text_prompt
stringlengths
168
30.3k
code_prompt
stringlengths
67
124k
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Initialisation Step2: First, we initialise a LDPSetCreator with the stellar parameter estimates and our filter set. This may take some time, since we also need to download the necessary model spectra to a local cache directory (can be several hundreds of MB). Step3: Next, we create the limb darkening profiles with their uncertainties for each filter, all contained in an LDPSet object. Step4: Limb darkening profile visualisation Step5: Limb darkening coefficient estimation Step6: We can also use MCMC to estimate the coefficient uncertainties (or the full covariance matrix) more accurately Step7: Finally, we can decide we don't trust the stellar models the profiles were computed from too much, and set an multiplicative factor on the profile uncertainties. Step8: Likelihood evaluation Step9: jointly for all passbands Step10: or in parallel for a number of coefficient sets, what can be useful when using population-based optimizers or MCMC samplers, such as emcee
<ASSISTANT_TASK:> Python Code: %pylab inline from IPython.display import display, Latex import seaborn as sb sb.set_context('notebook') sb.set_style('ticks') from ldtk import LDPSetCreator, BoxcarFilter, TabulatedFilter from ldtk.filters import sdss_g, sdss_r, sdss_i, sdss_z sc = LDPSetCreator(teff=(5500,100), logg=(4.5,0.2), z=(0.25,0.05), filters=[sdss_g, sdss_r, sdss_i, sdss_z], dataset='vis-lowres') ps = sc.create_profiles(nsamples=2000) ps.resample_linear_z(300) cmap = cm.get_cmap("Spectral") cp = cmap(linspace(0.1,1.0,4)) fig,ax = subplots(1, 2, figsize=(12,4), sharey=True) for i in range(ps._nfilters): ax[0].fill_between(ps._z, ps._mean[i]-3*ps._std[i], ps._mean[i]+3*ps._std[i], facecolor=cp[i], alpha=0.2) ax[0].plot(ps._z, ps._mean[i], '-', c=cp[i], label=ps._filters[i]) ax[1].fill_between(ps._mu, ps._mean[i]-3*ps._std[i], ps._mean[i]+3*ps._std[i], facecolor=cp[i], alpha=0.2) ax[1].plot(ps._mu, ps._mean[i], '-', c=cp[i], label=ps._filters[i]) ax[0].legend() setp(ax[0], xlim=(0,1.05), ylim=(0.2,1.05), xlabel='z', ylabel='Flux') setp(ax[1], xlim=(1.05,0), ylim=(0.2,1.05), xlabel='$\mu$') sb.despine(fig, offset=10, trim=True) setp(ax[1].get_yticklabels(), visible=False) fig.tight_layout() x,y = meshgrid(linspace(-1.05, 1.05, 150), linspace(-1.05, 1.05, 150)) r = sqrt(x**2+y**2) profiles = ps.profile_averages fig, axs = subplots(1, 4, figsize=(12,3), sharex=True, sharey=True) for i,ldp in enumerate(profiles): axs.flat[i].imshow(interp(r, ps._z, ldp, left=0, right=0), vmin=0, vmax=1, aspect='auto', extent=(-1.05,1.05,-1.05,1.05)) axs.flat[i].contour(x, y, interp(r, ps._z, ldp, left=0, right=0), colors='k', alpha=0.15, levels=[0.0, 0.25, 0.4, 0.55, 0.65, 0.75, 0.85, 0.95, 1]) axs.flat[i].set_title(ps._filters[i]) setp(axs, xticks=[], yticks=[]) fig.tight_layout() qc, qe = ps.coeffs_qd() for i, (c, e) in enumerate(zip(qc, qe)): display(Latex('u$_{i:d} = {c[0]:5.4f} \pm {e[0]:5.4f}\quad$' 'v$_{i:d} = {c[1]:5.4f} \pm {e[1]:5.4f}$'.format(i=i+1,c=c,e=e))) qc, qe = ps.coeffs_qd(do_mc=True, n_mc_samples=10000) for i, (c, e) in enumerate(zip(qc, qe)): display(Latex('u$_{i:d} = {c[0]:5.4f} \pm {e[0]:5.4f}\quad$' 'v$_{i:d} = {c[1]:5.4f} \pm {e[1]:5.4f}$'.format(i=i+1,c=c,e=e))) ps.set_uncertainty_multiplier(2) qc, qe = ps.coeffs_qd(do_mc=True, n_mc_samples=10000) for i, (c, e) in enumerate(zip(qc, qe)): display(Latex('u$_{i:d} = {c[0]:5.4f} \pm {e[0]:5.4f}\quad$' 'v$_{i:d} = {c[1]:5.4f} \pm {e[1]:5.4f}$'.format(i=i+1,c=c,e=e))) print(ps.lnlike_qd([0.69, 0.15], flt=0)) print(ps.lnlike_qd([[0.69, 0.15], [0.48 ,0.16], [0.38, 0.15], [0.38, 0.10]])) print(ps.lnlike_qd([[[0.69, 0.15], [0.48 ,0.16], [0.38, 0.15], [0.38, 0.10]], [[0.66, 0.12], [0.43 ,0.12], [0.35, 0.14], [0.37, 0.13]]])) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The data you'll be exloring Step2: Duplicated data Step3: So this is actually a mask. We can now ask for the data where the mask applies Step4: Missing data Step5: How much missing data do we have for heights? Step6: In python, False evaluates to 0, and True to 1. So we can count the number of missing by doing Step7: As before, we can use that mask on our original dataset, and see it Step8: How about age? Step9: And gender? Step10: But wait, we have another problem. We seem to have male and MALE Step11: Outliers Step12: This was useful, we can see that there are some really tall people, and some quite small ones. The distribution also looks close to normal Step13: Looking at a few of these outliers Step14: Over Step15: Note Step16: How about the ages? Step17: Well, this is quite useless. The reason is that using standard deviations assumes that the distribution is normal, and we can clearly see it isn't. Step18: What if we used percentiles? Step19: Note Step20: Now that looks a lot better. We can clearly identify that almost everyone is an adult, except the point on the extreme left. Step21: Starting to look better, what about the point on the far right?
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np % matplotlib inline from matplotlib import pyplot as plt data = pd.read_csv('all_data.csv') data.head(10) duplicated_data = data.duplicated() duplicated_data.head() data[duplicated_data] heights = data['height'] ages = data['age'] gender = data['gender'] missing_height = heights.isnull() missing_height.head() missing_height.sum() data[missing_height] missing_ages = ages.isnull() data[missing_ages] gender.value_counts(dropna=False) missing_gender = data['gender'].isnull() data[missing_gender] gender.value_counts(dropna=False).plot(kind='bar', rot=0) heights.hist(bins=40, figsize=(16,4)) plt.xlabel('Height') plt.ylabel('Count') def print_analysis(series): for nr in range(1, 4): upper_limit = series.mean() + (nr * series.std()) lower_limit = series.mean() - (nr * series.std()) over_range = series > upper_limit percent_over_range = over_range.sum() / len(series) * 100 under_range = series < lower_limit percent_under_range = under_range.sum() / len(series) * 100 in_range = (series < upper_limit) & (series > lower_limit) percent_in_range = in_range.sum() / len(series) * 100 print('\nFor the range of %0.0f standard deviations:' % nr) print(' Lower limit: %0.0f' % lower_limit) print(' Percent under range: %0.1f%%' % percent_under_range) print(' Upper limit: %0.0f' % upper_limit) print(' Percent over range: %0.1f%%' % percent_over_range) print(' Percent within range: %0.1f%%' % percent_in_range) heights.hist(bins=20) plt.xlabel('Height') plt.ylabel('Count') print_analysis(heights) heights[heights < heights.mean() - 2*heights.std()] heights[heights > heights.mean() + 2*heights.std()] heights[heights < heights.mean() - 3*heights.std()] heights[heights > heights.mean() + 3*heights.std()] ages.hist(bins=40, figsize=(16,4)) plt.xlabel('Age') plt.ylabel('Count') print_analysis(ages) ages.max() extreme_value = .99 ages.dropna().quantile(extreme_value) # under_extreme_value = ages, where ages is smaller than the extreme value: under_extreme_value = ages[ages < ages.dropna().quantile(extreme_value)] under_extreme_value.hist(bins=40, figsize=(16,4)) plt.xlabel('Age') plt.ylabel('Count') non_babies = under_extreme_value[under_extreme_value > 10] non_babies.hist(bins=40, figsize=(16,4)) plt.xlabel('Age') plt.ylabel('Count') non_babies.max() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1. Let's start with a showcase Step2: Starting from reading this dataset, to answering questions about this data in a few lines of code Step3: How does the survival rate of the passengers differ between sexes? Step4: Or how does it differ between the different classes? Step5: All the needed functionality for the above examples will be explained throughout this tutorial. Step6: to answering questions about this data in a few lines of code Step7: What is the difference in diurnal profile between weekdays and weekend? Step8: We will come back to these example, and build them up step by step. Step9: Attributes of the DataFrame Step10: To check the data types of the different columns Step11: An overview of that information can be given with the info() method Step12: Also a DataFrame has a values attribute, but attention Step13: Apart from importing your data from an external source (text file, excel, database, ..), one of the most common ways of creating a dataframe is from a dictionary of arrays or lists. Step14: One-dimensional data Step15: Attributes of a Series Step16: You can access the underlying numpy array representation with the .values attribute Step17: We can access series values via the index, just like for NumPy arrays Step18: Unlike the NumPy array, though, this index can be something other than integers Step19: but with the power of numpy arrays. Many things you can do with numpy arrays, can also be applied on DataFrames / Series. Step20: A range of methods Step21: Fancy indexing, like indexing with a list or boolean indexing Step22: But also a lot of pandas specific methods, e.g. Step23: <div class="alert alert-success"> Step24: <div class="alert alert-success"> Step25: 3. Data import and export Step26: Very powerful csv reader Step27: Luckily, if we have a well formed csv file, we don't need many of those arguments Step28: <div class="alert alert-success"> Step29: 4. Exploration Step30: info() Step31: Getting some basic summary statistics about the data with describe Step32: Quickly visualizing the data Step33: <div class="alert alert-success"> Step34: The default plot (when not specifying kind) is a line plot of all columns Step35: This does not say too much .. Step36: Or we can use some more advanced time series features -> see further in this notebook! Step37: df[] provides some convenience shortcuts Step38: or multiple columns Step39: But, slicing accesses the rows Step40: Systematic indexing with loc and iloc Step41: Selecting by position with iloc works similar as indexing numpy arrays Step42: The different indexing methods can also be used to assign data Step43: Boolean indexing (filtering) Step44: <div class="alert alert-success"> Step45: <div class="alert alert-success"> Step46: 6. The group-by operation Step47: Recap Step48: However, in many cases your data has certain groups in it, and in that case, you may want to calculate this statistic for each of the groups. Step49: This becomes very verbose when having multiple groups. You could make the above a bit easier by looping over the different values, but still, it is not very convenient to work with. Step50: And many more methods are available. Step51: Application of the groupby concept on the titanic data Step52: <div class="alert alert-success"> Step53: <div class="alert alert-success"> Step54: <div class="alert alert-success"> Step55: <div class="alert alert-success"> Step56: <div class="alert alert-success"> Step57: <div class="alert alert-success"> Step58: 7. Working with time series data Step59: When we ensure the DataFrame has a DatetimeIndex, time-series related functionality becomes available Step60: Indexing a time series works with strings Step61: A nice feature is "partial string" indexing, so you don't need to provide the full datetime string. Step62: Time and date components can be accessed from the index Step63: Converting your time series with resample Step64: The time series has a frequency of 1 hour. I want to change this to daily Step65: Above I take the mean, but as with groupby I can also specify other methods Step66: The string to specify the new time frequency Step67: <div class="alert alert-success"> Step68: <div class="alert alert-success"> Step69: Now, we can calculate the mean of each month over the different years Step70: <div class="alert alert-success"> Step71: <div class="alert alert-success"> Step72: Add a column indicating week/weekend Step73: Now we can groupby the hour of the day and the weekend (or use pivot_table) Step74: <div class="alert alert-success">
<ASSISTANT_TASK:> Python Code: %matplotlib inline import numpy as np import pandas as pd import matplotlib.pyplot as plt pd.options.display.max_rows = 8 df = pd.read_csv("data/titanic.csv") df.head() df['Age'].hist() df.groupby('Sex')[['Survived']].aggregate(lambda x: x.sum() / len(x)) df.groupby('Pclass')['Survived'].aggregate(lambda x: x.sum() / len(x)).plot(kind='bar') data = pd.read_csv('data/20000101_20161231-NO2.csv', sep=';', skiprows=[1], na_values=['n/d'], index_col=0, parse_dates=True) data.head() data['1999':].resample('M').mean().plot(ylim=[0,120]) data['1999':].resample('A').mean().plot(ylim=[0,100]) data['weekday'] = data.index.weekday data['weekend'] = data['weekday'].isin([5, 6]) data_weekend = data.groupby(['weekend', data.index.hour])['BASCH'].mean().unstack(level=0) data_weekend.plot() df df.index df.columns df.dtypes df.info() df.values data = {'country': ['Belgium', 'France', 'Germany', 'Netherlands', 'United Kingdom'], 'population': [11.3, 64.3, 81.3, 16.9, 64.9], 'area': [30510, 671308, 357050, 41526, 244820], 'capital': ['Brussels', 'Paris', 'Berlin', 'Amsterdam', 'London']} df_countries = pd.DataFrame(data) df_countries df['Age'] age = df['Age'] age.index age.values[:10] age[0] df = df.set_index('Name') df age = df['Age'] age age['Dooley, Mr. Patrick'] age * 1000 age.mean() age[age > 70] df['Embarked'].value_counts() df['Fare'].max() df['Fare'].median() # df['Survived'].sum() / len(df['Survived']) df['Survived'].mean() #pd.read #df.to pd.read_csv? df = pd.read_csv("data/titanic.csv") df.head() no2 = pd.read_csv('data/20000101_20161231-NO2.csv', sep=';', skiprows=[1], na_values=['n/d'], index_col=0, parse_dates=True) no2 no2.head(3) no2.tail() no2.info() no2.describe() no2.plot(kind='box', ylim=[0,250]) no2['BASCH'].plot(kind='hist', bins=50) df['Age'].hist() no2.plot(figsize=(12,6)) no2[-500:].plot(figsize=(12,6)) df = pd.read_csv("data/titanic.csv") df['Age'] df[['Age', 'Fare']] df[10:15] df = df.set_index('Name') df.loc['Bonnell, Miss. Elizabeth', 'Fare'] df.loc['Bonnell, Miss. Elizabeth':'Andersson, Mr. Anders Johan', :] df.iloc[0:2,1:3] df.loc['Braund, Mr. Owen Harris', 'Survived'] = 100 df df['Fare'] > 50 df[df['Fare'] > 50] df = pd.read_csv("data/titanic.csv") df[df['Sex'] == 'male'] df.loc[df['Sex'] == 'male', 'Age'].mean() df.loc[df['Sex'] == 'female', 'Age'].mean() len(df[df['Age'] > 70]) (df['Age'] > 70).sum() df = pd.DataFrame({'key':['A','B','C','A','B','C','A','B','C'], 'data': [0, 5, 10, 5, 10, 15, 10, 15, 20]}) df df['data'].sum() for key in ['A', 'B', 'C']: print(key, df[df['key'] == key]['data'].sum()) df.groupby('key').sum() df.groupby('key').aggregate(np.sum) # 'sum' df.groupby('key')['data'].sum() df = pd.read_csv("data/titanic.csv") df.head() df.groupby('Sex')['Age'].mean() # df['Survived'].sum() / len(df['Survived']) df['Survived'].mean() df25 = df[df['Age'] <= 25] df25['Survived'].sum() / len(df25['Survived']) # df.groupby('Sex')[['Survived']].aggregate(lambda x: x.sum() / len(x)) df.groupby('Sex')[['Survived']].mean() df.groupby('Pclass')['Survived'].mean().plot(kind='bar') df['AgeClass'] = pd.cut(df['Age'], bins=np.arange(0,90,10)) df.groupby('AgeClass')['Fare'].mean().plot(kind='bar', rot=0) no2 = pd.read_csv('data/20000101_20161231-NO2.csv', sep=';', skiprows=[1], na_values=['n/d'], index_col=0, parse_dates=True) no2.index no2["2010-01-01 09:00": "2010-01-01 12:00"] no2['2012-01':'2012-03'] no2.index.hour no2.index.year no2.plot() no2.head() no2.resample('D').mean().head() no2.resample('D').max().head() no2.resample('M').mean().plot() # 'A' # no2['2012'].resample('D').plot() no2.loc['2009':, 'VERS'].resample('M').agg(['mean', 'median']).plot() no2.resample('A').mean().plot() no2.mean(axis=1).resample('A').mean().plot(color='k', linestyle='--', linewidth=4) no2['month'] = no2.index.month no2.groupby('month').mean() no2.groupby('month').mean().plot() no2.groupby(no2.index.hour).mean().plot() no2.index.weekday? no2['weekday'] = no2.index.weekday no2['weekend'] = no2['weekday'].isin([5, 6]) data_weekend = no2.groupby(['weekend', no2.index.hour]).mean() data_weekend.head() data_weekend_BASCH = data_weekend['BASCH'].unstack(level=0) data_weekend_BASCH.head() data_weekend_BASCH.plot() no2['hour'] = no2.index.hour no2.pivot_table(columns='weekend', index='hour', values='BASCH') # re-reading the data to have a clean version no2 = pd.read_csv('data/20000101_20161231-NO2.csv', sep=';', skiprows=[1], na_values=['n/d'], index_col=0, parse_dates=True) exceedances = no2 > 200 # group by year and count exceedances (sum of boolean) exceedances = exceedances.groupby(exceedances.index.year).sum() ax = exceedances.loc[2005:].plot(kind='bar') ax.axhline(18, color='k', linestyle='--') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Task 1. Compiling Ebola Data Step2: 2. Step3: 3. Step4: 4. Step5: Comments Step6: Task 3. Class War in Titanic Step7: For each of the following questions state clearly your assumptions and discuss your findings Step8: Data cleaning Step9: 1. Showing types, describing data and changing to categorical types Step10: 2. Step11: Comments Step12: 4. Step13: Comments Step14: Comments Step15: We don't see any clear difference between the two groups in term of survival rate. Step16: We can clearly notice that the survival rate decreases drastically as the class changes from first to "ecnonomy" class. Step17: We notice a huge difference in the survival rate between genders. Indeed, women have a much higher survival rate than men.
<ASSISTANT_TASK:> Python Code: DATA_FOLDER = 'Data' # Use the data folder provided in Tutorial 02 - Intro to Pandas. path = "Data/ebola" countries = [("Guinea","guinea_data"), ("Liberia","liberia_data"), ("Sierra Leone","sl_data")] data = pd.DataFrame() # for each country dataframe, concatenate all the sheets and add a new column with the corresponding country for country in countries: allFiles = glob.glob(path + "/" + country[1] + "/" + "/*csv") data_per_country = pd.concat((pd.read_csv(file) for file in allFiles), axis=0) data_per_country['Country'] = country[0] data = pd.concat([data, data_per_country]) # merge columns 'Date' and 'date' data['Date'] = pd.concat([data['Date'].dropna(), data['date'].dropna()]) data = data.drop('date', axis=1) data['Date'] = pd.to_datetime(data['Date']) # Guinea # basic formating of the data, to be more readable for a human data_cleaned_guinea = data.query('Country == "Guinea"').dropna(axis=1, how='all').set_index(['Date', 'Description'])['Totals'] data_cleaned_guinea = pd.pivot_table(data_cleaned_guinea.reset_index(), values='Totals', index='Date', columns='Description', aggfunc='sum') # select the two columns for which we are interested data_cleaned_guinea = data_cleaned_guinea[['New cases of confirmed', 'New deaths registered']].apply(pd.to_numeric, errors='coerce') # group by month computing the mean data_cleaned_guinea = data_cleaned_guinea.groupby(data_cleaned_guinea.index.month).mean() # display the values in a sexy manner data_cleaned_guinea.rename_axis({'New cases of confirmed': 'New cases (mean)', 'New deaths registered': 'Deaths (mean)'}, axis='columns', inplace=True) data_cleaned_guinea.index.names = ['Month'] data_cleaned_guinea.columns.name = '' data_cleaned_guinea # this function checks if a cumulative cell has been correctly fullfilled among the days, i.e. it checks that # as we go through the days the cumulative cell does not strictly decrease. If this is the case, then we write # NaN in the concerned cumulative cell: it is considered that the cell has been wrongly filled. def check_cumulative_entries(df, column): # initialize the last entry to 0 last_entry = 0 # for each day we will check if the current entry is strictly smaller the the last entry for d in df.index: current_entry = df.loc[d, column] if last_entry > current_entry: # if this is the case, we write NaN value in the concerned cell df.loc[d, column] = pd.np.nan else: # in the case where there is no problem, we update the last entry value, otherwise we don't change it last_entry = current_entry # we return the series modified return df[column] # this function builds a daily entry serie based on a cumulative one def compute_daily_entries_from_cumulative(df, column): # build the serie based on the dataframe df and the column we are interested s_cum = df[column] # create a shifted version of it s_cum_shifted = s_cum.shift(1) # initialize the first entry of the shifted version by the first entry of the original one s_cum_shifted[0] = s_cum[0] # compute the daily entry serie s_daily = s_cum - s_cum_shifted # return it return s_daily # Liberia # basic formating of the data, to be more readable for a human data_cleaned_liberia = data.query('Country == "Liberia"').dropna(axis=1, how='all').set_index(['Date','Variable'])['National'].apply(pd.to_numeric, errors='coerce') data_cleaned_liberia = pd.pivot_table(data_cleaned_liberia.reset_index(), values='National', index='Date', columns='Variable', aggfunc='sum') # new cases # write cumulative confirmed cases in last 6 entries as the concerned cells are empty (they just wrote the # cumulative confirmed cases in a different cell) for i, row in data_cleaned_liberia[(data_cleaned_liberia.index.month == 12) & (data_cleaned_liberia.index.day > 3)].iterrows(): data_cleaned_liberia.loc[i, 'Total confirmed cases'] = row['New case/s (confirmed)'] # check consistency of cumulative data data_cleaned_liberia['Total confirmed cases'] = check_cumulative_entries(data_cleaned_liberia, 'Total confirmed cases') # create daily entries data_cleaned_liberia['New case/s confirmed'] = compute_daily_entries_from_cumulative(data_cleaned_liberia, 'Total confirmed cases') # compute the mean by month new_cases_liberia = data_cleaned_liberia['New case/s confirmed'].resample('M').mean() # new deaths new_deaths_liberia = data_cleaned_liberia['Newly reported deaths'].resample('M').mean() # concatenate the two time series data_cleaned_liberia = pd.concat([new_cases_liberia, new_deaths_liberia], axis=1) # display the values in a sexy manner data_cleaned_liberia.rename_axis({'New case/s confirmed': 'New cases (mean)', 'Newly reported deaths': 'Deaths (mean)'}, axis='columns', inplace=True) data_cleaned_liberia.index.names = ['Month'] data_cleaned_liberia.index = data_cleaned_liberia.index.month data_cleaned_liberia # Sierra Leone # basic formating of the data, to be more readable for a human data_cleaned_SL = data.query('Country == "Sierra Leone"').dropna(axis=1, how='all').set_index(['Date','variable'])['National'].apply(pd.to_numeric, errors='coerce') data_cleaned_SL = pd.pivot_table(data_cleaned_SL.reset_index(), values='National', index='Date', columns='variable', aggfunc='sum') # no specific problem for the new cases new_cases_SL = data_cleaned_SL['new_confirmed'].resample('M').mean() # new deaths # check consisteny of cumulative data data_cleaned_SL['death_confirmed'] = check_cumulative_entries(data_cleaned_SL, 'death_confirmed') # create daily entries data_cleaned_SL['death_confirmed'] = compute_daily_entries_from_cumulative(data_cleaned_SL, 'death_confirmed') #compute the mean by month new_deaths_SL = data_cleaned_SL['death_confirmed'].resample('M').mean() # concatenate the two time series data_cleaned_SL = pd.concat([new_cases_SL, new_deaths_SL], axis=1) data_cleaned_SL # display the values in a sexy manner data_cleaned_SL.rename_axis({'new_confirmed': 'New cases (mean)', 'death_confirmed': 'Deaths (mean)'}, axis='columns', inplace=True) data_cleaned_SL.index.names = ['Month'] data_cleaned_SL.index = data_cleaned_SL.index.month data_cleaned_SL # general overview data_cleaned_guinea['Country'] = 'Guinea' data_cleaned_liberia['Country'] = 'Liberia' data_cleaned_SL['Country'] = 'Sierra Leone' # concatenate the data from the three countries to have a general overview overview = pd.concat([data_cleaned_guinea, data_cleaned_liberia,data_cleaned_SL]) overview.reset_index().set_index(['Country', 'Month']) path_RNA = "Data/microbiome" data_RNA = pd.DataFrame() allFiles_RNA = glob.glob(path_RNA + "/MID*.xls") metadata_RNA = path_RNA + "/metadata.xls" # Concat all the MID* files data_RNA = pd.concat((pd.read_excel(file, index_col=0, names=[file[16:-4]]) for file in allFiles_RNA), axis=1) # transpose index/columns and sort indexes data_RNA = data_RNA.T # add last file as columns data_RNA = pd.concat([data_RNA, pd.read_excel(metadata_RNA, index_col=0)], axis=1) # replace NaN values by 'unknown' data_RNA = data_RNA.fillna(value='unknown') data_RNA from IPython.core.display import HTML HTML(filename=DATA_FOLDER+'/titanic.html') # load data data_titanic = pd.read_excel('Data/titanic.xls') data_titanic.head() # We are only interested in handling a few of the columns and their missing values # We drop the row with a NaN value for Embarked since there are only two of them # We could also replace by the most frequent value policy, and thus fill with "S" in this case data_titanic.dropna(subset=["embarked"], inplace=True) # Fill NaN with median value policy for fare and age data_titanic["fare"].fillna(data_titanic["fare"].median(), inplace=True) data_titanic["age"].fillna(data_titanic["age"].median(), inplace=True) data_titanic.dtypes data_titanic.describe() for col in ['pclass', 'survived', 'sex', 'embarked']: data_titanic[col] = data_titanic[col].astype('category') data_titanic.dtypes import matplotlib.pyplot as plt fig, axes = plt.subplots(2, 2, figsize=(10,10)) data_titanic['pclass'].value_counts().plot(kind='bar', ax=axes[0, 0]) axes[0, 0].set_title('Number of passenger w.r.t class') data_titanic['embarked'].value_counts().plot(kind='bar', ax=axes[0, 1]) axes[0, 1].set_title('Number of passenger w.r.t embarkment location') data_titanic['sex'].value_counts().plot(kind='bar', ax=axes[1, 0]) axes[1, 0].set_title('Number of passenger w.r.t sex') age_binned = pd.cut(data_titanic['age'], bins=[0, 10, 20, 30, 40, 50, 60, 70, 80], include_lowest=True) axes[1, 1].set_title('Number of passenger w.r.t age range') age_binned.value_counts(sort=False).plot(kind='bar', ax=axes[1, 1]) plt.show() fig, axes = plt.subplots(1, 2, figsize=(16,8)) s = data_titanic['cabin'] s_nan = s.astype(str).str[0] # We have to replace the N s_nan = s_nan.replace('n', 'NaN') s_no_nan = s.dropna().astype(str).str[0] axes[0].set_title('Cabin repartition with undefined') s_nan.value_counts().plot.pie(ax=axes[0], autopct='%1.0f%%') axes[1].set_title('Cabin repartition without undefined') s_no_nan.value_counts().plot.pie(ax=axes[1], autopct='%1.0f%%') plt.show() plt.figure(figsize=(8,8)) df = data_titanic[data_titanic['survived'] == 1]['pclass'] df.value_counts().plot.pie(autopct='%1.0f%%') plt.title('Proportion of survivors for each class') plt.show() df = data_titanic[data_titanic['survived'] == 1] df = df.groupby(['pclass', 'sex']).size().unstack() df.plot.bar(stacked=True, figsize=(14,8)) plt.title('Proportion of survivors per sex and class') plt.show() df = data_titanic[['age', 'pclass', 'sex', 'survived']] df = df.sort_values('age') # Take the 50% quantile (quantile) of the indices (since the median by age) will not produce two equally sized sets. # The result will satisfy the conditions answered for the question 20) in the FAQ # CAREFUL: df must be sorted by age before taking such a median by indices. med_id = df.shape[0] // 2 print('Age of the median:', int(df.iloc[med_id]['age']), 'years old') df['age_group'] = 'Older' df.iloc[:med_id]['age_group'] = 'Younger' df['age_group'] = df['age_group'].astype('category') df['survived'] = df['survived'].astype(bool) groups = pd.DataFrame(df.groupby(['age_group', 'pclass', 'sex', 'survived']).size()) # Following the instructions: Present your results in a DataFrame with unique index. groups.reset_index(inplace=True) groups.columns = ['age category', 'class', 'sex', 'survived', 'count'] groups fig, axes = plt.subplots(1, 2, figsize=(16,8)) groups[groups['age category'] == 'Younger'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[0], labels=['', '']) groups[groups['age category'] == 'Older'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[1], labels=['', '']) axes[0].set_title('Proportion of survivors for younger') axes[1].set_title('Proportion of survivors for older') axes[0].legend(labels=['Not survived', 'Survived']) axes[1].legend(labels=['Not survived', 'Survived']) plt.show() fig, axes = plt.subplots(1, 3, figsize=(16,5)) groups[groups['class'] == 1].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[0], labels=['', '']) groups[groups['class'] == 2].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[1], labels=['', '']) groups[groups['class'] == 3].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[2], labels=['', '']) axes[0].set_title('Proportion of survivors for class 1') axes[1].set_title('Proportion of survivors for class 2') axes[2].set_title('Proportion of survivors for class 3') axes[0].legend(labels=['Not survived', 'Survived']) axes[1].legend(labels=['Not survived', 'Survived']) axes[2].legend(labels=['Not survived', 'Survived']) plt.show() fig, axes = plt.subplots(1, 2, figsize=(16,8)) groups[groups['sex'] == 'male'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[0], labels=['', '']) groups[groups['sex'] == 'female'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[1], labels=['', '']) axes[0].set_title('Proportion of survivors for male') axes[1].set_title('Proportion of survivors for female') axes[0].legend(labels=['Not survived', 'Survived']) axes[1].legend(labels=['Not survived', 'Survived']) plt.show() df = data_titanic[['age', 'pclass', 'sex', 'survived']] df = df.sort_values('age') # Take the 12.5% quantile (quantile) of the indices (since the median by age) will not produce two equally sized sets. # The result will satisfy the conditions answered for the question 20) in the FAQ # CAREFUL: df must be sorted by age before taking such a median by indices. med_id = df.shape[0] // 8 print('Age of the median:', int(df.iloc[med_id]['age']), 'years old') df['age_group'] = 'Older' df.iloc[:med_id]['age_group'] = 'Younger' df['age_group'] = df['age_group'].astype('category') df['survived'] = df['survived'].astype(bool) groups = pd.DataFrame(df.groupby(['age_group', 'pclass', 'sex', 'survived']).size()) # Following the instructions: Present your results in a DataFrame with unique index. groups.reset_index(inplace=True) groups.columns = ['age category', 'class', 'sex', 'survived', 'count'] fig, axes = plt.subplots(1, 2, figsize=(16,8)) groups[groups['age category'] == 'Younger'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[0], labels=['', '']) groups[groups['age category'] == 'Older'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[1], labels=['', '']) axes[0].set_title('Proportion of survivors for younger') axes[1].set_title('Proportion of survivors for older') axes[0].legend(labels=['Not survived', 'Survived']) axes[1].legend(labels=['Not survived', 'Survived']) plt.show() fig, axes = plt.subplots(1, 2, figsize=(16,8)) groups[groups['sex'] == 'male'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[0], labels=['', '']) groups[groups['sex'] == 'female'].groupby('survived').sum().plot.pie(y='count', autopct='%1.0f%%', ax=axes[1], labels=['', '']) axes[0].set_title('Proportion of survivors for male') axes[1].set_title('Proportion of survivors for female') axes[0].legend(labels=['Not survived', 'Survived']) axes[1].legend(labels=['Not survived', 'Survived']) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The dnnSwift object writes its output into the 'weights_dir' directory. The output consists of weights and validation data. Validation data is calculated from data that was not trained on, i.e. it can be used for 1-fold cross validation of the training epochs. Step2: The validation files are pickled dictionaries containing various metrics. Step3: Lets determine the epoch with the best validation accuracy. Step4: We've already seen that "top_1_acc" represents the top-1 accuracy. This is a common measure for determining the accuracy of neural networks. It represents the probability of the network correctly predicting the class of a validation data point. Additionally, the top-N accuracy is also calculated. This is the probability that the label of a validation data point is in the top N most likely classes predicted by the neural network. Step5: Beyond that, we can also calculate the precision-recall curves from the "precision" and "recall" keys. These entries contain nested dictionaries and are calculated for each label independently. They are calculated for various probability thresholds. That means that instead of naively using the highest probability to determine the class, one can set custom thresholds for each category. Step6: In addition to the precision and recall, the number of items predicted for each category at each threshold level is also stored. This can be useful for computing averages of precision and recall between categories. Note that this is not the total number of elements for each class in the validation data, but the number of elements predicted by the DNN, correct or not. Step7: Imports for this vignette Step8: ImageHandler Step9: The resulting file, TrainingData.h5, has the following structure Step10: Loading the Training Data Step11: The categories argument assigns numerical values to each label. The output of a tensorflow neural network is a vector of numbers, which can be interpreted as probabilities after the proper normalization. The integer value of the categories dictionary indicates the order of labels, i.e. in this case 'Circle' is assigned to the one-hot vector (1,0) and 'Square' to the one-hot vector (0,1). A normalized output of (0.4,0.6) would then be interpreted as a 60% probability for the input image being a square. Step12: By default, the split is 80%-10%-10% (Training, Validation, Testing), but this can be customized via the data_split argument of the constructor. It expects a list of values indicating the relative sizes of each image set (in order Step13: The image split can be saved. If, for whatever reason, the network needs to be revalidated or training is interrupted and continued, the identical training dataset must be used. For this reason, ImageHandler can also be initialized with an index list, preventing the creation of a new one. Step14: Images can be extracted directly from the image handler. This returns a custom object with the attributes "imgs" and "labels", which hold the image and label data, respectively. Note that index_high is an inclusive index, as opposed to python's usual indexing logic of excluding the upper limit. Ergo, setting Step15: Initializing the DNN Step16: The network wrapper is initialized via Step17: The required parameters are as follows Step18: The filename is the relative path under the objects basedir folder. The output type is defined by the file ending, e.g. *.png outputs an image. The full list of permitted output types can be found at the PyGraphViz homepage. Step19: The required parameters are as follows Step20: The trained parameters ('weights') are output as as pickled python dictionary. For each node with a set of parameters (i.e. convolutions and all derivatives), two keys exist in the dictionary, 'node_name/w' and 'node_name/b' for the multiplicative weights and the biases, respectively. The values of each dictionary entry is a numpy array Step21: If initializing a DNN with non-random weights, the dictionary must have two keys for each layer that requires parameters with the expected shape Step22: Comparing the input labels with the output logits Step23: Optional parameters for 'run_network()' Step24: Then initialize the network and run the output
<ASSISTANT_TASK:> Python Code: import dnnSwift # The layout is a list of dictionaries defining each layer of the DNN. # For this example, the DNN will consist of two blocks of # "convolution - convolution - maximum pooling", followed by a fully # connected layer and finally a cross entropy cost function dnn_layout = [ { "name": "data", "type": "input" }, { "name": "conv1", "type": "conv", "n_kernels": 32, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "data" }, { "name": "conv2", "type": "conv", "n_kernels": 32, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "conv1" }, { "name": "maxpool1", "type": "maxpool", "size": (3, 3), "stride": (2, 2), "padding" : "VALID", "input": "conv2" }, { "name": "conv3", "type": "conv", "n_kernels": 64, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "maxpool1" }, { "name": "conv4", "type": "conv", "n_kernels": 64, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "conv3" }, { "name": "maxpool2", "type": "maxpool", "size": (3, 3), "stride": (2, 2), "padding" : "VALID", "input": "conv4" }, {"name": "fc1", "type": "fc", "input": "maxpool2"}, {"name": "CrossEntropy", "type": "cross_entropy", "input": "fc1"}] # This is a dictionary that assigns numerical values to each label. The # keys of the dictionary are the actual labels used in the hdf5 file and # the values should be integery from 0 to N. Internally, labels are turned # into one-hot vectors, so in this set up, "0" becomes (1, 0, 0), "5" # becomes (0, 1, 0), and "7" becomes (0, 0, 1) categories = {"0": 0, "5": 1, "7": 2} # Initialize the DNN object. my_dnn = dnnSwift.DNNWrapper( categories=categories, layout=dnn_layout) # The training data must be initialized. This means that the hdf5 file is # scanned and the images split into a training, validation, and test set. # The indices of the lists are written into the 'outfile' as a pickled # dictionary. my_dnn.initialize_training_data( filename="demo_data/MNISTDemo.h5", outfile="demo_data/MNISTDemo_split.pkl") # Train the network. Set 'verbose=True' to see the full output, including # the remaining time my_dnn.train_dnn( num_epochs=5, batch_size=128, weights_dir="demo_data/weights", verbose=False) import pickle import os # For each epoch, a weights file and a validation file are created. # Counting starts at 0, i.e. *_0.pkl is the output AFTER the first epoch! all_files = os.listdir("demo_data/weights") print "All Files: " for f in all_files: print " - %s" % f with open("demo_data/weights/val_0.pkl", "r") as f: val_dat = pickle.load(f) keys = val_dat.keys() print "Validation file type: " + str(type(val_dat)) print "Validation file keys:" for key in keys: print " - %s" % key val_accs = [] for i in range(5): with open("demo_data/weights/val_%s.pkl" % str(i), "r") as f: val_accs.append(pickle.load(f)["top_1_acc"]) best_epoch = val_accs.index(max(val_accs)) print "Validation accuracies:" for val_acc in val_accs: print " - %.4f" % val_acc print "Best epoch: %s" % str(best_epoch) with open("demo_data/weights/val_0.pkl", "r") as f: val = pickle.load(f)["top_n_acc"] for key in val.keys(): print "Top-%s accuracy: %s" % (key, val[key]) import matplotlib.pyplot as plt # Precision and Recall are calculated for each category individually print "Labels: " + str(best_val["precision"].keys()) # We'll use the result of the first epoch to make the curve at least # somewhat interesting with open("demo_data/weights/val_0.pkl", "r") as f: val_dat = pickle.load(f) precision = val_dat["precision"]["5"] recall = val_dat["recall"]["5"] counts = val_dat["counts"]["5"] # The disadvantage of using a dictionary is that the entries are not # sorted. Future versions of this package may use a different storage # method for the validation p_thresh, p_val = zip(*precision.items()) sort_indices = [p_thresh.index(p) for p in sorted(p_thresh, key=lambda x: float(x))] p_thresh = [float(p_thresh[i]) for i in sort_indices] p_val = [p_val[i] for i in sort_indices] r_thresh, r_val = zip(*recall.items()) sort_indices = [r_thresh.index(r) for r in sorted(r_thresh, key=lambda x: float(x))] r_thresh = [float(r_thresh[i]) for i in sort_indices] r_val = [r_val[i] for i in sort_indices] c_thresh, c_val = zip(*counts.items()) sort_indices = [c_thresh.index(c) for c in sorted(c_thresh, key=lambda x: float(x))] c_thresh = [float(c_thresh[i]) for i in sort_indices] c_val = [c_val[i] for i in sort_indices] # The thresholds for all categories are identical: assert(p_thresh == r_thresh == c_thresh) # A value of 'nan' indicates that nothing was predicted, correctly or not, # with the given probability threshold. print "Threshold | Precision | Recall  | Counts" print "--------------------------------------------" for i in range(len(p_thresh)): print "%8.4f |" % p_thresh[i], \ "%8.4f |" % p_val[i], \ "%8.4f |" % r_val[i], \ "%5d" % c_val[i] print "--------------------------------------------" from __future__ import division import h5py import numpy as np import pickle import matplotlib.pyplot as plt %matplotlib inline # The size of our image segments (both dimensions have the same size) img_dims = 25 # The number of images in each class num_images = 10000 max_rad = ((img_dims - 1) // 2) - 1 center = (img_dims - 1) // 2 ind_y, ind_x = np.indices(dimensions=(img_dims, img_dims)) - center # Circles rand_rads = np.random.randint(5, max_rad+1, num_images) rand_intensities = np.random.randint(1, 256, num_images) noise_field = np.random.randint(-32, 33, (img_dims, img_dims, num_images)) rad_field = np.repeat(np.expand_dims(np.sqrt(ind_y**2 + ind_x**2), 2), num_images, 2) <= rand_rads img_circles = (rad_field.astype(dtype=np.int16) * rand_intensities) + noise_field img_circles[img_circles < 0] = 0 img_circles[img_circles > 255] = 255 # Squares rand_rads = np.random.randint(5, max_rad+1, num_images) rand_intensities = np.random.randint(1, 256, num_images) noise_field = np.random.randint(-32, 33, (img_dims, img_dims, num_images)) ind_x_square = np.repeat(np.expand_dims(ind_x, 2), num_images, 2) ind_y_square = np.repeat(np.expand_dims(ind_y, 2), num_images, 2) square_field = (np.abs(ind_x_square) <= rand_rads) * (np.abs(ind_y_square) <= rand_rads) img_squares = (square_field.astype(dtype=np.int16) * rand_intensities) + noise_field img_squares[img_squares < 0] = 0 img_squares[img_squares > 255] = 255 imgs = np.concatenate((img_circles, img_squares), 2) imgs = np.transpose(imgs, (2, 0, 1)) imgs = np.expand_dims(imgs, 1) imgs = imgs.astype(np.uint8) labels = np.expand_dims(np.repeat(("Circle", "Square"), (num_images, num_images)), 1) with h5py.File("TrainingData.h5", "w") as h5handle: h5handle.create_dataset(name="images", data=imgs, chunks=(1, 1, img_dims, img_dims), compression=3) h5handle.create_dataset(name="labels", data=labels, chunks=(1, 1), compression=3) with h5py.File("TrainingData.h5", "r") as h5handle: print "Entries: ", h5handle.keys() print h5handle["images"] print h5handle["labels"] import DNNSwift img_handler = DNNSwift.ImageHandler.initialize( filename="TrainingData.h5", categories={"Circle": 0, "Square": 1}) for list_name in img_handler.get_list_names(): print list_name, ":: Length:", img_handler.get_list_length(list_name) img_handler = DNNSwift.ImageHandler.initialize( filename="TrainingData.h5", categories={"Circle": 0, "Square": 1}, data_split=[60, 20, 20]) img_handler.save_lists("IndexLists.pkl") import pickle with open("IndexLists.pkl", "r") as f: index_file = pickle.load(f) print "Keys:", index_file.keys() print "Index Lists:" for key in index_file["index_list"].keys(): print " ", key, ":", index_file["index_list"][key] print "md5sum:", index_file["h5file_hash"] img_handler = DNNSwift.ImageHandler.initialize_with_index_list( filename="TrainingData.h5", categories={"Circle": 0, "Square": 1}, index_list=index_file) images = img_handler.get_images(list_name="test", index_low=0, index_high=9) print "Object type:", images print "images.imgs:", type(images.imgs), ";", images.imgs.shape print "images.labels:", type(images.labels), ";", images.labels.shape plt.imshow(np.concatenate(images.imgs[..., 0], axis=1)) dnn_layout = [{"name": "input", "type": "input"}, {"name": "conv1", "type": "conv", "n_kernels": 32, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "input"}, {"name": "conv2", "type": "conv", "n_kernels": 32, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "conv1"}, {"name": "maxpool1", "type": "maxpool", "size": (3, 3), "stride": (2, 2), "padding" : "VALID", "input": "conv2"}, {"name": "conv3", "type": "conv", "n_kernels": 64, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "maxpool1"}, {"name": "conv4", "type": "conv", "n_kernels": 64, "size": (3, 3), "stride": (1, 1), "padding" : "VALID", "input": "conv3"}, {"name": "maxpool2", "type": "maxpool", "size": (3, 3), "stride": (2, 2), "padding" : "VALID", "input": "conv4"}, {"name": "fc1", "type": "fc", "input": "maxpool2"}, {"name": "CrossEntropy", "type": "cross_entropy", "input": "fc1"}] trainer = DNNSwift.DNN( img_dims=img_handler.get_image_dims(), labels=img_handler.get_image_groups(), layer_params=dnn_layout, basedir="dnn_output") trainer.print_structure(filename="DNN_Structure.png") trainer.train_network( batch_size=128, image_handler=img_handler, num_epochs=1, subdir="weights", logfile="dnn_output/DNN_log.txt") import pickle with open("dnn_output/weights/val_0.pkl", "r") as f: val_dat = pickle.load(f) print "Keys:", val_dat.keys() print "Validation Accuracy:", val_dat["top_1_acc"] with open("dnn_output/weights/weights_0.pkl", "r") as f: weights = pickle.load(f) keys = sorted(weights.keys()) for key in keys: print key, ":", weights[key].shape # Initialize the object with the optimal set of weights trainer = DNNSwift.DNN( img_dims=img_handler.get_image_dims(), labels=img_handler.get_image_groups(), layer_params=dnn_layout, basedir="dnn_output", weights=weights) images = img_handler.get_images("test", 0, 9) output = trainer.run_network(input_images=images.imgs) print "Output shape:", output.shape print "Output:\n", np.squeeze(output) print "Image Categories:", img_handler.get_image_groups() print "Network Output:", np.argmax(np.squeeze(output), axis=1) print "Ground Truth: ", np.argmax(images.labels, axis=1) images = img_handler.get_images("test", 0, 3) big_image = np.concatenate( (np.concatenate((images.imgs[0], images.imgs[1]), axis=0), np.concatenate((images.imgs[2], images.imgs[3]), axis=0)), axis=1) big_image = np.expand_dims(big_image, axis=0) print "Big Image shape:", big_image.shape plt.imshow(big_image[0, :, :, 0]) # Use the same weights as above trainer = DNNSwift.DNN( img_dims=(50, 50, 1), labels=img_handler.get_image_groups(), layer_params=dnn_layout, basedir="dnn_output", weights=weights) output = trainer.run_network(input_images=big_image) output_argmax = np.squeeze(np.argmax(output, axis=3)) plt.imshow(output_argmax) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Exercise 1 Step2: Exercise 2 Step3: Exercise 3 Step4: Exercise 4 Step5: Exercise 5 Step6: Exercise 6
<ASSISTANT_TASK:> Python Code: # Source: Manuel Torres. Universidad de Almería. import pymysql # Establecemos la conexion con la base de datos bd = pymysql.connect("localhost", "root", "gebd", "RRHH") # Preparamos el cursor que nos va a ayudar a realizar las operaciones con la base de datos cursor = bd.cursor() # Ejecutamos un query SQL usando el metodo execute() que nos proporciona el cursor cursor.execute("SELECT * FROM Empleado") resultado = cursor.fetchall() # Extraemos una sola fila usando el metodo fetchone() for fila in resultado: print("%s %s %s" % (fila[0], fila[1], fila[2])) # Nos desconectamos de la base de datos bd.close() resultado[0][2] all_jobs = [x[2] for x in resultado] all_jobs = [] for i in resultado: all_jobs.append(i[2]) all_jobs diff_jobs = set(all_jobs) diff_jobs jobs_count = {} for i in diff_jobs: jobs_count[i] = 0 jobs_count for i in all_jobs: jobs_count[i] += 1 jobs_count jobs_count = {} for i in diff_jobs: jobs_count[i] = all_jobs.count(i) jobs_count jobs_count['Analista'] count_jobs = [] for i in jobs_count: count_jobs.append((jobs_count[i], i)) count_jobs sorted_count_jobs = sorted(count_jobs, reverse=True) sorted_count_jobs sorted_count_jobs[1][1] i = 1 most_common_jobs = [(sorted_count_jobs[0][1], sorted_count_jobs[0][0])] most_common_jobs while(sorted_count_jobs[i][0] == sorted_count_jobs[0][0]): x = (sorted_count_jobs[i][1], sorted_count_jobs[i][0]) most_common_jobs.append(x) i += 1 most_common_jobs <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: First we need to define materials that will be used in the problem. Before defining a material, we must create nuclides that are used in the material. Step2: With the nuclides we defined, we will now create three materials for the fuel, water, and cladding of the fuel pins. Step3: With our three materials, we can now create a Materials object that can be exported to an actual XML file. Step4: Now let's move on to the geometry. This problem will be a square array of fuel pins and control rod guide tubes for which we can use OpenMC's lattice/universe feature. The basic universe will have three regions for the fuel, the clad, and the surrounding coolant. The first step is to create the bounding surfaces for fuel and clad, as well as the outer bounding surfaces of the problem. Step5: With the surfaces defined, we can now construct a fuel pin cell from cells that are defined by intersections of half-spaces created by the surfaces. Step6: Likewise, we can construct a control rod guide tube with the same surfaces. Step7: Using the pin cell universe, we can construct a 17x17 rectangular lattice with a 1.26 cm pitch. Step8: Next, we create a NumPy array of fuel pin and guide tube universes for the lattice. Step9: OpenMC requires that there is a "root" universe. Let us create a root cell that is filled by the pin cell universe and then assign it to the root universe. Step10: We now must create a geometry that is assigned a root universe and export it to XML. Step11: With the geometry and materials finished, we now just need to define simulation parameters. In this case, we will use 10 inactive batches and 40 active batches each with 2500 particles. Step12: Let us also create a Plots file that we can use to verify that our fuel assembly geometry was created successfully. Step13: With the plots.xml file, we can now generate and view the plot. OpenMC outputs plots in .ppm format, which can be converted into a compressed format like .png with the convert utility. Step14: As we can see from the plot, we have a nice array of fuel and guide tube pin cells with fuel, cladding, and water! Step15: Next, we will instantiate an openmc.mgxs.Library for the energy and delayed groups with our the fuel assembly geometry. Step16: Now, we can run OpenMC to generate the cross sections. Step17: Tally Data Processing Step18: The statepoint is now ready to be analyzed by the Library. We simply have to load the tallies from the statepoint into the Library and our MGXS objects will compute the cross sections for us under-the-hood. Step19: Using Tally Arithmetic to Compute the Delayed Neutron Precursor Concentrations Step20: Another useful feature of the Python API is the ability to extract the surface currents for the interfaces and surfaces of a mesh. We can inspect the currents for the mesh by getting the pandas dataframe. Step21: Cross Section Visualizations
<ASSISTANT_TASK:> Python Code: import math import pickle from IPython.display import Image import matplotlib.pyplot as plt import numpy as np import openmc import openmc.mgxs import openmoc import openmoc.process from openmoc.opencg_compatible import get_openmoc_geometry from openmoc.materialize import load_openmc_mgxs_lib %matplotlib inline # Instantiate some Nuclides h1 = openmc.Nuclide('H1') b10 = openmc.Nuclide('B10') o16 = openmc.Nuclide('O16') u235 = openmc.Nuclide('U235') u238 = openmc.Nuclide('U238') zr90 = openmc.Nuclide('Zr90') # 1.6 enriched fuel fuel = openmc.Material(name='1.6% Fuel') fuel.set_density('g/cm3', 10.31341) fuel.add_nuclide(u235, 3.7503e-4) fuel.add_nuclide(u238, 2.2625e-2) fuel.add_nuclide(o16, 4.6007e-2) # borated water water = openmc.Material(name='Borated Water') water.set_density('g/cm3', 0.740582) water.add_nuclide(h1, 4.9457e-2) water.add_nuclide(o16, 2.4732e-2) water.add_nuclide(b10, 8.0042e-6) # zircaloy zircaloy = openmc.Material(name='Zircaloy') zircaloy.set_density('g/cm3', 6.55) zircaloy.add_nuclide(zr90, 7.2758e-3) # Instantiate a Materials object materials_file = openmc.Materials((fuel, water, zircaloy)) materials_file.default_xs = '71c' # Export to "materials.xml" materials_file.export_to_xml() # Create cylinders for the fuel and clad fuel_outer_radius = openmc.ZCylinder(x0=0.0, y0=0.0, R=0.39218) clad_outer_radius = openmc.ZCylinder(x0=0.0, y0=0.0, R=0.45720) # Create boundary planes to surround the geometry min_x = openmc.XPlane(x0=-10.71, boundary_type='reflective') max_x = openmc.XPlane(x0=+10.71, boundary_type='reflective') min_y = openmc.YPlane(y0=-10.71, boundary_type='reflective') max_y = openmc.YPlane(y0=+10.71, boundary_type='reflective') min_z = openmc.ZPlane(z0=-10., boundary_type='reflective') max_z = openmc.ZPlane(z0=+10., boundary_type='reflective') # Create a Universe to encapsulate a fuel pin fuel_pin_universe = openmc.Universe(name='1.6% Fuel Pin') # Create fuel Cell fuel_cell = openmc.Cell(name='1.6% Fuel') fuel_cell.fill = fuel fuel_cell.region = -fuel_outer_radius fuel_pin_universe.add_cell(fuel_cell) # Create a clad Cell clad_cell = openmc.Cell(name='1.6% Clad') clad_cell.fill = zircaloy clad_cell.region = +fuel_outer_radius & -clad_outer_radius fuel_pin_universe.add_cell(clad_cell) # Create a moderator Cell moderator_cell = openmc.Cell(name='1.6% Moderator') moderator_cell.fill = water moderator_cell.region = +clad_outer_radius fuel_pin_universe.add_cell(moderator_cell) # Create a Universe to encapsulate a control rod guide tube guide_tube_universe = openmc.Universe(name='Guide Tube') # Create guide tube Cell guide_tube_cell = openmc.Cell(name='Guide Tube Water') guide_tube_cell.fill = water guide_tube_cell.region = -fuel_outer_radius guide_tube_universe.add_cell(guide_tube_cell) # Create a clad Cell clad_cell = openmc.Cell(name='Guide Clad') clad_cell.fill = zircaloy clad_cell.region = +fuel_outer_radius & -clad_outer_radius guide_tube_universe.add_cell(clad_cell) # Create a moderator Cell moderator_cell = openmc.Cell(name='Guide Tube Moderator') moderator_cell.fill = water moderator_cell.region = +clad_outer_radius guide_tube_universe.add_cell(moderator_cell) # Create fuel assembly Lattice assembly = openmc.RectLattice(name='1.6% Fuel Assembly') assembly.pitch = (1.26, 1.26) assembly.lower_left = [-1.26 * 17. / 2.0] * 2 # Create array indices for guide tube locations in lattice template_x = np.array([5, 8, 11, 3, 13, 2, 5, 8, 11, 14, 2, 5, 8, 11, 14, 2, 5, 8, 11, 14, 3, 13, 5, 8, 11]) template_y = np.array([2, 2, 2, 3, 3, 5, 5, 5, 5, 5, 8, 8, 8, 8, 8, 11, 11, 11, 11, 11, 13, 13, 14, 14, 14]) # Initialize an empty 17x17 array of the lattice universes universes = np.empty((17, 17), dtype=openmc.Universe) # Fill the array with the fuel pin and guide tube universes universes[:,:] = fuel_pin_universe universes[template_x, template_y] = guide_tube_universe # Store the array of universes in the lattice assembly.universes = universes # Create root Cell root_cell = openmc.Cell(name='root cell') root_cell.fill = assembly # Add boundary planes root_cell.region = +min_x & -max_x & +min_y & -max_y & +min_z & -max_z # Create root Universe root_universe = openmc.Universe(universe_id=0, name='root universe') root_universe.add_cell(root_cell) # Create Geometry and set root Universe geometry = openmc.Geometry() geometry.root_universe = root_universe # Export to "geometry.xml" geometry.export_to_xml() # OpenMC simulation parameters batches = 50 inactive = 10 particles = 2500 # Instantiate a Settings object settings_file = openmc.Settings() settings_file.batches = batches settings_file.inactive = inactive settings_file.particles = particles settings_file.output = {'tallies': False} # Create an initial uniform spatial source distribution over fissionable zones bounds = [-10.71, -10.71, -10, 10.71, 10.71, 10.] uniform_dist = openmc.stats.Box(bounds[:3], bounds[3:], only_fissionable=True) settings_file.source = openmc.source.Source(space=uniform_dist) # Export to "settings.xml" settings_file.export_to_xml() # Instantiate a Plot plot = openmc.Plot(plot_id=1) plot.filename = 'materials-xy' plot.origin = [0, 0, 0] plot.pixels = [250, 250] plot.width = [-10.71*2, -10.71*2] plot.color = 'mat' # Instantiate a Plots object, add Plot, and export to "plots.xml" plot_file = openmc.Plots([plot]) plot_file.export_to_xml() # Run openmc in plotting mode openmc.plot_geometry(output=False) # Convert OpenMC's funky ppm to png !convert materials-xy.ppm materials-xy.png # Display the materials plot inline Image(filename='materials-xy.png') # Instantiate a 20-group EnergyGroups object energy_groups = openmc.mgxs.EnergyGroups() energy_groups.group_edges = np.logspace(-3, 7.3, 21) # Instantiate a 1-group EnergyGroups object one_group = openmc.mgxs.EnergyGroups() one_group.group_edges = np.array([energy_groups.group_edges[0], energy_groups.group_edges[-1]]) # Instantiate a 6-delayed-group list delayed_groups = list(range(1,7)) # Instantiate a tally mesh mesh = openmc.Mesh(mesh_id=1) mesh.type = 'regular' mesh.dimension = [17, 17, 1] mesh.lower_left = [-10.71, -10.71, -10000.] mesh.width = [1.26, 1.26, 20000.] # Initialize an 20-energy-group and 6-delayed-group MGXS Library mgxs_lib = openmc.mgxs.Library(geometry) mgxs_lib.energy_groups = energy_groups mgxs_lib.delayed_groups = delayed_groups # Specify multi-group cross section types to compute mgxs_lib.mgxs_types = ['total', 'transport', 'nu-scatter matrix', 'kappa-fission', 'inverse-velocity', 'chi-prompt', 'prompt-nu-fission', 'chi-delayed', 'delayed-nu-fission', 'beta'] # Specify a "mesh" domain type for the cross section tally filters mgxs_lib.domain_type = 'mesh' # Specify the mesh domain over which to compute multi-group cross sections mgxs_lib.domains = [mesh] # Construct all tallies needed for the multi-group cross section library mgxs_lib.build_library() # Create a "tallies.xml" file for the MGXS Library tallies_file = openmc.Tallies() mgxs_lib.add_to_tallies_file(tallies_file, merge=True) # Instantiate a current tally mesh_filter = openmc.MeshFilter(mesh) current_tally = openmc.Tally(name='current tally') current_tally.scores = ['current'] current_tally.filters = [mesh_filter] # Add current tally to the tallies file tallies_file.append(current_tally) # Export to "tallies.xml" tallies_file.export_to_xml() # Run OpenMC openmc.run() # Load the last statepoint file sp = openmc.StatePoint('statepoint.50.h5') # Initialize MGXS Library with OpenMC statepoint data mgxs_lib.load_from_statepoint(sp) # Extrack the current tally separately current_tally = sp.get_tally(name='current tally') # Set the time constants for the delayed precursors (in seconds^-1) precursor_halflife = np.array([55.6, 24.5, 16.3, 2.37, 0.424, 0.195]) precursor_lambda = -np.log(0.5) / precursor_halflife beta = mgxs_lib.get_mgxs(mesh, 'beta') # Create a tally object with only the delayed group filter for the time constants beta_filters = [f for f in beta.xs_tally.filters if type(f) is not openmc.DelayedGroupFilter] lambda_tally = beta.xs_tally.summation(nuclides=beta.xs_tally.nuclides) for f in beta_filters: lambda_tally = lambda_tally.summation(filter_type=type(f), remove_filter=True) * 0. + 1. # Set the mean of the lambda tally and reshape to account for nuclides and scores lambda_tally._mean = precursor_lambda lambda_tally._mean.shape = lambda_tally.std_dev.shape # Set a total nuclide and lambda score lambda_tally.nuclides = [openmc.Nuclide(name='total')] lambda_tally.scores = ['lambda'] delayed_nu_fission = mgxs_lib.get_mgxs(mesh, 'delayed-nu-fission') # Use tally arithmetic to compute the precursor concentrations precursor_conc = beta.xs_tally.summation(filter_type=openmc.EnergyFilter, remove_filter=True) * \ delayed_nu_fission.xs_tally.summation(filter_type=openmc.EnergyFilter, remove_filter=True) / lambda_tally # The difference is a derived tally which can generate Pandas DataFrames for inspection precursor_conc.get_pandas_dataframe().head(10) current_tally.get_pandas_dataframe().head(10) # Extract the energy-condensed delayed neutron fraction tally beta_by_group = beta.get_condensed_xs(one_group).xs_tally.summation(filter_type='energy', remove_filter=True) beta_by_group.mean.shape = (17, 17, 6) beta_by_group.mean[beta_by_group.mean == 0] = np.nan # Plot the betas plt.figure(figsize=(18,9)) fig = plt.subplot(231) plt.imshow(beta_by_group.mean[:,:,0], interpolation='none', cmap='jet') plt.colorbar() plt.title('Beta - delayed group 1') fig = plt.subplot(232) plt.imshow(beta_by_group.mean[:,:,1], interpolation='none', cmap='jet') plt.colorbar() plt.title('Beta - delayed group 2') fig = plt.subplot(233) plt.imshow(beta_by_group.mean[:,:,2], interpolation='none', cmap='jet') plt.colorbar() plt.title('Beta - delayed group 3') fig = plt.subplot(234) plt.imshow(beta_by_group.mean[:,:,3], interpolation='none', cmap='jet') plt.colorbar() plt.title('Beta - delayed group 4') fig = plt.subplot(235) plt.imshow(beta_by_group.mean[:,:,4], interpolation='none', cmap='jet') plt.colorbar() plt.title('Beta - delayed group 5') fig = plt.subplot(236) plt.imshow(beta_by_group.mean[:,:,5], interpolation='none', cmap='jet') plt.colorbar() plt.title('Beta - delayed group 6') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The sigmoid function "squashes" inputs to lie between 0 and 1. Unfortunately, this means that for inputs with sigmoid output close to 0 or 1, the gradient with respect to those inputs are close to zero. This leads to the phenomenon of vanishing gradients, where gradients drop close to zero, and the net does not learn well. Step2: Let's try and see now how the two kinds of nonlinearities change deep neural net training in practice. Below, we build a very simple neural net with three layers (two hidden layers), for which you can swap out ReLU/ sigmoid nonlinearities. Step3: Train net with sigmoid nonlinearity first Step4: Now train net with ReLU nonlinearity Step5: The Vanishing Gradient Issue Step6: Feel free to play around with this notebook to gain intuition. Things you might want to try
<ASSISTANT_TASK:> Python Code: # Setup import numpy as np import matplotlib.pyplot as plt %matplotlib inline plt.rcParams['figure.figsize'] = (10.0, 8.0) # set default size of plots plt.rcParams['image.interpolation'] = 'nearest' plt.rcParams['image.cmap'] = 'gray' # for auto-reloading external modules # see http://stackoverflow.com/questions/1907993/autoreload-of-modules-in-ipython %load_ext autoreload %autoreload 2 # generate random data -- not linearly separable np.random.seed(0) N = 100 # number of points per class D = 2 # dimensionality K = 3 # number of classes X = np.zeros((N*K, D)) num_train_examples = X.shape[0] y = np.zeros(N*K, dtype='uint8') for j in range(K): ix = range(N*j, N*(j+1)) r = np.linspace(0.0,1,N) # radius t = np.linspace(j*4,(j+1)*4,N) + np.random.randn(N)*0.2 # theta X[ix] = np.c_[r*np.sin(t), r*np.cos(t)] y[ix] = j fig = plt.figure() plt.scatter(X[:, 0], X[:, 1], c=y, s=40, cmap=plt.cm.Spectral) plt.xlim([-1,1]) plt.ylim([-1,1]) def sigmoid(x): x = 1 / (1 + np.exp(-x)) return x def sigmoid_grad(x): return (x) * (1 - x) def relu(x): return np.maximum(0,x) #function to train a three layer neural net with either RELU or sigmoid nonlinearity via vanilla grad descent def three_layer_net(NONLINEARITY, X, y, model, step_size, reg): #parameter initialization h = model['h'] h2= model['h2'] W1= model['W1'] W2= model['W2'] W3= model['W3'] b1= model['b1'] b2= model['b2'] b3= model['b3'] # some hyperparameters # gradient descent loop num_examples = X.shape[0] plot_array_1=[] plot_array_2=[] for i in range(50000): #FOWARD PROP if NONLINEARITY== 'RELU': hidden_layer = relu(np.dot(X, W1) + b1) hidden_layer2 = relu(np.dot(hidden_layer, W2) + b2) scores = np.dot(hidden_layer2, W3) + b3 elif NONLINEARITY == 'SIGM': hidden_layer = sigmoid(np.dot(X, W1) + b1) hidden_layer2 = sigmoid(np.dot(hidden_layer, W2) + b2) scores = np.dot(hidden_layer2, W3) + b3 exp_scores = np.exp(scores) probs = exp_scores / np.sum(exp_scores, axis=1, keepdims=True) # [N x K] #print(X.shape) #print(scores.shape) #print(np.sum(exp_scores, axis=1, keepdims=True).shape) #print(probs.shape) #assert False # compute the loss: average cross-entropy loss and regularization # v = probs[range(num_examples), y] -> 1d vector v[i] = probs[i, y[i]]] corect_logprobs = -np.log(probs[range(num_examples), y]) data_loss = np.sum(corect_logprobs) / num_examples reg_loss = 0.5*reg*np.sum(W1*W1) + 0.5*reg*np.sum(W2*W2)+ 0.5*reg*np.sum(W3*W3) loss = data_loss + reg_loss if i % 1000 == 0: print("iteration %d: loss %f" % (i, loss)) # compute the gradient on scores dscores = probs dscores[range(num_examples), y] -= 1 dscores /= num_examples # BACKPROP HERE dW3 = (hidden_layer2.T).dot(dscores) db3 = np.sum(dscores, axis=0, keepdims=True) if NONLINEARITY == 'RELU': #backprop ReLU nonlinearity here dhidden2 = np.dot(dscores, W3.T) dhidden2[hidden_layer2 <= 0] = 0 dW2 = np.dot( hidden_layer.T, dhidden2) plot_array_2.append(np.sum(np.abs(dW2)) / np.sum(np.abs(dW2.shape))) db2 = np.sum(dhidden2, axis=0) dhidden = np.dot(dhidden2, W2.T) dhidden[hidden_layer <= 0] = 0 elif NONLINEARITY == 'SIGM': #backprop sigmoid nonlinearity here dhidden2 = dscores.dot(W3.T)*sigmoid_grad(hidden_layer2) dW2 = (hidden_layer.T).dot(dhidden2) plot_array_2.append(np.sum(np.abs(dW2))/np.sum(np.abs(dW2.shape))) db2 = np.sum(dhidden2, axis=0) dhidden = dhidden2.dot(W2.T)*sigmoid_grad(hidden_layer) dW1 = np.dot(X.T, dhidden) plot_array_1.append(np.sum(np.abs(dW1))/np.sum(np.abs(dW1.shape))) db1 = np.sum(dhidden, axis=0) # add regularization dW3 += reg * W3 dW2 += reg * W2 dW1 += reg * W1 #option to return loss, grads -- uncomment next comment grads={} grads['W1']=dW1 grads['W2']=dW2 grads['W3']=dW3 grads['b1']=db1 grads['b2']=db2 grads['b3']=db3 #return loss, grads # update W1 += -step_size * dW1 b1 += -step_size * db1 W2 += -step_size * dW2 b2 += -step_size * db2 W3 += -step_size * dW3 b3 += -step_size * db3 # evaluate training set accuracy if NONLINEARITY == 'RELU': hidden_layer = relu(np.dot(X, W1) + b1) hidden_layer2 = relu(np.dot(hidden_layer, W2) + b2) elif NONLINEARITY == 'SIGM': hidden_layer = sigmoid(np.dot(X, W1) + b1) hidden_layer2 = sigmoid(np.dot(hidden_layer, W2) + b2) scores = np.dot(hidden_layer2, W3) + b3 predicted_class = np.argmax(scores, axis=1) print('training accuracy: %.2f' % (np.mean(predicted_class == y))) #return cost, grads return plot_array_1, plot_array_2, W1, W2, W3, b1, b2, b3 #Initialize toy model, train sigmoid net N = 100 # number of points per class D = 2 # dimensionality K = 3 # number of classes h=50 h2=50 num_train_examples = X.shape[0] model={} model['h'] = h # size of hidden layer 1 model['h2']= h2# size of hidden layer 2 model['W1']= 0.1 * np.random.randn(D,h) model['b1'] = np.zeros((1,h)) model['W2'] = 0.1 * np.random.randn(h,h2) model['b2']= np.zeros((1,h2)) model['W3'] = 0.1 * np.random.randn(h2,K) model['b3'] = np.zeros((1,K)) (sigm_array_1, sigm_array_2, s_W1, s_W2,s_W3, s_b1, s_b2,s_b3) = three_layer_net('SIGM', X,y,model, step_size=1e-1, reg=1e-3) #Re-initialize model, train relu net model={} model['h'] = h # size of hidden layer 1 model['h2']= h2# size of hidden layer 2 model['W1']= 0.1 * np.random.randn(D,h) model['b1'] = np.zeros((1,h)) model['W2'] = 0.1 * np.random.randn(h,h2) model['b2']= np.zeros((1,h2)) model['W3'] = 0.1 * np.random.randn(h2,K) model['b3'] = np.zeros((1,K)) (relu_array_1, relu_array_2, r_W1, r_W2,r_W3, r_b1, r_b2,r_b3) = three_layer_net('RELU', X,y,model, step_size=1e-1, reg=1e-3) plt.plot(np.array(sigm_array_1)) plt.plot(np.array(sigm_array_2)) plt.title('Sum of magnitudes of gradients -- SIGM weights') plt.legend(("sigm first layer", "sigm second layer")) plt.plot(np.array(relu_array_1)) plt.plot(np.array(relu_array_2)) plt.title('Sum of magnitudes of gradients -- ReLU weights') plt.legend(("relu first layer", "relu second layer")) # Overlaying the two plots to compare plt.plot(np.array(relu_array_1)) plt.plot(np.array(relu_array_2)) plt.plot(np.array(sigm_array_1)) plt.plot(np.array(sigm_array_2)) plt.title('Sum of magnitudes of gradients -- hidden layer neurons') plt.legend(("relu first layer", "relu second layer","sigm first layer", "sigm second layer")) # plot the classifiers- SIGMOID h = 0.02 x_min, x_max = X[:, 0].min() - 1, X[:, 0].max() + 1 y_min, y_max = X[:, 1].min() - 1, X[:, 1].max() + 1 xx, yy = np.meshgrid(np.arange(x_min, x_max, h), np.arange(y_min, y_max, h)) Z = np.dot(sigmoid(np.dot(sigmoid(np.dot(np.c_[xx.ravel(), yy.ravel()], s_W1) + s_b1), s_W2) + s_b2), s_W3) + s_b3 Z = np.argmax(Z, axis=1) Z = Z.reshape(xx.shape) fig = plt.figure() plt.contourf(xx, yy, Z, cmap=plt.cm.Spectral, alpha=0.8) plt.scatter(X[:, 0], X[:, 1], c=y, s=40, cmap=plt.cm.Spectral) plt.xlim(xx.min(), xx.max()) plt.ylim(yy.min(), yy.max()) # plot the classifiers-- RELU h = 0.02 x_min, x_max = X[:, 0].min() - 1, X[:, 0].max() + 1 y_min, y_max = X[:, 1].min() - 1, X[:, 1].max() + 1 xx, yy = np.meshgrid(np.arange(x_min, x_max, h), np.arange(y_min, y_max, h)) Z = np.dot(relu(np.dot(relu(np.dot(np.c_[xx.ravel(), yy.ravel()], r_W1) + r_b1), r_W2) + r_b2), r_W3) + r_b3 Z = np.argmax(Z, axis=1) Z = Z.reshape(xx.shape) fig = plt.figure() plt.contourf(xx, yy, Z, cmap=plt.cm.Spectral, alpha=0.8) plt.scatter(X[:, 0], X[:, 1], c=y, s=40, cmap=plt.cm.Spectral) plt.xlim(xx.min(), xx.max()) plt.ylim(yy.min(), yy.max()) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Generating data Step2: Model specification Step3: In order to update our beliefs about the parameters, we use the posterior distributions, which will be used as the prior distributions for the next inference. The data used for each inference iteration has to be independent from the previous iterations, otherwise the same (possibly wrong) belief is injected over and over in the system, amplifying the errors and misleading the inference. By ensuring the data is independent, the system should converge to the true parameter values. Step4: Now we just need to generate more data and build our Bayesian model so that the prior distributions for the current iteration are the posterior distributions from the previous iteration. It is still possible to continue using NUTS sampling method because Interpolated class implements calculation of gradients that are necessary for Hamiltonian Monte Carlo samplers.
<ASSISTANT_TASK:> Python Code: import matplotlib.pyplot as plt import matplotlib as mpl from pymc3 import Model, Normal, Slice from pymc3 import sample from pymc3 import traceplot from pymc3.distributions import Interpolated from theano import as_op import theano.tensor as tt import numpy as np from scipy import stats %matplotlib inline # Initialize random number generator np.random.seed(123) # True parameter values alpha_true = 5 beta0_true = 7 beta1_true = 13 # Size of dataset size = 100 # Predictor variable X1 = np.random.randn(size) X2 = np.random.randn(size) * 0.2 # Simulate outcome variable Y = alpha_true + beta0_true * X1 + beta1_true * X2 + np.random.randn(size) basic_model = Model() with basic_model: # Priors for unknown model parameters alpha = Normal('alpha', mu=0, sd=1) beta0 = Normal('beta0', mu=12, sd=1) beta1 = Normal('beta1', mu=18, sd=1) # Expected value of outcome mu = alpha + beta0 * X1 + beta1 * X2 # Likelihood (sampling distribution) of observations Y_obs = Normal('Y_obs', mu=mu, sd=1, observed=Y) # draw 10000 posterior samples trace = sample(10000) traceplot(trace); def from_posterior(param, samples): smin, smax = np.min(samples), np.max(samples) width = smax - smin x = np.linspace(smin, smax, 100) y = stats.gaussian_kde(samples)(x) # what was never sampled should have a small probability but not 0, # so we'll extend the domain and use linear approximation of density on it x = np.concatenate([[x[0] - 3 * width], x, [x[-1] + 3 * width]]) y = np.concatenate([[0], y, [0]]) return Interpolated(param, x, y) traces = [trace] for _ in range(10): # generate more data X1 = np.random.randn(size) X2 = np.random.randn(size) * 0.2 Y = alpha_true + beta0_true * X1 + beta1_true * X2 + np.random.randn(size) model = Model() with model: # Priors are posteriors from previous iteration alpha = from_posterior('alpha', trace['alpha']) beta0 = from_posterior('beta0', trace['beta0']) beta1 = from_posterior('beta1', trace['beta1']) # Expected value of outcome mu = alpha + beta0 * X1 + beta1 * X2 # Likelihood (sampling distribution) of observations Y_obs = Normal('Y_obs', mu=mu, sd=1, observed=Y) # draw 10000 posterior samples trace = sample(10000) traces.append(trace) print('Posterior distributions after ' + str(len(traces)) + ' iterations.') cmap = mpl.cm.autumn for param in ['alpha', 'beta0', 'beta1']: plt.figure(figsize=(8, 2)) for update_i, trace in enumerate(traces): samples = trace[param] smin, smax = np.min(samples), np.max(samples) x = np.linspace(smin, smax, 100) y = stats.gaussian_kde(samples)(x) plt.plot(x, y, color=cmap(1 - update_i / len(traces))) plt.axvline({'alpha': alpha_true, 'beta0': beta0_true, 'beta1': beta1_true}[param], c='k') plt.ylabel('Frequency') plt.title(param) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Enoncé Step2: Exercice 1 Step3: Exercice 2 Step4: Vous avez aussi le droit de tricher pour une troisième idée Heap / Tas mais il faudra vous débrouiller tout seul. Step5: Réponses Step6: Or trier tous les éléments n'est pas nécessaire. On n'a pas besoin de trier tous les éléments après la position k. Il est donc a priori envisageable de fairre mieux en ne faisant que les calculs nécessaires. Step7: Le coût de l'algorithme est en $O(kn)$. Step8: Le coût de l'algorithme est dans le pire des cas $O(n * (\ln k + k))$ Step9: Exercice 3 Step10: Une seconde version sans récurrence. Step11: Exercice 4 Step12: La première fonction est plus rapide surtout parce que le tri est implémenté par une fonction du langage particulièrement optimisée (en C). Il faudrait implémenter un tri en python pour pouvoir comparer. Step13: Il faut faire tourner la fonction un grand nombre de fois sur différentes tailles de n pour voir l'évolution. Step14: Pas évident, le langage est trop haut niveau et le coût de l'interpréteur gomme les aspects algorithmique. Il faudrait augmenter la taille du tableau à trier ou affiner la mesure.
<ASSISTANT_TASK:> Python Code: from jyquickhelper import add_notebook_menu add_notebook_menu() %matplotlib inline import numpy perm = numpy.random.permutation(numpy.arange(20)) perm def topk_sortall(ensemble, k): # à vous # ... pass topk_sortall(perm, 4) def topk_idee1ou2(ensemble, k): pass from time import perf_counter def topk_sortall(ensemble, k): ensemble = ensemble.copy() ensemble.sort() return ensemble[:k] topk_sortall(perm, 4) def topk_tri_selection(ensemble, k): ensemble = ensemble.copy() for i in range(0, min(k, len(ensemble))): for j in range(i + 1, len(ensemble)): if ensemble[i] > ensemble[j]: ensemble[i], ensemble[j] = ensemble[j], ensemble[i] return ensemble[:k] topk_tri_selection(perm, 4) def topk_insertion(ensemble, k): def position(sub, value): a, b = 0, len(sub) - 1 m = (a + b) // 2 while a < b: if value == sub[m]: return m if value < sub[m]: b = m - 1 else: a = m + 1 m = (a + b) // 2 return m if sub[m] >= value else m + 1 res = [ensemble[0]] for i in range(1, len(ensemble)): if ensemble[i] < res[-1]: # on insère selon un méthode dichotomique p = position(res, ensemble[i]) res.insert(p, ensemble[i]) if len(res) > k: res.pop() return res topk_insertion(perm, 4) def topk_fusion(ensemble, k): n = len(ensemble) // (len(ensemble) // k) res = [] last = 0 while last < len(ensemble): res.append(last) last += n res.append(len(ensemble)) subs = [] for i in range(1, len(res)): sub = ensemble[res[i-1] : res[i]] sub.sort() subs.append(sub) indices = [0 for sub in subs] topk = [] while len(topk) < k: arg = None for i, sub in enumerate(subs): if indices[i] < len(sub) and (arg is None or sub[indices[i]] < subs[arg][indices[arg]]): arg = i topk.append(subs[arg][indices[arg]]) indices[arg] += 1 return topk topk_fusion(perm, 4) def topk_select_recursive(ensemble, k): if len(ensemble) <= k: return ensemble p = ensemble[k] inf, sup = [], [] for e in ensemble: if e > p: sup.append(e) else: inf.append(e) if len(inf) == k: return inf if len(sup) == 0: # potentiellement une boucle infinie, on change # le pivot de côté sup.append(p) del inf[inf.index(p)] if len(inf) >= k: return topk_select_recursive(inf, k) return inf + topk_select_recursive(sup, k - len(inf)) topk_select_recursive(perm, 4) def topk_select(ensemble, k): ensemble = ensemble.copy() def loop(a, b, pivot): pivot_index = None while a < b: while a < len(ensemble) and ensemble[a] < pivot: a += 1 while b >= 0 and ensemble[b] >= pivot: if ensemble[b] == pivot: pivot_index = b b -= 1 if a < b: ensemble[a], ensemble[b] = ensemble[b], ensemble[a] return min(a, len(ensemble) - 1), pivot_index a = 0 b = len(ensemble) - 1 m = k while True: pivot = ensemble[m] m, pi = loop(a, b, pivot) if m == k: return ensemble[:m] # Les cas particuliers interviennent lorsque pivot choisi est # identique au précédent. if m > k: if b == m - 1: ensemble[b], ensemble[pi] = ensemble[pi], ensemble[b] b -= 1 else: b = m - 1 else: if a == m: ensemble[a], ensemble[pi] = ensemble[pi], ensemble[a] a += 1 else: a = m m = k topk_select(perm, 4) from time import perf_counter def measure_time(fct, perm, k, repeat=1000): t1 = perf_counter() for r in range(repeat): fct(perm, k) return perf_counter() - t1 measure_time(topk_sortall, perm, 4) measure_time(topk_tri_selection, perm, 4) measure_time(topk_insertion, perm, 4) measure_time(topk_fusion, perm, 4) measure_time(topk_select_recursive, perm, 4) measure_time(topk_select, perm, 4) perm10000 = numpy.random.permutation(numpy.arange(10000)) measure_time(topk_sortall, perm10000, 40, repeat=10) measure_time(topk_tri_selection, perm10000, 40, repeat=10) measure_time(topk_insertion, perm10000, 40, repeat=10) measure_time(topk_fusion, perm10000, 40, repeat=10) measure_time(topk_select_recursive, perm10000, 40, repeat=10) measure_time(topk_select, perm10000, 40, repeat=10) from tqdm import tqdm from pandas import DataFrame perm1000 = numpy.random.permutation(numpy.arange(1000)) res = [] for k in tqdm(range(100, 501, 50)): obs = dict(k=k, n=perm1000.shape[0]) for fct in [topk_sortall, topk_tri_selection, topk_insertion, topk_fusion, topk_select_recursive, topk_select]: obs[fct.__name__] = measure_time(fct, perm1000, k, repeat=10) res.append(obs) df = DataFrame(res) df.head() import matplotlib.pyplot as plt fig, ax = plt.subplots(1, 2, figsize=(14, 4)) df.set_index('k').drop(["n", "topk_tri_selection"], axis=1).plot( logy=True, logx=True, title="Coût en fonction de k", ax=ax[0]) df.set_index('k')[["topk_tri_selection"]].plot( logy=True, logx=True, title="Coût en fonction de k", ax=ax[1]); res = [] k = 10 for n in tqdm([20, 100, 1000, 10000, 100000]): permn = numpy.random.permutation(numpy.arange(n)) obs = dict(k=k, n=permn.shape[0]) for fct in [topk_sortall, topk_tri_selection, topk_insertion, topk_fusion, topk_select_recursive, topk_select]: obs[fct.__name__] = measure_time(fct, permn, k, repeat=10) res.append(obs) df = DataFrame(res) df.head() df.set_index('n').drop(["k"], axis=1).plot( logy=True, logx=True, title="Coût en fonction de n"); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Read the csv file into a panda Step2: Chart 1 features a whitegrid style to help assign a number to each bar. Despine removes Tufte's chart junk. Step3: Chart 2 features a white chart style. Y label is removed because county label is redudant. Also, X label is more useful. Despine removes Tufte's chart junk. Step4: Chart 3 features a dark grid style. Although the grid helps assign values to the bars, the color is distracting and tends to chart junk
<ASSISTANT_TASK:> Python Code: import seaborn as sns import matplotlib.pyplot as plt import pandas as pd sns.set(style="ticks", context='talk', font_scale=1.1) %matplotlib inline df = pd.read_csv('top10mountain-lions.csv') sns.set_style("whitegrid") sns.barplot(x="count", y="COUNTY", data=df, color="#2ecc71") sns.despine(bottom=True, left=True) sns.set_style("white") sns.barplot(x="count", y="COUNTY", data=df, color="#f6a14e") plt.ylabel('') plt.xlabel('Mountain Lion Sightings') sns.despine(bottom=True, left=True) sns.set_style("darkgrid") sns.barplot(x="count", y="COUNTY", data=df, color="#7fe5ba") plt.ylabel('') plt.xlabel('Mountain Lion Sightings') sns.despine(bottom=True, left=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Loading the dataset for the assignment Step2: So, according to the description of the dataset as well as the descriptions of the columns we do have a dataset with information about the Google Play Store, we could apply many algorithms since we do have a great variety of tuples, more than 10k, and 13 features. Step3: we could check that our dataset presents 10.841 tuples Step4: and 13 columns/features Step5: Where each column/feature represents Step6: So, analyzing the number of 'missing' data we have Step7: And we need to take action about this situation dropping all instances with missing values from our dataset Step8: Checking the result of this operation we conclude with less number of instances Step9: Fiding Step10: The feature 'Price' is one of the columns that need some normalization. As we can see below, we have a mean of $1,17 per app and the data is very skewed. Below we plotted a chart with the distribution of this Step11: So as we can see below we now have a normalized data for the price in another DataFrame following the same histogram. As Price, there is other information that we need to check like the number of installs, rating, reviews, and size. Step12: About the information of 'Installs' we have a categorized information, dividing the number of downloads in chunks as we can notice below Step13: Let's see how the distribution of the rating values is presented. So, we do have a mean really high of 4.16 in ratings' data and a standard deviation of around 0.56. Notice that the minimum note is 1 and that the first quartile is about 4 in ratings, in other words, we do have a skewed data with a long left long tail. We already normalized this feature. Step14: If we going to utilize the method for classification we should classify based on a label. For this purpose, we will consider, based on the distribution of the rating. So, we'll propose the following Step15: Now it's after we categorize the new label, we a ready to normalize the data from the rating. Remembering that we are normalizing the data from 0-1. Step16: We should also normalize reviews and price data Step17: What this pair plot above shows us is how the mobile market works. The first only plot that we noticed was the $rating x install$ chart. In this chart we can notice that the highest ratings received are way less the number of installs, that same behavior can be observed with the $rating x reviews$ the third observation is over the $rating x price$ chart, in this chat we can conclude that there is no 'good' software with the high rating! Step18: The k-Means algorithm coded in scikit-learn utilizes the Lloyd’s or Elkan’s algorithm [http Step19: 3.Post processing
<ASSISTANT_TASK:> Python Code: !pip install cufflinks import pandas as pd import numpy as np from matplotlib import pyplot as plt plt.style.use('ggplot') import seaborn as sns # for making plots with seaborn color = sns.color_palette() sns.set(rc={'figure.figsize':(25,15)}) import plotly plotly.offline.init_notebook_mode(connected=True) import plotly.graph_objs as go import plotly.figure_factory as ff #import cufflinks as cf import warnings warnings.filterwarnings('ignore') %matplotlib inline df = pd.read_csv('./db/googleplaystore.csv') df.sample(10) len(df) df.columns df.drop_duplicates(subset='App', inplace=True) df = df[df['Android Ver'] != np.nan] df = df[df['Android Ver'] != 'NaN'] df = df[df['Installs'] != 'Free'] df = df[df['Installs'] != 'Paid'] df['Installs'] = df['Installs'].apply(lambda x: x.replace('+', '') if '+' in str(x) else x) df['Installs'] = df['Installs'].apply(lambda x: x.replace(',', '') if ',' in str(x) else x) df['Installs'] = df['Installs'].apply(lambda x: int(x)) df['Installs'] = df['Installs'].apply(lambda x: float(x)) df['Size'] = df['Size'].apply(lambda x: str(x).replace('Varies with device', 'NaN') if 'Varies with device' in str(x) else x) df['Size'] = df['Size'].apply(lambda x: str(x).replace('M', '') if 'M' in str(x) else x) df['Size'] = df['Size'].apply(lambda x: str(x).replace(',', '') if 'M' in str(x) else x) df['Size'] = df['Size'].apply(lambda x: float(str(x).replace('k', '')) / 1000 if 'k' in str(x) else x) df['Size'] = df['Size'].apply(lambda x: float(x)) df['Reviews'] = df['Reviews'].apply(lambda x: int(x)) df['Price'] = df['Price'].apply(lambda x: str(x).replace('$', '') if '$' in str(x) else str(x)) df['Price'] = df['Price'].apply(lambda x: float(x)) total = df.isnull().sum().sort_values(ascending=False) percent = (df.isnull().sum()/df.isnull().count()).sort_values(ascending=False) missing_data = pd.concat([total, percent], axis=1, keys=['Total', 'Percent']) missing_data.head(6) df.dropna(how ='any', inplace = True) total = df.isnull().sum().sort_values(ascending=False) percent = (df.isnull().sum()/df.isnull().count()).sort_values(ascending=False) missing_data = pd.concat([total, percent], axis=1, keys=['Total', 'Percent']) missing_data.head(6) print(len(df)) 10841 - 7021 df["Price"].describe() x = df['Rating'].dropna() z = df['Installs'][df.Installs!=0].dropna() p = df['Reviews'][df.Reviews!=0].dropna() t = df['Type'].dropna() price = df['Price'] p = sns.pairplot(pd.DataFrame(list(zip(x, np.log(z), np.log10(p), t, price)), columns=['Rating', 'Installs', 'Reviews', 'Type', 'Price']), hue='Type', palette="Set2") print("\n", df['Category'].unique()) print(df["Genres"].unique()) from scipy import stats sns.distplot(df["Price"], kde=False, fit=stats.norm); df["Price"].describe() dfmod = df dfmod["Price"] = (df["Price"] - df["Price"].min()) / (df["Price"].max() - df["Price"].min()) dfmod["Price"].describe() sns.distplot(dfmod["Price"], kde=False, fit=stats.norm); %%capture dfmod["Installs"] = (df["Installs"] - df["Installs"].min()) / (df["Installs"].max() - df["Installs"].min()) print(dfmod["Rating"].describe()) sns.distplot(df["Rating"], kde=False, fit=stats.norm); sns.distplot(df["Installs"], rug=True, hist=False) print(df["Rating"].describe()) print("\n", df['Rating'].unique()) sns.distplot(df["Rating"], hist=True) dfmod.loc[(dfmod['Rating'] >= 0.0 ) & (dfmod['Rating'] <= 4.25 ), 'label_rating'] = '0 bad' dfmod.loc[(dfmod['Rating'] > 4.25 ) & (dfmod['Rating'] <= 4.75 ), 'label_rating'] = '1 normal' dfmod.loc[(dfmod['Rating'] > 4.75), 'label_rating'] = '2 good' print(dfmod['label_rating'].unique()) dfmod["Rating"] = (df["Rating"] - df["Rating"].min()) / (df["Rating"].max() - df["Rating"].min()) sns.distplot(dfmod["Rating"], hist=True) dfmod["Installs"] = (df["Installs"] - df["Installs"].min()) / (df["Installs"].max() - df["Installs"].min()) dfmod["Price"] = (df["Price"] - df["Price"].min()) / (df["Price"].max() - df["Price"].min()) dfmod["Reviews"] = (df["Reviews"] - df["Reviews"].min()) / (df["Reviews"].max() - df["Reviews"].min()) dfmod[['Rating', 'Installs', 'Price', 'Reviews', 'label_rating' ]] #sns.dfmod[['Rating', 'Installs', 'Price', 'Reviews', 'label_rating' ]] #sns.pairplot(data = dfmod[['Rating', 'Installs', 'Price', 'Reviews', 'label_rating' ]]) x = dfmod['Rating'] z = dfmod['Installs'] p = dfmod['Reviews'][df.Reviews!=0].dropna() t = dfmod['label_rating'].dropna() price = df['Price'] p = sns.pairplot(pd.DataFrame(list(zip(x, z, p, t, price)), columns=['Rating', 'Installs', 'Reviews', 'label_rating', 'Price']), hue='label_rating', palette="Set2") from sklearn.cluster import KMeans from sklearn.metrics import mean_squared_error from sklearn.metrics import mean_absolute_error from sklearn.model_selection import cross_val_score, cross_val_predict, KFold from sklearn import preprocessing, metrics from sklearn.cluster import AgglomerativeClustering from time import time seed_initialization = [37,110,777] n_jobs = 4 sample_size_ = 300 dataclust = dfmod[['Rating', 'Installs', 'Price', 'Reviews' ]]; table_results = [] for i in range(3,13): for y in range(3): t0 = time() estimator = KMeans(init='k-means++', n_clusters=i, random_state = seed_initialization[y], n_jobs = n_jobs) estimator.fit(dataclust) print(time()-t0) print("k: " + str(i)) print("seed: " + str(seed_initialization[y])) db = metrics.homogeneity_score(dfmod['label_rating'], estimator.labels_) si = metrics.silhouette_score(dataclust, estimator.labels_, metric='euclidean',sample_size=sample_size_) result_estimator = {"kmeans", i, seed_initialization[y], db, si} table_results.append(result_estimator) estimator2 = AgglomerativeClustering(n_clusters=6, linkage='ward').fit(dataclust) db2 = metrics.homogeneity_score(dfmod['label_rating'], estimator.labels_) si2 = metrics.silhouette_score(dataclust, estimator.labels_, metric='euclidean',sample_size=sample_size_) result_estimator = {"AgglomerativeClustering", 6, "-", db2, si2} table_results.append(result_estimator) result = pd.DataFrame(table_results, columns=["DB", "Silhouete","K","Seed","Algorithm"]) result <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Chart Attributes Step2: Axes - Set Range Step3: Percentage of Each Label in Column of DataFrame Step4: Count of (Continuous) Values in Column of DataFrame
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import seaborn as sns import matplotlib.pyplot as plt plt.figure(figsize = [15, 5]) plt.title('My plot') plt.xlabel('X values') plt.ylabel('Count of values') plt.xlim([0, 10]) plt.ylim([0, 5]) data_dict = { 'x': [0, 1, 1, 2, 1, 0, 0, 1, 2, 1, 1], 'y': [1, 1, 1, 1, 1, 0, 0, 0, 1, 2, 1] } df = pd.DataFrame(data=data_dict) plt.title('My plot') plt.xlabel('X values') plt.ylabel('Count of values') sns.countplot(df['x']); data_dict = { 'x': [0, 1, 1, 2, 1, 0, 0, 1, 2, 1, 1], 'y': [1, 1, 1, 1, 1, 0, 0, 0, 1, 2, 1] } df = pd.DataFrame(data=data_dict) percentage_dist = df['x'].value_counts(normalize=True).sort_index() ax = sns.barplot(x=percentage_dist.index, y=percentage_dist.values) ax.set_ylim([0,1]); mu, sigma = 0, 0.1 # mean and standard deviation data_dict = { 'x': np.random.normal(mu, sigma, 1000) } df = pd.DataFrame(data=data_dict) plt.hist(df['x'], bins=np.arange(start=-0.4, stop=0.4, step=0.05)); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Replace the variable values in the cell below Step2: Create a Dataset from BigQuery Step3: Let's do some regular expression parsing in BigQuery to get the source of the newspaper article from the URL. For example, if the url is http Step6: Now that we have good parsing of the URL to get the source, let's put together a dataset of source and titles. This will be our labeled dataset for machine learning. Step7: For ML training, we usually need to split our dataset into training and evaluation datasets (and perhaps an independent test dataset if we are going to do model or feature selection based on the evaluation dataset). AutoML however figures out on its own how to create these splits, so we won't need to do that here. Step8: AutoML for text classification requires that Step9: Let's make sure we have roughly the same number of labels for each of our three labels Step10: Finally we will save our data, which is currently in-memory, to disk. Step11: Now let's sample 1000 articles from the full dataset and make sure we have enough examples for each label in our sample dataset (see here for further details on how to prepare data for AutoML). Step12: Let's write the sample datatset to disk. Step13: Let's start by specifying where the information about the trained models will be saved as well as where our dataset is located Step14: Loading the dataset Step15: Let's look again at the number of examples per label to make sure we have a well-balanced dataset Step16: Preparing the labels Step17: Preparing the train/test splits Step18: To be on the safe side, we verify that the train and test splits Step19: Now let's create the features and labels we will feed our models with Step20: NNLM Model Step21: Note that this TF-Hub embedding produces a single 50-dimensional vector when passed a sentence Step22: Swivel Model Step23: Similarly as the previous pre-trained embedding, it outputs a single vector when passed a sentence Step24: Building the models Step25: Let's also wrap the training code into a train_and_evaluate function that Step26: Training NNLM Step27: Training Swivel Step28: Swivel trains faster but achieves a lower validation accuracy, and requires more epochs to train on. Step29: Then we can deploy the model using the gcloud CLI as before Step30: Before we try our deployed model, let's inspect its signature to know what to send to the deployed API Step31: Let's go ahead and hit our model
<ASSISTANT_TASK:> Python Code: import os from google.cloud import bigquery import pandas as pd %load_ext google.cloud.bigquery PROJECT = "cloud-training-demos" # Replace with your PROJECT BUCKET = PROJECT REGION = "us-central1" os.environ['PROJECT'] = PROJECT os.environ['BUCKET'] = BUCKET os.environ['REGION'] = REGION %%bigquery --project $PROJECT SELECT url, title, score FROM `bigquery-public-data.hacker_news.stories` WHERE LENGTH(title) > 10 AND score > 10 AND LENGTH(url) > 0 LIMIT 10 %%bigquery --project $PROJECT SELECT ARRAY_REVERSE(SPLIT(REGEXP_EXTRACT(url, '.*://(.[^/]+)/'), '.'))[OFFSET(1)] AS source, COUNT(title) AS num_articles FROM `bigquery-public-data.hacker_news.stories` WHERE REGEXP_CONTAINS(REGEXP_EXTRACT(url, '.*://(.[^/]+)/'), '.com$') AND LENGTH(title) > 10 GROUP BY source ORDER BY num_articles DESC LIMIT 100 regex = '.*://(.[^/]+)/' sub_query = SELECT title, ARRAY_REVERSE(SPLIT(REGEXP_EXTRACT(url, '{0}'), '.'))[OFFSET(1)] AS source FROM `bigquery-public-data.hacker_news.stories` WHERE REGEXP_CONTAINS(REGEXP_EXTRACT(url, '{0}'), '.com$') AND LENGTH(title) > 10 .format(regex) query = SELECT LOWER(REGEXP_REPLACE(title, '[^a-zA-Z0-9 $.-]', ' ')) AS title, source FROM ({sub_query}) WHERE (source = 'github' OR source = 'nytimes' OR source = 'techcrunch') .format(sub_query=sub_query) print(query) bq = bigquery.Client(project=PROJECT) title_dataset = bq.query(query).to_dataframe() title_dataset.head() print("The full dataset contains {n} titles".format(n=len(title_dataset))) title_dataset.source.value_counts() DATADIR = './data/' if not os.path.exists(DATADIR): os.makedirs(DATADIR) FULL_DATASET_NAME = 'titles_full.csv' FULL_DATASET_PATH = os.path.join(DATADIR, FULL_DATASET_NAME) # Let's shuffle the data before writing it to disk. title_dataset = title_dataset.sample(n=len(title_dataset)) title_dataset.to_csv( FULL_DATASET_PATH, header=False, index=False, encoding='utf-8') sample_title_dataset = title_dataset.sample(n=1000) sample_title_dataset.source.value_counts() SAMPLE_DATASET_NAME = 'titles_sample.csv' SAMPLE_DATASET_PATH = os.path.join(DATADIR, SAMPLE_DATASET_NAME) sample_title_dataset.to_csv( SAMPLE_DATASET_PATH, header=False, index=False, encoding='utf-8') import datetime import os import shutil import pandas as pd import tensorflow as tf from tensorflow.keras.callbacks import TensorBoard, EarlyStopping from tensorflow_hub import KerasLayer from tensorflow.keras.layers import Dense from tensorflow.keras.models import Sequential from tensorflow.keras.preprocessing.text import Tokenizer from tensorflow.keras.utils import to_categorical print(tf.__version__) %matplotlib inline MODEL_DIR = "./text_models" DATA_DIR = "./data" ls ./data/ DATASET_NAME = "titles_full.csv" TITLE_SAMPLE_PATH = os.path.join(DATA_DIR, DATASET_NAME) COLUMNS = ['title', 'source'] titles_df = pd.read_csv(TITLE_SAMPLE_PATH, header=None, names=COLUMNS) titles_df.head() titles_df.source.value_counts() CLASSES = { 'github': 0, 'nytimes': 1, 'techcrunch': 2 } N_CLASSES = len(CLASSES) def encode_labels(sources): classes = [CLASSES[source] for source in sources] one_hots = to_categorical(classes, num_classes=N_CLASSES) return one_hots encode_labels(titles_df.source[:4]) N_TRAIN = int(len(titles_df) * 0.95) titles_train, sources_train = ( titles_df.title[:N_TRAIN], titles_df.source[:N_TRAIN]) titles_valid, sources_valid = ( titles_df.title[N_TRAIN:], titles_df.source[N_TRAIN:]) sources_train.value_counts() sources_valid.value_counts() X_train, Y_train = titles_train.values, encode_labels(sources_train) X_valid, Y_valid = titles_valid.values, encode_labels(sources_valid) X_train[:3] Y_train[:3] NNLM = "https://tfhub.dev/google/nnlm-en-dim50/2" nnlm_module = KerasLayer(# TODO) nnlm_module(tf.constant([# TODO])) SWIVEL = "https://tfhub.dev/google/tf2-preview/gnews-swivel-20dim-with-oov/1" swivel_module = KerasLayer(# TODO) swivel_module(tf.constant([# TODO])) def build_model(hub_module, name): model = Sequential([ # TODO Dense(16, activation='relu'), Dense(N_CLASSES, activation='softmax') ], name=name) model.compile( optimizer='adam', loss='categorical_crossentropy', metrics=['accuracy'] ) return model def train_and_evaluate(train_data, val_data, model, batch_size=5000): X_train, Y_train = train_data tf.random.set_seed(33) model_dir = os.path.join(MODEL_DIR, model.name) if tf.io.gfile.exists(model_dir): tf.io.gfile.rmtree(model_dir) history = model.fit( X_train, Y_train, epochs=100, batch_size=batch_size, validation_data=val_data, callbacks=[EarlyStopping(), TensorBoard(model_dir)], ) return history data = (X_train, Y_train) val_data = (X_valid, Y_valid) nnlm_model = build_model(nnlm_module, 'nnlm') nnlm_history = train_and_evaluate(data, val_data, nnlm_model) history = nnlm_history pd.DataFrame(history.history)[['loss', 'val_loss']].plot() pd.DataFrame(history.history)[['accuracy', 'val_accuracy']].plot() swivel_model = build_model(swivel_module, name='swivel') swivel_history = train_and_evaluate(data, val_data, swivel_model) history = swivel_history pd.DataFrame(history.history)[['loss', 'val_loss']].plot() pd.DataFrame(history.history)[['accuracy', 'val_accuracy']].plot() OUTPUT_DIR = "./savedmodels" shutil.rmtree(OUTPUT_DIR, ignore_errors=True) EXPORT_PATH = os.path.join(OUTPUT_DIR, 'swivel') os.environ['EXPORT_PATH'] = EXPORT_PATH shutil.rmtree(EXPORT_PATH, ignore_errors=True) tf.saved_model.save(swivel_model, EXPORT_PATH) %%bash # TODO 5 MODEL_NAME=title_model VERSION_NAME=swivel if [[ $(gcloud ai-platform models list --format='value(name)' | grep ^$MODEL_NAME$) ]]; then echo "$MODEL_NAME already exists" else echo "Creating $MODEL_NAME" gcloud ai-platform models create --region=$REGION $MODEL_NAME fi if [[ $(gcloud ai-platform versions list --model $MODEL_NAME --format='value(name)' | grep ^$VERSION_NAME$) ]]; then echo "Deleting already existing $MODEL_NAME:$VERSION_NAME ... " echo yes | gcloud ai-platform versions delete --model=$MODEL_NAME $VERSION_NAME echo "Please run this cell again if you don't see a Creating message ... " sleep 2 fi echo "Creating $MODEL_NAME:$VERSION_NAME" gcloud ai-platform versions create $VERSION_NAME\ --model=$MODEL_NAME \ --framework=# TODO \ --python-version=# TODO \ --runtime-version=2.1 \ --origin=# TODO \ --staging-bucket=# TODO \ --machine-type n1-standard-4 \ --region=$REGION !saved_model_cli show \ --tag_set serve \ --signature_def serving_default \ --dir {EXPORT_PATH} !find {EXPORT_PATH} %%writefile input.json {# TODO} !gcloud ai-platform predict \ --model title_model \ --json-instances input.json \ --version swivel \ --region=$REGION <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: tutorial 1 Step2: <img src="https Step3: Tutorial 2 Step4: Tutorial 3 Step5: write() method Step6: <img src="https Step7: <img src="https Step8: <img src="https
<ASSISTANT_TASK:> Python Code: import xlsxwriter workbook = xlsxwriter.Workbook('hello.xlsx') worksheet = workbook.add_worksheet() worksheet.write('A1', 'Hello world') workbook.close() expenses = ( ['Rent', 1000], ['Gas', 100], ['Food', 300], ['Gym', 50], ) workbook = xlsxwriter.Workbook('Expenses01.xlsx') # worksheet은 sheet1, sheet2, ... 기본 이름이지만 이름을 별도로 붙일 수 있음! worksheet = workbook.add_worksheet() # start from the first cell! zero index row = 0 col = 0 for item, cost in (expenses): worksheet.write(row, col, item) worksheet.write(row, col+1, cost) row += 1 # 데이터 입력할 경우 write 사용 worksheet.write(row, 0, 'Total') worksheet.write(row, 1, '=SUM(B1:B4)') workbook.close() # 항상 닫아줘야함 # default는 sheet1, sheet2 .... 임 worksheet1 = workbook.add_worksheet() # sheet1 worksheet2 = workbook.add_worksheet('Data') worksheet3 = workbook.add_worksheet() # sheet3 workbook = xlsxwriter.Workbook("Expenses02.xlsx") worksheet = workbook.add_worksheet("Sheet1") # bold 처리 bold = workbook.add_format({"bold": True}) # format for cells money = workbook.add_format({"num_format": "$#,##0"}) # header 설정 worksheet.write('A1', 'Item', bold) worksheet.write('B1', 'Cost', bold) expenses = ( ['Rent', 1000], ['Gas', 100], ['Food', 300], ['Gym', 50], ) row = 1 # header를 작성했기에 row가 1부터 시작 col = 0 for item, cost in (expenses): worksheet.write(row, col, item) worksheet.write(row, col+1, cost, money) # write(row, col, 넣을 값(token), 형식[format]) row += 1 worksheet.write(row, 0, "Total", bold) worksheet.write(row, 1, "=sum(B2:B5)", money) workbook.close() from datetime import datetime workbook = xlsxwriter.Workbook("Expenses03.xlsx") worksheet = workbook.add_worksheet() bold = workbook.add_format({"bold":1}) money_format = workbook.add_format({"num_format": "$#,##0"}) date_format = workbook.add_format({"num_format": "mmmm d yyyy"}) worksheet.set_column(1, 1, 15) # column의 width 조절 worksheet.write("A1", "Item", bold) worksheet.write("B1", "Date", bold) worksheet.write("C1", "Cost", bold) expenses = ( ['Rent', '2013-01-13', 1000], ['Gas', '2013-01-14', 100], ['Food', '2013-01-16', 300], ['Gym', '2013-01-20', 50], ) # Start from the first cell below the headers. row = 1 col = 0 for item, date_str, cost in (expenses): date = datetime.strptime(date_str, "%Y-%m-%d") worksheet.write_string (row, col, item) worksheet.write_datetime(row, col + 1, date, date_format ) worksheet.write_number (row, col + 2, cost, money_format) row += 1 # Write a total using a formula. worksheet.write(row, 0, 'Total', bold) worksheet.write(row, 2, '=SUM(C2:C5)', money_format) workbook.close() import pandas as pd df = pd.DataFrame({"Data": [10, 20, 30, 20, 15, 30, 45]}) df ## pandas로 xlsxwriter 접근하기 df = pd.DataFrame({'Data': [10, 20, 30, 20, 15, 30, 45]}) writer = pd.ExcelWriter("pandas_simple.xlsx", engine="xlsxwriter") df.to_excel(writer, sheet_name="Sheet1") workbook = writer.book worksheet = writer.sheets["Sheet1"] # chart 객체 생성 chart = workbook.add_chart({"type":'column'}) # dataframe 데이터에서 chart 범위설정 chart.add_series({"values":"=Sheet1!$B$2:$B$8"}) # worksheet에 chart 삽입 worksheet.insert_chart("D2", chart) writer.save() # 차트 속성을 수정하려면 어떻게 해야할까..! # dataframe formatting 색깔 설정 worksheet.conditional_format('B2:B8', {'type': '3_color_scale'}) # 이걸 하면 알록달록 아래처럼 나옴 df1 = pd.DataFrame({'Data': [11, 12, 13, 14]}) df2 = pd.DataFrame({'Data': [21, 22, 23, 24]}) df3 = pd.DataFrame({'Data': [31, 32, 33, 34]}) df4 = pd.DataFrame({'Data': [41, 42, 43, 44]}) # writer 설정 writer = pd.ExcelWriter('pandas_positioning.xlsx', engine='xlsxwriter') # df1을 넣는 위치 설정 df1.to_excel(writer, sheet_name='Sheet1') # 기초 A1 df2.to_excel(writer, sheet_name='Sheet1', startcol=3) # col 4번째(3)부터 시작 df3.to_excel(writer, sheet_name='Sheet1', startrow=6) # row 7번째부터 시작 # header와 index 없이 설정가능! 단 시작 위치는 고려해야함 df4.to_excel(writer, sheet_name='Sheet1', startrow=7, startcol=4, header=False, index=False) # writer를 닫음 writer.save() list_data = [10, 20, 30, 20, 15, 30, 45] df = pd.DataFrame(list_data) excel_file = 'column.xlsx' sheet_name = 'Sheet1' writer = pd.ExcelWriter(excel_file, engine='xlsxwriter') df.to_excel(writer, sheet_name=sheet_name) workbook = writer.book worksheet = writer.sheets[sheet_name] chart = workbook.add_chart({'type': 'column'}) chart.add_series({ 'values': '=Sheet1!$B$2:$B$8', 'gap': 2 # 여백 }) # chart : y axis 설정 chart.set_y_axis({'major_gridlines': {'visible': False}}) # chart legend(범주) 해제 chart.set_legend({'position': 'none'}) # insert the chart into the worksheet worksheet.insert_chart('D2', chart) # d2는 에러나고 D2라고 해야되요 writer.save() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Note that we need at least 10mV to even resolve a signal on the scope. So the NEP is only part of the story Step2: This setting (20dB) leaves plenty of bandwidth but can't resolve our signal (1.3uW). It's limited to double our signal. Step3: On 30dB we start to hit the bandwidth limit but can resolve down to 0.8 uW (half our signal). Even so, we'd only get 10mV out of it. Step4: This can resolve down to 8nW so our 1.3uW would be ~1000x larger.
<ASSISTANT_TASK:> Python Code: # Enter the specs of the detector nep = 2.34e-12 # in Watts per root hz BW = 10e6 # Bandwidth in Hz gain = 0.75e4 # gain in V/A responsivity = 0.5 # Amps per Watt (assume 800 nm) pmin = nep * np.sqrt(BW) volts_min = pmin * responsivity * gain print("voltage generated by p_min:",volts_min) scope_floor_factor = 0.010/volts_min # the power has to be scope_floor_factor times larger in order to generate 10mV: pmin * scope_floor_factor nep = 1.21e-12 BW = 260e3 gain = 2.38e4 responsivity = 0.5 pmin = nep * np.sqrt(BW) volts_min = pmin * responsivity * gain print(volts_min) scope_floor_factor = 0.010/volts_min # resolvable power: pmin * scope_floor_factor nep = 0.2e-12 BW = 50e6 gain = 50000 responsivity = 25 pmin = nep * np.sqrt(BW) volts_min = pmin * responsivity * gain print(volts_min) scope_floor_factor = 0.010/volts_min # resolvable power: pmin * scope_floor_factor 1.3e-6 * 50000 * 25 # watts times volts/amp times amps/watt gives volts: <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The mystery section remains the same. Step2: All the blocks are empty. Step3: The 'PresetStyle' settings are empty, too. Step4: Each of the registry settings are completely blank. Step5: The only difference seems to be two bytes in the mystery section, at offsets 0x07 and 0x08. Step6: I believe the only real way to get unrecorded settings is to reset the memory, which clears all the values to zero.
<ASSISTANT_TASK:> Python Code: import sys sys.path.append('..') import collections import mido from commons import dgxdump from commons.dumpdata import messages, songdata, regdata, regvalues old_syx_messages = mido.read_syx_file('../data/syxout5.syx') clear_syx_messages = mido.read_syx_file('../data/clear_bulk.txt') o_dump = dgxdump.DgxDump(old_syx_messages) c_dump = dgxdump.DgxDump(clear_syx_messages) # songs slices songslices = collections.OrderedDict([ ('songs', slice(0x00, 0x01)), ('mystery', slice(0x01, 0x15D)), ('tracks', slice(0x15D, 0x167)), ('durations', slice(0x167, 0x17B)), ('trackdurations', slice(0x17B, 0x1F3)), ('presetstyle', slice(0x1F3, 0x22F)), ('beginningblocks', slice(0x22F, 0x24D)), ('nextblocks', slice(0x24D, 0x2CF)), ('startmarker', slice(0x2CF, 0x2D5)), ('blockdata', slice(0x2D5, 0x106D5)), ('endmarker', slice(0x106D5, None)), ]) EXPECTED_SIZE = 0x106DB PRESETSTYLE = b'PresetStyle\0'*5 MARKER = b'PK0001' def hex_string(data): return " ".join("{:02X}".format(b) for b in data) def bin_string(data): return " ".join("{:08b}".format(b) for b in data) def line_hex(data, head=None, tail=0): if head is None: head = len(data) tailstart = len(data) - tail if tailstart <= head: return (hex_string(data)) else: return ("{} .. {}".format(hex_string(data[:head]), hex_string(data[tailstart:]))) def song_section(dump, section): return dump.song_data.data[songslices[section]] for sec in songslices: print(sec) print(line_hex(song_section(o_dump, sec), 32, 4)) print(line_hex(song_section(c_dump, sec), 32, 4)) song_section(o_dump, 'mystery') == song_section(c_dump, 'mystery') all(b==0 for b in song_section(c_dump, 'nextblocks')) all(b==0 for b in song_section(c_dump, 'blockdata')) bytes(song_section(c_dump, 'presetstyle')) print(line_hex(o_dump.reg_data.data, 32, 4)) print(line_hex(c_dump.reg_data.data, 32, 4)) for bank in range(1, 8+1): for button in range(1, 2+1): print(bank, button) print(line_hex(o_dump.reg_data.settings.get_setting(bank, button).data)) print(line_hex(c_dump.reg_data.settings.get_setting(bank, button).data)) for x in range(2, 7): !diff -qs ../data/backup_experiment/cb1.txt ../data/backup_experiment/cb{x}.txt !diff -qs ../data/backup_experiment/cb1.txt ../data/clear_bulk.txt c2_syx_messages = mido.read_syx_file('../data/backup_experiment/cb1.txt') c2_dump = dgxdump.DgxDump(c2_syx_messages) c_dump.song_data.data == c2_dump.song_data.data c_dump.reg_data.data == c2_dump.reg_data.data for sec in songslices: c_sec = song_section(c_dump, sec) c2_sec = song_section(c2_dump, sec) if c_sec != c2_sec: print(sec) print(line_hex(c_sec, 32, 4)) print(line_hex(c2_sec, 32, 4)) for n, (a, b) in enumerate(zip(c_dump.song_data.data, c2_dump.song_data.data)): if a != b: print("{0:02X}: {1:02X} {2:02X} ({1:03d} {2:03d})".format(n, a, b)) r1_dump = dgxdump.DgxDump(mido.read_syx_file('../data/post_clear/1reg.syx')) c2_dump.song_data.data == r1_dump.song_data.data c2_dump.reg_data.data == r1_dump.reg_data.data for bank in range(1, 8+1): for button in range(1, 2+1): if not all(x == 0 for x in r1_dump.reg_data.settings.get_setting(bank, button).data): print(bank, button) line_hex(r1_dump.reg_data.settings.get_setting(3, 2).data) for bb in [(3, 2), (1, 1)]: sets = r1_dump.reg_data.settings.get_setting(*bb) print(line_hex(sets.data)) sets.print_settings() sets.print_unusual() r2_dump = dgxdump.DgxDump(mido.read_syx_file('../data/post_clear/2reg.txt')) sets = r2_dump.reg_data.settings.get_setting(2,2) sets.print_settings() sets.print_unusual() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The the model from a checkpoint. Step6: Helper class and method. Step7: Add forward hooks to all layers of the model Step8: A Brief Overview of the Model Step9: Compute statistics of the output representations Step11: Print summary of statitics Step12: Visualize the distribution of how often each unit is on or off
<ASSISTANT_TASK:> Python Code: BATCH_SIZE = 16 PROJECT_DIR = os.path.expanduser("~/nta/nupic.research/projects/gsc") EXPERIMENT_NAME = "default_sparse_cnn" CHECKPOINT_FILE = "/home/ec2-user/nta/results/experiments/gsc/default_sparse_cnn/RemoteProcessTrainable_0_2021-01-07_15-54-473wnu2slv/checkpoint_30/checkpoint" USE_CUDA = torch.cuda.is_available() # Load the experiment import os import sys sys.path.insert(0, PROJECT_DIR) from experiments import CONFIGS config = CONFIGS[EXPERIMENT_NAME] exp_cls = config["experiment_class"] exp = exp_cls() # Load dataloader with specified BATCH_SIZE. dataset = exp_cls.load_dataset(config, train=True) train_loader = DataLoader( dataset=dataset, batch_size=BATCH_SIZE, shuffle=True, num_workers=0, sampler=None, pin_memory=USE_CUDA, drop_last=config.get("train_loader_drop_last", False), ) # Path to checkpoint. assert CHECKPOINT_FILE is not None, "You should specify a path to a checkpoint." # Load model config = CONFIGS[EXPERIMENT_NAME] exp_cls = config["experiment_class"] exp = exp_cls() model = exp_cls.create_model(config, "cuda") load_state_from_checkpoint(model=model, checkpoint_path=CHECKPOINT_FILE, device="cuda"); class SaveForwardOutput: Forward hook for atorch.nn.Module. This will store the output from a module during the forward pass. :param name: name of the module (e.g. "classifier") :param verbose: whether to print something every forward pass def __init__(self, name=None, verbose=False): self.name = name self.verbose = verbose self.output = None def __call__(self, module, x, y): Forward hook on torch.nn.Module :param module: module :param x: tuple of inputs :param y: ouput of module if self.verbose: print(f"Forward hook of {self.name} ({module.__class__.__name__})") # Save the output of the layer. self.output = y def calculate_on_counts(rep): Calculates the number of times a unit is on for the given batch. :param rep: tensor of an intermediate representation :return: a 1D tensor of with len equal to the total number of units rep = rep.flatten(start_dim=1) on_mask = rep != 0 on_counts = on_mask.sum(axis=0) return on_counts def calculate_sparsities(rep): Calculates the fraction of units off for each sample in the batch. :param rep: tensor of an intermediate representation :return: tensor of sparsities, one for each sample in the batch rep = rep.flatten(start_dim=1) off_mask = rep == 0 sparsities = off_mask.sum(axis=1).float() sparsities = sparsities / rep.shape[1] return sparsities forward_hooks = {} tracked_modules = [] for n, m in model.named_modules(): # Skip over modules that have sub-modules. # These sub-modules will be found recursively by 'named_modules'. if len(list(m.children())) > 0: continue # TODO: We can filter which modules get tracked if needed. forward_hook = SaveForwardOutput(name=n) m.register_forward_hook(forward_hook) forward_hooks[n] = forward_hook tracked_modules.append(m) total_params, on_params = count_nonzero_params(model) print(f"Model density (on_params / total_params): {on_params:,} / {total_params:,} = {on_params/total_params:.2f}") print(model) # This will be a tensor of length equal to the total number of output units to the given layer. # Each value will represent the frequency ("freq") of how often that unit is on throughout the whol dataset. layer_on_freqs = defaultdict(int) # This will be a list of sparsities measure for each output passed to the layer. layer_sparsities = defaultdict(list) # Loop through the whole dataset. See "Load the experiment" section # above to use the validation dataloader if desired. total_images = 0 model.eval() for x, y in train_loader: x, y = x.to("cuda"), y.to("cuda") out = model(x) for name, hook in forward_hooks.items(): # Retrieve ouput saved in the forward hook. representation = hook.output # Tally the on-counts for each unit. on_counts = calculate_on_counts(representation) layer_on_freqs[name] += on_counts # Compute the level of sparsity for each output. sparsities = calculate_sparsities(representation) layer_sparsities[name].extend(sparsities.tolist()) total_images += len(x) # Divide through by number of samples to find on-frequency for eash unit. for layer, on_counts in layer_on_freqs.items(): layer_on_freqs[layer] = on_counts.float() / total_images df = DataFrame(columns=["module type", "mu output sparsity", "sd output sparsity", "entropy", "dead neuron count", "total neurons", "fraction_dead"]) def log2_of_zeros(arr): Intentionally leave zero's as they are when taking the log. arr = arr.copy() arr[arr != 0] = np.log(arr[arr != 0]) return arr for (layer, sparsities), freqs, module in zip(layer_sparsities.items(), layer_on_freqs.values(), tracked_modules): mu_sparsity = np.mean(sparsities) sd_sparsity = np.std(sparsities) module_type = module.__class__.__name__ print(f"Layer {layer} ({module_type})") print(f" Average sparsity of output = {mu_sparsity:.3f} ± {sd_sparsity:.3f}") freqs = freqs.cpu().numpy() entropy = np.sum(-freqs * log2_of_zeros(freqs) / len(freqs)) print(f" Entropy of layer = {entropy}") dead_count = (freqs == 0).sum() total_neurons = len(freqs) fraction_dead = dead_count / total_neurons print(f" Fractions of dead neurons in layer = {fraction_dead:.3f} ({dead_count} out of {total_neurons})") print() df.at[layer] = (module_type, mu_sparsity, sd_sparsity, entropy, dead_count, total_neurons, fraction_dead) df print("Names of layers observed via hooks: (helpful for specifying 'layer' in the cell below.\n") pprint(list(layer_on_freqs.keys())) # Choose one layer to visualize the frequency of it's output units being on or off. layer = "linear_kwinner" on_freqs = layer_on_freqs[layer].cpu().numpy() fig = sns.histplot(data=on_freqs, kde=True, stat="probability") fig.set_xlabel("on-frequency") fig.set_title(f"How often are units on for layer '{layer}'"); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step3: Q2 (10 points) Step6: Q3 (10 points) Step7: Q4 (10 points) Step8: Q5 (10 points)
<ASSISTANT_TASK:> Python Code: heart = sm.datasets.heart.load_pandas().data heart.head(n=6) heart.sort_values('age', ascending=False, inplace=True) heart.head() sum(heart.censors == 0) heart.loc[(heart.censors == 1) & (heart.age < 45), 'age'].mean() heart.groupby(['censors']).agg(['mean', 'std']) import seaborn as sns sns.lmplot(data=heart, x='age', y='survival', hue='censors') pass def flatten(list_of_lists): Flatten a list of lists. for alist in list_of_lists: for item in alist: yield item def flatmap(f, xs): First map, then flatten result. return flatten(map(f, xs)) list(flatmap(lambda x: x.split(), ["hello world", "the quick dog"])) def affine(x, A, b): Affine transofrm. return A@x + b def rev_affine(y, A, b): Reverse affine transform. return np.linalg.solve(A, (y - b)) A = np.random.random((3,3,)) b = np.random.random(3) x = np.random.random(3) x y = affine(x, A, b) y rev_affine(y, A, b) dna = '''> A simulated DNA sequence. TTAGGCAGTAACCCCGCGATAGGTAGAGCACGCAATCGTCAAGGCGTGCGGTAGGGCTTCCGTGTCTTACCCAAAGAAAC GACGTAACGTTCCCCGGGCGGTTAAACCAAATCCACTTCACCAACGGCATAACGCGAAGCCCAAACTAAATCGCGCTCGA GCGGACGCACATTCGCTAGGCTGTGTAGGGGCAGTCTCCGTTAAGGACGATTACCACGTGATGGTAGTTCGCAACATTGG ACTGTCGGGAATTCCCGAAGGCACTTAAGCGGAGTCTTAGCGTACAGTAACGCAGTCCCGCGTGAACGACTGACAGATGA ''' dna = ''.join(dna.split('\n')[1:]) dna from collections import Counter c = Counter(zip(dna[:-1], dna[1:])) c sum(c.values()) def sgd(b, x, y, max_iter, alpha): n = x.shape[0] for i in range(max_iter): for j in range(n): b[0] -= alpha * (2*(b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) b[1] =- alpha * (2*x[j] * (b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) b[2] -= alpha * (2*x[j]**2 * (b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) return b %%time np.random.seed(12345) n = 10000 x = np.linspace(0, 10, n) y = 2*x**2 + 6*x + 3 + np.random.normal(0, 5, n) k = 100 alpha = 0.00001 b0 = np.random.random(3) b = sgd(b0, x, y, k, alpha) yhat = b[0] + b[1]*x+ b[2]*x**2 idx = sorted(np.random.choice(n, 100)) plt.scatter(x[idx], y[idx]) plt.plot(x[idx], yhat[idx], c='red') pass from numba import jit @jit(nopython = True) def sgd_numba(b, x, y, max_iter, alpha): n = x.shape[0] for i in range(max_iter): for j in range(n): b[0] -= alpha * (2*(b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) b[1] =- alpha * (2*x[j] * (b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) b[2] -= alpha * (2*x[j]**2 * (b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) return b # Call once to trigger compilation sgd_numba(b0, x, y, k, alpha); %%time np.random.seed(12345) n = 10000 x = np.linspace(0, 10, n) y = 2*x**2 + 6*x + 3 + np.random.normal(0, 5, n) k = 100 alpha = 0.00001 b0 = np.random.random(3) b = sgd_numba(b0, x, y, k, alpha) yhat = b[0] + b[1]*x+ b[2]*x**2 idx = sorted(np.random.choice(n, 100)) plt.scatter(x[idx], y[idx]) plt.plot(x[idx], yhat[idx], c='red') pass %load_ext cython %%cython -a cimport cython @cython.wraparound(False) @cython.boundscheck(False) def sgd_cython(double[:] b, double[:] x, double[:] y, int max_iter, double alpha): cdef int n = x.shape[0] cdef int i, j for i in range(max_iter): for j in range(n): b[0] -= alpha * (2*(b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) b[1] =- alpha * (2*x[j] * (b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) b[2] -= alpha * (2*x[j]**2 * (b[0] + b[1]*x[j] + b[2]*x[j]**2 - y[j])) return b %%time np.random.seed(12345) n = 10000 x = np.linspace(0, 10, n) y = 2*x**2 + 6*x + 3 + np.random.normal(0, 5, n) k = 100 alpha = 0.00001 b0 = np.random.random(3) b = sgd_cython(b0, x, y, k, alpha) yhat = b[0] + b[1]*x+ b[2]*x**2 idx = sorted(np.random.choice(n, 100)) plt.scatter(x[idx], y[idx]) plt.plot(x[idx], yhat[idx], c='red') pass <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Function Step2: Step3: * Log in web WeChat using QR code image / 用微信App扫QR码图片来自动登录 Step4: Step5: * Interactive Conversation Step6: Try the parcel enquiry bot by yourself
<ASSISTANT_TASK:> Python Code: # from __future__ import unicode_literals, division import time, datetime, requests, itchat from itchat.content import * import tagui as t from time import localtime, strftime # import pandas as pd # Function # input : Parcel ID, type: string # Return: File name of screenshot png image containing parcel status results, type: string def Enquire_Parcel(str_parcel_id): # print('str_parcel_id : ', str_parcel_id) result_filename = 'results/' + str(str_parcel_id).lstrip() + strftime("-%Y-%m-%d-%Hm%Mm%Ss", localtime()) + '.png' # print('result_filename : ', result_filename) t.init(visual_automation = True) t.url('http://qexpress.co.nz/tracking.aspx?orderNumber=' + str(str_parcel_id).lstrip()) t.wait(0.5) t.keyboard('[end]') t.wait(0.5) t.snap('page.png', result_filename) t.wait(0.5) t.close() print('[ Enquie Parcel ] ID : {} | File Name : {}'.format(str_parcel_id, result_filename)) return result_filename; ####################################################################### ### Optional Adhoc Test ### Function: Enquire_Parcel ####################################################################### msg_parcel_id = 'DZ140053181NZ' msg_filename = Enquire_Parcel(msg_parcel_id) # itchat.auto_login(hotReload=True) # hotReload=True: 退出程序后暂存登陆状态。即使程序关闭,一定时间内重新开启也可以不用重新扫码。 itchat.auto_login(enableCmdQR=-2) # enableCmdQR=-2: 命令行显示QR图片 # If click Kernel -> Interupt, then hot re-login is possible: # itchat.auto_login(hotReload=True) ####################################################################### ### Optional Adhoc Test ### Send Enquire_Parcel status through WeChat ####################################################################### # Locate User / 获取分别对应相应键值的用户。 # friend = itchat.search_friends(name=u'IPA-Bot') friend = itchat.search_friends(name=u'白黑') for i in range(0, len(friend)): print('NickName : %s' % friend[i]['NickName']) print('Alias A-ID: %s' % friend[i]['Alias']) print('RemarkName: %s' % friend[i]['RemarkName']) print('UserName : %s' % friend[i]['UserName']) # Picture / 图片 reply = itchat.send_image(msg_filename, friend[0]['UserName']) print(reply['BaseResponse']['ErrMsg']) # 如果收到[TEXT, MAP, CARD, NOTE, SHARING]类的信息,会自动回复: @itchat.msg_register([TEXT, MAP, CARD, NOTE, SHARING]) # 文字、位置、名片、通知、分享 def text_reply(msg): print(u'[ Terminal Info ] Thank you! 谢谢亲[嘴唇]我已收到 I received: [ %s ] %s From: %s' % (msg['Type'], msg['Text'], msg['FromUserName'])) itchat.send(u'Thank you! 谢谢亲[嘴唇]我已收到\nI received:\n[ %s ]\n%s' % (msg['Type'], msg['Text']), msg['FromUserName']) ###################################################################################################### # Parcel Enquiry module ###################################################################################################### if "Parcel" in msg['Text'] or "parcel" in msg['Text']: # Check parcel enquiry command keyword: Parcel msg_filename = Enquire_Parcel(msg['Text'].replace('Parcel ','').replace('parcel ','')) # Extract Parcel ID from message itchat.send_image(msg_filename, msg['FromUserName']) ###################################################################################################### # 如果收到[PICTURE, RECORDING, ATTACHMENT, VIDEO]类的信息,会自动保存: @itchat.msg_register([PICTURE, RECORDING, ATTACHMENT, VIDEO]) # 图片、语音、文件、视频 def download_files(msg): msg['Text'](msg['FileName']) print(u'[ Terminal Info ] Thank you! 谢谢亲[嘴唇]我已收到 I received: [ %s ] %s From: %s' % ({'Picture': 'img', 'Video': 'vid'}.get(msg['Type'], 'fil'), msg['FileName'], msg['FromUserName'])) itchat.send(u'Thank you! 谢谢亲[嘴唇]我已收到\nI received:', msg['FromUserName']) return '@%s@%s' % ({'Picture': 'img', 'Video': 'vid'}.get(msg['Type'], 'fil'), msg['FileName']) # 如果收到新朋友的请求,会自动通过验证添加加好友,并主动打个招呼:幸会幸会!Nice to meet you! @itchat.msg_register(FRIENDS) def add_friend(msg): print(u'[ Terminal Info ] New Friend Request 新朋友的请求,自动通过验证添加加好友 From: %s' % msg['RecommendInfo']['UserName']) itchat.add_friend(**msg['Text']) # 该操作会自动将新好友的消息录入,不需要重载通讯录 itchat.send_msg(u'幸会幸会!Nice to meet you!', msg['RecommendInfo']['UserName']) # 在群里,如果收到@自己的文字信息,会自动回复: @itchat.msg_register(TEXT, isGroupChat=True) def text_reply(msg): if msg['isAt']: print(u'[ Terminal Info ] Group@Info 在群里收到@自己的文字信息: %s From: %s %s' % (msg['Content'], msg['ActualNickName'], msg['FromUserName'])) itchat.send(u'@%s\u2005I received: %s' % (msg['ActualNickName'], msg['Content']), msg['FromUserName']) itchat.run() # Click Kernel -> Interupt, then logout itchat.logout() # 安全退出 <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Generate Features And Target Data Step2: Create Logistic Regression Step3: Cross-Validate Model Using Recall
<ASSISTANT_TASK:> Python Code: # Load libraries from sklearn.model_selection import cross_val_score from sklearn.linear_model import LogisticRegression from sklearn.datasets import make_classification # Generate features matrix and target vector X, y = make_classification(n_samples = 10000, n_features = 3, n_informative = 3, n_redundant = 0, n_classes = 2, random_state = 1) # Create logistic regression logit = LogisticRegression() # Cross-validate model using precision cross_val_score(logit, X, y, scoring="recall") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Everything is represented by objects in python or relation among objects. Every object has a value, type, identity. Identity can be thought of as address of object in memory which never changes. The 'is' operator compares the identity of the objects. Type of an object is also unchangable.<br>
<ASSISTANT_TASK:> Python Code: def \ quicksort(): pass class Meta(type): pass class MyClass(metaclass = Meta): pass class MySubclass(MyClass): pass <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Toy Network Step2: Centrality Step3: Eigenvector Centrality Step4: Betweenness Centrality Step5: Centrality Measures Are Different Step6: Transitivity Step7: Measure Transitivity Step8: Clustering Coefficient Step9: Community Detection Step10: Real Network Step11: Subset the Data Step12: Subset the Data Step13: Create the network (two ways) Step14: Set edge weights for Network Object Step15: Thresholding Step16: Look at the network Step17: Take out the singletons to get a clearer picture Step18: Look at the degree distribution Step19: Look at party in the network Step20: Prepare the Visualization Step21: Visualize the network by party Step22: Do it again with a lower threshold Step23: Modularity Step24: Visualize the Communities Step25: How did we do? Step26: Pretty, but now what? Step27: Merge in some network data Step28: Degree is not significant Step29: Betweeness is! Step40: Questions?
<ASSISTANT_TASK:> Python Code: import pandas as pd import networkx as nx import numpy as np import scipy as sp import itertools import matplotlib.pyplot as plt import statsmodels.api as sm %matplotlib inline G = nx.Graph() G.add_nodes_from(['A','B','C','D','E','F','G']) G.add_edges_from([('A','B'),('A','C'), ('A','D'),('A','F'), ('B','E'),('C','E'), ('F','G')]) nx.draw_networkx(G, with_labels=True) deg = nx.degree_centrality(G) print(deg) eig_c = nx.eigenvector_centrality_numpy(G) toy_adj = nx.adjacency_matrix(G) print(eig_c) val,vec = np.linalg.eig(toy_adj.toarray()) print(val) vec[:,0] betw = nx.betweenness_centrality(G) print(betw) cent_scores = pd.DataFrame({'deg':deg,'eig_c':eig_c,'betw':betw}) print(cent_scores.corr()) cent_scores G_trans = G.copy() G_trans.add_edge('A','E') G_trans.add_edge('F','D') nx.draw_networkx(G_trans, with_labels=True) print("Transitivity:") print(nx.transitivity(G)) print(nx.transitivity(G_trans)) print("Triangles:") print(nx.triangles(G)) print(nx.triangles(G_trans)) print("Clustering coefficient") print(nx.clustering(G)) print(nx.clustering(G_trans)) print("Average Clustering") print(nx.average_clustering(G)) print(nx.average_clustering(G_trans)) coms = nx.algorithms.community.centrality.girvan_newman(G) i = 2 for com in itertools.islice(coms,4): print(i, ' communities') i+=1 print(tuple(c for c in com)) edges = [] with open('cosponsors.txt') as d: for line in d: edges.append(line.split()) dates = pd.read_csv('Dates.txt',sep='-',header=None) dates.columns = ['year','month','day'] index_loc = np.where(dates.year==2004) edges_04 = [edges[i] for i in index_loc[0]] # Get nodes senate = pd.read_csv('senate.csv') senators = senate.loc[senate.congress==108,['id','party']] # Creae adjacency matrix adj_mat = np.zeros([len(senators),len(senators)]) senators = pd.DataFrame(senators) senators['adj_ind']=range(len(senators)) # Create Graph Object senateG= nx.Graph() senateG.add_nodes_from(senators.id) party_dict = dict(zip(senators.id,senators.party)) nx.set_node_attributes(senateG, name='party',values=party_dict) for bill in edges_04: if bill[0] == "NA": continue bill = [int(i) for i in bill] if bill[0] not in list(senators.id): continue combos = list(itertools.combinations(bill,2)) senateG.add_edges_from(combos) for pair in combos: i = senators.loc[senators.id == int(pair[0]), 'adj_ind'] j = senators.loc[senators.id == int(pair[1]), 'adj_ind'] adj_mat[i,j]+=1 adj_mat[j,i]+=1 for row in range(len(adj_mat)): cols = np.where(adj_mat[row,:])[0] i = senators.loc[senators.adj_ind==row,'id'] i = int(i) for col in cols: j = senators.loc[senators.adj_ind==col,'id'] j = int(j) senateG[i][j]['bills']=adj_mat[row,col] bill_dict = nx.get_edge_attributes(senateG,'bills') elarge=[(i,j) for (i,j) in bill_dict if bill_dict[(i,j)] >40] nx.draw_spring(senateG, edgelist = elarge,with_labels=True) senateGt= nx.Graph() senateGt.add_nodes_from(senateG.nodes) senateGt.add_edges_from(elarge) deg = senateGt.degree() rem = [n[0] for n in deg if n[1]==0] senateGt_all = senateGt.copy() senateGt.remove_nodes_from(rem) nx.draw_spring(senateGt,with_labels=True) foo=pd.DataFrame({'tup':deg}) deg = senateGt.degree() foo = pd.DataFrame(foo) foo[['grp','deg']]=foo['tup'].apply(pd.Series) foo.deg.plot.hist() party = nx.get_node_attributes(senateG,'party') dems = [] gop = [] for i in party: if party[i]==100: dems.append(i) else: gop.append(i) pos = nx.spring_layout(senateGt) pos_all = nx.circular_layout(senateG) dem_dict={} gop_dict={} dem_lone = {} gop_lone= {} for n in dems: if n in rem: dem_lone[n]=pos_all[n] else:dem_dict[n] = pos[n] for n in gop: if n in rem: gop_lone[n]=pos_all[n] else:gop_dict[n] = pos[n] dems = list(set(dems)-set(rem)) gop = list(set(gop)-set(rem)) nx.draw_networkx_nodes(senateGt, pos=dem_dict, nodelist = dems,node_color='b',node_size = 100) nx.draw_networkx_nodes(senateGt, pos=gop_dict, nodelist = gop,node_color='r', node_size = 100) nx.draw_networkx_nodes(senateG, pos=dem_lone, nodelist = list(dem_lone.keys()),node_color='b',node_size = 200) nx.draw_networkx_nodes(senateG, pos=gop_lone, nodelist = list(gop_lone.keys()),node_color='r', node_size = 200) nx.draw_networkx_edges(senateGt,pos=pos, edgelist=elarge) dems = list(set(dems)-set(rem)) gop = list(set(gop)-set(rem)) nx.draw_networkx_nodes(senateGt, pos=dem_dict, nodelist = dems,node_color='b',node_size = 100) nx.draw_networkx_nodes(senateGt, pos=gop_dict, nodelist = gop,node_color='r', node_size = 100) nx.draw_networkx_nodes(senateGt_all, pos=dem_lone, nodelist = list(dem_lone.keys()),node_color='b',node_size = 100) nx.draw_networkx_nodes(senateGt_all, pos=gop_lone, nodelist = list(gop_lone.keys()),node_color='r', node_size = 100) nx.draw_networkx_edges(senateGt,pos=pos, edgelist=elarge) colors = greedy_modularity_communities(senateGt, weight = 'bills') pos = nx.spring_layout(senateGt) pos0={} pos1={} for n in colors[0]: pos0[n] = pos[n] for n in colors[1]: pos1[n] = pos[n] nx.draw_networkx_nodes(senateGt, pos=pos0, nodelist = colors[0],node_color='r') nx.draw_networkx_nodes(senateGt, pos=pos1, nodelist = colors[1],node_color='b') nx.draw_networkx_edges(senateGt,pos=pos, edgelist=elarge) print('gop misclassification') for i in colors[1]: if i in dems: print(i,len(senateGt[i])) print('dem misclassification') for i in colors[0]: if i in gop: print(i,len(senateGt[i])) sh = pd.read_csv('SH.tab',sep='\t') sh['dem']= sh.party==100 sh['dem']=sh.dem*1 model_data = sh.loc[ (sh.congress == 108) & (sh.chamber=='S'), ['ids','dem','pb','pa'] ] model_data['passed']=model_data.pb+model_data.pa model_data.set_index('ids',inplace=True) bet_cent = nx.betweenness_centrality(senateG,weight='bills') bet_cent = pd.Series(bet_cent) deg_cent = nx.degree_centrality(senateGt) deg_cent = pd.Series(deg_cent) model_data['between']=bet_cent model_data['degree']=deg_cent y =model_data.loc[:,'passed'] x =model_data.loc[:,['degree','dem']] x['c'] = 1 ols_model1 = sm.OLS(y,x,missing='drop') results = ols_model1.fit() print(results.summary()) y =model_data.loc[:,'passed'] x =model_data.loc[:,['between','dem']] x['c'] = 1 ols_model1 = sm.OLS(y,x,missing='drop') results = ols_model1.fit() print(results.summary()) # Some functions from the NetworkX package import heapq class MappedQueue(object): The MappedQueue class implements an efficient minimum heap. The smallest element can be popped in O(1) time, new elements can be pushed in O(log n) time, and any element can be removed or updated in O(log n) time. The queue cannot contain duplicate elements and an attempt to push an element already in the queue will have no effect. MappedQueue complements the heapq package from the python standard library. While MappedQueue is designed for maximum compatibility with heapq, it has slightly different functionality. Examples -------- A `MappedQueue` can be created empty or optionally given an array of initial elements. Calling `push()` will add an element and calling `pop()` will remove and return the smallest element. >>> q = MappedQueue([916, 50, 4609, 493, 237]) >>> q.push(1310) True >>> x = [q.pop() for i in range(len(q.h))] >>> x [50, 237, 493, 916, 1310, 4609] Elements can also be updated or removed from anywhere in the queue. >>> q = MappedQueue([916, 50, 4609, 493, 237]) >>> q.remove(493) >>> q.update(237, 1117) >>> x = [q.pop() for i in range(len(q.h))] >>> x [50, 916, 1117, 4609] References ---------- .. [1] Cormen, T. H., Leiserson, C. E., Rivest, R. L., & Stein, C. (2001). Introduction to algorithms second edition. .. [2] Knuth, D. E. (1997). The art of computer programming (Vol. 3). Pearson Education. def __init__(self, data=[]): Priority queue class with updatable priorities. self.h = list(data) self.d = dict() self._heapify() def __len__(self): return len(self.h) def _heapify(self): Restore heap invariant and recalculate map. heapq.heapify(self.h) self.d = dict([(elt, pos) for pos, elt in enumerate(self.h)]) if len(self.h) != len(self.d): raise AssertionError("Heap contains duplicate elements") def push(self, elt): Add an element to the queue. # If element is already in queue, do nothing if elt in self.d: return False # Add element to heap and dict pos = len(self.h) self.h.append(elt) self.d[elt] = pos # Restore invariant by sifting down self._siftdown(pos) return True def pop(self): Remove and return the smallest element in the queue. # Remove smallest element elt = self.h[0] del self.d[elt] # If elt is last item, remove and return if len(self.h) == 1: self.h.pop() return elt # Replace root with last element last = self.h.pop() self.h[0] = last self.d[last] = 0 # Restore invariant by sifting up, then down pos = self._siftup(0) self._siftdown(pos) # Return smallest element return elt def update(self, elt, new): Replace an element in the queue with a new one. # Replace pos = self.d[elt] self.h[pos] = new del self.d[elt] self.d[new] = pos # Restore invariant by sifting up, then down pos = self._siftup(pos) self._siftdown(pos) def remove(self, elt): Remove an element from the queue. # Find and remove element try: pos = self.d[elt] del self.d[elt] except KeyError: # Not in queue raise # If elt is last item, remove and return if pos == len(self.h) - 1: self.h.pop() return # Replace elt with last element last = self.h.pop() self.h[pos] = last self.d[last] = pos # Restore invariant by sifting up, then down pos = self._siftup(pos) self._siftdown(pos) def _siftup(self, pos): Move element at pos down to a leaf by repeatedly moving the smaller child up. h, d = self.h, self.d elt = h[pos] # Continue until element is in a leaf end_pos = len(h) left_pos = (pos << 1) + 1 while left_pos < end_pos: # Left child is guaranteed to exist by loop predicate left = h[left_pos] try: right_pos = left_pos + 1 right = h[right_pos] # Out-of-place, swap with left unless right is smaller if right < left: h[pos], h[right_pos] = right, elt pos, right_pos = right_pos, pos d[elt], d[right] = pos, right_pos else: h[pos], h[left_pos] = left, elt pos, left_pos = left_pos, pos d[elt], d[left] = pos, left_pos except IndexError: # Left leaf is the end of the heap, swap h[pos], h[left_pos] = left, elt pos, left_pos = left_pos, pos d[elt], d[left] = pos, left_pos # Update left_pos left_pos = (pos << 1) + 1 return pos def _siftdown(self, pos): Restore invariant by repeatedly replacing out-of-place element with its parent. h, d = self.h, self.d elt = h[pos] # Continue until element is at root while pos > 0: parent_pos = (pos - 1) >> 1 parent = h[parent_pos] if parent > elt: # Swap out-of-place element with parent h[parent_pos], h[pos] = elt, parent parent_pos, pos = pos, parent_pos d[elt] = pos d[parent] = parent_pos else: # Invariant is satisfied break return pos from __future__ import division import networkx as nx from networkx.algorithms.community.quality import modularity def greedy_modularity_communities(G, weight=None): Find communities in graph using Clauset-Newman-Moore greedy modularity maximization. This method currently supports the Graph class and does not consider edge weights. Greedy modularity maximization begins with each node in its own community and joins the pair of communities that most increases modularity until no such pair exists. Parameters ---------- G : NetworkX graph Returns ------- Yields sets of nodes, one for each community. Examples -------- >>> from networkx.algorithms.community import greedy_modularity_communities >>> G = nx.karate_club_graph() >>> c = list(greedy_modularity_communities(G)) >>> sorted(c[0]) [8, 14, 15, 18, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33] References ---------- .. [1] M. E. J Newman 'Networks: An Introduction', page 224 Oxford University Press 2011. .. [2] Clauset, A., Newman, M. E., & Moore, C. "Finding community structure in very large networks." Physical Review E 70(6), 2004. # Count nodes and edges N = len(G.nodes()) m = sum([d.get('weight', 1) for u, v, d in G.edges(data=True)]) q0 = 1.0 / (2.0*m) # Map node labels to contiguous integers label_for_node = dict((i, v) for i, v in enumerate(G.nodes())) node_for_label = dict((label_for_node[i], i) for i in range(N)) # Calculate degrees k_for_label = G.degree(G.nodes(), weight=weight) k = [k_for_label[label_for_node[i]] for i in range(N)] # Initialize community and merge lists communities = dict((i, frozenset([i])) for i in range(N)) merges = [] # Initial modularity partition = [[label_for_node[x] for x in c] for c in communities.values()] q_cnm = modularity(G, partition) # Initialize data structures # CNM Eq 8-9 (Eq 8 was missing a factor of 2 (from A_ij + A_ji) # a[i]: fraction of edges within community i # dq_dict[i][j]: dQ for merging community i, j # dq_heap[i][n] : (-dq, i, j) for communitiy i nth largest dQ # H[n]: (-dq, i, j) for community with nth largest max_j(dQ_ij) a = [k[i]*q0 for i in range(N)] dq_dict = dict( (i, dict( (j, 2*q0 - 2*k[i]*k[j]*q0*q0) for j in [ node_for_label[u] for u in G.neighbors(label_for_node[i])] if j != i)) for i in range(N)) dq_heap = [ MappedQueue([ (-dq, i, j) for j, dq in dq_dict[i].items()]) for i in range(N)] H = MappedQueue([ dq_heap[i].h[0] for i in range(N) if len(dq_heap[i]) > 0]) # Merge communities until we can't improve modularity while len(H) > 1: # Find best merge # Remove from heap of row maxes # Ties will be broken by choosing the pair with lowest min community id try: dq, i, j = H.pop() except IndexError: break dq = -dq # Remove best merge from row i heap dq_heap[i].pop() # Push new row max onto H if len(dq_heap[i]) > 0: H.push(dq_heap[i].h[0]) # If this element was also at the root of row j, we need to remove the # dupliate entry from H if dq_heap[j].h[0] == (-dq, j, i): H.remove((-dq, j, i)) # Remove best merge from row j heap dq_heap[j].remove((-dq, j, i)) # Push new row max onto H if len(dq_heap[j]) > 0: H.push(dq_heap[j].h[0]) else: # Duplicate wasn't in H, just remove from row j heap dq_heap[j].remove((-dq, j, i)) # Stop when change is non-positive if dq <= 0: break # Perform merge communities[j] = frozenset(communities[i] | communities[j]) del communities[i] merges.append((i, j, dq)) # New modularity q_cnm += dq # Get list of communities connected to merged communities i_set = set(dq_dict[i].keys()) j_set = set(dq_dict[j].keys()) all_set = (i_set | j_set) - set([i, j]) both_set = i_set & j_set # Merge i into j and update dQ for k in all_set: # Calculate new dq value if k in both_set: dq_jk = dq_dict[j][k] + dq_dict[i][k] elif k in j_set: dq_jk = dq_dict[j][k] - 2.0*a[i]*a[k] else: # k in i_set dq_jk = dq_dict[i][k] - 2.0*a[j]*a[k] # Update rows j and k for row, col in [(j, k), (k, j)]: # Save old value for finding heap index if k in j_set: d_old = (-dq_dict[row][col], row, col) else: d_old = None # Update dict for j,k only (i is removed below) dq_dict[row][col] = dq_jk # Save old max of per-row heap if len(dq_heap[row]) > 0: d_oldmax = dq_heap[row].h[0] else: d_oldmax = None # Add/update heaps d = (-dq_jk, row, col) if d_old is None: # We're creating a new nonzero element, add to heap dq_heap[row].push(d) else: # Update existing element in per-row heap dq_heap[row].update(d_old, d) # Update heap of row maxes if necessary if d_oldmax is None: # No entries previously in this row, push new max H.push(d) else: # We've updated an entry in this row, has the max changed? if dq_heap[row].h[0] != d_oldmax: H.update(d_oldmax, dq_heap[row].h[0]) # Remove row/col i from matrix i_neighbors = dq_dict[i].keys() for k in i_neighbors: # Remove from dict dq_old = dq_dict[k][i] del dq_dict[k][i] # Remove from heaps if we haven't already if k != j: # Remove both row and column for row, col in [(k, i), (i, k)]: # Check if replaced dq is row max d_old = (-dq_old, row, col) if dq_heap[row].h[0] == d_old: # Update per-row heap and heap of row maxes dq_heap[row].remove(d_old) H.remove(d_old) # Update row max if len(dq_heap[row]) > 0: H.push(dq_heap[row].h[0]) else: # Only update per-row heap dq_heap[row].remove(d_old) del dq_dict[i] # Mark row i as deleted, but keep placeholder dq_heap[i] = MappedQueue() # Merge i into j and update a a[j] += a[i] a[i] = 0 communities = [ frozenset([label_for_node[i] for i in c]) for c in communities.values()] return sorted(communities, key=len, reverse=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Model Family Step7: 1.4. Basic Approximations Step8: 2. Key Properties --&gt; Resolution Step9: 2.2. Canonical Horizontal Resolution Step10: 2.3. Range Horizontal Resolution Step11: 2.4. Number Of Vertical Levels Step12: 2.5. High Top Step13: 3. Key Properties --&gt; Timestepping Step14: 3.2. Timestep Shortwave Radiative Transfer Step15: 3.3. Timestep Longwave Radiative Transfer Step16: 4. Key Properties --&gt; Orography Step17: 4.2. Changes Step18: 5. Grid --&gt; Discretisation Step19: 6. Grid --&gt; Discretisation --&gt; Horizontal Step20: 6.2. Scheme Method Step21: 6.3. Scheme Order Step22: 6.4. Horizontal Pole Step23: 6.5. Grid Type Step24: 7. Grid --&gt; Discretisation --&gt; Vertical Step25: 8. Dynamical Core Step26: 8.2. Name Step27: 8.3. Timestepping Type Step28: 8.4. Prognostic Variables Step29: 9. Dynamical Core --&gt; Top Boundary Step30: 9.2. Top Heat Step31: 9.3. Top Wind Step32: 10. Dynamical Core --&gt; Lateral Boundary Step33: 11. Dynamical Core --&gt; Diffusion Horizontal Step34: 11.2. Scheme Method Step35: 12. Dynamical Core --&gt; Advection Tracers Step36: 12.2. Scheme Characteristics Step37: 12.3. Conserved Quantities Step38: 12.4. Conservation Method Step39: 13. Dynamical Core --&gt; Advection Momentum Step40: 13.2. Scheme Characteristics Step41: 13.3. Scheme Staggering Type Step42: 13.4. Conserved Quantities Step43: 13.5. Conservation Method Step44: 14. Radiation Step45: 15. Radiation --&gt; Shortwave Radiation Step46: 15.2. Name Step47: 15.3. Spectral Integration Step48: 15.4. Transport Calculation Step49: 15.5. Spectral Intervals Step50: 16. Radiation --&gt; Shortwave GHG Step51: 16.2. ODS Step52: 16.3. Other Flourinated Gases Step53: 17. Radiation --&gt; Shortwave Cloud Ice Step54: 17.2. Physical Representation Step55: 17.3. Optical Methods Step56: 18. Radiation --&gt; Shortwave Cloud Liquid Step57: 18.2. Physical Representation Step58: 18.3. Optical Methods Step59: 19. Radiation --&gt; Shortwave Cloud Inhomogeneity Step60: 20. Radiation --&gt; Shortwave Aerosols Step61: 20.2. Physical Representation Step62: 20.3. Optical Methods Step63: 21. Radiation --&gt; Shortwave Gases Step64: 22. Radiation --&gt; Longwave Radiation Step65: 22.2. Name Step66: 22.3. Spectral Integration Step67: 22.4. Transport Calculation Step68: 22.5. Spectral Intervals Step69: 23. Radiation --&gt; Longwave GHG Step70: 23.2. ODS Step71: 23.3. Other Flourinated Gases Step72: 24. Radiation --&gt; Longwave Cloud Ice Step73: 24.2. Physical Reprenstation Step74: 24.3. Optical Methods Step75: 25. Radiation --&gt; Longwave Cloud Liquid Step76: 25.2. Physical Representation Step77: 25.3. Optical Methods Step78: 26. Radiation --&gt; Longwave Cloud Inhomogeneity Step79: 27. Radiation --&gt; Longwave Aerosols Step80: 27.2. Physical Representation Step81: 27.3. Optical Methods Step82: 28. Radiation --&gt; Longwave Gases Step83: 29. Turbulence Convection Step84: 30. Turbulence Convection --&gt; Boundary Layer Turbulence Step85: 30.2. Scheme Type Step86: 30.3. Closure Order Step87: 30.4. Counter Gradient Step88: 31. Turbulence Convection --&gt; Deep Convection Step89: 31.2. Scheme Type Step90: 31.3. Scheme Method Step91: 31.4. Processes Step92: 31.5. Microphysics Step93: 32. Turbulence Convection --&gt; Shallow Convection Step94: 32.2. Scheme Type Step95: 32.3. Scheme Method Step96: 32.4. Processes Step97: 32.5. Microphysics Step98: 33. Microphysics Precipitation Step99: 34. Microphysics Precipitation --&gt; Large Scale Precipitation Step100: 34.2. Hydrometeors Step101: 35. Microphysics Precipitation --&gt; Large Scale Cloud Microphysics Step102: 35.2. Processes Step103: 36. Cloud Scheme Step104: 36.2. Name Step105: 36.3. Atmos Coupling Step106: 36.4. Uses Separate Treatment Step107: 36.5. Processes Step108: 36.6. Prognostic Scheme Step109: 36.7. Diagnostic Scheme Step110: 36.8. Prognostic Variables Step111: 37. Cloud Scheme --&gt; Optical Cloud Properties Step112: 37.2. Cloud Inhomogeneity Step113: 38. Cloud Scheme --&gt; Sub Grid Scale Water Distribution Step114: 38.2. Function Name Step115: 38.3. Function Order Step116: 38.4. Convection Coupling Step117: 39. Cloud Scheme --&gt; Sub Grid Scale Ice Distribution Step118: 39.2. Function Name Step119: 39.3. Function Order Step120: 39.4. Convection Coupling Step121: 40. Observation Simulation Step122: 41. Observation Simulation --&gt; Isscp Attributes Step123: 41.2. Top Height Direction Step124: 42. Observation Simulation --&gt; Cosp Attributes Step125: 42.2. Number Of Grid Points Step126: 42.3. Number Of Sub Columns Step127: 42.4. Number Of Levels Step128: 43. Observation Simulation --&gt; Radar Inputs Step129: 43.2. Type Step130: 43.3. Gas Absorption Step131: 43.4. Effective Radius Step132: 44. Observation Simulation --&gt; Lidar Inputs Step133: 44.2. Overlap Step134: 45. Gravity Waves Step135: 45.2. Sponge Layer Step136: 45.3. Background Step137: 45.4. Subgrid Scale Orography Step138: 46. Gravity Waves --&gt; Orographic Gravity Waves Step139: 46.2. Source Mechanisms Step140: 46.3. Calculation Method Step141: 46.4. Propagation Scheme Step142: 46.5. Dissipation Scheme Step143: 47. Gravity Waves --&gt; Non Orographic Gravity Waves Step144: 47.2. Source Mechanisms Step145: 47.3. Calculation Method Step146: 47.4. Propagation Scheme Step147: 47.5. Dissipation Scheme Step148: 48. Solar Step149: 49. Solar --&gt; Solar Pathways Step150: 50. Solar --&gt; Solar Constant Step151: 50.2. Fixed Value Step152: 50.3. Transient Characteristics Step153: 51. Solar --&gt; Orbital Parameters Step154: 51.2. Fixed Reference Date Step155: 51.3. Transient Method Step156: 51.4. Computation Method Step157: 52. Solar --&gt; Insolation Ozone Step158: 53. Volcanos Step159: 54. Volcanos --&gt; Volcanoes Treatment
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'inm', 'inm-cm5-0', 'atmos') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.overview.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.overview.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.overview.model_family') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "AGCM" # "ARCM" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.overview.basic_approximations') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "primitive equations" # "non-hydrostatic" # "anelastic" # "Boussinesq" # "hydrostatic" # "quasi-hydrostatic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.resolution.horizontal_resolution_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.resolution.canonical_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.resolution.range_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.resolution.number_of_vertical_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.resolution.high_top') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.timestepping.timestep_dynamics') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.timestepping.timestep_shortwave_radiative_transfer') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.timestepping.timestep_longwave_radiative_transfer') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.orography.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "present day" # "modified" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.key_properties.orography.changes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "related to ice sheets" # "related to tectonics" # "modified mean" # "modified variance if taken into account in model (cf gravity waves)" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.horizontal.scheme_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "spectral" # "fixed grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.horizontal.scheme_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "finite elements" # "finite volumes" # "finite difference" # "centered finite difference" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.horizontal.scheme_order') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "second" # "third" # "fourth" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.horizontal.horizontal_pole') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "filter" # "pole rotation" # "artificial island" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.horizontal.grid_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Gaussian" # "Latitude-Longitude" # "Cubed-Sphere" # "Icosahedral" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.grid.discretisation.vertical.coordinate_type') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "isobaric" # "sigma" # "hybrid sigma-pressure" # "hybrid pressure" # "vertically lagrangian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.timestepping_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Adams-Bashforth" # "explicit" # "implicit" # "semi-implicit" # "leap frog" # "multi-step" # "Runge Kutta fifth order" # "Runge Kutta second order" # "Runge Kutta third order" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.prognostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "surface pressure" # "wind components" # "divergence/curl" # "temperature" # "potential temperature" # "total water" # "water vapour" # "water liquid" # "water ice" # "total water moments" # "clouds" # "radiation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.top_boundary.top_boundary_condition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "sponge layer" # "radiation boundary condition" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.top_boundary.top_heat') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.top_boundary.top_wind') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.lateral_boundary.condition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "sponge layer" # "radiation boundary condition" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.diffusion_horizontal.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.diffusion_horizontal.scheme_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "iterated Laplacian" # "bi-harmonic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_tracers.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Heun" # "Roe and VanLeer" # "Roe and Superbee" # "Prather" # "UTOPIA" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_tracers.scheme_characteristics') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Eulerian" # "modified Euler" # "Lagrangian" # "semi-Lagrangian" # "cubic semi-Lagrangian" # "quintic semi-Lagrangian" # "mass-conserving" # "finite volume" # "flux-corrected" # "linear" # "quadratic" # "quartic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_tracers.conserved_quantities') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "dry mass" # "tracer mass" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_tracers.conservation_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "conservation fixer" # "Priestley algorithm" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_momentum.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "VanLeer" # "Janjic" # "SUPG (Streamline Upwind Petrov-Galerkin)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_momentum.scheme_characteristics') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "2nd order" # "4th order" # "cell-centred" # "staggered grid" # "semi-staggered grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_momentum.scheme_staggering_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Arakawa B-grid" # "Arakawa C-grid" # "Arakawa D-grid" # "Arakawa E-grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_momentum.conserved_quantities') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Angular momentum" # "Horizontal momentum" # "Enstrophy" # "Mass" # "Total energy" # "Vorticity" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.dynamical_core.advection_momentum.conservation_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "conservation fixer" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.aerosols') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "sulphate" # "nitrate" # "sea salt" # "dust" # "ice" # "organic" # "BC (black carbon / soot)" # "SOA (secondary organic aerosols)" # "POM (particulate organic matter)" # "polar stratospheric ice" # "NAT (nitric acid trihydrate)" # "NAD (nitric acid dihydrate)" # "STS (supercooled ternary solution aerosol particle)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_radiation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_radiation.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_radiation.spectral_integration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "wide-band model" # "correlated-k" # "exponential sum fitting" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_radiation.transport_calculation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "two-stream" # "layer interaction" # "bulk" # "adaptive" # "multi-stream" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_radiation.spectral_intervals') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_GHG.greenhouse_gas_complexity') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "CO2" # "CH4" # "N2O" # "CFC-11 eq" # "CFC-12 eq" # "HFC-134a eq" # "Explicit ODSs" # "Explicit other fluorinated gases" # "O3" # "H2O" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_GHG.ODS') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "CFC-12" # "CFC-11" # "CFC-113" # "CFC-114" # "CFC-115" # "HCFC-22" # "HCFC-141b" # "HCFC-142b" # "Halon-1211" # "Halon-1301" # "Halon-2402" # "methyl chloroform" # "carbon tetrachloride" # "methyl chloride" # "methylene chloride" # "chloroform" # "methyl bromide" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_GHG.other_flourinated_gases') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "HFC-134a" # "HFC-23" # "HFC-32" # "HFC-125" # "HFC-143a" # "HFC-152a" # "HFC-227ea" # "HFC-236fa" # "HFC-245fa" # "HFC-365mfc" # "HFC-43-10mee" # "CF4" # "C2F6" # "C3F8" # "C4F10" # "C5F12" # "C6F14" # "C7F16" # "C8F18" # "c-C4F8" # "NF3" # "SF6" # "SO2F2" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_ice.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_ice.physical_representation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "bi-modal size distribution" # "ensemble of ice crystals" # "mean projected area" # "ice water path" # "crystal asymmetry" # "crystal aspect ratio" # "effective crystal radius" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_ice.optical_methods') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "T-matrix" # "geometric optics" # "finite difference time domain (FDTD)" # "Mie theory" # "anomalous diffraction approximation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_liquid.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_liquid.physical_representation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "cloud droplet number concentration" # "effective cloud droplet radii" # "droplet size distribution" # "liquid water path" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_liquid.optical_methods') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "geometric optics" # "Mie theory" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_cloud_inhomogeneity.cloud_inhomogeneity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Monte Carlo Independent Column Approximation" # "Triplecloud" # "analytic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_aerosols.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_aerosols.physical_representation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "number concentration" # "effective radii" # "size distribution" # "asymmetry" # "aspect ratio" # "mixing state" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_aerosols.optical_methods') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "T-matrix" # "geometric optics" # "finite difference time domain (FDTD)" # "Mie theory" # "anomalous diffraction approximation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.shortwave_gases.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_radiation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_radiation.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_radiation.spectral_integration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "wide-band model" # "correlated-k" # "exponential sum fitting" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_radiation.transport_calculation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "two-stream" # "layer interaction" # "bulk" # "adaptive" # "multi-stream" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_radiation.spectral_intervals') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_GHG.greenhouse_gas_complexity') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "CO2" # "CH4" # "N2O" # "CFC-11 eq" # "CFC-12 eq" # "HFC-134a eq" # "Explicit ODSs" # "Explicit other fluorinated gases" # "O3" # "H2O" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_GHG.ODS') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "CFC-12" # "CFC-11" # "CFC-113" # "CFC-114" # "CFC-115" # "HCFC-22" # "HCFC-141b" # "HCFC-142b" # "Halon-1211" # "Halon-1301" # "Halon-2402" # "methyl chloroform" # "carbon tetrachloride" # "methyl chloride" # "methylene chloride" # "chloroform" # "methyl bromide" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_GHG.other_flourinated_gases') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "HFC-134a" # "HFC-23" # "HFC-32" # "HFC-125" # "HFC-143a" # "HFC-152a" # "HFC-227ea" # "HFC-236fa" # "HFC-245fa" # "HFC-365mfc" # "HFC-43-10mee" # "CF4" # "C2F6" # "C3F8" # "C4F10" # "C5F12" # "C6F14" # "C7F16" # "C8F18" # "c-C4F8" # "NF3" # "SF6" # "SO2F2" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_ice.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_ice.physical_reprenstation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "bi-modal size distribution" # "ensemble of ice crystals" # "mean projected area" # "ice water path" # "crystal asymmetry" # "crystal aspect ratio" # "effective crystal radius" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_ice.optical_methods') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "T-matrix" # "geometric optics" # "finite difference time domain (FDTD)" # "Mie theory" # "anomalous diffraction approximation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_liquid.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_liquid.physical_representation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "cloud droplet number concentration" # "effective cloud droplet radii" # "droplet size distribution" # "liquid water path" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_liquid.optical_methods') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "geometric optics" # "Mie theory" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_cloud_inhomogeneity.cloud_inhomogeneity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Monte Carlo Independent Column Approximation" # "Triplecloud" # "analytic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_aerosols.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_aerosols.physical_representation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "number concentration" # "effective radii" # "size distribution" # "asymmetry" # "aspect ratio" # "mixing state" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_aerosols.optical_methods') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "T-matrix" # "geometric optics" # "finite difference time domain (FDTD)" # "Mie theory" # "anomalous diffraction approximation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.radiation.longwave_gases.general_interactions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "scattering" # "emission/absorption" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.boundary_layer_turbulence.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Mellor-Yamada" # "Holtslag-Boville" # "EDMF" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.boundary_layer_turbulence.scheme_type') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "TKE prognostic" # "TKE diagnostic" # "TKE coupled with water" # "vertical profile of Kz" # "non-local diffusion" # "Monin-Obukhov similarity" # "Coastal Buddy Scheme" # "Coupled with convection" # "Coupled with gravity waves" # "Depth capped at cloud base" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.boundary_layer_turbulence.closure_order') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.boundary_layer_turbulence.counter_gradient') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.deep_convection.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.deep_convection.scheme_type') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "mass-flux" # "adjustment" # "plume ensemble" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.deep_convection.scheme_method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "CAPE" # "bulk" # "ensemble" # "CAPE/WFN based" # "TKE/CIN based" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.deep_convection.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "vertical momentum transport" # "convective momentum transport" # "entrainment" # "detrainment" # "penetrative convection" # "updrafts" # "downdrafts" # "radiative effect of anvils" # "re-evaporation of convective precipitation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.deep_convection.microphysics') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "tuning parameter based" # "single moment" # "two moment" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.shallow_convection.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.shallow_convection.scheme_type') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "mass-flux" # "cumulus-capped boundary layer" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.shallow_convection.scheme_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "same as deep (unified)" # "included in boundary layer turbulence" # "separate diagnosis" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.shallow_convection.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "convective momentum transport" # "entrainment" # "detrainment" # "penetrative convection" # "re-evaporation of convective precipitation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.turbulence_convection.shallow_convection.microphysics') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "tuning parameter based" # "single moment" # "two moment" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.microphysics_precipitation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.microphysics_precipitation.large_scale_precipitation.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.microphysics_precipitation.large_scale_precipitation.hydrometeors') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "liquid rain" # "snow" # "hail" # "graupel" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.microphysics_precipitation.large_scale_cloud_microphysics.scheme_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.microphysics_precipitation.large_scale_cloud_microphysics.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "mixed phase" # "cloud droplets" # "cloud ice" # "ice nucleation" # "water vapour deposition" # "effect of raindrops" # "effect of snow" # "effect of graupel" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.atmos_coupling') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "atmosphere_radiation" # "atmosphere_microphysics_precipitation" # "atmosphere_turbulence_convection" # "atmosphere_gravity_waves" # "atmosphere_solar" # "atmosphere_volcano" # "atmosphere_cloud_simulator" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.uses_separate_treatment') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "entrainment" # "detrainment" # "bulk cloud" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.prognostic_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.diagnostic_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.prognostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "cloud amount" # "liquid" # "ice" # "rain" # "snow" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.optical_cloud_properties.cloud_overlap_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "random" # "maximum" # "maximum-random" # "exponential" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.optical_cloud_properties.cloud_inhomogeneity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_water_distribution.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_water_distribution.function_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_water_distribution.function_order') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_water_distribution.convection_coupling') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "coupled with deep" # "coupled with shallow" # "not coupled with convection" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_ice_distribution.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_ice_distribution.function_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_ice_distribution.function_order') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.cloud_scheme.sub_grid_scale_ice_distribution.convection_coupling') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "coupled with deep" # "coupled with shallow" # "not coupled with convection" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.isscp_attributes.top_height_estimation_method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "no adjustment" # "IR brightness" # "visible optical depth" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.isscp_attributes.top_height_direction') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "lowest altitude level" # "highest altitude level" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.cosp_attributes.run_configuration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Inline" # "Offline" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.cosp_attributes.number_of_grid_points') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.cosp_attributes.number_of_sub_columns') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.cosp_attributes.number_of_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.radar_inputs.frequency') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.radar_inputs.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "surface" # "space borne" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.radar_inputs.gas_absorption') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.radar_inputs.effective_radius') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.lidar_inputs.ice_types') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "ice spheres" # "ice non-spherical" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.observation_simulation.lidar_inputs.overlap') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "max" # "random" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.sponge_layer') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Rayleigh friction" # "Diffusive sponge layer" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.background') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "continuous spectrum" # "discrete spectrum" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.subgrid_scale_orography') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "effect on drag" # "effect on lifting" # "enhanced topography" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.orographic_gravity_waves.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.orographic_gravity_waves.source_mechanisms') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "linear mountain waves" # "hydraulic jump" # "envelope orography" # "low level flow blocking" # "statistical sub-grid scale variance" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.orographic_gravity_waves.calculation_method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "non-linear calculation" # "more than two cardinal directions" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.orographic_gravity_waves.propagation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "linear theory" # "non-linear theory" # "includes boundary layer ducting" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.orographic_gravity_waves.dissipation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "total wave" # "single wave" # "spectral" # "linear" # "wave saturation vs Richardson number" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.non_orographic_gravity_waves.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.non_orographic_gravity_waves.source_mechanisms') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "convection" # "precipitation" # "background spectrum" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.non_orographic_gravity_waves.calculation_method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "spatially dependent" # "temporally dependent" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.non_orographic_gravity_waves.propagation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "linear theory" # "non-linear theory" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.gravity_waves.non_orographic_gravity_waves.dissipation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "total wave" # "single wave" # "spectral" # "linear" # "wave saturation vs Richardson number" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.solar_pathways.pathways') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "SW radiation" # "precipitating energetic particles" # "cosmic rays" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.solar_constant.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "fixed" # "transient" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.solar_constant.fixed_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.solar_constant.transient_characteristics') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.orbital_parameters.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "fixed" # "transient" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.orbital_parameters.fixed_reference_date') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.orbital_parameters.transient_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.orbital_parameters.computation_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Berger 1978" # "Laskar 2004" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.solar.insolation_ozone.solar_ozone_impact') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.volcanos.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.atmos.volcanos.volcanoes_treatment.volcanoes_implementation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "high frequency solar constant anomaly" # "stratospheric aerosols optical thickness" # "Other: [Please specify]" # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description:
<ASSISTANT_TASK:> Python Code: def minimum_sum(n , k ) : if(k % n == 0 ) : return 0 ;  return 1  n = 3 k = 56 print(minimum_sum(n , k ) ) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Import section specific modules Step2: 6.1 Sky Models<a id='deconv Step3: Left Step4: Left Step6: Left
<ASSISTANT_TASK:> Python Code: import numpy as np import matplotlib.pyplot as plt %matplotlib inline from IPython.display import HTML HTML('../style/course.css') #apply general CSS import matplotlib.image as mpimg from IPython.display import Image from astropy.io import fits import aplpy #Disable astropy/aplpy logging import logging logger0 = logging.getLogger('astropy') logger0.setLevel(logging.CRITICAL) logger1 = logging.getLogger('aplpy') logger1.setLevel(logging.CRITICAL) from IPython.display import HTML HTML('../style/code_toggle.html') fig = plt.figure(figsize=(16, 7)) gc1 = aplpy.FITSFigure('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-model.fits', \ figure=fig, subplot=[0.0,0.1,0.35,0.8]) gc1.show_colorscale(vmin=-0.1, vmax=1.0, cmap='viridis') gc1.hide_axis_labels() gc1.hide_tick_labels() plt.title('Sky Model') gc1.add_colorbar() gc2 = aplpy.FITSFigure('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-psf.fits', \ figure=fig, subplot=[0.5,0.1,0.35,0.8]) gc2.show_colorscale(cmap='viridis') gc2.hide_axis_labels() gc2.hide_tick_labels() plt.title('KAT-7 PSF') gc2.add_colorbar() fig.canvas.draw() fig = plt.figure(figsize=(16, 5)) fh = fits.open('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-model.fits') skyModel = fh[0].data fh = fits.open('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-psf.fits') psf = fh[0].data fh = fits.open('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-dirty.fits') dirtyImg = fh[0].data fh = fits.open('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-residual.fits') residualImg = fh[0].data #convolve the sky model with the PSF sampFunc = np.fft.fft2(psf) #sampling function skyModelVis = np.fft.fft2(skyModel) #sky model visibilities sampModelVis = sampFunc * skyModelVis #sampled sky model visibilities convImg = np.fft.fftshift(np.fft.ifft2(sampModelVis)).real + residualImg #sky model convolved with PSF gc1 = aplpy.FITSFigure(convImg, figure=fig, subplot=[0,0.0,0.30,1]) gc1.show_colorscale(vmin=-1., vmax=3.0, cmap='viridis') gc1.hide_axis_labels() gc1.hide_tick_labels() plt.title('PSF convolved with Sky Model') gc1.add_colorbar() gc2 = aplpy.FITSFigure(dirtyImg, figure=fig, subplot=[0.33,0.0,0.30,1]) gc2.show_colorscale(vmin=-1., vmax=3.0, cmap='viridis') gc2.hide_axis_labels() gc2.hide_tick_labels() plt.title('Dirty') gc2.add_colorbar() gc3 = aplpy.FITSFigure(dirtyImg - convImg, figure=fig, subplot=[0.67,0.0,0.30,1]) gc3.show_colorscale(cmap='viridis') gc3.hide_axis_labels() gc3.hide_tick_labels() plt.title('Difference') gc3.add_colorbar() fig.canvas.draw() fig = plt.figure(figsize=(16, 7)) gc1 = aplpy.FITSFigure('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-residual.fits', \ figure=fig, subplot=[0.1,0.1,0.35,0.8]) gc1.show_colorscale(vmin=-0.8, vmax=3., cmap='viridis') gc1.hide_axis_labels() gc1.hide_tick_labels() plt.title('Residual') gc1.add_colorbar() gc2 = aplpy.FITSFigure('../data/fits/deconv/KAT-7_6h60s_dec-30_10MHz_10chans_uniform_n100-image.fits', \ figure=fig, subplot=[0.5,0.1,0.35,0.8]) gc2.show_colorscale(vmin=-0.8, vmax=3., cmap='viridis') gc2.hide_axis_labels() gc2.hide_tick_labels() plt.title('Restored') gc2.add_colorbar() fig.canvas.draw() def gauss2d(sigma): Return a normalized 2d Gaussian function, sigma: size in pixels return lambda x,y: (1./(2.*np.pi*(sigma**2.))) * np.exp(-1. * ((xpos**2. + ypos**2.) / (2. * sigma**2.))) imgSize = 512 xpos, ypos = np.mgrid[0:imgSize, 0:imgSize].astype(float) xpos -= imgSize/2. ypos -= imgSize/2. sigmas = [64., 16., 4., 1.] fig = plt.figure(figsize=(16, 7)) #Gaussian image-domain source ax1 = plt.subplot2grid((2, 4), (0, 0)) gauss1 = gauss2d(sigmas[0]) ax1.imshow(gauss1(xpos, ypos)) ax1.axis('off') plt.title('Sigma: %i'%int(sigmas[0])) #Gaussian image-domain source ax2 = plt.subplot2grid((2, 4), (0, 1)) gauss2 = gauss2d(sigmas[1]) ax2.imshow(gauss2(xpos, ypos)) ax2.axis('off') plt.title('Sigma: %i'%int(sigmas[1])) #Gaussian image-domain source ax3 = plt.subplot2grid((2, 4), (0, 2)) gauss3 = gauss2d(sigmas[2]) ax3.imshow(gauss3(xpos, ypos)) ax3.axis('off') plt.title('Sigma: %i'%int(sigmas[2])) #Gaussian image-domain source ax4 = plt.subplot2grid((2, 4), (0, 3)) gauss4 = gauss2d(sigmas[3]) ax4.imshow(gauss4(xpos, ypos)) ax4.axis('off') plt.title('Sigma: %i'%int(sigmas[3])) #plot the visibility flux distribution as a function of baseline length ax5 = plt.subplot2grid((2, 4), (1, 0), colspan=4) visGauss1 = np.abs( np.fft.fftshift( np.fft.fft2(gauss1(xpos, ypos)))) visGauss2 = np.abs( np.fft.fftshift( np.fft.fft2(gauss2(xpos, ypos)))) visGauss3 = np.abs( np.fft.fftshift( np.fft.fft2(gauss3(xpos, ypos)))) visGauss4 = np.abs( np.fft.fftshift( np.fft.fft2(gauss4(xpos, ypos)))) ax5.plot(visGauss1[int(imgSize/2),int(imgSize/2):], label='%i'%int(sigmas[0])) ax5.plot(visGauss2[int(imgSize/2),int(imgSize/2):], label='%i'%int(sigmas[1])) ax5.plot(visGauss3[int(imgSize/2),int(imgSize/2):], label='%i'%int(sigmas[2])) ax5.plot(visGauss4[int(imgSize/2),int(imgSize/2):], label='%i'%int(sigmas[3])) ax5.hlines(1., xmin=0, xmax=int(imgSize/2)-1, linestyles='dashed') plt.legend() plt.ylabel('Flux') plt.xlabel('Baseline Length') plt.xlim(0, int(imgSize/8)-1) ax5.set_xticks([]) ax5.set_yticks([]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Here, we consider different dental insurance options which are available online for individual and group member plans.
<ASSISTANT_TASK:> Python Code: def nonPremCost(maxY, unitCostPrev, rPrev, prevDeduct, costBase, rBase, baseDeduct): paidPrev = 0 paidBase = 0 # first, calculate the preventive services, suppose that 2 units per year totalCostPrev = unitCostPrev * 2 coveredPrev = min(maxY, max(0, totalCostPrev - prevDeduct) * rPrev) #print('coveredPrev=', coveredPrev) coveredBase = maxY - coveredPrev paidPrev = totalCostPrev - coveredPrev; #print('paidPrev=', paidPrev) # second, calculate the basic filling services, suppose that total cost is costBase if coveredBase <= 0: paidBase = costBase else: paidBase = costBase - min(coveredBase, rBase*max(0, costBase-baseDeduct)) extraCost = paidPrev + paidBase return extraCost unitCostPrev = 150 # cost estimate for each teeth cleaning x = [50*i for i in range(41)] # vector for total base cost # BlueCare lower $28.93 # nonPremCost(1000, unitCostPrev, 1, 100, costBase, 0.8, 100) yB1 = [nonPremCost(1000, unitCostPrev, 1, 100, costBase, 0.8, 100) for costBase in x] yB1t = [i+28.93*12 for i in yB1] # total out-of-pocket (absolute) yB1a = [i/.7+28.93*12 for i in yB1] # adjusted to pre-tax cost # BlueCare Higher $ 44.76 # nonPremCost(1000, unitCostPrev, 1, 0, costBase, 0.8, 60) yB2 = [nonPremCost(1000, unitCostPrev, 1, 0, costBase, 0.8, 60) for costBase in x] yB2t = [i+44.76*12 for i in yB2] yB2a = [i/.7+44.76*12 for i in yB2] # Metlife Option 1 $33.62 # nonPremCost(1000, unitCostPrev, 1, 0, costBase, 0.7, 75) yM1 = [nonPremCost(1000, unitCostPrev, 1, 0, costBase, 0.7, 75) for costBase in x] yM1t = [i+33.62*12 for i in yM1] yM1a = [i/.7+33.62*12 for i in yM1] # Metlife Option 2 $37.5 # nonPremCost(1500, unitCostPrev, 1, 0, costBase, 0.7, 50) yM2 = [nonPremCost(1500, unitCostPrev, 1, 0, costBase, 0.7, 50) for costBase in x] yM2t = [i+37.5*12 for i in yM2] yM2a = [i/.7+37.5*12 for i in yM2] # Metlife Option 3 $42.36 # nonPremCost(2000, unitCostPrev, 1, 0, costBase, 0.8, 25) yM3 = [nonPremCost(2000, unitCostPrev, 1, 0, costBase, 0.8, 25) for costBase in x] yM3t = [i+42.36*12 for i in yM3] yM3a = [i/.7+42.36*12 for i in yM3] # Guardian Option 1 $ 37.07 # nonPremCost(1000, unitCostPrev, 1, 50, costBase, 0.7, 0) yG1 = [nonPremCost(1000, unitCostPrev, 1, 50, costBase, 0.7, 0) for costBase in x] yG1t = [i+37.07*12 for i in yG1] yG1a = [i/.7+37.07*12 for i in yG1] # Guardian Option 2 $ 25.50 # nonPremCost(500, unitCostPrev, 0.8, 50, costBase, 0.5, 0) yG2 = [nonPremCost(500, unitCostPrev, 0.8, 50, costBase, 0.5, 0) for costBase in x] yG2t = [i+25.50*12 for i in yG2] yG2a = [i/.7+25.50*12 for i in yG2] # Metlife Option 4 $37.5 # nonPremCost(1500, unitCostPrev, 1, 0, costBase, 0.8, 50) yMg = [nonPremCost(1500, unitCostPrev, 1, 0, costBase, 0.8, 50) for costBase in x] yMgt = [i+37.5*12 for i in yMg] yMga = [i/.7+37.5*12 for i in yMg] y = [i+2*unitCostPrev for i in x] plotChoice = 2 if plotChoice == 0: plt.plot(x,yB1,'b--',x,yB2,'b^',x,yM1,'r--',x,yM2,'r^',x,yM3,'r*',x,yG1,'g--', x,yG2,'g^', x, yMg, 'ro') plt.title('Extra Dental Cost when preventive cost: %s' %(unitCostPrev*2)) plt.xlabel('Estimate of basic restorative service cost') plt.ylabel('Out-of-pocket copayment (w/o annual premium)') elif plotChoice == 1: plt.plot(x,y,'k', x,yB1t,'b--',x,yB2t,'b^',x,yM1t,'r--',x,yM2t,'r^',x,yM3t,'r*',x,yG1t,'g--', x,yG2t,'g^') plt.title('Dental Cost in the bill when preventive cost: %s' %(unitCostPrev*2)) plt.xlabel('Estimate of basic restorative service cost') plt.ylabel('Cost in bill (annual premium plus out-of-pocket copayment)') elif plotChoice == 2: plt.plot(x,y,'k',x,yB1a,'b--',x,yB2a,'b^',x,yM1a,'r--',x,yM2a,'r^',x,yM3a,'r*',x,yG1a,'g--', x,yG2a,'g^', x, yMga, 'ro') plt.title('Adjusted Pre-Tax Dental Cost when preventive cost: %s' %(unitCostPrev*2)) plt.xlabel('Estimate of basic restorative service cost') plt.ylabel('Adjusted pre-tax dental cost (annual premium plus out-of-pocket copayment)') else: print('no figure generateds') plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 注意上面代码细节,导入标准库 os time 和 sys 之后,使用一个空格分开了非标准库 requests Step2: 这里为了方便引用了第一个代码块的一些函数,注意,上面的 download_one 函数其实是第一个例子的 for 循环结构体,编写并发代码经常这样重构,把依次执行的 for 循环改成函数,以便并发调用 Step3: 注意,这个示例中调用 future.result() 方法绝不会阻塞,因为 future 由 as_completed 函数产出。 Step4: 对于简单用途来说,这两个实现 Executor 接口的唯一指的注意的区别是,ThreadPoolExecutor.__init__ 方法需要 max_workers 参数,指定线程池中的线程数量,在 ProcessPoolExecutor 类中,那个参数是可选的,大多数时候不适用,默认值是 os.cpu_count() 函数返回的 CPU 数量,这样处理说得通,因为对 CPU 密集型的处理来说,不可能要求使用超过 CPU 数量的职程。二队 I/O 密集型处理来说,可以在一个 ThreadPoolExecutor 实例中使用 10 和 100 个或 1000 个线程,最佳线程数量取决于线程做的事,以及可用内存等
<ASSISTANT_TASK:> Python Code: import os import time import sys import requests POP20_CC = ('CN IN US ID BR PK NG BD RU JP ' 'MX PH VN ET EG DE IR TR CD FR').split() BASE_URL = 'http://flupy.org/data/flags' DEST_DIR = 'downloads/' def save_flag(img, filename): path = os.path.join(DEST_DIR, filename) with open(path, 'wb') as fp: fp.write(img) def get_flag(cc): url = '{}/{cc}/{cc}.gif'.format(BASE_URL, cc=cc.lower()) resp = requests.get(url) return resp.content def show(text): print(text, end=' ') # 输出末尾的换行符变成了空格 sys.stdout.flush() #Python 中正常情况下,遇到换行才会刷新 stdout 缓冲。所以这里手动刷新缓冲 def download_many(cc_list): for cc in sorted(cc_list): image = get_flag(cc) show(cc) save_flag(image, cc.lower() + '.gif') return len(cc_list) def main(download_many): t0 = time.time() count = download_many(POP20_CC) elapsed = time.time() - t0 msg = '\n{} flags downloaded in {:.2f}s' print(msg.format(count, elapsed)) main(download_many) from concurrent import futures MAX_WORKERS = 20 def download_one(cc): image = get_flag(cc) show(cc) save_flag(image, cc.lower() + '.gif') return cc def download_many(cc_list): workers = min(MAX_WORKERS, len(cc_list)) with futures.ThreadPoolExecutor(workers) as executor: # 与内置的 map 方法类似,不过 download_one 函数会在多个线程中并发调用 # map 方法返回一个生成器,因此可以迭代,获取各个函数的返回值 res = executor.map(download_one, sorted(cc_list)) return len(list(res)) main(download_many) def download_many(cc_list): cc_list = cc_list[:5] # max_workers 硬编码为 3,以便在输出中观察待完成的期物 with futures.ThreadPoolExecutor(max_workers=3) as executor: to_do = [] # 按照字母表迭代国家代码,明确表明输出的顺序与输入一致 for cc in sorted(cc_list): # submit 方法可以排定调用对象的执行时间,然后返回一个期物,表示这个待执行的操作 future = executor.submit(download_one, cc) to_do.append(future) msg = 'Scheduled for {}: {}' print(msg.format(cc, future)) results = [] for future in futures.as_completed(to_do): res = future.result() msg = '{} result: {!r}' print(msg.format(future, res)) results.append(res) return len(results) main(download_many) from concurrent import futures MAX_WORKERS = 20 def download_one(cc): image = get_flag(cc) show(cc) save_flag(image, cc.lower() + '.gif') return cc def download_many(cc_list): workers = min(MAX_WORKERS, len(cc_list)) with futures.ProcessPoolExecutor() as executor: res = executor.map(download_one, sorted(cc_list)) return len(list(res)) main(download_many) from time import sleep, strftime from concurrent import futures # 将参数打印,前面加上时间戳 def display(*args): print(strftime('[%H:%M:%S]'), end=' ') print(*args) # 开始时候显示一个消息,休眠 n 秒,休眠 n 秒,结束时候显示一个消息 # 消息使用制表符缩进,缩进量由 n 确定 def loiter(n): msg = '{}loiter({}): doing nothing for {}s...' display(msg.format('\t'*n, n, n)) sleep(n) msg = '{}loiter({}): done' display(msg.format('\t'*n, n)) return n * 10 def main(): display('Script starting') executor = futures.ThreadPoolExecutor(max_workers=3) results = executor.map(loiter, range(5)) display('results:', results) display('Waiting for individual results:') # for 循环中的 enumerate 函数会隐式调用 next(results), # 这个函数又会在(内部)表示第一个任务(loiter(0))的 _f 期物上调用_f.result() 方法。 # result 方法会阻塞,直到期物运行结束,因此这个循环每次迭代时都要等待下一个结果做好准备。 for i, result in enumerate(results): display('result {}: {}'.format(i, result)) main() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: b) Retrieve constants from astropy's constants module Step2: c) Compute $r_s$, convert to cm Step3: d) $r_s$ in units of solar radii Step4: e) $r_s$ in units of AU Step5: f) Compare $r_s$ of Sag A* to orbits of solar system planets Step6: g) How much bigger is neutron star radius than $r_s$? Step7: 6) Planets Step8: b-c) Orbital period, in years Step9: d) Light travel time in hours, given
<ASSISTANT_TASK:> Python Code: import numpy as np # This is how we'll access astropy's units module: import astropy.units as u # astropy stores fundamental physical constants like # the mass of the sun M_sun from astropy.constants import M_sun masses = u.Quantity([4.31e6*M_sun, 1*M_sun, 1.4*M_sun]) masses # Newton's gravitational constant G, # speed of light c, radius of sun R_sun from astropy.constants import c, G, R_sun # Convert the masses to units of grams using the `to` method masses.to(u.gram) r_s = 2*G*masses/c**2 print "r_s in centimeters: {0}".format(r_s.to(u.cm)) print "r_s in solar radii: {0}".format(r_s/R_sun) print "r_s in AU: {0}".format(r_s.to(u.AU)) %matplotlib inline import matplotlib.pyplot as plt planet_names = ['Mercury', 'Venus', 'Earth', 'Mars', 'Jupiter', 'Saturn', 'Uranus', 'Neptune'] semimajor_axes = u.Quantity([0.38, 0.72, 1, 1.5, 5.2, 9.5, 19.1, 30.0], unit=u.AU) print "Any planets interior to r_s?: {0}".format(any(r_s[0] > semimajor_axes)) fig, ax = plt.subplots() ax.bar(range(len(semimajor_axes)), semimajor_axes.to(u.AU).value, log=True, color='k') ax.set_xticklabels(planet_names, ha='left') ax.axhline(r_s[0].to(u.AU).value, color='r', label='$r_s$') ax.legend() ax.set_ylabel('Semimajor Axis [AU]'); radius_neutron_star = 10*u.km print("how much bigger is neutron star's radius?: {0:.2f}x bigger" .format(float(radius_neutron_star/r_s[2]))) planet_names = ['Mercury', 'Venus', 'Earth', 'Mars', 'Jupiter', 'Saturn', 'Uranus', 'Neptune', 'Pluto'] semimajor_axes = u.Quantity([0.38, 0.72, 1, 1.5, 5.2, 9.5, 19.1, 30.0, 40], unit=u.AU) semimajor_axes.to(u.cm) T = (4 * np.pi**2 * semimajor_axes**3 / (G*M_sun))**0.5 T.to(u.year) (semimajor_axes/c).to(u.hour) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Define a function that runs the Diffusion model through its BMI for a fixed number of time steps. Store the temperture field from each time step in a list. Return the list. Step2: Run the model for awhile. Step3: Define a function to visualize the temperature field at a time step (defined by an index into the list of temperature fields). Step4: Make an interactive plot of temperature over time. Step5: Update the model interactively Step6: We're going to use this a little later to interactively run and plot our model. Step7: Instantiate the heat model and initialize it. Step8: Set the initial temperature. Step9: Run the model interactively over time. Note that as you move the slider, the model runs to the updated time.
<ASSISTANT_TASK:> Python Code: %matplotlib auto import matplotlib.pyplot as plt from ipywidgets import interact from bmi_live.bmi_diffusion import BmiDiffusion def run_model(n_steps=10): model = BmiDiffusion() model.initialize('../data/diffusion.yaml') grid_shape = model.get_grid_shape(0) initial_temp = model.get_value('plate_surface__temperature') initial_temp[20] = 100. model.set_value('plate_surface__temperature', initial_temp) temp = [initial_temp.reshape(grid_shape)] for _ in range(n_steps): model.update() new_temp = model.get_value('plate_surface__temperature') temp.append(new_temp.reshape(grid_shape)) model.finalize() return temp temperature = run_model(50) xmin, xmax = 0., temperature[0].shape[1] ymin, ymax = 0., temperature[0].shape[0] im = plt.imshow(temperature[0], vmax=100, extent=[xmin, xmax, ymin, ymax], origin='upper', cmap='gist_stern') plt.title('Plate Temperature') plt.colorbar().ax.set_ylabel('Temperature (K)') def plot_temperature(time_index=0): im.set_data(temperature[time_index]) interact(plot_temperature, time_index=(0, 50, 1)) def plot_temperature(temperature): plt.clf() xmin, xmax = 0., temperature.shape[1] ymin, ymax = 0., temperature.shape[0] plt.imshow(temperature, vmin=0., vmax=10., extent=[xmin, xmax, ymin, ymax], origin='upper', cmap='Reds') plt.title('Plate Temperature') # plt.colorbar().ax.set_ylabel('Temperature (K)') class HeatRunner(object): def __init__(self, heat): self._heat = heat self._cache = [] def run_and_plot(self, time_index): for _ in range(len(self._cache), time_index): self._heat.update() self._cache.append( heat.get_value('plate_surface__temperature').reshape(self._heat.get_grid_shape(0))) plot_temperature(self._cache[time_index - 1]) heat = BmiDiffusion() heat.initialize('../data/diffusion.yaml') init_temperature = heat.get_value('plate_surface__temperature') init_temperature.shape = heat.get_grid_shape(0) init_temperature[2, 2] = 100. heat.set_value('plate_surface__temperature', init_temperature) runner = HeatRunner(heat) interact(runner.run_and_plot, time_index=(0, 100, 1)) current_temperature = heat.get_value('plate_surface__temperature') current_temperature.shape = heat.get_grid_shape(0) current_temperature[5, 7] = 100. heat.set_value('plate_surface__temperature', current_temperature) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: CONTENTS Step2: The Agent Program can be obtained by creating the instance of the class by passing the appropriate parameters. Because of the call method the object that is created behaves like a callable and returns an appropriate action as most Agent Programs do. To instantiate the object we need a policy(pi) and a mdp whose utility of states will be estimated. Let us import a GridMDP object from the mdp module. Figure 17.1 (sequential_decision_environment) is similar to Figure 21.1 but has some discounting as gamma = 0.9. Step3: Figure 17.1 (sequential_decision_environment) is a GridMDP object and is similar to the grid shown in Figure 21.1. The rewards in the terminal states are +1 and -1 and -0.04 in rest of the states. <img src="files/images/mdp.png"> Now we define a policy similar to Fig 21.1 in the book. Step4: Let us create our object now. We also use the same alpha as given in the footnote of the book on page 837. Step5: The rl module also has a simple implementation to simulate iterations. The function is called run_single_trial. Now we can try our implementation. We can also compare the utility estimates learned by our agent to those obtained via value iteration. Step6: The values calculated by value iteration Step7: Now the values estimated by our agent after 200 trials. Step8: We can also explore how these estimates vary with time by using plots similar to Fig 21.5a. To do so we define a function to help us with the same. We will first enable matplotlib using the inline backend. Step9: Here is a plot of state (2,2). Step10: It is also possible to plot multiple states on the same plot. Step11: ACTIVE REINFORCEMENT LEARNING Step12: The Agent Program can be obtained by creating the instance of the class by passing the appropriate parameters. Because of the call method the object that is created behaves like a callable and returns an appropriate action as most Agent Programs do. To instantiate the object we need a mdp similar to the PassiveTDAgent. Step13: Now to try out the q_agent we make use of the run_single_trial function in rl.py (which was also used above). Let us use 200 iterations. Step14: Now let us see the Q Values. The keys are state-action pairs. Where differnt actions correspond according to Step15: The Utility U of each state is related to Q by the following equation. Step16: Let us finally compare these estimates to value_iteration results.
<ASSISTANT_TASK:> Python Code: from rl import * %psource PassiveTDAgent from mdp import sequential_decision_environment # Action Directions north = (0, 1) south = (0,-1) west = (-1, 0) east = (1, 0) policy = { (0, 2): east, (1, 2): east, (2, 2): east, (3, 2): None, (0, 1): north, (2, 1): north, (3, 1): None, (0, 0): north, (1, 0): west, (2, 0): west, (3, 0): west, } our_agent = PassiveTDAgent(policy, sequential_decision_environment, alpha=lambda n: 60./(59+n)) from mdp import value_iteration print(value_iteration(sequential_decision_environment)) for i in range(200): run_single_trial(our_agent,sequential_decision_environment) print(our_agent.U) %matplotlib inline import matplotlib.pyplot as plt def graph_utility_estimates(agent_program, mdp, no_of_iterations, states_to_graph): graphs = {state:[] for state in states_to_graph} for iteration in range(1,no_of_iterations+1): run_single_trial(agent_program, mdp) for state in states_to_graph: graphs[state].append((iteration, agent_program.U[state])) for state, value in graphs.items(): state_x, state_y = zip(*value) plt.plot(state_x, state_y, label=str(state)) plt.ylim([0,1.2]) plt.legend(loc='lower right') plt.xlabel('Iterations') plt.ylabel('U') agent = PassiveTDAgent(policy, sequential_decision_environment, alpha=lambda n: 60./(59+n)) graph_utility_estimates(agent, sequential_decision_environment, 500, [(2,2)]) graph_utility_estimates(agent, sequential_decision_environment, 500, [(2,2), (3,2)]) %psource QLearningAgent q_agent = QLearningAgent(sequential_decision_environment, Ne=5, Rplus=2, alpha=lambda n: 60./(59+n)) for i in range(200): run_single_trial(q_agent,sequential_decision_environment) q_agent.Q U = defaultdict(lambda: -1000.) # Very Large Negative Value for Comparison see below. for state_action, value in q_agent.Q.items(): state, action = state_action if U[state] < value: U[state] = value U print(value_iteration(sequential_decision_environment)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We know that the variables relate as follows Step2: Parameter learning is the task to estimate the values of the conditional probability distributions (CPDs), for the variables fruit, size, and tasty. Step3: We can see, for example, that as many apples as bananas were observed and that 5 large bananas were tasty, while only 1 was not. Step4: mle.estimate_cpd(variable) computes the state counts and divides each cell by the (conditional) sample size. The mle.get_parameters()-method returns a list of CPDs for all variable of the model. Step5: While very straightforward, the ML estimator has the problem of overfitting to the data. In above CPD, the probability of a large banana being tasty is estimated at 0.833, because 5 out of 6 observed large bananas were tasty. Fine. But note that the probability of a small banana being tasty is estimated at 0.0, because we observed only one small banana and it happened to be not tasty. But that should hardly make us certain that small bananas aren't tasty! Step6: The estimated values in the CPDs are now more conservative. In particular, the estimate for a small banana being not tasty is now around 0.64 rather than 1.0. Setting equivalent_sample_size to 10 means that for each parent configuration, we add the equivalent of 10 uniform samples (here Step7: Structure Learning Step8: While the scores vary slightly, we can see that the correct model1 has a much higher score than model2. Step9: Search strategies Step10: Once more nodes are involved, one needs to switch to heuristic search. HillClimbSearch implements a greedy local search that starts from the DAG start (default Step11: The search correctly identifies e.g. that B and C do not influnce H directly, only through A and of course that D, E, F are independent. Step12: The CITests.py module in pgmpy implements a few possible conditional independence tests. Step13: The estimate()-method provides a shorthand for the three steps above and directly returns a BayesianModel Step14: PC PDAG construction is only guaranteed to work under the assumption that the identified set of independencies is faithful, i.e. there exists a DAG that exactly corresponds to it. Spurious dependencies in the data set can cause the reported independencies to violate faithfulness. It can happen that the estimated PDAG does not have any faithful completions (i.e. edge orientations that do not introduce new v-structures). In that case a warning is issued.
<ASSISTANT_TASK:> Python Code: import pandas as pd data = pd.DataFrame(data={'fruit': ["banana", "apple", "banana", "apple", "banana","apple", "banana", "apple", "apple", "apple", "banana", "banana", "apple", "banana",], 'tasty': ["yes", "no", "yes", "yes", "yes", "yes", "yes", "yes", "yes", "yes", "yes", "no", "no", "no"], 'size': ["large", "large", "large", "small", "large", "large", "large", "small", "large", "large", "large", "large", "small", "small"]}) print(data) from pgmpy.models import BayesianModel model = BayesianModel([('fruit', 'tasty'), ('size', 'tasty')]) # fruit -> tasty <- size from pgmpy.estimators import ParameterEstimator pe = ParameterEstimator(model, data) print("\n", pe.state_counts('fruit')) # unconditional print("\n", pe.state_counts('tasty')) # conditional on fruit and size from pgmpy.estimators import MaximumLikelihoodEstimator mle = MaximumLikelihoodEstimator(model, data) print(mle.estimate_cpd('fruit')) # unconditional print(mle.estimate_cpd('tasty')) # conditional # Calibrate all CPDs of `model` using MLE: model.fit(data, estimator=MaximumLikelihoodEstimator) from pgmpy.estimators import BayesianEstimator est = BayesianEstimator(model, data) print(est.estimate_cpd('tasty', prior_type='BDeu', equivalent_sample_size=10)) import numpy as np import pandas as pd from pgmpy.models import BayesianModel from pgmpy.estimators import BayesianEstimator # generate data data = pd.DataFrame(np.random.randint(low=0, high=2, size=(5000, 4)), columns=['A', 'B', 'C', 'D']) model = BayesianModel([('A', 'B'), ('A', 'C'), ('D', 'C'), ('B', 'D')]) model.fit(data, estimator=BayesianEstimator, prior_type="BDeu") # default equivalent_sample_size=5 for cpd in model.get_cpds(): print(cpd) import pandas as pd import numpy as np from pgmpy.estimators import BDeuScore, K2Score, BicScore from pgmpy.models import BayesianModel # create random data sample with 3 variables, where Z is dependent on X, Y: data = pd.DataFrame(np.random.randint(0, 4, size=(5000, 2)), columns=list('XY')) data['Z'] = data['X'] + data['Y'] bdeu = BDeuScore(data, equivalent_sample_size=5) k2 = K2Score(data) bic = BicScore(data) model1 = BayesianModel([('X', 'Z'), ('Y', 'Z')]) # X -> Z <- Y model2 = BayesianModel([('X', 'Z'), ('X', 'Y')]) # Y <- X -> Z print(bdeu.score(model1)) print(k2.score(model1)) print(bic.score(model1)) print(bdeu.score(model2)) print(k2.score(model2)) print(bic.score(model2)) print(bdeu.local_score('Z', parents=[])) print(bdeu.local_score('Z', parents=['X'])) print(bdeu.local_score('Z', parents=['X', 'Y'])) from pgmpy.estimators import ExhaustiveSearch es = ExhaustiveSearch(data, scoring_method=bic) best_model = es.estimate() print(best_model.edges()) print("\nAll DAGs by score:") for score, dag in reversed(es.all_scores()): print(score, dag.edges()) from pgmpy.estimators import HillClimbSearch # create some data with dependencies data = pd.DataFrame(np.random.randint(0, 3, size=(2500, 8)), columns=list('ABCDEFGH')) data['A'] += data['B'] + data['C'] data['H'] = data['G'] - data['A'] hc = HillClimbSearch(data) best_model = hc.estimate(scoring_method=BicScore(data)) print(best_model.edges()) from pgmpy.estimators import PC from pgmpy.estimators.CITests import chi_square data = pd.DataFrame(np.random.randint(0, 3, size=(2500, 8)), columns=list('ABCDEFGH')) data['A'] += data['B'] + data['C'] data['H'] = data['G'] - data['A'] data['E'] *= data['F'] print(chi_square(X='B', Y='H', Z=[], data=data, significance_level=0.05)) # dependent print(chi_square(X='B', Y='E', Z=[], data=data, significance_level=0.05)) # independent print(chi_square(X='B', Y='H', Z=['A'], data=data, significance_level=0.05)) # independent print(chi_square(X='A', Y='G', Z=[], data=data, significance_level=0.05)) # independent print(chi_square(X='A', Y='G', Z=['H'], data=data, significance_level=0.05)) # dependent est = PC(data) skel, seperating_sets = est.build_skeleton(significance_level=0.01) print("Undirected edges: ", skel.edges()) pdag = est.skeleton_to_pdag(skel, seperating_sets) print("PDAG edges: ", pdag.edges()) model = pdag.to_dag() print("DAG edges: ", model.edges()) print(est.estimate(significance_level=0.01).edges()) from pgmpy.estimators import MmhcEstimator from pgmpy.estimators import BDeuScore data = pd.DataFrame(np.random.randint(0, 3, size=(2500, 8)), columns=list('ABCDEFGH')) data['A'] += data['B'] + data['C'] data['H'] = data['G'] - data['A'] data['E'] *= data['F'] mmhc = MmhcEstimator(data) skeleton = mmhc.mmpc() print("Part 1) Skeleton: ", skeleton.edges()) # use hill climb search to orient the edges: hc = HillClimbSearch(data) model = hc.estimate(tabu_length=10, white_list=skeleton.to_directed().edges(), scoring_method=BDeuScore(data)) print("Part 2) Model: ", model.edges()) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Request parameters Step2: Exercise Step3: Implement get_echo Step4: Now run the spec in a terminal using
<ASSISTANT_TASK:> Python Code: # Use this cell to test the output !curl http://localhost:5000/datetime/v1/echo -vk # Here's the `limit` parameter definition, including # - it's a `query` parameter # - its name # - its schema print(show_component('https://teamdigitale.github.io/openapi/0.0.5/definitions.yaml#/parameters/limit')) # Use this cell to test your api # hint: get the timezone from !pip install pytz import pytz tz = pytz.timezone('Europe/Rome') print(tz.zone) # No timezones in Neverland :) 'Neverland' in pytz.all_timezones ### Exercise solution def get_echo(tz='UTC'): if tz not in pytz.all_timezones: return problem( status=400, title="Bad Timezone", detail="The specified timezone is not valid", ext={"valid_timezones": pytz.all_timezones} ) d = datetime.now(tz=pytz.timezone(tz)) return {"timestamp": d.isoformat().replace('+00:00', 'Z')} render_markdown(f''' play a bit with the [Swagger UI]({api_server_url('ui')}) and try making a request! ''') ## TODO do we have enough time to show flask_testing? # Check that default works !curl http://localhost:5000/datetime/v1/echo -kv # Test a valid timezone !curl http://localhost:5000/datetime/v1/echo?tz=Europe/Rome -kv # Test an invalid timezone !curl http://localhost:5000/datetime/v1/echo?tz=Frittole -kv <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2. Create a Predictive Service (One time) <a id='create'></a> Step2: Load an already created service Step3: Query the model <a id='query'></a> Step4: Query via REST
<ASSISTANT_TASK:> Python Code: reference_sf = graphlab.SFrame('data/sf_processed.sframe/') pretrained_model = graphlab.load_model('data/imagenet_model') nn_model = graphlab.load_model('data/nearest_dress_model') reference_sf def dress_similar(url): img = graphlab.Image(url) image_sf = graphlab.SFrame() image_sf['image'] = [img] image_sf['features'] = pretrained_model.extract_features(image_sf) ans = nn_model.query(image_sf, k=5) return ans QUERY_URL = 'http://static.ddmcdn.com/gif/blue-dress.jpg' Image(QUERY_URL) def retrieve_image(nearest_neighbors_output, input_sframe): joined = input_sframe.join(nearest_neighbors_output, on={'_id':'reference_label'}) sorted_sf = joined.sort('rank') return sorted_sf['image'] images = retrieve_image(dress_similar(QUERY_URL), reference_sf) images.show() import graphlab as gl # Replace with your path. ps_state_path = 's3://<your-bucket-name>/predictive_service/ps' # Set your AWS credentials. gl.aws.set_credentials(<key>, <secret>) # Create an EC2 config ec2_config = gl.deploy.Ec2Config() # Launch a predictive service ps = gl.deploy.predictive_service.create(name = 'sklearn-predictive-service', ec2_config = ec2_config, state_path = ps_state_path, num_hosts = 1) import graphlab as gl ps = gl.deploy.predictive_service.load('s3://gl-demo-usw2/predictive_service/demolab/ps-1.6') ps #ps.add('dress_similar', dress_similar) ps.update('dress_similar', dress_similar) ps.apply_changes() ps.query('dress_similar', url=QUERY_URL) import json import requests def restful_query(url): # Query the service. headers = {'content-type': 'application/json' } payload = {'api_key':'b437e588-0f2b-45e1-81c8-ce3acfa81ade', 'data':{'url':url}} end_point = 'http://demolab-one-six-2015364754.us-west-2.elb.amazonaws.com/query/dress_similar' resp = requests.post(end_point,json.dumps(payload), headers=headers) # Join with existing data. ans = gl.SArray(json.loads(resp.content)['response']).unpack('') return retrieve_image(ans, reference_sf) restful_query('http://static.ddmcdn.com/gif/blue-dress.jpg').show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 基底関数 Step2: 例題 Step3: ${\bf w}$ のベイズ推定
<ASSISTANT_TASK:> Python Code: %matplotlib inline import matplotlib.pyplot as plt import numpy as np def basisNone(x, dmy1=None, dmy2=None, dmy3=None): return x def basisPoly(x, j, dmy1=None, dmy2=None): return x ** j def basisGauss(x, j, mu, s): return np.exp(- (x-mu[j]) ** 2 / (2 * s ** 2)) def basisSigmoid(x, j, mu, s): return 1.0 / (1 + np.exp(-(x - mu[j])/s)) basis = { "Linear": basisNone, "Polynomial": basisPoly, "Gauss": basisGauss, "Sigmoid": basisSigmoid, } x = np.linspace(-1, 1, 100) mu = np.linspace(-1, 1, 10) plt.figure(figsize=(16, 3)) for ikey, key in enumerate(basis): plt.subplot(1, 4, ikey + 1) plt.title(key + " Kernel") for j in range(len(mu)): plt.plot(x, [basis[key](tmpx, j, mu, 0.1) for tmpx in x]) def y(x, w, basisName, mu=None, s=None): ret = w[0] for index in range(1, len(w)): ret += w[index] * basis[basisName](x, index, mu, s) return ret N = 30 # サンプル数 M = 5 # モデル次元 b = 2. # ノイズの精度 x_opt = np.linspace(-5, 5, N) y_opt = 2 * np.sin(x_opt) + 3 y_obs = (y_opt + np.random.normal(0, 1.0/b, len(x_opt)))[:, np.newaxis] plt.plot(x_opt, y_obs, "k.", label="Observation") plt.plot(x_opt, y_opt, "r-", linewidth=3, label="Truth") plt.xlim(-5, 5) plt.legend() # 計画行列を求める def makeDesignMatrix(x, basis, mu, s): ret = np.zeros((len(x), len(mu))) for i in range(len(x)): for j in range(len(mu)): ret[i][ j] = basis(x[i], j, mu, s) return ret, ret.transpose() M, key = 15, "Sigmoid" alphas = [] betas = [] plt.figure(figsize=(16,8)) for index, size in enumerate(np.linspace(3, len(x_opt)-1, 10)): # extract data size = int(size) indices = sorted(np.random.choice(range(len(x_opt)), size, False)) x_opt_tmp = x_opt[indices] y_opt_tmp = y_opt[indices] y_obs_tmp = y_obs[indices] # generate Phi mu = np.linspace(min(x_opt_tmp), max(x_opt_tmp), M) s = 1.0 phi, phit = makeDesignMatrix(x_opt_tmp, basis[key], mu, s) phit = phi.transpose() # eigenvalues of Phi eigs = np.linalg.eigvalsh(beta * phit.dot(phi)) # estimate values including alpha, beta alpha, beta = 0.0001, 0.1 for i in range(10): sN = np.linalg.inv((alpha) * np.eye(M) + beta * phit.dot(phi)) mN = beta * sN.dot(phit).dot(y_obs_tmp) mNt = mN.transpose() gamma = sum([eig / (alpha + eig) for eig in eigs]) beta = 1 / (1/(size - gamma) * sum([(y_obs_tmp[i] - mNt.dot(phi[i, :]))**2 for i in range(size)])) alpha = gamma / (mNt.dot(mN)) beta = np.clip(float(beta), 0, 10) alpha = np.clip(float(alpha), 0, 10) alphas.append(alpha) betas.append(beta) # Plot estimations and sigmas from estimated values # alpha, beta, mN, SN phi, phit = makeDesignMatrix(x_opt, basis[key], mu, s) y_out = np.array([np.dot(mN.transpose(), phi[i, :]) for i in range(N)]) sigma = np.sqrt(np.array([1.0 / beta + phi[i, :].transpose().dot(sN).dot(phi[i, :]) for i in range(N)])) # Plot estimations plt.subplot(2, 5, index+1) plt.plot(x_opt, y_opt, "k:") plt.plot(x_opt_tmp, y_opt_tmp, "ko") plt.plot(x_opt, y_out, "r-") plt.fill_between(x_opt, y_out[:, 0] - sigma, y_out[:, 0] + sigma, facecolor="k", alpha=0.4) plt.ylim([0, 6]) # Plot aplhas and betas plt.figure(figsize=(16, 3)) plt.subplot(1, 2, 1) plt.plot(alphas, "k-"); plt.title("alpha") plt.subplot(1, 2, 2) plt.plot(betas, "k-"); plt.title("beta") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load house sales data Step2: Split data into training and testing Step3: Useful SFrame summary functions Step4: As we see we get the same answer both ways Step5: Aside Step6: We can test that our function works by passing it something where we know the answer. In particular we can generate a feature and then put the output exactly on a line Step7: Now that we know it works let's build a regression model for predicting price based on sqft_living. Rembember that we train on train_data! Step8: Predicting Values Step9: Now that we can calculate a prediction given the slope and intercept let's make a prediction. Use (or alter) the following to find out the estimated price for a house with 2650 squarefeet according to the squarefeet model we estiamted above. Step10: Residual Sum of Squares Step11: Let's test our get_residual_sum_of_squares function by applying it to the test model where the data lie exactly on a line. Since they lie exactly on a line the residual sum of squares should be zero! Step12: Now use your function to calculate the RSS on training data from the squarefeet model calculated above. Step13: Predict the squarefeet given price Step14: Now that we have a function to compute the squarefeet given the price from our simple regression model let's see how big we might expect a house that costs $800,000 to be. Step15: New Model Step16: Test your Linear Regression Algorithm
<ASSISTANT_TASK:> Python Code: import graphlab sales = graphlab.SFrame('kc_house_data.gl/') train_data,test_data = sales.random_split(.8,seed=0) # Let's compute the mean of the House Prices in King County in 2 different ways. prices = sales['price'] # extract the price column of the sales SFrame -- this is now an SArray # recall that the arithmetic average (the mean) is the sum of the prices divided by the total number of houses: sum_prices = prices.sum() num_houses = prices.size() # when prices is an SArray .size() returns its length avg_price_1 = sum_prices/num_houses avg_price_2 = prices.mean() # if you just want the average, the .mean() function print "average price via method 1: " + str(avg_price_1) print "average price via method 2: " + str(avg_price_2) # if we want to multiply every price by 0.5 it's a simple as: half_prices = 0.5*prices # Let's compute the sum of squares of price. We can multiply two SArrays of the same length elementwise also with * prices_squared = prices*prices sum_prices_squared = prices_squared.sum() # price_squared is an SArray of the squares and we want to add them up. print "the sum of price squared is: " + str(sum_prices_squared) def simple_linear_regression(input_feature, output): N = len(input_feature) # compute the sum of input_feature and output sum_input = input_feature.sum() sum_output = output.sum() # compute the product of the output and the input_feature and its sum product = input_feature * output product_sum = product.sum() # compute the squared value of the input_feature and its sum input_square = input_feature * input_feature sum_input_square = input_square.sum() # use the formula for the slope slope = (product_sum - (sum_output * sum_input) * 1.0/N) / (sum_input_square - sum_input*sum_input*1.0/N) # use the formula for the intercept intercept = (sum_output - slope * sum_input) / N return (intercept, slope) test_feature = graphlab.SArray(range(5)) test_output = graphlab.SArray(1 + 1*test_feature) (test_intercept, test_slope) = simple_linear_regression(test_feature, test_output) print "Intercept: " + str(test_intercept) print "Slope: " + str(test_slope) sqft_intercept, sqft_slope = simple_linear_regression(train_data['sqft_living'], train_data['price']) print "Intercept: " + str(sqft_intercept) print "Slope: " + str(sqft_slope) def get_regression_predictions(input_feature, intercept, slope): # calculate the predicted values: predicted_values = input_feature * slope + intercept return predicted_values my_house_sqft = 2650 estimated_price = get_regression_predictions(my_house_sqft, sqft_intercept, sqft_slope) print "The estimated price for a house with %d squarefeet is $%.2f" % (my_house_sqft, estimated_price) def get_residual_sum_of_squares(input_feature, output, intercept, slope): # First get the predictions predictions = get_regression_predictions(input_feature, intercept, slope) # then compute the residuals (since we are squaring it doesn't matter which order you subtract) residuals = output - predictions # square the residuals and add them up RSS = (residuals * residuals).sum() return(RSS) print get_residual_sum_of_squares(test_feature, test_output, test_intercept, test_slope) # should be 0.0 rss_prices_on_sqft = get_residual_sum_of_squares(train_data['sqft_living'], train_data['price'], sqft_intercept, sqft_slope) print 'The RSS of predicting Prices based on Square Feet is : ' + str(rss_prices_on_sqft) def inverse_regression_predictions(output, intercept, slope): # solve output = intercept + slope*input_feature for input_feature. Use this equation to compute the inverse predictions: estimated_feature = (output - intercept) * 1.0 / slope return estimated_feature my_house_price = 800000 estimated_squarefeet = inverse_regression_predictions(my_house_price, sqft_intercept, sqft_slope) print "The estimated squarefeet for a house worth $%.2f is %d" % (my_house_price, estimated_squarefeet) # Estimate the slope and intercept for predicting 'price' based on 'bedrooms' br_intercept, br_slope = simple_linear_regression(train_data['bedrooms'], train_data['price']) # Compute RSS when using bedrooms on TEST data: get_residual_sum_of_squares(test_data['bedrooms'], test_data['price'], br_intercept, br_slope) # Compute RSS when using squarefeet on TEST data: get_residual_sum_of_squares(test_data['sqft_living'], test_data['price'], sqft_intercept, sqft_slope) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Please ignore any incompatibility warnings and errors. Step2: Change the following cell as necessary Step3: Create BigQuery tables Step4: Let's create a table with 1 million examples. Step5: Make the validation dataset be 1/10 the size of the training dataset. Step6: Export the tables as CSV files
<ASSISTANT_TASK:> Python Code: !sudo chown -R jupyter:jupyter /home/jupyter/training-data-analyst %pip install google-cloud-bigquery==1.25.0 # Importing necessary tensorflow library and printing the TF version. import tensorflow as tf print("Tensorflow version: ",tf.__version__) import os from google.cloud import bigquery # Change with your own bucket and project below: BUCKET = "<BUCKET>" PROJECT = "<PROJECT>" OUTDIR = "gs://{bucket}/taxifare/data".format(bucket=BUCKET) os.environ['BUCKET'] = BUCKET os.environ['OUTDIR'] = OUTDIR os.environ['PROJECT'] = PROJECT bq = bigquery.Client(project = PROJECT) dataset = bigquery.Dataset(bq.dataset("taxifare")) try: bq.create_dataset(dataset) print("Dataset created") except: print("Dataset already exists") %%bigquery CREATE OR REPLACE TABLE taxifare.feateng_training_data AS SELECT (tolls_amount + fare_amount) AS fare_amount, pickup_datetime, pickup_longitude AS pickuplon, pickup_latitude AS pickuplat, dropoff_longitude AS dropofflon, dropoff_latitude AS dropofflat, passenger_count*1.0 AS passengers, 'unused' AS key FROM `nyc-tlc.yellow.trips` WHERE ABS(MOD(FARM_FINGERPRINT(CAST(pickup_datetime AS STRING)), 1000)) = 1 AND trip_distance > 0 AND fare_amount >= 2.5 AND pickup_longitude > -78 AND pickup_longitude < -70 AND dropoff_longitude > -78 AND dropoff_longitude < -70 AND pickup_latitude > 37 AND pickup_latitude < 45 AND dropoff_latitude > 37 AND dropoff_latitude < 45 AND passenger_count > 0 %%bigquery CREATE OR REPLACE TABLE taxifare.feateng_valid_data AS SELECT (tolls_amount + fare_amount) AS fare_amount, pickup_datetime, pickup_longitude AS pickuplon, pickup_latitude AS pickuplat, dropoff_longitude AS dropofflon, dropoff_latitude AS dropofflat, passenger_count*1.0 AS passengers, 'unused' AS key FROM `nyc-tlc.yellow.trips` WHERE ABS(MOD(FARM_FINGERPRINT(CAST(pickup_datetime AS STRING)), 10000)) = 2 AND trip_distance > 0 AND fare_amount >= 2.5 AND pickup_longitude > -78 AND pickup_longitude < -70 AND dropoff_longitude > -78 AND dropoff_longitude < -70 AND pickup_latitude > 37 AND pickup_latitude < 45 AND dropoff_latitude > 37 AND dropoff_latitude < 45 AND passenger_count > 0 %%bash echo "Deleting current contents of $OUTDIR" gsutil -m -q rm -rf $OUTDIR echo "Extracting training data to $OUTDIR" bq --location=US extract \ --destination_format CSV \ --field_delimiter "," --noprint_header \ taxifare.feateng_training_data \ $OUTDIR/taxi-train-*.csv echo "Extracting validation data to $OUTDIR" bq --location=US extract \ --destination_format CSV \ --field_delimiter "," --noprint_header \ taxifare.feateng_valid_data \ $OUTDIR/taxi-valid-*.csv gsutil ls -l $OUTDIR !gsutil cat gs://$BUCKET/taxifare/data/taxi-train-000000000000.csv | head -2 <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Organize and manage datasets Step2: Write the datasets into the SQLite file Step3: List and view all the datasets in the database file Step4: View a dataset fields or columns Step5: Load a dataset into a dataframe directly from the database file Step6: Drop any dataset from the database file
<ASSISTANT_TASK:> Python Code: # Create a SQLite database # log in to your terminal, change to the folder where you want to keep the database file. # type the following code and change xxxx to a name you want to give the database. Mine is called datarepo: sqlite3 xxxx.db .databases # press control D to exit the database. # Import relevant modules import os import sys from sqlalchemy import create_engine import pandas as pd import datetime as dt # Connect to the database conn = create_engine('sqlite:///datarepo.db') # Define full path to the directory containing all the datasets to be written datapath = '/Users/xxxx/xxxx/dataset' # a list to hold information datfile = [] file_in_database = [] new_datfile = [] # store the existing txt and csv datasets in a list datfile if os.path.isdir(datapath): for i in os.listdir(datapath): ipath = os.path.join(datapath, i) if os.path.isfile(ipath): if os.path.splitext(ipath)[1] == '.txt' or os.path.splitext( ipath)[1] == '.csv' or os.path.splitext( ipath)[1] == '.xlsx' or os.path.splitext( ipath)[1] == '.xls': datfile.append(ipath) # read the existing files in the database and store the information in a list file_in_database sql = "select tbl_name from sqlite_master where type='table'" res = pd.read_sql(sql, conn) for i in [j for k in res.values.tolist() for j in k]: file_in_database.append(os.path.join(datapath, i)) # get the list of new datasets that have not been written to the database for file in datfile: if file not in file_in_database: new_datfile.append(file) # check whether list of new datasets is empty if len(new_datfile) == 0: print( "The datasets in the source folder have all already been written to the database." ) sys.exit # otherwise, write the new datasets to the database else: for file in new_datfile: #write excel dataset if file.split(".")[-1] == 'xlsx' or file.split(".")[-1] == 'xls': tab_name = file.split("/")[ -1] # strip the path and get the file name only start = dt.datetime.now() df = pd.read_excel(file) df.to_sql(tab_name, conn, if_exists='append') print('{} seconds: writing of {} to the database is completed.'. format((dt.datetime.now() - start).seconds, tab_name)) #write csv or txt dataset if file.split(".")[-1] == 'csv' or file.split(".")[-1] == 'txt': tab_name = file.split("/")[ -1] # strip the path and get the file name only start = dt.datetime.now() chunksize = 1000 # you can increase the chunksize counter = 0 index_start = 1 for df in pd.read_table( # confirm the delimiter type (comma or tab) in your csv/txt file and change sep value accordingly file, chunksize=chunksize, iterator=True, sep=",", encoding='utf-8'): df.index += index_start counter += 1 print('{} seconds: completed {} rows'.format(( dt.datetime.now() - start).seconds, counter * chunksize)) df.to_sql(tab_name, conn, if_exists='append') index_start = df.index[-1] + 1 from sqlalchemy import create_engine import pandas as pd # Connect to the database conn = create_engine('sqlite:///datarepo.db') # Get the list of current datasets in the database def list_dataset(): try: sql = "select tbl_name from sqlite_master where type='table'" return pd.read_sql(sql, conn) except Exception as err: print(err) #list_dataset() from sqlalchemy import create_engine import pandas as pd # Connect to the database conn = create_engine('sqlite:///datarepo.db') # View a dataset columns or fields def view_dataset_cols(table_name): try: h = "'" + table_name + "'" sql = ( "select sql from sqlite_master where type ='table' and tbl_name = %s" % h) x = pd.read_sql(sql, conn) j = str(x.values.tolist()) k = j[:len(j) - 6] return k.split("\\n\\t")[1:] except Exception as err: print(err) #view_dataset_cols('winequality-red.csv') from sqlalchemy import create_engine import pandas as pd # Connect to the database conn = create_engine('sqlite:///datarepo.db') # Load a dataset into a dataframe def load_dataset(table_name): try: tabname = "'" + table_name + "'" sql = " SELECT * FROM %s" % tabname return pd.read_sql(sql, conn) except Exception as err: print(err) # You can amend the SQL code to select only the needed fields from a dataset. #j = load_dataset('housing.csv') #j.head() from sqlalchemy import create_engine import pandas as pd # Connect to the database conn = create_engine('sqlite:///datarepo.db') # Drop a dataset def drop_dataset(table_name): try: tabname = "'" + table_name + "'" sql = "DROP TABLE %s" % tabname print('The dataset: ' + tabname + ' has been dropped from the database.') pd.read_sql(sql, conn) except Exception as err: pass #drop_dataset('test.csv') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Introduction Step2: Shape signature for comparison Step3: In order to get a representative correct signature, mean signature per-resolution was generated using 20 correct signatures. The mean was calculated in each point. Step4: Signature configuration Step5: The RMSE over the 10 correct segmentations was compared with RMSE over the 10 erroneous segmentations. As expected, RMSE for correct segmentations was greater than RMSE for erroneous segmentations along all the resolutions. In general, this is true, but optimal resolution guarantee the maximum difference between both of RMSE results Step6: The greatest difference resulted at resolution 0.09. In this resolution, threshold for separate erroneous and correct segmentations is established as 30% of the distance between the mean RMSE of the correct masks and the mean RMSE of the erroneous masks.
<ASSISTANT_TASK:> Python Code: ## Functions import sys sys.path.append("../dev") import bib_mri as FW import numpy as np import scipy as scipy import scipy.misc as misc import matplotlib as mpl import matplotlib.pyplot as plt from numpy import genfromtxt import platform %matplotlib inline def sign_extract(seg, resols): #Function for shape signature extraction splines = FW.get_spline(seg,smoothness) sign_vect = np.array([]).reshape(0,points) #Initializing temporal signature vector for resol in resols: sign_vect = np.vstack((sign_vect, FW.get_profile(splines, n_samples=points, radius=resol))) return sign_vect def sign_fit(sig_ref, sig_fit): #Function for signature fitting dif_curv = [] for shift in range(points): dif_curv.append(np.abs(np.sum((sig_ref - np.roll(sig_fit[0],shift))**2))) return np.apply_along_axis(np.roll, 1, sig_fit, np.argmin(dif_curv)) print "Python version: ", platform.python_version() print "Numpy version: ", np.version.version print "Scipy version: ", scipy.__version__ print "Matplotlib version: ", mpl.__version__ #Loading labeled segmentations seg_label = genfromtxt('../dataset/Seg_Watershed/watershed_label.csv', delimiter=',').astype('uint8') list_mask = seg_label[seg_label[:,1] == 0, 0][:20] #Extracting correct segmentations for mean signature list_normal_mask = seg_label[seg_label[:,1] == 0, 0][20:30] #Extracting correct names for configuration list_error_mask = seg_label[seg_label[:,1] == 1, 0][:10] #Extracting correct names for configuration mask_correct = np.load('../dataset/Seg_Watershed/mask_wate_{}.npy'.format(list_mask[0])) mask_error = np.load('../dataset/Seg_Watershed/mask_wate_{}.npy'.format(list_error_mask[0])) plt.figure() plt.axis('off') plt.imshow(mask_correct,'gray',interpolation='none') plt.title("Correct segmentation example") plt.show() plt.figure() plt.axis('off') plt.imshow(mask_error,'gray',interpolation='none') plt.title("Erroneous segmentation example") plt.show() n_list = len(list_mask) smoothness = 700 #Smoothness degree = 1 #Spline degree fit_res = 0.35 resols = np.arange(0.01,0.5,0.01) #Signature resolutions resols = np.insert(resols,0,fit_res) #Insert resolution for signature fitting points = 100 #Points of Spline reconstruction refer_wat = np.empty((n_list,resols.shape[0],points)) #Initializing signature vector for mask in xrange(n_list): mask_p = np.load('../dataset/Seg_Watershed/mask_wate_{}.npy'.format(list_mask[mask])) refer_temp = sign_extract(mask_p, resols) #Function for shape signature extraction refer_wat[mask] = refer_temp if mask > 0: #Fitting curves using the first one as basis prof_ref = refer_wat[0] refer_wat[mask] = sign_fit(prof_ref[0], refer_temp) #Function for signature fitting print "Signatures' vector size: ", refer_wat.shape res_ex = 10 plt.figure() plt.plot(refer_wat[:,res_ex,:].T) plt.title("Signatures for res: %f"%(resols[res_ex])) plt.show() refer_wat_mean = np.mean(refer_wat,axis=0) #Finding mean signature per resolution print "Mean signature size: ", refer_wat_mean.shape plt.figure() #Plotting mean signature plt.plot(refer_wat_mean[res_ex,:]) plt.title("Mean signature for res: %f"%(resols[res_ex])) plt.show() n_list = np.amax((len(list_normal_mask),len(list_error_mask))) refer_wat_n = np.empty((n_list,resols.shape[0],points)) #Initializing correct signature vector refer_wat_e = np.empty((n_list,resols.shape[0],points)) #Initializing error signature vector for mask in xrange(n_list): #Loading correct mask mask_pn = np.load('../dataset/Seg_Watershed/mask_wate_{}.npy'.format(list_normal_mask[mask])) refer_temp_n = sign_extract(mask_pn, resols) #Function for shape signature extraction refer_wat_n[mask] = sign_fit(refer_wat_mean[0], refer_temp_n) #Function for signature fitting #Loading erroneous mask mask_pe = np.load('../dataset/Seg_Watershed/mask_wate_{}.npy'.format(list_error_mask[mask])) refer_temp_e = sign_extract(mask_pe, resols) #Function for shape signature extraction refer_wat_e[mask] = sign_fit(refer_wat_mean[0], refer_temp_e) #Function for signature fitting print "Correct segmentations' vector: ", refer_wat_n.shape print "Erroneous segmentations' vector: ", refer_wat_e.shape plt.figure() plt.plot(refer_wat_n[:,res_ex,:].T) plt.title("Correct signatures for res: %f"%(resols[res_ex])) plt.show() plt.figure() plt.plot(refer_wat_e[:,res_ex,:].T) plt.title("Erroneous signatures for res: %f"%(resols[res_ex])) plt.show() rmse_nacum = np.sqrt(np.sum((refer_wat_mean - refer_wat_n)**2,axis=2)/(refer_wat_mean.shape[1])) rmse_eacum = np.sqrt(np.sum((refer_wat_mean - refer_wat_e)**2,axis=2)/(refer_wat_mean.shape[1])) dif_dis = rmse_eacum - rmse_nacum #Difference between erroneous signatures and correct signatures in_max_res = np.argmax(np.mean(dif_dis,axis=0)) #Finding optimal resolution at maximum difference opt_res = resols[in_max_res] print "Optimal resolution for error detection: ", opt_res perc_th = 0.3 #Established percentage to threshold correct_max = np.mean(rmse_nacum[:,in_max_res]) #Finding threshold for separate segmentations error_min = np.mean(rmse_eacum[:,in_max_res]) th_res = perc_th*(error_min-correct_max)+correct_max print "Threshold for separate segmentations: ", th_res #### Plotting erroneous and correct segmentation signatures ticksx_resols = ["%.2f" % el for el in np.arange(0.01,0.5,0.01)] #Labels for plot xticks ticksx_resols = ticksx_resols[::6] ticksx_index = np.arange(1,50,6) figpr = plt.figure() #Plotting mean RMSE for correct segmentations plt.boxplot(rmse_nacum[:,1:], showmeans=True) #Element 0 was introduced only for fitting, #in comparation is not used. plt.axhline(y=0, color='g', linestyle='--') plt.axhline(y=th_res, color='r', linestyle='--') plt.axvline(x=in_max_res, color='r', linestyle='--') plt.xlabel('Resolutions', fontsize = 12, labelpad=-2) plt.ylabel('RMSE correct signatures', fontsize = 12) plt.xticks(ticksx_index, ticksx_resols) plt.show() figpr = plt.figure() #Plotting mean RMSE for erroneous segmentations plt.boxplot(rmse_eacum[:,1:], showmeans=True) plt.axhline(y=0, color='g', linestyle='--') plt.axhline(y=th_res, color='r', linestyle='--') plt.axvline(x=in_max_res, color='r', linestyle='--') plt.xlabel('Resolutions', fontsize = 12, labelpad=-2) plt.ylabel('RMSE error signatures', fontsize = 12) plt.xticks(ticksx_index, ticksx_resols) plt.show() figpr = plt.figure() #Plotting difference for mean RMSE over all resolutions plt.boxplot(dif_dis[:,1:], showmeans=True) plt.axhline(y=0, color='g', linestyle='--') plt.axvline(x=in_max_res, color='r', linestyle='--') plt.xlabel('Resolutions', fontsize = 12, labelpad=-2) plt.ylabel('Difference RMSE signatures', fontsize = 12) plt.xticks(ticksx_index, ticksx_resols) plt.show() n_resols = [fit_res, opt_res] #Resolutions for fitting and comparison #### Teste dataset (Watershed) #Loading labels seg_label = genfromtxt('../dataset/Seg_Watershed/watershed_label.csv', delimiter=',').astype('uint8') all_seg = np.hstack((seg_label[seg_label[:,1] == 0, 0][30:], seg_label[seg_label[:,1] == 1, 0][10:])) #Extracting erroneous and correct names lab_seg = np.hstack((seg_label[seg_label[:,1] == 0, 1][30:], seg_label[seg_label[:,1] == 1, 1][10:])) #Extracting erroneous and correct labels refer_wat_mean_opt = np.vstack((refer_wat_mean[0],refer_wat_mean[in_max_res])) #Mean signature with fitting #and optimal resolution refer_seg = np.empty((all_seg.shape[0],len(n_resols),points)) #Initializing correct signature vector in_mask = 0 for mask in all_seg: mask_ = np.load('../dataset/Seg_Watershed/mask_wate_{}.npy'.format(mask)) refer_temp = sign_extract(mask_, n_resols) #Function for shape signature extraction refer_seg[in_mask] = sign_fit(refer_wat_mean_opt[0], refer_temp) #Function for signature fitting ###### Uncomment this block to see each segmentation with true and predicted labels #RMSE_ = np.sqrt(np.sum((refer_wat_mean_opt[1] - refer_seg[in_mask,1])**2)/(refer_wat_mean_opt.shape[1])) #plt.figure() #plt.axis('off') #plt.imshow(mask_,'gray',interpolation='none') #plt.title("True label: {}, Predic. label: {}".format(lab_seg[in_mask],(RMSE_>th_res).astype('uint8'))) #plt.show() in_mask += 1 #### Segmentation evaluation result over all segmentations RMSE = np.sqrt(np.sum((refer_wat_mean_opt[1] - refer_seg[:,1])**2,axis=1)/(refer_wat_mean_opt.shape[1])) pred_seg = RMSE > th_res #Apply threshold comp_seg = np.logical_not(np.logical_xor(pred_seg,lab_seg)) #Comparation method result with true labels acc_w = np.sum(comp_seg)/(1.0*len(comp_seg)) print "Final accuracy on Watershed {} segmentations: {}".format(len(comp_seg),acc_w) #### Teste dataset (ROQS) seg_label = genfromtxt('../dataset/Seg_ROQS/roqs_label.csv', delimiter=',').astype('uint8') #Loading labels all_seg = np.hstack((seg_label[seg_label[:,1] == 0, 0], seg_label[seg_label[:,1] == 1, 0])) #Extracting erroneous and correct names lab_seg = np.hstack((seg_label[seg_label[:,1] == 0, 1], seg_label[seg_label[:,1] == 1, 1])) #Extracting erroneous and correct labels refer_wat_mean_opt = np.vstack((refer_wat_mean[0],refer_wat_mean[in_max_res])) #Mean signature with fitting #and optimal resolution refer_seg = np.empty((all_seg.shape[0],len(n_resols),points)) #Initializing correct signature vector in_mask = 0 for mask in all_seg: mask_ = np.load('../dataset/Seg_ROQS/mask_roqs_{}.npy'.format(mask)) refer_temp = sign_extract(mask_, n_resols) #Function for shape signature extraction refer_seg[in_mask] = sign_fit(refer_wat_mean_opt[0], refer_temp) #Function for signature fitting ###### Uncomment this block to see each segmentation with true and predicted labels #RMSE_ = np.sqrt(np.sum((refer_wat_mean_opt[1] - refer_seg[in_mask,1])**2)/(refer_wat_mean_opt.shape[1])) #plt.figure() #plt.axis('off') #plt.imshow(mask_,'gray',interpolation='none') #plt.title("True label: {}, Predic. label: {}".format(lab_seg[in_mask],(RMSE_>th_res).astype('uint8'))) #plt.show() in_mask += 1 #### Segmentation evaluation result over all segmentations RMSE = np.sqrt(np.sum((refer_wat_mean_opt[1] - refer_seg[:,1])**2,axis=1)/(refer_wat_mean_opt.shape[1])) pred_seg = RMSE > th_res #Apply threshold comp_seg = np.logical_not(np.logical_xor(pred_seg,lab_seg)) #Comparation method result with true labels acc_r = np.sum(comp_seg)/(1.0*len(comp_seg)) print "Final accuracy on ROQS {} segmentations: {}".format(len(comp_seg),acc_r) #### Teste dataset (Pixel-based) seg_label = genfromtxt('../dataset/Seg_pixel/pixel_label.csv', delimiter=',').astype('uint8') #Loading labels all_seg = np.hstack((seg_label[seg_label[:,1] == 0, 0], seg_label[seg_label[:,1] == 1, 0])) #Extracting erroneous and correct names lab_seg = np.hstack((seg_label[seg_label[:,1] == 0, 1], seg_label[seg_label[:,1] == 1, 1])) #Extracting erroneous and correct labels refer_wat_mean_opt = np.vstack((refer_wat_mean[0],refer_wat_mean[in_max_res])) #Mean signature with fitting #and optimal resolution refer_seg = np.empty((all_seg.shape[0],len(n_resols),points)) #Initializing correct signature vector in_mask = 0 for mask in all_seg: mask_ = np.load('../dataset/Seg_pixel/mask_pixe_{}.npy'.format(mask)) refer_temp = sign_extract(mask_, n_resols) #Function for shape signature extraction refer_seg[in_mask] = sign_fit(refer_wat_mean_opt[0], refer_temp) #Function for signature fitting ###### Uncomment this block to see each segmentation with true and predicted labels #RMSE_ = np.sqrt(np.sum((refer_wat_mean_opt[1] - refer_seg[in_mask,1])**2)/(refer_wat_mean_opt.shape[1])) #plt.figure() #plt.axis('off') #plt.imshow(mask_,'gray',interpolation='none') #plt.title("True label: {}, Predic. label: {}".format(lab_seg[in_mask],(RMSE_>th_res).astype('uint8'))) #plt.show() in_mask += 1 #### Segmentation evaluation result over all segmentations RMSE = np.sqrt(np.sum((refer_wat_mean_opt[1] - refer_seg[:,1])**2,axis=1)/(refer_wat_mean_opt.shape[1])) pred_seg = RMSE > th_res #Apply threshold comp_seg = np.logical_not(np.logical_xor(pred_seg,lab_seg)) #Comparation method result with true labels acc_p = np.sum(comp_seg)/(1.0*len(comp_seg)) print "Final accuracy on pixel-based {} segmentations: {}".format(len(comp_seg),acc_p) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Qué Entidades (tablas) puede definir?
<ASSISTANT_TASK:> Python Code: import pandas as pd DF = pd.read_csv('../data/alternative.tsv', sep='\t') DF DF['Berri1'].plot() # plot easier <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Trapezoidal rule Step2: Now use scipy.integrate.quad to integrate the f and g functions and see how the result compares with your trapz function. Print the results and errors.
<ASSISTANT_TASK:> Python Code: %matplotlib inline import matplotlib.pyplot as plt import numpy as np from scipy import integrate def trapz(f, a, b, N): h = (b - a)/N i = np.arange(1,N) c = h*(0.5*f(a)+f(b)*0.5+f(a+i*h).sum()) return c f = lambda x: x**2 g = lambda x: np.sin(x) I = trapz(f, 0, 1, 1000) assert np.allclose(I, 0.33333349999999995) J = trapz(g, 0, np.pi, 1000) assert np.allclose(J, 1.9999983550656628) a = integrate.quad(f,0,1) b = integrate.quad(g,0,np.pi) print (a) print (b) assert True # leave this cell to grade the previous one <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let us also define a generic print function that will be the callback trigger when the selected_values trait of all the widgets changes. Step2: <a name="sec Step3: <a name="sec Step4: Note that you need to press Enter in order to pass a new value into the textbox. Also, try typing a wrong command, such as Step5: The state of the widget can be updated with the set_widget_state() method. Note that since allow_callback=False, nothing gets printed after running the command, even though selected_values is updated. Step6: Similar to the list widget, MenpoWidgets has a widget for defining a command for slicing a list (or numpy.array). Commands can have any vald Python syntax, such as Step7: Note that by defining a single int number, then an ipywidget.IntSlider appears that allows to select the index. Similarly, by inserting any slicing command with a constant step, then an ipywidgets.IntRangeSlider appears. The sliders are disabled when inserting a slicing command with non-constant step. The placement of the sliders with respect to the textbox is controlled by the orientation argument. Step8: To update the widget's state, you need to pass in a new dict of options, as Step9: <a name="sec Step10: The Apply to all button sets the currently selected colour to all the labels. Step11: In case there is only one label, defined either with a list of length 1 or by setting labels=None, then the drop-down menu to select object does not appear. For example, let's update the state of the widget Step12: <a name="sec Step13: As with all widgets, the state can be updated as Step14: An index selection widget where the selection can be performed with -/+ (previous/next) buttons can be created as Step15: Note that since text_editable is True, you can actually edit the index directly from the textbox. Additionally, by setting loop_enabled=True means that by pressing '+' when the textbox is at the last index, it takes you to the minimum index. Step16: Let's also update its state with a new set of options Step17: <a name="sec Step18: and its state can be updated as Step19: The second one defines two zoom values that are intended to control the height and width of a figure. Step20: Note that the sliders can be linkedd in order to preserve the aspect ratio of the figure. The state can be updated as Step21: <a name="sec Step22: The widget can be updated with a new dict of options as Step23: <a name="sec Step24: The Render lines tick box also controls the visibility of the rest of the options. So by updating the state with render_lines=False, the options disappear. Step25: <a name="sec Step26: <a name="sec Step27: Of course the state of the widget can be updated as Step28: <a name="sec Step29: Note that the percentage mode is accompanied by a ListWidget that expects a single float, whereas the range mode invokes a ListWidget that expects two float numbers. The state of the widget can be changed as Step30: On the other hand, AxesTicksWidget has two functionalities per axis Step31: The state can be updated as Step32: The AxesOptionsWidget involves the AxesLimitsWidget and AxesTicksWidget widgets and also allows the selection of font-related options. As always, the initial options are provided in a dict Step33: The state of the widget can be updated as Step34: <a name="sec Step35: <a name="sec Step36: <a name="sec
<ASSISTANT_TASK:> Python Code: from menpowidgets.tools import (LogoWidget, ListWidget, SlicingCommandWidget, ColourSelectionWidget, IndexButtonsWidget, IndexSliderWidget, ZoomOneScaleWidget, ZoomTwoScalesWidget, ImageOptionsWidget, LineOptionsWidget, MarkerOptionsWidget, NumberingOptionsWidget, AxesLimitsWidget, AxesTicksWidget, AxesOptionsWidget, LegendOptionsWidget, GridOptionsWidget, HOGOptionsWidget, DSIFTOptionsWidget, DaisyOptionsWidget, LBPOptionsWidget, IGOOptionsWidget) from menpowidgets.style import map_styles_to_hex_colours from menpo.visualize import print_dynamic def render_function(change): print(change['new']) wid = LogoWidget(scale=0.6, style='info') wid list_cmd = [0, 1, 2] wid = ListWidget(list_cmd, mode='int', description='List:', render_function=render_function, example_visible=True) wid wid.style(box_style='danger', font_size=15) wid.set_widget_state([20, 16], allow_callback=False) # Initial options slice_cmd = {'command': ':3', 'length': 10} # Create widget wid = SlicingCommandWidget(slice_cmd, description='Command:', render_function=render_function, example_visible=True, orientation='horizontal') # Display widget wid wid.style(border_visible=True, border_style='dashed', font_weight='bold') wid.set_widget_state({'command': ':40', 'length': 40}, allow_callback=True) wid = ColourSelectionWidget([[255, 38, 31], 'blue', 'green'], labels=['a', 'b', 'c'], render_function=render_function) # Set styling wid.style(box_style='warning', apply_to_all_style='info', label_colour='black', label_background_colour=map_styles_to_hex_colours('info', background=True), font_weight='bold') # Display widget wid wid.set_colours(['red', 'orange', 'pink'], allow_callback=True) wid.set_widget_state(['red'], None) # Initial options index = {'min': 0, 'max': 100, 'step': 1, 'index': 10} # Crete widget wid = IndexSliderWidget(index, description='Index: ', render_function=render_function, continuous_update=False) # Set styling wid.style(box_style='danger', slider_handle_colour=map_styles_to_hex_colours('danger'), slider_bar_colour=map_styles_to_hex_colours('danger')) # Display widget wid wid.set_widget_state({'min': 10, 'max': 500, 'step': 2, 'index': 50}, allow_callback=True) index = {'min': 0, 'max': 100, 'step': 1, 'index': 10} wid = IndexButtonsWidget(index, render_function=render_function, loop_enabled=False, text_editable=True) wid wid.style(box_style='danger', plus_style='success', minus_style='danger', text_colour='blue', text_background_colour=map_styles_to_hex_colours('info', background=True)) wid.set_widget_state({'min': 20, 'max': 500, 'step': 2, 'index': 50}, loop_enabled=True, text_editable=True, allow_callback=True) # Initial options zoom_options = {'min': 0.1, 'max': 4., 'step': 0.05, 'zoom': 1.} # Create widget wid = ZoomOneScaleWidget(zoom_options, render_function=render_function) # Set styling wid.style(box_style='danger') wid.zoom_slider.background_color = map_styles_to_hex_colours('info') wid.zoom_slider.slider_color = map_styles_to_hex_colours('danger') # Display widget wid wid.set_widget_state({'zoom': 0.5, 'min': 0., 'max': 4., 'step': 0.2}, allow_callback=True) # Initial options zoom_options = {'min': 0.1, 'max': 4., 'step': 0.1, 'zoom': [1., 1.], 'lock_aspect_ratio': False} # Create widget wid = ZoomTwoScalesWidget(zoom_options, render_function=render_function, continuous_update=True) # Set styling wid.style(box_style='danger') # Display widget wid zoom_options = {'min': 0.5, 'max': 10., 'step': 0.3, 'zoom': [2., 3.]} wid.set_widget_state(zoom_options, allow_callback=True) # Initial options image_options = {'alpha': 1., 'interpolation': 'bilinear', 'cmap_name': None} # Create widget wid = ImageOptionsWidget(image_options, render_function=render_function) # Set styling wid.style(box_style='success', padding=10, border_visible=True, border_radius=45) # Display widget wid wid.set_widget_state({'alpha': 0.8, 'interpolation': 'none', 'cmap_name': 'gray'}, allow_callback=True) # Initial options line_options = {'render_lines': True, 'line_width': 1, 'line_colour': ['blue', 'red'], 'line_style': '-'} # Create widget wid = LineOptionsWidget(line_options, render_function=render_function, labels=['menpo', 'widgets']) # Set styling wid.style(box_style='danger', padding=6) # Display widget wid wid.set_widget_state({'render_lines': False, 'line_width': 5, 'line_colour': ['purple'], 'line_style': '--'}, allow_callback=True, labels=None) # Initial options marker_options = {'render_markers': True, 'marker_size': 20, 'marker_face_colour': ['red', 'green'], 'marker_edge_colour': ['black', 'blue'], 'marker_style': 'o', 'marker_edge_width': 1} # Create widget wid = MarkerOptionsWidget(marker_options, render_function=render_function, labels=['a', 'b']) # Set styling wid.style(box_style='info', padding=6) # Display widget wid wid.set_widget_state({'render_markers': True, 'marker_size': 20, 'marker_face_colour': ['red'], 'marker_edge_colour': ['black'], 'marker_style': 'o', 'marker_edge_width': 1}, labels=None, allow_callback=True) # Initial options numbers_options = {'render_numbering': True, 'numbers_font_name': 'serif', 'numbers_font_size': 10, 'numbers_font_style': 'normal', 'numbers_font_weight': 'normal', 'numbers_font_colour': ['black'], 'numbers_horizontal_align': 'center', 'numbers_vertical_align': 'bottom'} # Create widget wid = NumberingOptionsWidget(numbers_options, render_function=render_function) # Set styling wid.style(box_style='success', border_visible=True, border_colour='black', border_style='solid', border_width=1, border_radius=0, padding=10, margin=10) # Display widget wid wid.set_widget_state({'render_numbering': True, 'numbers_font_name': 'serif', 'numbers_font_size': 10, 'numbers_font_style': 'normal', 'numbers_font_weight': 'normal', 'numbers_font_colour': ['green'], 'numbers_horizontal_align': 'center', 'numbers_vertical_align': 'bottom'}, allow_callback=True) # Create widget wid = AxesLimitsWidget(axes_x_limits=[0, 10], axes_y_limits=0.1, render_function=render_function) # Set styling wid.style(box_style='danger') # Display widget wid wid.set_widget_state([-200, 200], None, allow_callback=True) # Initial options axes_ticks = {'x': [], 'y': [10., 20., 30.]} # Create widget wid = AxesTicksWidget(axes_ticks, render_function=render_function) # St styling wid.style(box_style='danger') # Display widget wid wid.set_widget_state({'x': list(range(5)), 'y': None}, allow_callback=True) # Initial options axes_options = {'render_axes': True, 'axes_font_name': 'serif', 'axes_font_size': 10, 'axes_font_style': 'normal', 'axes_font_weight': 'normal', 'axes_x_limits': None, 'axes_y_limits': None, 'axes_x_ticks': [0, 100], 'axes_y_ticks': None} # Create widget wid = AxesOptionsWidget(axes_options, render_function=render_function) # Set styling wid.style(box_style='warning', padding=6, border_visible=True, border_colour=map_styles_to_hex_colours('warning')) # Display widget wid axes_options = {'render_axes': True, 'axes_font_name': 'serif', 'axes_font_size': 10, 'axes_font_style': 'normal', 'axes_font_weight': 'normal', 'axes_x_limits': [0., 0.05], 'axes_y_limits': 0.1, 'axes_x_ticks': [0, 100], 'axes_y_ticks': None} wid.set_widget_state(axes_options, allow_callback=True) # Initial options legend_options = {'render_legend': True, 'legend_title': '', 'legend_font_name': 'serif', 'legend_font_style': 'normal', 'legend_font_size': 10, 'legend_font_weight': 'normal', 'legend_marker_scale': 1., 'legend_location': 2, 'legend_bbox_to_anchor': (1.05, 1.), 'legend_border_axes_pad': 1., 'legend_n_columns': 1, 'legend_horizontal_spacing': 1., 'legend_vertical_spacing': 1., 'legend_border': True, 'legend_border_padding': 0.5, 'legend_shadow': False, 'legend_rounded_corners': True} # Create widget wid = LegendOptionsWidget(legend_options, render_function=render_function) # Set styling wid.style(border_visible=True, font_size=15) # Display widget wid legend_options = {'render_legend': True, 'legend_title': 'asd', 'legend_font_name': 'sans-serif', 'legend_font_style': 'normal', 'legend_font_size': 60, 'legend_font_weight': 'normal', 'legend_marker_scale': 2., 'legend_location': 7, 'legend_bbox_to_anchor': (1.05, 1.), 'legend_border_axes_pad': 1., 'legend_n_columns': 2, 'legend_horizontal_spacing': 3., 'legend_vertical_spacing': 7., 'legend_border': False, 'legend_border_padding': 0.5, 'legend_shadow': True, 'legend_rounded_corners': True} wid.set_widget_state(legend_options, allow_callback=True) # Initial options grid_options = {'render_grid': True, 'grid_line_width': 1, 'grid_line_style': '-'} # Create widget wid = GridOptionsWidget(grid_options, render_function=render_function) # Set styling wid.style(box_style='warning') # Display widget wid wid.set_widget_state({'render_grid': True, 'grid_line_width': 10, 'grid_line_style': ':'}) # Initial options hog_options = {'mode': 'dense', 'algorithm': 'dalaltriggs', 'num_bins': 9, 'cell_size': 8, 'block_size': 2, 'signed_gradient': True, 'l2_norm_clip': 0.2, 'window_height': 1, 'window_width': 1, 'window_unit': 'blocks', 'window_step_vertical': 1, 'window_step_horizontal': 1, 'window_step_unit': 'pixels', 'padding': True} # Create widget wid = HOGOptionsWidget(hog_options, render_function=render_function) # Set styling wid.style('info') # Display widget wid # Initial options dsift_options = {'window_step_horizontal': 1, 'window_step_vertical': 1, 'num_bins_horizontal': 2, 'num_bins_vertical': 2, 'num_or_bins': 9, 'cell_size_horizontal': 6, 'cell_size_vertical': 6, 'fast': True} # Create widget wid = DSIFTOptionsWidget(dsift_options, render_function=render_function) # Set styling wid.style('success') # Display widget wid # Initial options daisy_options = {'step': 1, 'radius': 15, 'rings': 2, 'histograms': 2, 'orientations': 8, 'normalization': 'l1', 'sigmas': None, 'ring_radii': None} # Create widget wid = DaisyOptionsWidget(daisy_options, render_function=render_function) # Set styling wid.style('danger') # Display widget wid # Initial options lbp_options = {'radius': list(range(1, 5)), 'samples': [8] * 4, 'mapping_type': 'u2', 'window_step_vertical': 1, 'window_step_horizontal': 1, 'window_step_unit': 'pixels', 'padding': True} # Create widget wid = LBPOptionsWidget(lbp_options, render_function=render_function) # Set styling wid.style(box_style='warning') # Display widget wid wid = IGOOptionsWidget({'double_angles': True}, render_function=render_function) wid <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Generating synthetic data Step2: Line fitting using Bayes' theorem Step3: Specificity is necessary for credibility. Let's show that by optimizing the posterior function, we can fit a line. Step4: We can see that the model is very close to the model we drew the data from. It works! Step5: We can see that the probability of this model is very similar to the probability of the alternative model we fit above. How can we pick which one to use? Step6: We performed the Odds Ratio calculation on logarithmic space, so negative values show that the simpler (fixed slope) model is preferred, whereas if the values are positive and large, the free-slope model is preferred. Step7: Different datasets will prefer different models Step9: Indeed, the answer changed sign. Odds Ratios, p-values and everything else should always be interpreted conservatively. I prefer odds ratios that are very large, larger than 1,000 before stating that one model is definitively preferred. Otherwise, I tend to prefer the simpler model. Step10: Here we can see that with five data points, the odds ratio will tend to prefer the simpler model. We do not have too much information---why request the extra information? Note that for the second dataset in some cases the deviations are great enough that the alternative model is strongly preferred (right panel, extra bump at 10). However, this is rare.
<ASSISTANT_TASK:> Python Code: # important stuff: import os import pandas as pd import numpy as np import statsmodels.tools.numdiff as smnd import scipy # Graphics import matplotlib as mpl import matplotlib.pyplot as plt import seaborn as sns from matplotlib import rc rc('text', usetex=True) rc('text.latex', preamble=r'\usepackage{cmbright}') rc('font', **{'family': 'sans-serif', 'sans-serif': ['Helvetica']}) # Magic function to make matplotlib inline; # other style specs must come AFTER %matplotlib inline # This enables SVG graphics inline. # There is a bug, so uncomment if it works. %config InlineBackend.figure_formats = {'png', 'retina'} # JB's favorite Seaborn settings for notebooks rc = {'lines.linewidth': 2, 'axes.labelsize': 18, 'axes.titlesize': 18, 'axes.facecolor': 'DFDFE5'} sns.set_context('notebook', rc=rc) sns.set_style("dark") mpl.rcParams['xtick.labelsize'] = 16 mpl.rcParams['ytick.labelsize'] = 16 mpl.rcParams['legend.fontsize'] = 14 n = 50 # number of data points x = np.linspace(-10, 10, n) yerr = np.abs(np.random.normal(0, 2, n)) y = np.linspace(5, -5, n) + np.random.normal(0, yerr, n) plt.scatter(x, y) # bayes model fitting: def log_prior(theta): beta = theta return -1.5 * np.log(1 + beta ** 2) def log_likelihood(beta, x, y, yerr): sigma = yerr y_model = beta * x return -0.5 * np.sum(np.log(2 * np.pi * sigma ** 2) + (y - y_model) ** 2 / sigma ** 2) def log_posterior(theta, x, y, yerr): return log_prior(theta) + log_likelihood(theta, x, y, yerr) def neg_log_prob_free(theta, x, y, yerr): return -log_posterior(theta, x, y, yerr) # calculate probability of free model: res = scipy.optimize.minimize(neg_log_prob_free, 0, args=(x, y, yerr), method='Powell') plt.scatter(x, y) plt.plot(x, x*res.x, '-', color='g') print('The probability of this model is {0:.2g}'.format(np.exp(log_posterior(res.x, x, y, yerr)))) print('The optimized probability is {0:.4g}x'.format(np.float64(res.x))) # bayes model fitting: def log_likelihood_fixed(x, y, yerr): sigma = yerr y_model = -1/2*x return -0.5 * np.sum(np.log(2 * np.pi * sigma ** 2) + (y - y_model) ** 2 / sigma ** 2) def log_posterior_fixed(x, y, yerr): return log_likelihood_fixed(x, y, yerr) plt.scatter(x, y) plt.plot(x, -0.5*x, '-', color='purple') print('The probability of this model is {0:.2g}'.format(np.exp(log_posterior_fixed(x, y, yerr)))) def model_selection(X, Y, Yerr, **kwargs): guess = kwargs.pop('guess', -0.5) # calculate probability of free model: res = scipy.optimize.minimize(neg_log_prob_free, guess, args=(X, Y, Yerr), method='Powell') # Compute error bars second_derivative = scipy.misc.derivative(log_posterior, res.x, dx=1.0, n=2, args=(X, Y, Yerr), order=3) cov_free = -1/second_derivative alpha_free = np.float64(res.x) log_free = log_posterior(alpha_free, X, Y, Yerr) # log goodness of fit for fixed models log_MAP = log_posterior_fixed(X, Y, Yerr) good_fit = log_free - log_MAP # occam factor - only the free model has a penalty log_occam_factor =(-np.log(2 * np.pi) + np.log(cov_free)) / 2 + log_prior(alpha_free) # give more standing to simpler models. but just a little bit! lg = log_free - log_MAP + log_occam_factor - 2 return lg model_selection(x, y, yerr) n = 50 # number of data points x = np.linspace(-10, 10, n) yerr = np.abs(np.random.normal(0, 2, n)) y = x*-0.55 + np.random.normal(0, yerr, n) plt.scatter(x, y) model_selection(x, y, yerr) def simulate_many_odds_ratios(n): Given a number `n` of data points, simulate 1,000 data points drawn from a null model and an alternative model and compare the odds ratio for each. iters = 1000 lg1 = np.zeros(iters) lg2 = np.zeros(iters) for i in range(iters): x = np.linspace(-10, 10, n) yerr = np.abs(np.random.normal(0, 2, n)) # simulate two models: only one matches the fixed model y1 = -0.5*x + np.random.normal(0, yerr, n) y2 = -0.46*x + np.random.normal(0, yerr, n) lg1[i] = model_selection(x, y1, yerr) m2 = model_selection(x, y2, yerr) # Truncate OR for ease of plotting if m2 < 10: lg2[i] = m2 else: lg2[i] = 10 return lg1, lg2 def make_figures(n): lg1, lg2 = simulate_many_odds_ratios(n) lg1 = np.sort(lg1) lg2 = np.sort(lg2) fifty_point1 = lg1[int(np.floor(len(lg1)/2))] fifty_point2 = lg2[int(np.floor(len(lg2)/2))] fig, ax = plt.subplots(ncols=2, figsize=(15, 7), sharey=True) fig.suptitle('Log Odds Ratio for n={0} data points'.format(n), fontsize=20) sns.kdeplot(lg1, label='slope=-0.5', ax=ax[0], cumulative=False) ax[0].axvline(x=fifty_point1, ls='--', color='k') ax[0].set_title('Data drawn from null model') ax[0].set_ylabel('Density') sns.kdeplot(lg2, label='slope=-0.46', ax=ax[1], cumulative=False) ax[1].axvline(x=fifty_point2, ls='--', color='k') ax[1].set_title('Data drawn from alternative model') fig.text(0.5, 0.04, 'Log Odds Ratio', ha='center', size=18) return fig, ax fig, ax = make_figures(n=5) fig, ax = make_figures(n=50) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Set up your Google Cloud Platform project Step2: Import libraries and define constants Step3: Data exploration and preparation Step4: Build a final view for to use as trainding data for clustering Step5: Create our initial model Step6: Work towards creating a better model Step7: Select optimal k Step8: The code below assumes we've used the naming convention originally created in this notebook, and the k value occurs after the 2nd underscore. If you've changed the model_prefix_name variable, then this code might break. Step9: Note - when you run this notebook, you will get different results, due to random cluster initialization. If you'd like to consistently return the same cluster for reach run, you may explicitly select your initialization through hyperparameter selection (https Step10: In addition to the output above, I'll note a few insights we get from our clusters. Step11: Clean up
<ASSISTANT_TASK:> Python Code: !pip install google-cloud-bigquery !pip install google-cloud-bigquery-storage !pip install pandas-gbq # Reservation package needed to setup flex slots for flat-rate pricing !pip install google-cloud-bigquery-reservation # Automatically restart kernel after installs import IPython app = IPython.Application.instance() app.kernel.do_shutdown(True) PROJECT_ID = "UPDATE TO YOUR PROJECT ID" REGION = 'US' DATA_SET_ID = 'bqml_kmeans' # Ensure you first create a data set in BigQuery !gcloud config set project $PROJECT_ID # If you have not built the Data Set, the following command will build it for you # !bq mk --location=$REGION --dataset $PROJECT_ID:$DATA_SET_ID from google.cloud import bigquery import numpy as np import pandas as pd import pandas_gbq import matplotlib.pyplot as plt pd.set_option('display.float_format', lambda x: '%.3f' % x) # used to display float format client = bigquery.Client(project=PROJECT_ID) # We start with GA360 data, and will eventually build synthetic CRM as an example. # This block is the first step, just working with GA360 ga360_only_view = 'GA360_View' shared_dataset_ref = client.dataset(DATA_SET_ID) ga360_view_ref = shared_dataset_ref.table(ga360_only_view) ga360_view = bigquery.Table(ga360_view_ref) ga360_query = ''' SELECT fullVisitorID, ABS(farm_fingerprint(fullVisitorID)) AS Hashed_fullVisitorID, # This will be used to generate random data. MAX(device.operatingSystem) AS OS, # We can aggregate this because an OS is tied to a fullVisitorID. SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Apparel' THEN 1 ELSE 0 END) AS Apparel, SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Office' THEN 1 ELSE 0 END) AS Office, SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Electronics' THEN 1 ELSE 0 END) AS Electronics, SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Limited Supply' THEN 1 ELSE 0 END) AS LimitedSupply, SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Accessories' THEN 1 ELSE 0 END) AS Accessories, SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Shop by Brand' THEN 1 ELSE 0 END) AS ShopByBrand, SUM (CASE WHEN REGEXP_EXTRACT (v2ProductCategory, r'^(?:(?:.*?)Home/)(.*?)/') = 'Bags' THEN 1 ELSE 0 END) AS Bags, ROUND (SUM (productPrice/1000000),2) AS productPrice_USD FROM `bigquery-public-data.google_analytics_sample.ga_sessions_*`, UNNEST(hits) AS hits, UNNEST(hits.product) AS hits_product WHERE _TABLE_SUFFIX BETWEEN '20160801' AND '20160831' AND geoNetwork.country = 'United States' AND type = 'EVENT' GROUP BY 1, 2 ''' ga360_view.view_query = ga360_query.format(PROJECT_ID) ga360_view = client.create_table(ga360_view) # API request print(f"Successfully created view at {ga360_view.full_table_id}") # Show a sample of GA360 data ga360_query_df = f''' SELECT * FROM {ga360_view.full_table_id.replace(":", ".")} LIMIT 5 ''' job_config = bigquery.QueryJobConfig() # Start the query query_job = client.query(ga360_query_df, job_config=job_config) #API Request df_ga360 = query_job.result() df_ga360 = df_ga360.to_dataframe() df_ga360 # Create synthetic CRM data in SQL CRM_only_view = 'CRM_View' shared_dataset_ref = client.dataset(DATA_SET_ID) CRM_view_ref = shared_dataset_ref.table(CRM_only_view) CRM_view = bigquery.Table(CRM_view_ref) # Query below works by hashing the fullVisitorID, which creates a random distribution. # We use modulo to artificially split gender and hhi distribution. CRM_query = ''' SELECT fullVisitorID, IF (MOD(Hashed_fullVisitorID,2) = 0, "M", "F") AS gender, CASE WHEN MOD(Hashed_fullVisitorID,10) = 0 THEN 55000 WHEN MOD(Hashed_fullVisitorID,10) < 3 THEN 65000 WHEN MOD(Hashed_fullVisitorID,10) < 7 THEN 75000 WHEN MOD(Hashed_fullVisitorID,10) < 9 THEN 85000 WHEN MOD(Hashed_fullVisitorID,10) = 9 THEN 95000 ELSE Hashed_fullVisitorID END AS hhi FROM ( SELECT fullVisitorID, ABS(farm_fingerprint(fullVisitorID)) AS Hashed_fullVisitorID, FROM `bigquery-public-data.google_analytics_sample.ga_sessions_*`, UNNEST(hits) AS hits, UNNEST(hits.product) AS hits_product WHERE _TABLE_SUFFIX BETWEEN '20160801' AND '20160831' AND geoNetwork.country = 'United States' AND type = 'EVENT' GROUP BY 1, 2) ''' CRM_view.view_query = CRM_query.format(PROJECT_ID) CRM_view = client.create_table(CRM_view) # API request print(f"Successfully created view at {CRM_view.full_table_id}") # See an output of the synthetic CRM data CRM_query_df = f''' SELECT * FROM {CRM_view.full_table_id.replace(":", ".")} LIMIT 5 ''' job_config = bigquery.QueryJobConfig() # Start the query query_job = client.query(CRM_query_df, job_config=job_config) #API Request df_CRM = query_job.result() df_CRM = df_CRM.to_dataframe() df_CRM # Build a final view, which joins GA360 data with CRM data final_data_view = 'Final_View' shared_dataset_ref = client.dataset(DATA_SET_ID) final_view_ref = shared_dataset_ref.table(final_data_view) final_view = bigquery.Table(final_view_ref) final_data_query = f''' SELECT g.*, c.* EXCEPT(fullVisitorId) FROM {ga360_view.full_table_id.replace(":", ".")} g JOIN {CRM_view.full_table_id.replace(":", ".")} c ON g.fullVisitorId = c.fullVisitorId ''' final_view.view_query = final_data_query.format(PROJECT_ID) final_view = client.create_table(final_view) # API request print(f"Successfully created view at {final_view.full_table_id}") # Show final data used prior to modeling sql_demo = f''' SELECT * FROM {final_view.full_table_id.replace(":", ".")} LIMIT 5 ''' job_config = bigquery.QueryJobConfig() # Start the query query_job = client.query(sql_demo, job_config=job_config) #API Request df_demo = query_job.result() df_demo = df_demo.to_dataframe() df_demo def makeModel (n_Clusters, Model_Name): sql =f''' CREATE OR REPLACE MODEL `{PROJECT_ID}.{DATA_SET_ID}.{Model_Name}` OPTIONS(model_type='kmeans', kmeans_init_method = 'KMEANS++', num_clusters={n_Clusters}) AS SELECT * except(fullVisitorID, Hashed_fullVisitorID) FROM `{final_view.full_table_id.replace(":", ".")}` ''' job_config = bigquery.QueryJobConfig() client.query(sql, job_config=job_config) # Make an API request. # Let's start with a simple test to ensure everything works. # After running makeModel(), allow a few minutes for training to complete. model_test_name = "test" makeModel(3, model_test_name) # After training is completed, you can either check in the UI, or you can interact with it using list_models(). for model in client.list_models(DATA_SET_ID): print(model) # Define upper and lower bound for k, then build individual models for each. # After running this loop, look at the UI to see several model objects that exist. low_k = 3 high_k = 15 model_prefix_name = 'kmeans_clusters_' lst = list(range (low_k, high_k+1)) #build list to iterate through k values for k in lst: model_name = model_prefix_name + str(k) makeModel(k, model_name) print(f"Model started: {model_name}") # list all current models models = client.list_models(DATA_SET_ID) # Make an API request. print("Listing current models:") for model in models: full_model_id = f"{model.dataset_id}.{model.model_id}" print(full_model_id) # Remove our sample model from BigQuery, so we only have remaining models from our previous loop model_id = DATA_SET_ID+"."+model_test_name client.delete_model(model_id) # Make an API request. print(f"Deleted model '{model_id}'") # This will create a dataframe with each model name, the Davies Bouldin Index, and Loss. # It will be used for the elbow method and to help determine optimal K df = pd.DataFrame(columns=['davies_bouldin_index', 'mean_squared_distance']) models = client.list_models(DATA_SET_ID) # Make an API request. for model in models: full_model_id = f"{model.dataset_id}.{model.model_id}" sql =f''' SELECT davies_bouldin_index, mean_squared_distance FROM ML.EVALUATE(MODEL `{full_model_id}`) ''' job_config = bigquery.QueryJobConfig() # Start the query, passing in the extra configuration. query_job = client.query(sql, job_config=job_config) # Make an API request. df_temp = query_job.to_dataframe() # Wait for the job to complete. df_temp['model_name'] = model.model_id df = pd.concat([df, df_temp], axis=0) # This will modify the dataframe above, produce a new field with 'n_clusters', and will sort for graphing df['n_clusters'] = df['model_name'].str.split('_').map(lambda x: x[2]) df['n_clusters'] = df['n_clusters'].apply(pd.to_numeric) df = df.sort_values(by='n_clusters', ascending=True) df df.plot.line(x='n_clusters', y=['davies_bouldin_index', 'mean_squared_distance']) model_to_use = 'kmeans_clusters_5' # User can edit this final_model = DATA_SET_ID+'.'+model_to_use sql_get_attributes = f''' SELECT centroid_id, feature, categorical_value FROM ML.CENTROIDS(MODEL {final_model}) WHERE feature IN ('OS','gender') ''' job_config = bigquery.QueryJobConfig() # Start the query query_job = client.query(sql_get_attributes, job_config=job_config) #API Request df_attributes = query_job.result() df_attributes = df_attributes.to_dataframe() df_attributes.head() # get numerical information about clusters sql_get_numerical_attributes = f''' WITH T AS ( SELECT centroid_id, ARRAY_AGG(STRUCT(feature AS name, ROUND(numerical_value,1) AS value) ORDER BY centroid_id) AS cluster FROM ML.CENTROIDS(MODEL {final_model}) GROUP BY centroid_id ), Users AS( SELECT centroid_id, COUNT(*) AS Total_Users FROM( SELECT * EXCEPT(nearest_centroids_distance) FROM ML.PREDICT(MODEL {final_model}, ( SELECT * FROM {final_view.full_table_id.replace(":", ".")} ))) GROUP BY centroid_id ) SELECT centroid_id, Total_Users, (SELECT value from unnest(cluster) WHERE name = 'Apparel') AS Apparel, (SELECT value from unnest(cluster) WHERE name = 'Office') AS Office, (SELECT value from unnest(cluster) WHERE name = 'Electronics') AS Electronics, (SELECT value from unnest(cluster) WHERE name = 'LimitedSupply') AS LimitedSupply, (SELECT value from unnest(cluster) WHERE name = 'Accessories') AS Accessories, (SELECT value from unnest(cluster) WHERE name = 'ShopByBrand') AS ShopByBrand, (SELECT value from unnest(cluster) WHERE name = 'Bags') AS Bags, (SELECT value from unnest(cluster) WHERE name = 'productPrice_USD') AS productPrice_USD, (SELECT value from unnest(cluster) WHERE name = 'hhi') AS hhi FROM T LEFT JOIN Users USING(centroid_id) ORDER BY centroid_id ASC ''' job_config = bigquery.QueryJobConfig() # Start the query query_job = client.query(sql_get_numerical_attributes, job_config=job_config) #API Request df_numerical_attributes = query_job.result() df_numerical_attributes = df_numerical_attributes.to_dataframe() df_numerical_attributes.head() sql_score = f''' SELECT * EXCEPT(nearest_centroids_distance) FROM ML.PREDICT(MODEL {final_model}, ( SELECT * FROM {final_view.full_table_id.replace(":", ".")} LIMIT 1)) ''' job_config = bigquery.QueryJobConfig() # Start the query query_job = client.query(sql_score, job_config=job_config) #API Request df_score = query_job.result() df_score = df_score.to_dataframe() df_score # Are you sure you want to do this? This is to delete all models models = client.list_models(DATA_SET_ID) # Make an API request. for model in models: full_model_id = f"{model.dataset_id}.{model.model_id}" client.delete_model(full_model_id) # Make an API request. print(f"Deleted: {full_model_id}") # Are you sure you want to do this? This is to delete all tables and views tables = client.list_tables(DATA_SET_ID) # Make an API request. for table in tables: full_table_id = f"{table.dataset_id}.{table.table_id}" client.delete_table(full_table_id) # Make an API request. print(f"Deleted: {full_table_id}") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Traversing the parsed tree Step2: To print only the groups of names and feed URL for the podcasts, leaving out all of the data in the header section by iterating over only the outline nodes and print the text and xmlURL attributes by looking up the values in the attrib dictionary Step3: Finding Nodes in a Documents Step4: It is possible to take advantage of the fact that the outline nodes are only nested two levels deep. Changing the search path to .//outline/outline means the loop will process only the second level of outline nodes. Step5: Parsed Node Attributes Step6: The text content of the nodes is available, along with the tail text, which comes after the end of a close tag. Step7: XML entity references embedded in the document are converted to the appropriate characters before values are returned. Step8: Watching Events While Parsing Step9: The event-style of processing is more natural for some operations, such as converting XML input to some other format. This technique can be used to convert list of podcasts from the earlier examples from an XML file to a CSV file, so they can be loaded into a spreadsheet or database application. Step10: Parsing Strings Step11: For structured XML that uses the id attribute to identify unique nodes of interest, XMLID() is a convenient way to access the parse results.
<ASSISTANT_TASK:> Python Code: from xml.etree import ElementTree with open('podcasts.opml', 'rt') as f: tree = ElementTree.parse(f) print(tree) from xml.etree import ElementTree import pprint with open('podcasts.opml', 'rt') as f: tree = ElementTree.parse(f) for node in tree.iter(): print(node.tag) from xml.etree import ElementTree with open('podcasts.opml', 'rt') as f: tree = ElementTree.parse(f) for node in tree.iter('outline'): name = node.attrib.get('text') url = node.attrib.get('xmlUrl') if name and url: print(' %s' % name) print(' %s' % url) else: print(name) from xml.etree import ElementTree with open('podcasts.opml', 'rt') as f: tree = ElementTree.parse(f) for node in tree.findall('.//outline'): url = node.attrib.get('xmlUrl') if url: print(url) from xml.etree import ElementTree with open('podcasts.opml', 'rt') as f: tree = ElementTree.parse(f) for node in tree.findall('.//outline/outline'): url = node.attrib.get('xmlUrl') print(url) from xml.etree import ElementTree with open('data.xml', 'rt') as f: tree = ElementTree.parse(f) node = tree.find('./with_attributes') print(node.tag) for name, value in sorted(node.attrib.items()): print(' %-4s = "%s"' % (name, value)) from xml.etree import ElementTree with open('data.xml', 'rt') as f: tree = ElementTree.parse(f) for path in ['./child', './child_with_tail']: node = tree.find(path) print(node.tag) print(' child node text:', node.text) print(' and tail text :', node.tail) from xml.etree import ElementTree with open('data.xml', 'rt') as f: tree = ElementTree.parse(f) node = tree.find('entity_expansion') print(node.tag) print(' in attribute:', node.attrib['attribute']) print(' in text :', node.text.strip()) from xml.etree.ElementTree import iterparse depth = 0 prefix_width = 8 prefix_dots = '.' * prefix_width line_template = ''.join([ '{prefix:<0.{prefix_len}}', '{event:<8}', '{suffix:<{suffix_len}} ', '{node.tag:<12} ', '{node_id}', ]) EVENT_NAMES = ['start', 'end', 'start-ns', 'end-ns'] for (event, node) in iterparse('podcasts.opml', EVENT_NAMES): if event == 'end': depth -= 1 prefix_len = depth * 2 print(line_template.format( prefix=prefix_dots, prefix_len=prefix_len, suffix='', suffix_len=(prefix_width - prefix_len), node=node, node_id=id(node), event=event, )) if event == 'start': depth += 1 import csv from xml.etree.ElementTree import iterparse import sys writer = csv.writer(sys.stdout, quoting=csv.QUOTE_NONNUMERIC) group_name = '' parsing = iterparse('podcasts.opml', events=['start']) for (event, node) in parsing: if node.tag != 'outline': # Ignore anything not part of the outline continue if not node.attrib.get('xmlUrl'): # Remember the current group group_name = node.attrib['text'] else: # Output a podcast entry writer.writerow( (group_name, node.attrib['text'], node.attrib['xmlUrl'], node.attrib.get('htmlUrl', '')) ) from xml.etree.ElementTree import XML def show_node(node): print(node.tag) if node.text is not None and node.text.strip(): print(' text: "%s"' % node.text) if node.tail is not None and node.tail.strip(): print(' tail: "%s"' % node.tail) for name, value in sorted(node.attrib.items()): print(' %-4s = "%s"' % (name, value)) for child in node: show_node(child) parsed = XML(''' <root> <group> <child id="a">This is child "a".</child> <child id="b">This is child "b".</child> </group> <group> <child id="c">This is child "c".</child> </group> </root> ''') print('parsed =', parsed) for elem in parsed: show_node(elem) from xml.etree.ElementTree import XMLID tree, id_map = XMLID(''' <root> <group> <child id="a">This is child "a".</child> <child id="b">This is child "b".</child> </group> <group> <child id="c">This is child "c".</child> </group> </root> ''') for key, value in sorted(id_map.items()): print('%s = %s' % (key, value)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Introduction Step2: Tasks Step3: Verify that the database is running and responding to the pymongo driver.
<ASSISTANT_TASK:> Python Code: from IPython.display import IFrame IFrame( 'https://www.sunfrog.com/Geek-Tech/First-solve-the-problem-Then-write-the-code.html', width=800, height=350, ) from IPython.display import IFrame IFrame( 'https://docs.mongodb.com/manual/reference/geojson/', width=800, height=350, ) # a module for importing values so I do not have to expose them in this Jupyter notebook from meta import dockerized_mongo_path # the '!' preceding the command allows me to access the shell from the Jupyter notebook # in which I am writing this blog post # ./expect-up-daemon calls a /usr/bin/expect script # in the $dockerized_mongo_path to bring up the dockerized MongoDB !cd $dockerized_mongo_path && ./expect-up-daemon from pymongo import MongoClient client = MongoClient() db = client.app collection_names = sorted(db.collection_names()) print(collection_names) collections = accidents, citations = [db.get_collection(collection) for collection in collection_names] info = [{collection_name: format(collection.count(), ',')} for collection_name, collection in zip(collection_names, collections)] print("document counts") for item in info: print(item) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Word Count by Sender Step2: Top N Words Step3: Top Words by Sender Step4: Top Unbalanced Words Step5: Words Used Just By Step6: Word Count by Month Step7: Total Step8: By Sender Step9: Word Count by Hour Step10: Total Step11: By Sender Step12: Word Trend [WIP] Step13: Total Step14: Words with highest variability
<ASSISTANT_TASK:> Python Code: import numpy as np import pandas as pd import seaborn as sns import os import sys sys.path.append(os.path.join(os.getcwd(), "src")) import util.io as mio import util.plotting as mplot from model.conversationDataframe import ConversationDataframe from stats.wordsCountStats import WordsCountStats from stats.iConvStats import IConvStats from util import statsUtil %matplotlib notebook sns.set_context("paper") %load_ext autoreload %autoreload 2 # filepath to your conversation file. You can use my conversations examples for testing FILEPATH = "src/resources/unittest/test_plotting.txt" # load conversation conv = ConversationDataframe(FILEPATH) conv.loadMessages() msgs = conv.messages msgs.head() # load sender stats sender_stats = conv.stats.generateStats(IConvStats.STATS_NAME_WORDCOUNT, ngram_range=(1,1)) sender_word_count = sender_stats.wordsCount sender_word_count.head(3) total_word_count = sender_stats.getWordsCount() total_word_count.sort_values(ascending=False)[:5] sender_stats.getWordsCount(sender='s1').sort_values(ascending=False)[:5] unbalances_word_count = (sender_word_count.loc['s1']-sender_word_count.loc['s2']).abs() unbalances_word_count.sort_values(ascending=False)[:5] sender_stats.getWordsUsedJustBy('s2', 's1').head(5) # load month stats month_stats = conv.stats.generateStats(IConvStats.STATS_NAME_WORDCOUNT, groupByColumns=['year', 'month']) month_word_count = month_stats.wordsCount month_word_count.head() #filepath = conv.statsFolder + '\\' + 'wordCount.txt' #mio.printDataFrameToFile(stats, filepath) tot_month_word_count = month_stats.getWordsCount(['17','your','youth']) tot_month_word_count.head() mplot.plotWordsCount(month_stats, ['17','your','youth']) mplot.plotWordsCount(month_stats, ['17','your','youth'], sender='s1') # get data to plot (target words) target_words = ['your','youth'] stats_to_plot = statsUtil.transformStats(month_word_count[target_words], 'word', 'val') mplot._genericFactorPlot(stats_to_plot, 'month', 'val', {}, "Word count", "count", col='year', row='word') # load hours stats hour_stats = conv.stats.generateStats(IConvStats.STATS_NAME_WORDCOUNT, groupByColumns=['hour']) hour_word_count = hour_stats.wordsCount hour_word_count.head(3) # plot total for target words mplot.plotWordsCount(hour_stats, ['17','your','youth']) # get data to plot (target words) target_words = ['17','your','youth'] stats_to_plot = statsUtil.transformStats(hour_word_count[target_words], 'word', 'val') mplot._genericFactorPlot(stats_to_plot, 'hour', 'val', {}, "", "", row='word') # load month stats month_stats = conv.stats.generateStats(IConvStats.STATS_NAME_WORDCOUNT, groupByColumns=['year', 'month']) month_word_count = month_stats.wordsCount total_month_word_trend = month_stats._computeWordsTrend(month_word_count) total_month_word_trend.head() change_threshold = 20 total_month_word_trend[(total_month_word_trend>change_threshold)|(total_month_word_trend<(-change_threshold))]\ .dropna(axis=1, how='all').dropna(axis=0, how='all') total_month_word_trend.apply(lambda x:np.std(x), axis=0).sort_values(ascending=False)[:5] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Basics Step2: Converting to a different format Step3: Lengths, slicing and joining Step4: Non-byte aligned binary data Step5: Packing and unpacking Step6: Finding and replacing Step7: Bit-operations
<ASSISTANT_TASK:> Python Code: import bitstring from_hex = bitstring.BitArray('0x0001b3') from_bin = bitstring.BitArray('0b001100') from_oct = bitstring.BitArray('0o34100') from_int = bitstring.BitArray(uint=45, length=8) from_int_bigendian = bitstring.BitArray(intbe=-32768, length=16) from_float = bitstring.BitArray(float=10.3, length=32) # floats must be 32 or 64 bits long from_float_littleendian = bitstring.BitArray(floatle=-273.15, length=64) # floats must be 32 or 64 bits long from_raw = bitstring.BitArray(bytes=b'\x00\x01\x02\xff', length=28) from_bool = bitstring.BitArray(True) from_hex, from_bin, from_oct, from_int, from_int_bigendian, from_float, from_float_littleendian, from_raw, from_bool from_int.bin, from_int.bytes, from_int.uint, from_int.int, from_int.hex, from_float_littleendian.floatbe len(from_bool), len(from_float) from_int[-4:].bin, from_int[:4].int from_hex + from_int seven_bits = bitstring.BitArray(int=32, length=7) len(seven_bits), seven_bits.bin seven_bits.tobytes() # tobytes() ensures padding to byte-alignment packed = bitstring.pack('bool, int:7, floatbe:32', True, -32, -273.15) len(packed), packed.bin, packed.bytes packed.unpack('bool, int:7, floatbe:32') list(packed.find('0b0000')), list(packed.findall('0b0000')) packed.replace('0b0000', '0b1111') packed.bin packed.startswith('0b111'), packed.endswith('0b111') a = bitstring.BitArray('0b00001111') b = bitstring.BitArray('0b01010101') (a).bin, (~a).bin, (a<<2).bin, (a>>2).bin, (a*2).bin, (a&b).bin, (a|b).bin, (a^b).bin <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Viewing Sentences Line by Line Step2: <div class="alert alert-info"><font color=black>**NOTE** Step3: <div class="alert alert-info"><font color=black>**WORKAROUND Step4: Viewing Specific Entities Step5: Customizing Colors and Effects Step6: For more on applying CSS background colors and gradients, visit https
<ASSISTANT_TASK:> Python Code: # Perform standard imports import spacy nlp = spacy.load('en_core_web_sm') # Import the displaCy library from spacy import displacy doc = nlp(u'Over the last quarter Apple sold nearly 20 thousand iPods for a profit of $6 million. ' u'By contrast, Sony sold only 7 thousand Walkman music players.') displacy.render(doc, style='ent', jupyter=True) for sent in doc.sents: displacy.render(nlp(sent.text), style='ent', jupyter=True) doc2 = nlp(u'Over the last quarter Apple sold nearly 20 thousand iPods for a profit of $6 million. ' u'By contrast, my kids sold a lot of lemonade.') for sent in doc2.sents: displacy.render(nlp(sent.text), style='ent', jupyter=True) for sent in doc2.sents: docx = nlp(sent.text) if docx.ents: displacy.render(docx, style='ent', jupyter=True) else: print(docx.text) options = {'ents': ['ORG', 'PRODUCT']} displacy.render(doc, style='ent', jupyter=True, options=options) colors = {'ORG': 'linear-gradient(90deg, #aa9cfc, #fc9ce7)', 'PRODUCT': 'radial-gradient(yellow, green)'} options = {'ents': ['ORG', 'PRODUCT'], 'colors':colors} displacy.render(doc, style='ent', jupyter=True, options=options) displacy.serve(doc, style='ent', options=options) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Run standard preprocessing steps, see here. Step2: Now compare this with the reference clustering of PAGA preprint, Suppl. Fig. 12, available from here.
<ASSISTANT_TASK:> Python Code: import numpy as np import pandas as pd import scanpy.api as sc sc.settings.verbosity = 3 # verbosity: errors (0), warnings (1), info (2), hints (3) sc.settings.set_figure_params(dpi=70) # dots (pixels) per inch determine size of inline figures sc.logging.print_versions() adata = sc.read_10x_h5('./data/1M_neurons_neuron20k.h5') adata.var_names_make_unique() adata sc.pp.recipe_zheng17(adata) sc.tl.pca(adata) sc.pp.neighbors(adata) sc.tl.umap(adata) sc.tl.louvain(adata) sc.tl.paga(adata) sc.pl.paga_compare(adata, edges=True, threshold=0.05) anno = pd.read_csv('/Users/alexwolf/Dropbox/1M/louvain.csv.gz', compression='gzip', header=None, index_col=0) anno.columns = ['louvain_ref'] adata.obs['louvain_ref'] = anno.loc[adata.obs.index]['louvain_ref'].astype(str) sc.pl.umap(adata, color=['louvain_ref'], legend_loc='on data') adata.write('./write/subsampled.h5ad') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: So how should we query points? Step2: Solving for theta and finding the equivelent slope of the angle... Step3: It's actually pretty bad lol Step4: Next, we query OpenStreetMap for the map data! Step5: We need to turn the map into a usable graph structure now! Step6: Possible optimization here Step7: How nice! Now we need to decide what kind of edges we need to split on due to elevation differences. Let's test some stuff out. Step8: Note that all values are even since our graph is directed, so there are edges going in each direction. Here's a question Step9: I've seen better, but it's not worth doing anything about now. Road graphs are always kind of sparse, so I imagine this would increase somewhat linearly with edge total. Programming splitting sounds like a pain, though. I'll do it later (tm) Step10: Here comes that big dramatic |V|log|V| sort that all CS classes have been prepraring me for!! Step11: Well that was quick. Let's get to the «physics» Step12: Let's see what happens when we try to "integrate" this more precisely. Step13: Attempt #1
<ASSISTANT_TASK:> Python Code: import matplotlib.pyplot as plt import numpy as np # Data for plotting deg = np.arange(0.0, 90.01, 0.01) def deg2dist(deg): return 10.29 * np.cos(np.pi / 180 * deg) dist = deg2dist(deg) # Note that using plt.subplots below is equivalent to using # fig = plt.figure and then ax = fig.add_subplot(111) fig, ax = plt.subplots() ax.plot(deg, dist) ax.set(xlabel='degrees', ylabel='Distance', title='Distance between lines of longitude 1/3 arc second apart') ax.grid() fig.savefig("degrees_and_dist.png") plt.show() print("Notable Latitudes") print("49th parrallel (US-Canada border): ", deg2dist(49)) print("25.9 deg N (Brownsville, TX): ", deg2dist(25.9)) print("35.0 deg (LA): ", deg2dist(35.0)) print("40.7 deg (NYC): ", deg2dist(40.7)) g = -9.81 #accelertion due to gravity, m/s drag_c = .6 #drag coefficient of human body cross_a = .68 #Cross-sectional area of human body mass = 80 #kg frict_c = .03 #Coefficient of friction import math def acceleration_due_to_wind(v): return -v**2 * (1.225 * drag_c * cross_a) / (2 * mass) def acceleration_due_to_slope_no_friction(theta): return g * math.sin(theta) def equivalent_slope(v): return math.tan(math.asin(acceleration_due_to_wind(v) / g)) t = np.arange(0.0, 15.0, 0.01) s = [equivalent_slope(v) for v in t] plt.plot(t, s) plt.xlabel('Speed (m/s)') plt.ylabel('Equivalent Slope') plt.title('Comparing deceleration due to wind to accelerations due to upward slopes') plt.show() t = np.arange(0.0, 15.0, 0.01) s = [equivalent_slope(v) for v in t] t = t * 2.237 plt.plot(t, s) plt.xlabel('Speed (mph)') plt.ylabel('Equivalent Slope') plt.title('Comparing deceleration due to wind to accelerations due to upward slopes') plt.show() t = np.arange(0.0, 15.0, 0.01) s = [acceleration_due_to_wind(v)/(g) for v in t] t = t * 2.237 plt.plot(t, s) plt.xlabel('Speed (mph)') plt.ylabel('Equivalent Friction coefficient') plt.title('Comparing deceleration due to wind to accelerations due to friction coefficients on flat') plt.show() data = { 'north': 33.7874, 'west': -84.4203, 'south': 33.7677, 'east': -84.3812, } import wget from scan_product_links import urls import math import os us_urls = urls("elevationproductslinks/13secondplots.csv") mx_ca_urls = urls("elevationproductslinks/1secondplots.csv") def download_coords(data, country='United States'): # TODO check if request is gucci # TODO Remove the following block of code in production if country == 'United States': path_suffix = '_13' useful_urls = us_urls else: path_suffix = '_1' useful_urls = mx_ca_urls for lat in range( math.ceil(float(data['south'])), math.ceil(float(data['north'])) + 1 # Eg N 87.7 to N 86. ): for lng in range( math.floor(float(data['west'])), math.floor(float(data['east'])) + 1 ): fname = ('grd' + ('n' if lat>0 else 's') + str(abs(math.ceil(lat))).zfill(2) + ('e' if lng>=0 else 'w') + str(abs(math.floor(lng))).zfill(3)) database_path = ('elevationdata/' + fname + path_suffix + '/w001001.adf' ) if not os.path.exists(database_path): try: print("downloading" + useful_urls[(lat, lng)] + "\n") wget.download(useful_urls[(lat, lng)]) print("\n") file_name = useful_urls[(lat, lng)].split('/')[-1] archive = zipfile.ZipFile(file_name) for file in archive.namelist(): if file.startswith("grd" + fname[3:] + path_suffix + "/"): archive.extract(file, "elevationdata") os.remove(file_name) except (urllib.error.HTTPError): print("Could not download data for", (lat, lng)) except KeyError: print("Thing not found in urls: " (lat, lng)) download_coords(data) mapsize = ( data['west'], data['south'], data['east'], data['north'] ) import subprocess import math import osmapi import os.path import pickle def get_map_data(mapsize): mapfilepath = 'maps/map'+str(mapsize)+'.dat' # TODO Allow spanning countries # (west, south, east, north), string api_link = osmapi.OsmApi(#username='evanxq1@gmail.com', #password='hrVQ*DO9aD9q'#, #api="api06.dev.openstreetmap.org" ) try: if os.path.exists(mapfilepath): print('loading local map...') with open(mapfilepath, 'rb') as f: map_data = pickle.load(f) else: print('requesting map...') map_data = api_link.Map(mapsize[0], mapsize[1], mapsize[2], mapsize[3]) with open(mapfilepath, 'wb') as f: pickle.dump(map_data, f) # TODO delete this entire try block tbh except IOError as e: print("Couldn't write map data!", e.errorno, e.strerror) # except Error as e: # osmapi.OsmApi.MaximumRetryLimitReachedError: #TODO: handle errors # print(e.errorno, e.strerror) # print("Could not get map data!") # return False, [], [], [], [], [], [] return map_data get_map_data(mapsize) map_data = get_map_data(mapsize) # Todo add to node ititialziation class Node: def __init__(self, node_id, lat, lng, is_stoplight, adj): self.node_id = node_id self.lat = lat self.lng = lng self.is_stoplight = is_stoplight self.adj = adj self.edge_coords = None self.edge_elevations = [] self.edge_work = [] def __lt__(self, other): return False def __gt__(self, other): return False def create_adj_node_ptrs(self): self.adj_node_ptrs = list(nodes[adj_node_id] for adj_node_id in self.adj) # TODO support bridges data['allow_bridges'] = False data['banned_highway_types'] = [ 'motorway', 'trunk', 'service', 'steps', 'footway', 'pedestrian', 'sidewalk', 'path' ] # Also may include primary, secondary # Highway type descriptions https://wiki.openstreetmap.org/wiki/Key:highway # motorway: interstate # trunk: mostly grade-separated state/us highways, always with medians # primary: major roads # footway: exclusively pedestrians # sidewall: always on side of road # pedestrian: pedestrian oriented path, but not sidewalk # steps: stairsteps # path: trail # bridleway: horse trail from collections import defaultdict def map_to_graph(map_data): banned_types = set(data['banned_highway_types']) graph = defaultdict(set) for entry in map_data: if (entry['type'] == 'way' and 'data' in entry.keys() and 'tag' in entry['data'].keys() and 'highway' in entry['data']['tag'].keys() ): highway_type = entry['data']['tag']['highway'] else: # Is not labelled highway continue if (True and highway_type not in banned_types and (data['allow_bridges'] or ('bridge' not in entry['data']['tag'])) ): road_nodes = entry['data']['nd'] for i in range(len(road_nodes) - 1): graph[road_nodes[i]].add(road_nodes[i+1]) graph[road_nodes[i+1]].add(road_nodes[i]) return graph adj_list = map_to_graph(map_data) def get_node_entries(target_nodes, map_data): for item in map_data: item_id = item["data"]["id"] if item_id in target_nodes: yield (item_id, item) node_lat_lng = [] datapts_per_degree = 10800 def create_node_list_with_elevations(adj_list, map_data): nodes = dict() node_heights, node_latlons = dict(), dict() stoplights = set() for node_id, node_info in get_node_entries(adj_list.keys(), map_data): nodes[node_id] = Node( node_id, lat=float(node_info['data']['lat']), lng=float(node_info['data']['lon']), is_stoplight = ('tag' in node_info['data'] and 'highway' in node_info['data']['tag'] and node_info['data']['tag']['highway'] == 'traffic_signals' ), adj = list(adj_list[node_id]) ) return nodes nodes = create_node_list_with_elevations(adj_list, map_data) for node_id, node in nodes.items(): node.create_adj_node_ptrs() import numpy as np datapts_per_degree = 10800 def add_edges_return_queries(nodes): large_query = set() for node_id, node in nodes.items(): edge_coords = [] for adj_node in node.adj_node_ptrs: # Degrees aren't squares, so this isn't super valid, but it's not important. dist_in_degs = np.sqrt((node.lat - adj_node.lat)**2 + (node.lng - adj_node.lng)**2) n_steps = max(int(dist_in_degs * datapts_per_degree), 2) lat_steps = np.linspace(node.lat, adj_node.lat, num=n_steps, endpoint=True) lng_steps = np.linspace(node.lng, adj_node.lng, num=n_steps, endpoint=True) coords = list(zip(lat_steps, lng_steps)) edge_coords.append(coords) large_query.update(coords) node.edge_coords = edge_coords return large_query large_query = add_edges_return_queries(nodes) # Make sure each node's edges start with the same coordinates def test_edge_coords_start(nodes): for node_id, node in nodes.items(): first = (node.lat, node.lng) for edge in node.edge_coords: assert edge[0] == first test_edge_coords_start(nodes) # Make sure each node's edges end with the same coordinates # as its adjacent node's start with def test_edge_coords_end(nodes): for node_id, node in nodes.items(): assert len(node.edge_coords) == len(node.adj) == len(node.adj_node_ptrs) for i in range(len(node.adj_node_ptrs)): assert (node.adj_node_ptrs[i].lat, node.adj_node_ptrs[i].lng) == node.edge_coords[i][-1] test_edge_coords_end(nodes) from collections import defaultdict def build_query_text(large_query, country="United States"): queries = defaultdict(str) latlng_order = defaultdict(list) for lat_lng in large_query: lat, lng = lat_lng fname = ('grd' + ('n' if lat>0 else 's') + str(abs(math.ceil(lat))).zfill(2) + ('e' if lng>=0 else 'w') # lng = 0 block is all east I guess + str(abs(math.floor(lng))).zfill(3) ) s = str(lng) + ' ' + str(lat) + '\n' queries[fname] += s latlng_order[fname].append(lat_lng) return queries, latlng_order def query_elevations(queries, latlng_order, country="United States"): points = [] elevations = [] for fname in queries.keys(): if country == 'United States': # TODO deal with AK database_path = 'elevationdata/' + fname + '_13/w001001.adf' if country == 'Mexico' or country == 'Canada' or country == None: # TODO deal with country == None which would be sorta weird database_path = 'elevationdata/' + fname + '_1/w001001.adf' proc = subprocess.Popen( ['gdallocationinfo', database_path, '-valonly', '-geoloc'], stdin=subprocess.PIPE, stdout=subprocess.PIPE, universal_newlines=True ) output, err = proc.communicate(queries[fname]) elevations += [float(s) for s in output.splitlines()] points += latlng_order[fname] if len(points) != len(elevations): raise Exception("Error querying points: " + str(len(points)) + " points, " + str(len(elevations)) + " elevations") ret = dict() for i in range(len(points)): ret[points[i]] = elevations[i] return ret queries, latlng_order = build_query_text(large_query, country="United States") elevations = query_elevations(queries, latlng_order, country="United States") def set_node_elevations(nodes, elevations): for node_id, node in nodes.items(): for edge in node.edge_coords: elevation_list = [] for coord_pair in edge: elevation_list.append(elevations[coord_pair]) node.edge_elevations.append(elevation_list) set_node_elevations(nodes, elevations) deviations = [] high_deviations = [] low_deviations = [] for node_id, node in nodes.items(): for i, edge in enumerate(node.edge_elevations): bottom_end = min(edge[0], edge[-1]) top_end = max(edge[0], edge[-1]) top = max(edge) bottom = min(edge) deviations.append(max(top-top_end, bottom_end-bottom)) high_deviations.append(top-top_end) low_deviations.append(bottom_end-bottom) print(0, len(deviations)) print(.01, sum([i >= .01 for i in deviations])) print(.1, sum([i >= .1 for i in deviations])) print(.3, sum([i >= .3 for i in deviations])) print(1, sum([i >= 1 for i in deviations])) print(3, sum([i >= 3 for i in deviations])) print(5, sum([i >= 5 for i in deviations])) edges_to_scan = 0 for node_id, node in nodes.items(): for i, edge in enumerate(node.edge_elevations): bottom_end = min(edge[0], edge[-1]) top_end = max(edge[0], edge[-1]) top = max(edge) bottom = min(edge) edges_to_scan += len(node.edge_elevations) print(edges_to_scan/4) # over 4 rather than 2 since we only have to look at "opposite" nodes from the ones we split data['mass'] = 80 #kg data['init_speed'] = 1.0 data['use_stoplights'] = True def prep_graph(nodes): init_energy = .5 *data['mass'] * data['init_speed'] ** 2 for node_id, node in nodes.items(): node.energy = init_energy node.speed = data['init_speed'] node.prev_node = None node.next_nodes = set() node.path_start = node # TODO add to some other method node.elevation = node.edge_elevations[0][0] prep_graph(nodes) sorted_nodes = sorted(nodes.values(), key=lambda n: -n.elevation) g = -9.81 #accelertion due to gravity, m/s data['drag_c'] = .6 #drag coefficient of human body data['cross_a'] = .68 #Cross-sectional area of human body data['mass'] = 80 #kg data['frict_c'] = .03 #Coefficient of friction import math def prep_data_constants(data): data['c1'] = (1.225 * data['drag_c'] * data['cross_a']) / (2 * data['mass']) data['c2'] = g * data['frict_c'] def new_velocity(v0, dh, dist): # for small changes in V; dist is horizontal dist if v0 == 0: return 0 theta = math.atan2(dh, dist) # Original implementation # a = ((g * math.sin(theta)) # - (1.225 * drag_c * cross_a * v0 ** 2) / (2 * mass) # + (g * frict_c * math.cos(theta)) # ) # Prematurely optimized (tm) implementation a = ((g * math.sin(theta)) - v0 ** 2 * data['c1'] + math.cos(theta) * data['c2'] ) # Total Acceleration = grav, air resistance, rolling friction resistance # Assumes final velocity causes about the amount of air resistance as # inital velocity vel_sqr = 2 * a * math.sqrt(dist**2 + dh**2) + v0 ** 2 if vel_sqr > 0: return math.sqrt(vel_sqr) else: return 0 prep_data_constants(data) new_velocity(1.0, -2, 30) new_velocity(1.0, -1, 30) def new_velocity(v0, dh, dist, integrations=1): # for small changes in V; dist is horizontal dist if v0 == 0: return 0 theta = math.atan2(dh, dist) # Original implementation # a = ((g * math.sin(theta)) # - (1.225 * drag_c * cross_a * v0 ** 2) / (2 * mass) # + (g * frict_c * math.cos(theta)) # ) # Prematurely optimized (tm) implementation v = v0 dist_per_i = dist/integrations dh_per_i = dh/integrations for i in range(integrations): a = ((g * math.sin(theta)) - v ** 2 * data['c1'] + math.cos(theta) * data['c2'] ) # Total Acceleration = grav, air resistance, rolling friction resistance # Assumes final velocity causes about the amount of air resistance as # inital velocity vel_sqr = 2 * a * math.sqrt(dist_per_i**2 + dh_per_i**2) + v ** 2 if vel_sqr > 0: v = math.sqrt(vel_sqr) else: return 0 return v def new_velocity_no_friction(v0, dh, dist): # for small changes in V; dist is horizontal dist integrations=1 if v0 == 0: return 0 theta = math.atan2(dh, dist) # Original implementation # a = ((g * math.sin(theta)) # - (1.225 * drag_c * cross_a * v0 ** 2) / (2 * mass) # + (g * frict_c * math.cos(theta)) # ) # Prematurely optimized (tm) implementation v = v0 dist_per_i = dist/integrations dh_per_i = dh/integrations for i in range(integrations): a = ((g * math.sin(theta)) + math.cos(theta) * data['c2'] ) # Total Acceleration = grav, air resistance, rolling friction resistance # Assumes final velocity causes about the amount of air resistance as # inital velocity vel_sqr = 2 * a * math.sqrt(dist_per_i**2 + dh_per_i**2) + v ** 2 if vel_sqr > 0: v = math.sqrt(vel_sqr) else: return 0 return v new_velocity_no_friction(1.0, -1, 30) new_velocity(1.0, -1, 30, 1) new_velocity(1.0, -1, 30, 10) new_velocity(1.0, -1, 30, 100) new_velocity(1.0, -1, 30, 1000) new_velocity(1.0, -1, 30, 10000) new_velocity_no_friction(1.0, -2, 30) new_velocity(1.0, -2, 30, 1) new_velocity(1.0, -2, 30, 10) new_velocity(1.0, -2, 30, 100) new_velocity(1.0, -2, 30, 1000) new_velocity(1.0, -2, 30, 10000) def latlong_dist(lat1_raw, lon1_raw, lat2_raw, lon2_raw): lat1 = math.radians(float(lat1_raw)) lon1 = math.radians(float(lon1_raw)) lat2 = math.radians(float(lat2_raw)) lon2 = math.radians(float(lon2_raw)) # approximate radius of earth in m R = 6373000.0 dlon = lon2 - lon1 dlat = lat2 - lat1 a = (math.sin(dlat / 2)**2 + math.cos(lat1) * math.cos(lat2) * math.sin(dlon / 2)**2) c = 2 * math.atan2(math.sqrt(a), math.sqrt(1 - a)) distance = R * c return distance data['approx_frict_c'] = .03 def calculate_work(dist, dh): # Work done by gravity theta = math.atan2(dh, dist) a = ((g * math.sin(theta)) + math.cos(theta) * g * data['approx_frict_c'] ) real_dist = math.sqrt(dist**2 + dh**2) return real_dist * a * data['mass'] def find_work_all_edges(sorted_nodes): for node in sorted_nodes: node.edge_work = [] for i in range(len(node.adj)): edge_coords = node.edge_coords[i] edge_elevations = node.edge_elevations[i] work = 0 horiz_dist = latlong_dist(edge_coords[0][0], edge_coords[0][1], edge_coords[1][0], edge_coords[1][1]) for j in range(len(edge_coords) - 1): dh = edge_elevations[j+1] - edge_elevations[j] # horiz dist is actually same for each part of an edge # horiz_dist = latlong_dist(edge_coords[j][0], edge_coords[j][1], edge_coords[j+1][0], edge_coords[j+1][1]) work += calculate_work(horiz_dist, dh) node.edge_work.append(work) find_work_all_edges(sorted_nodes) import numpy as np import pylab as pl from matplotlib import collections as mc # lines = [[(0, 1), (1, 1)], [(2, 3), (3, 3)], [(1, 2), (1, 3)]] # c = np.array([(1, 0, 0, 1), (0, 1, 0, 1), (0, 0, 1, 1)]) def graph_paths(sorted_nodes): lines = [] colors = [] max_lat = -90 min_lat = 90 max_lng = -180 min_lng = 180 done = set() for node in sorted_nodes: max_lat = max(node.lat, max_lat) min_lat = min(node.lat, min_lat) max_lng = max(node.lng, max_lng) min_lng = min(node.lng, min_lng) for adj in node.next_nodes: if ((adj.lng,adj.lat), (node.lng, node.lat)) not in done: lines.append([(node.lng, node.lat),(adj.lng,adj.lat)]) done.add(((node.lng, node.lat),(adj.lng,adj.lat))) colors = [] for line in lines: beginning, end = line x1, y1 = beginning x2, y2 = end angle = math.atan2(x2-x1, y2-y1) colors.append((math.cos(angle) * .5 + .5, math.sin(angle) * .5 + .5, 0, 1)) lc = mc.LineCollection(lines, colors=colors, linewidths=1) fig, ax = pl.subplots(figsize=(16,10)) ax.add_collection(lc) # ax.autoscale() # ax.margins(0.001) ax.set_xlim(min_lng, max_lng) ax.set_ylim(min_lat, max_lat) plt.show() import numpy as np import pylab as pl from matplotlib import collections as mc # lines = [[(0, 1), (1, 1)], [(2, 3), (3, 3)], [(1, 2), (1, 3)]] # c = np.array([(1, 0, 0, 1), (0, 1, 0, 1), (0, 0, 1, 1)]) def generate_compass(): lines = [] for x in [-1, -.5, 0, .5, 1]: for y in [-1, -.5, 0, .5, 1]: if (x, y) != (0,0): lines.append([(0,0), ((x,y))]) colors = [] for line in lines: beginning, end = line x1, y1 = beginning x2, y2 = end angle = math.atan2(x2-x1, y2-y1) colors.append((math.cos(angle) * .5 + .5, math.sin(angle) * .5 + .5, 0, 1)) lc = mc.LineCollection(lines, colors=colors, linewidths=1) fig, ax = pl.subplots() ax.add_collection(lc) ax.autoscale() # ax.margins(0.001) plt.show() generate_compass() # Adding this for reference # class Node: # def __init__(self, node_id, lat, lng, is_stoplight, adj): # self.node_id = node_id # self.lat = lat # self.lng = lng # self.is_stoplight = is_stoplight # self.adj = adj # self.edge_coords = None # self.edge_elevations = [] # def create_adj_node_ptrs(self): # self.adj_node_ptrs = list(nodes[adj_node_id] for adj_node_id in self.adj) # node.speed = data['init_speed'] # node.prev_node = None # node.path_start = node # # TODO add to some other method # node.elevation = node.edge_elevations[0][0] # g = -9.81 #accelertion due to gravity, m/s # data['drag_c'] = .6 #drag coefficient of human body # data['cross_a'] = .68 #Cross-sectional area of human body # data['mass'] = 80 #kg # data['frict_c'] = .03 #Coefficient of friction # def prep_data_constants(data): # data['c1'] = (1.225 * data['drag_c'] * data['cross_a']) / (2 * data['mass']) # data['c2'] = g * data['frict_c'] from heapq import heappush, heappop def algo_1(sorted_nodes): edges_explored = 0 for top_node in sorted_nodes: if top_node.prev_node != None: # Already part of a path continue need_to_explore = set([top_node]) heap = [(-top_node.elevation, top_node)] while need_to_explore: _, node = heappop(heap) if node not in need_to_explore: continue need_to_explore.remove(node) node_energy = node.energy for i in range(len(node.adj)): adj = node.adj_node_ptrs[i] edge_work = node.edge_work[i] # For air resistance version, check first if # (node.speed > adj.speed or node.elevation > adj.elevaton) # then ride down nodes if edge_work + node_energy > adj.energy: adj.energy = edge_work + node_energy if adj.prev_node is not None: prev = adj.prev_node next_nodes = prev.next_nodes next_nodes.remove(adj) adj.prev_node = node node.next_nodes.add(adj) adj.path_start = top_node need_to_explore.add(adj) heappush(heap, (-adj.elevation, adj)) edges_explored += 1 return edges_explored prep_graph(nodes) # reset graph algo_1(sorted_nodes) graph_paths(sorted_nodes) def test_nodes(sorted_nodes): for node in sorted_nodes: for adj in node.adj_node_ptrs: if adj in node.next_nodes: assert adj.prev_node == node else: assert adj.prev_node != node test_nodes(sorted_nodes) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Preparing the data Step2: Counting word frequency Step3: Let's keep the first 10000 most frequent words. As Andrew noted, most of the words in the vocabulary are rarely used so they will have little effect on our predictions. Below, we'll sort vocab by the count value and keep the 10000 most frequent words. Step4: What's the last word in our vocabulary? We can use this to judge if 10000 is too few. If the last word is pretty common, we probably need to keep more words. Step5: The last word in our vocabulary shows up in 30 reviews out of 25000. I think it's fair to say this is a tiny proportion of reviews. We are probably fine with this number of words. Step6: Text to vector function Step7: If you do this right, the following code should return Step8: Now, run through our entire review data set and convert each review to a word vector. Step9: Train, Validation, Test sets Step10: Building the network Step11: Intializing the model Step12: Training the network Step13: Testing Step14: Try out your own text!
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import tensorflow as tf import tflearn from tflearn.data_utils import to_categorical reviews = pd.read_csv('reviews.txt', header=None) labels = pd.read_csv('labels.txt', header=None) from collections import Counter total_counts = Counter() for _, row in reviews.iterrows(): total_counts.update(row[0].split(' ')) print("Total words in data set: ", len(total_counts)) vocab = sorted(total_counts, key=total_counts.get, reverse=True)[:10000] print(vocab[:60]) print(vocab[-1], ': ', total_counts[vocab[-1]]) word2idx = {word: i for i, word in enumerate(vocab)} def text_to_vector(text): word_vector = np.zeros(len(vocab), dtype=np.int_) for word in text.split(' '): idx = word2idx.get(word, None) if idx is None: continue else: word_vector[idx] += 1 return np.array(word_vector) text_to_vector('The tea is for a party to celebrate ' 'the movie so she has no time for a cake')[:65] word_vectors = np.zeros((len(reviews), len(vocab)), dtype=np.int_) for ii, (_, text) in enumerate(reviews.iterrows()): word_vectors[ii] = text_to_vector(text[0]) # Printing out the first 5 word vectors word_vectors[:5, :23] Y = (labels=='positive').astype(np.int_) records = len(labels) shuffle = np.arange(records) np.random.shuffle(shuffle) test_fraction = 0.9 train_split, test_split = shuffle[:int(records*test_fraction)], shuffle[int(records*test_fraction):] trainX, trainY = word_vectors[train_split,:], to_categorical(Y.values[train_split, 0], 2) testX, testY = word_vectors[test_split,:], to_categorical(Y.values[test_split, 0], 2) trainY # Network building def build_model(): # This resets all parameters and variables, leave this here tf.reset_default_graph() # Inputs net = tflearn.input_data([None, 10000]) # Hidden layer(s) net = tflearn.fully_connected(net, 200, activation='ReLU') net = tflearn.fully_connected(net, 25, activation='ReLU') # Output layer net = tflearn.fully_connected(net, 2, activation='softmax') net = tflearn.regression(net, optimizer='sgd', learning_rate=0.1, loss='categorical_crossentropy') model = tflearn.DNN(net) return model model = build_model() # Training model.fit(trainX, trainY, validation_set=0.1, show_metric=True, batch_size=128, n_epoch=100) predictions = (np.array(model.predict(testX))[:,0] >= 0.5).astype(np.int_) test_accuracy = np.mean(predictions == testY[:,0], axis=0) print("Test accuracy: ", test_accuracy) # Helper function that uses your model to predict sentiment def test_sentence(sentence): positive_prob = model.predict([text_to_vector(sentence.lower())])[0][1] print('Sentence: {}'.format(sentence)) print('P(positive) = {:.3f} :'.format(positive_prob), 'Positive' if positive_prob > 0.5 else 'Negative') sentence = "Moonlight is by far the best movie of 2016." test_sentence(sentence) sentence = "It's amazing anyone could be talented enough to make something this spectacularly awful" test_sentence(sentence) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We can ask our talea for as many durations as we want. (Taleas output nonreduced fractions instead of durations. This is to allow talea output to model either durations or time signatures, depending on the application.) We include some negative values, which we will later interpret as rests. We can ask our talea for ten durations like this Step2: Let's use our talea to make notes and rests, stopping when the duration of the accumulated notes and rests sums to that of the four time signatures defined above Step3: To attach the four time signatures defined above, we must split our notes and rests at measure boundaries. Then we can attach a time signature to the first note or rest in each of the four selections that result Step4: Then we group our notes and rests by measure, and metrically respell each group Step5: Pitching notes Step6: Then we loop through pitched logical ties, pitching notes as we go Step7: Attaching articulations and dynamics Step8: We can use Abjad's run selector to loop through the runs in our music, attaching articulations and dynamics along the way
<ASSISTANT_TASK:> Python Code: pairs = [(4, 4), (3, 4), (7, 16), (6, 8)] time_signatures = [abjad.TimeSignature(_) for _ in pairs] durations = [_.duration for _ in time_signatures] time_signature_total = sum(durations) counts = [1, 2, -3, 4] denominator = 16 talea = rmakers.Talea(counts, denominator) talea_index = 0 talea[:10] events = [] accumulated_duration = abjad.Duration(0) while accumulated_duration < time_signature_total: duration = talea[talea_index] if 0 < duration: pitch = abjad.NamedPitch("c'") else: pitch = None duration = abs(duration) if time_signature_total < (duration + accumulated_duration): duration = time_signature_total - accumulated_duration events_ = abjad.LeafMaker()([pitch], [duration]) events.extend(events_) accumulated_duration += duration talea_index += 1 staff = abjad.Staff(events) abjad.show(staff) selections = abjad.mutate.split(staff[:], time_signatures, cyclic=True) for time_signature, selection in zip(time_signatures, selections): first_leaf = abjad.get.leaf(selection, 0) abjad.attach(time_signature, first_leaf) abjad.show(staff) measure_selections = abjad.select(staff).leaves().group_by_measure() for time_signature, measure_selection in zip(time_signatures, measure_selections): abjad.Meter.rewrite_meter(measure_selection, time_signature) abjad.show(staff) string = "d' fs' a' d'' g' ef'" strings = string.split() pitches = abjad.CyclicTuple(strings) plts = abjad.select(staff).logical_ties(pitched=True) for i, plt in enumerate(plts): pitch = pitches[i] for note in plt: note.written_pitch = pitch abjad.show(staff) for selection in abjad.select(staff).runs(): print(selection) for selection in abjad.select(staff).runs(): articulation = abjad.Articulation("tenuto") abjad.attach(articulation, selection[0]) if 3 <= len(selection): abjad.hairpin("p < f", selection) else: dynamic = abjad.Dynamic("ppp") abjad.attach(dynamic, selection[0]) abjad.override(staff).dynamic_line_spanner.staff_padding = 4 abjad.show(staff) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: for Step2: if & for 연습문제 Step3: comprehension Step4: practice
<ASSISTANT_TASK:> Python Code: a = 99 if a % 9 == 0: if a % 11 == 0: print '!!!' elif a % 10 ==0: print '???' else: print 'hahaha' x = 7 if (5 > x) and (x < 10): print 'oh!' a = [] if a: print 'right' else: print "empty" 5 == 6 5 != 6 a = 0 if not a == 0: print 'haha' count = 1 while count <=3: print count count += 1 print count print 'a' count = 1 while True: print count count += 1 if count > 3: break var = 7 while var > 0: var -= 1 if var == 5: continue print 'Current variable value :', var print 'Good bye!' nums = [1, 3, 5] position = 0 while position < len(nums): number = nums[position] if number % 2 == 0: print 'even number' break position += 1 else: print 'no even number' nums = [1, 3, 2, 5, 4, 6, 7, 9, 8] pos = 0 while pos < len(nums): print nums[pos], pos += 1 a = [1, 2, 3, 4] b = a print a == b a = [1, 2, 3, 4, 5] for i in a: print i nums = [1, 3, 2, 5, 4, 6, 7, 8, 9] for val in nums: print val, print for i in nums: print i, print for num in nums: print num, str = 'hello world' for char in str: print char capitals = {'korea' : 'seoul', 'japan' : 'tokyo', 'usa' : 'Washington D.C'} for country in capitals: print country, capitals[country] print '-' * 20 for key in capitals.keys(): print key print '-' * 20 for val in capitals.values(): print val print '-' * 20 for k, v in capitals.items(): print k, v nums = [1, 3, 2, 5, 4, 6, 7, 9, 8] for val in nums: print val, for i, _ in enumerate(nums): print 'value at index', i a = [1, 2, 3, 4] b = [2, 3, 4] for i in a: for j in b: print i, j nums = range(1, 101) for i in nums: if i % 2 == 0 or i % 11 ==0: print i, a = [22, 1, 3, 4, 7, 98, 21, 55, 87, 99, 19, 20, 45] minimum = a[0] for i in a[1:]: if minimum > i: minimum = i print minimum a = [22, 1, 3, 4, 7, 98, 21, 55, 87, 99, 19, 20, 45] sum1 = 0 for i in a: sum1 = sum1 + i print float(sum1)/len(a) nums = [1, 2, 3, 4, 5, 6] even_nums = [] for i in nums: if i % 2 == 0: even_nums.append(i) print even_nums nums = [1, 2, 3, 4, 5, 6] even_nums2 = [i for i in nums if i % 2 == 0] even_nums3 = [i + 3 for i in nums if i % 2 == 0] print even_nums2, even_nums3 nums2 = [i for i in nums] nums3 = [i**2 for i in nums] print nums2 print nums3 nums4 = [i for i in nums if i < 4] nums5 = [i**2 if i < 4 else i * 2 for i in nums] print nums4 print nums5 rows = range(1, 4) cols = range(1, 3) for row in rows: for col in cols: print row, col print '-' * 20 cells = [(row, col) for row in rows for col in cols] for row, col in cells: print row, col words = ['apple', 'banana', 'chicago', 'do', 'elephant'] dict1 = {} for w in words: dict1[w] = len(w) print dict1 words = ['apple', 'banana', 'chicago', 'do', 'elephant'] words_dict = {w: len(w) for w in words} print words_dict Celsius = [39.2, 36.5, 37.3, 37.8] F = [1.8 * c + 32 for c in Celsius] print F str1 = 'Today is very nice and I want to go out for dinner' temp = [ch for ch in str1 if ch == ' '] print len(temp) str1 = 'Today is very nice and I want to go out for dinner' vowels = 'aeiou' temp = [ch for ch in str1 if not ch in vowels] print ''.join(temp) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: From a sample of the RMS Titanic data, we can see the various features present for each passenger on the ship Step3: The very same sample of the RMS Titanic data now shows the Survived feature removed from the DataFrame. Note that data (the passenger data) and outcomes (the outcomes of survival) are now paired. That means for any passenger data.loc[i], they have the survival outcome outcome[i]. Step5: Tip Step6: Question 1 Step7: Answer Step9: Examining the survival statistics, a large majority of males did not survive the ship sinking. However, a majority of females did survive the ship sinking. Let's build on our previous prediction Step10: Question 2 Step11: Answer Step13: Examining the survival statistics, the majority of males younger than 10 survived the ship sinking, whereas most males age 10 or older did not survive the ship sinking. Let's continue to build on our previous prediction Step14: Question 3 Step15: Answer Step17: After exploring the survival statistics visualization, fill in the missing code below so that the function will make your prediction. Step18: Question 4
<ASSISTANT_TASK:> Python Code: import numpy as np import pandas as pd # RMS Titanic data visualization code from titanic_visualizations import survival_stats from IPython.display import display %matplotlib inline # Load the dataset in_file = 'titanic_data.csv' full_data = pd.read_csv(in_file) # Print the first few entries of the RMS Titanic data display(full_data.head()) # Store the 'Survived' feature in a new variable and remove it from the dataset outcomes = full_data['Survived'] data = full_data.drop('Survived', axis = 1) # Show the new dataset with 'Survived' removed display(data.head()) def accuracy_score(truth, pred): Returns accuracy score for input truth and predictions. # Ensure that the number of predictions matches number of outcomes if len(truth) == len(pred): # Calculate and return the accuracy as a percent return "Predictions have an accuracy of {:.2f}%.".format((truth == pred).mean()*100) else: return "Number of predictions does not match number of outcomes!" # Test the 'accuracy_score' function predictions = pd.Series(np.ones(5, dtype = int)) print accuracy_score(outcomes[:5], predictions) def predictions_0(data): Model with no features. Always predicts a passenger did not survive. predictions = [] for _, passenger in data.iterrows(): # Predict the survival of 'passenger' predictions.append(0) # Return our predictions return pd.Series(predictions) # Make the predictions predictions = predictions_0(data) print accuracy_score(outcomes, predictions) survival_stats(data, outcomes, 'Sex') def predictions_1(data): Model with one feature: - Predict a passenger survived if they are female. predictions = [] for _, passenger in data.iterrows(): # Remove the 'pass' statement below # and write your prediction conditions here if passenger['Sex'] == 'female': predictions.append(1) else: predictions.append(0) # Return our predictions return pd.Series(predictions) # Make the predictions predictions = predictions_1(data) print accuracy_score(outcomes, predictions) survival_stats(data, outcomes, 'Age', ["Sex == 'male'"]) def predictions_2(data): Model with two features: - Predict a passenger survived if they are female. - Predict a passenger survived if they are male and younger than 10. predictions = [] for _, passenger in data.iterrows(): # Remove the 'pass' statement below # and write your prediction conditions here if passenger['Sex'] == 'female' or (passenger['Sex'] == 'male' and passenger['Age'] < 10) : predictions.append(1) else: predictions.append(0) # Return our predictions return pd.Series(predictions) # Make the predictions predictions = predictions_2(data) print accuracy_score(outcomes, predictions) survival_stats(data, outcomes, 'SibSp', ["Sex == 'male'", "Age < 10"]) def predictions_3(data): Model with multiple features. Makes a prediction with an accuracy of at least 80%. predictions = [] for _, passenger in data.iterrows(): # Remove the 'pass' statement below # and write your prediction conditions here if passenger['Sex'] == 'female' and passenger['SibSp'] < 3 and passenger['Parch'] < 3: predictions.append(1) elif passenger['Sex'] == 'male' and passenger['Age'] < 10 and passenger['SibSp'] < 3: predictions.append(1) else: predictions.append(0) # Return our predictions return pd.Series(predictions) # Make the predictions predictions = predictions_3(data) print accuracy_score(outcomes, predictions) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Introducing randomized search Step2: We then run the random search Step3: Either grid search or randomized search is probably fine for tuning random forests. Step4: How does this compare an untuned SVM? What about an SVM with especially badly tuned hyperparams?
<ASSISTANT_TASK:> Python Code: import wget import pandas as pd import numpy as np from sklearn.cross_validation import train_test_split # Import the dataset data_url = 'https://raw.githubusercontent.com/nslatysheva/data_science_blogging/master/datasets/spam/spam_dataset.csv' dataset = wget.download(data_url) dataset = pd.read_csv(dataset, sep=",") # Convert dataframe to numpy array and split # data into input matrix X and class label vector y npArray = np.array(dataset) X = npArray[:,:-1].astype(float) y = npArray[:,-1] # Split into training and test sets XTrain, XTest, yTrain, yTest = train_test_split(X, y, random_state=1) from scipy.stats import uniform from scipy.stats import norm from sklearn.grid_search import RandomizedSearchCV from sklearn import metrics # Designate distributions to sample hyperparameters from n_estimators = np.random.uniform(25, 45, 5).astype(int) max_features = np.random.normal(20, 10, 5).astype(int) hyperparameters = {'n_estimators': list(n_estimators), 'max_features': list(max_features)} print hyperparameters from sklearn.ensemble import RandomForestClassifier # Run randomized search randomCV = RandomizedSearchCV(RandomForestClassifier(), param_distributions=hyperparameters, n_iter=10) randomCV.fit(XTrain, yTrain) # Identify optimal hyperparameter values best_n_estim = randomCV.best_params_['n_estimators'] best_max_features = randomCV.best_params_['max_features'] print("The best performing n_estimators value is: {:5.1f}".format(best_n_estim)) print("The best performing max_features value is: {:5.1f}".format(best_max_features)) # Train classifier using optimal hyperparameter values # We could have also gotten this model out from randomCV.best_estimator_ clfRDF = RandomForestClassifier(n_estimators=best_n_estim, max_features=best_max_features) clfRDF.fit(XTrain, yTrain) RF_predictions = clfRDF.predict(XTest) print (metrics.classification_report(yTest, RF_predictions)) print ("Overall Accuracy:", round(metrics.accuracy_score(yTest, RF_predictions),2)) from sklearn.svm import SVC # Search for good hyperparameter values # Specify values to grid search over g_range = 2. ** np.arange(-15, 5, step=5) C_range = 2. ** np.arange(-5, 15, step=5) hyperparameters = [{'gamma': g_range, 'C': C_range}] print hyperparameters from sklearn.grid_search import GridSearchCV from sklearn.svm import SVC # Grid search using cross-validation grid = GridSearchCV(SVC(), param_grid=hyperparameters, cv=10) grid.fit(XTrain, yTrain) bestG = grid.best_params_['gamma'] bestC = grid.best_params_['C'] # Train SVM and output predictions rbfSVM = SVC(kernel='rbf', C=bestC, gamma=bestG) rbfSVM.fit(XTrain, yTrain) SVM_predictions = rbfSVM.predict(XTest) print metrics.classification_report(yTest, SVM_predictions) print "Overall Accuracy:", round(metrics.accuracy_score(yTest, SVM_predictions),2) from sklearn.linear_model import LogisticRegression # Search for good hyperparameter values # Specify values to grid search over penalty = ["l1", "l2"] C_range = np.arange(0.1, 1.1, 0.1) hyperparameters = [{'penalty': penalty, 'C': C_range}] # Grid search using cross-validation grid = GridSearchCV(LogisticRegression(), param_grid=hyperparameters, cv=10) grid.fit(XTrain, yTrain) bestPenalty = grid.best_params_['penalty'] bestC = grid.best_params_['C'] print bestPenalty print bestC # Train model and output predictions classifier_logistic = LogisticRegression(penalty=bestPenalty, C=bestC) classifier_logistic_fit = classifier_logistic.fit(XTrain, yTrain) logistic_predictions = classifier_logistic_fit.predict(XTest) print metrics.classification_report(yTest, logistic_predictions) print "Overall Accuracy:", round(metrics.accuracy_score(yTest, logistic_predictions),2) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1 | Background Step2: 3.1 | Slicing the Organizational Data Step3: 3.2 | Joining the Organizational Data Step4: 4 | Network Summary Data Step5: 5 | Slicing the Final Output Step6: 6 | Visualizing the Data Step7: From the data above, we can see that this organization has a greater percentage of students who meet or exceed requirements for the 7 SEL indicators, except for Problem-Solving.
<ASSISTANT_TASK:> Python Code: import sys import pandas as pd import matplotlib.pyplot as plt import datetime as dt import seaborn as sns import numpy as np %matplotlib inline print('Python version:', sys.version) print('Pandas version: ', pd.__version__) print('Today: ', dt.date.today()) MaleFemale = "/Users/kavyabeheraj/Desktop/Current Classes/Data Bootcamp/Male_Female_Sample_Org_Output.csv" # Sample organizational output for males and females df = pd.read_csv(MaleFemale) df male = pd.read_csv(MaleFemale).head(14) female = pd.read_csv(MaleFemale).tail(14) mlmean = male.head(7) # Reads the first seven lines of the dataframe mlmean = mlmean[["Label","Mean"]].set_index("Label") # Slices only two columns and sets the index to be "Label" mlmean = mlmean.rename(index={"Academic Behavior" : "AcaBeh", "Academic Self-efficacy" : "AcaEf", "Growth Mindset" : "Growth", "Interpersonal Skills" : "Intp", "Problem Solving" : "Prob", "SELF-ADVOCACY" : "SelfAd", "BELONGING" : "Belong"}, columns={"Mean" : "Male Mean"}) mlmean mlpp = male.tail(7) # Reads the first seven lines of the dataframe mlpp = mlpp[["Label","Mean"]].set_index("Label") # Slices only two columns and sets the index to be "Label" mlpp = mlpp.rename(index={"Academic Behavior Percent Perfect" : "AcaBeh", "Academic Self-efficacy Percent Perfect" : "AcaEf", "Growth Mindset Percent Perfect" : "Growth", "Interpersonal Skills Percent Perfect" : "Intp", "Problem Solving Percent Perfect" : "Prob", "SELF ADVOCACY PERCENT PERFECT" : "SelfAd", "BELONGING PERCENT PERFECT ge 4" : "Belong"}, columns={"Mean" : "Male Percent Positive"}) mlpp fmmean = female.head(7) # Reads the first seven lines of the dataframe fmmean = fmmean[["Label","Mean"]].set_index("Label") # Slices only two columns and sets the index to be "Label" fmmean = fmmean.rename(index={"Academic Behavior" : "AcaBeh", "Academic Self-efficacy" : "AcaEf", "Growth Mindset" : "Growth", "Interpersonal Skills" : "Intp", "Problem Solving" : "Prob", "SELF-ADVOCACY" : "SelfAd", "BELONGING" : "Belong"}, columns={"Mean" : "Female Mean"}) fmmean fmpp = female.tail(7) fmpp = fmpp[["Label","Mean"]].set_index("Label") fmpp = fmpp.rename(index={"Academic Behavior Percent Perfect" : "AcaBeh", "Academic Self-efficacy Percent Perfect" : "AcaEf", "Growth Mindset Percent Perfect" : "Growth", "Interpersonal Skills Percent Perfect" : "Intp", "Problem Solving Percent Perfect" : "Prob", "SELF ADVOCACY PERCENT PERFECT" : "SelfAd", "BELONGING PERCENT PERFECT ge 4" : "Belong"}, columns={"Mean" : "Female Percent Positive"}) fmpp mean = pd.concat([mlmean, fmmean], axis=1) mean ppos = pd.concat([mlpp, fmpp], axis=1) ppos meanppos = pd.concat([mlpp, fmpp, mlmean, fmmean], axis=1) meanppos mean.plot.barh(figsize = (10,7)) df2 = "/Users/kavyabeheraj/Desktop/Current Classes/Data Bootcamp/Network_Summary_Gender.csv" network = pd.read_csv(df2) network mlnet = network.tail(7) mlnet = mlnet[["label","mean", "percentPositive"]].set_index("label") mlnet = mlnet.rename(index={"Academic Behavior" : "AcaBeh", "Academic Self-efficacy" : "AcaEf", "Growth Mindset" : "Growth", "Interpersonal Skills" : "Intp", "Problem Solving" : "Prob", "Self-Advocacy" : "SelfAd", "Belonging" : "Belong"}, columns={"mean" : "Male Mean, Network", "percentPositive" : "Male Percent Positive, Network"}) mlnet fmnet = network[7:14] fmnet = fmnet[["label","mean", "percentPositive"]].set_index("label") fmnet = fmnet.rename(index={"Academic Behavior" : "AcaBeh", "Academic Self-efficacy" : "AcaEf", "Growth Mindset" : "Growth", "Interpersonal Skills" : "Intp", "Problem Solving" : "Prob", "Self-Advocacy" : "SelfAd", "Belonging" : "Belong"}, columns={"mean" : "Female Mean, Network", "percentPositive" : "Female Percent Positive, Network"}) fmnet output = pd.concat([meanppos, fmnet, mlnet ], axis=1) output mean_output = output[["Male Mean", "Female Mean", "Male Mean, Network", "Female Mean, Network"]] mean_output pp_output = output[["Male Percent Positive", "Male Percent Positive, Network", "Female Percent Positive", "Female Percent Positive, Network"]] pp_output mean_net = output[["Male Mean, Network", "Female Mean, Network"]] mean_net ppos_net = output[["Male Percent Positive, Network", "Female Percent Positive, Network"]] ppos_net plt.style.use('seaborn-pastel') ax = ppos_net.plot(linestyle='-', marker='o', colormap = "Accent") ppos.plot(kind='bar', colormap = "Pastel2", ax=ax, figsize = (10,7)) ax.set_ylim(0, 0.8) ax.set_title("Percent Positive Male and Female SEL Outcomes, Organization vs. Network") plt.style.use('seaborn-pastel') ax = mean_net.plot(linestyle='-', marker='o', colormap = "Accent") mean.plot(kind='bar', colormap = "Pastel2", ax=ax, figsize = (10,7)) ax.set_ylim(0, 5) ax.set_title("Mean Male and Female SEL Outcomes, Organization vs. Network") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Computational Graph Step2: Session Step3: More complicated computations can be performed by combining Tensor nodes with Operation nodes. Use the tf.add node to mathematically add node1 and node2 Step4: Placeholders Step5: Make the graph more complex by adding another operation Step6: Variables Step7: Initialize all variables with a special operation. Until this point, they are uninitialized Step8: Because x is a placeholder, linear_model can be evaluated for several x values simultaneously Step9: Loss Function Step10: The values of W and b need to be updated in order to get a perfect fit. We can manually figure out what they should be in order to get the right y output (with a loss of 0) Step11: tf.train API Step12: The above values are the final model parameters which minimize the loss function! Step13: TensorBoard Graphs
<ASSISTANT_TASK:> Python Code: import tensorflow as tf node1 = tf.constant(3.0, dtype=tf.float32) node2 = tf.constant(4.0) # also tf.float32 implicitly print(node1, node2) sess = tf.Session() print(sess.run([node1, node2])) node3 = tf.add(node1, node2) print(node3) print(sess.run(node3)) a = tf.placeholder(tf.float32) b = tf.placeholder(tf.float32) adder_node = a + b # + provides a shortcut for tf.add(a, b) print(sess.run(adder_node, {a: 3, b: 4.5})) print(sess.run(adder_node, {a: [1, 3], b: [2, 4]})) add_and_triple = adder_node * 3. print(sess.run(add_and_triple, {a: 3, b: 4.5})) W = tf.Variable([.3], dtype=tf.float32) b = tf.Variable([-.3], dtype=tf.float32) x = tf.placeholder(tf.float32) linear_model = W * x + b init = tf.global_variables_initializer() sess.run(init) Sessionprint(sess.run(linear_model, {x: [1, 2, 3, 4]})) y = tf.placeholder(tf.float32) squared_deltas = tf.square(linear_model - y) loss = tf.reduce_sum(squared_deltas) print(sess.run(loss, {x: [1, 2, 3, 4], y: [0, -1, -2, -3]})) fixW = tf.assign(W, [-1.]) fixb = tf.assign(b, [1.]) sess.run([fixW, fixb]) print(sess.run(loss, {x: [1, 2, 3, 4], y: [0, -1, -2, -3]})) optimizer = tf.train.GradientDescentOptimizer(0.01) train = optimizer.minimize(loss) sess.run(init) # reset values to incorrect defaults. for i in range(1000): sess.run(train, {x: [1, 2, 3, 4], y: [0, -1, -2, -3]}) print(sess.run([W, b])) # Model parameters W = tf.Variable([.3], dtype=tf.float32) b = tf.Variable([-.3], dtype=tf.float32) # Model input and output x = tf.placeholder(tf.float32) linear_model = W * x + b y = tf.placeholder(tf.float32) # loss loss = tf.reduce_sum(tf.square(linear_model - y)) # sum of the squares # optimizer optimizer = tf.train.GradientDescentOptimizer(0.01) train = optimizer.minimize(loss) # training data x_train = [1, 2, 3, 4] y_train = [0, -1, -2, -3] # training loop init = tf.global_variables_initializer() sess = tf.Session() sess.run(init) # reset values to wrong for i in range(1000): sess.run(train, {x: x_train, y: y_train}) # evaluate training accuracy curr_W, curr_b, curr_loss = sess.run([W, b, loss], {x: x_train, y: y_train}) print("W: %s b: %s loss: %s"%(curr_W, curr_b, curr_loss)) g = tf.Graph() with g.as_default(): a = tf.placeholder(tf.float32, name="node1") b = tf.placeholder(tf.float32, name="node2") c = a + b tf.summary.FileWriter("logs", g).close() #from this notebook's directory run > tensorboard --logdir=logs #then open TensorBoard at: http://localhost:6006/#graphs <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 深度卷积生成对抗网络 Step2: 加载和准备数据集 Step3: 创建模型 Step4: 使用(尚未训练的)生成器创建一张图片。 Step5: 判别器 Step6: 使用(尚未训练的)判别器对所生成的图像进行真伪分类。模型将被训练为对真实图像输出正值,对伪造图像输出负值。 Step7: 定义损失函数和优化器 Step8: 判别器损失 Step9: 生成器损失 Step10: 判别器和生成器优化器不同,因为您将分别训练两个网络。 Step11: 保存检查点 Step12: 定义训练循环 Step13: 训练循环在生成器接收到一个随机种子作为输入时开始。该种子用于生成一个图像。判别器随后被用于对真实图像(选自训练集)和伪造图像(由生成器生成)进行分类。为每一个模型计算损失,并使用梯度更新生成器和判别器。 Step14: 生成与保存图片 Step15: 训练模型 Step16: 恢复最新的检查点。 Step17: 创建 GIF Step18: 使用训练过程中生成的图片通过 imageio 生成动态 gif
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import tensorflow as tf tf.__version__ # To generate GIFs !pip install imageio !pip install git+https://github.com/tensorflow/docs import glob import imageio import matplotlib.pyplot as plt import numpy as np import os import PIL from tensorflow.keras import layers import time from IPython import display (train_images, train_labels), (_, _) = tf.keras.datasets.mnist.load_data() train_images = train_images.reshape(train_images.shape[0], 28, 28, 1).astype('float32') train_images = (train_images - 127.5) / 127.5 # Normalize the images to [-1, 1] BUFFER_SIZE = 60000 BATCH_SIZE = 256 # Batch and shuffle the data train_dataset = tf.data.Dataset.from_tensor_slices(train_images).shuffle(BUFFER_SIZE).batch(BATCH_SIZE) def make_generator_model(): model = tf.keras.Sequential() model.add(layers.Dense(7*7*256, use_bias=False, input_shape=(100,))) model.add(layers.BatchNormalization()) model.add(layers.LeakyReLU()) model.add(layers.Reshape((7, 7, 256))) assert model.output_shape == (None, 7, 7, 256) # Note: None is the batch size model.add(layers.Conv2DTranspose(128, (5, 5), strides=(1, 1), padding='same', use_bias=False)) assert model.output_shape == (None, 7, 7, 128) model.add(layers.BatchNormalization()) model.add(layers.LeakyReLU()) model.add(layers.Conv2DTranspose(64, (5, 5), strides=(2, 2), padding='same', use_bias=False)) assert model.output_shape == (None, 14, 14, 64) model.add(layers.BatchNormalization()) model.add(layers.LeakyReLU()) model.add(layers.Conv2DTranspose(1, (5, 5), strides=(2, 2), padding='same', use_bias=False, activation='tanh')) assert model.output_shape == (None, 28, 28, 1) return model generator = make_generator_model() noise = tf.random.normal([1, 100]) generated_image = generator(noise, training=False) plt.imshow(generated_image[0, :, :, 0], cmap='gray') def make_discriminator_model(): model = tf.keras.Sequential() model.add(layers.Conv2D(64, (5, 5), strides=(2, 2), padding='same', input_shape=[28, 28, 1])) model.add(layers.LeakyReLU()) model.add(layers.Dropout(0.3)) model.add(layers.Conv2D(128, (5, 5), strides=(2, 2), padding='same')) model.add(layers.LeakyReLU()) model.add(layers.Dropout(0.3)) model.add(layers.Flatten()) model.add(layers.Dense(1)) return model discriminator = make_discriminator_model() decision = discriminator(generated_image) print (decision) # This method returns a helper function to compute cross entropy loss cross_entropy = tf.keras.losses.BinaryCrossentropy(from_logits=True) def discriminator_loss(real_output, fake_output): real_loss = cross_entropy(tf.ones_like(real_output), real_output) fake_loss = cross_entropy(tf.zeros_like(fake_output), fake_output) total_loss = real_loss + fake_loss return total_loss def generator_loss(fake_output): return cross_entropy(tf.ones_like(fake_output), fake_output) generator_optimizer = tf.keras.optimizers.Adam(1e-4) discriminator_optimizer = tf.keras.optimizers.Adam(1e-4) checkpoint_dir = './training_checkpoints' checkpoint_prefix = os.path.join(checkpoint_dir, "ckpt") checkpoint = tf.train.Checkpoint(generator_optimizer=generator_optimizer, discriminator_optimizer=discriminator_optimizer, generator=generator, discriminator=discriminator) EPOCHS = 50 noise_dim = 100 num_examples_to_generate = 16 # You will reuse this seed overtime (so it's easier) # to visualize progress in the animated GIF) seed = tf.random.normal([num_examples_to_generate, noise_dim]) # Notice the use of `tf.function` # This annotation causes the function to be "compiled". @tf.function def train_step(images): noise = tf.random.normal([BATCH_SIZE, noise_dim]) with tf.GradientTape() as gen_tape, tf.GradientTape() as disc_tape: generated_images = generator(noise, training=True) real_output = discriminator(images, training=True) fake_output = discriminator(generated_images, training=True) gen_loss = generator_loss(fake_output) disc_loss = discriminator_loss(real_output, fake_output) gradients_of_generator = gen_tape.gradient(gen_loss, generator.trainable_variables) gradients_of_discriminator = disc_tape.gradient(disc_loss, discriminator.trainable_variables) generator_optimizer.apply_gradients(zip(gradients_of_generator, generator.trainable_variables)) discriminator_optimizer.apply_gradients(zip(gradients_of_discriminator, discriminator.trainable_variables)) def train(dataset, epochs): for epoch in range(epochs): start = time.time() for image_batch in dataset: train_step(image_batch) # Produce images for the GIF as you go display.clear_output(wait=True) generate_and_save_images(generator, epoch + 1, seed) # Save the model every 15 epochs if (epoch + 1) % 15 == 0: checkpoint.save(file_prefix = checkpoint_prefix) print ('Time for epoch {} is {} sec'.format(epoch + 1, time.time()-start)) # Generate after the final epoch display.clear_output(wait=True) generate_and_save_images(generator, epochs, seed) def generate_and_save_images(model, epoch, test_input): # Notice `training` is set to False. # This is so all layers run in inference mode (batchnorm). predictions = model(test_input, training=False) fig = plt.figure(figsize=(4, 4)) for i in range(predictions.shape[0]): plt.subplot(4, 4, i+1) plt.imshow(predictions[i, :, :, 0] * 127.5 + 127.5, cmap='gray') plt.axis('off') plt.savefig('image_at_epoch_{:04d}.png'.format(epoch)) plt.show() train(train_dataset, EPOCHS) checkpoint.restore(tf.train.latest_checkpoint(checkpoint_dir)) # Display a single image using the epoch number def display_image(epoch_no): return PIL.Image.open('image_at_epoch_{:04d}.png'.format(epoch_no)) display_image(EPOCHS) anim_file = 'dcgan.gif' with imageio.get_writer(anim_file, mode='I') as writer: filenames = glob.glob('image*.png') filenames = sorted(filenames) for filename in filenames: image = imageio.imread(filename) writer.append_data(image) image = imageio.imread(filename) writer.append_data(image) import tensorflow_docs.vis.embed as embed embed.embed_file(anim_file) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: TF Lattice 预制模型 Step2: 导入所需的软件包: Step3: 下载 UCI Statlog (Heart) 数据集: Step4: 提取特征和标签并将它们转换为张量: Step5: 设置用于在本指南中进行训练的默认值: Step6: 特征配置 Step7: 定义我们的特征配置 Step8: 接下来,我们需要确保为使用自定义词汇表的特征(例如上面的“thal”)正确设置单调性。 Step9: 校准线性模型 Step10: 现在,与任何其他 tf.keras.Model 一样,我们编译该模型并将其拟合到我们的数据中。 Step11: 训练完模型后,我们可以在测试集中对其进行评估。 Step12: 校准点阵模型 Step13: 和以前一样,我们编译、拟合并评估我们的模型。 Step14: 校准点阵集成模型 Step15: 和以前一样,我们编译、拟合并评估我们的模型。 Step16: 随机点阵集成 Step17: 和以前一样,我们编译、拟合并评估我们的模型。 Step18: RTL 层随机点阵集成 Step19: 和以前一样,我们编译、拟合并评估我们的模型。 Step20: 晶体点阵集成 Step21: 和以前一样,我们编译、拟合并评估我们的模型。
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. #@test {"skip": true} !pip install tensorflow-lattice pydot import tensorflow as tf import copy import logging import numpy as np import pandas as pd import sys import tensorflow_lattice as tfl logging.disable(sys.maxsize)[ASDF] csv_file = tf.keras.utils.get_file( 'heart.csv', 'http://storage.googleapis.com/download.tensorflow.org/data/heart.csv') df = pd.read_csv(csv_file) train_size = int(len(df) * 0.8) train_dataframe = df[:train_size] test_dataframe = df[train_size:] df.head()[ASDF] # Features: # - age # - sex # - cp chest pain type (4 values) # - trestbps resting blood pressure # - chol serum cholestoral in mg/dl # - fbs fasting blood sugar > 120 mg/dl # - restecg resting electrocardiographic results (values 0,1,2) # - thalach maximum heart rate achieved # - exang exercise induced angina # - oldpeak ST depression induced by exercise relative to rest # - slope the slope of the peak exercise ST segment # - ca number of major vessels (0-3) colored by flourosopy # - thal 3 = normal; 6 = fixed defect; 7 = reversable defect # # This ordering of feature names will be the exact same order that we construct # our model to expect. feature_names = [ 'age', 'sex', 'cp', 'chol', 'fbs', 'trestbps', 'thalach', 'restecg', 'exang', 'oldpeak', 'slope', 'ca', 'thal' ] feature_name_indices = {name: index for index, name in enumerate(feature_names)} # This is the vocab list and mapping we will use for the 'thal' categorical # feature. thal_vocab_list = ['normal', 'fixed', 'reversible'] thal_map = {category: i for i, category in enumerate(thal_vocab_list)}[ASDF] # Custom function for converting thal categories to buckets def convert_thal_features(thal_features): # Note that two examples in the test set are already converted. return np.array([ thal_map[feature] if feature in thal_vocab_list else feature for feature in thal_features ]) # Custom function for extracting each feature. def extract_features(dataframe, label_name='target', feature_names=feature_names): features = [] for feature_name in feature_names: if feature_name == 'thal': features.append( convert_thal_features(dataframe[feature_name].values).astype(float)) else: features.append(dataframe[feature_name].values.astype(float)) labels = dataframe[label_name].values.astype(float) return features, labels train_xs, train_ys = extract_features(train_dataframe) test_xs, test_ys = extract_features(test_dataframe) # Let's define our label minimum and maximum. min_label, max_label = float(np.min(train_ys)), float(np.max(train_ys)) # Our lattice models may have predictions above 1.0 due to numerical errors. # We can subtract this small epsilon value from our output_max to make sure we # do not predict values outside of our label bound. numerical_error_epsilon = 1e-5 LEARNING_RATE = 0.01 BATCH_SIZE = 128 NUM_EPOCHS = 500 PREFITTING_NUM_EPOCHS = 10 def compute_quantiles(features, num_keypoints=10, clip_min=None, clip_max=None, missing_value=None): # Clip min and max if desired. if clip_min is not None: features = np.maximum(features, clip_min) features = np.append(features, clip_min) if clip_max is not None: features = np.minimum(features, clip_max) features = np.append(features, clip_max) # Make features unique. unique_features = np.unique(features) # Remove missing values if specified. if missing_value is not None: unique_features = np.delete(unique_features, np.where(unique_features == missing_value)) # Compute and return quantiles over unique non-missing feature values. return np.quantile( unique_features, np.linspace(0., 1., num=num_keypoints), interpolation='nearest').astype(float) # Feature configs are used to specify how each feature is calibrated and used. feature_configs = [ tfl.configs.FeatureConfig( name='age', lattice_size=3, monotonicity='increasing', # We must set the keypoints manually. pwl_calibration_num_keypoints=5, pwl_calibration_input_keypoints=compute_quantiles( train_xs[feature_name_indices['age']], num_keypoints=5, clip_max=100), # Per feature regularization. regularizer_configs=[ tfl.configs.RegularizerConfig(name='calib_wrinkle', l2=0.1), ], ), tfl.configs.FeatureConfig( name='sex', num_buckets=2, ), tfl.configs.FeatureConfig( name='cp', monotonicity='increasing', # Keypoints that are uniformly spaced. pwl_calibration_num_keypoints=4, pwl_calibration_input_keypoints=np.linspace( np.min(train_xs[feature_name_indices['cp']]), np.max(train_xs[feature_name_indices['cp']]), num=4), ), tfl.configs.FeatureConfig( name='chol', monotonicity='increasing', # Explicit input keypoints initialization. pwl_calibration_input_keypoints=[126.0, 210.0, 247.0, 286.0, 564.0], # Calibration can be forced to span the full output range by clamping. pwl_calibration_clamp_min=True, pwl_calibration_clamp_max=True, # Per feature regularization. regularizer_configs=[ tfl.configs.RegularizerConfig(name='calib_hessian', l2=1e-4), ], ), tfl.configs.FeatureConfig( name='fbs', # Partial monotonicity: output(0) <= output(1) monotonicity=[(0, 1)], num_buckets=2, ), tfl.configs.FeatureConfig( name='trestbps', monotonicity='decreasing', pwl_calibration_num_keypoints=5, pwl_calibration_input_keypoints=compute_quantiles( train_xs[feature_name_indices['trestbps']], num_keypoints=5), ), tfl.configs.FeatureConfig( name='thalach', monotonicity='decreasing', pwl_calibration_num_keypoints=5, pwl_calibration_input_keypoints=compute_quantiles( train_xs[feature_name_indices['thalach']], num_keypoints=5), ), tfl.configs.FeatureConfig( name='restecg', # Partial monotonicity: output(0) <= output(1), output(0) <= output(2) monotonicity=[(0, 1), (0, 2)], num_buckets=3, ), tfl.configs.FeatureConfig( name='exang', # Partial monotonicity: output(0) <= output(1) monotonicity=[(0, 1)], num_buckets=2, ), tfl.configs.FeatureConfig( name='oldpeak', monotonicity='increasing', pwl_calibration_num_keypoints=5, pwl_calibration_input_keypoints=compute_quantiles( train_xs[feature_name_indices['oldpeak']], num_keypoints=5), ), tfl.configs.FeatureConfig( name='slope', # Partial monotonicity: output(0) <= output(1), output(1) <= output(2) monotonicity=[(0, 1), (1, 2)], num_buckets=3, ), tfl.configs.FeatureConfig( name='ca', monotonicity='increasing', pwl_calibration_num_keypoints=4, pwl_calibration_input_keypoints=compute_quantiles( train_xs[feature_name_indices['ca']], num_keypoints=4), ), tfl.configs.FeatureConfig( name='thal', # Partial monotonicity: # output(normal) <= output(fixed) # output(normal) <= output(reversible) monotonicity=[('normal', 'fixed'), ('normal', 'reversible')], num_buckets=3, # We must specify the vocabulary list in order to later set the # monotonicities since we used names and not indices. vocabulary_list=thal_vocab_list, ), ][ASDF] tfl.premade_lib.set_categorical_monotonicities(feature_configs) # Model config defines the model structure for the premade model. linear_model_config = tfl.configs.CalibratedLinearConfig( feature_configs=feature_configs[:5], use_bias=True, # We must set the output min and max to that of the label. output_min=min_label, output_max=max_label, output_calibration=True, output_calibration_num_keypoints=10, output_initialization=np.linspace(min_label, max_label, num=10), regularizer_configs=[ # Regularizer for the output calibrator. tfl.configs.RegularizerConfig(name='output_calib_hessian', l2=1e-4), ]) # A CalibratedLinear premade model constructed from the given model config. linear_model = tfl.premade.CalibratedLinear(linear_model_config) # Let's plot our model. tf.keras.utils.plot_model(linear_model, show_layer_names=False, rankdir='LR') linear_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), metrics=[tf.keras.metrics.AUC()], optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) linear_model.fit( train_xs[:5], train_ys, epochs=NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False)[ASDF] print('Test Set Evaluation...') print(linear_model.evaluate(test_xs[:5], test_ys))[ASDF] # This is a calibrated lattice model: inputs are calibrated, then combined # non-linearly using a lattice layer. lattice_model_config = tfl.configs.CalibratedLatticeConfig( feature_configs=feature_configs[:5], output_min=min_label, output_max=max_label - numerical_error_epsilon, output_initialization=[min_label, max_label], regularizer_configs=[ # Torsion regularizer applied to the lattice to make it more linear. tfl.configs.RegularizerConfig(name='torsion', l2=1e-2), # Globally defined calibration regularizer is applied to all features. tfl.configs.RegularizerConfig(name='calib_hessian', l2=1e-2), ]) # A CalibratedLattice premade model constructed from the given model config. lattice_model = tfl.premade.CalibratedLattice(lattice_model_config) # Let's plot our model. tf.keras.utils.plot_model(lattice_model, show_layer_names=False, rankdir='LR') lattice_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), metrics=[tf.keras.metrics.AUC()], optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) lattice_model.fit( train_xs[:5], train_ys, epochs=NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False) print('Test Set Evaluation...') print(lattice_model.evaluate(test_xs[:5], test_ys))[ASDF] # This is a calibrated lattice ensemble model: inputs are calibrated, then # combined non-linearly and averaged using multiple lattice layers. explicit_ensemble_model_config = tfl.configs.CalibratedLatticeEnsembleConfig( feature_configs=feature_configs, lattices=[['trestbps', 'chol', 'ca'], ['fbs', 'restecg', 'thal'], ['fbs', 'cp', 'oldpeak'], ['exang', 'slope', 'thalach'], ['restecg', 'age', 'sex']], num_lattices=5, lattice_rank=3, output_min=min_label, output_max=max_label - numerical_error_epsilon, output_initialization=[min_label, max_label]) # A CalibratedLatticeEnsemble premade model constructed from the given # model config. explicit_ensemble_model = tfl.premade.CalibratedLatticeEnsemble( explicit_ensemble_model_config) # Let's plot our model. tf.keras.utils.plot_model( explicit_ensemble_model, show_layer_names=False, rankdir='LR') explicit_ensemble_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), metrics=[tf.keras.metrics.AUC()], optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) explicit_ensemble_model.fit( train_xs, train_ys, epochs=NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False) print('Test Set Evaluation...') print(explicit_ensemble_model.evaluate(test_xs, test_ys)) # This is a calibrated lattice ensemble model: inputs are calibrated, then # combined non-linearly and averaged using multiple lattice layers. random_ensemble_model_config = tfl.configs.CalibratedLatticeEnsembleConfig( feature_configs=feature_configs, lattices='random', num_lattices=5, lattice_rank=3, output_min=min_label, output_max=max_label - numerical_error_epsilon, output_initialization=[min_label, max_label], random_seed=42) # Now we must set the random lattice structure and construct the model. tfl.premade_lib.set_random_lattice_ensemble(random_ensemble_model_config) # A CalibratedLatticeEnsemble premade model constructed from the given # model config. random_ensemble_model = tfl.premade.CalibratedLatticeEnsemble( random_ensemble_model_config) # Let's plot our model. tf.keras.utils.plot_model( random_ensemble_model, show_layer_names=False, rankdir='LR') random_ensemble_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), metrics=[tf.keras.metrics.AUC()], optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) random_ensemble_model.fit( train_xs, train_ys, epochs=NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False) print('Test Set Evaluation...') print(random_ensemble_model.evaluate(test_xs, test_ys)) # Make sure our feature configs have the same lattice size, no per-feature # regularization, and only monotonicity constraints. rtl_layer_feature_configs = copy.deepcopy(feature_configs) for feature_config in rtl_layer_feature_configs: feature_config.lattice_size = 2 feature_config.unimodality = 'none' feature_config.reflects_trust_in = None feature_config.dominates = None feature_config.regularizer_configs = None # This is a calibrated lattice ensemble model: inputs are calibrated, then # combined non-linearly and averaged using multiple lattice layers. rtl_layer_ensemble_model_config = tfl.configs.CalibratedLatticeEnsembleConfig( feature_configs=rtl_layer_feature_configs, lattices='rtl_layer', num_lattices=5, lattice_rank=3, output_min=min_label, output_max=max_label - numerical_error_epsilon, output_initialization=[min_label, max_label], random_seed=42) # A CalibratedLatticeEnsemble premade model constructed from the given # model config. Note that we do not have to specify the lattices by calling # a helper function (like before with random) because the RTL Layer will take # care of that for us. rtl_layer_ensemble_model = tfl.premade.CalibratedLatticeEnsemble( rtl_layer_ensemble_model_config) # Let's plot our model. tf.keras.utils.plot_model( rtl_layer_ensemble_model, show_layer_names=False, rankdir='LR') rtl_layer_ensemble_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), metrics=[tf.keras.metrics.AUC()], optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) rtl_layer_ensemble_model.fit( train_xs, train_ys, epochs=NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False) print('Test Set Evaluation...') print(rtl_layer_ensemble_model.evaluate(test_xs, test_ys)) # This is a calibrated lattice ensemble model: inputs are calibrated, then # combines non-linearly and averaged using multiple lattice layers. crystals_ensemble_model_config = tfl.configs.CalibratedLatticeEnsembleConfig( feature_configs=feature_configs, lattices='crystals', num_lattices=5, lattice_rank=3, output_min=min_label, output_max=max_label - numerical_error_epsilon, output_initialization=[min_label, max_label], random_seed=42) # Now that we have our model config, we can construct a prefitting model config. prefitting_model_config = tfl.premade_lib.construct_prefitting_model_config( crystals_ensemble_model_config) # A CalibratedLatticeEnsemble premade model constructed from the given # prefitting model config. prefitting_model = tfl.premade.CalibratedLatticeEnsemble( prefitting_model_config) # We can compile and train our prefitting model as we like. prefitting_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) prefitting_model.fit( train_xs, train_ys, epochs=PREFITTING_NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False) # Now that we have our trained prefitting model, we can extract the crystals. tfl.premade_lib.set_crystals_lattice_ensemble(crystals_ensemble_model_config, prefitting_model_config, prefitting_model) # A CalibratedLatticeEnsemble premade model constructed from the given # model config. crystals_ensemble_model = tfl.premade.CalibratedLatticeEnsemble( crystals_ensemble_model_config) # Let's plot our model. tf.keras.utils.plot_model( crystals_ensemble_model, show_layer_names=False, rankdir='LR') crystals_ensemble_model.compile( loss=tf.keras.losses.BinaryCrossentropy(), metrics=[tf.keras.metrics.AUC()], optimizer=tf.keras.optimizers.Adam(LEARNING_RATE)) crystals_ensemble_model.fit( train_xs, train_ys, epochs=NUM_EPOCHS, batch_size=BATCH_SIZE, verbose=False) print('Test Set Evaluation...') print(crystals_ensemble_model.evaluate(test_xs, test_ys)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Some common symbols we will see in this class Step2: Everyone knows how to do a summation in Python right? Step3: What if we need to apply an operation to each element in the summation first? Step4: Ok down to business Step6: Measures of centrality
<ASSISTANT_TASK:> Python Code: set([1,2,3,4]) # Translate here. Add as many new cells as you like. sum(range(5)) # One liner here :) sum(map(lambda x: x * x, range(5))) # Config environment for code examples. %matplotlib inline import networkx as nx import matplotlib as plt plt.rcParams['figure.figsize'] = 17, 12 g = nx.scale_free_graph(40).to_undirected() nx.draw_networkx(g) g = nx.gnp_random_graph(40, 0.1) nx.draw_networkx(g) def degree_distribution(g): :param g: networkx.Graph :returns ?: whatever you need to plot the degree distribution. pass # Here you can either script or write a function to plot the degree distributions. # Use as many cells as you need. <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Export DataFrame Step2: Explore Pandas MultiIndex
<ASSISTANT_TASK:> Python Code: # Author: Denis Engemann <denis.engemann@gmail.com> # # License: BSD (3-clause) import mne import matplotlib.pyplot as plt import numpy as np from mne.datasets import sample print(__doc__) data_path = sample.data_path() raw_fname = data_path + '/MEG/sample/sample_audvis_filt-0-40_raw.fif' event_fname = data_path + '/MEG/sample/sample_audvis_filt-0-40_raw-eve.fif' raw = mne.io.read_raw_fif(raw_fname) # For simplicity we will only consider the first 10 epochs events = mne.read_events(event_fname)[:10] # Add a bad channel raw.info['bads'] += ['MEG 2443'] picks = mne.pick_types(raw.info, meg='grad', eeg=False, eog=True, stim=False, exclude='bads') tmin, tmax = -0.2, 0.5 baseline = (None, 0) reject = dict(grad=4000e-13, eog=150e-6) event_id = dict(auditory_l=1, auditory_r=2, visual_l=3, visual_r=4) epochs = mne.Epochs(raw, events, event_id, tmin, tmax, proj=True, picks=picks, baseline=baseline, preload=True, reject=reject) # The following parameters will scale the channels and times plotting # friendly. The info columns 'epoch' and 'time' will be used as hierarchical # index whereas the condition is treated as categorial data. Note that # this is optional. By passing None you could also print out all nesting # factors in a long table style commonly used for analyzing repeated measure # designs. index, scale_time, scalings = ['epoch', 'time'], 1e3, dict(grad=1e13) df = epochs.to_data_frame(picks=None, scalings=scalings, scale_time=scale_time, index=index) # Create MEG channel selector and drop EOG channel. meg_chs = [c for c in df.columns if 'MEG' in c] df.pop('EOG 061') # this works just like with a list. # Pandas is using a MultiIndex or hierarchical index to handle higher # dimensionality while at the same time representing data in a flat 2d manner. print(df.index.names, df.index.levels) # Inspecting the index object unveils that 'epoch', 'time' are used # for subsetting data. We can take advantage of that by using the # .ix attribute, where in this case the first position indexes the MultiIndex # and the second the columns, that is, channels. # Plot some channels across the first three epochs xticks, sel = np.arange(3, 600, 120), meg_chs[:15] df.ix[:3, sel].plot(xticks=xticks) mne.viz.tight_layout() # slice the time starting at t0 in epoch 2 and ending 500ms after # the base line in epoch 3. Note that the second part of the tuple # represents time in milliseconds from stimulus onset. df.ix[(1, 0):(3, 500), sel].plot(xticks=xticks) mne.viz.tight_layout() # Note: For convenience the index was converted from floating point values # to integer values. To restore the original values you can e.g. say # df['times'] = np.tile(epoch.times, len(epochs_times) # We now reset the index of the DataFrame to expose some Pandas # pivoting functionality. To simplify the groupby operation we # we drop the indices to treat epoch and time as categroial factors. df = df.reset_index() # The ensuing DataFrame then is split into subsets reflecting a crossing # between condition and trial number. The idea is that we can broadcast # operations into each cell simultaneously. factors = ['condition', 'epoch'] sel = factors + ['MEG 1332', 'MEG 1342'] grouped = df[sel].groupby(factors) # To make the plot labels more readable let's edit the values of 'condition'. df.condition = df.condition.apply(lambda name: name + ' ') # Now we compare the mean of two channels response across conditions. grouped.mean().plot(kind='bar', stacked=True, title='Mean MEG Response', color=['steelblue', 'orange']) mne.viz.tight_layout() # We can even accomplish more complicated tasks in a few lines calling # apply method and passing a function. Assume we wanted to know the time # slice of the maximum response for each condition. max_latency = grouped[sel[2]].apply(lambda x: df.time[x.argmax()]) print(max_latency) # Then make the plot labels more readable let's edit the values of 'condition'. df.condition = df.condition.apply(lambda name: name + ' ') plt.figure() max_latency.plot(kind='barh', title='Latency of Maximum Reponse', color=['steelblue']) mne.viz.tight_layout() # Finally, we will again remove the index to create a proper data table that # can be used with statistical packages like statsmodels or R. final_df = max_latency.reset_index() final_df.rename(columns={0: sel[2]}) # as the index is oblivious of names. # The index is now written into regular columns so it can be used as factor. print(final_df) plt.show() # To save as csv file, uncomment the next line. # final_df.to_csv('my_epochs.csv') # Note. Data Frames can be easily concatenated, e.g., across subjects. # E.g. say: # # import pandas as pd # group = pd.concat([df_1, df_2]) # group['subject'] = np.r_[np.ones(len(df_1)), np.ones(len(df_2)) + 1] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 通过这段代码可以看出,类对象 A 是由type() 产生的,也就是说 type 也可以用来产生新的对象,而且产生的是类对象,因此它是所有类对象的类: Step2: class 定义类的语法实际上转化为 type(name, bases, dict),其中 name 参数为类的名字,bases 为继承父类的元组,dict 为类的属性和方法: Step3: 理论上说这就是元类的意义,但从实际的角度出发显然使用 class 语法更方便、合理,而元类的实际意义则是通过继承 type 类来构造一个新的元类,并进行特定的操作以产生具有特定行为的类对象。这样看来它的本质与普通的类对象没有差异,只不过继承的是 type 类。 Step4: 通常情况下自己定义 __new__ 需要通过调用父类的 __new__ 方法创建一个 cls 的实例,同样在定义元类的时候则是调用上面提到的 type 的用法(因为元类继承自 type): Step5: 此时我们再来看 Enum 的类,已经不再是 type 而是其元类 MetaEnum: Step6: 除了 __new__ 方法之外,PEP 3115 还定义了 __prepare__ 属性,用于设定初始化的命名空间(即 type 的第 3 个参数),还是以 enum.Enum 为例,我们需要限制枚举类型中属性名称不得重复使用,则可以通过元类限制类的行为:
<ASSISTANT_TASK:> Python Code: print(type(12)) print(type('python')) class A: pass print(type(A)) print(type.__doc__) class A: pass # 实际上等于 B = type('A', (), {}) print(A.__name__ == B.__name__) class Enum: def __new__(cls, value): print(cls, value) return value def __init__(self): print("Will not be called!") e = Enum(1) class MetaEnum(type): def __new__(metaclass, name, base, attrs): print("Metaclass: {}\nName: {}\nParents: {}\nAttributes: {}".format(metaclass, name, base, attrs)) return super().__new__(metaclass, name, base, attrs) class Enum(metaclass=MetaEnum): # Python 2.7 中定义元类的方法是使用 __metaclass__ 变量 # [PEP 3115](https://www.python.org/dev/peps/pep-3115/) # 将 Python 3.0 以后语法改为 class Cls(metaclass=Meta) test = 0 type(Enum) # 定义新的字典类,在赋值新的 dict[k] = v 时 # 检查 k 是否重复 class _EnumDict(dict): def __init__(self): super().__init__() self.members = [] def __setitem__(self, k, v): if k in self.members: raise TypeError("Attempted to reuse key: '{}'".format(k)) else: self.members.append(k) super().__setitem__(k, v) class MetaEnum(type): @classmethod def __prepare__(metaclass, cls, bases): return _EnumDict() def __new__(metaclass, name, base, attrs): return super().__new__(metaclass, name, base, attrs) class Enum(metaclass=MetaEnum): pass class Color(Enum): try: red = 1 red = 2 except TypeError:# 这里没有使用 as err: 的原因是? print("TypeError catched") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 2. Key Properties --&gt; Variables Step7: 3. Key Properties --&gt; Seawater Properties Step8: 3.2. Ocean Freezing Point Value Step9: 4. Key Properties --&gt; Resolution Step10: 4.2. Canonical Horizontal Resolution Step11: 4.3. Number Of Horizontal Gridpoints Step12: 5. Key Properties --&gt; Tuning Applied Step13: 5.2. Target Step14: 5.3. Simulations Step15: 5.4. Metrics Used Step16: 5.5. Variables Step17: 6. Key Properties --&gt; Key Parameter Values Step18: 6.2. Additional Parameters Step19: 7. Key Properties --&gt; Assumptions Step20: 7.2. On Diagnostic Variables Step21: 7.3. Missing Processes Step22: 8. Key Properties --&gt; Conservation Step23: 8.2. Properties Step24: 8.3. Budget Step25: 8.4. Was Flux Correction Used Step26: 8.5. Corrected Conserved Prognostic Variables Step27: 9. Grid --&gt; Discretisation --&gt; Horizontal Step28: 9.2. Grid Type Step29: 9.3. Scheme Step30: 9.4. Thermodynamics Time Step Step31: 9.5. Dynamics Time Step Step32: 9.6. Additional Details Step33: 10. Grid --&gt; Discretisation --&gt; Vertical Step34: 10.2. Number Of Layers Step35: 10.3. Additional Details Step36: 11. Grid --&gt; Seaice Categories Step37: 11.2. Number Of Categories Step38: 11.3. Category Limits Step39: 11.4. Ice Thickness Distribution Scheme Step40: 11.5. Other Step41: 12. Grid --&gt; Snow On Seaice Step42: 12.2. Number Of Snow Levels Step43: 12.3. Snow Fraction Step44: 12.4. Additional Details Step45: 13. Dynamics Step46: 13.2. Transport In Thickness Space Step47: 13.3. Ice Strength Formulation Step48: 13.4. Redistribution Step49: 13.5. Rheology Step50: 14. Thermodynamics --&gt; Energy Step51: 14.2. Thermal Conductivity Step52: 14.3. Heat Diffusion Step53: 14.4. Basal Heat Flux Step54: 14.5. Fixed Salinity Value Step55: 14.6. Heat Content Of Precipitation Step56: 14.7. Precipitation Effects On Salinity Step57: 15. Thermodynamics --&gt; Mass Step58: 15.2. Ice Vertical Growth And Melt Step59: 15.3. Ice Lateral Melting Step60: 15.4. Ice Surface Sublimation Step61: 15.5. Frazil Ice Step62: 16. Thermodynamics --&gt; Salt Step63: 16.2. Sea Ice Salinity Thermal Impacts Step64: 17. Thermodynamics --&gt; Salt --&gt; Mass Transport Step65: 17.2. Constant Salinity Value Step66: 17.3. Additional Details Step67: 18. Thermodynamics --&gt; Salt --&gt; Thermodynamics Step68: 18.2. Constant Salinity Value Step69: 18.3. Additional Details Step70: 19. Thermodynamics --&gt; Ice Thickness Distribution Step71: 20. Thermodynamics --&gt; Ice Floe Size Distribution Step72: 20.2. Additional Details Step73: 21. Thermodynamics --&gt; Melt Ponds Step74: 21.2. Formulation Step75: 21.3. Impacts Step76: 22. Thermodynamics --&gt; Snow Processes Step77: 22.2. Snow Aging Scheme Step78: 22.3. Has Snow Ice Formation Step79: 22.4. Snow Ice Formation Scheme Step80: 22.5. Redistribution Step81: 22.6. Heat Diffusion Step82: 23. Radiative Processes Step83: 23.2. Ice Radiation Transmission
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'pcmdi', 'sandbox-1', 'seaice') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.model.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.model.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.variables.prognostic') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Sea ice temperature" # "Sea ice concentration" # "Sea ice thickness" # "Sea ice volume per grid cell area" # "Sea ice u-velocity" # "Sea ice v-velocity" # "Sea ice enthalpy" # "Internal ice stress" # "Salinity" # "Snow temperature" # "Snow depth" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.seawater_properties.ocean_freezing_point') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "TEOS-10" # "Constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.seawater_properties.ocean_freezing_point_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.canonical_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.number_of_horizontal_gridpoints') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.target') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.simulations') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.metrics_used') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.key_parameter_values.typical_parameters') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Ice strength (P*) in units of N m{-2}" # "Snow conductivity (ks) in units of W m{-1} K{-1} " # "Minimum thickness of ice created in leads (h0) in units of m" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.key_parameter_values.additional_parameters') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.description') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.on_diagnostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.missing_processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.properties') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Energy" # "Mass" # "Salt" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.budget') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.was_flux_correction_used') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.corrected_conserved_prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.grid') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Ocean grid" # "Atmosphere Grid" # "Own Grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.grid_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Structured grid" # "Unstructured grid" # "Adaptive grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Finite differences" # "Finite elements" # "Finite volumes" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.thermodynamics_time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.dynamics_time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.layering') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Zero-layer" # "Two-layers" # "Multi-layers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.number_of_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.has_mulitple_categories') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.number_of_categories') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.category_limits') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.ice_thickness_distribution_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.other') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.has_snow_on_ice') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.number_of_snow_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.snow_fraction') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.horizontal_transport') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Incremental Re-mapping" # "Prather" # "Eulerian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.transport_in_thickness_space') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Incremental Re-mapping" # "Prather" # "Eulerian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.ice_strength_formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Hibler 1979" # "Rothrock 1975" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.redistribution') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Rafting" # "Ridging" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.rheology') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Free-drift" # "Mohr-Coloumb" # "Visco-plastic" # "Elastic-visco-plastic" # "Elastic-anisotropic-plastic" # "Granular" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.enthalpy_formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Pure ice latent heat (Semtner 0-layer)" # "Pure ice latent and sensible heat" # "Pure ice latent and sensible heat + brine heat reservoir (Semtner 3-layer)" # "Pure ice latent and sensible heat + explicit brine inclusions (Bitz and Lipscomb)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.thermal_conductivity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Pure ice" # "Saline ice" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.heat_diffusion') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Conduction fluxes" # "Conduction and radiation heat fluxes" # "Conduction, radiation and latent heat transport" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.basal_heat_flux') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Heat Reservoir" # "Thermal Fixed Salinity" # "Thermal Varying Salinity" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.fixed_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.heat_content_of_precipitation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.precipitation_effects_on_salinity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.new_ice_formation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_vertical_growth_and_melt') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_lateral_melting') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Floe-size dependent (Bitz et al 2001)" # "Virtual thin ice melting (for single-category)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_surface_sublimation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.frazil_ice') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.has_multiple_sea_ice_salinities') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.sea_ice_salinity_thermal_impacts') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.salinity_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Prescribed salinity profile" # "Prognostic salinity profile" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.constant_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.salinity_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Prescribed salinity profile" # "Prognostic salinity profile" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.constant_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_thickness_distribution.representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Virtual (enhancement of thermal conductivity, thin ice melting)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_floe_size_distribution.representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Parameterised" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_floe_size_distribution.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.are_included') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Flocco and Feltham (2010)" # "Level-ice melt ponds" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.impacts') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Albedo" # "Freshwater" # "Heat" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.has_snow_aging') # PROPERTY VALUE(S): # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.snow_aging_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.has_snow_ice_formation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.snow_ice_formation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.redistribution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.heat_diffusion') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Single-layered heat diffusion" # "Multi-layered heat diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.radiative_processes.surface_albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Delta-Eddington" # "Parameterized" # "Multi-band albedo" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.radiative_processes.ice_radiation_transmission') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Delta-Eddington" # "Exponential attenuation" # "Ice radiation transmission per category" # "Other: [Please specify]" # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: As always, let's do imports and initialize a logger and a new Bundle. Step2: Dataset Parameters Step3: times Step4: fluxes Step5: sigmas Step6: compute_times / compute_phases Step7: NOTE Step8: ld_mode Step9: ld_func Step10: ld_coeffs_source Step11: ld_coeffs Step12: passband Step13: intens_weighting Step14: pblum_mode Step15: pblum_component Step16: pblum_dataset Step17: pblum Step18: l3_mode Step19: l3 Step20: l3_frac Step21: Compute Options Step22: irrad_method Step23: For more details on irradiation, see the Irradiation tutorial Step24: For more details on boosting, see the Beaming and Boosting example script Step25: For more details on atmospheres, see the Atmospheres & Passbands tutorial Step26: Plotting Step27: Since these are the only two columns available in the synthetic model, the only other option is to plot in phase instead of time. Step28: In system hierarchies where there may be multiple periods, it is also possible to determine whose period to use for phasing. Step29: Mesh Fields Step30: These new columns are stored with the lc's dataset tag, but with the 'mesh' dataset-kind. Step31: Any of these columns are then available to use as edge or facecolors when plotting the mesh (see the section on the mesh dataset). Step32: Now let's look at each of the available fields. Step33: pblum_ext is the extrinsic passband luminosity of the entire star/mesh - this is a single value (unlike most of the parameters in the mesh) and does not have per-element values. Step34: abs_normal_intensities are the absolute normal intensities per-element. Step35: normal_intensities are the relative normal intensities per-element. Step36: abs_intensities are the projected absolute intensities (towards the observer) per-element. Step37: intensities are the projected relative intensities (towards the observer) per-element.
<ASSISTANT_TASK:> Python Code: #!pip install -I "phoebe>=2.3,<2.4" import phoebe from phoebe import u # units logger = phoebe.logger() b = phoebe.default_binary() b.add_dataset('lc') print(b.get_dataset(kind='lc', check_visible=False)) print(b.get_parameter(qualifier='times')) print(b.get_parameter(qualifier='fluxes')) print(b.get_parameter(qualifier='sigmas')) print(b.get_parameter(qualifier='compute_times')) print(b.get_parameter(qualifier='compute_phases', context='dataset')) print(b.get_parameter(qualifier='phases_t0')) print(b.get_parameter(qualifier='ld_mode', component='primary')) b.set_value('ld_mode', component='primary', value='lookup') print(b.get_parameter(qualifier='ld_func', component='primary')) print(b.get_parameter(qualifier='ld_coeffs_source', component='primary')) b.set_value('ld_mode', component='primary', value='manual') print(b.get_parameter(qualifier='ld_coeffs', component='primary')) print(b.get_parameter(qualifier='passband')) print(b.get_parameter(qualifier='intens_weighting')) print(b.get_parameter(qualifier='pblum_mode')) b.set_value('pblum_mode', value='component-coupled') print(b.get_parameter(qualifier='pblum_component')) b.set_value('pblum_mode', value='dataset-coupled') print(b.get_parameter(qualifier='pblum_dataset')) b.set_value('pblum_mode', value='decoupled') print(b.get_parameter(qualifier='pblum', component='primary')) print(b.get_parameter(qualifier='l3_mode')) b.set_value('l3_mode', value='flux') print(b.get_parameter(qualifier='l3')) b.set_value('l3_mode', value='fraction') print(b.get_parameter(qualifier='l3_frac')) print(b.get_compute()) print(b.get_parameter(qualifier='irrad_method')) print(b.get_parameter(qualifier='boosting_method')) print(b.get_parameter(qualifier='atm', component='primary')) b.set_value('times', phoebe.linspace(0,1,101)) b.run_compute() print(b.filter(context='model').twigs) print(b.get_parameter(qualifier='times', kind='lc', context='model')) print(b.get_parameter(qualifier='fluxes', kind='lc', context='model')) afig, mplfig = b.plot(show=True) afig, mplfig = b.plot(x='phases', show=True) print(b.filter(qualifier='period').components) afig, mplfig = b.plot(x='phases:binary', show=True) b.add_dataset('mesh', times=[0], dataset='mesh01') print(b.get_parameter(qualifier='columns').choices) b.set_value('columns', value=['intensities@lc01', 'abs_intensities@lc01', 'normal_intensities@lc01', 'abs_normal_intensities@lc01', 'pblum_ext@lc01', 'boost_factors@lc01']) b.run_compute() print(b.get_model().datasets) print(b.filter(dataset='lc01', kind='mesh', context='model').twigs) afig, mplfig = b.filter(kind='mesh').plot(fc='intensities', ec='None', show=True) print(b.get_parameter(qualifier='pblum_ext', component='primary', dataset='lc01', kind='mesh', context='model')) print(b.get_parameter(qualifier='abs_normal_intensities', component='primary', dataset='lc01', kind='mesh', context='model')) print(b.get_parameter(qualifier='normal_intensities', component='primary', dataset='lc01', kind='mesh', context='model')) print(b.get_parameter(qualifier='abs_intensities', component='primary', dataset='lc01', kind='mesh', context='model')) print(b.get_parameter(qualifier='intensities', component='primary', dataset='lc01', kind='mesh', context='model')) print(b.get_parameter(qualifier='boost_factors', component='primary', dataset='lc01', kind='mesh', context='model')) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Import the model Step2: Example 1 Step3: and given to the RoadRunnnerModel as any other limb darkening model. Step4: after which the transit model evaluation goes as usual Step5: Example 2 Step6: Thawing the model
<ASSISTANT_TASK:> Python Code: %pylab inline rc('figure', figsize=(13,6)) def plot_lc(time, flux, c=None, ylim=(0.9865, 1.0025), ax=None, alpha=1): if ax is None: fig, ax = subplots() else: fig, ax = None, ax ax.plot(time, flux, c=c, alpha=alpha) ax.autoscale(axis='x', tight=True) setp(ax, xlabel='Time [d]', ylabel='Flux', xlim=time[[0,-1]], ylim=ylim) if fig is not None: fig.tight_layout() return ax from pytransit import RoadRunnerModel, LDTkLDModel from ldtk import sdss_g, sdss_i, sdss_z time = linspace(-0.05, 0.05, 1500) ldm = LDTkLDModel(teff=(5500, 150), logg=(4.5, 0.1), z=(0.0, 0.1), pbs=[sdss_i], frozen=True) tm = RoadRunnerModel(ldm) tm.set_data(time) flux1 = tm.evaluate(k=0.1, ldc=[None], t0=0.0, p=1.0, a=4.2, i=0.5*pi, e=0.0, w=0.0) plot_lc(time, flux1); ldm = LDTkLDModel([sdss_g, sdss_z], (5500, 150), (4.5, 0.1), (0.0, 0.1), frozen=True) lcids = zeros(time.size, int) lcids[time.size//2:] = 1 tm = RoadRunnerModel(ldm) tm.set_data(time, lcids=lcids, pbids=[0,1]) flux1 = tm.evaluate(k=0.1, ldc=[None], t0=0.0, p=1.0, a=4.2, i=0.5*pi, e=0.0, w=0.0) plot_lc(time, flux1, ylim=(0.986, 1.0025)); ldm.frozen = False flux1 = tm.evaluate(k=0.1, ldc=[None], t0=0.0, p=1.0, a=4.2, i=0.5*pi, e=0.0, w=0.0) ax = plot_lc(time, flux1); for i in range(10): flux1 = tm.evaluate(k=0.1, ldc=[None], t0=0.0, p=1.0, a=4.2, i=0.5*pi, e=0.0, w=0.0) ax = plot_lc(time, flux1, ax=ax, c='C0', alpha=0.25); setp(ax, ylim=(0.986, 1.0025)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load, explore, and prepare the dataset Step2: Downloading/ checking out the bike sharing dataset Step3: Dummy variables Step4: Batch normalization for standardizing the dataset using mean and variance/ scaling the data Step5: Splitting the dataset into training, validation, and testing sets Step6: Dividing the entire training data into training and validation sets to avoid overfitting and underfitting during the training Step7: How to build the NN Step8: Training the NN Step9: Test predictions
<ASSISTANT_TASK:> Python Code: %matplotlib inline %config InlineBackend.figure_format = 'retina' import numpy as np import pandas as pd import matplotlib.pyplot as plt # To check the data in the Terminal/Konsole % ls data/bike_data/ data_path = 'data/bike_data/hour.csv' rides = pd.read_csv(data_path) # # The new historical/time-seri data to visualize # data_path_watch = 'data/watch_multisensor_data/2_Year_Data_Basis_Watch/2-year_data/Basis_Watch_Data.csv' # watch = pd.read_csv(data_path_watch) rides.head() rides[:10] rides[:24*10].plot(x='dteday', y='cnt') # watch[:1000].plot() dummy_fields = ['season', 'weathersit', 'mnth', 'hr', 'weekday'] for each in dummy_fields: dummies = pd.get_dummies(rides[each], prefix=each, drop_first=False) rides = pd.concat([rides, dummies], axis=1) fields_to_drop = ['instant', 'dteday', 'season', 'weathersit', 'weekday', 'atemp', 'mnth', 'workingday', 'hr'] data = rides.drop(fields_to_drop, axis=1) data.head() quant_features = ['casual', 'registered', 'cnt', 'temp', 'hum', 'windspeed'] # Store scalings in a dictionary so we can convert back later scaled_features = {} for each in quant_features: mean, std = data[each].mean(), data[each].std() scaled_features[each] = [mean, std] data.loc[:, each] = (data[each] - mean)/std # Save data for approximately the last 21 days * 24 hours-per-day (24 hours/day) test_data = data[-21*24:] # Now remove the test data from the data set data = data[:-21*24] # Separate the data into features and targets target_fields = ['cnt', 'casual', 'registered'] features, targets = data.drop(target_fields, axis=1), data[target_fields] test_features_txn, test_targets_txm = test_data.drop(target_fields, axis=1), test_data[target_fields] test_features_txn.shape, test_targets_txm.shape # Hold out the last 60 days for validation set # txn: t is time/row (num of records) and n is space/col (input feature space dims) # txm: t is time/row (num of records) and m is space/col (output feature space dims) train_features_txn, train_targets_txm = features[:-60*24], targets[:-60*24] valid_features_txn, valid_targets_txm = features[-60*24:], targets[-60*24:] train_features_txn.shape, train_targets_txm.shape, valid_features_txn.shape, valid_targets_txm.shape class NN(object): # n: num_input_units in input layer, # h: num_hidden_units in the hidden layer, # m: num_out_units in the output layer, and # lr: learning_rate def __init__(self, n, h, m, lr): # Initialize parameters: weights and biases self.w_nxh = np.random.normal(loc=0.0, scale=n**(-0.5), size=(n, h)) self.b_1xh = np.zeros(shape=(1, h)) self.w_hxm = np.random.normal(loc=0.0, scale=h**(-0.5), size=(h, m)) self.b_1xm = np.zeros(shape=(1, m)) self.lr = lr # Train to update NN paramteres (w, b) in each epoch using NN hyper-parameters def train(self, X_txn, Y_txm): ''' Train the network on batch of features (X_txn) and targets (Y_txm). Arguments --------- features: X_txn is a 2D array, each row is one data record (t), each column is a feature (n) txn: ixj, rowxcol, and hxw targets: Y_txm is a 2D array as well. ''' dw_nxh = np.zeros_like(self.w_nxh) db_1xh = np.zeros_like(self.b_1xh) dw_hxm = np.zeros_like(self.w_hxm) db_1xm = np.zeros_like(self.b_1xm) for each_X, each_Y in zip(X_txn, Y_txm): #### Implement the forward pass here #### ### Forward pass ### x_1xn = np.array(each_X, ndmin=2) # [[each]] y_1xm = np.array(each_Y, ndmin=2) # [[each]] # TODO: Hidden layer - Replace these values with your calculations. h_in_1xh = (x_1xn @ self.w_nxh) + self.b_1xh # signals into hidden layer h_out_1xh = np.tanh(h_in_1xh) # TODO: Output layer - Replace these values with your calculations. out_logits_1xm = (h_out_1xh @ self.w_hxm) + self.b_1xm # signals into final output layer y_pred_1xm = np.tanh(out_logits_1xm) # signals from final output layer #### Implement the backward pass here #### ### Backward pass ### dy_1xm = y_pred_1xm - y_1xm # Output layer error: difference between actual target and desired output. # TODO: Output error - Replace this value with your calculations. dout_logits_1xm = dy_1xm * (1-(np.tanh(out_logits_1xm)**2)) # dtanh= (1-(np.tanh(x))**2) dh_out_1xh = dout_logits_1xm @ self.w_hxm.T # TODO: Calculate the hidden layer's contribution to the error dh_in_1xh = dh_out_1xh * (1-(np.tanh(h_in_1xh)**2)) dx_1xn = dh_in_1xh @ self.w_nxh.T # is dx_1xn USELESS? # TODO: Backpropagated error terms - Replace these values with your calculations. db_1xm += dout_logits_1xm dw_hxm += (dout_logits_1xm.T @ h_out_1xh).T db_1xh += dh_in_1xh dw_nxh += (dh_in_1xh.T @ x_1xn).T # TODO: Update the NN parameters (w, b) in each epoch of training self.w_hxm -= self.lr * dw_hxm # update hidden-to-output weights with gradient descent step self.b_1xm -= self.lr * db_1xm # output units/neurons/cells/nodes self.w_nxh -= self.lr * dw_nxh # update input-to-hidden weights with gradient descent step self.b_1xh -= self.lr * db_1xh # hidden units/cells/neurons/nodes def run(self, X_txn): ''' Run a forward pass through the network with input features Arguments --------- features: X_txn is a 2D array of records (t as row) and their features (n as col) ''' #### Implement the forward pass here #### ### Forward pass ### x_txn = X_txn # TODO: Hidden layer - Replace these values with your calculations. h_in_txh = (x_txn @ self.w_nxh) + self.b_1xh # signals into hidden layer h_out_txh = np.tanh(h_in_txh) # TODO: Output layer - Replace these values with your calculations. out_logits_txm = (h_out_txh @ self.w_hxm) + self.b_1xm # signals into final output layer y_pred_txm = np.tanh(out_logits_txm) # signals from final output layer return y_pred_txm # Mean Squared-Error(MSE) def MSE(Y_pred_1xt, Y_1xt): return np.mean((Y_pred_1xt-Y_1xt)**2) ### Set the hyperparameters here ### num_epochs = 100 # updating NN parameters (w, b) learning_rate = 2 * 1/train_features_txn.shape[0] # train_features = x_txn, t: number of recorded samples/records hidden_nodes = 5 output_nodes = 1 # y_tx1 input_nodes = train_features_txn.shape[1] # x_txn # Buidlingthe NN by initializing/instantiating the NN class nn = NN(h=hidden_nodes, lr=learning_rate, m=output_nodes, n=input_nodes) # Training-validating the NN - learning process losses_tx2 = {'train':[], 'valid':[]} for each_epoch in range(num_epochs): # # Go through a random minibatch of 128 records from the training data set # random_minibatch = np.random.choice(train_features_txn.index, size=128) # x_txn, y_txm = train_features_txn.ix[random_minibatch].values, train_targets_txm.ix[random_minibatch]['cnt'] # Go through the full batch of records in the training data set x_txn , y_tx1 = train_features_txn.values, train_targets_txm['cnt'] nn.train(X_txn=x_txn, Y_txm=y_tx1) # Printing out the training progress train_loss_1x1_value = MSE(Y_pred_1xt=nn.run(X_txn=train_features_txn).T, Y_1xt=train_targets_txm['cnt'].values) valid_loss_1x1_value = MSE(Y_pred_1xt=nn.run(X_txn=valid_features_txn).T, Y_1xt=valid_targets_txm['cnt'].values) print('each_epoch:', each_epoch, 'num_epochs:', num_epochs, 'train_loss:', train_loss_1x1_value, 'valid_loss:', valid_loss_1x1_value) losses_tx2['train'].append(train_loss_1x1_value) losses_tx2['valid'].append(valid_loss_1x1_value) plt.plot(losses_tx2['train'], label='Train loss') plt.plot(losses_tx2['valid'], label='Valid loss') plt.legend() _ = plt.ylim() fig, ax = plt.subplots(figsize=(8,4)) mean, std = scaled_features['cnt'] predictions_tx1 = nn.run(test_features_txn).T*std + mean ax.plot(predictions_tx1[0], label='Prediction') ax.plot((test_targets_txm['cnt']*std + mean).values, label='Data') ax.set_xlim(right=len(predictions_tx1)) ax.legend() dates = pd.to_datetime(rides.ix[test_data.index]['dteday']) dates = dates.apply(lambda d: d.strftime('%b %d')) ax.set_xticks(np.arange(len(dates))[12::24]) _ = ax.set_xticklabels(dates[12::24], rotation=45) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step3: Part 1 Step4: (1a) Interpreting PCA Step5: (1b) Sample covariance matrix Step7: (1c) Covariance Function Step8: (1d) Eigendecomposition Step9: (1e) PCA scores Step11: Part 2 Step12: (2b) PCA on dataRandom Step14: Visualization 2 Step15: Visualization 3 Step16: (2c) 3D to 2D Step17: Visualization 4 Step19: (2d) Variance explained Step20: Part 3 Step22: (3b) Parse the data Step23: (3c) Min and max flouresence Step24: Visualization 5 Step26: (3d) Fractional signal change Step27: Visualization 6 Step28: (3e) PCA on the scaled data Step29: Visualization 7 Step31: Visualization 8 Step32: Part 4 Step33: (4b) Recreate with np.tile and np.eye Step34: (4c) Recreate with np.kron Step35: (4d) Aggregate by time As we discussed in Part (4a), we would like to incorporate knowledge of our experimental setup into our analysis. To do this, we'll first study the temporal aspects of neural response, by aggregating our features by time. In other words, we want to see how different pixels (and the underlying neurons captured in these pixels) react in each of the 20 seconds after a new visual pattern is displayed, regardless of what the pattern is. Hence, instead of working with the 240 features individually, we'll aggregate the original features into 20 new features, where the first new feature captures the pixel response one second after a visual pattern appears, the second new feature is the response after two seconds, and so on. Step36: (4e) Obtain a compact representation Step37: Visualization 9 Step38: (4f) Aggregate by direction Step39: (4g) Compact representation of direction data Step40: Visualization 10
<ASSISTANT_TASK:> Python Code: labVersion = 'cs190_week5_v_1_2' import matplotlib.pyplot as plt import numpy as np def preparePlot(xticks, yticks, figsize=(10.5, 6), hideLabels=False, gridColor='#999999', gridWidth=1.0): Template for generating the plot layout. plt.close() fig, ax = plt.subplots(figsize=figsize, facecolor='white', edgecolor='white') ax.axes.tick_params(labelcolor='#999999', labelsize='10') for axis, ticks in [(ax.get_xaxis(), xticks), (ax.get_yaxis(), yticks)]: axis.set_ticks_position('none') axis.set_ticks(ticks) axis.label.set_color('#999999') if hideLabels: axis.set_ticklabels([]) plt.grid(color=gridColor, linewidth=gridWidth, linestyle='-') map(lambda position: ax.spines[position].set_visible(False), ['bottom', 'top', 'left', 'right']) return fig, ax def create2DGaussian(mn, sigma, cov, n): Randomly sample points from a two-dimensional Gaussian distribution np.random.seed(142) return np.random.multivariate_normal(np.array([mn, mn]), np.array([[sigma, cov], [cov, sigma]]), n) dataRandom = create2DGaussian(mn=50, sigma=1, cov=0, n=100) # generate layout and plot data fig, ax = preparePlot(np.arange(46, 55, 2), np.arange(46, 55, 2)) ax.set_xlabel(r'Simulated $x_1$ values'), ax.set_ylabel(r'Simulated $x_2$ values') ax.set_xlim(45, 54.5), ax.set_ylim(45, 54.5) plt.scatter(dataRandom[:,0], dataRandom[:,1], s=14**2, c='#d6ebf2', edgecolors='#8cbfd0', alpha=0.75) pass dataCorrelated = create2DGaussian(mn=50, sigma=1, cov=.9, n=100) # generate layout and plot data fig, ax = preparePlot(np.arange(46, 55, 2), np.arange(46, 55, 2)) ax.set_xlabel(r'Simulated $x_1$ values'), ax.set_ylabel(r'Simulated $x_2$ values') ax.set_xlim(45.5, 54.5), ax.set_ylim(45.5, 54.5) plt.scatter(dataCorrelated[:,0], dataCorrelated[:,1], s=14**2, c='#d6ebf2', edgecolors='#8cbfd0', alpha=0.75) pass # TODO: Replace <FILL IN> with appropriate code correlatedData = sc.parallelize(dataCorrelated) meanCorrelated = correlatedData.sum() / correlatedData.count() correlatedDataZeroMean = correlatedData.map(lambda x : x - meanCorrelated) print meanCorrelated print correlatedData.take(1) print correlatedDataZeroMean.take(1) # TEST Interpreting PCA (1a) from test_helper import Test Test.assertTrue(np.allclose(meanCorrelated, [49.95739037, 49.97180477]), 'incorrect value for meanCorrelated') Test.assertTrue(np.allclose(correlatedDataZeroMean.take(1)[0], [-0.28561917, 0.10351492]), 'incorrect value for correlatedDataZeroMean') # TODO: Replace <FILL IN> with appropriate code # Compute the covariance matrix using outer products and correlatedDataZeroMean correlatedCov = correlatedDataZeroMean.map(lambda x : np.outer(x, x)).reduce(lambda x, y: x + y) / correlatedData.count() print correlatedCov # TEST Sample covariance matrix (1b) covResult = [[ 0.99558386, 0.90148989], [0.90148989, 1.08607497]] Test.assertTrue(np.allclose(covResult, correlatedCov), 'incorrect value for correlatedCov') # TODO: Replace <FILL IN> with appropriate code def estimateCovariance(data): Compute the covariance matrix for a given rdd. Note: The multi-dimensional covariance array should be calculated using outer products. Don't forget to normalize the data by first subtracting the mean. Args: data (RDD of np.ndarray): An `RDD` consisting of NumPy arrays. Returns: np.ndarray: A multi-dimensional array where the number of rows and columns both equal the length of the arrays in the input `RDD`. # First obtain the zero mean data meanCorrelated = (data.sum() / data.count()) zeroMeanCorrelatedData = data.map(lambda x : x - meanCorrelated) # Covariance matrix covMatrix = zeroMeanCorrelatedData.map(lambda x : np.outer(x, x)).reduce(lambda x, y: x + y) / data.count() return covMatrix correlatedCovAuto= estimateCovariance(correlatedData) print correlatedCovAuto # TEST Covariance function (1c) correctCov = [[ 0.99558386, 0.90148989], [0.90148989, 1.08607497]] Test.assertTrue(np.allclose(correctCov, correlatedCovAuto), 'incorrect value for correlatedCovAuto') # TODO: Replace <FILL IN> with appropriate code from numpy.linalg import eigh # Calculate the eigenvalues and eigenvectors from correlatedCovAuto eigVals, eigVecs = eigh(correlatedCovAuto) print 'eigenvalues: {0}'.format(eigVals) print '\neigenvectors: \n{0}'.format(eigVecs) # Use np.argsort to find the top eigenvector based on the largest eigenvalue inds = np.argsort(eigVals) print "inds", inds topComponent = eigVecs[:,inds[1]] print '\ntop principal component: {0}'.format(topComponent) # TEST Eigendecomposition (1d) def checkBasis(vectors, correct): return np.allclose(vectors, correct) or np.allclose(np.negative(vectors), correct) Test.assertTrue(checkBasis(topComponent, [0.68915649, 0.72461254]), 'incorrect value for topComponent') # TODO: Replace <FILL IN> with appropriate code # Use the topComponent and the data from correlatedData to generate PCA scores correlatedDataScores = correlatedData.map(lambda x : x.dot(topComponent)) print 'one-dimensional data (first three):\n{0}'.format(np.asarray(correlatedDataScores.take(3))) # TEST PCA Scores (1e) firstThree = [70.51682806, 69.30622356, 71.13588168] Test.assertTrue(checkBasis(correlatedDataScores.take(3), firstThree), 'incorrect value for correlatedDataScores') # TODO: Replace <FILL IN> with appropriate code def pca(data, k=2): Computes the top `k` principal components, corresponding scores, and all eigenvalues. Note: All eigenvalues should be returned in sorted order (largest to smallest). `eigh` returns each eigenvectors as a column. This function should also return eigenvectors as columns. Args: data (RDD of np.ndarray): An `RDD` consisting of NumPy arrays. k (int): The number of principal components to return. Returns: tuple of (np.ndarray, RDD of np.ndarray, np.ndarray): A tuple of (eigenvectors, `RDD` of scores, eigenvalues). Eigenvectors is a multi-dimensional array where the number of rows equals the length of the arrays in the input `RDD` and the number of columns equals `k`. The `RDD` of scores has the same number of rows as `data` and consists of arrays of length `k`. Eigenvalues is an array of length d (the number of features). # Correlated Covariance matrix covMatrix = estimateCovariance(data) #print "covMatrix", covMatrix # Eigen decomposition eigVals, eigVecs = eigh(covMatrix) #print "eigVecs", eigVecs # Sort the eigVals inds = np.argsort(eigVals) #print "Inds", inds # Obtain the k-top k_top = eigVecs[:,[inds[i] for i in range(k-1, -1, -1)]] if k==1: k_top = eigVecs[:,inds[len(inds)-1]] #print "k_top", k_top # k-scores k_scores = data.map(lambda x : x.dot(k_top)) # Return the `k` principal components, `k` scores, and all eigenvalues return k_top, k_scores, eigVals # Run pca on correlatedData with k = 2 topComponentsCorrelated, correlatedDataScoresAuto, eigenvaluesCorrelated = pca(correlatedData) # Note that the 1st principal component is in the first column print 'topComponentsCorrelated: \n{0}'.format(topComponentsCorrelated) print ('\ncorrelatedDataScoresAuto (first three): \n{0}' .format('\n'.join(map(str, correlatedDataScoresAuto.take(3))))) print '\neigenvaluesCorrelated: \n{0}'.format(eigenvaluesCorrelated) # Create a higher dimensional test set pcaTestData = sc.parallelize([np.arange(x, x + 4) for x in np.arange(0, 20, 4)]) componentsTest, testScores, eigenvaluesTest = pca(pcaTestData, 3) print '\npcaTestData: \n{0}'.format(np.array(pcaTestData.collect())) print '\ncomponentsTest: \n{0}'.format(componentsTest) print ('\ntestScores (first three): \n{0}' .format('\n'.join(map(str, testScores.take(3))))) print '\neigenvaluesTest: \n{0}'.format(eigenvaluesTest) # TEST PCA Function (2a) Test.assertTrue(checkBasis(topComponentsCorrelated.T, [[0.68915649, 0.72461254], [-0.72461254, 0.68915649]]), 'incorrect value for topComponentsCorrelated') firstThreeCorrelated = [[70.51682806, 69.30622356, 71.13588168], [1.48305648, 1.5888655, 1.86710679]] Test.assertTrue(np.allclose(firstThreeCorrelated, np.vstack(np.abs(correlatedDataScoresAuto.take(3))).T), 'incorrect value for firstThreeCorrelated') Test.assertTrue(np.allclose(eigenvaluesCorrelated, [1.94345403, 0.13820481]), 'incorrect values for eigenvaluesCorrelated') topComponentsCorrelatedK1, correlatedDataScoresK1, eigenvaluesCorrelatedK1 = pca(correlatedData, 1) Test.assertTrue(checkBasis(topComponentsCorrelatedK1.T, [0.68915649, 0.72461254]), 'incorrect value for components when k=1') Test.assertTrue(np.allclose([70.51682806, 69.30622356, 71.13588168], np.vstack(np.abs(correlatedDataScoresK1.take(3))).T), 'incorrect value for scores when k=1') Test.assertTrue(np.allclose(eigenvaluesCorrelatedK1, [1.94345403, 0.13820481]), 'incorrect values for eigenvalues when k=1') Test.assertTrue(checkBasis(componentsTest.T[0], [ .5, .5, .5, .5]), 'incorrect value for componentsTest') Test.assertTrue(np.allclose(np.abs(testScores.first()[0]), 3.), 'incorrect value for testScores') Test.assertTrue(np.allclose(eigenvaluesTest, [ 128, 0, 0, 0 ]), 'incorrect value for eigenvaluesTest') # TODO: Replace <FILL IN> with appropriate code randomData = sc.parallelize(dataRandom) # Use pca on randomData topComponentsRandom, randomDataScoresAuto, eigenvaluesRandom = pca(randomData) print 'topComponentsRandom: \n{0}'.format(topComponentsRandom) print ('\nrandomDataScoresAuto (first three): \n{0}' .format('\n'.join(map(str, randomDataScoresAuto.take(3))))) print '\neigenvaluesRandom: \n{0}'.format(eigenvaluesRandom) # TEST PCA on `dataRandom` (2b) Test.assertTrue(checkBasis(topComponentsRandom.T, [[-0.2522559 , 0.96766056], [-0.96766056, -0.2522559]]), 'incorrect value for topComponentsRandom') firstThreeRandom = [[36.61068572, 35.97314295, 35.59836628], [61.3489929 , 62.08813671, 60.61390415]] Test.assertTrue(np.allclose(firstThreeRandom, np.vstack(np.abs(randomDataScoresAuto.take(3))).T), 'incorrect value for randomDataScoresAuto') Test.assertTrue(np.allclose(eigenvaluesRandom, [1.4204546, 0.99521397]), 'incorrect value for eigenvaluesRandom') def projectPointsAndGetLines(data, components, xRange): Project original data onto first component and get line details for top two components. topComponent= components[:, 0] slope1, slope2 = components[1, :2] / components[0, :2] means = data.mean()[:2] demeaned = data.map(lambda v: v - means) projected = demeaned.map(lambda v: (v.dot(topComponent) / topComponent.dot(topComponent)) * topComponent) remeaned = projected.map(lambda v: v + means) x1,x2 = zip(*remeaned.collect()) lineStartP1X1, lineStartP1X2 = means - np.asarray([xRange, xRange * slope1]) lineEndP1X1, lineEndP1X2 = means + np.asarray([xRange, xRange * slope1]) lineStartP2X1, lineStartP2X2 = means - np.asarray([xRange, xRange * slope2]) lineEndP2X1, lineEndP2X2 = means + np.asarray([xRange, xRange * slope2]) return ((x1, x2), ([lineStartP1X1, lineEndP1X1], [lineStartP1X2, lineEndP1X2]), ([lineStartP2X1, lineEndP2X1], [lineStartP2X2, lineEndP2X2])) ((x1, x2), (line1X1, line1X2), (line2X1, line2X2)) = \ projectPointsAndGetLines(correlatedData, topComponentsCorrelated, 5) # generate layout and plot data fig, ax = preparePlot(np.arange(46, 55, 2), np.arange(46, 55, 2), figsize=(7, 7)) ax.set_xlabel(r'Simulated $x_1$ values'), ax.set_ylabel(r'Simulated $x_2$ values') ax.set_xlim(45.5, 54.5), ax.set_ylim(45.5, 54.5) plt.plot(line1X1, line1X2, linewidth=3.0, c='#8cbfd0', linestyle='--') plt.plot(line2X1, line2X2, linewidth=3.0, c='#d6ebf2', linestyle='--') plt.scatter(dataCorrelated[:,0], dataCorrelated[:,1], s=14**2, c='#d6ebf2', edgecolors='#8cbfd0', alpha=0.75) plt.scatter(x1, x2, s=14**2, c='#62c162', alpha=.75) pass ((x1, x2), (line1X1, line1X2), (line2X1, line2X2)) = \ projectPointsAndGetLines(randomData, topComponentsRandom, 5) # generate layout and plot data fig, ax = preparePlot(np.arange(46, 55, 2), np.arange(46, 55, 2), figsize=(7, 7)) ax.set_xlabel(r'Simulated $x_1$ values'), ax.set_ylabel(r'Simulated $x_2$ values') ax.set_xlim(45.5, 54.5), ax.set_ylim(45.5, 54.5) plt.plot(line1X1, line1X2, linewidth=3.0, c='#8cbfd0', linestyle='--') plt.plot(line2X1, line2X2, linewidth=3.0, c='#d6ebf2', linestyle='--') plt.scatter(dataRandom[:,0], dataRandom[:,1], s=14**2, c='#d6ebf2', edgecolors='#8cbfd0', alpha=0.75) plt.scatter(x1, x2, s=14**2, c='#62c162', alpha=.75) pass from mpl_toolkits.mplot3d import Axes3D m = 100 mu = np.array([50, 50, 50]) r1_2 = 0.9 r1_3 = 0.7 r2_3 = 0.1 sigma1 = 5 sigma2 = 20 sigma3 = 20 c = np.array([[sigma1 ** 2, r1_2 * sigma1 * sigma2, r1_3 * sigma1 * sigma3], [r1_2 * sigma1 * sigma2, sigma2 ** 2, r2_3 * sigma2 * sigma3], [r1_3 * sigma1 * sigma3, r2_3 * sigma2 * sigma3, sigma3 ** 2]]) np.random.seed(142) dataThreeD = np.random.multivariate_normal(mu, c, m) from matplotlib.colors import ListedColormap, Normalize from matplotlib.cm import get_cmap norm = Normalize() cmap = get_cmap("Blues") clrs = cmap(np.array(norm(dataThreeD[:,2])))[:,0:3] fig = plt.figure(figsize=(11, 6)) ax = fig.add_subplot(121, projection='3d') ax.azim=-100 ax.scatter(dataThreeD[:,0], dataThreeD[:,1], dataThreeD[:,2], c=clrs, s=14**2) xx, yy = np.meshgrid(np.arange(-15, 10, 1), np.arange(-50, 30, 1)) normal = np.array([0.96981815, -0.188338, -0.15485978]) z = (-normal[0] * xx - normal[1] * yy) * 1. / normal[2] xx = xx + 50 yy = yy + 50 z = z + 50 ax.set_zlim((-20, 120)), ax.set_ylim((-20, 100)), ax.set_xlim((30, 75)) ax.plot_surface(xx, yy, z, alpha=.10) ax = fig.add_subplot(122, projection='3d') ax.azim=10 ax.elev=20 #ax.dist=8 ax.scatter(dataThreeD[:,0], dataThreeD[:,1], dataThreeD[:,2], c=clrs, s=14**2) ax.set_zlim((-20, 120)), ax.set_ylim((-20, 100)), ax.set_xlim((30, 75)) ax.plot_surface(xx, yy, z, alpha=.1) plt.tight_layout() pass # TODO: Replace <FILL IN> with appropriate code threeDData = sc.parallelize(dataThreeD) componentsThreeD, threeDScores, eigenvaluesThreeD = pca(threeDData) print 'componentsThreeD: \n{0}'.format(componentsThreeD) print ('\nthreeDScores (first three): \n{0}' .format('\n'.join(map(str, threeDScores.take(3))))) print '\neigenvaluesThreeD: \n{0}'.format(eigenvaluesThreeD) # TEST 3D to 2D (2c) Test.assertEquals(componentsThreeD.shape, (3, 2), 'incorrect shape for componentsThreeD') Test.assertTrue(np.allclose(np.sum(eigenvaluesThreeD), 969.796443367), 'incorrect value for eigenvaluesThreeD') Test.assertTrue(np.allclose(np.abs(np.sum(componentsThreeD)), 1.77238943258), 'incorrect value for componentsThreeD') Test.assertTrue(np.allclose(np.abs(np.sum(threeDScores.take(3))), 237.782834092), 'incorrect value for threeDScores') scoresThreeD = np.asarray(threeDScores.collect()) # generate layout and plot data fig, ax = preparePlot(np.arange(20, 150, 20), np.arange(-40, 110, 20)) ax.set_xlabel(r'New $x_1$ values'), ax.set_ylabel(r'New $x_2$ values') ax.set_xlim(5, 150), ax.set_ylim(-45, 50) plt.scatter(scoresThreeD[:,0], scoresThreeD[:,1], s=14**2, c=clrs, edgecolors='#8cbfd0', alpha=0.75) pass # TODO: Replace <FILL IN> with appropriate code def varianceExplained(data, k=1): Calculate the fraction of variance explained by the top `k` eigenvectors. Args: data (RDD of np.ndarray): An RDD that contains NumPy arrays which store the features for an observation. k: The number of principal components to consider. Returns: float: A number between 0 and 1 representing the percentage of variance explained by the top `k` eigenvectors. components, scores, eigenvalues = pca(data, k) <FILL IN> varianceRandom1 = varianceExplained(randomData, 1) varianceCorrelated1 = varianceExplained(correlatedData, 1) varianceRandom2 = varianceExplained(randomData, 2) varianceCorrelated2 = varianceExplained(correlatedData, 2) varianceThreeD2 = varianceExplained(threeDData, 2) print ('Percentage of variance explained by the first component of randomData: {0:.1f}%' .format(varianceRandom1 * 100)) print ('Percentage of variance explained by both components of randomData: {0:.1f}%' .format(varianceRandom2 * 100)) print ('\nPercentage of variance explained by the first component of correlatedData: {0:.1f}%'. format(varianceCorrelated1 * 100)) print ('Percentage of variance explained by both components of correlatedData: {0:.1f}%' .format(varianceCorrelated2 * 100)) print ('\nPercentage of variance explained by the first two components of threeDData: {0:.1f}%' .format(varianceThreeD2 * 100)) # TEST Variance explained (2d) Test.assertTrue(np.allclose(varianceRandom1, 0.588017172066), 'incorrect value for varianceRandom1') Test.assertTrue(np.allclose(varianceCorrelated1, 0.933608329586), 'incorrect value for varianceCorrelated1') Test.assertTrue(np.allclose(varianceRandom2, 1.0), 'incorrect value for varianceRandom2') Test.assertTrue(np.allclose(varianceCorrelated2, 1.0), 'incorrect value for varianceCorrelated2') Test.assertTrue(np.allclose(varianceThreeD2, 0.993967356912), 'incorrect value for varianceThreeD2') import os baseDir = os.path.join('data') inputPath = os.path.join('cs190', 'neuro.txt') inputFile = os.path.join(baseDir, inputPath) lines = sc.textFile(inputFile) print lines.first()[0:100] # Check that everything loaded properly assert len(lines.first()) == 1397 assert lines.count() == 46460 # TODO: Replace <FILL IN> with appropriate code def parse(line): Parse the raw data into a (`tuple`, `np.ndarray`) pair. Note: You should store the pixel coordinates as a tuple of two ints and the elements of the pixel intensity time series as an np.ndarray of floats. Args: line (str): A string representing an observation. Elements are separated by spaces. The first two elements represent the coordinates of the pixel, and the rest of the elements represent the pixel intensity over time. Returns: tuple of tuple, np.ndarray: A (coordinate, pixel intensity array) `tuple` where coordinate is a `tuple` containing two values and the pixel intensity is stored in an NumPy array which contains 240 values. myline = line.split(' ') myline = [float(x) for x in myline] return ((int(myline[0]), int(myline[1])), np.array(myline[2:])) rawData = lines.map(parse) rawData.cache() entry = rawData.first() print 'Length of movie is {0} seconds'.format(len(entry[1])) print 'Number of pixels in movie is {0:,}'.format(rawData.count()) print ('\nFirst entry of rawData (with only the first five values of the NumPy array):\n({0}, {1})' .format(entry[0], entry[1][:5])) # TEST Parse the data (3b) Test.assertTrue(isinstance(entry[0], tuple), "entry's key should be a tuple") Test.assertEquals(len(entry), 2, 'entry should have a key and a value') Test.assertTrue(isinstance(entry[0][1], int), 'coordinate tuple should contain ints') Test.assertEquals(len(entry[0]), 2, "entry's key should have two values") Test.assertTrue(isinstance(entry[1], np.ndarray), "entry's value should be an np.ndarray") Test.assertTrue(isinstance(entry[1][0], np.float), 'the np.ndarray should consist of np.float values') Test.assertEquals(entry[0], (0, 0), 'incorrect key for entry') Test.assertEquals(entry[1].size, 240, 'incorrect length of entry array') Test.assertTrue(np.allclose(np.sum(entry[1]), 24683.5), 'incorrect values in entry array') # TODO: Replace <FILL IN> with appropriate code #mn = rawData.min() mn = rawData.map(lambda (x, y) : min(y)).min() mx = rawData.map(lambda (x, y) : max(y)).max() #print mn, mx # TEST Min and max flouresence (3c) Test.assertTrue(np.allclose(mn, 100.6), 'incorrect value for mn') Test.assertTrue(np.allclose(mx, 940.8), 'incorrect value for mx') example = rawData.filter(lambda (k, v): np.std(v) > 100).values().first() # generate layout and plot data fig, ax = preparePlot(np.arange(0, 300, 50), np.arange(300, 800, 100)) ax.set_xlabel(r'time'), ax.set_ylabel(r'flouresence') ax.set_xlim(-20, 270), ax.set_ylim(270, 730) plt.plot(range(len(example)), example, c='#8cbfd0', linewidth='3.0') pass # TODO: Replace <FILL IN> with appropriate code def rescale(ts): Take a np.ndarray and return the standardized array by subtracting and dividing by the mean. Note: You should first subtract the mean and then divide by the mean. Args: ts (np.ndarray): Time series data (`np.float`) representing pixel intensity. Returns: np.ndarray: The times series adjusted by subtracting the mean and dividing by the mean. ts_mean = ts.mean() return (ts - ts_mean) / ts_mean scaledData = rawData.mapValues(lambda v: rescale(v)) mnScaled = scaledData.map(lambda (k, v): v).map(lambda v: min(v)).min() mxScaled = scaledData.map(lambda (k, v): v).map(lambda v: max(v)).max() print mnScaled, mxScaled # TEST Fractional signal change (3d) Test.assertTrue(isinstance(scaledData.first()[1], np.ndarray), 'incorrect type returned by rescale') Test.assertTrue(np.allclose(mnScaled, -0.27151288), 'incorrect value for mnScaled') Test.assertTrue(np.allclose(mxScaled, 0.90544876), 'incorrect value for mxScaled') example = scaledData.filter(lambda (k, v): np.std(v) > 0.1).values().first() # generate layout and plot data fig, ax = preparePlot(np.arange(0, 300, 50), np.arange(-.1, .6, .1)) ax.set_xlabel(r'time'), ax.set_ylabel(r'flouresence') ax.set_xlim(-20, 260), ax.set_ylim(-.12, .52) plt.plot(range(len(example)), example, c='#8cbfd0', linewidth='3.0') pass # TODO: Replace <FILL IN> with appropriate code # Run pca using scaledData componentsScaled, scaledScores, eigenvaluesScaled = pca(scaledData, k=3) # TEST PCA on the scaled data (3e) Test.assertEquals(componentsScaled.shape, (240, 3), 'incorrect shape for componentsScaled') Test.assertTrue(np.allclose(np.abs(np.sum(componentsScaled[:5, :])), 0.283150995232), 'incorrect value for componentsScaled') Test.assertTrue(np.allclose(np.abs(np.sum(scaledScores.take(3))), 0.0285507449251), 'incorrect value for scaledScores') Test.assertTrue(np.allclose(np.sum(eigenvaluesScaled[:5]), 0.206987501564), 'incorrect value for eigenvaluesScaled') import matplotlib.cm as cm scoresScaled = np.vstack(scaledScores.collect()) imageOneScaled = scoresScaled[:,0].reshape(230, 202).T # generate layout and plot data fig, ax = preparePlot(np.arange(0, 10, 1), np.arange(0, 10, 1), figsize=(9.0, 7.2), hideLabels=True) ax.grid(False) ax.set_title('Top Principal Component', color='#888888') image = plt.imshow(imageOneScaled,interpolation='nearest', aspect='auto', cmap=cm.gray) pass imageTwoScaled = scoresScaled[:,1].reshape(230, 202).T # generate layout and plot data fig, ax = preparePlot(np.arange(0, 10, 1), np.arange(0, 10, 1), figsize=(9.0, 7.2), hideLabels=True) ax.grid(False) ax.set_title('Second Principal Component', color='#888888') image = plt.imshow(imageTwoScaled,interpolation='nearest', aspect='auto', cmap=cm.gray) pass # Adapted from python-thunder's Colorize.transform where cmap='polar'. # Checkout the library at: https://github.com/thunder-project/thunder and # http://thunder-project.org/ def polarTransform(scale, img): Convert points from cartesian to polar coordinates and map to colors. from matplotlib.colors import hsv_to_rgb img = np.asarray(img) dims = img.shape phi = ((np.arctan2(-img[0], -img[1]) + np.pi/2) % (np.pi*2)) / (2 * np.pi) rho = np.sqrt(img[0]**2 + img[1]**2) saturation = np.ones((dims[1], dims[2])) out = hsv_to_rgb(np.dstack((phi, saturation, scale * rho))) return np.clip(out * scale, 0, 1) # Show the polar mapping from principal component coordinates to colors. x1AbsMax = np.max(np.abs(imageOneScaled)) x2AbsMax = np.max(np.abs(imageTwoScaled)) numOfPixels = 300 x1Vals = np.arange(-x1AbsMax, x1AbsMax, (2 * x1AbsMax) / numOfPixels) x2Vals = np.arange(x2AbsMax, -x2AbsMax, -(2 * x2AbsMax) / numOfPixels) x2Vals.shape = (numOfPixels, 1) x1Data = np.tile(x1Vals, (numOfPixels, 1)) x2Data = np.tile(x2Vals, (1, numOfPixels)) # Try changing the first parameter to lower values polarMap = polarTransform(2.0, [x1Data, x2Data]) gridRange = np.arange(0, numOfPixels + 25, 25) fig, ax = preparePlot(gridRange, gridRange, figsize=(9.0, 7.2), hideLabels=True) image = plt.imshow(polarMap, interpolation='nearest', aspect='auto') ax.set_xlabel('Principal component one'), ax.set_ylabel('Principal component two') gridMarks = (2 * gridRange / float(numOfPixels) - 1.0) x1Marks = x1AbsMax * gridMarks x2Marks = -x2AbsMax * gridMarks ax.get_xaxis().set_ticklabels(map(lambda x: '{0:.1f}'.format(x), x1Marks)) ax.get_yaxis().set_ticklabels(map(lambda x: '{0:.1f}'.format(x), x2Marks)) pass # Use the same transformation on the image data # Try changing the first parameter to lower values brainmap = polarTransform(2.0, [imageOneScaled, imageTwoScaled]) # generate layout and plot data fig, ax = preparePlot(np.arange(0, 10, 1), np.arange(0, 10, 1), figsize=(9.0, 7.2), hideLabels=True) ax.grid(False) image = plt.imshow(brainmap,interpolation='nearest', aspect='auto') pass # TODO: Replace <FILL IN> with appropriate code vector = np.array([0., 1., 2., 3., 4., 5.]) # Create a multi-dimensional array that when multiplied (using .dot) against vector, results in # a two element array where the first element is the sum of the 0, 2, and 4 indexed elements of # vector and the second element is the sum of the 1, 3, and 5 indexed elements of vector. # This should be a 2 row by 6 column array sumEveryOther = np.array([[1, 0, 1, 0, 1, 0], [0, 1, 0, 1, 0, 1]]) # Create a multi-dimensional array that when multiplied (using .dot) against vector, results in a # three element array where the first element is the sum of the 0 and 3 indexed elements of vector, # the second element is the sum of the 1 and 4 indexed elements of vector, and the third element is # the sum of the 2 and 5 indexed elements of vector. # This should be a 3 row by 6 column array sumEveryThird = np.array([[1, 0, 0, 1, 0, 0], [0, 1, 0, 0, 1, 0], [0, 0, 1, 0, 0, 1]]) # Create a multi-dimensional array that can be used to sum the first three elements of vector and # the last three elements of vector, which returns a two element array with those values when dotted # with vector. # This should be a 2 row by 6 column array sumByThree = np.array([[1, 1, 1, 0, 0, 0], [0, 0, 0, 1, 1, 1]]) # Create a multi-dimensional array that sums the first two elements, second two elements, and # last two elements of vector, which returns a three element array with those values when dotted # with vector. # This should be a 3 row by 6 column array sumByTwo = np.array([[1, 1, 0, 0, 0, 0], [0, 0, 1, 1, 0, 0], [0, 0, 0, 0, 1, 1]]) print 'sumEveryOther.dot(vector):\t{0}'.format(sumEveryOther.dot(vector)) print 'sumEveryThird.dot(vector):\t{0}'.format(sumEveryThird.dot(vector)) print '\nsumByThree.dot(vector):\t{0}'.format(sumByThree.dot(vector)) print 'sumByTwo.dot(vector): \t{0}'.format(sumByTwo.dot(vector)) # TEST Aggregation using arrays (4a) Test.assertEquals(sumEveryOther.shape, (2, 6), 'incorrect shape for sumEveryOther') Test.assertEquals(sumEveryThird.shape, (3, 6), 'incorrect shape for sumEveryThird') Test.assertTrue(np.allclose(sumEveryOther.dot(vector), [6, 9]), 'incorrect value for sumEveryOther') Test.assertTrue(np.allclose(sumEveryThird.dot(vector), [3, 5, 7]), 'incorrect value for sumEveryThird') Test.assertEquals(sumByThree.shape, (2, 6), 'incorrect shape for sumByThree') Test.assertEquals(sumByTwo.shape, (3, 6), 'incorrect shape for sumByTwo') Test.assertTrue(np.allclose(sumByThree.dot(vector), [3, 12]), 'incorrect value for sumByThree') Test.assertTrue(np.allclose(sumByTwo.dot(vector), [1, 5, 9]), 'incorrect value for sumByTwo') # Reference for what to recreate print 'sumEveryOther: \n{0}'.format(sumEveryOther) print '\nsumEveryThird: \n{0}'.format(sumEveryThird) # TODO: Replace <FILL IN> with appropriate code # Use np.tile and np.eye to recreate the arrays sumEveryOtherTile = np.tile(np.eye(2), 3) sumEveryThirdTile = np.tile(np.eye(3), 2) print sumEveryOtherTile print 'sumEveryOtherTile.dot(vector): {0}'.format(sumEveryOtherTile.dot(vector)) print '\n', sumEveryThirdTile print 'sumEveryThirdTile.dot(vector): {0}'.format(sumEveryThirdTile.dot(vector)) # TEST Recreate with `np.tile` and `np.eye` (4b) Test.assertEquals(sumEveryOtherTile.shape, (2, 6), 'incorrect shape for sumEveryOtherTile') Test.assertEquals(sumEveryThirdTile.shape, (3, 6), 'incorrect shape for sumEveryThirdTile') Test.assertTrue(np.allclose(sumEveryOtherTile.dot(vector), [6, 9]), 'incorrect value for sumEveryOtherTile') Test.assertTrue(np.allclose(sumEveryThirdTile.dot(vector), [3, 5, 7]), 'incorrect value for sumEveryThirdTile') # Reference for what to recreate print 'sumByThree: \n{0}'.format(sumByThree) print '\nsumByTwo: \n{0}'.format(sumByTwo) # TODO: Replace <FILL IN> with appropriate code # Use np.kron, np.eye, and np.ones to recreate the arrays sumByThreeKron = np.kron(np.eye(2), np.ones(shape=(1,3))) sumByTwoKron = np.kron(np.eye(3), np.ones(shape=(1,2))) print sumByThreeKron print 'sumByThreeKron.dot(vector): {0}'.format(sumByThreeKron.dot(vector)) print '\n', sumByTwoKron print 'sumByTwoKron.dot(vector): {0}'.format(sumByTwoKron.dot(vector)) # TEST Recreate with `np.kron` (4c) Test.assertEquals(sumByThreeKron.shape, (2, 6), 'incorrect shape for sumByThreeKron') Test.assertEquals(sumByTwoKron.shape, (3, 6), 'incorrect shape for sumByTwoKron') Test.assertTrue(np.allclose(sumByThreeKron.dot(vector), [3, 12]), 'incorrect value for sumByThreeKron') Test.assertTrue(np.allclose(sumByTwoKron.dot(vector), [1, 5, 9]), 'incorrect value for sumByTwoKron') # TODO: Replace <FILL IN> with appropriate code # Create a multi-dimensional array to perform the aggregation T = np.array(np.tile([[0]*19+[1]]*20, 12)) print T # Transform scaledData using T. Make sure to retain the keys. timeData = scaledData.map(lambda (x, y) : (x, T.dot(y))) timeData.cache() print timeData.count() print timeData.first() timeDataFirst = timeData.values().first() print timeDataFirst[:2] # TEST Aggregate by time (4d) Test.assertEquals(T.shape, (20, 240), 'incorrect shape for T') timeDataFirst = timeData.values().first() timeDataFifth = timeData.values().take(5)[4] Test.assertEquals(timeData.count(), 46460, 'incorrect length of timeData') Test.assertEquals(timeDataFirst.size, 20, 'incorrect value length of timeData') Test.assertEquals(timeData.keys().first(), (0, 0), 'incorrect keys in timeData') Test.assertTrue(np.allclose(timeDataFirst[:2], [0.00802155, 0.00607693]), 'incorrect values in timeData') Test.assertTrue(np.allclose(timeDataFifth[-2:],[-0.00636676, -0.0179427]), 'incorrect values in timeData') # TODO: Replace <FILL IN> with appropriate code componentsTime, timeScores, eigenvaluesTime = pca(timeData, k=3) print 'componentsTime: (first five) \n{0}'.format(componentsTime[:5,:]) print ('\ntimeScores (first three): \n{0}' .format('\n'.join(map(str, timeScores.take(3))))) print '\neigenvaluesTime: (first five) \n{0}'.format(eigenvaluesTime[:5]) # TEST Obtain a compact representation (4e) Test.assertEquals(componentsTime.shape, (20, 3), 'incorrect shape for componentsTime') Test.assertTrue(np.allclose(np.abs(np.sum(componentsTime[:5, :])), 2.37299020), 'incorrect value for componentsTime') Test.assertTrue(np.allclose(np.abs(np.sum(timeScores.take(3))), 0.0213119114), 'incorrect value for timeScores') Test.assertTrue(np.allclose(np.sum(eigenvaluesTime[:5]), 0.844764792), 'incorrect value for eigenvaluesTime') scoresTime = np.vstack(timeScores.collect()) imageOneTime = scoresTime[:,0].reshape(230, 202).T imageTwoTime = scoresTime[:,1].reshape(230, 202).T brainmap = polarTransform(3, [imageOneTime, imageTwoTime]) # generate layout and plot data fig, ax = preparePlot(np.arange(0, 10, 1), np.arange(0, 10, 1), figsize=(9.0, 7.2), hideLabels=True) ax.grid(False) image = plt.imshow(brainmap,interpolation='nearest', aspect='auto') pass # TODO: Replace <FILL IN> with appropriate code # Create a multi-dimensional array to perform the aggregation D = np.kron(np.eye(12), np.ones(shape=(1,20))) # Transform scaledData using D. Make sure to retain the keys. directionData = scaledData.map(lambda (x, y) : (x, D.dot(y))) directionData.cache() print directionData.count() print directionData.first() # TEST Aggregate by direction (4f) Test.assertEquals(D.shape, (12, 240), 'incorrect shape for D') directionDataFirst = directionData.values().first() directionDataFifth = directionData.values().take(5)[4] Test.assertEquals(directionData.count(), 46460, 'incorrect length of directionData') Test.assertEquals(directionDataFirst.size, 12, 'incorrect value length of directionData') Test.assertEquals(directionData.keys().first(), (0, 0), 'incorrect keys in directionData') Test.assertTrue(np.allclose(directionDataFirst[:2], [ 0.03346365, 0.03638058]), 'incorrect values in directionData') Test.assertTrue(np.allclose(directionDataFifth[:2], [ 0.01479147, -0.02090099]), 'incorrect values in directionData') # TODO: Replace <FILL IN> with appropriate code componentsDirection, directionScores, eigenvaluesDirection = pca(directionData, k=3) print 'componentsDirection: (first five) \n{0}'.format(componentsDirection[:5,:]) print ('\ndirectionScores (first three): \n{0}' .format('\n'.join(map(str, directionScores.take(3))))) print '\neigenvaluesDirection: (first five) \n{0}'.format(eigenvaluesDirection[:5]) # TEST Compact representation of direction data (4g) Test.assertEquals(componentsDirection.shape, (12, 3), 'incorrect shape for componentsDirection') Test.assertTrue(np.allclose(np.abs(np.sum(componentsDirection[:5, :])), 1.080232069), 'incorrect value for componentsDirection') Test.assertTrue(np.allclose(np.abs(np.sum(directionScores.take(3))), 0.10993162084), 'incorrect value for directionScores') Test.assertTrue(np.allclose(np.sum(eigenvaluesDirection[:5]), 2.0089720377), 'incorrect value for eigenvaluesDirection') scoresDirection = np.vstack(directionScores.collect()) imageOneDirection = scoresDirection[:,0].reshape(230, 202).T imageTwoDirection = scoresDirection[:,1].reshape(230, 202).T brainmap = polarTransform(2, [imageOneDirection, imageTwoDirection]) # with thunder: Colorize(cmap='polar', scale=2).transform([imageOneDirection, imageTwoDirection]) # generate layout and plot data fig, ax = preparePlot(np.arange(0, 10, 1), np.arange(0, 10, 1), figsize=(9.0, 7.2), hideLabels=True) ax.grid(False) image = plt.imshow(brainmap, interpolation='nearest', aspect='auto') pass <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 평점 데이터 Step2: 이 데이터는 다음과 같이 데이터프레임으로 변환할 수 있다. Step3: 여기에서 user 열은 사용자 아이디, item 열은 상품 아이디, rate 열은 평점이다. 즉, 196번 사용자는 242번 영화에 대해 평점 3점을 주었음을 알 수 있다. Step4: 이 평점 행렬의 일부만 살펴보면 다음과 같이 평점 데이터가 일부 위치에만 존재하는 sparse 행렬임을 알 수 있다. Step5: 평점 행렬의 빈칸을 흰색, 점수를 검은색으로 시각화 하면 다음과 같다. Step6: 추천 시스템 알고리즘 Step7: 추천성능 평가기준 Step8: Collaborative Filter Step9: Latent Factor 모형
<ASSISTANT_TASK:> Python Code: import surprise data = surprise.Dataset.load_builtin('ml-100k') df = pd.DataFrame(data.raw_ratings, columns=["user", "item", "rate", "id"]) del df["id"] df.head(10) df_table = df.set_index(["user", "item"]).unstack() df_table.fillna("").ix[212:222, 808:817] plt.imshow(df_table) plt.grid(False) plt.xlabel("item") plt.ylabel("user") plt.title("Rate Matrix") plt.show() data.split(n_folds=3) bsl_options = {'method': 'als', 'n_epochs': 5, 'reg_u': 12, 'reg_i': 5 } algo = surprise.BaselineOnly(bsl_options=bsl_options) np.random.seed(0) acc = np.zeros(3) for i, (trainset, testset) in enumerate(data.folds()): algo.train(trainset) predictions = algo.test(testset) acc[i] = surprise.accuracy.fcp(predictions, verbose=True) acc.mean() surprise.evaluate(algo, data) sim_options = {'name': 'msd'} algo = surprise.KNNBasic(sim_options=sim_options) surprise.evaluate(algo, data) sim_options = {'name': 'cosine'} algo = surprise.KNNBasic(sim_options=sim_options) surprise.evaluate(algo, data) sim_options = {'name': 'pearson'} algo = surprise.KNNBasic(sim_options=sim_options) surprise.evaluate(algo, data) sim_options = {'name': 'pearson_baseline'} algo = surprise.KNNBasic(sim_options=sim_options) surprise.evaluate(algo, data) sim_options = {'name': 'pearson_baseline'} algo = surprise.KNNWithMeans(sim_options=sim_options) surprise.evaluate(algo, data) sim_options = {'name': 'pearson_baseline'} algo = surprise.KNNBaseline(sim_options=sim_options) surprise.evaluate(algo, data) algo = surprise.SVD(n_factors=200, n_epochs=30) surprise.evaluate(algo, data) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load data Step2: Find most appropriate number of states using cross validation Step3: Remarks Step4: Remarks Step5: Remarks Step6: Remarks Step7: Remarks Step8: Remarks Step9: then we stat to see the emergence of the S-shaped place field progressions again, indicating that the reward locations are overexpressed by several different states. Step10: With enough expressiveness in the number of states, we see the S-shaped curve reappear, which suggests an overexpression of the reward locations, which is consistent with what we see with place cells in animals.
<ASSISTANT_TASK:> Python Code: import matplotlib.pyplot as plt import numpy as np import pandas as pd import seaborn as sns import sys from IPython.display import display, clear_output sys.path.insert(0, 'helpers') from efunctions import * # load my helper function(s) to save pdf figures, etc. from hc3 import load_data, get_sessions from hmmlearn import hmm # see https://github.com/ckemere/hmmlearn import klabtools as klab import seqtools as sq import importlib importlib.reload(sq) # reload module here only while prototyping... importlib.reload(klab) # reload module here only while prototyping... %matplotlib inline sns.set(rc={'figure.figsize': (12, 4),'lines.linewidth': 1.5}) sns.set_style("white") datadirs = ['/home/etienne/Dropbox/neoReader/Data', 'C:/etienne/Dropbox/neoReader/Data', '/Users/etienne/Dropbox/neoReader/Data'] fileroot = next( (dir for dir in datadirs if os.path.isdir(dir)), None) animal = 'gor01'; month,day = (6,7); session = '16-40-19' # 91 units spikes = load_data(fileroot=fileroot, datatype='spikes',animal=animal, session=session, month=month, day=day, fs=32552, verbose=False) eeg = load_data(fileroot=fileroot, datatype='eeg', animal=animal, session=session, month=month, day=day,channels=[0,1,2], fs=1252, starttime=0, verbose=False) posdf = load_data(fileroot=fileroot, datatype='pos',animal=animal, session=session, month=month, day=day, verbose=False) speed = klab.get_smooth_speed(posdf,fs=60,th=8,cutoff=0.5,showfig=False,verbose=False) ## bin ALL spikes ds = 0.125 # bin spikes into 125 ms bins (theta-cycle inspired) binned_spikes_all = klab.bin_spikes(spikes.data, ds=ds, fs=spikes.samprate, verbose=True) ## identify boundaries for running (active) epochs and then bin those observations into separate sequences: runbdries = klab.get_boundaries_from_bins(eeg.samprate,bins=speed.active_bins,bins_fs=60) binned_spikes_bvr = klab.bin_spikes(spikes.data, fs=spikes.samprate, boundaries=runbdries, boundaries_fs=eeg.samprate, ds=ds) ## stack data for hmmlearn: seq_stk_bvr = sq.data_stack(binned_spikes_bvr, verbose=True) seq_stk_all = sq.data_stack(binned_spikes_all, verbose=True) ## split data into train, test, and validation sets: tr_b,vl_b,ts_b = sq.data_split(seq_stk_bvr, tr=60, vl=20, ts=20, randomseed = 0, verbose=False) Smax = 40 S = np.arange(start=5,step=1,stop=Smax+1) tr_ll = [] vl_ll = [] ts_ll = [] for num_states in S: clear_output(wait=True) print('Training and evaluating {}-state hmm'.format(num_states)) sys.stdout.flush() myhmm = sq.hmm_train(tr_b, num_states=num_states, n_iter=30, verbose=False) tr_ll.append( (np.array(list(sq.hmm_eval(myhmm, tr_b)))/tr_b.sequence_lengths ).mean()) vl_ll.append( (np.array(list(sq.hmm_eval(myhmm, vl_b)))/vl_b.sequence_lengths ).mean()) ts_ll.append( (np.array(list(sq.hmm_eval(myhmm, ts_b)))/ts_b.sequence_lengths ).mean()) clear_output(wait=True) print('Done!') sys.stdout.flush() num_states = 35 fig = plt.figure(1, figsize=(12, 4)) ax = fig.add_subplot(111) ax.annotate('plateau at approx ' + str(num_states), xy=(num_states, -38.5), xycoords='data', xytext=(-140, -30), textcoords='offset points', arrowprops=dict(arrowstyle="->", connectionstyle="angle3,angleA=0,angleB=-90"), ) ax.plot(S, tr_ll, lw=1.5, label='train') ax.plot(S, vl_ll, lw=1.5, label='validation') ax.plot(S, ts_ll, lw=1.5, label='test') ax.legend(loc=2) ax.set_xlabel('number of states') ax.set_ylabel('normalized (to single time bin) log likelihood') ax.axhspan(-38.5, -37.5, facecolor='0.75', alpha=0.25) ax.set_xlim([5, S[-1]]) from placefieldviz import hmmplacefieldposviz num_states = 35 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields #state_pos, peakorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth) fig, axes = plt.subplots(4, 3, figsize=(17, 11)) axes = [item for sublist in axes for item in sublist] for ii, ax in enumerate(axes): vth = ii+1 state_pos, peakorder, stateorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, verbose=False) ax.matshow(state_pos[peakorder,:], interpolation='none', cmap='OrRd') #ax.set_xlabel('position bin') ax.set_ylabel('state') ax.set_xticklabels([]) ax.set_yticklabels([]) ax.set_title('learned place fields; RUN > ' + str(vth), y=1.02) ax.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=1) ax.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=1) ax.axis('tight') from placefieldviz import hmmplacefieldposviz num_states = 35 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields #state_pos, peakorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth) fig, axes = plt.subplots(4, 3, figsize=(17, 11)) axes = [item for sublist in axes for item in sublist] for ii, ax in enumerate(axes): num_states = 5 + ii*5 state_pos, peakorder, stateorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True) ax.matshow(state_pos[peakorder,:], interpolation='none', cmap='OrRd') #ax.set_xlabel('position bin') ax.set_ylabel('state') ax.set_xticklabels([]) ax.set_yticklabels([]) ax.set_title('learned place fields; RUN > ' + str(vth) + '; m = ' + str(num_states), y=1.02) ax.axis('tight') saveFigure('posterfigs/numstates.pdf') from placefieldviz import hmmplacefieldposviz num_states = 35 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields #state_pos, peakorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth) fig, axes = plt.subplots(4, 3, figsize=(17, 11)) axes = [item for sublist in axes for item in sublist] for ii, ax in enumerate(axes): ds = (ii+1)*0.03125 state_pos, peakorder, stateorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True) ax.matshow(state_pos[peakorder,:], interpolation='none', cmap='OrRd') #ax.set_xlabel('position bin') ax.set_ylabel('state') ax.set_xticklabels([]) ax.set_yticklabels([]) ax.set_title('learned place fields; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=1) ax.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=1) ax.axis('tight') from placefieldviz import hmmplacefieldposviz num_states = 35 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields #state_pos, peakorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth) fig, axes = plt.subplots(4, 3, figsize=(17, 11)) axes = [item for sublist in axes for item in sublist] for ii, ax in enumerate(axes): ds = (ii+1)*0.0625 state_pos, peakorder, stateorder = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True) ax.matshow(state_pos[peakorder,:], interpolation='none', cmap='OrRd') #ax.set_xlabel('position bin') ax.set_ylabel('state') ax.set_xticklabels([]) ax.set_yticklabels([]) ax.set_title('learned place fields; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=1) ax.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=1) ax.axis('tight') from placefieldviz import hmmplacefieldposviz num_states = 25 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields state_pos_b, peakorder_b, stateorder_b = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='both') state_pos_1, peakorder_1, stateorder_1 = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='first') state_pos_2, peakorder_2, stateorder_2 = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='second') fig, (ax1, ax2, ax3) = plt.subplots(1, 3, figsize=(17, 3)) ax1.matshow(state_pos_b[peakorder_b,:], interpolation='none', cmap='OrRd') ax1.set_ylabel('state') ax1.set_xticklabels([]) ax1.set_yticklabels([]) ax1.set_title('learned place fields BOTH; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax1.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.axis('tight') ax2.matshow(state_pos_1[peakorder_1,:], interpolation='none', cmap='OrRd') ax2.set_ylabel('state') ax2.set_xticklabels([]) ax2.set_yticklabels([]) ax2.set_title('learned place fields FIRST; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax2.plot([13, 35], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax2.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax2.axis('tight') ax3.matshow(state_pos_2[peakorder_2,:], interpolation='none', cmap='OrRd') ax3.set_ylabel('state') ax3.set_xticklabels([]) ax3.set_yticklabels([]) ax3.set_title('learned place fields SECOND; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax3.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax3.plot([7, 41], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax3.axis('tight') saveFigure('posterfigs/expsplit.pdf') from placefieldviz import hmmplacefieldposviz num_states = 45 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields state_pos_b, peakorder_b, stateorder_b = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='both') state_pos_1, peakorder_1, stateorder_1 = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='first') state_pos_2, peakorder_2, stateorder_2 = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='second') fig, (ax1, ax2, ax3) = plt.subplots(1, 3, figsize=(17, 3)) ax1.matshow(state_pos_b[peakorder_b,:], interpolation='none', cmap='OrRd') ax1.set_ylabel('state') ax1.set_xticklabels([]) ax1.set_yticklabels([]) ax1.set_title('learned place fields BOTH; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax1.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.axis('tight') ax2.matshow(state_pos_1[peakorder_1,:], interpolation='none', cmap='OrRd') ax2.set_ylabel('state') ax2.set_xticklabels([]) ax2.set_yticklabels([]) ax2.set_title('learned place fields FIRST; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax2.plot([13, 35], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax2.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax2.axis('tight') ax3.matshow(state_pos_2[peakorder_2,:], interpolation='none', cmap='OrRd') ax3.set_ylabel('state') ax3.set_xticklabels([]) ax3.set_yticklabels([]) ax3.set_title('learned place fields SECOND; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax3.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax3.plot([7, 41], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax3.axis('tight') from placefieldviz import hmmplacefieldposviz num_states = 100 ds = 0.0625 # bin spikes into 62.5 ms bins (theta-cycle inspired) vth = 8 # units/sec velocity threshold for place fields state_pos_b, peakorder_b, stateorder_b = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='both') state_pos_1, peakorder_1, stateorder_1 = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='first') state_pos_2, peakorder_2, stateorder_2 = hmmplacefieldposviz(num_states=num_states, ds=ds, posdf=posdf, spikes=spikes, speed=speed, vth=vth, normalize=True, experiment='second') fig, (ax1, ax2, ax3) = plt.subplots(1, 3, figsize=(17, 3)) ax1.matshow(state_pos_b[peakorder_b,:], interpolation='none', cmap='OrRd') ax1.set_ylabel('state') ax1.set_xticklabels([]) ax1.set_yticklabels([]) ax1.set_title('learned place fields BOTH; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax1.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.axis('tight') ax2.matshow(state_pos_1[peakorder_1,:], interpolation='none', cmap='OrRd') ax2.set_ylabel('state') ax2.set_xticklabels([]) ax2.set_yticklabels([]) ax2.set_title('learned place fields FIRST; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax2.plot([13, 35], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax2.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax2.axis('tight') ax2.add_patch( patches.Rectangle( (-1, 0), # (x,y) 8, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) ax2.add_patch( patches.Rectangle( (41, 0), # (x,y) 11, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) ax3.matshow(state_pos_2[peakorder_2,:], interpolation='none', cmap='OrRd') ax3.set_ylabel('state') ax3.set_xticklabels([]) ax3.set_yticklabels([]) ax3.set_title('learned place fields SECOND; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax3.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax3.plot([7, 41], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax3.axis('tight') ax3.add_patch( patches.Rectangle( (-1, 0), # (x,y) 14, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) ax3.add_patch( patches.Rectangle( (35, 0), # (x,y) 15, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) import matplotlib.patches as patches fig, (ax1, ax2, ax3) = plt.subplots(1, 3, figsize=(17, 3)) ax1.matshow(state_pos_b[stateorder_b,:], interpolation='none', cmap='OrRd') ax1.set_ylabel('state') ax1.set_xticklabels([]) ax1.set_yticklabels([]) ax1.set_title('learned place fields BOTH; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax1.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.axis('tight') ax2.matshow(state_pos_1[stateorder_1,:], interpolation='none', cmap='OrRd') ax2.set_ylabel('state') ax2.set_xticklabels([]) ax2.set_yticklabels([]) ax2.set_title('learned place fields FIRST; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax2.plot([13, 13], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax2.plot([7, 7], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax2.plot([35, 35], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax2.plot([41, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax2.axis('tight') ax2.add_patch( patches.Rectangle( (-1, 0), # (x,y) 8, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) ax2.add_patch( patches.Rectangle( (41, 0), # (x,y) 11, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) ax3.matshow(state_pos_2[stateorder_2,:], interpolation='none', cmap='OrRd') ax3.set_ylabel('state') ax3.set_xticklabels([]) ax3.set_yticklabels([]) ax3.set_title('learned place fields SECOND; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax3.plot([13, 13], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax3.plot([7, 7], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax3.plot([35, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax3.plot([41, 41], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax3.axis('tight') ax3.add_patch( patches.Rectangle( (-1, 0), # (x,y) 14, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) ax3.add_patch( patches.Rectangle( (35, 0), # (x,y) 15, # width num_states, # height hatch='/', facecolor='w', alpha=0.5 ) ) fig.suptitle('State ordering not by peak location, but by the state transition probability matrix', y=1.08, fontsize=14) saveFigure('posterfigs/zigzag.pdf') state_pos_b[state_pos_b < np.transpose(np.tile(state_pos_b.max(axis=1),[state_pos_b.shape[1],1]))] = 0 state_pos_b[state_pos_b == np.transpose(np.tile(state_pos_b.max(axis=1),[state_pos_b.shape[1],1]))] = 1 state_pos_1[state_pos_1 < np.transpose(np.tile(state_pos_1.max(axis=1),[state_pos_1.shape[1],1]))] = 0 state_pos_1[state_pos_1 == np.transpose(np.tile(state_pos_1.max(axis=1),[state_pos_1.shape[1],1]))] = 1 state_pos_2[state_pos_2 < np.transpose(np.tile(state_pos_2.max(axis=1),[state_pos_2.shape[1],1]))] = 0 state_pos_2[state_pos_2 == np.transpose(np.tile(state_pos_2.max(axis=1),[state_pos_2.shape[1],1]))] = 1 fig, (ax1, ax2, ax3) = plt.subplots(1, 3, figsize=(17, 3)) ax1.matshow(state_pos_b[peakorder_b,:], interpolation='none', cmap='OrRd') ax1.set_ylabel('state') ax1.set_xticklabels([]) ax1.set_yticklabels([]) ax1.set_title('learned place fields BOTH; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax1.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax1.axis('tight') ax2.matshow(state_pos_1[peakorder_1,:], interpolation='none', cmap='OrRd') ax2.set_ylabel('state') ax2.set_xticklabels([]) ax2.set_yticklabels([]) ax2.set_title('learned place fields FIRST; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax2.plot([13, 35], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax2.plot([7, 41], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax2.axis('tight') ax3.matshow(state_pos_2[peakorder_2,:], interpolation='none', cmap='OrRd') ax3.set_ylabel('state') ax3.set_xticklabels([]) ax3.set_yticklabels([]) ax3.set_title('learned place fields SECOND; RUN > ' + str(vth) + '; m = ' + str(num_states) + '; ds = ' + str(ds), y=1.02) ax3.plot([13, 35], [0, num_states], color='k', linestyle='dashed', linewidth=2) ax3.plot([7, 41], [0, num_states], color='gray', linestyle='dashed', linewidth=1) ax3.axis('tight') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: 1. Implementar o algoritmo K-means Step3: Teste a função criada e visualize os centróides que foram calculados. Step5: 1.2 Definir os Clusters Step6: Teste a função criada. Step8: 1.2.2 Calcular o centroide mais próximo Step9: Teste a função criada Step11: 1.2.3 Calcular centroid mais próximo de cada dado do dataset Step12: Teste a função criada visualizando os cluster formados. Step14: 1.3 Métrica de avaliação Step15: Teste a função codificada executando o código abaixo. Step17: 1.4 Atualizar os clusters Step18: Visualize os clusters formados Step19: Execute a função de atualização e visualize novamente os cluster formados Step20: 2. K-means Step21: Verifique o resultado do algoritmo abaixo! Step22: 2.2 Comparar com algoritmo do Scikit-Learn Step23: 3. Método do cotovelo Step24: 4. Dataset Real
<ASSISTANT_TASK:> Python Code: # import libraries # linear algebra import numpy as np # data processing import pandas as pd # data visualization from matplotlib import pyplot as plt # load the data with pandas dataset = pd.read_csv('dataset.csv', header=None) dataset = np.array(dataset) plt.scatter(dataset[:,0], dataset[:,1], s=10) plt.show() def calculate_initial_centers(dataset, k): Inicializa os centróides iniciais de maneira arbitrária Argumentos: dataset -- Conjunto de dados - [m,n] k -- Número de centróides desejados Retornos: centroids -- Lista com os centróides calculados - [k,n] #### CODE HERE #### centroid = [] c = 0 while (c < k): x = np.array(np.random.uniform(min(dataset[:,0]),max(dataset[:,0]))) y = np.array(np.random.uniform(min(dataset[:,1]),max(dataset[:,1]))) centroid.append([x,y]) c += 1 centroids = np.array(centroid) ### END OF CODE ### return centroids k = 3 centroids = calculate_initial_centers(dataset, k) plt.scatter(dataset[:,0], dataset[:,1], s=10) plt.scatter(centroids[:,0], centroids[:,1], marker='^', c='red',s=100) plt.show() import math def euclidean_distance(a, b): Calcula a distância euclidiana entre os pontos a e b Argumentos: a -- Um ponto no espaço - [1,n] b -- Um ponto no espaço - [1,n] Retornos: distance -- Distância euclidiana entre os pontos #### CODE HERE #### #s = 0 #for i in range(len(a)): # diff = (a[i] - b[i]) # s += diff*diff #distance = math.sqrt(s) #distance = math.sqrt(sum([((a[i] - b[i])**2) for i in range(len(a))])) distance = math.sqrt(sum((a-b)**2)) ### END OF CODE ### return distance a = np.array([1, 5, 9]) b = np.array([3, 7, 8]) if (euclidean_distance(a,b) == 3): print("Distância calculada corretamente!") else: print("Função de distância incorreta") def nearest_centroid(a, centroids): Calcula o índice do centroid mais próximo ao ponto a Argumentos: a -- Um ponto no espaço - [1,n] centroids -- Lista com os centróides - [k,n] Retornos: nearest_index -- Índice do centróide mais próximo #### CODE HERE #### dist = float("inf") k = len(centroids) for i in range(k): d = euclidean_distance(a, centroids[i]) if d < dist: nindex = i dist = d nearest_index = nindex ### END OF CODE ### return nearest_index # Seleciona um ponto aleatório no dataset index = np.random.randint(dataset.shape[0]) a = dataset[index,:] # Usa a função para descobrir o centroid mais próximo idx_nearest_centroid = nearest_centroid(a, centroids) # Plota os dados ------------------------------------------------ plt.scatter(dataset[:,0], dataset[:,1], s=10) # Plota o ponto aleatório escolhido em uma cor diferente plt.scatter(a[0], a[1], c='magenta', s=30) # Plota os centroids plt.scatter(centroids[:,0], centroids[:,1], marker='^', c='red', s=100) # Plota o centroid mais próximo com uma cor diferente plt.scatter(centroids[idx_nearest_centroid,0], centroids[idx_nearest_centroid,1], marker='^', c='springgreen', s=100) # Cria uma linha do ponto escolhido para o centroid selecionado plt.plot([a[0], centroids[idx_nearest_centroid,0]], [a[1], centroids[idx_nearest_centroid,1]], c='orange') plt.annotate('CENTROID', (centroids[idx_nearest_centroid,0], centroids[idx_nearest_centroid,1],)) plt.show() def all_nearest_centroids(dataset, centroids): Calcula o índice do centroid mais próximo para cada ponto do dataset Argumentos: dataset -- Conjunto de dados - [m,n] centroids -- Lista com os centróides - [k,n] Retornos: nearest_indexes -- Índices do centróides mais próximos - [m,1] #### CODE HERE #### nearest_indexes = [nearest_centroid(dataset[i], centroids) for i in range(len(dataset))] ### END OF CODE ### return nearest_indexes nearest_indexes = all_nearest_centroids(dataset, centroids) plt.scatter(dataset[:,0], dataset[:,1], c=nearest_indexes) plt.scatter(centroids[:,0], centroids[:,1], marker='^', c='red', s=100) plt.show() def inertia(dataset, centroids, nearest_indexes): Soma das distâncias quadradas das amostras para o centro do cluster mais próximo. Argumentos: dataset -- Conjunto de dados - [m,n] centroids -- Lista com os centróides - [k,n] nearest_indexes -- Índices do centróides mais próximos - [m,1] Retornos: inertia -- Soma total do quadrado da distância entre os dados de um cluster e seu centróide tmp_data = np.array([[1,2,3],[3,6,5],[4,5,6]]) tmp_centroide = np.array([[2,3,4]]) tmp_nearest_indexes = all_nearest_centroids(tmp_data, tmp_centroide) if inertia(tmp_data, tmp_centroide, tmp_nearest_indexes) == 26: #### CODE HERE #### '''s = 0 for i in range(len(tmp_data)): m = euclidean_distance(tmp_data[i],tmp_centroide[0])**2 s += m''' inertia = sum([euclidean_distance(tmp_data[i],tmp_centroide[0])**2 for i in range(len(tmp_data))]) ### END OF CODE ### return inertia tmp_data = np.array([[1,2,3],[3,6,5],[4,5,6]]) tmp_centroide = np.array([[2,3,4]]) tmp_nearest_indexes = all_nearest_centroids(tmp_data, tmp_centroide) if inertia(tmp_data, tmp_centroide, tmp_nearest_indexes) == 26: print("Inertia calculada corretamente!") else: print("Função de inertia incorreta!") # Use a função para verificar a inertia dos seus clusters inertia(dataset, centroids, nearest_indexes) def update_centroids(dataset, centroids, nearest_indexes): Atualiza os centroids Argumentos: dataset -- Conjunto de dados - [m,n] centroids -- Lista com os centróides - [k,n] nearest_indexes -- Índices do centróides mais próximos - [m,1] Retornos: centroids -- Lista com centróides atualizados - [k,n] #### CODE HERE #### ### END OF CODE ### return centroids nearest_indexes = all_nearest_centroids(dataset, centroids) # Plota os os cluster ------------------------------------------------ plt.scatter(dataset[:,0], dataset[:,1], c=nearest_indexes) # Plota os centroids plt.scatter(centroids[:,0], centroids[:,1], marker='^', c='red', s=100) for index, centroid in enumerate(centroids): dataframe = dataset[nearest_indexes == index,:] for data in dataframe: plt.plot([centroid[0], data[0]], [centroid[1], data[1]], c='lightgray', alpha=0.3) plt.show() centroids = update_centroids(dataset, centroids, nearest_indexes) class KMeans(): def __init__(self, n_clusters=8, max_iter=300): self.n_clusters = n_clusters self.max_iter = max_iter def fit(self,X): # Inicializa os centróides self.cluster_centers_ = [None] # Computa o cluster de cada amostra self.labels_ = [None] # Calcula a inércia inicial old_inertia = [None] for index in [None]: #### CODE HERE #### ### END OF CODE ### return self def predict(self, X): return [None] kmeans = KMeans(n_clusters=k) kmeans.fit(dataset) print("Inércia = ", kmeans.inertia_) plt.scatter(dataset[:,0], dataset[:,1], c=kmeans.labels_) plt.scatter(kmeans.cluster_centers_[:,0], kmeans.cluster_centers_[:,1], marker='^', c='red', s=100) plt.show() #### CODE HERE #### # fonte: https://stackabuse.com/k-means-clustering-with-scikit-learn/ import matplotlib.pyplot as plt from sklearn.cluster import KMeans plt.scatter(dataset[:,0],dataset[:,1], label='True Position') kmeans = KMeans(n_clusters=k) kmeans.fit(dataset) print("Inércia = ", kmeans.inertia_) #print(kmeans.cluster_centers_) #print(kmeans.labels_) plt.scatter(dataset[:,0],dataset[:,1], c=kmeans.labels_, cmap='Set3') plt.scatter(kmeans.cluster_centers_[:,0] ,kmeans.cluster_centers_[:,1], marker='^', color='black', s=100) #### CODE HERE #### #### CODE HERE #### from sklearn import metrics url="http://archive.ics.uci.edu/ml/machine-learning-databases/iris/iris.data" data=pd.read_csv(url, header=None) labels_true = [0, 0, 0, 1, 1, 1] labels_pred = [0, 0, 1, 1, 2, 2] metrics.homogeneity_score(labels_true, labels_pred) metrics.completeness_score(labels_true, labels_pred) #2 #3 #4 <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Script setup Step2: Settings Step3: Update the download links Step4: Note that, as of August 25, 2020, the following sources are available only from the OPSD server and the data will be downloaded from it even if download_from is set to 'original_sources' Step5: Set up the NUTS converter Step6: Setup translation dictionaries Step7: Download and process per country Step8: Translate column names Step9: Add information and choose columns Step10: Merge DataFrames Step11: Translate values and harmonize energy source level 2 Step12: Separate and assign energy source level 1 - 3 and technology Step13: According to the OPSD energy hierarchy, the power plants whose energy_source_level_2 is either Storage or Other fossil fuels do not belong to the class of renewable-energy facilities. Therefore, we can remove them. Step14: Summary of DataFrame Step15: Transform electrical capacity from kW to MW Step16: Georeferencing Step17: Merge geometry information by using the postcode Step18: Transform geoinformation Step19: Remove the utm_zone "32" from the utm_east value Step20: Conversion UTM to latitude and longitude Step21: Check Step22: Remove temporary columns Step23: Save temporary Pickle (to have a point to quickly return to if things break after this point) Step24: Clean data Step25: Assign NUTS codes Step26: Visualize Step27: Save Step28: Denmark DK Step29: The function for reading the data on the wind turbines. Step30: Translate column names Step31: Add data source and missing information Step32: Correct the dates Step33: Translate values and harmonize energy source level 2 Step34: Georeferencing Step35: Postcode to lat/lon (WGS84) Step36: Merge DataFrames, add NUTS information and choose columns Step37: Let us check geoinformation on the facilities for which NUTS codes could not be determined. Step38: As we see, no information on municipality and latitude/longitude coordinates are present for those power plants, so there was no possibility to assign them their NUTS codes. Step39: Remove duplicate rows Step40: Transform electrical_capacity from kW to MW Step41: Visualize Step42: Save Step43: France FR Step44: ODRE data Step45: Translate column names Step46: Add data source Step47: Translate values Step48: Correct site names Step49: Replace suspicious dates with N/A Step50: Check missing values Step51: As we see above, no column contains only the null value, so we do not need to drop any. Step52: No row contains only the null values, so no need to for filtering on that basis. Step53: In order to facilitate further processing, we can remove the rows that we know for sure we won't need. Step54: Standardize source levels 1-3 and technology Step55: First, let us standardize the values for energy source level 2 and technology. Step56: Let us now deal with the third level of the energy hierarchy. Only Bioenergy has the third level. Information on it can be found in the column energy_source_level_3 (whose original name was combustible). Step57: We see that only the following two corrections are needed Step58: Finally, we declare all the plants as renewable and show the final hierarchy. Step59: Georeferencing Step60: Determine NUTS codes Step61: Let us now check the facilities without NUTS classification. Step62: We see that no row with known longitude and latitude was left unclassified. Step63: We also see that problematic municipality names are either not present in the official translation tables or more than one municipality in the tables bears them. Step64: Therefore, we can confirm that NUTS classification codes were determined with the highest precision possible. Step65: Old data Step66: This French data source contains number of installations and sum of installed capacity per energy source per municipality. The list is limited to the plants which are covered by article 10 of february 2000 by an agreement to a purchase commitment. Step67: Add data source Step68: Translate values and harmonize energy source level 2 Step69: Separate and assign energy source level 1-3 and technology Step70: Show the hierarchy of the energy types present in the data. Step71: Georeferencing Step72: Determine NUTS codes Step73: As we can see, the NUTS codes were determined successfully for all the facilities in the dataset. Step74: Select the columns Step75: Visualize Step76: Save Step77: Poland PL Step78: Load and explore the data Step79: There are only five columns Step80: To ease the work, we can translate the columns' names to English using the OPSD translation tables. Step81: Inspect the data Step82: We can see that each name comes in two forms Step83: Now, let us check the strings for districts (powiats). Step84: As we see in the list, the same district can be referred to by more than one string. We identify the following ways a district is referred to in the dataset Step85: Harmonising energy levels Step86: Georeferencing (NUTS classification) Step87: We can now apply a heuristic method for finding the corresponding name in the GeoNames data. It is based on similarity between strings. It turns out that it works fine, except for a couple of cases, which we deal with manually. Step88: The following districts have not been mapped correctly Step89: Show the rows for which we could not find postcodes. Step90: There are only 17 such power plants and all of them are placed in the districts which we deliberately left out for manual classification. Step91: Add data source and year Step92: Select columns Step93: Save Step94: Switzerland CH Step95: Translate column names Step96: Add data source Step97: Harmonize energy source hierarchy and translate values Step98: Separate and assign energy source level 1-3 and technology Step99: The power plants with energy_source_level_3=Biomass and biogas and technology=Steam turbine do not belong to the renewable energy power plants, so we can remove them. Step100: Replace the rest of the original terms with their OPSD equivalents Step101: Georeferencing Step102: Add NUTS information Step103: Let us check the stations for which NUTS codes could not be determined. Step104: We see that the municipalities of only plants for which we could not determine the NUTS codes cannot be found in the official translation tables, so there was no possibility to assign them their NUTS classification codes. Step105: Select columns to keep Step106: Visualize Step107: Save Step108: Check and validation of the renewable power plants list as well as the creation of CSV/XLSX/SQLite files can be found in Part 2 of this script. It also generates a daily time series of cumulated installed capacities by energy source. Step109: Clean the data Step110: Translate column names Step111: Add data source Step112: Translate values and harmonise energy source levels 1-3 and technology Step113: Georeferencing Step114: Cases with unknown Easting and Northing coordinates Step115: Cases for approximation Step116: Add NUTS information Step117: Let us see the facilities for which the NUTS codes could not be determined. Step118: There are two such rows only. The langitude and longitude coordinates, as well as municipality codes, are missing from the data set, so NUTS codes could not have been determined. Step119: We see that some facilities appear to be located in the sea. Let us plot the original OSGB coordinates to see if translation to the standard longitude and latitude coordinates failed for some locations. Step120: As we can see, the maps are basically the same, which confirms that translation to the longitude and latitude coordinates is done correctly and that they reflect the positions specified by the original X and Y OSGB coordinates. Step121: Save Step122: Sweden Step123: Load the data Step124: Clean the data Step125: Translate column names Step126: Correct the dates Step127: Add source Step128: Translate values and harmonize energy source levels Step129: Georeferencing Step130: Assigning NUTS codes Step131: Select the columns to keep Step132: Visualize Step133: Save Step134: Czech Republic Step135: Let's inspect the dataframe's columns Step136: It contains 30 columns Step137: As of April 2020, as we can see in the output above, there are only 4 sites which use more than one type of renewable energy, and there are 193 sites which do not use renewable energy at all. Step138: Reformat the data Step139: Let us see what is this restructured dataframe like. Step140: The number of columns has been reduced as we have transformed the data to the long format. The rows representning conventional power plants have been excluded. Since only few sites use multiple types of energy, the total number of rows has not increased. Step141: Translate values and harmonize energy levels Step142: Add data source Step143: Georeferencing Step144: Assign NUTS codes Step145: Select the columns to keep Step146: Drop duplicates Step147: Visualuze Step148: Save Step149: Zip the raw data
<ASSISTANT_TASK:> Python Code: version = '2020-08-25' import logging import os import posixpath import urllib.parse import urllib.request import re import zipfile import pickle import urllib import shutil import datetime import numpy as np import pandas as pd import utm # for transforming geoinformation in the utm format import requests import fake_useragent from string import Template from IPython.display import display import xlrd import bs4 import bng_to_latlon import matplotlib.pyplot as plt from matplotlib.pyplot import figure # for visualizing locations on maps import cartopy.crs as ccrs import cartopy.feature as cfeature from cartopy.io import shapereader import geopandas import shapely logging.basicConfig( level=logging.INFO, format='%(asctime)s - %(name)s - %(levelname)s - %(message)s', datefmt='%d %b %Y %H:%M:%S' ) logger = logging.getLogger() # Create input, intermediate and output folders if they don't exist. # If the paths are relative, the correspoding folders will be created # inside the current working directory. input_directory_path = os.path.join('input', 'original_data') intermediate_directory_path = 'intermediate' output_directory_path = os.path.join('output', 'renewable_power_plants') os.makedirs(input_directory_path, exist_ok=True) os.makedirs(intermediate_directory_path, exist_ok=True) os.makedirs(output_directory_path, exist_ok=True) # Create the folder to which the Eurostat files with data at the level of the whole EU/Europe #are going to be downloaded eurostat_eu_directory_path = os.path.join('input', 'eurostat_eu') os.makedirs(eurostat_eu_directory_path, exist_ok=True) # Define the path of the file with the list of sources. source_list_filepath = os.path.join('input', 'sources.csv') # Import the utility functions and classes from the util package import util.helper from util.visualizer import visualize_points download_from = 'original_sources' #download_from = 'opsd_server' source_df = pd.read_csv(source_list_filepath) uk_main_page = 'https://www.gov.uk/government/publications/renewable-energy-planning-database-monthly-extract' current_link = util.helper.get_beis_link(uk_main_page) current_filename = current_link.split('/')[-1] source_df.loc[(source_df['country'] == 'UK') & (source_df['source'] == 'BEIS'), 'url'] = current_link source_df.loc[(source_df['country'] == 'UK') & (source_df['source'] == 'BEIS'), 'filename'] = current_filename source_df.to_csv(source_list_filepath, index=False, header=True) source_df.fillna('') import util.downloader from util.downloader import Downloader downloader = Downloader(version, input_directory_path, source_list_filepath, download_from) #import importlib #importlib.reload(util.nuts_converter) #importlib.reload(util.downloader) #from util.downloader import Downloader #downloader = Downloader(version, input_directory_path, source_list_filepath, download_from) from util.nuts_converter import NUTSConverter nuts_converter = NUTSConverter(downloader, eurostat_eu_directory_path) # Get column translation list columnnames = pd.read_csv(os.path.join('input', 'column_translation_list.csv')) columnnames.head(2) # Get value translation list valuenames = pd.read_csv(os.path.join('input', 'value_translation_list.csv')) valuenames.head(2) # Define the lists of source names downloader = Downloader(version, input_directory_path, source_list_filepath, download_from) tsos = ['50Hertz', 'Amprion', 'TenneT', 'TransnetBW'] datasets = ['50Hertz', 'Amprion', 'TenneT', 'TransnetBW','bnetza','bnetza_pv','bnetza_pv_historic'] # Download the files and get the local file paths indexed by source names filepaths = downloader.download_data_for_country('DE') # Remove the Eurostat NUTS file as it's a geoinformation source DE_postcode2nuts_filepath = filepaths.pop('Eurostat') # Open all data sets before processing. filenames = {} for source in filepaths: filepath = filepaths[source] print(source, filepath) if os.path.splitext(filepath)[1] != '.xlsx' and zipfile.is_zipfile(filepath): filenames[source] = zipfile.ZipFile(filepath) else: filenames[source] = filepath # Read TSO data from the zip files dfs = {} basenames_by_tso = { '50Hertz': '50Hertz Transmission GmbH EEG-Zahlungen Stammdaten 2019', 'Amprion': 'Amprion GmbH EEG-Zahlungen Anlagenstammdaten 2019', 'TenneT': 'TenneT TSO GmbH Anlagenstammdaten 2019', 'TransnetBW': 'TransnetBW GmbH Anlagenstammdaten 2019', } for tso in tsos: filename = basenames_by_tso[tso]+'.csv' print('Reading', filename) #print(filenames[tso].namelist()) dfs[tso] = pd.read_csv( filenames[tso].open(filename), sep=';', thousands='.', decimal=',', # Headers have to have the same order for all TSOs. Therefore just define headers here. # Remove the following three lines if for next version, headers should be read out initially # to then check if order is the same everywhere. names=['EEG-Anlagenschlüssel', 'MASTR_Nr_EEG','Netzbetreiber Betriebsnummer','Netzbetreiber Name', 'Strasse_flurstueck','PLZ','Ort / Gemarkung','Gemeindeschlüssel','Bundesland', 'Installierte Leistung','Energieträger','Spannungsebene','Leistungsmessung','Regelbarkeit', 'Inbetriebnahme','Außerbetriebnahme','Netzzugang','Netzabgang'], header=None, skiprows=1, parse_dates=[14, 15, 16, 17], #[11, 12, 13, 14] #infer_datetime_format=True, date_parser = lambda x: pd.to_datetime(x, errors='coerce', format='%d.%m.%Y'), encoding='iso-8859-1', dayfirst=True, low_memory=False ) print('Done reading ' + filename) for filename in filenames.values(): if(isinstance(filename, zipfile.ZipFile)): #print(filename) filename.close() # define the date parser def date_parser(x): if type(x) == str: return datetime.datetime.strptime(x, '%D.%M.%Y') elif type(x) == float and pd.isnull(x): return pd.NaT def inspect(x): try: converted = datetime.datetime.strptime(x, '%d.%m.%Y') return False except: return True # Read BNetzA register print('Reading bnetza: '+filenames['bnetza']) dfs['bnetza'] = pd.read_excel(filenames['bnetza'], sheet_name='Gesamtübersicht', header=0, converters={'4.9 Postleit-zahl': str, 'Gemeinde-Schlüssel': str} ) skiprows = {'bnetza_pv_historic': 10, 'bnetza_pv': 9} for dataset in ['bnetza_pv', 'bnetza_pv_historic']: print(dataset) print('Reading ' + dataset + ': ' + filenames[dataset]) xls_handle = pd.ExcelFile(filenames[dataset]) print('Concatenating all '+dataset+' sheets into one dataframe') dfs[dataset] = pd.concat( (xls_handle.parse( sheet, skiprows=skiprows[dataset], converters={'Anlage \nPLZ': str} ) for sheet in xls_handle.sheet_names), sort=True ) # Make sure that the column `Inbetriebnahme-datum *)` (commissioning date) in the bnetza_pv set is datetime. mask = dfs['bnetza_pv']['Inbetriebnahme-datum *)'].apply(lambda x: type(x) == int) dfs['bnetza_pv']['Inbetriebnahme-datum *)'] = pd.to_datetime(dfs['bnetza_pv']['Inbetriebnahme-datum *)'], errors='coerce', dayfirst=True, infer_datetime_format=True) dfs['bnetza_pv']['Inbetriebnahme-datum *)'] = dfs['bnetza_pv']['Inbetriebnahme-datum *)'].apply( lambda x: x.to_datetime64() ) dfs['bnetza_pv_historic'] = dfs['bnetza_pv_historic'].drop(['Unnamed: 7'], axis=1) pickle.dump( dfs, open( "intermediate/temp_dfs_DE_after_reading.pickle", "wb" ) ) dfs = pickle.load( open( "intermediate/temp_dfs_DE_after_reading.pickle", "rb" ) ) # Choose the translation terms for Germany, create dictionary and show dictionary columnnames = pd.read_csv(os.path.join('input', 'column_translation_list.csv')) idx_DE = columnnames[columnnames['country'] == 'DE'].index column_dict_DE = columnnames.loc[idx_DE].set_index('original_name')['opsd_name'].to_dict() column_dict_DE # Start the column translation process for each original data source print('Translation...') for dataset in dfs: # Remove newlines and any other duplicate whitespaces in column names: dfs[dataset] = dfs[dataset].rename(columns={col: re.sub(r"\s+", ' ', col) for col in dfs[dataset].columns}) # Do column name translations print(dataset) #print(list(dfs[dataset].columns)) dfs[dataset].rename(columns=column_dict_DE, inplace=True) #print(list(dfs[dataset].columns).index('decommissioning_date')) #print('--------------------------------------------') print('done.') # Add data source names to the DataFrames for tso in tsos: dfs[tso]['data_source'] = tso dfs[tso]['tso'] = tso dfs['bnetza']['data_source'] = 'BNetzA' dfs['bnetza_pv']['data_source'] = 'BNetzA_PV' dfs['bnetza_pv_historic']['data_source'] = 'BNetzA_PV_historic' # Add for the BNetzA PV data the energy source level 2 dfs['bnetza_pv']['energy_source_level_2'] = 'Photovoltaics' dfs['bnetza_pv_historic']['energy_source_level_2'] = 'Photovoltaics' # Select those columns of the original data which are utilised further dfs['bnetza'] = dfs['bnetza'].loc[:, ('commissioning_date', 'decommissioning_date', 'notification_reason', 'energy_source_level_2', 'electrical_capacity_kW', 'thermal_capacity_kW', 'voltage_level', 'dso', 'eeg_id', 'bnetza_id', 'federal_state', 'postcode', 'municipality_code', 'municipality', 'address', 'address_number', 'utm_zone', 'utm_east', 'utm_north', 'data_source')] for dataset in datasets: print(dataset+':'); display(dfs[dataset].tail(2)) # Merge DataFrames of each original source into a common DataFrame DE_renewables dfs_list = [] for dataset in datasets: dfs_list.append(dfs[dataset]) DE_renewables = pd.concat(dfs_list, sort=True) DE_renewables.head(2) DE_renewables.reset_index(drop=True, inplace=True) DE_renewables.head(2) # Choose the translation terms for Germany, create dictionary and show dictionary valuenames = pd.read_csv(os.path.join('input', 'value_translation_list.csv')) idx_DE = valuenames[valuenames['country'] == 'DE'].index value_dict_DE = valuenames.loc[idx_DE].set_index('original_name')['opsd_name'].to_dict() value_dict_DE print('replacing...') # Replace all original value names by the OPSD value names. # Running time: some minutes. DE_renewables.replace(value_dict_DE, inplace=True) print('Done!') DE_renewables['postcode'] = DE_renewables['postcode'].apply(pd.to_numeric, errors='ignore') # Create dictionary in order to assign energy_source to its subtype energy_source_dict_DE = valuenames.loc[idx_DE].set_index( 'opsd_name')['energy_source_level_2'].to_dict() # Column energy_source partly contains energy source level 3 and technology information, # thus this column is copied to new column technology... DE_renewables['technology'] = DE_renewables['energy_source_level_2'] # ...and the energy source level 2 values are replaced by the higher level classification DE_renewables['energy_source_level_2'].replace(energy_source_dict_DE, inplace=True) # Choose energy source level 2 entries where energy_source is "Bioenergy" in order to # separate Bioenergy subtypes to "energy_source_level_3" and subtypes for the rest to "technology" idx_DE_Bioenergy = DE_renewables[DE_renewables['energy_source_level_2'] == 'Bioenergy'].index # Assign technology to energy source level 3 for all entries where energy source level 2 is # Bioenergy and delete those entries from technology DE_renewables[['energy_source_level_3']] = DE_renewables.iloc[idx_DE_Bioenergy][['technology']] DE_renewables.loc[idx_DE_Bioenergy]['technology'] = np.nan # Assign energy source level 1 to the dataframe DE_renewables['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy of the energy types present in the frame energy_columns = ['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology'] DE_renewables[energy_columns].drop_duplicates().sort_values(by='energy_source_level_2') drop_mask = DE_renewables['energy_source_level_2'].isin(['Other fossil fuels', 'Storage']) DE_renewables.drop(DE_renewables.index[drop_mask], axis=0, inplace=True) # Electrical capacity per energy source level 2 (in MW) DE_renewables.groupby(['energy_source_level_2'])['electrical_capacity_kW'].sum() / 1000 # kW to MW DE_renewables[['electrical_capacity_kW', 'thermal_capacity_kW']] /= 1000 # adapt column name DE_renewables.rename(columns={'electrical_capacity_kW': 'electrical_capacity', 'thermal_capacity_kW': 'thermal_capacity'}, inplace=True) # Read generated postcode/location file postcode = pd.read_csv(os.path.join('input', 'de_tso_postcode_full.csv')) # Drop possible duplicates in postcodes postcode.drop_duplicates('postcode', keep='last', inplace=True) # Show first entries postcode.head(2) # Take postcode and longitude/latitude information postcode = postcode[['postcode', 'lon', 'lat']] # Cast DE_renewables['postcode'] to int64 in order to do the natural join of the dataframes DE_renewables['postcode'] = pd.to_numeric(DE_renewables['postcode'], errors='coerce') # Join two dataframes DE_renewables = DE_renewables.merge(postcode, on=['postcode'], how='left') DE_renewables.groupby(['utm_zone'])['utm_zone'].count() # Find entries with 32 value at the beginning idx_32 = (DE_renewables['utm_east'].astype(str).str[:2] == '32') idx_notnull = DE_renewables['utm_east'].notnull() # Remove 32 from utm_east entries DE_renewables.loc[idx_32, 'utm_east'] = DE_renewables.loc[idx_32, 'utm_east'].astype(str).str[2:].astype(float) def convert_to_latlon(utm_east, utm_north, utm_zone): try: return utm.to_latlon(utm_east, utm_north, utm_zone, 'U') except: return '' DE_renewables['latlon'] = DE_renewables.loc[idx_notnull, ['utm_east', 'utm_north', 'utm_zone']].apply( lambda x: convert_to_latlon(x[0], x[1], x[2]), axis=1).astype(str) lat = [] lon = [] for row in DE_renewables['latlon']: try: # Split tuple format into the column lat and lon row = row.lstrip('(').rstrip(')') parts = row.split(',') if(len(parts)<2): raise Exception('This is not a proper tuple. So go to exception block.') lat.append(parts[0]) lon.append(parts[1]) except: # set NaN lat.append(np.NaN) lon.append(np.NaN) DE_renewables['latitude'] = pd.to_numeric(lat) DE_renewables['longitude'] = pd.to_numeric(lon) # Add new values to DataFrame lon and lat DE_renewables['lat'] = DE_renewables[['lat', 'latitude']].apply( lambda x: x[1] if pd.isnull(x[0]) else x[0], axis=1) DE_renewables['lon'] = DE_renewables[['lon', 'longitude']].apply( lambda x: x[1] if pd.isnull(x[0]) else x[0], axis=1) #DE_renewables[DE_renewables['data_source'] == '50Hertz'].to_excel('test.xlsx') print('Missing coordinates ', DE_renewables.lat.isnull().sum()) display( DE_renewables[DE_renewables.lat.isnull()].groupby( ['energy_source_level_2','data_source'] )['data_source'].count() ) print('Share of missing coordinates (note that NaN can mean it\'s all fine):') DE_renewables[DE_renewables.lat.isnull()].groupby( ['energy_source_level_2','data_source'] )['data_source'].count() / DE_renewables.groupby( ['energy_source_level_2','data_source'] )['data_source'].count() # drop lonlat column that contains both, latitute and longitude DE_renewables.drop(['latlon', 'longitude', 'latitude'], axis=1, inplace=True) pickle.dump(DE_renewables, open( "intermediate/temp_dfs_DE_before_cleaning.pickle", "wb" ) ) DE_renewables = pickle.load( open( "intermediate/temp_dfs_DE_before_cleaning.pickle", "rb" ) ) # Remove out-of-range dates # Keep only values between 1900 and 2100 to rule out outliers / wrong values. # Also, Excel doesn't support dates before 1900.. mask = ((DE_renewables['commissioning_date']>pd.Timestamp('1900')) & (DE_renewables['commissioning_date']<pd.Timestamp('2100'))) DE_renewables = DE_renewables[mask] DE_renewables['municipality_code'] = DE_renewables['municipality_code'].astype(str) # Remove spaces from municipality code DE_renewables['municipality_code'] = DE_renewables['municipality_code'].str.replace(' ', '', regex=False) DE_renewables['municipality_code'] = pd.to_numeric(DE_renewables['municipality_code'], errors='coerce', downcast='integer') # Merge address and address_number to_string = lambda x: str(x) if not pd.isnull(x) else '' DE_renewables['address'] = DE_renewables['address'].map(to_string) + ' ' + DE_renewables['address_number'].map(to_string) # Make sure that the column has no whitespaces at the beginning and the end DE_renewables['address'] = DE_renewables['address'].str.strip() # Remove the column with address numbers as it is not needed anymore del DE_renewables['address_number'] # Set up a temporary postcode column as a string column for joining with the appropriate NUTS correspondence table DE_renewables['postcode_str'] = DE_renewables['postcode'].astype(str).str[:-2] DE_renewables = nuts_converter.add_nuts_information(DE_renewables, 'DE', DE_postcode2nuts_filepath, postcode_column='postcode_str', how=['postcode', 'municipality_code', 'municipality', 'latlon']) # Drop the temporary column DE_renewables.drop('postcode_str', axis='columns', inplace=True) # Report the number of facilites whose NUTS codes were successfully sudetermined determined = DE_renewables['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', DE_renewables.shape[0], 'facilities in DE.') # Report the number of facilites whose NUTS codes could not be determined not_determined = DE_renewables['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', DE_renewables.shape[0], 'facilities in DE.') visualize_points(DE_renewables['lat'], DE_renewables['lon'], 'Germany', categories=DE_renewables['energy_source_level_2'] ) DE_renewables.to_pickle('intermediate/DE_renewables.pickle') del DE_renewables # Download the data for Denmark filepaths = downloader.download_data_for_country('DK') print(filepaths) def read_dk_wind_turbines(filepath, sheet_name): # Reads the data on Danish wind turbines # from the sheet of the given name # in the file with the path. # Returns the data as a Pandas dataframe. book = xlrd.open_workbook(filepath) sheet = book.sheet_by_name(sheet_name) # Since the column names are in two rows, not one, # collect them in two parts. The first part is # fixed and contains column names. header = [] for i in range(0, 16): # Make sure that strings 1) do not contain the newline sign # and 2) have no trailing blank spaces. column_name = sheet.cell_value(17, i).replace("\n", "").strip() header = header + [column_name] # The second part is variable. It consists of two subparts: # 1) previous years (type float) # 2) the past months of the current year (type date) # Reading previous years as column names i = 16 cell = sheet.cell(16, i) while cell.ctype == xlrd.XL_CELL_NUMBER: column_name = str(int(cell.value)) header = header + [column_name] i = i + 1 cell = sheet.cell(16, i) # Reading the months of the current year as column names while cell.ctype == xlrd.XL_CELL_DATE: year, month, _, _, _, _ = xlrd.xldate_as_tuple(cell.value, book.datemode) column_name = str("{}-{}".format(year, month)) header = header + [column_name] i = i + 1 cell = sheet.cell(16, i) # Add the final column for the total of the current year header += ['{}-total'.format(header[-1].split('-')[0])] # Skip the first 17 rows in the sheet. The rest contains the data. df = pd.read_excel(filepath, sheet_name=sheet_name, skiprows=17, skipfooter=3 ) # #df.drop(df.columns[len(df.columns)-1], axis=1, inplace=True) # Set the column names. df.columns = header return df # Get wind turbines data wind_turbines_sheet_name = 'IkkeAfmeldte-Existing turbines' DK_wind_filepath = filepaths['Energistyrelsen'] DK_wind_df = read_dk_wind_turbines(DK_wind_filepath, wind_turbines_sheet_name ) # Get photovoltaic data DK_solar_filepath = filepaths['Energinet'] DK_solar_df = pd.read_excel(DK_solar_filepath, sheet_name='Data', skiprows=[0], converters={'Postnr': str} ) # Remove duplicates DK_wind_df.drop_duplicates(inplace=True) DK_solar_df.drop_duplicates(inplace=True) # Choose the translation terms for Denmark, create dictionary and show dictionary idx_DK = columnnames[columnnames['country'] == 'DK'].index column_dict_DK = columnnames.loc[idx_DK].set_index('original_name')['opsd_name'].to_dict() # Windows has problems reading the csv entry for east and north (DK). # The reason might be the difference when opening the csv between linux and # windows. column_dict_DK_temp = {} for k, v in column_dict_DK.items(): column_dict_DK_temp[k] = v if v == 'utm_east' or v == 'utm_north': # merge 2 lines to 1 new_key = ''.join(k.splitlines()) column_dict_DK_temp[new_key] = v column_dict_DK = column_dict_DK_temp column_dict_DK # Replace column names based on column_dict_DK DK_wind_df.rename(columns=column_dict_DK, inplace=True) DK_solar_df.rename(columns=column_dict_DK, inplace=True) # Add names of the data sources to the DataFrames DK_wind_df['data_source'] = 'Energistyrelsen' DK_solar_df['data_source'] = 'Energinet.dk' # Add energy source level 2 and technology for each of the two DataFrames DK_wind_df['energy_source_level_2'] = 'Wind' DK_solar_df['energy_source_level_2'] = 'Solar' DK_solar_df['technology'] = 'Photovoltaics' mask=DK_solar_df['commissioning_date'] == '1970-01-01' DK_solar_df.loc[mask, 'commissioning_date'] = np.nan # Choose the translation terms for Denmark, create dictionary and show dictionary idx_DK = valuenames[valuenames['country'] == 'DK'].index value_dict_DK = valuenames.loc[idx_DK].set_index('original_name')['opsd_name'].to_dict() # Replace all original value names by the OPSD value names DK_wind_df.replace(value_dict_DK, inplace=True) DK_solar_df.replace(value_dict_DK, inplace=True) # Index for all values with utm information idx_notnull = DK_wind_df['utm_east'].notnull() # Convert from UTM values to latitude and longitude coordinates DK_wind_df['lonlat'] = DK_wind_df.loc[idx_notnull, ['utm_east', 'utm_north'] ].apply(lambda x: utm.to_latlon(x[0], x[1], 32, 'U'), axis=1).astype(str) # Split latitude and longitude in two columns lat = [] lon = [] for row in DK_wind_df['lonlat']: try: # Split tuple format # into the column lat and lon row = row.lstrip('(').rstrip(')') lat.append(row.split(',')[0]) lon.append(row.split(',')[1]) except: # set NAN lat.append(np.NaN) lon.append(np.NaN) DK_wind_df['lat'] = pd.to_numeric(lat) DK_wind_df['lon'] = pd.to_numeric(lon) # drop lonlat column that contains both, latitute and longitude DK_wind_df.drop('lonlat', axis=1, inplace=True) # Get geo-information zip_DK_geo = zipfile.ZipFile(filepaths['Geonames']) # Read generated postcode/location file DK_geo = pd.read_csv(zip_DK_geo.open('DK.txt'), sep='\t', header=None) # add column names as defined in associated readme file DK_geo.columns = ['country_code', 'postcode', 'place_name', 'admin_name1', 'admin_code1', 'admin_name2', 'admin_code2', 'admin_name3', 'admin_code3', 'lat', 'lon', 'accuracy'] # Drop rows of possible duplicate postal_code DK_geo.drop_duplicates('postcode', keep='last', inplace=True) DK_geo['postcode'] = DK_geo['postcode'].astype(str) # Add longitude/latitude infomation assigned by postcode (for Energinet.dk data) DK_solar_df = DK_solar_df.merge(DK_geo[['postcode', 'lon', 'lat']], on=['postcode'], how='left') # Show number of units with missing coordinates separated by wind and solar print('Missing Coordinates DK_wind', DK_wind_df.lat.isnull().sum(), 'out of', len(DK_wind_df.index)) print('Missing Coordinates DK_solar', DK_solar_df.lat.isnull().sum(), 'out of', len(DK_solar_df.index)) zip_DK_geo.close() # Merge DataFrames for wind and solar into DK_renewables dataframes = [DK_wind_df, DK_solar_df] DK_renewables = pd.concat(dataframes, sort=False) DK_renewables = DK_renewables.reset_index() # Assign energy source level 1 to the dataframe DK_renewables['energy_source_level_1'] = 'Renewable energy' # Merge the address and address-number columns into one to_string = lambda x: str(x) if not pd.isnull(x) else "" DK_renewables['address'] = DK_renewables['address'].map(to_string) + " " + DK_renewables['address_number'].map(to_string) # Make sure that the column has no whitespaces at the beginning or the end DK_renewables['address'] = DK_renewables['address'].str.strip() # Assign NUTS codes DK_postcode2nuts = filepaths['Eurostat'] DK_renewables = nuts_converter.add_nuts_information(DK_renewables, 'DK', DK_postcode2nuts, how=['latlon', 'postcode', 'municipality_code', 'municipality_name']) # Report the number of facilites whose NUTS codes were successfully sudetermined determined = DK_renewables['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', DK_renewables.shape[0], 'facilities in DK.') # Report the number of facilites whose NUTS codes could not be determined not_determined = DK_renewables['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', DK_renewables.shape[0], 'facilities in DK.') DK_renewables[DK_renewables['nuts_1_region'].isnull()][['municipality', 'municipality_code', 'lat', 'lon']] # Select those columns of the orignal data which are utilised further columns_of_interest = ['commissioning_date', 'energy_source_level_1', 'energy_source_level_2', 'technology', 'electrical_capacity_kW', 'dso', 'gsrn_id', 'postcode', 'municipality_code', 'municipality', 'address', 'utm_east', 'utm_north', 'lon', 'lat', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'hub_height', 'rotor_diameter', 'manufacturer', 'model', 'data_source'] # Clean DataFrame from columns other than specified above DK_renewables = DK_renewables.loc[:, columns_of_interest] DK_renewables.reset_index(drop=True, inplace=True) # Remove duplicates DK_renewables.drop_duplicates(inplace=True) DK_renewables.reset_index(drop=True, inplace=True) # kW to MW DK_renewables['electrical_capacity_kW'] /= 1000 # adapt column name DK_renewables.rename(columns={'electrical_capacity_kW': 'electrical_capacity'}, inplace=True) visualize_points(DK_renewables['lat'], DK_renewables['lon'], 'Denmark', categories=DK_renewables['energy_source_level_2'] ) DK_renewables.to_pickle('intermediate/DK_renewables.pickle') del DK_renewables # Download the data filepaths = downloader.download_data_for_country('FR') # Show the local paths filepaths # Load the data FR_re_filepath = filepaths['ODRE'] FR_re_df = pd.read_csv(FR_re_filepath, sep=';', parse_dates=['dateRaccordement', 'dateDeraccordement', 'dateMiseEnService', 'dateDebutVersion'], infer_datetime_format=True) # Make sure that the column dateDeraccordement is datetime FR_re_df['dateDeraccordement'] = pd.to_datetime(FR_re_df['dateDeraccordement'], errors='coerce') # Choose the translation terms for France, create dictionary and show it columnnames = pd.read_csv(os.path.join('input', 'column_translation_list.csv')) idx_FR = columnnames[(columnnames['country'] == 'FR') & (columnnames['data_source'] == 'ODRE')].index column_dict_FR = columnnames.loc[idx_FR].set_index('original_name')['opsd_name'].to_dict() column_dict_FR # Translate column names FR_re_df.rename(columns=column_dict_FR, inplace=True) # Keep only the columns specified in the translation dictionary as we'll need only them columns_to_keep = list(column_dict_FR.values()) FR_re_df = FR_re_df.loc[:, columns_to_keep] FR_re_df.reset_index(drop=True, inplace=True) # Show a pair of rows FR_re_df.head(2) FR_re_df['data_source'] = 'Open Data Réseaux Énergies' FR_re_df['as_of_year'] = 2018 # Year for which the dataset has been compiled by the data source # Choose the translation terms for France, create a dictionary and show it valuenames = pd.read_csv(os.path.join('input', 'value_translation_list.csv')) idx_FR = valuenames[(valuenames['country'] == 'FR') & (valuenames['data_source'] == 'ODRE')].index value_dict_FR = valuenames.loc[idx_FR].set_index('original_name')['opsd_name'].to_dict() value_dict_FR # Replace all original value names by the OPSD value names FR_re_df.replace(value_dict_FR, inplace=True) no_name_aliases = ['Agrégation des installations de moins de 36KW', 'Confidentiel', 'confidentiel'] no_name_mask = FR_re_df['site_name'].isin(no_name_aliases) FR_re_df.loc[no_name_mask, 'site_name'] = np.nan mask = (FR_re_df['commissioning_date'].dt.year <= 1900) &\ ((FR_re_df['technology'].isin(['Photovoltaics', 'Onshore']) |\ (FR_re_df['energy_source_level_2'] == 'Solar'))) FR_re_df.loc[mask, 'commissioning_date'] = np.nan #for x in FR_re_df[FR_re_df['commissioning_date'].dt.year <= 1980]['technology']: # print(x) # Check the columns FR_re_df.isnull().all() # Check the rows print('There is a row containing all the null values?') FR_re_df.isnull().all(axis=1).any() FR_re_df[['energy_source_level_2', 'technology']].drop_duplicates() # Define the mask for selecting rows with unusable info on electrical capacity ec_mask = (FR_re_df['electrical_capacity'] == 0) | (FR_re_df['electrical_capacity'].isna()) # Define the mask for selecting the rows with non-renewable energy_source_level_2 non_renewable_esl2 = ['Non-renewable thermal', 'Non-hydraulic storage', 'Nuclear'] non_renewable_esl2_mask = FR_re_df['energy_source_level_2'].isin(non_renewable_esl2) # Define the mask to select the rows with non-renewable technology non_renewable_technologies = ['Steam turbine', 'Combustion cogeneration', 'Combustion engine', 'Combined cycle', 'Pumped storage', 'Piston motor', 'Nuclear fission'] non_renewable_technology_mask = FR_re_df['technology'].isin(non_renewable_technologies) # Define the mask to select the rows without specified energy type and technology other_mask = (FR_re_df['energy_source_level_2'] == 'Other') & \ ((FR_re_df['technology'] == 'Other') | (pd.isnull(FR_re_df['technology']))) # Combine the masks drop_mask = ec_mask | non_renewable_esl2_mask | non_renewable_technology_mask | other_mask # Show how many rows are going to be dropped print('Dropping', drop_mask.sum(), 'rows out of', FR_re_df.shape[0]) # Keep all the rows not selected by the drop mask keep_mask = ~drop_mask FR_re_df = FR_re_df[keep_mask].reindex() # Show some rows print("A sample of the kept data:") FR_re_df.sample(5) FR_re_df[['energy_source_level_2', 'technology']].drop_duplicates() # Make sure that the proper string is used to indicate other or unspecified technology FR_re_df['technology'].replace('Other', 'Other or unspecified technology', inplace=True) # Define a function that will deal with other cases def standardize(row): level_2 = row['energy_source_level_2'] technology = row['technology'] if level_2 in ['Marine', 'Geothermal', 'Bioenergy']: technology = np.nan elif level_2 in ['Solar', 'Hydro', 'Other'] and pd.isna(technology): technology = 'Other or unspecified technology' elif level_2 == 'Wind' and (pd.isna(technology) or technology == 'Other or unspecified technology'): technology = 'Onshore' if level_2 == 'Hydro' and technology in ['Lake', 'Closed']: technology = 'Other or unspecified technology' elif level_2 == 'Solar' and technology == 'Thermodynamic': technology = 'Other or unspecified technology' elif level_2 == 'Other' and technology == 'Photovoltaics': level_2 = 'Solar' return [level_2, technology] # Apply the rules coded in function standardize FR_re_df[['energy_source_level_2', 'technology']] = FR_re_df.apply(standardize, axis=1, result_type='expand') # Show the existing level 2 types and technologies FR_re_df[['energy_source_level_2', 'technology']].drop_duplicates() FR_re_df[['energy_source_level_2', 'energy_source_level_3']].drop_duplicates() index = (pd.isna(FR_re_df['energy_source_level_3']) & \ (FR_re_df['energy_source_level_2'] == 'Bioenergy')) FR_re_df.loc[index, 'energy_source_level_3'] = 'Other or unspecified' index = FR_re_df['energy_source_level_3'] == 'Wood' FR_re_df.loc[index, 'energy_source_level_3'] = 'Biomass and biogas' # Assign energy_source_level_1 to the dataframe FR_re_df['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy energy_columns = ['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology'] FR_re_df[energy_columns].drop_duplicates() # Get the local path of the downloaded georeferencing data FR_geo_filepath = filepaths['Opendatasoft'] # Read INSEE Code Data FR_geo = pd.read_csv(FR_geo_filepath, sep=';', header=0, converters={'Code_postal': str}) # Drop possible duplicates of the same INSEE code FR_geo.drop_duplicates('INSEE_COM', keep='last', inplace=True) # create columns for latitude/longitude lat = [] lon = [] # split in latitude/longitude for row in FR_geo['Geo Point']: try: # Split tuple format # into the column lat and lon row = row.lstrip('(').rstrip(')') lat.append(row.split(',')[0]) lon.append(row.split(',')[1]) except: # set NAN lat.append(np.NaN) lon.append(np.NaN) # add these columns to the INSEE DataFrame FR_geo['lat'] = pd.to_numeric(lat) FR_geo['lon'] = pd.to_numeric(lon) # Column names of merge key have to be named identically FR_re_df.rename(columns={'municipality_code': 'INSEE_COM'}, inplace=True) # Merge longitude and latitude columns by the Code INSEE FR_re_df = FR_re_df.merge(FR_geo[['INSEE_COM', 'lat', 'lon']], on=['INSEE_COM'], how='left') # Translate Code INSEE column back to municipality_code FR_re_df.rename(columns={'INSEE_COM': 'municipality_code'}, inplace=True) #import importlib #importlib.reload(util.nuts_converter) #from util.nuts_converter import NUTSConverter #nuts_converter = NUTSConverter(downloader, eurostat_eu_directory_path) FR_postcode2nuts_path = filepaths['Eurostat'] FR_re_df = nuts_converter.add_nuts_information(FR_re_df, 'FR', FR_postcode2nuts_path, lau_name_type='NATIONAL', closest_approximation=True, how=['municipality_code', 'latlon']) # Report the number of facilites whose NUTS codes were successfully determined determined = FR_re_df['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', FR_re_df.shape[0], 'facilities in FR.') # Report the number of facilites whose NUTS codes could not be determined not_determined = FR_re_df['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', FR_re_df.shape[0], 'facilities in FR.') # Check the facilities without NUTS classification no_nuts = FR_re_df['nuts_1_region'].isnull() # Find the masks where some information for finding the proper NUTS code is present lat_or_lon_present = ~(FR_re_df['lat'].isna() & FR_re_df['lon'].isna()) municipality_code_present = ~(FR_re_df['municipality_code'].isnull()) municipality_name_present = ~(FR_re_df['municipality'].isnull()) # Show the cases where NUTS classification failed even though it shouldn't have print('1. No NUTS code but latitude/longitude info present') problematic_lat_lon = FR_re_df[no_nuts & lat_or_lon_present][['lat', 'lon']] display(problematic_lat_lon) print('2. No NUTS code but municipality code info present') problematic_municipality_codes = FR_re_df[no_nuts & municipality_code_present]['municipality_code'].unique() display(problematic_municipality_codes) print('3. No NUTS code but municipality name info present') problematic_municipality_names = FR_re_df[no_nuts & municipality_name_present]['municipality'].unique() display(problematic_municipality_names) # Check if the any problematic code is actually present in the translation table present_any = False for code in problematic_municipality_codes: mask = nuts_converter.municipality2nuts_df['municipality_code'].str.match(code) present_any = present_any or mask.any() print(present_any) # Print only the names of those problematic municipalities, which appear in the translation table only once. for name in problematic_municipality_names: mask = nuts_converter.municipality2nuts_df['municipality'].str.match(name) if mask.sum() == 1: print(name) FR_re_df['electrical_capacity'] = FR_re_df['electrical_capacity'] / 1000 # Load the data FR_re_filepath = filepaths['gouv.fr'] FR_re_df_old = pd.read_excel(FR_re_filepath, sheet_name='Commune', encoding='UTF8', thousands='.', decimals=',', header=[3, 4], skipfooter=9, # skip the summary rows index_col=[0, 1], # required for MultiIndex converters={'Code officiel géographique': str}) FR_re_df_old.tail() # Rearrange data FR_re_df_old.index.rename(['insee_com', 'municipality'], inplace=True) FR_re_df_old.columns.rename(['energy_source_level_2', None], inplace=True) FR_re_df_old = (FR_re_df_old .stack(level='energy_source_level_2', dropna=False) .reset_index(drop=False)) # Choose the translation terms for France, create dictionary and show dictionary idx_FR = columnnames[(columnnames['country'] == 'FR') & (columnnames['data_source'] == 'gouv.fr')].index column_dict_FR = columnnames.loc[idx_FR].set_index('original_name')['opsd_name'].to_dict() column_dict_FR # Translate columnnames FR_re_df_old.rename(columns=column_dict_FR, inplace=True) # Drop all rows that contain NA FR_re_df_old = FR_re_df_old.dropna() FR_re_df_old.head(10) FR_re_df_old['data_source'] = 'Ministry for the Ecological and Inclusive Transition' FR_re_df_old['as_of_year'] = 2017 # Year for which the dataset has been compiled by the data source # Choose the translation terms for France, create dictionary and show dictionary idx_FR = valuenames[(valuenames['country'] == 'FR') & (valuenames['data_source'] == 'gouv.fr')].index value_dict_FR = valuenames.loc[idx_FR].set_index('original_name')['opsd_name'].to_dict() value_dict_FR # Replace all original value names by the OPSD value names FR_re_df_old.replace(value_dict_FR, inplace=True) energy_source_dict_FR = valuenames.loc[idx_FR].set_index( 'opsd_name')['energy_source_level_2'].to_dict() display(energy_source_dict_FR) display(FR_re_df_old[['energy_source_level_2']].drop_duplicates()) (FR_re_df_old['energy_source_level_2'].replace(energy_source_dict_FR).unique()) # Create dictionnary in order to assign energy_source to its subtype energy_source_dict_FR = valuenames.loc[idx_FR].set_index( 'opsd_name')['energy_source_level_2'].to_dict() # Column energy_source partly contains subtype information, thus this column is copied # to new column for energy_source_subtype. FR_re_df_old['technology'] = FR_re_df_old['energy_source_level_2'] # Only Photovoltaics should be kept as technology. Hydro should be changed to 'Other or unspecified technology', # Geothermal to NaN, and Wind to Onshore. # 1. np.nan means that technology should not be specified for the respective kind of sources # according to the hierarchy (http://open-power-system-data.org/2016-10-25-opsd_tree.svg) # 2. 'Other or unspecified technology' means that technology should be specified # but it was unclear or missing in the original dataset. technology_translation_dictionary = { 'Solar' : 'Photovoltaics', 'Wind': 'Onshore', 'Hydro': 'Other or unspecified technology', 'Geothermal': np.nan } FR_re_df_old['technology'].replace(technology_translation_dictionary, inplace=True) # The energy source subtype values in the energy_source column are replaced by # the higher level classification FR_re_df_old['energy_source_level_2'].replace(energy_source_dict_FR, inplace=True) # Assign energy_source_level_1 to the dataframe FR_re_df_old['energy_source_level_1'] = 'Renewable energy' FR_re_df_old.reset_index(drop=True, inplace=True) # Choose energy source level 2 entries where energy source level 2 is Bioenergy in order to # seperate Bioenergy subtypes to energy source level 3 and subtypes for the rest to technology idx_FR_Bioenergy = FR_re_df_old[FR_re_df_old['energy_source_level_2'] == 'Bioenergy'].index # Assign technology to energy source level 3 for all entries where energy source level 2 is # Bioenergy and delete those entries from technology FR_re_df_old[['energy_source_level_3']] = FR_re_df_old.iloc[idx_FR_Bioenergy][['technology']] FR_re_df_old.loc[idx_FR_Bioenergy,'technology'] = np.nan FR_re_df_old[['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology']].drop_duplicates() # Column names of merge key have to be named identically FR_re_df_old.rename(columns={'municipality_code': 'INSEE_COM'}, inplace=True) # Merge longitude and latitude columns by the Code INSEE FR_re_df_old = FR_re_df_old.merge(FR_geo[['INSEE_COM', 'lat', 'lon']], on=['INSEE_COM'], how='left') # Translate Code INSEE column back to municipality_code FR_re_df_old.rename(columns={'INSEE_COM': 'municipality_code'}, inplace=True) FR_postcode2nuts_path = filepaths['Eurostat'] FR_re_df_old = nuts_converter.add_nuts_information(FR_re_df_old, 'FR', FR_postcode2nuts_path, how=['municipality_code', 'latlon']) # how=['municipality', 'municipality_code', 'latlon'] # Report the number of facilites whose NUTS codes were successfully determined determined = FR_re_df_old['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', FR_re_df_old.shape[0], 'facilities in FR.') # Report the number of facilites whose NUTS codes could not be determined not_determined = FR_re_df_old['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', FR_re_df_old.shape[0], 'facilities in FR.') # Show the facilities without NUTS classification FR_re_df_old[FR_re_df_old['nuts_1_region'].isnull()] # For each column present in the new data's column space, but not the old, # add an empty column to the old data. for new_column in FR_re_df.columns: if new_column not in FR_re_df.columns: FR_re_df_old[new_column] = np.nan # Define the mask to select the municipalities from the old data, that are not covered # by the new. not_included = ~(FR_re_df_old['municipality_code'].isin(FR_re_df['municipality_code'])) FR_re_df_old[not_included] # Add a dummy column to the new data frame # representing the number of power plants (always 1) FR_re_df['number_of_installations'] = 1 # Mark the old data rows as aggregations on municipality level. FR_re_df_old['site_name'] = 'Aggregated data for ' + FR_re_df_old['municipality'] # Concatenate the new data with the old rows referring to the municipalities # not covered by the new. FR_re_df = pd.concat([FR_re_df, FR_re_df_old[not_included]], ignore_index=True, axis='index', sort=True) columns_to_keep = ['EIC_code', 'municipality_group_code', 'IRIS_code', 'as_of_year', 'commissioning_date', 'connection_date', 'data_source', 'departement', 'departement_code', 'disconnection_date', 'electrical_capacity', 'energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'lat', 'lon', 'municipality', 'municipality_code', 'municipality_group', 'number_of_installations', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'region', 'region_code', 'site_name', 'source_station_code', 'technology'] FR_re_df = FR_re_df[columns_to_keep] FR_re_df.reset_index(drop=True, inplace=True) visualize_points(FR_re_df['lat'], FR_re_df['lon'], 'France', categories=FR_re_df['energy_source_level_2'] ) FR_re_df.to_pickle('intermediate/FR_renewables.pickle') del FR_re_df # Download the data filepaths = downloader.download_data_for_country('PL') # Get the local paths to the data files PL_re_filepath = filepaths['Urzad Regulacji Energetyki'] PL_postcode2nuts_filepath = filepaths['Eurostat'] PL_geo_filepath = filepaths['Geonames'] # Read the data into a pandas dataframe PL_re_df = pd.read_excel(PL_re_filepath, encoding='latin', header=2, skipfooter=14 ) # Show 5 random rows PL_re_df.sample(n=5) # Get the mask for selecting the WS plants ws_mask = PL_re_df['Rodzaj_OZE'] == 'WS' # Drop them print('Dropping', ws_mask.sum(), 'out of', PL_re_df.shape[0], 'power plants.') PL_re_df.drop(PL_re_df.index[ws_mask], axis=0, inplace=True) PL_re_df.reset_index(drop=True, inplace=True) # Choose the translation terms for Poland, create and show the dictionary columnnames = pd.read_csv(os.path.join('input', 'column_translation_list.csv')) idx_PL = columnnames[(columnnames['country'] == 'PL') & (columnnames['data_source'] == 'Urzad Regulacji Energetyki')].index column_dict_PL = columnnames.loc[idx_PL].set_index('original_name')['opsd_name'].to_dict() column_dict_PL # Translate column names PL_re_df.rename(columns=column_dict_PL, inplace=True) # Show a couple of rows PL_re_df.head(2) print('The number of missing values in the data:', PL_re_df.isna().sum().sum()) print('Are all capacities proper numbers?', PL_re_df['electrical_capacity'].dtype == 'float64') print('What about the energy codes?', PL_re_df['energy_type'].unique()) # Check the voivodeships print('Show the names of the voivodeships.') PL_re_df['region'].unique() PL_re_df['region'] = PL_re_df['region'].str.strip().str.capitalize() PL_re_df['region'].unique() districts = PL_re_df['district'].unique() districts.sort() districts # Correct the typos PL_re_df.loc[PL_re_df['district'] == 'lipowski', 'district'] = 'lipnowski' PL_re_df.loc[PL_re_df['district'] == 'hojnowski', 'district'] = 'hajnowski' # Choose the translation terms for Poland, create dictionary idx_PL = valuenames[valuenames['country'] == 'PL'].index value_dict_PL = valuenames.loc[idx_PL].set_index('original_name')['opsd_name'].to_dict() # Set energy source level 3 PL_re_df['energy_source_level_3'] = PL_re_df['energy_type'].replace(value_dict_PL) # Create dictionnary in order to assign energy_source_level_2 to its subtype idx_PL = valuenames[valuenames['country'] == 'PL'].index energy_source_dict_PL = valuenames.loc[idx_PL].set_index('original_name')['energy_source_level_2'].to_dict() # Add energy_source_level_2 PL_re_df['energy_source_level_2'] = PL_re_df['energy_type'].replace(energy_source_dict_PL) # Standardize the values for technology # 1. np.nan means that technology should not be specified for the respective kind of sources # according to the hierarchy (http://open-power-system-data.org/2016-10-25-opsd_tree.svg) # 2. 'Other or unspecified technology' means that technology should be specified # but it was unclear or missing in the original dataset. technology_translation_dictionary = { 'BG': np.nan, 'BM': np.nan, 'PVA': 'Other or unspecified technology', # Photovoltaics? 'WIL': 'Other or unspecified technology', # Onshore? 'WO': 'Other or unspecified technology', # Run-of-river } PL_re_df['technology'] = PL_re_df['energy_type'].replace(technology_translation_dictionary) # Add energy_source_level_1 PL_re_df['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy of sources present in the dataset PL_re_df[['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology']].drop_duplicates().sort_values(by='energy_source_level_2') # Define the function to standardize district names from the original data def standardize_districts(original_string): if original_string[-1] == ',': # there is one district whose name ends with ','; that's a typo in the data original_string = original_string[:-1] if original_string.startswith('m. st. '): return original_string[7:] elif original_string.startswith('m. '): return original_string[3:] elif any([original_string.endswith(suffix) for suffix in ['ski', 'cki', 'zki']]): return 'Powiat ' + original_string else: return original_string # Get geo-information zip_PL_geo = zipfile.ZipFile(PL_geo_filepath) # Read generated postcode/location file PL_geo = pd.read_csv(zip_PL_geo.open('PL.txt'), sep='\t', header=None) # add column names as defined in associated readme file PL_geo.columns = ['country_code', 'postcode', 'place_name', 'admin_name1', 'admin_code1', 'admin_name2', 'admin_code2', 'admin_name3', 'admin_code3', 'lat', 'lon', 'accuracy'] # Drop rows of possible duplicate postal_code PL_geo.drop_duplicates('postcode', keep='last', inplace=True) PL_geo['postcode'] = PL_geo['postcode'].astype(str) # Get the names geonames_districts = PL_geo['admin_name2'].unique() # Show them geonames_districts # Standardize the district names from the original data PL_re_df['standardized_district'] = PL_re_df['district'].apply(standardize_districts) standardized_districts = PL_re_df['standardized_district'].unique() # Check which districts could not be found in the GeoNames data #print(len([x for x in semi if x in geopowiats]), len([x for x in semi if x not in geopowiats])) not_found = set(standardized_districts).difference(set(geonames_districts)) number_of_not_found = len(not_found) total = len(standardized_districts) print('{}/{} names could not be found. Those are:'.format(number_of_not_found, total)) print(not_found) # We define the similarity between two strings, string1 and string2, # as the length of the longest prefix of string1 that appears in string2. # Note 1: this measure of similarity is not necessarily symmetrical. # Note 2: a prefix of a string is its substring that starts from the beginning of the string. def calculate_similarity(string1, string2): for n in range(len(string1), 1, -1): prefix = string1[0:(n-1)] if prefix in string2: return len(prefix) return 0 # Define a function to find, among a group of candidate strings, # the most similar string to the one given as the reference string. def find_the_most_similar(reference_string, candidate_strings): the_most_similar = None maximal_similarity = 0 for candidate_string in candidate_strings: similarity = calculate_similarity(reference_string, candidate_string) if similarity > maximal_similarity: maximal_similarity = similarity the_most_similar = candidate_string return the_most_similar, maximal_similarity already_mapped = PL_re_df[['district', 'standardized_district']].drop_duplicates().to_dict(orient='records') already_mapped = {mapping['district'] : mapping['standardized_district'] for mapping in already_mapped if mapping['standardized_district'] in geonames_districts} # Make a dictionary to map each district from the original data to its GeoNames equivalent. # The districts whose standardized versions have been found in the GeoNames data to their standardizations. # The mappings for other districts will be found using the previously defined similarity measures. districts_map = PL_re_df[['district', 'standardized_district']].drop_duplicates().to_dict(orient='records') districts_map = {mapping['district'] : mapping['standardized_district'] for mapping in districts_map} # Override the mappings for the 49 districts whose standardized names have not been found in the GeoNames data. for district, standardized_district in districts_map.items(): #standardized_district = ['standardized_district'] if standardized_district not in geonames_districts: #print('---------') if standardized_district.startswith('Powiat'): standardized_district = standardized_district[7:] #print(district) capitalized = standardized_district.capitalize() lowercase = standardized_district.lower() candidate1, similarity1 = find_the_most_similar(capitalized, geonames_districts) candidate2, similarity2 = find_the_most_similar(lowercase, geonames_districts) if similarity1 > similarity2: districts_map[district] = candidate1 #print('\t', candidate1, similarity1) elif similarity2 > similarity1: districts_map[district] = candidate2 #print('\t', candidate2, similarity2) else: # Break the ties by mapping to the shorter string if len(candidate1) < len(candidate2): districts_map[district] = candidate1 #print('\t', candidate1, '|', candidate2, similarity1) else: districts_map[district] = candidate2 #print('\t', candidate2, '|', candidate1, similarity2) # Apply the override to PL_re_df PL_re_df['standardized_district'] = PL_re_df['district'].apply(lambda district: districts_map[district]) # Show the results PL_re_df[['district', 'standardized_district']].drop_duplicates() # Clear the mappings for wołowski, Nowy Sącz, rzeszowski, hojnowski. for district in ['wołowski', 'm. Nowy Sącz', 'rzeszowski', 'hojnowski']: districts_map[district] = '' PL_re_df.loc[PL_re_df['district'] == district, 'standardized_district'] = '' # For each mapping, select a postcode from the GeoNames data df_dict = {'original' : [], 'geonames' : []} for original_name in districts_map: geonames_name = districts_map[original_name] df_dict['original'].append(original_name) df_dict['geonames'].append(geonames_name) mapping_df = pd.DataFrame.from_dict(df_dict) # To make sure that the selected postcodes do appear in the NUTS table, # we drop, from PL_geo, all rows with the postcodes not in the postcode-to-NUTS table for Poland. PL_table = nuts_converter.open_postcode2nuts(filepaths['Eurostat'])['CODE'] PL_geo = pd.merge(PL_geo, PL_table, how='inner', left_on='postcode', right_on='CODE') PL_geo.drop(['CODE'], axis='columns', inplace=True) # merged = pd.merge(mapping_df, PL_geo[['admin_name2', 'postcode']], how='left', left_on='geonames', right_on='admin_name2') # Rename the column postcode to make its meaning straightforward merged.rename(columns={'postcode' : 'random_postcode'}, inplace=True) merged = merged.drop_duplicates(['geonames']) print(PL_re_df.shape) PL_re_df = pd.merge(PL_re_df, merged[['geonames', 'random_postcode']], how='left', left_on='standardized_district', right_on='geonames') # Show results PL_re_df.head(2) display(PL_re_df[PL_re_df['random_postcode'].isnull()]) PL_re_df['random_postcode'].isnull().sum() PL_postcode2nuts_path = filepaths['Eurostat'] PL_re_df = nuts_converter.add_nuts_information(PL_re_df, 'PL', PL_postcode2nuts_path, postcode_column='random_postcode', how=['postcode']) # Report the number of facilites whose NUTS codes were successfully sudetermined determined = PL_re_df['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', PL_re_df.shape[0], 'facilities in PL.') # Manual assignments manual_nuts3_map = { 'wołowski' : 'PL518', 'm. Nowy Sącz' : 'PL218', 'rzeszowski' : 'PL325' } for district in manual_nuts3_map: nuts3 = manual_nuts3_map[district] nuts2 = nuts3[:-1] nuts1 = nuts3[:-2] mask = (PL_re_df['district'] == district) PL_re_df.loc[mask, ['nuts_1_region', 'nuts_2_region', 'nuts_3_region']] = [nuts1, nuts2, nuts3] # Report the number of facilites whose NUTS codes could not be determined not_determined = PL_re_df['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', PL_re_df.shape[0], 'facilities in PL.') PL_re_df['data_source'] = 'Urzad Regulacji Energetyki' PL_re_df['as_of_year'] = 2019 # The year for which the dataset has been compiled by the data source # Choose which column to keep PL_re_df = PL_re_df.loc[:, [ 'URE_id', 'region', 'district', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'electrical_capacity', 'energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology', 'data_source', 'as_of_year']] PL_re_df.to_pickle('intermediate/PL_renewables.pickle') del PL_re_df # Download the data and get the local paths of the downloaded files filepaths = downloader.download_data_for_country('CH') CH_re_filepath = filepaths['BFE'] CH_geo_filepath = filepaths['Geonames'] CH_postcode2nuts_filepath = filepaths['Eurostat'] # Get data of renewables per municipality CH_re_df = pd.read_excel(CH_re_filepath, sheet_name='KEV Bezüger 2018', encoding='UTF8', thousands='.', decimals=',' #header=[0] #skipfooter=9, # contains summarized values #index_col=[0, 1], # required for MultiIndex #converters={'Code officiel géographique':str} ) # Choose the translation terms for Switzerland, create dictionary and show dictionary idx_CH = columnnames[columnnames['country'] == 'CH'].index column_dict_CH = columnnames.loc[idx_CH].set_index('original_name')['opsd_name'].to_dict() column_dict_CH # Translate columnnames CH_re_df.columns = [column_name.replace("\n", "") for column_name in CH_re_df.columns] CH_re_df.rename(columns=column_dict_CH, inplace=True) CH_re_df['data_source'] = 'BFE' # Choose the translation terms for Switzerland, create dictionary idx_CH = valuenames[valuenames['country'] == 'CH'].index value_dict_CH = valuenames.loc[idx_CH].set_index('original_name')['opsd_name'].to_dict() # Assign energy_source_level_1 to the dataframe CH_re_df['energy_source_level_1'] = 'Renewable energy' # Create dictionnary in order to assign energy_source to its subtype #energy_source_dict_CH = valuenames.loc[idx_CH].set_index('opsd_name')['energy_source_level_2'].to_dict() # # ...and the energy source subtype values in the energy_source column are replaced by # the higher level classification #CH_re_df['energy_source_level_2'].replace(energy_source_dict_CH, inplace=True) CH_re_df['energy_source_level_3'] = CH_re_df['technology'] # Create dictionnary in order to assign energy_source_level_2 to its subtype idx_CH = valuenames[valuenames['country'] == 'CH'].index energy_source_dict_CH = valuenames.loc[idx_CH].set_index('original_name')['energy_source_level_2'].to_dict() # Add energy_source_level_2 CH_re_df['energy_source_level_2'] = CH_re_df['energy_source_level_2'].replace(energy_source_dict_CH) # Translate values in order to standardize energy_source_level_3 value_dict_CH = valuenames.loc[idx_CH].set_index('original_name')['opsd_name'].to_dict() CH_re_df['energy_source_level_3'].replace(value_dict_CH, inplace=True) # Standardize the values for technology # 1. np.nan means that technology should not be specified for the respective kind of sources # according to the hierarchy (http://open-power-system-data.org/2016-10-25-opsd_tree.svg) # 2. 'Other or unspecified technology' means that technology should be specified # but it was unclear or missing in the original dataset. technology_translation_dictionary = { 'Klärgasanlage': np.nan, 'Dampfprozess': 'Steam turbine', 'übrige Biomasse - WKK-Anlage': 'Other or unspecified technology', 'übrige Biomasse - Dampfprozess': 'Steam turbine', 'Schlammverbrennungsanlage': 'Combustion engine', 'WKK-Prozess': 'Other or unspecified technology', 'Kehrrichtverbrennungsanlage': 'Combustion engine', 'Integrierte Anlage': 'Photovoltaics', 'Angebaute Anlage': 'Photovoltaics', 'Freistehende Anlage': 'Photovoltaics', 'Trinkwasserkraftwerk': 'Other or unspecified technology', 'Durchlaufkraftwerk': 'Run-of-river', 'Dotierwasserkraftwerk': 'Other or unspecified technology', 'Ausleitkraftwerk': 'Other or unspecified technology', 'Wind Offshore': 'Other or unspecified technology', 'Abwasserkraftwerk': 'Other or unspecified technology', 'Unbekannt': 'Other or unspecified technology', np.nan: 'Onshore', None: 'Onshore' } CH_re_df['technology'].replace(technology_translation_dictionary, inplace=True) # Add energy_source_level_1 CH_re_df['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy of sources present in the dataset energy_columns = ['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology'] CH_re_df[energy_columns].drop_duplicates().sort_values(by='energy_source_level_2') drop_mask = (CH_re_df['energy_source_level_3'] == 'Biomass and biogas') & \ (CH_re_df['technology'] == 'Steam turbine') drop_indices = drop_mask[drop_mask].index CH_re_df.drop(drop_indices, axis='index', inplace=True) CH_re_df.reset_index(drop=True, inplace=True) CH_re_df.replace(value_dict_CH, inplace=True) # Get geo-information zip_CH_geo = zipfile.ZipFile(CH_geo_filepath) # Read generated postcode/location file CH_geo = pd.read_csv(zip_CH_geo.open('CH.txt'), sep='\t', header=None) # add column names as defined in associated readme file CH_geo.columns = ['country_code', 'postcode', 'place_name', 'admin_name1', 'admin_code1', 'admin_name2', 'admin_code2', 'admin_name3', 'admin_code3', 'lat', 'lon', 'accuracy'] # Drop rows of possible duplicate postal_code CH_geo.drop_duplicates('postcode', keep='last', inplace=True) CH_geo['postcode'] = CH_geo['postcode'].astype(str) # harmonise data class CH_geo.postcode = CH_geo.postcode.astype(int) # Add longitude/latitude infomation assigned by municipality code CH_re_df = pd.merge(CH_re_df, CH_geo[['lat', 'lon', 'postcode']], left_on='municipality_code', right_on='postcode', how='left' ) zip_CH_geo.close() CH_postcode2nuts_path = filepaths['Eurostat'] # Use the string versions of postcode and municipality code columns CH_re_df['postcode_str'] = CH_re_df['postcode'].astype(str).str[:-2] CH_re_df['municipality_code_str'] = CH_re_df['municipality_code'].astype(str) CH_re_df = nuts_converter.add_nuts_information(CH_re_df, 'CH', CH_postcode2nuts_path, postcode_column='postcode_str', municipality_code_column='municipality_code_str', lau_name_type='NATIONAL', how=['postcode', 'municipality']) # Report the number of facilites whose NUTS codes were successfully sudetermined determined = CH_re_df['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', CH_re_df.shape[0], 'facilities in CH.') # Report the number of facilites whose NUTS codes could not be determined not_determined = CH_re_df['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', CH_re_df.shape[0], 'facilities in CH.') CH_re_df[CH_re_df['nuts_1_region'].isnull()][['postcode', 'municipality']] # Check the facilities without NUTS classification no_nuts = CH_re_df['nuts_1_region'].isnull() # Find the masks where some information for finding the proper NUTS code is present municipality_name_present = ~(CH_re_df['municipality'].isnull()) # Show the cases where NUTS classification failed even though it shouldn't have problematic_municipality_names = CH_re_df[no_nuts & municipality_name_present]['municipality'].unique() print('Problematic municipalities:', ', '.join(list(problematic_municipality_names)) + '.') print('Are those names present in the official NUTS tables for CH?') if nuts_converter.municipality2nuts_df['municipality'].isin(problematic_municipality_names).any(): print('At least one is.') else: print('No, none is.') # kW to MW CH_re_df['electrical_capacity'] /= 1000 # kWh to MWh CH_re_df['production'] /= 1000 columns_to_keep = ['project_name', 'energy_source_level_2','energy_source_level_3', 'technology', 'electrical_capacity', 'production', 'tariff', 'commissioning_date', 'contract_period_end', 'address', 'municipality_code', 'municipality', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'canton', 'company', 'title', 'surname', 'first_name', 'data_source', 'energy_source_level_1', 'lat', 'lon', 'postcode'] CH_re_df = CH_re_df.loc[:, columns_to_keep] CH_re_df.reset_index(drop=True, inplace=True) visualize_points(CH_re_df['lat'], CH_re_df['lon'], 'Switzerland', categories=CH_re_df['energy_source_level_2'] ) CH_re_df.to_pickle('intermediate/CH_renewables.pickle') del CH_re_df # Download the data and get the local paths to the corresponding files filepaths = downloader.download_data_for_country('UK') UK_re_filepath = filepaths['BEIS'] UK_geo_filepath = filepaths['Geonames'] UK_postcode2nuts_filepath = filepaths['Eurostat'] # Read the renewable powerplants data into a dataframe UK_re_df = pd.read_csv(UK_re_filepath, header=2, encoding='latin1', parse_dates=['Record Last Updated (dd/mm/yyyy)','Operational'], infer_datetime_format=True, thousands=',' ) # Drop empty columns and rows UK_re_df.dropna(axis='index', how='all', inplace=True) UK_re_df.dropna(axis='columns', how='all', inplace=True) # Keep only operational facilities in the dataset UK_re_df = UK_re_df.loc[UK_re_df["Development Status"] == "Operational"] UK_re_df.reset_index(inplace=True, drop=True) # Standardize string columns strip_and_lower = ['CHP Enabled'] strip_only = ['Country', 'County', 'Operator (or Applicant)', 'Mounting Type for Solar'] for column in strip_and_lower: util.helper.standardize_column(UK_re_df, column, lower=True) for column in strip_only: util.helper.standardize_column(UK_re_df, column, lower=False) # Drop Flywheels, Battery and Liquid Air Energy Storage UK_re_df = UK_re_df[~UK_re_df['Technology Type'].isin(['Flywheels', 'Battery', 'Liquid Air Energy Storage'])] UK_re_df.reset_index(drop=True, inplace=True) # Copy the column "Technology Type" to a new column named "technology" UK_re_df['technology'] = UK_re_df['Technology Type'] # Choose the translation terms for the UK and create the translation dictionary idx_UK = columnnames[columnnames['country'] == 'UK'].index column_dict_UK = columnnames.loc[idx_UK].set_index('original_name')['opsd_name'].to_dict() # Show the dictionary column_dict_UK # Translate column names UK_re_df.rename(columns=column_dict_UK, inplace=True) UK_re_df['data_source'] = 'BEIS' # Create dictionnary in order to assign energy_source_level_2 to its subtype idx_UK = valuenames[valuenames['country'] == 'UK'].index energy_source_dict_UK = valuenames.loc[idx_UK].set_index('original_name')['energy_source_level_2'].to_dict() # Add energy_source_level_2 UK_re_df['energy_source_level_2'] = UK_re_df['energy_source_level_3'].replace(energy_source_dict_UK) # Translate values in order to standardize energy_source_level_3 value_dict_UK = valuenames.loc[idx_UK].set_index('original_name')['opsd_name'].to_dict() UK_re_df['energy_source_level_3'].replace(value_dict_UK, inplace=True) # Standardize the values for technology # 1. np.nan means that technology should not be specified for the respective kind of sources # according to the hierarchy (http://open-power-system-data.org/2016-10-25-opsd_tree.svg) # 2. 'Other or unspecified technology' means that technology should be specified # but it was unclear or missing in the original dataset. technology_translation_dictionary = { 'Biomass (co-firing)': 'Other or unspecified technology', 'Biomass (dedicated)': 'Other or unspecified technology', 'Advanced Conversion Technologies': 'Other or unspecified technology', 'Anaerobic Digestion': 'Other or unspecified technology', 'EfW Incineration': np.nan, 'Large Hydro': 'Other or unspecified technology', 'Small Hydro': 'Other or unspecified technology', 'Landfill Gas': np.nan, 'Solar Photovoltaics': 'Photovoltaics', 'Sewage Sludge Digestion': np.nan, 'Tidal Barrage and Tidal Stream': np.nan, 'Shoreline Wave': np.nan, 'Wind Offshore': 'Offshore', 'Wind Onshore': 'Onshore', 'Pumped Storage Hydroelectricity': 'Pumped storage' } UK_re_df['technology'].replace(technology_translation_dictionary, inplace=True) # Add energy_source_level_1 UK_re_df['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy of sources present in the dataset UK_re_df[['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology']].drop_duplicates() # Define a wrapper for bng_to_latlon for handling None values def to_lat_lon(easting, northing): if pd.isnull(easting) or pd.isnull(northing): return (None, None) else: return bng_to_latlon.OSGB36toWGS84(easting, northing) # Convert easting and northing columns to numbers UK_re_df['X-coordinate'] = pd.to_numeric( UK_re_df['X-coordinate'].astype(str).str.replace(',', ''), errors='coerce' ) UK_re_df['Y-coordinate'] = pd.to_numeric( UK_re_df['Y-coordinate'].astype(str).str.replace(',', ''), errors='coerce' ) # Convert easting and northing coordinates to standard latitude and longitude latlon = UK_re_df.apply(lambda row: to_lat_lon(row["X-coordinate"], row["Y-coordinate"]), axis=1 ) # Split a column of (latitude, longitude) pairs into two separate coordinate columns latitude = latlon.apply(lambda x: x[0]) longitude = latlon.apply(lambda x: x[1]) # Add them to the dataframe UK_re_df['latitude'] = latitude UK_re_df['longitude'] = longitude # Get geo-information zip_UK_geo = zipfile.ZipFile(UK_geo_filepath) # Read generated postcode/location file UK_geo = pd.read_csv(zip_UK_geo.open('GB_full.txt'), sep='\t', header=None) # add column names as defined in associated readme file UK_geo.columns = ['country_code', 'postcode', 'place_name', 'admin_name1', 'admin_code1', 'admin_name2', 'admin_code2', 'admin_name3', 'admin_code3', 'lat', 'lon', 'accuracy'] # Drop rows of possible duplicate postal_code UK_geo.drop_duplicates('postcode', keep='last', inplace=True) UK_geo['postcode'] = UK_geo['postcode'].astype(str) # Find the rows where latitude and longitude are unknown missing_latlon_mask = UK_re_df['latitude'].isna() | UK_re_df['longitude'].isna() missing_latlon = UK_re_df[missing_latlon_mask] # Add longitude/latitude infomation assigned by post code updated_latlon = pd.merge(missing_latlon, UK_geo[['lat', 'lon', 'postcode']], left_on='postcode', right_on='postcode', how='left' ) # Return the updated rows to the original frame UK_re_df = pd.merge(UK_re_df, updated_latlon[['uk_beis_id', 'lat', 'lon']], on='uk_beis_id', how='left' ) # Use the bng_to_latlon coordinates (columns: 'latitude' and 'longitude') if present, # otherwise, use those obtained with UK_geo (columns: 'lat' and 'lon'). UK_re_df['longitude'] = UK_re_df.apply(lambda row: row['longitude'] if not pd.isnull(row['longitude']) else row['lon'], axis=1 ) UK_re_df['latitude'] = UK_re_df.apply(lambda row: row['latitude'] if not pd.isnull(row['latitude']) else row['lat'], axis=1 ) # Drop the UK_geo columns (lat/lon) # as the information was moved to the 'latitude' and 'longitude' columns. UK_re_df.drop(['lat', 'lon'], axis='columns', inplace=True) zip_UK_geo.close() # Find the rows where latitude and longitude are unknown missing_latlon_mask = UK_re_df['latitude'].isna() | UK_re_df['longitude'].isna() missing_latlon = UK_re_df[missing_latlon_mask].copy() missing_latlon = missing_latlon.reset_index() # Determine their post code prefixes prefixes = missing_latlon.apply(lambda row: str(row['postcode']).split(' ')[0], axis=1 ) missing_latlon['Prefix'] = prefixes # Determine the centroids of the areas covered by the prefixes grouped_UK_geo=UK_geo.groupby(by=lambda i: str(UK_geo['postcode'].loc[i]).split(' ')[0]) # Assing the centroid coordinates to the facilities with unknown coordinates updated_latlon = pd.merge(missing_latlon, grouped_UK_geo.mean(), left_on="Prefix", right_index=True, how="left" ) # Return the updated rows to the original frame UK_re_df = pd.merge(UK_re_df, updated_latlon[['uk_beis_id', 'lat', 'lon']], on='uk_beis_id', how='left' ) # Keep the already known coordinates (columns: 'latitude' and 'longitude') if present, # otherwise, use those obtained by approximation (columns: 'lat' and 'lon'). UK_re_df['longitude'] = UK_re_df.apply(lambda row: row['longitude'] if not pd.isnull(row['longitude']) else row['lon'], axis=1 ) UK_re_df['latitude'] = UK_re_df.apply(lambda row: row['latitude'] if not pd.isnull(row['latitude']) else row['lat'], axis=1 ) # Drop the UK_geo columns (lat/lon) # as the information was moved to the 'latitude' and 'longitude' columns. UK_re_df.drop(['lat', 'lon'], axis='columns', inplace=True) UK_postcode2nuts_filepath = filepaths['Eurostat'] UK_re_df = nuts_converter.add_nuts_information(UK_re_df, 'UK', UK_postcode2nuts_filepath, latitude_column='latitude', longitude_column='longitude', closest_approximation=True, lau_name_type='NATIONAL', how=['latlon', 'municipality']) # Report the number of facilites whose NUTS codes were successfully sudetermined determined = UK_re_df['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', UK_re_df.shape[0], 'facilities in UK.') # Report the number of facilites whose NUTS codes could not be determined not_determined = UK_re_df['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', UK_re_df.shape[0], 'facilities in UK.') UK_re_df[UK_re_df['nuts_1_region'].isnull()] visualize_points(UK_re_df['latitude'], UK_re_df['longitude'], 'United Kingdom', categories=UK_re_df['energy_source_level_2'] ) max_X = UK_re_df['X-coordinate'].max() min_X = UK_re_df['X-coordinate'].min() max_Y = UK_re_df['Y-coordinate'].max() min_Y = UK_re_df['Y-coordinate'].min() figure(num=None, figsize=(8, 6), dpi=100, facecolor='w', edgecolor='k') ax = plt.axes(projection=ccrs.OSGB()) ax.coastlines('10m') ax.scatter(UK_re_df['X-coordinate'], UK_re_df['Y-coordinate'],s=0.5) plt.show() # Rename 'longitude' and 'latitude' to 'lon' and 'lat' to conform to the naming convention # used for other countries. UK_re_df.rename(columns={'longitude': 'lon', 'latitude': 'lat'}, inplace=True) # Define the columns to keep columns_of_interest = ['commissioning_date', 'uk_beis_id', 'operator', 'site_name', 'energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology', 'electrical_capacity', 'chp', 'support_robranding', 'support_fit', 'support_cfd', 'capacity_individual_turbine', 'number_of_turbines', 'solar_mounting_type', 'status', 'address', 'municipality', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'region', 'country', 'postcode', 'lon', 'lat', 'data_source' ] for col in columns_of_interest: if col not in UK_re_df.columns: print(col) # Clean the dataframe from columns other than those specified above UK_re_df = UK_re_df.loc[:, columns_of_interest] UK_re_df.reset_index(drop=True, inplace=True) UK_re_df.columns UK_re_df.to_pickle('intermediate/UK_renewables.pickle') # Download the data and get the local paths to the corresponding files filepaths = downloader.download_data_for_country('SE') print(filepaths) SE_re_filepath = filepaths['Vindbrukskollen'] SE_geo_filepath = filepaths['Geonames'] SE_postcode2nuts_filepath = filepaths['Eurostat'] # Define the function for converting the column "Senast sparads" to date type #def from_int_to_date(int_date): # print(int_date) # str_date =str(int_date) # year = str_date[:4] # month = str_date[4:6] # day = str_date[6:8] # str_date = '{}/{}/{}'.format(year, month, day) # return pd.to_datetime(str_date, format='%Y/%m/%d') # Read the data SE_re_df = pd.read_excel(SE_re_filepath, sheet_name='Vindkraftverk', na_values='-', parse_dates=['Uppfört', 'Senast sparad'], infer_datetime_format=True, #converters={'Senast sparad' : from_int_to_date} ) # Show 5 rows from the beginning SE_re_df.head(5) # Drop empty rows and columns SE_re_df.dropna(axis='index', how='all', inplace=True) SE_re_df.dropna(axis='columns', how='all', inplace=True) # Make sure that the column Uppfört is of the date type and correctly formatted SE_re_df['Uppfört'] = pd.to_datetime(SE_re_df['Uppfört'], format='%Y-%m-%d') # Keep only operational wind farms subset_mask = SE_re_df['Status'].isin(['Beviljat', 'Uppfört']) SE_re_df.drop(SE_re_df[~subset_mask].index, axis='index', inplace=True) # Remove the farms whose capacity is not known. subset_mask = SE_re_df['Maxeffekt (MW)'].isna() SE_re_df.drop(SE_re_df[subset_mask].index, axis='index', inplace=True) # Standardize string columns string_columns = ['Modell', 'Fabrikat', 'Elområde', 'Kommun', 'Län', 'Handlingstyp', 'Placering'] for col in string_columns: util.helper.standardize_column(SE_re_df, col, lower=False) # Choose the translation terms for the UK and create the translation dictionary idx_SE = columnnames[columnnames['country'] == 'SE'].index column_dict_SE = columnnames.loc[idx_SE].set_index('original_name')['opsd_name'].to_dict() # Show the dictionary display(column_dict_SE) # Translate column names SE_re_df.rename(columns=column_dict_SE, inplace=True) SE_re_df.loc[(SE_re_df['commissioning_date'].dt.year == 1900), 'commissioning_date'] = np.nan SE_re_df['data_source'] = 'Vindbrukskollen' # Choose the translation terms for Sweden idx_SE = valuenames[valuenames['country'] == 'SE'].index value_dict_SE = valuenames.loc[idx_SE].set_index('original_name')['opsd_name'].to_dict() value_dict_SE # Replace all original value names by the OPSD value names SE_re_df.replace(value_dict_SE, inplace=True) # Set nans in the technology column to 'Unknown or unspecified technology' SE_re_df['technology'].fillna('Unknown or unspecified technology', inplace=True) # Add energy level 2 SE_re_df['energy_source_level_2'] = 'Wind' # Add energy_source_level_1 SE_re_df['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy of sources present in the dataset SE_re_df[['energy_source_level_1', 'energy_source_level_2', 'technology']].drop_duplicates() # Get latitude and longitude columns lat, lon = util.helper.sweref99tm_latlon_transform(SE_re_df['sweref99tm_north'], SE_re_df['sweref99tm_east']) # Include them in the dataframe SE_re_df['lat'] = lat SE_re_df['lon'] = lon SE_postcode2nuts_filepath = filepaths['Eurostat'] SE_re_df = nuts_converter.add_nuts_information(SE_re_df, 'SE', SE_postcode2nuts_filepath, lau_name_type='NATIONAL', how=['municipality', 'latlon']) # Report the number of facilites whose NUTS codes were successfully sudetermined determined = SE_re_df['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', SE_re_df.shape[0], 'facilities in SE.') # Report the number of facilites whose NUTS codes could not be determined not_determined = SE_re_df['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', SE_re_df.shape[0], 'facilities in SE.') # Define which columns should be kept columns_to_keep = ['municipality', 'county', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'lat', 'lon', 'energy_source_level_1', 'energy_source_level_2', 'technology', 'se_vindbrukskollen_id', 'site_name', 'manufacturer', 'electrical_capacity', 'commissioning_date', 'data_source'] # Keep only the selected columns SE_re_df = SE_re_df.loc[:, columns_to_keep] visualize_points(SE_re_df['lat'], SE_re_df['lon'], 'Sweden', categories=SE_re_df['technology'] ) SE_re_df.reset_index(inplace=True, drop=True) SE_re_df.to_pickle('intermediate/SE_renewables.pickle') del SE_re_df # Download the data and get the local paths to the corresponding files print('Start:', datetime.datetime.now()) downloader = Downloader(version, input_directory_path, source_list_filepath, download_from) filepaths = downloader.download_data_for_country('CZ') print('End:', datetime.datetime.now()) CZ_re_filepath = filepaths['ERU'] CZ_geo_filepath = filepaths['Geonames'] CZ_postcode2nuts_filepath = filepaths['Eurostat'] # Define a converter for CZ postcode strings def to_cz_postcode_format(postcode_str): return postcode_str[:3] + ' ' + postcode_str[3:] # Read the data from the csv file CZ_re_df = pd.read_csv(CZ_re_filepath, escapechar='\\', dtype = { 'number_of_sources' : int, }, parse_dates=['licence_approval_date'], infer_datetime_format=True, converters = { 'site_postcode' : to_cz_postcode_format, 'holder_postcode' : to_cz_postcode_format } ) # Show a few rows CZ_re_df.head(5) CZ_re_df.dtypes mwe_columns = [col for col in CZ_re_df.columns if 'megawatts_electric' in col and col != 'megawatts_electric_total'] mwt_columns = [col for col in CZ_re_df.columns if 'megawatts_thermal' in col and col != 'megawatts_thermal_total'] def count_types(row): global mwe_columns different_types = sum([row[col] > 0 for col in mwe_columns]) return different_types CZ_re_df.apply(count_types, axis=1).value_counts() # Drop empty columns and rows CZ_re_df.dropna(axis='index', how='all', inplace=True) CZ_re_df.dropna(axis='columns', how='all', inplace=True) # Drop rows with no data on electrical capacity and the rows where total electrical capacity is 0 empty_mask = (CZ_re_df['megawatts_electric_total'] == 0) | (CZ_re_df['megawatts_electric_total'].isnull()) CZ_re_df = CZ_re_df.loc[~empty_mask] CZ_re_df.reset_index(inplace=True, drop=True) # Replace NANs with zeroes in mwe and mwt columns replacement_dict = {col : 0 for col in mwe_columns + mwt_columns} CZ_re_df.fillna(replacement_dict, inplace=True) # Drop the rows where renewable-energy share of the total capacity is equal to zero conventional_mask = (CZ_re_df['megawatts_electric_hydro'] + CZ_re_df['megawatts_electric_solar'] + CZ_re_df['megawatts_electric_biogas_and_biomass'] + CZ_re_df['megawatts_electric_wind'] + CZ_re_df['megawatts_electric_unspecified']) == 0 CZ_re_df = CZ_re_df.loc[~conventional_mask] CZ_re_df.reset_index(inplace=True, drop=True) # Define the function which will extract the data about the type of energy specified by the given column # and return it as a dataframe in the "long format" def select_and_reformat(df, column): # Use the mwe and mwt columns defined above global mwe_columns global mwt_columns # Declare the given column and its mwt counterpart as exceptions mwt_exception = column.replace('electric', 'thermal') exceptions = [column, mwt_exception] # Exclude all the mwe and mwt columns which do not correspond to the given energy type columns_to_skip = [col for col in mwe_columns + mwt_columns if col not in exceptions] # Keep all the other columns columns_to_keep = [col for col in df.columns if col not in columns_to_skip] # Find the stations which use the given type of energy selection_mask = (df[column] > 0) # Keep them and select the columns we decided to keep selection_df = df[selection_mask][columns_to_keep] # Create a new column which will indicate the energy type selection_df['energy_type'] = " ".join(column.split('_')[2:]) # Remove the energy type name from the columns representing electrical capacity # and megawatts thermal selection_df.rename(columns = {column : 'electrical_capacity', mwt_exception : 'megawatts_thermal'}, inplace=True) selection_df.drop(columns=['megawatts_electric_total', 'megawatts_thermal_total'], inplace=True) # Ensure the rows are properly indexed as 0,1,2,... selection_df.reset_index(inplace=True, drop=True) return selection_df # Create a dataframe for each energy type dataframes = [] for column in mwe_columns: selection = select_and_reformat(CZ_re_df, column) energy_type = selection['energy_type'].unique()[0] dataframes.append(selection) # Concatenate the dataframes CZ_re_df = pd.concat(dataframes, ignore_index=False) CZ_re_df.reset_index(inplace=True, drop=True) CZ_re_df # Choose the translation terms for CZ and create the translation dictionary idx_CZ = columnnames[columnnames['country'] == 'CZ'].index column_dict_CZ = columnnames.loc[idx_CZ].set_index('original_name')['opsd_name'].to_dict() # Show the dictionary column_dict_CZ # Translate column names CZ_re_df.rename(columns=column_dict_CZ, inplace=True) # Choose the translation terms for Czech Republic idx_CZ = valuenames[valuenames['country'] == 'CZ'].index # Choose the translation terms for energy source level 3 energy3_dict_CZ = valuenames.loc[idx_CZ].set_index('original_name')['opsd_name'].to_dict() energy3_dict_CZ # Add energy source level 3 CZ_re_df['energy_source_level_3'] = CZ_re_df['technology'].replace(energy3_dict_CZ) # Choose the terms for energy source level 2 energy2_dict_CZ = valuenames.loc[idx_CZ].set_index('original_name')['energy_source_level_2'].to_dict() CZ_re_df['energy_source_level_2'] = CZ_re_df['technology'].replace(energy2_dict_CZ) # Standardize the values for technology # 1. np.nan means that technology should not be specified for the respective kind of sources # according to the hierarchy (http://open-power-system-data.org/2016-10-25-opsd_tree.svg) # 2. 'Other or unspecified technology' means that technology should be specified # but it was unclear or missing in the original dataset. technology_dict = { 'biogas and biomass' : np.nan, 'wind' : 'Onshore', 'solar' : 'Other or unspecified technology', 'hydro' : 'Run-of-river', 'unspecified' : np.nan } CZ_re_df['technology'] = CZ_re_df['technology'].replace(technology_dict) # Add energy_source_level_1 CZ_re_df['energy_source_level_1'] = 'Renewable energy' # Show the hierarchy of sources present in the dataset CZ_re_df[['energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology']].drop_duplicates() CZ_re_df['data_source'] = 'ERU' # Get geo-information zip_CZ_geo = zipfile.ZipFile(CZ_geo_filepath) # Read generated postcode/location file CZ_geo = pd.read_csv(zip_CZ_geo.open('CZ.txt'), sep='\t', header=None) # add column names as defined in associated readme file CZ_geo.columns = ['country_code', 'postcode', 'place_name', 'admin_name1', 'admin_code1', 'admin_name2', 'admin_code2', 'admin_name3', 'admin_code3', 'lat', 'lon', 'accuracy'] # Drop rows of possible duplicate postal_code CZ_geo.drop_duplicates('postcode', keep='last', inplace=True) # Add longitude/latitude infomation assigned by postcode CZ_re_df = pd.merge(CZ_re_df, CZ_geo[['lat', 'lon', 'postcode']], left_on='postcode', right_on='postcode', how='left' ) CZ_postcode2nuts_filepath = filepaths['Eurostat'] CZ_re_df = nuts_converter.add_nuts_information(CZ_re_df, 'CZ', CZ_postcode2nuts_filepath, how=['postcode']) # Report the number of facilites whose NUTS codes were successfully determined determined = CZ_re_df['nuts_1_region'].notnull().sum() print('NUTS successfully determined for', determined, 'out of', CZ_re_df.shape[0], 'facilities in CZ.') # Report the number of facilites whose NUTS codes could not be determined not_determined = CZ_re_df['nuts_1_region'].isnull().sum() print('NUTS could not be determined for', not_determined, 'out of', CZ_re_df.shape[0], 'facilities in CZ.') # Define which columns should be kept columns_to_keep = ['site_name', 'region', 'municipality', 'locality', 'postcode', 'nuts_1_region', 'nuts_2_region', 'nuts_3_region', 'lat', 'lon', 'energy_source_level_1', 'energy_source_level_2', 'energy_source_level_3', 'technology', 'owner', 'electrical_capacity', 'data_source'] # Keep only the selected columns CZ_re_df = CZ_re_df.loc[:, columns_to_keep] CZ_re_df.drop_duplicates(inplace=True) CZ_re_df.reset_index(drop=True, inplace=True) visualize_points(CZ_re_df['lat'], CZ_re_df['lon'], 'Czechia', categories=CZ_re_df['energy_source_level_2'] ) CZ_re_df.reset_index(inplace=True, drop=True) CZ_re_df.to_pickle('intermediate/CZ_renewables.pickle') del CZ_re_df zip_archive = zipfile.ZipFile(input_directory_path + '.zip', 'w', zipfile.ZIP_DEFLATED) print("Zipping the raw files...") for filename in os.listdir(input_directory_path): print("Adding", filename, "to the zip.") filepath = os.path.join(input_directory_path, filename) zip_archive.write(filepath) zip_archive.close() print("Done!") #shutil.rmtree(input_directory_path) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The main imports we use from RecSim are user and document -- they provide the abstract classes needed to instantiate all components of the environment. Step2: A Document Model Step3: Having implemented a document template, we now need a document sampler. A document sampler is a generative distribution for documents, which will get invoked to regenerate the corpus either after every step or after every session (depending on runner_lib settings). The object of interest is the sample_document() function required by the base class. It must return a document sampled from our desired distribution. In our case, it returns a document with a kaleness score sampled from a uniform distribution. Step4: With this we can now simulate documents. Step6: In RecSim, we never have to manually sample documents---the simulator does this, so a document sampler is a required argument of the simulation. Step7: Also similarly to our document model, we have need a starting state sampler, that sets the starting user state for every session. For this tutoral, we will just sample the starting $\text{nke}_0$ and keep all the static parameters the same, meaning that we essentially deal with the same user at different levels of satisfaction. One can, of course, extend this easily to generate also users with different parameters by randomizing the values. Step8: Let's try this out! Step9: Response model Step10: User model Step11: The simulate_response() method takes in a slate (list) of recommended (i.e., produced by the agent) LTSDocuments and must output a slate of user responses. The k-th response in the slate of responses corresponds to the k-th document in the recommendation slate. In this case, we pick one document to click on based on our choice model, and produce an engagement value. We will let the responses to the unclicked documents be vacuous, however, one might use them in more subtle ways (e.g., recording whether the user inspected that document, etc.). Step12: The update_state() method implements our state transition kernel. It consumes the recommended slate, as well as the actual choices (responses) to induce a state transition. The state is modified in-place, so the function does not return anything. Step14: Finally, the session expires when the time budget goes to 0. Step15: We have all the components to instantiate a user model, so let's wrap them up in a class. Step16: Finally, we assemble all components into an Environment. Step17: Recap Step18: Now, we simply use the OpenAI gym wrapper, which essentially provides a familiar step-based API.
<ASSISTANT_TASK:> Python Code: # @title Install !pip install --upgrade --no-cache-dir recsim #@title Generic imports import numpy as np from gym import spaces import matplotlib.pyplot as plt from scipy import stats #@title RecSim imports from recsim import document from recsim import user from recsim.choice_model import MultinomialLogitChoiceModel from recsim.simulator import environment from recsim.simulator import recsim_gym class LTSDocument(document.AbstractDocument): def __init__(self, doc_id, kaleness): self.kaleness = kaleness # doc_id is an integer representing the unique ID of this document super(LTSDocument, self).__init__(doc_id) def create_observation(self): return np.array([self.kaleness]) @staticmethod def observation_space(): return spaces.Box(shape=(1,), dtype=np.float32, low=0.0, high=1.0) def __str__(self): return "Document {} with kaleness {}.".format(self._doc_id, self.kaleness) class LTSDocumentSampler(document.AbstractDocumentSampler): def __init__(self, doc_ctor=LTSDocument, **kwargs): super(LTSDocumentSampler, self).__init__(doc_ctor, **kwargs) self._doc_count = 0 def sample_document(self): doc_features = {} doc_features['doc_id'] = self._doc_count doc_features['kaleness'] = self._rng.random_sample() self._doc_count += 1 return self._doc_ctor(**doc_features) sampler = LTSDocumentSampler() for i in range(5): print(sampler.sample_document()) d = sampler.sample_document() print("Documents have observation space:", d.observation_space(), "\n" "An example realization is: ", d.create_observation()) class LTSUserState(user.AbstractUserState): def __init__(self, memory_discount, sensitivity, innovation_stddev, choc_mean, choc_stddev, kale_mean, kale_stddev, net_kaleness_exposure, time_budget, observation_noise_stddev=0.1 ): ## Transition model parameters ############################## self.memory_discount = memory_discount self.sensitivity = sensitivity self.innovation_stddev = innovation_stddev ## Engagement parameters self.choc_mean = choc_mean self.choc_stddev = choc_stddev self.kale_mean = kale_mean self.kale_stddev = kale_stddev ## State variables ############################## self.net_kaleness_exposure = net_kaleness_exposure self.satisfaction = 1 / (1 + np.exp(-sensitivity * net_kaleness_exposure)) self.time_budget = time_budget # Noise self._observation_noise = observation_noise_stddev def create_observation(self): User's state is not observable. clip_low, clip_high = (-1.0 / (1.0 * self._observation_noise), 1.0 / (1.0 * self._observation_noise)) noise = stats.truncnorm( clip_low, clip_high, loc=0.0, scale=self._observation_noise).rvs() noisy_sat = self.satisfaction + noise return np.array([noisy_sat,]) @staticmethod def observation_space(): return spaces.Box(shape=(1,), dtype=np.float32, low=-2.0, high=2.0) # scoring function for use in the choice model -- the user is more likely to # click on more chocolatey content. def score_document(self, doc_obs): return 1 - doc_obs class LTSStaticUserSampler(user.AbstractUserSampler): _state_parameters = None def __init__(self, user_ctor=LTSUserState, memory_discount=0.9, sensitivity=0.01, innovation_stddev=0.05, choc_mean=5.0, choc_stddev=1.0, kale_mean=4.0, kale_stddev=1.0, time_budget=60, **kwargs): self._state_parameters = {'memory_discount': memory_discount, 'sensitivity': sensitivity, 'innovation_stddev': innovation_stddev, 'choc_mean': choc_mean, 'choc_stddev': choc_stddev, 'kale_mean': kale_mean, 'kale_stddev': kale_stddev, 'time_budget': time_budget } super(LTSStaticUserSampler, self).__init__(user_ctor, **kwargs) def sample_user(self): starting_nke = ((self._rng.random_sample() - .5) * (1 / (1.0 - self._state_parameters['memory_discount']))) self._state_parameters['net_kaleness_exposure'] = starting_nke return self._user_ctor(**self._state_parameters) sampler = LTSStaticUserSampler() starting_nke = [] for i in range(1000): sampled_user = sampler.sample_user() starting_nke.append(sampled_user.net_kaleness_exposure) _ = plt.hist(starting_nke) class LTSResponse(user.AbstractResponse): # The maximum degree of engagement. MAX_ENGAGEMENT_MAGNITUDE = 100.0 def __init__(self, clicked=False, engagement=0.0): self.clicked = clicked self.engagement = engagement def create_observation(self): return {'click': int(self.clicked), 'engagement': np.array(self.engagement)} @classmethod def response_space(cls): # `engagement` feature range is [0, MAX_ENGAGEMENT_MAGNITUDE] return spaces.Dict({ 'click': spaces.Discrete(2), 'engagement': spaces.Box( low=0.0, high=cls.MAX_ENGAGEMENT_MAGNITUDE, shape=tuple(), dtype=np.float32) }) def user_init(self, slate_size, seed=0): super(LTSUserModel, self).__init__(LTSResponse, LTSStaticUserSampler(LTSUserState, seed=seed), slate_size) self.choice_model = MultinomialLogitChoiceModel({}) def simulate_response(self, slate_documents): # List of empty responses responses = [self._response_model_ctor() for _ in slate_documents] # Get click from of choice model. self.choice_model.score_documents( self._user_state, [doc.create_observation() for doc in slate_documents]) scores = self.choice_model.scores selected_index = self.choice_model.choose_item() # Populate clicked item. self._generate_response(slate_documents[selected_index], responses[selected_index]) return responses def generate_response(self, doc, response): response.clicked = True # linear interpolation between choc and kale. engagement_loc = (doc.kaleness * self._user_state.choc_mean + (1 - doc.kaleness) * self._user_state.kale_mean) engagement_loc *= self._user_state.satisfaction engagement_scale = (doc.kaleness * self._user_state.choc_stddev + ((1 - doc.kaleness) * self._user_state.kale_stddev)) log_engagement = np.random.normal(loc=engagement_loc, scale=engagement_scale) response.engagement = np.exp(log_engagement) def update_state(self, slate_documents, responses): for doc, response in zip(slate_documents, responses): if response.clicked: innovation = np.random.normal(scale=self._user_state.innovation_stddev) net_kaleness_exposure = (self._user_state.memory_discount * self._user_state.net_kaleness_exposure - 2.0 * (doc.kaleness - 0.5) + innovation ) self._user_state.net_kaleness_exposure = net_kaleness_exposure satisfaction = 1 / (1.0 + np.exp(-self._user_state.sensitivity * net_kaleness_exposure) ) self._user_state.satisfaction = satisfaction self._user_state.time_budget -= 1 return def is_terminal(self): Returns a boolean indicating if the session is over. return self._user_state.time_budget <= 0 LTSUserModel = type("LTSUserModel", (user.AbstractUserModel,), {"__init__": user_init, "is_terminal": is_terminal, "update_state": update_state, "simulate_response": simulate_response, "_generate_response": generate_response}) slate_size = 3 num_candidates = 10 ltsenv = environment.Environment( LTSUserModel(slate_size), LTSDocumentSampler(), num_candidates, slate_size, resample_documents=True) def clicked_engagement_reward(responses): reward = 0.0 for response in responses: if response.clicked: reward += response.engagement return reward lts_gym_env = recsim_gym.RecSimGymEnv(ltsenv, clicked_engagement_reward) observation_0 = lts_gym_env.reset() print('Observation 0') print('Available documents') doc_strings = ['doc_id ' + key + " kaleness " + str(value) for key, value in observation_0['doc'].items()] print('\n'.join(doc_strings)) print('Noisy user state observation') print(observation_0['user']) # Agent recommends the first three documents. recommendation_slate_0 = [0, 1, 2] observation_1, reward, done, _ = lts_gym_env.step(recommendation_slate_0) print('Observation 1') print('Available documents') doc_strings = ['doc_id ' + key + " kaleness " + str(value) for key, value in observation_1['doc'].items()] print('\n'.join(doc_strings)) rsp_strings = [str(response) for response in observation_1['response']] print('User responses to documents in the slate') print('\n'.join(rsp_strings)) print('Noisy user state observation') print(observation_1['user']) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: You can find more examples at LearnPython & PythonTutorial. Step2: You may separate commands using ";" Step3: print myfloat1 Step4: This is a box of comments Step5: 3. Lists Step6: Here is a simple example that shows how a list is different with an array. Step7: Exercise <br> Step8: You may insert several other elements to the list using "append", "insert", "index" and several others. See below for for more details Step9: Lines and Indentation Step10: 5. For Loop Step11: Exercise <br> Step12: Exercise <br>
<ASSISTANT_TASK:> Python Code: #a = 2 #b = 1 a, b, c = 2, 3, "Hello World!" #print a # works in python2 but not python3 print( a ) print ("Hello World!") print (3*3) print (3**2) print (2+2) myint = 7 myfloat1 = 7.0; myfloat2 = float(7) print (myint/2); print (myfloat1/2); print (myfloat2*2); print (myfloat2**2) mystring1 = 'Hello' # in R mystring1 <- 'Hello' mystring2 = "World" mystring12 = mystring1+" "+mystring2+"!"+"?"+"!" #add a comment print (mystring12) dir() del mystring1, mystring2 dir() print (mystring12) print (len(mystring12)) print (mystring12 * 2) print (3.0 / 2) print (3 / 2.) print (3 / 2) print (mystring12) print (mystring12[0]) print (mystring12[1:2]) # 1:n [1:n] print (mystring12[:]) mylist = [1, 2, 3.] print (mylist) print (mylist[0]) mylist = [1, 2, 3, "2", "Hello World", [1, 2, 3] ] print (mylist) print (mylist[-1]) print (mylist[2]*3) firstname= ["Mansoore","Shakib", "Mahdi","Somayeh"] lastname=["Razmkhah", "Panah", "Alehdaghi","Noshadi"] print (firstname) print (lastname) #The "zip" function pairs several lists of the same size. firstlast = zip(firstname, lastname) print (list(firstlast)) x = 2 print (x == 2) print (x < 2) print (not x < 2) print( (x == 2)*(x > 1) ) a = 0 if a == 0: print( "a equals zero" ) # do not use a is equal to zero (bad English) else: print( "a is non-zero" ) # do not use a is not equal to zero (bad English) if x==2: print( "x equals two" ) else: print( "x differs" ) print( firstname ) if "John" in firstname: print "John is in the list" print( range(10) ) print( range(2,6) ) print( range(2,14,4) ) print( range(len(firstname))) for i in range(len(firstname)): print( firstname[i] ) for name in firstname: print( name ) def sq(x): return x**2 print( sq(75) ) def sqlist1(X): return [sq(x) for x in X] sqlist1(range(6)) def sqlist2(X): Y=[0]*len(X) for i in range(len(X)): Y[i]=sq(X[i]) return Y sqlist2(range(6)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load the data from the publication Step2: Create and fit a receptive field model Step3: Investigate model coefficients Step4: Create and fit a stimulus reconstruction model Step5: Visualize stimulus reconstruction Step6: Investigate model coefficients
<ASSISTANT_TASK:> Python Code: # Authors: Chris Holdgraf <choldgraf@gmail.com> # Eric Larson <larson.eric.d@gmail.com> # Nicolas Barascud <nicolas.barascud@ens.fr> # # License: BSD (3-clause) import numpy as np import matplotlib.pyplot as plt from scipy.io import loadmat from os.path import join import mne from mne.decoding import ReceptiveField from sklearn.model_selection import KFold from sklearn.preprocessing import scale path = mne.datasets.mtrf.data_path() decim = 2 data = loadmat(join(path, 'speech_data.mat')) raw = data['EEG'].T speech = data['envelope'].T sfreq = float(data['Fs']) sfreq /= decim speech = mne.filter.resample(speech, down=decim, npad='auto') raw = mne.filter.resample(raw, down=decim, npad='auto') # Read in channel positions and create our MNE objects from the raw data montage = mne.channels.make_standard_montage('biosemi128') info = mne.create_info(montage.ch_names, sfreq, 'eeg').set_montage(montage) raw = mne.io.RawArray(raw, info) n_channels = len(raw.ch_names) # Plot a sample of brain and stimulus activity fig, ax = plt.subplots() lns = ax.plot(scale(raw[:, :800][0].T), color='k', alpha=.1) ln1 = ax.plot(scale(speech[0, :800]), color='r', lw=2) ax.legend([lns[0], ln1[0]], ['EEG', 'Speech Envelope'], frameon=False) ax.set(title="Sample activity", xlabel="Time (s)") mne.viz.tight_layout() # Define the delays that we will use in the receptive field tmin, tmax = -.2, .4 # Initialize the model rf = ReceptiveField(tmin, tmax, sfreq, feature_names=['envelope'], estimator=1., scoring='corrcoef') # We'll have (tmax - tmin) * sfreq delays # and an extra 2 delays since we are inclusive on the beginning / end index n_delays = int((tmax - tmin) * sfreq) + 2 n_splits = 3 cv = KFold(n_splits) # Prepare model data (make time the first dimension) speech = speech.T Y, _ = raw[:] # Outputs for the model Y = Y.T # Iterate through splits, fit the model, and predict/test on held-out data coefs = np.zeros((n_splits, n_channels, n_delays)) scores = np.zeros((n_splits, n_channels)) for ii, (train, test) in enumerate(cv.split(speech)): print('split %s / %s' % (ii + 1, n_splits)) rf.fit(speech[train], Y[train]) scores[ii] = rf.score(speech[test], Y[test]) # coef_ is shape (n_outputs, n_features, n_delays). we only have 1 feature coefs[ii] = rf.coef_[:, 0, :] times = rf.delays_ / float(rf.sfreq) # Average scores and coefficients across CV splits mean_coefs = coefs.mean(axis=0) mean_scores = scores.mean(axis=0) # Plot mean prediction scores across all channels fig, ax = plt.subplots() ix_chs = np.arange(n_channels) ax.plot(ix_chs, mean_scores) ax.axhline(0, ls='--', color='r') ax.set(title="Mean prediction score", xlabel="Channel", ylabel="Score ($r$)") mne.viz.tight_layout() # Print mean coefficients across all time delays / channels (see Fig 1) time_plot = 0.180 # For highlighting a specific time. fig, ax = plt.subplots(figsize=(4, 8)) max_coef = mean_coefs.max() ax.pcolormesh(times, ix_chs, mean_coefs, cmap='RdBu_r', vmin=-max_coef, vmax=max_coef, shading='gouraud') ax.axvline(time_plot, ls='--', color='k', lw=2) ax.set(xlabel='Delay (s)', ylabel='Channel', title="Mean Model\nCoefficients", xlim=times[[0, -1]], ylim=[len(ix_chs) - 1, 0], xticks=np.arange(tmin, tmax + .2, .2)) plt.setp(ax.get_xticklabels(), rotation=45) mne.viz.tight_layout() # Make a topographic map of coefficients for a given delay (see Fig 2C) ix_plot = np.argmin(np.abs(time_plot - times)) fig, ax = plt.subplots() mne.viz.plot_topomap(mean_coefs[:, ix_plot], pos=info, axes=ax, show=False, vmin=-max_coef, vmax=max_coef) ax.set(title="Topomap of model coefficients\nfor delay %s" % time_plot) mne.viz.tight_layout() # We use the same lags as in :footcite:`CrosseEtAl2016`. Negative lags now # index the relationship # between the neural response and the speech envelope earlier in time, whereas # positive lags would index how a unit change in the amplitude of the EEG would # affect later stimulus activity (obviously this should have an amplitude of # zero). tmin, tmax = -.2, 0. # Initialize the model. Here the features are the EEG data. We also specify # ``patterns=True`` to compute inverse-transformed coefficients during model # fitting (cf. next section and :footcite:`HaufeEtAl2014`). # We'll use a ridge regression estimator with an alpha value similar to # Crosse et al. sr = ReceptiveField(tmin, tmax, sfreq, feature_names=raw.ch_names, estimator=1e4, scoring='corrcoef', patterns=True) # We'll have (tmax - tmin) * sfreq delays # and an extra 2 delays since we are inclusive on the beginning / end index n_delays = int((tmax - tmin) * sfreq) + 2 n_splits = 3 cv = KFold(n_splits) # Iterate through splits, fit the model, and predict/test on held-out data coefs = np.zeros((n_splits, n_channels, n_delays)) patterns = coefs.copy() scores = np.zeros((n_splits,)) for ii, (train, test) in enumerate(cv.split(speech)): print('split %s / %s' % (ii + 1, n_splits)) sr.fit(Y[train], speech[train]) scores[ii] = sr.score(Y[test], speech[test])[0] # coef_ is shape (n_outputs, n_features, n_delays). We have 128 features coefs[ii] = sr.coef_[0, :, :] patterns[ii] = sr.patterns_[0, :, :] times = sr.delays_ / float(sr.sfreq) # Average scores and coefficients across CV splits mean_coefs = coefs.mean(axis=0) mean_patterns = patterns.mean(axis=0) mean_scores = scores.mean(axis=0) max_coef = np.abs(mean_coefs).max() max_patterns = np.abs(mean_patterns).max() y_pred = sr.predict(Y[test]) time = np.linspace(0, 2., 5 * int(sfreq)) fig, ax = plt.subplots(figsize=(8, 4)) ax.plot(time, speech[test][sr.valid_samples_][:int(5 * sfreq)], color='grey', lw=2, ls='--') ax.plot(time, y_pred[sr.valid_samples_][:int(5 * sfreq)], color='r', lw=2) ax.legend([lns[0], ln1[0]], ['Envelope', 'Reconstruction'], frameon=False) ax.set(title="Stimulus reconstruction") ax.set_xlabel('Time (s)') mne.viz.tight_layout() time_plot = (-.140, -.125) # To average between two timepoints. ix_plot = np.arange(np.argmin(np.abs(time_plot[0] - times)), np.argmin(np.abs(time_plot[1] - times))) fig, ax = plt.subplots(1, 2) mne.viz.plot_topomap(np.mean(mean_coefs[:, ix_plot], axis=1), pos=info, axes=ax[0], show=False, vmin=-max_coef, vmax=max_coef) ax[0].set(title="Model coefficients\nbetween delays %s and %s" % (time_plot[0], time_plot[1])) mne.viz.plot_topomap(np.mean(mean_patterns[:, ix_plot], axis=1), pos=info, axes=ax[1], show=False, vmin=-max_patterns, vmax=max_patterns) ax[1].set(title="Inverse-transformed coefficients\nbetween delays %s and %s" % (time_plot[0], time_plot[1])) mne.viz.tight_layout() plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Flip coin Step2: "Rain-Sprinkler-Grass" bayesian network Step3: Happiness Test Step4: $P(of='H', given=['S', 'R'], value=1)$ Step5: Alarm test Step6: Test #1
<ASSISTANT_TASK:> Python Code: from IPython.display import display, HTML from nxpd import draw import networkx as nx def draw_graph( graph, labels=None ): # create networkx graph G = nx.DiGraph() G.graph['dpi'] = 120 G.add_nodes_from(set([ graph[k1][k2] for k1 in range(len(graph)) for k2 in range(len(graph[k1])) ])) G.add_edges_from(graph) return draw(G, show='ipynb') from lea import * flip1 = Lea.fromValFreqs(('head',67),('tail',33)) flip1 P(flip1=='head') Pf(flip1=='head') flip1.random(10) flip2 = flip1.clone() flips = flip1 + '-' + flip2 flips P(flip1==flip2) P(flip1!=flip2) flip1.upper() flip1.upper()[0] def toInt(flip): return 1 if flip=='head' else 0 headCount1 = flip1.map(toInt) headCount1 headCount2 = flip2.map(toInt) headCounts = headCount1 + headCount2 headCounts headCounts.given(flip1==flip2) headCounts.given(flip1!=flip2) flip1.given(headCounts==0) flip1.given(headCounts==1) flip1.given(headCounts==2) rain = B(20,100) sprinkler = Lea.if_(rain, B(1,100), B(40,100)) grassWet = Lea.buildCPT( ( ~sprinkler & ~rain, False ), ( ~sprinkler & rain, B(80,100)), ( sprinkler & ~rain, B(90,100)), ( sprinkler & rain, B(99,100)) ) grassWet Sunny = B(70,100) Raise = B(1,100) print(Sunny) print(Raise) # independence check assert Sunny.given(Raise).p(True) == Sunny.p(True) Happy = Lea.buildCPT( (Sunny & Raise, B(100,100)), (~Sunny & Raise, B(90,100)), (Sunny & ~Raise, B(70,100)), (~Sunny & ~Raise, B(10,100)) ) Happy # Evidences # P(H|S)=0.703 # P(H|R)=0.97 # P(H)=P(H|S)P(S)+P(H|¬S)P(¬S)=…≈0.5245 assert Happy.given(Sunny).pmf(True) == 0.703 assert Happy.given(Raise).pmf(True) == 0.97 assert Happy.pmf(True) == 0.5245 Raise.given(Happy & Sunny).pmf(True) Raise.given(Happy).pmf(True) Raise.given(Happy & ~Sunny).pmf(True) graph = [ ('Burglary', 'Alarm'), ('Earthquake', 'Alarm'), ('Alarm', 'John'), ('Alarm', 'Mary') ] draw_graph(graph) Burglary = B(1,1000) Earthquake = B(2,1000) Alarm = Lea.buildCPT( (Burglary & Earthquake, B(95,100)), (Burglary & ~Earthquake, B(94,100)), (~Burglary & Earthquake, B(29,100)), (~Burglary & ~Earthquake, B(1,1000)), ) John = Lea.if_(Alarm, B(90,100), B(5,100)) Mary = Lea.if_(Alarm, B(70,100), B(1,100)) # P(+b) P(e) P(a|+b,e) P(+j|a) P(+m|a) print('P(+b):', Burglary.pmf(True)) print('P(e):', Earthquake.pmf(True)) print('P(a|+b,e):', Alarm.given(Burglary & Earthquake).pmf(True)) print('P(+j|a):', John.given(Alarm).pmf(True)) print('P(+m|a):', Mary.given(Alarm).pmf(True)) print('=', 0.001 * 0.002 * 0.95 * 0.9 * 0.7) graph = [ ('A', 'X1'), ('A', 'X2'), ('A', 'X3'), ] draw_graph(graph) A = Lea.boolProb(1,2) # using variable elimination # X1_A = Lea.if_(A, (2,10), (6,10)) # X2_A = Lea.if_(A, (2,10), (6,10)) # X3_A = Lea.if_(A, (2,10), (6,10)) X1 = B(4, 10) X2 = B(4, 10) X3 = B(4, 10) A.given(X1 & X2 & ~X3).pmf(True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: Functions Step3: Put in a file and import into a new notebook Step4: Note that the log has to be fairly big for the benchmarking to work properly, because otherwise the CPU caches the computation and this skews the results. Step5: 60 times faster on my machine! Step6: OK, we'll make a fake example. Step8: However, you can't speed up our original list-based function this way. Step9: Plotting basics Step10: Not we can only plot part of biglog because it contains too many points for matplotlib (and for our screen!). If we really wanted to plot it, we'd have to find a way to upscale it. Step11: Objected oriented basics Step12: Web scraping basics Step13: Use View Source in your browser to figure out where the age range is on the page, and what it looks like. Step14: Using a regular expression Step15: Exercise Step16: Functional programming basics Step17: What if we want to sort based on the number of characters? Don't ask why, we just do. Then we write a function that returns a key which, when sorted, will give the ordering we want. Step18: We could rewrite that tiny function as a lambda, which is basically a little unnamed function Step19: When would you make a named function vs a lambda? It all depends on whether you want to use it again or not. Step20: We can get around defining that tiny function sq() with a lambda, which you can think of as a temporary, 'throwaway' function Step21: In practice, we'd often write this as a list comprehension. Then we can skip the creation of the funciton or lambda entirely Step22: One of the advantages of map is that it is 'lazy', so if you map a function to a giant list, you don't get a giant list back, you get an iterator. A list-comp would give you a giant list, possibly jamming the memory on your box. Step23: partial for making curry Step24: But some people might find it more inuitive to do it this way
<ASSISTANT_TASK:> Python Code: layers = [0.23, 0.34, 0.45, 0.25, 0.23, 0.35] uppers = layers[:-1] lowers = layers[1:] rcs = [] for pair in zip(lowers, uppers): rc = (pair[1] - pair[0]) / (pair[1] + pair[0]) rcs.append(rc) rcs # Exercise def compute_rc(layers): Computes reflection coefficients given a list of layer impedances. uppers = layers[:-1] lowers = layers[1:] rcs = [] for pair in zip(lowers, uppers): rc = (pair[1] - pair[0]) / (pair[1] + pair[0]) rcs.append(rc) return rcs compute_rc(layers) import numpy as np # Just like importing file biglog = np.random.random(10000000) %timeit compute_rc(biglog) # Exercise def compute_rc_vector(layers): uppers = layers[:-1] lowers = layers[1:] return (lowers - uppers) / (uppers + lowers) %timeit compute_rc_vector(biglog) from numba import jit @jit def compute_rc_numba(layers): uppers = layers[:-1] lowers = layers[1:] return (lowers - uppers) / (uppers + lowers) %timeit compute_rc_numba(biglog) def compute_rc_slow(layers): uppers = layers[:-1] lowers = layers[1:] rcs = np.zeros_like(uppers) for i in range(rcs.size): rcs[i] = (lowers[i] - uppers[i]) / (uppers[i] + lowers[i]) return rcs %timeit compute_rc_slow(biglog) @jit def compute_rc_faster(layers): uppers = layers[:-1] lowers = layers[1:] rcs = np.zeros_like(uppers) for i in range(rcs.size): rcs[i] = (lowers[i] - uppers[i]) / (uppers[i] + lowers[i]) return rcs %timeit compute_rc_faster(biglog) @jit def compute_rc_hopeful(layers): Computes reflection coefficients given a list of layer impedances. uppers = layers[:-1] lowers = layers[1:] rcs = [] for pair in zip(lowers, uppers): rc = (pair[1] - pair[0]) / (pair[1] + pair[0]) rcs.append(rc) return rcs %timeit compute_rc_hopeful(biglog) import matplotlib.pyplot as plt %matplotlib inline plt.plot(biglog[:500]) fig = plt.figure(figsize=(15,2)) ax = fig.add_subplot(111) ax.plot(biglog[:500]) ax.set_title("big log") plt.show() class Layers(object): def __init__(self, layers, label=None): # Just make sure we end up with an array self.layers = np.array(layers) self.label = label or "My log" self.length = self.layers.size # But storing len in an attribute is unexpected... def __len__(self): # ...better to do this. return len(self.layers) def rcs(self): uppers = self.layers[:-1] lowers = self.layers[1:] return (lowers-uppers) / (uppers+lowers) def plot(self, lw=0.5, color='#6699ff'): fig = plt.figure(figsize=(2,6)) ax = fig.add_subplot(111) ax.barh(range(len(self.layers)), self.layers, color=color, lw=lw, align='edge', height=1.0, alpha=1.0, zorder=10) ax.grid(zorder=2) ax.set_ylabel('Layers') ax.set_title(self.label) ax.set_xlim([-0.5,1.0]) ax.set_xlabel('Measurement (units)') ax.invert_yaxis() #ax.set_xticks(ax.get_xticks()[::2]) # take out every second tick ax.spines['right'].set_visible(False) # hide the spine on the right ax.yaxis.set_ticks_position('left') # Only show ticks on the left and bottom spines plt.show() l = Layers(layers, label='Well # 1') l.rcs() len(l) l.plot() rel_interval = np.cumsum(l.rcs(), dtype=float) len(rel_interval) relative_layers = np.insert(rel_interval, 0, 0) relative_layers relative = Layers(relative_layers, "relative") relative.layers relative.plot() url = "http://en.wikipedia.org/wiki/Jurassic" import requests r = requests.get(url) r.text[:500] import re s = re.search(r'<i>(.+?million years ago)</i>', r.text) text = s.group(1) def get_age(period): url = "http://en.wikipedia.org/wiki/" + period r = requests.get(url) start, end = re.search(r'<i>([\.0-9]+)–([\.0-9]+)&#160;million years ago</i>', r.text).groups() return float(start), float(end) period = "Jurassic" get_age(period) def duration(period): t0, t1 = get_age(period) duration = t0 - t1 response = "According to Wikipedia, the {0} period was {1:.2f} Ma long.".format(period, duration) return response duration('Cretaceous') l = [0.001, 1, 3, 51, 41 , 601] sorted(l) def strlen(n): return len(str(n)) sorted(l, key=strlen) sorted(l, key=lambda n: len(str(n))) def sq(n): return n**2 # In Python 3, map produces an iterator, not a list. # So we must cast to list to inspect its contents. list(map(sq, l)) list(map(lambda n: n**2, l)) [n**2 for n in l] def runsum(a, b): return a + b # For some reason reduce is not in the main namespace like map from functools import reduce reduce(runsum, l) def runmult(a, b): return a * b reduce(runmult, l) def power(a, b): return a**b def cuber(a): return power(a, 3) cuber(2) from functools import partial cuber = partial(power, b=3) cuber(2) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1. Import dataset Step2: Our first collection of feature vectors will come from the Restaurant_Name column. We are still trying to predict whether a restaurant falls under the "pristine" category (Grade A, score greater than 90) or not. We could also try to see whether we could predict a restaurant's grade (A, B, C or F) Step3: Even though we do not have more features (3430) than rows of data (14888), we can still attempt to reduce the feature space by using Truncated SVD Step4: This must be the most uninformative plot in the history of plots. Obviously 2 principal components aren't enough. Let's try with 100 Step5: Is it worth it to keep adding dimensions? Recall that we started with a 3430-dimensional feature space which we have already reduced to 100 dimensions, and according to the graph above each dimension over the 100th one will be adding less than 0.5% in our explanation of the variance. Let us try once more with 300 dimensions, to see if we can get something respectably over 50% (so we can be sure we are doing better than a coin toss) Step6: 66.2% of the variance is explained through our model. This is quite respectable. Step7: Restaurant Streets as a Bag-of-words model
<ASSISTANT_TASK:> Python Code: import warnings warnings.filterwarnings('ignore') import pandas as pd import numpy as np import matplotlib.pyplot as plt %matplotlib inline from scipy import stats import seaborn as sns sns.set(rc={"axes.labelsize": 15}); # Some nice default configuration for plots plt.rcParams['figure.figsize'] = 10, 7.5; plt.rcParams['axes.grid'] = True; plt.gray(); #Reading the dataset in a dataframe using Pandas df = pd.read_csv("data.csv") #Print first observations df.head() df.columns from sklearn.feature_extraction.text import CountVectorizer # Turn the text documents into vectors vectorizer = CountVectorizer(min_df=1, stop_words="english") X = vectorizer.fit_transform(df['Restaurant_Name']).toarray() y = df['Letter_Grade'] target_names = y.unique() # Train/Test split and cross validation: from sklearn import cross_validation X_train, X_test, y_train, y_test = cross_validation.train_test_split(X, y, train_size = 0.8) X_train.shape from sklearn.decomposition import TruncatedSVD svd_two = TruncatedSVD(n_components=2, random_state=42) X_train_svd = svd_two.fit_transform(X_train) pc_df = pd.DataFrame(X_train_svd) # cast resulting matrix as a data frame sns.pairplot(pc_df, diag_kind='kde'); # Percentage of variance explained for each component def pca_summary(pca): return pd.DataFrame([np.sqrt(pca.explained_variance_), pca.explained_variance_ratio_, pca.explained_variance_ratio_.cumsum()], index = ["Standard deviation", "Proportion of Variance", "Cumulative Proportion"], columns = (map("PC{}".format, range(1, len(pca.components_)+1)))) pca_summary(svd_two) # Only 3.5% of the variance is explained in the data svd_two.explained_variance_ratio_.sum() from itertools import cycle def plot_PCA_2D(data, target, target_names): colors = cycle('rgbcmykw') target_ids = range(len(target_names)) plt.figure() for i, c, label in zip(target_ids, colors, target_names): plt.scatter(data[target == i, 0], data[target == i, 1], c=c, label=label) plt.legend() plot_PCA_2D(X_train_svd, y_train, target_names) # Now, let's try with 100 components to see how much it explains svd_hundred = TruncatedSVD(n_components=100, random_state=42) X_train_svd_hundred = svd_hundred.fit_transform(X_train) # 43.7% of the variance is explained in the data for 100 dimensions # This is mostly due to the High dimension of data and sparcity of the data svd_hundred.explained_variance_ratio_.sum() plt.figure(figsize=(10, 7)) plt.bar(range(100), svd_hundred.explained_variance_) svd_sparta = TruncatedSVD(n_components=300, random_state=42) X_train_svd_sparta = svd_sparta.fit_transform(X_train) X_test_svd_sparta = svd_sparta.fit_transform(X_test) svd_sparta.explained_variance_ratio_.sum() plt.figure(figsize=(10, 7)) plt.bar(range(300), svd_sparta.explained_variance_) from sklearn.feature_extraction.text import TfidfVectorizer from sklearn.feature_extraction.text import CountVectorizer from sklearn import cross_validation from sklearn.naive_bayes import MultinomialNB # Fit a classifier on the training set classifier = MultinomialNB().fit(np.absolute(X_train_svd_sparta), y_train) print("Training score: {0:.1f}%".format( classifier.score(X_train_svd_sparta, y_train) * 100)) # Evaluate the classifier on the testing set print("Testing score: {0:.1f}%".format( classifier.score(X_test_svd_sparta, y_test) * 100)) streets = df['Geocode'].apply(pd.Series) streets = df['Geocode'].tolist() split_streets = [i.split(' ', 1)[1] for i in streets] split_streets = [i.split(' ', 1)[1] for i in split_streets] split_streets = [i.split(' ', 1)[0] for i in split_streets] split_streets[0] import re shortword = re.compile(r'\W*\b\w{1,3}\b') for i in range(len(split_streets)): split_streets[i] = shortword.sub('', split_streets[i]) # Create a new column with the street: df['Street_Words'] = split_streets from sklearn.feature_extraction.text import CountVectorizer # Turn the text documents into vectors vectorizer = CountVectorizer(min_df=1, stop_words="english") X = vectorizer.fit_transform(df['Street_Words']).toarray() y = df['Letter_Grade'] target_names = y.unique() # Train/Test split and cross validation: from sklearn import cross_validation X_train, X_test, y_train, y_test = cross_validation.train_test_split(X, y, train_size = 0.8) X_train.shape from sklearn.decomposition import TruncatedSVD svd_two = TruncatedSVD(n_components=2, random_state=42) X_train_svd = svd_two.fit_transform(X_train) pc_df = pd.DataFrame(X_train_svd) # cast resulting matrix as a data frame sns.pairplot(pc_df, diag_kind='kde'); pca_summary(svd_two) # 25% of the variance is explained in the data when we use only TWO principal components! svd_two.explained_variance_ratio_.sum() # Now, let's try with 10 components to see how much it explains svd_ten = TruncatedSVD(n_components=10, random_state=42) X_train_svd_ten = svd_ten.fit_transform(X_train) # 53.9% of the variance is explained in the data for 10 dimensions # This is mostly due to the High dimension of data and sparcity of the data svd_ten.explained_variance_ratio_.sum() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Adaptation pour faciliter l'usage de ce notebook Step2: Variable avec formule Step3: Simulation Step4: Réforme
<ASSISTANT_TASK:> Python Code: from datetime import date from openfisca_france import init_country from openfisca_france.model.base import * import functools from openfisca_core.formulas import make_reference_formula_decorator from openfisca_france.entities import entity_class_by_symbol reference_formula = make_reference_formula_decorator(entity_class_by_symbol = entity_class_by_symbol, update = True) reference_input_variable = functools.partial(reference_input_variable, update = True) TaxBenefitSystem = init_country() tax_benefit_system = TaxBenefitSystem() # age = 60 # ages = [12, 37, 28] # jean_eric = { # 'name': u'Jean-Éric', # 'age': 33, # } # aurelie = dict( # name = u'Aurélie', # age = 33, # ) # personnes = [aurelie, jean_eric] simulation = tax_benefit_system.new_scenario().init_single_entity( period = 2014, parent1 = dict( birth = date(1980, 1, 1), salaire_de_base = 12000, ), parent2 = dict( birth = date(1980, 1, 1), salaire_de_base = 6000, ), enfants = [ dict( birth = date(2014, 1, 1), ), ], ).new_simulation(debug = True) simulation.calculate("salsuperbrut") simulation.calculate("revdisp") from openfisca_core import reforms Reform = reforms.make_reform( key = 'cotisations_revenu_de_base', name = u"Réforme des cotisations pour un Revenu de base", reference = tax_benefit_system, ) @Reform.formula class cotisations_contributives(SimpleFormulaColumn): column = FloatCol entity_class = Individus label = u"Nouvelles cotisations contributives" def function(self, simulation, period): ags = simulation.calculate('ags', period) agff_tranche_a_employeur = simulation.calculate('agff_tranche_a_employeur', period) apec_employeur = simulation.calculate('apec_employeur', period) arrco_tranche_a_employeur = simulation.calculate('arrco_tranche_a_employeur', period) assedic_employeur = simulation.calculate('assedic_employeur', period) cotisation_exceptionnelle_temporaire_employeur = simulation.calculate('cotisation_exceptionnelle_temporaire_employeur', period) fonds_emploi_hospitalier = simulation.calculate('fonds_emploi_hospitalier', period) ircantec_employeur = simulation.calculate('ircantec_employeur', period) pension_civile_employeur = simulation.calculate('pension_civile_employeur', period) prevoyance_obligatoire_cadre = simulation.calculate('prevoyance_obligatoire_cadre', period) rafp_employeur = simulation.calculate('rafp_employeur', period) vieillesse_deplafonnee_employeur = simulation.calculate('vieillesse_deplafonnee_employeur', period) vieillesse_plafonnee_employeur = simulation.calculate('vieillesse_plafonnee_employeur', period) allocations_temporaires_invalidite = simulation.calculate('allocations_temporaires_invalidite', period) accident_du_travail = simulation.calculate('accident_du_travail', period) agff_tranche_a_employe = simulation.calculate('agff_tranche_a_employe', period) agirc_tranche_b_employe = simulation.calculate('agirc_tranche_b_employe', period) apec_employe = simulation.calculate('apec_employe', period) arrco_tranche_a_employe = simulation.calculate('arrco_tranche_a_employe', period) assedic_employe = simulation.calculate('assedic_employe', period) cotisation_exceptionnelle_temporaire_employe = simulation.calculate('cotisation_exceptionnelle_temporaire_employe', period) ircantec_employe = simulation.calculate('ircantec_employe', period) pension_civile_employe = simulation.calculate('pension_civile_employe', period) rafp_employe = simulation.calculate('rafp_employe', period) vieillesse_deplafonnee_employe = simulation.calculate('vieillesse_deplafonnee_employe', period) vieillesse_plafonnee_employe = simulation.calculate('vieillesse_plafonnee_employe', period) cotisations_contributives = ( # cotisations patronales contributives dans le prive ags + agff_tranche_a_employeur + apec_employeur + arrco_tranche_a_employeur + assedic_employeur + cotisation_exceptionnelle_temporaire_employeur + prevoyance_obligatoire_cadre + # TODO contributive ou pas vieillesse_deplafonnee_employeur + vieillesse_plafonnee_employeur + # cotisations patronales contributives dans le public fonds_emploi_hospitalier + ircantec_employeur + pension_civile_employeur + rafp_employeur + # anciennes cot patronales non-contributives classées ici comme contributives allocations_temporaires_invalidite + accident_du_travail + # anciennes cotisations salariales contributives dans le prive agff_tranche_a_employe + agirc_tranche_b_employe + apec_employe + arrco_tranche_a_employe + assedic_employe + cotisation_exceptionnelle_temporaire_employe + vieillesse_deplafonnee_employe + vieillesse_plafonnee_employe + # anciennes cotisations salariales contributives dans le public ircantec_employe + pension_civile_employe + rafp_employe ) return period, cotisations_contributives @Reform.formula class nouv_salbrut(SimpleFormulaColumn): reference = tax_benefit_system.column_by_name['salaire_de_base'] # Le salaire brut se définit dans la réforme comme le salaire super-brut auquel # on retranche les cotisations contributives def function(self, simulation, period): period = period.start.period('month').offset('first-of') salsuperbrut = simulation.calculate('salsuperbrut', period) cotisations_contributives = simulation.calculate('cotisations_contributives', period) nouv_salbrut = ( salsuperbrut - cotisations_contributives ) return period, nouv_salbrut @Reform.formula class nouv_csg(SimpleFormulaColumn): reference = tax_benefit_system.column_by_name['csg_imposable_salaire'] # On applique une CSG unique à 22,5% qui finance toutes les prestations non-contributives def function(self, simulation, period): period = period.start.period('month').offset('first-of') nouv_salbrut = simulation.calculate('nouv_salbrut', period) nouv_csg = ( -0.225 * nouv_salbrut ) return period, nouv_csg @Reform.formula class salnet(SimpleFormulaColumn): reference = tax_benefit_system.column_by_name['salaire_net'] # On retire la nouvelle CSG (pas celle qui finance le RDB) pour trouver le nouveau salaire net def function(self, simulation, period): period = period.start.period('month').offset('first-of') nouv_salbrut = simulation.calculate('nouv_salbrut', period) nouv_csg = simulation.calculate('nouv_csg', period) salnet = ( nouv_salbrut + nouv_csg ) return period, salnet @Reform.formula class sal(SimpleFormulaColumn): reference = tax_benefit_system.column_by_name['salaire_de_base'] # Nous sommes partis du nouveau salaire net et par rapport au salaire imposable actuel, # nous avons supprimé : les heures sup, la déductibilité de CSG def function(self, simulation, period): period = period salnet = simulation.calculate('salnet', period) primes_fonction_publique = simulation.calculate('primes_fonction_publique', period) indemnite_residence = simulation.calculate('indemnite_residence', period) supp_familial_traitement = simulation.calculate('supp_familial_traitement', period) rev_microsocial_declarant1 = simulation.calculate('rev_microsocial_declarant1', period) return period, ( salnet + primes_fonction_publique + indemnite_residence + supp_familial_traitement + hsup + rev_microsocial_declarant1 ) reform = Reform() reform_simulation = reform.new_scenario().init_single_entity( period = 2014, parent1 = dict( birth = date(1980, 1, 1), salaire_de_base = 12000, ), parent2 = dict( birth = date(1980, 1, 1), salaire_de_base = 6000, ), enfants = [ dict( birth = date(2014, 1, 1), ), ], ).new_simulation(debug = True) reform_simulation.calculate('salsuperbrut') reform_simulation.calculate('cotisations_contributives') reform_simulation.calculate('nouv_salbrut') reform_simulation.calculate('salbrut') reform_simulation.calculate('salnet') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We initialize a lines list of strings and demonstrate how the default alphabetic sort gives the wrong results Step2: In Python 3, the key parameter specifies a function that should be applied to the list items before sorting them. If we use int to convert each of the string values to an integer so that we can perform a numerical sort, we raise an error because the 'a' can’t be converted to an integer Step4: We create our own sort function, for which we define linenoRegex, which includes two capture groups, both of which are strings by default. The first captures all digits from the beginning of the line number value. The second captures anything after the numbers. The regex splits the input into a tuple that contains the two values as strings, and we convert the first value to an integer before we return it. For example, the input value '4008a' will return (4008,'a'), where the '4008' is an integer and the 'a' is a string. Step5: If we now specify our splitId function as the value of the key parameter in the sorted() function, the values will be split into two parts before sorting. Tuples are sorted part by part from start to finish, so we don’t have to tell the function explicitly how to sort once we’ve defined the two parts of our tuple
<ASSISTANT_TASK:> Python Code: import re lines = ['4008','4008a','4009','1','9'] sorted(lines) sorted(lines,key=int) # this raises an error linenoRegex = re.compile('(\d+)(.*)') def splitId(id): Splits @id value like 4008a into parts, for sorting results = linenoRegex.match(id).groups() return (int(results[0]),results[1]) sorted(lines,key=splitId) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Tuples Step2: Dictionaries Step3: Sets Step4: Flow Control Step5: While Loops Step6: Functions
<ASSISTANT_TASK:> Python Code: # defining lists sport_list = [ 'cycling', 'football', 'fitness' ] first_prime_numbers = [ 2, 3, 5, 7, 11, 13, 17, 19 ] # getting contents sport = sport_list[ 2 ] third_prime = first_prime_numbers[ 2 ] # printing print( 'All sports:', sport_list ) print( 'Sport to be done:', sport ) print( '\nFirst primes:', first_prime_numbers ) print( 'Third prime number:', third_prime ) # adapt entries and append new entries sport_list[ 1 ] = 'swimming' sport_list.append( 'running' ) first_prime_numbers.append( 23 ) # printing print( 'All sports:', sport_list ) print( 'First primes:', first_prime_numbers ) # defining tuple sport_tuple = ( 'cycling', 'football', 'fitness' ) # getting contents sport = sport_tuple[ 2 ] # printing print( 'All sports:', sport_tuple ) print( 'Sport to be done:', sport ) # append new entries sport_tuple += ( 'running', ) # printing print( 'All sports:', sport_tuple ) print() # changing entries will fail # --> ERROR is being generated on purpose # --> NOTE: Error is handled by 'try: ... except: ...' statement try: sport_tuple[ 1 ] = 'swimming' except: print('ERROR: Entries within tuples cannot be adapted!') # defining dictionaries sports_days = { 'Monday': 'pause', 'Tuesday': 'fitness', 'Wednesday' : 'running', 'Thursday' : 'fitness', 'Friday' : 'swimming', 'Saturday' : 'cycling', 'Sunday' : 'cycling' } print( 'Sport by day:', sports_days ) print( '\nOn Tuesday:', sports_days[ 'Tuesday' ]) # Changes are made by using the key as identifier sports_days[ 'Tuesday' ] = 'running' print( 'Sport by day:', sports_days ) # defining sets sports_set = { 'fitness', 'running', 'swimming', 'cycling'} print( sports_set ) print() # indexing will fail # --> ERROR is being generated on purpose try: print( sports_set[0] ) except: print('ERROR: No indexing of sets!') # adding elements (or not) sports_set.add( 'pause' ) print(sports_set) sports_set.add( 'fitness' ) print(sports_set) # union of sets (also: intersection, complement, ...) all_stuff_set = set( sports_set ) union_of_sets = all_stuff_set.union( first_prime_numbers) print( union_of_sets ) # looping in lists simply parsing along the list for s in sport_list: print( s ) print() # looping in dictionaries happens along keys for s in sports_days: print( '{}: \t{}'.format( s, sports_days[ s ] ) ) # initialize variables sum_primes = 0 _n = 0 # sum primes up to sum-value of 20 while sum_primes < 20: # add prime of according index sum_primes += first_prime_numbers[ _n ] # increase index _n += 1 print( 'Sum of first {} primes is {}.'.format( _n, sum_primes ) ) def get_n_th_prime( n, first_prime_numbers ): ''' DOC String IN: index of prime number, list of prime numbers OUT: n-th prime number ''' # do something smart as, e.g., checking that according index really exists # "assert" does the job by checking first arg and--if not being TRUE--providing text given as second arg try: val = first_prime_numbers[ n - 1 ] except: return '"ERROR: Index not feasible!"' # NOTE: since counting starts at 0, (n-1)st number is returned # Furthermore, there is no need for a function here; a simple reference would have done the job! return first_prime_numbers[ n - 1 ] # show doc string print( help( get_n_th_prime ) ) # apply functions N = 3 print( '{}. prime number is {}.'.format( N, get_n_th_prime( N, first_prime_numbers ) ) ) print() N = 30 print( '{}. prime number is {}.'.format( N, get_n_th_prime( N, first_prime_numbers ) ) ) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Start by running Monte Carlo code for a single sphere Step2: Run Monte Carlo for sphere geometry Step3: Plot results Step4: The first plot shows us the reflectance of a single sphere, which should give us a qualitative guide for the features we expect to see in the bulk film reflectance. Step5: Plot results
<ASSISTANT_TASK:> Python Code: %matplotlib inline import numpy as np import structcol as sc import structcol.refractive_index as ri from structcol import montecarlo as mc from structcol import detector as det from structcol import phase_func_sphere as pfs import matplotlib.pyplot as plt import seaborn as sns import os # Properties of source wavelengths = sc.Quantity(np.arange(400., 801.,15),'nm') # wavelengths at which to calculate reflectance # Geometric properties of sample particle_radius = sc.Quantity('0.110 um') # radius of the sphere particles volume_fraction_particles = sc.Quantity(0.5, '') # volume fraction of the particles in the sphere boundary volume_fraction_bulk = sc.Quantity(0.55,'') # volume fraction of the spheres in the bulk film sphere_boundary_diameter = sc.Quantity(10,'um') # radius of the sphere boundary bulk_thickness = sc.Quantity('50 um') # thickness of the bulk film boundary = 'sphere' # geometry of sample boundary_bulk = 'film' # geometry of the bulk sample # Refractive indices n_particle = ri.n('vacuum', wavelengths) # refractive index of particle n_matrix = ri.n('fused silica', wavelengths)+ 9e-4*ri.n('vacuum', wavelengths)*1j # refractive index of matrix n_matrix_bulk = ri.n('vacuum', wavelengths) # refractive index of the bulk matrix n_medium = ri.n('vacuum', wavelengths) # refractive index of medium outside the bulk sample. # Monte Carlo parameters ntrajectories = 2000 # number of trajectories to run with a spherical boundary nevents = 300 # number of scattering events for each trajectory in a spherical boundary ntrajectories_bulk = 2000 # number of trajectories to run in the bulk film nevents_bulk = 300 # number of events to run in the bulk film # plot settings sns.set_style('white') # sets white plotting background # initialize quantities we want to save as a function of wavelength reflectance_sphere = np.zeros(wavelengths.size) mu_scat_bulk = sc.Quantity(np.zeros(wavelengths.size),'1/um') mu_abs_bulk = sc.Quantity(np.zeros(wavelengths.size),'1/um') p_bulk = np.zeros((wavelengths.size, 200)) # loop through wavelengths for i in range(wavelengths.size): # print wavlengths to keep track of where we are in calculation print('wavelength: ' + str(wavelengths[i])) # caculate the effective index of the sample n_sample = ri.n_eff(n_particle[i], n_matrix[i], volume_fraction_particles) # Calculate the phase function and scattering and absorption coefficients from the single scattering model # (this absorption coefficient is of the scatterer, not of an absorber added to the system) p, mu_scat, mu_abs = mc.calc_scat(particle_radius, n_particle[i], n_sample, volume_fraction_particles, wavelengths[i]) # Initialize the trajectories r0, k0, W0 = mc.initialize(nevents, ntrajectories, n_matrix_bulk[i], n_sample, boundary, sample_diameter = sphere_boundary_diameter) r0 = sc.Quantity(r0, 'um') k0 = sc.Quantity(k0, '') W0 = sc.Quantity(W0, '') # Create trajectories object trajectories = mc.Trajectory(r0, k0, W0) # Generate a matrix of all the randomly sampled angles first sintheta, costheta, sinphi, cosphi, _, _ = mc.sample_angles(nevents, ntrajectories, p) # Create step size distribution step = mc.sample_step(nevents, ntrajectories, mu_scat) # Run photons trajectories.absorb(mu_abs, step) trajectories.scatter(sintheta, costheta, sinphi, cosphi) trajectories.move(step) # Calculate reflection and transmition (refl_indices, trans_indices, _, _, _, refl_per_traj, trans_per_traj, _,_,_,_, reflectance_sphere[i], _,_, norm_refl, norm_trans) = det.calc_refl_trans(trajectories, sphere_boundary_diameter, n_matrix_bulk[i], n_sample, boundary, p=p, mu_abs=mu_abs, mu_scat=mu_scat, run_fresnel_traj = False, return_extra = True) ### Calculate phase function and lscat ### # use output of calc_refl_trans to calculate phase function, mu_scat, and mu_abs for the bulk p_bulk[i,:], mu_scat_bulk[i], mu_abs_bulk[i] = pfs.calc_scat_bulk(refl_per_traj, trans_per_traj, trans_indices, norm_refl, norm_trans, volume_fraction_bulk, sphere_boundary_diameter, n_matrix_bulk[i], wavelengths[i], plot=False, phi_dependent=False) plt.figure() plt.plot(wavelengths, reflectance_sphere, linewidth = 3) plt.ylim([0,1]) plt.xlim([400,800]) plt.xlabel('Wavelength (nm)') plt.ylabel('Reflectance') plt.title('Single sphere reflectance') plt.figure() plt.plot(wavelengths, p_bulk[:,100], linewidth = 3) plt.xlim([400,800]) plt.xlabel('Wavelength (nm)') plt.ylabel('Probability') plt.title('Phase function value at backscattering angle') plt.figure() ax = plt.subplot(111, projection='polar') theta = np.linspace(0, np.pi, 200) ind = 4 print(wavelengths[ind]) ax.plot(theta, p_bulk[ind,:], color = 'b') ax.plot(-theta, p_bulk[ind,:], color = 'b') plt.savefig('phase_1sphere_1.pdf') # initialize some quantities we want to save as a function of wavelength reflectance_bulk = np.zeros(wavelengths.size) # loop through wavelengths for i in range(wavelengths.size): # print the wavelength keep track of where we are in calculation print('wavelength: ' + str(wavelengths[i])) # Initialize the trajectories r0, k0, W0 = mc.initialize(nevents_bulk, ntrajectories_bulk, n_medium[i], n_matrix_bulk[i], boundary_bulk) r0 = sc.Quantity(r0, 'um') W0 = sc.Quantity(W0, '') k0 = sc.Quantity(k0, '') # Sample angles sintheta, costheta, sinphi, cosphi, _, _ = mc.sample_angles(nevents_bulk, ntrajectories_bulk, p_bulk[i,:]) # Calculate step size # note: in future versions, mu_abs will be removed from step size sampling, so 0 is entered here step = mc.sample_step(nevents_bulk, ntrajectories_bulk, mu_scat_bulk[i]) # Create trajectories object trajectories = mc.Trajectory(r0, k0, W0) # Run photons #trajectories.absorb(mu_abs_bulk[i], step) trajectories.scatter(sintheta, costheta, sinphi, cosphi) trajectories.move(step) # calculate reflectance reflectance_bulk[i], transmittance = det.calc_refl_trans(trajectories, bulk_thickness, n_medium[i], n_matrix_bulk[i], boundary_bulk) plt.figure() plt.plot(wavelengths, reflectance_bulk, linewidth = 3) plt.ylim([0,1]) plt.xlim([400,800]) plt.xlabel('Wavelength (nm)') plt.ylabel('Reflectance') plt.title('Bulk Reflectance'); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load data. Step2: Creata a unique bank account (bank + account) Step3: Build the graph. Step4: Add non-empty edges. Step5: Look at the largest connected components. Step6: Look at it in a directed graph.
<ASSISTANT_TASK:> Python Code: %matplotlib inline import pandas as pd import numpy as np import networkx as nx import matplotlib.pyplot as plt client_info = pd.read_csv('data/client_info.csv') demographic_info = pd.read_csv('data/demographic_data.csv') transaction_info = pd.read_csv('data/transction_info.csv') order_info = pd.read_csv('data/order_info.csv') transaction_info['bank_account'] = transaction_info['bank'] + transaction_info['account'].map(str) G = nx.Graph() G.add_nodes_from(transaction_info['account_id'].unique().tolist()) G.add_nodes_from(transaction_info['bank_account'][transaction_info['bank_account'].notnull()].unique()) nonEmpty = transaction_info[transaction_info['bank_account'].notnull()] edges = zip(nonEmpty['account_id'],nonEmpty['bank_account'], nonEmpty['amount']) G.add_weighted_edges_from(edges) giant = max(nx.connected_component_subgraphs(G), key=len) nx.draw_circular(giant) Gdi = nx.DiGraph() Gdi.add_nodes_from(giant.nodes()) Gdi.add_edges_from(giant.edges()) nx.draw_circular(Gdi) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Kita buat covariance matrix-nya. Step2: Agar lebih sederhana, kita pilih 4 industri saja dalam portfolio kita. Step3: Expected returns dan covariance matrix untuk aset-aset ini Step4: Mari membuat fungsi untuk menghitung expected return dan volatilitas dari portfolio dengan operasi matriks seperti dijelaskan di atas. Step5: Misalkan 4 aset tadi kita alokasikan secara seimbang Step6: Kita bisa hitung expected return dari portfolionya dengan alokasi ini Step7: Dan juga volatilitasnya Step8: Praktek Efficient Frontier dengan 2 Aset Step9: Sekarang mari kita hitung returns dari kombinasi alokasi di atas, dan kita masukkan dalam list. Step10: Kita lakukan hal yang sama untuk volatility. Step11: Mari kita gabungkan return dan volatilitas menjadi dataframe agar mudah diplot. Step12: Sekarang mari kita plot volatility vs return-nya. Step16: Done! Kita telah menggambar efficient frontier untuk 2 aset. Step19: Whoa! It works! Step20: Kelemahan Efficient Frontier Step21: Expected return dari kedua asset di atas adalah Step22: MSR untuk dua asset di atas adalah Step23: Jadi alokasi yang optimal adalah Food 75% dan Steel 25%. Step24: Maka prosentase alokasinya sudah berubah jauh. Padahal perubahannya tidak sampai 1%. Step25: Wow! Sekarang MSR mengalokasikan 100% ke aset Steel. Demikian juga kalau kita rubah sebaliknya Step27: Maka MSR mengalokasikan 100% ke Food. Padahal perubahannya tidak sampai 2%. Step28: Alokasi Seimbang
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np %matplotlib inline # Load data returns dari sektor2 ind = pd.read_csv("ind30_m_vw_rets.csv", header=0, index_col=0)/100 # Ubah index jadi perioda bulanan ind.index = pd.to_datetime(ind.index, format="%Y%m").to_period('M') # Hilangkan spasi pada kolom ind.columns = ind.columns.str.strip() # Batasi lingkup agar sama dengan di MOOC ind = ind["1996":"2000"] # Konversi returns menjadi tahunan. "er" adalah expected return compounded_growth = (1+ind).prod() er = compounded_growth ** (12/ind.shape[0]) -1 print('Expected returns:') print(er) # Covariance matrix cov = ind.cov() assets = ['Food', 'Beer', 'Smoke', 'Coal'] er[assets] cov.loc[assets, assets] def portfolio_return(weights, returns): return weights.T @ returns def portfolio_vol(weights, covmat): return (weights.T @ covmat @ weights)**0.5 weights = np.repeat(1/4, 4) weights portfolio_return(weights, er[assets]) portfolio_vol(weights, cov.loc[assets, assets]) # Pilih 2 aset assets = ['Games', 'Fin'] # Generate kombinasi alokasi untuk dua aset N_POINTS = 20 weights = [np.array([w, 1-w]) for w in np.linspace(0, 1, N_POINTS)] weights rets = [portfolio_return(w, er[assets]) for w in weights] rets vols = [portfolio_vol(w, cov.loc[assets,assets]) for w in weights] vols ef = pd.DataFrame(data={'Return': rets, 'Volatility': vols}) ef ef.plot.line(x='Volatility', y='Return', title='Efficient Frontier dengan Dua Aset ({} dan {})'.format(assets[0], assets[1]), figsize=(15,6), style='.-') from scipy.optimize import minimize def minimize_vol(target_return, er, cov): Returns the optimal weights that achieve the target return given a set of expected returns and a covariance matrix n = er.shape[0] init_guess = np.repeat(1/n, n) bounds = ((0.0, 1.0),) * n # an N-tuple of 2-tuples! # construct the constraints weights_sum_to_1 = {'type': 'eq', 'fun': lambda weights: np.sum(weights) - 1 } return_is_target = {'type': 'eq', 'args': (er,), 'fun': lambda weights, er: target_return - portfolio_return(weights,er) } weights = minimize(portfolio_vol, init_guess, args=(cov,), method='SLSQP', options={'disp': False}, constraints=(weights_sum_to_1,return_is_target), bounds=bounds) return weights.x def optimal_weights(n_points, er, cov): target_rs = np.linspace(er.min(), er.max(), n_points) weights = [minimize_vol(target_return, er, cov) for target_return in target_rs] return weights def plot_ef(n_points, er, cov): Plots the multi-asset efficient frontier weights = optimal_weights(n_points, er, cov) rets = [portfolio_return(w, er) for w in weights] vols = [portfolio_vol(w, cov) for w in weights] ef = pd.DataFrame({ "Returns": rets, "Volatility": vols }) ax = ef.plot.line(x="Volatility", y="Returns", style='.-', label='Efficient Frontier', legend=True, figsize=(15,6)) ax.set_ylabel('Returns') ax.set_xlim(left=0) ax.set_ylim(bottom=0) return ax assets = ['Smoke', 'Fin', 'Games', 'Coal'] plot_ef(25, er[assets], cov.loc[assets, assets]) # Credit: Vijay Vaidyanathan # https://www.coursera.org/learn/introduction-portfolio-construction-python def msr(riskfree_rate, er, cov): Returns the weights of the portfolio that gives you the maximum sharpe ratio given the riskfree rate and expected returns and a covariance matrix n = er.shape[0] init_guess = np.repeat(1/n, n) bounds = ((0.0, 1.0),) * n # an N-tuple of 2-tuples! # construct the constraints weights_sum_to_1 = {'type': 'eq', 'fun': lambda weights: np.sum(weights) - 1 } def neg_sharpe(weights, riskfree_rate, er, cov): Returns the negative of the sharpe ratio of the given portfolio r = portfolio_return(weights, er) vol = portfolio_vol(weights, cov) return -(r - riskfree_rate)/vol weights = minimize(neg_sharpe, init_guess, args=(riskfree_rate, er, cov), method='SLSQP', options={'disp': False}, constraints=(weights_sum_to_1,), bounds=bounds) return weights.x def plot_cml(ax, riskfree_rate, w_msr, er, cov): r = portfolio_return(w_msr, er) vol = portfolio_vol(w_msr, cov) x = [0, vol] y = [riskfree_rate, r] ax.plot(x, y, color='green', marker='o', label='CML', linestyle='-', linewidth=2, markersize=10) ax.legend() RISKFREE_RATE = 0.10 ax = plot_ef(25, er[assets], cov.loc[assets, assets]) w_msr = msr(RISKFREE_RATE, er[assets], cov.loc[assets, assets]) plot_cml(ax, RISKFREE_RATE, w_msr, er[assets], cov.loc[assets, assets]) assets = ['Food', 'Steel'] er[assets] msr(RISKFREE_RATE, er[assets], cov.loc[assets, assets]) msr(RISKFREE_RATE, np.array([0.11, 0.12]), cov.loc[assets, assets]) msr(RISKFREE_RATE, np.array([0.10, 0.13]), cov.loc[assets, assets]) msr(RISKFREE_RATE, np.array([0.13, 0.10]), cov.loc[assets, assets]) # Credit: Vijay Vaidyanathan # https://www.coursera.org/learn/introduction-portfolio-construction-python def gmv(cov): Returns the weights of the Global Minimum Volatility portfolio given a covariance matrix n = cov.shape[0] return msr(0, np.repeat(1, n), cov) assets = ['Smoke', 'Fin', 'Games', 'Coal'] def plot_point(ax, weights, er, cov, label, color='C1'): r = portfolio_return(weights, er) vol = portfolio_vol(weights, cov) x = [vol] y = [r] ax.plot([vol], [r], color=color, marker='o', label=label, linestyle='-', linewidth=2, markersize=10) ax.legend() ax = plot_ef(25, er[assets], cov.loc[assets, assets]) w_gmv = gmv(cov.loc[assets, assets]) plot_point(ax, w_gmv, er[assets], cov.loc[assets, assets], 'GMV') n_assets = len(assets) ax = plot_ef(25, er[assets], cov.loc[assets, assets]) w_ew = np.repeat(1/n_assets, n_assets) plot_point(ax, w_ew, er[assets], cov.loc[assets, assets], 'Equal weights', color='C4') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Read and preprocess the data. Preprocessing consists of Step2: Fit ICA model using the FastICA algorithm, detect and plot components Step3: Plot properties of ECG components Step4: Plot the estimated source of detected ECG related components
<ASSISTANT_TASK:> Python Code: # Authors: Denis Engemann <denis.engemann@gmail.com> # # License: BSD (3-clause) import mne from mne.preprocessing import ICA, create_ecg_epochs from mne.datasets import sample print(__doc__) data_path = sample.data_path() raw_fname = data_path + '/MEG/sample/sample_audvis_filt-0-40_raw.fif' raw = mne.io.read_raw_fif(raw_fname) raw.pick_types(meg=True, eeg=False, exclude='bads', stim=True).load_data() raw.filter(1, 30, fir_design='firwin') # peak-to-peak amplitude rejection parameters reject = dict(grad=4000e-13, mag=4e-12) # longer + more epochs for more artifact exposure events = mne.find_events(raw, stim_channel='STI 014') epochs = mne.Epochs(raw, events, event_id=None, tmin=-0.2, tmax=0.5, reject=reject) ica = ICA(n_components=0.95, method='fastica').fit(epochs) ecg_epochs = create_ecg_epochs(raw, tmin=-.5, tmax=.5) ecg_inds, scores = ica.find_bads_ecg(ecg_epochs, threshold='auto') ica.plot_components(ecg_inds) ica.plot_properties(epochs, picks=ecg_inds) ica.plot_sources(raw, picks=ecg_inds) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Convert the image to grayscale Step2: TODO Step3: Test out other filters!
<ASSISTANT_TASK:> Python Code: import matplotlib.pyplot as plt import matplotlib.image as mpimg import cv2 import numpy as np %matplotlib inline # Read in the image image = mpimg.imread(fname='images/curved_lane.jpg') plt.imshow(X=image) # Convert to grayscale for filtering gray = cv2.cvtColor(src=image, code=cv2.COLOR_RGB2GRAY) plt.imshow(X=gray, cmap='gray') # Create a custom kernel # 3x3 array for edge detection sobel_y = np.array([[ -1, -2, -1], [ 0, 0, 0], [ 1, 2, 1]]) ## TODO: Create and apply a Sobel x operator sobel_x = np.array([[ -1, 0, 1], [ -2, 0, 2], [ -1, 0, 1]]) # Filter the image using filter2D, which has inputs: (grayscale image, bit-depth, kernel) filtered_image = cv2.filter2D(src=gray, ddepth=-1, kernel=sobel_y) filtered_image2 = cv2.filter2D(src=gray, ddepth=-1, kernel=sobel_x) plt.imshow(X=filtered_image, cmap='gray') plt.imshow(X=filtered_image2, cmap='gray') image2 = mpimg.imread(fname='images/white_lines.jpg') gray2 = cv2.cvtColor(src=image2, code=cv2.COLOR_RGB2GRAY) sample_filter = np.array([[ 0, 0, 2, 0, 0], [ 0, 0, 1, 0, 0], [ 2, -1, 1, -1, 2], [ 0, 0, 1, 0, 0], [ 0, 0, 2, 0, 0]]) filtered_image3 = cv2.filter2D(src=gray2, ddepth=-1, kernel=sample_filter) plt.imshow(X=gray2, cmap='gray') plt.imshow(X=filtered_image3, cmap='gray') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: As you should be able to see, there are a few different parameters we can consider in our models Step2: From this visualisation you can see that only 40% of people survived on the Titanic. Thus if we assume that the testing data is similar to the training script (which is a very valid assumption) then we could simply predict that everyone died and we would still be right about 60% of the time. So already we can beat random chance! But we should be able to determine a better model then that anyway. Step3: Wow! I expected some kind of a trend but nothing like this one. As you can see nearly all women survived in first class and the same trend is observed with second class. The women in third class survived more often then men but significantly less then the women in first and second class. The men in first class have a higher chance of surviving then the men the second and third class who have nearly identical chances. Step4: Interestingly, there seems to be a non-normal distribution for the ages. There is a small spike for young children before having a right-skewed distribution centring around 25 years. A likely explanation for this behaviour would be that families bring their children on the voyage but teenagers are expected to be old enough to care for themselves if the parents went away. Step7: 3. Building a Simple Model Step8: 4. Evaluating the Model Step9: Our guess is alright! On average I get around 75% guess accuracy but you might be seeing another number. My model works on probability so the number of correct guesses changes when rerun. Step10: As you can see, the model is normally distributed about 75.5% and has a spread from 70% to 80% accuracy. That means we are getting the right answer 3/4 of the time! That isn't too bad but I know we can do better. Step11: 5. Improving The Model By Including Age Step12: Interestingly, it seems that children below 16 years have a really high chance of surviving as well as passengers above 50 years old. The worst survival rate is for passengers between 18 to 45 years. Step13: This result supports what we found before, that females mostly survived over males, but it also provides some new insight. Notice that for male children their survival rate is still really high (<15 years) but is consistently low otherwise. As such you could tweak the model to say that children are much more likely to survived irregardless of gender. Step14: Our conclusion is supported! Now we have to figure out if we can include this in the model. Step17: Now with these results visualised it should be easier to see. The survival rate for infants (<5 years) is quite high, while for men between 20 to 25 years it is only 35%. Anytime there is a 50% reading this is because their isn't enough information and you can only conclude that the probability matches random chance. Step18: Currently the execution time for the below cell is really long because I haven't bothered to optimise it.
<ASSISTANT_TASK:> Python Code: # IMPORT STATEMENTS. import numpy as np # linear algebra import pandas as pd # data processing, CSV file I/O (e.g. pd.read_csv) import seaborn as sns # data visualisation import matplotlib.pyplot as plt # data visualisation import random # Used to sample survival. # DEFINE GLOBALS. NUM_OF_ROLLS = 3 df = pd.read_csv("../input/train.csv", index_col=0) df.head() # First visualise the general case (i.e. no considerations) total, survivors = df.shape[0], df[df.Survived==1].shape[0] survival_rate = float(survivors)/float(total)*100 f, ax = plt.subplots(figsize=(7, 7)) ax.set_title("Proportion of People Who Died On The Titanic") ax.pie( [survival_rate, 100-survival_rate], autopct='%1.1f%%', labels=['Survived', 'Died'] ) None # Removes console output sns.set_style('white') f, ax = plt.subplots(figsize=(8, 8)) sns.barplot( ax=ax, x='Pclass', y='Survived', hue='Sex', data=df, capsize=0.05 ) ax.set_title("Survival By Gender and Ticket Class") ax.set_ylabel("Survival (%)") ax.set_xlabel("") ax.set_xticklabels(["First Class", "Second Class", "Third Class"]) None # Suppress console output sns.set_style("whitegrid") f, ax = plt.subplots(figsize=(12, 5)) ax = sns.distplot( df.Age.dropna().values, bins=range(0, 81, 1), kde=False, axlabel='Age (Years)', ax=ax ) total, classes_count = float(df['Pclass'].shape[0]), df['Pclass'].value_counts() proportions = list(map(lambda x: classes_count.loc[x]/total*100, [1, 2, 3])) f, ax = plt.subplots(figsize=(8, 8)) ax.set_title('Proportion of Passengers By Class') ax.pie(proportions, autopct='%1.1f%%', labels=['First Class', 'Second Class', 'Third Class']) None # Removes console output def probability(df, key_list): Finds the probability of surviving based on the parameters passed in key_list. The key_list input is structured like so: [Ticket Class, Sex] So for example, an input could be [1, 'male']. pclass, sex = key_list filtered_df = df[(df.Sex == sex) & (df.Pclass == pclass)] return filtered_df['Survived'].mean() ############################################################################################## sexes = df.Sex.unique() ticket_classes = df.Pclass.unique() probability_dict = dict() for x in ticket_classes: for y in sexes: key = [x, y] probability_dict[str(key)] = probability(df, key) ############################################################################################## def make_guesses(df): Makes guesses on if the passengers survived or died. guesses = list() for passenger_index, row in df.iterrows(): # Find if the passenger survived. survival_key = [row.Pclass, row.Sex] survival_odds = probability_dict[str(survival_key)] survived_rolls = list(map(lambda x: random.random() <= survival_odds, range(NUM_OF_ROLLS))) survived = sum(survived_rolls) > NUM_OF_ROLLS/2 # Add the result to the guesses guesses.append(survived) return guesses ############################################################################################## df['Guess'] = make_guesses(df) df['CorrectGuess'] = df.Guess == df.Survived df.head() df.CorrectGuess.mean() results = list() for ii in range(10**2): guesses = make_guesses(df) correct_guesses = (df.Survived == guesses) results.append(correct_guesses.mean()) sns.distplot(results, kde=False) None df.drop('Guess', axis=1, inplace=True) df.drop('CorrectGuess', axis=1, inplace=True) df.head() f, ax = plt.subplots(figsize=(12, 8)) sns.distplot( df.Age.dropna().values, bins=range(0, 81, 1), kde=False, axlabel='Age (Years)', ax=ax ) sns.distplot( df[(df.Survived == 1)].Age.dropna().values, bins=range(0, 81, 1), kde=False, axlabel='Age (Years)', ax=ax ) None # Suppress console output. f, ax = plt.subplots(2, figsize=(12, 8)) # Plot both sexes on different axes for ii, sex in enumerate(['male', 'female']): sns.distplot( df[df.Sex == sex].Age.dropna().values, bins=range(0, 81, 1), kde=False, axlabel='Age (Years)', ax=ax[ii] ) sns.distplot( df[(df.Survived == 1)&(df.Sex == sex)].Age.dropna().values, bins=range(0, 81, 1), kde=False, axlabel='Age (Years)', ax=ax[ii] ) None # Suppress console output. f, ax = plt.subplots(2, figsize=(12, 8)) # Plot both sexes on different axes for ii, sex in enumerate(['male', 'female']): sns.distplot( df[df.Sex == sex].Age.dropna().values, bins=range(0, 81, 5), kde=False, axlabel='Age (Years)', ax=ax[ii] ) sns.distplot( df[(df.Survived == 1)&(df.Sex == sex)].Age.dropna().values, bins=range(0, 81, 5), kde=False, axlabel='Age (Years)', ax=ax[ii] ) None # Suppress console output. survival_rates, survival_labels = list(), list() for x in range(0, 90+5, 5): aged_df = df[(x <= df.Age)&(df.Age <= x+5)] survival_rate = aged_df['Survived'].mean() survival_rate = 0.5 if (survival_rate == 0.0 or survival_rate == 1.0) else survival_rate survival_rates.append(survival_rate if (survival_rate != 0.0 or survival_rate != 1.0) else 0.5) survival_labels.append('(%i, %i]' % (x, x+5)) f, ax = plt.subplots(figsize=(12, 8)) ax = sns.barplot(x=survival_labels, y=survival_rates, ax=ax) ax.set_xticklabels(ax.get_xticklabels(), rotation=50) None # Suppress console output def getProbability(passengerId, df): Finds the weighted probability of surviving based on the passenger's parameters. This function finds the passenger's information by looking for their id in the dataframe and extracting the information that it needs. Currently the probability is found using a weighted mean on the following parameters: - Pclass: Higher the ticket class the more likely they will survive. - Sex: Women on average had a higher chance of living. - Age: Infants and older people had a greater chance of living. passenger = df.loc[passengerId] # Survival rate based on sex and ticket class. bySexAndClass = df[ (df.Sex == passenger.Sex) & (df.Pclass == passenger.Pclass) ].Survived.mean() # Survival rate based on sex and age. byAge = df[ (df.Sex == passenger.Sex) & ((df.Age//5-1)*5 <= passenger.Age) & (passenger.Age <= (df.Age//5)*5) ].Survived.mean() # Find the weighting for each of the rates. parameters = [bySexAndClass, byAge] rolls = [5, 4] # Roll numbers are hardcoded until I figure out the weighting system probabilities = [] for Nrolls, prob in zip(rolls, parameters): for _ in range(Nrolls): probabilities += [prob] return probabilities ############################################################################################## def make_guesses(df): Makes guesses on if the passengers survived or died. guesses = list() for passenger_index, _row in df.iterrows(): # Find if the passenger survived. survival_odds = getProbability(passenger_index, df) roll_outcomes = [] for prob in survival_odds: roll_outcomes += [random.random() <= prob] survived = sum(roll_outcomes) > len(roll_outcomes)/2 # Add the result to the guesses guesses.append(survived) return guesses ############################################################################################## df['Guess'] = make_guesses(df) df['CorrectGuess'] = df.Guess == df.Survived df.head() df.CorrectGuess.mean() results = list() for ii in range(10**2): guesses = make_guesses(df) correct_guesses = (df.Survived == guesses) results.append(correct_guesses.mean()) if ii % 10 == 0: print("%i/%i" % (ii, 10**2)) sns.distplot(results, kde=False) None <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Table of Contents Step2: IPython also comes with a sophisticated display system that lets us insert rich web elements in the notebook. Here you can see an example of how to add Youtube videos in a notebook Step3: <div id='inside' /> Step4: lets you capture the standard output and error output of some code into a Python variable. Step5: Writting our own magics! Step7: To create a new cell magic, we create a function that takes a line (containing possible options) and a cell's contents as its arguments, and we decorate it with @register_cell_magic. Step8: This cell magic is currently only available in your interactive session. To distribute it, you need to create an IPython extension. This is a regular Python module or package that extends IPython.
<ASSISTANT_TASK:> Python Code: %matplotlib inline import numpy as np import matplotlib.pyplot as plt import scipy as sp xgrid = np.linspace(-3,3,50) f1 = np.exp(-xgrid**2) f2 = np.tanh(xgrid) plt.figure(figsize=(8,6)) plt.plot(xgrid, f1, 'bo-') plt.plot(xgrid, f2, 'ro-') plt.title('Just a demo plot') plt.grid() plt.show() from IPython.display import YouTubeVideo YouTubeVideo('HrxX9TBj2zY') # this will list all magic commands %lsmagic # also work in ls, cd, mkdir, etc %pwd %history # this will execute and show the output of the program %run ./hola_mundo.py def naive_loop(): for i in range(100): for j in range(100): for k in range(100): a = 1+1 return None %timeit -n 10 naive_loop() %time naive_loop() %%bash cd .. ls %%capture output !ls %%writefile myfile.txt Holanda que talca! !cat myfile.txt !rm myfile.txt from IPython.core.magic import register_cell_magic @register_cell_magic def cpp(line, cell): Compile, execute C++ code, and return the standard output. # We first retrieve the current IPython interpreter instance. ip = get_ipython() # We define the source and executable filenames. source_filename = '_temp.cpp' program_filename = '_temp' # We write the code to the C++ file. with open(source_filename, 'w') as f: f.write(cell) # We compile the C++ code into an executable. compile = ip.getoutput("g++ {0:s} -o {1:s}".format( source_filename, program_filename)) # We execute the executable and return the output. output = ip.getoutput('./{0:s}'.format(program_filename)) print('\n'.join(output)) %%cpp #include<iostream> int main() { std::cout << "Hello world!"; } %load_ext cpp_ext <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1. Define Dataset Metadata Step2: 2. Define CSV Data Input Function Step3: 3. Define Feature Columns Step4: b. Create normalized feature columns Step5: 4. Define Autoencoder Model Function Step6: 5. Run Experiment using Estimator Train_And_Evaluate Step7: b. Define TrainSpec and EvaluSpec Step8: d. Run Experiment via train_and_evaluate Step9: 6. Use the trained model to encode data (prediction) Step10: Visualise Encoded Data
<ASSISTANT_TASK:> Python Code: MODEL_NAME = 'auto-encoder-01' TRAIN_DATA_FILES_PATTERN = 'data/data-*.csv' RESUME_TRAINING = False MULTI_THREADING = True FEATURE_COUNT = 64 HEADER = ['key'] HEADER_DEFAULTS = [[0]] UNUSED_FEATURE_NAMES = ['key'] CLASS_FEATURE_NAME = 'CLASS' FEATURE_NAMES = [] for i in range(FEATURE_COUNT): HEADER += ['x_{}'.format(str(i+1))] FEATURE_NAMES += ['x_{}'.format(str(i+1))] HEADER_DEFAULTS += [[0.0]] HEADER += [CLASS_FEATURE_NAME] HEADER_DEFAULTS += [['NA']] print("Header: {}".format(HEADER)) print("Features: {}".format(FEATURE_NAMES)) print("Class Feature: {}".format(CLASS_FEATURE_NAME)) print("Unused Features: {}".format(UNUSED_FEATURE_NAMES)) def parse_csv_row(csv_row): columns = tf.decode_csv(csv_row, record_defaults=HEADER_DEFAULTS) features = dict(zip(HEADER, columns)) for column in UNUSED_FEATURE_NAMES: features.pop(column) target = features.pop(CLASS_FEATURE_NAME) return features, target def csv_input_fn(files_name_pattern, mode=tf.estimator.ModeKeys.EVAL, skip_header_lines=0, num_epochs=None, batch_size=200): shuffle = True if mode == tf.estimator.ModeKeys.TRAIN else False print("") print("* data input_fn:") print("================") print("Input file(s): {}".format(files_name_pattern)) print("Batch size: {}".format(batch_size)) print("Epoch Count: {}".format(num_epochs)) print("Mode: {}".format(mode)) print("Shuffle: {}".format(shuffle)) print("================") print("") file_names = tf.matching_files(files_name_pattern) dataset = data.TextLineDataset(filenames=file_names) dataset = dataset.skip(skip_header_lines) if shuffle: dataset = dataset.shuffle(buffer_size=2 * batch_size + 1) num_threads = multiprocessing.cpu_count() if MULTI_THREADING else 1 dataset = dataset.batch(batch_size) dataset = dataset.map(lambda csv_row: parse_csv_row(csv_row), num_parallel_calls=num_threads) dataset = dataset.repeat(num_epochs) iterator = dataset.make_one_shot_iterator() features, target = iterator.get_next() return features, target features, target = csv_input_fn(files_name_pattern="") print("Feature read from CSV: {}".format(list(features.keys()))) print("Target read from CSV: {}".format(target)) df_params = pd.read_csv("data/params.csv", header=0, index_col=0) len(df_params) df_params['feature_name'] = FEATURE_NAMES df_params.head() def standard_scaler(x, mean, stdv): return (x-mean)/stdv def maxmin_scaler(x, max_value, min_value): return (x-min_value)/(max_value-min_value) def get_feature_columns(): feature_columns = {} # feature_columns = {feature_name: tf.feature_column.numeric_column(feature_name) # for feature_name in FEATURE_NAMES} for feature_name in FEATURE_NAMES: feature_max = df_params[df_params.feature_name == feature_name]['max'].values[0] feature_min = df_params[df_params.feature_name == feature_name]['min'].values[0] normalizer_fn = lambda x: maxmin_scaler(x, feature_max, feature_min) feature_columns[feature_name] = tf.feature_column.numeric_column(feature_name, normalizer_fn=normalizer_fn ) return feature_columns print(get_feature_columns()) def autoencoder_model_fn(features, labels, mode, params): feature_columns = list(get_feature_columns().values()) input_layer_size = len(feature_columns) encoder_hidden_units = params.encoder_hidden_units # decoder units are the reverse of the encoder units, without the middle layer (redundant) decoder_hidden_units = encoder_hidden_units.copy() decoder_hidden_units.reverse() decoder_hidden_units.pop(0) output_layer_size = len(FEATURE_NAMES) he_initialiser = tf.contrib.layers.variance_scaling_initializer() l2_regulariser = tf.contrib.layers.l2_regularizer(scale=params.l2_reg) print("[{}]->{}-{}->[{}]".format(len(feature_columns) ,encoder_hidden_units ,decoder_hidden_units, output_layer_size)) is_training = (mode == tf.estimator.ModeKeys.TRAIN) # input layer input_layer = tf.feature_column.input_layer(features=features, feature_columns=feature_columns) # Adding Gaussian Noise to input layer noisy_input_layer = input_layer + (params.noise_level * tf.random_normal(tf.shape(input_layer))) # Dropout layer dropout_layer = tf.layers.dropout(inputs=noisy_input_layer, rate=params.dropout_rate, training=is_training) # # Dropout layer without Gaussian Nosing # dropout_layer = tf.layers.dropout(inputs=input_layer, # rate=params.dropout_rate, # training=is_training) # Encoder layers stack encoding_hidden_layers = tf.contrib.layers.stack(inputs= dropout_layer, layer= tf.contrib.layers.fully_connected, stack_args=encoder_hidden_units, #weights_initializer = he_init, weights_regularizer =l2_regulariser, activation_fn = tf.nn.relu ) # Decoder layers stack decoding_hidden_layers = tf.contrib.layers.stack(inputs=encoding_hidden_layers, layer=tf.contrib.layers.fully_connected, stack_args=decoder_hidden_units, #weights_initializer = he_init, weights_regularizer =l2_regulariser, activation_fn = tf.nn.relu ) # Output (reconstructed) layer output_layer = tf.layers.dense(inputs=decoding_hidden_layers, units=output_layer_size, activation=None) # Encoding output (i.e., extracted features) reshaped encoding_output = tf.squeeze(encoding_hidden_layers) # Reconstruction output reshaped (for serving function) reconstruction_output = tf.squeeze(tf.nn.sigmoid(output_layer)) # Provide an estimator spec for `ModeKeys.PREDICT`. if mode == tf.estimator.ModeKeys.PREDICT: # Convert predicted_indices back into strings predictions = { 'encoding': encoding_output, 'reconstruction': reconstruction_output } export_outputs = { 'predict': tf.estimator.export.PredictOutput(predictions) } # Provide an estimator spec for `ModeKeys.PREDICT` modes. return tf.estimator.EstimatorSpec(mode, predictions=predictions, export_outputs=export_outputs) # Define loss based on reconstruction and regularization # reconstruction_loss = tf.losses.mean_squared_error(tf.squeeze(input_layer), reconstruction_output) # loss = reconstruction_loss + tf.losses.get_regularization_loss() reconstruction_loss = tf.losses.sigmoid_cross_entropy(multi_class_labels=tf.squeeze(input_layer), logits=tf.squeeze(output_layer)) loss = reconstruction_loss + tf.losses.get_regularization_loss() # Create Optimiser optimizer = tf.train.AdamOptimizer(params.learning_rate) # Create training operation train_op = optimizer.minimize( loss=loss, global_step=tf.train.get_global_step()) # Calculate root mean squared error as additional eval metric eval_metric_ops = { "rmse": tf.metrics.root_mean_squared_error( tf.squeeze(input_layer), reconstruction_output) } # Provide an estimator spec for `ModeKeys.EVAL` and `ModeKeys.TRAIN` modes. estimator_spec = tf.estimator.EstimatorSpec(mode=mode, loss=loss, train_op=train_op, eval_metric_ops=eval_metric_ops) return estimator_spec def create_estimator(run_config, hparams): estimator = tf.estimator.Estimator(model_fn=autoencoder_model_fn, params=hparams, config=run_config) print("") print("Estimator Type: {}".format(type(estimator))) print("") return estimator TRAIN_SIZE = 2000 NUM_EPOCHS = 1000 BATCH_SIZE = 100 NUM_EVAL = 10 TOTAL_STEPS = (TRAIN_SIZE/BATCH_SIZE)*NUM_EPOCHS CHECKPOINT_STEPS = int((TRAIN_SIZE/BATCH_SIZE) * (NUM_EPOCHS/NUM_EVAL)) hparams = tf.contrib.training.HParams( num_epochs = NUM_EPOCHS, batch_size = BATCH_SIZE, encoder_hidden_units=[30,3], learning_rate = 0.01, l2_reg = 0.0001, noise_level = 0.0, max_steps = TOTAL_STEPS, dropout_rate = 0.05 ) model_dir = 'trained_models/{}'.format(MODEL_NAME) run_config = tf.contrib.learn.RunConfig( save_checkpoints_steps=CHECKPOINT_STEPS, tf_random_seed=19830610, model_dir=model_dir ) print(hparams) print("Model Directory:", run_config.model_dir) print("") print("Dataset Size:", TRAIN_SIZE) print("Batch Size:", BATCH_SIZE) print("Steps per Epoch:",TRAIN_SIZE/BATCH_SIZE) print("Total Steps:", TOTAL_STEPS) print("Required Evaluation Steps:", NUM_EVAL) print("That is 1 evaluation step after each",NUM_EPOCHS/NUM_EVAL," epochs") print("Save Checkpoint After",CHECKPOINT_STEPS,"steps") train_spec = tf.estimator.TrainSpec( input_fn = lambda: csv_input_fn( TRAIN_DATA_FILES_PATTERN, mode = tf.contrib.learn.ModeKeys.TRAIN, num_epochs=hparams.num_epochs, batch_size=hparams.batch_size ), max_steps=hparams.max_steps, hooks=None ) eval_spec = tf.estimator.EvalSpec( input_fn = lambda: csv_input_fn( TRAIN_DATA_FILES_PATTERN, mode=tf.contrib.learn.ModeKeys.EVAL, num_epochs=1, batch_size=hparams.batch_size ), # exporters=[tf.estimator.LatestExporter( # name="encode", # the name of the folder in which the model will be exported to under export # serving_input_receiver_fn=csv_serving_input_fn, # exports_to_keep=1, # as_text=True)], steps=None, hooks=None ) if not RESUME_TRAINING: print("Removing previous artifacts...") shutil.rmtree(model_dir, ignore_errors=True) else: print("Resuming training...") tf.logging.set_verbosity(tf.logging.INFO) time_start = datetime.utcnow() print("Experiment started at {}".format(time_start.strftime("%H:%M:%S"))) print(".......................................") estimator = create_estimator(run_config, hparams) tf.estimator.train_and_evaluate( estimator=estimator, train_spec=train_spec, eval_spec=eval_spec ) time_end = datetime.utcnow() print(".......................................") print("Experiment finished at {}".format(time_end.strftime("%H:%M:%S"))) print("") time_elapsed = time_end - time_start print("Experiment elapsed time: {} seconds".format(time_elapsed.total_seconds())) import itertools DATA_SIZE = 2000 input_fn = lambda: csv_input_fn( TRAIN_DATA_FILES_PATTERN, mode=tf.contrib.learn.ModeKeys.INFER, num_epochs=1, batch_size=500 ) estimator = create_estimator(run_config, hparams) predictions = estimator.predict(input_fn=input_fn) predictions = itertools.islice(predictions, DATA_SIZE) predictions = list(map(lambda item: list(item["encoding"]), predictions)) print(predictions[:5]) y = pd.read_csv("data/data-01.csv", header=None, index_col=0)[65] data_reduced = pd.DataFrame(predictions, columns=['c1','c2','c3']) data_reduced['class'] = y data_reduced.head() from mpl_toolkits.mplot3d import Axes3D import matplotlib.pyplot as plt fig = plt.figure(figsize=(15,10)) ax = fig.add_subplot(111, projection='3d') ax.scatter(xs=data_reduced.c2/1000000, ys=data_reduced.c3/1000000, zs=data_reduced.c1/1000000, c=data_reduced['class'], marker='o') plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Bringing in a FITS File Step2: Here, we've got a 50 x 200 image. HTTM will assume this is four slices of 50 x 50 by default. We have 1000000 electrons in one pixel in the center of slice 0.
<ASSISTANT_TASK:> Python Code: %matplotlib inline %config InlineBackend.figure_format = 'png' import matplotlib matplotlib.rcParams['figure.figsize'] = (8, 8) import astropy.io.fits as fits import numpy spot50=fits.open('fits_data/electron_flux_fits/spot50.fits') matplotlib.pyplot.imshow(numpy.log10(spot50[0].data),clim=(2,8)) matplotlib.pyplot.gca().invert_yaxis() from httm.fits_utilities.electron_flux_fits import electron_flux_converter_from_fits ideal_data = electron_flux_converter_from_fits('fits_data/electron_flux_fits/spot50.fits') matplotlib.pyplot.imshow(numpy.log10(ideal_data.slices[0].pixels+1), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import introduce_smear_rows smeared=introduce_smear_rows(ideal_data) matplotlib.pyplot.imshow(numpy.log10(list(smeared.slices)[0].pixels+1), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import add_shot_noise shot = add_shot_noise(smeared) matplotlib.pyplot.imshow(numpy.log10(shot.slices[0].pixels+1), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import simulate_blooming bloomed = simulate_blooming(shot) matplotlib.pyplot.imshow(numpy.log10(bloomed.slices[0].pixels+1), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import add_readout_noise noisy = add_readout_noise(bloomed) matplotlib.pyplot.imshow(numpy.log10(noisy.slices[0].pixels+40), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import simulate_undershoot undershot=simulate_undershoot(noisy) matplotlib.pyplot.imshow(numpy.log10(undershot.slices[0].pixels+150), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import add_baseline baselined = add_baseline(undershot) matplotlib.pyplot.imshow(numpy.log10(baselined.slices[0].pixels-32000), clim=(0,8),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.transformations.electron_flux_converters_to_raw import convert_electrons_to_adu raw = convert_electrons_to_adu(baselined) matplotlib.pyplot.imshow(numpy.log10(raw.slices[0].pixels-5099), clim=(0,4),interpolation='none') matplotlib.pyplot.gca().invert_yaxis() from httm.fits_utilities.raw_fits import write_raw_converter_to_calibrated_fits write_raw_converter_to_calibrated_fits(raw,'spot50_raw.fits') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Style sheet for Matplotlib Step2: Sample Bar Plot Step3: Sample Pie Plot Step4: Average age of Men and Women Step5: Now we have read the data from the csv files Step6: Producing the same graph for women members Step7: Dealing with Occupational Backgrounds
<ASSISTANT_TASK:> Python Code: import os os.chdir("/home/archimedeas/wrkspc/anaconda/major_1/datasets/1_the_senate_datasets") import pandas as pd import numpy as np from bokeh._legacy_charts import output_notebook, show import bokeh df = pd.read_csv("1_age_group_5yr_span.csv", index_col = 0) df df.shape %matplotlib inline import matplotlib.pyplot as plt plt.style.use('ggplot') plt.rcParams['figure.figsize'] = (10.0, 8.0) import numpy as np import matplotlib.pyplot as plt N = 5 menMeans = (20, 35, 30, 35, 27) menStd = (2, 3, 4, 1, 2) ind = np.arange(N) # the x locations for the groups width = 0.35 # the width of the bars fig, ax = plt.subplots() rects1 = ax.bar(ind, menMeans, width, color = 'red', alpha = 0.6) womenMeans = (25, 32, 34, 20, 25) womenStd = (3, 5, 2, 3, 3) rects2 = ax.bar(ind + width, womenMeans, width ) # add some text for labels, title and axes ticks ax.set_ylabel('Scores') ax.set_title('Scores by group and gender') ax.set_xticks(ind + width) ax.set_xticklabels(('Frogs', 'Hogs', 'Bogs', 'Slogs', 'Kerebos')) ax.legend((rects1[0], rects2[0]), ('Men', 'Women')) plt.show() import matplotlib.pyplot as plt import pandas as pd # The slices will be ordered and plotted counter-clockwise. labels = 'Frogs', 'Hogs', 'Dogs', 'Logs' sizes = [15, 30, 45, 10] colors = ['yellowgreen', 'gold', 'lightskyblue', 'lightcoral'] explode = (0.1, 0.1, 0.1, 0.1) plt.pie(sizes, explode=explode, labels=labels, colors=colors, autopct='%1.1f%%', shadow=True, startangle=90) # Set aspect ratio to be equal so that pie is drawn as a circle. plt.axis('equal') plt.show() df_men = pd.read_csv("1_age_group_5yr_span.csv") ls_labels_men = [] ls_values_men = [] for i in range(1,df_men.shape[0]): ls_labels_men.append(str(df_men.iat[i,0])) ls_values_men.append(float(df_men.iat[i,1])) import numpy as np import matplotlib.pyplot as plt N = len(ls_labels_men) ind = np.arange(N) # the x locations for the groups width = 0.35 # the width of the bars fig, ax = plt.subplots() rects1 = ax.bar(ind, ls_values_men, width, color = 'red', alpha = 0.6) #rects2 = ax.bar(ind + width, ls_values_men, width ) # add some text for labels, title and axes ticks ax.set_ylabel('Scores') ax.set_title('Scores by group and gender') ax.set_xticks(ind + width) ax.set_xticklabels(ls_labels_men) #ax.legend((rects1[0], rects2[0]), ('Men', 'Women')) plt.show() df_women = pd.read_csv("8_women_age_group.csv") ls_labels_women = [] ls_values_women = [] for i in range(1,df_women.shape[0]): ls_labels_women.append(str(df_women.iat[i,0])) ls_values_women.append(float(df_women.iat[i,1])) import numpy as np import matplotlib.pyplot as plt N = len(ls_labels_women) ind = np.arange(N) # the x locations for the groups width = 0.35 # the width of the bars fig, ax = plt.subplots() #rects1 = ax.bar(ind, ls_values_women, width, color = 'red', alpha = 0.6) rects2 = ax.bar(ind + width, ls_values_women, width ) # add some text for labels, title and axes ticks ax.set_ylabel('Scores') ax.set_title('Scores by group and gender') ax.set_xticks(ind + width) ax.set_xticklabels(ls_labels_women) #ax.legend((rects1[0], rects2[0]), ('Men', 'Women')) plt.show() import pandas as pd df_men = pd.read_csv("4_educational_background.csv") df_men ls_labels_men = [] ls_values_men = [] for i in range(1,df_men.shape[0]): ls_labels_men.append(str(df_men.iat[i,0])) ls_values_men.append(float(df_men.iat[i,1])) len(ls_labels_men) import matplotlib.pyplot as plt import pandas as pd plt.rcParams['figure.figsize'] = (10.0, 10.0) # The slices will be ordered and plotted counter-clockwise. labels = ls_labels_men sizes = ls_values_men colors = ['yellowgreen', 'gold', 'lightskyblue', 'lightcoral', 'red', 'lightgreen'] #explode = (0.1, 0.1, 0.1, 0.1, 0, 0) p, text = plt.pie(sizes, labels=labels, colors = colors, shadow=True, startangle=90 ) # Set aspect ratio to be equal so that pie is drawn as a circle. plt.axis('equal') #plt.title("Educational Background", fontsize = 50, loc = 'right') plt.legend(p, labels, loc= 'lower right') plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: FMO dynamics simulated with ZOFE master equation Step2: Excited state dynamics Step3: Gaussian pump pulse Step4: Absorption spectra
<ASSISTANT_TASK:> Python Code: import qspectra as qs import numpy as np import matplotlib.pyplot as plt %matplotlib inline electronic_fmo = np.array(np.mat( 12400 -87.7 5.5 -5.9 6.7 -13.7 -9.9; -87.7 12520 30.8 8.2 0.7 11.8 4.3; 5.5 30.8 12200 -53.5 -2.2 -9.6 6.; -5.9 8.2 -53.5 12310 -70.7 -17. -63.3; 6.7 0.7 -2.2 -70.7 12470 81.1 -1.3; -13.7 11.8 -9.6 -17. 81.1 12620 39.7; -9.9 4.3 6. -63.3 -1.3 39.7 12430 )) dipoles_fmo = np.array([d / np.linalg.norm(d) for d in np.array([[3.019, 3.442, 0.797, 3.213, 2.969, 0.547, 1.983], [2.284, -2.023, -3.871, 2.145, -2.642, 3.562, 2.837], [1.506, 0.431, 0.853, 1.112, -0.661, -1.851, 2.015]]).T]) # Bath parameters for pseudomode bath -- fit to the Drude spectral density for FMO for 77K of Ishizaki and Fleming # (each PM is represented by a Lorentzian at frequency Omega, with width gamma, and of strength huang # in the bath correlation SPECTRUM, NOT spectral density) Omega = [-500., -200., -90., 1., 21., 60., 80., 130., 200., 300., 400., 500., 600., 800., 1100., 1500.] # frequencies of PMs huang = [-2.5133e-03, -7.5398e-03, -2.5133e-02, 5.0265e+01, 2.2619e+00, 4.5239e-02, 2.7646e-01, 9.2991e-03, 2.2619e-02, 1.5080e-02, 3.0159e-03, 3.5186e-03, 2.8274e-04, 1.7593e-03, 4.3982e-04, 4.3982e-04] # Huang-Rhys factors of PMs (couplings to PMs) gamma = [500., 100., 50., 50., 50., 50., 80., 40., 80., 150., 200., 200., 80., 250., 200., 300.] # dampings of the PMs n_sites = len(electronic_fmo) numb_pm = len(Omega) on = np.ones(n_sites, complex) Omega = np.array([Omega[pm]*on for pm in range(numb_pm)]) huang = np.array([huang[pm]*on for pm in range(numb_pm)]) gamma = np.array([gamma[pm]*on for pm in range(numb_pm)]) fmo_hamiltonian = qs.ElectronicHamiltonian(electronic_fmo, bath=qs.PseudomodeBath(numb_pm, Omega, gamma, huang), dipoles=dipoles_fmo) %%time dynamical_model = qs.ZOFEModel(fmo_hamiltonian, hilbert_subspace='e', unit_convert=qs.CM_FS) t, rho = qs.simulate_dynamics(dynamical_model, [1,0,0,0,0,0,0], 1000) plt.title('Excitation from site 1') plt.plot(t, np.einsum('tii->ti', rho.reshape(-1, 7, 7)).real) plt.xlim(0, 1000) plt.xlabel('Time (fs)') plt.ylabel('Population') plt.legend(['Site {}'.format(n) for n in xrange(1, 8)]); %%time pump = qs.GaussianPulse(12500, 50, scale=1e-3, freq_convert=qs.CM_FS) dynamical_model = qs.ZOFEModel(fmo_hamiltonian, hilbert_subspace='ge', unit_convert=qs.CM_FS) t, rho_oop_vec = qs.simulate_pump(dynamical_model, pump, 'x', 1000) rho = np.array([dynamical_model.state_vec_to_operators(k)[0] for k in rho_oop_vec]) plt.title('Laser excitation') plt.plot(t, 2 * pump(t, 12500).real, 'k--') plt.plot(t, np.einsum('tii->ti', rho.reshape(-1, 8, 8)[:, 1:, 1:]).real) plt.xlabel('Time (fs)') plt.ylabel('Population') plt.xlim(pump.t_init, 1000) plt.legend(np.concatenate([['Laser (arb. units)'], ['Site {}'.format(n) for n in xrange(1, 8)]])); %%time f, X = qs.absorption_spectra(dynamical_model, 2000) plt.plot(f, X) plt.xlim(12000, 12800); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: เปลี่ยน rating ให้กลายเป็น integer เนื่องจากตอนที่ดึงข้อมูลจาก API ข้อมูลส่วนของ rating จะมาเป็น string Step2: แสดงคำตอบของแต่ละคนเพื่อเช็คว่าค่า rating ที่ได้มาเป็น integer แล้ว Step3: ใช้ Pandas เข้ามาช่วยจัดการข้อมูล Step4: กลุ่มคำถามทั้งหมด Step5: คะแนน "โดยรวมทุกสาขา" จากคำตอบของแต่ละกลุ่มคำถาม Step6: สาขาทั้งหมด Step7: คะแนน "แยกแต่ละสาขา" จากคำตอบของแต่ละกลุ่มคำถาม Step8: ส่งข้อมูลออกไปเป็น group ของ questions จะ render ได้ง่ายกว่า Step9: ถ้าจัดข้อมูลแบบตัวแปร b ได้ เราสามารถ transpose และส่งออกไป render ได้ง่าย Step10: หลังจากา loop แต่ละ question group แล้ว ให้ loop แต่ละ สาขา (branch) เพื่อสร้าง list ของคำถามของสาขานั้นๆ มาก่อน Step11: [IGNORE] ทดลองโค้ดบางอย่าง
<ASSISTANT_TASK:> Python Code: form_uid = 'HQnDRM' #form_uid = 'iSEGWq' typeform_api_key = '_API_KEY_' url = 'https://api.typeform.com/v1/form/' + form_uid + '?key=' + typeform_api_key import requests response = requests.get(url) results = response.json() results questions = results.get('questions') questions responses = results.get('responses') responses print('Total Responses: ' + str(len(responses))) answers = [each['answers'] for each in responses] for answer in answers: for each in answer: if 'rating_' in each: answer[each] = int(answer[each]) print(answers) print('Completion rate: ' + str(len(list(filter(lambda x: x, answers))) / len(answers))) import pandas as pd df = pd.DataFrame(answers) df df[df['list_53368385_choice'] == 'จตุจักร'] df[df['list_53368385_choice'] == 'คลองสาน'] df_questions = pd.DataFrame(questions) df_questions question_groups = list(filter(lambda x: type(x) == str, df_questions.group.unique())) question_groups for each_question_group in question_groups: print('--- ' + df_questions[df_questions['id'] == each_question_group]['question'].iloc[0] + ' ---') questions_in_group = df_questions[df_questions['group'] == each_question_group][['id', 'question']] for idx, question in zip(questions_in_group.id, questions_in_group.question): print(question + ': ' + str(df[idx].mean())) print() branch_column_name = 'list_53368385_choice' branches = list(filter(lambda x: type(x) == str, df[branch_column_name].unique())) branches df[df[branch_column_name] == 'จตุจักร'] df_questions questions_in_no_group = df_questions[ df_questions['group'].isnull() & df_questions['id'].str.contains('rating_') ][['id', 'question']] questions_in_no_group df_questions[df_questions['group'] == 'group_53368461'] df_questions[df_questions['group'] == 'group_53368461'].shape[0] charts = {} for each_branch in branches: branch = [] df_branch = df[df[branch_column_name] == each_branch] for each_question_group in question_groups: chart = {'data': []} chart['id'] = each_question_group chart['label'] = df_questions[df_questions['id'] == each_question_group]['question'].iloc[0] + '...' questions_in_group = df_questions[df_questions['group'] == each_question_group][['id', 'question']] for idx, question in zip(questions_in_group.id, questions_in_group.question): chart['data'].append( [ question, df_branch[idx].mean() ] ) branch.append(chart) chart = {'data': []} chart['id'] = 'group_others' chart['label'] = 'Others' questions_in_no_group = df_questions[df_questions['group'].isnull() & df_questions['id'].str.contains('rating_')][['id', 'question']] for idx, question in zip(questions_in_no_group.id, questions_in_no_group.question): chart['data'].append( [ question, df_branch[idx].mean() ] ) branch.append(chart) charts[each_branch] = branch charts #for each_question_group in question_groups: # count = df_questions[df_questions['group'] == each_question_group].shape[0] for each_branch in branches: #for idx in range(count): print(charts[each_branch][2]['data']) print('------') for idx, _ in enumerate(charts): for each_branch in branches: print(charts[each_branch][idx]['id']) print('------') scores = [] for each_branch in branches: score_each_branch = [] for each in charts[each_branch][0]['data']: score_each_branch.append(each[1]) scores.append(score_each_branch) scores list(zip(*scores)) list(map(list, zip(*scores))) import numpy as np np_scores = np.array(scores) np_scores.T a = [['xx', 8.0, 9.0], ['yy', 5.0, 7.0]] a b = list(zip(*a)) b list(zip(*b)) x = [ ('คำตอบคำถาม1-สาขา1', 'คำตอบคำถาม2-สาขา1', 'คำตอบคำถาม3-สาขา1'), ('คำตอบคำถาม1-สาขา2', 'คำตอบคำถาม2-สาขา2', 'คำตอบคำถาม3-สาขา2'), ('คำตอบคำถาม1-สาขา3', 'คำตอบคำถาม2-สาขา3', 'คำตอบคำถาม3-สาขา3'), ('คำตอบคำถาม1-สาขา4', 'คำตอบคำถาม2-สาขา4', 'คำตอบคำถาม3-สาขา4'), ] x = [('คำถาม 1', 'คำถาม 2', 'คำถาม 3'), ] + x list(map(list, zip(*x))) df_answers = df df_questions df_answers question_groups branches df_questions[df_questions['group'] == 'group_53368461'][['id', 'question']] df_answers[df_answers[branch_column_name] == 'บางนา'] charts = [] # for each question group # for questions in each question group filtered_questions = df_questions[df_questions['group'] == 'group_53368461'][['id', 'question']] for question_id, question in zip(filtered_questions.id, filtered_questions.question): for idx, each in enumerate(branches): if idx == 0: chart = [question] df_branch = df_answers[df_answers[branch_column_name] == each] chart.append(df_branch[question_id].mean()) charts.append(chart) charts filtered_questions df_branch prefixes = ['list_', 'rating_', 'textfield_'] for each in questions: if any([each['id'].startswith(prefix) for prefix in prefixes]): try: print(df[each['id']]) except KeyError: print('No one answers..') form_uid = 'iSEGWq' typeform_api_key = '__API_KEY__' url = 'https://api.typeform.com/v1/forms?key=' + typeform_api_key response = requests.get(url) results = response.json() results <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Define model name of your model and the location of MODFLOW executable. All MODFLOW files and output will be stored in the subdirectory defined by the workspace. Create a model named ml and specify that this is a MODFLOW-2005 model. Step2: Define the number of layers, rows and columns, and the cell size along the rows (delr) and along the columns (delc). Then create a discretization file. Specify the top and bottom of the aquifer. The heads are computed quasi-steady state (hence a steady MODFLOW run) while the interface will move. There is one stress period with a length of 400 days and 200 steps (so one step is 2 days). Step3: All cells are active (ibound=1), while the last cell is fixed head (ibound=-1). The starting values of the head are not important, as the heads are computed every time with a steady run. Step4: Define the hydraulic conductivity. The aquifer is confined (laytype=0) and the intercell hydraulic conductivity is the harmonic meand (layavg=0). Step5: Inflow on the right side of the model is 1 m$^3$/d (layer 0, row 0, column 0, discharge 1) Step6: Define the output control to save heads and interface every 50 steps, and define the pcg solver with default arguments. Step7: The intial interface is straight. The isource is one everywhere (inflow and outflow is fresh (zone 1)) except for the first cell (index=0) which has saltwater inflow (zone 2). Step8: Write the MODFLOW input files and run the model Step9: Load the head and zeta data from the file Step10: Make a graph and add the solution of Wilson and Sa da Costa Step11: Convert zeta surfaces to relative seawater concentrations
<ASSISTANT_TASK:> Python Code: %matplotlib inline import os import platform import numpy as np import matplotlib.pyplot as plt import flopy.modflow as mf import flopy.utils as fu import flopy.plot as fp modelname = 'swiex1' #Set name of MODFLOW exe # assumes executable is in users path statement exe_name = 'mf2005' if platform.system() == 'Windows': exe_name = 'mf2005.exe' workspace = os.path.join('data') #make sure workspace directory exists if not os.path.exists(workspace): os.makedirs(workspace) ml = mf.Modflow(modelname, version='mf2005', exe_name=exe_name, model_ws=workspace) nlay = 1 nrow = 1 ncol = 50 delr = 5. delc = 1. nper, perlen, nstp = 1, 400., 200 discret = mf.ModflowDis(ml, nlay=nlay, nrow=nrow, ncol=ncol, delr=delr, delc=delc, top=0, botm=-40.0, steady=True, nper=nper, perlen=perlen, nstp=nstp) ibound = np.ones((nrow, ncol)) ibound[0, -1] = -1 bas = mf.ModflowBas(ml, ibound=ibound, strt=0.0) lpf = mf.ModflowLpf(ml, hk=2., laytyp=0, layavg=0) wel = mf.ModflowWel(ml, stress_period_data = {0:[[0, 0, 0, 1]]} ) spd = {} for istp in xrange(49, nstp+1, 50): spd[(0, istp)] = ['save head', 'print budget'] spd[(0, istp+1)] = [] oc = mf.ModflowOc(ml, stress_period_data=spd) pcg = mf.ModflowPcg(ml) z = np.zeros((nrow, ncol), np.float) z[0, 16:24] = np.arange(-2.5, -40, -5) z[0, 24:] = -40 z = [z] # zeta needs to be isource = np.ones((nrow, ncol), np.int) isource[0, 0] = 2 # swi = mf.ModflowSwi2(ml, nsrf=1, istrat=1, toeslope=0.2, tipslope=0.2, nu=[0, 0.025], zeta=z, ssz=0.2, isource=isource, nsolver=1) ml.write_input() ml.run_model(silent=True) #--read model heads hfile = fu.HeadFile(os.path.join(ml.model_ws, modelname+'.hds')) head = hfile.get_alldata() #--read model zeta zfile = fu.CellBudgetFile(os.path.join(ml.model_ws, modelname+'.zta')) kstpkper = zfile.get_kstpkper() zeta = [] for kk in kstpkper: zeta.append(zfile.get_data(kstpkper=kk, text='ZETASRF 1')[0]) zeta = np.array(zeta) plt.figure(figsize=(16,6)) # define x-values of xcells and plot interface x = np.arange(0, ncol*delr, delr) + delr/2. label = ['SWI2','_','_','_'] # labels with an underscore are not added to legend for i in range(4): zt = np.ma.masked_outside(zeta[i,0,0,:], -39.99999, -0.00001) plt.plot(x, zt, 'r-', lw=1, zorder=10, label=label[i]) # Data for the Wilson - Sa da Costa solution k = 2.0 n = 0.2 nu = 0.025 H = 40.0 tzero = H * n / (k * nu) / 4.0 Ltoe = np.zeros(4) v = 0.125 t = np.arange(100, 500, 100) label = ['W & SD','_','_','_'] # labels with an underscore are not added to legend for i in range(4): Ltoe[i] = H * np.sqrt(k * nu * (t[i] + tzero) / n / H) plt.plot([100 - Ltoe[i] + v * t[i], 100 + Ltoe[i] + v * t[i]], [0, -40], '0.75', lw=8, zorder=0, label=label[i]) # Scale figure and add legend plt.axis('scaled') plt.xlim(0, 250) plt.ylim(-40, 0) plt.legend(loc='best'); X, Y = np.meshgrid(x, [0, -40]) zc = fp.SwiConcentration(model=ml) conc = zc.calc_conc(zeta={0:zeta[3,:,:,:]}) / 0.025 print conc[0, 0, :] v = np.vstack((conc[0, 0, :], conc[0, 0, :])) plt.imshow(v, extent=[0, 250, -40, 0], cmap='Reds') cb = plt.colorbar(orientation='horizontal') cb.set_label('percent seawater'); plt.contour(X, Y, v, [0.75, 0.5, 0.25], linewidths=[2, 1.5, 1], colors='black'); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2D trajectory interpolation Step2: Use these arrays to create interpolated functions $x(t)$ and $y(t)$. Then use those functions to create the following arrays Step3: Make a parametric plot of ${x(t),y(t)}$ that shows the interpolated values and the original points
<ASSISTANT_TASK:> Python Code: %matplotlib inline import matplotlib.pyplot as plt import seaborn as sns import numpy as np from scipy.interpolate import interp1d trajectory = np.load('trajectory.npz') x = trajectory['x'] y = trajectory['y'] t = trajectory['t'] assert isinstance(x, np.ndarray) and len(x)==40 assert isinstance(y, np.ndarray) and len(y)==40 assert isinstance(t, np.ndarray) and len(t)==40 newt = np.linspace(min(t),max(t),200) sin_approx = interp1d(t, x, kind='cubic') sin_approx2 = interp1d(t, x, kind='cubic') newx = sin_approx(newt) newy = sin_approx(newt) assert newt[0]==t.min() assert newt[-1]==t.max() assert len(newt)==200 assert len(newx)==200 assert len(newy)==200 plt.plot(newx, newy, marker='o', linestyle='', label='original data') plt.plot(newx, newy, marker='.', label='interpolated'); plt.legend(loc=4); plt.xlabel('$x(t)$') plt.ylabel('$y(t)$'); plt.xlim(-0.7, 0.9) plt.ylim(-0.7,0.9) assert True # leave this to grade the trajectory plot <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's see an example Step2: Loading the data Step3: Parsing the data Step4: Let's see what the numeric attributes for headlines written by this author look like. We're going to use Pandas for this. Step5: From this information, we're going to extract the chunk type sequence of each headline (i.e. the first level of the parse tree) and use it as an indicator of the overall structure of the headline. So in the above example, we would extract and use the following sequence of chunk types in our analysis Step6: Now let's see how that works with our chunk type sequences, for two randomly selected headlines from the first author Step7: Pair-wise similarity matrix for the headlines Step8: Visualization Step9: And to add a bit of color to our visualization, let's use K-Means to identify 5 clusters of similar headlines, which we will use in our visualization Step10: Finally let's plot the actual chart using Bokeh Step11: The above interactive chart shows a number of dense groups of headlines, as well as some sparse ones. Some of the dense groups that stand out more are Step12: The basic stats don't show a significant difference between the headlines written by the two authors. Step13: Now that we have analyzed the headlines for the second author, let's see how many common patterns exist between the two authors Step14: We observe that about 50% (347/700) of the headlines have a similar structure.
<ASSISTANT_TASK:> Python Code: from pattern.en import parsetree s = parsetree('The cat sat on the mat.') for sentence in s: for chunk in sentence.chunks: print chunk.type, [(w.string, w.type) for w in chunk.words] import cPickle as pickle author1 = pickle.load( open( "author1.p", "rb" ) ) author1[0] for story in author1: story["title_length"] = len(story["title"]) story["title_chunks"] = [chunk.type for chunk in parsetree(story["title"])[0].chunks] story["title_chunks_length"] = len(story["title_chunks"]) author1[0] import pandas as pd df1 = pd.DataFrame.from_dict(author1) df1.describe() import difflib print "Similarity scores for...\n" print "Two identical sequences: ", difflib.SequenceMatcher(None,["A","B","C"],["A","B","C"]).ratio() print "Two similar sequences: ", difflib.SequenceMatcher(None,["A","B","C"],["A","B","D"]).ratio() print "Two completely different sequences: ", difflib.SequenceMatcher(None,["A","B","C"],["X","Y","Z"]).ratio() v1 = author1[3]["title_chunks"] v2 = author1[1]["title_chunks"] print v1, v2, difflib.SequenceMatcher(None,v1,v2).ratio() import numpy as np chunks = [author["title_chunks"] for author in author1] m = np.zeros((700,700)) for i, chunkx in enumerate(chunks): for j, chunky in enumerate(chunks): m[i][j] = difflib.SequenceMatcher(None,chunkx,chunky).ratio() from sklearn.manifold import TSNE tsne_model = TSNE(n_components=2, verbose=1, random_state=0) tsne = tsne_model.fit_transform(m) from sklearn.cluster import MiniBatchKMeans kmeans_model = MiniBatchKMeans(n_clusters=5, init='k-means++', n_init=1, init_size=1000, batch_size=1000, verbose=False, max_iter=1000) kmeans = kmeans_model.fit(m) kmeans_clusters = kmeans.predict(m) kmeans_distances = kmeans.transform(m) import bokeh.plotting as bp from bokeh.models import HoverTool, BoxSelectTool from bokeh.plotting import figure, show, output_notebook colormap = np.array([ "#1f77b4", "#aec7e8", "#ff7f0e", "#ffbb78", "#2ca02c", "#98df8a", "#d62728", "#ff9896", "#9467bd", "#c5b0d5", "#8c564b", "#c49c94", "#e377c2", "#f7b6d2", "#7f7f7f", "#c7c7c7", "#bcbd22", "#dbdb8d", "#17becf", "#9edae5" ]) output_notebook() plot_author1 = bp.figure(plot_width=900, plot_height=700, title="Author1", tools="pan,wheel_zoom,box_zoom,reset,hover,previewsave", x_axis_type=None, y_axis_type=None, min_border=1) plot_author1.scatter(x=tsne[:,0], y=tsne[:,1], color=colormap[kmeans_clusters], source=bp.ColumnDataSource({ "chunks": [x["title_chunks"] for x in author1], "title": [x["title"] for x in author1], "cluster": kmeans_clusters })) hover = plot_author1.select(dict(type=HoverTool)) hover.tooltips={"chunks": "@chunks (title: \"@title\")", "cluster": "@cluster"} show(plot_author1) author2 = pickle.load( open( "author2.p", "rb" ) ) for story in author2: story["title_length"] = len(story["title"]) story["title_chunks"] = [chunk.type for chunk in parsetree(story["title"])[0].chunks] story["title_chunks_length"] = len(story["title_chunks"]) pd.DataFrame.from_dict(author2).describe() chunks_joint = [author["title_chunks"] for author in (author1+author2)] m_joint = np.zeros((1400,1400)) for i, chunkx in enumerate(chunks_joint): for j, chunky in enumerate(chunks_joint): sm=difflib.SequenceMatcher(None,chunkx,chunky) m_joint[i][j] = sm.ratio() set1= [author["title_chunks"] for author in author1] set2= [author["title_chunks"] for author in author2] list_new = [itm for itm in set1 if itm in set2] len(list_new) tsne_joint = tsne_model.fit_transform(m_joint) plot_joint = bp.figure(plot_width=900, plot_height=700, title="Author1 vs. Author2", tools="pan,wheel_zoom,box_zoom,reset,hover,previewsave", x_axis_type=None, y_axis_type=None, min_border=1) plot_joint.scatter(x=tsne_joint[:,0], y=tsne_joint[:,1], color=colormap[([0] * 700 + [3] * 700)], source=bp.ColumnDataSource({ "chunks": [x["title_chunks"] for x in author1] + [x["title_chunks"] for x in author2], "title": [x["title"] for x in author1] + [x["title"] for x in author2] })) hover = plot_joint.select(dict(type=HoverTool)) hover.tooltips={"chunks": "@chunks (title: \"@title\")"} show(plot_joint) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description:
<ASSISTANT_TASK:> Python Code:: import pandas as pd import boto3 from io import StringIO # Set your AWS credentials and region aws_access_key_id = 'access_key_id' aws_secret_access_key = 'secret_access_key' aws_region = 'aws_region' # Set the S3 bucket and file path s3_bucket = 's3_bucket_name' s3_file_path = 'data.csv' # Create a session with boto3 session = boto3.Session( aws_access_key_id=aws_access_key_id, aws_secret_access_key=aws_secret_access_key, region_name=aws_region ) # Create an S3 client s3 = session.client('s3') # Read the CSV file from S3 into a pandas dataframe s3_object = s3.get_object(Bucket=s3_bucket, Key=s3_file_path) s3_data = s3_object['Body'].read().decode('utf-8') df = pd.read_csv(StringIO(s3_data)) # Print the dataframe print(df.head()) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: ipython shell Step2: Ok, backup, how do I interact with the notebook and what is it? Step3: So, you exectued this by hitting the 'play' button in the tool bar or you used 'shift-enter'. Some other ways Step4: My favs... Step5: MUCHS INFOS Step6: Magics for running code under other interpreters Step7: Exercise Step8: Hints Step9: Running Shell Commands Step10: Managing the IPython Kernel Step11: If the Kernel dies you will be prompted to restart it. Here we call the low-level system libc.time routine with the wrong argument via Step12: Side note on versions Step13: I promised you latex! Step14: Debugging Step15: Lots of useful features in the python debugger (and could probably do with a seperate lecture). We'll save that for another day... Step18: The %cython magic
<ASSISTANT_TASK:> Python Code: %%writefile hello.py #!/usr/bin/env python def printHello(): print "Hello World" print "File Loaded" cat mystuff.ipynb 2+4 %timeit range(1000) %%timeit x = range(10000) max(x) %lsmagic ls %matplotlib inline %%capture capt from __future__ import print_function import sys print('Hello stdout') print('and stderr', file=sys.stderr) capt.stdout, capt.stderr capt.show() %%script python import sys print 'hello from Python %s' % sys.version %%bash echo "hello from $BASH" %%script ./lnum.py my first line my second more a = 3 b = 4 a + b a*b a - b _ ___ _49 Out[62] _i In[50] !python --version !ping www.google.com import time time.sleep(10) import sys from ctypes import CDLL # This will crash a Linux or Mac system; equivalent calls can be made on Windows dll = 'dylib' if sys.platform == 'darwin' else 'so.6' libc = CDLL("libc.%s" % dll) libc.time(-1) # BOOM!! !python --version !ipython --version %load http://matplotlib.sourceforge.net/mpl_examples/pylab_examples/integral_demo.py %pdb !ipython nbconvert mystuff.ipynb --to pdf #Note that I had to install cython to get this to work. # try doing 'conda update cython' if you get an error %load_ext Cython %%cython cimport numpy cpdef cysum(numpy.ndarray[double] A): Compute the sum of an array cdef double a=0 for i in range(A.shape[0]): a += A[i] return a def pysum(A): Compute the sum of an array a = 0 for i in range(A.shape[0]): a += A[i] return a import numpy as np for sz in (100, 1000, 10000): A = np.random.random(sz) print("==>Python %i" % sz, end=' ') %timeit pysum(A) print("==>np.sum %i" % sz, end=' ') %timeit A.sum() print("==>Cython %i" % sz, end=' ') %timeit cysum(A) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: We load a famous social graph published in 1977, called Zachary's Karate club graph. This graph represents the friendships between members of a Karate Club. The club's president and the instructor were involved in a dispute, resulting in a split-up of this group. Here, we simply display the graph with matplotlib (using networkx.draw()). Step2: Now, we're going to display this graph in the notebook with d3.js. The first step is to bring this graph to Javascript. We choose here to export the graph in JSON. Note that d3.js generally expects each edge to be an object with a source and a target. Also, we specify which side each member has taken (club attribute). Step3: The next step is to create an HTML object that will contain the visualization. Here, we create a &lt;div&gt; element in the notebook. We also specify a few CSS styles for nodes and links (also called edges). Step4: The last step is trickier. We write the Javascript code to load the graph from the JSON file, and display it with d3.js. Knowing the basics of d3.js is required here (see the documentation of d3.js). We also give detailled explanations in the code comments below. (http
<ASSISTANT_TASK:> Python Code: import json import numpy as np import networkx as nx import matplotlib.pyplot as plt %matplotlib inline g = nx.karate_club_graph() plt.figure(figsize=(6,4)); nx.draw(g) from networkx.readwrite import json_graph data = json_graph.node_link_data(g) with open('graph.json', 'w') as f: json.dump(data, f, indent=4) %%html <div id="d3-example"></div> <style> .node {stroke: #fff; stroke-width: 1.5px;} .link {stroke: #999; stroke-opacity: .6;} </style> %%javascript // We load the d3.js library from the Web. require.config({paths: {d3: "http://d3js.org/d3.v3.min"}}); require(["d3"], function(d3) { // The code in this block is executed when the // d3.js library has been loaded. // First, we specify the size of the canvas containing // the visualization (size of the <div> element). var width = 300, height = 300; // We create a color scale. var color = d3.scale.category10(); // We create a force-directed dynamic graph layout. var force = d3.layout.force() .charge(-120) .linkDistance(30) .size([width, height]); // In the <div> element, we create a <svg> graphic // that will contain our interactive visualization. var svg = d3.select("#d3-example").select("svg") if (svg.empty()) { svg = d3.select("#d3-example").append("svg") .attr("width", width) .attr("height", height); } // We load the JSON file. d3.json("graph.json", function(error, graph) { // In this block, the file has been loaded // and the 'graph' object contains our graph. // We load the nodes and links in the force-directed // graph. force.nodes(graph.nodes) .links(graph.links) .start(); // We create a <line> SVG element for each link // in the graph. var link = svg.selectAll(".link") .data(graph.links) .enter().append("line") .attr("class", "link"); // We create a <circle> SVG element for each node // in the graph, and we specify a few attributes. var node = svg.selectAll(".node") .data(graph.nodes) .enter().append("circle") .attr("class", "node") .attr("r", 5) // radius .style("fill", function(d) { // The node color depends on the club. return color(d.club); }) .call(force.drag); // The name of each node is the node number. node.append("title") .text(function(d) { return d.name; }); // We bind the positions of the SVG elements // to the positions of the dynamic force-directed graph, // at each time step. force.on("tick", function() { link.attr("x1", function(d) { return d.source.x; }) .attr("y1", function(d) { return d.source.y; }) .attr("x2", function(d) { return d.target.x; }) .attr("y2", function(d) { return d.target.y; }); node.attr("cx", function(d) { return d.x; }) .attr("cy", function(d) { return d.y; }); }); }); }); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let us set up imports and parameters in one place for the cluster and the local engine Step2: Load an image Step3: Resize the image with default downsampling Step4: LANCZOS anti-aliasing method is recommended for downsampling by PIL tutorial, but is much slower Step5: Save the resized image. Step6: Let us define functions that do the above in one go for all files Step7: For quick and dirty experiments we can use the default downsampling. Step8: Since the processing is dominated by the CPU-bound resizing we can benefit from parallelization
<ASSISTANT_TASK:> Python Code: from IPython.parallel import Client rc = Client() print "Using cluster with %d engines." % len(rc.ids) %%px --local import os import os.path from PIL import Image src_dir = "/kaggle/retina/sample" # source directory of images to resize trg_dir = "/kaggle/retina/resized" # target directory of the resized images prefix = "resized_" # string to prepend to the resized file name hsize = 256 # horizontal size of the resized image vsize = 256 # vertical size of the resized image all_files = filter(lambda x: x.endswith(".jpeg"), os.listdir(src_dir)) filename = all_files[0] filepath = os.path.join(src_dir, filename) %timeit -n1 -r1 Image.open(filepath) im = Image.open(filepath) %timeit im.resize((hsize, vsize)) resized_im = im.resize((hsize, vsize), Image.NEAREST) %timeit im.resize((hsize, vsize), Image.LANCZOS) if not os.path.exists(trg_dir): os.makedirs(trg_dir) resized_filepath = os.path.join(trg_dir, prefix + filename) %timeit -n1 -r1 resized_im.save(resized_filepath, "JPEG", quality = 100) %%px --local def resize_method(filename, method): filepath = os.path.join(src_dir, filename) im = Image.open(filepath) resized_im = im.resize((hsize, vsize), method) resized_filepath = os.path.join(trg_dir, prefix + filename) resized_im.save(resized_filepath, "JPEG", quality = 100) def resize_NEAREST(filename): resize_method(filename, Image.NEAREST) def resize_LANCZOS(filename): resize_method(filename, Image.LANCZOS) %timeit -n1 -r1 map(resize_NEAREST, all_files) %timeit -n1 -r1 map(resize_LANCZOS, all_files) v = rc[:] %timeit -n1 -r1 v.map_sync(resize_NEAREST, all_files) %timeit -n1 -r1 v.map_sync(resize_LANCZOS, all_files) <END_TASK>