoxyacetophenone (acetosyringone) (150 mM in DMSO) (Sigma-Aldrich, catalog number: D134406-1G )
Aluminum foil (Reynolds wrap 76.2 m x 304 mm) (Reynolds Consumer Products Inc.)
Liquid nitrogen
100x Halt™ Protease Inhibitor Cocktail (Thermo Fisher Scientific, catalog number: 78429 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Bradford reagent (Bio-Rad Protein Assay Dye reagent concentrate) (Bio-Rad Laboratories, AbD Serotec®, catalog number: 500-0006 )
Small columns for Ni-NTA bead wash and elution (any that will fit a 1.5 ml Eppendorf tube, e.g. miniprep column)
500 µl Vivaspin Column MWCO of 5,000 (Sartorius stedim biotech, catalog number: VS0111 )
Ni-NTA beads (QIAGEN, catalog number: 1018240 )
96 well plates for Bradford assay (Thermo Fisher Scientific, catalog number: 80040LE0910 )
2-(N-morpholino)ethanesulfonic acid (MES) (Sigma-Aldrich, catalog number: M2933 )
MgCl2 (Thermo Fisher Scientific, catalog number: M33-500 )
Sodium phosphate monobasic (Thermo Fisher Scientific, catalog number: S369-500 )
Sodium phosphate dibasic (Thermo Fisher Scientific, catalog number: S374-500 )
Imidazole (Sigma-Aldrich, catalog number: I-2399 )
Lennox LB media (see Recipes)
Infiltration buffer (see Recipes)
Sodium phosphate buffer (see Recipes)
Extraction buffer (see Recipes)
Wash buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
Plant pots (400 ml volume or similar, Gage Durapot) (Merrill's Packaging, catalog number: 03GA-0350S )
Plant growth trays (T.O. Plastics, catalog number: 710245C )
Tall covers that won’t touch the leaves (Acrodome) (Drader Manufactoring Industries Ltd., catalog number: 69973 )
Mortar and pestle
500 ml culture flasks
Immersion recipient for dipping N. benthamiana plants (e.g. 250 ml beakers)
Metal beads (2.38 mm) (Tool Supply, catalog number: 6230 )
Ball mill (Mixer Mill MM 400 ) (RETSCH, catalog number: MM 400)
Plant growth chambers capable of sustaining 26 °C under long-day conditions (16 h light/8 h dark) with 170-190 µmol m-2 s-1 light intensity.
Spray bottle with water.
Incubator/orbital shaker, capable of 30 °C at 230 rpm incubation for 500 ml culture flaks.
Spectrophotometer capable of OD600 measurements.
Large centrifuge capable of spinning down 250 ml or greater volumes at 5,000 x g for 10 min
Desiccator or vacuum chamber
Vacuum pump (Savant Systems LLC, catalog number: Gel Pump-GP110 )
-80 °C Freezer
Rotating agitator/circular shaker
Table top centrifuges (500-20,800 x g, 4 °C)
Spectrophotometer capable of 96 well plate measurements at 595 nm
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Souza, A. D. (2015). Expression and Partial Purification of His-tagged Proteins in a Plant System. Bio-protocol 5(17): e1572. DOI: 10.21769/BioProtoc.1572.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,573
|
https://bio-protocol.org/exchange/protocoldetail?id=1573&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Immunolocalization of Proteins in Corals: the V-type H+-ATPase Proton Pump
KB Katie L. Barott
Martin Tresguerres
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1573 Views: 10223
Edited by: Arsalan Daudi
Reviewed by: Claudia CatalanottiModesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Here we describe the immunolocalization of a membrane-bound proton pump, the V-type H+-ATPase (VHA), in tissues and isolated cells of scleractinian corals. Immunolocalization of coral proteins requires additional steps not required for various model organisms, such as decalcification of the coral skeleton for immunohistochemistry or removal of cells away from the skeleton for immunocytochemistry. The tissue and cell preparation techniques described here can be adapted for localization of other coral proteins, provided the appropriate validation steps have been taken for the primary antibodies and species of coral used. These techniques are important for improving our understanding of coral cell physiology
Materials and Reagents
Live coral
Electron microscopy grade paraformaldehyde (16% solution in 10 ml ampules) (Electron Microscopy Sciences, catalog number: 15700 or 15710 )
Ethyl alcohol (absolute, 200 proof)
Ethyl alcohol (190 proof)
Xylenes (any reagent ≥ 98.5% xylenes, other tissue clearing agents such as Safeclear, are also acceptable) (Safeclear, catalog number: 044-192 )
Paraffin embedding medium (e.g. Paraplast X-TRA) (McCormick Scientific, catalog number: 39503002 )
Triton-X-100 (Bio-Rad Laboratories, AbD Serotec®, catalog number: 1610407 or Sigma-Aldrich, catalog number: T8787 )
Normal goat serum (Vector laboratories, catalog number: S-1000 )
Keyhole Limpet Hemocyanin (Sigma-Aldrich, catalog number: 7017 )
Phosphate buffered saline (PBS) (e.g. 10x) (Corning Incorporated, catalog number: 46-013-CM )
Microscope slides and coverslips
Custom, antigen-affinity purified, rabbit polyclonal anti-VHAB antibodies developed using a peptide antigen matching a conserved region of the VHAB subunit (AREEVPGRRGFPGY) (Genscript USA, Inc.). The epitope is 100% conserved among diverse animal species, and specifically recognizes VHAB from coral (Barott et al., 2015), bone-eating worms (Tresguerres et al., 2013), hagfish (Clifford, et al. 2015), and sharks (Tresguerres et al., 2010; Roa et al., 2014).
Note: This protocol may be adapted for other proteins following validation of the primary antibodies in the coral species to be examined. However, successful localization using different primary antibodies may require optimization of the fixation procedure from that described below.
Secondary antibodies: Goat anti-rabbit IgG Alexa Fluor 555 (2 mg/ml) (Life Technologies, catalog number: A21429 )
Note: The Alexa555 fluorophore is used to avoid overlap with the coral’s endogenous green fluorescent protein (GFP), but other fluorophores outside of the GFP emission range may also work.
Hoescht 33342 (Life Technologies, catalog number: H1399 )
Mounting medium (e.g. Electron Microscopy Sciences, catalog number: 17895 )
Note: Unless otherwise noted, reagents can be obtained from any general laboratory reagent manufacturer or supplier.
S22 buffer (see Recipes)
Ca-free S22 buffer + 0.5 M EDTA (see Recipes)
Fixative solution (see Recipes)
Blocking buffer (see Recipes)
Equipment
Chemical fume hood
Fluorescence microscope (e.g. Zeiss AxioObserver Z1, or any other microscope with the ability to detect blue (“DAPI filter”, peak excitation 350 nm; peak emission 461 nm; for Hoescht staining of nuclei) and red (“TRITC filter”, peak excitation 550 nm; peak emission 570 nm; for secondary antibodies) fluorescence.
Optional
Coral endogenous GFP and chlorophyll from dinoflagellate symbionts (Symbiodinum) are visible using settings for “green fluorescence” (“FITC filter”, peak excitation 490 nm; peak emission 525 nm).
Structured illumination (Zeiss Apotome2), confocal capabilities *suggested but not required.
Differential Interference Contrast (DIC) (Nomarski microscopy) *suggested but not required.
Microcentrifuge [any model capable of spinning 1.5 ml tubes at 3,000 x g at 4 ℃
Note: This temperature can be achieved by placing the microcentrifuge inside of a fridge.
Tissue cassettes (e.g. C&A Scientific, catalog number: EC-0109x )
Tissue embedding station or any other method to pour liquid paraffin (e.g. Kedee, model: KD-BM II )
Embedding base molds (metal) (e.g. C&A Scientific, catalog number: HB-07 , 15 , 24 , 30 )
Embedding rings (plastic) (e.g. Biologix, catalog number: 41-3004 )
Microtome (any model capable of cutting 5-30 μm paraffin sections)
Slide warmer/hot plate (any model capable of warming up slides to 30 ℃)
Hydrobarrier pen (Pap pen) (e.g. Vector Laboratories, catalog number: H-4000 )
Rotating platform (any rotator/shaker/rocker)
Software
Imaging software (e.g. Zeiss Axiovision software, Adobe Photoshop, ImageJ)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Immunodetection
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,574
|
https://bio-protocol.org/exchange/protocoldetail?id=1574&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Spot Assays for Viability Analysis of Cyanobacteria
AD Anja Katharina Dörrich
AW Annegret Wilde
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1574 Views: 10727
Edited by: Maria Sinetova
Reviewed by: Elizabeth LibbyAmit Dey
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Cyanobacteria are prokaryotic organisms performing oxygenic photosynthesis. The cyanobacterium Synechocystis sp. PCC 6803 is a model organism for the study of photosynthesis, gene regulation and biotechnological applications because it is easy to manipulate genetically. Moreover, this cyanobacterium can grow photoautotrophically as well as chemoheterotrophically in the dark utilizing glucose. Microbiologists often use optical density measured with a spectrophotometer for the comparison of growth performance of different strains in liquid cultures. Because Synechocystis sp. PCC 6803 (especially motile strains) tend to form aggregates under stress conditions this method might be not suitable for evaluation of different strains under different growth conditions. In addition, many labs are not well equipped with standardized photobioreactors and illumination facilities to ensure reproducibility of growth curves. Here, we describe a highly reproducible spot assay for viability analysis of Cyanobacterial strains.
Keywords: Cyanobacteria Synechocystis 6803 Spot assay Growth assay
Materials and Reagents
Synechocystis sp. PCC 6803 strain (wild type obtained from S. Shestakov, Moscow State University, Russia)
CaCl2.2H2O (Carl Roth, catalog number: 5239.1 )
Citric acid (Carl Roth, catalog number: X863.2 )
NaNO3 (Carl Roth, catalog number: A136.2 )
MgSO4.7H2O (Carl Roth, catalog number: P027.1 )
Na2-EDTA (Carl Roth, catalog number: 8043.2 )
H3BO3 (Carl Roth, catalog number: 6943.1 )
MnCl2.4H2O (Carl Roth, catalog number: T881.3 )
ZnSO4.7H2O (Carl Roth, catalog number: T884.1 )
Na2MoO4.2H2O (Carl Roth, catalog number: 0274.1 )
Co(NO3)2.6H2O (Carl Roth, catalog number: HN16.1 )
CuSO4.5H2O (Carl Roth, catalog number: P024.1 )
Na2CO3 (Carl Roth, catalog number: P028.2 )
Ammonium iron (III) citrate (Carl Roth, catalog number: P027.1)
K2HPO4.3H2O (Merck KGaA, Calbiochem®, catalog number: 105099 )
2-[(2-Hydroxy-1, 1-bis(hydroxymethyl)ethyl)amino]ethanesulfonic acid (TES) (Carl Roth, catalog number: 9137.3 )
Bacto Agar (BD Bioscience, catalog number: 214010 )
Syringes (50 ml volume)
Sterile syringe filters (Sarstedt Filtropur S 0.2 µm, catalog number: 83.1826.001 and 0.45 µm, catalog number: 83.1826 )
Sterile 96-well microliter plates (i.e. VWR International, catalog number: 734-2328 )
100x BG11 medium (see Recipes)
Trace metal mix (see Recipes)
Stock Solutions for BG-11 medium (see Recipes)
1x BG11 (2x BG11) (see Recipes)
BG11 agar (see Recipes)
Na2S2O3 solution (see Recipes)
0.25 M Na2-EDTA (see Recipes)
Equipment
Wide neck Erlenmeyer flasks with 100 ml volume (Carl Roth, catalog number: C146.1 )
Light source (18 W/840) (Philips, model: MASTER TL-D Super 80 )
Laboratory shaker (one-dimensional orbital motion) (Heidolph Instruments GmbH, catalog number: 036130180 )
UV/Vis spectrophotometer (Shimadzu, model: UV-2401PC )
Multichannel pipettes (8-channel pipette, 0.5-10 µl and 10-100 µl) (Starlab ErgoOne®, catalog number: S7108-0510 and S7108-1100 )
Petri dishes with square shape (120 x 120 x 17 mm) (Greiner Bio-One GmbH, catalog number: 688102 )
Transmitted light scanner with adjustable cover (i.e. Epson perfection v700 photo, a good camera can be used as an alternative)
Laminar flow hood (i.e. Heraeus HeraSafe HS)
LI-190R Quantum Sensor
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Dörrich, A. K. and Wilde, A. (2015). Spot Assays for Viability Analysis of Cyanobacteria. Bio-protocol 5(17): e1574. DOI: 10.21769/BioProtoc.1574.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell viability
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,575
|
https://bio-protocol.org/exchange/protocoldetail?id=1575&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cryo-focused Ion Beam Sample Preparation for Imaging Vitreous Cells by Cryo-electron Tomography
MS Miroslava Schaffer
Benjamin D. Engel
TL Tim Laugks
JM Julia Mahamid
JP Jürgen M. Plitzko
WB Wolfgang Baumeister
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1575 Views: 21447
Edited by: Tie Liu
Reviewed by: Pengpeng Li
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Cryo-electron tomography (CET) is a well-established technique for imaging cellular and molecular structures at sub-nanometer resolution. As the method is limited to samples that are thinner than 500 nm, suitable sample preparation is required to attain CET data from larger cell volumes. Recently, cryo-focused ion beam (cryo-FIB) milling of plunge-frozen biological material has been shown to reproducibly yield large, homogeneously thin, distortion-free vitreous cross-sections for state-of-the-art CET. All eukaryotic and prokaryotic cells that can be plunge-frozen can be thinned with the cryo-FIB technique. Together with advances in low-dose microscopy, this has shifted the frontiers of in situ structural biology. In this protocol we describe the typical steps of the cryo-FIB technique, starting with fully grown cell cultures. Three recently investigated biological samples are given as examples.
Keywords: Focused ion beam Cryo-electron microscopy Tomography Chlamydomonas Yeast
Materials and Reagents
Biological material
Note: The FIB-milling procedure is compatible with a wide range of cell types, including single-celled eukaryotes, prokaryotes, and mammalian cells such as HeLa and neuronal cultures. The following examples are used in this protocol:
A Chlamydomonas reinhardtii (C. reinhardtii) wild-type strain CC-124 (137c) (Chlamydomonas Resource Center, University of Minnesota, Minneapolis, MN)
B Chlamydomonas reinhardtii strain mat3-4 (Umen and Goodenough, 2001)
C Yeast strain Saccharomyces cerevisiae (S. cerevisiae)
Tris-acetate-phosphate (TAP) medium (Harris et al., 2009; Culture media recipe is available at http://www.chlamy.org/media.html)
Lugol’s iodine solution (Sigma-Aldrich, catalog number: 62650-100ML-F )
Liquid nitrogen
Ethane/propane high purity gas mixture (37% ethane) (Linde)
Filter paper
YPD liquid medium (see Recipes)
Equipment
R 2/1 Holey Carbon-coated 200-mesh copper grids (Quantifoil Micro Tools GmbH, catalog number: Q2100CR1 )
Tweezers
Screwdrivers
Light microscope
Teflon sheets (custom made, cut from larger sheets in the exact shape and size as the filter paper used for plunge-freezing)
Glass petri dish (9-12 cm)
Glass microscopy slides (Thermo Fisher Scientific, catalog number: 10144633B )
Cryo grid boxes (custom made, or FEI, Eindhoven, The Netherlands)
Cryo AutoGrid boxes (custom made, or FEI, Eindhoven, The Netherlands)
AutoGrids (custom made and modified for FIB work, see Figure 1a)
Clip rings (FEI, Eindhoven, The Netherlands, see Figure 1b)
Liquid nitrogen Dewars
Personal protection equipment for work with liquid nitrogen (safety glasses, face shield, and cold-resistant gloves)
Hemocytometer (Neubauer)
Pipets and tips
Clipping tools (custom made, or FEI, Eindhoven, The Netherlands)
Personal protective equipment for work with liquid nitrogen and liquid ethane/propane
Plasma cleaner (Harrick, model: PDC-3XG )
Vitrobot Mark 4 (FEI)
Focused ion beam microscope (FEI, model: DB Quanta 3D FEG ), Cryo-system (Quorum Technologies, model: PP3000T ), Cryo-stage (custom made, Max Planck Institute)
Transmission electron microscope I. (FEI, model: Tecnai G2 Polara , FEG 300kV), Post-column energy-filter (Gatan, model: HR-GIF 2002 ), Direct detection camera (Gatan, model: K2 Summit ), SerialEM software (Mastronarde, 2005)
Transmission electron microscope II. (FEI, model: Titan Krios, FEG 300kV), post-column energy-filter (Gatan, model: 968 Quantum K2 ) Direct detection camera (Gatan, model: K2 Summit), SerialEM software (Mastronarde, 2005)
Figure 1. AutoGrids modified for cryo-FIB. a) Top and b) bottom side of an AutoGrid holding a clipped TEM grid. The flat top side shows the cutout required for cryo-FIB milling. c) The FIB shuttle loaded with two AutoGrids. Detailed view showing a properly oriented AutoGrid loaded into the shuttle. Note that the AutoGrid cutout faces up.
Software
FIB software
Procedure
Note: Working with liquid nitrogen and liquid ethane/propane mixture is potentially dangerous. Personal protective equipment should be used.
Vitrification by plunge-freezing
Note: Standard protocols can be used for plunge-freezing cells (e.g. Iancu et al., 2006). For proper vitrification (freezing in non-crystalline ice) and cell density, parameters must be optimized for each specific cell type.
Cell concentration is determined by counting using a hemocytometer. (C. reinhardtii cells are fixed with Lugol’s iodine solution for the counting process in order to stop cell motility. A Lugol’s solution to cell culture of ratio 1:10 is sufficient.)
The concentration of the cells is diluted to 200-750 cells/μl in fresh TAP for the C. reinhardtii wild-type strain, 500-4,000 cells/μl in fresh TAP for the C. reinhardtii mat3-4 strain, and 10,000-15,000 cells/μl for S. cerevisiae cells in YPD medium.
The carbon-coated 200-mesh copper TEM grids placed carbon side up on a glass slide are glow discharged by 30 sec plasma cleaning. The slide is then stored in a glass petri dish until plunging, which should proceed immediately.
The cells are plunge-frozen using the Vitrobot:
The Vitrobot is set to 90% humidity, blot force 10, 7 to 10 sec blot time, room temperature (C. reinhardtii cells) or 27 °C (S. cerevisiae cells).
3.5 μl of the diluted cell culture is pipetted onto TEM grids inside the Vitrobot.
The grids are blotted from the reverse side using Teflon sheets on both sides and filter paper on the backside. Then they are immediately plunged into the liquid ethane/propane mixture at liquid nitrogen temperature.
The plunge-frozen grids are then stored in sealed boxes under liquid nitrogen until used.
Sample thinning using cryo-FIB milling
Cooling the FIB system from room temperature to cryo conditions.
Before starting the cooling, the vacuum in the FIB chamber and in the prep-chamber must be lower than 4 x 10-6 mbar to avoid contamination from water vapor.
The N2 gas pipeline between the liquid nitrogen Dewar and the FIB chamber (vacuum isolated line) is pumped to 2 x 10-2 mbar.
The nitrogen gas flow for the stage and anti-contaminator are adjusted to 3.8 L/min and 4.2 L/min, respectively. These values ensure that temperatures of 182 °C and 192 °C are reached after cooling, respectively.
The cooling is started by slowly inserting the cooling rod into the liquid nitrogen Dewar.
Sample clipping and loading the AutoGrids into the FIB shuttle.
Note: Clipping and loading is started when the cryo-stage and anti-contaminator reach temperatures below -160 °C. Using a surgical mask can minimize water vapor contamination of the work area.
The shuttle and the clipping support base are placed into the loading box (Figure 2).
The loading box is filled with liquid nitrogen.
After boiling has finished, the double wall tank is filled with liquid nitrogen by slightly tilting the loading box (Figure 2).
The sample boxes from the storage Dewar are transferred into the loading box and opened there. Transfer time should be minimized to avoid contamination of the sample.
All tools that will contact the TEM grids are pre-cooled by liquid nitrogen in the loading box immediately before use.
Figure 2. Sample clipping and loading. a-c) The sample loading box with double-walled reservoir (9). The second reservoir is filled with liquid nitrogen through the filling gaps (2, 8). The AutoGrid notch (6) aids the fast and easy handling of Autogrids under liquid nitrogen. The clipping tool (1) and tweezers can be cooled in the round bore (7). The shuttle (3) (in loading position), sample storage box (4) and clipping metal support (5) are immersed under liquid nitrogen.
The AutoGrid is placed into the clipping metal support with the flat side facing down. It must be centered properly. The TEM grid is removed from the sample box and placed into the AutoGrid with cells facing down. The grid is then clipped into the AutoGrid with a clip ring using the clipping tool (Figure 1b).
As the shuttle has space for two AutoGrids, step B2f) is repeated for the second AutoGrid.
The AutoGrids are loaded into the shuttle and oriented such that the cutouts are facing up (Figure 1c). The shuttle is then flipped back into the transfer position.
Shuttle transfer onto the FIB cryo-stage.
The temperatures of the cryo-stage and anti-contaminator should be between -194 °C and -165 °C. The temperature of the anti-contaminator should be lower than the temperature of the cryo-stage.
The stage is moved to the transfer position.
The loading box (Figure 3c) is placed onto the pumping station (Figure 3a) and covered.
The transfer unit (Figure 3b) is placed onto the cover of the loading box, and the transfer unit’s insertion rod is attached to the shuttle.
The pumping of the transfer unit and loading box is started. After one minute, the shuttle is lifted out of the loading box into the transfer unit. The transfer unit valve is closed, the pumping is stopped and the loading station is vented (Figure 3d).
Figure 3. Sample transfer system. a) The Quorum cryo-system with the transfer unit (1). The pumping station (2) with the loading box inside. b) The sample transfer unit with the small transfer chamber (3) and the shuttle (4) attached to the transfer rod. c) The loading box (5) inside the pumping station (7). Here, the shuttle is in the transfer position (6). d) The transfer unit attached to the loading box for shuttle pick-up/drop-off. The small transfer chamber (3) is closed/opened using the transfer unit valve (8).
The transfer unit is attached to the airlock of the FIB (“prep chamber” connected to the turbo pump of the Quorum system).
The airlock is pumped to the vacuum level required to safely open the airlock valves and the transfer unit valve.
The shuttle is transferred onto the cryo-stage with the insertion rod.
The insertion rod is detached from the shuttle and retracted, then the airlock valves and the transfer unit valve are closed. The airlock is vented and the transfer unit is removed.
Lamella milling.
Note: See Video 1 for an overview of the milling procedure. For help with basic FIB operation, press the F1 key in the FIB software.
Before starting the milling, the vacuum in the FIB chamber at cryo condition must be lower than 2 x 10-6 mbar to avoid contamination from water vapor.
The FIB user interface of the FIB microscope is active.
The column valves are opened and ion beam emission is started (“Beam on” or “Wake up” buttons are pressed).
Electron and ion beams are in the operational state.
Note: The following parameters enable rapid milling of the bulk cellular material, followed by fine milling and polishing of the lamella.
The scanning parameters for the electron beam are set to: 5.0 kV beam energy, 12 pA beam current, 1,024 x, 884 or 1,536 x 1,024 scan resolution, 1 µs dwell time. Scanning is started.
Scan rotation for both beams is set to 180 degrees.
Low magnification (70x) is set and the stage is moved to one of the two AutoGrids.
The grid bar is scanned at increased zoom to adjust focus, astigmatism and other required alignments for the electron beam.
The stage is linked to a focused working distance (“Link Z to FWD” button).
The stage is moved to the eucentric height (coincidence point) of the microscope (ion and electron beams display the same location).
The stage rotation is adjusted to align the AutoGrid cutout with the incident direction of the ion beam. This is achieved by facing the cutout towards the bottom of the electron image (Figure 4a).
Organometallic platinum deposition is performed on both AutoGrids using the in situ gas injection system to protect the lamella surface and reduce curtaining effects (protocol adapted from Hayles et al., 2007):
Stage parameters are set to 0° tilt and 3 mm below eucentric height.
The stage is adjusted such that the AutoGrid faces the gas injection system (GIS). For this, a relative stage rotation of 180° is performed using the compucentric rotation. The AutoGrid is then centered at the GIS position in the electron image (Figure 4b).
The GIS temperature is set to 26 °C.
The GIS needle is inserted and opened for 4 to 8 sec.
The GIS needle is retracted.
The stage is moved back to the initial position where it was before the procedure.
Figure 4. Lamella milling. a). Scanning electron microscope (SEM) image of an AutoGrid aligned with the incident direction of the ion beam. b). The AutoGrid is centered at the GIS position in the SEM image and the GIS needle is inserted. c). SEM image of a TEM grid with Chlamydomonas cells. d). SEM image of two target Chlamydomonas cells before FIB milling. e). FIB-induced secondary electron (FIB SE) image of the two target cells with two rectangle standard milling patterns as a starting point for the milling procedure. f). FIB SE image showing the milling step at 50pA where patterns on both sides are made slimmer (but pattern width remains constant) and shifted closer to the lamella edge. g, i). FIB SE and h) SEM images of the finished lamella after cryo-FIB milling. See Video 1 for an overview of cryo-FIB milling.
Video 1. Cryo-FIB milling of a vitreous Chlamydomonas cell
The stage is tilted to the milling position with the ion beam almost parallel (typically 6 to 12°) to the grid surface. For a shuttle that is 7° pre-tilted, and a desired milling angle of 10° with respect to TEM grid surface, the stage is tilted to 17°.
The ion beam parameters are set to: 30.0 kV beam energy, 10 pA beam current, 1,024 x 884 or 1,536 x 1,024 scan resolution, 1 µs dwell time.
The focus and astigmatism of the ion beam are adjusted while scanning the grid bar at increased zoom.
A target cell is localized in both electron and ion beam images (Figure 4c-e).
Note: The three meshes closest to the edge of the TEM grid are often not accessible in the TEM microscope. Generally, central meshes are preferred.
The eucentric height is adjusted using stage movement in the z-direction so that the ion beam and the electron beam show the same sample surface.
Note: The eucentric height must be separately adjusted for each milling position.
Two parallel rectangular standard milling patterns are drawn (Figure 4e). With pre-tilt correction disabled, the size of the pattern is approximately 10 x 6 µm and the distance between the patterns is more than 5 µm. The milling direction is set to top-to-bottom for one pattern and to bottom-to-top for the other, so that the milling direction of the pattern is always towards the lamella edge. The milling parameters are set to: Ice material (or Si), 1 µs dwell time, 60% overlap.
The ion beam current is changed to 0.3 nA, and a fast single scan is taken (50 ns dwell time) to verify the proper milling position.
The milling process is started. The milling is stopped as soon as the material is completely removed, as observed by live imaging of the scanned area.
Iteratively, the beam current is reduced, pattern heights on both sides are made slimmer (while keeping pattern widths constant) and patterns are shifted closer to the lamella edge (Figure 4f and Video 1). Typical steps for the beam current are 0.1 nA, 50 pA and then 30 pA.
At a sample thickness of about 500 nm, the final milling is performed using 30 pA and optionally the cleaning-cross-section pattern. The target lamella thickness is between 300 and 100 nm (Figure 4g). During this step, thickness is estimated using electron images (Figure 4h-i).
It is possible to prepare multiple lamellas (~10) during one FIB session. For each new lamella, first set the ion beam current back to 10 pA and then repeat steps B4p-v).
Note: To minimize time-dependent ice contamination, it is recommended to perform steps B4p-U at all sample locations first, then afterwards perform step B4v for each lamella.
Shuttle transfer out of the FIB
The column valves are closed (“Beam on\off” buttons, or “Sleep” button to end the FIB session).
The stage is moved to the transfer position.
The loading box is filled with liquid nitrogen and then placed onto the pumping station.
The transfer unit is docked to the airlock of the FIB.
The airlock is pumped to the vacuum level required to safely open the airlock valves. The airlock valves and the transfer unit valve are then opened.
The shuttle is retrieved from the cryo-stage with the insertion rod and retracted out of the FIB chamber into the transfer unit.
The airlock valves and the transfer unit valve are closed.
The airlock is vented.
The transfer unit is attached to the loading box.
The loading station is pumped for 50 sec. Then the transfer unit valve is opened, and the shuttle is inserted into the loading box with the liquid nitrogen. The pumping is stopped and the loading station is vented.
The insertion rod is detached from the shuttle and the transfer unit is removed.
AutoGrids are removed from the shuttle and stored under liquid nitrogen in storage boxes suitable for AutoGrids.
Warming the FIB system
The cooling rod is taken out of the liquid nitrogen Dewar.
When the cryo-stage and anti-contaminator have reached a temperature of about 20 °C, the gas flow is decreased to 0.5 L/min.
Cryo-ET
The AutoGrid sample is loaded into the cryo-TEM microscope under cryo conditions using the standard procedure (see FEI user manual). When loading the AutoGrid, the AutoGrid cutout (and thus the milling direction of the lamellas) must be aligned perpendicular to the tilt axis of the stage.
The lamella positions are localized using low magnification imaging.
Tilt-series acquisition is performed using SerialEM software under low-dose conditions (<100 e/Å2 cumulative dose). K2 images are recorded at 2° tilt increments, with −4 μm to −8 μm defocus, typically with pixel sizes of 3 to 5 Å.
Representative data
Figure 5 shows examples of final cryo-FIB-prepared lamellas of Chlamydomonas and yeast cells. Samples of this quality are reproducibly produced by the described technique (Rigort et al., 2012) and have been used for data collection published elsewhere (Engel et al., 2014; Villa et al., 2013).
Figure 5. TEM images of final lamellas. a) Cross-section of a Chlamydomonas cell, with a lamella thickness of 100 nm. b) Cross-section through several yeast cells, with a lamella thickness of 250 nm.
Recipes
YPD liquid medium
1% yeast extract
2% peptone
2% D-glucose
Sterilize by autoclaving
Acknowledgments
We thank Alexander Rigort and Felix Bäuerlein for their contributions to developing the cryo-FIB technique (Rigort et al., 2012), and Elizabeth Villa for fruitful scientific discussions. This work was supported by the European Commission's 7th Framework Programme grant agreements ERC-2012-SyG_318987-ToPAG and HEALTH-F4-2008-201648/PROSPECTS, the Deutsche Forschungsgemeinschaft Excellence Clusters CIPSM and SFB 1035, the Federal Ministry of Education and Research (BMBF), an inter-institutional research initiative of the Max Planck Society, a postdoctoral research fellowship from the Alexander von Humboldt Foundation (to BDE), and by EMBO and HFSP postdoctoral research fellowships.
References
Engel, B. D., Schaffer, M., Kuhn Cuellar, L., Villa, E., Plitzko, J. M. and Baumeister, W. (2015). Native architecture of the Chlamydomonas chloroplast revealed by in situ cryo-electron tomography. Elife 4: e04889.
Harris, E. H., Stern, D. B. and Witman, G. B. (2009). The chlamydomonas sourcebook. Academic Press, Elsevier, 2000.
Hayles, M. F., Stokes, D. J., Phifer, D. and Findlay, K. C. (2007). A technique for improved focused ion beam milling of cryo-prepared life science specimens. J Microsc 226(Pt 3): 263-269.
Iancu, C. V., Tivol, W. F., Schooler, J. B., Dias, D. P., Henderson, G. P., Murphy, G. E., Wright, E. R., Li, Z., Yu, Z., Briegel, A., Gan, L., He, Y. and Jensen, G. J. (2006). Electron cryotomography sample preparation using the Vitrobot. Nat Protoc 1(6): 2813-2819.
Mastronarde, D. N. (2005). Automated electron microscope tomography using robust prediction of specimen movements. J Struct Biol 152(1): 36-51.
Rigort, A., Villa, E., Bauerlein, F. J., Engel, B. D. and Plitzko, J. M. (2012). Integrative approaches for cellular cryo-electron tomography: correlative imaging and focused ion beam micromachining. Methods Cell Biol 111: 259-281.
Umen, J. G. and Goodenough, U. W. (2001). Control of cell division by a retinoblastoma protein homolog in Chlamydomonas. Genes Dev 15(13): 1652-1661.
Villa, E., Schaffer, M., Plitzko J. M. and Baumeister, W. (2013). Opening windows into the cell: Focused-ion-beam milling for cryo-electron tomography. Curr Opin Struc Biol 23(5), 771–777.
Copyright: Schaffer et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Schaffer, M., Engel, B. D., Laugks, T., Mahamid, J., Plitzko, J. M. and Baumeister, W. (2015). Cryo-focused Ion Beam Sample Preparation for Imaging Vitreous Cells by Cryo-electron Tomography. Bio-protocol 5(17): e1575. DOI: 10.21769/BioProtoc.1575.
Engel, B. D., Schaffer, M., Kuhn Cuellar, L., Villa, E., Plitzko, J. M. and Baumeister, W. (2015). Native architecture of the Chlamydomonas chloroplast revealed by in situ cryo-electron tomography. Elife 4: e04889.
Download Citation in RIS Format
Category
Plant Science > Phycology > Cell analysis
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,576
|
https://bio-protocol.org/exchange/protocoldetail?id=1576&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Poly (A) RNA in Mesophyll Cells of Nicotiana benthamiana Using in situ Hybridization
Yuri Mizuno
Daigo Takemoto
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1576 Views: 8559
Edited by: Zhaohui Liu
Reviewed by: Pablo Bolanos-VillegasNing Liu
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Export of transcribed mRNAs from nucleoplasm to cytosol is an essential process for the translation of genes into proteins. This process is tightly regulated by nuclear pores, composed of about 30 nucleoporin proteins (Nups). Whether or not the mRNAs are able to be appropriately exported to cytoplasm is of an importance for understanding the role of Nups. Here, we describe a practical protocol to detect the intracellular localization of mRNAs in mesophyll cells of Nicotiana benthamiana (N. benthamiana). This protocol is based on poly (A) in situ hybridization method using an oligo d(T) probe conjugated with Alexa Fluor-488.
Keywords: poly (A) in situ hybridization Nicotiana benthamiana Virus-induced gene silencing nucleoporin mRNAs
Materials and Reagents
Leaves of 3-4 weeks old wild type or Nup gene silenced N. benthamiana
Notes:
a.This method can be applied for other dicot plants with relatively soft leaves.
b.For Virus-induced gene silencing (VIGS) of N. benthamiana. See Zhang and Liu (2014).
10 µM 48-mer oligo d(T) 5’-labeled with Alexa Fluor-488, HPLC-purified [purchased from custom oligo services (e.g. Eurofins Genomics)]
Note: Dissolved in TE (Tris-EDTA) buffer and store at -80 °C, shaded.
99.8% Methanol (4 ml per sample) (Wako pure chemical, special glade, catalog number: 131-01826 )
99.5% Ethanol (5 ml per sampl) (Wako pure chemical, special glade, catalog number: 057-00456 )
99.5% Ethanol/Xylene (1:1 v/v, 1 ml per sample) (Wako pure chemical, special glade, catalog number: 244-00086 )
99.8%Methanol/Fixation solutionB (1:1 v/v, 1 ml per sample)
PerfectHyb Plus Hybridization Buffer (2 ml per sample) (Sigma-Aldrich, catalog number: H7033 )
Fixation cocktail (see Recipes)
Fixation solution A (see Recipes)
Fixation solution B (see Recipes)
Equipment
3 ml vial containers
Rotary shaker (e.g. BioCraft, model: BC-730 )
Hybridization oven or incubator (50 °C) with rotary shaker (e.g. TAITEC, model: BR-23FP MR )
Confocal laser-scanning microscope (preferred) or ordinary fluorescent microscope with the filter set for GFP or Alexa Fluor-488 (e.g. Olympus, model: FV1000-D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Cell staining
Plant Science > Plant molecular biology > RNA
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,577
|
https://bio-protocol.org/exchange/protocoldetail?id=1577&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Non-Radioactive Method for Measuring PP2A Activity in Plants
Jian Chen
GS Guoxin Shen
Hong Zhang
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1577 Views: 8423
Edited by: Tie Liu
Reviewed by: Harrie van Erp
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Protein phosphatase 2A (PP2A) is a group of important cellular regulators in eukaryotes that dephosphorylate more than 30% of cellular proteins whose activities are turned on or off by phosphorylation. In plants, PP2A was found to regulate critical components involved in plant growth and development, and in response to biotic and abiotic stresses. Therefore, determining the PP2A activities at different developmental stages, in different tissues, or in various mutants is critical in order to understand the functions of PP2A in plants. Traditional PP2A enzyme assay uses radioactive isotope and often take days to finish. This PP2A enzyme assay described here is a method to determine PP2A activity without using radioactive materials in less than 6 h.
Keywords: PP2A activity Plant PP2A PP2A holoenzyme
Materials and Reagents
Serine/Threonine Phosphatase Assay Kit (Promega Corporation, catalog number: V2460 )
Protein Assay Dye Reagent (Bio-Rad Laboratories, AbD Serotec®, catalog number: 500-0006 )
Protein Phosphatase (PPase) Inhibitor 2 (I-2) (New England BioLabs, catalog number: P0755S )
Liquid nitrogen (N2)
Tris (pH 7.0) (Thermo Fisher Scientific, catalog number: BP152-5 )
EDTA (Thermo Fisher Scientific, catalog number: S312-12 )
DTT (Sigma-Aldrich, catalog number: D0632 )
Brij 35 (Thermo Fisher Scientific, catalog: BP345-500 )
1x PP2A assay buffer (see Recipes)
Equipment
Tabletop centrifuge for 96-well plate (Eppendorf, model: 5810R )
Centrifuge at 4 °C or in cold-room (Eppendorf, model: 5415D )
Microplate reader (xMark™ Microplate Absorbance Spectrophotometer) (Bio-Rad Laboratories, catalog number: 1681150 )
Pestle and mortar
37 °C waterbath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Chen, J., Shen, G. and Zhang, H. (2015). A Non-Radioactive Method for Measuring PP2A Activity in Plants. Bio-protocol 5(17): e1577. DOI: 10.21769/BioProtoc.1577.
Chen, J., Hu, R., Zhu, Y., Shen, G. and Zhang, H. (2014). Arabidopsis PHOSPHOTYROSYL PHOSPHATASE ACTIVATOR is essential for PROTEIN PHOSPHATASE 2A holoenzyme assembly and plays important roles in hormone signaling, salt stress response, and plant development. Plant Physiol 166(3): 1519-1534.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,578
|
https://bio-protocol.org/exchange/protocoldetail?id=1578&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Post-crystallization Improvement of RNA Crystals by Synergistic Ion Exchange and Dehydration
Jinwei Zhang
Adrian R. Ferré-D’Amaré
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1578 Views: 7999
Edited by: Arsalan Daudi
Reviewed by: Smita Nair
Original Research Article:
The authors used this protocol in Sep 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2014
Abstract
Compared to the recent dramatic growth in the numbers of genome-wide and functional studies of complex non-coding RNAs, mechanistic and structural analyses have lagged behind. A major technical bottleneck in the structural determination of large RNAs and their complexes is preparation of diffracting crystals. Empirically, a vast majority of such RNA crystals fail to diffract X-rays to usable resolution (~4 Å) due to their inherent disorder and non-specific packing within the crystals. Here, we present a protocol that combines post-crystallization cation replacement and dehydration that dramatically improved the diffraction quality of crystals of a large gene-regulatory mRNA-tRNA complex. This procedure not only extended the resolution limit of X-ray data from 8.5 to 3.2 Å, but also significantly improved the quality of the data, enabling de novo phasing and structure determination. Because it exploits the general importance of counterions and solvation in RNA structure, this procedure may prove broadly useful in the crystallographic analyses of other large non-coding RNAs.
Keywords: RNA crystallography Dehydration Post-crystallization treatment T-box riboswitch TRNA
Materials and Reagents
Oligonucleotides for PCR amplification (IDT DNA Technologies)
Taq DNA polymerase (5,000 U/ml) (New England Biolabs, catalog number: M0273L )
T7 RNA polymerase (50,000 U/ml) (New England Biolabs, catalog number: M0251L )
Diethylpyrocarbonate (DEPC) (catalog number: D5758 )-treated water
Note: DEPC is a toxic alkylating agent and should be handled with appropriate personal protective equipment in a chemical fume hood (Rupert et al., 2004).
KCl (Thermo Fisher Scientific, catalog number: P333-500 )
MgCl2.6H2O (Sigma-Aldrich, catalog number: M9272-1KG )
CaCl2.2H2O (Sigma-Aldrich, catalog number: 223506 )
SrCl2.6H2O (J.T. Baker, catalog number: 4036-01 )
BaCl2.2H2O (Sigma-Aldrich, catalog number: 217565 )
UltraPure Low-melting-point agarose (Life Technologies, InvitrogenTM, catalog number: 15517-014 )
Neutralized tris (2-carboxyethyl) phosphine (TCEP) (Life Technologies, catalog number: 20490 )
Spermine tetrahydrochloride (Sigma-Aldrich, catalogue number: S1141 )
Polyethylene Glycol 3350 monodisperse (PEG3350) (Hampton Research, catalog number: HR2-591 )
Tris base (Thermo Fisher Scientific, catalog number: BP152-10 )
Boric acid (Thermo Fisher Scientific, catalog number: A73-1 )
EDTA (Thermo Fisher Scientific, catalog number: BP118-500 )
Urea (Thermo Fisher Scientific, catalog number: U17-12 )
RNA binding buffer (see Recipes)
20 mM spermine solution (see Recipes)
Crystallization solution (see Recipes)
Crystal treatment solutions (see Recipes)
Equipment
EasyXtal 15-Well Tool (QIAGEN, catalog number: 132007 )
9-well glass depression plate (Hampton Research, catalog number: HR3-134 )
MicroSieves and MicroSaws (MiTeGen, catalog number: T2-L25-A1 )
90° angled MicroLoops or MicroMounts (MiTeGen, catalog number: M5-L18SP-A2LD or M2-L18SP-A2 )
BioRad C1000 Touch PCR thermocycler (Bio-Rad Laboratories, catalog number: 1851197 )
37 °C Heat Block (Eppendorf Thermomixer, catalog number: 022670107 )
Urea polyacrylamide gel electrophoresis system (CBS Scientific custom)
Handheld UV lamp for UV shadowing (Spectroline, model: EF 140C )
Whatman Elutrap RNA Electroelution System (GE Healthcare Dharmacon, catalog number: 10447705 )
Amicon Ultra centrifugal concentrators (10 kD MWCO, 0.5 ml) (Millipore, catalog number: UFC5010BK )
Leica Stereo microscope (Leica, model: M80 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Zhang, J. and Ferré-D’Amaré, A. R. (2015). Post-crystallization Improvement of RNA Crystals by Synergistic Ion Exchange and Dehydration. Bio-protocol 5(17): e1578. DOI: 10.21769/BioProtoc.1578.
Download Citation in RIS Format
Category
Biochemistry > RNA > RNA structure
Molecular Biology > RNA > RNA structure
Molecular Biology > RNA > RNA synthesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,579
|
https://bio-protocol.org/exchange/protocoldetail?id=1579&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Real-time Measurement of the Intra-bacterial Redox Potential
JH Joris van der Heijden
BF B. Brett Finlay
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1579 Views: 8732
Edited by: Arsalan Daudi
Reviewed by: Daan C. Swarts
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
All bacteria that live in oxygenated environments have to deal with oxidative stress caused by some form of exogenous or endogenous reactive oxygen species (ROS) (Imlay, 2013). Large quantities of ROS damage DNA, lipids and proteins which can eventually lead to bacterial cell death (Imlay, 2013). In contrast, smaller quantities of ROS can play more sophisticated roles in cellular signalling pathways affecting almost every process in the bacterial cell e.g. metabolism, stress responses, transcription, protein synthesis, etc. Previously, inadequate analytical methods prevented appropriate analysis of the intra-bacterial redox potential. Herein, we describe a method for the measurement of real-time changes to the intra-bacterial redox potential using redox-sensitive GFP (roGFP2) (van der Heijden et al., 2015). The roGFP2 protein is engineered to contain specific cysteine residues that form an internal disulfide bridge upon oxidation which results in a slight shift in protein conformation (Hanson et al., 2004). This shift results in two distinct protein isoforms with different fluorescence excitation spectra after excitation at 405 nm and 480 nm respectively. Consequently, the corresponding 405/480 nm ratio can be used as a measure for the intra-bacterial redox potential. The ratio-metric analysis excludes variations due to differences in roGFP2 concentrations and since the conformational shift is reversible the system allows for measurement of oxidizing as well as reducing conditions. In this protocol we describe the system by measuring the intra-bacterial redox potential inside Salmonella typhimurium (S. typhimurium) however this system can be adjusted for use in other Gram-negative bacteria.
Materials and Reagents
LB broth (Miller) (Sigma-Aldrich, catalog number: MKBS8229V )
Salmonella typhimurium (SL1344)
Carbenicillin (Goldbio, catalog number: 4800-94-6 ) [stock solution 100 mg/ml in 50% water/methanol (v/v) kept at -20 °C]
Saline (sodium chloride) (Sigma-Aldrich, catalog number: S9888 ) [0.9% sodium chloride in sterile water (w/w)]
Hydrogen peroxide [30% (w/w)] (Sigma-Aldrich, catalog number: 026K3770 )
Dithiothreitol (AMRESCO, catalog number: 0363C45 ) (stock solution 1 M in sterile water kept at -20 °C)
pfpv25-roGFP2 vector (available by contacting bfinlay@interchange.ubc.ca) (van der Heijden et al., 2015)
10% glycerol in sterile water (v/v) (glycerol) (Sigma-Aldrich, catalog number: G5516 )
Agar (Sigma-Aldrich, catalog number: A5306 )
125 ml flasks (VWR International, catalog number: 89090-316 )
1.5 ml sterile Eppendorf tubes (VWR International, catalog number: 89000-028 )
10% glycerol in sterile water
Luria Broth (see Recipes)
Equipment
Black, 96-well assay plate with flat clear bottom (Corning, Costar®, catalog number: 3631 )
37 °C incubator/shaker (New Brunswick Scientific, model: M1025-0000 )
Electroporator (Bio-Rad Laboratories, catalog number: 165-2100 )
Fluorescent plate reader (Tecan Trading AG, model: Infinite M200 ) or comparable device able to measure 96-well plates at 37 °C, excitation at 405 nm and 480 nm, emission at 510 nm
Spectrophotometer (Thermo Fisher Scientific, model: spectronic 200 )
20-200 μl Multichannel pipet (Rainin, model: L12 200R )
Electroporation cuvettes (gap size 1 mm) (VWR International, catalog number: 89047-206 )
Microcentrifuge (Thermo Fisher Scientific, catalog number: 75003424 )
10 ml glass culture tube (VWR International, catalog number: 47729-574 )
Software
For fluorescent plate reader (Magellan 7)
Note: This software comes with the Tecan fluorescent plate reader. If a different plate reader is used, software comparable to Magellan 7 can be used for data acquisition of fluorescence measurements.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Reactive oxygen species
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
158
|
https://bio-protocol.org/exchange/protocoldetail?id=158&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
VSVG Psudotyped Retrovirus Production
Jia Li
Published: Dec 5, 2011
DOI: 10.21769/BioProtoc.158 Views: 18002
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
Retrovirus vector pseudotyped with vesicular stomatitis virus G (VSV-G) protein has been proven to exhibit high efficiency to deliver genes in a variety of cells. Efficiency is affected by relative cell growth rate and phosphatidylserine level on the cell membrane.
Materials and Reagents
Dulbecco's modified eagle medium (DMEM) (Life Technologies, Gibco®, catalog number: 11995-065 )
Fetal bovine serum (FBS) (Gemini Bio-Products, catalog number: 900-108 )
Penicillin/streptomycin solution (Life Technologies, Gibco®, catalog number: 15140-122 )
NaCl (Sigma-Aldrich, catalog number: S7653 )
HEPES (Sigma-Aldrich, catalog number: H7523 )
Na2HPO4 (Sigma-Aldrich, catalog number: S7907 )
CaCl2 (Sigma-Aldrich, catalog number: C5080 )
Chloroquine (Sigma-Aldrich, catalog number: C6628 )
Sodium butyrate (Sigma-Aldrich, catalog number: B5887 )
Gag/pol (Cell Biolabs, catalog number: RV-111 )
VSVG and retrovirus vector (Clontech, catalog number: 631512 )
Calcium-phosphate (Ca-P) transfection solution (see Recipes)
2x HeBS (pH 7.0) (see Recipes)
DMEM culture medium (see Recipes)
Equipment
24-Well plate
Centrifuges
Water bath
10 cm tissue culture plate
0.45 micro filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Li, J. (2011). VSVG Psudotyped Retrovirus Production. Bio-101: e158. DOI: 10.21769/BioProtoc.158.
Download Citation in RIS Format
Category
Molecular Biology > RNA > Transfection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,580
|
https://bio-protocol.org/exchange/protocoldetail?id=1580&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Hydroquinone Dioxygenase Activity
SM Stefano Mancini
MS Marc Solioz
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1580 Views: 7435
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
We recently demonstrated the presence of a quinone detoxification pathway present in Firmicutes. It is based on two enzyme activities, namely a hydroquinone dioxygenase, YaiA, described here, and a hydroquinone reductase, YaiB, described in a separate protocol. In Lactococcus lactis (L. lactis), these enzymes are encoded by the yahCD-yaiAB operon. The operon is induced by copper to prevent the synergistic toxicity of quinones and copper. The hydroquinone dioxygenase, YaiA, converts hydroquinones to 4-hydroxymuconic semialdehyde, using molecular oxygen as oxidant according to the reaction: hydroquinone + O2 → 4-hydroxymuconic semialdehyde + H+ We here describe two methods for measurements for hydroquinone dioxygenase activity, based on oxygen consumption measured with an oxygen electrode and the spectrophotometric detection of 4-hydroxymuconic semialdehyde. Both assays are conducted with crude cell extracts.
Materials and Reagents
Hydroquinone dioxygenase from an Escherichia coli (E. coli) strain heterologously overexpressing such an enzyme from a plasmid (Mancini et al., 2015)
Hydroquinone (100 mM in ethanol) (Sigma-Aldrich, catalog number: H9003 )
50 mM Tris-Cl [pH 7.5, 10% (v/v) glycerol]
20 mM Tris-Cl (pH 7.5)
10 mg/ml DNaseI (Sigma-Aldrich, catalog number: 11284932001 )
10 mM isopropyl-b-D-thiogalactoside (Sigma-Aldrich, catalog number: I6758 )
100 mM 4-hydroxybenzoate (Sigma-Aldrich, catalog number: H5501 )
100 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich, catalog number: P7626 )
1 mM phenylmethylsulfonyl fluoride (Roche Diagnostics)
Nitrocellulose filters (0.45 μm pore size)
100 mM hydroquinone (see Recipes)
50 mM Tris-Cl (see Recipes)
20 mM Tris-Cl (see Recipes)
10 mg/ml DNaseI (see Recipes)
10 mM isopropyl-β-D-thiogalactoside (see Recipes)
100 mM 4-hydroxybenzoate (see Recipes)
100 mM phenylmethylsulfonyl fluoride (see Recipes)
Equipment
Thermostated spectrophotometer (Shimadzu, model: UV2600 or similar)
Clark electrode (Warner Instruments, model: 1302 or any other commercial oxygraph)
French Press
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Mancini, S. and Solioz, M. (2015). Determination of Hydroquinone Dioxygenase Activity. Bio-protocol 5(17): e1580. DOI: 10.21769/BioProtoc.1580.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,581
|
https://bio-protocol.org/exchange/protocoldetail?id=1581&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Quinone Reductase Activity
SM Stefano Mancini
MS Marc Solioz
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1581 Views: 8153
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Feb 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2015
Abstract
We recently demonstrated the presence of a quinone detoxification pathway present in Firmicutes. It is based on two enzyme activities, namely a quinone reductase, YaiB, described here, and a hydroquinone dioxygenase, YaiA, described in a separate protocol. In Lactococcus lactis (L. lactis), these enzymes are encoded by the yahCD-yaiAB operon. The operon is induced by copper to prevent the synergistic toxicity of quinones and copper. The quinone reductase, YaiB, reduces p-benzoquinone and a range of quinone derivatives to hydroquinone, using NADPH as a reductant, according to the reaction: p-benzoquinone + NADPH + H+ → hydroquinone + NADP+. We here describe the measurement of quinone reductase activity, based on the spectrophotometric measurement of NADPH-oxidation.
Materials and Reagents
Quinone reductase purified from Escherichia coli (E. coli) by Ni-NTA chromatography as described in Mancini et al. (2015).
p-Benzoquinone (Sigma-Aldrich, catalog number: B10358 )
Note: optionally other quinone substrates like 1, 4-penzoquinone, 2-methyl-1, 4-benzoquinone, 2, 5-dimethyl-1, 4-benzoquinone, menadione, naphthoquinone, or 2, 6-dichloro-1, 4-benzoquinone, all available from Sigma-Aldrich.
50 mM NADPH in water; prepare on the day of use (Sigma-Aldrich, catalog number: N5130 )
20 mM Tris-Cl buffer (pH 7.5)
Flavin mononucleotide (Sigma-Aldrich, catalog number: F1392 )
p-Benzoquinone (see Recipes)
NADPH (see Recipes)
20 mM Tris-Cl (see Recipes)
100 µM flavin mononucleotide (see Recipes)
Equipment
Thermostated spectrophotometer (Shimadzu, model: UV2600 or similar)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Mancini, S. and Solioz, M. (2015). Determination of Quinone Reductase Activity. Bio-protocol 5(17): e1581. DOI: 10.21769/BioProtoc.1581.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,582
|
https://bio-protocol.org/exchange/protocoldetail?id=1582&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
[14C]-Tryptophan Metabolic Tracing in Liver Cancer Cells
Krishna S. Tummala
Nabil Djouder
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1582 Views: 8924
Edited by: Jia Li
Reviewed by: Shannon RuppertYong Teng
Original Research Article:
The authors used this protocol in Dec 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2014
Abstract
Nicotinamide adenine dinucleotide (NAD+) is a coenzyme for many NAD+-consuming proteins with diverse biological functions. Oscillations in NAD+ levels may influence several cellular signaling pathways. NAD+ synthesis via Preiss-Handler route (salvage reactions) has been extensively reported. However, the contribution of L-tryptophan/kynurenine catabolism in de novo NAD+ synthesis is poorly understood. Using L-[14C]-tryptophan tracing in four liver cancer cell lines and siRNA-mediated silencing of arylformamidase (AFMID), a key enzyme involved in L-tryptophan degradation, we demonstrate the contribution of L-tryptophan catabolism in de novo synthesis of NAD+ pools. NAD+ modulation is therefore important in maintaining cellular homeostasis and appropriate cellular functions according to nutrients availability.
Keywords: Kynurenine pathway De novo NAD+ synthesis [14C]-Tryptophan metabolic tracing Arylformamidase (AFMID) Liver cancer
Materials and Reagents
Liver cancer cell lines: Huh-7 (JCRB, catalog number: JCRB0403 ), HepG2 (ATCC, catalog number: HB-8065 ), SNU-398 (ATCC, catalog number: CRL-2233 ), and SNU-449 (ATCC, catalog number: CRL-2234 )
DMEM (Life technologies)
RPMI (Life technologies)
Amino acid free medium and without fetal bovine serum called Hanks’ Balanced Salt Solution (HBSS) (Sigma-Aldrich)
Fetal bovine serum (Cultek)
Penicilin and streptocmycin (Life Technologies, Gibco®)
100x Non-essential amino acids’ solution (Life technologies)
RNAiMAX (Life Technologies, InvitrogenTM, catalog number: 13778030 )
OptiMem (Life Technologies, catalog number: 11058021 )
Non silencing small interference RNA control (siCtl) and small interference RNA Arylformamidase (siAFMID) (GE Healthcare Dharmacon, catalog number: L-HUMAN-XX-0005 5 nmol )
NAD+-[carbonyl-14C] (Perkin Elmer, catalog number: NEC831010UC )
L-[benzene-ring-U-14C]-tryptophan (Moravek, catalog number: MC 2335 )
PEI-cellulose thin layer chromatography (TLC) (F plates of 20 x 20 cm) (Merk Millipore catalog number: 105725 )
Ammonium acetate (Sigma-Aldrich, catalog number: A1542 )
Ethanol and methanol (Sigma-Aldrich)
NAD+-[carbonyl-14C] (see Recipes)
L-[benzene-ring-U-14C]-tryptophan (see Recipes)
Cell density (around 60-80%) (see Recipes)
Equipment
Phosphor-image reader (Molecular Dynamics, model: Storm820 )
Phosphor-image screen (GE Healthcare Dharmacon, catalog number: 63-0034-79 )
Speedvac centrifuge (Thermo Fisher Scientific)
4 °C table top centrifuge (Eppendorf, model: 5424R )
Fume hood to handle radioactive materials
Cell scrapers (Corning Incorporated, catalog number: 3008 )
Ruler
Software
Fiji software (www.fiji.sc/Fiji)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Tummala, K. S. and Djouder, N. (2015). [14C]-Tryptophan Metabolic Tracing in Liver Cancer Cells. Bio-protocol 5(17): e1582. DOI: 10.21769/BioProtoc.1582.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Cell Biology > Cell metabolism > Amino acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,583
|
https://bio-protocol.org/exchange/protocoldetail?id=1583&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Bioimaging Pipeline to Show Membrane Trafficking Regulators Localized to the Golgi Apparatus and Other Organelles in Plant Cells
Satoshi Naramoto
TD Tomoko Dainobu
MO Marisa S. Otegui
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1583 Views: 9221
Edited by: Arsalan Daudi
Reviewed by: Renate Weizbauer
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
The plant Golgi apparatus is composed of numerous stacks of cisterna, designated as cis, medial, and trans Golgi cisternae; these stacks move within the cytoplasm along the actin cytoskeleton. Cis cisternae receive secretory products from endoplasmic reticulum (ER) and they subsequently progress through the stack to the trans cisternae, where they are sorted to other destinations, including cell wall, plasma membrane (PM), vacuoles, and chloroplasts. In addition, the plant Golgi apparatus plays a role of glycosylating proteins as well as synthesizing cell wall polysaccharides, such as hemicelluloses and pectins. This protocol describes procedures for imaging fluorescently-tagged proteins localized to the plant Golgi apparatus of Arabidopsis seedlings using confocal laser microscopy (CLSM), total internal reflection fluorescence microscope (TIRF), and immunogold labeling of high-pressure frozen/freeze substituted samples by transmission electron microscopy (TEM). We particularly focus on long-term time lapse imaging and protein localization in subdomains within the Golgi. This protocol can be also used for other organelles, tissues, and plant species.
Materials and Reagents
½X Murashige and Skoog (MS) medium (Sigma-Aldrich, catalog number: M5519 )
Bacto Agar [Becton, Dickinson and Company (BD), catalog number: 2140101 ]
Arabidopsis thaliana seedlings, expressing Golgi-localized proteins fused to a fluorescent protein (e.g. 35S::ST-mRFP in Col, 35S::ERD2-GFP in Col, pGNL1:: GNL1-YFP in gnl1, pGNOM::GNOM-GFP in gnom)
Inhibitors [such as BrefeldinA (BFA) (Sigma-Aldrich, catalog number: B7651 ), monensin (Sigma-Aldrich, catalog number: M5273 ), salinomycin (Sigma-Aldrich, catalog number: S4526 )]
Dimethyl sulfoxide (DMSO) (Wako Chemicals USA, catalog number: 046-2198 )
Freezing planchets type B (Ted Pella, catalog number: 39201 )
Sucrose (Wako Chemicals USA, catalog number: 196-00015 )
1.8 ml cryovials [for example: Nunc® cryotubes (Sigma-Aldrich, catalog number: V7884-450EA )]
Methacrylate-based resin (Lowicryl HM20 resin kit) (Electron Microscopy Sciences, catalog number: 14340 )
Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, catalog number: S8282-500G )
Sodium phosphate dibasic (Na2HPO4) (Sigma-Aldrich, catalog number: S7907-100G )
Liquid nitrogen
0.5% Formvar solution (Electron Microscopy Sciences, catalog number: 15820 )
Tween-20 (Sigma-Aldrich, catalog number: P1379-25ML )
Primary antibodies against fluorescent tag [e.g. green fluorescent proteins(GFP)]
Secondary antibodies conjugated to gold nanoparticles (5, 10, or 15 nm in diameter)
Cryo-substitution solution (see Recipes)
Lead citrate (see Recipes)
Uranyl actetate solution (see Recipes)
Phosphate-buffer saline (PBS) stock solution (10x) (see Recipes)
0.1% Tween-20 in PBS (PBS-T-0.1%) (see Recipes)
0.5% Tween-20 in PBS (PBS-T-0.5%) (see Recipes)
Blocking buffer (see Recipes)
HM20 resin solutions (see Recipes)
Equipment
Coverwell® silicone imaging chambers (2.5 mm deep, 20 mm diameter) (Electron Microscopy Sciences, catalog number: 70326-16 )
Nickel slot grids (Electron Microscopy Sciences, catalog number: 2015-Ni )
0.12-0.17 mm thick coverslips (Matsunami Glass, catalog number: C022221 )
Light Forceps (Hammacher, catalog number: HWC 118-10 )
Lab-Tek Chambered Coverglass (Thermo Fisher Scientific, catalog number: 155361 )
0.9-1.2 mm thick Glass slides (Matsunami Glass, catalog number: S24410 )
Parafilm
22 °C plant growing chamber
Inverted confocal Microscope (Olympus, model: FV1200 )
Note: equipped with 473 nm or 559 nm diode laser and with water immersion 63x / 1.20 numerical aperture objectives or oil immersion 100x / 1.40 numerical aperture objectives
TIRF Microscope equipped with oil immersion CFI Apo TIRF 100x H / 1.49 numerical aperture objectives (Nikon, model: Eclipse TE2000-E with TIRF2 system)
High-pressure freezer (Leica, model: EM HPM100 or Bal-tec/RMC/ABRA Fluid AG, model: HPM 010 )
Automated freeze-substitution and low-temperature resin embedding/polymerization system (for example, Leica, model: AFS2 )
Ultramicrotome (for example, Leica, model: EM UC7 ultramicrotome )
Glass knife maker (for example, Leica, model: EM KMR3 )
Ultra 45° diamond knife or other types of wet diamond knives (Diatome AG)
Transmission electron microscope (for example, FEI, model: Tecnai 12 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Naramoto, S., Dainobu, T. and Otegui, M. S. (2015). A Bioimaging Pipeline to Show Membrane Trafficking Regulators Localized to the Golgi Apparatus and Other Organelles in Plant Cells. Bio-protocol 5(17): e1583. DOI: 10.21769/BioProtoc.1583.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Confocal microscopy
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,584
|
https://bio-protocol.org/exchange/protocoldetail?id=1584&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chitin-challenged Mice Model to Study M2 Macrophages Polarization
Lidia Jiménez-García
SH Sandra Herránz
Alfonso Luque
Sonsoles Hortelano
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1584 Views: 9141
Edited by: Ivan Zanoni
Reviewed by: Sabine Le Saux
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Chitin is a key component of insects, fungi, and house-dust mites. Chitin has been shown to induce M2-type immune responses in vivo. Intranasal or intraperitoneal (i.p.) administration of chitin particles results in infiltration of eosinophils to the local sites and activation of macrophages with a M2 phenotype. Chitin-challenged mice model can be used to induce M2 macrophages polarization and thus to analyze the M2 phenotype from isolated peritoneal cells.
Keywords: Chitin Macrophages M2 polarization Mice
Materials and Reagents
Mice C57BL/6 male (age 8-12 weeks)
Chitin (Sigma-Aldrich, catalog number: C9752 )
70% ethanol
PBS (Lonza, catalog number: BE 17-515Q )
70 μm sterile cell strainers (BD Biosciences, catalog number: 352350 )
RPMI 1640 (Lonza, catalog number: BE 12-115F )
10 ml syringe
21 G Needles
25 G Needles
15 ml conical tubes
Equipment
Sonication bath, P-selecta ultrasons (150 W)
Scissors
Bench-top refrigerated centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Macrophage
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,585
|
https://bio-protocol.org/exchange/protocoldetail?id=1585&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Thioglycollate-elicited Peritoneal Macrophages Preparation and Arginase Activity Measurement in IL-4 Stimulated Macrophages
Lidia Jiménez-García
SH Sandra Herránz
Alfonso Luque
Sonsoles Hortelano
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1585 Views: 21544
Edited by: Ivan Zanoni
Reviewed by: Sabine Le Saux
Original Research Article:
The authors used this protocol in Jan 2015
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2015
Abstract
Macrophages are an essential cell population of innate immunity that plays important roles in inflammatory processes. Two main different phenotypes have been described with opposing activities: The classically activated macrophages (M1) and the alternatively activated macrophages (M2). Alternative activation of mouse macrophages can be induced by type 2 cytokines such as IL-4 and it is characterized by the regulation of the L-arginine metabolism. M2 macrophages convert arginine to ornithine and urea through the action of Arginase-1. Here we described a method for the isolation of peritoneal macrophages from thioglycollate-elicited mice and alternative activation by stimulation with IL-4. Intraperitoneal injection of thioglycollate elicits large numbers of macrophages into peritoneal cavity.
Keywords: Macrophages Thioglycollate Arginase IL-4
Materials and Reagents
Mice C57BL/6 male (age 8-12 weeks)
Difco Fluid Thioglycollate medium (BD, catalog number: 225650 )
70% and 100% ethanol
PBS (Lonza, catalog number: BE 17-515Q )
RPMI 1640 (Lonza, catalog number: BE 12-115F )
FBS (endotoxin<10 EU/ml) (Hyclone, catalog number: SV30160.03 )
Penicillin-Streptomycin (Lonza, catalog number: BE 17-602E )
Murine IL-4 (Peprotech, catalog number: 214-14 )
Tris (Panreac Applichem, catalog number: 131940.1211 )
NaCl (Merck KGaA, catalog number: 1.06404.1000 )
EDTA (Sigma-Aldrich, catalog number: ED255 )
Triton X-100 (Sigma-Aldrich, catalog number: 8787 )
Protease inhibitor mixture (Sigma-Aldrich, catalog number: P8340 )
Urea (Sigma-Aldrich, catalog number: 4883 )
MnCl2 (Sigma-Aldrich, catalog number: 244589 )
L-arginine monohydrochloride (Sigma-Aldrich, catalog number: A6969 )
H2SO4 (Sigma-Aldrich, catalog number: 320501 )
H3PO4 (Sigma-Aldrich, catalog number: 345245 )
Isonitrosopropiophenone (Sigma-Aldrich, catalog number: I3502 )
12-well plates
1.5 ml Eppendorf tubes
50 ml sterile Falcon tubes
Cell strainer (Becton Dickinson, catalog number: 352340 )
10 ml syringe
21G Needles
25G needles
Lysis buffer (see Recipes)
Heat-inactivated FBS (see Recipes)
Stopping solution (see Recipes)
Equipment
Bench-top refrigerated centrifuge
Scissors
Incubator (37 °C, 5% CO2 and 95 % humidity)
Tissue culture hood (biosafety cabinet)
Optical microscopy
Neubauer cell counting chamber
Espectrophotometer plate reader
Thermoblock (Eppendorf Thermomixer Compact) or water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Jiménez-García, L., Herránz, S., Luque, A. and Hortelano, S. (2015). Thioglycollate-elicited Peritoneal Macrophages Preparation and Arginase Activity Measurement in IL-4 Stimulated Macrophages. Bio-protocol 5(17): e1585. DOI: 10.21769/BioProtoc.1585.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Macrophage
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,586
|
https://bio-protocol.org/exchange/protocoldetail?id=1586&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electron Paramagnetic Resonance (EPR) Spectroscopy to Detect Reactive Oxygen Species in Staphylococcus aureus
VT Vinai Chittezham Thomas
SC Sujata S. Chaudhari
JJ Jocelyn Jones
MZ Matthew C. Zimmerman
KB Kenneth W. Bayles
Published: Vol 5, Iss 17, Sep 5, 2015
DOI: 10.21769/BioProtoc.1586 Views: 10155
Edited by: Fanglian He
Reviewed by: Benoit Chassaing
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Under aerobic conditions, Staphylococcus aureus (S. aureus) primarily metabolizes glucose to acetic acid. Although normally S. aureus is able to re-utilize acetate as a carbon source following glucose exhaustion, significantly high levels of acetate in the culture media may not only be growth inhibitory but also potentiates cell death in stationary phase cultures by a mechanism dependent on cytoplasmic acidification. One consequence of acetic acid toxicity is the production of reactive oxygen species (ROS). The present protocol describes the detection of ROS in S. aureus undergoing cell death by electron paramagnetic resonance (EPR) spectroscopy. Using 1-hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine (CMH) as a cell permeable spin probe, we demonstrate the detection of various oxygen radicals generated by bacteria. Although standardized for S. aureus, the methods described here should be easily adapted for other bacterial species. This protocol is adapted from Thomas et al. (2014) and Thomas et al. (2010).
Keywords: EPR Staphylococcus aureus Reactive oxygen species Spectroscopy
Materials and Reagents
Staphylococcus aureus
Bacto tryptic soy broth without dextrose (TSB) (BD Diagnostic Systems, catalog number: DF0862178 )
Glucose (Sigma-Aldrich, catalog number: G8270 ).
1-hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine (CMH) (Noxygen Science Transfer & Diagnostics GmbH, catalog number: NOX-2.2-100mg )
Superoxide dismutase (SOD) (Sigma-Aldrich, catalog number: S7571 )
Dimethyl thiourea (DMTU) (Sigma-Aldrich, catalog number: D188700 )
Critoseal (Thermo Fisher Scientific, catalog number: 0267620 )
5 µM DETC (Noxygen, Catalog number: NOX-10.1 )
25 µM deferoxamine (Noxygen, Catalog number: NOX-10.1)
Culture flask (250 ml)
Culture tubes
1.5 ml Eppendorf tubes
Krebs-HEPES buffer (KDD buffer) (see Recipes)
Equipment
37 °C shaker-incubator (250 rpm per min)
Leica Biosystems Critoseal capillary tube sealant (Leica Microsystems, catalog number: MS215003A )
Bruker e-Scan EPR Spectrometer and Noxygen Temperature Controller Bio-I (Bruker, model: NOX-E.11-ESR )
Micropipettes (50 µl, EPR tubes) (Noxygen Science Transfer & Diagnostics GmbH, catalog number: MS215003A )
Spectrophotometer
Vortex-Genie 2
Software
Bruker WinEPR Data Processing software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Thomas, V. C., Chaudhari, S. S., Jones, J., Zimmerman, M. C. and Bayles, K. W. (2015). Electron Paramagnetic Resonance (EPR) Spectroscopy to Detect Reactive Oxygen Species in Staphylococcus aureus. Bio-protocol 5(17): e1586. DOI: 10.21769/BioProtoc.1586.
Thomas, V. C., Sadykov, M. R., Chaudhari, S. S., Jones, J., Endres, J. L., Widhelm, T. J., Ahn, J. S., Jawa, R. S., Zimmerman, M. C. and Bayles, K. W. (2014). A central role for carbon-overflow pathways in the modulation of bacterial cell death. PLoS Pathog 10(6): e1004205.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,587
|
https://bio-protocol.org/exchange/protocoldetail?id=1587&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chemotaxis and Jumping Assays in Nematodes
TB Tiffany Baiocchi
Adler R. Dillman
Published: Vol 5, Iss 18, Sep 20, 2015
DOI: 10.21769/BioProtoc.1587 Views: 10824
Edited by: Fanglian He
Reviewed by: Peichuan Zhang
Original Research Article:
The authors used this protocol in Mar 2011
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2011
Abstract
Nematodes have sensitive olfactory perception, which is used to detect and differentiate many volatile odorants. Some odorants are attractive, others repulsive, and yet others evoke no particular response. Chemotaxis assays can be used to determine the role of certain odors in many different behaviors including foraging, predator avoidance, and mate attraction. In addition to chemotaxis, some species of nematodes in the entomopathogenic genus Steinernema can jump, which is thought to play an important role in host-seeking and dispersal (Dillman and Sternberg, 2012). Jumping and chemotaxis assays have been successfully used to identify odorants that stimulate these behaviors in a variety of nematodes (Bargmann et al., 1993; Campbell and Kaya, 1999; Hallem et al., 2011; Dillman et al., 2012; Castelletto et al., 2014). Here a detailed protocol for chemotaxis and jumping assays is provided based on the growing body of literature.
Keywords: Entomopathogenic Chemotaxis Jumping Behavior Nematodes
Materials and Reagents
Nematodes
Note: The Caenorhabditis Genetics Center (CGC) is a great resource for many commonly used nematodes (http://cbs.umn.edu/cgc/home), but not all nematodes are available through this resource. For example, entomopathogenic nematodes (EPNs) are not available through the CGC and either need to be collected from field sampling or requested from another researcher’s lab.
Medical grade certified air mixtures of your chosen percent gas to be tested (e.g. 10% CO2) with the balance being N2 (Praxair, catalog number: 7727-37-9 )
Parafilm (Thermo Fisher Scientific, catalog number: 13-374-10 )
Paraffin oil
Nalgene (Thermo Fisher Scientific, catalog number: 8000-0020 ) FTP 1/8” I.D. tubing
Soda Lime (2-5 mm pellets) (Sigma-Aldrich, catalog number: 72073 )
½ inch Teflon tape
Laser printer transparency film (e.g. Apollo VCG7060E)
Low-pressure system fittings kit (Bio-Rad Laboratories, catalog number: 7318220 )
Sodium azide (Thermo Fisher Scientific, catalog number: BP9221-500 )
BBL-agar (BD) or Difco-agar
100 x 15 mm petri dishes (VWR International, catalog number: 25384-088 )
60 x 15 mm petri dishes (VWR International, catalog number: 25384-090 )
1.55 mm Whatman 1 filter paper (Fisher Scientific, catalog number: 09-805B )
Blunt Luer-Lok needle (e.g. HAMPTON RESEARCH CORP 22s/2”/3)
Disposable 10 ml Luer-Lok syringe (e.g. BD)
Disposable needle (21 gauge, 1.5 inch) (e.g. BD)
1/8 inch I.D. (inner diameter) PVC tubing
50 ml gastight syringes (e.g. HAMPTON RESEARCH CORP, model: 1050 )
10 ml gastight syringes (e.g. HAMPTON RESEARCH CORP, model: 1010 )
Chemotaxis agar (see Recipes)
Equipment
Dissection stereo microscope (e.g. Leica Microsystems, model: Leica M80 )
Infusion syringe pump (e.g. Harvard Apparatus, model: PHD 22/2000 )
31 gauge drill bit (3.05 mm) (e.g. Alltrade Tools LLC, model: 480902 rotary tool set )
56 gauge drill bit (1.18 mm) (e.g. Alltrade Tools LLC, model: 480902 rotary tool set )
Drill or dremmel (e.g. Alltrade Tools LLC, model: 480902 rotary tool set )
Anti-vibration platform (Foam bottom with cardboard platform)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Baiocchi, T. and Dillman, A. R. (2015). Chemotaxis and Jumping Assays in Nematodes. Bio-protocol 5(18): e1587. DOI: 10.21769/BioProtoc.1587.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Chemotaxis
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,588
|
https://bio-protocol.org/exchange/protocoldetail?id=1588&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Mitogen-activated Protein Kinase (MAPK) Activation upon Exogenous Chemical Application in Arabidopsis Protoplasts
Arsheed Hussain Sheikh
Alok Krishna Sinha
Published: Vol 5, Iss 18, Sep 20, 2015
DOI: 10.21769/BioProtoc.1588 Views: 11332
Edited by: Zhaohui Liu
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
The mitogen activated protein kinase cascade is a highly conserved signal pathway in plants. The exogenous chemicals, like hormones, can trigger a series of signalling cascades, including MAPK pathway, to modulate the plant physiology. Upon activation, some MAPKs are phosphorylated. It is important to develop methods that can detect changes in the phosphorylation status of MAPKs in plants when they come in contact with external chemicals. This method describes the exogenous treatment of Arabidopsis protoplasts with Kinetin and subsequent detection of the activated MAPKs. This method is useful for studying the effect of exogenously applied chemical compounds on the MAPK signaling cascade in Arabidopsis.
Keywords: MAP kinase Phosphorylation In vitro kinase assay Signal transduction Immunoprecipitation
Materials and Reagents
Plants: Arabidopsis thaliana (Col-0) obtained from NASC The European Arabidopsis Stock Centre
Sodium chloride (NaCl) (Carl Roth, catalog number: 3957 )
MgCl2 (Thermo Fisher Scientific, catalog number: M35 )
CaCl2 (Thermo Fisher Scientific, catalog number: C69 )
Potassium chloride (KCl) (Sigma-Aldrich, catalog number: P9541 )
D-Mannitol (Sigma-Aldrich, catalog number: M4125 )
MES hydrate (Sigma-Aldrich, catalog number: 8250 )
Albumin bovine modified Cohn Fraction V, pH 7.0 (BSA) (SERVA Electrophoresis GmbH, catalog number: 11943 )
Macerozyme ONOZUKA R10 (Yakult Pharmaceutical Industry Co)
Cellulase ONOZUKA R10 (Yakult Pharmaceutical Industry Co)
Kinetin (Sigma-Aldrich, catalog number: K3378 )
Phospho-p44/42 MAPK (ERK1/2) Antibody (pTEpY Antibody) (Cell Signaling Technology, catalog number: 9101 )
PierceTM ECL Western Blotting Substrate (Thermo Fisher Scientific, catalog number: 32109 )
Protein free blocking solution (PFBS) (Thermo Fisher Scientific)
0.45 µm acetate filter (Carl Roth, catalog number: AH53.1 )
Petri Dishes (Greiner Bio-One GmbH, catalog number: 628103 )
Nitrocellulose Hybond ECL membrane (GE Healthcare, Amersham biosciences®, model: RPN82D )
Stock solutions (see Recipes)
Enzyme solution (see Recipes)
W5 solution (see Recipes)
WI solution (see Recipes)
0.5 mM mannitol (see Recipes)
Kinetin (see Recipes)
1 L transfer buffer (see Recipes)
1 LTBST (Tris-Buffered Saline and Tween 20) (see Recipes)
5x SDS-Loading buffer (see Recipes)
10% SDS-PAGE gel (see Recipes)
Equipment
Phytochambers or light room or greenhouse (23 °C, 16 h dark / 8 h light)
Sharp razor blades (Carl Roth, catalog number: CK07.1 )
Polycarbonate dessicator (Carl Roth, catalog number: PK30.1 )
Nylon Net Filter, Hydrophilic (100 µm, 25 mm) (EMD Millipore, catalog number: NY1H02500 )
Round bottom 12 ml cell culture polystyrene tubes (Greiner Bio-One GmbH, catalog number: 163160 )
Swing bucket refrigerated Centrifuge (Eppendorf, model: 6810R )
Haemocytometer
SDS-PAGE gel running apparatus (Bio-Rad Laboratories)
Semi-dry blotting apparatus (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Perception and signaling
Biochemistry > Protein > Activity
Cell Biology > Cell-based analysis > Gene expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,589
|
https://bio-protocol.org/exchange/protocoldetail?id=1589&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
[14C] Glucose Cell Wall Incorporation Assay for the Estimation of Cellulose Biosynthesis
CB Chad Brabham
JS Jozsef Stork
SD Seth Debolt
Published: Vol 5, Iss 18, Sep 20, 2015
DOI: 10.21769/BioProtoc.1589 Views: 6674
Reviewed by: Renate Weizbauer
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Cellulose is synthesized by Cellulose Synthase A proteins at the plasma membrane using the substrate UDP glucose. Herein, we provide a detailed method for measuring the incorporation of radiolabeled glucose into the cellulose fraction of the cell wall. In this method Arabidopsis seedlings are treated for 2 h with a cellulose biosynthesis inhibitor in the presence of radiolabeled glucose, and are subsequently boiled in acetic-nitric acid to solubilize non-cellulosic material. The radiolabeled glucose detected in the insoluble fraction indicates the amount of cellulose synthesized during the experimental timeframe. The short-term nature of this method is a useful tool in determining if inhibition of cellulose biosynthesis is the herbicides primary mode of action.
Materials and Reagents
Arabidopsis seed (Arabidopsis thaliana L.)
Dextrose (Sigma-Aldrich, catalog number: D9434 )
Radiolabeled glucose [glucose D-14C(U)] (American Radiolabeled Chemicals, catalog number: ARC 0122D )
Acetic Acid, Glacial (Certified ACS) (Fisher Scientific, catalog number: A38-212 )
Nitric Acid, Fuming (Certified ACS) (Fisher Scientific, catalog number: A202-212 )
Counting cocktail (Biodegradable Scintillation Cocktails) (Biosafe II, catalog number: 111195 )
Deionized sterile water (autoclaved at 120 °C for 30 min)
Murashige & Skoog (MS) Basal Salt Mixture (PhytoTechnology Laboratories®, catalog number: M524 )
MES monohydrate (Sigma-Aldrich, catalog number: 69889 )
Model A307 Sample Oxidizer (PerkinElmer, catalog number: A030700 )
Aluminum foil
Eppendorf tubes (1.5 ml) (autoclaved at 120 °C for 30 min)
MS media (see Recipes)
Acetic-nitric acid reagent (see Recipes)
Equipment
Eppendorf tube holders
Pasteur pipets and tips
1 L Erlenmeyer flask (autoclaved at 120 °C for 30 min)
Microscale
Orbital shaker
Microcentrifuge
Glass scintillation vials (20 ml)
Scintillation Counter (Packard Tri-Carb Liquid Scintillation Counter)
Autoclave
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite: Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Brabham, C., Stork, J. and Debolt, S. (2015). [14C] Glucose Cell Wall Incorporation Assay for the Estimation of Cellulose Biosynthesis. Bio-protocol 5(18): e1589. DOI: 10.21769/BioProtoc.1589.
Brabham, C., Lei, L., Gu, Y., Stork, J., Barrett, M. and DeBolt, S. (2014). Indaziflam herbicidal action: a potent cellulose biosynthesis inhibitor. Plant Physiol 166(3): 1177-1185.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
159
|
https://bio-protocol.org/exchange/protocoldetail?id=159&type=1
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Glucose Tolerance Test in Mice
Peichuan Zhang
Published: Oct 5, 2011
DOI: 10.21769/BioProtoc.159 Views: 63610
Download PDF
Ask a question
Favorite
Cited by
Abstract
Glucose tolerance test is a standard procedure that addresses how quickly exogenous glucose can be cleared from blood. Specifically, uptake of glucose from the blood by cells is regulated by insulin. Impairment of glucose tolerance (i.e, longer time to clear given amount of glucose) indicates problems with maintenance of glucose homeostasis (insulin resistance, carbohydrate metabolism, diabetes, etc). According to the WHO, in a standard oral glucose tolerance test (OGTT), glucose level should be below 7.8 mmol/L (140 mg/dl) at 2 h. Levels between this and 11.1 mmol/L (200 mg/dl) indicate “impaired glucose tolerance”, and any level above 11.1 mmol/L (200 mg/dl) confirms a diagnosis of diabetes.
Materials and Reagents
Mice (~20 C57BL/6J (B6) males of 2-3 months old)
70% ethanol
Beta-D(+)-glucose (Sigma-Aldrich, catalog number: G8270 )
NaCl
KCl
Sodium phosphate
Phosphate buffered saline (PBS) (see Recipes)
Equipment
ACCU-CHEK comfort curve glucometer (Roche Diagnostics, catalog number: 03537536001 ) (this product has been discontinued. Any new product of ACCU-CHEK should work fine as well)
Such device quantifies glucose amperometrically by measuring the current produced upon oxidation of glucose to gluconic acid by glucose oxidase, or to gluconolactone by dehydrogenase.
27 gauge needle (Single-Use Needles, supplied by VWR, BD Medical, catalog number: BD305109 )
Microvette CB300 Z serum separator (SARSTEDT, catalog number: 16.440.100 )
Acrodisc 25 mm syringe filters w/ 0.2 μM HT Tuffryn membrane (Pall Corporation, catalog number: 4192 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Carbohydrate > Glucose
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
1,590
|
https://bio-protocol.org/exchange/protocoldetail?id=1590&type=0
|
# Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Persister Cells from Biofilm and Planktonic Populations of Pseudomonas aeruginosa
Cláudia N. H. Marques
Published: Vol 5, Iss 18, Sep 20, 2015
DOI: 10.21769/BioProtoc.1590 Views: 12110
Edited by: Maria Sinetova
Reviewed by: Alexander B. WestbyeEsteban Paredes-Osses
Original Research Article:
The authors used this protocol in Nov 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2014
Abstract
Persister cells are a stochastically produced sub-population of non-growing bacterial cells. Recently these cells have been more widely studied due to the recognition that they are tolerant to antimicrobials and thus, play a major role in the resilience of bacterial populations to antimicrobials, particularly in chronic biofilm infections. The following protocol describes the isolation/selection of persister cell sub-populations of Pseudomonas aeruginosa present in biofilms (sessile) and planktonic populations (free-living).
Keywords: Persister cells Pseudomonas aeruginossa Biofilms Tube reactors Planktonic populations
Materials and Reagents
Bacterial culture [Pseudomonas aeruginosa PA14]. This method has also been performed for Escherichia coli (BW25113) and Staphylococcus aureus (ATCC, catalog number: 6538)]
LB broth Lennox (BD, catalog number: 240230 )
Ciprofloxacin hydrochloride (Corning Incorporated, catalog number: 61-277-RF )
Agar (BD, catalog number: 214040 )
MgCl2.7H2O (VWR International, BDH®, catalog number: 0288-VBD )
DI water (distilled water)
Sodium chloride (VWR International, BDH®, catalog number: 0241-VBD )
Spooled Masterflex peroxide-cured silicone tubing, L/S 14, 250 ft. (Cole-Parmer, catalog number: UX-96407-14 )
Masterflex Norprene tubing (A60 G), L/S 13, 50 ft. (Cole-Parmer, catalog number: UX-06404-13 )
PVDF barbed Y connector, 3/8" ID, 1/4", 2-3/8", 1-3/4"; Pack Of 10 (Cole-Parmer, catalog number: WU-30703-93 )
Barbed fittings, Straight Connector, Clear PP,1/16" ID, 1/32", 25/32", 1/4" (Cole-Parmer, catalog number: WU-30506-00 )
Barbed fittings, Reducing Connector, Clear PP,1/8" x 1/16" ID, 3/32", 13/16", 1/8" (Cole-Parmer, catalog number: WU-30506-06 )
Barbed fittings, T connector, Kynar, 1/4" ID, 1/8", 1-15/16", 1-5/16"; 10/pack (Cole-Parmer, catalog number: WU-30703-75 )
Sterile Petri dishes
Microfuge tubes
Syringe 60 ml
Syringe needle (Gauge 21G)
Micropipettes (P1000, P200, P20)
Aluminum Foil
Saline (see Recipes)
Saline with Mg2Cl4.7H2O (see Recipes)
LB agar with Mg2Cl4.7H2O (see Recipes)
Equipment
Peristaltic pump (Cole-Parmer, catalog number: EW-07553-80 ) with an 8 channel, 6 rollers, 3-stop Ismatec minicartridge pump head (Cole-Parmer, catalog number: EW-78002-50 )
Inoculation ports (VWR® Sleeve Stoppers) (VWR International, catalog number: 89097-534 )
GeneMate Incubated Shakers (BioExpress, catalog number: H-2000-M )
General Purpose Laboratory Incubators, SHEL LAB (BioExpress, catalog number: G-1400-1 )
Nalgene® Carboys with Handles, Polypropylene, Thermo Scientific (VWR International, catalog number: 16101-084 )
Nalgene® Top WorksTM Aseptic Closure System, Silicone, for Bottles and Carboys, Thermo Scientific (VWR International, catalog number: 2135-8303 )
Acro® 50 Vent Filters, Pall Laboratory (VWR International, catalog number: 28143-616 )
Erlenmeyer Flasks (150 ml)
Homogenizer (PRO SCIENTIFIC, model: Bio-Gen Pro200 )
Table top refrigerated Centrifuge (Eppendorf, catalog number: 5418R )
Spectrophotometer (BD, catalog number: DU700 series )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite:Marques, C. N. H. (2015). Isolation of Persister Cells from Biofilm and Planktonic Populations of Pseudomonas aeruginosa. Bio-protocol 5(18): e1590. DOI: 10.21769/BioProtoc.1590.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Biofilm culture
Microbiology > Microbial biofilm > Killing assay
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Questions regarding experiment details
0 Answer
2 Views
Jan 24, 2025
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.