text_prompt
stringlengths
168
30.3k
code_prompt
stringlengths
67
124k
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: <h4>Training and Evaluation Set</h4> Step2: <h4>Test Set</h4> Step3: <h4>Read the target predicted by AWS ML</h4> Step4: <h4>AWS ML Estimated/Predicted</h4> Step5: <h4>Plot actual value and predicted value</h4> Step6: <h4>Predicted value has lot more noise</h4>
<ASSISTANT_TASK:> Python Code: def straight_line(x): return 5 * x + 8 straight_line(25) straight_line(1.254) np.random.seed(5) samples = 150 x_vals = pd.Series(np.random.rand(samples) * 20) y_vals = x_vals.map(straight_line) # Add random noise y_noisy_vals = y_vals + np.random.randn(samples) * 3 df = pd.DataFrame({'x': x_vals, 'y':y_vals, 'y_noisy': y_noisy_vals}) df.head() # Correlation will indicate how strongly features are related to the output df.corr() fig = plt.figure(figsize = (12, 8)) plt.scatter(x = df.x, y = df.y, label = 'ideal fit') plt.scatter(x = df.x, y = df.y_noisy, color = 'r', marker = '+', label = 'Target') plt.grid(True) plt.xlabel('Input Feature') plt.ylabel('Target') plt.legend() data_path = '..\Data\RegressionExamples\straight_line' df.to_csv(os.path.join(data_path, 'straight_line_example_all.csv'), index = True, index_label = 'Row') # 130 rows for Training + Eval Set df[df.index < 130].to_csv(os.path.join(data_path,'straight_line_noisy_example_train.csv'), index = True, index_label = 'Row' ,columns = ['x','y_noisy']) # run all the samples for prediction df.to_csv(os.path.join(data_path, 'straight_line_example_test_all.csv'), index = True, index_label = 'Row', columns = 'x') df_predicted = pd.read_csv('./output/bp-oDvVSUKSpPe-straight_line_example_test_all.csv.gz') df_predicted.head() df_predicted.columns = ["Row", "y_predicted"] df_predicted.index = df_predicted.Row df_predicted.head() fig = plt.figure(figsize = (12, 8)) plt.scatter(x = df.x, y = df.y_noisy, color = 'r', label = 'actual',) plt.scatter(x = df.x, y = df_predicted.y_predicted, color = 'b', label = 'predicted') plt.grid(True) plt.legend() # Training Data Residuals residuals = (df_predicted.y_predicted - df.y_noisy) fig = plt.figure(figsize = (12, 8)) plt.hist(residuals) plt.grid(True) plt.xlabel('(Predicted - Actual)') plt.ylabel('Count') plt.title('Residuals Distribution') plt.axvline(color = 'g') # left of 0 = prediction < actual # right of 0 = prediction > actual fig = plt.figure(figsize = (12, 8)) plt.boxplot([df.y_noisy, df_predicted.y_predicted], labels = ['actual','predicted']) plt.title('Box Plot - Actual, Predicted') plt.ylabel('Target') plt.grid(True) df_predicted_numeric = pd.read_csv('./output-numeric/bp-VNV4qb98Jmd-straight_line_example_test_all.csv.gz') df_predicted_numeric.columns = ["Row", "y_predicted"] df_predicted_numeric.head() fig = plt.figure(figsize = (12, 8)) plt.scatter(x = df.x, y = df.y_noisy, color = 'r', label = 'actual',) plt.scatter(x = df.x, y = df_predicted.y_predicted, color = 'k', label = 'predicted bin') plt.scatter(x = df.x, y = df_predicted_numeric.y_predicted, color = 'b', label = 'predicted num') plt.legend() fig = plt.figure(figsize = (12, 8)) plt.boxplot([df.y_noisy, df_predicted.y_predicted, df_predicted_numeric.y_predicted], labels = ['actual','predicted-bin','predicted-numeric']) plt.title('Box Plot - Actual, Predicted') plt.ylabel('Target') plt.grid(True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2) What's the current wind speed? How much warmer does it feel than it actually is? Step2: 3) The first daily forecast is the forecast for today. For the place you decided on up above, how much of the moon is currently visible? Step3: 4) What's the difference between the high and low temperatures for today? Step4: 5) Loop through the daily forecast, printing out the next week's worth of predictions. I'd like to know the high temperature for each day, and whether it's hot, warm, or cold, based on what temperatures you think are hot, warm or cold. Step5: 6) What's the weather looking like for the rest of today in Miami, Florida? I'd like to know the temperature for every hour, and if it's going to have cloud cover of more than 0.5 say "{temperature} and cloudy" instead of just the temperature. Step6: 7) What was the temperature in Central Park on Christmas Day, 1980? How about 1990? 2000?
<ASSISTANT_TASK:> Python Code: import requests url="https://api.forecast.io/forecast/64f4867f7d4c86182f3d1c6ed881dbfc/17.3850,78.4867" response=requests.get(url) data=response.json() data.keys() data['currently'].keys() print("The current wind speed is",data['currently']['windSpeed'],"miles per hour.") apparentTemperature=data['currently']['apparentTemperature'] temperature=data['currently']['temperature'] if apparentTemperature-temperature > 0: print("It feels", "%.2f" %(apparentTemperature-temperature),"degrees warmer.") else: print("It feels", "%.2f" %(temperature-apparentTemperature),"degrees cooler.") data['daily'].keys() mooncover=data['daily']['data'][0]['moonPhase'] if mooncover == 0: print("Today is a new moon day. The mooncover is",mooncover) if mooncover > 0 and mooncover <0.25: print("The moon is in waxing crescent phase. The mooncover is",mooncover) if mooncover == 0.25: print("Today is a first quarter moon. The mooncover is",mooncover) if mooncover > 0.25 and mooncover <0.5: print("The moon is in waxing gibbous phase. The mooncover is",mooncover) if mooncover == 0.5: print("Today is a full moon day. The mooncover is",mooncover) if mooncover > 0.5 and mooncover<0.75: print("The moon is in waning gibbous phase. The mooncover is",mooncover) if mooncover == 0.75: print("Today is a last quarter moon. The mooncover is",mooncover) if mooncover >0.75: print("The moon is in waning crescent phase. The mooncover is",mooncover) low=data['daily']['data'][0]['temperatureMin'] print("The low temperature is",low) high=data['daily']['data'][0]['temperatureMax'] print("The high temperature is",high) print("There is a difference of",high-low,"degrees between the high and low temperatures today.") x=0 hotlimit=86 warmlimit=68 for date in data['daily']['data']: if data['daily']['data'][x]['temperatureMax'] > hotlimit: print("The high for day",x,"of the mext week is",data['daily']['data'][x]['temperatureMax'],"Fahrenheit") print("It's a hot day. ") if data['daily']['data'][x]['temperatureMax'] < hotlimit and data['daily']['data'][x]['temperatureMax'] > warmlimit : print("The high for day",x,"of the mext week is",data['daily']['data'][x]['temperatureMax'],"Fahrenheit") print("It's a warm day. ") if data['daily']['data'][x]['temperatureMax'] < warmlimit: print("The high for day",x,"of the mext week is",data['daily']['data'][x]['temperatureMax'],"Fahrenheit") print("It's a cold day. ") x=x+1 import requests url="https://api.forecast.io/forecast/64f4867f7d4c86182f3d1c6ed881dbfc/25.7617,-80.1918" miamiresponse=requests.get(url) miamidata=miamiresponse.json() miamidata.keys() noofhoursinaday=0 miamidata['hourly']['data'] for count in miamidata['hourly']['data']: if miamidata['hourly']['data'][noofhoursinaday]['cloudCover'] > 0.5: print("The temperature for hour",noofhoursinaday+1,"is",miamidata['hourly']['data'][noofhoursinaday]['temperature'],"degrees F and cloudy.") else: print("The temperature for hour",noofhoursinaday+1,"is",miamidata['hourly']['data'][noofhoursinaday]['temperature'],"degrees F.") noofhoursinaday=noofhoursinaday+1 if noofhoursinaday>23: break import requests timestamp='346550400' url="https://api.forecast.io/forecast/64f4867f7d4c86182f3d1c6ed881dbfc/40.7829,-73.9654,"+timestamp cpresponse=requests.get(url) cpdata=cpresponse.json() print("The temperature at midnight of Christmas in 1980 was",cpdata['currently']['temperature'],"degrees F") import requests timestamp='662083200' url="https://api.forecast.io/forecast/64f4867f7d4c86182f3d1c6ed881dbfc/40.7829,-73.9654,"+timestamp cpresponse=requests.get(url) cpdata=cpresponse.json() print("The temperature at midnight of Christmas in 1990 was",cpdata['currently']['temperature'],"degrees F") import requests timestamp='977702400' url="https://api.forecast.io/forecast/64f4867f7d4c86182f3d1c6ed881dbfc/40.7829,-73.9654,"+timestamp cpresponse=requests.get(url) cpdata=cpresponse.json() print("The temperature at midnight of Christmas in 2000 was",cpdata['currently']['temperature'],"degrees F") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load capacity curves Step2: Load ground motion records Step3: Load damage state thresholds Step4: Calculate fragility function Step5: Fit lognormal CDF fragility curves Step6: Plot fragility functions Step7: Save fragility functions
<ASSISTANT_TASK:> Python Code: import numpy from rmtk.vulnerability.common import utils from rmtk.vulnerability.derivation_fragility.NLTHA_on_SDOF import MSA_utils from rmtk.vulnerability.derivation_fragility.NLTHA_on_SDOF.read_pinching_parameters import read_parameters from rmtk.vulnerability.derivation_fragility.NLTHA_on_SDOF import double_MSA_on_SDOF %matplotlib inline capacity_curves_file = '/Users/chiaracasotto/GitHub/rmtk_data/2MSA/capacity_curves.csv' sdof_hysteresis = "/Users/chiaracasotto/GitHub/rmtk_data/pinching_parameters.csv" capacity_curves = utils.read_capacity_curves(capacity_curves_file) capacity_curves = utils.check_SDOF_curves(capacity_curves) utils.plot_capacity_curves(capacity_curves) hysteresis = read_parameters(sdof_hysteresis) gmrs_folder = '../../../../../rmtk_data/MSA_records' number_models_in_DS = 1 no_bins = 2 no_rec_bin = 10 damping_ratio = 0.05 minT = 0.1 maxT = 2 filter_aftershocks = 'FALSE' Mw_multiplier = 0.92 waveform_path = '../../../../../rmtk_data/2MSA/waveform.csv' gmrs = utils.read_gmrs(gmrs_folder) gmr_characteristics = MSA_utils.assign_Mw_Tg(waveform_path, gmrs, Mw_multiplier, damping_ratio, filter_aftershocks) #utils.plot_response_spectra(gmrs,minT,maxT) damage_model_file = "/Users/chiaracasotto/GitHub/rmtk_data/2MSA/damage_model_ISD.csv" damage_model = utils.read_damage_model(damage_model_file) degradation = False record_scaled_folder = "../../../../../rmtk_data/2MSA/Scaling_factors" msa = MSA_utils.define_2MSA_parameters(no_bins,no_rec_bin,record_scaled_folder,filter_aftershocks) PDM, Sds, gmr_info = double_MSA_on_SDOF.calculate_fragility( capacity_curves, hysteresis, msa, gmrs, gmr_characteristics, damage_model, damping_ratio,degradation, number_models_in_DS) IMT = 'Sa' T = 0.47 #T = numpy.arange(0.4,1.91,0.01) regression_method = 'max likelihood' fragility_model = MSA_utils.calculate_fragility_model_damaged( PDM,gmrs,gmr_info,IMT,msa,damage_model, T,damping_ratio, regression_method) minIML, maxIML = 0.01, 4 MSA_utils.plot_fragility_model(fragility_model,damage_model,minIML, maxIML) output_type = "csv" output_path = "../../../../../rmtk_data/2MSA/" minIML, maxIML = 0.01, 4 tax = 'RC' MSA_utils.save_mean_fragility(fragility_model,damage_model,tax,output_type,output_path,minIML, maxIML) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Import section specific modules Step2: 3.2 Hour Angle (HA) and Local Sidereal Time (LST)
<ASSISTANT_TASK:> Python Code: import numpy as np import matplotlib.pyplot as plt %matplotlib inline from IPython.display import HTML HTML('../style/course.css') #apply general CSS from IPython.display import HTML import ephem import matplotlib %pylab inline pylab.rcParams['figure.figsize'] = (15, 10) import matplotlib HTML('../style/code_toggle.html') #Setting up the observer JB = ephem.Observer() JB.lat = '53:14:10' JB.lon = '-02:18:26' JB.elevation = 0.0 months = ["Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec"] h_number = np.zeros((14,),dtype=float) #Calculating the lst at differnt times of the year for k in xrange(1,14): if k < 10: JB.date = '2016/'+str(k)+'/22 23:59:59' str_sid = str(JB.sidereal_time()).split(":") h_number[k-1] = float(str_sid[0]) + float(str_sid[1])/60. + float(str_sid[2])/3600. elif k > 10: JB.date = '2016/'+str(k-1)+'/22 23:59:59' str_sid = str(JB.sidereal_time()).split(":") h_number[k-1] = float(str_sid[0]) + float(str_sid[1])/60. + float(str_sid[2])/3600 #Plot matplotlib.rcParams.update({'font.size': 13.75}) fig, ax = plt.subplots() h_number[-1] = h_number[0] x = np.arange(14) x[9:] = x[9:]-1 ax.plot(x,h_number) ax.set_ylim([0,24]) ticks = np.array([0,2,4,6,8,10,12,14,16,18,20,22,24]) plt.yticks(ticks) labels = [item.get_text() for item in ax.get_xticklabels()] labels = np.array(["Jan","Mar","May","Jul","Sep","Nov","Jan"]) ax.set_xticklabels(labels) labels = [item.get_text() for item in ax.get_yticklabels()] labels = np.array(['$0^h$','$2^h$','$4^h$','$6^h$','$8^h$','$10^h$','$12^h$','$14^h$','$16^h$','$18^h$','$20^h$','$22^h$','$24^h$']) ax.set_yticklabels(labels) plt.grid('on') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Ahora vamos a eliminar todo aquello que no se consideren cadenas de texto válidas. Para ello definiremos una función que elimine aquello que no queremos contabilizar. Step2: Ahora vamos a crear el primer RDD del contenido del libro.
<ASSISTANT_TASK:> Python Code: fileName='book.txt' import re def removePunctuation(text): return re.sub('[^a-z| |0-9]', '', text.strip().lower()) shakespeareRDD = (sc .textFile(fileName, 8) .map(removePunctuation)) shakespeareRDD.take(4) print '\n'.join(shakespeareRDD .zipWithIndex() # to (line, lineNum) .map(lambda (l, num): '{0}: {1}'.format(num, l)) # to 'lineNum: line' .take(15)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Read in matched Gene expression data. Step2: Run a simple screen for DX probes Step3: Pathway and Gene Annotation Analysis Step4: Overexpressed pathways Step5: Underexpressed pathways Step6: I am folling up on Fatty Acid Metabolism as opposed to biological oxidations, because it has a larger effect size, although the smaller gene-set size gives it a less extreme p-value.
<ASSISTANT_TASK:> Python Code: import NotebookImport from Imports import * import seaborn as sns sns.set_context('paper',font_scale=1.5) sns.set_style('white') matched_rna = pd.read_hdf('/data_ssd/RNASeq_2014_07_15.h5', 'matched_tn') rna_microarray = pd.read_hdf('/data_ssd/GEO_microarray_dx.h5', 'data') matched_rna = rna_microarray.join(matched_rna) dx_rna = binomial_test_screen(matched_rna, fc=1.) dx_rna = dx_rna[dx_rna.num_dx > 300] dx_rna.frac.hist(bins=30) dx_rna.ix[['ADH1A','ADH1B','ADH1C']] dx_rna.shape dx_rna.p.rank().ix[['ADH1A','ADH1B','ADH1C']] dx_rna.sort('p').head(10) paired_bp_tn_split(matched_rna.ix['ADH1B'], codes, data_type='mRNA') gs2 = gene_sets.ix[dx_rna.index].fillna(0) rr = screen_feature(dx_rna.frac, rev_kruskal, gs2.T, align=False) fp = (1.*gene_sets.T * dx_rna.frac).T.dropna().replace(0, np.nan).mean().order() fp.name = 'mean frac' rr.ix[ti(fp > .5)].join(fp).sort('p').head() rr.ix[ti(fp < .5)].join(fp).sort('p').head() def fig_1f(ax): v = pd.concat([dx_rna.frac, dx_rna.frac.ix[ti(gs2['REACTOME_CELL_CYCLE_MITOTIC']>0)], dx_rna.frac.ix[ti(gs2['KEGG_FATTY_ACID_METABOLISM']>0)]]) v1 = pd.concat([pd.Series('All Genes', dx_rna.frac.index), pd.Series('Cell Cycle\nMitotic', ti(gs2['REACTOME_CELL_CYCLE_MITOTIC']>0)), pd.Series('Fatty Acid\nMetabolism', ti(gs2['KEGG_FATTY_ACID_METABOLISM']>0))]) v1.name = '' v.name = 'Fraction Overexpressed' violin_plot_pandas(v1, v, ann=None, ax=ax) prettify_ax(ax) return ax #Do not import fig, ax = subplots(1,1, figsize=(5,3)) fig_1f(ax); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Generate some data Step2: Let's try adding Gaussian (normal) noise... Step3: ... or some Cauchy (heavy-tailed) noise Step4: Trying to recover the linear function using Ridge regression Step5: Cauchy noise Step6: That looks much less impressive. The problem is that the squared-$\ell^2$-norm minimized by Ridge regression is too sensitive to outliers. Step7: $\ell^1$ cost Step8: Japanese cost
<ASSISTANT_TASK:> Python Code: from __future__ import print_function import numpy as np from sklearn.linear_model import Ridge from flexible_linear import FlexibleLinearRegression import matplotlib import matplotlib.pyplot as plt matplotlib.style.use('ggplot') %matplotlib inline np.random.seed(1) N = 500 A = 50 B = 3 x = np.linspace(0, 100, N, dtype=float) X = x.reshape(-1, 1) # scikit-learn wants 2d arrays y = A + B * x plt.plot(x, y, '-') y_gauss = y + 20*np.random.randn(N) plt.plot(x, y, '-', x, y_gauss, '-') plt.legend(['True', 'Noisy'], loc='upper left') y_cauchy = y + 20*np.random.standard_cauchy(N) plt.plot(x, y, '-', x, y_cauchy, '.') plt.legend(['True', 'Noisy'], loc='lower right') clf = Ridge() clf.fit(X, y_gauss) pred = clf.predict(X) plt.plot(x, y, '-', x, pred, '-') plt.legend(['True', 'Recovered'], loc='upper left') print(" True: %.3f + %.3f * x" % (A, B)) print("Recovered: %.3f + %.3f * x" % (clf.intercept_, clf.coef_[0])) clf = Ridge() clf.fit(X, y_cauchy) pred = clf.predict(X) plt.plot(x, y, '-', x, pred, '-') plt.legend(['True', 'Recovered'], loc='upper left') print(" True: %.3f + %.3f * x" % (A, B)) print("Recovered: %.3f + %.3f * x" % (clf.intercept_, clf.coef_[0])) clf = FlexibleLinearRegression(cost_func='l2', C=0.0) clf.fit(X, y_cauchy) pred = clf.predict(X) plt.plot(x, y, '-', x, pred, '-') plt.legend(['True', 'Recovered'], loc='upper left') print(" True: %.3f + %.3f * x" % (A, B)) print("Recovered: %.3f + %.3f * x" % (clf.coef_[0], clf.coef_[1])) clf = FlexibleLinearRegression(cost_func='l1', C=0.0) clf.fit(X, y_cauchy) pred = clf.predict(X) plt.plot(x, y, '-', x, pred, '-') plt.legend(['True', 'Recovered'], loc='upper left') print(" True: %.3f + %.3f * x" % (A, B)) print("Recovered: %.3f + %.3f * x" % (clf.coef_[0], clf.coef_[1])) clf = FlexibleLinearRegression(cost_func='japanese', C=0.0, cost_opts={'eta': 10.0}) clf.fit(X, y_cauchy) pred = clf.predict(X) plt.plot(x, y, '-', x, pred, '-') plt.legend(['True', 'Recovered'], loc='upper left') print(" True: %.3f + %.3f * x" % (A, B)) print("Recovered: %.3f + %.3f * x" % (clf.coef_[0], clf.coef_[1])) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Q1 - échantillon aléatoire Step2: Q1 - dessiner le nuage de points - donnée Step3: Q2 - tri Step4: Q3 - moyenne Step5: Q4 - distance Step6: Q5 - fonction comme paramètre Step7: Ecrire la fonction précédente en utilisant la fonction fct. Step8: Q6 - optimiser Step9: Le premier point de coupure trouvé (le trait orange) correspond à un des bords d'un des escaliers. Step10: Q8 - fonction récursive Step11: Q9 - coût Step12: L'instruction suivante permet de voir où le programme passe la majeure partie de son temps. Step13: La fonction sum cache une boucle, avec la boucle for dans la fonction optimise, cela explique le coût en $O(n^2)$. Le fait qu'à chaque itération, on passe une observation d'un côté à l'autre de la coupure puis on recalcule les moyennes... Il y a deux façons d'optimiser ce calcul selon qu'on tient compte du fait que les valeurs de $Y$ sont binaires ou non. Step14: C'est carrément plus rapide et cela marche pour toute fonction fct. Step15: Si on ne suppose pas que les $Y_i$ sont binaires et qu'ils sont quelconques, les histogrammes contiendront plus de deux éléments. Dans ce cas, il faut conserver deux tableaux triés des $Y_i$, de part et d'autres de la coupure. Lorsqu'on bouge la coupure $k$, cela revient à déplacer $Y_k$ d'un tableau à l'autre ce qui se fera par recherche dichotomique donc en $O(\ln n)$. La mise à jour de la moyenne des valeurs absolues est immédiate si la fonction fct=abs(x-y) et pas forcément immédiate dans le cas général. Lorsque c'est une valeur absolue, il faut utiliser quelques résultats sur la régression quantile.
<ASSISTANT_TASK:> Python Code: from jyquickhelper import add_notebook_menu add_notebook_menu() import random X = [random.random() * 16 for i in range(0,1000)] Y = [ int(x**0.5) % 2 for x in X] %matplotlib inline import matplotlib.pyplot as plt plt.plot(X, Y, '.') nuage = [(x,y) for x,y in zip(X,Y)] nuage.sort() nuage[:5] def somme_diff(xy, i, j): m = sum(e[1] for e in xy[i:j]) / (j-i) return sum(abs(e[1]-m) for e in xy[i:j]) somme_diff(nuage, 0, 5), somme_diff(nuage, 0, len(nuage)) def difference(nuage, i, j, k): m1 = somme_diff(nuage, i, k) m2 = somme_diff(nuage, k, j) m = somme_diff(nuage, i, j) return abs(m1+m2-m) difference(nuage, 0, len(nuage), 100) def fct(x, y): return abs(x-y) def distance_list(list_x, list_y, f): return sum(f(x,y) for x,y in zip(list_x, list_y)) distance_list([0, 1], [0, 2], fct) def somme_diff(xy, i, j, f): m = sum(e[1] for e in xy[i:j]) / (j-i) # On a modifié les fonctions précédentes pour calculer # une fonction d'erreur "custom" ou définie par l'utilisateur. return sum(f(e[1], m) for e in xy[i:j]) def difference(nuage, i, j, k, f): m1 = somme_diff(nuage, i, k, f) m2 = somme_diff(nuage, k, j, f) m = somme_diff(nuage, i, j, f) return abs(m - m1) + abs(m - m2) difference(nuage, 0, len(nuage), 100, fct) def optimise(nuage, i, j, f): mx = -1 ib = None for k in range(i+1,j-1): d = difference(nuage, i,j,k, f) if ib is None or d > mx: mx = d ib = k if ib is None: # Au cas où l'intervalle est vide, on retourne une coupure # égale à i. ib = i mx = 0 return ib, mx optimise(nuage, 0, len(nuage), fct) import matplotlib.pyplot as plt x = nuage[552][0] plt.plot(X,Y,'.') plt.plot([x,x], [0,1]) optimise(nuage, 0, 68, fct), optimise(nuage, 68, len(nuage), fct) import matplotlib.pyplot as plt x = nuage[58][0] x2 = nuage[552][0] plt.plot(X,Y,'.') plt.plot([x,x], [0,1]) plt.plot([x2,x2], [0,1]) def recursive(nuage, i, j, f, th=0.1): k, mx = optimise(nuage, i, j, f) if mx <= th: return None r1 = recursive(nuage, i, k, f, th=th) r2 = recursive(nuage, k, j, f, th=th) if r1 is None and r2 is None: return [k] elif r1 is None: return [k] + r2 elif r2 is None: return r1 + [k] else: return r1 + [k] + r2 r = recursive(nuage, 0, len(nuage), fct) r import matplotlib.pyplot as plt plt.plot(X, Y, '.') for i in r: x = nuage[i][0] plt.plot([x,x], [0,1]) def somme_diff_abs(xy, i, j): m = sum(e[1] for e in xy[i:j]) / (j-i) return sum(abs(e[1]-m) for e in xy[i:j]) def difference_abs(nuage, i, j, k): m1 = somme_diff_abs(nuage, i, k) m2 = somme_diff_abs(nuage, k, j) m = somme_diff_abs(nuage, i, j) return abs(m1+m2-m) def optimise_abs(nuage, i, j): mx = -1 ib = None for k in range(i+1,j-1): d = difference_abs(nuage, i,j,k) if ib is None or d > mx: mx = d ib = k if ib is None: ib = i mx = 0 return ib, mx %timeit optimise_abs(nuage, 0, len(nuage)) # %prun optimise_abs(nuage, 0, len(nuage)) def histogramme_y(xy, i, j): d = [0, 0] for x, y in xy[i:j]: d[y] += 1 return d def somme_diff_histogramme(d): m = d[1] * 1.0 / (d[0] + d[1]) return (1-m) * d[1] + m * d[0] def optimise_rapide(nuage, i, j): # On calcule les histogrammes. d1 = histogramme_y(nuage, i, i+1) d2 = histogramme_y(nuage, i+1, j) d = d1.copy() d[0] += d2[0] d[1] += d2[1] m = somme_diff_histogramme(d) m1 = somme_diff_histogramme(d1) m2 = somme_diff_histogramme(d2) mx = -1 ib = None for k in range(i+1,j-1): d = abs(m1+m2-m) if ib is None or d > mx: mx = d ib = k # On met à jour les histogrammes. On ajoute d'un côté, on retranche de l'autre. y = nuage[k][1] d1[y] += 1 d2[y] -= 1 m1 = somme_diff_histogramme(d1) m2 = somme_diff_histogramme(d2) if ib is None: ib = i mx = 0 return ib, mx # On vérifie qu'on obtient les mêmes résultats. optimise_rapide(nuage, 0, len(nuage)), optimise_abs(nuage, 0, len(nuage)) %timeit optimise_rapide(nuage, 0, len(nuage)) import random X2 = list(range(10)) Y2 = X2 import matplotlib.pyplot as plt plt.plot(X2,Y2,'.') nuage2 = [(x,y) for x,y in zip(X2,Y2)] nuage2.sort() r = recursive(nuage2, 0, len(nuage2), fct) len(r), r import matplotlib.pyplot as plt plt.plot(X2,Y2,'.') for i in r: x = nuage2[i][0] plt.plot([x,x], [0,10]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 2. Key Properties --&gt; Variables Step7: 3. Key Properties --&gt; Seawater Properties Step8: 3.2. Ocean Freezing Point Value Step9: 4. Key Properties --&gt; Resolution Step10: 4.2. Canonical Horizontal Resolution Step11: 4.3. Number Of Horizontal Gridpoints Step12: 5. Key Properties --&gt; Tuning Applied Step13: 5.2. Target Step14: 5.3. Simulations Step15: 5.4. Metrics Used Step16: 5.5. Variables Step17: 6. Key Properties --&gt; Key Parameter Values Step18: 6.2. Additional Parameters Step19: 7. Key Properties --&gt; Assumptions Step20: 7.2. On Diagnostic Variables Step21: 7.3. Missing Processes Step22: 8. Key Properties --&gt; Conservation Step23: 8.2. Properties Step24: 8.3. Budget Step25: 8.4. Was Flux Correction Used Step26: 8.5. Corrected Conserved Prognostic Variables Step27: 9. Grid --&gt; Discretisation --&gt; Horizontal Step28: 9.2. Grid Type Step29: 9.3. Scheme Step30: 9.4. Thermodynamics Time Step Step31: 9.5. Dynamics Time Step Step32: 9.6. Additional Details Step33: 10. Grid --&gt; Discretisation --&gt; Vertical Step34: 10.2. Number Of Layers Step35: 10.3. Additional Details Step36: 11. Grid --&gt; Seaice Categories Step37: 11.2. Number Of Categories Step38: 11.3. Category Limits Step39: 11.4. Ice Thickness Distribution Scheme Step40: 11.5. Other Step41: 12. Grid --&gt; Snow On Seaice Step42: 12.2. Number Of Snow Levels Step43: 12.3. Snow Fraction Step44: 12.4. Additional Details Step45: 13. Dynamics Step46: 13.2. Transport In Thickness Space Step47: 13.3. Ice Strength Formulation Step48: 13.4. Redistribution Step49: 13.5. Rheology Step50: 14. Thermodynamics --&gt; Energy Step51: 14.2. Thermal Conductivity Step52: 14.3. Heat Diffusion Step53: 14.4. Basal Heat Flux Step54: 14.5. Fixed Salinity Value Step55: 14.6. Heat Content Of Precipitation Step56: 14.7. Precipitation Effects On Salinity Step57: 15. Thermodynamics --&gt; Mass Step58: 15.2. Ice Vertical Growth And Melt Step59: 15.3. Ice Lateral Melting Step60: 15.4. Ice Surface Sublimation Step61: 15.5. Frazil Ice Step62: 16. Thermodynamics --&gt; Salt Step63: 16.2. Sea Ice Salinity Thermal Impacts Step64: 17. Thermodynamics --&gt; Salt --&gt; Mass Transport Step65: 17.2. Constant Salinity Value Step66: 17.3. Additional Details Step67: 18. Thermodynamics --&gt; Salt --&gt; Thermodynamics Step68: 18.2. Constant Salinity Value Step69: 18.3. Additional Details Step70: 19. Thermodynamics --&gt; Ice Thickness Distribution Step71: 20. Thermodynamics --&gt; Ice Floe Size Distribution Step72: 20.2. Additional Details Step73: 21. Thermodynamics --&gt; Melt Ponds Step74: 21.2. Formulation Step75: 21.3. Impacts Step76: 22. Thermodynamics --&gt; Snow Processes Step77: 22.2. Snow Aging Scheme Step78: 22.3. Has Snow Ice Formation Step79: 22.4. Snow Ice Formation Scheme Step80: 22.5. Redistribution Step81: 22.6. Heat Diffusion Step82: 23. Radiative Processes Step83: 23.2. Ice Radiation Transmission
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'nerc', 'sandbox-3', 'seaice') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.model.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.model.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.variables.prognostic') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Sea ice temperature" # "Sea ice concentration" # "Sea ice thickness" # "Sea ice volume per grid cell area" # "Sea ice u-velocity" # "Sea ice v-velocity" # "Sea ice enthalpy" # "Internal ice stress" # "Salinity" # "Snow temperature" # "Snow depth" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.seawater_properties.ocean_freezing_point') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "TEOS-10" # "Constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.seawater_properties.ocean_freezing_point_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.canonical_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.resolution.number_of_horizontal_gridpoints') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.target') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.simulations') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.metrics_used') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.tuning_applied.variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.key_parameter_values.typical_parameters') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Ice strength (P*) in units of N m{-2}" # "Snow conductivity (ks) in units of W m{-1} K{-1} " # "Minimum thickness of ice created in leads (h0) in units of m" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.key_parameter_values.additional_parameters') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.description') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.on_diagnostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.assumptions.missing_processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.properties') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Energy" # "Mass" # "Salt" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.budget') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.was_flux_correction_used') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.key_properties.conservation.corrected_conserved_prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.grid') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Ocean grid" # "Atmosphere Grid" # "Own Grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.grid_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Structured grid" # "Unstructured grid" # "Adaptive grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Finite differences" # "Finite elements" # "Finite volumes" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.thermodynamics_time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.dynamics_time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.horizontal.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.layering') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Zero-layer" # "Two-layers" # "Multi-layers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.number_of_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.discretisation.vertical.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.has_mulitple_categories') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.number_of_categories') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.category_limits') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.ice_thickness_distribution_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.seaice_categories.other') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.has_snow_on_ice') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.number_of_snow_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.snow_fraction') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.grid.snow_on_seaice.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.horizontal_transport') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Incremental Re-mapping" # "Prather" # "Eulerian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.transport_in_thickness_space') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Incremental Re-mapping" # "Prather" # "Eulerian" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.ice_strength_formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Hibler 1979" # "Rothrock 1975" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.redistribution') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Rafting" # "Ridging" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.dynamics.rheology') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Free-drift" # "Mohr-Coloumb" # "Visco-plastic" # "Elastic-visco-plastic" # "Elastic-anisotropic-plastic" # "Granular" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.enthalpy_formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Pure ice latent heat (Semtner 0-layer)" # "Pure ice latent and sensible heat" # "Pure ice latent and sensible heat + brine heat reservoir (Semtner 3-layer)" # "Pure ice latent and sensible heat + explicit brine inclusions (Bitz and Lipscomb)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.thermal_conductivity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Pure ice" # "Saline ice" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.heat_diffusion') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Conduction fluxes" # "Conduction and radiation heat fluxes" # "Conduction, radiation and latent heat transport" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.basal_heat_flux') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Heat Reservoir" # "Thermal Fixed Salinity" # "Thermal Varying Salinity" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.fixed_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.heat_content_of_precipitation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.energy.precipitation_effects_on_salinity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.new_ice_formation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_vertical_growth_and_melt') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_lateral_melting') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Floe-size dependent (Bitz et al 2001)" # "Virtual thin ice melting (for single-category)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.ice_surface_sublimation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.mass.frazil_ice') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.has_multiple_sea_ice_salinities') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.sea_ice_salinity_thermal_impacts') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.salinity_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Prescribed salinity profile" # "Prognostic salinity profile" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.constant_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.mass_transport.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.salinity_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Prescribed salinity profile" # "Prognostic salinity profile" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.constant_salinity_value') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.salt.thermodynamics.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_thickness_distribution.representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Virtual (enhancement of thermal conductivity, thin ice melting)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_floe_size_distribution.representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Parameterised" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.ice_floe_size_distribution.additional_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.are_included') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.formulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Flocco and Feltham (2010)" # "Level-ice melt ponds" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.melt_ponds.impacts') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Albedo" # "Freshwater" # "Heat" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.has_snow_aging') # PROPERTY VALUE(S): # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.snow_aging_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.has_snow_ice_formation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.snow_ice_formation_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.redistribution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.thermodynamics.snow_processes.heat_diffusion') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Single-layered heat diffusion" # "Multi-layered heat diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.radiative_processes.surface_albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Delta-Eddington" # "Parameterized" # "Multi-band albedo" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.seaice.radiative_processes.ice_radiation_transmission') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Delta-Eddington" # "Exponential attenuation" # "Ice radiation transmission per category" # "Other: [Please specify]" # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: init the connection to the ftp server Step2: What is in the current directory ? Step3: change to the directory of level 4 delayed-time global maps, and list the content. Step4: get one file, and unzip it Step5: close the connection to the ftp server Step6: Now we are going to download several files.
<ASSISTANT_TASK:> Python Code: from ftplib import FTP import os import numpy as np ftp = FTP('ftp.sltac.cls.fr') ftp.login('pprandi','PierreCMEMS2017') ftp.retrlines('LIST') ftp.cwd('Core/SEALEVEL_GLO_PHY_L4_REP_OBSERVATIONS_008_047/dataset-duacs-rep-global-merged-allsat-phy-l4-v3/2016/') ftp.retrlines('LIST') filename="dt_global_allsat_phy_l4_20160925_20170209.nc.gz" downloadDir = "/Users/pierre/Documents/Presentations/210706_CMEMSArctic/data_tmp" fHandle = open("%s/%s" %(downloadDir, filename), "wb") ftp.retrbinary("RETR " + filename , fHandle.write) fHandle.close() os.system("gzip -d %s/%s" %(downloadDir, filename)) ftp.quit() # get back to parent directory on the ftp server ftp = FTP('ftp.sltac.cls.fr') ftp.login('pprandi','PierreCMEMS2017') ftp.cwd('Core/SEALEVEL_GLO_PHY_L4_REP_OBSERVATIONS_008_047/dataset-duacs-rep-global-merged-allsat-phy-l4-v3') # get two files a month for five years for year in np.arange(2010, 2016, 1): ftp.cwd("%4i" %year) remoteFilesList = ftp.nlst() for month in np.arange(1, 13, 1): for day in [1, 15]: print("downloading year %s, month %s, day %s" %(year, month, day)) pattern = "dt_global_allsat_phy_l4_%4i%02i%02i_" %(year, month, day) index = [i for i, elem in enumerate(remoteFilesList) if pattern in elem][0] remoteFilename = remoteFilesList[index] localFilename = "%s/dt_global_allsat_phy_l4_%4i%02i%02i.nc.gz" %(downloadDir, year, month, day) if not os.path.isfile(localFilename[0:-3]): fHandle = open("%s" %localFilename, "wb") ftp.retrbinary("RETR " + remoteFilename , fHandle.write) fHandle.close() os.system("gzip -d %s" %localFilename) ftp.cwd("..") ftp.quit() # download one along track file ftp = FTP('ftp.sltac.cls.fr') ftp.login('pprandi','PierreCMEMS2017') ftp.cwd('/Core/SEALEVEL_GLO_PHY_L3_REP_OBSERVATIONS_008_045/dataset-duacs-rep-global-alg-phy-l3-v3/2016/') ftp.retrlines('LIST') filename="dt_global_alg_phy_vfec_l3_20160925_20170209.nc.gz" downloadDir = "/Users/pierre/Documents/Presentations/201706_CMEMSArctic/data_tmp" fHandle = open("%s/%s" %(downloadDir, filename), "wb") ftp.retrbinary("RETR " + filename , fHandle.write) fHandle.close() os.system("gzip -d %s/%s" %(downloadDir, filename)) ftp.quit() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Passage Ranking using TFR-BERT Step2: Import TensorFlow Ranking and useful libraries through the notebook. Step3: Data preparation Step4: Overview of TFR-BERT in Orbit Step5: Note Step6: Define Task Step7: Train and evaluate the model
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. !pip install -q tensorflow-ranking tf-models-official import os import tensorflow as tf import tensorflow_ranking as tfr from official.nlp.configs import encoders from tensorflow_ranking.extension.premade import tfrbert_task !wget -O "/tmp/train.tfrecords" "https://ciir.cs.umass.edu/downloads/Antique/tf-ranking/antique_train_seq_64_elwc.tfrecords" !wget -O "/tmp/test.tfrecords" "https://ciir.cs.umass.edu/downloads/Antique/tf-ranking/antique_test_seq_64_elwc.tfrecords" !mkdir -p /tmp/tfrbert !wget "https://storage.googleapis.com/cloud-tpu-checkpoints/bert/v3/uncased_L-12_H-768_A-12.tar.gz" -P "/tmp/tfrbert" !mkdir -p /tmp/tfrbert/uncased_L-12_H-768_A-12 !tar -xvf /tmp/tfrbert/uncased_L-12_H-768_A-12.tar.gz --strip-components 3 -C "/tmp/tfrbert/uncased_L-12_H-768_A-12/" SEQ_LENGTH = 64 context_feature_spec = {} example_feature_spec = { 'input_word_ids': tf.io.FixedLenFeature( shape=(SEQ_LENGTH,), dtype=tf.int64, default_value=[0] * SEQ_LENGTH), 'input_mask': tf.io.FixedLenFeature( shape=(SEQ_LENGTH,), dtype=tf.int64, default_value=[0] * SEQ_LENGTH), 'input_type_ids': tf.io.FixedLenFeature( shape=(SEQ_LENGTH,), dtype=tf.int64, default_value=[0] * SEQ_LENGTH)} label_spec = ( "relevance", tf.io.FixedLenFeature(shape=(1,), dtype=tf.int64, default_value=-1) ) # Set up data config # We use a small list size here for demo purposes only. Users can use a larger # list size on a machine with more memory to train TFR-BERT. train_data_config = tfrbert_task.TFRBertDataConfig( input_path="/tmp/train.tfrecords", is_training=True, global_batch_size=8, list_size=2, dataset_fn='tfrecord', seq_length=64) validation_data_config = tfrbert_task.TFRBertDataConfig( input_path="/tmp/test.tfrecords", is_training=False, global_batch_size=8, list_size=2, dataset_fn='tfrecord', seq_length=64) # Set up task config task_config = tfrbert_task.TFRBertConfig( init_checkpoint='/tmp/tfrbert/uncased_L-12_H-768_A-12/bert_model.ckpt', train_data=train_data_config, validation_data=validation_data_config, model=tfrbert_task.TFRBertModelConfig( encoder=encoders.EncoderConfig( bert=encoders.BertEncoderConfig(num_layers=12)))) # Set up TFRBertTask task = tfrbert_task.TFRBertTask( task_config, label_spec=label_spec, dataset_fn=tf.data.TFRecordDataset, logging_dir='/tmp/model_dir') metrics = task.build_metrics() model = task.build_model() task.initialize(model) train_dataset = task.build_inputs(task_config.train_data) vali_dataset = task.build_inputs(task_config.validation_data) train_iterator = iter(train_dataset) vali_iterator = iter(vali_dataset) optimizer = tf.keras.optimizers.Adam(lr=1e-6) NUM_TRAIN_STEPS = 100 EVAL_STEPS = 10 for train_step in range(NUM_TRAIN_STEPS): task.train_step(next(train_iterator), model, optimizer, metrics=metrics) train_metrics = {m.name: m.result().numpy() for m in metrics} print("Training metrics for epoch: " + str(train_step) + " ", train_metrics) if train_step % EVAL_STEPS == 0: task.validation_step(next(train_iterator), model, metrics=metrics) vali_metrics = {m.name: m.result().numpy() for m in metrics} print("Validation metrics for epoch: " + str(train_step) + " ", vali_metrics) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The oandapy wraps the Oanda API in a format that make our codes cleaner and the task of extracting information from the API easier. Step2: We instantiate (create an instance) to prepare for the API call we are about to make. We named this instance as oanda. This name is flexible. In this case, we follow the documentation provide in oandapy. Step3: Using the instance we created earlier with the name oanda, we make an API call using get_prices method whilst passing the argument instruments="AUD_USD,NZD_USD,EUR_USD" to the API. The argument provided tells the Oanda API to return information only on these instruments. All the data is to be stored in the response variable. Step4: The above value is in the format of Python lists object. Python lists object can be identified by the squared brackets []. Step5: We can store individual value for future use Step6: We can also use the pandas DataFrame to display the value in a familiar and easier to read table format. The pandas library is a powerful library created for the sole purpose of data analysis Step7: Obtaining a List of Trabable Instruments Step8: Getting Historical Prices
<ASSISTANT_TASK:> Python Code: import pandas as pd import oandapy import configparser config = configparser.ConfigParser() config.read('../config/config_v1.ini') account_id = config['oanda']['account_id'] api_key = config['oanda']['api_key'] oanda = oandapy.API(environment="practice", access_token=api_key) response = oanda.get_prices(instruments= "AUD_USD,NZD_USD,EUR_USD") print(response) response['prices'] response["prices"][0]['ask'] data = response['prices'] time_stamp = data[0]['time'] instrument = data[0]['instrument'] bid_price = data[0]['bid'] ask_price = data[0]['ask'] print("[{}] {} bid={} ask={}".format(time_stamp, instrument, bid_price, ask_price)) pd.DataFrame(response["prices"]) response = oanda.get_instruments(account_id) pd.DataFrame(response['instruments']).head() pd.DataFrame(response['instruments']).tail() response = oanda.get_history(instrument="EUR_USD") print(response) res = pd.DataFrame(response["candles"]) res.head() res.columns = ['Close_Ask', 'Close_Bid', 'Complete', 'High_Ask', 'High_Bid', 'Low_Ask', 'Low_Bid', 'Open_Ask', 'Open_Bid', 'Time', 'Volume'] res = res.reindex_axis(['Time', 'Open_Bid', 'Open_Ask', 'High_Bid', 'High_Ask', 'Low_Bid', 'Low_Ask', 'Close_Bid', 'Close_Ask', 'Complete', 'Volume'], axis=1) res.tail() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Automatic generation of coupled cluster equations Step2: Define the orbital spaces Step3: Define the Hamiltonian operator Step4: Define a function to compute the cluster operator truncated to level n Step5: Setup the similarity-transformed Hamiltonian and compute expectation value Step6: Running the code Step7: We can inspect all the singles equations Step8: And generate nice-looking equations Step9: Counting the number of diagrams
<ASSISTANT_TASK:> Python Code: import wicked as w import time from IPython.display import display, Math, Latex def latex(expr): Function to render any object that has a member latex() function display(Math(expr.latex())) w.reset_space() w.add_space('o','fermion','occupied',['i','j','k','l','m','n']) w.add_space('v','fermion','unoccupied',['a','b','c','d','e','f']) E0 = w.op("E_0",['']) F = w.utils.gen_op('f',1,'ov','ov') V = w.utils.gen_op('v',2,'ov','ov') H = E0 + F + V def make_T(n): components = [f"{'v+' * k} {'o' * k}" for k in range(1,n + 1)] return w.op("t",components) make_T(3) def cc_equations(n): start = time.perf_counter() wt = w.WickTheorem() T = make_T(n) Hbar = w.bch_series(H,T,4) expr = wt.contract(w.rational(1), Hbar, 0, 2 * n) mbeq = expr.to_manybody_equation("r") end = time.perf_counter() t = end - start equations = {} for r in range(0,n + 1): s = f"{'o' * r}|{'v' * r}" equations[r] = (mbeq[s]) return equations, t equations, t = cc_equations(5) # count the number of terms for each rank s = 0 for rank,eq in equations.items(): print(f'Rank {rank}: {len(eq)} equations') s += len(eq) print(f'\nGenerated {s} equations in {t:.3f} seconds') equations[1] for eq in equations[1]: latex(eq) rows = [] for n in range(1,6): equations, t = cc_equations(n) count = " ".join([f'{len(eqs):4d}' for k, eqs in equations.items()]) rows.append(f' {n} {t:4.1f} {count}') width = 39 print(f'{"=" * width}') print(f' n time Excitation level ') print(f' (s) 0 1 2 3 4 5 ') print(f'{"-" * width}') print("\n".join(rows)) print(f'{"=" * width}') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Note Step2: Lesson Step3: Project 1 Step4: We'll create three Counter objects, one for words from postive reviews, one for words from negative reviews, and one for all the words. Step5: TODO Step6: Run the following two cells to list the words used in positive reviews and negative reviews, respectively, ordered from most to least commonly used. Step7: As you can see, common words like "the" appear very often in both positive and negative reviews. Instead of finding the most common words in positive or negative reviews, what you really want are the words found in positive reviews more often than in negative reviews, and vice versa. To accomplish this, you'll need to calculate the ratios of word usage between positive and negative reviews. Step8: Examine the ratios you've calculated for a few words Step9: Looking closely at the values you just calculated, we see the following Step10: Examine the new ratios you've calculated for the same words from before Step11: If everything worked, now you should see neutral words with values close to zero. In this case, "the" is near zero but slightly positive, so it was probably used in more positive reviews than negative reviews. But look at "amazing"'s ratio - it's above 1, showing it is clearly a word with positive sentiment. And "terrible" has a similar score, but in the opposite direction, so it's below -1. It's now clear that both of these words are associated with specific, opposing sentiments. Step12: End of Project 1. Step13: Project 2 Step14: Run the following cell to check your vocabulary size. If everything worked correctly, it should print 74074 Step15: Take a look at the following image. It represents the layers of the neural network you'll be building throughout this notebook. layer_0 is the input layer, layer_1 is a hidden layer, and layer_2 is the output layer. Step16: TODO Step17: Run the following cell. It should display (1, 74074) Step18: layer_0 contains one entry for every word in the vocabulary, as shown in the above image. We need to make sure we know the index of each word, so run the following cell to create a lookup table that stores the index of every word. Step20: TODO Step21: Run the following cell to test updating the input layer with the first review. The indices assigned may not be the same as in the solution, but hopefully you'll see some non-zero values in layer_0. Step23: TODO Step24: Run the following two cells. They should print out'POSITIVE' and 1, respectively. Step25: Run the following two cells. They should print out 'NEGATIVE' and 0, respectively. Step29: End of Project 2. Step30: Run the following cell to create a SentimentNetwork that will train on all but the last 1000 reviews (we're saving those for testing). Here we use a learning rate of 0.1. Step31: Run the following cell to test the network's performance against the last 1000 reviews (the ones we held out from our training set). Step32: Run the following cell to actually train the network. During training, it will display the model's accuracy repeatedly as it trains so you can see how well it's doing. Step33: That most likely didn't train very well. Part of the reason may be because the learning rate is too high. Run the following cell to recreate the network with a smaller learning rate, 0.01, and then train the new network. Step34: That probably wasn't much different. Run the following cell to recreate the network one more time with an even smaller learning rate, 0.001, and then train the new network. Step35: With a learning rate of 0.001, the network should finall have started to improve during training. It's still not very good, but it shows that this solution has potential. We will improve it in the next lesson. Step39: Project 4 Step40: Run the following cell to recreate the network and train it. Notice we've gone back to the higher learning rate of 0.1. Step41: That should have trained much better than the earlier attempts. It's still not wonderful, but it should have improved dramatically. Run the following cell to test your model with 1000 predictions. Step42: End of Project 4. Step46: Project 5 Step47: Run the following cell to recreate the network and train it once again. Step48: That should have trained much better than the earlier attempts. Run the following cell to test your model with 1000 predictions. Step49: End of Project 5. Step53: Project 6 Step54: Run the following cell to train your network with a small polarity cutoff. Step55: And run the following cell to test it's performance. It should be Step56: Run the following cell to train your network with a much larger polarity cutoff. Step57: And run the following cell to test it's performance. Step58: End of Project 6.
<ASSISTANT_TASK:> Python Code: def pretty_print_review_and_label(i): print(labels[i] + "\t:\t" + reviews[i][:80] + "...") g = open('reviews.txt','r') # What we know! reviews = list(map(lambda x:x[:-1],g.readlines())) g.close() g = open('labels.txt','r') # What we WANT to know! labels = list(map(lambda x:x[:-1].upper(),g.readlines())) g.close() len(reviews) reviews[0] labels[0] print("labels.txt \t : \t reviews.txt\n") pretty_print_review_and_label(2137) pretty_print_review_and_label(12816) pretty_print_review_and_label(6267) pretty_print_review_and_label(21934) pretty_print_review_and_label(5297) pretty_print_review_and_label(4998) from collections import Counter import numpy as np # Create three Counter objects to store positive, negative and total counts positive_counts = Counter() negative_counts = Counter() total_counts = Counter() # TODO: Loop over all the words in all the reviews and increment the counts in the appropriate counter objects import re for index, review in enumerate(reviews): label = labels[index] review = re.sub('\s+', ' ', review) # condense whitespacechars words = review.split(' ') total_counts += Counter(words) if label == 'POSITIVE': positive_counts += Counter(words) if label == 'NEGATIVE': negative_counts += Counter(words) # Examine the counts of the most common words in positive reviews positive_counts.most_common()[:10] # Examine the counts of the most common words in negative reviews negative_counts.most_common()[:10] # Create Counter object to store positive/negative ratios pos_neg_ratios = Counter() # TODO: Calculate the ratios of positive and negative uses of the most common words # Consider words to be "common" if they've been used at least 100 times common_words = [x for x in total_counts.most_common() if x[1] > 100] for word, count in common_words: pos_neg_ratios[word] = positive_counts[word] / float(negative_counts[word]+1) for word, ratio in pos_neg_ratios.most_common(): if ratio > 1: pos_neg_ratios[word] = np.log(ratio) else: pos_neg_ratios[word] = -np.log(1 / (ratio + 0.01)) print(pos_neg_ratios.most_common()[:15]) print(list(reversed(pos_neg_ratios.most_common()[:15]))) print("Pos-to-neg ratio for 'the' = {}".format(pos_neg_ratios["the"])) print("Pos-to-neg ratio for 'amazing' = {}".format(pos_neg_ratios["amazing"])) print("Pos-to-neg ratio for 'terrible' = {}".format(pos_neg_ratios["terrible"])) # TODO: Convert ratios to logs print("Pos-to-neg ratio for 'the' = {}".format(pos_neg_ratios["the"])) print("Pos-to-neg ratio for 'amazing' = {}".format(pos_neg_ratios["amazing"])) print("Pos-to-neg ratio for 'terrible' = {}".format(pos_neg_ratios["terrible"])) # words most frequently seen in a review with a "POSITIVE" label pos_neg_ratios.most_common()[:10] # words most frequently seen in a review with a "NEGATIVE" label list(reversed(pos_neg_ratios.most_common()))[0:10] # Note: Above is the code Andrew uses in his solution video, # so we've included it here to avoid confusion. # If you explore the documentation for the Counter class, # you will see you could also find the 30 least common # words like this: pos_neg_ratios.most_common()[:-31:-1] from IPython.display import Image review = "This was a horrible, terrible movie." Image(filename='sentiment_network.png') review = "The movie was excellent" Image(filename='sentiment_network_pos.png') # TODO: Create set named "vocab" containing all of the words from all of the reviews vocab = [x for x in total_counts] vocab_size = len(vocab) print(vocab_size) from IPython.display import Image Image(filename='sentiment_network_2.png') # TODO: Create layer_0 matrix with dimensions 1 by vocab_size, initially filled with zeros layer_0 = np.zeros((1,vocab_size)) layer_0.shape from IPython.display import Image Image(filename='sentiment_network.png') # Create a dictionary of words in the vocabulary mapped to index positions # (to be used in layer_0) word2index = {} for i, word in enumerate(vocab): word2index[word] = i # display the map of words to indices word2index def update_input_layer(review): Modify the global layer_0 to represent the vector form of review. The element at a given index of layer_0 should represent how many times the given word occurs in the review. Args: review(string) - the string of the review Returns: None global layer_0 # clear out previous state by resetting the layer to be all 0s layer_0 *= 0 # TODO: count how many times each word is used in the given review and store the results in layer_0 review = re.sub('\s+', ' ', review) # condense whitespace words = review.split(' ') for word in words: layer_0[0][word2index[word]] += 1 update_input_layer(reviews[0]) layer_0 def get_target_for_label(label): Convert a label to `0` or `1`. Args: label(string) - Either "POSITIVE" or "NEGATIVE". Returns: `0` or `1`. # TODO: Your code here if label == 'POSITIVE': return 1 else: return 0 labels[0] get_target_for_label(labels[0]) labels[1] get_target_for_label(labels[1]) import time import sys import numpy as np # Encapsulate our neural network in a class class SentimentNetwork: def __init__(self, reviews, labels, hidden_nodes = 10, learning_rate = 0.1): Create a SentimenNetwork with the given settings Args: reviews(list) - List of reviews used for training labels(list) - List of POSITIVE/NEGATIVE labels associated with the given reviews hidden_nodes(int) - Number of nodes to create in the hidden layer learning_rate(float) - Learning rate to use while training # Assign a seed to our random number generator to ensure we get # reproducable results during development np.random.seed(1) # process the reviews and their associated labels so that everything # is ready for training self.pre_process_data(reviews, labels) # Build the network to have the number of hidden nodes and the learning rate that # were passed into this initializer. Make the same number of input nodes as # there are vocabulary words and create a single output node. self.init_network(len(self.review_vocab),hidden_nodes, 1, learning_rate) def pre_process_data(self, reviews, labels): review_vocab = set() # TODO: populate review_vocab with all of the words in the given reviews # Remember to split reviews into individual words # using "split(' ')" instead of "split()". for review in reviews: for word in review.split(' '): review_vocab.add(word) # Convert the vocabulary set to a list so we can access words via indices self.review_vocab = list(review_vocab) label_vocab = set() # TODO: populate label_vocab with all of the words in the given labels. # There is no need to split the labels because each one is a single word. for label in labels: label_vocab.add(label) # Convert the label vocabulary set to a list so we can access labels via indices self.label_vocab = list(label_vocab) # Store the sizes of the review and label vocabularies. self.review_vocab_size = len(self.review_vocab) self.label_vocab_size = len(self.label_vocab) # Create a dictionary of words in the vocabulary mapped to index positions self.word2index = {} # TODO: populate self.word2index with indices for all the words in self.review_vocab # like you saw earlier in the notebook for i, word in enumerate(self.review_vocab): self.word2index[word] = i # Create a dictionary of labels mapped to index positions self.label2index = {} # TODO: do the same thing you did for self.word2index and self.review_vocab, # but for self.label2index and self.label_vocab instead for i, label in enumerate(self.label_vocab): self.label2index[label] = i def init_network(self, input_nodes, hidden_nodes, output_nodes, learning_rate): # Store the number of nodes in input, hidden, and output layers. self.input_nodes = input_nodes self.hidden_nodes = hidden_nodes self.output_nodes = output_nodes # Store the learning rate self.learning_rate = learning_rate # Initialize weights # TODO: initialize self.weights_0_1 as a matrix of zeros. These are the weights between # the input layer and the hidden layer. self.weights_0_1 = np.zeros((self.input_nodes, self.hidden_nodes)) # TODO: initialize self.weights_1_2 as a matrix of random values. # These are the weights between the hidden layer and the output layer. self.weights_1_2 = np.random.normal(0.0, self.output_nodes**-0.5, (self.hidden_nodes, self.output_nodes)) # TODO: Create the input layer, a two-dimensional matrix with shape # 1 x input_nodes, with all values initialized to zero self.layer_0 = np.zeros((1,input_nodes)) def update_input_layer(self,review): # TODO: You can copy most of the code you wrote for update_input_layer # earlier in this notebook. # # However, MAKE SURE YOU CHANGE ALL VARIABLES TO REFERENCE # THE VERSIONS STORED IN THIS OBJECT, NOT THE GLOBAL OBJECTS. # For example, replace "layer_0 *= 0" with "self.layer_0 *= 0" self.layer_0 *= 0 # clear out previous state for word in review.split(" "): if(word in self.word2index.keys()): self.layer_0[0][self.word2index[word]] += 1 def get_target_for_label(self,label): # TODO: Copy the code you wrote for get_target_for_label # earlier in this notebook. if(label == 'POSITIVE'): return 1 else: return 0 def sigmoid(self,x): # TODO: Return the result of calculating the sigmoid activation function # shown in the lectures return 1 / (1 + np.exp(-x)) def sigmoid_output_2_derivative(self,output): # TODO: Return the derivative of the sigmoid activation function, # where "output" is the original output from the sigmoid fucntion return output * (1 - output) def train(self, training_reviews, training_labels): # make sure out we have a matching number of reviews and labels assert(len(training_reviews) == len(training_labels)) # Keep track of correct predictions to display accuracy during training correct_so_far = 0 # Remember when we started for printing time statistics start = time.time() # loop through all the given revlayer_2_erroriews and run a forward and backward pass, # updating weights for every item for i in range(len(training_reviews)): # TODO: Get the next review and its correct label review = training_reviews[i] label = training_labels[i] # TODO: Implement the forward pass through the network. # That means use the given review to update the input layer, # then calculate values for the hidden layer, # and finally calculate the output layer. # # Do not use an activation function for the hidden layer, # but use the sigmoid activation function for the output layer. self.update_input_layer(review) layer_1 = np.dot(self.layer_0, self.weights_0_1) layer_2 = self.sigmoid(np.dot(layer_1, self.weights_1_2)) # TODO: Implement the back propagation pass here. # That means calculate the error for the forward pass's prediction # and update the weights in the network according to their # contributions toward the error, as calculated via the # gradient descent and back propagation algorithms you # learned in class. layer_2_error = layer_2 - self.get_target_for_label(label) layer_2_delta = layer_2_error * self.sigmoid_output_2_derivative(layer_2) layer_1_error = np.dot(layer_2_delta, self.weights_1_2.T) layer_1_delta = layer_1_error self.weights_1_2 -= np.dot(layer_1.T, layer_2_delta) * self.learning_rate self.weights_0_1 -= np.dot(self.layer_0.T, layer_1_delta) * self.learning_rate # TODO: Keep track of correct predictions. To determine if the prediction was # correct, check that the absolute value of the output error # is less than 0.5. If so, add one to the correct_so_far count. if layer_2_error < 0.5: correct_so_far += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the training process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(training_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct_so_far) + " #Trained:" + str(i+1) \ + " Training Accuracy:" + str(correct_so_far * 100 / float(i+1))[:4] + "%") if(i % 2500 == 0): print("") def test(self, testing_reviews, testing_labels): Attempts to predict the labels for the given testing_reviews, and uses the test_labels to calculate the accuracy of those predictions. # keep track of how many correct predictions we make correct = 0 # we'll time how many predictions per second we make start = time.time() # Loop through each of the given reviews and call run to predict # its label. for i in range(len(testing_reviews)): pred = self.run(testing_reviews[i]) if(pred == testing_labels[i]): correct += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the prediction process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(testing_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct) + " #Tested:" + str(i+1) \ + " Testing Accuracy:" + str(correct * 100 / float(i+1))[:4] + "%") def run(self, review): Returns a POSITIVE or NEGATIVE prediction for the given review. # TODO: Run a forward pass through the network, like you did in the # "train" function. That means use the given review to # update the input layer, then calculate values for the hidden layer, # and finally calculate the output layer. # # Note: The review passed into this function for prediction # might come from anywhere, so you should convert it # to lower case prior to using it. self.update_input_layer(review.lower()) layer_1 = np.dot(self.layer_0, self.weights_0_1) layer_2 = self.sigmoid(np.dot(layer_1, self.weights_1_2)) # TODO: The output layer should now contain a prediction. # Return `POSITIVE` for predictions greater-than-or-equal-to `0.5`, # and `NEGATIVE` otherwise. if(layer_2[0] >= 0.5): return "POSITIVE" else: return "NEGATIVE" mlp = SentimentNetwork(reviews[:-1000],labels[:-1000], learning_rate=0.1) mlp.test(reviews[-1000:],labels[-1000:]) mlp.train(reviews[:-1000],labels[:-1000]) mlp = SentimentNetwork(reviews[:-1000],labels[:-1000], learning_rate=0.01) mlp.train(reviews[:-1000],labels[:-1000]) mlp = SentimentNetwork(reviews[:-1000],labels[:-1000], learning_rate=0.001) mlp.train(reviews[:-1000],labels[:-1000]) from IPython.display import Image Image(filename='sentiment_network.png') def update_input_layer(review): global layer_0 # clear out previous state, reset the layer to be all 0s layer_0 *= 0 for word in review.split(" "): layer_0[0][word2index[word]] += 1 update_input_layer(reviews[0]) layer_0 review_counter = Counter() for word in reviews[0].split(" "): review_counter[word] += 1 review_counter.most_common() # TODO: -Copy the SentimentNetwork class from Projet 3 lesson # -Modify it to reduce noise, like in the video import time import sys import numpy as np # Encapsulate our neural network in a class class SentimentNetwork: def __init__(self, reviews, labels, hidden_nodes = 10, learning_rate = 0.1): Create a SentimenNetwork with the given settings Args: reviews(list) - List of reviews used for training labels(list) - List of POSITIVE/NEGATIVE labels associated with the given reviews hidden_nodes(int) - Number of nodes to create in the hidden layer learning_rate(float) - Learning rate to use while training # Assign a seed to our random number generator to ensure we get # reproducable results during development np.random.seed(1) # process the reviews and their associated labels so that everything # is ready for training self.pre_process_data(reviews, labels) # Build the network to have the number of hidden nodes and the learning rate that # were passed into this initializer. Make the same number of input nodes as # there are vocabulary words and create a single output node. self.init_network(len(self.review_vocab),hidden_nodes, 1, learning_rate) def pre_process_data(self, reviews, labels): review_vocab = set() # TODO: populate review_vocab with all of the words in the given reviews # Remember to split reviews into individual words # using "split(' ')" instead of "split()". for review in reviews: for word in review.split(' '): review_vocab.add(word) # Convert the vocabulary set to a list so we can access words via indices self.review_vocab = list(review_vocab) label_vocab = set() # TODO: populate label_vocab with all of the words in the given labels. # There is no need to split the labels because each one is a single word. for label in labels: label_vocab.add(label) # Convert the label vocabulary set to a list so we can access labels via indices self.label_vocab = list(label_vocab) # Store the sizes of the review and label vocabularies. self.review_vocab_size = len(self.review_vocab) self.label_vocab_size = len(self.label_vocab) # Create a dictionary of words in the vocabulary mapped to index positions self.word2index = {} # TODO: populate self.word2index with indices for all the words in self.review_vocab # like you saw earlier in the notebook for i, word in enumerate(self.review_vocab): self.word2index[word] = i # Create a dictionary of labels mapped to index positions self.label2index = {} # TODO: do the same thing you did for self.word2index and self.review_vocab, # but for self.label2index and self.label_vocab instead for i, label in enumerate(self.label_vocab): self.label2index[label] = i def init_network(self, input_nodes, hidden_nodes, output_nodes, learning_rate): # Store the number of nodes in input, hidden, and output layers. self.input_nodes = input_nodes self.hidden_nodes = hidden_nodes self.output_nodes = output_nodes # Store the learning rate self.learning_rate = learning_rate # Initialize weights # TODO: initialize self.weights_0_1 as a matrix of zeros. These are the weights between # the input layer and the hidden layer. self.weights_0_1 = np.zeros((self.input_nodes, self.hidden_nodes)) # TODO: initialize self.weights_1_2 as a matrix of random values. # These are the weights between the hidden layer and the output layer. self.weights_1_2 = np.random.normal(0.0, self.output_nodes**-0.5, (self.hidden_nodes, self.output_nodes)) # TODO: Create the input layer, a two-dimensional matrix with shape # 1 x input_nodes, with all values initialized to zero self.layer_0 = np.zeros((1,input_nodes)) def update_input_layer(self,review): # TODO: You can copy most of the code you wrote for update_input_layer # earlier in this notebook. # # However, MAKE SURE YOU CHANGE ALL VARIABLES TO REFERENCE # THE VERSIONS STORED IN THIS OBJECT, NOT THE GLOBAL OBJECTS. # For example, replace "layer_0 *= 0" with "self.layer_0 *= 0" self.layer_0 *= 0 # clear out previous state for word in review.split(" "): if(word in self.word2index.keys()): self.layer_0[0][self.word2index[word]] = 1 def get_target_for_label(self,label): # TODO: Copy the code you wrote for get_target_for_label # earlier in this notebook. if(label == 'POSITIVE'): return 1 else: return 0 def sigmoid(self,x): # TODO: Return the result of calculating the sigmoid activation function # shown in the lectures return 1 / (1 + np.exp(-x)) def sigmoid_output_2_derivative(self,output): # TODO: Return the derivative of the sigmoid activation function, # where "output" is the original output from the sigmoid fucntion return output * (1 - output) def train(self, training_reviews, training_labels): # make sure out we have a matching number of reviews and labels assert(len(training_reviews) == len(training_labels)) # Keep track of correct predictions to display accuracy during training correct_so_far = 0 # Remember when we started for printing time statistics start = time.time() # loop through all the given revlayer_2_erroriews and run a forward and backward pass, # updating weights for every item for i in range(len(training_reviews)): # TODO: Get the next review and its correct label review = training_reviews[i] label = training_labels[i] # TODO: Implement the forward pass through the network. # That means use the given review to update the input layer, # then calculate values for the hidden layer, # and finally calculate the output layer. # # Do not use an activation function for the hidden layer, # but use the sigmoid activation function for the output layer. self.update_input_layer(review) layer_1 = np.dot(self.layer_0, self.weights_0_1) layer_2 = self.sigmoid(np.dot(layer_1, self.weights_1_2)) # TODO: Implement the back propagation pass here. # That means calculate the error for the forward pass's prediction # and update the weights in the network according to their # contributions toward the error, as calculated via the # gradient descent and back propagation algorithms you # learned in class. layer_2_error = layer_2 - self.get_target_for_label(label) layer_2_delta = layer_2_error * self.sigmoid_output_2_derivative(layer_2) layer_1_error = np.dot(layer_2_delta, self.weights_1_2.T) layer_1_delta = layer_1_error self.weights_1_2 -= np.dot(layer_1.T, layer_2_delta) * self.learning_rate self.weights_0_1 -= np.dot(self.layer_0.T, layer_1_delta) * self.learning_rate # TODO: Keep track of correct predictions. To determine if the prediction was # correct, check that the absolute value of the output error # is less than 0.5. If so, add one to the correct_so_far count. if layer_2_error < 0.5: correct_so_far += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the training process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(training_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct_so_far) + " #Trained:" + str(i+1) \ + " Training Accuracy:" + str(correct_so_far * 100 / float(i+1))[:4] + "%") if(i % 2500 == 0): print("") def test(self, testing_reviews, testing_labels): Attempts to predict the labels for the given testing_reviews, and uses the test_labels to calculate the accuracy of those predictions. # keep track of how many correct predictions we make correct = 0 # we'll time how many predictions per second we make start = time.time() # Loop through each of the given reviews and call run to predict # its label. for i in range(len(testing_reviews)): pred = self.run(testing_reviews[i]) if(pred == testing_labels[i]): correct += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the prediction process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(testing_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct) + " #Tested:" + str(i+1) \ + " Testing Accuracy:" + str(correct * 100 / float(i+1))[:4] + "%") def run(self, review): Returns a POSITIVE or NEGATIVE prediction for the given review. # TODO: Run a forward pass through the network, like you did in the # "train" function. That means use the given review to # update the input layer, then calculate values for the hidden layer, # and finally calculate the output layer. # # Note: The review passed into this function for prediction # might come from anywhere, so you should convert it # to lower case prior to using it. self.update_input_layer(review.lower()) layer_1 = np.dot(self.layer_0, self.weights_0_1) layer_2 = self.sigmoid(np.dot(layer_1, self.weights_1_2)) # TODO: The output layer should now contain a prediction. # Return `POSITIVE` for predictions greater-than-or-equal-to `0.5`, # and `NEGATIVE` otherwise. if(layer_2[0] >= 0.5): return "POSITIVE" else: return "NEGATIVE" mlp = SentimentNetwork(reviews[:-1000],labels[:-1000], learning_rate=0.1) mlp.train(reviews[:-1000],labels[:-1000]) mlp.test(reviews[-1000:],labels[-1000:]) Image(filename='sentiment_network_sparse.png') layer_0 = np.zeros(10) layer_0 layer_0[4] = 1 layer_0[9] = 1 layer_0 weights_0_1 = np.random.randn(10,5) layer_0.dot(weights_0_1) indices = [4,9] layer_1 = np.zeros(5) for index in indices: layer_1 += (1 * weights_0_1[index]) layer_1 Image(filename='sentiment_network_sparse_2.png') layer_1 = np.zeros(5) for index in indices: layer_1 += (weights_0_1[index]) layer_1 # TODO: -Copy the SentimentNetwork class from Project 4 lesson # -Modify it according to the above instructions import time import sys import numpy as np # Encapsulate our neural network in a class class SentimentNetwork: def __init__(self, reviews, labels, hidden_nodes = 10, learning_rate = 0.1): Create a SentimenNetwork with the given settings Args: reviews(list) - List of reviews used for training labels(list) - List of POSITIVE/NEGATIVE labels associated with the given reviews hidden_nodes(int) - Number of nodes to create in the hidden layer learning_rate(float) - Learning rate to use while training # Assign a seed to our random number generator to ensure we get # reproducable results during development np.random.seed(1) # process the reviews and their associated labels so that everything # is ready for training self.pre_process_data(reviews, labels) # Build the network to have the number of hidden nodes and the learning rate that # were passed into this initializer. Make the same number of input nodes as # there are vocabulary words and create a single output node. self.init_network(len(self.review_vocab),hidden_nodes, 1, learning_rate) def pre_process_data(self, reviews, labels): review_vocab = set() # TODO: populate review_vocab with all of the words in the given reviews # Remember to split reviews into individual words # using "split(' ')" instead of "split()". for review in reviews: for word in review.split(' '): review_vocab.add(word) # Convert the vocabulary set to a list so we can access words via indices self.review_vocab = list(review_vocab) label_vocab = set() # TODO: populate label_vocab with all of the words in the given labels. # There is no need to split the labels because each one is a single word. for label in labels: label_vocab.add(label) # Convert the label vocabulary set to a list so we can access labels via indices self.label_vocab = list(label_vocab) # Store the sizes of the review and label vocabularies. self.review_vocab_size = len(self.review_vocab) self.label_vocab_size = len(self.label_vocab) # Create a dictionary of words in the vocabulary mapped to index positions self.word2index = {} # TODO: populate self.word2index with indices for all the words in self.review_vocab # like you saw earlier in the notebook for i, word in enumerate(self.review_vocab): self.word2index[word] = i # Create a dictionary of labels mapped to index positions self.label2index = {} # TODO: do the same thing you did for self.word2index and self.review_vocab, # but for self.label2index and self.label_vocab instead for i, label in enumerate(self.label_vocab): self.label2index[label] = i def init_network(self, input_nodes, hidden_nodes, output_nodes, learning_rate): # Store the number of nodes in input, hidden, and output layers. self.input_nodes = input_nodes self.hidden_nodes = hidden_nodes self.output_nodes = output_nodes # Store the learning rate self.learning_rate = learning_rate # Initialize weights # TODO: initialize self.weights_0_1 as a matrix of zeros. These are the weights between # the input layer and the hidden layer. self.weights_0_1 = np.zeros((self.input_nodes, self.hidden_nodes)) # TODO: initialize self.weights_1_2 as a matrix of random values. # These are the weights between the hidden layer and the output layer. self.weights_1_2 = np.random.normal(0.0, self.output_nodes**-0.5, (self.hidden_nodes, self.output_nodes)) self.layer_1 = np.zeros((1,hidden_nodes)) def get_target_for_label(self,label): # TODO: Copy the code you wrote for get_target_for_label # earlier in this notebook. if(label == 'POSITIVE'): return 1 else: return 0 def sigmoid(self,x): # TODO: Return the result of calculating the sigmoid activation function # shown in the lectures return 1 / (1 + np.exp(-x)) def sigmoid_output_2_derivative(self,output): # TODO: Return the derivative of the sigmoid activation function, # where "output" is the original output from the sigmoid fucntion return output * (1 - output) def train(self, training_reviews, training_labels): # make sure out we have a matching number of reviews and labels assert(len(training_reviews) == len(training_labels)) # Keep track of correct predictions to display accuracy during training correct_so_far = 0 # Remember when we started for printing time statistics start = time.time() # loop through all the given revlayer_2_erroriews and run a forward and backward pass, # updating weights for every item for i in range(len(training_reviews_raw)): # TODO: Get the next review and its correct label review = training_reviews[i] label = training_labels[i] # TODO: Implement the forward pass through the network. # That means use the given review to update the input layer, # then calculate values for the hidden layer, # and finally calculate the output layer. # # Do not use an activation function for the hidden layer, # but use the sigmoid activation function for the output layer. self.layer_1 *= 0 for index in review: self.layer_1 += self.weights_0_1[index] layer_2 = self.sigmoid(self.layer_1.dot(self.weights_1_2)) # TODO: Implement the back propagation pass here. # That means calculate the error for the forward pass's prediction # and update the weights in the network according to their # contributions toward the error, as calculated via the # gradient descent and back propagation algorithms you # learned in class. layer_2_error = layer_2 - self.get_target_for_label(label) layer_2_delta = layer_2_error * self.sigmoid_output_2_derivative(layer_2) layer_1_error = np.dot(layer_2_delta, self.weights_1_2.T) layer_1_delta = layer_1_error self.weights_1_2 -= np.dot(layer_1.T, layer_2_delta) * self.learning_rate self.weights_0_1 -= np.dot(self.layer_0.T, layer_1_delta) * self.learning_rate # TODO: Keep track of correct predictions. To determine if the prediction was # correct, check that the absolute value of the output error # is less than 0.5. If so, add one to the correct_so_far count. if layer_2_error < 0.5: correct_so_far += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the training process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(training_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct_so_far) + " #Trained:" + str(i+1) \ + " Training Accuracy:" + str(correct_so_far * 100 / float(i+1))[:4] + "%") if(i % 2500 == 0): print("") def test(self, testing_reviews, testing_labels): Attempts to predict the labels for the given testing_reviews, and uses the test_labels to calculate the accuracy of those predictions. # keep track of how many correct predictions we make correct = 0 # we'll time how many predictions per second we make start = time.time() # Loop through each of the given reviews and call run to predict # its label. for i in range(len(testing_reviews)): pred = self.run(testing_reviews[i]) if(pred == testing_labels[i]): correct += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the prediction process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(testing_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct) + " #Tested:" + str(i+1) \ + " Testing Accuracy:" + str(correct * 100 / float(i+1))[:4] + "%") def run(self, review): Returns a POSITIVE or NEGATIVE prediction for the given review. # TODO: Run a forward pass through the network, like you did in the # "train" function. That means use the given review to # update the input layer, then calculate values for the hidden layer, # and finally calculate the output layer. # # Note: The review passed into this function for prediction # might come from anywhere, so you should convert it # to lower case prior to using it. self.layer_1 *= 0 unique_indices = set() for word in review.lower().split(" "): if word in self.word2index.keys(): unique_indices.add(self.word2index[word]) for index in unique_indices: self.layer_1 += self.weights_0_1[index] layer_2 = self.sigmoid(np.dot(self.layer_1, self.weights_1_2)) # TODO: The output layer should now contain a prediction. # Return `POSITIVE` for predictions greater-than-or-equal-to `0.5`, # and `NEGATIVE` otherwise. if(layer_2[0] >= 0.5): return "POSITIVE" else: return "NEGATIVE" mlp = SentimentNetwork(reviews[:-1000],labels[:-1000], learning_rate=0.1) mlp.train(reviews[:-1000],labels[:-1000]) mlp.test(reviews[-1000:],labels[-1000:]) Image(filename='sentiment_network_sparse_2.png') # words most frequently seen in a review with a "POSITIVE" label pos_neg_ratios.most_common() # words most frequently seen in a review with a "NEGATIVE" label list(reversed(pos_neg_ratios.most_common()))[0:30] from bokeh.models import ColumnDataSource, LabelSet from bokeh.plotting import figure, show, output_file from bokeh.io import output_notebook output_notebook() hist, edges = np.histogram(list(map(lambda x:x[1],pos_neg_ratios.most_common())), density=True, bins=100, normed=True) p = figure(tools="pan,wheel_zoom,reset,save", toolbar_location="above", title="Word Positive/Negative Affinity Distribution") p.quad(top=hist, bottom=0, left=edges[:-1], right=edges[1:], line_color="#555555") show(p) frequency_frequency = Counter() for word, cnt in total_counts.most_common(): frequency_frequency[cnt] += 1 hist, edges = np.histogram(list(map(lambda x:x[1],frequency_frequency.most_common())), density=True, bins=100, normed=True) p = figure(tools="pan,wheel_zoom,reset,save", toolbar_location="above", title="The frequency distribution of the words in our corpus") p.quad(top=hist, bottom=0, left=edges[:-1], right=edges[1:], line_color="#555555") show(p) # TODO: -Copy the SentimentNetwork class from Project 4 lesson # -Modify it according to the above instructions import time import sys import numpy as np # Encapsulate our neural network in a class class SentimentNetwork: def __init__(self, reviews, labels, min_count = 10, polarity_cutoff = 0.1, hidden_nodes = 10, learning_rate = 0.1): Create a SentimenNetwork with the given settings Args: reviews(list) - List of reviews used for training labels(list) - List of POSITIVE/NEGATIVE labels associated with the given reviews hidden_nodes(int) - Number of nodes to create in the hidden layer learning_rate(float) - Learning rate to use while training # Assign a seed to our random number generator to ensure we get # reproducable results during development np.random.seed(1) # process the reviews and their associated labels so that everything # is ready for training self.pre_process_data(reviews, labels, min_count, polarity_cutoff) # Build the network to have the number of hidden nodes and the learning rate that # were passed into this initializer. Make the same number of input nodes as # there are vocabulary words and create a single output node. self.init_network(len(self.review_vocab),hidden_nodes, 1, learning_rate) Calculate the positive-to-negative ratios of words used in the reviews. (You can use code you've written elsewhere in the notebook, but we are moving it into the class like we did with other helper code earlier.) Andrew's solution only calculates a postive-to-negative ratio for words that occur at least 50 times. This keeps the network from attributing too much sentiment to rarer words. You can choose to add this to your solution if you would like. Change so words are only added to the vocabulary if they occur in the vocabulary more than min_count times. Change so words are only added to the vocabulary if the absolute value of their postive-to-negative ratio is at least polarity_cutoff def pre_process_data(self, reviews, labels, min_count, polarity_cutoff): positive_counts = Counter() negative_counts = Counter() total_counts = Counter() for i in range(len(reviews)): if(labels[i] == 'POSITIVE'): for word in reviews[i].split(" "): positive_counts[word] += 1 total_counts[word] += 1 else: for word in reviews[i].split(" "): negative_counts[word] += 1 total_counts[word] += 1 pos_neg_ratios = Counter() for term,cnt in list(total_counts.most_common()): if(cnt >= 50): pos_neg_ratio = positive_counts[term] / float(negative_counts[term]+1) pos_neg_ratios[term] = pos_neg_ratio for word,ratio in pos_neg_ratios.most_common(): if(ratio > 1): pos_neg_ratios[word] = np.log(ratio) else: pos_neg_ratios[word] = -np.log((1 / (ratio + 0.01))) review_vocab = set() # TODO: populate review_vocab with all of the words in the given reviews # Remember to split reviews into individual words # using "split(' ')" instead of "split()". for review in reviews: for word in review.split(' '): if(total_counts[word] > min_count): if(word in pos_neg_ratios.keys()): if((pos_neg_ratios[word] >= polarity_cutoff) or (pos_neg_ratios[word] <= -polarity_cutoff)): review_vocab.add(word) else: review_vocab.add(word) # Convert the vocabulary set to a list so we can access words via indices self.review_vocab = list(review_vocab) label_vocab = set() # TODO: populate label_vocab with all of the words in the given labels. # There is no need to split the labels because each one is a single word. for label in labels: label_vocab.add(label) # Convert the label vocabulary set to a list so we can access labels via indices self.label_vocab = list(label_vocab) # Store the sizes of the review and label vocabularies. self.review_vocab_size = len(self.review_vocab) self.label_vocab_size = len(self.label_vocab) # Create a dictionary of words in the vocabulary mapped to index positions self.word2index = {} # TODO: populate self.word2index with indices for all the words in self.review_vocab # like you saw earlier in the notebook for i, word in enumerate(self.review_vocab): self.word2index[word] = i # Create a dictionary of labels mapped to index positions self.label2index = {} # TODO: do the same thing you did for self.word2index and self.review_vocab, # but for self.label2index and self.label_vocab instead for i, label in enumerate(self.label_vocab): self.label2index[label] = i def init_network(self, input_nodes, hidden_nodes, output_nodes, learning_rate): # Store the number of nodes in input, hidden, and output layers. self.input_nodes = input_nodes self.hidden_nodes = hidden_nodes self.output_nodes = output_nodes # Store the learning rate self.learning_rate = learning_rate # Initialize weights # TODO: initialize self.weights_0_1 as a matrix of zeros. These are the weights between # the input layer and the hidden layer. self.weights_0_1 = np.zeros((self.input_nodes, self.hidden_nodes)) # TODO: initialize self.weights_1_2 as a matrix of random values. # These are the weights between the hidden layer and the output layer. self.weights_1_2 = np.random.normal(0.0, self.output_nodes**-0.5, (self.hidden_nodes, self.output_nodes)) self.layer_1 = np.zeros((1,hidden_nodes)) def get_target_for_label(self,label): # TODO: Copy the code you wrote for get_target_for_label # earlier in this notebook. if(label == 'POSITIVE'): return 1 else: return 0 def sigmoid(self,x): # TODO: Return the result of calculating the sigmoid activation function # shown in the lectures return 1 / (1 + np.exp(-x)) def sigmoid_output_2_derivative(self,output): # TODO: Return the derivative of the sigmoid activation function, # where "output" is the original output from the sigmoid fucntion return output * (1 - output) def train(self, training_reviews, training_labels): # make sure out we have a matching number of reviews and labels assert(len(training_reviews) == len(training_labels)) # Keep track of correct predictions to display accuracy during training correct_so_far = 0 # Remember when we started for printing time statistics start = time.time() # loop through all the given revlayer_2_erroriews and run a forward and backward pass, # updating weights for every item for i in range(len(training_reviews_raw)): # TODO: Get the next review and its correct label review = training_reviews[i] label = training_labels[i] # TODO: Implement the forward pass through the network. # That means use the given review to update the input layer, # then calculate values for the hidden layer, # and finally calculate the output layer. # # Do not use an activation function for the hidden layer, # but use the sigmoid activation function for the output layer. self.layer_1 *= 0 for index in review: self.layer_1 += self.weights_0_1[index] layer_2 = self.sigmoid(self.layer_1.dot(self.weights_1_2)) # TODO: Implement the back propagation pass here. # That means calculate the error for the forward pass's prediction # and update the weights in the network according to their # contributions toward the error, as calculated via the # gradient descent and back propagation algorithms you # learned in class. layer_2_error = layer_2 - self.get_target_for_label(label) layer_2_delta = layer_2_error * self.sigmoid_output_2_derivative(layer_2) layer_1_error = np.dot(layer_2_delta, self.weights_1_2.T) layer_1_delta = layer_1_error self.weights_1_2 -= np.dot(layer_1.T, layer_2_delta) * self.learning_rate self.weights_0_1 -= np.dot(self.layer_0.T, layer_1_delta) * self.learning_rate # TODO: Keep track of correct predictions. To determine if the prediction was # correct, check that the absolute value of the output error # is less than 0.5. If so, add one to the correct_so_far count. if layer_2_error < 0.5: correct_so_far += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the training process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(training_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct_so_far) + " #Trained:" + str(i+1) \ + " Training Accuracy:" + str(correct_so_far * 100 / float(i+1))[:4] + "%") if(i % 2500 == 0): print("") def test(self, testing_reviews, testing_labels): Attempts to predict the labels for the given testing_reviews, and uses the test_labels to calculate the accuracy of those predictions. # keep track of how many correct predictions we make correct = 0 # we'll time how many predictions per second we make start = time.time() # Loop through each of the given reviews and call run to predict # its label. for i in range(len(testing_reviews)): pred = self.run(testing_reviews[i]) if(pred == testing_labels[i]): correct += 1 # For debug purposes, print out our prediction accuracy and speed # throughout the prediction process. elapsed_time = float(time.time() - start) reviews_per_second = i / elapsed_time if elapsed_time > 0 else 0 sys.stdout.write("\rProgress:" + str(100 * i/float(len(testing_reviews)))[:4] \ + "% Speed(reviews/sec):" + str(reviews_per_second)[0:5] \ + " #Correct:" + str(correct) + " #Tested:" + str(i+1) \ + " Testing Accuracy:" + str(correct * 100 / float(i+1))[:4] + "%") def run(self, review): Returns a POSITIVE or NEGATIVE prediction for the given review. # TODO: Run a forward pass through the network, like you did in the # "train" function. That means use the given review to # update the input layer, then calculate values for the hidden layer, # and finally calculate the output layer. # # Note: The review passed into this function for prediction # might come from anywhere, so you should convert it # to lower case prior to using it. self.layer_1 *= 0 unique_indices = set() for word in review.lower().split(" "): if word in self.word2index.keys(): unique_indices.add(self.word2index[word]) for index in unique_indices: self.layer_1 += self.weights_0_1[index] layer_2 = self.sigmoid(np.dot(self.layer_1, self.weights_1_2)) # TODO: The output layer should now contain a prediction. # Return `POSITIVE` for predictions greater-than-or-equal-to `0.5`, # and `NEGATIVE` otherwise. if(layer_2[0] >= 0.5): return "POSITIVE" else: return "NEGATIVE" mlp = SentimentNetwork(reviews[:-1000],labels[:-1000],min_count=20,polarity_cutoff=0.05,learning_rate=0.01) mlp.train(reviews[:-1000],labels[:-1000]) mlp.test(reviews[-1000:],labels[-1000:]) mlp = SentimentNetwork(reviews[:-1000],labels[:-1000],min_count=20,polarity_cutoff=0.8,learning_rate=0.01) mlp.train(reviews[:-1000],labels[:-1000]) mlp.test(reviews[-1000:],labels[-1000:]) mlp_full = SentimentNetwork(reviews[:-1000],labels[:-1000],min_count=0,polarity_cutoff=0,learning_rate=0.01) mlp_full.train(reviews[:-1000],labels[:-1000]) Image(filename='sentiment_network_sparse.png') def get_most_similar_words(focus = "horrible"): most_similar = Counter() for word in mlp_full.word2index.keys(): most_similar[word] = np.dot(mlp_full.weights_0_1[mlp_full.word2index[word]],mlp_full.weights_0_1[mlp_full.word2index[focus]]) return most_similar.most_common() get_most_similar_words("excellent") get_most_similar_words("terrible") import matplotlib.colors as colors words_to_visualize = list() for word, ratio in pos_neg_ratios.most_common(500): if(word in mlp_full.word2index.keys()): words_to_visualize.append(word) for word, ratio in list(reversed(pos_neg_ratios.most_common()))[0:500]: if(word in mlp_full.word2index.keys()): words_to_visualize.append(word) pos = 0 neg = 0 colors_list = list() vectors_list = list() for word in words_to_visualize: if word in pos_neg_ratios.keys(): vectors_list.append(mlp_full.weights_0_1[mlp_full.word2index[word]]) if(pos_neg_ratios[word] > 0): pos+=1 colors_list.append("#00ff00") else: neg+=1 colors_list.append("#000000") from sklearn.manifold import TSNE tsne = TSNE(n_components=2, random_state=0) words_top_ted_tsne = tsne.fit_transform(vectors_list) p = figure(tools="pan,wheel_zoom,reset,save", toolbar_location="above", title="vector T-SNE for most polarized words") source = ColumnDataSource(data=dict(x1=words_top_ted_tsne[:,0], x2=words_top_ted_tsne[:,1], names=words_to_visualize, color=colors_list)) p.scatter(x="x1", y="x2", size=8, source=source, fill_color="color") word_labels = LabelSet(x="x1", y="x2", text="names", y_offset=6, text_font_size="8pt", text_color="#555555", source=source, text_align='center') p.add_layout(word_labels) show(p) # green indicates positive words, black indicates negative words <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 2. Key Properties --&gt; Flux Correction Step7: 3. Key Properties --&gt; Genealogy Step8: 3.2. CMIP3 Parent Step9: 3.3. CMIP5 Parent Step10: 3.4. Previous Name Step11: 4. Key Properties --&gt; Software Properties Step12: 4.2. Code Version Step13: 4.3. Code Languages Step14: 4.4. Components Structure Step15: 4.5. Coupler Step16: 5. Key Properties --&gt; Coupling Step17: 5.2. Atmosphere Double Flux Step18: 5.3. Atmosphere Fluxes Calculation Grid Step19: 5.4. Atmosphere Relative Winds Step20: 6. Key Properties --&gt; Tuning Applied Step21: 6.2. Global Mean Metrics Used Step22: 6.3. Regional Metrics Used Step23: 6.4. Trend Metrics Used Step24: 6.5. Energy Balance Step25: 6.6. Fresh Water Balance Step26: 7. Key Properties --&gt; Conservation --&gt; Heat Step27: 7.2. Atmos Ocean Interface Step28: 7.3. Atmos Land Interface Step29: 7.4. Atmos Sea-ice Interface Step30: 7.5. Ocean Seaice Interface Step31: 7.6. Land Ocean Interface Step32: 8. Key Properties --&gt; Conservation --&gt; Fresh Water Step33: 8.2. Atmos Ocean Interface Step34: 8.3. Atmos Land Interface Step35: 8.4. Atmos Sea-ice Interface Step36: 8.5. Ocean Seaice Interface Step37: 8.6. Runoff Step38: 8.7. Iceberg Calving Step39: 8.8. Endoreic Basins Step40: 8.9. Snow Accumulation Step41: 9. Key Properties --&gt; Conservation --&gt; Salt Step42: 10. Key Properties --&gt; Conservation --&gt; Momentum Step43: 11. Radiative Forcings Step44: 12. Radiative Forcings --&gt; Greenhouse Gases --&gt; CO2 Step45: 12.2. Additional Information Step46: 13. Radiative Forcings --&gt; Greenhouse Gases --&gt; CH4 Step47: 13.2. Additional Information Step48: 14. Radiative Forcings --&gt; Greenhouse Gases --&gt; N2O Step49: 14.2. Additional Information Step50: 15. Radiative Forcings --&gt; Greenhouse Gases --&gt; Tropospheric O3 Step51: 15.2. Additional Information Step52: 16. Radiative Forcings --&gt; Greenhouse Gases --&gt; Stratospheric O3 Step53: 16.2. Additional Information Step54: 17. Radiative Forcings --&gt; Greenhouse Gases --&gt; CFC Step55: 17.2. Equivalence Concentration Step56: 17.3. Additional Information Step57: 18. Radiative Forcings --&gt; Aerosols --&gt; SO4 Step58: 18.2. Additional Information Step59: 19. Radiative Forcings --&gt; Aerosols --&gt; Black Carbon Step60: 19.2. Additional Information Step61: 20. Radiative Forcings --&gt; Aerosols --&gt; Organic Carbon Step62: 20.2. Additional Information Step63: 21. Radiative Forcings --&gt; Aerosols --&gt; Nitrate Step64: 21.2. Additional Information Step65: 22. Radiative Forcings --&gt; Aerosols --&gt; Cloud Albedo Effect Step66: 22.2. Aerosol Effect On Ice Clouds Step67: 22.3. Additional Information Step68: 23. Radiative Forcings --&gt; Aerosols --&gt; Cloud Lifetime Effect Step69: 23.2. Aerosol Effect On Ice Clouds Step70: 23.3. RFaci From Sulfate Only Step71: 23.4. Additional Information Step72: 24. Radiative Forcings --&gt; Aerosols --&gt; Dust Step73: 24.2. Additional Information Step74: 25. Radiative Forcings --&gt; Aerosols --&gt; Tropospheric Volcanic Step75: 25.2. Historical Explosive Volcanic Aerosol Implementation Step76: 25.3. Future Explosive Volcanic Aerosol Implementation Step77: 25.4. Additional Information Step78: 26. Radiative Forcings --&gt; Aerosols --&gt; Stratospheric Volcanic Step79: 26.2. Historical Explosive Volcanic Aerosol Implementation Step80: 26.3. Future Explosive Volcanic Aerosol Implementation Step81: 26.4. Additional Information Step82: 27. Radiative Forcings --&gt; Aerosols --&gt; Sea Salt Step83: 27.2. Additional Information Step84: 28. Radiative Forcings --&gt; Other --&gt; Land Use Step85: 28.2. Crop Change Only Step86: 28.3. Additional Information Step87: 29. Radiative Forcings --&gt; Other --&gt; Solar Step88: 29.2. Additional Information
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'noaa-gfdl', 'sandbox-1', 'toplevel') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.flux_correction.details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.genealogy.year_released') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.genealogy.CMIP3_parent') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.genealogy.CMIP5_parent') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.genealogy.previous_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.software_properties.repository') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.software_properties.code_version') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.software_properties.code_languages') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.software_properties.components_structure') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.software_properties.coupler') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "OASIS" # "OASIS3-MCT" # "ESMF" # "NUOPC" # "Bespoke" # "Unknown" # "None" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.coupling.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.coupling.atmosphere_double_flux') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.coupling.atmosphere_fluxes_calculation_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Atmosphere grid" # "Ocean grid" # "Specific coupler grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.coupling.atmosphere_relative_winds') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.tuning_applied.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.tuning_applied.global_mean_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.tuning_applied.regional_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.tuning_applied.trend_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.tuning_applied.energy_balance') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.tuning_applied.fresh_water_balance') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.heat.global') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.heat.atmos_ocean_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.heat.atmos_land_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.heat.atmos_sea-ice_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.heat.ocean_seaice_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.heat.land_ocean_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.global') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.atmos_ocean_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.atmos_land_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.atmos_sea-ice_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.ocean_seaice_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.runoff') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.iceberg_calving') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.endoreic_basins') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.fresh_water.snow_accumulation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.salt.ocean_seaice_interface') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.key_properties.conservation.momentum.details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CO2.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CO2.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CH4.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CH4.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.N2O.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.N2O.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.tropospheric_O3.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.tropospheric_O3.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.stratospheric_O3.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.stratospheric_O3.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CFC.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CFC.equivalence_concentration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "Option 1" # "Option 2" # "Option 3" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.greenhouse_gases.CFC.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.SO4.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.SO4.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.black_carbon.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.black_carbon.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.organic_carbon.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.organic_carbon.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.nitrate.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.nitrate.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_albedo_effect.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_albedo_effect.aerosol_effect_on_ice_clouds') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_albedo_effect.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_lifetime_effect.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_lifetime_effect.aerosol_effect_on_ice_clouds') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_lifetime_effect.RFaci_from_sulfate_only') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.cloud_lifetime_effect.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.dust.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.dust.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.tropospheric_volcanic.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.tropospheric_volcanic.historical_explosive_volcanic_aerosol_implementation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Type A" # "Type B" # "Type C" # "Type D" # "Type E" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.tropospheric_volcanic.future_explosive_volcanic_aerosol_implementation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Type A" # "Type B" # "Type C" # "Type D" # "Type E" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.tropospheric_volcanic.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.stratospheric_volcanic.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.stratospheric_volcanic.historical_explosive_volcanic_aerosol_implementation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Type A" # "Type B" # "Type C" # "Type D" # "Type E" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.stratospheric_volcanic.future_explosive_volcanic_aerosol_implementation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Type A" # "Type B" # "Type C" # "Type D" # "Type E" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.stratospheric_volcanic.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.sea_salt.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.aerosols.sea_salt.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.other.land_use.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "M" # "Y" # "E" # "ES" # "C" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.other.land_use.crop_change_only') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.other.land_use.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.other.solar.provision') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "N/A" # "irradiance" # "proton" # "electron" # "cosmic ray" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.toplevel.radiative_forcings.other.solar.additional_information') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: <font size="1.5em">More information about the watermark magic command extension.</font> Step3: <br> Step4: <br> Step5: As we can see, the resulting principal components do not yield a subspace where the data is linearly separated well. Note that PCA is a unsupervised method and does not "consider" class labels in order to maximize the variance in contrast to Linear Discriminant Analysis. Here, the colors blue and red are just added for visualization purposes to indicate the degree of separation. Step6: We can clearly see that the projection via RBF kernel PCA yielded a subspace where the classes are separated well. Such a subspace can then be used as input for linear classification models, such as Support Vector Machines or naive Bayes classifiers, which will be covered in future articles. Step7: <br> Step8: <br> Step9: Again, the results obtained via the linear PCA approach does not produce a subspace where the 2 classes are linearly well separated. Step10: And again, this 1-dimensional subspace obtained via Gaussian RBF kernel PCA looks much better in terms of linear class separation. Step11: <br> Step12: <br> Step13: <br> Step15: <br> Step16: Now, let's make a new half-moon dataset and project it onto a 1-dimensonal subspace using the RBF kernel PCA Step17: <br>
<ASSISTANT_TASK:> Python Code: %load_ext watermark %watermark -v -u -d -p scipy,scikit-learn,numpy,matplotlib from scipy.spatial.distance import pdist, squareform from scipy import exp from scipy.linalg import eigh import numpy as np def stepwise_kpca(X, gamma, n_components): Implementation of a RBF kernel PCA. Arguments: X: A MxN dataset as NumPy array where the samples are stored as rows (M), and the attributes defined as columns (N). gamma: A free parameter (coefficient) for the RBF kernel. n_components: The number of components to be returned. # Calculating the squared Euclidean distances for every pair of points # in the MxN dimensional dataset. sq_dists = pdist(X, 'sqeuclidean') # Converting the pairwise distances into a symmetric MxM matrix. mat_sq_dists = squareform(sq_dists) # Computing the MxM kernel matrix. K = exp(-gamma * mat_sq_dists) # Centering the symmetric NxN kernel matrix. N = K.shape[0] one_n = np.ones((N,N)) / N K = K - one_n.dot(K) - K.dot(one_n) + one_n.dot(K).dot(one_n) # Obtaining eigenvalues in descending order with corresponding # eigenvectors from the symmetric matrix. eigvals, eigvecs = eigh(K) # Obtaining the i eigenvectors that corresponds to the i highest eigenvalues. X_pc = np.column_stack((eigvecs[:,-i] for i in range(1,n_components+1))) return X_pc %matplotlib inline import matplotlib.pyplot as plt from sklearn.datasets import make_moons X, y = make_moons(n_samples=100, random_state=123) plt.figure(figsize=(8,6)) plt.scatter(X[y==0, 0], X[y==0, 1], color='red', alpha=0.5) plt.scatter(X[y==1, 0], X[y==1, 1], color='blue', alpha=0.5) plt.title('A nonlinear 2Ddataset') plt.ylabel('y coordinate') plt.xlabel('x coordinate') plt.show() from sklearn.decomposition import PCA scikit_pca = PCA(n_components=2) X_spca = scikit_pca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X_spca[y==0, 0], X_spca[y==0, 1], color='red', alpha=0.5) plt.scatter(X_spca[y==1, 0], X_spca[y==1, 1], color='blue', alpha=0.5) plt.title('First 2 principal components after Linear PCA') plt.xlabel('PC1') plt.ylabel('PC2') plt.show() import numpy as np scikit_pca = PCA(n_components=1) X_spca = scikit_pca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X_spca[y==0, 0], np.zeros((50,1)), color='red', alpha=0.5) plt.scatter(X_spca[y==1, 0], np.zeros((50,1)), color='blue', alpha=0.5) plt.title('First principal component after Linear PCA') plt.xlabel('PC1') plt.show() X_pc = stepwise_kpca(X, gamma=15, n_components=2) plt.figure(figsize=(8,6)) plt.scatter(X_pc[y==0, 0], X_pc[y==0, 1], color='red', alpha=0.5) plt.scatter(X_pc[y==1, 0], X_pc[y==1, 1], color='blue', alpha=0.5) plt.title('First 2 principal components after RBF Kernel PCA') plt.text(-0.18, 0.18, 'gamma = 15', fontsize=12) plt.xlabel('PC1') plt.ylabel('PC2') plt.show() plt.figure(figsize=(8,6)) plt.scatter(X_pc[y==0, 0], np.zeros((50)), color='red', alpha=0.5) plt.scatter(X_pc[y==1, 0], np.zeros((50)), color='blue', alpha=0.5) plt.title('First principal component after RBF Kernel PCA') plt.text(-0.17, 0.007, 'gamma = 15', fontsize=12) plt.xlabel('PC1') plt.show() from sklearn.decomposition import KernelPCA scikit_kpca = KernelPCA(n_components=2, kernel='rbf', gamma=15) X_skernpca = scikit_kpca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X_skernpca[y==0, 0], X_skernpca[y==0, 1], color='red', alpha=0.5) plt.scatter(X_skernpca[y==1, 0], X_skernpca[y==1, 1], color='blue', alpha=0.5) plt.text(-0.48, 0.35, 'gamma = 15', fontsize=12) plt.title('First 2 principal components after RBF Kernel PCA via scikit-learn') plt.xlabel('PC1') plt.ylabel('PC2') plt.show() scikit_kpca = KernelPCA(n_components=1, kernel='rbf', gamma=15) X_skernpca = scikit_kpca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X_skernpca[y==0, 0], np.zeros((50,1)), color='red', alpha=0.5) plt.scatter(X_skernpca[y==1, 0], np.zeros((50,1)), color='blue', alpha=0.5) plt.text(-0.48, 0.007, 'gamma = 15', fontsize=12) plt.title('First principal component after RBF Kernel PCA') plt.xlabel('PC1') plt.show() from sklearn.datasets import make_circles X, y = make_circles(n_samples=1000, random_state=123, noise=0.1, factor=0.2) plt.figure(figsize=(8,6)) plt.scatter(X[y==0, 0], X[y==0, 1], color='red', alpha=0.5) plt.scatter(X[y==1, 0], X[y==1, 1], color='blue', alpha=0.5) plt.title('Concentric circles') plt.ylabel('y coordinate') plt.xlabel('x coordinate') plt.savefig('/Users/Sebastian/Desktop/circles1.pdf') scikit_pca = PCA(n_components=2) X_spca = scikit_pca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X[y==0, 0], np.zeros((500,1))+0.1, color='red', alpha=0.5) plt.scatter(X[y==1, 0], np.zeros((500,1))-0.1, color='blue', alpha=0.5) plt.ylim([-15,15]) plt.text(-0.125, 12.5, 'gamma = 15', fontsize=12) plt.title('First principal component after Linear PCA') plt.xlabel('PC1') plt.savefig('/Users/Sebastian/Desktop/circles2.pdf') X_pc = stepwise_kpca(X, gamma=15, n_components=1) plt.figure(figsize=(8,6)) plt.scatter(X_pc[y==0, 0], np.zeros((500,1)), color='red', alpha=0.5) plt.scatter(X_pc[y==1, 0], np.zeros((500,1)), color='blue', alpha=0.5) plt.text(-0.05, 0.007, 'gamma = 15', fontsize=12) plt.title('First principal component after RBF Kernel PCA') plt.xlabel('PC1') plt.savefig('/Users/Sebastian/Desktop/circles3.pdf') from sklearn.datasets.samples_generator import make_swiss_roll from mpl_toolkits.mplot3d import Axes3D X, color = make_swiss_roll(n_samples=800, random_state=123) fig = plt.figure(figsize=(7,7)) ax = fig.add_subplot(111, projection='3d') ax.scatter(X[:, 0], X[:, 1], X[:, 2], c=color, cmap=plt.cm.rainbow) plt.title('Swiss Roll in 3D') plt.show() from sklearn.decomposition import PCA scikit_pca = PCA(n_components=2) X_spca = scikit_pca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X_spca[:, 0], X_spca[:, 1], c=color, cmap=plt.cm.rainbow) plt.title('First 2 principal components after Linear PCA') plt.xlabel('PC1') plt.ylabel('PC2') plt.show() scikit_pca = PCA(n_components=1) X_spca = scikit_pca.fit_transform(X) plt.figure(figsize=(8,6)) plt.scatter(X_spca, np.zeros((800,1)), c=color, cmap=plt.cm.rainbow) plt.title('First principal component after Linear PCA') plt.xlabel('PC1') plt.show() X_pc = stepwise_kpca(X, gamma=0.1, n_components=2) plt.figure(figsize=(8,6)) plt.scatter(X_pc[:, 0], X_pc[:, 1], c=color, cmap=plt.cm.rainbow) plt.title('First 2 principal components after RBF Kernel PCA') plt.text(-0.14, 0.14, 'gamma = 0.1', fontsize=12) plt.xlabel('PC1') plt.ylabel('PC2') plt.show() plt.figure(figsize=(8,6)) plt.scatter(X_pc[:,0], np.zeros((800,1)), c=color, cmap=plt.cm.rainbow) plt.text(-0.125, 0.007, 'gamma = 0.1', fontsize=12) plt.title('First principal component after RBF Kernel PCA') plt.xlabel('PC1') plt.show() from sklearn.manifold import locally_linear_embedding X_lle, err = locally_linear_embedding(X, n_neighbors=12, n_components=2) plt.figure(figsize=(8,6)) plt.scatter(X_lle[:, 0], X_lle[:, 1], c=color, cmap=plt.cm.rainbow) plt.title('First 2 principal components after Locally Linear Embedding') plt.show() from sklearn.manifold import locally_linear_embedding X_lle, err = locally_linear_embedding(X, n_neighbors=12, n_components=1) plt.figure(figsize=(8,6)) plt.scatter(X_lle, np.zeros((800,1)), c=color, cmap=plt.cm.rainbow) plt.title('First principal component after Locally Linear Embedding') plt.show() from scipy.spatial.distance import pdist, squareform from scipy import exp from scipy.linalg import eigh import numpy as np def stepwise_kpca(X, gamma, n_components): Implementation of a RBF kernel PCA. Arguments: X: A MxN dataset as NumPy array where the samples are stored as rows (M), and the attributes defined as columns (N). gamma: A free parameter (coefficient) for the RBF kernel. n_components: The number of components to be returned. Returns the k eigenvectors (alphas) that correspond to the k largest eigenvalues (lambdas). # Calculating the squared Euclidean distances for every pair of points # in the MxN dimensional dataset. sq_dists = pdist(X, 'sqeuclidean') # Converting the pairwise distances into a symmetric MxM matrix. mat_sq_dists = squareform(sq_dists) # Computing the MxM kernel matrix. K = exp(-gamma * mat_sq_dists) # Centering the symmetric NxN kernel matrix. N = K.shape[0] one_n = np.ones((N,N)) / N K_norm = K - one_n.dot(K) - K.dot(one_n) + one_n.dot(K).dot(one_n) # Obtaining eigenvalues in descending order with corresponding # eigenvectors from the symmetric matrix. eigvals, eigvecs = eigh(K_norm) # Obtaining the i eigenvectors (alphas) that corresponds to the i highest eigenvalues (lambdas). alphas = np.column_stack((eigvecs[:,-i] for i in range(1,n_components+1))) lambdas = [eigvals[-i] for i in range(1,n_components+1)] return alphas, lambdas from sklearn.datasets import make_moons X, y = make_moons(n_samples=100, random_state=123) alphas, lambdas = stepwise_kpca(X, gamma=15, n_components=1) x_new = X[25] X_proj = alphas[25] # original projection x_new X_proj def project_x(x_new, X, gamma, alphas, lambdas): pair_dist = np.array([np.sum((x_new-row)**2) for row in X]) k = np.exp(-gamma * pair_dist) return k.dot(alphas / lambdas) # projection of the "new" datapoint x_reproj = project_x(x_new, X, gamma=15, alphas=alphas, lambdas=lambdas) x_reproj %matplotlib inline import matplotlib.pyplot as plt plt.figure(figsize=(8,6)) plt.scatter(alphas[y==0, 0], np.zeros((50)), color='red', alpha=0.5) plt.scatter(alphas[y==1, 0], np.zeros((50)), color='blue', alpha=0.5) plt.scatter(X_proj, 0, color='black', label='original projection of point X[24]', marker='^', s=100) plt.scatter(x_reproj, 0, color='green', label='remapped point X[24]', marker='x', s=500) plt.legend(scatterpoints=1) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Download model checkpoint Step2: Import the Model Architecture Step3: Exercise Step4: Build the Servable from the Estimator API Step6: Helper Functions for Building a TensorFlow Graph Step7: Unit test the helper function Step8: Run the Test Graph Step9: Remarks Step10: Unit Test the Preprocessing Helper Function Step11: Helper Function Step12: Unit Test the Output Postprocessing Helper Function Step13: End-to-End Helper Function Step14: Servable Model API Definition Step15: Build the Estimator Step16: Serving input receiver function Step17: Export the servable model to disk
<ASSISTANT_TASK:> Python Code: import numpy as np import os import tensorflow as tf import urllib.request # Define a constant indicating the number of layers in our loaded model. We're loading a # resnet-50 model. RESNET_SIZE = 50 # Model and serving directories MODEL_DIR="resnet_model_checkpoints" SERVING_DIR="estimator_servable" SAMPLE_DIR="../client" urllib.request.urlretrieve("http://download.tensorflow.org/models/official/resnet50_2017_11_30.tar.gz ", "resnet.tar.gz") #unzip the file into a directory called resnet from subprocess import call call(["mkdir", MODEL_DIR]) call(["tar", "-zxvf", "resnet.tar.gz", "-C", MODEL_DIR]) # Make sure you see model checkpoint files in this directory os.listdir(MODEL_DIR) %run ../../models/official/resnet/resnet_model.py # TODO: Copy constants from imagenet_main.py. def serving_model_fn(features, labels, mode): '''The main model function used by the estimator to define the TensorFlow model server API. Args: features: The client request, which is a dictionary: {'image': 1D tensor of jpeg strings} labels: None or not used since we are predicting only mode: TRAIN, EVAL, or PREDICT. Serving only uses PREDICT mode. Returns: If training or evaluating (should not happen), return a blank EstimatorSpec that does nothing. If predicting (always), return an EstimatorSpec that produces a response with top k classes and probabilities to send back to the client. ''' # TODO: Remove tf.summary.image(). This is used for monitoring during training. tf.summary.image('images', features, max_outputs=6) # Move preprocessing, network, and postprocessing into a helper function. # serving_input_to_output() will be defined below. predictions = serving_input_to_output(features, mode) # Create the PREDICT EstimatorSpec that will send a proper response back to the client. if mode == tf.estimator.ModeKeys.PREDICT: return create_servable_estimator_spec(predictions, mode) # TODO: You already returned the EstimatorSpec for predictions. # Training and evaluation are not needed. # Shortcut every graph element below here by returning a minimal EstimatorSpec. return ??? # Calculate loss, which includes softmax cross entropy and L2 regularization. cross_entropy = tf.losses.softmax_cross_entropy( logits=logits, onehot_labels=labels) # Create a tensor named cross_entropy for logging purposes. tf.identity(cross_entropy, name='cross_entropy') tf.summary.scalar('cross_entropy', cross_entropy) # Add weight decay to the loss. We exclude the batch norm variables because # doing so leads to a small improvement in accuracy. loss = cross_entropy + _WEIGHT_DECAY * tf.add_n( [tf.nn.l2_loss(v) for v in tf.trainable_variables() if 'batch_normalization' not in v.name]) if mode == tf.estimator.ModeKeys.TRAIN: # Scale the learning rate linearly with the batch size. When the batch size # is 256, the learning rate should be 0.1. initial_learning_rate = 0.1 * params['batch_size'] / 256 batches_per_epoch = _NUM_IMAGES['train'] / params['batch_size'] global_step = tf.train.get_or_create_global_step() # Multiply the learning rate by 0.1 at 30, 60, 80, and 90 epochs. boundaries = [ int(batches_per_epoch * epoch) for epoch in [30, 60, 80, 90]] values = [ initial_learning_rate * decay for decay in [1, 0.1, 0.01, 1e-3, 1e-4]] learning_rate = tf.train.piecewise_constant( tf.cast(global_step, tf.int32), boundaries, values) # Create a tensor named learning_rate for logging purposes. tf.identity(learning_rate, name='learning_rate') tf.summary.scalar('learning_rate', learning_rate) optimizer = tf.train.MomentumOptimizer( learning_rate=learning_rate, momentum=_MOMENTUM) # Batch norm requires update_ops to be added as a train_op dependency. update_ops = tf.get_collection(tf.GraphKeys.UPDATE_OPS) with tf.control_dependencies(update_ops): train_op = optimizer.minimize(loss, global_step) else: train_op = None accuracy = tf.metrics.accuracy( tf.argmax(labels, axis=1), predictions['classes']) metrics = {'accuracy': accuracy} # Create a tensor named train_accuracy for logging purposes. tf.identity(accuracy[1], name='train_accuracy') tf.summary.scalar('train_accuracy', accuracy[1]) return tf.estimator.EstimatorSpec( mode=mode, predictions=predictions, loss=loss, train_op=train_op, eval_metric_ops=metrics) def convert_jpeg_to_image(encoded_image): Preprocesses the image by subtracting out the mean from all channels. Args: image: A jpeg-formatted byte stream represented as a string. Returns: A 3d tensor of image pixels normalized to be between -0.5 and 0.5, resized to height x width x 3. The normalization approximates the preprocess_for_train and preprocess_for_eval functions in https://github.com/tensorflow/models/blob/v1.4.0/official/resnet/vgg_preprocessing.py. image = ??? # TODO: Use a tf function to decode the jpeg into a 3d tensor. image = tf.to_float(image) / 255.0 - 0.5 # Normalize values to be between -0.5 and 0.5. return image # Defining input test graph nodes: only needs to be run once! test_jpeg_ph = tf.placeholder(dtype=tf.string, shape=[], name='test_jpeg_placeholder') # A placeholder for a single string, which is a dimensionless (0D) tensor. test_decoded_tensor = convert_jpeg_to_image(test_jpeg_ph) # Output node, which returns a 3D tensor after processing. # Print the graph elements to check shapes. ? indicates that TensorFlow does not know the length. # of those dimensions. print(test_jpeg_ph) print(test_decoded_tensor) # Validate the result of the function using a sample image SAMPLE_DIR/cat_sample.jpg with open(os.path.join(SAMPLE_DIR, "cat_sample.jpg"), "rb") as imageFile: jpeg_str = imageFile.read() with tf.Session() as sess: result = sess.run(test_decoded_tensor, feed_dict={test_jpeg_ph: jpeg_str}) assert result.shape == (224, 224, 3) # TODO: Replace with assert statements to check max and min normalized pixel values assert False print('Hooray! JPEG decoding test passed!') def preprocess_input(features): '''Function to preprocess client request before feeding into the network. Use tf.map_fn and the convert_jpeg_to_image() helper function to convert the 1D input tensor of jpeg strings into a list of single-precision floating point 3D tensors, which are normalized pixel values for the images. Then stack and reshape this list of tensors into a 4D tensor with appropriate dimensions. Args: features: request received from our client, a dictionary with a single element containing a tensor of multiple jpeg images {'images' : 1D_tensor_of_jpeg_byte_strings} Returns: a 4D tensor of normalized pixel values for the input images. ''' images = features['images'] # A tensor of tf.strings processed_images = ??? # TODO: fill in the ??? processed_images = tf.stack(processed_images) # Convert list of 3D tensors to a 4D tensor processed_images = tf.reshape(tensor=processed_images, # Reshaping informs Tensorflow of the final dimensions of the 4D tensor shape=[-1, _DEFAULT_IMAGE_SIZE, _DEFAULT_IMAGE_SIZE, 3]) return processed_images # Build a Test Input Preprocessing Network: only needs to be run once! test_jpeg_tensor = tf.placeholder(dtype=tf.string, shape=???, name='test_jpeg_tensor') # A placeholder for a single string, which is a dimensionless (0D) tensor. test_processed_images = preprocess_input({'images': test_jpeg_tensor}) # Output node, which returns a 3D tensor after processing. # Print the graph elements to check shapes. ? indicates that Tensorflow does not know the length of those dimensions. print(test_jpeg_tensor) print(test_processed_images) # Run test network using a sample image SAMPLE_DIR/cat_sample.jpg with open(os.path.join(SAMPLE_DIR, "cat_sample.jpg"), "rb") as imageFile: jpeg_str = imageFile.read() with tf.Session() as sess: result = sess.run(test_processed_images, feed_dict={test_jpeg_tensor: np.array([jpeg_str, jpeg_str])}) # Duplicate for length 2 array assert result.shape == (2, 224, 224, 3) # 4D tensor with first dimension length 2, since we have 2 images # TODO: add a test for min and max normalized pixel values assert False # TODO: add a test to verify that the resulting tensor for image 0 and image 1 are identical. assert False print('Hooray! Input unit test succeeded!') TOP_K = 5 def postprocess_output(logits, k=TOP_K): '''Return top k classes and probabilities from class logits.''' probs = tf.nn.softmax(logits) # Converts logits to probabilities. top_k_probs, top_k_classes = ??? return {'classes': top_k_classes, 'probabilities': top_k_probs} # Build Test Output Postprocessing Network: only needs to be run once! test_logits_ph = tf.placeholder(dtype=tf.float32, shape=???, name='test_logits_placeholder') test_prediction_output = postprocess_output(test_logits_ph) # Print the graph elements to check shapes. print(test_logits_ph) print(test_prediction_output) # Run test network with tf.Session() as sess: logits = np.ones(???) # TODO: number of classes result = sess.run(test_prediction_output, {test_logits_ph: logits}) classes = result['classes'] probs = result['probabilities'] # Inefficient but simple element-wise check assert probs[1:].all() == probs[:-1].all() expected_probs = np.array(len(probs) * [1.0/???]) # Number of classes assert probs.all() == expected_probs.all() print('Hooray! Output unit test succeeded!') def serving_input_to_output(jpeg_tensor, mode, k=TOP_K): # TODO: Preprocess jpeg tensors before sending tensors to the network. preprocessed_images = ??? # TODO: Use 'channels_first' or 'channels_last' network = imagenet_resnet_v2(RESNET_SIZE, _LABEL_CLASSES, data_format='channels_last') # TODO: Connect the preprocessed images to the network logits = ??? # TODO: Postprocess outputs of network (logits) and send top k predictions back to client. predictions = ??? return predictions def create_servable_estimator_spec(predictions, mode): return tf.estimator.EstimatorSpec( mode=mode, predictions=predictions, # Note: This is not be used in serving, but must be provided for the Estimator API. ??? # TODO: assign an appropriate dictionary to the export_outputs parameter here. ) estimator = tf.estimator.Estimator( model_fn=serving_model_fn, model_dir=MODEL_DIR, ) def serving_input_receiver_fn(): return tf.estimator.export.build_raw_serving_input_receiver_fn(???)() ## TODO: Add dictionary estimator.export_savedmodel(export_dir_base=SERVING_DIR, serving_input_receiver_fn=serving_input_receiver_fn) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Internally it computes a dict with Step2: DECODE ONE VALUE Step3: MATCH ONE VALUE Step4: ENCODE A VALUE (EXCLUSIVELLY) Step5: ENCODE A VALUE (ALL) Step6: ENCODE AND Step7: DECODE AN IMAGE Step8: BANDS Step9: APPLY THE BitReader TO THE BAND THAT HOLDS THE BIT INFORMATION Step10: BitReader INFORMATION FOR KNOW COLLECTIONS AVAILABLE IN geetools.cloud_mask MODULE
<ASSISTANT_TASK:> Python Code: import ee ee.Initialize() from geetools import bitreader, cloud_mask options = { '0-1': {0:'clear', 1:'cloud', 2:'mix'}, # cloud state '2-2': {0: 'no_shadow', 1:'shadow'}, # cloud shadow (bit 0 is not needed) '6-7': {0:'climatology', 1:'low', 2:'average', 3:'high'} # land/water flag } reader = bitreader.BitReader(options, 16) reader.info print('bit length', reader.bit_length) value = 204 bits = reader.getBin(value) print('204:', bits) reader.decode(204) reader.match(204, 'cloud') reader.match(204, 'shadow') reader.encode('shadow') reader.encode('clear') reader.encode('no_shadow') print(reader.encodeOne('shadow')[0:100]) print(reader.encodeOne('cloud')[0:100]) print(reader.encodeAnd('cloud', 'shadow')[0:100]) import ee import ipygee as ui Map = ui.Map() Map.show() modcol = ee.ImageCollection('MODIS/006/MOD09GA').sort('system:time_start', False) mod = ee.Image(modcol.first()) red = 'sur_refl_b01' green = 'sur_refl_b04' blue = 'sur_refl_b03' qa = 'state_1km' qa_mask = mod.select(qa) Map.addLayer(mod, {'bands':[red, green, blue], 'min':0, 'max':5000}, 'Original') Map.addLayer(qa_mask, {'min':0, 'max':reader.max}, 'QA') mask = reader.decodeImage(mod, qa) Map.addLayer(mask.select(['cloud']), {'min':0, 'max':1}, 'Clouds') from geetools import cloud_mask state1km = cloud_mask.BITS_MODIS09GA state1km <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Example Step3: Example
<ASSISTANT_TASK:> Python Code: from zipline.pipeline.data import USEquityPricing as USEP from zipline.pipeline.factors import SimpleMovingAverage # sma30 and sma90 are Factors. # Factors represent computations producing numerical-valued outputs. sma30 = SimpleMovingAverage(inputs=[USEP.close], window_length=30) sma90 = SimpleMovingAverage(inputs=[USEP.close], window_length=90) # Comparisons between Factors produce Filters. # Filters represent computations producing boolean-valued outputs. screen = (sma30 > sma90) example0 = Pipeline( columns={"sma30": sma30, "sma90": sma90}, screen=screen, ) example0 example0.show_graph('svg') results0 = engine.run_pipeline(example0, start_date, end_date) results0 from zipline.pipeline.factors import VWAP vwap30 = VWAP(window_length=30) vwap90 = VWAP(window_length=90) # Arithmetic operations between Factors produce new Factors. vwap_pct_change = ((vwap30 - vwap90) / vwap30) # rank() is a method available on any Factor instance. # It produces a new Factor containing the numerical rank of each # asset after sorting the underyling Factor values. vwap_pct_change_rank = vwap_pct_change.rank(ascending=False) # top() is another method available on Factors. It produces a Filter # representing the top N assets sorted by the underlying Factor values. top200 = vwap_pct_change.top(200) example1 = Pipeline( columns={ "rank": vwap_pct_change_rank, "pct_change": vwap_pct_change, }, screen=top200, ) example1.show_graph() engine.run_pipeline(example1, start_date, end_date) import numpy as np from zipline.pipeline import CustomFactor class MaxDrawdown(CustomFactor): Factor computing the maximum drawdown an asset has taken in the last N days. inputs = [USEP.close] def compute(self, today, assets, out, closes): # The difference between each day and the max of all # earlier days in the period. drawdowns = fmax.accumulate(closes, axis=0) - closes drawdowns[isnan(drawdowns)] = np.NINF drawdown_ends = np.nanargmax(drawdowns, axis=0) # This is slow in pure Python. # Cython or Numba could accelerate this substantially. for i, end in enumerate(drawdown_ends): peak = nanmax(data[:end + 1, i]) out[i] = (peak - data[end, i]) / data[end, i] maxdd_90 = MaxDrawdown(window_length=90) # rank() takes an optional `mask` keyword, which can be passed a Filter # to signify "Compute rank() only for assets for which the Filter # returned True. masked_rank = vwap_pct_change.rank(mask=maxdd_90.bottom(200)) example2 = Pipeline( columns={ 'masked_rank': masked_rank }, screen=maxdd_90.bottom(200), ) example2.show_graph('svg') engine.run_pipeline(example1, start_date, end_date) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Key features Step2: Built on pandas Step3: Note how you can debug both pieces of code by running and inspecting df.a.mean(). Step4: Notice how much of this code is writing the word lambda. Step5: Lazy expressions Step6: No reset_index Step7: Unified (un)grouped API Step8: In pandas you have to change your code for grouped data. Step9: Note that g_cyl does not have an assign method, and requires passing what operation you want to do ("mean") as a string to .transform(). Step10: Suppose that we want to get the courses each student scored lowest on. Step11: In siuba it is simpler, and comparable in speed. Step12: This is because siuba's lazy expressions let it optimize grouped operations. Step13: SQL queries Step14: Abstract syntax trees Step15: Each black box in the printout above is a Call. Calls are the pieces that represent the underlying operations. They have methods to inspect and transform them. Step16: Nested data
<ASSISTANT_TASK:> Python Code: # this is a hidden cell print( <div class="output_area rendered_html docutils container"> {table} </div> .format(table = table.replace('\n', ""))) import pandas as pd from siuba import _, mutate my_data = pd.DataFrame({ 'g': ['a', 'a', 'b'], 'x': [1,2,3], }) # pandas my_data.assign(avg = lambda d: d.x.mean()) # siuba mutate(my_data, avg = _.x.mean()) (my_data .assign(avg = lambda d: d.x.mean()) # create new column .loc[lambda d: d.x != 3] # filter out some rows ) # actions can be imported individually from siuba import mutate, arrange # they can be combined using a pipe my_data >> mutate(y = _.x + 1) >> arrange(_.g, -_.x) # rather than repeat the name of your data, you can use lazy expressions --- my_data_frame = pd.DataFrame({'a': [1,2,3]}) # bad my_data_frame["b"] = my_data_frame["a"] + 1 my_data_frame["c"] = my_data_frame["b"] + 2 # good my_data_frame >> mutate(b = _.a + 1, c = _.b + 2) from siuba.data import mtcars from siuba import summarize g_cyl = mtcars.groupby("cyl") agg_res = g_cyl[["hp", "mpg"]].agg("mean") agg_res # bad agg_res.reset_index() # good summarize(g_cyl, hp = _.hp.mean(), mpg = _.mpg.mean()) g_cyl = mtcars.groupby("cyl") mtcars >> mutate(demeaned = _.hp - _.hp.mean()) # uses ungrouped mean g_cyl >> mutate(demeaned = _.hp - _.hp.mean()) # uses grouped mean g_cyl = mtcars.groupby("cyl") # ungrouped vs grouped mean mtcars.assign(demeaned = lambda d: d.hp - d.hp.mean()) mtcars.assign(demeaned = g_cyl.obj.hp - g_cyl.hp.transform("mean")) # fast grouped operations (pull from dev docs) # PLOT of timing import numpy as np import pandas as pd np.random.seed(123) students = pd.DataFrame({ 'student_id': np.repeat(np.arange(2000), 10), 'course_id': np.random.randint(1, 20, 20000), 'score': np.random.randint(1, 100, 20000) }) g_students = students.groupby('student_id') g_students %%time # pandas is_student_min = g_students.obj.score == g_students.score.transform('min') low_scores = students[is_student_min] from siuba.experimental.pd_groups import fast_filter %%time # siuba low_scores = fast_filter(g_students, _.score == _.score.min()) # set up code for timing from dplython import X, DplyFrame, sift, group_by as dply_group_by g_students2 = DplyFrame(students) >> dply_group_by(X.student_id) %%time g_students2 >> sift(X.score == X.score.min()) # generate SQL queries from siuba.data import cars_sql from siuba import group_by, mutate, show_query q = (cars_sql >> group_by("cyl") >> mutate(demeaned = _.hp - _.hp.mean()) >> show_query() ) # ASTs for transforming from siuba.siu import Symbolic, Call, strip_symbolic _ = Symbolic() sym = _.a.mean() + _["b"] sym call = strip_symbolic(sym) # get columns names used in lazy expression call.op_vars(attr_calls = False) from siuba import _, mutate, unnest tagged = pd.DataFrame({ 'id': [1,2,3], 'tags': ['a,b,c', 'd,e', 'f'] }) (tagged >> mutate(split_tags = _.tags.str.split(',')) >> unnest("split_tags") ) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's get started with some basic imports. Step2: And then we'll build a synthetic "dataset" and initialize a new bundle with those data Step3: mask_enabled and mask_phases parameters Step4: This is True by default, but mask_phases is set to an empty list, meaning that no masking will actually be applied. This mask_enabled parameter just allows for setting a mask via mask_phases and then toggling that mask on and off without having to reset mask_phases. Step5: We can now plot the observations to see the unmasked (fake) data. Step6: If we wanted to only include the eclipses, we could set mask_phases as a list of tuples, where each tuple contains the phase range that we want to keep. Step7: Note that b.run_compute, computes the forward model ignoring that mask, whether compute_phases is set or not. Step8: However, when calling b.run_solver, the mask will be applied when determining what times to compute the forward-model (see Advanced
<ASSISTANT_TASK:> Python Code: #!pip install -I "phoebe>=2.4,<2.5" import phoebe from phoebe import u # units import numpy as np b = phoebe.default_binary() b = phoebe.default_binary() b.add_dataset('lc', times=phoebe.linspace(0,5,1001)) b.run_compute() times = b.get_value('times@model') fluxes = b.get_value('fluxes@model') sigmas = np.ones_like(times) * 0.01 b = phoebe.default_binary() b.add_dataset('lc', compute_phases=phoebe.linspace(0,1,101), times=times, fluxes=fluxes, sigmas=sigmas, dataset='lc01') b.get_parameter(qualifier='mask_enabled', dataset='lc01', context='dataset') print(b.get_parameter(qualifier='mask_enabled', dataset='lc01', context='dataset').description) b.get_parameter(qualifier='mask_phases', dataset='lc01', context='dataset') print(b.get_parameter(qualifier='mask_phases', dataset='lc01', context='dataset').description) _ = b.plot(show=True) _ = b.plot(x='phases', show=True) b.set_value('mask_phases', [(-0.1, 0.1), (0.4,-0.4)]) _ = b.plot(show=True) _ = b.plot(x='phases', show=True) b.run_compute() _ = b.plot(x='phases', show=True, marker={'model': '+'}) b.set_value('compute_phases', []) b.run_compute() _ = b.plot(x='phases', show=True, marker={'model': '+'}) print(b.get_parameter('phases_t0').description) print(b.get_parameter('phases_t0').choices) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: <br> Step2: <br> Step7: <br> Step8: Select a simulation file to test Step9: Load the parameters for the models Step10: <br> Step11: <br> Step12: <br> Step13: <br>
<ASSISTANT_TASK:> Python Code: # Uncomment and run this one time only # !pip install http://download.pytorch.org/whl/cu75/torch-0.1.12.post2-cp27-none-linux_x86_64.whl # !pip install torchvision==0.1.8 # !pip install tabulate # !pip install --upgrade scikit-learn # !pip install --upgrade numpy # !pip install h5py # !pip install ibmseti # !pip install tqdm # !pip install --upgrade pandas # Uncomment and run this one time only! # from __future__ import print_function # import requests # import shutil # base_url = 'https://dal.objectstorage.open.softlayer.com/v1/AUTH_cdbef52bdf7a449c96936e1071f0a46b/code_challenge_models/effsubsee' # for i in range(1,6): # r = requests.get('{0}/fold{1}/FOLD{1}_BEST_wresnet34x2_batchsize96_checkpoint.pth.tar'.format(base_url, i), stream=True) # filename = 'effsubsee_FOLD{}_BEST_wresnet34x2_batchsize96_checkpoint.pth.tar'.format(i) # with open(filename, 'wb') as fout: # shutil.copyfileobj(r.raw, fout) # print('saved {}'.format(filename)) # Uncomment and run this once # !wget -O mean_stddev_primary_full_v3__384t__512f__logmod2-ph.hdf5 https://github.com/sgrvinod/ml4seti-Effsubsee/blob/master/folds/mean_stddev_primary_full_v3__384t__512f__logmod2-ph.hdf5?raw=true # Uncomment and run this one time only # !wget https://dal.objectstorage.open.softlayer.com/v1/AUTH_cdbef52bdf7a449c96936e1071f0a46b/simsignals_v3_zipped/primary_testset_preview_v3.zip # !unzip -q primary_testset_preview_v3.zip # !ls import math from torch import nn class BasicBlock(nn.Module): Graph of the Basic Block, as defined in the paper. This block contains two 3x3 convolutional layers, each with prior Batch Norm and ReLU. There is an additive residual connection across the block. If the number of dimensions change across the block, this residual is a convolutional projection of the input. Args: inplanes (int): number of dimensions in the input tensor. outplanes (int): number of dimensions in the output tensor. stride (int): stride length for the filter. dropout (float, fraction): the fraction of neurons to randomly drop/set to zero in-between conv. layers. def __init__(self, inplanes, outplanes, stride, dropout=0.0): super(BasicBlock, self).__init__() self.inplanes = inplanes self.outplanes = outplanes self.bn1 = nn.BatchNorm2d(inplanes) self.relu1 = nn.ReLU(inplace=True) self.conv1 = nn.Conv2d(inplanes, outplanes, kernel_size=3, stride=stride, padding=1, bias=False) self.bn2 = nn.BatchNorm2d(outplanes) self.relu2 = nn.ReLU(inplace=True) self.conv2 = nn.Conv2d(outplanes, outplanes, kernel_size=3, stride=1, padding=1, bias=False) self.dropout = dropout if self.inplanes != self.outplanes: self.projection = nn.Conv2d(inplanes, outplanes, kernel_size=1, stride=stride, padding=0, bias=False) else: self.projection = None def forward(self, x): out = self.bn1(x) out = self.relu1(out) if self.inplanes != self.outplanes: residual = self.projection(out) else: residual = x out = self.conv1(out) out = self.bn2(out) out = self.relu2(out) if self.dropout > 0.: out = nn.functional.dropout(out, p=self.dropout, training=self.training) out = self.conv2(out) out += residual return out class WideResNet(nn.Module): Graph of the Wide Residual Network, as defined in the paper. This network contains 4 convolutional blocks, each increasing dimensions by a factor of 'k': The first is a single 3x3 Convolution, increasing dimensions from 2 (log(amplitude^2), phase) to 16. The second is a sequence of Basic Blocks, 16 dimensions -> 16*k The third is a sequence of Basic Blocks, 16*k dimensions -> 16*k^2 The fourth is a sequence of Basic Blocks, 16*k dimensions -> 16*k^3 These convolutional layers are followed by Batch Norm, ReLU, Average Pool, and finally a Fully Connected Layer to perform the classification. Args: n (int): number of single convolutional layers in the entire network, 'n' in the paper. k (int): widening factor for each succeeding convolutional layer, 'k' in the paper. block (nn.module): BasicBlock. dropout (float, fraction): the fraction of neurons to randomly drop/set to zero inside the blocks. def __init__(self, n, k, block=BasicBlock, dropout=0.0): super(WideResNet, self).__init__() if (n - 4) % 6 != 0: raise ValueError("Invalid depth! Depth must be (6 * n_blocks + 4).") n_blocks = (n - 4) / 6 self.conv_block1 = nn.Conv2d(2, 16, kernel_size=3, stride=1, padding=1, bias=False) self.conv_block2 = self._make_layer(block, n_blocks, 16, 16 * k, 2, dropout) self.conv_block3 = self._make_layer(block, n_blocks, 16 * k, 32 * k, 2, dropout) self.conv_block4 = self._make_layer(block, n_blocks, 32 * k, 64 * k, 2, dropout) self.bn1 = nn.BatchNorm2d(64 * k) self.relu = nn.ReLU(inplace=True) self.fc = nn.Linear(64 * k * 6 * 8, 7) for m in self.modules(): if isinstance(m, nn.Conv2d): n_weights = m.kernel_size[0] * m.kernel_size[1] * m.out_channels m.weight.data.normal_(0, math.sqrt(2. / n_weights)) elif isinstance(m, nn.BatchNorm2d): m.weight.data.fill_(1) m.bias.data.zero_() elif isinstance(m, nn.Linear): m.bias.data.zero_() def _make_layer(self, block, n_blocks, inplanes, outplanes, stride, dropout): Graph of a Convolutional block layer (conv_block2/conv_block3/conv_block4), as defined in the paper. This graph assembles a number of blocks (BasicBlock) in sequence. Args: block (nn.module): BasicBlock or ResidualBlock. inplanes (int): number of dimensions in the input tensor. outplanes (int): number of dimensions in the output tensor. stride (int): stride length for the filter. dropout (float, fraction): the fraction of neurons to randomly drop/set to zero in-between conv. layers. layers = [] for i in range(n_blocks): if i == 0: layers.append(block(inplanes, outplanes, stride, dropout)) else: layers.append(block(outplanes, outplanes, 1, dropout)) return nn.Sequential(*layers) def forward(self, x): out = self.conv_block1(x) out = self.conv_block2(out) out = self.conv_block3(out) out = self.conv_block4(out) out = self.bn1(out) out = self.relu(out) out = nn.functional.avg_pool2d(out, 8) out = out.view(out.size(0), -1) return self.fc(out) def wresnet34x2(): model = WideResNet(n=34, k=2, block=BasicBlock, dropout=0.3) return model from __future__ import print_function import argparse import os import time import torch import torchvision.transforms as transforms import pandas as pd import ibmseti import numpy as np import ibmseti import h5py def normalizeSimFile(normalizeData, simfile): # Load the Normalizer function h = h5py.File(normalizeData, 'r') mean = torch.FloatTensor(h['mean'][:]) mean = mean.permute(2, 0, 1) std_dev = torch.FloatTensor(h['std_dev'][:]) std_dev = std_dev.permute(2, 0, 1) h.close() normalize = transforms.Normalize(mean=mean, std=std_dev) # Load simulation data time_freq_resolution=(384, 512) aca = ibmseti.compamp.SimCompamp(open(simfile, 'rb').read()) complex_data = aca.complex_data() complex_data = complex_data.reshape(time_freq_resolution[0], time_freq_resolution[1]) complex_data = complex_data * np.hanning(complex_data.shape[1]) cpfft = np.fft.fftshift(np.fft.fft(complex_data), 1) spectrogram = np.abs(cpfft) features = np.stack((np.log(spectrogram ** 2), np.arctan(cpfft.imag / cpfft.real)), -1) # create FloatTensor, permute to proper dimensional order, and normalize data = torch.FloatTensor(features) data = data.permute(2, 0, 1) data = normalize(data) # The model expects a 4D tensor s = data.size() data = data.contiguous().view(1, s[0], s[1], s[2]) input_var = torch.autograd.Variable(data, volatile=True) return input_var def singleProbs(model, input_var): model.eval() softmax = torch.nn.Softmax() softmax.zero_grad() output = model(input_var) probs = softmax(output).data.view(7).tolist() return probs #!ls primary_testset_preview_v3/* simfile = 'primary_testset_preview_v3/00b3b8fdb14ce41f341dbe251f476093.dat' allFolds = [] def loadFoldParams(modelcheckpoint): model = wresnet34x2().cpu() if os.path.isfile(modelcheckpoint): print("=> Loading checkpoint '{}'".format(modelcheckpoint)) checkpoint = torch.load(modelcheckpoint, map_location=lambda storage, loc: storage) best_acc = checkpoint['best_acc'] print("This model had an accuracy of %.2f on the validation set." % (best_acc,)) keys = checkpoint['state_dict'].keys() for old_key in keys: new_key = old_key.replace('module.', '') checkpoint['state_dict'][new_key] = checkpoint['state_dict'].pop(old_key) model.load_state_dict(checkpoint['state_dict']) print("=> Loaded checkpoint '{}' (epoch {})" .format(modelcheckpoint, checkpoint['epoch'])) else: print("=> No model checkpoint found. Exiting") return allFolds.append(model) def lf(): for i in range(1,6): loadFoldParams('effsubsee_FOLD{}_BEST_wresnet34x2_batchsize96_checkpoint.pth.tar'.format(i)) %time lf() assert len(allFolds) == 5 # normalize the simulation data file normalizer = 'mean_stddev_primary_full_v3__384t__512f__logmod2-ph.hdf5' %time input_var = normalizeSimFile(normalizer, simfile) # calculate probabilities def runAllModels(aSimFile): probs = np.zeros(7) for mf in allFolds: probs += singleProbs(mf, input_var) probs = probs/float(len(allFolds)) return probs %time probs = runAllModels(simfile) print('final class probabilities') print(probs) class_list = ['brightpixel', 'narrowband', 'narrowbanddrd', 'noise', 'squarepulsednarrowband', 'squiggle', 'squigglesquarepulsednarrowband'] print('signal classification') predicted_signal_class = class_list[probs.argmax()] print(predicted_signal_class) %matplotlib inline import matplotlib.pyplot as plt aca = ibmseti.compamp.SimCompamp(open(simfile,'rb').read()) spectrogram = aca.get_spectrogram() fig, ax = plt.subplots(figsize=(20, 10)) ax.imshow(np.log(spectrogram), aspect = 0.5*float(spectrogram.shape[1]) / spectrogram.shape[0], cmap='gray') import pandas as pd preview_test_set_pd = pd.read_csv('https://github.com/setiQuest/ML4SETI/raw/master/results/private_list_primary_v3_testset_preview_uuid_class_29june_2017.csv', index_col=None) expected_signal_class = preview_test_set_pd[preview_test_set_pd.UUID == simfile.split('/')[-1].rstrip('.dat')].SIGNAL_CLASSIFICATION.values[0] assert predicted_signal_class == expected_signal_class print(expected_signal_class) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The Data Step2: Exploratory Data Analysis Step3: Roughly 20 percent of the Age data is missing. The proportion of Age missing is likely small enough for reasonable replacement with some form of imputation. Looking at the Cabin column, it looks like we are just missing too much of that data to do something useful with at a basic level. We'll probably drop this later, or change it to another feature like "Cabin Known Step4: Cufflinks for plots Step5: Data Cleaning Step6: We can see the wealthier passengers in the higher classes tend to be older, which makes sense. We'll use these average age values to impute based on Pclass for Age. Step7: Now apply that function! Step8: Now let's check that heat map again! Step9: Great! Let's go ahead and drop the Cabin column and the row in Embarked that is NaN. Step10: Converting Categorical Features Step11: Great! Our data is ready for our model! Step12: Training and Predicting Step13: Let's move on to evaluate our model! Step14: Not so bad! You might want to explore other feature engineering and the other titanic_text.csv file, some suggestions for feature engineering
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import matplotlib.pyplot as plt import seaborn as sns %matplotlib inline train = pd.read_csv('titanic_train.csv') train.head(25) sns.heatmap(train.isnull(),yticklabels=False,cbar=False,cmap='viridis') sns.set_style('whitegrid') sns.countplot(x='Survived',data=train,palette='RdBu_r') # sns.set_style('whitegrid') sns.countplot(x='Survived',hue='Sex',data=train,palette='RdBu_r') # sns.set_style('whitegrid') sns.countplot(x='Survived',hue='Pclass',data=train,palette='rainbow') sns.distplot(train['Age'].dropna(),kde=False,color='darkred',bins=30) train['Age'].hist(bins=30,color='darkred',alpha=0.7) sns.countplot(x='SibSp',data=train) train['Fare'].hist(color='green',bins=40,figsize=(8,4)) import plotly_express as pex pex.histogram(data_frame=train, x='Fare', nbins=30) plt.figure(figsize=(12, 7)) sns.boxplot(x='Pclass',y='Age',data=train,palette='winter') def impute_age(cols): Age = cols[0] Pclass = cols[1] if pd.isnull(Age): if Pclass == 1: return 37 elif Pclass == 2: return 29 else: return 24 else: return Age train['Age'] = train[['Age','Pclass']].apply(impute_age,axis=1) sns.heatmap(train.isnull(),yticklabels=False,cbar=False,cmap='viridis') train.drop('Cabin',axis=1,inplace=True) train.head(50) train.shape train.dropna(inplace=True) train.shape train.info() sex = pd.get_dummies(train['Sex'],drop_first=True) embark = pd.get_dummies(train['Embarked'],drop_first=True) embark.head() sex.head() train.drop(['Sex','Embarked','Name','Ticket'],axis=1,inplace=True) train = pd.concat([train,sex,embark],axis=1) train.head() from sklearn.model_selection import train_test_split X_train, X_test, y_train, y_test = train_test_split(train.drop('Survived',axis=1), train['Survived'], test_size=0.30, random_state=101) from sklearn.linear_model import LogisticRegression logmodel = LogisticRegression() logmodel.verbose = 1 logmodel.fit(X_train,y_train) logmodel.coef_ logmodel.intercept_ predictions = logmodel.predict(X_test) from sklearn.metrics import classification_report print(classification_report(y_test,predictions)) test_df = pd.read_csv('titanic_test.csv') test_df.head() test_df.shape test_df.iloc[0] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: Auxiliary function to run the solver Step4: Define your solver Step5: Apply your custom solver Step6: View in 2D and 3D ("glass" brain like 3D plot)
<ASSISTANT_TASK:> Python Code: import numpy as np from scipy import linalg import mne from mne.datasets import sample from mne.viz import plot_sparse_source_estimates data_path = sample.data_path() fwd_fname = data_path + '/MEG/sample/sample_audvis-meg-eeg-oct-6-fwd.fif' ave_fname = data_path + '/MEG/sample/sample_audvis-ave.fif' cov_fname = data_path + '/MEG/sample/sample_audvis-shrunk-cov.fif' subjects_dir = data_path + '/subjects' condition = 'Left Auditory' # Read noise covariance matrix noise_cov = mne.read_cov(cov_fname) # Handling average file evoked = mne.read_evokeds(ave_fname, condition=condition, baseline=(None, 0)) evoked.crop(tmin=0.04, tmax=0.18) evoked = evoked.pick_types(eeg=False, meg=True) # Handling forward solution forward = mne.read_forward_solution(fwd_fname) def apply_solver(solver, evoked, forward, noise_cov, loose=0.2, depth=0.8): Function to call a custom solver on evoked data This function does all the necessary computation: - to select the channels in the forward given the available ones in the data - to take into account the noise covariance and do the spatial whitening - to apply loose orientation constraint as MNE solvers - to apply a weigthing of the columns of the forward operator as in the weighted Minimum Norm formulation in order to limit the problem of depth bias. Parameters ---------- solver : callable The solver takes 3 parameters: data M, gain matrix G, number of dipoles orientations per location (1 or 3). A solver shall return 2 variables: X which contains the time series of the active dipoles and an active set which is a boolean mask to specify what dipoles are present in X. evoked : instance of mne.Evoked The evoked data forward : instance of Forward The forward solution. noise_cov : instance of Covariance The noise covariance. loose : float in [0, 1] | 'auto' Value that weights the source variances of the dipole components that are parallel (tangential) to the cortical surface. If loose is 0 then the solution is computed with fixed orientation. If loose is 1, it corresponds to free orientations. The default value ('auto') is set to 0.2 for surface-oriented source space and set to 1.0 for volumic or discrete source space. depth : None | float in [0, 1] Depth weighting coefficients. If None, no depth weighting is performed. Returns ------- stc : instance of SourceEstimate The source estimates. # Import the necessary private functions from mne.inverse_sparse.mxne_inverse import \ (_prepare_gain, _check_loose_forward, is_fixed_orient, _reapply_source_weighting, _make_sparse_stc) all_ch_names = evoked.ch_names loose, forward = _check_loose_forward(loose, forward) # put the forward solution in fixed orientation if it's not already if loose == 0. and not is_fixed_orient(forward): forward = mne.convert_forward_solution( forward, surf_ori=True, force_fixed=True, copy=True, use_cps=True) # Handle depth weighting and whitening (here is no weights) gain, gain_info, whitener, source_weighting, mask = _prepare_gain( forward, evoked.info, noise_cov, pca=False, depth=depth, loose=loose, weights=None, weights_min=None) # Select channels of interest sel = [all_ch_names.index(name) for name in gain_info['ch_names']] M = evoked.data[sel] # Whiten data M = np.dot(whitener, M) n_orient = 1 if is_fixed_orient(forward) else 3 X, active_set = solver(M, gain, n_orient) X = _reapply_source_weighting(X, source_weighting, active_set, n_orient) stc = _make_sparse_stc(X, active_set, forward, tmin=evoked.times[0], tstep=1. / evoked.info['sfreq']) return stc def solver(M, G, n_orient): Dummy solver It just runs L2 penalized regression and keep the 10 strongest locations Parameters ---------- M : array, shape (n_channels, n_times) The whitened data. G : array, shape (n_channels, n_dipoles) The gain matrix a.k.a. the forward operator. The number of locations is n_dipoles / n_orient. n_orient will be 1 for a fixed orientation constraint or 3 when using a free orientation model. n_orient : int Can be 1 or 3 depending if one works with fixed or free orientations. If n_orient is 3, then ``G[:, 2::3]`` corresponds to the dipoles that are normal to the cortex. Returns ------- X : array, (n_active_dipoles, n_times) The time series of the dipoles in the active set. active_set : array (n_dipoles) Array of bool. Entry j is True if dipole j is in the active set. We have ``X_full[active_set] == X`` where X_full is the full X matrix such that ``M = G X_full``. K = linalg.solve(np.dot(G, G.T) + 1e15 * np.eye(G.shape[0]), G).T K /= np.linalg.norm(K, axis=1)[:, None] X = np.dot(K, M) indices = np.argsort(np.sum(X ** 2, axis=1))[-10:] active_set = np.zeros(G.shape[1], dtype=bool) for idx in indices: idx -= idx % n_orient active_set[idx:idx + n_orient] = True X = X[active_set] return X, active_set # loose, depth = 0.2, 0.8 # corresponds to loose orientation loose, depth = 1., 0. # corresponds to free orientation stc = apply_solver(solver, evoked, forward, noise_cov, loose, depth) plot_sparse_source_estimates(forward['src'], stc, bgcolor=(1, 1, 1), opacity=0.1) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: RANDOM FORESTS Step2: The first avalanche problem dictates the danger level - that was expected Step3: Looks like there is little gain when using a depth > 7. Step4: Now we see slight improvement in $R^{2}$. Step5: Gradient boosting Step6: Again, very small difference between random forests and boosted trees.
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import json import graphviz import matplotlib.pyplot as plt from sklearn import tree from sklearn.model_selection import train_test_split pd.set_option("display.max_rows",6) %matplotlib inline df_data = pd.read_csv(r'varsom_ml_preproc_3y.csv', index_col=0) target_ = 'danger_level' X = df_data.drop([target_, 'date'], axis=1) y = df_data.filter([target_], axis=1) X_train, X_test, y_train, y_test = train_test_split(X, y, random_state = 222, test_size = 0.3) print(df_data.columns.values) df_data.describe() print(df_data[df_data['danger_level']>3]['region_id'].unique()) dec_tree = tree.DecisionTreeRegressor(random_state=222, max_depth = 3) dec_tree.fit(X_train, y_train) # we're using the same data as in last linear model predictions_dt = dec_tree.predict(X_test) print(predictions_dt.shape, y_test.shape) # Visualize the tree dot_data = tree.export_graphviz(dec_tree, out_file=None, feature_names=df_data.drop([target_, 'date'], axis=1).columns, filled=True, rounded=True, special_characters=True) graph = graphviz.Source(dot_data) graph.render('aval_danger_by_problem_dt_lev7') graph print('Decision tree R^2: %.4f' % dec_tree.score(X_test, y_test)) depths = range(1, 20) tree_models = [tree.DecisionTreeRegressor(random_state=222, max_depth=d).fit(X_train, y_train) for d in depths] tree_Rsquare = [f.score(X_test, y_test) for f in tree_models] plt.plot(depths, tree_Rsquare, color = 'red') plt.xlabel('Tree depth') plt.ylabel('$R^2$') # so let's create a tree with depth = 7 dec_tree = tree.DecisionTreeRegressor(random_state=222, max_depth = 7) dec_tree.fit(X_train, y_train) # we're using the same data as in last linear model predictions_dt = dec_tree.predict(X_test) # Visualize the tree dot_data = tree.export_graphviz(dec_tree, out_file=None, feature_names=df_data.drop([target_, 'date'], axis=1).columns, filled=True, rounded=True, special_characters=True) graph = graphviz.Source(dot_data) graph.render('aval_danger_by_problem_dt2') graph print('Decision tree R^2: %.4f' % dec_tree.score(X_test, y_test)) from sklearn.ensemble import RandomForestRegressor forest_reg = RandomForestRegressor(random_state = 422, max_depth = 7) forest_reg.fit(X_train, y_train) predictions_rf = forest_reg.predict(X_test) print('Random forest R^2: %.4f' % forest_reg.score(X_test, y_test)) from sklearn.ensemble import GradientBoostingRegressor grad_boost = GradientBoostingRegressor(random_state = 222, max_depth = 6) grad_boost.fit(X_train, y_train) predictions_gb = grad_boost.predict(X_test) print('Gradient boosted tree R^2: %.4f' % grad_boost.score(X_test, y_test)) feature_labels = np.array(df_data.drop([target_, 'date'], axis=1).columns) #feature_labels = np.array(['CRIM', 'ZN', 'INDUS', 'CHAS', 'RM', 'AGE', 'RAD', 'TAX', 'PTRATIO', 'B', 'LSTAT', 'MEDV']) importance = forest_reg.feature_importances_ feature_indexes_by_importance = importance.argsort() for index in feature_indexes_by_importance: print('{}-{:.2f}%'.format(feature_labels[index], (importance[index] *100.0))) # excluding the variables where impotance is less than 1% X = df_data[['avalanche_problem_1_distribution_id', 'avalanche_problem_1_destructive_size_ext_id', 'avalanche_problem_1_trigger_simple_id', 'avalanche_problem_1_probability_id', 'avalanche_problem_2_destructive_size_ext_id', 'avalanche_problem_2_probability_id']] y = df_data['danger_level'] X_train, X_test, y_train, y_test = train_test_split(X, y, test_size = 0.3, random_state = 222) grad_boost = GradientBoostingRegressor(random_state = 222, max_depth = 7) grad_boost.fit(X_train, y_train) predictions_gb = grad_boost.predict(X_test) print('Gradient boosted tree R^2: %.4f' % grad_boost.score(X_test, y_test)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Create Data Step2: Alias Criminals Table A C, Then Select All Names From C
<ASSISTANT_TASK:> Python Code: # Ignore %load_ext sql %sql sqlite:// %config SqlMagic.feedback = False %%sql -- Create a table of criminals CREATE TABLE criminals (pid, name, age, sex, city, minor); INSERT INTO criminals VALUES (412, 'James Smith', 15, 'M', 'Santa Rosa', 1); INSERT INTO criminals VALUES (234, 'Bill James', 22, 'M', 'Santa Rosa', 0); INSERT INTO criminals VALUES (632, 'Stacy Miller', 23, 'F', 'Santa Rosa', 0); INSERT INTO criminals VALUES (621, 'Betty Bob', NULL, 'F', 'Petaluma', 1); INSERT INTO criminals VALUES (162, 'Jaden Ado', 49, 'M', NULL, 0); INSERT INTO criminals VALUES (901, 'Gordon Ado', 32, 'F', 'Santa Rosa', 0); INSERT INTO criminals VALUES (512, 'Bill Byson', 21, 'M', 'Santa Rosa', 0); INSERT INTO criminals VALUES (411, 'Bob Iton', NULL, 'M', 'San Francisco', 0); %%sql -- Select all names from the table 'c' SELECT c.name -- From the criminals table, now called c FROM criminals AS c <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Language Translation Step3: Explore the Data Step6: Implement Preprocessing Function Step8: Preprocess all the data and save it Step10: Check Point Step12: Check the Version of TensorFlow and Access to GPU Step15: Build the Neural Network Step18: Process Decoding Input Step21: Encoding Step24: Decoding - Training Step27: Decoding - Inference Step30: Build the Decoding Layer Step33: Build the Neural Network Step34: Neural Network Training Step36: Build the Graph Step39: Train Step41: Save Parameters Step43: Checkpoint Step46: Sentence to Sequence Step48: Translate
<ASSISTANT_TASK:> Python Code: DON'T MODIFY ANYTHING IN THIS CELL import helper import problem_unittests as tests source_path = 'data/small_vocab_en' target_path = 'data/small_vocab_fr' source_text = helper.load_data(source_path) target_text = helper.load_data(target_path) view_sentence_range = (0, 10) DON'T MODIFY ANYTHING IN THIS CELL import numpy as np print('Dataset Stats') print('Roughly the number of unique words: {}'.format(len({word: None for word in source_text.split()}))) sentences = source_text.split('\n') word_counts = [len(sentence.split()) for sentence in sentences] print('Number of sentences: {}'.format(len(sentences))) print('Average number of words in a sentence: {}'.format(np.average(word_counts))) print() print('English sentences {} to {}:'.format(*view_sentence_range)) print('\n'.join(source_text.split('\n')[view_sentence_range[0]:view_sentence_range[1]])) print() print('French sentences {} to {}:'.format(*view_sentence_range)) print('\n'.join(target_text.split('\n')[view_sentence_range[0]:view_sentence_range[1]])) def get_id_text(input, vocab_to_int): return [[vocab_to_int[word] for word in sentence.split()] for sentence in input] def text_to_ids(source_text, target_text, source_vocab_to_int, target_vocab_to_int): Convert source and target text to proper word ids :param source_text: String that contains all the source text. :param target_text: String that contains all the target text. :param source_vocab_to_int: Dictionary to go from the source words to an id :param target_vocab_to_int: Dictionary to go from the target words to an id :return: A tuple of lists (source_id_text, target_id_text) # TODO: Implement Function source_sentences = [sentence for sentence in source_text.split('\n')] target_sentences = [sentence + ' <EOS>' for sentence in target_text.split('\n')] source_id_text = get_id_text(source_sentences, source_vocab_to_int) target_id_text = get_id_text(target_sentences, target_vocab_to_int) return source_id_text, target_id_text DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_text_to_ids(text_to_ids) DON'T MODIFY ANYTHING IN THIS CELL helper.preprocess_and_save_data(source_path, target_path, text_to_ids) DON'T MODIFY ANYTHING IN THIS CELL import numpy as np import helper (source_int_text, target_int_text), (source_vocab_to_int, target_vocab_to_int), _ = helper.load_preprocess() DON'T MODIFY ANYTHING IN THIS CELL from distutils.version import LooseVersion import warnings import tensorflow as tf # Check TensorFlow Version assert LooseVersion(tf.__version__) >= LooseVersion('1.0'), 'Please use TensorFlow version 1.0 or newer' print('TensorFlow Version: {}'.format(tf.__version__)) # Check for a GPU if not tf.test.gpu_device_name(): warnings.warn('No GPU found. Please use a GPU to train your neural network.') else: print('Default GPU Device: {}'.format(tf.test.gpu_device_name())) def model_inputs(): Create TF Placeholders for input, targets, and learning rate. :return: Tuple (input, targets, learning rate, keep probability) # TODO: Implement Function input = tf.placeholder(tf.int32, (None, None), name='input') targets = tf.placeholder(tf.int32, (None, None), name='targets') learning_rate = tf.placeholder(tf.float32, name='learning_rate') keep_probability = tf.placeholder(tf.float32, name='keep_prob') return input, targets, learning_rate, keep_probability DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_model_inputs(model_inputs) def process_decoding_input(target_data, target_vocab_to_int, batch_size): Preprocess target data for dencoding :param target_data: Target Placehoder :param target_vocab_to_int: Dictionary to go from the target words to an id :param batch_size: Batch Size :return: Preprocessed target data # TODO: Implement Function go = target_vocab_to_int['<GO>'] ending = tf.strided_slice(target_data, [0, 0], [batch_size, -1], [1, 1]) return tf.concat([tf.fill([batch_size, 1], go), ending], 1) DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_process_decoding_input(process_decoding_input) def encoding_layer(rnn_inputs, rnn_size, num_layers, keep_prob): Create encoding layer :param rnn_inputs: Inputs for the RNN :param rnn_size: RNN Size :param num_layers: Number of layers :param keep_prob: Dropout keep probability :return: RNN state # TODO: Implement Function lstm = tf.contrib.rnn.BasicLSTMCell(rnn_size) dropout = tf.contrib.rnn.DropoutWrapper(lstm, keep_prob) cell = tf.contrib.rnn.MultiRNNCell([lstm] * num_layers) _, rnn_state = tf.nn.dynamic_rnn(cell, rnn_inputs, dtype=tf.float32) return rnn_state DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_encoding_layer(encoding_layer) def decoding_layer_train(encoder_state, dec_cell, dec_embed_input, sequence_length, decoding_scope, output_fn, keep_prob): Create a decoding layer for training :param encoder_state: Encoder State :param dec_cell: Decoder RNN Cell :param dec_embed_input: Decoder embedded input :param sequence_length: Sequence Length :param decoding_scope: TenorFlow Variable Scope for decoding :param output_fn: Function to apply the output layer :param keep_prob: Dropout keep probability :return: Train Logits # TODO: Implement Function dec_fn_train = tf.contrib.seq2seq.simple_decoder_fn_train(encoder_state) output_logits, _, _ = tf.contrib.seq2seq.dynamic_rnn_decoder( dec_cell, dec_fn_train, dec_embed_input, sequence_length, scope=decoding_scope ) train_logits = output_fn(output_logits) return train_logits DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_decoding_layer_train(decoding_layer_train) def decoding_layer_infer(encoder_state, dec_cell, dec_embeddings, start_of_sequence_id, end_of_sequence_id, maximum_length, vocab_size, decoding_scope, output_fn, keep_prob): Create a decoding layer for inference :param encoder_state: Encoder state :param dec_cell: Decoder RNN Cell :param dec_embeddings: Decoder embeddings :param start_of_sequence_id: GO ID :param end_of_sequence_id: EOS Id :param maximum_length: Maximum length of :param vocab_size: Size of vocabulary :param decoding_scope: TensorFlow Variable Scope for decoding :param output_fn: Function to apply the output layer :param keep_prob: Dropout keep probability :return: Inference Logits # TODO: Implement Function infer_decoder_fn = tf.contrib.seq2seq.simple_decoder_fn_inference( output_fn, encoder_state, dec_embeddings, start_of_sequence_id, end_of_sequence_id, maximum_length, vocab_size ) infer_logits, _, _ = tf.contrib.seq2seq.dynamic_rnn_decoder(dec_cell, decoder_fn=infer_decoder_fn, scope=decoding_scope) return infer_logits DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_decoding_layer_infer(decoding_layer_infer) def decoding_layer(dec_embed_input, dec_embeddings, encoder_state, vocab_size, sequence_length, rnn_size, num_layers, target_vocab_to_int, keep_prob): Create decoding layer :param dec_embed_input: Decoder embedded input :param dec_embeddings: Decoder embeddings :param encoder_state: The encoded state :param vocab_size: Size of vocabulary :param sequence_length: Sequence Length :param rnn_size: RNN Size :param num_layers: Number of layers :param target_vocab_to_int: Dictionary to go from the target words to an id :param keep_prob: Dropout keep probability :return: Tuple of (Training Logits, Inference Logits) # TODO: Implement Function with tf.variable_scope('decoding') as decoding_scope: dec_cell = tf.contrib.rnn.MultiRNNCell([tf.contrib.rnn.BasicLSTMCell(rnn_size)] * num_layers) dec_cell = tf.contrib.rnn.DropoutWrapper(dec_cell, input_keep_prob=keep_prob, output_keep_prob=keep_prob) output_fn = lambda x: tf.contrib.layers.fully_connected(x, vocab_size, None, scope=decoding_scope) with tf.variable_scope('decoding') as decoding_scope: train_logits = decoding_layer_train(encoder_state, dec_cell, dec_embed_input, sequence_length, decoding_scope, output_fn, keep_prob) with tf.variable_scope('decoding', reuse=True) as decoding_scope: infer_logits = decoding_layer_infer(encoder_state, dec_cell, dec_embeddings, target_vocab_to_int['<GO>'], target_vocab_to_int['<EOS>'], sequence_length - 1, vocab_size, decoding_scope, output_fn, keep_prob) return train_logits, infer_logits DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_decoding_layer(decoding_layer) def seq2seq_model(input_data, target_data, keep_prob, batch_size, sequence_length, source_vocab_size, target_vocab_size, enc_embedding_size, dec_embedding_size, rnn_size, num_layers, target_vocab_to_int): Build the Sequence-to-Sequence part of the neural network :param input_data: Input placeholder :param target_data: Target placeholder :param keep_prob: Dropout keep probability placeholder :param batch_size: Batch Size :param sequence_length: Sequence Length :param source_vocab_size: Source vocabulary size :param target_vocab_size: Target vocabulary size :param enc_embedding_size: Decoder embedding size :param dec_embedding_size: Encoder embedding size :param rnn_size: RNN Size :param num_layers: Number of layers :param target_vocab_to_int: Dictionary to go from the target words to an id :return: Tuple of (Training Logits, Inference Logits) # TODO: Implement Function enc_inputs = tf.contrib.layers.embed_sequence(input_data, source_vocab_size, enc_embedding_size) enc_state = encoding_layer(enc_inputs, rnn_size, num_layers, keep_prob) dec_inputs = process_decoding_input(target_data, target_vocab_to_int, batch_size) dec_embeddings = tf.Variable(tf.truncated_normal([target_vocab_size, dec_embedding_size], stddev=0.01)) dec_embed_inputs = tf.nn.embedding_lookup(dec_embeddings, dec_inputs) train_logits, infer_logits = decoding_layer( dec_embed_inputs, dec_embeddings, enc_state, target_vocab_size, sequence_length, rnn_size, num_layers, target_vocab_to_int, keep_prob ) return train_logits, infer_logits DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_seq2seq_model(seq2seq_model) # Number of Epochs epochs = 7 # Batch Size batch_size = 256 # RNN Size rnn_size = 512 # Number of Layers num_layers = 2 # Embedding Size encoding_embedding_size = 10 decoding_embedding_size = 10 # Learning Rate learning_rate = 0.001 # Dropout Keep Probability keep_probability = 0.7 DON'T MODIFY ANYTHING IN THIS CELL save_path = 'checkpoints/dev' (source_int_text, target_int_text), (source_vocab_to_int, target_vocab_to_int), _ = helper.load_preprocess() max_target_sentence_length = max([len(sentence) for sentence in source_int_text]) train_graph = tf.Graph() with train_graph.as_default(): input_data, targets, lr, keep_prob = model_inputs() sequence_length = tf.placeholder_with_default(max_target_sentence_length, None, name='sequence_length') input_shape = tf.shape(input_data) train_logits, inference_logits = seq2seq_model( tf.reverse(input_data, [-1]), targets, keep_prob, batch_size, sequence_length, len(source_vocab_to_int), len(target_vocab_to_int), encoding_embedding_size, decoding_embedding_size, rnn_size, num_layers, target_vocab_to_int) tf.identity(inference_logits, 'logits') with tf.name_scope("optimization"): # Loss function cost = tf.contrib.seq2seq.sequence_loss( train_logits, targets, tf.ones([input_shape[0], sequence_length])) # Optimizer optimizer = tf.train.AdamOptimizer(lr) # Gradient Clipping gradients = optimizer.compute_gradients(cost) capped_gradients = [(tf.clip_by_value(grad, -1., 1.), var) for grad, var in gradients if grad is not None] train_op = optimizer.apply_gradients(capped_gradients) DON'T MODIFY ANYTHING IN THIS CELL import time def get_accuracy(target, logits): Calculate accuracy max_seq = max(target.shape[1], logits.shape[1]) if max_seq - target.shape[1]: target = np.pad( target_batch, [(0,0),(0,max_seq - target_batch.shape[1]), (0,0)], 'constant') if max_seq - batch_train_logits.shape[1]: logits = np.pad( logits, [(0,0),(0,max_seq - logits.shape[1]), (0,0)], 'constant') return np.mean(np.equal(target, np.argmax(logits, 2))) train_source = source_int_text[batch_size:] train_target = target_int_text[batch_size:] valid_source = helper.pad_sentence_batch(source_int_text[:batch_size]) valid_target = helper.pad_sentence_batch(target_int_text[:batch_size]) with tf.Session(graph=train_graph) as sess: sess.run(tf.global_variables_initializer()) for epoch_i in range(epochs): for batch_i, (source_batch, target_batch) in enumerate( helper.batch_data(train_source, train_target, batch_size)): start_time = time.time() _, loss = sess.run( [train_op, cost], {input_data: source_batch, targets: target_batch, lr: learning_rate, sequence_length: target_batch.shape[1], keep_prob: keep_probability}) batch_train_logits = sess.run( inference_logits, {input_data: source_batch, keep_prob: 1.0}) batch_valid_logits = sess.run( inference_logits, {input_data: valid_source, keep_prob: 1.0}) train_acc = get_accuracy(target_batch, batch_train_logits) valid_acc = get_accuracy(np.array(valid_target), batch_valid_logits) end_time = time.time() print('Epoch {:>3} Batch {:>4}/{} - Train Accuracy: {:>6.3f}, Validation Accuracy: {:>6.3f}, Loss: {:>6.3f}' .format(epoch_i, batch_i, len(source_int_text) // batch_size, train_acc, valid_acc, loss)) # Save Model saver = tf.train.Saver() saver.save(sess, save_path) print('Model Trained and Saved') DON'T MODIFY ANYTHING IN THIS CELL # Save parameters for checkpoint helper.save_params(save_path) DON'T MODIFY ANYTHING IN THIS CELL import tensorflow as tf import numpy as np import helper import problem_unittests as tests _, (source_vocab_to_int, target_vocab_to_int), (source_int_to_vocab, target_int_to_vocab) = helper.load_preprocess() load_path = helper.load_params() def sentence_to_seq(sentence, vocab_to_int): Convert a sentence to a sequence of ids :param sentence: String :param vocab_to_int: Dictionary to go from the words to an id :return: List of word ids # TODO: Implement Function return [vocab_to_int.get(word, vocab_to_int['<UNK>']) for word in sentence.lower().split()] DON'T MODIFY ANYTHING IN THIS CELL THAT IS BELOW THIS LINE tests.test_sentence_to_seq(sentence_to_seq) translate_sentence = 'he saw a old yellow truck .' DON'T MODIFY ANYTHING IN THIS CELL translate_sentence = sentence_to_seq(translate_sentence, source_vocab_to_int) loaded_graph = tf.Graph() with tf.Session(graph=loaded_graph) as sess: # Load saved model loader = tf.train.import_meta_graph(load_path + '.meta') loader.restore(sess, load_path) input_data = loaded_graph.get_tensor_by_name('input:0') logits = loaded_graph.get_tensor_by_name('logits:0') keep_prob = loaded_graph.get_tensor_by_name('keep_prob:0') translate_logits = sess.run(logits, {input_data: [translate_sentence], keep_prob: 1.0})[0] print('Input') print(' Word Ids: {}'.format([i for i in translate_sentence])) print(' English Words: {}'.format([source_int_to_vocab[i] for i in translate_sentence])) print('\nPrediction') print(' Word Ids: {}'.format([i for i in np.argmax(translate_logits, 1)])) print(' French Words: {}'.format([target_int_to_vocab[i] for i in np.argmax(translate_logits, 1)])) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: <a id='1_data_cleaning'></a> Step2: Construction "./" means we use the current folder of the script. "../" would mean - one level higher relative to the script. In our case we want to stay in the same folder where the script file is located, and go to the "data" folder. Step3: Task 1 Step4: Dataset Descriptions Step5: It should be noticed that loc and iloc methods are most likely to return different values. For example, let's select the 3rd line. Step6: The at method is used for quick selection of the specific element Step7: If you need to select several columns, you could do it by feeding a list. Step8: Or you can use a slice Step9: If you need strings that match a condition (for example, only applications of the ART_AND_DESIGN category), the following query format is used (it also returns a DataFrame object) Step10: Here we used the head() function again to only show the first 5 rows). Step11: Let's take a look at the general information about dataset using the info() method. Step12: The dataset consists of 13 columns, only one of which is numeric (float64) and the rest are categorical (object). The dataset has 10841 rows. Note that there are also missing values, mostly in the Current Ver. Step13: Most applications are in FAMILY, GAME and TOOLS categories. Step14: There was a shift of a row on one column to the left. Let's delete this sample. Step15: Task 2 Step16: <a id='rating'></a> Step17: Checking for missing values Step18: <a id='size'></a> Step19: The size of applications is specified in megabytes and kilobytes. But the most common is the value 'Varies with device'. Step20: Now let's apply our function to the Size column Step21: Let's check that the column is in the float format now Step22: All values 'Variations with device' are missing now. Step23: As you can see there is about 16% of the samples with NaN values (previously 'Variations with device'). That's quite a lot. To deal with this, we can create a new column with binary values that will store information about these NaN samples (perhaps this information will be useful) and then process them in the original column. Step24: Now let's handle the missing values. There are several traditional methods to deal with them Step25: Just in case, check that there are no empty values Step26: <a id='type'></a> Step27: 93% of apps are free. To say more, you need to look at the relationships with other variables. We will deal with this in the next section. Let's check for missing values Step28: There is one missing, let's inspect this one. Step29: Task 6 Handle the instance with the missing "Type" in the best way on your opinion Step30: <a id='price'></a> Step31: The variable is numeric, but it contains special characters. That's why it has 'object' Type. Step32: Let's create a distribution plot of prices among the paid apps. Step33: Cheap apps make up the most part. Moreover, the rest of apps take too small part of all apps, so it is difficult to say anything by the graphic. Step34: Most apps cost around 1 and 3 dollars. The dispersion of values on the left part of the plot is due to the strong discreteness of small values of the original column. Let's have a look at the strange peak on the right side of the plot. Step35: Strange apps for the rich. Perhaps they are an indicator of status in certain circles or something like that. Step36: <a id='content_rating'></a> Step37: Remove the "Adults only 18+" and "Unrated classes". They are too few. Step38: Check for missing. Step39: <a id='genres'></a> Step40: THere are quite a lot of genres - 119. Moreover, some of them are actually a result of combining two basic genres. Let's find out the amount of unique ones. Step41: Task 8 Calculate the amount of genres for each app and estimate the general distribution for them? Use series.str.findall() Step42: There isn't a lot of applications with many genres. Let's look at some of them. Step43: You may notice that the genre column often contains the same as the category column. We will explore this in more detail later. Now let's check for missing values and move on. Step44: <a id='current_ver'></a> Step45: Because of too many unique values, this isn't a particularly informative column. It seems that each developer uses its own notation, so we will just remove it. Step46: <a id='android_ver'></a> Step47: There are 2 missing values. Remove it. Step48: Let's cluster them together in bigger classes. Step49: Groups 1-3 and 5-8 still have a small number of examples. The biggest one is 4 group. We probably should cluster the classes even more and combine 1-3 and 5-8 into two separate groups. Step50: With such distribution of values, this feature can actually contribute to the model. Step51: <a id='final_check'></a> Step52: <a id='removing_duplicates'></a> Step53: Some applications have duplicates with different sizes, so we’ll sort by size Step54: Task 9 Remove duplicates with drop_duplicates() (keep applications with the largest size) Step55: After filtering, we lost ~11% from the total volume of our dataset. Obviously this is an unpleasant measure, but it has to be done. Step56: <a id='2_data_relations'></a> Step57: There is no correlation between the numeric variables. Step58: Pairplots compares the distributions of variables in pairs and allow you to make the most common assumptions, which can then be checked and clarified later. Step59: Task 10 Step60: Apps with "0" rating are more likely to have a short title. At the same time, more popular applications are in the range of 20 to 50 characters. Step61: The average price of a "Free" app is zero dollars, a paid one is 14 dollars. Looks fine. Step62: Let's see which categories use the most subcategories. Step63: Task 11 Explore the genre number statistics for each category. Use groupby и describe. Step64: The maximum number of subcategories in one category is 2, the minimum is 1. Two subcategories are most often found in the categories PARENTING, FAMILY, EDUCATION. Only 11 categories have multiple genres. Step65: Let's calculate how many apps have the same genres and categories. Step66: The columns are completely the same for almost 70%. That is, 70% of the values don't contain new information. Most likely, there are more matches considering possible errors related to usage of regular expressions on raw data. Step67: Task 12 Explore whether there is a difference between distributions of apps with the same and with different categories and genres (use sns.countplot). Step68: The rating distributions for True and False are slightly different. You can see that applications with a rating 0 stand out a little bit. To numerically estimate this distribution, we will use the contingency table. Step69: The difference in distribution for apps with same category and genre is negligible. On the other side, applications with different genre and category are 1.5 times more likely to have "2" rating. Step70: <a id='rating_&_content_rating'></a> Step71: Let's look at the table of both at the rating contingency with Content Rating column and the is_not_equal_genre column. Step72: First thing you could notice are applications with the age rating "Everyone" and the same categories and genres. For those application the most common rating is "0". Apps with Everyone 10+ and is_not_equal_genre False mostly have rating "2". Step73: There are not a lot of paid applications, but numerous categories, so the graphics are so sparse. You can see that some categories have outlier applications Step74: In this graph, the column height shows the average value, and the bar shows the confidence interval. You can notice that the Finance and Lifestyle categories have a very wide confidence interval. This means that these categories are highly sparse and have some isolated groups in different parts of the distributions. It is not valid to use the average value for such categories. There is no sense to consider other categories with a wide confidence interval - there are too few examples to interpret the stats meaningfully. Step75: The shift was due to a few expensive "freaky" apps we already saw earlier. Let's remove them and rearrange the graphic. Step76: The Lifestyle and Finance categories became more realistic and stable. So, we are removing extra expensive samples. Step77: <a id='Категории_и_размер'></a> Step78: Task 14 Explore the distribution of app size in each category. Use the df_log table and the log_size column Step79: <a id='3_feature_space'></a> Step80: To measure processing time we will use a special context manager. Step81: <a id='base_model'></a> Step82: The so-called majority classifier can be the simplest type of a base model. The point is Step83: Now let's determine which class is most common in the training data. Step84: In the training set, samples with second class are more common. Then our test prediction will be an array with the same size as the size of out test set and it will be completely filled with 2. Step85: To analyze the results, we will use a function that displays several different metrics. Step86: Now let's calculate the accuracy of the majority classifier. Step87: These will be our reference values. Let's write them in the table. Step88: <a id='origin_features'></a> Step89: Now we'll get our test and training sets. (notice that we use the same random_state and therefore the data is split the same way as before) Step90: We will train a Logistic Regression model - one of the simplest ones among linear classifiers. To perform hyperparameter optimization we'll use cross-validation by applying Pipeline and GridSearchCV functions. This specific classifier was chosen in order to decrease the training time within the workshop. Results for more complex models will be provided in the bonus file. Step91: Again, we shall save the results in the table. Step92: As you can see, the F1-score of the model is slightly higher than the score of the majority classifier. Step93: Next, it is necessary to delete the application names - they are unique for each sample. If we encode them with dummy encoding, it will lead to adding N, where N is the length of the whole dataset, and all these columns will have only one value 1 and all the others 0. Such features obviously do not work. Step94: As was said before, sometimes it makes sense to encode columns with LabelEncoding. In our case the Content Rating column is suitable for this approach. We should encode it in a way, so with the growth of restrictions, the corresponding number will also grow. Step95: Now let's encode the remaining categories with the dummy method. Step96: Now we have 44 features instead of 4. Step97: Task 15 Train the model, make a prediction on the test data and output the statistics. Don't forget to measure your training time. Step98: As you can see, adding categorical features have improved the accuracy of the model. Step99: Let's add a price per megabyte column. Step100: Also let's add logarithms for price and size. Step101: Usually it is useful to indroduce polynomial features for the numerical ones. Let's make them from the previously calculated logarithms of price and size. To do this, we can use the scikit-learn function Polynomial Features. Step102: You can see that there are new columns low_price^2, log_price, log_size and log_size^2. Now you need to attach them to the main dataset, and discard unnecessary ones. To avoid errors during concatenation, we will replace the poly_df index with the df_new index. Step103: Add the number of characters and the number of words in the title as features. Step104: The names of applications contain a lot of garbage. It is better to clean it. Step105: First we need to check what the text looks like after cleaning. Step106: Now, after filtering, we can add the number of characters and the number of words as features. Step107: Next step is to add the difference between the original number of words and symbols and the normalized ones. Step108: For some reason there are normalized headers that have more words than original ones. We need to check it. Step109: Everything seems fine. Step110: Let's encode categorical features into numerical vectors. Step111: Now it's time to visualize our data. We will use UMAP for this. Step112: You can see that there is a lot of clusters and they contain different proportions of applications with different ratings. Let's apply a clustering algorithm to separate these groups. For now we will assume that we have 30 clusters and use the k_means algorithm. Step113: Now we visualize the results of our clustering. Step114: Looks promissing. Let's explore whether there is a difference in the distributions of the target variable in each cluster. Step115: Obviously, the distribution of the target variable differs in many way throughout the clusters. We probably should add the cluster indexes to the main dataset. Note that the cluster index is a category. To perform one-hot encoding we will remove the target variable and then we can add new columns to the main dataset. Step116: It also would be possible to use aggregation features Step117: Adding the manually created features increased the effectiveness of the model. Step118: Apparently, most of the information can be saved with 60-70 new projections. Let's see how many components do we need to keep 99% of the original dataset's information. Step119: <a id='greedy_selection'></a> Step120: Top 20 of the most significant features Step121: Let's find at what stage was the best accuracy. Step122: <a id='4_final_prediction'></a> Step123: <a id='conclusions'></a> Step124: The best result on the validation set was shown by a model trained on the features obtained by the greedy selection method. Because some features can decrease the accuracy, removing them allows you to get a better result than on the original dataset. However, on the test set, the greedy algorithm showed slightly worse results than the full dataset. This could happen due to the fact that the optimal set of features was selected for the validation set which in our case might have a slightly different distribution and the dataset isn't particularly large.
<ASSISTANT_TASK:> Python Code: #TODO add to cointainer !pip install umap-learn import numpy as np from numpy.random import seed import scipy.stats as stats from scipy.stats import uniform, truncnorm, randint import random import pandas as pd from sklearn.decomposition import PCA from sklearn.preprocessing import StandardScaler, PolynomialFeatures from sklearn.pipeline import Pipeline from sklearn.model_selection import train_test_split, GridSearchCV, RandomizedSearchCV from sklearn.metrics import f1_score, classification_report, confusion_matrix, accuracy_score, roc_auc_score from sklearn.metrics import r2_score, mean_absolute_error, mean_squared_error, make_scorer from sklearn.linear_model import LogisticRegression import sklearn.cluster as cluster import umap from joblib import load from io import BytesIO import requests import matplotlib.pyplot as plt from pylab import rcParams import seaborn as sns plt.style.use('seaborn-poster') %matplotlib inline import os import pickle import warnings from time import time warnings.filterwarnings('ignore') DATA_F ='./data/googleplaystore_alter.csv' FEATURE_IMPORTANCE_F= './data/feature_importances_logreg.csv' BONUS_F = './data/bonus_df_alter.csv' CLUSTER_F = './data/cluster.joblib?raw=true' df = pd.read_csv(DATA_F) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df.head(?) # df.tail(?) df.iloc[2] df['App'].head(5) df.at[1, 'App'] df.loc[1:3, ['App', 'Category']] df.iloc[2:4, [1, 2]] df[df['Category']=='ART_AND_DESIGN'].head(5) df[(df['Category']=='ART_AND_DESIGN') & (df.Type == 'Free')].head(5) df.info() df.Category.value_counts() df[df.Category == '2'] df = df[df.Category != '2'] ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df.Category. ? ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df.Rating. ? plt.figure(figsize=(7,7)) plt.pie(df.Rating.value_counts(), labels=df.Rating.value_counts().index, autopct='%1.1f%%', startangle=120, explode=[0.02]*3) plt.axis('equal') plt.show() # TODO # df.Rating.astype(int) # df.Rating.plot.pie() df.Rating.describe() df.Rating.isnull().sum() df.Size.value_counts() ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # def check_size(size_value): # write your code here df.Size = df.Size.apply(check_size) assert df.Size.dtype == float df.Size.dtype df.Size.isnull().sum()/len(df) df['unknown_size'] = df.Size.isnull() ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df.Size = df.Size.fillna(value=?) assert df.Size.isnull().sum() == 0 df.Size.isnull().sum() df.Type.value_counts(normalize=True) df.Type.isnull().sum() df[df.Type.isnull()] ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") assert df.Type.isnull().sum() == 0 df.Type.isnull().sum() df.Price.value_counts()[:10] ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df['Price'] = df['Price'].str.replace(?) # df['Price'] = df['Price']. ? assert df.Price.dtype == float plt.figure(figsize=[15, 7]) sns.distplot(df.Price[df.Type == 'Paid']) plt.xlabel("Price, $") plt.title('The distribution of apps by price' ,size = 24) plt.show() plt.figure(figsize=[15, 7]) sns.distplot(np.log(df.Price[df.Type == 'Paid'])) plt.xlabel("log(Price), $") plt.title('The distribution of apps by price',size = 24) plt.show() df[df.Price > 200] df.Price.isnull().sum() df['Content Rating'].value_counts() df = df[(df['Content Rating'] != 'Adults only 18+') & (df['Content Rating']!= 'Unrated')] df['Content Rating'].value_counts() df['Content Rating'].isnull().sum() df.Genres.value_counts() list_of_genres = [] for i in df.Genres.str.split(';').values: list_of_genres.extend(i) print('Amount of subcategory: {}'.format(len(set(list_of_genres)))) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # counts_of_genres = df.Genres.str.findall ? assert sum(counts_of_genres) == 11333 counts_of_genres.describe() (counts_of_genres>1).sum()/len(counts_of_genres) df[counts_of_genres>1].head(10) df.Genres.isnull().sum() df['Current Ver'].value_counts() df = df.drop(columns=['Current Ver']) df['Android Ver'].value_counts(normalize=True) df['Android Ver'].isnull().sum() df = df.dropna(subset=['Android Ver']) for i in range(1, 9): df.loc[df['Android Ver'].str.contains('^{}..*'.format(i)), 'Android Ver'] = '{} and up'.format(i) df['Android Ver'].value_counts(normalize=True).sort_index() df.loc[df['Android Ver'].str.contains('^[123]..*'), 'Android Ver'] = '1 and up' df.loc[df['Android Ver'].str.contains('^[5678]..*'), 'Android Ver'] = '5 and up' df['Android Ver'].value_counts(normalize=True) df['Android Ver'].isnull().sum() df.isnull().sum() df_dup = df[df.duplicated(subset='App')] df_dup.head() dup_apps = ['Box', 'Call Blocker', 'Bubble Shooter', 'Word Search'] df_tmp = pd.DataFrame() for col in dup_apps: df_tmp = pd.concat((df_tmp, df[df.App == col])) df_tmp df = df.sort_values('Size') ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df = df.drop_duplicates(?) assert df.shape == (9652, 10) df.shape df.head() corr_df = df.corr() cmap = sns.diverging_palette(220, 10, as_cmap=True) mask = np.zeros_like(corr_df, dtype=np.bool) mask[np.triu_indices_from(mask)] = True plt.subplots(figsize=[15,10]) plt.title('Correlation matrix') sns.heatmap(corr_df, mask=mask, cmap=cmap, linewidths=.5, annot=True) plt.show() df_log = df.copy() df_log['log_price'] = np.log1p(df_log.Price) df_log.unknown_size = df_log.unknown_size.astype(int) ax = sns.pairplot(df_log, hue='Rating', vars = ['Size', 'log_price', 'unknown_size'], plot_kws = {'alpha': 0.6, 's': 80, 'edgecolor': 'w'}, diag_kind='hist', diag_kws = {'edgecolor': 'w', 'alpha': 0.6, 'bins': 10}, size = 4) ax.fig.suptitle('Pairplot with grouping by rating', y=1.02, size=18) plt.show() df_app = pd.DataFrame({'App': df.App, 'Rating': df.Rating}) df_app['App_len'] = df_app.App.apply(len) plt.figure(figsize=(15, 7)) for i in sorted(df_app.Rating.unique()): sns.kdeplot(df_app.App_len[df_app.Rating==i], shade=True, legend=False,) plt.legend(labels=sorted(df_app.Rating.unique())) plt.xlabel("Number of characters in App") plt.title("The distribution of the Apps name",size = 18) plt.show() df.groupby('Type')['Price'].mean() df.head(5) df_cat_genrs = df[['Category', 'Genres', 'Rating']] df_cat_genrs['Count_of_genres'] = df_cat_genrs.Genres.str.findall(';').apply(len)+1 df_cat_genrs.head() ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # group_df = df_cat_genrs.groupby( ? )[ ? ].describe().sort_values('mean', ascending=False) group_df.head(15) df_cat_genrs.Category = df_cat_genrs.Category.str.lower() df_cat_genrs.Genres = df_cat_genrs.Genres.str.lower() df_cat_genrs.Genres = df_cat_genrs.Genres.str.replace('&', '') df_cat_genrs.Genres = df_cat_genrs.Genres.str.replace(';', ' ') df_cat_genrs.Category = df_cat_genrs.Category.str.replace('_', ' ') df_cat_genrs.Category = df_cat_genrs.Category.str.replace('and', '') df_cat_genrs.head(5) (df_cat_genrs['Category'] == df_cat_genrs['Genres']).sum()/len(df_cat_genrs) df_cat_genrs['is_cat_equal_genre'] = df_cat_genrs['Category'] == df_cat_genrs['Genres'] df_cat_genrs.head() plt.figure(figsize=(10, 5)) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # sns.countplot(x= ?, hue='Rating', data=df_cat_genrs, hue_order=np.sort(df['Rating'].unique())) plt.xlabel("Coincidence of Genre and Category") plt.title('The distribution of apps by ratings',size = 18) plt.show() cr_tab = pd.crosstab(df_cat_genrs.Rating, df_cat_genrs.is_cat_equal_genre) cr_tab cr_tab / cr_tab.min() df = df.drop(columns=['Genres']) df['is_cat_equal_genre'] = df_cat_genrs['is_cat_equal_genre'] # for task version - hide next 3 cells plt.figure(figsize=(10, 5)) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # sns.countplot(x= ?, hue= ?, data=df, hue_order=np.sort(df['Rating'].unique())) plt.xlabel("Сontent Rating") plt.title('The distribution of apps by ratings',size = 18) plt.show() ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df_ct_rc = pd.crosstab(?, ?) df_ct_rc /= df_ct_rc.sum() df_ct_rc plt.figure(figsize=(10,10)) for i, con_rating in enumerate(df['Content Rating'].unique()): plt.subplot(2, 2, i+1) vc = df.Rating[df['Content Rating']== con_rating].value_counts().sort_index() patches = plt.pie(vc, autopct='%1.1f%%', startangle=120, explode=[0.02]*3) plt.title(con_rating) plt.axis('equal') plt.legend(labels=vc.index, loc=(1.02,1.75)) plt.show() pd_ct_comp = pd.crosstab(df.Rating, [df['Content Rating'], df.is_cat_equal_genre]) pd_ct_comp /= pd_ct_comp.sum() pd_ct_comp = pd_ct_comp.style.background_gradient(cmap='summer_r') pd_ct_comp g = sns.catplot(x="Category",y="log_price", data=df_log[df_log.Type=='Paid']) g.fig.set_figheight(7) g.fig.set_figwidth(20) plt.title('The distribution of logarithmic price in different categories', size = 20) plt.xticks(rotation=90) plt.show() g = sns.catplot(x="Category",y="log_price", data=df_log[df_log.Type=='Paid'], kind='bar') g.fig.set_figheight(7) g.fig.set_figwidth(20) plt.title('The distribution of logarithmic price in different categories', size = 20) plt.xticks(rotation=90) plt.show() df_log.log_price[(df_log.Category.isin(['LIFESTYLE', 'FINANCE'])) & (df_log.Type == 'Paid')].describe() df_log[(df_log.log_price > 5.) & (df_log.Category.isin(['LIFESTYLE', 'FINANCE']))] g = sns.catplot(x="Category",y="log_price", data=df_log[(df_log.Type=='Paid') & (df_log.log_price < 5)], kind='bar') g.fig.set_figheight(7) g.fig.set_figwidth(20) plt.title('The distribution of logarithmic price in different categories', size = 20) plt.xticks(rotation=90) plt.show() df = df[~((df_log.Category.isin(['LIFESTYLE', 'FINANCE'])) & (df_log.log_price > 5))] df_log = df_log[~((df_log.Category.isin(['LIFESTYLE', 'FINANCE'])) & (df_log.log_price > 5))] df_log['log_size'] = df_log.Size.apply(np.log1p) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # g = sns.catplot(x= ?, y= ?, data=df_log) g.fig.set_figheight(7) g.fig.set_figwidth(20) plt.title('The distribution of logarithmic size in different categories', size = 20) plt.xticks(rotation=90) plt.show() results = pd.DataFrame(columns=['method', 'model', 'val score', 'test score', 'learning time', 'predict time']) class Timer(object): def __init__(self): self.elapsed_time = 0 def __enter__(self): self.start = time() def __exit__(self, type, value, traceback): self.end = time() self.elapsed_time = int((self.end - self.start)*1000) timer = Timer() Y = df.Rating.astype(int) df = df.drop(columns=['Rating']) y_train, y_test = train_test_split(Y, test_size=0.3, random_state=42) classes, counts = np.unique(y_train, return_counts=True) major_class = classes[np.argmax(counts)] major_class base_predict = np.full(y_test.shape, major_class) def calculate_metrics(y_predict, y_test): print('acсuracy: {:.4f}'.format(accuracy_score(y_predict, y_test))) print('F1 score: {:.4f}'.format(f1_score(y_predict, y_test, average='macro'))) print(classification_report(y_predict, y_test)) print(confusion_matrix(y_predict, y_test)) calculate_metrics(base_predict, y_test) results = results.append({'method':'Baseline', 'model': 'Majority', 'val score': None, 'test score': f1_score(base_predict, y_test, average='macro'), 'learning time' : None, 'predict time': None}, ignore_index=True) df.info() numeric_df = df.select_dtypes(include=['int64', 'float64', 'bool']) numeric_df.head() X_train, X_test, y_train, y_test = train_test_split(numeric_df, Y, test_size=0.3, random_state=42) pipe = Pipeline([('scale', StandardScaler()), ('clf', LogisticRegression(random_state=42))]) params = { 'clf__C': [0.01, 0.05, 0.1, 0.5, 0.9, 0.99], 'clf__penalty': ['l1', 'l2', 'elasticnet'] } np.random.seed(123) clf = GridSearchCV(pipe, cv=3, param_grid=params, scoring='f1_macro', verbose=1, n_jobs=6) with timer: clf.fit(X_train, y_train) learning_time = timer.elapsed_time best_clf = clf.best_estimator_.steps[1][1] best_clf clf.best_score_ with timer: predict = clf.predict(X_test) predict_time = timer.elapsed_time calculate_metrics(predict, y_test) results = results.append({'method':'Numeric', 'model': 'LR', 'val score': clf.best_score_, 'test score': f1_score(clf.predict(X_test), y_test, average='macro'), 'learning time': learning_time, 'predict time': predict_time}, ignore_index=True) df_dummies = df.copy() df_dummies = df_dummies.drop(columns=['App']) con_rat_dict = {'Everyone':0, 'Everyone 10+':1, 'Teen':2, 'Mature 17+':3} df_dummies = df_dummies.replace({"Content Rating": con_rat_dict}) df_dummies = pd.get_dummies(df_dummies) df_dummies.shape X_train, X_test, y_train, y_test = train_test_split(df_dummies, Y, test_size=0.3, random_state=42) np.random.seed(123) with timer: ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # clf = GridSearchCV(pipe, cv=3, # param_grid=params, # scoring='f1_macro', verbose=1, # n_jobs=6).fit(?, ?) learning_time = timer.elapsed_time print('Best score:', clf.best_score_) with timer: predict = clf.predict(X_test) predict_time = timer.elapsed_time calculate_metrics(predict, y_test) results = results.append({'method': 'Categories', 'model': 'LR', 'val score': clf.best_score_, 'test score': f1_score(clf.predict(X_test), y_test, average='macro'), 'learning time': learning_time, 'predict time': predict_time}, ignore_index=True) df_new = df.copy() df_new['price_for_mb'] = df_new.Size/df_new.Price df_new['price_for_mb'] = df_new['price_for_mb'].replace([np.inf, -np.inf], 0) df_new['log_price'] = df_new.Price.apply(np.log1p) df_new['log_size'] = df_new.Size.apply(np.log1p) p = PolynomialFeatures(degree=2).fit(df_new[['log_price', 'log_size']]) poly_df = pd.DataFrame(p.transform(df_new[['log_price', 'log_size']]), columns=p.get_feature_names(['log_price', 'log_size'])) poly_df.head(10) poly_df = poly_df.drop(columns=['log_price', 'log_size', '1']) poly_df.index = df_new.index df_new = pd.concat([df_new, poly_df.reindex(df_new.index)], axis=1) df_new.head(5) df_new['len_of_app_title'] = df_new.App.apply(len) df_new['count_of_app_title'] = df_new.App.str.split(' ').apply(len) # Let's change to lower case, remove special characters, leave only Latin letters and numbers. df_new['cleantext'] = df_new.App.str.lower() df_new['cleantext'] = df_new.cleantext.str.replace('[-_]', ' ') df_new['cleantext'] = df_new.cleantext.str.replace('[^0-9A-Za-z ]+', '') df_new[['App', 'cleantext']].head(10) df_new['len_of_cleantext_title'] = df_new.cleantext.apply(len) df_new['count_of_cleantext_title'] = df_new.cleantext.str.split(' ').apply(len) df_new['diff_len_title'] = df_new['len_of_app_title'] - df_new['len_of_cleantext_title'] df_new['diff_count_title'] = df_new['count_of_app_title'] - df_new['count_of_cleantext_title'] df_new[['diff_len_title', 'diff_count_title']].describe() df_new[['App', 'cleantext']][df_new['diff_count_title'] == -5] len_vocab = len(set(' '.join(df_new.cleantext.tolist()).split(' '))) max_count_of_cleantext_title = round(df_new.count_of_cleantext_title.max(), 0) print('Number of unique words: {}'.format(len_vocab)) print('Maximum number of words in a title: {}'.format(max_count_of_cleantext_title)) df_new = df_new.drop(columns=['App', 'cleantext']) df_new = df_new.replace({"Content Rating": con_rat_dict}) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # df_new = pd. ? df_new.shape scaled_data = StandardScaler().fit_transform(df_new) %%time np.random.seed(1) X_umap = umap.UMAP(n_components=2, random_state=2).fit_transform(scaled_data) plt.figure(figsize=[15, 9]) plt.title('UMAP') for i in Y.unique(): indx = np.where(Y.values == i) plt.scatter(X_umap[indx, 0], X_umap[indx, 1], marker='.', alpha=0.5, label=i) plt.legend() plt.show() cls = cluster.KMeans(n_clusters=30, random_state=42) kmeans_labels = cls.fit_predict(scaled_data) # For Google Colab below # Unfortunately, Google collab doesn't allow to reproduce KMeans model training in spite of the random_state. # Without it we can't reproduce our clusters and distributions inside them. That's why we're loading pretrained cluster # model. If you want train your own cluster model you can use the commented code # m_file = BytesIO(requests.get(CLUSTER_F).content) # cls = load(m_file) # kmeans_labels = cls.predict(scaled_data) plt.figure(figsize=[15, 9]) ax = plt.subplot() for i in np.unique(kmeans_labels): indx = np.where(kmeans_labels == i) plt.scatter(X_umap[indx, 0], X_umap[indx, 1], marker='.', alpha=0.5, label=i) ax.legend(loc='upper center', bbox_to_anchor=(1.05, 1.0), ncol=1, fancybox=True, shadow=True, fontsize=10) plt.show() df_clstr = pd.DataFrame({'Cluster': kmeans_labels, 'Rating':Y}) g = sns.catplot("Rating", col="Cluster", col_wrap=5, data=df_clstr, kind="count", height=2.5, aspect=.8, size=4) df_clstr = df_clstr.drop(columns=['Rating']) df_clstr['Cluster'] = df_clstr['Cluster'].astype('category') df_clstr = pd.get_dummies(df_clstr) df_clstr.index = df_new.index df_new=pd.concat([df_new, df_clstr], axis=1) df_new.shape X_train, X_test, y_train, y_test = train_test_split(df_new, Y, test_size=0.3, random_state=42) np.random.seed(123) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # with ?: # clf = GridSearchCV( ? ).fit( ? ) learning_time = timer.elapsed_time print('Best score:', clf.best_score_) print('Best params:', clf.best_params_) with timer: predict = clf.predict(X_test) predict_time = timer.elapsed_time calculate_metrics(predict, y_test) results = results.append({'method': 'Manual features', 'model': 'LR', 'val score': clf.best_score_, 'test score': f1_score(clf.predict(X_test), y_test, average='macro'), 'learning time':learning_time, 'predict time': predict_time}, ignore_index=True) model = PCA() pca_data = model.fit_transform(StandardScaler().fit_transform(df_new)) plt.figure(figsize=[13, 5]) plt.title('Principal Component Analysis (PCA)') plt.plot(range(len(model.explained_variance_ratio_)), model.explained_variance_ratio_, '--o') plt.ylabel('Explained variance ratio') plt.xlabel('Components') plt.tight_layout() plt.show() ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # model = PCA(n_components=?) # pca_data = model.fit_transform(?) assert pca_data.shape[1] == 48 pca_data.shape # %%time # X_train, X_test, y_train, y_test = train_test_split(df_new, Y, # test_size=0.3, # random_state=42) # scaled_data = StandardScaler().fit_transform(X_train) # scaled_X = pd.DataFrame(scaled_data, index=X_train.index, columns=X_train.columns) # clf_logreg = LogisticRegression(random_state=42, C=0.05, penalty='l2') # parameters_grid = {'C': [0.05]} # columns = X_train.columns # important_features = [] # features_scores = [] # np.random.seed(123) # for j in range(len(columns)-1): # print('{}\{}'.format(j, len(columns))) # col_for_del = [] # scores = [] # for i in columns: # cols = columns[columns != i] # clf = GridSearchCV(clf_logreg, cv=3, # param_grid=parameters_grid, # scoring='f1_macro', # verbose=0, # n_jobs=6).fit(scaled_X[cols], y_train) # scores.append(clf.best_score_) # max_col = columns[np.argmax(scores)] # print(max_col, clf.best_score_) # important_features.append(max_col) # features_scores.append(max(scores)) # columns = columns[columns != max_col] # print(j, '\r', end='') # features_scores.append(0) # important_features.append(columns[0]) # feature_importances = pd.DataFrame({'features': important_features, # 'feature_importances': features_scores, # 'iteration': range(len(features_scores))}) # feature_importances = feature_importances.sort_values('iteration', ascending=True) # feature_importances.to_csv(FEATURE_IMPORTANCE_F, index=False) feature_importances = pd.read_csv(FEATURE_IMPORTANCE_F) plt.figure(figsize=[15, 6]) plt.title('Brute force') plt.plot(feature_importances.iteration[:-1], feature_importances.feature_importances[:-1], '-o') plt.ylabel('f1_macro') plt.xlabel('iteration') plt.tight_layout() plt.show() feature_importances.features[::-1][:20] feature_importances[feature_importances.feature_importances == feature_importances.feature_importances.max()] max_id = feature_importances[ feature_importances.feature_importances == feature_importances.feature_importances.max() ].index[0] print('We can leave {} features'.format(len(feature_importances)-max_id)) selected_features = feature_importances.features[max_id:] # Greedy features ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # X_train, X_test, y_train, y_test = train_test_split(df_new[ ? ], Y, # test_size=0.3, # random_state=42) pipe = Pipeline([('scale', StandardScaler()), ('clf', LogisticRegression(random_state=42))]) params = { 'clf__C': [0.01, 0.05, 0.1, 0.5, 0.9, 0.99], 'clf__penalty': ['l1', 'l2', 'elasticnet'] } np.random.seed(123) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # with ? : # clf = GridSearchCV( ? ).fit( ? ) learning_time = timer.elapsed_time with timer: predict = clf.predict(X_test) predict_time = timer.elapsed_time calculate_metrics(predict, y_test) results = results.append({'method': 'Greedy selection', 'model': 'LR', 'val score': clf.best_score_, 'test score': f1_score(clf.predict(X_test), y_test, average='macro'), 'learning time': learning_time, 'predict time': predict_time}, ignore_index=True) # PCA features ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # X_train, X_test, y_train, y_test = train_test_split( ? ) np.random.seed(123) pipe = Pipeline([('scale', StandardScaler()), ('pca', PCA(n_components=0.99)), ('clf', LogisticRegression(random_state=42))]) ##### Implement this part of the code ##### raise NotImplementedError("Code not implemented, follow the instructions.") # with ? # clf = ? learning_time = timer.elapsed_time with timer: predict = clf.predict(X_test) predict_time = timer.elapsed_time calculate_metrics(clf.predict(X_test), y_test) results = results.append({'method': 'PCA features', 'model': 'LR', 'val score': clf.best_score_, 'test score': f1_score(clf.predict(X_test), y_test, average='macro'), 'learning time': learning_time, 'predict time': predict_time}, ignore_index=True) results # from sklearn.ensemble import RandomForestClassifier, GradientBoostingClassifier # from sklearn.linear_model import LogisticRegression # from catboost import CatBoostClassifier # from lightgbm import LGBMClassifier # log_params = {'clf__C': uniform(0.01, 0.99), # 'clf__penalty': ['l1', 'l2']} # rf_params = {'clf__n_estimators': randint(100, 1000), # 'clf__max_depth': randint(1,10), # 'clf__min_samples_leaf': randint(1, 10), # 'clf__min_samples_split': randint(2, 11)} # gb_params = {'clf__learning_rate': uniform(0.01, 0.49), # 'clf__n_estimators': randint(100, 700), # 'clf__max_depth': randint(1, 10), # 'clf__subsample': uniform(0.6, 0.4)} # models_dict = {'Logistic Regression':[log_params, LogisticRegression(random_state=42)], # 'Random Forest':[rf_params, RandomForestClassifier(random_state=42)], # 'Gradient Boosting': [gb_params, GradientBoostingClassifier(random_state=42)], # 'XGB':[gb_params, xgb.XGBClassifier(random_state=42)], # 'CatBoost':[gb_params, CatBoostClassifier(bootstrap_type='Bernoulli', random_state=42, verbose=0)], # 'LightBoost':[gb_params, LGBMClassifier(random_state=42)]} # ext_results = pd.DataFrame(columns=['method', 'model', 'val score', 'test score', 'learning time', 'predict time']) # def custom_pipe(clf, pca='False'): # if pca: # return Pipeline([('clf', clf)]) # else: # return Pipeline([('scale', StandardScaler()), # ('clf', clf)]) # X_train_gs, X_test_gs = train_test_split(df_new[selected_features],test_size=0.3, random_state=42) # X_train_all, X_test_all = train_test_split(df_new,test_size=0.3, random_state=42) # pca_model = PCA(n_components=0.99) # scaler = StandardScaler() # X_train_pca = pca_model.fit_transform(scaler.fit_transform(X_train_all)) # X_test_pca = pca_model.transform(scaler.transform(X_test_all)) # data_dict = {'Manual features':(X_train_all, X_test_all), # 'Greedy selection':(X_train_gs, X_test_gs), # 'PCA':(X_train_pca, X_test_pca)} # np.random.seed(123) # for method, (X_train, X_test) in data_dict.items(): # print(f'Method: {method}\n') # if method == "PCA": # pca_flag = True # else: # pca_flag = False # for clf_name, vals in models_dict.items(): # print(clf_name, '\n') # pipe = custom_pipe(vals[1], pca_flag) # with timer: # clf = RandomizedSearchCV(pipe, cv=3, random_state=123, # param_distributions=vals[0], # n_jobs=4, # verbose=1, # n_iter=100, # scoring='f1_macro').fit(X_train, y_train) # print(clf.best_params_ , '\n') # learning_time = int(timer.elapsed_time / 300) # with timer: # predict = clf.predict(X_test) # predict_time = timer.elapsed_time # ext_results = ext_results.append({'method': method, # 'model': clf_name, # 'val score': clf.best_score_, # 'test score': f1_score(predict, y_test, average='macro'), # 'learning time': learning_time, # 'predict time': predict_time}, # ignore_index=True) # ext_results.to_csv(BONUS_F, index=False) ext_results = pd.read_csv(BONUS_F) ext_results <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Scheme Scope Step7: 1.4. Basic Approximations Step8: 1.5. Prognostic Variables Form Step9: 1.6. Number Of Tracers Step10: 1.7. Family Approach Step11: 2. Key Properties --&gt; Software Properties Step12: 2.2. Code Version Step13: 2.3. Code Languages Step14: 3. Key Properties --&gt; Timestep Framework Step15: 3.2. Split Operator Advection Timestep Step16: 3.3. Split Operator Physical Timestep Step17: 3.4. Integrated Timestep Step18: 3.5. Integrated Scheme Type Step19: 4. Key Properties --&gt; Meteorological Forcings Step20: 4.2. Variables 2D Step21: 4.3. Frequency Step22: 5. Key Properties --&gt; Resolution Step23: 5.2. Canonical Horizontal Resolution Step24: 5.3. Number Of Horizontal Gridpoints Step25: 5.4. Number Of Vertical Levels Step26: 5.5. Is Adaptive Grid Step27: 6. Key Properties --&gt; Tuning Applied Step28: 6.2. Global Mean Metrics Used Step29: 6.3. Regional Metrics Used Step30: 6.4. Trend Metrics Used Step31: 7. Transport Step32: 7.2. Scheme Step33: 7.3. Mass Conservation Scheme Step34: 7.4. Convention Step35: 8. Emissions Step36: 8.2. Method Step37: 8.3. Sources Step38: 8.4. Prescribed Climatology Step39: 8.5. Prescribed Climatology Emitted Species Step40: 8.6. Prescribed Spatially Uniform Emitted Species Step41: 8.7. Interactive Emitted Species Step42: 8.8. Other Emitted Species Step43: 8.9. Other Method Characteristics Step44: 9. Concentrations Step45: 9.2. Prescribed Lower Boundary Step46: 9.3. Prescribed Upper Boundary Step47: 9.4. Prescribed Fields Mmr Step48: 9.5. Prescribed Fields Mmr Step49: 10. Optical Radiative Properties Step50: 11. Optical Radiative Properties --&gt; Absorption Step51: 11.2. Dust Step52: 11.3. Organics Step53: 12. Optical Radiative Properties --&gt; Mixtures Step54: 12.2. Internal Step55: 12.3. Mixing Rule Step56: 13. Optical Radiative Properties --&gt; Impact Of H2o Step57: 13.2. Internal Mixture Step58: 14. Optical Radiative Properties --&gt; Radiative Scheme Step59: 14.2. Shortwave Bands Step60: 14.3. Longwave Bands Step61: 15. Optical Radiative Properties --&gt; Cloud Interactions Step62: 15.2. Twomey Step63: 15.3. Twomey Minimum Ccn Step64: 15.4. Drizzle Step65: 15.5. Cloud Lifetime Step66: 15.6. Longwave Bands Step67: 16. Model Step68: 16.2. Processes Step69: 16.3. Coupling Step70: 16.4. Gas Phase Precursors Step71: 16.5. Scheme Type Step72: 16.6. Bulk Scheme Species
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'nerc', 'hadgem3-gc31-hm', 'aerosol') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.scheme_scope') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "troposhere" # "stratosphere" # "mesosphere" # "mesosphere" # "whole atmosphere" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.basic_approximations') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.prognostic_variables_form') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "3D mass/volume ratio for aerosols" # "3D number concenttration for aerosols" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.number_of_tracers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.family_approach') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.software_properties.repository') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.software_properties.code_version') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.software_properties.code_languages') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.timestep_framework.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Uses atmospheric chemistry time stepping" # "Specific timestepping (operator splitting)" # "Specific timestepping (integrated)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.timestep_framework.split_operator_advection_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.timestep_framework.split_operator_physical_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.timestep_framework.integrated_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.timestep_framework.integrated_scheme_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Explicit" # "Implicit" # "Semi-implicit" # "Semi-analytic" # "Impact solver" # "Back Euler" # "Newton Raphson" # "Rosenbrock" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.meteorological_forcings.variables_3D') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.meteorological_forcings.variables_2D') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.meteorological_forcings.frequency') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.resolution.name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.resolution.canonical_horizontal_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.resolution.number_of_horizontal_gridpoints') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.resolution.number_of_vertical_levels') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.resolution.is_adaptive_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.tuning_applied.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.tuning_applied.global_mean_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.tuning_applied.regional_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.key_properties.tuning_applied.trend_metrics_used') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.transport.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.transport.scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Uses Atmospheric chemistry transport scheme" # "Specific transport scheme (eulerian)" # "Specific transport scheme (semi-lagrangian)" # "Specific transport scheme (eulerian and semi-lagrangian)" # "Specific transport scheme (lagrangian)" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.transport.mass_conservation_scheme') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Uses Atmospheric chemistry transport scheme" # "Mass adjustment" # "Concentrations positivity" # "Gradients monotonicity" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.transport.convention') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Uses Atmospheric chemistry transport scheme" # "Convective fluxes connected to tracers" # "Vertical velocities connected to tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.method') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "None" # "Prescribed (climatology)" # "Prescribed CMIP6" # "Prescribed above surface" # "Interactive" # "Interactive above surface" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.sources') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Vegetation" # "Volcanos" # "Bare ground" # "Sea surface" # "Lightning" # "Fires" # "Aircraft" # "Anthropogenic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.prescribed_climatology') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Interannual" # "Annual" # "Monthly" # "Daily" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.prescribed_climatology_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.prescribed_spatially_uniform_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.interactive_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.other_emitted_species') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.emissions.other_method_characteristics') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.concentrations.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.concentrations.prescribed_lower_boundary') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.concentrations.prescribed_upper_boundary') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.concentrations.prescribed_fields_mmr') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.concentrations.prescribed_fields_mmr') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.absorption.black_carbon') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.absorption.dust') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.absorption.organics') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.mixtures.external') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.mixtures.internal') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.mixtures.mixing_rule') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.impact_of_h2o.size') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.impact_of_h2o.internal_mixture') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.radiative_scheme.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.radiative_scheme.shortwave_bands') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.radiative_scheme.longwave_bands') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.cloud_interactions.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.cloud_interactions.twomey') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.cloud_interactions.twomey_minimum_ccn') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.cloud_interactions.drizzle') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.cloud_interactions.cloud_lifetime') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.optical_radiative_properties.cloud_interactions.longwave_bands') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.model.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.model.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Dry deposition" # "Sedimentation" # "Wet deposition (impaction scavenging)" # "Wet deposition (nucleation scavenging)" # "Coagulation" # "Oxidation (gas phase)" # "Oxidation (in cloud)" # "Condensation" # "Ageing" # "Advection (horizontal)" # "Advection (vertical)" # "Heterogeneous chemistry" # "Nucleation" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.model.coupling') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Radiation" # "Land surface" # "Heterogeneous chemistry" # "Clouds" # "Ocean" # "Cryosphere" # "Gas phase chemistry" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.model.gas_phase_precursors') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "DMS" # "SO2" # "Ammonia" # "Iodine" # "Terpene" # "Isoprene" # "VOC" # "NOx" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.model.scheme_type') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Bulk" # "Modal" # "Bin" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.aerosol.model.bulk_scheme_species') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Sulphate" # "Nitrate" # "Sea salt" # "Dust" # "Ice" # "Organic" # "Black carbon / soot" # "SOA (secondary organic aerosols)" # "POM (particulate organic matter)" # "Polar stratospheric ice" # "NAT (Nitric acid trihydrate)" # "NAD (Nitric acid dihydrate)" # "STS (supercooled ternary solution aerosol particule)" # "Other: [Please specify]" # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: At this point, we have our stations and trips data loaded into memory. Step2: Then, let's iterate over the stations DataFrame, and add in the node attributes. Step3: In order to answer the question of "which stations are important", we need to specify things a bit more. Perhaps a measure such as betweenness centrality or degree centrality may be appropriate here. Step4: Exercise Step5: Exercise Step6: Let's now try drawing the graph. Step7: Exercise Step8: In this visual, nodes are sorted from highest connectivity to lowest connectivity in the unfiltered graph.
<ASSISTANT_TASK:> Python Code: # This block of code checks to make sure that a particular directory is present. if "divvy_2013" not in os.listdir('datasets/'): print('Unzip the divvy_2013.zip file in the datasets folder.') stations = pd.read_csv('datasets/divvy_2013/Divvy_Stations_2013.csv', parse_dates=['online date'], index_col='id', encoding='utf-8') stations trips = pd.read_csv('datasets/divvy_2013/Divvy_Trips_2013.csv', parse_dates=['starttime', 'stoptime'], index_col=['trip_id']) trips = trips.sort() trips G = nx.DiGraph() for r, d in stations.iterrows(): # call the pandas DataFrame row-by-row iterator G.add_node(r, attr_dict=d.to_dict()) # # Run the following code at your own risk :) # for r, d in trips.iterrows(): # start = d['from_station_id'] # end = d['to_station_id'] # if (start, end) not in G.edges(): # G.add_edge(start, end, count=1) # else: # G.edge[start][end]['count'] += 1 for (start, stop), d in trips.groupby(['from_station_id', 'to_station_id']): G.add_edge(start, stop, count=len(d)) from collections import Counter # Count the number of edges that have x trips recorded on them. trip_count_distr = Counter([d['count'] for _, _, d in G.edges(data=True)]) # Then plot the distribution of these plt.scatter(list(trip_count_distr.keys()), list(trip_count_distr.values()), alpha=0.1) plt.yscale('log') plt.xlabel('num. of trips') plt.ylabel('num. of edges') # Filter the edges to just those with more than 100 trips. G_filtered = G.copy() for u, v, d in G.edges(data=True): if d['count'] < 100: G_filtered.remove_edge(u,v) len(G_filtered.edges()) nx.draw(G_filtered) nodes = sorted(G_filtered.nodes(), key=lambda x:len(G.neighbors(x))) edges = G_filtered.edges() edgeprops = dict(alpha=0.1) nodecolor = plt.cm.viridis(np.arange(len(nodes)) / len(nodes)) fig = plt.figure(figsize=(6,6)) ax = fig.add_subplot(111) c = CircosPlot(nodes, edges, radius=10, ax=ax, fig=fig, edgeprops=edgeprops, nodecolor=nodecolor) c.draw() plt.savefig('images/divvy.png', dpi=300) nx.write_gpickle(G, 'datasets/divvy_2013/divvy_graph.pkl') G = nx.read_gpickle('datasets/divvy_2013/divvy_graph.pkl') G.nodes(data=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: <h2> Explore data </h2> Step4: Let's write a query to find the unique values for a given column and see how the number of babies and their average weight is distributed across a those values. This is important to ensure that we have enough examples of each data value, and to verify our hunch that the parameter has predictive value. Step5: We'll use the get_distinct_values function above to explore how the variables num_babies and avg_wt are distributed across the features is_male, mother_age, plurality and gestation_weeks
<ASSISTANT_TASK:> Python Code: PROJECT = "cloud-training-demos" # Replace with your PROJECT BUCKET = "cloud-training-bucket" # Replace with your BUCKET REGION = "us-central1" # Choose an available region for Cloud MLE TFVERSION = "1.14" # TF version for CMLE to use import os os.environ["BUCKET"] = BUCKET os.environ["PROJECT"] = PROJECT os.environ["REGION"] = REGION os.environ["TFVERSION"] = TFVERSION %%bash if ! gsutil ls | grep -q gs://${BUCKET}/; then gsutil mb -l ${REGION} gs://${BUCKET} fi # Create SQL query using natality data after the year 2000 query_string = SELECT weight_pounds, is_male, mother_age, plurality, gestation_weeks, FARM_FINGERPRINT(CONCAT(CAST(YEAR AS STRING), CAST(month AS STRING))) AS hashmonth FROM publicdata.samples.natality WHERE year > 2000 # Call BigQuery and examine in dataframe from google.cloud import bigquery bq = bigquery.Client(project = PROJECT) df = bq.query(query_string + "LIMIT 100").to_dataframe() df.head() def get_distinct_values(column_name): sql_query = SELECT {0}, COUNT(1) AS num_babies, AVG(weight_pounds) AS avg_wt FROM publicdata.samples.natality WHERE year > 2000 GROUP BY {0} .format(column_name) return bq.query(sql_query).to_dataframe() # Bar plot to see is_male with avg_wt linear and num_babies logarithmic df = get_distinct_values("is_male") df.plot(x = "is_male", y = "num_babies", kind = "bar"); df.plot(x = "is_male", y = "avg_wt", kind = "bar"); # Line plots to see mother_age with avg_wt linear and num_babies logarithmic df = get_distinct_values("mother_age") df = df.sort_values("mother_age") df.plot(x = "mother_age", y = "num_babies"); df.plot(x = "mother_age", y = "avg_wt"); # Bar plot to see plurality(singleton, twins, etc.) with avg_wt linear and num_babies logarithmic df = get_distinct_values("plurality") df = df.sort_values("plurality") df.plot(x = "plurality", y = "num_babies", logy = True, kind = "bar"); df.plot(x = "plurality", y = "avg_wt", kind = "bar"); # Bar plot to see gestation_weeks with avg_wt linear and num_babies logarithmic df = get_distinct_values("gestation_weeks") df = df.sort_values("gestation_weeks") df.plot(x = "gestation_weeks", y = "num_babies", logy = True, kind = "bar"); df.plot(x = "gestation_weeks", y = "avg_wt", kind = "bar"); <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Tweet Count Analysis Step2: Count 'Em Step3: Less than $1\%$ of our tweets are duplicates, so we have approximately the quantity of tweets that we thought we did. Step4: Now we have the tweet counts as a dictionary of (week_index, count) pairs. Before we go further, we should fill in the any missing weeks with a 0 value. Step5: After we've filled in missing weeks with a 0 value, we sort the pairs, then repackage them as a tuple of week indexes and a tuple of counts. Then we can pass these week indexes and counts to a bar plot function as x- and y-values, respectively. Step6: Unfortunately, we can't automatically display the figure in a Jupyter notebook on NYU's HPC server. So, we saved it to a file, and now we can display it below Step7: Ignoring the frequency of weeks containing 0 tweets, it seems roughly that there are two overlapping normal curves
<ASSISTANT_TASK:> Python Code: import os import sys # From https://stackoverflow.com/a/36218558 . def sparkImport(module_name, module_directory): Convenience function. Tells the SparkContext sc (must already exist) to load module module_name on every computational node before executing an RDD. Args: module_name: the name of the module, without ".py". module_directory: the path, absolute or relative, to the directory containing module module_Name. Returns: none. module_path = os.path.abspath( module_directory + "/" + module_name + ".py") sc.addPyFile(module_path) # Add all scripts from repository to local path. # From https://stackoverflow.com/a/35273613 . module_path = os.path.abspath(os.path.join('..')) if module_path not in sys.path: sys.path.append(module_path) import preprocessing sparkImport("preprocessing", "..") tweets = sc.textFile("tweets.csv") \ .filter(preprocessing.format_is_correct) \ .map(preprocessing.split_record) initial_count = tweets.count() print("Total number of tweets: " + str(initial_count)) tweet_ids = tweets \ .map(lambda record: record[preprocessing.field_index['id']]) \ .distinct() final_count = tweet_ids.count() print("Number of duplicates: " + str(initial_count - final_count)) print("Number of distinct tweets: " + str(final_count)) import matplotlib matplotlib.use('Agg') import matplotlib.pyplot as pyplot def get_week(unix_timestamp): # Add 3 to the day, because Unix timestamp 0 is on a Thursday. return ((int(unix_timestamp) / secondsPerDay + 3) / 7) secondsPerDay = 24*60*60 weekly_tweet_counts = tweets \ .map( lambda record: (get_week(record[preprocessing.field_index['timestamp']]), 1)) \ .countByKey() for week_index in range(min(weekly_tweet_counts.keys()), max(weekly_tweet_counts.keys())): if week_index not in weekly_tweet_counts.keys(): weekly_tweet_counts[week_index] = 0 weekly_tweet_counts_list = sorted(weekly_tweet_counts.items()) weekly_tweet_counts_xy = zip(*weekly_tweet_counts_list) week_indexes = weekly_tweet_counts_xy[0] week_counts = weekly_tweet_counts_xy[1] currentFigure = pyplot.figure() pyplot.figure(currentFigure.number) pyplot.bar(week_indexes, week_counts, width=1.0) pyplot.title('Tweet Count per Week') pyplot.xlabel('Week Index') pyplot.ylabel('Tweet Count') pyplot.xlim([min(week_indexes), max(week_indexes)]) pyplot.ylim([0, max(week_counts)]) pyplot.savefig("tweet_count_per_week.png") sorted_week_counts = sorted(week_counts) currentFigure = pyplot.figure() pyplot.figure(currentFigure.number) pyplot.hist(sorted_week_counts, 40) pyplot.title("Distribution of Weekly Tweet Counts") pyplot.xlabel("Weekly Tweet Count") pyplot.ylabel("Frequency") pyplot.savefig("distribution_of_weekly_counts.png") c_min = 150000 def get_day(unix_timestamp): return int(unix_timestamp) / (24*60*60) tweets_per_day = tweets \ .map(lambda record: (get_day(record[preprocessing.field_index['timestamp']]), 1)) \ .countByKey() for day in range(min(tweets_per_day.keys()), max(tweets_per_day.keys())): if day not in tweets_per_day.keys(): tweets_per_day[day] = 0 num_valid_days = 0 for day in range(min(tweets_per_day.keys()), max(tweets_per_day.keys())): # check if day has enough tweets valid_days = range(day - 31, day) valid_day_counts = [tweets_per_day[past_day] for past_day in valid_days] if sum(valid_day_counts) > 4*c_min: num_valid_days = num_valid_days + 1 print("Number of days satisfying our rule: " + str(num_valid_days)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let us plot the first five examples of the train data (first row) and test data (second row). Step2: Then we import shogun components and convert the data to shogun objects Step3: Let's plot a few missclassified examples - I guess we all agree that these are notably harder to detect. Step4: Now the question is - is 97.30% accuracy the best we can do? While one would usually re-train KNN with different values for k here and likely perform Cross-validation, we just use a small trick here that saves us lots of computation time Step5: We have the prediction for each of the 13 k's now and can quickly compute the accuracies Step6: So k=3 seems to have been the optimal choice. Step7: So we can significantly speed it up. Let's do a more systematic comparison. For that a helper function is defined to run the evaluation for KNN Step8: Evaluate KNN with and without Cover Tree. This takes a few seconds Step9: Generate plots with the data collected in the evaluation Step10: Although simple and elegant, KNN is generally very resource costly. Because all the training samples are to be memorized literally, the memory cost of KNN learning becomes prohibitive when the dataset is huge. Even when the memory is big enough to hold all the data, the prediction will be slow, since the distances between the query point and all the training points need to be computed and ranked. The situation becomes worse if in addition the data samples are all very high-dimensional. Leaving aside computation time issues, k-NN is a very versatile and competitive algorithm. It can be applied to any kind of objects (not just numerical data) - as long as one can design a suitable distance function. In pratice k-NN used with bagging can create improved and more robust results. Step11: Let's apply the SVM to the same test data set to compare results Step12: Since the SVM performs way better on this task - let's apply it to all data we did not use in training.
<ASSISTANT_TASK:> Python Code: import numpy as np import os SHOGUN_DATA_DIR=os.getenv('SHOGUN_DATA_DIR', '../../../data') from scipy.io import loadmat, savemat from numpy import random from os import path mat = loadmat(os.path.join(SHOGUN_DATA_DIR, 'multiclass/usps.mat')) Xall = mat['data'] Yall = np.array(mat['label'].squeeze(), dtype=np.double) # map from 1..10 to 0..9, since shogun # requires multiclass labels to be # 0, 1, ..., K-1 Yall = Yall - 1 random.seed(0) subset = random.permutation(len(Yall)) Xtrain = Xall[:, subset[:5000]] Ytrain = Yall[subset[:5000]] Xtest = Xall[:, subset[5000:6000]] Ytest = Yall[subset[5000:6000]] Nsplit = 2 all_ks = range(1, 21) print(Xall.shape) print(Xtrain.shape) print(Xtest.shape) %matplotlib inline import pylab as P def plot_example(dat, lab): for i in range(5): ax=P.subplot(1,5,i+1) P.title(int(lab[i])) ax.imshow(dat[:,i].reshape((16,16)), interpolation='nearest') ax.set_xticks([]) ax.set_yticks([]) _=P.figure(figsize=(17,6)) P.gray() plot_example(Xtrain, Ytrain) _=P.figure(figsize=(17,6)) P.gray() plot_example(Xtest, Ytest) from shogun import MulticlassLabels, features from shogun import KNN, EuclideanDistance labels = MulticlassLabels(Ytrain) feats = features(Xtrain) k=3 dist = EuclideanDistance() knn = KNN(k, dist, labels) labels_test = MulticlassLabels(Ytest) feats_test = features(Xtest) knn.train(feats) pred = knn.apply_multiclass(feats_test) print("Predictions", pred.get_int_labels()[:5]) print("Ground Truth", Ytest[:5]) from shogun import MulticlassAccuracy evaluator = MulticlassAccuracy() accuracy = evaluator.evaluate(pred, labels_test) print("Accuracy = %2.2f%%" % (100*accuracy)) idx=np.where(pred != Ytest)[0] Xbad=Xtest[:,idx] Ybad=Ytest[idx] _=P.figure(figsize=(17,6)) P.gray() plot_example(Xbad, Ybad) knn.put('k', 13) multiple_k=knn.classify_for_multiple_k() print(multiple_k.shape) for k in range(13): print("Accuracy for k=%d is %2.2f%%" % (k+1, 100*np.mean(multiple_k[:,k]==Ytest))) from shogun import Time, KNN_COVER_TREE, KNN_BRUTE start = Time.get_curtime() knn.put('k', 3) knn.put('knn_solver', KNN_BRUTE) pred = knn.apply_multiclass(feats_test) print("Standard KNN took %2.1fs" % (Time.get_curtime() - start)) start = Time.get_curtime() knn.put('k', 3) knn.put('knn_solver', KNN_COVER_TREE) pred = knn.apply_multiclass(feats_test) print("Covertree KNN took %2.1fs" % (Time.get_curtime() - start)) def evaluate(labels, feats, use_cover_tree=False): from shogun import MulticlassAccuracy, CrossValidationSplitting import time split = CrossValidationSplitting(labels, Nsplit) split.build_subsets() accuracy = np.zeros((Nsplit, len(all_ks))) acc_train = np.zeros(accuracy.shape) time_test = np.zeros(accuracy.shape) for i in range(Nsplit): idx_train = split.generate_subset_inverse(i) idx_test = split.generate_subset_indices(i) for j, k in enumerate(all_ks): #print "Round %d for k=%d..." % (i, k) feats.add_subset(idx_train) labels.add_subset(idx_train) dist = EuclideanDistance(feats, feats) knn = KNN(k, dist, labels) knn.set_store_model_features(True) if use_cover_tree: knn.put('knn_solver', KNN_COVER_TREE) else: knn.put('knn_solver', KNN_BRUTE) knn.train() evaluator = MulticlassAccuracy() pred = knn.apply_multiclass() acc_train[i, j] = evaluator.evaluate(pred, labels) feats.remove_subset() labels.remove_subset() feats.add_subset(idx_test) labels.add_subset(idx_test) t_start = time.clock() pred = knn.apply_multiclass(feats) time_test[i, j] = (time.clock() - t_start) / labels.get_num_labels() accuracy[i, j] = evaluator.evaluate(pred, labels) feats.remove_subset() labels.remove_subset() return {'eout': accuracy, 'ein': acc_train, 'time': time_test} labels = MulticlassLabels(Ytest) feats = features(Xtest) print("Evaluating KNN...") wo_ct = evaluate(labels, feats, use_cover_tree=False) wi_ct = evaluate(labels, feats, use_cover_tree=True) print("Done!") import matplotlib fig = P.figure(figsize=(8,5)) P.plot(all_ks, wo_ct['eout'].mean(axis=0), 'r-*') P.plot(all_ks, wo_ct['ein'].mean(axis=0), 'r--*') P.legend(["Test Accuracy", "Training Accuracy"]) P.xlabel('K') P.ylabel('Accuracy') P.title('KNN Accuracy') P.tight_layout() fig = P.figure(figsize=(8,5)) P.plot(all_ks, wo_ct['time'].mean(axis=0), 'r-*') P.plot(all_ks, wi_ct['time'].mean(axis=0), 'b-d') P.xlabel("K") P.ylabel("time") P.title('KNN time') P.legend(["Plain KNN", "CoverTree KNN"], loc='center right') P.tight_layout() from shogun import GaussianKernel, GMNPSVM width=80 C=1 gk=GaussianKernel() gk.set_width(width) svm=GMNPSVM(C, gk, labels) _=svm.train(feats) out=svm.apply(feats_test) evaluator = MulticlassAccuracy() accuracy = evaluator.evaluate(out, labels_test) print("Accuracy = %2.2f%%" % (100*accuracy)) Xrem=Xall[:,subset[6000:]] Yrem=Yall[subset[6000:]] feats_rem=features(Xrem) labels_rem=MulticlassLabels(Yrem) out=svm.apply(feats_rem) evaluator = MulticlassAccuracy() accuracy = evaluator.evaluate(out, labels_rem) print("Accuracy = %2.2f%%" % (100*accuracy)) idx=np.where(out.get_labels() != Yrem)[0] Xbad=Xrem[:,idx] Ybad=Yrem[idx] _=P.figure(figsize=(17,6)) P.gray() plot_example(Xbad, Ybad) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The parameter <tt>box_l</tt> sets the size of the simulation box. In general, one should check for finite Step2: The skin is used for constructing Step3: The <tt>periodicity</tt> parameter indicates that the system is periodic in all three Step4: We set up the central bead and the other beads are initialized at random positions on the surface of the colloid. The beads are then allowed to relax using Step5: The best way to ensure a relatively uniform distribution Step6: Now that the beads are arranged in the shape of a raspberry, the surface beads are made virtual particles Step7: 5 Inserting Counterions and Salt Ions Step8: We then check that charge neutrality is maintained Step9: A WCA potential acts between all of the ions. This potential represents a purely repulsive Step10: After inserting the ions, again a short integration is performed with a force cap to Step11: 6 Electrostatics Step12: Generally a Bjerrum length of $2$ is appropriate when using WCA interactions with $\sigma=1$, since a typical ion has a radius of $0.35\ \mathrm{nm}$, while the Bjerrum Step13: 7 Lattice-Boltzmann Step14: The important parameters for the LB fluid are the density, the viscosity, the time step, Step15: A logical way of picking a specific set of parameters is to choose them such that the hydrodynamic radius of an ion roughly matches its physical radius determined by the Step16: 8 Simulating Electrophoresis Step17: Plot the raspberry trajectory with <tt>matplotlib</tt>
<ASSISTANT_TASK:> Python Code: import espressomd espressomd.assert_features(["ELECTROSTATICS", "ROTATION", "ROTATIONAL_INERTIA", "EXTERNAL_FORCES", "MASS", "VIRTUAL_SITES_RELATIVE", "CUDA", "LENNARD_JONES"]) from espressomd import interactions from espressomd import electrostatics from espressomd import lb from espressomd.virtual_sites import VirtualSitesRelative import numpy as np # System parameters ############################################################# box_l = 40. # size of the simulation box skin = 0.3 # Skin parameter for the Verlet lists time_step = 0.01 eq_tstep = 0.001 n_cycle = 1000 integ_steps = 150 # Interaction parameters (Lennard-Jones for raspberry) ############################################################# radius_col = 3. harmonic_radius = 3.0 # the subscript c is for colloid and s is for salt (also used for the surface beads) eps_ss = 1. # LJ epsilon between the colloid's surface particles. sig_ss = 1. # LJ sigma between the colloid's surface particles. eps_cs = 48. # LJ epsilon between the colloid's central particle and surface particles. sig_cs = radius_col # LJ sigma between the colloid's central particle and surface particles (colloid's radius). a_eff = 0.32 # effective hydrodynamic radius of a bead due to the discreteness of LB. # System setup ############################################################# system = espressomd.System(box_l=[box_l] * 3) system.time_step = time_step system.cell_system.skin = skin system.periodicity = [True, True, True] # the LJ potential with the central bead keeps all the beads from simply collapsing into the center system.non_bonded_inter[1, 0].wca.set_params(epsilon=eps_cs, sigma=sig_cs) # the LJ potential (WCA potential) between surface beads causes them to be roughly equidistant on the # colloid surface system.non_bonded_inter[1, 1].wca.set_params(epsilon=eps_ss, sigma=sig_ss) # the harmonic potential pulls surface beads towards the central colloid bead col_center_surface_bond = interactions.HarmonicBond(k=3000., r_0=harmonic_radius) system.bonded_inter.add(col_center_surface_bond) # for the warmup we use a Langevin thermostat with an extremely low temperature and high friction coefficient # such that the trajectories roughly follow the gradient of the potential while not accelerating too much system.thermostat.set_langevin(kT=0.00001, gamma=40., seed=42) print("# Creating raspberry") center = system.box_l / 2 colPos = center # Charge of the colloid q_col = -40 # Number of particles making up the raspberry (surface particles + the central particle). n_col_part = int(4 * np.pi * np.power(radius_col, 2) + 1) # Place the central particle system.part.add(id=0, pos=colPos, type=0, q=q_col, fix=(True, True, True), rotation=(1, 1, 1)) # Create central particle # Create surface beads uniformly distributed over the surface of the central particle for i in range(1, n_col_part): colSurfPos = np.random.randn(3) colSurfPos = colSurfPos / np.linalg.norm(colSurfPos) * radius_col + colPos system.part.add(id=i, pos=colSurfPos, type=1) system.part[i].add_bond((col_center_surface_bond, 0)) print("# Number of colloid beads = {}".format(n_col_part)) # Relax bead positions. The LJ potential with the central bead combined with the # harmonic bond keep the monomers roughly radius_col away from the central bead. The LJ # between the surface beads cause them to distribute more or less evenly on the surface. system.force_cap = 1000 system.time_step = eq_tstep print("Relaxation of the raspberry surface particles") for i in range(n_cycle): system.integrator.run(integ_steps) # Restore time step system.time_step = time_step # this loop moves the surface beads such that they are once again exactly radius_col away from the center # For the scalar distance, we use system.distance() which considers periodic boundaries # and the minimum image convention colPos = system.part[0].pos for p in system.part[1:]: p.pos = (p.pos - colPos) / np.linalg.norm(system.distance(p, system.part[0])) * radius_col + colPos p.pos = (p.pos - colPos) / np.linalg.norm(p.pos - colPos) * radius_col + colPos # Select the desired implementation for virtual sites system.virtual_sites = VirtualSitesRelative() # Setting min_global_cut is necessary when there is no interaction defined with a range larger than # the colloid such that the virtual particles are able to communicate their forces to the real particle # at the center of the colloid system.min_global_cut = radius_col # Calculate the center of mass position (com) and the moment of inertia (momI) of the colloid com = np.average(system.part[1:].pos, 0) # system.part[:].pos returns an n-by-3 array momI = 0 for i in range(n_col_part): momI += np.power(np.linalg.norm(com - system.part[i].pos), 2) # note that the real particle must be at the center of mass of the colloid because of the integrator print("\n# moving central particle from {} to {}".format(system.part[0].pos, com)) system.part[0].fix = [False, False, False] system.part[0].pos = com system.part[0].mass = n_col_part system.part[0].rinertia = np.ones(3) * momI # Convert the surface particles to virtual sites related to the central particle # The id of the central particles is 0, the ids of the surface particles start at 1. for p in system.part[1:]: p.vs_auto_relate_to(0) print("# Adding the positive ions") salt_rho = 0.001 # Number density of ions volume = system.volume() N_counter_ions = int(round((volume * salt_rho) + abs(q_col))) i = 0 while i < N_counter_ions: pos = np.random.random(3) * system.box_l # make sure the ion is placed outside of the colloid if (np.power(np.linalg.norm(pos - center), 2) > np.power(radius_col, 2) + 1): system.part.add(pos=pos, type=2, q=1) i += 1 print("# Added {} positive ions".format(N_counter_ions)) print("\n# Adding the negative ions") N_co_ions = N_counter_ions - abs(q_col) i = 0 while i < N_co_ions: pos = np.random.random(3) * system.box_l # make sure the ion is placed outside of the colloid if (np.power(np.linalg.norm(pos - center), 2) > np.power(radius_col, 2) + 1): system.part.add(pos=pos, type=3, q=-1) i += 1 print("# Added {} negative ions".format(N_co_ions)) # Check charge neutrality assert np.abs(np.sum(system.part[:].q)) < 1E-10 # WCA interactions for the ions, essentially giving them a finite volume system.non_bonded_inter[0, 2].lennard_jones.set_params( epsilon=eps_ss, sigma=sig_ss, cutoff=sig_ss * pow(2., 1. / 6.), shift="auto", offset=sig_cs - 1 + a_eff) system.non_bonded_inter[0, 3].lennard_jones.set_params( epsilon=eps_ss, sigma=sig_ss, cutoff=sig_ss * pow(2., 1. / 6.), shift="auto", offset=sig_cs - 1 + a_eff) system.non_bonded_inter[2, 2].wca.set_params(epsilon=eps_ss, sigma=sig_ss) system.non_bonded_inter[2, 3].wca.set_params(epsilon=eps_ss, sigma=sig_ss) system.non_bonded_inter[3, 3].wca.set_params(epsilon=eps_ss, sigma=sig_ss) print("\n# Equilibrating the ions (without electrostatics):") # Langevin thermostat for warmup before turning on the LB. temperature = 1.0 system.thermostat.set_langevin(kT=temperature, gamma=1.) print("Removing overlap between ions") ljcap = 100 CapSteps = 100 for i in range(CapSteps): system.force_cap = ljcap system.integrator.run(integ_steps) ljcap += 5 system.force_cap = 0 # Turning on the electrostatics # Note: Production runs would typically use a target accuracy of 10^-4 print("\n# Tuning P3M parameters...") bjerrum = 2. p3m = electrostatics.P3M(prefactor=bjerrum * temperature, accuracy=0.001) system.actors.add(p3m) print("# Tuning complete") E = 0.1 # an electric field of 0.1 is the upper limit of the linear response regime for this model Efield = np.array([E, 0, 0]) for p in system.part: p.ext_force = p.q * Efield system.part[:].v = (0, 0, 0) lb = espressomd.lb.LBFluidGPU(kT=temperature, seed=42, dens=1., visc=3., agrid=1., tau=system.time_step) system.actors.add(lb) system.thermostat.turn_off() system.thermostat.set_lb(LB_fluid=lb, seed=123, gamma=20.0) # Reset the simulation clock system.time = 0 initial_pos = system.part[0].pos num_iterations = 1000 num_steps_per_iteration = 1000 with open('posVsTime.dat', 'w') as f: # file where the raspberry trajectory will be written to for i in range(num_iterations): system.integrator.run(num_steps_per_iteration) pos = system.part[0].pos - initial_pos f.write("%.2f %.4f %.4f %.4f\n" % (system.time, pos[0], pos[1], pos[2])) print("# time: {:.0f} ({:.0f}%), col_pos: {}".format( system.time, (i + 1) * 100. / num_iterations, np.around(pos, 1), end='\r')) print("\n# Finished") import matplotlib.pyplot as plt from mpl_toolkits.mplot3d import Axes3D %matplotlib notebook trajectory_file = 'posVsTime.dat' trajectory = np.loadtxt(trajectory_file)[:, 1:4] # optional: trajectory smoothing with a running average N = 6 trajectory = np.array( [np.convolve(trajectory[:, i], np.ones((N,)) / N, mode='valid') for i in range(3)]) # calculate bounding box (cubic box to preserve scaling) trajectory_range = np.max(trajectory, axis=1) - np.min(trajectory, axis=1) mid_range = np.median(trajectory, axis=1) max_range = 1.01 * np.max(np.abs(trajectory_range)) bbox = np.array([mid_range - max_range / 2, mid_range + max_range / 2]) # 3D plot fig = plt.figure(figsize=(9, 6)) ax = fig.add_subplot(111, projection='3d') ax.set_xlabel('X axis') ax.set_ylabel('Y axis') ax.set_zlabel('Z axis') ax.set_xlim(*bbox[:, 0]) ax.set_ylim(*bbox[:, 1]) ax.set_zlim(*bbox[:, 2]) ax.text(*trajectory[:, 0], '\u2190 start', 'y') ax.scatter(*trajectory[:, 0]) ax.plot(*trajectory) plt.tight_layout() plt.rcParams.update({'font.size': 14}) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Model Type Step7: 1.4. Elemental Stoichiometry Step8: 1.5. Elemental Stoichiometry Details Step9: 1.6. Prognostic Variables Step10: 1.7. Diagnostic Variables Step11: 1.8. Damping Step12: 2. Key Properties --&gt; Time Stepping Framework --&gt; Passive Tracers Transport Step13: 2.2. Timestep If Not From Ocean Step14: 3. Key Properties --&gt; Time Stepping Framework --&gt; Biology Sources Sinks Step15: 3.2. Timestep If Not From Ocean Step16: 4. Key Properties --&gt; Transport Scheme Step17: 4.2. Scheme Step18: 4.3. Use Different Scheme Step19: 5. Key Properties --&gt; Boundary Forcing Step20: 5.2. River Input Step21: 5.3. Sediments From Boundary Conditions Step22: 5.4. Sediments From Explicit Model Step23: 6. Key Properties --&gt; Gas Exchange Step24: 6.2. CO2 Exchange Type Step25: 6.3. O2 Exchange Present Step26: 6.4. O2 Exchange Type Step27: 6.5. DMS Exchange Present Step28: 6.6. DMS Exchange Type Step29: 6.7. N2 Exchange Present Step30: 6.8. N2 Exchange Type Step31: 6.9. N2O Exchange Present Step32: 6.10. N2O Exchange Type Step33: 6.11. CFC11 Exchange Present Step34: 6.12. CFC11 Exchange Type Step35: 6.13. CFC12 Exchange Present Step36: 6.14. CFC12 Exchange Type Step37: 6.15. SF6 Exchange Present Step38: 6.16. SF6 Exchange Type Step39: 6.17. 13CO2 Exchange Present Step40: 6.18. 13CO2 Exchange Type Step41: 6.19. 14CO2 Exchange Present Step42: 6.20. 14CO2 Exchange Type Step43: 6.21. Other Gases Step44: 7. Key Properties --&gt; Carbon Chemistry Step45: 7.2. PH Scale Step46: 7.3. Constants If Not OMIP Step47: 8. Tracers Step48: 8.2. Sulfur Cycle Present Step49: 8.3. Nutrients Present Step50: 8.4. Nitrous Species If N Step51: 8.5. Nitrous Processes If N Step52: 9. Tracers --&gt; Ecosystem Step53: 9.2. Upper Trophic Levels Treatment Step54: 10. Tracers --&gt; Ecosystem --&gt; Phytoplankton Step55: 10.2. Pft Step56: 10.3. Size Classes Step57: 11. Tracers --&gt; Ecosystem --&gt; Zooplankton Step58: 11.2. Size Classes Step59: 12. Tracers --&gt; Disolved Organic Matter Step60: 12.2. Lability Step61: 13. Tracers --&gt; Particules Step62: 13.2. Types If Prognostic Step63: 13.3. Size If Prognostic Step64: 13.4. Size If Discrete Step65: 13.5. Sinking Speed If Prognostic Step66: 14. Tracers --&gt; Dic Alkalinity Step67: 14.2. Abiotic Carbon Step68: 14.3. Alkalinity
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'ncc', 'noresm2-mh', 'ocnbgchem') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.model_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Geochemical" # "NPZD" # "PFT" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.elemental_stoichiometry') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Fixed" # "Variable" # "Mix of both" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.elemental_stoichiometry_details') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.prognostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.diagnostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.damping') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.time_stepping_framework.passive_tracers_transport.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "use ocean model transport time step" # "use specific time step" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.time_stepping_framework.passive_tracers_transport.timestep_if_not_from_ocean') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.time_stepping_framework.biology_sources_sinks.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "use ocean model transport time step" # "use specific time step" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.time_stepping_framework.biology_sources_sinks.timestep_if_not_from_ocean') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.transport_scheme.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Offline" # "Online" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.transport_scheme.scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Use that of ocean model" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.transport_scheme.use_different_scheme') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.boundary_forcing.atmospheric_deposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "from file (climatology)" # "from file (interannual variations)" # "from Atmospheric Chemistry model" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.boundary_forcing.river_input') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "from file (climatology)" # "from file (interannual variations)" # "from Land Surface model" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.boundary_forcing.sediments_from_boundary_conditions') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.boundary_forcing.sediments_from_explicit_model') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.CO2_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.CO2_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "OMIP protocol" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.O2_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.O2_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "OMIP protocol" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.DMS_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.DMS_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.N2_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.N2_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.N2O_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.N2O_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.CFC11_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.CFC11_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.CFC12_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.CFC12_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.SF6_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.SF6_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.13CO2_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.13CO2_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.14CO2_exchange_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.14CO2_exchange_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.gas_exchange.other_gases') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.carbon_chemistry.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "OMIP protocol" # "Other protocol" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.carbon_chemistry.pH_scale') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Sea water" # "Free" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.key_properties.carbon_chemistry.constants_if_not_OMIP') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.sulfur_cycle_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.nutrients_present') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Nitrogen (N)" # "Phosphorous (P)" # "Silicium (S)" # "Iron (Fe)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.nitrous_species_if_N') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Nitrates (NO3)" # "Amonium (NH4)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.nitrous_processes_if_N') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Dentrification" # "N fixation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.upper_trophic_levels_definition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.upper_trophic_levels_treatment') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.phytoplankton.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "None" # "Generic" # "PFT including size based (specify both below)" # "Size based only (specify below)" # "PFT only (specify below)" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.phytoplankton.pft') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Diatoms" # "Nfixers" # "Calcifiers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.phytoplankton.size_classes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Microphytoplankton" # "Nanophytoplankton" # "Picophytoplankton" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.zooplankton.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "None" # "Generic" # "Size based (specify below)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.ecosystem.zooplankton.size_classes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Microzooplankton" # "Mesozooplankton" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.disolved_organic_matter.bacteria_present') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.disolved_organic_matter.lability') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "None" # "Labile" # "Semi-labile" # "Refractory" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.particules.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Diagnostic" # "Diagnostic (Martin profile)" # "Diagnostic (Balast)" # "Prognostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.particules.types_if_prognostic') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "POC" # "PIC (calcite)" # "PIC (aragonite" # "BSi" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.particules.size_if_prognostic') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "No size spectrum used" # "Full size spectrum" # "Discrete size classes (specify which below)" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.particules.size_if_discrete') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.particules.sinking_speed_if_prognostic') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Constant" # "Function of particule size" # "Function of particule type (balast)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.dic_alkalinity.carbon_isotopes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "C13" # "C14)" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.dic_alkalinity.abiotic_carbon') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.ocnbgchem.tracers.dic_alkalinity.alkalinity') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Prognostic" # "Diagnostic)" # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Select data Step2: Train models
<ASSISTANT_TASK:> Python Code: import os import warnings import tqdm import numpy as np import pandas as pd warnings.simplefilter(action='ignore', category=pd.errors.PerformanceWarning) %load_ext autoreload %autoreload 2 import socceraction.spadl as spadl import socceraction.vaep.features as fs import socceraction.vaep.labels as lab # Configure file and folder names datafolder = "../data-fifa" spadl_h5 = os.path.join(datafolder, "spadl-statsbomb.h5") features_h5 = os.path.join(datafolder, "features.h5") labels_h5 = os.path.join(datafolder, "labels.h5") predictions_h5 = os.path.join(datafolder, "predictions.h5") # Create a train and test set of games games = pd.read_hdf(spadl_h5, "games") traingames = games[:len(games)//2] testgames = games[len(games)//2:] print(len(traingames), len(testgames)) # Select shots from the data and all available info about these shots def get_shots(games): shots = [] with pd.HDFStore(spadl_h5) as spadlstore,\ pd.HDFStore(features_h5) as featurestore: for game_id in tqdm.tqdm(games.game_id, desc="Selecting features"): ai = spadl.add_names(spadlstore[f"actions/game_{game_id}"]) shot_idx = ai.type_name.str.contains("shot") Xi = featurestore[f"game_{game_id}"] shots.append(Xi[shot_idx]) return pd.concat(shots) train_shots = get_shots(traingames) test_shots = get_shots(testgames) # Decide which features to use to compute the expected goals value of the shots from re import match xfns = [ fs.actiontype_onehot, fs.bodypart_onehot, fs.startlocation, fs.movement, fs.space_delta, fs.startpolar, fs.team, ] nb_prev_actions = 2 f = fs.feature_column_names(xfns, nb_prev_actions) f = list(filter(lambda v: not match('type_[a-z_]+_a0', v), f)) f.remove("dx_a0") f.remove("dy_a0") f.remove("movement_a0") f # Create features-matrix X and label-vector y. from sklearn.linear_model import LogisticRegression from sklearn.metrics import roc_auc_score, brier_score_loss, log_loss from xgboost import XGBClassifier def Xy(f,shots): return shots[f], shots.result_success_a0 # Logistic regression X,y = Xy(f, train_shots) model = LogisticRegression().fit(X, y) X,y = Xy(f, test_shots) pred = [p[1] for p in model.predict_proba(X)] print("ROC AUC: %.3f" % roc_auc_score(y, pred)) print("Brier score: %.3f" % brier_score_loss(y, pred)) print("Log loss: %.3f" % log_loss(y, pred)) # XGBoost X,y = Xy(f, train_shots) model = XGBClassifier().fit(X, y) X,y = Xy(f, test_shots) pred = [p[1] for p in model.predict_proba(X)] print("ROC AUC: %.3f" % roc_auc_score(y, pred)) print("Brier score: %.3f" % brier_score_loss(y, pred)) print("Log loss: %.3f" % log_loss(y, pred)) # Naive baseline, always predict class distribution X,y = Xy(f, train_shots) avgP = np.mean(y) X,y = Xy(f, test_shots) pred = [avgP for _i in y] print("ROC AUC: %.3f" % roc_auc_score(y, pred)) print("Brier score: %.3f" % brier_score_loss(y, pred)) print("Log loss: %.3f" % log_loss(y, pred)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: <h2> 1. Refactor the input </h2> Step2: <h2> 2. Refactor the way features are created. </h2> Step3: <h2> Create and train the model </h2> Step4: <h3> Evaluate model </h3>
<ASSISTANT_TASK:> Python Code: !sudo chown -R jupyter:jupyter /home/jupyter/training-data-analyst # Ensure the right version of Tensorflow is installed. !pip freeze | grep tensorflow==2.5 from google.cloud import bigquery import tensorflow as tf import numpy as np import shutil print(tf.__version__) CSV_COLUMNS = ['fare_amount', 'pickuplon','pickuplat','dropofflon','dropofflat','passengers', 'key'] DEFAULTS = [[0.0], [-74.0], [40.0], [-74.0], [40.7], [1.0], ['nokey']] # TODO: Create an appropriate input function read_dataset def read_dataset(filename, mode): #TODO Add CSV decoder function and dataset creation and methods return dataset def get_train_input_fn(): return read_dataset('./taxi-train.csv', mode = tf.estimator.ModeKeys.TRAIN) def get_valid_input_fn(): return read_dataset('./taxi-valid.csv', mode = tf.estimator.ModeKeys.EVAL) INPUT_COLUMNS = [ tf.feature_column.numeric_column('pickuplon'), tf.feature_column.numeric_column('pickuplat'), tf.feature_column.numeric_column('dropofflat'), tf.feature_column.numeric_column('dropofflon'), tf.feature_column.numeric_column('passengers'), ] def add_more_features(feats): # Nothing to add (yet!) return feats feature_cols = add_more_features(INPUT_COLUMNS) tf.compat.v1.logging.set_verbosity(tf.compat.v1.logging.INFO) OUTDIR = 'taxi_trained' shutil.rmtree(OUTDIR, ignore_errors = True) # start fresh each time model = tf.compat.v1.estimator.LinearRegressor( feature_columns = feature_cols, model_dir = OUTDIR) model.train(input_fn = get_train_input_fn, steps = 200) metrics = model.evaluate(input_fn = get_valid_input_fn, steps = None) print('RMSE on dataset = {}'.format(np.sqrt(metrics['average_loss']))) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Allow the Cloud ML Engine service account to read/write to the bucket containing training data. Step2: <h2> Packaging up the code </h2> Step3: <h2> Find absolute paths to your data </h2> Step4: <h2> Running the Python module from the command-line </h2> Step5: <h2> Running locally using gcloud </h2> Step6: When I ran it (due to random seeds, your results will be different), the average_loss (Mean Squared Error) on the evaluation dataset was 187, meaning that the RMSE was around 13. Step7: <h2> Submit training job using gcloud </h2> Step8: Don't be concerned if the notebook appears stalled (with a blue progress bar) or returns with an error about being unable to refresh auth tokens. This is a long-lived Cloud job and work is going on in the cloud. Step9: <h2> Prediction </h2> Step10: <h2> Train on larger dataset </h2>
<ASSISTANT_TASK:> Python Code: import os PROJECT = 'cloud-training-demos' # REPLACE WITH YOUR PROJECT ID REGION = 'us-central1' # Choose an available region for Cloud MLE from https://cloud.google.com/ml-engine/docs/regions. BUCKET = 'cloud-training-demos-ml' # REPLACE WITH YOUR BUCKET NAME. Use a regional bucket in the region you selected. # for bash os.environ['PROJECT'] = PROJECT os.environ['BUCKET'] = BUCKET os.environ['REGION'] = REGION os.environ['TFVERSION'] = '2.1' # Tensorflow version %%bash gcloud config set project $PROJECT gcloud config set compute/region $REGION %%bash PROJECT_ID=$PROJECT AUTH_TOKEN=$(gcloud auth print-access-token) SVC_ACCOUNT=$(curl -X GET -H "Content-Type: application/json" \ -H "Authorization: Bearer $AUTH_TOKEN" \ https://ml.googleapis.com/v1/projects/${PROJECT_ID}:getConfig \ | python -c "import json; import sys; response = json.load(sys.stdin); \ print(response['serviceAccount'])") echo "Authorizing the Cloud ML Service account $SVC_ACCOUNT to access files in $BUCKET" gsutil -m defacl ch -u $SVC_ACCOUNT:R gs://$BUCKET gsutil -m acl ch -u $SVC_ACCOUNT:R -r gs://$BUCKET # error message (if bucket is empty) can be ignored gsutil -m acl ch -u $SVC_ACCOUNT:W gs://$BUCKET !find taxifare !cat taxifare/trainer/model.py %%bash echo $PWD rm -rf $PWD/taxi_trained cp $PWD/../tensorflow/taxi-train.csv . cp $PWD/../tensorflow/taxi-valid.csv . head -1 $PWD/taxi-train.csv head -1 $PWD/taxi-valid.csv %%bash rm -rf taxifare.tar.gz taxi_trained export PYTHONPATH=${PYTHONPATH}:${PWD}/taxifare python -m trainer.task \ --train_data_paths="${PWD}/taxi-train*" \ --eval_data_paths=${PWD}/taxi-valid.csv \ --output_dir=${PWD}/taxi_trained \ --train_steps=1000 --job-dir=./tmp %%bash ls $PWD/taxi_trained/export/exporter/ %%writefile ./test.json {"pickuplon": -73.885262,"pickuplat": 40.773008,"dropofflon": -73.987232,"dropofflat": 40.732403,"passengers": 2} ## local predict doesn't work with Python 3 yet #%bash #model_dir=$(ls ${PWD}/taxi_trained/export/exporter) #gcloud ai-platform local predict \ # --model-dir=${PWD}/taxi_trained/export/exporter/${model_dir} \ # --json-instances=./test.json %%bash rm -rf taxifare.tar.gz taxi_trained gcloud ai-platform local train \ --module-name=trainer.task \ --package-path=${PWD}/taxifare/trainer \ -- \ --train_data_paths=${PWD}/taxi-train.csv \ --eval_data_paths=${PWD}/taxi-valid.csv \ --train_steps=1000 \ --output_dir=${PWD}/taxi_trained !ls $PWD/taxi_trained %%bash echo $BUCKET gsutil -m rm -rf gs://${BUCKET}/taxifare/smallinput/ gsutil -m cp ${PWD}/*.csv gs://${BUCKET}/taxifare/smallinput/ %%bash OUTDIR=gs://${BUCKET}/taxifare/smallinput/taxi_trained JOBNAME=lab3a_$(date -u +%y%m%d_%H%M%S) echo $OUTDIR $REGION $JOBNAME gsutil -m rm -rf $OUTDIR gcloud ai-platform jobs submit training $JOBNAME \ --region=$REGION \ --module-name=trainer.task \ --package-path=${PWD}/taxifare/trainer \ --job-dir=$OUTDIR \ --staging-bucket=gs://$BUCKET \ --scale-tier=BASIC \ --runtime-version=2.1 \ --python-version=3.7 \ -- \ --train_data_paths="gs://${BUCKET}/taxifare/smallinput/taxi-train*" \ --eval_data_paths="gs://${BUCKET}/taxifare/smallinput/taxi-valid*" \ --output_dir=$OUTDIR \ --train_steps=10000 %%bash gsutil cp -r ${PWD}/taxi_trained gs://${BUCKET}/taxifare/smallinput/ gsutil ls gs://${BUCKET}/taxifare/smallinput/taxi_trained/export/exporter %%bash MODEL_NAME="taxifare" MODEL_VERSION="v1" MODEL_LOCATION=$(gsutil ls gs://${BUCKET}/taxifare/smallinput/taxi_trained/export/exporter | tail -1) echo "Run these commands one-by-one (the very first time, you'll create a model and then create a version)" #gcloud ai-platform versions delete ${MODEL_VERSION} --model ${MODEL_NAME} #gcloud ai-platform models delete ${MODEL_NAME} gcloud ai-platform models create ${MODEL_NAME} --regions $REGION gcloud ai-platform versions create ${MODEL_VERSION} --model ${MODEL_NAME} --origin ${MODEL_LOCATION} --runtime-version $TFVERSION --region global %%bash gcloud ai-platform predict --model=taxifare --version=v1 --json-instances=./test.json from googleapiclient import discovery from oauth2client.client import GoogleCredentials import json credentials = GoogleCredentials.get_application_default() api = discovery.build('ml', 'v1', credentials=credentials, discoveryServiceUrl='https://storage.googleapis.com/cloud-ml/discovery/ml_v1_discovery.json') request_data = {'instances': [ { 'pickuplon': -73.885262, 'pickuplat': 40.773008, 'dropofflon': -73.987232, 'dropofflat': 40.732403, 'passengers': 2, } ] } parent = 'projects/%s/models/%s/versions/%s' % (PROJECT, 'taxifare', 'v1') response = api.projects().predict(body=request_data, name=parent).execute() print("response={0}".format(response)) %%bash XXXXX this takes 60 minutes. if you are sure you want to run it, then remove this line. OUTDIR=gs://${BUCKET}/taxifare/ch3/taxi_trained JOBNAME=lab3a_$(date -u +%y%m%d_%H%M%S) CRS_BUCKET=cloud-training-demos # use the already exported data echo $OUTDIR $REGION $JOBNAME gsutil -m rm -rf $OUTDIR gcloud ai-platform jobs submit training $JOBNAME \ --region=$REGION \ --module-name=trainer.task \ --package-path=${PWD}/taxifare/trainer \ --job-dir=$OUTDIR \ --staging-bucket=gs://$BUCKET \ --scale-tier=STANDARD_1 \ --runtime-version=2.1 \ --python-version=3.7 \ -- \ --train_data_paths="gs://${CRS_BUCKET}/taxifare/ch3/train.csv" \ --eval_data_paths="gs://${CRS_BUCKET}/taxifare/ch3/valid.csv" \ --output_dir=$OUTDIR \ --train_steps=100000 <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description:
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np l = [('A', 'a', '1'), ('A', 'b', '2'), ('B','a', '1'), ('A', 'b', '1'), ('B','b', '1'), ('A', 'a', '2')] np.random.seed(1) df = pd.DataFrame(np.random.randn(5, 6), columns=l) def g(df): df=df[sorted(df.columns.to_list())] df.columns = pd.MultiIndex.from_tuples(df.columns, names=['Caps','Middle','Lower']) return df df = g(df.copy()) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Fully-Connected Neural Nets Step4: Affine layer Step5: Affine layer Step6: ReLU layer Step7: ReLU layer Step8: "Sandwich" layers Step9: Loss layers Step10: Two-layer network Step11: Solver Step12: Multilayer network Step13: As another sanity check, make sure you can overfit a small dataset of 50 images. First we will try a three-layer network with 100 units in each hidden layer. You will need to tweak the learning rate and initialization scale, but you should be able to overfit and achieve 100% training accuracy within 20 epochs. Step14: Now try to use a five-layer network with 100 units on each layer to overfit 50 training examples. Again you will have to adjust the learning rate and weight initialization, but you should be able to achieve 100% training accuracy within 20 epochs. Step15: Inline question Step16: Once you have done so, run the following to train a six-layer network with both SGD and SGD+momentum. You should see the SGD+momentum update rule converge faster. Step17: RMSProp and Adam Step18: Once you have debugged your RMSProp and Adam implementations, run the following to train a pair of deep networks using these new update rules Step19: Train a good model! Step20: Test you model
<ASSISTANT_TASK:> Python Code: # As usual, a bit of setup import time import numpy as np import matplotlib.pyplot as plt from cs231n.classifiers.fc_net import * from cs231n.data_utils import get_CIFAR10_data from cs231n.gradient_check import eval_numerical_gradient, eval_numerical_gradient_array from cs231n.solver import Solver %matplotlib inline plt.rcParams['figure.figsize'] = (10.0, 8.0) # set default size of plots plt.rcParams['image.interpolation'] = 'nearest' plt.rcParams['image.cmap'] = 'gray' # for auto-reloading external modules # see http://stackoverflow.com/questions/1907993/autoreload-of-modules-in-ipython %load_ext autoreload %autoreload 2 def rel_error(x, y): returns relative error return np.max(np.abs(x - y) / (np.maximum(1e-8, np.abs(x) + np.abs(y)))) # Load the (preprocessed) CIFAR10 data. data = get_CIFAR10_data() for k, v in data.iteritems(): print '%s: ' % k, v.shape # Test the affine_forward function num_inputs = 2 input_shape = (4, 5, 6) output_dim = 3 input_size = num_inputs * np.prod(input_shape) weight_size = output_dim * np.prod(input_shape) x = np.linspace(-0.1, 0.5, num=input_size).reshape(num_inputs, *input_shape) w = np.linspace(-0.2, 0.3, num=weight_size).reshape(np.prod(input_shape), output_dim) b = np.linspace(-0.3, 0.1, num=output_dim) out, _ = affine_forward(x, w, b) correct_out = np.array([[ 1.49834967, 1.70660132, 1.91485297], [ 3.25553199, 3.5141327, 3.77273342]]) # Compare your output with ours. The error should be around 1e-9. print 'Testing affine_forward function:' print 'difference: ', rel_error(out, correct_out) # Test the affine_backward function x = np.random.randn(10, 2, 3) w = np.random.randn(6, 5) b = np.random.randn(5) dout = np.random.randn(10, 5) dx_num = eval_numerical_gradient_array(lambda x: affine_forward(x, w, b)[0], x, dout) dw_num = eval_numerical_gradient_array(lambda w: affine_forward(x, w, b)[0], w, dout) db_num = eval_numerical_gradient_array(lambda b: affine_forward(x, w, b)[0], b, dout) _, cache = affine_forward(x, w, b) dx, dw, db = affine_backward(dout, cache) # The error should be around 1e-10 print 'Testing affine_backward function:' print 'dx error: ', rel_error(dx_num, dx) print 'dw error: ', rel_error(dw_num, dw) print 'db error: ', rel_error(db_num, db) # Test the relu_forward function x = np.linspace(-0.5, 0.5, num=12).reshape(3, 4) out, _ = relu_forward(x) correct_out = np.array([[ 0., 0., 0., 0., ], [ 0., 0., 0.04545455, 0.13636364,], [ 0.22727273, 0.31818182, 0.40909091, 0.5, ]]) # Compare your output with ours. The error should be around 1e-8 print 'Testing relu_forward function:' print 'difference: ', rel_error(out, correct_out) x = np.random.randn(10, 10) dout = np.random.randn(*x.shape) dx_num = eval_numerical_gradient_array(lambda x: relu_forward(x)[0], x, dout) _, cache = relu_forward(x) dx = relu_backward(dout, cache) # The error should be around 1e-12 print 'Testing relu_backward function:' print 'dx error: ', rel_error(dx_num, dx) from cs231n.layer_utils import affine_relu_forward, affine_relu_backward x = np.random.randn(2, 3, 4) w = np.random.randn(12, 10) b = np.random.randn(10) dout = np.random.randn(2, 10) out, cache = affine_relu_forward(x, w, b) dx, dw, db = affine_relu_backward(dout, cache) dx_num = eval_numerical_gradient_array(lambda x: affine_relu_forward(x, w, b)[0], x, dout) dw_num = eval_numerical_gradient_array(lambda w: affine_relu_forward(x, w, b)[0], w, dout) db_num = eval_numerical_gradient_array(lambda b: affine_relu_forward(x, w, b)[0], b, dout) print 'Testing affine_relu_forward:' print 'dx error: ', rel_error(dx_num, dx) print 'dw error: ', rel_error(dw_num, dw) print 'db error: ', rel_error(db_num, db) num_classes, num_inputs = 10, 50 x = 0.001 * np.random.randn(num_inputs, num_classes) y = np.random.randint(num_classes, size=num_inputs) dx_num = eval_numerical_gradient(lambda x: svm_loss(x, y)[0], x, verbose=False) loss, dx = svm_loss(x, y) # Test svm_loss function. Loss should be around 9 and dx error should be 1e-9 print 'Testing svm_loss:' print 'loss: ', loss print 'dx error: ', rel_error(dx_num, dx) dx_num = eval_numerical_gradient(lambda x: softmax_loss(x, y)[0], x, verbose=False) loss, dx = softmax_loss(x, y) # Test softmax_loss function. Loss should be 2.3 and dx error should be 1e-8 print '\nTesting softmax_loss:' print 'loss: ', loss print 'dx error: ', rel_error(dx_num, dx) N, D, H, C = 3, 5, 50, 7 X = np.random.randn(N, D) y = np.random.randint(C, size=N) std = 1e-2 model = TwoLayerNet(input_dim=D, hidden_dim=H, num_classes=C, weight_scale=std) print 'Testing initialization ... ' W1_std = abs(model.params['W1'].std() - std) b1 = model.params['b1'] W2_std = abs(model.params['W2'].std() - std) b2 = model.params['b2'] assert W1_std < std / 10, 'First layer weights do not seem right' assert np.all(b1 == 0), 'First layer biases do not seem right' assert W2_std < std / 10, 'Second layer weights do not seem right' assert np.all(b2 == 0), 'Second layer biases do not seem right' print 'Testing test-time forward pass ... ' model.params['W1'] = np.linspace(-0.7, 0.3, num=D*H).reshape(D, H) model.params['b1'] = np.linspace(-0.1, 0.9, num=H) model.params['W2'] = np.linspace(-0.3, 0.4, num=H*C).reshape(H, C) model.params['b2'] = np.linspace(-0.9, 0.1, num=C) X = np.linspace(-5.5, 4.5, num=N*D).reshape(D, N).T scores = model.loss(X) correct_scores = np.asarray( [[11.53165108, 12.2917344, 13.05181771, 13.81190102, 14.57198434, 15.33206765, 16.09215096], [12.05769098, 12.74614105, 13.43459113, 14.1230412, 14.81149128, 15.49994135, 16.18839143], [12.58373087, 13.20054771, 13.81736455, 14.43418138, 15.05099822, 15.66781506, 16.2846319 ]]) scores_diff = np.abs(scores - correct_scores).sum() assert scores_diff < 1e-6, 'Problem with test-time forward pass' print 'Testing training loss (no regularization)' y = np.asarray([0, 5, 1]) loss, grads = model.loss(X, y) correct_loss = 3.4702243556 assert abs(loss - correct_loss) < 1e-10, 'Problem with training-time loss' model.reg = 1.0 loss, grads = model.loss(X, y) correct_loss = 26.5948426952 assert abs(loss - correct_loss) < 1e-10, 'Problem with regularization loss' for reg in [0.0, 0.7]: print 'Running numeric gradient check with reg = ', reg model.reg = reg loss, grads = model.loss(X, y) for name in sorted(grads): f = lambda _: model.loss(X, y)[0] grad_num = eval_numerical_gradient(f, model.params[name], verbose=False) print '%s relative error: %.2e' % (name, rel_error(grad_num, grads[name])) model = TwoLayerNet() solver = None ############################################################################## # TODO: Use a Solver instance to train a TwoLayerNet that achieves at least # # 50% accuracy on the validation set. # ############################################################################## pass ############################################################################## # END OF YOUR CODE # ############################################################################## # Run this cell to visualize training loss and train / val accuracy plt.subplot(2, 1, 1) plt.title('Training loss') plt.plot(solver.loss_history, 'o') plt.xlabel('Iteration') plt.subplot(2, 1, 2) plt.title('Accuracy') plt.plot(solver.train_acc_history, '-o', label='train') plt.plot(solver.val_acc_history, '-o', label='val') plt.plot([0.5] * len(solver.val_acc_history), 'k--') plt.xlabel('Epoch') plt.legend(loc='lower right') plt.gcf().set_size_inches(15, 12) plt.show() N, D, H1, H2, C = 2, 15, 20, 30, 10 X = np.random.randn(N, D) y = np.random.randint(C, size=(N,)) for reg in [0, 3.14]: print 'Running check with reg = ', reg model = FullyConnectedNet([H1, H2], input_dim=D, num_classes=C, reg=reg, weight_scale=5e-2, dtype=np.float64) loss, grads = model.loss(X, y) print 'Initial loss: ', loss for name in sorted(grads): f = lambda _: model.loss(X, y)[0] grad_num = eval_numerical_gradient(f, model.params[name], verbose=False, h=1e-5) print '%s relative error: %.2e' % (name, rel_error(grad_num, grads[name])) # TODO: Use a three-layer Net to overfit 50 training examples. num_train = 50 small_data = { 'X_train': data['X_train'][:num_train], 'y_train': data['y_train'][:num_train], 'X_val': data['X_val'], 'y_val': data['y_val'], } weight_scale = 1e-2 learning_rate = 1e-4 model = FullyConnectedNet([100, 100], weight_scale=weight_scale, dtype=np.float64) solver = Solver(model, small_data, print_every=10, num_epochs=20, batch_size=25, update_rule='sgd', optim_config={ 'learning_rate': learning_rate, } ) solver.train() plt.plot(solver.loss_history, 'o') plt.title('Training loss history') plt.xlabel('Iteration') plt.ylabel('Training loss') plt.show() # TODO: Use a five-layer Net to overfit 50 training examples. num_train = 50 small_data = { 'X_train': data['X_train'][:num_train], 'y_train': data['y_train'][:num_train], 'X_val': data['X_val'], 'y_val': data['y_val'], } learning_rate = 1e-3 weight_scale = 1e-5 model = FullyConnectedNet([100, 100, 100, 100], weight_scale=weight_scale, dtype=np.float64) solver = Solver(model, small_data, print_every=10, num_epochs=20, batch_size=25, update_rule='sgd', optim_config={ 'learning_rate': learning_rate, } ) solver.train() plt.plot(solver.loss_history, 'o') plt.title('Training loss history') plt.xlabel('Iteration') plt.ylabel('Training loss') plt.show() from cs231n.optim import sgd_momentum N, D = 4, 5 w = np.linspace(-0.4, 0.6, num=N*D).reshape(N, D) dw = np.linspace(-0.6, 0.4, num=N*D).reshape(N, D) v = np.linspace(0.6, 0.9, num=N*D).reshape(N, D) config = {'learning_rate': 1e-3, 'velocity': v} next_w, _ = sgd_momentum(w, dw, config=config) expected_next_w = np.asarray([ [ 0.1406, 0.20738947, 0.27417895, 0.34096842, 0.40775789], [ 0.47454737, 0.54133684, 0.60812632, 0.67491579, 0.74170526], [ 0.80849474, 0.87528421, 0.94207368, 1.00886316, 1.07565263], [ 1.14244211, 1.20923158, 1.27602105, 1.34281053, 1.4096 ]]) expected_velocity = np.asarray([ [ 0.5406, 0.55475789, 0.56891579, 0.58307368, 0.59723158], [ 0.61138947, 0.62554737, 0.63970526, 0.65386316, 0.66802105], [ 0.68217895, 0.69633684, 0.71049474, 0.72465263, 0.73881053], [ 0.75296842, 0.76712632, 0.78128421, 0.79544211, 0.8096 ]]) print 'next_w error: ', rel_error(next_w, expected_next_w) print 'velocity error: ', rel_error(expected_velocity, config['velocity']) num_train = 4000 small_data = { 'X_train': data['X_train'][:num_train], 'y_train': data['y_train'][:num_train], 'X_val': data['X_val'], 'y_val': data['y_val'], } solvers = {} for update_rule in ['sgd', 'sgd_momentum']: print 'running with ', update_rule model = FullyConnectedNet([100, 100, 100, 100, 100], weight_scale=5e-2) solver = Solver(model, small_data, num_epochs=5, batch_size=100, update_rule=update_rule, optim_config={ 'learning_rate': 1e-2, }, verbose=True) solvers[update_rule] = solver solver.train() print plt.subplot(3, 1, 1) plt.title('Training loss') plt.xlabel('Iteration') plt.subplot(3, 1, 2) plt.title('Training accuracy') plt.xlabel('Epoch') plt.subplot(3, 1, 3) plt.title('Validation accuracy') plt.xlabel('Epoch') for update_rule, solver in solvers.iteritems(): plt.subplot(3, 1, 1) plt.plot(solver.loss_history, 'o', label=update_rule) plt.subplot(3, 1, 2) plt.plot(solver.train_acc_history, '-o', label=update_rule) plt.subplot(3, 1, 3) plt.plot(solver.val_acc_history, '-o', label=update_rule) for i in [1, 2, 3]: plt.subplot(3, 1, i) plt.legend(loc='upper center', ncol=4) plt.gcf().set_size_inches(15, 15) plt.show() # Test RMSProp implementation; you should see errors less than 1e-7 from cs231n.optim import rmsprop N, D = 4, 5 w = np.linspace(-0.4, 0.6, num=N*D).reshape(N, D) dw = np.linspace(-0.6, 0.4, num=N*D).reshape(N, D) cache = np.linspace(0.6, 0.9, num=N*D).reshape(N, D) config = {'learning_rate': 1e-2, 'cache': cache} next_w, _ = rmsprop(w, dw, config=config) expected_next_w = np.asarray([ [-0.39223849, -0.34037513, -0.28849239, -0.23659121, -0.18467247], [-0.132737, -0.08078555, -0.02881884, 0.02316247, 0.07515774], [ 0.12716641, 0.17918792, 0.23122175, 0.28326742, 0.33532447], [ 0.38739248, 0.43947102, 0.49155973, 0.54365823, 0.59576619]]) expected_cache = np.asarray([ [ 0.5976, 0.6126277, 0.6277108, 0.64284931, 0.65804321], [ 0.67329252, 0.68859723, 0.70395734, 0.71937285, 0.73484377], [ 0.75037008, 0.7659518, 0.78158892, 0.79728144, 0.81302936], [ 0.82883269, 0.84469141, 0.86060554, 0.87657507, 0.8926 ]]) print 'next_w error: ', rel_error(expected_next_w, next_w) print 'cache error: ', rel_error(expected_cache, config['cache']) # Test Adam implementation; you should see errors around 1e-7 or less from cs231n.optim import adam N, D = 4, 5 w = np.linspace(-0.4, 0.6, num=N*D).reshape(N, D) dw = np.linspace(-0.6, 0.4, num=N*D).reshape(N, D) m = np.linspace(0.6, 0.9, num=N*D).reshape(N, D) v = np.linspace(0.7, 0.5, num=N*D).reshape(N, D) config = {'learning_rate': 1e-2, 'm': m, 'v': v, 't': 5} next_w, _ = adam(w, dw, config=config) expected_next_w = np.asarray([ [-0.40094747, -0.34836187, -0.29577703, -0.24319299, -0.19060977], [-0.1380274, -0.08544591, -0.03286534, 0.01971428, 0.0722929], [ 0.1248705, 0.17744702, 0.23002243, 0.28259667, 0.33516969], [ 0.38774145, 0.44031188, 0.49288093, 0.54544852, 0.59801459]]) expected_v = np.asarray([ [ 0.69966, 0.68908382, 0.67851319, 0.66794809, 0.65738853,], [ 0.64683452, 0.63628604, 0.6257431, 0.61520571, 0.60467385,], [ 0.59414753, 0.58362676, 0.57311152, 0.56260183, 0.55209767,], [ 0.54159906, 0.53110598, 0.52061845, 0.51013645, 0.49966, ]]) expected_m = np.asarray([ [ 0.48, 0.49947368, 0.51894737, 0.53842105, 0.55789474], [ 0.57736842, 0.59684211, 0.61631579, 0.63578947, 0.65526316], [ 0.67473684, 0.69421053, 0.71368421, 0.73315789, 0.75263158], [ 0.77210526, 0.79157895, 0.81105263, 0.83052632, 0.85 ]]) print 'next_w error: ', rel_error(expected_next_w, next_w) print 'v error: ', rel_error(expected_v, config['v']) print 'm error: ', rel_error(expected_m, config['m']) learning_rates = {'rmsprop': 1e-4, 'adam': 1e-3} for update_rule in ['adam', 'rmsprop']: print 'running with ', update_rule model = FullyConnectedNet([100, 100, 100, 100, 100], weight_scale=5e-2) solver = Solver(model, small_data, num_epochs=5, batch_size=100, update_rule=update_rule, optim_config={ 'learning_rate': learning_rates[update_rule] }, verbose=True) solvers[update_rule] = solver solver.train() print plt.subplot(3, 1, 1) plt.title('Training loss') plt.xlabel('Iteration') plt.subplot(3, 1, 2) plt.title('Training accuracy') plt.xlabel('Epoch') plt.subplot(3, 1, 3) plt.title('Validation accuracy') plt.xlabel('Epoch') for update_rule, solver in solvers.iteritems(): plt.subplot(3, 1, 1) plt.plot(solver.loss_history, 'o', label=update_rule) plt.subplot(3, 1, 2) plt.plot(solver.train_acc_history, '-o', label=update_rule) plt.subplot(3, 1, 3) plt.plot(solver.val_acc_history, '-o', label=update_rule) for i in [1, 2, 3]: plt.subplot(3, 1, i) plt.legend(loc='upper center', ncol=4) plt.gcf().set_size_inches(15, 15) plt.show() best_model = None ################################################################################ # TODO: Train the best FullyConnectedNet that you can on CIFAR-10. You might # # batch normalization and dropout useful. Store your best model in the # # best_model variable. # ################################################################################ pass ################################################################################ # END OF YOUR CODE # ################################################################################ y_test_pred = np.argmax(best_model.loss(X_test), axis=1) y_val_pred = np.argmax(best_model.loss(X_val), axis=1) print 'Validation set accuracy: ', (y_val_pred == y_val).mean() print 'Test set accuracy: ', (y_test_pred == y_test).mean() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Operations on Tensors Step2: Point-wise operations Step3: NumPy Interoperability Step4: You can convert a native TF tensor to a NumPy array using .numpy() Step5: Linear Regression Step6: Let's also create a test dataset to evaluate our models Step7: Loss Function Step8: Using mean squared error, our loss is Step9: This values for the MSE loss above will give us a baseline to compare how a more complex model is doing. Step10: Gradient Function Step11: Training Loop Step12: Now let's compare the test loss for this linear regression to the test loss from the baseline model that outputs always the mean of the training set Step13: This is indeed much better!
<ASSISTANT_TASK:> Python Code: !sudo chown -R jupyter:jupyter /home/jupyter/training-data-analyst # Ensure the right version of Tensorflow is installed. !pip freeze | grep tensorflow==2.1 || pip install tensorflow==2.1 import numpy as np import tensorflow as tf from matplotlib import pyplot as plt print(tf.__version__) x = tf.constant([2, 3, 4]) x x = tf.Variable(2.0, dtype=tf.float32, name="my_variable") x.assign(45.8) x x.assign_add(4) x x.assign_sub(3) x # TODO 1a a = # TODO -- Your code here. b = # TODO -- Your code here. c = # TODO -- Your code here. d = # TODO -- Your code here. print("c:", c) print("d:", d) # TODO 1b a = # TODO -- Your code here. b = # TODO -- Your code here. c = # TODO -- Your code here. d = # TODO -- Your code here. print("c:", c) print("d:", d) # TODO 1c # tf.math.exp expects floats so we need to explicitly give the type a = # TODO -- Your code here. b = # TODO -- Your code here. print("b:", b) # native python list a_py = [1, 2] b_py = [3, 4] tf.add(a_py, b_py) # numpy arrays a_np = np.array([1, 2]) b_np = np.array([3, 4]) tf.add(a_np, b_np) # native TF tensor a_tf = tf.constant([1, 2]) b_tf = tf.constant([3, 4]) tf.add(a_tf, b_tf) a_tf.numpy() X = tf.constant(range(10), dtype=tf.float32) Y = 2 * X + 10 print(f"X:{X}") print(f"Y:{Y}") X_test = tf.constant(range(10, 20), dtype=tf.float32) Y_test = 2 * X_test + 10 print(f"X_test:{X_test}") print(f"Y_test:{Y_test}") y_mean = Y.numpy().mean() def predict_mean(X): y_hat = [y_mean] * len(X) return y_hat Y_hat = predict_mean(X_test) errors = (Y_hat - Y) ** 2 loss = tf.reduce_mean(errors) loss.numpy() def loss_mse(X, Y, w0, w1): Y_hat = w0 * X + w1 errors = (Y_hat - Y) ** 2 return tf.reduce_mean(errors) # TODO 2 def compute_gradients(X, Y, w0, w1): # TODO -- Your code here. w0 = tf.Variable(0.0) w1 = tf.Variable(0.0) dw0, dw1 = compute_gradients(X, Y, w0, w1) print("dw0:", dw0.numpy()) print("dw1", dw1.numpy()) # TODO 3 STEPS = 1000 LEARNING_RATE = .02 MSG = "STEP {step} - loss: {loss}, w0: {w0}, w1: {w1}\n" w0 = tf.Variable(0.0) w1 = tf.Variable(0.0) for step in range(0, STEPS + 1): dw0, dw1 = # TODO -- Your code here. if step % 100 == 0: loss = # TODO -- Your code here. print(MSG.format(step=step, loss=loss, w0=w0.numpy(), w1=w1.numpy())) loss = loss_mse(X_test, Y_test, w0, w1) loss.numpy() X = tf.constant(np.linspace(0, 2, 1000), dtype=tf.float32) Y = X * tf.exp(-(X**2)) %matplotlib inline plt.plot(X, Y) def make_features(X): f1 = tf.ones_like(X) # Bias. f2 = X f3 = tf.square(X) f4 = tf.sqrt(X) f5 = tf.exp(X) return tf.stack([f1, f2, f3, f4, f5], axis=1) def predict(X, W): return tf.squeeze(X @ W, -1) def loss_mse(X, Y, W): Y_hat = predict(X, W) errors = (Y_hat - Y) ** 2 return tf.reduce_mean(errors) def compute_gradients(X, Y, W): with tf.GradientTape() as tape: loss = loss_mse(Xf, Y, W) return tape.gradient(loss, W) STEPS = 2000 LEARNING_RATE = 0.02 Xf = make_features(X) n_weights = Xf.shape[1] W = tf.Variable(np.zeros((n_weights, 1)), dtype=tf.float32) # For plotting steps, losses = [], [] plt.figure() for step in range(1, STEPS + 1): dW = compute_gradients(X, Y, W) W.assign_sub(dW * LEARNING_RATE) if step % 100 == 0: loss = loss_mse(Xf, Y, W) steps.append(step) losses.append(loss) plt.clf() plt.plot(steps, losses) print(f"STEP: {STEPS} MSE: {loss_mse(Xf, Y, W)}") plt.figure() plt.plot(X, Y, label="actual") plt.plot(X, predict(Xf, W), label="predicted") plt.legend() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Похожим образом можно сделать трёхмерный список. Step2: Чаще всего используются двумерные списки с равным количеством элементов в каждой строке. Такой двумерный список можно называть матрицей. Step3: Доступ и изменение элементов Step4: Создание матрицы n x m Step5: Но не все так просто... Step6: Изменилась не только вторая строка, но и все остальные. Так произошло, потому что после повторения списка каждая строка указывает на один и тот же массив. Step7: Ввод матрицы Step8: Или более кратко с помощью генератора списка
<ASSISTANT_TASK:> Python Code: lst_2d = [ [2, 4, 'unicorn'], [False, 39], [None], ] lst_3d = [ [[1, 1, 2], [3, 5], [8, 13]], [[21, 34], [55]] ] matrix = [ [0, 0, 1, 5], [1, 0, 2, 0], [0, 3, 1, 0], ] matrix = [ [0, 0, 1, 5], [1, 0, 2, 0], [0, 3, 1, 0], ] print(matrix[1][2]) matrix[0][1] = 9 for row in matrix: print(*row) n, m = 3, 4 matrix = [[0] * m] * n n, m = 3, 4 matrix = [[0] * m] * n # Изменяем третий элемент во второй строке matrix[1][2] = 1 for row in matrix: print(*row) n, m = 3, 4 matrix = [[0] * m for i in range(n)] matrix[1][2] = 1 for row in matrix: print(*row) n, m = map(int, input().split()) matrix = [] for i in range(n): matrix.append(list(map(int, input().split()))) n, m = map(int, input().split()) matrix = [list(map(int, input().split())) for i in range(n)] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step2: 2 - Outline of the Assignment Step4: Expected output Step6: Expected output Step8: Expected output Step10: Expected output Step12: <table style="width Step14: Expected Output Step16: Expected Output Step18: Expected output with sigmoid Step20: Expected Output
<ASSISTANT_TASK:> Python Code: import numpy as np import h5py import matplotlib.pyplot as plt from testCases_v2 import * from dnn_utils_v2 import sigmoid, sigmoid_backward, relu, relu_backward %matplotlib inline plt.rcParams['figure.figsize'] = (5.0, 4.0) # set default size of plots plt.rcParams['image.interpolation'] = 'nearest' plt.rcParams['image.cmap'] = 'gray' %load_ext autoreload %autoreload 2 np.random.seed(1) # GRADED FUNCTION: initialize_parameters def initialize_parameters(n_x, n_h, n_y): Argument: n_x -- size of the input layer n_h -- size of the hidden layer n_y -- size of the output layer Returns: parameters -- python dictionary containing your parameters: W1 -- weight matrix of shape (n_h, n_x) b1 -- bias vector of shape (n_h, 1) W2 -- weight matrix of shape (n_y, n_h) b2 -- bias vector of shape (n_y, 1) np.random.seed(1) ### START CODE HERE ### (≈ 4 lines of code) W1 = np.random.randn(n_h, n_x) * 0.01 b1 = np.zeros((n_h, 1)) W2 = np.random.randn(n_y, n_h) * 0.01 b2 = np.zeros((n_y, 1)) ### END CODE HERE ### assert(W1.shape == (n_h, n_x)) assert(b1.shape == (n_h, 1)) assert(W2.shape == (n_y, n_h)) assert(b2.shape == (n_y, 1)) parameters = {"W1": W1, "b1": b1, "W2": W2, "b2": b2} return parameters parameters = initialize_parameters(2,2,1) print("W1 = " + str(parameters["W1"])) print("b1 = " + str(parameters["b1"])) print("W2 = " + str(parameters["W2"])) print("b2 = " + str(parameters["b2"])) # GRADED FUNCTION: initialize_parameters_deep def initialize_parameters_deep(layer_dims): Arguments: layer_dims -- python array (list) containing the dimensions of each layer in our network Returns: parameters -- python dictionary containing your parameters "W1", "b1", ..., "WL", "bL": Wl -- weight matrix of shape (layer_dims[l], layer_dims[l-1]) bl -- bias vector of shape (layer_dims[l], 1) np.random.seed(3) parameters = {} L = len(layer_dims) # number of layers in the network for l in range(1, L): ### START CODE HERE ### (≈ 2 lines of code) parameters['W' + str(l)] = np.random.randn(layer_dims[l], layer_dims[l-1]) * 0.01 parameters['b' + str(l)] = np.zeros((layer_dims[l], 1)) ### END CODE HERE ### assert(parameters['W' + str(l)].shape == (layer_dims[l], layer_dims[l-1])) assert(parameters['b' + str(l)].shape == (layer_dims[l], 1)) return parameters parameters = initialize_parameters_deep([5,4,3]) print("W1 = " + str(parameters["W1"])) print("b1 = " + str(parameters["b1"])) print("W2 = " + str(parameters["W2"])) print("b2 = " + str(parameters["b2"])) # GRADED FUNCTION: linear_forward def linear_forward(A, W, b): Implement the linear part of a layer's forward propagation. Arguments: A -- activations from previous layer (or input data): (size of previous layer, number of examples) W -- weights matrix: numpy array of shape (size of current layer, size of previous layer) b -- bias vector, numpy array of shape (size of the current layer, 1) Returns: Z -- the input of the activation function, also called pre-activation parameter cache -- a python dictionary containing "A", "W" and "b" ; stored for computing the backward pass efficiently ### START CODE HERE ### (≈ 1 line of code) Z = np.dot(W, A) + b ### END CODE HERE ### assert(Z.shape == (W.shape[0], A.shape[1])) cache = (A, W, b) return Z, cache A, W, b = linear_forward_test_case() Z, linear_cache = linear_forward(A, W, b) print("Z = " + str(Z)) # GRADED FUNCTION: linear_activation_forward def linear_activation_forward(A_prev, W, b, activation): Implement the forward propagation for the LINEAR->ACTIVATION layer Arguments: A_prev -- activations from previous layer (or input data): (size of previous layer, number of examples) W -- weights matrix: numpy array of shape (size of current layer, size of previous layer) b -- bias vector, numpy array of shape (size of the current layer, 1) activation -- the activation to be used in this layer, stored as a text string: "sigmoid" or "relu" Returns: A -- the output of the activation function, also called the post-activation value cache -- a python dictionary containing "linear_cache" and "activation_cache"; stored for computing the backward pass efficiently if activation == "sigmoid": # Inputs: "A_prev, W, b". Outputs: "A, activation_cache". ### START CODE HERE ### (≈ 2 lines of code) Z, linear_cache = linear_forward(A_prev, W, b) A, activation_cache = sigmoid(Z) ### END CODE HERE ### elif activation == "relu": # Inputs: "A_prev, W, b". Outputs: "A, activation_cache". ### START CODE HERE ### (≈ 2 lines of code) Z, linear_cache = linear_forward(A_prev, W, b) A, activation_cache = relu(Z) ### END CODE HERE ### assert (A.shape == (W.shape[0], A_prev.shape[1])) cache = (linear_cache, activation_cache) return A, cache A_prev, W, b = linear_activation_forward_test_case() A, linear_activation_cache = linear_activation_forward(A_prev, W, b, activation = "sigmoid") print("With sigmoid: A = " + str(A)) A, linear_activation_cache = linear_activation_forward(A_prev, W, b, activation = "relu") print("With ReLU: A = " + str(A)) # GRADED FUNCTION: L_model_forward def L_model_forward(X, parameters): Implement forward propagation for the [LINEAR->RELU]*(L-1)->LINEAR->SIGMOID computation Arguments: X -- data, numpy array of shape (input size, number of examples) parameters -- output of initialize_parameters_deep() Returns: AL -- last post-activation value caches -- list of caches containing: every cache of linear_relu_forward() (there are L-1 of them, indexed from 0 to L-2) the cache of linear_sigmoid_forward() (there is one, indexed L-1) caches = [] A = X L = len(parameters) // 2 # number of layers in the neural network # Implement [LINEAR -> RELU]*(L-1). Add "cache" to the "caches" list. for l in range(1, L): A_prev = A ### START CODE HERE ### (≈ 2 lines of code) W, b = parameters['W' + str(l)], parameters['b' + str(l)] A, cache = linear_activation_forward(A_prev, W, b, 'relu') caches.append(cache) ### END CODE HERE ### # Implement LINEAR -> SIGMOID. Add "cache" to the "caches" list. ### START CODE HERE ### (≈ 2 lines of code) W, b = parameters['W' + str(L)], parameters['b' + str(L)] AL, cache = linear_activation_forward(A, W, b, 'sigmoid') caches.append(cache) ### END CODE HERE ### assert(AL.shape == (1,X.shape[1])) return AL, caches X, parameters = L_model_forward_test_case() AL, caches = L_model_forward(X, parameters) print("AL = " + str(AL)) print("Length of caches list = " + str(len(caches))) # GRADED FUNCTION: compute_cost def compute_cost(AL, Y): Implement the cost function defined by equation (7). Arguments: AL -- probability vector corresponding to your label predictions, shape (1, number of examples) Y -- true "label" vector (for example: containing 0 if non-cat, 1 if cat), shape (1, number of examples) Returns: cost -- cross-entropy cost m = Y.shape[1] # Compute loss from aL and y. ### START CODE HERE ### (≈ 1 lines of code) logprobs = np.multiply(np.log(AL), Y) + np.multiply((1-Y), np.log(1 - AL)) cost = - np.sum(logprobs) / m ### END CODE HERE ### cost = np.squeeze(cost) # To make sure your cost's shape is what we expect (e.g. this turns [[17]] into 17). assert(cost.shape == ()) return cost Y, AL = compute_cost_test_case() print("cost = " + str(compute_cost(AL, Y))) # GRADED FUNCTION: linear_backward def linear_backward(dZ, cache): Implement the linear portion of backward propagation for a single layer (layer l) Arguments: dZ -- Gradient of the cost with respect to the linear output (of current layer l) cache -- tuple of values (A_prev, W, b) coming from the forward propagation in the current layer Returns: dA_prev -- Gradient of the cost with respect to the activation (of the previous layer l-1), same shape as A_prev dW -- Gradient of the cost with respect to W (current layer l), same shape as W db -- Gradient of the cost with respect to b (current layer l), same shape as b A_prev, W, b = cache m = A_prev.shape[1] ### START CODE HERE ### (≈ 3 lines of code) dW = 1.0 / m * np.dot(dZ, A_prev.T) db = 1.0 / m * np.sum(dZ, axis=1, keepdims=True) dA_prev = np.dot(W.T, dZ) ### END CODE HERE ### assert (dA_prev.shape == A_prev.shape) assert (dW.shape == W.shape) assert (db.shape == b.shape) return dA_prev, dW, db # Set up some test inputs dZ, linear_cache = linear_backward_test_case() dA_prev, dW, db = linear_backward(dZ, linear_cache) print ("dA_prev = "+ str(dA_prev)) print ("dW = " + str(dW)) print ("db = " + str(db)) # GRADED FUNCTION: linear_activation_backward def linear_activation_backward(dA, cache, activation): Implement the backward propagation for the LINEAR->ACTIVATION layer. Arguments: dA -- post-activation gradient for current layer l cache -- tuple of values (linear_cache, activation_cache) we store for computing backward propagation efficiently activation -- the activation to be used in this layer, stored as a text string: "sigmoid" or "relu" Returns: dA_prev -- Gradient of the cost with respect to the activation (of the previous layer l-1), same shape as A_prev dW -- Gradient of the cost with respect to W (current layer l), same shape as W db -- Gradient of the cost with respect to b (current layer l), same shape as b linear_cache, activation_cache = cache if activation == "relu": ### START CODE HERE ### (≈ 2 lines of code) dZ = relu_backward(dA, activation_cache) dA_prev, dW, db = linear_backward(dZ, linear_cache) ### END CODE HERE ### elif activation == "sigmoid": ### START CODE HERE ### (≈ 2 lines of code) dZ = sigmoid_backward(dA, activation_cache) dA_prev, dW, db = linear_backward(dZ, linear_cache) ### END CODE HERE ### return dA_prev, dW, db AL, linear_activation_cache = linear_activation_backward_test_case() dA_prev, dW, db = linear_activation_backward(AL, linear_activation_cache, activation = "sigmoid") print ("sigmoid:") print ("dA_prev = "+ str(dA_prev)) print ("dW = " + str(dW)) print ("db = " + str(db) + "\n") dA_prev, dW, db = linear_activation_backward(AL, linear_activation_cache, activation = "relu") print ("relu:") print ("dA_prev = "+ str(dA_prev)) print ("dW = " + str(dW)) print ("db = " + str(db)) # GRADED FUNCTION: L_model_backward def L_model_backward(AL, Y, caches): Implement the backward propagation for the [LINEAR->RELU] * (L-1) -> LINEAR -> SIGMOID group Arguments: AL -- probability vector, output of the forward propagation (L_model_forward()) Y -- true "label" vector (containing 0 if non-cat, 1 if cat) caches -- list of caches containing: every cache of linear_activation_forward() with "relu" (it's caches[l], for l in range(L-1) i.e l = 0...L-2) the cache of linear_activation_forward() with "sigmoid" (it's caches[L-1]) Returns: grads -- A dictionary with the gradients grads["dA" + str(l)] = ... grads["dW" + str(l)] = ... grads["db" + str(l)] = ... grads = {} L = len(caches) # the number of layers m = AL.shape[1] Y = Y.reshape(AL.shape) # after this line, Y is the same shape as AL # Initializing the backpropagation ### START CODE HERE ### (1 line of code) dAL = - (np.divide(Y, AL) - np.divide(1 - Y, 1 - AL)) # derivative of cost with respect to AL ### END CODE HERE ### # Lth layer (SIGMOID -> LINEAR) gradients. Inputs: "AL, Y, caches". Outputs: "grads["dAL"], grads["dWL"], grads["dbL"] ### START CODE HERE ### (approx. 2 lines) current_cache = caches[L-1] grads["dA" + str(L)], grads["dW" + str(L)], grads["db" + str(L)] = linear_activation_backward(dAL, current_cache, 'sigmoid') ### END CODE HERE ### for l in reversed(range(L-1)): # lth layer: (RELU -> LINEAR) gradients. # Inputs: "grads["dA" + str(l + 2)], caches". Outputs: "grads["dA" + str(l + 1)] , grads["dW" + str(l + 1)] , grads["db" + str(l + 1)] ### START CODE HERE ### (approx. 5 lines) current_cache = caches[l] dA_prev_temp, dW_temp, db_temp = linear_activation_backward(grads["dA" + str(l+2)], current_cache, 'relu') grads["dA" + str(l + 1)] = dA_prev_temp grads["dW" + str(l + 1)] = dW_temp grads["db" + str(l + 1)] = db_temp ### END CODE HERE ### return grads AL, Y_assess, caches = L_model_backward_test_case() grads = L_model_backward(AL, Y_assess, caches) print ("dW1 = "+ str(grads["dW1"])) print ("db1 = "+ str(grads["db1"])) print ("dA1 = "+ str(grads["dA1"])) # GRADED FUNCTION: update_parameters def update_parameters(parameters, grads, learning_rate): Update parameters using gradient descent Arguments: parameters -- python dictionary containing your parameters grads -- python dictionary containing your gradients, output of L_model_backward Returns: parameters -- python dictionary containing your updated parameters parameters["W" + str(l)] = ... parameters["b" + str(l)] = ... L = len(parameters) // 2 # number of layers in the neural network # Update rule for each parameter. Use a for loop. ### START CODE HERE ### (≈ 3 lines of code) for l in range(L): parameters["W" + str(l+1)] = parameters["W" + str(l+1)] - learning_rate * grads["dW" + str(l+1)] parameters["b" + str(l+1)] = parameters["b" + str(l+1)] - learning_rate * grads["db" + str(l+1)] ### END CODE HERE ### return parameters parameters, grads = update_parameters_test_case() parameters = update_parameters(parameters, grads, 0.1) print ("W1 = "+ str(parameters["W1"])) print ("b1 = "+ str(parameters["b1"])) print ("W2 = "+ str(parameters["W2"])) print ("b2 = "+ str(parameters["b2"])) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1.1 Step2: 1.1 Step3: 1.2 Step4: 1.3 Step5: 1.4 Step6: 1.5 (Multi-Part) Step7: b. Use the print() function to print your list. Step8: c. Use the print() function to print out the middle element. Step9: d. Now replace the middle element with a different item, your favorite song, or song bird. Step10: e. Use the same print statement from b. to print your new list. Check out the differences. Step11: f. Add a new element to the end. Read about append(). Step12: g. Add a new element to the beginning. Read about insert(). Step13: h. Add a new element somewhere other than the beginning or the end. Step14: 1.6 Step15: Question 2 Step16: a. look up the motif for a particular SacII enzyme Step17: b. add below two enzymes and their motifs to dictionary Step18: 2.2 Step19: 2.3 Step20: Extra Pratice
<ASSISTANT_TASK:> Python Code: #type your code here runningTotal = 0 listOfNumbers = [4,7,9,1,8,6] #type your code here print(listOfNumbers) print("The average of these numbers is {0:.2f}".format(average)) word = "Python" print(len(word)) #type your code here numbers = (1, 2, 3, 4, 5, 6, 7, 8, 9) # Declaring the tuple count_odd = 0 count_even = 0 #type your code here print("Number of even numbers :",count_even) print("Number of odd numbers :",count_odd) motif = "GAATTC" count = 0 dna_strings = ['AGTGAACCGTCAGATCCGCTAGCGCGAATTC','GGAGACCGACACCCTCCTGCTATGGGTGCTGCTGCTC','TGGGTGCCCGGCAGCACCGGCGACGCACCGGTCGC', 'CACCATGGTGAGCAAGGGCGAGGAGAATAACATGGCC','ATCATCAAGGAGTTCATGCGCTTCAAGAATTC','CATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGA' ,'TCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGCCTT'] #type your code #type your code here #type your code #type your code #type your code #type your code #type your code #type your code #type your code #type your code #type your code #type your code #type your code #type your code dna = 'AAATTCGTGACTGTAA' #type your code here #type your code here sequences=['ATGCCCGGCCCGGC','GCGTGCTAGCAATACGATAAACCGG', 'ATATATATCGAT','ATGGGCCC'] #type your code here <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Set parameters Step2: Frequency analysis Step3: Now let's take a look at the spatial distributions of the PSD. Step4: Alternatively, you can also create PSDs from Epochs objects with functions Step5: Notably, Step6: Lastly, we can also retrieve the unaggregated segments by passing Step7: Time-frequency analysis Step8: Inspect power Step9: Joint Plot Step10: Inspect ITC
<ASSISTANT_TASK:> Python Code: # Authors: Alexandre Gramfort <alexandre.gramfort@inria.fr> # Stefan Appelhoff <stefan.appelhoff@mailbox.org> # Richard Höchenberger <richard.hoechenberger@gmail.com> # # License: BSD (3-clause) import os.path as op import numpy as np import matplotlib.pyplot as plt import mne from mne.time_frequency import tfr_morlet, psd_multitaper, psd_welch from mne.datasets import somato data_path = somato.data_path() subject = '01' task = 'somato' raw_fname = op.join(data_path, 'sub-{}'.format(subject), 'meg', 'sub-{}_task-{}_meg.fif'.format(subject, task)) # Setup for reading the raw data raw = mne.io.read_raw_fif(raw_fname) events = mne.find_events(raw, stim_channel='STI 014') # picks MEG gradiometers picks = mne.pick_types(raw.info, meg='grad', eeg=False, eog=True, stim=False) # Construct Epochs event_id, tmin, tmax = 1, -1., 3. baseline = (None, 0) epochs = mne.Epochs(raw, events, event_id, tmin, tmax, picks=picks, baseline=baseline, reject=dict(grad=4000e-13, eog=350e-6), preload=True) epochs.resample(200., npad='auto') # resample to reduce computation time epochs.plot_psd(fmin=2., fmax=40., average=True, spatial_colors=False) epochs.plot_psd_topomap(ch_type='grad', normalize=True) f, ax = plt.subplots() psds, freqs = psd_multitaper(epochs, fmin=2, fmax=40, n_jobs=1) psds = 10. * np.log10(psds) psds_mean = psds.mean(0).mean(0) psds_std = psds.mean(0).std(0) ax.plot(freqs, psds_mean, color='k') ax.fill_between(freqs, psds_mean - psds_std, psds_mean + psds_std, color='k', alpha=.5) ax.set(title='Multitaper PSD (gradiometers)', xlabel='Frequency (Hz)', ylabel='Power Spectral Density (dB)') plt.show() # Estimate PSDs based on "mean" and "median" averaging for comparison. kwargs = dict(fmin=2, fmax=40, n_jobs=1) psds_welch_mean, freqs_mean = psd_welch(epochs, average='mean', **kwargs) psds_welch_median, freqs_median = psd_welch(epochs, average='median', **kwargs) # Convert power to dB scale. psds_welch_mean = 10 * np.log10(psds_welch_mean) psds_welch_median = 10 * np.log10(psds_welch_median) # We will only plot the PSD for a single sensor in the first epoch. ch_name = 'MEG 0122' ch_idx = epochs.info['ch_names'].index(ch_name) epo_idx = 0 _, ax = plt.subplots() ax.plot(freqs_mean, psds_welch_mean[epo_idx, ch_idx, :], color='k', ls='-', label='mean of segments') ax.plot(freqs_median, psds_welch_median[epo_idx, ch_idx, :], color='k', ls='--', label='median of segments') ax.set(title='Welch PSD ({}, Epoch {})'.format(ch_name, epo_idx), xlabel='Frequency (Hz)', ylabel='Power Spectral Density (dB)') ax.legend(loc='upper right') plt.show() psds_welch_unagg, freqs_unagg = psd_welch(epochs, average=None, **kwargs) print(psds_welch_unagg.shape) # define frequencies of interest (log-spaced) freqs = np.logspace(*np.log10([6, 35]), num=8) n_cycles = freqs / 2. # different number of cycle per frequency power, itc = tfr_morlet(epochs, freqs=freqs, n_cycles=n_cycles, use_fft=True, return_itc=True, decim=3, n_jobs=1) power.plot_topo(baseline=(-0.5, 0), mode='logratio', title='Average power') power.plot([82], baseline=(-0.5, 0), mode='logratio', title=power.ch_names[82]) fig, axis = plt.subplots(1, 2, figsize=(7, 4)) power.plot_topomap(ch_type='grad', tmin=0.5, tmax=1.5, fmin=8, fmax=12, baseline=(-0.5, 0), mode='logratio', axes=axis[0], title='Alpha', show=False) power.plot_topomap(ch_type='grad', tmin=0.5, tmax=1.5, fmin=13, fmax=25, baseline=(-0.5, 0), mode='logratio', axes=axis[1], title='Beta', show=False) mne.viz.tight_layout() plt.show() power.plot_joint(baseline=(-0.5, 0), mode='mean', tmin=-.5, tmax=2, timefreqs=[(.5, 10), (1.3, 8)]) itc.plot_topo(title='Inter-Trial coherence', vmin=0., vmax=1., cmap='Reds') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Use XLA with tf.function Step2: Then define some necessary constants and prepare the MNIST dataset. Step3: Finally, define the model and the optimizer. The model uses a single dense layer. Step4: Define the training function Step5: Train and test the model Step6: And, finally, check the accuracy Step7: Behind the scenes, the XLA compiler has compiled the entire TF function to HLO, which has enabled fusion optimizations. Using the introspection facilities, we can see the HLO code (other interesting possible values for "stage" are optimized_hlo for HLO after optimizations and optimized_hlo_dot for a Graphviz graph)
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import tensorflow as tf tf.compat.v1.enable_eager_execution() # Size of each input image, 28 x 28 pixels IMAGE_SIZE = 28 * 28 # Number of distinct number labels, [0..9] NUM_CLASSES = 10 # Number of examples in each training batch (step) TRAIN_BATCH_SIZE = 100 # Number of training steps to run TRAIN_STEPS = 1000 # Loads MNIST dataset. train, test = tf.keras.datasets.mnist.load_data() train_ds = tf.data.Dataset.from_tensor_slices(train).batch(TRAIN_BATCH_SIZE).repeat() # Casting from raw data to the required datatypes. def cast(images, labels): images = tf.cast( tf.reshape(images, [-1, IMAGE_SIZE]), tf.float32) labels = tf.cast(labels, tf.int64) return (images, labels) layer = tf.keras.layers.Dense(NUM_CLASSES) optimizer = tf.keras.optimizers.Adam() @tf.function(jit_compile=True) def train_mnist(images, labels): images, labels = cast(images, labels) with tf.GradientTape() as tape: predicted_labels = layer(images) loss = tf.reduce_mean(tf.nn.sparse_softmax_cross_entropy_with_logits( logits=predicted_labels, labels=labels )) layer_variables = layer.trainable_variables grads = tape.gradient(loss, layer_variables) optimizer.apply_gradients(zip(grads, layer_variables)) for images, labels in train_ds: if optimizer.iterations > TRAIN_STEPS: break train_mnist(images, labels) images, labels = cast(test[0], test[1]) predicted_labels = layer(images) correct_prediction = tf.equal(tf.argmax(predicted_labels, 1), labels) accuracy = tf.reduce_mean(tf.cast(correct_prediction, tf.float32)) print("Prediction accuracy after training: %s" % accuracy) print(train_mnist.experimental_get_compiler_ir(images, labels)(stage='hlo')) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's show the symbols data, to see how good the recommender has to be. Step2: Let's run the trained agent, with the test set Step3: And now a "realistic" test, in which the learner continues to learn from past samples in the test set (it even makes some random moves, though very few). Step4: What are the metrics for "holding the position"?
<ASSISTANT_TASK:> Python Code: # Basic imports import os import pandas as pd import matplotlib.pyplot as plt import numpy as np import datetime as dt import scipy.optimize as spo import sys from time import time from sklearn.metrics import r2_score, median_absolute_error from multiprocessing import Pool %matplotlib inline %pylab inline pylab.rcParams['figure.figsize'] = (20.0, 10.0) %load_ext autoreload %autoreload 2 sys.path.append('../../') import recommender.simulator as sim from utils.analysis import value_eval from recommender.agent import Agent from functools import partial NUM_THREADS = 1 LOOKBACK = -1 # 252*4 + 28 STARTING_DAYS_AHEAD = 252 POSSIBLE_FRACTIONS = [0.0, 1.0] # Get the data SYMBOL = 'SPY' total_data_train_df = pd.read_pickle('../../data/data_train_val_df.pkl').stack(level='feature') data_train_df = total_data_train_df[SYMBOL].unstack() total_data_test_df = pd.read_pickle('../../data/data_test_df.pkl').stack(level='feature') data_test_df = total_data_test_df[SYMBOL].unstack() if LOOKBACK == -1: total_data_in_df = total_data_train_df data_in_df = data_train_df else: data_in_df = data_train_df.iloc[-LOOKBACK:] total_data_in_df = total_data_train_df.loc[data_in_df.index[0]:] # Create many agents index = np.arange(NUM_THREADS).tolist() env, num_states, num_actions = sim.initialize_env(total_data_train_df, SYMBOL, starting_days_ahead=STARTING_DAYS_AHEAD, possible_fractions=POSSIBLE_FRACTIONS, n_levels=10) agents = [Agent(num_states=num_states, num_actions=num_actions, random_actions_rate=0.98, random_actions_decrease=0.9999, dyna_iterations=20, name='Agent_{}'.format(i)) for i in index] def show_results(results_list, data_in_df, graph=False): for values in results_list: total_value = values.sum(axis=1) print('Sharpe ratio: {}\nCum. Ret.: {}\nAVG_DRET: {}\nSTD_DRET: {}\nFinal value: {}'.format(*value_eval(pd.DataFrame(total_value)))) print('-'*100) initial_date = total_value.index[0] compare_results = data_in_df.loc[initial_date:, 'Close'].copy() compare_results.name = SYMBOL compare_results_df = pd.DataFrame(compare_results) compare_results_df['portfolio'] = total_value std_comp_df = compare_results_df / compare_results_df.iloc[0] if graph: plt.figure() std_comp_df.plot() print('Sharpe ratio: {}\nCum. Ret.: {}\nAVG_DRET: {}\nSTD_DRET: {}\nFinal value: {}'.format(*value_eval(pd.DataFrame(data_in_df['Close'].iloc[STARTING_DAYS_AHEAD:])))) # Simulate (with new envs, each time) n_epochs = 7 for i in range(n_epochs): tic = time() env.reset(STARTING_DAYS_AHEAD) results_list = sim.simulate_period(total_data_in_df, SYMBOL, agents[0], starting_days_ahead=STARTING_DAYS_AHEAD, possible_fractions=POSSIBLE_FRACTIONS, verbose=False, other_env=env) toc = time() print('Epoch: {}'.format(i)) print('Elapsed time: {} seconds.'.format((toc-tic))) print('Random Actions Rate: {}'.format(agents[0].random_actions_rate)) show_results([results_list], data_in_df) env.reset(STARTING_DAYS_AHEAD) results_list = sim.simulate_period(total_data_in_df, SYMBOL, agents[0], learn=False, starting_days_ahead=STARTING_DAYS_AHEAD, possible_fractions=POSSIBLE_FRACTIONS, other_env=env) show_results([results_list], data_in_df, graph=True) TEST_DAYS_AHEAD = 20 env.set_test_data(total_data_test_df, TEST_DAYS_AHEAD) tic = time() results_list = sim.simulate_period(total_data_test_df, SYMBOL, agents[0], learn=False, starting_days_ahead=TEST_DAYS_AHEAD, possible_fractions=POSSIBLE_FRACTIONS, verbose=False, other_env=env) toc = time() print('Epoch: {}'.format(i)) print('Elapsed time: {} seconds.'.format((toc-tic))) print('Random Actions Rate: {}'.format(agents[0].random_actions_rate)) show_results([results_list], data_test_df, graph=True) env.set_test_data(total_data_test_df, TEST_DAYS_AHEAD) tic = time() results_list = sim.simulate_period(total_data_test_df, SYMBOL, agents[0], learn=True, starting_days_ahead=TEST_DAYS_AHEAD, possible_fractions=POSSIBLE_FRACTIONS, verbose=False, other_env=env) toc = time() print('Epoch: {}'.format(i)) print('Elapsed time: {} seconds.'.format((toc-tic))) print('Random Actions Rate: {}'.format(agents[0].random_actions_rate)) show_results([results_list], data_test_df, graph=True) print('Sharpe ratio: {}\nCum. Ret.: {}\nAVG_DRET: {}\nSTD_DRET: {}\nFinal value: {}'.format(*value_eval(pd.DataFrame(data_test_df['Close'].iloc[STARTING_DAYS_AHEAD:])))) import pickle with open('../../data/dyna_10000_states_full_training.pkl', 'wb') as best_agent: pickle.dump(agents[0], best_agent) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description:
<ASSISTANT_TASK:> Python Code: import scipy.integrate import math import numpy as np def NDfx(x): return((1/math.sqrt((2*math.pi)))*(math.e**((-.5)*(x**2)))) x = 2.5 u = 1 o2 = 3 norm = (x-u)/o2 prob = scipy.integrate.quad(NDfx, -np.inf, norm)[0] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Run solver Step2: Plot dipole activations Step3: Show the evoked response and the residual for gradiometers Step4: Generate stc from dipoles Step5: View in 2D and 3D ("glass" brain like 3D plot)
<ASSISTANT_TASK:> Python Code: # Author: Alexandre Gramfort <alexandre.gramfort@telecom-paristech.fr> # Daniel Strohmeier <daniel.strohmeier@tu-ilmenau.de> # # License: BSD (3-clause) import numpy as np import mne from mne.datasets import sample from mne.minimum_norm import make_inverse_operator, apply_inverse from mne.inverse_sparse import tf_mixed_norm, make_stc_from_dipoles from mne.viz import (plot_sparse_source_estimates, plot_dipole_locations, plot_dipole_amplitudes) print(__doc__) data_path = sample.data_path() subjects_dir = data_path + '/subjects' fwd_fname = data_path + '/MEG/sample/sample_audvis-meg-eeg-oct-6-fwd.fif' ave_fname = data_path + '/MEG/sample/sample_audvis-no-filter-ave.fif' cov_fname = data_path + '/MEG/sample/sample_audvis-shrunk-cov.fif' # Read noise covariance matrix cov = mne.read_cov(cov_fname) # Handling average file condition = 'Left visual' evoked = mne.read_evokeds(ave_fname, condition=condition, baseline=(None, 0)) evoked = mne.pick_channels_evoked(evoked) # We make the window slightly larger than what you'll eventually be interested # in ([-0.05, 0.3]) to avoid edge effects. evoked.crop(tmin=-0.1, tmax=0.4) # Handling forward solution forward = mne.read_forward_solution(fwd_fname) # alpha_space regularization parameter is between 0 and 100 (100 is high) alpha_space = 30. # spatial regularization parameter # alpha_time parameter promotes temporal smoothness # (0 means no temporal regularization) alpha_time = 1. # temporal regularization parameter loose, depth = 0.2, 0.9 # loose orientation & depth weighting # Compute dSPM solution to be used as weights in MxNE inverse_operator = make_inverse_operator(evoked.info, forward, cov, loose=loose, depth=depth) stc_dspm = apply_inverse(evoked, inverse_operator, lambda2=1. / 9., method='dSPM') # Compute TF-MxNE inverse solution with dipole output dipoles, residual = tf_mixed_norm( evoked, forward, cov, alpha_space, alpha_time, loose=loose, depth=depth, maxit=200, tol=1e-6, weights=stc_dspm, weights_min=8., debias=True, wsize=16, tstep=4, window=0.05, return_as_dipoles=True, return_residual=True) # Crop to remove edges for dip in dipoles: dip.crop(tmin=-0.05, tmax=0.3) evoked.crop(tmin=-0.05, tmax=0.3) residual.crop(tmin=-0.05, tmax=0.3) plot_dipole_amplitudes(dipoles) # Plot dipole location of the strongest dipole with MRI slices idx = np.argmax([np.max(np.abs(dip.amplitude)) for dip in dipoles]) plot_dipole_locations(dipoles[idx], forward['mri_head_t'], 'sample', subjects_dir=subjects_dir, mode='orthoview', idx='amplitude') # # Plot dipole locations of all dipoles with MRI slices # for dip in dipoles: # plot_dipole_locations(dip, forward['mri_head_t'], 'sample', # subjects_dir=subjects_dir, mode='orthoview', # idx='amplitude') ylim = dict(grad=[-120, 120]) evoked.pick_types(meg='grad', exclude='bads') evoked.plot(titles=dict(grad='Evoked Response: Gradiometers'), ylim=ylim, proj=True) residual.pick_types(meg='grad', exclude='bads') residual.plot(titles=dict(grad='Residuals: Gradiometers'), ylim=ylim, proj=True) stc = make_stc_from_dipoles(dipoles, forward['src']) plot_sparse_source_estimates(forward['src'], stc, bgcolor=(1, 1, 1), opacity=0.1, fig_name="TF-MxNE (cond %s)" % condition, modes=['sphere'], scale_factors=[1.]) time_label = 'TF-MxNE time=%0.2f ms' clim = dict(kind='value', lims=[10e-9, 15e-9, 20e-9]) brain = stc.plot('sample', 'inflated', 'rh', views='medial', clim=clim, time_label=time_label, smoothing_steps=5, subjects_dir=subjects_dir, initial_time=150, time_unit='ms') brain.add_label("V1", color="yellow", scalar_thresh=.5, borders=True) brain.add_label("V2", color="red", scalar_thresh=.5, borders=True) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Luego se cargan los datos de la competencia Step2: Visualización de datos y estudio inicial Step3: Como puede observarse hay un total de 12 columnas de las cuales 5 son datos categóricos. De los datos numéricos que se pueden ver en la tabla (de descripción) se puede deducir lo siguiente Step4: Como vemos, el dato de Cabin estamos perdiendo aproximadamente el 77%. Me parece que eso no es bueno. En cuanto a edad, tenemos casi el 20% de los datos perdidos, y el 0.22% de datos perdidos de Embarked. Step5: Ahora vamos a estudiar las features del DataFrames, haciendo comparativas de si sobrevivió o no. Step6: Analizando los gráficos realizados se pueden sacar algunas conclusiones. Por el lado la edad, se observa que la mayoría de los que iban en el Titanic eran entre 20 y 40 años. De los cuales podemos decir que, mas o menos entre los 20 y 30 la mayoría no sobrevivió. Mientras que entre los 30 y 40 había una pequeña chance mayor de sobrevivir. También se observa que, lo niños entre 0 y 10 años tenían mejor chance de sobrevivir. Step7: En primer lugar puede observarse que la diagonal es igual a 1. Esto siempre es así, la correlación de una variable consigo misma, siempre es máxima. Step8: Se puede observar que existe una mayor probabilidad de sobrevivir aquellas mujeres entre 20 y 40 años. En cambio para los hombres esto no se cumple. Por otro lado, los niños varones recién nacios y hasta los 10 años aproximadamente tiene más probabilidad de sobrevivir, esto se observa además, con la mujeres mayores de edad. Step9: De estos gráficos se pueden deducir que existe una mayor proporción de hombres que han muerto pertenecientes a la clase 3 en comparación de aquellos que iban en las otras clases. En cambio, para los sobrevivientes (hombres) existe una relación casi idéntica de sobrevivientes de la clase 1 con los de la clase 3. Step10: En estes gráficos podemos observar el rango de edades en las que los hombres y mujeres tuvieron mayores probabilidad de sobrevivir. Step11: Del gráfico anterior podemos observar que la clase 3 en su mayoría son personas jóvenes, miestras que la clase 1, si bien cubre el mayor rango de edades, la masa se concentra entre los 30 y 50 años de edad. Step12: De estos gráficos se puede observar que (y es el análisis realizado por Heads or Tails) dentro de la primera clase hay dos tipos de grupos, los ricos y los super ricos. Step13: Valores perdidos Step14: Podemos observar que hay una gran cantidad de valores perdidos de la variable 'Cabin' (77.10% de valores perdidos). No creo que haya mucho para hacer. Step15: Son dos mujeres, una de 38 años y otra de 62 años. Ninguna con familiares. Lo que haremos es decidir que "Embarked" es mejor para estas mujeres. Step16: Aquí, simplemente lo que hice fue comparar las mujeres que se parecen a las dos "perdidas". Viendo la variable 'Fare' de este grupo, observamos que hay 1 sola mujer que pagó 83.1583, mientras que hay 3 mujeres que pagaron 86.5. Siendo este grupo dónde yo voy a poner a la dos mujeres. Step17: Veremos quien es al que le falta la variable 'Fare' en el dataframe de Test Step18: Lo que haemos será ponerle el promedio de todos los 'Fare' que compartan el mismo Sibsp, Parch, Sex, Embarked, Pclass Step19: Feature Engineering Step20: Niños Step21: De los estudiado podemos obervar que iban muy pocos niños en la clase 1, de los cuales aparentemente sobrevivieron todos. Por el lado de la clase 2 y 3, vemos una mayor cantidad de niños y niña, de los cuales tiene un gran porcentaje de superviviencias. Se puede decir que lo niños de la clase 2 y 3 tenían más chances de sobrevivir. Step22: Del primer gráfico se puede concluir que existe una mayor probabilidad de que si alguien sobrevive, se le conozca la edad (un 40%). En contrapartida, si una persona no se le conoce la edad tiene una chance de sobrevivir de unos 30%. Step23: Aquí se puede observar lo que veníamos estudiando anteriormente, existe una mayor probabilidad de sobrevivir si había personas que viajaban con varios familiares. Aquí observarmos que lo ideal es viajar con 1, 2 hasta 3 familiares más. Step24: Se puede observar, como vimos anteriormente, que si se viajaba solo tenía menos chances de sobrevivir. Vemos los que viajaron solo sobrevivieron el 30.35%. Mientras que los que no viajaron solos sobrevivieron el 50%. Step25: Título Step26: Ahora hay que buscar patrones en los títulos para ello veremos cuales son los diferente títulos y cuantos con ese títulos hay. Además buscaremos un promedio de la edad de ese titulo. Step27: Como podemos observar los títulos de Rev. y Dr. lo tienen muy pocas personas, por lo tanto no nos aportaría mucha información. Por otro lado podemos observar que Step28: Nos preparamos para el modelado Step29: Modelado Step30: Perceptrón
<ASSISTANT_TASK:> Python Code: #%matplotlib inline import warnings warnings.filterwarnings("ignore") import pandas as pd import matplotlib.pyplot as plt import seaborn as sns import numpy as np from scipy import stats from sklearn.model_selection import train_test_split from sklearn.linear_model import LogisticRegression from sklearn.linear_model import Perceptron from sklearn.model_selection import cross_val_score from sklearn.model_selection import KFold from sklearn.metrics import confusion_matrix from sklearn.model_selection import GridSearchCV train = pd.read_csv('train.csv') test = pd.read_csv('test.csv') print('Train Dataset info') train.head(10) print('La cantidad de columnas en train es: %i y la cantidad de renglones es: %i'\ %(len(train.columns), len(train.index))) train.describe() print(train.info()) train.isnull().sum() total = len(train.index) sobrev = train[train['Survived'] == 1] nosobrev = train[train['Survived'] == 0] s = float(len(sobrev)) ns = float(len(nosobrev)) s_percent = s/total*100.0 sobre_color = 'green' nosobre_color = 'red' print('Sobrevivió el %.2f porciento. En el DataFrame hay un total de %i sobrevivientes y un\ total de %i no sobrevivientes' %(s_percent, s, ns)) plt.figure() # Estudio de la edad sns.distplot(sobrev['Age'].dropna().values, bins=range(0, 100, 1), color=sobre_color, label='Sobrevivio') sns.distplot(nosobrev['Age'].dropna().values, bins=range(0, 100, 1), color=nosobre_color, axlabel='Age', label='No Sobrevivio') plt.show() plt.figure() # Estudio del sexo sns.barplot('Sex', 'Survived', data=train, palette='Reds_d') plt.show() #Estudio de Pclass plt.figure() sns.barplot('Pclass','Survived', data=train) plt.show() # SibSp study plt.figure() sns.barplot('SibSp', 'Survived', data=train) plt.show() # Parch study plt.figure() sns.barplot('Parch', 'Survived', data=train) plt.show() # Embarked Study plt.figure() sns.barplot('Embarked', 'Survived', data=train) plt.show() # Fare study plt.figure() sns.distplot(sobrev['Fare'].dropna().values, bins=range(0, 513, 1), color=sobre_color, label='Sobrevivio') sns.distplot(nosobrev['Fare'].dropna().values, bins=range(0, 513, 1), color=nosobre_color, label='No Sobrevivio', axlabel="Fare") plt.show() plt.figure(figsize=(14,12)) cm = sns.heatmap(train.drop('PassengerId', axis=1).corr(), vmax=0.6, square=True, annot=True) plt.show() msobre = train[(train['Survived'] == 1) & (train['Sex'] == 'male')] mNosobre = train[(train['Survived'] == 0) & (train['Sex'] == 'male')] fsobre = train[(train['Survived'] == 1) & (train['Sex'] == 'female')] fNosobre = train[(train['Survived'] == 0) & (train['Sex'] == 'female')] plt.figure(figsize=(18,6)) plt.subplot(121) sns.distplot(msobre['Age'].dropna().values, bins=range(0, 100, 1), color=sobre_color, label='Sobrevivido') sns.distplot(mNosobre['Age'].dropna().values, bins=range(0, 100, 1), color=nosobre_color, label='No Sobrevivido', axlabel='Edad hombres') plt.subplot(122) sns.distplot(fsobre['Age'].dropna().values, bins=range(0, 100, 1), color=sobre_color, label='Sobrevivido') sns.distplot(fNosobre['Age'].dropna().values, bins=range(0, 100, 1), color=nosobre_color, label='No Sobrevivido', axlabel="Edad Mujeres") plt.show() male = train[(train['Sex'] == 'male')] female = train[(train['Sex'] == 'female')] tabMale = pd.crosstab(male['Survived'], male['Pclass']) print('Hombres - Clase - Sobrevivientes') print(tabMale) tabFemale = pd.crosstab(female['Survived'], female['Pclass']) print('\n\nMujeres - Clase - Sobrevivientes') print(tabFemale) plt.figure(figsize=(18,6)) plotMale = tabMale.div(tabMale.sum(1).astype(float), axis=0).plot(kind="bar", stacked=True) plt.xlabel('Sobreviviente') plt.ylabel('Porcentaje') plt.title("Hombres") plt.show() plt.figure(figsize=(18,6)) plotFemale = tabFemale.div(tabFemale.sum(1).astype(float), axis=0).plot(kind="bar", stacked=True) plt.title("Mujeres") plt.xlabel('Sobreviviente') plt.ylabel('Porcentaje') plt.show() # Class 1 Male msobreClass1 = train[(train['Survived'] == 1) & (train['Sex'] == 'male') & (train['Pclass'] == 1)] mnosobreClass1 = train[(train['Survived'] == 0) & (train['Sex'] == 'male') & (train['Pclass'] == 1)] # Class 2 Male msobreClass2 = train[(train['Survived'] == 1) & (train['Sex'] == 'male') & (train['Pclass'] == 2)] mnosobreClass2 = train[(train['Survived'] == 0) & (train['Sex'] == 'male') & (train['Pclass'] == 2)] # Class 3 Male msobreClass3 = train[(train['Survived'] == 1) & (train['Sex'] == 'male') & (train['Pclass'] == 3)] mnosobreClass3 = train[(train['Survived'] == 0) & (train['Sex'] == 'male') & (train['Pclass'] == 3)] # Class 1 Female fsobreClass1 = train[(train['Survived'] == 1) & (train['Sex'] == 'female') & (train['Pclass'] == 1)] fnosobreClass1 = train[(train['Survived'] == 0) & (train['Sex'] == 'female') & (train['Pclass'] == 1)] # Class 2 Female fsobreClass2 = train[(train['Survived'] == 1) & (train['Sex'] == 'female') & (train['Pclass'] == 2)] fnosobreClass2 = train[(train['Survived'] == 0) & (train['Sex'] == 'female') & (train['Pclass'] == 2)] # Class 3 Female fsobreClass3 = train[(train['Survived'] == 1) & (train['Sex'] == 'female') & (train['Pclass'] == 3)] fnosobreClass3 = train[(train['Survived'] == 0) & (train['Sex'] == 'female') & (train['Pclass'] == 3)] print("Graficos Hombres") plt.figure(figsize=(16,6)) plt.subplot(131) sns.distplot(msobreClass1['Age'].dropna().values, bins=range(0,100,1), color=sobre_color, label='Sobreviviente Clase 1') sns.distplot(mnosobreClass1['Age'].dropna().values, bins=range(0,100,1), color=nosobre_color, label='No sobreviviente Clase 1', axlabel="Edad") plt.title("Class 1") plt.subplot(132) sns.distplot(msobreClass2['Age'].dropna().values, bins=range(0,100,1), color=sobre_color, label='Sobreviviente Clase 2') sns.distplot(mnosobreClass2['Age'].dropna().values, bins=range(0,100,1), color=nosobre_color, label='No sobreviviente Clase 2', axlabel="Edad") plt.title("Class 2") plt.subplot(133) sns.distplot(msobreClass3['Age'].dropna().values, bins=range(0,100,1), color=sobre_color, label='Sobreviviente Clase 3') sns.distplot(mnosobreClass3['Age'].dropna().values, bins=range(0,100,1), color=nosobre_color, label='No sobreviviente Clase 3', axlabel="Edad") plt.title("Class 3") plt.show() print("Graficos mujeres") plt.figure(figsize=(16,6)) plt.subplot(131) sns.distplot(fsobreClass1['Age'].dropna().values, bins=range(0,100,1), color=sobre_color, label='Sobreviviente Clase 1') sns.distplot(fnosobreClass1['Age'].dropna().values, bins=range(0,100,1), color=nosobre_color, label='No sobreviviente Clase 1') plt.title("Class 1") plt.subplot(132) sns.distplot(fsobreClass2['Age'].dropna().values, bins=range(0,100,1), color=sobre_color, label='Sobreviviente Clase 2') sns.distplot(fnosobreClass2['Age'].dropna().values, bins=range(0,100,1), color=nosobre_color, label='No sobreviviente Clase 2') plt.title("Class 2") plt.subplot(133) sns.distplot(fsobreClass3['Age'].dropna().values, bins=range(0,100,1), color=sobre_color, label='Sobreviviente Clase 3') sns.distplot(fnosobreClass3['Age'].dropna().values, bins=range(0,100,1), color=nosobre_color, label='No sobreviviente Clase 3') plt.title("Class 3") plt.show() class1 = train[(train['Pclass'] == 1)] class2 = train[(train['Pclass'] == 2)] class3 = train[(train['Pclass'] == 3)] plt.figure() ax = sns.distplot(class1['Age'].dropna().values, bins=range(0, 100, 1), label="Class 1") ax.legend(loc="best") ax = sns.distplot(class2['Age'].dropna().values, bins=range(0, 100, 1), label='Class 2') ax.legend(loc="best") ax = sns.distplot(class3['Age'].dropna().values, bins=range(0, 100, 1), label='Class 3', axlabel='Clases') ax.legend(loc="best") plt.show() plt.figure(figsize=(12,10)) # Class 1 plt.subplot(311) ax1 = sns.distplot(np.log10(sobrev['Fare'][sobrev['Pclass'] == 1].dropna().values+1), color=sobre_color) ax1 = sns.distplot(np.log10(nosobrev['Fare'][nosobrev['Pclass'] == 1].dropna().values+1), color=nosobre_color, axlabel='Fare') ax1.set_xlim(0, np.max(np.log10(train['Fare'].dropna().values))) ax1.legend(loc="best") # Class 2 plt.subplot(312) ax2 = sns.distplot(np.log10(sobrev['Fare'][sobrev['Pclass'] == 2].dropna().values+1), color=sobre_color) ax2 = sns.distplot(np.log10(nosobrev['Fare'][nosobrev['Pclass'] == 2].dropna().values+1), color=nosobre_color, axlabel='Fare') ax2.set_xlim(0, np.max(np.log10(train['Fare'].dropna().values))) ax2.legend(loc="best") # Class 3 plt.subplot(313) ax3 = sns.distplot(np.log10(sobrev['Fare'][sobrev['Pclass'] == 3].dropna().values+1), color=sobre_color) ax3 = sns.distplot(np.log10(nosobrev['Fare'][nosobrev['Pclass'] == 3].dropna().values+1), color=nosobre_color, axlabel='Fare') ax3.set_xlim(0, np.max(np.log10(train['Fare'].dropna().values))) ax3.legend(loc="best") # Config Plot plt.subplots_adjust(top=1, bottom=0.08, left=0.10, right=1, hspace=0.25, wspace=0.35) plt.show() plt.figure(figsize=(12,10)) ax = sns.boxplot(x="Pclass", y="Fare", hue="Survived", data=train); ax.set_yscale('log') plt.show() print("Train Dataframe") print(train.info()) print("Test Dataframe") print(test.info()) print(train[train['Embarked'].isnull()]) combine = pd.concat([train, test]) combine.where((combine['Pclass'] < 1.5) & (combine['Sex'] == "female") & (combine['SibSp'] == 0.0) & (combine['Parch'] == 0.0) ).groupby(['Embarked','Pclass','Sex','Parch','SibSp', 'Fare', 'Survived']).size() train['Embarked'].iloc[61] = "S" train['Embarked'].iloc[829] = "S" print(test[test['Fare'].isnull()]) combine = pd.concat([train, test]) test['Fare'].iloc[152] = combine['Fare'][(combine['Pclass'] == 3) & (combine['Sex'] == "male") & (combine['SibSp'] == 0.0) & (combine['Parch'] == 0.0) & (combine['Embarked'] == "S")].dropna().median() print("El valor que se agregó fue: " + str(test['Fare'].iloc[152])) # Defininf combine combine = pd.concat([train.drop('Survived', 1), test]) survived = train['Survived'] # creating feature eng combine['Child'] = combine['Age'] <= 12 combine['Age_know'] = combine["Age"].isnull() == False combine['Family'] = combine['SibSp'] + combine['Parch'] combine['Alone'] = (combine['SibSp'] + combine['Parch']) == 0 combine['Title'] = combine['Name'].str.split(', ', expand=True)[1].str.split('. ', expand=True)[0] combine['Young'] = (combine['Age'] <= 30) & (combine['Age'] >= 12) combine['Old'] = combine['Age'] >= 60 # come back to train and test data train = combine.iloc[:len(train)] test = combine.iloc[len(test):] # add survived again train['Survived'] = survived # update sobrev and nosobrev sobrev = train[train['Survived'] == 1] nosobrev = train[train['Survived'] == 0] tab = pd.crosstab(train['Child'], train['Pclass']) print("\nNiños vs Clases") print(tab) tab = pd.crosstab(train['Child'], train['Sex']) print("\nNiños vs Sexo") print(tab) tab = pd.crosstab(train['Child'], train['Survived']) print("\nNiños vs Sobrevivientes") print(tab) plt.figure() sns.factorplot(x="Sex", y="Survived", hue="Child", col='Pclass', data=train, kind='bar') plt.show() tab = pd.crosstab(train['Age_know'], train['Survived']) print("\nEdad conocida vs Sobrevivientes") print(tab) plt.figure() buff = tab.div(tab.sum(1).astype('float'), axis=0).plot(kind='bar',stacked=True) plt.xlabel('Edad conocida') plt.ylabel('Porcentaje') plt.show() tab = pd.crosstab(train['Age_know'], train['Pclass']) print("\nEdad conocida vs Class") print(tab) plt.figure() buff = tab.div(tab.sum(1).astype('float'), axis=0).plot(kind='bar',stacked=True) plt.xlabel('Edad conocida') plt.ylabel('Porcentaje') plt.show() tab = pd.crosstab(train['Age_know'], train['Sex']) print("\nEdad conocida vs Sexo") print(tab) plt.figure() buff = tab.div(tab.sum(1).astype('float'), axis=0).plot(kind='bar',stacked=True) plt.xlabel('Edad conocida') plt.ylabel('Porcentaje') plt.show() tab = pd.crosstab(train['Family'], train['Survived']) print("\nTamaño de la familia vs Sobrevivientes") print(tab) plt.figure(figsize=(18,14)) buff = tab.div(tab.sum(1).astype('float'), axis=0).plot(kind='bar',stacked=True) plt.xlabel('Cantidad de miembros de la familia') plt.ylabel('Porcentaje') plt.show() tab = pd.crosstab(train['Alone'], train['Survived']) print("\nViajantes solitarios vs Sobrevivientes") print(tab) plt.figure(figsize=(18,14)) buff = tab.div(tab.sum(1).astype('float'), axis=0).plot(kind='bar',stacked=True) plt.xlabel('Viajantes solitarios') plt.ylabel('Porcentaje') plt.show() stats.binom_test(x=374,n=163+374,p=175/(175.+179.)) train.loc[:,['Name', 'Age']].head(10) train.loc[:,['Name', 'Age', 'Title']].head(10) print(combine['Age'].groupby(combine['Title']).count()) print(combine['Age'].groupby(combine['Title']).mean()) plt.figure(figsize=[12,10]) title = combine[combine['Title'].isin(['Mr', 'Mrs', 'Miss', 'Master', 'Rev', 'Dr'])] foo = title['Age'].hist(by=title['Title'], bins=np.arange(0,80,1)) plt.show() print(combine[combine['Title'].isin(["Mrs"])]['Age'].describe()) print("Young") tab = pd.crosstab(train['Survived'], train['Young']) print(tab) sns.barplot('Young', 'Survived', data=train) plt.show() print("Old") tab = pd.crosstab(train['Survived'], train['Old']) print(tab) sns.barplot('Old', 'Survived', data=train) plt.show() combine = pd.concat([train.drop('Survived',1), test]) survived = train['Survived'] combine['Sex'] = combine['Sex'].astype('category') combine['Sex'].cat.categories = [0,1] combine['Sex'] = combine['Sex'].astype('int') combine["Embarked"] = combine["Embarked"].astype("category") combine["Embarked"].cat.categories = [0,1,2] combine["Embarked"] = combine["Embarked"].astype("int") test = combine.iloc[len(test):] train = combine.iloc[:len(train)] train['Survived'] = survived training, testing = train_test_split(train, test_size=0.2, random_state=0) cols = ['Sex', 'Pclass', 'Child', 'Alone', 'Family', 'Age_know', 'Young', 'Old'] tcols = np.append(['Survived'], cols) df = training.loc[:,tcols].dropna() X = df.loc[:,cols] y = np.ravel(df.loc[:,['Survived']]) clf_log = LogisticRegression() clf_log = clf_log.fit(X,y) score_log = cross_val_score(clf_log, X, y, cv=5).mean() print(score_log) clf_pctr = Perceptron( class_weight='balanced' ) clf_pctr = clf_pctr.fit(X,y) score_pctr = cross_val_score(clf_pctr, X, y, cv=5).mean() print(score_pctr) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Lecture 7 Step3: Documenting Invariants Step4: Accessing Documentation (1) Step5: Accessing Documentation (2) Step6: Testing Step7: Principles of Testing Step8: Test at the boundaries Step9: We can also check to make sure the $a=0$ case is handled okay Step11: When you get an error Step12: Let's put our tests into one file. Step15: Code Coverage Step16: Run the tests and check code coverage Step17: Run the tests, report code coverage, and report missing lines. Step18: Run tests, including the doctests, report code coverage, and report missing lines. Step19: Let's put some tests in for the linear roots function. Step20: Now run the tests and check code coverage.
<ASSISTANT_TASK:> Python Code: def quad_roots(a=1.0, b=2.0, c=0.0): Returns the roots of a quadratic equation: ax^2 + bx + c = 0. INPUTS ======= a: float, optional, default value is 1 Coefficient of quadratic term b: float, optional, default value is 2 Coefficient of linear term c: float, optional, default value is 0 Constant term RETURNS ======== roots: 2-tuple of complex floats Has the form (root1, root2) unless a = 0 in which case a ValueError exception is raised EXAMPLES ========= >>> quad_roots(1.0, 1.0, -12.0) ((3+0j), (-4+0j)) import cmath # Can return complex numbers from square roots if a == 0: raise ValueError("The quadratic coefficient is zero. This is not a quadratic equation.") else: sqrtdisc = cmath.sqrt(b * b - 4.0 * a * c) r1 = -b + sqrtdisc r2 = -b - sqrtdisc return (r1 / 2.0 / a, r2 / 2.0 / a) def quad_roots(a=1.0, b=2.0, c=0.0): Returns the roots of a quadratic equation: ax^2 + bx + c. INPUTS ======= a: float, optional, default value is 1 Coefficient of quadratic term b: float, optional, default value is 2 Coefficient of linear term c: float, optional, default value is 0 Constant term RETURNS ======== roots: 2-tuple of complex floats Has the form (root1, root2) unless a = 0 in which case a ValueError exception is raised NOTES ===== PRE: - a, b, c have numeric type - three or fewer inputs POST: - a, b, and c are not changed by this function - raises a ValueError exception if a = 0 - returns a 2-tuple of roots EXAMPLES ========= >>> quad_roots(1.0, 1.0, -12.0) ((3+0j), (-4+0j)) import cmath # Can return complex numbers from square roots if a == 0: raise ValueError("The quadratic coefficient is zero. This is not a quadratic equation.") else: sqrtdisc = cmath.sqrt(b * b - 4.0 * a * c) r1 = -b + sqrtdisc r2 = -b - sqrtdisc return (r1 / 2.0 / a, r2 / 2.0 / a) quad_roots.__doc__.splitlines() import pydoc pydoc.doc(quad_roots) import doctest doctest.testmod(verbose=True) def test_quadroots(): assert quad_roots(1.0, 1.0, -12.0) == ((3+0j), (-4+0j)) test_quadroots() def test_quadroots_types(): try: quad_roots("", "green", "hi") except TypeError as err: assert(type(err) == TypeError) test_quadroots_types() def test_quadroots_zerocoeff(): try: quad_roots(a=0.0) except ValueError as err: assert(type(err) == ValueError) test_quadroots_zerocoeff() %%file roots.py def quad_roots(a=1.0, b=2.0, c=0.0): Returns the roots of a quadratic equation: ax^2 + bx + c = 0. INPUTS ======= a: float, optional, default value is 1 Coefficient of quadratic term b: float, optional, default value is 2 Coefficient of linear term c: float, optional, default value is 0 Constant term RETURNS ======== roots: 2-tuple of complex floats Has the form (root1, root2) unless a = 0 in which case a ValueError exception is raised EXAMPLES ========= >>> quad_roots(1.0, 1.0, -12.0) ((3+0j), (-4+0j)) import cmath # Can return complex numbers from square roots if a == 0: raise ValueError("The quadratic coefficient is zero. This is not a quadratic equation.") else: sqrtdisc = cmath.sqrt(b * b - 4.0 * a * c) r1 = -b + sqrtdisc r2 = -b - sqrtdisc return (r1 / 2.0 / a, r2 / 2.0 / a) %%file test_roots.py import roots def test_quadroots_result(): assert roots.quad_roots(1.0, 1.0, -12.0) == ((3+0j), (-4+0j)) def test_quadroots_types(): try: roots.quad_roots("", "green", "hi") except TypeError as err: assert(type(err) == TypeError) def test_quadroots_zerocoeff(): try: roots.quad_roots(a=0.0) except ValueError as err: assert(type(err) == ValueError) !pytest %%file roots.py def linear_roots(a=1.0, b=0.0): Returns the roots of a linear equation: ax+ b = 0. INPUTS ======= a: float, optional, default value is 1 Coefficient of linear term b: float, optional, default value is 0 Coefficient of constant term RETURNS ======== roots: 1-tuple of real floats Has the form (root) unless a = 0 in which case a ValueError exception is raised EXAMPLES ========= >>> linear_roots(1.0, 2.0) -2.0 if a == 0: raise ValueError("The linear coefficient is zero. This is not a linear equation.") else: return ((-b / a)) def quad_roots(a=1.0, b=2.0, c=0.0): Returns the roots of a quadratic equation: ax^2 + bx + c = 0. INPUTS ======= a: float, optional, default value is 1 Coefficient of quadratic term b: float, optional, default value is 2 Coefficient of linear term c: float, optional, default value is 0 Constant term RETURNS ======== roots: 2-tuple of complex floats Has the form (root1, root2) unless a = 0 in which case a ValueError exception is raised EXAMPLES ========= >>> quad_roots(1.0, 1.0, -12.0) ((3+0j), (-4+0j)) import cmath # Can return complex numbers from square roots if a == 0: raise ValueError("The quadratic coefficient is zero. This is not a quadratic equation.") else: sqrtdisc = cmath.sqrt(b * b - 4.0 * a * c) r1 = -b + sqrtdisc r2 = -b - sqrtdisc return (r1 / 2.0 / a, r2 / 2.0 / a) !pytest --cov !pytest --cov --cov-report term-missing !pytest --doctest-modules --cov --cov-report term-missing %%file test_roots.py import roots def test_quadroots_result(): assert roots.quad_roots(1.0, 1.0, -12.0) == ((3+0j), (-4+0j)) def test_quadroots_types(): try: roots.quad_roots("", "green", "hi") except TypeError as err: assert(type(err) == TypeError) def test_quadroots_zerocoeff(): try: roots.quad_roots(a=0.0) except ValueError as err: assert(type(err) == ValueError) def test_linearoots_result(): assert roots.linear_roots(2.0, -3.0) == 1.5 def test_linearroots_types(): try: roots.linear_roots("ocean", 6.0) except TypeError as err: assert(type(err) == TypeError) def test_linearroots_zerocoeff(): try: roots.linear_roots(a=0.0) except ValueError as err: assert(type(err) == ValueError) !pytest --doctest-modules --cov --cov-report term-missing <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: If you get something like "Pandas version Step2: Remind yourself Step3: Question. Can you see consolidation here? Step4: Answer these questions below. Code is sufficient, but it's often helpful to add comments to remind yourself what you did, and why. Step5: Question 4. Japan's aging population Step6: Comment. Now we have the number of people in any five-year age group running down columns. The column labels are the years. Step7: Question 5. Dynamics of the yield curve Step8: With the dataframe ylds
<ASSISTANT_TASK:> Python Code: # to make sure things are working, run this import pandas as pd print('Pandas version: ', pd.__version__) import pandas as pd import matplotlib.pyplot as plt import datetime as dt %matplotlib inline url = 'http://pages.stern.nyu.edu/~dbackus/Data/beer_production_1947-2004.xlsx' beer = pd.read_excel(url, skiprows=12, index_col=0) print('Dimensions:', beer.shape) beer[list(range(1,11))].head(3) vars = list(range(1,101)) # extract top 100 firms pdf = beer[vars].T # transpose (flip rows and columns) pdf[[1947, 1967, 1987, 2004]].head() # a basic plot fig, ax = plt.subplots() pdf[1947].plot(ax=ax, logy=True) pdf[1967].plot(ax=ax, logy=True) pdf[1987].plot(ax=ax, logy=True) pdf[2004].plot(ax=ax, logy=True) ax.legend() # for help ax.set_title? # this is easier if we put the basic plot in a function def make_plot(): fig, ax = plt.subplots() pdf[1947].plot(ax=ax, logy=True) pdf[1967].plot(ax=ax, logy=True) pdf[1987].plot(ax=ax, logy=True) pdf[2004].plot(ax=ax, logy=True) ax.legend() return ax ax = make_plot() ax.set_title('Beer sales by industry rank', fontsize=14) # line width: put lw=2 in each of the plot statements ax = make_plot() ax.set_xlabel('Industry Rank') ax.set_ylabel('Sales (log scale)') # log scale: otherwise the differences are too large # we can't show the alternative because some of the numbers are zero # color: we add color='somecolor' in each of the plot statements # data input (takes about 20 seconds on a wireless network) url1 = 'http://esa.un.org/unpd/wpp/DVD/Files/' url2 = '1_Indicators%20(Standard)/EXCEL_FILES/1_Population/' url3 = 'WPP2015_POP_F07_1_POPULATION_BY_AGE_BOTH_SEXES.XLS' url = url1 + url2 + url3 cols = [2, 4, 5] + list(range(6,28)) prj = pd.read_excel(url, sheetname=1, skiprows=16, parse_cols=cols, na_values=['…']) print('Dimensions: ', prj.shape) print('Column labels: ', prj.columns) # rename some variables pop = prj pop = pop.rename(columns={'Reference date (as of 1 July)': 'Year', 'Major area, region, country or area *': 'Country', 'Country code': 'Code'}) # select countries and years countries = ['Japan'] years = [2015, 2035, 2055, 2075, 2095] pop = pop[pop['Country'].isin(countries) & pop['Year'].isin(years)] pop = pop.drop(['Country', 'Code'], axis=1) pop = pop.set_index('Year').T pop = pop/1000 # convert population from thousands to millions pop.head() pop.tail() pop[[2015]].plot() pop[[2015]].plot(kind='bar') # my fav pop[[2015]].plot(kind='barh') fig, ax = plt.subplots(figsize=(10,6)) pop.plot(ax=ax) ax.set_title('Population by age') ax.set_xlabel('Population (millions)') ax.set_ylabel('Age Range') pop.plot(kind='bar', subplots=True, figsize=(6,8), sharey=True) # data input (takes about 20 seconds on a wireless network) url = 'http://pages.stern.nyu.edu/~dbackus/Data/feds200628.csv' gsw = pd.read_csv(url, skiprows=9, index_col=0, usecols=list(range(11)), parse_dates=True) print('Dimensions: ', gsw.shape) print('Column labels: ', gsw.columns) print('Row labels: ', gsw.index) # grab recent data df = gsw[gsw.index >= dt.datetime(2010,1,1)] # convert to annual, last day of year df = df.resample('A', how='last').sort_index() df.head() df.columns = list(range(1,11)) ylds = df.T ylds.head(3) fig, ax = plt.subplots() ylds.plot(ax=ax) ax.set_title('US Treasury Yields') ax.set_ylabel('Yield') ax.set_xlabel('Maturity in Years') ybar = ylds.mean(axis=1) ybar.plot(ax=ax, color='black', linewidth=3, linestyle='dashed') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: After doing a pip install, click on Reset Session so that the Python environment picks up the new package Step2: Preprocess JPEG images to TF Records Step3: Run as a Python module Step4: Then, run it on Cloud ML Engine with --use_tpu Step5: Monitoring training with TensorBoard Step6: Deploying and predicting with model Step7: To predict with the model, let's take one of the example images that is available on Google Cloud Storage <img src="http Step8: The online prediction service expects images to be base64 encoded as described here. Step9: Send it to the prediction service
<ASSISTANT_TASK:> Python Code: %%bash pip install apache-beam[gcp] import os PROJECT = 'cloud-training-demos' # REPLACE WITH YOUR PROJECT ID BUCKET = 'cloud-training-demos-ml' # REPLACE WITH YOUR BUCKET NAME REGION = 'us-central1' # REPLACE WITH YOUR BUCKET REGION e.g. us-central1 MODEL_TYPE = 'tpu' # do not change these os.environ['PROJECT'] = PROJECT os.environ['BUCKET'] = BUCKET os.environ['REGION'] = REGION os.environ['MODEL_TYPE'] = MODEL_TYPE os.environ['TFVERSION'] = '1.8' # Tensorflow version %%bash gcloud config set project $PROJECT gcloud config set compute/region $REGION %%bash gsutil cat gs://cloud-ml-data/img/flower_photos/train_set.csv | sed 's/,/ /g' | awk '{print $2}' | sort | uniq > /tmp/labels.txt %%bash gsutil cat gs://cloud-ml-data/img/flower_photos/train_set.csv | wc -l gsutil cat gs://cloud-ml-data/img/flower_photos/eval_set.csv | wc -l %%bash export PYTHONPATH=${PYTHONPATH}:${PWD}/flowersmodeltpu gsutil -m rm -rf gs://${BUCKET}/tpu/flowers/data python -m trainer.preprocess \ --train_csv gs://cloud-ml-data/img/flower_photos/train_set.csv \ --validation_csv gs://cloud-ml-data/img/flower_photos/eval_set.csv \ --labels_file /tmp/labels.txt \ --project_id $PROJECT \ --output_dir gs://${BUCKET}/tpu/flowers/data %%bash gsutil ls gs://${BUCKET}/tpu/flowers/data/ %%bash WITHOUT_TPU="--train_batch_size=2 --train_steps=5" OUTDIR=./flowers_trained rm -rf $OUTDIR export PYTHONPATH=${PYTHONPATH}:${PWD}/flowersmodeltpu python -m flowersmodeltpu.task \ --output_dir=$OUTDIR \ --num_train_images=3300 \ --num_eval_images=370 \ $WITHOUT_TPU \ --learning_rate=0.01 \ --project=${PROJECT} \ --train_data_path=gs://${BUCKET}/tpu/flowers/data/train* \ --eval_data_path=gs://${BUCKET}/tpu/flowers/data/validation* %%bash WITH_TPU="--train_batch_size=256 --train_steps=3000 --batch_norm --use_tpu" WITHOUT_TPU="--train_batch_size=2 --train_steps=5" OUTDIR=gs://${BUCKET}/flowers/trained_${MODEL_TYPE}_delete JOBNAME=flowers_${MODEL_TYPE}_$(date -u +%y%m%d_%H%M%S) echo $OUTDIR $REGION $JOBNAME gsutil -m rm -rf $OUTDIR gcloud ml-engine jobs submit training $JOBNAME \ --region=$REGION \ --module-name=flowersmodeltpu.task \ --package-path=${PWD}/flowersmodeltpu \ --job-dir=$OUTDIR \ --staging-bucket=gs://$BUCKET \ --scale-tier=BASIC_TPU \ --runtime-version=$TFVERSION \ -- \ --output_dir=$OUTDIR \ --num_train_images=3300 \ --num_eval_images=370 \ $WITH_TPU \ --learning_rate=0.01 \ --project=${PROJECT} \ --train_data_path=gs://${BUCKET}/tpu/flowers/data/train-* \ --eval_data_path=gs://${BUCKET}/tpu/flowers/data/validation-* %%bash MODEL_LOCATION=$(gsutil ls gs://${BUCKET}/flowers/trained_${MODEL_TYPE}/export/exporter | tail -1) saved_model_cli show --dir $MODEL_LOCATION --all from google.datalab.ml import TensorBoard TensorBoard().start('gs://{}/flowers/trained_{}'.format(BUCKET, MODEL_TYPE)) for pid in TensorBoard.list()['pid']: TensorBoard().stop(pid) print 'Stopped TensorBoard with pid {}'.format(pid) %%bash MODEL_NAME="flowers" MODEL_VERSION=${MODEL_TYPE} MODEL_LOCATION=$(gsutil ls gs://${BUCKET}/flowers/trained_${MODEL_TYPE}/export/exporter | tail -1) echo "Deleting and deploying $MODEL_NAME $MODEL_VERSION from $MODEL_LOCATION ... this will take a few minutes" #gcloud ml-engine versions delete --quiet ${MODEL_VERSION} --model ${MODEL_NAME} #gcloud ml-engine models delete ${MODEL_NAME} #gcloud ml-engine models create ${MODEL_NAME} --regions $REGION gcloud alpha ml-engine versions create ${MODEL_VERSION} --machine-type mls1-c4-m4 --model ${MODEL_NAME} --origin ${MODEL_LOCATION} --runtime-version=$TFVERSION %%bash gcloud alpha ml-engine models list %%bash IMAGE_URL=gs://cloud-ml-data/img/flower_photos/sunflowers/1022552002_2b93faf9e7_n.jpg # Copy the image to local disk. gsutil cp $IMAGE_URL flower.jpg # Base64 encode and create request message in json format. python -c 'import base64, sys, json; img = base64.b64encode(open("flower.jpg", "rb").read()).decode(); print(json.dumps({"image_bytes":{"b64": img}}))' &> request.json %%bash gcloud ml-engine predict \ --model=flowers2 \ --version=${MODEL_TYPE} \ --json-instances=./request.json <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 0.1 Directory Set up Step2: 0.2 Display images Step3: 1. Photometry set up Step4: Define starting values. Fill in values here Step5: Aperture photometry set up. Play around with adjusting the aperture radii sizes and see the resulting image under 'Tests' Step8: 1.1 Centroiding Step9: Use centroiding algorithm to find the actual centers of the targe and comparison. Step10: Inspect PSF to see whether shift makes sense Step12: 1.2 Aperture Photometry Step14: Sky annulus Step15: Extract values from regions Step16: Define new regions where the target and comparison are centered. Step17: Place mask on region Step18: Place mask on sky annulus slice. Step19: 1.3 Tests Step20: b. Disply image with aperture mask and sky annulus Step21: 2. Photometry Step22: Sum all flux inside target and comparison apertures and divide by number of pixels to get average count per pixel. Step23: 2.2 Optimize photometry aperture Step24: 2.3 Calculate the target's magnitude and uncertainty
<ASSISTANT_TASK:> Python Code: import numpy as np import matplotlib.pyplot as plt import astropy.io.fits as fits ## make matplotlib appear in the notebook rather than in a new window %matplotlib inline datadir = '' objname = '2016HO3' def plotfits(imno): img = fits.open(datadir+objname+'_{0:02d}.fits'.format(numb))[0].data f = plt.figure(figsize=(10,12)) #im = plt.imshow(img, cmap='hot') im = plt.imshow(img[480:580, 460:600], cmap='hot') plt.clim(1800, 2800) plt.colorbar(im, fraction=0.034, pad=0.04) plt.savefig("figure{0}.png".format(imno)) plt.show() numb = 1 plotfits(numb) numb = 2 plotfits(numb) partimg = fits.open(datadir+objname+'_01.fits'.format(numb))[0].data[480:580, 460:600] targcen = np.array([##,##]) ## target center compcen = np.array([##,##]) ## comparison center searchr = 6 ## search box size ap_r = 2 ## aperture radius sky_inner = 3 sky_outer = 5 def cent_weight(n): Assigns centroid weights wghts=np.zeros((n),np.float) for i in range(n): wghts[i]=float(i-n/2)+0.5 return wghts def calc_CoM(psf, weights): Finds Center of Mass of image cent=np.zeros((2),np.float) ### Write Equations for finding Center of Mass here ### return cent ## Cut a box between search limits, centered around targcen targbox = partimg[targcen[0]-searchr : targcen[0]+searchr, targcen[1]-searchr : targcen[1]+searchr] weights = cent_weight(len(targbox)) tcenoffset = calc_CoM(targbox, weights) print(tcenoffset) tcenter = targcen + tcenoffset plt.plot(sum(targbox)) plt.show() compbox = partimg[compcen[0]-searchr : compcen[0]+searchr, compcen[1]-searchr : compcen[1]+searchr] compw = cent_weight(len(compbox)) ccenoffset = calc_CoM(compbox,compw) ccenter = compcen + ccenoffset print(tcenter) compw def circle(npix, r1): Builds a circle pup=np.zeros((npix,npix),np.int) for i in range(npix): for j in range(npix): r=np.sqrt((float(i-npix/2)+0.5)**2+(float(j-npix/2)+0.5)**2) if r<=r1: pup[i,j]=1 return pup def annulus(npix, r_inner,r_outer=-1.): Builds an annulus pup=np.zeros((npix,npix),np.int) for i in range(npix): for j in range(npix): #### Fill in annulus form here #### if ((r<=r_outer)&(r>=r_inner)): pup[i,j]=1 return pup circmask = circle(searchr*2, ap_r) annmask = annulus(searchr*2, sky_inner, sky_outer) newtarg = partimg[int(round(tcenter[0]))-searchr : int(round(tcenter[0]))+searchr, int(round(tcenter[1]))-searchr : int(round(tcenter[1]))+searchr] newcomp = partimg[int(round(ccenter[0]))-searchr : int(round(ccenter[0]))+searchr, int(round(ccenter[1]))-searchr : int(round(ccenter[1]))+searchr] targaper = newtarg * circmask compaper = newcomp * circmask targann = newtarg * annmask compann = newcomp * annmask im = plt.imshow(partimg, cmap='hot') plt.clim(1800, 2800) plt.scatter(targcen[1], targcen[0], c='g', marker='x') plt.scatter(compcen[1], compcen[0], c='g', marker='x') plt.scatter(tcenter[1], tcenter[0], c='b', marker='x') plt.scatter(ccenter[1], ccenter[0], c='b', marker='x') plt.show() im = plt.imshow(targaper, cmap='hot') plt.clim(1800, 2800) plt.show() im = plt.imshow(targann, cmap='hot') plt.clim(1800, 2800) plt.show() def calcsnr(target, bg): signal = target - bg noise = np.sqrt(signal + bg) snr = signal / noise return snr, noise targc = np.sum(targaper) / np.sum(circmask) targbg= np.sum(targann) / np.sum(annmask) compc = np.sum(compaper) / np.sum(circmask) compbg= np.sum(compann) / np.sum(annmask) snr, noise = calcsnr(targc, targbg) print(snr) snr, noise = calcsnr(compc, compbg) print(snr) ## Write code here that tries a range of photometry apertures and finds the best SNR ## print(bestaper) print(snr) targc = circle(searchr*2, ap_r)*newtarg targskyc = annulus(searchr*2, sky_inner, sky_outer)*newtarg compc = circle(searchr*2, ap_r)*newcomp compskyc = annulus(searchr*2, sky_inner, sky_outer)*newcomp ratio = np.sum(compc)/np.sum(targc) ### complete here ### ### complete here ### ### complete here ### refmag = 19.4 ### complete here ### print("Measured Magnitude = {:0.3f} ± {:0.3f}".format(mag, sigmamag)) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Description Step7: 1.4. Land Atmosphere Flux Exchanges Step8: 1.5. Atmospheric Coupling Treatment Step9: 1.6. Land Cover Step10: 1.7. Land Cover Change Step11: 1.8. Tiling Step12: 2. Key Properties --&gt; Conservation Properties Step13: 2.2. Water Step14: 2.3. Carbon Step15: 3. Key Properties --&gt; Timestepping Framework Step16: 3.2. Time Step Step17: 3.3. Timestepping Method Step18: 4. Key Properties --&gt; Software Properties Step19: 4.2. Code Version Step20: 4.3. Code Languages Step21: 5. Grid Step22: 6. Grid --&gt; Horizontal Step23: 6.2. Matches Atmosphere Grid Step24: 7. Grid --&gt; Vertical Step25: 7.2. Total Depth Step26: 8. Soil Step27: 8.2. Heat Water Coupling Step28: 8.3. Number Of Soil layers Step29: 8.4. Prognostic Variables Step30: 9. Soil --&gt; Soil Map Step31: 9.2. Structure Step32: 9.3. Texture Step33: 9.4. Organic Matter Step34: 9.5. Albedo Step35: 9.6. Water Table Step36: 9.7. Continuously Varying Soil Depth Step37: 9.8. Soil Depth Step38: 10. Soil --&gt; Snow Free Albedo Step39: 10.2. Functions Step40: 10.3. Direct Diffuse Step41: 10.4. Number Of Wavelength Bands Step42: 11. Soil --&gt; Hydrology Step43: 11.2. Time Step Step44: 11.3. Tiling Step45: 11.4. Vertical Discretisation Step46: 11.5. Number Of Ground Water Layers Step47: 11.6. Lateral Connectivity Step48: 11.7. Method Step49: 12. Soil --&gt; Hydrology --&gt; Freezing Step50: 12.2. Ice Storage Method Step51: 12.3. Permafrost Step52: 13. Soil --&gt; Hydrology --&gt; Drainage Step53: 13.2. Types Step54: 14. Soil --&gt; Heat Treatment Step55: 14.2. Time Step Step56: 14.3. Tiling Step57: 14.4. Vertical Discretisation Step58: 14.5. Heat Storage Step59: 14.6. Processes Step60: 15. Snow Step61: 15.2. Tiling Step62: 15.3. Number Of Snow Layers Step63: 15.4. Density Step64: 15.5. Water Equivalent Step65: 15.6. Heat Content Step66: 15.7. Temperature Step67: 15.8. Liquid Water Content Step68: 15.9. Snow Cover Fractions Step69: 15.10. Processes Step70: 15.11. Prognostic Variables Step71: 16. Snow --&gt; Snow Albedo Step72: 16.2. Functions Step73: 17. Vegetation Step74: 17.2. Time Step Step75: 17.3. Dynamic Vegetation Step76: 17.4. Tiling Step77: 17.5. Vegetation Representation Step78: 17.6. Vegetation Types Step79: 17.7. Biome Types Step80: 17.8. Vegetation Time Variation Step81: 17.9. Vegetation Map Step82: 17.10. Interception Step83: 17.11. Phenology Step84: 17.12. Phenology Description Step85: 17.13. Leaf Area Index Step86: 17.14. Leaf Area Index Description Step87: 17.15. Biomass Step88: 17.16. Biomass Description Step89: 17.17. Biogeography Step90: 17.18. Biogeography Description Step91: 17.19. Stomatal Resistance Step92: 17.20. Stomatal Resistance Description Step93: 17.21. Prognostic Variables Step94: 18. Energy Balance Step95: 18.2. Tiling Step96: 18.3. Number Of Surface Temperatures Step97: 18.4. Evaporation Step98: 18.5. Processes Step99: 19. Carbon Cycle Step100: 19.2. Tiling Step101: 19.3. Time Step Step102: 19.4. Anthropogenic Carbon Step103: 19.5. Prognostic Variables Step104: 20. Carbon Cycle --&gt; Vegetation Step105: 20.2. Carbon Pools Step106: 20.3. Forest Stand Dynamics Step107: 21. Carbon Cycle --&gt; Vegetation --&gt; Photosynthesis Step108: 22. Carbon Cycle --&gt; Vegetation --&gt; Autotrophic Respiration Step109: 22.2. Growth Respiration Step110: 23. Carbon Cycle --&gt; Vegetation --&gt; Allocation Step111: 23.2. Allocation Bins Step112: 23.3. Allocation Fractions Step113: 24. Carbon Cycle --&gt; Vegetation --&gt; Phenology Step114: 25. Carbon Cycle --&gt; Vegetation --&gt; Mortality Step115: 26. Carbon Cycle --&gt; Litter Step116: 26.2. Carbon Pools Step117: 26.3. Decomposition Step118: 26.4. Method Step119: 27. Carbon Cycle --&gt; Soil Step120: 27.2. Carbon Pools Step121: 27.3. Decomposition Step122: 27.4. Method Step123: 28. Carbon Cycle --&gt; Permafrost Carbon Step124: 28.2. Emitted Greenhouse Gases Step125: 28.3. Decomposition Step126: 28.4. Impact On Soil Properties Step127: 29. Nitrogen Cycle Step128: 29.2. Tiling Step129: 29.3. Time Step Step130: 29.4. Prognostic Variables Step131: 30. River Routing Step132: 30.2. Tiling Step133: 30.3. Time Step Step134: 30.4. Grid Inherited From Land Surface Step135: 30.5. Grid Description Step136: 30.6. Number Of Reservoirs Step137: 30.7. Water Re Evaporation Step138: 30.8. Coupled To Atmosphere Step139: 30.9. Coupled To Land Step140: 30.10. Quantities Exchanged With Atmosphere Step141: 30.11. Basin Flow Direction Map Step142: 30.12. Flooding Step143: 30.13. Prognostic Variables Step144: 31. River Routing --&gt; Oceanic Discharge Step145: 31.2. Quantities Transported Step146: 32. Lakes Step147: 32.2. Coupling With Rivers Step148: 32.3. Time Step Step149: 32.4. Quantities Exchanged With Rivers Step150: 32.5. Vertical Grid Step151: 32.6. Prognostic Variables Step152: 33. Lakes --&gt; Method Step153: 33.2. Albedo Step154: 33.3. Dynamics Step155: 33.4. Dynamic Lake Extent Step156: 33.5. Endorheic Basins Step157: 34. Lakes --&gt; Wetlands
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'awi', 'awi-cm-1-0-hr', 'land') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.model_overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.land_atmosphere_flux_exchanges') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "water" # "energy" # "carbon" # "nitrogen" # "phospherous" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.atmospheric_coupling_treatment') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.land_cover') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "bare soil" # "urban" # "lake" # "land ice" # "lake ice" # "vegetated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.land_cover_change') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.conservation_properties.energy') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.conservation_properties.water') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.conservation_properties.carbon') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.timestepping_framework.timestep_dependent_on_atmosphere') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.timestepping_framework.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.timestepping_framework.timestepping_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.software_properties.repository') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.software_properties.code_version') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.key_properties.software_properties.code_languages') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.horizontal.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.horizontal.matches_atmosphere_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.vertical.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.grid.vertical.total_depth') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_water_coupling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.number_of_soil layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.structure') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.texture') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.organic_matter') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.water_table') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.continuously_varying_soil_depth') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.soil_map.soil_depth') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.prognostic') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.functions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "vegetation type" # "soil humidity" # "vegetation state" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.direct_diffuse') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "distinction between direct and diffuse albedo" # "no distinction between direct and diffuse albedo" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.snow_free_albedo.number_of_wavelength_bands') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.vertical_discretisation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.number_of_ground_water_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.lateral_connectivity') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "perfect connectivity" # "Darcian flow" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Bucket" # "Force-restore" # "Choisnel" # "Explicit diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.freezing.number_of_ground_ice_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.freezing.ice_storage_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.freezing.permafrost') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.drainage.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.hydrology.drainage.types') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "Gravity drainage" # "Horton mechanism" # "topmodel-based" # "Dunne mechanism" # "Lateral subsurface flow" # "Baseflow from groundwater" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.vertical_discretisation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.heat_storage') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "Force-restore" # "Explicit diffusion" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.soil.heat_treatment.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "soil moisture freeze-thaw" # "coupling with snow temperature" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.number_of_snow_layers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.density') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.water_equivalent') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.heat_content') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.temperature') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.liquid_water_content') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.snow_cover_fractions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "ground snow fraction" # "vegetation snow fraction" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "snow interception" # "snow melting" # "snow freezing" # "blowing snow" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.snow_albedo.type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "prescribed" # "constant" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.snow.snow_albedo.functions') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "vegetation type" # "snow age" # "snow density" # "snow grain type" # "aerosol deposition" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.dynamic_vegetation') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_representation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "vegetation types" # "biome types" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_types') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "broadleaf tree" # "needleleaf tree" # "C3 grass" # "C4 grass" # "vegetated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biome_types') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "evergreen needleleaf forest" # "evergreen broadleaf forest" # "deciduous needleleaf forest" # "deciduous broadleaf forest" # "mixed forest" # "woodland" # "wooded grassland" # "closed shrubland" # "opne shrubland" # "grassland" # "cropland" # "wetlands" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_time_variation') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "fixed (not varying)" # "prescribed (varying from files)" # "dynamical (varying from simulation)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.vegetation_map') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.interception') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.phenology') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic (vegetation map)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.phenology_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.leaf_area_index') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prescribed" # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.leaf_area_index_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biomass') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biomass_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biogeography') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.biogeography_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.stomatal_resistance') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "light" # "temperature" # "water availability" # "CO2" # "O3" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.stomatal_resistance_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.vegetation.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.number_of_surface_temperatures') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.evaporation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "alpha" # "beta" # "combined" # "Monteith potential evaporation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.energy_balance.processes') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "transpiration" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.anthropogenic_carbon') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "grand slam protocol" # "residence time" # "decay time" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.number_of_carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.forest_stand_dynamics') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.photosynthesis.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.autotrophic_respiration.maintainance_respiration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.autotrophic_respiration.growth_respiration') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.allocation.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.allocation.allocation_bins') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "leaves + stems + roots" # "leaves + stems + roots (leafy + woody)" # "leaves + fine roots + coarse roots + stems" # "whole plant (no distinction)" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.allocation.allocation_fractions') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "fixed" # "function of vegetation type" # "function of plant allometry" # "explicitly calculated" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.phenology.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.vegetation.mortality.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.number_of_carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.decomposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.litter.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.number_of_carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.carbon_pools') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.decomposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.soil.method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.is_permafrost_included') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.emitted_greenhouse_gases') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.decomposition') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.carbon_cycle.permafrost_carbon.impact_on_soil_properties') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.nitrogen_cycle.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.tiling') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.grid_inherited_from_land_surface') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.grid_description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.number_of_reservoirs') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.water_re_evaporation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "flood plains" # "irrigation" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.coupled_to_atmosphere') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.coupled_to_land') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.quantities_exchanged_with_atmosphere') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "heat" # "water" # "tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.basin_flow_direction_map') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "present day" # "adapted for other periods" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.flooding') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.oceanic_discharge.discharge_type') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "direct (large rivers)" # "diffuse" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.river_routing.oceanic_discharge.quantities_transported') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "heat" # "water" # "tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.coupling_with_rivers') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.time_step') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.quantities_exchanged_with_rivers') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "heat" # "water" # "tracers" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.vertical_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.prognostic_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.ice_treatment') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.albedo') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "prognostic" # "diagnostic" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.dynamics') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "No lake dynamics" # "vertical" # "horizontal" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.dynamic_lake_extent') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.method.endorheic_basins') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.land.lakes.wetlands.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 1. Import dataset Step2: Throughout the Machine Learning part of this project we will be using scikit-learn, an open source machine learning library for the Python programming language. Step3: We are explaining 1% of the variance with our model. Definitely nothing to write home about... This was to be expected anyway, since the numerical data we have added pertain to a whole zip code, not each individual restaurant. Step4: b. Linear Regression on averaged data Step5: It is of paramount importance to remember that we are NOT supposed to be extracting any useful information from this regression model we are about to apply. After all, we only have a tiny number of rows, each one corresponding to an entire Zip Code. However we might still be able to create a model that will yield some strong trends which would help us make, if not a prediction, an educated guess about the average score of all restaurants in a Zip Code with given demographic data. Step6: This is a not a very exciting score for our model; We are explaining 35.2% of the variance, but we have to keep into account that Step7: We can see from the scatterplot and the Pearson Correlation Coefficient that there is indeed a weak positive correlation between the two quantities. Recall that for Simple Linear Regression models like ours, the square of the Pearson Correlation Coefficient is equal to the R-squared parameter we have calculated above, i.e. the fraction of the variance in our data explained by our model. Step8: I was expecting a much lower score for this model compared to the previous one. Population isn't really a good indicator of restaurants' health inspection scores, since the more populous Zip Codes (for instance Step9: It is quite interesting that the correlation between the two quantities is negative. Of course this could just mean that the really "small" Zip Codes correspond to rather affluent (and hence, sparsely populated) neighborhoods with very few restaurants that probably score really well in the inspection. Step10: Predict Score using zip code's Home Ownership Step11: This is quite an interesting and even unexpected result, since we had this predisposition to believe that since Median Income and Home Ownership Percentages are (or should be) strongly correlated, then the percentage of Home Ownership should be a respectable indicator (if not a predictor) for successful restaurants in the context of Health Inspections. It seems it doesn't play such a role though. Step12: This "best fit" line illustrates how disastrous this model is. Since the percentage of home owners in a Zip Code is bounded between 0 and 100%, the model "predicts" that all restaurants, regardless of Home_Ownership fraction, would score between 90 and 92, without taking into account uncertainty for the slope... Step13: The three attempts for individual linear regression predictive models have not really made us any wiser, even though they did at least show us some broad trends pertinent to our data set, which we could loosely extrapolate to other urban areas with the characteristics of Austin. (good luck with that!)
<ASSISTANT_TASK:> Python Code: import warnings warnings.filterwarnings('ignore') import pandas as pd import numpy as np import matplotlib.pyplot as plt import seaborn as sns %matplotlib inline #Reading the dataset in a dataframe using Pandas df = pd.read_csv('../data/master.csv') #Print first observations df.head() # There are some NaN values in our numerics (UT Campus and ABIA) # Let us remove rows from those zip codes from the DataFrame: df = df[np.isfinite(df['Population'])] # create X and y feature_cols = ['Med_Income', 'Population', 'Home_Ownership'] X = df[feature_cols] y = df.Score # follow the usual sklearn pattern: import, instantiate, fit from sklearn.linear_model import LinearRegression lm = LinearRegression() lm.fit(X, y) # print intercept and coefficients print lm.intercept_ print lm.coef_ # pair the feature names with the coefficients zip(feature_cols, lm.coef_) # Explained variance score: 1 is perfect prediction print('Variance score: %.2f' % lm.score(X,y)) # Let us check how many rows we are left with after excluding the UT Campus and ABIA areas: len(df) average_scores = df.groupby('Zip_Code').mean() len(average_scores) average_scores.head() from sklearn.linear_model import LinearRegression lm = LinearRegression() X = average_scores['Med_Income'].values y = average_scores['Score'].values # Check the shapes of the X and y vectors: print X.shape print y.shape # Reshape to get them to work when we fit the model: X = X.reshape(34,1); y = y.reshape(34,1); # Fit linear regression model: lm.fit(X, y) # print intercept and coefficients print lm.intercept_ print lm.coef_ # And score it: lm.score(X,y) # Visualization using Seaborn: sns.lmplot(x="Med_Income", y="Score", data=average_scores); print "The Pearson Correlation coefficient between Median Income and Average Score is {0}".\ format(np.corrcoef(average_scores['Med_Income'].values, average_scores['Score'].values)[1][0]) from sklearn.linear_model import LinearRegression lm = LinearRegression() X = average_scores['Population'].values y = average_scores['Score'].values # Check the shapes of the X and y vectors: print X.shape print y.shape # Reshape to get them to work when we fit the model: X = X.reshape(34,1); y = y.reshape(34,1); # Fit linear regression model: lm.fit(X, y) # print intercept and coefficients print lm.intercept_ print lm.coef_ # And score it: lm.score(X,y) # Visualization using Seaborn: sns.lmplot(x="Population", y="Score", data=average_scores); print "The Pearson Correlation coefficient between Population and Average Score is {0}".\ format(np.corrcoef(average_scores['Population'].values, average_scores['Score'].values)[1][0]) print "For a predicted score: {0} (just below the cutoff), the population would have to be {1}".\ format(lm.predict(450000)[0][0], 450000) from sklearn.linear_model import LinearRegression lm = LinearRegression() X = average_scores['Home_Ownership'].values y = average_scores['Score'].values # Reshape the X and y vectors to get them to work when we fit the model: X = X.reshape(34,1); y = y.reshape(34,1); # Fit linear regression model: lm.fit(X, y) # print intercept and coefficients print lm.intercept_ print lm.coef_ # And score it: lm.score(X,y) # Visualization using Seaborn: sns.lmplot(x="Home_Ownership", y="Score", data=average_scores); print "The Pearson Correlation coefficient between Home Ownership Percentage and Average Score is {0}".\ format(np.corrcoef(average_scores['Home_Ownership'].values, average_scores['Score'].values)[1][0]) feature_cols = ['Med_Income', 'Population', 'Home_Ownership'] from sklearn.linear_model import LinearRegression lm = LinearRegression() X = average_scores[feature_cols] y = average_scores['Score'].values # Check the shapes of the X and y vectors: print X.shape print y.shape y = y.reshape(34,1); # Fit linear regression model: lm.fit(X, y) # print intercept and coefficients print lm.intercept_ print lm.coef_ # And score it: lm.score(X,y) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Set up our source space. Step2: Export source positions to nift file
<ASSISTANT_TASK:> Python Code: # Author: Annalisa Pascarella <a.pascarella@iac.cnr.it> # # License: BSD (3-clause) import os.path as op import matplotlib.pyplot as plt import mne from mne.datasets import sample from mne import setup_volume_source_space from mne import make_forward_solution from mne.minimum_norm import make_inverse_operator, apply_inverse from nilearn import plotting # Set dir data_path = sample.data_path() subject = 'sample' data_dir = op.join(data_path, 'MEG', subject) subjects_dir = op.join(data_path, 'subjects') bem_dir = op.join(subjects_dir, subject, 'bem') # Set file names fname_mixed_src = op.join(bem_dir, '%s-oct-6-mixed-src.fif' % subject) fname_aseg = op.join(subjects_dir, subject, 'mri', 'aseg.mgz') fname_model = op.join(bem_dir, '%s-5120-bem.fif' % subject) fname_bem = op.join(bem_dir, '%s-5120-bem-sol.fif' % subject) fname_evoked = data_dir + '/sample_audvis-ave.fif' fname_trans = data_dir + '/sample_audvis_raw-trans.fif' fname_fwd = data_dir + '/sample_audvis-meg-oct-6-mixed-fwd.fif' fname_cov = data_dir + '/sample_audvis-shrunk-cov.fif' # List substructures we are interested in. We select only the # sub structures we want to include in the source space labels_vol = ['Left-Amygdala', 'Left-Thalamus-Proper', 'Left-Cerebellum-Cortex', 'Brain-Stem', 'Right-Amygdala', 'Right-Thalamus-Proper', 'Right-Cerebellum-Cortex'] # Get a surface-based source space. We could set one up like this:: # # >>> src = setup_source_space(subject, fname=None, spacing='oct6', # add_dist=False, subjects_dir=subjects_dir) # # But we already have one saved: src = mne.read_source_spaces(op.join(bem_dir, 'sample-oct-6-src.fif')) # Now we create a mixed src space by adding the volume regions specified in the # list labels_vol. First, read the aseg file and the source space bounds # using the inner skull surface (here using 10mm spacing to save time): vol_src = setup_volume_source_space( subject, mri=fname_aseg, pos=7.0, bem=fname_model, volume_label=labels_vol, subjects_dir=subjects_dir, verbose=True) # Generate the mixed source space src += vol_src # Visualize the source space. src.plot(subjects_dir=subjects_dir) n = sum(src[i]['nuse'] for i in range(len(src))) print('the src space contains %d spaces and %d points' % (len(src), n)) # We could write the mixed source space with:: # # >>> write_source_spaces(fname_mixed_src, src, overwrite=True) # nii_fname = op.join(bem_dir, '%s-mixed-src.nii' % subject) src.export_volume(nii_fname, mri_resolution=True) plotting.plot_img(nii_fname, cmap='nipy_spectral') plt.show() # Compute the fwd matrix fwd = make_forward_solution(fname_evoked, fname_trans, src, fname_bem, mindist=5.0, # ignore sources<=5mm from innerskull meg=True, eeg=False, n_jobs=1) leadfield = fwd['sol']['data'] print("Leadfield size : %d sensors x %d dipoles" % leadfield.shape) src_fwd = fwd['src'] n = sum(src_fwd[i]['nuse'] for i in range(len(src_fwd))) print('the fwd src space contains %d spaces and %d points' % (len(src_fwd), n)) # Load data condition = 'Left Auditory' evoked = mne.read_evokeds(fname_evoked, condition=condition, baseline=(None, 0)) noise_cov = mne.read_cov(fname_cov) # Compute inverse solution and for each epoch snr = 3.0 # use smaller SNR for raw data inv_method = 'MNE' # sLORETA, MNE, dSPM parc = 'aparc' # the parcellation to use, e.g., 'aparc' 'aparc.a2009s' lambda2 = 1.0 / snr ** 2 # Compute inverse operator inverse_operator = make_inverse_operator(evoked.info, fwd, noise_cov, depth=None, fixed=False) stcs = apply_inverse(evoked, inverse_operator, lambda2, inv_method, pick_ori=None) # Get labels for FreeSurfer 'aparc' cortical parcellation with 34 labels/hemi labels_parc = mne.read_labels_from_annot(subject, parc=parc, subjects_dir=subjects_dir) # Average the source estimates within each label of the cortical parcellation # and each sub structure contained in the src space # If mode = 'mean_flip' this option is used only for the surface cortical label src = inverse_operator['src'] label_ts = mne.extract_label_time_course([stcs], labels_parc, src, mode='mean', allow_empty=True, return_generator=False) # plot the times series of 2 labels fig, axes = plt.subplots(1) axes.plot(1e3 * stcs.times, label_ts[0][0, :], 'k', label='bankssts-lh') axes.plot(1e3 * stcs.times, label_ts[0][71, :].T, 'r', label='Brain-stem') axes.set(xlabel='Time (ms)', ylabel='MNE current (nAm)') axes.legend() mne.viz.tight_layout() plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2
<ASSISTANT_TASK:> Python Code: plt.figure(figsize=(10,6)); plt.scatter(Peaks,Energy); plt.xlim(0,240) plt.ylim(0,1000) plt.xlabel('x (mm)'); plt.ylabel('y (mm)'); plt.plot(xlots,yfit); plt.legend(['data','Fit'],loc='lower right'); plt.text(5,900,'a = %.3f +/- %.3f keV' % (plsq[0], np.sqrt(pcov[0,0])),size=17) plt.text(5,800,'b = %.3f +/- %.3f keV MCA$^{-1}$' % (plsq[1], np.sqrt(pcov[1,1])),size=17) plt.text(5,700,'c = (%.4f +/- %.4f)$\cdot 10^{-3}$ keV MCA$^{-2}$' % (plsq[2]*1e3, np.sqrt(pcov[2,2])*1e3),size=17) plt.xlabel('MCA Number',fontsize=20); plt.ylabel('Energy (keV)',fontsize = 20); plt.xticks(size = 13); plt.yticks(size = 13); plt.savefig('LinearMCAFit') def deltaE(N,dN): daN = np.sqrt((da/a)**2 + (dN/N)**2)*(a*N) dbN2 = np.sqrt((db/b)**2 + 4*(dN/N)**2)*(b*N**2) dcN3 = np.sqrt((dc/c**2) + 9*(dN/N)**2)*(c*N**3) dEMeas = np.sqrt(daN**2 + dbN2**2 + dcN3**2)*1e-3 #Convert to KeV return dEMeas N = np.array([102.40]) #Channel number of 60 degree scattered photopeak dN = np.array([9.00]) theta = np.array([60])*np.pi/180 EMeas = myfun(N,a,b,c) EMeas dEMeas = deltaE(N,dN) dEMeas Eo = 661.7 #Initial keV energy of gamma rays (before scattering) mc2 = 511 #electron mass in keV def ECompton(Eo,mc2,theta): return Eo/(1+(Eo/mc2)*(1-np.cos(theta))) EComp = ECompton(Eo,mc2,theta) EComp thetas = np.linspace(-np.pi,np.pi,50); plt.figure(figsize=(10,6)); plt.plot(thetas,ECompton(Eo,mc2,thetas),label='Compton'); plt.errorbar(theta,EMeas,dEMeas); plt.scatter(theta,EMeas,dEMeas,label='Measured'); plt.legend(); plt.xlabel('Scattering Angle [Radians]',fontsize=20); plt.ylabel('Final Energy (keV)',fontsize = 20); plt.xticks(size = 13); plt.yticks(size = 13); plt.xlim(-np.pi,np.pi); #plt.savefig('Sample') def Thomson(theta): ro = 2.82*1e-15 return (1/2)*(ro**2)*(1+np.cos(theta)**2) #set b = 1 def KleinNishina(theta): ro = 2.82*1e-15 gamma = Eo/mc2 return (1/2)*(ro**2)*(1+np.cos(theta)**2)*((1+gamma*(1-np.cos(theta)))**(-2))*(1+((gamma*(1-np.cos(theta)))**2)/((1+np.cos(theta)**2)*(1+gamma*(1-np.cos(theta))))) thetas = np.linspace(-np.pi,np.pi,50); plt.figure(figsize=(10,6)); plt.plot(thetas,Thomson(thetas),label='Thomson'); plt.plot(thetas,KleinNishina(thetas),label='Klein-Nishina'); plt.legend(); plt.xlabel('Scattering Angle [Radians]',fontsize=20); plt.ylabel('Differential Cross section',fontsize = 20); plt.xticks(size = 13); plt.yticks(size = 13); plt.xlim(-np.pi,np.pi); #plt.savefig('Sample') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: CONTENTS Step2: Check the shape of these NumPy arrays to make sure we have loaded the database correctly. Step3: Visualizing Data Step4: Let's have a look at the average of all the images of training and testing data. Step5: Testing Step6: Now, we will initialize a DataSet with our training examples, so we can use it in our algorithms. Step7: Moving forward we can use MNIST_DataSet to test our algorithms. Step8: It is obvious that this Learner is not very efficient. In fact, it will guess correctly in only 1135/10000 of the samples, roughly 10%. It is very fast though, so it might have its use as a quick first guess. Step9: To make sure that the output we got is correct, let's plot that image along with its label. Step10: k-Nearest Neighbors Step11: To make sure that the output we got is correct, let's plot that image along with its label. Step12: Hurray! We've got it correct. Don't worry if our algorithm predicted a wrong class. With this techinique we have only ~97% accuracy on this dataset. Step13: Visualizing Data Step14: Let's now see how many times each class appears in the training and testing data Step15: Unlike Digits, in Fashion all items appear the same number of times. Step16: Plurality Learner Step17: Naive-Bayes Step18: Let's check if we got the right output. Step19: K-Nearest Neighbors Step20: The output is 1, which means the item at index 211 is a trouser. Let's see if the prediction is correct
<ASSISTANT_TASK:> Python Code: from learning import * from notebook import * train_img, train_lbl, test_img, test_lbl = load_MNIST() print("Training images size:", train_img.shape) print("Training labels size:", train_lbl.shape) print("Testing images size:", test_img.shape) print("Testing labels size:", test_lbl.shape) # takes 5-10 seconds to execute this show_MNIST(train_lbl, train_img) # takes 5-10 seconds to execute this show_MNIST(test_lbl, test_img) print("Average of all images in training dataset.") show_ave_MNIST(train_lbl, train_img) print("Average of all images in testing dataset.") show_ave_MNIST(test_lbl, test_img) print(train_img.shape, train_lbl.shape) temp_train_lbl = train_lbl.reshape((60000,1)) training_examples = np.hstack((train_img, temp_train_lbl)) print(training_examples.shape) # takes ~10 seconds to execute this MNIST_DataSet = DataSet(examples=training_examples, distance=manhattan_distance) pL = PluralityLearner(MNIST_DataSet) print(pL(177)) %matplotlib inline print("Actual class of test image:", test_lbl[177]) plt.imshow(test_img[177].reshape((28,28))) # takes ~45 Secs. to execute this nBD = NaiveBayesLearner(MNIST_DataSet, continuous = False) print(nBD(test_img[0])) %matplotlib inline print("Actual class of test image:", test_lbl[0]) plt.imshow(test_img[0].reshape((28,28))) # takes ~20 Secs. to execute this kNN = NearestNeighborLearner(MNIST_DataSet, k=3) print(kNN(test_img[211])) %matplotlib inline print("Actual class of test image:", test_lbl[211]) plt.imshow(test_img[211].reshape((28,28))) train_img, train_lbl, test_img, test_lbl = load_MNIST(fashion=True) # takes 5-10 seconds to execute this show_MNIST(train_lbl, train_img, fashion=True) # takes 5-10 seconds to execute this show_MNIST(test_lbl, test_img, fashion=True) print("Average of all images in training dataset.") show_ave_MNIST(train_lbl, train_img, fashion=True) print("Average of all images in testing dataset.") show_ave_MNIST(test_lbl, test_img, fashion=True) temp_train_lbl = train_lbl.reshape((60000,1)) training_examples = np.hstack((train_img, temp_train_lbl)) # takes ~10 seconds to execute this MNIST_DataSet = DataSet(examples=training_examples, distance=manhattan_distance) pL = PluralityLearner(MNIST_DataSet) print(pL(177)) %matplotlib inline print("Actual class of test image:", test_lbl[177]) plt.imshow(test_img[177].reshape((28,28))) # takes ~45 Secs. to execute this nBD = NaiveBayesLearner(MNIST_DataSet, continuous = False) print(nBD(test_img[24])) %matplotlib inline print("Actual class of test image:", test_lbl[24]) plt.imshow(test_img[24].reshape((28,28))) # takes ~20 Secs. to execute this kNN = NearestNeighborLearner(MNIST_DataSet, k=3) print(kNN(test_img[211])) %matplotlib inline print("Actual class of test image:", test_lbl[211]) plt.imshow(test_img[211].reshape((28,28))) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The purpose of the exersise is to manipulate and plot the current weather of a number of European cities. The data has been downloaded from Openweather, and has been loaded for you below using the given function read_weather. Step2: Part 1 Step3: Optional extension
<ASSISTANT_TASK:> Python Code: import matplotlib.pyplot as plt import numpy as np import pickle %matplotlib inline def read_weather(): with open('data/weather.pkl', 'rb') as f: return pickle.load(f) # The file weather.pkl contains a list of dictionaries Data = read_weather() Data[0] # Implement Q1 part 1 here: # ------------------------- tempr_dict = {} for countrydata in Data: tempr_dict[countrydata['name']] = (countrydata['coord']['lat'], countrydata['main']['temp']) print(tempr_dict) # Run this cell to tests if you have completed part 1 correctly: assert(all(key in tempr_dict for key in ['Berlin', 'Kiev', 'London', 'Moscow', 'Southampton'])),\ 'keys of your weather dictionary should be Berlin, Kiev, London, Moscow, Southampton' assert(len(tempr_dict['Moscow']) == 2), "Entries in your dictionary should be a tuple of two values" # Part 2: fig = plt.figure(figsize=(12, 5)) ax = fig.add_subplot(111) for name, value in tempr_dict.items(): ax.plot(value[0], value[1], 'bx') ax.annotate(name, value) ax.set_title('City Temperatures') ax.set_xlabel('Latitude') ax.set_ylabel('Temp (K)') # Implement Q2 pt 1 here # ----------------------- weather_dict = {} for countrydata in Data: weather_dict[countrydata['name']] = countrydata['coord']['lat'], countrydata['main'] print(weather_dict) def plot_weather_lattitude(weather_dictionary, var_name): fig = plt.figure(figsize=(12, 5)) ax = fig.add_subplot(111) for name, value in weather_dictionary.items(): ax.plot(value[0], value[1][var_name], 'bx') ax.annotate(name, (value[0], value[1][var_name])) ax.set_xlabel('Latitude') ax.set_ylabel(var_name) # Here are the variables that should be in your data weather_vars = ['temp', 'temp_max', 'temp_min', 'pressure', 'humidity'] # EXERCISE: Loop over the variable strings above and plot them for var_name in weather_vars: plot_weather_lattitude(weather_dict, var_name) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Generating stats files with cProfile Step2: Table/Grid View Step3: Chart View Step5: Comparing Alternative Implementations Step6: Comparison View
<ASSISTANT_TASK:> Python Code: %matplotlib inline import pandas as pd import numpy as np import cProfile from pstatsviewer import StatsViewer from qgrid import nbinstall nbinstall() # Construct two 5000 x 8 frames with random floats. df1 = pd.DataFrame( np.random.randn(5000, 8), columns=[chr(ord('A') + i) for i in range(8)], index=range(5000), ) df2 = pd.DataFrame( np.random.randn(5000, 8), columns=[chr(ord('A') + i) for i in range(8)], index=range(5000, 10000), ) df1.head(5) from qgrid import show_grid def concat_naive(): for i in range(500): pd.concat([df1, df2]) cProfile.run( 'concat_naive()', 'naive.stats', ) slow = StatsViewer("naive.stats") slow.table() slow.chart() def concat_fast(): Concatenate using numpy primitives instead of pd.concat. for i in range(500): pd.DataFrame( np.vstack([df1.values, df2.values]), columns=df1.columns, index=np.hstack([ df1.index.values, df2.index.values, ]) ) cProfile.run( 'concat_fast()', 'fast.stats', ) fast = StatsViewer("fast.stats") slow.compare_table(fast, lsuffix="_slow", rsuffix="_fast") slow.compare_chart(fast, 'tottime', 25) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Making new Layers and Models via subclassing Step2: The Layer class Step3: You would use a layer by calling it on some tensor input(s), much like a Python Step4: Note that the weights w and b are automatically tracked by the layer upon Step5: Note you also have access to a quicker shortcut for adding weight to a layer Step6: Layers can have non-trainable weights Step7: It's part of layer.weights, but it gets categorized as a non-trainable weight Step8: Best practice Step9: In many cases, you may not know in advance the size of your inputs, and you Step10: The __call__() method of your layer will automatically run build the first time Step11: Implementing build() separately as shown above nicely separates creating weights Step12: The add_loss() method Step13: These losses (including those created by any inner layer) can be retrieved via Step14: In addition, the loss property also contains regularization losses created Step15: These losses are meant to be taken into account when writing training loops, Step16: The add_metric() method Step17: Metrics tracked in this way are accessible via layer.metrics Step18: Just like for add_loss(), these metrics are tracked by fit() Step19: You can optionally enable serialization on your layers Step20: Note that the __init__() method of the base Layer class takes some keyword Step21: If you need more flexibility when deserializing the layer from its config, you Step26: Privileged mask argument in the call() method Step27: Let's write a simple training loop on MNIST Step28: Note that since the VAE is subclassing Model, it features built-in training Step29: Beyond object-oriented development
<ASSISTANT_TASK:> Python Code: #@title Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import tensorflow as tf from tensorflow import keras class Linear(keras.layers.Layer): def __init__(self, units=32, input_dim=32): super(Linear, self).__init__() w_init = tf.random_normal_initializer() self.w = tf.Variable( initial_value=w_init(shape=(input_dim, units), dtype="float32"), trainable=True, ) b_init = tf.zeros_initializer() self.b = tf.Variable( initial_value=b_init(shape=(units,), dtype="float32"), trainable=True ) def call(self, inputs): return tf.matmul(inputs, self.w) + self.b x = tf.ones((2, 2)) linear_layer = Linear(4, 2) y = linear_layer(x) print(y) assert linear_layer.weights == [linear_layer.w, linear_layer.b] class Linear(keras.layers.Layer): def __init__(self, units=32, input_dim=32): super(Linear, self).__init__() self.w = self.add_weight( shape=(input_dim, units), initializer="random_normal", trainable=True ) self.b = self.add_weight(shape=(units,), initializer="zeros", trainable=True) def call(self, inputs): return tf.matmul(inputs, self.w) + self.b x = tf.ones((2, 2)) linear_layer = Linear(4, 2) y = linear_layer(x) print(y) class ComputeSum(keras.layers.Layer): def __init__(self, input_dim): super(ComputeSum, self).__init__() self.total = tf.Variable(initial_value=tf.zeros((input_dim,)), trainable=False) def call(self, inputs): self.total.assign_add(tf.reduce_sum(inputs, axis=0)) return self.total x = tf.ones((2, 2)) my_sum = ComputeSum(2) y = my_sum(x) print(y.numpy()) y = my_sum(x) print(y.numpy()) print("weights:", len(my_sum.weights)) print("non-trainable weights:", len(my_sum.non_trainable_weights)) # It's not included in the trainable weights: print("trainable_weights:", my_sum.trainable_weights) class Linear(keras.layers.Layer): def __init__(self, units=32, input_dim=32): super(Linear, self).__init__() self.w = self.add_weight( shape=(input_dim, units), initializer="random_normal", trainable=True ) self.b = self.add_weight(shape=(units,), initializer="zeros", trainable=True) def call(self, inputs): return tf.matmul(inputs, self.w) + self.b class Linear(keras.layers.Layer): def __init__(self, units=32): super(Linear, self).__init__() self.units = units def build(self, input_shape): self.w = self.add_weight( shape=(input_shape[-1], self.units), initializer="random_normal", trainable=True, ) self.b = self.add_weight( shape=(self.units,), initializer="random_normal", trainable=True ) def call(self, inputs): return tf.matmul(inputs, self.w) + self.b # At instantiation, we don't know on what inputs this is going to get called linear_layer = Linear(32) # The layer's weights are created dynamically the first time the layer is called y = linear_layer(x) class MLPBlock(keras.layers.Layer): def __init__(self): super(MLPBlock, self).__init__() self.linear_1 = Linear(32) self.linear_2 = Linear(32) self.linear_3 = Linear(1) def call(self, inputs): x = self.linear_1(inputs) x = tf.nn.relu(x) x = self.linear_2(x) x = tf.nn.relu(x) return self.linear_3(x) mlp = MLPBlock() y = mlp(tf.ones(shape=(3, 64))) # The first call to the `mlp` will create the weights print("weights:", len(mlp.weights)) print("trainable weights:", len(mlp.trainable_weights)) # A layer that creates an activity regularization loss class ActivityRegularizationLayer(keras.layers.Layer): def __init__(self, rate=1e-2): super(ActivityRegularizationLayer, self).__init__() self.rate = rate def call(self, inputs): self.add_loss(self.rate * tf.reduce_sum(inputs)) return inputs class OuterLayer(keras.layers.Layer): def __init__(self): super(OuterLayer, self).__init__() self.activity_reg = ActivityRegularizationLayer(1e-2) def call(self, inputs): return self.activity_reg(inputs) layer = OuterLayer() assert len(layer.losses) == 0 # No losses yet since the layer has never been called _ = layer(tf.zeros(1, 1)) assert len(layer.losses) == 1 # We created one loss value # `layer.losses` gets reset at the start of each __call__ _ = layer(tf.zeros(1, 1)) assert len(layer.losses) == 1 # This is the loss created during the call above class OuterLayerWithKernelRegularizer(keras.layers.Layer): def __init__(self): super(OuterLayerWithKernelRegularizer, self).__init__() self.dense = keras.layers.Dense( 32, kernel_regularizer=tf.keras.regularizers.l2(1e-3) ) def call(self, inputs): return self.dense(inputs) layer = OuterLayerWithKernelRegularizer() _ = layer(tf.zeros((1, 1))) # This is `1e-3 * sum(layer.dense.kernel ** 2)`, # created by the `kernel_regularizer` above. print(layer.losses) import numpy as np inputs = keras.Input(shape=(3,)) outputs = ActivityRegularizationLayer()(inputs) model = keras.Model(inputs, outputs) # If there is a loss passed in `compile`, the regularization # losses get added to it model.compile(optimizer="adam", loss="mse") model.fit(np.random.random((2, 3)), np.random.random((2, 3))) # It's also possible not to pass any loss in `compile`, # since the model already has a loss to minimize, via the `add_loss` # call during the forward pass! model.compile(optimizer="adam") model.fit(np.random.random((2, 3)), np.random.random((2, 3))) class LogisticEndpoint(keras.layers.Layer): def __init__(self, name=None): super(LogisticEndpoint, self).__init__(name=name) self.loss_fn = keras.losses.BinaryCrossentropy(from_logits=True) self.accuracy_fn = keras.metrics.BinaryAccuracy() def call(self, targets, logits, sample_weights=None): # Compute the training-time loss value and add it # to the layer using `self.add_loss()`. loss = self.loss_fn(targets, logits, sample_weights) self.add_loss(loss) # Log accuracy as a metric and add it # to the layer using `self.add_metric()`. acc = self.accuracy_fn(targets, logits, sample_weights) self.add_metric(acc, name="accuracy") # Return the inference-time prediction tensor (for `.predict()`). return tf.nn.softmax(logits) layer = LogisticEndpoint() targets = tf.ones((2, 2)) logits = tf.ones((2, 2)) y = layer(targets, logits) print("layer.metrics:", layer.metrics) print("current accuracy value:", float(layer.metrics[0].result())) inputs = keras.Input(shape=(3,), name="inputs") targets = keras.Input(shape=(10,), name="targets") logits = keras.layers.Dense(10)(inputs) predictions = LogisticEndpoint(name="predictions")(logits, targets) model = keras.Model(inputs=[inputs, targets], outputs=predictions) model.compile(optimizer="adam") data = { "inputs": np.random.random((3, 3)), "targets": np.random.random((3, 10)), } model.fit(data) class Linear(keras.layers.Layer): def __init__(self, units=32): super(Linear, self).__init__() self.units = units def build(self, input_shape): self.w = self.add_weight( shape=(input_shape[-1], self.units), initializer="random_normal", trainable=True, ) self.b = self.add_weight( shape=(self.units,), initializer="random_normal", trainable=True ) def call(self, inputs): return tf.matmul(inputs, self.w) + self.b def get_config(self): return {"units": self.units} # Now you can recreate the layer from its config: layer = Linear(64) config = layer.get_config() print(config) new_layer = Linear.from_config(config) class Linear(keras.layers.Layer): def __init__(self, units=32, **kwargs): super(Linear, self).__init__(**kwargs) self.units = units def build(self, input_shape): self.w = self.add_weight( shape=(input_shape[-1], self.units), initializer="random_normal", trainable=True, ) self.b = self.add_weight( shape=(self.units,), initializer="random_normal", trainable=True ) def call(self, inputs): return tf.matmul(inputs, self.w) + self.b def get_config(self): config = super(Linear, self).get_config() config.update({"units": self.units}) return config layer = Linear(64) config = layer.get_config() print(config) new_layer = Linear.from_config(config) class CustomDropout(keras.layers.Layer): def __init__(self, rate, **kwargs): super(CustomDropout, self).__init__(**kwargs) self.rate = rate def call(self, inputs, training=None): if training: return tf.nn.dropout(inputs, rate=self.rate) return inputs from tensorflow.keras import layers class Sampling(layers.Layer): Uses (z_mean, z_log_var) to sample z, the vector encoding a digit. def call(self, inputs): z_mean, z_log_var = inputs batch = tf.shape(z_mean)[0] dim = tf.shape(z_mean)[1] epsilon = tf.keras.backend.random_normal(shape=(batch, dim)) return z_mean + tf.exp(0.5 * z_log_var) * epsilon class Encoder(layers.Layer): Maps MNIST digits to a triplet (z_mean, z_log_var, z). def __init__(self, latent_dim=32, intermediate_dim=64, name="encoder", **kwargs): super(Encoder, self).__init__(name=name, **kwargs) self.dense_proj = layers.Dense(intermediate_dim, activation="relu") self.dense_mean = layers.Dense(latent_dim) self.dense_log_var = layers.Dense(latent_dim) self.sampling = Sampling() def call(self, inputs): x = self.dense_proj(inputs) z_mean = self.dense_mean(x) z_log_var = self.dense_log_var(x) z = self.sampling((z_mean, z_log_var)) return z_mean, z_log_var, z class Decoder(layers.Layer): Converts z, the encoded digit vector, back into a readable digit. def __init__(self, original_dim, intermediate_dim=64, name="decoder", **kwargs): super(Decoder, self).__init__(name=name, **kwargs) self.dense_proj = layers.Dense(intermediate_dim, activation="relu") self.dense_output = layers.Dense(original_dim, activation="sigmoid") def call(self, inputs): x = self.dense_proj(inputs) return self.dense_output(x) class VariationalAutoEncoder(keras.Model): Combines the encoder and decoder into an end-to-end model for training. def __init__( self, original_dim, intermediate_dim=64, latent_dim=32, name="autoencoder", **kwargs ): super(VariationalAutoEncoder, self).__init__(name=name, **kwargs) self.original_dim = original_dim self.encoder = Encoder(latent_dim=latent_dim, intermediate_dim=intermediate_dim) self.decoder = Decoder(original_dim, intermediate_dim=intermediate_dim) def call(self, inputs): z_mean, z_log_var, z = self.encoder(inputs) reconstructed = self.decoder(z) # Add KL divergence regularization loss. kl_loss = -0.5 * tf.reduce_mean( z_log_var - tf.square(z_mean) - tf.exp(z_log_var) + 1 ) self.add_loss(kl_loss) return reconstructed original_dim = 784 vae = VariationalAutoEncoder(original_dim, 64, 32) optimizer = tf.keras.optimizers.Adam(learning_rate=1e-3) mse_loss_fn = tf.keras.losses.MeanSquaredError() loss_metric = tf.keras.metrics.Mean() (x_train, _), _ = tf.keras.datasets.mnist.load_data() x_train = x_train.reshape(60000, 784).astype("float32") / 255 train_dataset = tf.data.Dataset.from_tensor_slices(x_train) train_dataset = train_dataset.shuffle(buffer_size=1024).batch(64) epochs = 2 # Iterate over epochs. for epoch in range(epochs): print("Start of epoch %d" % (epoch,)) # Iterate over the batches of the dataset. for step, x_batch_train in enumerate(train_dataset): with tf.GradientTape() as tape: reconstructed = vae(x_batch_train) # Compute reconstruction loss loss = mse_loss_fn(x_batch_train, reconstructed) loss += sum(vae.losses) # Add KLD regularization loss grads = tape.gradient(loss, vae.trainable_weights) optimizer.apply_gradients(zip(grads, vae.trainable_weights)) loss_metric(loss) if step % 100 == 0: print("step %d: mean loss = %.4f" % (step, loss_metric.result())) vae = VariationalAutoEncoder(784, 64, 32) optimizer = tf.keras.optimizers.Adam(learning_rate=1e-3) vae.compile(optimizer, loss=tf.keras.losses.MeanSquaredError()) vae.fit(x_train, x_train, epochs=2, batch_size=64) original_dim = 784 intermediate_dim = 64 latent_dim = 32 # Define encoder model. original_inputs = tf.keras.Input(shape=(original_dim,), name="encoder_input") x = layers.Dense(intermediate_dim, activation="relu")(original_inputs) z_mean = layers.Dense(latent_dim, name="z_mean")(x) z_log_var = layers.Dense(latent_dim, name="z_log_var")(x) z = Sampling()((z_mean, z_log_var)) encoder = tf.keras.Model(inputs=original_inputs, outputs=z, name="encoder") # Define decoder model. latent_inputs = tf.keras.Input(shape=(latent_dim,), name="z_sampling") x = layers.Dense(intermediate_dim, activation="relu")(latent_inputs) outputs = layers.Dense(original_dim, activation="sigmoid")(x) decoder = tf.keras.Model(inputs=latent_inputs, outputs=outputs, name="decoder") # Define VAE model. outputs = decoder(z) vae = tf.keras.Model(inputs=original_inputs, outputs=outputs, name="vae") # Add KL divergence regularization loss. kl_loss = -0.5 * tf.reduce_mean(z_log_var - tf.square(z_mean) - tf.exp(z_log_var) + 1) vae.add_loss(kl_loss) # Train. optimizer = tf.keras.optimizers.Adam(learning_rate=1e-3) vae.compile(optimizer, loss=tf.keras.losses.MeanSquaredError()) vae.fit(x_train, x_train, epochs=3, batch_size=64) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: In this tutorial we focus on plotting functions of Step2: Notice that evoked is a list of Step3: Let's start with a simple one. We plot event related potentials / fields Step4: All plotting functions of MNE-python returns a handle to the figure instance. Step5: Now let's make it a bit fancier and only use MEG channels. Many of the Step6: Notice the legend on the left. The colors would suggest that there may be two Step7: By default the topomaps are drawn from evenly spread out points of time over Step8: Or we can automatically select the peaks. Step9: You can take a look at the documentation of Step10: Notice that we created five axes, but had only four categories. The fifth Step11: Sometimes, you may want to compare two conditions at a selection of sensors, Step12: We can also plot the activations as images. The time runs along the x-axis Step13: Finally we plot the sensor data as a topographical view. In the simple case Step14: Visualizing field lines in 3D
<ASSISTANT_TASK:> Python Code: import os.path as op import numpy as np import matplotlib.pyplot as plt import mne data_path = mne.datasets.sample.data_path() fname = op.join(data_path, 'MEG', 'sample', 'sample_audvis-ave.fif') evoked = mne.read_evokeds(fname, baseline=(None, 0), proj=True) print(evoked) evoked_l_aud = evoked[0] evoked_r_aud = evoked[1] evoked_l_vis = evoked[2] evoked_r_vis = evoked[3] fig = evoked_l_aud.plot(exclude=()) fig.tight_layout() picks = mne.pick_types(evoked_l_aud.info, meg=True, eeg=False, eog=False) evoked_l_aud.plot(spatial_colors=True, gfp=True, picks=picks) evoked_l_aud.plot_topomap() times = np.arange(0.05, 0.151, 0.05) evoked_r_aud.plot_topomap(times=times, ch_type='mag') evoked_r_aud.plot_topomap(times='peaks', ch_type='mag') fig, ax = plt.subplots(1, 5) evoked_l_aud.plot_topomap(times=0.1, axes=ax[0], show=False) evoked_r_aud.plot_topomap(times=0.1, axes=ax[1], show=False) evoked_l_vis.plot_topomap(times=0.1, axes=ax[2], show=False) evoked_r_vis.plot_topomap(times=0.1, axes=ax[3], show=True) ts_args = dict(gfp=True) topomap_args = dict(sensors=False) evoked_r_aud.plot_joint(title='right auditory', times=[.07, .105], ts_args=ts_args, topomap_args=topomap_args) conditions = ["Left Auditory", "Right Auditory", "Left visual", "Right visual"] evoked_dict = dict() for condition in conditions: evoked_dict[condition.replace(" ", "/")] = mne.read_evokeds( fname, baseline=(None, 0), proj=True, condition=condition) print(evoked_dict) colors = dict(Left="Crimson", Right="CornFlowerBlue") linestyles = dict(Auditory='-', visual='--') pick = evoked_dict["Left/Auditory"].ch_names.index('MEG 1811') mne.viz.plot_compare_evokeds(evoked_dict, picks=pick, colors=colors, linestyles=linestyles) evoked_r_aud.plot_image(picks=picks) title = 'MNE sample data (condition : %s)' evoked_l_aud.plot_topo(title=title % evoked_l_aud.comment) colors = 'yellow', 'green', 'red', 'blue' mne.viz.plot_evoked_topo(evoked, color=colors, title=title % 'Left/Right Auditory/Visual') subjects_dir = data_path + '/subjects' trans_fname = data_path + '/MEG/sample/sample_audvis_raw-trans.fif' maps = mne.make_field_map(evoked_l_aud, trans=trans_fname, subject='sample', subjects_dir=subjects_dir, n_jobs=1) # explore several points in time field_map = evoked_l_aud.plot_field(maps, time=.1) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Here is what the simulated data look like. We use the pylab module from the plotting library matplotlib. Step2: Model Specification Step3: Now we build our model, which we will present in full first, then explain each part line-by-line. Step4: The first line, Step5: Having defined the priors, the next statement creates the expected value mu of the outcomes, specifying the linear relationship Step6: By default, this uses Broyden–Fletcher–Goldfarb–Shanno (BFGS) algorithm to find the maximum of the log-posterior but also allows selection of other optimization algorithms from the scipy.optimize module. For example, below we use Powell's method to find the MAP. Step7: It is important to note that the MAP estimate is not always reasonable, especially if the mode is at an extreme. This can be a subtle issue; with high dimensional posteriors, one can have areas of extremely high density but low total probability because the volume is very small. This will often occur in hierarchical models with the variance parameter for the random effect. If the individual group means are all the same, the posterior will have near infinite density if the scale parameter for the group means is almost zero, even though the probability of such a small scale parameter will be small since the group means must be extremely close together. Step8: The sample function returns a trace object that can be queried in a similar way to a dict containing a map from variable names to numpy.arrays. The first dimension of the array is the sampling index and the later dimensions match the shape of the variable. We can see the last 5 values for the alpha variable as follows Step9: Posterior analysis Step10: The left column consists of a smoothed histogram (using kernel density estimation) of the marginal posteriors of each stochastic random variable while the right column contains the samples of the Markov chain plotted in sequential order. The beta variable, being vector-valued, produces two histograms and two sample traces, corresponding to both predictor coefficients. Step11: Case study 1 Step12: Model Specification Step13: Notice that we transform the log volatility process s into the volatility process by exp(-2*s). Here, exp is a Theano function, rather than the corresponding function in NumPy; Theano provides a large subset of the mathematical functions that NumPy does. Step14: We can check our samples by looking at the traceplot for nu and log_sigma. Step15: Finally we plot the distribution of volatility paths by plotting many of our sampled volatility paths on the same graph. Each is rendered partially transparent (via the alpha argument in Matplotlib's plot function) so the regions where many paths overlap are shaded more darkly. Step16: Case study 2 Step17: One approach for dealing with excess zeros is to use a mixture model. The mixture model contains two components Step18: Notice that since the latent occupancy indicators are discrete, we cannot use a gradient-based MCMC step method like HMC or NUTS for this variable. Instead, we will sample using a BinaryMetropolis sampler that proposes only binary values at each iteration for z; for the continuous-valued parameters, theta and p we will use a standard Metropolis sampler. Step19: The resulting posteriors for the unknown parameters suggest an occupancy rate in the neighborhood of 0.3 to 0.4, and an expected count (conditional on occupancy) of just over 2. Step20: Arbitrary deterministics Step21: An important drawback of this approach is that it is not possible for theano to inspect these functions in order to compute the gradient required for the Hamiltonian-based samplers. Therefore, it is not possible to use the HMC or NUTS samplers for a model that uses such an operator. However, it is possible to add a gradient if we inherit from theano.Op instead of using as_op. The PyMC example set includes a more elaborate example of the usage of as_op. Step22: Generalized Linear Models Step23: The model can then be very concisely specified in one line of code. Step24: The error distribution, if not specified via the family argument, is assumed to be normal. In the case of logistic regression, this can be modified by passing in a Binomial family object. Step25: Backends Step26: The stored trace can then later be loaded using the load command
<ASSISTANT_TASK:> Python Code: import numpy as np # Intialize random number generator np.random.seed(123) # True parameter values alpha, sigma = 1, 1 beta = [1, 2.5] # Size of dataset size = 100 # Predictor variable X1 = np.linspace(0, 1, size) X2 = np.linspace(0,.2, size) # Simulate outcome variable Y = alpha + beta[0]*X1 + beta[1]*X2 + np.random.randn(size)*sigma %matplotlib inline import pylab as pl fig, axes = pl.subplots(1, 2, sharex=True, figsize=(10,4)) axes[0].scatter(X1, Y) axes[1].scatter(X2, Y) axes[0].set_ylabel('Y'); axes[0].set_xlabel('X1'); axes[1].set_xlabel('X2'); from pymc3 import Model, Normal, HalfNormal basic_model = Model() with basic_model: # Priors for unknown model parameters alpha = Normal('alpha', mu=0, sd=10) beta = Normal('beta', mu=0, sd=10, shape=2) sigma = HalfNormal('sigma', sd=1) # Expected value of outcome mu = alpha + beta[0]*X1 + beta[1]*X2 # Likelihood (sampling distribution) of observations Y_obs = Normal('Y_obs', mu=mu, sd=sigma, observed=Y) help(Normal) #try help(Model), help(Uniform) or help(basic_model) from pymc3 import find_MAP map_estimate = find_MAP(model=basic_model) print(map_estimate) from scipy import optimize map_estimate = find_MAP(model=basic_model, fmin=optimize.fmin_powell) print(map_estimate) from pymc3 import NUTS, sample with basic_model: # obtain starting values via MAP start = find_MAP(fmin=optimize.fmin_powell) # instantiate sampler step = NUTS(scaling=start) # draw 500 posterior samples trace = sample(500, step, start=start) trace['alpha'][-5:] from pymc3 import traceplot traceplot(trace); from pymc3 import summary summary(trace) n = 400 returns = np.genfromtxt("data/SP500.csv")[-n:] pl.plot(returns); from pymc3 import Exponential, T, logtransform, exp, Deterministic from pymc3.distributions.timeseries import GaussianRandomWalk with Model() as sp500_model: nu = Exponential('nu', 1./10, testval=.1) sigma, log_sigma = sp500_model.TransformedVar('sigma', Exponential.dist(1./.02, testval=.1), logtransform) s = GaussianRandomWalk('s', sigma**-2, shape=n) volatility_process = Deterministic('volatility_process', exp(-2*s)) r = T('r', nu, lam=volatility_process, observed=returns) import scipy with sp500_model: start = find_MAP(vars=[s], fmin=scipy.optimize.fmin_l_bfgs_b) step = NUTS(scaling=start) trace = sample(50, step, progressbar=False) # Start next run at the last sampled position. step = NUTS(scaling=trace[-1], gamma=.25) trace = sample(400, step, start=trace[-1]) #figsize(12,6) traceplot(trace, [nu, log_sigma]); pl.title(str(volatility_process)); pl.plot(trace[volatility_process][::10].T,'b', alpha=.03); pl.xlabel('time'); pl.ylabel('log volatility'); y = np.array([0, 2, 1, 0, 4, 2, 0, 0, 4, 0, 0, 0, 0, 0, 3, 0, 0, 6, 0, 0, 0, 2, 1, 2, 0, 0, 0, 1, 0, 0, 0, 4, 2, 0, 0, 0, 1, 0, 2, 4, 0, 0, 1, 0, 0, 0, 0, 0, 2, 0, 2, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 2, 1, 0, 0, 0, 0, 3, 0, 2, 0, 1, 2, 2, 2, 2, 3, 0, 0, 0, 0, 1, 0, 3, 1, 0, 0, 0, 0, 0, 2, 0, 0, 1, 0, 0]) pl.hist(y, bins=range(7)); from pymc3 import Beta, Bernoulli, ZeroInflatedPoisson, Uniform, Poisson with Model() as zip_model: # Estimated occupancy p = Beta('p', 1, 1) # Latent variable for occupancy z = Bernoulli('z', p, shape=y.shape) # Estimated mean count theta = Uniform('theta', 0, 100) # Poisson likelihood yd = ZeroInflatedPoisson('y', theta, z, observed=y) from pymc3 import Metropolis, BinaryMetropolis, sample with zip_model: start = {'p': 0.5, 'z': (y > 0), 'theta': 5, 'yd_missing': np.array([1,1])} step1 = Metropolis([theta, p]) step2 = BinaryMetropolis([z]) trace = sample(10000, [step1, step2], start) traceplot(trace[5000:], vars=['p', 'theta']); import theano.tensor as T from theano.compile.ops import as_op @as_op(itypes=[T.lscalar], otypes=[T.lscalar]) def crazy_modulo3(value): if value > 0: return value % 3 else : return (-value + 1) % 3 with Model() as model_deterministic: a = Poisson('a', 1) b = crazy_modulo3(a) from pymc3.distributions import Continuous class Beta(Continuous): def __init__(self, mu, *args, **kwargs): super(Beta, self).__init__(*args, **kwargs) self.mu = mu self.mode = mu def logp(self, value): mu = self.mu return beta_logp(value - mu) @as_op(itypes=[T.dscalar], otypes=[T.dscalar]) def beta_logp(value): return -1.5 * np.log(1 + (value)**2) with Model() as model: beta = Beta('slope', mu=0, testval=0) # Convert X and Y to a pandas DataFrame import pandas df = pandas.DataFrame({'x1': X1, 'x2': X2, 'y': Y}) from pymc3.glm import glm with Model() as model_glm: glm('y ~ x1 + x2', df) from pymc3.glm.families import Binomial df_logistic = pandas.DataFrame({'x1': X1, 'x2': X2, 'y': Y > 0}) with Model() as model_glm_logistic: glm('y ~ x1 + x2', df_logistic, family=Binomial()) from pymc3.backends import SQLite with model_glm_logistic: backend = SQLite('trace.sqlite') trace = sample(5000, Metropolis(), trace=backend) summary(trace, vars=['x1', 'x2']) from pymc3.backends.sqlite import load with basic_model: trace_loaded = load('trace.sqlite') trace_loaded <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Either create a new ipyrad assembly or load an existing one Step2: Or load a finished assembly from its JSON file Step3: Look at the stats summary for this assembly Step4: Load R-language extension Step5: Transfer Python object to R Step6: Now R knows about statsDF Step7: Let's transfer more data from Python to R Step8: Plot coverage among samples Step9: Plot the distribution of SNPs among loci
<ASSISTANT_TASK:> Python Code: ## import ipyrad and give it a shorter name import ipyrad as ip ## create a test assembly data = ip.Assembly("data") data.set_params('project_dir', 'test') data.set_params('raw_fastq_path', 'ipsimdata/rad_example_R1_.fastq.gz') data.set_params('barcodes_path', 'ipsimdata/rad_example_barcodes.txt') ## Assemble data set; runs steps 1-7 data.run('1') ## load the JSON file for this assembly data = ip.load_json("test/data.json") ## Data can be accessed from the object's stats and stats_df attributes print data.stats ## This requires that you have the Python module `rpy2` installed. ## If you do not, it can be installed in anaconda with: ## conda install rpy2 %load_ext rpy2.ipython ## rename data.stats as statsDF statsDF = data.stats ## import statsDF into R namespace %R -i statsDF %%R print(statsDF) %%R -w 350 -h 350 ## the dimensions above tell IPython how big to make the embedded figure ## alternatively you can adjust the size when you save the figure plot(statsDF$reads_raw, statsDF$reads_filtered, pch=20, cex=3) ### Other stats from our assembly are also available. ### First store names and then import into R s5 = data.stats_dfs.s5 s7L = data.stats_dfs.s7_loci s7S = data.stats_dfs.s7_snps s7N = data.stats_dfs.s7_samples ## no spaces allowed between comma-separated names when ## transferring multiple objects to R %R -i s5,s7L,s7S,s7N %%R -w 800 -h 320 ## barplot(s7N$sample_coverage, col='grey30', names=rownames(s7N), ylab="N loci", xlab="Sample") %%R -w 450 -h 400 print(s7S) barplot(s7S$var, col=rgb(0,0,1,1/4), names=rownames(s7S), ylab="N loci", ylim=c(0, 400), xlab="N variable sites") barplot(s7S$pis, col=rgb(1,0,0,1/4), names=rownames(s7S), ylab="N loci", ylim=c(0, 400), xlab="N variable sites", add=TRUE) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Define path to working csv files, input and output Step2: Create a dataframe from the csv file Step3: Add a new column named "survived" Step4: Then, apply the lambda function created to a new column "survived" Step5: Rename index and column to comply the format to be submitted Step6: Done with indexing, from this point, create a new csv file for gender based probability and submit
<ASSISTANT_TASK:> Python Code: from pandas import Series, DataFrame import pandas as pd f = r'/home/hase/Documents/ZHAW/InfoEng/Lectures/Scripting/data/titanic3_test.csv' fo = r'/home/hase/Documents/ZHAW/InfoEng/Lectures/Scripting/data/submit/titanic3_test_gender.csv' df = pd.read_csv(f, sep=';', index_col='id', usecols=['id', 'sex']) df.head() # Get the first five rows of the dataframe def gender(row): if row['sex'] == 'female': return 1 else: return 0 df['survived'] = df.apply(lambda row: gender(row),axis=1) # axis=1 means it applies to a row level # Needs to be lambda to a pass a function to df.apply? df.head() df.drop('sex', axis=1, inplace=True) # axis=1 means column-wise, and inplace=True does operation in place # i.e. no need to do df = df.drop(....) df.head() df.index.name = 'key' df.index.name df.rename(columns={'survived':'value'}, inplace=True) df.head() df.to_csv(fo, sep=';') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 创建客户端 Step2: 申请秘钥 Step3: 返回值为一个Document Step4: doc['srl']字段为语义角色标注结果,每个四元组的格式为[论元或谓词, 语义角色标签, 起始下标, 终止下标]。其中,谓词的语义角色标签为PRED,起止下标对应以tok开头的第一个单词数组。 Step5: 遍历谓词论元结构: Step6: 为已分词的句子执行语义角色分析:
<ASSISTANT_TASK:> Python Code: !pip install hanlp_restful -U from hanlp_restful import HanLPClient HanLP = HanLPClient('https://www.hanlp.com/api', auth=None, language='zh') # auth不填则匿名,zh中文,mul多语种 doc = HanLP('2021年HanLPv2.1为生产环境带来次世代最先进的多语种NLP技术。', tasks='srl') print(doc) doc.pretty_print() for i, pas in enumerate(doc['srl'][0]): print(f'第{i+1}个谓词论元结构:') for form, role, begin, end in pas: print(f'{form} = {role} at [{begin}, {end}]') HanLP(tokens=[ ["HanLP", "为", "生产", "环境", "带来", "次世代", "最", "先进", "的", "多语种", "NLP", "技术", "。"], ["我", "的", "希望", "是", "希望", "张晚霞", "的", "背影", "被", "晚霞", "映红", "。"] ], tasks='srl', skip_tasks='tok*').pretty_print() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Convolution Layer Step2: Pooling layer Step3: Fully Connected Layer Step5: Building The Model Step6: Convolutional Neural Network Step7: Cost Function Step8: Stochastic Gradient Descent Methods (SGD) Step9: Momentum Step10: RMSProp Step11: Training and Validating Step12: Training the Model
<ASSISTANT_TASK:> Python Code: #### Libraries # Third Party Libraries import numpy as np from sklearn.model_selection import train_test_split import theano import theano.tensor as T from theano.tensor.nnet import conv2d from theano.tensor.signal import pool class ConvLayer(object): def __init__(self, input, filter_shape, image_shape, padding=(0, 0), stride=(1, 1), activation_fn=None): assert image_shape[1] == filter_shape[1] # rng = np.random.RandomState(seed) self.input = input self.filter_shape = filter_shape self.image_shape = image_shape self.activation_fn = activation_fn fan_in = np.prod(filter_shape[1:]) fan_out = filter_shape[0]*np.prod(filter_shape[2:]) // 2 W_bound = np.sqrt(6/(fan_in+fan_out)) w = np.random.uniform(low=-W_bound, high=W_bound, size=filter_shape) b_vals = np.random.uniform(size=filter_shape[0]) # Initiliaze weights with random variables self.W = theano.shared(name='weights', value=w.astype(theano.config.floatX), borrow=True) self.b = theano.shared(name='bias', value=b_vals.astype(theano.config.floatX), borrow=True) conv_out = conv2d(input=input, filters=self.W, border_mode=padding, subsample=stride, filter_shape=filter_shape, input_shape=image_shape) l_output = conv_out + self.b.dimshuffle(('x', 0, 'x', 'x')) self.output = (l_output if activation_fn is None else activation_fn(l_output)) # Parameters of the model self.params = [self.W, self.b] class PoolingLayer(object): def __init__(self, input, pool_shape=(2, 2), ignore_border=True, activation_fn=None): self.input = input self.pool_shape = pool_shape self.ignore_border = ignore_border l_output = pool.pool_2d(input=input, ds=pool_shape, ignore_border=self.ignore_border) self.output = (l_output if activation_fn is None else activation_fn(l_output)) class FC(object): def __init__(self, input, n_in, n_out, W=None, b=None, seed=35, activation_fn=None): # rng = np.random.RandomState(seed) self.input = input if W is None: W_values = np.random.uniform(low=-np.sqrt(6./(n_in+n_out)), high=np.sqrt(6./(n_in+n_out)), size=(n_out, n_in)).astype(theano.config.floatX) if activation_fn == theano.tensor.nnet.sigmoid: W_values *= 4 W = theano.shared(name='Weights', value=W_values, borrow=True) if b is None: b_values = np.zeros(n_out, dtype=theano.config.floatX) b = theano.shared(name='bias', value=b_values, borrow=True) self.W = W self.b = b l_output = (T.dot(self.W, input.T)).T + self.b self.output = (l_output if activation_fn is None else activation_fn(l_output)) self.params = [self.W, self.b] def elu(x, alpha=1.0): return T.switch(x > 0, x, T.exp(x)-1) def l2_reg(x, lmbd=0.05): L_2 regularization l2 = 0 for elements in x: l2 += T.sum(elements[0]**2) return lmbd / 2 * l2 X = T.tensor4(name='X', dtype=theano.config.floatX) Y = T.imatrix(name='Y') y = T.ivector(name='y') lr = T.scalar(name='learning_rate', dtype=theano.config.floatX) nkerns = [8, 32] batch_size = 256 act_f = elu conv_layer1 = ConvLayer(input=X, filter_shape=(nkerns[0], 1, 3, 3), image_shape=(batch_size, 1, 28, 28), activation_fn=None) pool_layer1 = PoolingLayer(input=conv_layer1.output, activation_fn=act_f) conv_layer2 = ConvLayer(input=pool_layer1.output, filter_shape=(nkerns[1], nkerns[0], 5, 5), image_shape=(batch_size, nkerns[0], 13, 13), activation_fn=None) pool_layer2 = PoolingLayer(input=conv_layer2.output, activation_fn=act_f) # outputs from convolution network need to be flattend before being # passed through to the the fully-connected layer fc_layer_input = pool_layer2.output.flatten(2) fc_layer1 = FC(input=fc_layer_input, n_in=nkerns[1] * 4 * 4, n_out=512, activation_fn=act_f) fc_layer2 = FC(input=fc_layer1.output, n_in=512, n_out=10, activation_fn=act_f) params = fc_layer2.params + fc_layer1.params\ + conv_layer2.params + conv_layer1.params cost_input = T.nnet.nnet.softmax(fc_layer2.output) cost = T.mean(T.nnet.nnet.categorical_crossentropy(cost_input, Y)) \ + l2_reg(params) grads = T.grad(cost, params) def sgd(l_rate, parameters, grads): updates = [] for param, grad in zip(parameters, grads): updates.append((param, param - l_rate * grad)) return updates def momentum(l_rate, parameters, grads, momentum=0.9): def update_rule(param, velocity, df): v_next = momentum * velocity - l_rate * df updates = (param, param+v_next), (velocity, v_next) return updates assert momentum <=1 and momentum >= 0 velocities = [theano.shared(name='v_%s' % param, value=param.get_value() * 0., broadcastable=param.broadcastable) for param in parameters] updates = [] for p, v, g in zip(parameters, velocities, grads): param_updates, vel_updates = update_rule(p, v, g) updates.append(param_updates) updates.append(vel_updates) return updates def rmsprop(l_rate, d_rate=0.9, epsilon=1e-6, parameters=None, grads=None): one = T.constant(1.0) def update_rule(param, cache, df): cache_val = d_rate * cache + (one-d_rate) * df**2 x = l_rate * df / (T.sqrt(cache_val) + epsilon) updates = (param, param-x), (cache, cache_val) return updates caches = [theano.shared(name='c_{}'.format(param), value=param.get_value() * 0., broadcastable=param.broadcastable) for param in parameters] updates = [] for p, c, g in zip(parameters, caches, grads): param_updates, cache_updates = update_rule(p, c, g) updates.append(param_updates) updates.append(cache_updates) return updates train = theano.function(inputs=[X, Y, lr], outputs=cost, updates=rmsprop(l_rate=lr, parameters=params, grads=grads), allow_input_downcast=True) # Validation results pred_result = cost_input.argmax(axis=1) accu = theano.function(inputs=[X, y], outputs=T.sum(T.eq(pred_result, y)), allow_input_downcast=True) pred = theano.function(inputs=[X], outputs=pred_result, allow_input_downcast=True) def train_model(training_data, validation_data, test_data=None, learning_rate=1e-4, epochs=100): print('---Training Model---') predicted_results = [] total_values, total_val_values = len(training_data), len(validation_data) for epoch in range(epochs): print('Currently on epoch {}'.format(epoch+1)) np.random.shuffle(training_data) mini_batches = [training_data[k: k+batch_size] for k in range(0, total_values, batch_size)] validation_batches = [validation_data[m: m+batch_size] for m in range(0, total_val_values, batch_size)] training_cost, accuracy = 0, 0 training_cost_list, accuracy_list = [], [] for mini_batch in mini_batches: labels = mini_batch[:, 0] label_matrix = np.zeros(shape=(256, 10), dtype=theano.config.floatX) for i, label in enumerate(labels): vec = scalar_to_vec(int(label), 10) label_matrix[i] = vec digits = mini_batch[:, 1:]/255 digits = digits.reshape(-1, 1, 28, 28) cost_ij = train(digits, label_matrix, learning_rate) training_cost += cost_ij for val_batch in validation_batches: labels = mini_batch[:, 0] label_matrix = np.zeros(shape=(256, 10), dtype=theano.config.floatX) for i, label in enumerate(labels): vec = scalar_to_vec(int(label), 10) label_matrix[i] = vec digits = mini_batch[:, 1:]/255 digits = digits.reshape(-1, 1, 28, 28) accuracy += accu(digits, labels) training_cost_list.append(training_cost/total_values) accuracy_list.append(accuracy/total_val_values) print('The accuracy is: {}'.format(accuracy/total_val_values)) print('The loss is: {}'.format(training_cost/total_values)) print('--------------------------') if np.any(test_data): print('===================================') print('Using test data to predict results') total_values = len(test_data) mini_batches = [test_data[k: k+batch_size] for k in range(0, total_values, batch_size)] for mini_batch in mini_batches: digits = mini_batch[:, :]/255 digits = digits.reshape(-1, 1, 28, 28) result = pred(digits) predicted_results = np.append(predicted_results, result) print('Done') return training_cost_list, accuracy_list, predicted_results <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The sequences below were generated here. Step2: We make a list of amplicons (sequences with pairs of primers from the Dseqrecords) Step3: We need a list of golden gate linkers, these could be generated automatically in some other way. Step4: we zip together the golden gate linkers and sequences to a flat list. Step5: The optional settings below are important. Sequences with a size equal to or shorter than maxlink will be incorporated in the primers. Step6: We get only three sequences, since the golden gate linkers are incorporated in the primers. Step7: We can assemble these by setting the limit to 4 and only_terminal_overlaps to True. Step8: We got three circular products. The second one should be the same as the theoretical one below Step9: The candidate and the correct sequence has the same cseguid, so they represent the same circular sequence.
<ASSISTANT_TASK:> Python Code: from pydna.all import * frags = parse(''' >1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 50 bp ccagaatacagtgccttagatctacggatcgtatctgcgatttggccgat >2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 50 bp gccctgcttggtagatcaggcgagccaataacattctatagtgtagcctt >3|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 50 bp gagagcgctcctgtttcaatgcttgcaaactctagcagctatactgtagg ''' ) frags amplicons = [primer_design(f) for f in frags] golden_gate_linkers = [Dseqrecord(lnk) for lnk in "GAAT GATC AATT GAAT".split()] golden_gate_linkers from itertools import chain, zip_longest seqlist = list( chain.from_iterable( zip_longest(golden_gate_linkers, amplicons)))[:-1] seqlist a,b,c = assembly_fragments( seqlist, maxlink=4, overlap=4 ) a.locus, b.locus, c.locus = "sequenceA", "sequenceB", "sequenceC" a.figure() b.figure() c.figure() from pydna.assembly import terminal_overlap asm = Assembly((a,b,c), limit=4, algorithm=terminal_overlap) asm correct = Dseqrecord("") for s in seqlist[1:]: correct += s correct = correct.looped() correct.cseguid() candidate = asm.assemble_circular()[1] candidate.cseguid() from Bio.Restriction import BsaI BsaI.site for f in (a,b,c): f.forward_primer = BsaI.site + "a" + f.forward_primer f.reverse_primer = BsaI.site + "a" + f.reverse_primer print(f.name) print(f.forward_primer.format("tab")) print(f.reverse_primer.format("tab")) print(f.figure()) first_prod = pcr(a.forward_primer, a.reverse_primer, a.template) first_prod.figure() first_prod.cut(BsaI) first_prod.cut(BsaI)[1].seq <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Optimizing Real World Problems Step12: The Generic Problem Class Step14: Great. Now that the class and its basic methods is defined, lets extend it for Step21: Utility functions for genetic algorithms. Step22: Putting it all together and making the GA Step23: Visualize
<ASSISTANT_TASK:> Python Code: %matplotlib inline # All the imports from __future__ import print_function, division from math import * import random import sys import matplotlib.pyplot as plt # TODO 1: Enter your unity ID here __author__ = "pwang13" class O: Basic Class which - Helps dynamic updates - Pretty Prints def __init__(self, **kwargs): self.has().update(**kwargs) def has(self): return self.__dict__ def update(self, **kwargs): self.has().update(kwargs) return self def __repr__(self): show = [':%s %s' % (k, self.has()[k]) for k in sorted(self.has().keys()) if k[0] is not "_"] txt = ' '.join(show) if len(txt) > 60: show = map(lambda x: '\t' + x + '\n', show) return '{' + ' '.join(show) + '}' print("Unity ID: ", __author__) # Few Utility functions def say(*lst): Print whithout going to new line print(*lst, end="") sys.stdout.flush() def random_value(low, high, decimals=2): Generate a random number between low and high. decimals incidicate number of decimal places return round(random.uniform(low, high),decimals) def gt(a, b): return a > b def lt(a, b): return a < b def shuffle(lst): Shuffle a list random.shuffle(lst) return lst class Decision(O): Class indicating Decision of a problem def __init__(self, name, low, high): @param name: Name of the decision @param low: minimum value @param high: maximum value O.__init__(self, name=name, low=low, high=high) class Objective(O): Class indicating Objective of a problem def __init__(self, name, do_minimize=True, low=0, high=1): @param name: Name of the objective @param do_minimize: Flag indicating if objective has to be minimized or maximized O.__init__(self, name=name, do_minimize=do_minimize, low=low, high=high) def normalize(self, val): return (val - self.low)/(self.high - self.low) class Point(O): Represents a member of the population def __init__(self, decisions): O.__init__(self) self.decisions = decisions self.objectives = None def __hash__(self): return hash(tuple(self.decisions)) def __eq__(self, other): return self.decisions == other.decisions def clone(self): new = Point(self.decisions[:]) new.objectives = self.objectives[:] return new class Problem(O): Class representing the cone problem. def __init__(self, decisions, objectives): Initialize Problem. :param decisions - Metadata for Decisions :param objectives - Metadata for Objectives O.__init__(self) self.decisions = decisions self.objectives = objectives @staticmethod def evaluate(point): assert False return point.objectives @staticmethod def is_valid(point): return True def generate_one(self, retries = 20): for _ in xrange(retries): point = Point([random_value(d.low, d.high) for d in self.decisions]) if self.is_valid(point): return point raise RuntimeError("Exceeded max runtimes of %d" % 20) class POM3(Problem): from pom3.pom3 import pom3 as pom3_helper helper = pom3_helper() def __init__(self): Initialize the POM3 classes names = ["Culture", "Criticality", "Criticality Modifier", "Initial Known", "Inter-Dependency", "Dynamism", "Size", "Plan", "Team Size"] lows = [0.1, 0.82, 2, 0.40, 1, 1, 0, 0, 1] highs = [0.9, 1.20, 10, 0.70, 100, 50, 4, 5, 44] # TODO 2: Use names, lows and highs defined above to code up decision # and objective metadata for POM3. decisions = [Decision(n, l, h) for n , l, h in zip(names, lows, highs)] objectives = [Objective("Cost", True, 0, 1000), Objective("Score", False, 0, 1), Objective("Completion", False, 0, 1), Objective("Idle", True, 0, 1)] # objectives = [Objective("Cost", True, 0, 1000), Objective("Score", False, 0, 1), # Objective("Completion", False, 0, 1), Objective("idle". True, 0, 1)] Problem.__init__(self, decisions, objectives) @staticmethod def evaluate(point): if not point.objectives: point.objectives = POM3.helper.simulate(point.decisions) return point.objectives pom3 = POM3() one = pom3.generate_one() print(POM3.evaluate(one)) def populate(problem, size): Create a Point list of length size population = [] for _ in range(size): population.append(problem.generate_one()) return population def crossover(mom, dad): Create a new point which contains decisions from the first half of mom and second half of dad n = len(mom.decisions) return Point(mom.decisions[:n//2] + dad.decisions[n//2:]) def mutate(problem, point, mutation_rate=0.01): Iterate through all the decisions in the point and if the probability is less than mutation rate change the decision(randomly set it between its max and min). for i, decision in enumerate(problem.decisions): if random.random() < mutation_rate: point.decisions[i] = random_value(decision.low, decision.high) return point def bdom(problem, one, two): Return if one dominates two based on binary domintation objs_one = problem.evaluate(one) objs_two = problem.evaluate(two) dominates = False for i, obj in enumerate(problem.objectives): better = lt if obj.do_minimize else gt if better(objs_one[i], objs_two[i]): dominates = True elif objs_one[i] != objs_two[i]: return False return dominates def fitness(problem, population, point, dom_func): Evaluate fitness of a point based on the definition in the previous block. For example point dominates 5 members of population, then fitness of point is 5. return len([1 for another in population if dom_func(problem, point, another)]) def elitism(problem, population, retain_size, dom_func): Sort the population with respect to the fitness of the points and return the top 'retain_size' points of the population fitnesses = [] for point in population: fitnesses.append((fitness(problem, population, point, dom_func), point)) population = [tup[1] for tup in sorted(fitnesses, reverse=True)] return population[:retain_size] def ga(pop_size = 100, gens = 250, dom_func=bdom): problem = POM3() population = populate(problem, pop_size) [problem.evaluate(point) for point in population] initial_population = [point.clone() for point in population] gen = 0 while gen < gens: say(".") children = [] for _ in range(pop_size): mom = random.choice(population) dad = random.choice(population) while (mom == dad): dad = random.choice(population) child = mutate(problem, crossover(mom, dad)) if problem.is_valid(child) and child not in population+children: children.append(child) population += children population = elitism(problem, population, pop_size, dom_func) gen += 1 print("") return initial_population, population def plot_pareto(initial, final): initial_objs = [point.objectives for point in initial] final_objs = [point.objectives for point in final] initial_x = [i[1] for i in initial_objs] initial_y = [i[2] for i in initial_objs] final_x = [i[1] for i in final_objs] final_y = [i[2] for i in final_objs] plt.scatter(initial_x, initial_y, color='b', marker='+', label='initial') plt.scatter(final_x, final_y, color='r', marker='o', label='final') plt.title("Scatter Plot between initial and final population of GA") plt.ylabel("Score") plt.xlabel("Completion") plt.legend(loc=9, bbox_to_anchor=(0.5, -0.175), ncol=2) plt.show() initial, final = ga(gens=50) plot_pareto(initial, final) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's illustrate again with a standard normal base measure. We can construct a function base_measure that generates samples from it. Step2: Because the normal distribution has continuous support, we can generate samples from it forever and we will never see the same sample twice (in theory). We can illustrate this by drawing from the distribution ten thousand times and seeing that we get ten thousand unique values. Step3: However, when we feed the base measure through the stochastic memoization procedure and then sample, we get many duplicate samples. The number of unique samples goes down as $\alpha$ increases. Step4: At this point, we have a function dp_draws that returns samples from a probability distribution (specifically, a probability distribution sampled from $\text{DP}(\alpha H_0)$). We can use dp_draws as a base distribution for another Dirichlet process! Step5: How do we interpret this? norm_dp is a sampler from a probability distribution that looks like the standard normal distribution. norm_hdp is a sampler from a probability distribution that "looks like" the distribution norm_dp samples from. Step6: And here is a histogram for samples drawn from norm_hdp, our second sampler. Step7: The second plot doesn't look very much like the first! The level to which a sample from a Dirichlet process approximates the base distribution is a function of the dispersion parameter $\alpha$. Because I set $\alpha=10$ (which is relatively small), the approximation is fairly course. In terms of memoization, a small $\alpha$ value means the stochastic memoizer will more frequently reuse values already seen instead of drawing new ones. Step8: Since the Hierarchical DP is a Dirichlet Process inside of Dirichlet process, we must provide it with both a first and second level $\alpha$ value. Step9: We can sample directly from the probability distribution drawn from the Hierarchical Dirichlet Process. Step10: norm_hdp is not equivalent to the Hierarchical Dirichlet Process; it samples from a single distribution sampled from this HDP. Each time we instantiate the norm_hdp variable, we are getting a sampler for a unique distribution. Below we sample five times and get five different distributions.
<ASSISTANT_TASK:> Python Code: from numpy.random import choice from scipy.stats import beta class DirichletProcessSample(): def __init__(self, base_measure, alpha): self.base_measure = base_measure self.alpha = alpha self.cache = [] self.weights = [] self.total_stick_used = 0. def __call__(self): remaining = 1.0 - self.total_stick_used i = DirichletProcessSample.roll_die(self.weights + [remaining]) if i is not None and i < len(self.weights) : return self.cache[i] else: stick_piece = beta(1, self.alpha).rvs() * remaining self.total_stick_used += stick_piece self.weights.append(stick_piece) new_value = self.base_measure() self.cache.append(new_value) return new_value @staticmethod def roll_die(weights): if weights: return choice(range(len(weights)), p=weights) else: return None from scipy.stats import norm base_measure = lambda: norm().rvs() from pandas import Series ndraws = 10000 print("Number of unique samples after {} draws:".format(ndraws),) draws = Series([base_measure() for _ in range(ndraws)]) print(draws.unique().size) norm_dp = DirichletProcessSample(base_measure, alpha=100) print("Number of unique samples after {} draws:".format(ndraws),) dp_draws = Series([norm_dp() for _ in range(ndraws)]) print(dp_draws.unique().size) norm_hdp = DirichletProcessSample(norm_dp, alpha=10) import matplotlib.pyplot as plt Series(norm_dp() for _ in range(10000)).hist() _=plt.title("Histogram of Samples from norm_dp") Series(norm_hdp() for _ in range(10000)).hist() _=plt.title("Histogram of Samples from norm_hdp") class HierarchicalDirichletProcessSample(DirichletProcessSample): def __init__(self, base_measure, alpha1, alpha2): first_level_dp = DirichletProcessSample(base_measure, alpha1) self.second_level_dp = DirichletProcessSample(first_level_dp, alpha2) def __call__(self): return self.second_level_dp() norm_hdp = HierarchicalDirichletProcessSample(base_measure, alpha1=10, alpha2=20) Series(norm_hdp() for _ in range(10000)).hist() _=plt.title("Histogram of samples from distribution drawn from Hierarchical DP") for i in range(5): norm_hdp = HierarchicalDirichletProcessSample(base_measure, alpha1=10, alpha2=10) _=Series(norm_hdp() for _ in range(100)).hist() _=plt.title("Histogram of samples from distribution drawn from Hierarchical DP") _=plt.figure() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Lesson Step2: Project 1 Step5: Transforming Text into Numbers
<ASSISTANT_TASK:> Python Code: def pretty_print_review_and_label(i): print(labels[i] + "\t:\t" + reviews[i][:80] + "...") g = open('reviews.txt','r') # What we know! reviews = list(map(lambda x:x[:-1],g.readlines())) g.close() g = open('labels.txt','r') # What we WANT to know! labels = list(map(lambda x:x[:-1].upper(),g.readlines())) g.close() len(reviews) reviews[0] labels[0] print("labels.txt \t : \t reviews.txt\n") pretty_print_review_and_label(2137) pretty_print_review_and_label(12816) pretty_print_review_and_label(6267) pretty_print_review_and_label(21934) pretty_print_review_and_label(5297) pretty_print_review_and_label(4998) from collections import Counter import numpy as np positive_counts = Counter() negative_counts = Counter() total_counts = Counter() for i in range(len(reviews)): if(labels[i] == 'POSITIVE'): for word in reviews[i].split(" "): positive_counts[word] += 1 total_counts[word] += 1 else: for word in reviews[i].split(" "): negative_counts[word] += 1 total_counts[word] += 1 positive_counts.most_common() pos_neg_ratios = Counter() for term,cnt in list(total_counts.most_common()): if(cnt > 100): pos_neg_ratio = positive_counts[term] / float(negative_counts[term]+1) pos_neg_ratios[term] = pos_neg_ratio for word,ratio in pos_neg_ratios.most_common(): if(ratio > 1): pos_neg_ratios[word] = np.log(ratio) else: pos_neg_ratios[word] = -np.log((1 / (ratio+0.01))) # words most frequently seen in a review with a "POSITIVE" label pos_neg_ratios.most_common() # words most frequently seen in a review with a "NEGATIVE" label list(reversed(pos_neg_ratios.most_common()))[0:30] from IPython.display import Image review = "This was a horrible, terrible movie." Image(filename='sentiment_network.png') review = "The movie was excellent" Image(filename='sentiment_network_pos.png') def update_input_layer(review): Modify the global layer_0 to represent the vector form of review. The element at a given index of layer_0 should represent \ how many times the given word occurs in the review. Args: review(string) - the string of the review Returns: None global layer_0 # clear out previous state, reset the layer to be all 0s layer_0 *= 0 ## Your code here [np.ceil(pos_neg_ratios[x]) for x in review.split()] pass def get_target_for_label(label): Convert a label to `0` or `1`. Args: label(string) - Either "POSITIVE" or "NEGATIVE". Returns: `0` or `1`. if label == 'POSITIVE': return 1 else: return 0 <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Spectral Representations of Natural Images Step2: Image Upload Step3: We rescale images to a reasonable resolution, otherwise this would take very long. Note that we will have $h \times w$ nodes in the resulting graph, where $h$ and $w$ are the height and width of the image. Step4: Helper Functions Step5: By using a sparse matrix representation of the Laplacian, we save on memory significantly. Step6: After we have computed the Laplacian, we can compute its eigenvectors. Step7: The Laplacian is always positive semidefinite. Step8: Keeping the Top $m$ Components Step9: Saving Results Step10: You can download the images from this folder as a zipped folder by running the cells below.
<ASSISTANT_TASK:> Python Code: #@title License # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import functools import io import itertools import os import matplotlib.pyplot as plt import numpy as np import PIL import scipy.sparse import scipy.sparse.linalg from google.colab import files imgs = files.upload() def open_as_array(img_bytes): img_pil = PIL.Image.open(io.BytesIO(img_bytes)) img_pil = img_pil.resize((img_width, img_height)) return np.asarray(img_pil) img_name, img_bytes = list(imgs.items())[0] img_data = open_as_array(img_bytes) plt.axis('off') _ = plt.imshow(img_data) img_width = 50 img_height = 40 def get_index(x, y, img_width, img_height): return y * img_width + x; def get_neighbours(x, y, img_width, img_height): neighbours_x_pos = [max(0, x - 1), x, min(x + 1, img_width - 1)] neighbours_y_pos = [max(0, y - 1), y, min(y + 1, img_height - 1)] neighbours = product(neighbours_x_pos, neighbours_y_pos) neighbours = set(neighbours) neighbours.discard((x, y)) return neighbours def compute_sparse_laplacian(img_width, img_height): neighbours_fn = functools.partial(get_neighbours, img_width=img_width, img_height=img_height) index_fn = functools.partial(get_index, img_width=img_width, img_height=img_height) senders = [] recievers = [] values = [] for x in range(img_width): for y in range(img_height): pos = (x, y) pos_index = index_fn(*pos) degree = 0. for neighbour in neighbours_fn(*pos): neigh_index = index_fn(*neighbour) senders.append(pos_index) recievers.append(neigh_index) values.append(-1.) degree += 1. senders.append(pos_index) recievers.append(pos_index) values.append(degree) num_nodes = img_width * img_height laplacian_shape = (num_nodes, num_nodes) return scipy.sparse.coo_matrix((values, (senders, recievers))) laplacian = compute_sparse_laplacian(img_width, img_height) num_eigenvecs = 1500 v0 = np.ones(img_width * img_height) eigenvals, eigenvecs = scipy.sparse.linalg.eigsh(laplacian, k=num_eigenvecs, which='SM', v0=v0) assert np.all(eigenvals >= 0) plt.hist(eigenvals, bins=100) plt.title('Histogram of Laplacian Eigenvalues') plt.show() def keep_first_components(img_data, num_components): orig_shape = img_data.shape img_reshaped = np.reshape(img_data, (-1, 3)) chosen_eigenvecs = eigenvecs[:, :num_components] spectral_coeffs = chosen_eigenvecs.T @ img_reshaped upd_img_data_reshaped = chosen_eigenvecs @ spectral_coeffs return np.reshape(upd_img_data_reshaped, orig_shape).astype(int) plt.axis('off') plt.imshow(keep_first_components(img_data, 200)) plt.savefig('test.png', bbox_inches='tight', pad_inches=0) save_dir = 'processed' os.mkdir(save_dir) for img_name, img_bytes in imgs.items(): base_name = os.path.basename(img_name).split('.')[0] img_data = open_as_array(img_name) for num_components in [1, 2, 5, 10, 20, 100, 200, 500]: upd_img_data = keep_first_components(img_data, num_components) upd_img_name = f'{base_name}-{num_components}.png' plt.axis('off') plt.imshow(upd_img_data) _ = plt.savefig(f'{save_dir}/{upd_img_name}', bbox_inches='tight', pad_inches=0) !zip -r processed.zip processed files.download('processed.zip') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Now for a bit of exploratory data analysis so we can get to know our data Step2: Plot the data Step3: I'm sure there are more creative and informative ways to plot the data, but for now it's time to move on. Step4: Find the relevant features Step5: Try various machine learning algorithms Step6: How to format the data for the Kaggle contest submission based on the sampleSubmission.csv file Step7: sklearn.neighbors.KNeighborsRegressor Step8: sklearn.linear_model.LinearRegression Step9: sklearn.neural_network.MLPClassifier Step10: Restaurant Revenue Prediction Kaggle solution Step11: Concatenate the train and test data together into a single dataframe to pre-process and featurize both consistently Step12: Now is the time for us to impute values for the rare restaurant types (DT and MB). Step13: Here we can define and train a model to impute restaurant type. Step14: Now we can binarize the "P" columns with dummy variables Step15: To finish up our data preprocessing, we need to scale all input features to between 0 and 1 (this is especially important for KNN or SVM(SVR) models. Step16: Now we can define and train a Ridge Regression model. Step17: So, now we're ready for our final submission to Kaggle Step18: One last quick comparison.
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import sklearn import matplotlib.pyplot as plt import seaborn as sns from IPython.display import display %matplotlib inline train_data = pd.read_csv("train.csv") train_data = train_data.drop('Id', axis=1) test_data = pd.read_csv("test.csv") test_data = test_data.drop('Id', axis=1) display(train_data[:10]) display(test_data[:10]) train_data.describe() test_data.describe() train_data.head() train_data.tail() train_data.sample(5) train_data.keys() test_data.keys() test_data.keys() feature_columns = train_data[['P1', 'P2', 'P3', 'P4', 'P5', 'P6', 'P7', 'P8', 'P9', 'P10', 'P11', 'P12', 'P13', 'P14', 'P15', 'P16', 'P17', 'P18', 'P19', 'P20', 'P21', 'P22', 'P23', 'P24', 'P25', 'P26', 'P27', 'P28', 'P29', 'P30', 'P31', 'P32', 'P33', 'P34', 'P35', 'P36', 'P37']] feature_columns.plot.box(figsize=(20, 20)) # Cribbed from https://www.kaggle.com/ani310/restaurant-revenue-prediction/restaurant-revenue # Format the data so that dates are easier to work with. # Create a column that contains data about the number of days the restaurant has been open. # Remove the column that has the restaurant's opening date. train_data['Open Date'] = pd.to_datetime(train_data['Open Date'], format='%m/%d/%Y') test_data['Open Date'] = pd.to_datetime(test_data['Open Date'], format='%m/%d/%Y') train_data['OpenDays'] = "" test_data['OpenDays'] = "" date_last_train = pd.DataFrame({'Date':np.repeat(['01/01/2015'], [len(train_data)])}) date_last_test = pd.DataFrame({'Date':np.repeat(['01/01/2015'], [len(test_data)])}) date_last_train['Date'] = pd.to_datetime(date_last_train['Date'], format='%m/%d/%Y') date_last_test['Date'] = pd.to_datetime(date_last_test['Date'], format='%m/%d/%Y') train_data['OpenDays'] = date_last_train['Date'] - train_data['Open Date'] test_data['OpenDays'] = date_last_test['Date'] - test_data['Open Date'] train_data['OpenDays'] = train_data['OpenDays'].astype('timedelta64[D]').astype(int) test_data['OpenDays'] = test_data['OpenDays'].astype('timedelta64[D]').astype(int) train_data = train_data.drop('Open Date', axis=1) test_data = test_data.drop('Open Date', axis=1) # Compare the revenue generated by the restaurants in Big Cities vs Other: city_perc = train_data [["City Group", "revenue"]].groupby(['City Group'], as_index=False).mean() sns.barplot(x='City Group', y='revenue', data=city_perc) plt.title("Revenue by city size") # Convert data from 'City Group' and create columns of indicator variables for 'Big Cities' or 'Other': city_group_dummy = pd.get_dummies(train_data['City Group']) train_data = train_data.join(city_group_dummy) city_group_dummy_test = pd.get_dummies(test_data['City Group']) test_data = test_data.join(city_group_dummy_test) train_data = train_data.drop('City Group', axis=1) test_data = test_data.drop('City Group', axis=1) # Create scatterplot showing how long a restaurant has been open impacts revenue. # This will also show any outliers. plt.scatter(train_data['OpenDays'], train_data['revenue']) plt.xlabel("Days Open") plt.ylabel("Revenue") plt.title("Restaurant revenue by location age") from sklearn.feature_selection import SelectFromModel # from sklearn.linear_model import LassoCV from sklearn.ensemble import ExtraTreesClassifier X_train = train_data.iloc[:, 2:] y = train_data['revenue'] print("X_train.shape: {}".format(X_train.shape)) clf = ExtraTreesClassifier() clf = clf.fit(X_train, y) print("clf.feature_.importances_: \n{}".format(clf.feature_importances_)) model = SelectFromModel(clf, prefit=True) print(model) X_train_new = model.transform(X_train) print("X_train_new.shape: {}".format(X_train_new.shape)) X_train_new = pd.DataFrame(X_train_new) print(X_train_new[:5]) from sklearn.ensemble import RandomForestRegressor # Tweak seaborn visualizations and adapt to Jupyter notebooks: sns.set_context("notebook", font_scale=1.1) sns.set_style("ticks") # Make dataframes for train and test: X_train = pd.DataFrame({'OpenDaysLog':train_data['OpenDays'].apply(np.log), 'Big Cities':train_data['Big Cities'], 'Other':train_data['Other'], 'P2':train_data['P2'], 'P8':train_data['P8'], 'P22':train_data['P22'], 'P24':train_data['P24'], 'P28':train_data['P28'], 'P26':train_data['P26']}) y_train = train_data['revenue'].apply(np.log) X_test = pd.DataFrame({'OpenDaysLog':test_data['OpenDays'].apply(np.log), 'Big Cities':test_data['Big Cities'], 'Other':test_data['Other'], 'P2':test_data['P2'], 'P8':test_data['P8'], 'P22':test_data['P22'], 'P24':test_data['P24'], 'P28':test_data['P28'], 'P26':test_data['P26']}) # Time to build the models and make some predictions: from sklearn import linear_model cls = RandomForestRegressor(n_estimators=150) cls.fit(X_train, y_train) pred = cls.predict(X_test) pred = np.exp(pred) pred cls.score(X_train, y_train) test_data = pd.read_csv("test.csv") submission = pd.DataFrame({ "Id": test_data["Id"], "Prediction": pred }) # submission.to_csv('RandomForestSimple.csv', header=True, index=False) from sklearn.neighbors import KNeighborsRegressor # Use dataframes from sklearn.ensemble.RandomForestRegressor example above. knn_cls = KNeighborsRegressor(n_neighbors=2) knn_cls.fit(X_train, y_train) knn_pred = knn_cls.predict(X_test) knn_pred = np.exp(knn_pred) knn_cls.score(X_train, y_train) from sklearn.linear_model import LinearRegression # Use dataframes from sklearn.ensemble.RandomForestRegressor example above. lr_cls = LinearRegression() lr_cls.fit(X_train, y_train) lr_pred = lr_cls.predict(X_test) lr_pred = np.exp(lr_pred) lr_cls.score(X_train, y_train) from sklearn.neural_network import MLPRegressor mlp_cls = MLPRegressor(solver='lbfgs') mlp_cls.fit(X_train, y_train) mlp_pred = mlp_cls.predict(X_test) mlp_pred = np.exp(mlp_pred) mlp_cls.score(X_train, y_train) import datetime %pylab inline from sklearn.model_selection import LeaveOneOut from sklearn.grid_search import GridSearchCV, RandomizedSearchCV from sklearn.metrics import mean_squared_error, mean_absolute_error from sklearn.preprocessing import MinMaxScaler from sklearn.ensemble import ExtraTreesClassifier # Regressors considered: from sklearn.svm import SVR from sklearn.neighbors import KNeighborsRegressor # Regressor chosen by the author for final submission: from sklearn.linear_model import Ridge # Kaggle added ~311.5 "fake" data points to the test for each real data point. # Dividing by this number gives more accurate counts of the "real" data in the test set. FAKE_DATA_RATIO = 311.5 # Set a random seed: SEED = 0 # Read in the data provided by Kaggle: train = pd.read_csv('train.csv', index_col=0, parse_dates=[1]) test = pd.read_csv('test.csv', index_col=0, parse_dates=[1]) print("Training data dimensions: \n{}".format(train.shape)) print("Test data dimensions: \n{}".format(test.shape)) df = pd.concat((test, train), ignore_index=True) df.describe() # Convert date strings to "days open" numerical value: df["Open Date"] = df["Open Date"].apply(pd.to_datetime) last_date = df["Open Date"].max() # Create a datetime delta object: df["Open Date"] = last_date - df["Open Date"] # Convert the delta object to an int: df["Open Date"] = df["Open Date"].dt.days + 1 # Scale "days since opening" so that the marginal impact decreases over time. # This and the similar log transform of City Count below are the modifications # that were not in the official competition submission. df["Log Days Opened"] = df["Open Date"].apply(np.log) df = df.drop(["Open Date"], axis=1) # Resize plots: pylab.rcParams['figure.figsize'] = (8, 6) df[["Log Days Opened", "revenue"]].plot(x="Log Days Opened", y="revenue", kind='scatter', title="Log (Days Opened) vs Revenue") # There is a certain set of columns that are either all zero or all non-zero. # We have added a feature to mark this -- the 'zeros' feature will be 17 for # these rows and 0 or 1 for the rows which are rarely or never zero. # Here are the features with the notable zero behavior: zero_cols = ['P14', 'P15', 'P16', 'P17', 'P18', 'P24', 'P25', 'P26', 'P27', 'P30', 'P31', 'P32', 'P33', 'P34', 'P35', 'P36', 'P37'] # We make a feature that holds this count of zero columns in the above list: df['zeros'] = (df[zero_cols] == 0).sum(1) pylab.rcParams['figure.figsize'] = (20, 8) fig, axs = plt.subplots(1,2) fig.suptitle("Distribution of new Zeros features:", fontsize=18) # There is only one row with a zero count between 0 and 17 in the training set: df['zeros'].ix[pd.notnull(df.revenue)].value_counts().plot( title="Training Set", kind='bar', ax=axs[0]) # In the test set, however, there are many rows with an intermediate count of zeros. # This is probably an artifact of how the fake test data was generated, and might # indicate that conditional dependence between columns was not preserved. df['zeros'].ix[pd.isnull(df.revenue)].value_counts().plot( title="Test Set", kind='bar', ax=axs[1], color='red') # Here we convert two categorical variables, "Restaurant Type", and "City # Group (Size)" to dummy variables: pylab.rcParams['figure.figsize'] = (6, 4) # The two categories of City Group both appear very frequently: train["City Group"].value_counts().plot( title="City Group Distribution in the Training Set", kind='bar') # Two of the four Restaurant Types (DT and MB) are very rare: train["Type"].value_counts().plot( title="Restaurant Type Distribution in the Training Set", kind='bar') (test["Type"].value_counts() / FAKE_DATA_RATIO).plot( title="Approximate Restaurant Type Distribution in True Test Set", kind='bar', color='red') df = df.join(pd.get_dummies(df['City Group'], prefix="CG")) df = df.join(pd.get_dummies(df['Type'], prefix="T")) # Since only n-1 columns are needed to binarize n categories, drop one # of the new columns and drop the original columns. # In addition, drop the rare restaurant types. df = df.drop(["City Group", "Type", "CG_Other", "T_MB", "T_DT"], axis=1) print(df.shape) df.describe(include='all') # Replace city names with the count of their frequency in the training + # estimated frequency in the test set. city_counts = (test["City"].value_counts() / FAKE_DATA_RATIO).add(train["City"].value_counts(), fill_value=0) df["City"] = df["City"].replace(city_counts) print("Some example estimated counts of restaurants per city: \n{}".format( city_counts.head())) # Take the natural logarithm of city count so that the marginal effect decreases: df["Log City Count"] = df["City"].apply(np.log) df = df.drop(["City"], axis=1) # The last vertical spread of points below are restaurants in Istanbul. pylab.rcParams['figure.figsize'] = (8, 6) df[["Log City Count", "revenue"]].plot(x="Log City Count", y="revenue", kind='scatter', title="Log City Count vs Revenue") # tofit are the rows in the training set that belong to one of the common restaurant types: tofit = df.ix[((df.T_FC==1) | (df.T_IL==1)) & (pd.notnull(df.revenue))] # tofill are rows in either train or test that belong to one of the rare types: tofill = df.ix[((df.T_FC==0) & (df.T_IL==0))] print("Type training set shape: \n{}".format(tofit.shape)) print("Data to impute: \n{}".format(tofill.shape)) # Restaurants with type FC are labeled 1, those with type IL are labeled 0. y = tofit.T_FC # Drop the label columns and revenue (which is not in the test set): X = tofit.drop(["T_FC", "T_IL", "revenue"], axis=1) model_grid = {'max_depth': [None, 8], 'min_samples_split': [4,9,16], 'min_samples_leaf': [1,4], 'max_features': ['sqrt', 0.5, None]} type_model = ExtraTreesClassifier(n_estimators=25, random_state=SEED) grid = RandomizedSearchCV(type_model, model_grid, n_iter=10, cv=5, scoring="roc_auc") grid.fit(X, y) print("Best parameters for Type Model: \n{}".format(grid.best_params_)) type_model.set_params(**grid.best_params_) type_model.fit(X, y) imputations = type_model.predict(tofill.drop(["T_FC", "T_IL", "revenue"], axis=1)) df.loc[(df.T_FC==0) & (df.T_IL==0), "T_FC"] = imputations df = df.drop(["T_IL"], axis=1) df[:7] print("% labeled FC in the training set: \n{}".format(df.T_FC.mean())) print("% of imputed values labeled FC: \n{}".format(np.mean(imputations))) print("Pre-binarizing columns: {}".format(len(df.columns))) for col in df.columns: if col[0] == 'P': print(col, len(df[col].unique()), "Unique Values") df = df.join(pd.get_dummies(df[col], prefix=col)) df = df.drop([col, df.columns[-1]], axis=1) print("Post-binarizing columns: {}".format(len(df.columns))) min_max_scaler = MinMaxScaler() rev = df.revenue df = df.drop(['revenue'], axis=1) df = pd.DataFrame(data=min_max_scaler.fit_transform(df), columns=df.columns, index=df.index) df = df.join(rev) # Now that preprocessing is finished, let's have a look at the data before modeling with it: df.describe() # Recover the original train and test rows based on revenue (which is null for test rows) train = df.ix[pd.notnull(df.revenue)] test = df.ix[pd.isnull(df.revenue)].drop(['revenue'], axis=1) # Scale revenue by sqrt. # The reason is to decrease the influence of the few very large revenue values. y = train.revenue.apply(np.sqrt) X = train.drop(["revenue"], axis=1) model_grid = [{'normalize': [True, False], 'alpha': np.logspace(0,10)}] model = Ridge() # Use a grid search and leave-one-out CV on the train set to find the best regularization parameter to use. grid = GridSearchCV(model, model_grid, scoring='neg_mean_squared_error') grid.fit(X, y) print("Best parameters set found on development set: \n{}".format( grid.best_params_)) # Retrain model on the full training set using the best parameters found in the last step: model.set_params(**grid.best_params_) model.fit(X, y) # Predict on the test set using the trained model: submission = pd.DataFrame(columns=['Prediction'], index=test.index, data=model.predict(test)) # Convert back to revenue from sqrt(revenue): submission.Prediction = submission.Prediction.apply(np.square) submission.Prediction[:7] # Add required column name for Kaggle's submission parser: submission.index.name='Id' # Write out the submission: # submission.to_csv("TFI_Ridge.csv") # Quick sanity check on the submission: submission.describe().astype(int) # Revenue from training set for comparison: train[['revenue']].describe().astype(int) train[['revenue']].plot(kind='kde', title="Training Set Revenue Distribution") submission.columns = ["predicted revenue"] submission.plot(kind='kde', title="Prediction Revenue Distribution", color='red') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step4: Here the code from previous chapters we'll reuse. Step5: In the previous chapter we defined metrics that quantify the performance of bike sharing this system. In this chapter we see how those metrics depend on the parameters of the system, like the Customer rate of customers at bike stations. Step6: When you run State, it returns a new State object Step7: Not all functions have return values. For example, when you run step, Step8: add_five takes a parameter, x, which could be any number. It Step9: As a more useful example, here's a version of run_simulation that Step10: We can call run_simulation like this Step11: The result is a State object that represents the final state of the system, including the metrics we'll use to evaluate the performance of the system Step12: The simulation we just ran starts with olin=10 and wellesley=2, and uses the values p1=0.3, p2=0.2, and num_steps=60. Step13: The arguments indicate where the sequence should start and stop, and how Step14: When this loop runs, it Step15: Each time through the loop, we run a simulation with a different value Step16: And add values like this Step17: The result is a SweepSeries that maps from each value of p1 to the Step18: NumPy provides functions that compute a variety of summary statistics, like mean, median, and std (which computes standard deviation). Step19: In this example, computing the mean might not be useful, but in the exercises below, it will be. Step20: Exercise Step21: Exercise Step22: Exercise Step23: Optional Exercises Step24: Exercise
<ASSISTANT_TASK:> Python Code: # install Pint if necessary try: import pint except ImportError: !pip install pint # download modsim.py if necessary from os.path import exists filename = 'modsim.py' if not exists(filename): from urllib.request import urlretrieve url = 'https://raw.githubusercontent.com/AllenDowney/ModSim/main/' local, _ = urlretrieve(url+filename, filename) print('Downloaded ' + local) # import functions from modsim from modsim import * def step(state, p1, p2): Simulate one time step. state: bikeshare State object p1: probability of an Olin->Wellesley ride p2: probability of a Wellesley->Olin ride if flip(p1): bike_to_wellesley(state) if flip(p2): bike_to_olin(state) def bike_to_olin(state): Move one bike from Wellesley to Olin. state: bikeshare State object if state.wellesley == 0: state.wellesley_empty += 1 return state.wellesley -= 1 state.olin += 1 def bike_to_wellesley(state): Move one bike from Olin to Wellesley. state: bikeshare State object if state.olin == 0: state.olin_empty += 1 return state.olin -= 1 state.wellesley += 1 from numpy import sqrt root_2 = sqrt(2) root_2 bikeshare = State(olin=10, wellesley=2) bikeshare def add_five(x): return x + 5 add_five(3) def run_simulation(p1, p2, num_steps): state = State(olin=10, wellesley=2, olin_empty=0, wellesley_empty=0) for i in range(num_steps): step(state, p1, p2) return state final_state = run_simulation(0.3, 0.2, 60) print(final_state.olin_empty, final_state.wellesley_empty) from numpy import linspace p1_array = linspace(0, 1, 5) p1_array for p1 in p1_array: print(p1) p1_array = linspace(0, 0.6, 6) p2 = 0.2 num_steps = 60 for p1 in p1_array: final_state = run_simulation(p1, p2, num_steps) print(p1, final_state.olin_empty) sweep = SweepSeries() for p1 in p1_array: final_state = run_simulation(p1, p2, num_steps) sweep[p1] = final_state.olin_empty sweep.plot(label='Olin') decorate(title='Olin-Wellesley Bikeshare', xlabel='Customer rate at Olin (p1 in customers/min)', ylabel='Number of unhappy customers') from numpy import mean mean(sweep) # Solution def make_state(): state = State(olin=10, wellesley=2) return state # Solution init = make_state() # Solution p1_array = linspace(0, 1, 101) p1_array # Solution def sweep_p1(p1_array): p2 = 0.2 num_steps = 60 sweep = SweepSeries() for p1 in p1_array: state = run_simulation(p1, p2, num_steps) sweep[p1] = state.olin_empty return sweep # Solution p1_array = linspace(0, 1, 101) sweep = sweep_p1(p1_array) sweep.plot(label='Olin') decorate(title='Olin-Wellesley Bikeshare', xlabel='Customer rate at Olin (p1 in customers/min)', ylabel='Number of unhappy customers') # Solution def sweep_p2(p2_array): p1 = 0.5 num_steps = 60 sweep = SweepSeries() for p2 in p2_array: state = run_simulation(p1, p2, num_steps) sweep[p2] = state.olin_empty return sweep # Solution p2_array = linspace(0, 1, 101) sweep = sweep_p2(p2_array) sweep.plot(label='Olin') decorate(title='Olin-Wellesley Bikeshare', xlabel='Customer rate at Wellesley (p2 in customers/min)', ylabel='Number of unhappy customers') # Solution def run_multiple_simulations(p1, p2, num_steps, num_runs): totals = TimeSeries() for i in range(num_runs): state = run_simulation(p1, p2, num_steps) totals[i] = state.olin_empty + state.wellesley_empty return totals # Solution p1 = 0.3 p2 = 0.3 num_steps = 60 num_runs = 10 totals = run_multiple_simulations(p1, p2, num_steps, num_runs) show(totals) # Solution mean(totals) # Solution p1_array = linspace(0, 1, 20) p2 = 0.3 num_steps = 60 num_runs = 20 sweep = SweepSeries() for p1 in p1_array: totals = run_multiple_simulations(p1, p2, num_steps, num_runs) sweep[p1] = mean(totals) # Solution sweep.plot(label='total', color='green') decorate(title='Olin-Wellesley Bikeshare', xlabel='Customer rate at Olin (p1 in customers/min)', ylabel='Average total unhappy customers') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2. wadiz_df Data 정리 Step2: 3. Project_money Data 처리 Step3: 4. Project_money_all, Wadiz_df 합치기 Step4: 5. Data 추가 Step5: 5. Comment Crawling Step6: 6. 맞춤법 검사 Step7: 7. 개설자 댓글이 존재하는 Project만 선정
<ASSISTANT_TASK:> Python Code: wadiz_df = pd.DataFrame(columns=["project_id", "title", "area", "category", "target", "result", "duration", "comment_all", "comment_user", "comment_provider", "money_supporter", "sign_supporter"]) project_money_all = pd.DataFrame() for page in range(1, 100): try: project_id = page response = requests.get("http://www.wadiz.kr/web/campaign/detail/{page_num}".format(page_num=project_id)) #print(project_id) dom = BeautifulSoup(response.content, "html.parser") title_1 = dom.select("div.wd-ui-title-wrap h1.wd-h1") title = title_1[0].text area_1 = dom.select("div.wd-ui-campaign-info li.wd-data-area") area = area_1[0].text category_1 = dom.select("div.wd-ui-campaign-info li.wd-data-tag") category = category_1[0].text target_1 = dom.select("div.wd-info-target em.wd-data-target") target = target_1[0].text result_1 = dom.select("div.wd-ui-target-old span.wd-data-collection") result = result_1[0].find("em").text comment_all_1 = dom.select_one("div.wd-ui-tab-wrap") comment_all = comment_all_1.find_all("li")[1].text[18:-3] comment_provider_1 = dom.select("ul.wd-list-reply") comment_provider = len(comment_provider_1) comment_user = int(comment_all) - comment_provider number_join_all = dom.select_one("li.wd-last").text[17:-6] number_money_1 = dom.select("li.wd-data-money") number_money = number_money_1[0].text[6:-1][:-1] number_supporter_1 = dom.select("li.wd-data-sign") number_supporter = number_supporter_1[0].text[6:-1][:-1] duration_1 = dom.select("li.wd-data-date") duration = duration_1[0].text[-23:] #print(title, area, category, target, result) wadiz_df.loc[len(wadiz_df)] = [project_id, title, area, category, target, result, duration, comment_all, comment_user, comment_provider, number_money, number_supporter] p_id = page response_1 = requests.get("http://www.wadiz.kr/web/campaign/detailBacker/{project_num}".format(project_num = p_id)) dom_1 = BeautifulSoup(response_1.content, "html.parser") dom_1.select("span.wd-data-sponsor") a = pd.Series(dom_1.select("span.wd-data-sponsor strong")[1::2]) b = a.apply(lambda x: x.text[97:-93]) b = b.apply(lambda x: x.replace(",", "")) time = dom_1.select("span.wd-data-sponsor script") date = pd.Series() for i in time: date_1 = i.text[67:-53] date.loc[len(date)] = date_1 date = date.apply(lambda x: x[0:10]) p = pd.DataFrame(columns=["project_id"]) project_money = pd.concat([p, b, date], axis=1).fillna(p_id) project_money = project_money.rename(columns={0 : "funding_money", 1: "funding_date"}) project_money = project_money.loc[project_money["funding_money"] != ""] project_money_all = project_money_all.append(project_money) #print(p_id) except: continue #project_money_all = project_money_all[project_money_all['funding_money'] != ""] project_money_all.index = np.arange(len(project_money_all)) # Data 저장 wadiz_df.to_csv('wadiz_df_0329.csv', encoding='utf-8') project_money_all.to_csv('project_money_all_0329.csv') # 최종 금액 0원 초과만 재분류 wadiz_df = wadiz_df[wadiz_df["result"] > 0] # 날짜 처리 date = np.vstack(wadiz_df.duration.astype(str).apply(lambda x: list(map(str, x.split('-')))).values) wadiz_df["date_start"] = date[:,0] wadiz_df["date_end"] = date[:,1] wadiz_df.drop("duration", axis=1, inplace=True) # 날짜 이상치 처리 wadiz_df = wadiz_df[wadiz_df['date_start'] != '\t\t\t\t\t\t\t\t\t\t '] wadiz_df["date_start"] = pd.to_datetime(wadiz_df["date_start"]) wadiz_df["date_end"] = pd.to_datetime(wadiz_df["date_end"]) # 펀딩 기간 추가 (date_duration) wadiz_df["date_duration"] = wadiz_df["date_end"] - wadiz_df["date_start"] wadiz_df.head() # year, month 뽑기 wadiz_df['year'] = wadiz_df['date_start'].apply(lambda x : x.year) wadiz_df['month'] = wadiz_df['date_start'].apply(lambda x: x.month) # 한글-> 영문처리 wadiz_df["area"][wadiz_df["area"] == u'서울특별시'] = 'seoul' wadiz_df["area"][wadiz_df["area"] == u'경기도'] = 'kyungki' wadiz_df["area"][wadiz_df["area"] == u'부산광역시'] = 'busan' wadiz_df["area"][wadiz_df["area"] == u'인천광역시'] = 'incheon' wadiz_df["area"][wadiz_df["area"] == u'경상북도'] = 'kyungbuk' wadiz_df["area"][wadiz_df["area"] == u'전라북도'] = 'jeonbuk' wadiz_df["area"][wadiz_df["area"] == u'강원도'] = 'kangwon' wadiz_df["area"][wadiz_df["area"] == u'대구광역시'] = 'deagu' wadiz_df["area"][wadiz_df["area"] == u'충청남도'] = 'chungnam' wadiz_df["area"][wadiz_df["area"] == u'충청북도'] = 'chungbuk' wadiz_df["area"][wadiz_df["area"] == u'대전광역시'] = 'deajeon' wadiz_df["area"][wadiz_df["area"] == u'광주광역시'] = 'gwangju' wadiz_df["area"][wadiz_df["area"] == u'경상남도'] = 'kyungnam' wadiz_df["area"][wadiz_df["area"] == u'제주특별자치도'] = 'jeju' wadiz_df["area"][wadiz_df["area"] == u'울산광역시'] = 'ulsan' wadiz_df["area"][wadiz_df["area"] == u'전라남도'] = 'jeonnam' wadiz_df["area"][wadiz_df["area"] == u'세종특별자치시'] = 'sejong' wadiz_df["category"][wadiz_df["category"] == u"나눔/공익"] = 'share/public' wadiz_df["category"][wadiz_df["category"] == u"라이프/패션"] = 'life/fashion' wadiz_df["category"][wadiz_df["category"] == u"테크/디자인"] = 'tech/design' wadiz_df["category"][wadiz_df["category"] == u"교육"] = 'education' wadiz_df["category"][wadiz_df["category"] == u"책/영화"] = 'book/movie' wadiz_df["category"][wadiz_df["category"] == u"음악/공연"] = 'music/concert' wadiz_df["category"][wadiz_df["category"] == u"미술/사진/전시"] = 'art/photo/exhibit' wadiz_df["category"][wadiz_df["category"] == u"환경"] = 'environment' wadiz_df["category"][wadiz_df["category"] == u"스포츠"] = 'sports' wadiz_df["category"][wadiz_df["category"] == u"여행"] = 'travel' wadiz_df["category"][wadiz_df["category"] == u"게임/만화"] = 'game/comics' wadiz_df["category"][wadiz_df["category"] == u"피규어/웹툰"] = 'figure/webtoon' # category 이상치 처리 wadiz_df["category"].fillna('etc', inplace = True) # area, category -> LabelEncoding le = LabelEncoder() wadiz_df["category_label"] = le.fit_transform(wadiz_df["category"]) wadiz_df["area_label"] = le.fit_transform(wadiz_df["area"]) # area, category -> OneHotEncoding category_dummy = pd.get_dummies(wadiz_df['category'], prefix = 'category_label') area_dummy = pd.get_dummies(wadiz_df['area'], prefix = 'category_label') month = pd.get_dummies(wadiz_df.month, prefix="month") year = pd.get_dummies(wadiz_df.year, prefix="year") wadiz_df = pd.concat([wadiz_df, category_dummy, area_dummy, year, month], axis=1) # 콤마 제거 wadiz_df['result'] = wadiz_df['result'].apply(lambda x: x.replace(",", "")) wadiz_df['target'] = wadiz_df['target'].apply(lambda x: x.replace(",", "")) # int 변환 wadiz_df['result'] = wadiz_df['result'].apply(lambda x : int(x)) wadiz_df['target'] = wadiz_df['target'].apply(lambda x : int(x)) # funding_rate 생성 # Success/Fail 나누기 wadiz_df["funding_rate"] = wadiz_df["result"] / wadiz_df["target"] wadiz_df["success"] = wadiz_df["result"] / wadiz_df["target"] wadiz_df["success"][wadiz_df['funding_rate']>=1] = 1 wadiz_df["success"][wadiz_df['funding_rate']<1] = 0 wadiz_df['project_id'] = wadiz_df['project_id'].apply(lambda x: int(x)) # 날짜 계산용 DataFrame 생성 date_difference = pd.merge(project_money_all, wadiz_df, on="project_id") # funding_date 처리 project_money_all["funding_date"] = pd.to_datetime(project_money_all["funding_date"]) date_difference["funding_date"] = pd.to_datetime(date_difference["funding_date"]) date_difference["date_start"] = pd.to_datetime(date_difference["date_start"]) date_difference["funding_date"] - date_difference["date_start"] # 프로젝트 개설일과 개인별 펀딩일 차이 project_money_all["date_difference"] = date_difference["funding_date"] - date_difference["date_start"] # NaN값 제거 (이상치) project_money_all['date_difference'] = project_money_all['date_difference'].fillna('-1') project_money_all = project_money_all[project_money_all['date_difference'] >= '0 days'] # 날짜 처리 project_money_all["date_difference"] = project_money_all["date_difference"].apply(lambda x: int(x)/8.640000e+13) #project_money_all = project_money_all[project_money_all["date_difference"] >= 0] project_money_all type(project_money_all['date_difference'][0]) project_money_all["0day_difference"] = np.ones(len(project_money_all)) # 0~5일 이내 funding된 금액만 처리 for i in np.arange(6): number = i project_money_all["{number}day_difference".format(number = i)] = np.ones(len(project_money_all)) project_money_all["{number}day_difference".format(number = i)][project_money_all["date_difference"] <= number] = "short" project_money_all["{number}day_difference".format(number = i)][project_money_all["date_difference"] > number] = "long" project_money_all['funding_money'] = project_money_all['funding_money'].apply(lambda x: int(x)) zero_day = project_money_all.loc[project_money_all["0day_difference"] == "short"] one_day = project_money_all.loc[project_money_all["1day_difference"] == "short"] two_day = project_money_all.loc[project_money_all["2day_difference"] == "short"] three_day = project_money_all.loc[project_money_all["3day_difference"] == "short"] four_day = project_money_all.loc[project_money_all["4day_difference"] == "short"] five_day = project_money_all.loc[project_money_all["5day_difference"] == "short"] zero_day = zero_day.groupby("project_id", as_index=False).sum() one_day = one_day.groupby("project_id", as_index=False).sum() two_day = two_day.groupby("project_id", as_index=False).sum() three_day = three_day.groupby("project_id", as_index=False).sum() four_day = four_day.groupby("project_id", as_index=False).sum() five_day = five_day.groupby("project_id", as_index=False).sum() zero_day = zero_day.rename(columns={"funding_money" : "0day_funding_money"}) one_day = one_day.rename(columns={"funding_money" : "1day_funding_money"}) two_day = two_day.rename(columns={"funding_money" : "2day_funding_money"}) three_day = three_day.rename(columns={"funding_money" : "3day_funding_money"}) four_day = four_day.rename(columns={"funding_money" : "4day_funding_money"}) five_day = five_day.rename(columns={"funding_money" : "5day_funding_money"}) zero_day = zero_day.rename(columns={"date_difference" : "0day_date"}) one_day = one_day.rename(columns={"date_difference" : "1day_date"}) two_day = two_day.rename(columns={"date_difference" : "2day_date"}) three_day = three_day.rename(columns={"date_difference" : "3day_date"}) four_day = four_day.rename(columns={"date_difference" : "4day_date"}) five_day = five_day.rename(columns={"date_difference" : "5day_date"}) wadiz_df = pd.merge(wadiz_df, zero_day, on = "project_id", how='outer') wadiz_df = pd.merge(wadiz_df, one_day, on = "project_id", how='outer') wadiz_df = pd.merge(wadiz_df, two_day, on = "project_id", how='outer') wadiz_df = pd.merge(wadiz_df, three_day, on = "project_id", how='outer') wadiz_df = pd.merge(wadiz_df, four_day, on = "project_id", how='outer') wadiz_df = pd.merge(wadiz_df, five_day, on = "project_id", how='outer') # NaN 값 체크 # Nan값은 0~5일내에 펀딩된 금액이 없는 것을 뜻함 for i in wadiz_df.columns: column = i print(len(wadiz_df.loc[wadiz_df["{column}".format(column = i)].isnull() == True])) wadiz_df.fillna(0, inplace=True) #NaN 값 다시 체크 for i in wadiz_df.columns: column = i print(len(wadiz_df.loc[wadiz_df["{column}".format(column = i)].isnull() == True])) #funding_rate 생성 for i in np.arange(6): number = i wadiz_df["{number}day_funding_rate".format(number = i)] = \ wadiz_df["{number}day_funding_money".format(number = i)]/wadiz_df["target"] # funding_rate 1 이상인 값들 체크 for i in np.arange(6): number = i print(len(wadiz_df.loc[wadiz_df["{number}day_funding_rate".format(number = i)] >= 1])) # funding_rate -> log scale for i in np.arange(6): number = i wadiz_df["{number}day_log_funding_rate".format(number = i)] = wadiz_df["{number}day_funding_rate"\ .format(number = i)].apply(lambda x: np.log(x)) wadiz_df.to_csv('wadiz_df_0329_1.csv', encoding='utf-8') project_id = wadiz_df.project_id user_data = pd.DataFrame(columns=['project_id', 'user_id', 'comment', 'date']) user_data_all = pd.DataFrame() provider_data = pd.DataFrame(columns=['project_id', 'provider_id', 'comment', 'date']) provider_data_all = pd.DataFrame() for i in project_id[0:]: project_id_list = i response = requests.get('https://www.wadiz.kr/web/campaign/detail/qa/{project_id_list}'.format(project_id_list = i)) dom = BeautifulSoup(response.content, 'html.parser') user_all = dom.select('div.wd-ui-recommend li.') print(project_id_list) if len(user_all) == 0: pass else: for number in np.arange(len(user_all)): user = user_all[number] user_url = user.select_one('a.wd-data-name').get('href') user_comment = user.select_one('span').text try: user_date = user.select_one('span.wd-data-whenCreated').text except: continue user_data.loc[len(user_data)] = [project_id_list, user_url, user_comment, user_date] provider_all = dom.select('ul.wd-list-reply') #print(project_id_list) for number in np.arange(len(provider_all)): provider = provider_all[number] provider_url = provider.select_one('a.wd-data-name').get('href') provider_comment = provider.select('span')[-2].text provider_date = provider.select('span')[-1].text provider_data.loc[len(provider_data)] = [project_id_list, provider_url, provider_comment, provider_date] user_data_all = user_data_all.append(user_data) provider_data_all = provider_data_all.append(provider_data) user_data_all.to_csv('user_data_all_0329.csv', encoding='utf-8') provider_data_all.to_csv('provider_data_all_0329.csv', encoding='utf-8') comment_analysis = pd.DataFrame(columns={'project_id', 'provider_id', 'result', 'original', 'checked', 'words', 'time', 'comment_length'}) for i in np.arange(len(provider_data_all)): try: result = spell_checker.check(provider_data_all['comment'][i]) comment = pd.DataFrame(provider_data_all.loc[i]).T comment_result = pd.DataFrame([result]) comment_result.index = comment.index comment_result_df = comment.join(comment_result) comment_analysis = comment_analysis.append(comment_result_df) comment_analysis['comment_length'][i] = len(comment_analysis['words'][i]) if i in 100*np.arange(220): print(i) except: continue # comment_error 생성 comment_error = pd.DataFrame([comment_analysis.project_id, comment_analysis.errors, comment_analysis.provider_id, comment_analysis.comment_length]).T # data int타입으로 전환 comment_error['errors'] = comment_error['errors'].apply(lambda x: int(x)) comment_error['comment_length'] = comment_error['comment_length'].apply(lambda x: int(x)) # comment error 처리 comment_error['errors'] = comment_error['errors'].apply(lambda x: int(x)) comment_error['comment_length'] = comment_error['comment_length'].apply(lambda x: int(x)) # id로 groupby comment_error = comment_error.groupby(by='project_id', as_index=False).sum() # grammar_level 생성 # 각 댓글에 속한 error를 전체 어절로 나눔 comment_error['provider_grammar_level'] = comment_error['errors']/comment_error['comment_length'] comment_analysis.to_csv('comment_analysis.csv', encoding='utf-8') wadiz_provider_analysis = pd.merge(wadiz_df, comment_error, how='inner', on= 'project_id') wadiz_provider_analysis.to_csv('wadiz_provider_analysis_0329.csv', encoding='utf-8') wadiz_df.head() wadiz_provider_analysis project_money_all provider_data_all user_data_all <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load LendingClub Loans dataset Step2: The target column (label column) of the dataset that we are interested in is called bad_loans. In this column 1 means a risky (bad) loan 0 means a safe loan. Step3: Unlike the previous assignment where we used several features, in this assignment, we will just be using 4 categorical Step4: Now, let's look at the head of the dataset. Step5: Performing one-hot encoding with Pandas Step6: Let's explore what the "grade_A" column looks like. Step7: This column is set to 1 if the loan grade is A and 0 otherwise. Step8: Using the list of the training data indicies and the test data indicies to get a DataFrame with the training data and a DataFrame with the test data. Step9: Decision tree implementation Step10: Because there are several steps in this assignment, we have introduced some stopping points where you can check your code and make sure it is correct before proceeding. To test your intermediate_node_num_mistakes function, run the following code until you get a Test passed!, then you should proceed. Otherwise, you should spend some time figuring out where things went wrong. Step11: Function to pick best feature to split on Step12: Now, creating a list of the features we are considering for the decision tree to test the above function. Not including the 0th element on the list since it corresponds to the "safe loans" column, the label we are trying to predict. Step13: To test your best_splitting_feature function, run the following code Step14: Building the tree Step15: We have provided a function that learns the decision tree recursively and implements 3 stopping conditions Step16: Here is a recursive function to count the nodes in your tree Step17: Run the following test code to check your implementation. Make sure you get 'Test passed' before proceeding. Step18: Build the tree! Step19: Making predictions with a decision tree Step20: Now, let's consider the first example of the test set and see what my_decision_tree model predicts for this data point. Step21: Let's add some annotations to our prediction to see what the prediction path was that lead to this predicted class Step22: Quiz question Step23: Quiz question Step24: Quiz question Step25: Evaluating your decision tree Step26: Now, let's use this function to evaluate the classification error on the test set. Step27: Quiz Question Step28: Printing out a decision stump Step29: Quiz Question Step30: Exploring the intermediate left subtree Step31: Exploring the left subtree of the left subtree Step32: Quiz question Step33: Quiz question
<ASSISTANT_TASK:> Python Code: import json import numpy as np import pandas as pd import matplotlib as mpl import matplotlib.pyplot as plt import seaborn as sns sns.set_style('darkgrid') %matplotlib inline loans = pd.read_csv("lending-club-data_assign_2.csv") # safe_loans = 1 => safe # safe_loans = -1 => risky loans['safe_loans'] = loans['bad_loans'].apply(lambda x : +1 if x==0 else -1) loans = loans.drop('bad_loans', 1) features = ['grade', # grade of the loan 'term', # the term of the loan 'home_ownership', # home_ownership status: own, mortgage or rent 'emp_length', # number of years of employment ] target = 'safe_loans' loans = loans[features + [target]] loans.head(5) loans_one_hot_enc = pd.get_dummies(loans) loans_one_hot_enc["grade_A"].head(5) with open('module-5-assignment-2-train-idx.json', 'r') as f: train_idx_lst = json.load(f) train_idx_lst = [int(entry) for entry in train_idx_lst] with open('module-5-assignment-2-test-idx.json', 'r') as f: test_idx_lst = json.load(f) test_idx_lst = [int(entry) for entry in test_idx_lst] train_data = loans_one_hot_enc.ix[train_idx_lst] test_data = loans_one_hot_enc.ix[test_idx_lst] def intermediate_node_num_mistakes(labels_in_node): # Corner case: If labels_in_node is empty, return 0 if len(labels_in_node) == 0: return 0 # Count the number of 1's (safe loans) N_count_plu_1 = (labels_in_node == 1).sum() # Count the number of -1's (risky loans) N_count_neg_1 = (labels_in_node == -1).sum() # Return the number of mistakes that the majority classifier makes. return min(N_count_plu_1, N_count_neg_1) # Test case 1 example_labels = np.array([-1, -1, 1, 1, 1]) if intermediate_node_num_mistakes(example_labels) == 2: print 'Test passed!' else: print 'Test 1 failed... try again!' # Test case 2 example_labels = np.array([-1, -1, 1, 1, 1, 1, 1]) if intermediate_node_num_mistakes(example_labels) == 2: print 'Test passed!' else: print 'Test 2 failed... try again!' # Test case 3 example_labels = np.array([-1, -1, -1, -1, -1, 1, 1]) if intermediate_node_num_mistakes(example_labels) == 2: print 'Test passed!' else: print 'Test 3 failed... try again!' def best_splitting_feature(data, features, target): best_feature = None # Keep track of the best feature best_error = 10 # Keep track of the best error so far # Note: Since error is always <= 1, we should intialize it with something larger than 1. # Convert to float to make sure error gets computed correctly. num_data_points = float(len(data)) # Loop through each feature to consider splitting on that feature for feature in features: # The left split will have all data points where the feature value is 0 left_split = data[data[feature] == 0] # The right split will have all data points where the feature value is 1 right_split = data[data[feature] == 1] # Calculate the number of misclassified examples in the left split. # Remember that we implemented a function for this! (It was called intermediate_node_num_mistakes) left_mistakes = intermediate_node_num_mistakes(left_split[target].values) # Calculate the number of misclassified examples in the right split. right_mistakes = intermediate_node_num_mistakes(right_split[target].values) # Compute the classification error of this split. # Error = (# of mistakes (left) + # of mistakes (right)) / (# of data points) error = (left_mistakes + right_mistakes)/num_data_points # If this is the best error we have found so far, store the feature as best_feature and the error as best_error if error < best_error: best_error = error best_feature = feature return best_feature # Return the best feature we found feature_lst = train_data.columns.values.tolist()[1:] print feature_lst if best_splitting_feature(train_data, feature_lst, 'safe_loans') == 'term_ 36 months': print 'Test passed!' else: print 'Test failed... try again!' def create_leaf(target_values): # Create a leaf node leaf = {'splitting_feature' : None, 'left' : None, 'right' : None, 'is_leaf': True } # Count the number of data points that are +1 and -1 in this node. num_ones = (target_values == 1).sum() num_minus_ones = (target_values == -1).sum() # For the leaf node, set the prediction to be the majority class. # Store the predicted class (1 or -1) in leaf['prediction'] if num_ones > num_minus_ones: leaf['prediction'] = 1 else: leaf['prediction'] = -1 # Return the leaf node return leaf def decision_tree_create(data, features, target, current_depth = 0, max_depth = 10): remaining_features = features[:] # Make a copy of the features. target_values = data[target].values print "--------------------------------------------------------------------" print "Subtree, depth = %s (%s data points)." % (current_depth, len(target_values)) # Stopping condition 1 # (Check if there are mistakes at current node. # Recall you wrote a function intermediate_node_num_mistakes to compute this.) if intermediate_node_num_mistakes(target_values) == 0: ## YOUR CODE HERE print "Stopping condition 1 reached." # If not mistakes at current node, make current node a leaf node return create_leaf(target_values) # Stopping condition 2 (check if there are remaining features to consider splitting on) if remaining_features == 0: ## YOUR CODE HERE print "Stopping condition 2 reached." # If there are no remaining features to consider, make current node a leaf node return create_leaf(target_values) # Additional stopping condition (limit tree depth) if current_depth >= max_depth : ## YOUR CODE HERE print "Reached maximum depth. Stopping for now." # If the max tree depth has been reached, make current node a leaf node return create_leaf(target_values) # Find the best splitting feature (recall the function best_splitting_feature implemented above) splitting_feature = best_splitting_feature(data, remaining_features, target) # Split on the best feature that we found. left_split = data[data[splitting_feature] == 0] right_split = data[data[splitting_feature] == 1] remaining_features.remove(splitting_feature) print "Split on feature %s. (%s, %s)" % (\ splitting_feature, len(left_split), len(right_split)) # Create a leaf node if the split is "perfect" if len(left_split) == len(data): print "Creating leaf node." return create_leaf(left_split[target]) if len(right_split) == len(data): print "Creating leaf node." return create_leaf(right_split[target]) # Repeat (recurse) on left and right subtrees left_tree = decision_tree_create(left_split, remaining_features, target, current_depth + 1, max_depth) right_tree = decision_tree_create(right_split, remaining_features, target, current_depth + 1, max_depth) return {'is_leaf' : False, 'prediction' : None, 'splitting_feature': splitting_feature, 'left' : left_tree, 'right' : right_tree} def count_nodes(tree): if tree['is_leaf']: return 1 return 1 + count_nodes(tree['left']) + count_nodes(tree['right']) small_data_decision_tree = decision_tree_create(train_data, feature_lst, 'safe_loans', max_depth = 3) if count_nodes(small_data_decision_tree) == 13: print 'Test passed!' else: print 'Test failed... try again!' print 'Number of nodes found :', count_nodes(small_data_decision_tree) print 'Number of nodes that should be there : 13' my_decision_tree = decision_tree_create(train_data, feature_lst, 'safe_loans', max_depth = 6) def classify(tree, x, annotate = False): # if the node is a leaf node. if tree['is_leaf']: if annotate: print "At leaf, predicting %s" % tree['prediction'] return tree['prediction'] else: # split on feature. split_feature_value = x[tree['splitting_feature']] if annotate: print "Split on %s = %s" % (tree['splitting_feature'], split_feature_value) if split_feature_value == 0: return classify(tree['left'], x, annotate) else: return classify(tree['right'], x, annotate) test_data.iloc[0] print 'Predicted class: %s ' % classify(my_decision_tree, test_data.iloc[0]) classify(my_decision_tree, test_data.iloc[0], annotate=True) print "term_ 36 months" print "grade_D" print "grade_D" def evaluate_classification_error(tree, data): # Apply the classify(tree, x) to each row in your data predictions = data.apply(lambda x: classify(tree, x, annotate=False) , axis = 1) # Once you've made the predictions, calculate the classification error and return it number_mistakes = (predictions != data['safe_loans'].values).sum() total_examples = float(len(predictions)) classification_error = number_mistakes/total_examples return classification_error evaluate_classification_error(my_decision_tree, test_data) print "Classification error of my_decision_tree on \ the test_data: %.2f" %(evaluate_classification_error(my_decision_tree, test_data)) def print_stump(tree, name = 'root'): split_name = tree['splitting_feature'] # split_name is something like 'term. 36 months' if split_name is None: print "(leaf, label: %s)" % tree['prediction'] return None split_feature, split_value = split_name.split('_') print ' %s' % name print ' |---------------|----------------|' print ' | |' print ' | |' print ' | |' print ' [{0} == 0] [{0} == 1] '.format(split_name) print ' | |' print ' | |' print ' | |' print ' (%s) (%s)' \ % (('leaf, label: ' + str(tree['left']['prediction']) if tree['left']['is_leaf'] else 'subtree'), ('leaf, label: ' + str(tree['right']['prediction']) if tree['right']['is_leaf'] else 'subtree')) print_stump(my_decision_tree) print "term_ 36 months" print_stump(my_decision_tree['left'], my_decision_tree['splitting_feature']) print_stump(my_decision_tree['left']['left'], my_decision_tree['left']['splitting_feature']) print "term_ 36 months, grade_A, grade_B" print_stump(my_decision_tree['right'], my_decision_tree['splitting_feature']) print_stump(my_decision_tree['right']['right'], my_decision_tree['right']['splitting_feature']) print "term_ 36 months, grade_D, no third feature because second split resulted in leaf" <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load Image As Greyscale Step2: Save Image
<ASSISTANT_TASK:> Python Code: # Load library import cv2 import numpy as np from matplotlib import pyplot as plt # Load image as grayscale image = cv2.imread('images/plane.jpg', cv2.IMREAD_GRAYSCALE) # Show image plt.imshow(image, cmap='gray'), plt.axis("off") plt.show() # Save image cv2.imwrite('images/plane_new.jpg', image) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Document Authors Step2: Document Contributors Step3: Document Publication Step4: Document Table of Contents Step5: 1.2. Model Name Step6: 1.3. Ice Albedo Step7: 1.4. Atmospheric Coupling Variables Step8: 1.5. Oceanic Coupling Variables Step9: 1.6. Prognostic Variables Step10: 2. Key Properties --&gt; Software Properties Step11: 2.2. Code Version Step12: 2.3. Code Languages Step13: 3. Grid Step14: 3.2. Adaptive Grid Step15: 3.3. Base Resolution Step16: 3.4. Resolution Limit Step17: 3.5. Projection Step18: 4. Glaciers Step19: 4.2. Description Step20: 4.3. Dynamic Areal Extent Step21: 5. Ice Step22: 5.2. Grounding Line Method Step23: 5.3. Ice Sheet Step24: 5.4. Ice Shelf Step25: 6. Ice --&gt; Mass Balance Step26: 7. Ice --&gt; Mass Balance --&gt; Basal Step27: 7.2. Ocean Step28: 8. Ice --&gt; Mass Balance --&gt; Frontal Step29: 8.2. Melting Step30: 9. Ice --&gt; Dynamics Step31: 9.2. Approximation Step32: 9.3. Adaptive Timestep Step33: 9.4. Timestep
<ASSISTANT_TASK:> Python Code: # DO NOT EDIT ! from pyesdoc.ipython.model_topic import NotebookOutput # DO NOT EDIT ! DOC = NotebookOutput('cmip6', 'miroc', 'sandbox-3', 'landice') # Set as follows: DOC.set_author("name", "email") # TODO - please enter value(s) # Set as follows: DOC.set_contributor("name", "email") # TODO - please enter value(s) # Set publication status: # 0=do not publish, 1=publish. DOC.set_publication_status(0) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.model_name') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.ice_albedo') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "prescribed" # "function of ice age" # "function of ice density" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.atmospheric_coupling_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.oceanic_coupling_variables') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.prognostic_variables') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "ice velocity" # "ice thickness" # "ice temperature" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.software_properties.repository') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.software_properties.code_version') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.key_properties.software_properties.code_languages') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.grid.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.grid.adaptive_grid') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.grid.base_resolution') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.grid.resolution_limit') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.grid.projection') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.glaciers.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.glaciers.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.glaciers.dynamic_areal_extent') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.overview') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.grounding_line_method') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # Valid Choices: # "grounding line prescribed" # "flux prescribed (Schoof)" # "fixed grid size" # "moving grid" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.ice_sheet') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.ice_shelf') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.mass_balance.surface_mass_balance') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.mass_balance.basal.bedrock') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.mass_balance.basal.ocean') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.mass_balance.frontal.calving') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.mass_balance.frontal.melting') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.dynamics.description') # PROPERTY VALUE: # Set as follows: DOC.set_value("value") # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.dynamics.approximation') # PROPERTY VALUE(S): # Set as follows: DOC.set_value("value") # Valid Choices: # "SIA" # "SAA" # "full stokes" # "Other: [Please specify]" # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.dynamics.adaptive_timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # Valid Choices: # True # False # TODO - please enter value(s) # PROPERTY ID - DO NOT EDIT ! DOC.set_id('cmip6.landice.ice.dynamics.timestep') # PROPERTY VALUE: # Set as follows: DOC.set_value(value) # TODO - please enter value(s) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Insults package Step2: Identifying quotation marks Step3: We need to clean up the open and closed inverted commas with straight ones. Step4: Making recommended Google search queries
<ASSISTANT_TASK:> Python Code: # print("\x1b[30;1m\"red\"\x1b[0m") # print("\x1b[31;1m\"red\"\x1b[0m") # print("\x1b[32;1m\"red\"\x1b[0m") # print("\x1b[33;1m\"red\"\x1b[0m") # print("\x1b[34;1m\"red\"\x1b[0m") # print("\x1b[35;1m\"red\"\x1b[0m") # print("\x1b[36;1m\"red\"\x1b[0m") # print("\x1b[37;1m\"red\"\x1b[0m") # print("\x1b[30;1m\"red\"\x1b[0m") # print("\x1b[31;1m\"red\"\x1b[0m") # print("\x1b[32;1m\"red\"\x1b[0m") # print("\x1b[33;1m\"red\"\x1b[0m") # print("\x1b[34;1m\"red\"\x1b[0m") # print("\x1b[35;1m\"red\"\x1b[0m") # print("\x1b[36;1m\"red\"\x1b[0m") # print("\x1b[37;1m\"red\"\x1b[0m") # print("\x1b[30m\"red\"\x1b[0m") # print("\x1b[31m\"red\"\x1b[0m") # print("\x1b[32m\"red\"\x1b[0m") # print("\x1b[33m\"red\"\x1b[0m") # print("\x1b[34m\"red\"\x1b[0m") # print("\x1b[35m\"red\"\x1b[0m") # print("\x1b[36m\"red\"\x1b[0m") # print("\x1b[37m\"red\"\x1b[0m") from __future__ import print_function import regex as re # for x in range(256): # # # formatting = "\x1b[" + str(x) + "m\"red\"\x1b[0m" # # # formatting = "\x1b[" + str(x) + "m k \x1b[0m" # formatting = "\033[38;5;" + str(x) + "mo \x1b[0m" # print(formatting, end=" ") # if x%36 == 15: # print("") def print_this_way(string, x, y): # formatting = "\033[38;5;" + str(16 + int(4*x) + 36*int(4*y)) + "m\"red\"\x1b[0m" formatting = '\x1b[38;5;' + str(16 + int(4*x) + 36*int(4*y)) + 'm'+ string +'\x1b[0m' # print(formatting, end=" ") print('\x1b[38;5;' + str(16 + int(4*x) + 36*int(4*y)) + 'm'+ string +'\x1b[0m', end=" ") import numpy as np for x in np.arange(0,1,0.2): for y in np.arange(0,1,0.2): print_this_way("o", x, y) print("") # formatting_ = "\x1b[37m\"red\"\x1b[0m" # print(formatting_, end=" ") # print(type(formatting)) # print(type("\x1b[37m\"red\"\x1b[0m")) # "\x1b[37m\"red\"\x1b[0m" print('\x1b[1;31m'+'Hello world'+'\x1b[0m' + " noobs") import sys from termcolor import colored, cprint text = colored('Hello, World!', 'red', attrs=['reverse', 'blink']) print(text) cprint('Hello, World!', 'green', 'on_red') print_red_on_cyan = lambda x: cprint(x, 'red', 'on_cyan') print_red_on_cyan('Hello, World!') print_red_on_cyan('Hello, Universe!') for i in range(10): cprint(i, 'magenta', end=' ') cprint("Attention!", 'red', attrs=['bold'], file=sys.stderr) from insults import Insults Insults.load_model() comment = "You eat people?" Insults.rate_comment(comment) comments = ["You called me a \"dickhead\", so I'll say you're a cunt.", "These shitakes taste like shit."] print(Insults.foul_language(comments, context=False)) fake_news = u''' Prime Minister Lee Hsien Loong has been addressed as a dictator by many Singaporeans and rightly so, but few can point out what he actually did that defines him as one – after all, everything is legal right? For a start, dictators write their own rules and never subject themselves to the rules they wrote. The one trait shared between Lee Hsien Loong and dictators like Kim Jong Un, Hitler, Stalin and Mao is when they are all above the laws, it is still legal. One just need to look at the joke of a Presidential Election conducted this year to understand what a dictator is all about: Writing his own laws Knowing that having a race-based election infringes the Constitution, Lee Hsien Loong single-handedly abused his majority power in Parliament to re-write the Constitution. After making a mistake about Halimah Yacob’s Indian race, Lee Hsien Loong appointed a committee of his cronies to re-write the definition of the Malay race. Creating proxies to act on his behalf The 16-member committee to decide “Malayness” was appointed by Lee Hsien Loong and the committee actively consults the dictator for directions. The Council of Presidential Advisers (CPA) restricting the powers of a President also acts by Lee Hsien Loong’s bidding. Halimah Yacob herself is a walking puppet and proxy of Lee Hsien Loong. These proxies are created to create a facade that due processes are in place, but a sharper mind knows better. Breaching the laws he created When opposition party’s ex-member Yaw Shin Long resigned from his MP position, a by-election was called and insisted so by Lee Hsien Loong. However, when Halimah Yacob resigned from her MP position, Lee Hsien Loong feigned ignorance and claimed no by-election is needed. However the fact remains that the Parliament lost one representative voice (not that it matters since it is still PAP anyway), so a by-election should be called for Yew Tee-Marsiling GRC. Abuse laws to his political advantage A walkover is legal, according to the election laws he written. Therefore, the Lee Hsien Loong-endorsed candidate becoming a President through a walkover is wholly legit. Banning the two opponent Presidential contestants because they fail to meet the S$500 million financial requirements is also perfectly legit. Halimah Yacob, an Indian, is now a legit Malay because a committee said so. Everything is legal yet corrupted, the colour white is actually a stain itself. His words are final Like all dictators, Lee Hsien Loong’s words are final. Yes there are unhappiness, he said, “but I did the right thing”. Lee Hsien Loong’s words exemplify the saying that the road to hell is paved with good intentions. A civil court case launched by Dr Tan Cheng Bock was blocked by the High Court. Opposition MP Sylvia Lim’s question in Parliament is denied, twice. Nobody could ask a damn question, because his words are final. Gutter politics at it’s finest. Whether Singapore is corrupted depends on one’s acceptance of the political system. If Singapore is perceived as a democracy, it breaches every value of the Singapore pledge and the government is corrupted inside out. Whereas if Singapore is perceived as a dictatorship, it is fully legitimised and corruption-free. ''' import unidecode fake_news_ = unidecode.unidecode(fake_news) import regex as re print(re.findall(r'"(.*?)"', fake_news_)) #todo <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Define parameters Step2: Let's investigate spatial filter with max power ratio. Step3: Let's also look at the power spectrum of that source and compare it to Step4: Epoched data
<ASSISTANT_TASK:> Python Code: # Author: Denis A. Engemann <denis.engemann@gmail.com> # Victoria Peterson <victoriapeterson09@gmail.com> # License: BSD-3-Clause import matplotlib.pyplot as plt import mne from mne import Epochs from mne.datasets.fieldtrip_cmc import data_path from mne.decoding import SSD fname = data_path() / 'SubjectCMC.ds' # Prepare data raw = mne.io.read_raw_ctf(fname) raw.crop(50., 110.).load_data() # crop for memory purposes raw.resample(sfreq=250) raw.pick_types(meg=True, eeg=False, ref_meg=False) freqs_sig = 9, 12 freqs_noise = 8, 13 ssd = SSD(info=raw.info, reg='oas', sort_by_spectral_ratio=False, # False for purpose of example. filt_params_signal=dict(l_freq=freqs_sig[0], h_freq=freqs_sig[1], l_trans_bandwidth=1, h_trans_bandwidth=1), filt_params_noise=dict(l_freq=freqs_noise[0], h_freq=freqs_noise[1], l_trans_bandwidth=1, h_trans_bandwidth=1)) ssd.fit(X=raw.get_data()) pattern = mne.EvokedArray(data=ssd.patterns_[:4].T, info=ssd.info) pattern.plot_topomap(units=dict(mag='A.U.'), time_format='') # The topographies suggest that we picked up a parietal alpha generator. # Transform ssd_sources = ssd.transform(X=raw.get_data()) # Get psd of SSD-filtered signals. psd, freqs = mne.time_frequency.psd_array_welch( ssd_sources, sfreq=raw.info['sfreq'], n_fft=4096) # Get spec_ratio information (already sorted). # Note that this is not necessary if sort_by_spectral_ratio=True (default). spec_ratio, sorter = ssd.get_spectral_ratio(ssd_sources) # Plot spectral ratio (see Eq. 24 in Nikulin 2011). fig, ax = plt.subplots(1) ax.plot(spec_ratio, color='black') ax.plot(spec_ratio[sorter], color='orange', label='sorted eigenvalues') ax.set_xlabel("Eigenvalue Index") ax.set_ylabel(r"Spectral Ratio $\frac{P_f}{P_{sf}}$") ax.legend() ax.axhline(1, linestyle='--') # We can see that the initial sorting based on the eigenvalues # was already quite good. However, when using few components only # the sorting might make a difference. below50 = freqs < 50 # for highlighting the freq. band of interest bandfilt = (freqs_sig[0] <= freqs) & (freqs <= freqs_sig[1]) fig, ax = plt.subplots(1) ax.loglog(freqs[below50], psd[0, below50], label='max SNR') ax.loglog(freqs[below50], psd[-1, below50], label='min SNR') ax.loglog(freqs[below50], psd[:, below50].mean(axis=0), label='mean') ax.fill_between(freqs[bandfilt], 0, 10000, color='green', alpha=0.15) ax.set_xlabel('log(frequency)') ax.set_ylabel('log(power)') ax.legend() # We can clearly see that the selected component enjoys an SNR that is # way above the average power spectrum. # Build epochs as sliding windows over the continuous raw file. events = mne.make_fixed_length_events(raw, id=1, duration=5.0, overlap=0.0) # Epoch length is 5 seconds. epochs = Epochs(raw, events, tmin=0., tmax=5, baseline=None, preload=True) ssd_epochs = SSD(info=epochs.info, reg='oas', filt_params_signal=dict(l_freq=freqs_sig[0], h_freq=freqs_sig[1], l_trans_bandwidth=1, h_trans_bandwidth=1), filt_params_noise=dict(l_freq=freqs_noise[0], h_freq=freqs_noise[1], l_trans_bandwidth=1, h_trans_bandwidth=1)) ssd_epochs.fit(X=epochs.get_data()) # Plot topographies. pattern_epochs = mne.EvokedArray(data=ssd_epochs.patterns_[:4].T, info=ssd_epochs.info) pattern_epochs.plot_topomap(units=dict(mag='A.U.'), time_format='') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Get epochs Step2: Run beamformers and look at maximum outputs Step3: We can also look at the spatial distribution
<ASSISTANT_TASK:> Python Code: # Author: Alexandre Gramfort <alexandre.gramfort@telecom-paristech.fr> # # License: BSD (3-clause) # sphinx_gallery_thumbnail_number = 3 import matplotlib.pyplot as plt import numpy as np import mne from mne.datasets import sample from mne.beamformer import make_lcmv, apply_lcmv print(__doc__) data_path = sample.data_path() raw_fname = data_path + '/MEG/sample/sample_audvis_raw.fif' event_fname = data_path + '/MEG/sample/sample_audvis_raw-eve.fif' fname_fwd = data_path + '/MEG/sample/sample_audvis-meg-eeg-oct-6-fwd.fif' label_name = 'Aud-lh' fname_label = data_path + '/MEG/sample/labels/%s.label' % label_name subjects_dir = data_path + '/subjects' event_id, tmin, tmax = 1, -0.2, 0.5 # Setup for reading the raw data raw = mne.io.read_raw_fif(raw_fname, preload=True) raw.info['bads'] = ['MEG 2443', 'EEG 053'] # 2 bads channels events = mne.read_events(event_fname) # Set up pick list: EEG + MEG - bad channels (modify to your needs) picks = mne.pick_types(raw.info, meg=True, eeg=False, stim=True, eog=True, exclude='bads') # Pick the channels of interest raw.pick_channels([raw.ch_names[pick] for pick in picks]) # Re-normalize our empty-room projectors, so they are fine after subselection raw.info.normalize_proj() # Read epochs epochs = mne.Epochs(raw, events, event_id, tmin, tmax, baseline=(None, 0), preload=True, proj=True, reject=dict(grad=4000e-13, mag=4e-12, eog=150e-6)) evoked = epochs.average() forward = mne.read_forward_solution(fname_fwd) forward = mne.convert_forward_solution(forward, surf_ori=True) # Compute regularized noise and data covariances noise_cov = mne.compute_covariance(epochs, tmin=tmin, tmax=0, method='shrunk') data_cov = mne.compute_covariance(epochs, tmin=0.04, tmax=0.15, method='shrunk') evoked.plot(time_unit='s') pick_oris = [None, 'normal', 'max-power'] names = ['free', 'normal', 'max-power'] descriptions = ['Free orientation, voxel: %i', 'Normal orientation, voxel: %i', 'Max-power orientation, voxel: %i'] colors = ['b', 'k', 'r'] fig, ax = plt.subplots(1) max_voxs = list() for pick_ori, name, desc, color in zip(pick_oris, names, descriptions, colors): # compute unit-noise-gain beamformer with whitening of the leadfield and # data (enabled by passing a noise covariance matrix) filters = make_lcmv(evoked.info, forward, data_cov, reg=0.05, noise_cov=noise_cov, pick_ori=pick_ori, weight_norm='unit-noise-gain') # apply this spatial filter to source-reconstruct the evoked data stc = apply_lcmv(evoked, filters, max_ori_out='signed') # View activation time-series in maximum voxel at 100 ms: time_idx = stc.time_as_index(0.1) max_idx = np.argmax(stc.data[:, time_idx]) # we know these are all left hemi, so we can just use vertices[0] max_voxs.append(stc.vertices[0][max_idx]) ax.plot(stc.times, stc.data[max_idx, :], color, label=desc % max_idx) ax.set(xlabel='Time (ms)', ylabel='LCMV value', ylim=(-0.8, 2.2), title='LCMV in maximum voxel') ax.legend() mne.viz.utils.plt_show() # take absolute value for plotting np.abs(stc.data, out=stc.data) # Plot last stc in the brain in 3D with PySurfer if available brain = stc.plot(hemi='lh', subjects_dir=subjects_dir, initial_time=0.1, time_unit='s') brain.show_view('lateral') for color, vertex in zip(colors, max_voxs): brain.add_foci([vertex], coords_as_verts=True, scale_factor=0.5, hemi='lh', color=color) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Fit ICA model using the FastICA algorithm, detect and inspect components
<ASSISTANT_TASK:> Python Code: # Authors: Denis Engemann <denis.engemann@gmail.com> # # License: BSD (3-clause) import mne from mne.preprocessing import ICA, create_ecg_epochs from mne.datasets import sample print(__doc__) data_path = sample.data_path() raw_fname = data_path + '/MEG/sample/sample_audvis_filt-0-40_raw.fif' raw = mne.io.read_raw_fif(raw_fname, preload=True) raw.filter(1, 30, method='iir') raw.pick_types(meg=True, eeg=False, exclude='bads', stim=True) # longer + more epochs for more artifact exposure events = mne.find_events(raw, stim_channel='STI 014') epochs = mne.Epochs(raw, events, event_id=None, tmin=-0.2, tmax=0.5) ica = ICA(n_components=0.95, method='fastica').fit(epochs) ecg_epochs = create_ecg_epochs(raw, tmin=-.5, tmax=.5) ecg_inds, scores = ica.find_bads_ecg(ecg_epochs) ica.plot_components(ecg_inds) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: If you already have an H2O cluster running that you'd like to connect to (for example, in a multi-node Hadoop environment), then you can specify the IP and port of that cluster as follows Step2: Download EEG Data Step3: Explore Data Step4: Now let's take a look at the top of the frame Step5: The first 14 columns are numeric values that represent EEG measurements from the headset. The "eyeDetection" column is the response. There is an additional column called "split" that was added (by me) in order to specify partitions of the data (so we can easily benchmark against other tools outside of H2O using the same splits). I randomly divided the dataset into three partitions Step6: To select a subset of the columns to look at, typical Pandas indexing applies Step7: Now let's select a single column, for example -- the response column, and look at the data more closely Step8: It looks like a binary response, but let's validate that assumption Step9: If you don't specify the column types when you import the file, H2O makes a guess at what your column types are. If there are 0's and 1's in a column, H2O will automatically parse that as numeric by default. Step10: Now we can check that there are two levels in our response column Step11: We can query the categorical "levels" as well ('0' and '1' stand for "eye open" and "eye closed") to see what they are Step12: We may want to check if there are any missing values, so let's look for NAs in our dataset. For tree-based methods like GBM and RF, H2O handles missing feature values automatically, so it's not a problem if we are missing certain feature values. However, it is always a good idea to check to make sure that you are not missing any of the training labels. Step13: The isna method doesn't directly answer the question, "Does the response column contain any NAs?", rather it returns a 0 if that cell is not missing (Is NA? FALSE == 0) and a 1 if it is missing (Is NA? TRUE == 1). So if there are no missing values, then summing over the whole column should produce a summand equal to 0.0. Let's take a look Step14: Great, no missing labels. Step15: The sum is still zero, so there are no missing values in any of the cells. Step16: Ok, the data is not exactly evenly distributed between the two classes -- there are more 0's than 1's in the dataset. However, this level of imbalance shouldn't be much of an issue for the machine learning algos. (We will revisit this later in the modeling section below). Step17: Split H2O Frame into a train and test set Step18: Machine Learning in H2O Step19: We first create a model object of class, "H2OGradientBoostingEstimator". This does not actually do any training, it just sets the model up for training by specifying model parameters. Step20: Specify the predictor set and response Step21: Now that we have specified x and y, we can train the model Step22: Inspect Model Step23: Model Performance on a Test Set Step24: Individual model performance metrics can be extracted using methods like r2, auc and mse. In the case of binary classification, we may be most interested in evaluating test set Area Under the ROC Curve (AUC). Step25: Cross-validated Performance Step26: This time around, we will simply pull the training and cross-validation metrics out of the model. To do so, you use the auc method again, and you can specify train or xval as True to get the correct metric. Step27: Grid Search Step28: Define an "H2OGridSearch" object by specifying the algorithm (GBM) and the hyper parameters Step29: An "H2OGridSearch" object also has a train method, which is used to train all the models in the grid. Step30: Compare Models Step31: The "best" model in terms of validation set AUC is listed first in auc_table. Step32: The last thing we may want to do is generate predictions on the test set using the "best" model, and evaluate the test set AUC.
<ASSISTANT_TASK:> Python Code: import h2o # Start an H2O Cluster on your local machine h2o.init() # This will not actually do anything since it's a fake IP address # h2o.init(ip="123.45.67.89", port=54321) #csv_url = "http://www.stat.berkeley.edu/~ledell/data/eeg_eyestate_splits.csv" csv_url = "https://h2o-public-test-data.s3.amazonaws.com/eeg_eyestate_splits.csv" data = h2o.import_file(csv_url) data.shape data.head() data.columns columns = ['AF3', 'eyeDetection', 'split'] data[columns].head() y = 'eyeDetection' data[y] data[y].unique() data[y] = data[y].asfactor() data[y].nlevels() data[y].levels() data.isna() data[y].isna() data[y].isna().sum() data.isna().sum() data[y].table() n = data.shape[0] # Total number of training samples data[y].table()['Count']/n train = data[data['split']=="train"] train.shape valid = data[data['split']=="valid"] valid.shape test = data[data['split']=="test"] test.shape # Import H2O GBM: from h2o.estimators.gbm import H2OGradientBoostingEstimator model = H2OGradientBoostingEstimator(distribution='bernoulli', ntrees=100, max_depth=4, learn_rate=0.1) x = list(train.columns) x del x[12:14] #Remove the 13th and 14th columns, 'eyeDetection' and 'split' x model.train(x=x, y=y, training_frame=train, validation_frame=valid) print(model) perf = model.model_performance(test) print(perf.__class__) perf.r2() perf.auc() perf.mse() cvmodel = H2OGradientBoostingEstimator(distribution='bernoulli', ntrees=100, max_depth=4, learn_rate=0.1, nfolds=5) cvmodel.train(x=x, y=y, training_frame=data) print(cvmodel.auc(train=True)) print(cvmodel.auc(xval=True)) ntrees_opt = [5,50,100] max_depth_opt = [2,3,5] learn_rate_opt = [0.1,0.2] hyper_params = {'ntrees': ntrees_opt, 'max_depth': max_depth_opt, 'learn_rate': learn_rate_opt} from h2o.grid.grid_search import H2OGridSearch gs = H2OGridSearch(H2OGradientBoostingEstimator, hyper_params = hyper_params) gs.train(x=x, y=y, training_frame=train, validation_frame=valid) print(gs) # print out the auc for all of the models auc_table = gs.sort_by('auc(valid=True)',increasing=False) print(auc_table) best_model = h2o.get_model(auc_table['Model Id'][0]) best_model.auc() best_perf = best_model.model_performance(test) best_perf.auc() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: First we need to define materials that will be used in the problem. Before defining a material, we must create nuclides that are used in the material. Step2: With the nuclides we defined, we will now create three distinct materials for water, clad and fuel. Step3: With our materials, we can now create a MaterialsFile object that can be exported to an actual XML file. Step4: Now let's move on to the geometry. Our problem will have three regions for the fuel, the clad, and the surrounding coolant. The first step is to create the bounding surfaces -- in this case two cylinders and six reflective planes. Step5: With the surfaces defined, we can now create cells that are defined by intersections of half-spaces created by the surfaces. Step6: OpenMC requires that there is a "root" universe. Let us create a root cell that is filled by the pin cell universe and then assign it to the root universe. Step7: We now must create a geometry that is assigned a root universe, put the geometry into a GeometryFile object, and export it to XML. Step8: Next, we must define simulation parameters. In this case, we will use 10 inactive batches and 190 active batches each with 10,000 particles. Step9: Now we are finally ready to make use of the openmc.mgxs module to generate multi-group cross sections! First, let's define "coarse" 2-group and "fine" 8-group structures using the built-in EnergyGroups class. Step10: Now we will instantiate a variety of MGXS objects needed to run an OpenMOC simulation to verify the accuracy of our cross sections. In particular, we define transport, fission, nu-fission, nu-scatter and chi cross sections for each of the three cells in the fuel pin with the 8-group structure as our energy groups. Step11: Next, we showcase the use of OpenMC's tally precision trigger feature in conjunction with the openmc.mgxs module. In particular, we will assign a tally trigger of 1E-2 on the standard deviation for each of the tallies used to compute multi-group cross sections. Step12: Now, we must loop over all cells to set the cross section domains to the various cells - fuel, clad and moderator - included in the geometry. In addition, we will set each cross section to tally cross sections on a per-nuclide basis through the use of the MGXS class' boolean by_nuclide instance attribute. Step13: Now we a have a complete set of inputs, so we can go ahead and run our simulation. Step14: Tally Data Processing Step15: In addition to the statepoint file, our simulation also created a summary file which encapsulates information about the materials and geometry. This is necessary for the openmc.mgxs module to properly process the tally data. We first create a Summary object and link it with the statepoint. Step16: The statepoint is now ready to be analyzed by our multi-group cross sections. We simply have to load the tallies from the StatePoint into each object as follows and our MGXS objects will compute the cross sections for us under-the-hood. Step17: That's it! Our multi-group cross sections are now ready for the big spotlight. This time we have cross sections in three distinct spatial zones - fuel, clad and moderator - on a per-nuclide basis. Step18: Our multi-group cross sections are capable of summing across all nuclides to provide us with macroscopic cross sections as well. Step19: Although a printed report is nice, it is not scalable or flexible. Let's extract the microscopic cross section data for the moderator as a Pandas DataFrame . Step20: Next, we illustate how one can easily take multi-group cross sections and condense them down to a coarser energy group structure. The MGXS class includes a get_condensed_xs(...) method which takes an EnergyGroups parameter with a coarse(r) group structure and returns a new MGXS condensed to the coarse groups. We illustrate this process below using the 2-group structure created earlier. Step21: Group condensation is as simple as that! We now have a new coarse 2-group TransportXS in addition to our original 16-group TransportXS. Let's inspect the 2-group TransportXS by printing it to the screen and extracting a Pandas DataFrame as we have already learned how to do. Step22: Verification with OpenMOC Step23: Next, we we can inject the multi-group cross sections into the equivalent fuel pin cell OpenMOC geometry. Step24: We are now ready to run OpenMOC to verify our cross-sections from OpenMC. Step25: We report the eigenvalues computed by OpenMC and OpenMOC here together to summarize our results. Step26: As a sanity check, let's run a simulation with the coarse 2-group cross sections to ensure that they also produce a reasonable result. Step27: There is a non-trivial bias in both the 2-group and 8-group cases. In the case of a pin cell, one can show that these biases do not converge to <100 pcm with more particle histories. For heterogeneous geometries, additional measures must be taken to address the following three sources of bias Step28: Now, we use matplotlib and seaborn to plot the continuous-energy and multi-group cross sections on a single plot. Step29: Another useful type of illustration is scattering matrix sparsity structures. First, we extract Pandas DataFrames for the H-1 and O-16 scattering matrices. Step30: Matplotlib's imshow routine can be used to plot the matrices to illustrate their sparsity structures.
<ASSISTANT_TASK:> Python Code: import numpy as np import matplotlib.pyplot as plt import seaborn as sns import openmc import openmc.mgxs as mgxs from openmc.source import Source from openmc.stats import Box import openmoc from openmoc.compatible import get_openmoc_geometry import pyne.ace %matplotlib inline # Instantiate some Nuclides h1 = openmc.Nuclide('H-1') o16 = openmc.Nuclide('O-16') u235 = openmc.Nuclide('U-235') u238 = openmc.Nuclide('U-238') zr90 = openmc.Nuclide('Zr-90') # 1.6% enriched fuel fuel = openmc.Material(name='1.6% Fuel') fuel.set_density('g/cm3', 10.31341) fuel.add_nuclide(u235, 3.7503e-4) fuel.add_nuclide(u238, 2.2625e-2) fuel.add_nuclide(o16, 4.6007e-2) # borated water water = openmc.Material(name='Borated Water') water.set_density('g/cm3', 0.740582) water.add_nuclide(h1, 4.9457e-2) water.add_nuclide(o16, 2.4732e-2) # zircaloy zircaloy = openmc.Material(name='Zircaloy') zircaloy.set_density('g/cm3', 6.55) zircaloy.add_nuclide(zr90, 7.2758e-3) # Instantiate a MaterialsFile, add Materials materials_file = openmc.MaterialsFile() materials_file.add_material(fuel) materials_file.add_material(water) materials_file.add_material(zircaloy) materials_file.default_xs = '71c' # Export to "materials.xml" materials_file.export_to_xml() # Create cylinders for the fuel and clad fuel_outer_radius = openmc.ZCylinder(x0=0.0, y0=0.0, R=0.39218) clad_outer_radius = openmc.ZCylinder(x0=0.0, y0=0.0, R=0.45720) # Create boundary planes to surround the geometry min_x = openmc.XPlane(x0=-0.63, boundary_type='reflective') max_x = openmc.XPlane(x0=+0.63, boundary_type='reflective') min_y = openmc.YPlane(y0=-0.63, boundary_type='reflective') max_y = openmc.YPlane(y0=+0.63, boundary_type='reflective') min_z = openmc.ZPlane(z0=-0.63, boundary_type='reflective') max_z = openmc.ZPlane(z0=+0.63, boundary_type='reflective') # Create a Universe to encapsulate a fuel pin pin_cell_universe = openmc.Universe(name='1.6% Fuel Pin') # Create fuel Cell fuel_cell = openmc.Cell(name='1.6% Fuel') fuel_cell.fill = fuel fuel_cell.region = -fuel_outer_radius pin_cell_universe.add_cell(fuel_cell) # Create a clad Cell clad_cell = openmc.Cell(name='1.6% Clad') clad_cell.fill = zircaloy clad_cell.region = +fuel_outer_radius & -clad_outer_radius pin_cell_universe.add_cell(clad_cell) # Create a moderator Cell moderator_cell = openmc.Cell(name='1.6% Moderator') moderator_cell.fill = water moderator_cell.region = +clad_outer_radius pin_cell_universe.add_cell(moderator_cell) # Create root Cell root_cell = openmc.Cell(name='root cell') root_cell.region = +min_x & -max_x & +min_y & -max_y root_cell.fill = pin_cell_universe # Create root Universe root_universe = openmc.Universe(universe_id=0, name='root universe') root_universe.add_cell(root_cell) # Create Geometry and set root Universe openmc_geometry = openmc.Geometry() openmc_geometry.root_universe = root_universe # Instantiate a GeometryFile geometry_file = openmc.GeometryFile() geometry_file.geometry = openmc_geometry # Export to "geometry.xml" geometry_file.export_to_xml() # OpenMC simulation parameters batches = 50 inactive = 10 particles = 10000 # Instantiate a SettingsFile settings_file = openmc.SettingsFile() settings_file.batches = batches settings_file.inactive = inactive settings_file.particles = particles settings_file.output = {'tallies': True, 'summary': True} bounds = [-0.63, -0.63, -0.63, 0.63, 0.63, 0.63] settings_file.source = Source(space=Box( bounds[:3], bounds[3:], only_fissionable=True)) # Activate tally precision triggers settings_file.trigger_active = True settings_file.trigger_max_batches = settings_file.batches * 4 # Export to "settings.xml" settings_file.export_to_xml() # Instantiate a "coarse" 2-group EnergyGroups object coarse_groups = mgxs.EnergyGroups() coarse_groups.group_edges = np.array([0., 0.625e-6, 20.]) # Instantiate a "fine" 8-group EnergyGroups object fine_groups = mgxs.EnergyGroups() fine_groups.group_edges = np.array([0., 0.058e-6, 0.14e-6, 0.28e-6, 0.625e-6, 4.e-6, 5.53e-3, 821.e-3, 20.]) # Extract all Cells filled by Materials openmc_cells = openmc_geometry.get_all_material_cells() # Create dictionary to store multi-group cross sections for all cells xs_library = {} # Instantiate 8-group cross sections for each cell for cell in openmc_cells: xs_library[cell.id] = {} xs_library[cell.id]['transport'] = mgxs.TransportXS(groups=fine_groups) xs_library[cell.id]['fission'] = mgxs.FissionXS(groups=fine_groups) xs_library[cell.id]['nu-fission'] = mgxs.NuFissionXS(groups=fine_groups) xs_library[cell.id]['nu-scatter'] = mgxs.NuScatterMatrixXS(groups=fine_groups) xs_library[cell.id]['chi'] = mgxs.Chi(groups=fine_groups) # Create a tally trigger for +/- 0.01 on each tally used to compute the multi-group cross sections tally_trigger = openmc.Trigger('std_dev', 1E-2) # Add the tally trigger to each of the multi-group cross section tallies for cell in openmc_cells: for mgxs_type in xs_library[cell.id]: xs_library[cell.id][mgxs_type].tally_trigger = tally_trigger # Instantiate an empty TalliesFile tallies_file = openmc.TalliesFile() # Iterate over all cells and cross section types for cell in openmc_cells: for rxn_type in xs_library[cell.id]: # Set the cross sections domain type to the cell xs_library[cell.id][rxn_type].domain = cell xs_library[cell.id][rxn_type].domain_type = 'cell' # Tally cross sections by nuclide xs_library[cell.id][rxn_type].by_nuclide = True # Add OpenMC tallies to the tallies file for XML generation for tally in xs_library[cell.id][rxn_type].tallies.values(): tallies_file.add_tally(tally, merge=True) # Export to "tallies.xml" tallies_file.export_to_xml() # Run OpenMC executor = openmc.Executor() executor.run_simulation(output=True) # Load the last statepoint file sp = openmc.StatePoint('statepoint.080.h5') # Load the summary file and link it with the statepoint su = openmc.Summary('summary.h5') sp.link_with_summary(su) # Iterate over all cells and cross section types for cell in openmc_cells: for rxn_type in xs_library[cell.id]: xs_library[cell.id][rxn_type].load_from_statepoint(sp) nufission = xs_library[fuel_cell.id]['nu-fission'] nufission.print_xs(xs_type='micro', nuclides=['U-235', 'U-238']) nufission = xs_library[fuel_cell.id]['nu-fission'] nufission.print_xs(xs_type='macro', nuclides='sum') nuscatter = xs_library[moderator_cell.id]['nu-scatter'] df = nuscatter.get_pandas_dataframe(xs_type='micro') df.head(10) # Extract the 16-group transport cross section for the fuel fine_xs = xs_library[fuel_cell.id]['transport'] # Condense to the 2-group structure condensed_xs = fine_xs.get_condensed_xs(coarse_groups) condensed_xs.print_xs() df = condensed_xs.get_pandas_dataframe(xs_type='micro') df # Create an OpenMOC Geometry from the OpenCG Geometry openmoc_geometry = get_openmoc_geometry(su.opencg_geometry) # Get all OpenMOC cells in the gometry openmoc_cells = openmoc_geometry.getRootUniverse().getAllCells() # Inject multi-group cross sections into OpenMOC Materials for cell_id, cell in openmoc_cells.items(): # Ignore the root cell if cell.getName() == 'root cell': continue # Get a reference to the Material filling this Cell openmoc_material = cell.getFillMaterial() # Set the number of energy groups for the Material openmoc_material.setNumEnergyGroups(fine_groups.num_groups) # Extract the appropriate cross section objects for this cell transport = xs_library[cell_id]['transport'] nufission = xs_library[cell_id]['nu-fission'] nuscatter = xs_library[cell_id]['nu-scatter'] chi = xs_library[cell_id]['chi'] # Inject NumPy arrays of cross section data into the Material # NOTE: Sum across nuclides to get macro cross sections needed by OpenMOC openmoc_material.setSigmaT(transport.get_xs(nuclides='sum').flatten()) openmoc_material.setNuSigmaF(nufission.get_xs(nuclides='sum').flatten()) openmoc_material.setSigmaS(nuscatter.get_xs(nuclides='sum').flatten()) openmoc_material.setChi(chi.get_xs(nuclides='sum').flatten()) # Generate tracks for OpenMOC openmoc_geometry.initializeFlatSourceRegions() track_generator = openmoc.TrackGenerator(openmoc_geometry, num_azim=128, spacing=0.1) track_generator.generateTracks() # Run OpenMOC solver = openmoc.CPUSolver(track_generator) solver.computeEigenvalue() # Print report of keff and bias with OpenMC openmoc_keff = solver.getKeff() openmc_keff = sp.k_combined[0] bias = (openmoc_keff - openmc_keff) * 1e5 print('openmc keff = {0:1.6f}'.format(openmc_keff)) print('openmoc keff = {0:1.6f}'.format(openmoc_keff)) print('bias [pcm]: {0:1.1f}'.format(bias)) openmoc_geometry = get_openmoc_geometry(su.opencg_geometry) openmoc_cells = openmoc_geometry.getRootUniverse().getAllCells() # Inject multi-group cross sections into OpenMOC Materials for cell_id, cell in openmoc_cells.items(): # Ignore the root cell if cell.getName() == 'root cell': continue openmoc_material = cell.getFillMaterial() openmoc_material.setNumEnergyGroups(coarse_groups.num_groups) # Extract the appropriate cross section objects for this cell transport = xs_library[cell_id]['transport'] nufission = xs_library[cell_id]['nu-fission'] nuscatter = xs_library[cell_id]['nu-scatter'] chi = xs_library[cell_id]['chi'] # Perform group condensation transport = transport.get_condensed_xs(coarse_groups) nufission = nufission.get_condensed_xs(coarse_groups) nuscatter = nuscatter.get_condensed_xs(coarse_groups) chi = chi.get_condensed_xs(coarse_groups) # Inject NumPy arrays of cross section data into the Material openmoc_material.setSigmaT(transport.get_xs(nuclides='sum').flatten()) openmoc_material.setNuSigmaF(nufission.get_xs(nuclides='sum').flatten()) openmoc_material.setSigmaS(nuscatter.get_xs(nuclides='sum').flatten()) openmoc_material.setChi(chi.get_xs(nuclides='sum').flatten()) # Generate tracks for OpenMOC openmoc_geometry.initializeFlatSourceRegions() track_generator = openmoc.TrackGenerator(openmoc_geometry, num_azim=128, spacing=0.1) track_generator.generateTracks() # Run OpenMOC solver = openmoc.CPUSolver(track_generator) solver.computeEigenvalue() # Print report of keff and bias with OpenMC openmoc_keff = solver.getKeff() openmc_keff = sp.k_combined[0] bias = (openmoc_keff - openmc_keff) * 1e5 print('openmc keff = {0:1.6f}'.format(openmc_keff)) print('openmoc keff = {0:1.6f}'.format(openmoc_keff)) print('bias [pcm]: {0:1.1f}'.format(bias)) # Instantiate a PyNE ACE continuous-energy cross sections library pyne_lib = pyne.ace.Library('../../../../data/nndc/293.6K/U_235_293.6K.ace') pyne_lib.read('92235.71c') # Extract the U-235 data from the library u235 = pyne_lib.tables['92235.71c'] # Extract the continuous-energy U-235 fission cross section data fission = u235.reactions[18] # Create a loglog plot of the U-235 continuous-energy fission cross section plt.loglog(u235.energy, fission.sigma, color='b', linewidth=1) # Extract energy group bounds and MGXS values to plot nufission = xs_library[fuel_cell.id]['fission'] energy_groups = nufission.energy_groups x = energy_groups.group_edges y = nufission.get_xs(nuclides=['U-235'], order_groups='decreasing', xs_type='micro') # Fix low energy bound to the value defined by the ACE library x[0] = u235.energy[0] # Extend the mgxs values array for matplotlib's step plot y = np.insert(y, 0, y[0]) # Create a step plot for the MGXS plt.plot(x, y, drawstyle='steps', color='r', linewidth=3) plt.title('U-235 Fission Cross Section') plt.xlabel('Energy [MeV]') plt.ylabel('Micro Fission XS') plt.legend(['Continuous', 'Multi-Group']) plt.xlim((x.min(), x.max())) # Construct a Pandas DataFrame for the microscopic nu-scattering matrix nuscatter = xs_library[moderator_cell.id]['nu-scatter'] df = nuscatter.get_pandas_dataframe(xs_type='micro') # Slice DataFrame in two for each nuclide's mean values h1 = df[df['nuclide'] == 'H-1']['mean'] o16 = df[df['nuclide'] == 'O-16']['mean'] # Cast DataFrames as NumPy arrays h1 = h1.as_matrix() o16 = o16.as_matrix() # Reshape arrays to 2D matrix for plotting h1.shape = (fine_groups.num_groups, fine_groups.num_groups) o16.shape = (fine_groups.num_groups, fine_groups.num_groups) # Create plot of the H-1 scattering matrix fig = plt.subplot(121) fig.imshow(h1, interpolation='nearest', cmap='jet') plt.title('H-1 Scattering Matrix') plt.xlabel('Group Out') plt.ylabel('Group In') plt.grid() # Create plot of the O-16 scattering matrix fig2 = plt.subplot(122) fig2.imshow(o16, interpolation='nearest', cmap='jet') plt.title('O-16 Scattering Matrix') plt.xlabel('Group Out') plt.ylabel('Group In') plt.grid() # Show the plot on screen plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: errorbarjitter function Step2: Example 1 Step3: Iris dataset example Step4: References Step5: Learning Index
<ASSISTANT_TASK:> Python Code: import pandas as pd import numpy as np import matplotlib.pyplot as plt import seaborn as sns %matplotlib inline sns.set_style('darkgrid') sns.set_context('talk') def errorbarjitter(df, groupByCol, statsCol, fig=None, xlab='group', ylab='units', rotate = 0): grouped = df.groupby([groupByCol]) stats = grouped.aggregate({statsCol:[np.std, np.mean]}) groups = df[groupByCol].unique() means, devs = stats[statsCol]['mean'], stats[statsCol]['std'] plt.figure(figsize=(15,7)) if fig is None: fig = plt.figure() for (i, (m, s)) in enumerate(zip(means, devs)): pts = np.array(df[df[groupByCol]==groups[i]][statsCol]) x = i*np.ones(len(pts)) + 0.2*np.random.rand(len(pts))-0.1 plt.scatter(x, pts, c='k', alpha=0.5) delta = 0.22 plt.scatter(i+delta, m, edgecolor='k', facecolor='none', linewidth=3, s=25) plt.plot([i+delta, i+delta], [m-s, m+s], '-', c=[0, 0, 0], lw=2.0) plt.xticks(range(len(groups)), groups, rotation=rotate); plt.xlabel(xlab) plt.ylabel(ylab) path = "ex-data.csv"; exdata = pd.read_csv(path) exdata.head() grouped = exdata.groupby(['runner']) stats = grouped.aggregate({'time':[np.std, np.mean]}) stats errorbarjitter(exdata, 'runner', 'time', xlab = 'runner', ylab = 'time (s)') plt.title('5 runners average course time') path = "iris.csv"; data = pd.read_csv(path) data.head() fig = plt.figure() errorbarjitter(data, 'Species', 'Sepal.Length', xlab = 'species', ylab = 'sepal length') plt.title('Sepal length by species') fig = plt.figure() errorbarjitter(data, 'Species', 'Sepal.Width', xlab = 'species', ylab = 'sepal width') plt.title('Sepal width by species') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Length', xlab = 'species', ylab = 'petal length') plt.title('Petal length by species') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Width', xlab = 'species', ylab = 'petal width') plt.title('Petal width by species') sns.set_style('darkgrid') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Width', xlab = 'species', ylab = 'petal width') plt.title('Petal width by species') sns.set_style('whitegrid') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Width', xlab = 'species', ylab = 'petal width') plt.title('Petal width by species') sns.set_style('dark') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Width', xlab = 'species', ylab = 'petal width') plt.title('Petal width by species') sns.set_style('white') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Width', xlab = 'species', ylab = 'petal width') plt.title('Petal width by species') sns.set_style('ticks') fig = plt.figure() errorbarjitter(data, 'Species', 'Petal.Width', xlab = 'species', ylab = 'petal width') plt.title('Petal width by species') path = "learning-data.csv"; learning = pd.read_csv(path) sns.set_style('darkgrid') fig = plt.figure() errorbarjitter(learning, 'animal', 'pi', xlab = 'animal', ylab = 'performance index') plt.title('learning assay') plt.ylim(-1,1) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Default Values and placeholder Step2: JupyterJSWidgets work with EasyForm
<ASSISTANT_TASK:> Python Code: from beakerx import * f = EasyForm("Form and Run") f.addTextField("first") f.addTextField("last") f['first'] = "First" f['last'] = "Last" f.addButton("Go!", tag="run") f "Good morning " + f["first"] + " " + f["last"] f['last'][::-1] + '...' + f['first'] f['first'] = 'Beaker' f['last'] = 'Berzelius' h = EasyForm(title="Form and Run") h.addTextField("first", width=10) h.addTextField("default") h.addTextArea("Text Area 1", height=5, width=20) h.addTextArea("Text Area 2") h.addTextArea("Text Area 3", height=10) h.addTextArea("Text Area 4",width=20) h g2 = EasyForm("Field Types") options = ["a", "b", "c", "d", "e", "f"] g2.addList("List Single", options, multi=False) g2.addList("List Two Row", options, rows=2) g2 f['last']+ ", "+f['first'] f['last'] = "new Value" f['first'] = "new Value2" # All Kinds of Fields g = EasyForm("Field Types") g.addTextField("Short Text Field", width=10) g.addTextField("Text Field") g.addPasswordField("Password Field", width=10) g.addTextArea("Text Area") g.addTextArea("Tall Text Area", 10, 5) g.addCheckBox("Check Box") options = ["a", "b", "c", "d"] g.addComboBox("Combo Box", options) g.addComboBox("Combo Box editable", options, editable=True) g.addList("List", options) g.addList("List Single", options, multi=False) g.addList("List Two Row", options, rows=2) g.addCheckBoxes("Check Boxes", options) g.addCheckBoxes("Check Boxes H", options, orientation=EasyForm.HORIZONTAL) g.addRadioButtons("Radio Buttons", options) g.addRadioButtons("Radio Buttons H", options, orientation=EasyForm.HORIZONTAL) g.addDatePicker("Date") g.addButton("Go!", tag="run2") g result = dict() for child in g: result[child] = g[child] result gdp = EasyForm("Field Types") gdp.addDatePicker("Date") gdp gdp['Date'] f.put("first", "Micheal") f.put("last", "Fox") # Read values from form firstName = f.get("first") lastName = f.get("last") print("Good morning " + firstName + " " + lastName) f = EasyForm("actionPerformed demo") f.addTextField("first") f['first'] = "First" b = f.addButton("Action!") b.actionPerformed = lambda: print("clicked "+f["first"]) f import operator f1 = EasyForm("OnInit and OnChange") f1.addTextField("first", width=15) f1.addTextField("last", width=15)\ .onInit(lambda: operator.setitem(f1, 'last', "setinit1"))\ .onChange(lambda text: operator.setitem(f1, 'first', text + ' extra')) button = f1.addButton("action", "action_button") button.actionPerformed = lambda: operator.setitem(f1, 'last', 'action done') f1 f3c = EasyForm("form3") f3c = EasyForm("form3") f3c.addTextArea("Default Value", value = "Initial value") f3c.addTextArea("Place Holder", placeholder = "Put here some text") f3c.addCheckBox("Default Checked", value = True) f3c result = dict() for child in f3c: result[child] = f3c[child] result from beakerx import * from ipywidgets import * w = IntSlider() f = EasyForm("Form and Run") f.addTextField("first") f.addTextField("last") f.addWidget("slider", w) f['first'] = "First" f['last'] = "Last" f.addButton("Go!", tag="run") f f['slider'] <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Using Provenance in Adama Step2: Connect the adama Python object to your API server of choice. The official one is https Step3: Create a random namespace Step4: Add the service prov, already included in this notebook Step5: If you are interested in checking out the metadata file of this service, evaluate the next cell Step6: Do a simple search and save the result Step7: result can be treated as a standard Python list (it is actually a subclass of list). An additional method .prov returns the provenance of the response. It is equivalent to inspecting the headers of the HTTP response and following the link to the provenance object. Step8: The format prov returns the PROV object as a native Python object, that can be manipulated according to the prov library (already included in this notebook/container) Step9: If this is being evaluated in an IPython notebook, requesting the png format should display the image of the provenance graph (double-click on the image to see at full resolution). The image can also be saved to a file by passing an extra argument
<ASSISTANT_TASK:> Python Code: import requests import string import random lorem = requests.get('http://loripsum.net/api/plaintext').text WORDS = [word.lower() for word in filter(lambda c: c not in string.punctuation, lorem).split()] def random_words(n=2): return '_'.join(random.choice(WORDS) for i in range(n)) import requests requests.packages.urllib3.disable_warnings() import adamalib reload(adamalib.adamalib) API = 'https://adama-dev.cloudapp.net/community/v0.3' TOKEN = 'mytoken' adama = adamalib.Adama(API, token=TOKEN, verify=False) namespace = adama.namespaces.add(name=random_words()) namespace import provn.main service = namespace.services.add(provn.main) service !cat provn/metadata.yml result = service.search() result result.prov() result.prov(format='prov') result.prov(format='png') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: 2. Inference Step2: 2.1 Helper functions Step3: 2.2 Convert the model with TF-TRT Step4: 2.3 Run inference with converted model Step5: Compare to the original function Step6: 3. Dynamic sequence length Step7: The converted model is optimized for a sequnce length of 128 (and batch size 8). If we infer the converted model using a different sequence length, then two things can happen
<ASSISTANT_TASK:> Python Code: !pip install -q tf-models-official import tensorflow as tf import tensorflow_hub as hub tfhub_handle_encoder = 'https://tfhub.dev/tensorflow/bert_en_uncased_L-12_H-768_A-12/3' bert_saved_model_path = 'bert_base' bert_model = hub.load(tfhub_handle_encoder) tf.saved_model.save(bert_model, bert_saved_model_path) import matplotlib.pyplot as plt import numpy as np from tensorflow.python.saved_model import signature_constants from tensorflow.python.saved_model import tag_constants from tensorflow.python.compiler.tensorrt import trt_convert as trt from timeit import default_timer as timer tf.get_logger().setLevel('ERROR') def get_func_from_saved_model(saved_model_dir): saved_model_loaded = tf.saved_model.load( saved_model_dir, tags=[tag_constants.SERVING]) graph_func = saved_model_loaded.signatures[ signature_constants.DEFAULT_SERVING_SIGNATURE_DEF_KEY] return graph_func, saved_model_loaded def predict_and_benchmark_throughput(input_dict, model, N_warmup_run=50, N_run=500, result_key='predictions', batch_size=None): elapsed_time = [] for val in input_dict.values(): input_batch_size = val.shape[0] break if batch_size is None or batch_size > input_batch_size: batch_size = input_batch_size print('Benchmarking with batch size', batch_size) elapsed_time = np.zeros(N_run) for i in range(N_warmup_run): preds = model(**input_dict) # Force device synchronization with .numpy() tmp = preds[result_key][0].numpy() for i in range(N_run): start_time = timer() preds = model(**input_dict) # Synchronize tmp += preds[result_key][0].numpy() end_time = timer() elapsed_time[i] = end_time - start_time if i>=50 and i % 50 == 0: print('Steps {}-{} average: {:4.1f}ms'.format(i-50, i, (elapsed_time[i-50:i].mean()) * 1000)) latency = elapsed_time.mean() * 1000 print('Latency: {:5.2f}+/-{:4.2f}ms'.format(latency, elapsed_time.std() * 1000)) print('Throughput: {:.0f} samples/s'.format(N_run * batch_size / elapsed_time.sum())) return latency def trt_convert(input_path, output_path, input_shapes, explicit_batch=False, dtype=np.float32, precision='FP32', prof_strategy='Optimal'): conv_params=trt.TrtConversionParams( precision_mode=precision, minimum_segment_size=50, max_workspace_size_bytes=12*1<<30, maximum_cached_engines=1) converter = trt.TrtGraphConverterV2( input_saved_model_dir=input_path, conversion_params=conv_params, use_dynamic_shape=explicit_batch, dynamic_shape_profile_strategy=prof_strategy) converter.convert() def input_fn(): for shapes in input_shapes: # return a list of input tensors yield [np.ones(shape=x).astype(dtype) for x in shapes] converter.build(input_fn) converter.save(output_path) def random_input(batch_size, seq_length): # Generate random input data mask = tf.convert_to_tensor(np.ones((batch_size, seq_length), dtype=np.int32)) type_id = tf.convert_to_tensor(np.zeros((batch_size, seq_length), dtype=np.int32)) word_id = tf.convert_to_tensor(np.random.randint(0, 1000, size=[batch_size, seq_length], dtype=np.int32)) return {'input_mask':mask, 'input_type_ids': type_id, 'input_word_ids':word_id} bert_trt_path = bert_saved_model_path + '_trt' input_shapes = [[(1, 128), (1, 128), (1, 128)]] trt_convert(bert_saved_model_path, bert_trt_path, input_shapes, True, np.int32, precision='FP16') trt_func, _ = get_func_from_saved_model(bert_trt_path) input_dict = random_input(1, 128) result_key = 'bert_encoder_1' # 'classifier' res = predict_and_benchmark_throughput(input_dict, trt_func, result_key=result_key) func, model = get_func_from_saved_model(bert_saved_model_path) res = predict_and_benchmark_throughput(input_dict, func, result_key=result_key) seq1 = random_input(1, 128) res1 = func(**seq1) seq2 = random_input(1, 180) res2 = func(**seq2) bert_trt_path = bert_saved_model_path + '_trt2' input_shapes = [[(1, 128), (1, 128), (1, 128)], [(1, 180), (1, 180), (1, 180)]] trt_convert(bert_saved_model_path, bert_trt_path, input_shapes, True, np.int32, precision='FP16', prof_strategy='Range') trt_func_dynamic, _ = get_func_from_saved_model(bert_trt_path) trt_res = trt_func_dynamic(**seq1) result_key = 'bert_encoder_1' # 'classifier' res = predict_and_benchmark_throughput(seq1, trt_func_dynamic, result_key=result_key) res = predict_and_benchmark_throughput(seq2, trt_func_dynamic, result_key=result_key) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Skautská hra Step2: Řešení bez slovníků, ale hlavně takové, kde by nebylo úplně snadné přidat další otázky. Step3: Řešení, kde přidání, změna či odebrání jakékoli otázky znamená jen změnu na jednom míste v seznamu otázek.
<ASSISTANT_TASK:> Python Code: cisla = [(1, 1), (2, 4), (3, 9), (4, 16), (5, 25), (6,36), (7, 49), (8, 64), (9, 81), (10, 100)] mocniny = dict(cisla) print(mocniny) import random while True: odpoved = input('Na kolik odpovědí chceš hrát? ') try: odpoved = int(odpoved) break except ValueError: print('Musíš napsat celé číslo!') kdo = [] s_kym = [] co_delali = [] kde = [] kdy = [] proc = [] vsechno = [kdo,s_kym,co_delali,kde,kdy,proc] for i in range (odpoved): kdo1 = input ('Kdo? ') s_kym1 = input ('S kým? ') co_delali1 = input ('Co dělali? ') kde1 = input ('Kde? ') kdy1 = input ('Kdy? ') proc1 = input ('Proč? ') print('') kdo.append(kdo1) s_kym.append(s_kym1) co_delali.append(co_delali1) kde.append(kde1) kdy.append(kdy1) proc.append(proc1) a=random.choice(kdo) b=random.choice(s_kym) c=random.choice(co_delali) d=random.choice(kde) e=random.choice(kdy) f=random.choice(proc) print(a, b, c, d, e, f) import random kdo_seznam = [] s_kym_seznam = [] kde_seznam = [] co_delali_seznam = [] proc_seznam = [] for pocet in range(3): kdo = input('Kdo? ') kdo_seznam.append(kdo) s_kym = input('S kým? ') s_kym_seznam.append(s_kym) kde = input('Kde? ') kde_seznam.append(kde) co_delali = input('Co dělali? ') co_delali_seznam.append(co_delali) proc = input('Proč? ') proc_seznam.append(proc) print(random.choice(kdo_seznam), 's', random.choice(s_kym_seznam),'v', random.choice(kde_seznam), random.choice(co_delali_seznam), random.choice(proc_seznam)) from random import choice otazky = ['Kdo', 'S kym', 'Co delali', 'Kde'] odpovedi = {} for otazka in otazky: odpovedi[otazka] = [] # Alternativní cesta # odpovedi = {otazka: [] for otazka in otazky} for otazka in otazky: while True: odpoved = input('Zadej odpoved na otazku {}? '.format(otazka)) if not odpoved: break else: odpovedi[otazka].append(odpoved) veta = '' for otazka in otazky: veta = veta + choice(odpovedi[otazka]) + ' ' print(veta) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Program 1 Step2: Program 2
<ASSISTANT_TASK:> Python Code: import numpy as np import tensorflow as tf import matplotlib.pyplot as plt import seaborn as sns %matplotlib inline def calc_diff_err_p1(n): h = 2.*np.pi/n x = tf.range(1., n+1.)[:, None]*h - np.pi u = tf.exp(tf.sin(x)) u_prime = tf.cos(x) * u e = tf.cast(tf.ones(tf.cast(n, tf.int64)), n.dtype) indices = tf.cast(tf.concat([ tf.tile(tf.range(n)[:, None], [4,1]), tf.concat([tf.roll(tf.range(n)[:, None], i, 0) for i in [-1, -2, 1, 2]], axis=0) ], axis=1 ), tf.int64) values = tf.concat( [2.*e/3., -e/12., -2.*e/3, e/12.], axis=0 )/h D = tf.sparse.reorder(tf.sparse.SparseTensor(indices, values, tf.cast((n, n), tf.int64))) err = tf.norm(tf.sparse.sparse_dense_matmul(D, u) - u_prime, np.inf) return err n_vec = 2.**tf.range(3., 13.) fig = plt.figure(figsize=(10,8)) _ = plt.loglog(n_vec, tf.map_fn(calc_diff_err_p1, tf.cast(n_vec, tf.float64)), linestyle='none', marker='.', label='float64') _ = plt.loglog(n_vec, tf.map_fn(calc_diff_err_p1, tf.cast(n_vec, tf.float32)), linestyle='none', marker='x', label='float32') _ = plt.title('Error for 4th order method with differing precision') _ = plt.xlabel('N') _ = plt.ylabel('error') _ = plt.legend() def calc_diff_err_p2(n): # n = tf.constant(8., dtype=tf.float64) # n_vec[0] h = 2.*np.pi/n x = tf.range(1., n+1.)[:, None]*h - np.pi u = tf.exp(tf.sin(x)) u_prime = tf.cos(x) * u d = 0.5*((-1.)**np.arange(1., n))/np.tan(np.arange(1., n)*h/2.) col = np.append([0.], d.tolist()) row = np.append(col[0], col[-1:0:-1]) D = tf.cast(tf.linalg.LinearOperatorToeplitz(col, row).to_dense(), n.dtype) err = tf.norm(D @ u - u_prime, np.inf) return err n_vec = tf.range(2., 100., 2.) fig = plt.figure(figsize=(10,8)) _ = plt.loglog(n_vec, tf.map_fn(calc_diff_err_p2, tf.cast(n_vec, tf.float64)), linestyle='none', marker='.', label='float64') _ = plt.loglog(n_vec, tf.map_fn(calc_diff_err_p2, tf.cast(n_vec, tf.float32)), linestyle='none', marker='x', label='float32') _ = plt.title('Error for Spectral method with differing precision') _ = plt.xlabel('N') _ = plt.ylabel('error') _ = plt.legend() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: \begin{equation} Step4: \begin{array}{r | r | l | l | l | l} \hline
<ASSISTANT_TASK:> Python Code: writer = pytablewriter.LatexMatrixWriter() writer.table_name = "B" writer.value_matrix = [ ["a_{11}", "a_{12}", "\\ldots", "a_{1n}"], ["a_{21}", "a_{22}", "\\ldots", "a_{2n}"], [r"\vdots", "\\vdots", "\\ddots", "\\vdots"], ["a_{n1}", "a_{n2}", "\\ldots", "a_{nn}"], ] writer.write_table() writer = pytablewriter.LatexTableWriter() writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.MarkdownTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.MarkdownTableWriter() writer.table_name = "write example with a margin" writer.header_list = header_list writer.value_matrix = data writer.margin = 1 # add a whitespace for both sides of each cell writer.write_table() writer = pytablewriter.MediaWikiTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.NumpyTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.PandasDataFrameWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.PandasDataFrameWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.is_datetime_instance_formatting = False writer.write_table() writer = pytablewriter.PythonCodeTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.PythonCodeTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.is_datetime_instance_formatting = False writer.write_table() writer = pytablewriter.RstGridTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.RstSimpleTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.RstCsvTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.LtsvTableWriter() writer.header_list = header_list writer.value_matrix = data writer.write_table() writer = pytablewriter.TomlTableWriter() writer.table_name = table_name writer.header_list = header_list writer.value_matrix = data writer.write_table() from datetime import datetime import pytablewriter as ptw writer = ptw.JavaScriptTableWriter() writer.header_list = ["header_a", "header_b", "header_c"] writer.value_matrix = [ [-1.1, "2017-01-02 03:04:05", datetime(2017, 1, 2, 3, 4, 5)], [0.12, "2017-02-03 04:05:06", datetime(2017, 2, 3, 4, 5, 6)], ] print("// without type hints: column data types detected automatically by default") writer.table_name = "without type hint" writer.write_table() print("// with type hints: Integer, DateTime, String") writer.table_name = "with type hint" writer.type_hint_list = [ptw.Integer, ptw.DateTime, ptw.String] writer.write_table() from datetime import datetime import pytablewriter as ptw writer = ptw.PythonCodeTableWriter() writer.value_matrix = [ [-1.1, float("inf"), "2017-01-02 03:04:05", datetime(2017, 1, 2, 3, 4, 5)], [0.12, float("nan"), "2017-02-03 04:05:06", datetime(2017, 2, 3, 4, 5, 6)], ] # column data types detected automatically by default writer.table_name = "python variable without type hints" writer.header_list = ["float", "infnan", "string", "datetime"] writer.write_table() # set type hints writer.table_name = "python variable with type hints" writer.header_list = ["hint_int", "hint_str", "hint_datetime", "hint_str"] writer.type_hint_list = [ptw.Integer, ptw.String, ptw.DateTime, ptw.String] writer.write_table() writer = pytablewriter.MarkdownTableWriter() writer.from_csv( dedent( \ "i","f","c","if","ifc","bool","inf","nan","mix_num","time" 1,1.10,"aa",1.0,"1",True,Infinity,NaN,1,"2017-01-01 00:00:00+09:00" 2,2.20,"bbb",2.2,"2.2",False,Infinity,NaN,Infinity,"2017-01-02 03:04:05+09:00" 3,3.33,"cccc",-3.0,"ccc",True,Infinity,NaN,NaN,"2017-01-01 00:00:00+09:00" ) ) writer.write_table() writer = pytablewriter.MarkdownTableWriter() writer.table_name = "ps" writer.from_csv( dedent( \ USER PID %CPU %MEM VSZ RSS TTY STAT START TIME COMMAND root 1 0.0 0.4 77664 8784 ? Ss May11 0:02 /sbin/init root 2 0.0 0.0 0 0 ? S May11 0:00 [kthreadd] root 4 0.0 0.0 0 0 ? I< May11 0:00 [kworker/0:0H] root 6 0.0 0.0 0 0 ? I< May11 0:00 [mm_percpu_wq] root 7 0.0 0.0 0 0 ? S May11 0:01 [ksoftirqd/0] ), delimiter=" ", ) writer.write_table() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Observations Step2: Obtaining the parameters from the database Step3: The RefLightCurves Class Step4: Find the number of objects in the table Step5: Get all ids on the table Step6: The astrophysical object properties can be obtained by using the following function in the form of a pd.DataFrame Step7: Get the parameters for an object Step8: The instance of the class representing the astrophysical object itself can be obtained by the following method for SN Step9: Following the usual methods in sims.catUtils.supernovae.SNObject the properties of this SN can be seen using Step10: Simpler methods for Twinkles Step11: The tableName, idCol, objectTypeID, and columns will change from one astrophysical object to another. Step12: We can get the light curves for each band by
<ASSISTANT_TASK:> Python Code: from __future__ import absolute_import, division, print_function import os import numpy as np import pandas as pd %matplotlib inline import matplotlib.pyplot as plt import seaborn as sns sns.set() # Import from monitor from desc.monitor import RefLightCurves import desc.monitor as monitor data_dir = os.path.join(os.environ['MONITOR_DIR'], 'data') opsimCsv = os.path.join(data_dir, 'SelectedKrakenVisits.csv') opsimdf = pd.read_csv(opsimCsv, index_col='obsHistID') df = opsimdf[['expMJD', 'filter', 'fiveSigmaDepth']] import pymssql from lsst.utils import getPackageDir import lsst.sims.catUtils.baseCatalogModels as bcm from lsst.daf.persistence import DbAuth config = bcm.BaseCatalogConfig() config.load(os.path.join(getPackageDir("sims_catUtils"), "config", "db.py")) username = DbAuth.username(config.host, config.port) password = DbAuth.password(config.host, config.port) hostname = config.host DBConnection = pymssql.connect(user=username, password=password, host=hostname, database=config.database, port=config.port) db = DBConnection.cursor() # The ids are obtained from Instance Catalogs reflc = RefLightCurves(idSequence=(6144007055260714, 6144158471480362), tableName='TwinkSN', dbConnection=DBConnection, dbCursor=db) reflc.dbConnection print(reflc.get_numObjects()) reflc.get_numObjects() ids = reflc.allIdinTable(chunksize=None) print(ids.astype(int).values.flatten()) ids = reflc.allIdinTable(chunksize=10) print(ids.next().astype(int).values.flatten()) reflc.get_params(6144007055260714) allParamsInIdSequence = reflc.get_params() allParamsInIdSequence reflcAll = RefLightCurves(tableName='TwinkSN', dbConnection=DBConnection, dbCursor=db) # Slow because all rows allParams = reflcAll.get_params() allParams.head() sn = reflc.astro_object(idValue=6144007055260714) from lsst.sims.photUtils import BandpassDict # Get the `bandpassDict` instance from files using catsim methods lsstBP = BandpassDict.loadBandpassesFromFiles() # This is a tuple, the first component gives the total bandpass, while the second gives the hardware bandpass # Pass the bandpass and get the lightcurve for the observations reflc.lightCurve(idValue=6144007055260714, observations=df, bandPassDict=lsstBP[0]) reflcTwink = RefLightCurves.fromTwinklesData(tableName='TwinkSN', idCol='id', objectTypeID=42, dbHostName=None, columns=('id', 'redshift', 'snra', 'sndec', 't0', 'x0', 'x1', 'c'), idSequence=None) reflcTwink.idCol reflcTwink.lightCurve(idValue=6144007055260714) reflcTwink.lightCurve(idValue=6144007055260714, bandName='r') <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Let's get all the available date from the IPython community. For now, this is just the mailing lists. One day, BigBang will also get its issue tracker data! That will be very exciting. Step2: Now let's isolate the messages involving Fernando Perez. Step3: Note that our way of finding Fernando Perez was not very precise. We've picked up another Fernando. Step4: In future iterations, we will use a more sensitive entity recognition technique to find Fernando. This will have to do for now. Step5: We now have two Archives made from the original Archive, with the same range of dates, but one with and the other without Fernando. Both contain emails from many addresses. We want to get a single metric of activity. Step6: Let's make a stackplot of this data to see how much of the conversation on the IPython developer's list has been Fernando, over time.
<ASSISTANT_TASK:> Python Code: from bigbang.archive import Archive import matplotlib.pyplot as plt import numpy as np import pandas as pd url = "ipython-user" arx = Archive(url) fernandos = Archive(arx.data[arx.data.From.map(lambda x: 'Fernando' in x)]) fernandos.data[:3] [x for x in fernandos.get_activity()] not_fernandos = Archive(arx.data[arx.data.From.map(lambda x: 'Fernando' not in x)]) not_fernandos.data[:3] not_fernandos.get_activity().sum(1).values.shape nf = pd.DataFrame(not_fernandos.get_activity().sum(1)) f = pd.DataFrame(fernandos.get_activity().sum(1)) both = pd.merge(nf,f,how="outer",left_index=True,right_index=True,suffixes=("_nf","_f")).fillna(0) fig = plt.figure(figsize=(12.5, 7.5)) fa = fernandos.get_activity() d = np.row_stack((both['0_f'], both['0_nf'])) plt.stackplot(both.index.values,d,linewidth=0) fig.axes[0].xaxis_date() plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: The control freak sequence Step2: Below we write a generic function that takes the functions $u(t)$,$v(t)$ and $w(t)$ as an argument and then visualizes the pumping process in $d$-space. We will use this function to explore the control freak sequence and the later on also the not so control freak sequence. Step3: Now let us see what happends as time proceedes! Step4: Now that we have explored the momentum space behaviour let us again look at a small real space sample! First we define a function that generates Rice-Mele type finitel lattice Hamiltonians for given values of $u$,$v$ and $w$. Step5: Next we define a class that we will mainly use to hold data about our pumping sequence. The information in these objects will be used to visualize the spectrum and wavefunctions of bulk and edge localized states. Step6: Now let us create an instance of the above class with the data of the control freak pump sequence Step7: Finally we write a simple function to visualize the spectrum and the wavefunctions in a symmilar fashion as we did for the SSH model. We shall now explicitly mark the edge states in the spectrum with red and blue. Step8: We can now interact with the above function and see the evolution of the surface states. Step9: To complete the analysis of the control freak sequence we now investigate the flow of Wannier centers in time in a chain with periodic boundary conditions. We again first define a class that holds the approporiate data and then write a plotting function. Step10: An alternative way to visualize Wannier flow of a periodic system is shown below. The inner circle represent $t/T=0$ and the outer $t/T=1$, the sections of the disc correspond to unitcells. Step11: If we investigate pumping in a finite but sample without periodic boundary condition we will see that the edgestates cross the gap! Step12: We have now done all the heavy lifting with regards of coding. Now we can reuse all the plotting and data generating classes and functions for other sequences. Step13: The $d$ space story can now be easily explored via the seq_and_d function we have defined earlier. Step14: Similarly the spectrum and wavefunctions can also be investigated via the pumpdata class Step15: Finally wannierflow class let us see the movement of the Wannier centers.
<ASSISTANT_TASK:> Python Code: # The usual imports %pylab inline from ipywidgets import * # Some extra imports for 3D from mpl_toolkits.mplot3d import * # These are only needed to make things pretty.. # they are mostly refered to in the formatting part of the figures # and enshure us to have the figures also present in the book. from matplotlib.patches import FancyArrowPatch class Arrow3D(FancyArrowPatch): def __init__(self, xs, ys, zs, *args, **kwargs): FancyArrowPatch.__init__(self, (0,0), (0,0), *args, **kwargs) self._verts3d = xs, ys, zs def draw(self, renderer): xs3d, ys3d, zs3d = self._verts3d xs, ys, zs = proj3d.proj_transform(xs3d, ys3d, zs3d, renderer.M) self.set_positions((xs[0],ys[0]),(xs[1],ys[1])) FancyArrowPatch.draw(self, renderer) # this generates a parameter mesh in momentum and time kran,tran=meshgrid(linspace(-pi,pi,30),linspace(0,1,51)) # a helper function for defining the d vector def dkt(k,t,uvw): ''' A simple function that returns the d vector of the RM model. ''' return [uvw(t)[1]+uvw(t)[2]*cos(k),uvw(t)[2]*sin(k),uvw(t)[0]] def f(t): ''' A piecewise function for the control freak sequence used to define u(t),v(t),w(t) ''' t=mod(t,1); return ( 8*t*((t>=0)&(t<1/8))+\ (0*t+1)*((t>=1/8)&(t<3/8))+\ (4-8*t)*((t>=3/8)&(t<1/2))+\ 0*t*((t>=1/2)&(t<1))); def uvwCF(t): ''' u,v and w functions of the control freak sequence ''' return array([f(t)-f(t-1/2),2*f(t+1/4),f(t-1/4)]) def seq_and_d(funcs,ti=10): ''' A figure generating function for the Rice Mele model. It plots the functions defining the sequence and the d-space structure. ''' figsize(10,5) fig=figure() func=eval(funcs); ax1=fig.add_subplot(121) ftsz=20 # plotting the functions defining the sequence plot(tran[:,0],func(tran[:,0])[1],'k-',label=r'$v$',linewidth=3) plot(tran[:,0],func(tran[:,0])[2],'g--',label=r'$w$',linewidth=3) plot(tran[:,0],func(tran[:,0])[0],'m-',label=r'$u$',linewidth=3) plot([tran[ti,0],tran[ti,0]],[-3,3],'r-',linewidth=3) # this is just to make things look like in the book ylim(-1.5,2.5) legend(fontsize=20,loc=3) xlabel(r'time $t/T$',fontsize=ftsz) xticks(linspace(0,1,5),[r'$0$',r'$0.25$',r'$0.5$',r'$0.75$',r'$1$'],fontsize=ftsz) ylabel(r'amplitudes $u,v,w$',fontsize=ftsz) yticks([-1,0,1,2],[r'$-1$',r'$0$',r'$1$',r'$2$'],fontsize=ftsz) grid(True) ax2=fig.add_subplot(122, projection='3d') # plotting d space image of the pumping sequence plot(*dkt(kran[ti,:],tran[ti,:],func),marker='o',mec='red',mfc='red',ls='-',lw=6,color='red') plot(*dkt(kran.flatten(),tran.flatten(),func),color='blue',alpha=0.5) # this is just to make things look like in the book # basically everything below is just to make things look nice.. ax2.w_xaxis.set_pane_color((1.0, 1.0, 1.0, 1.0)) ax2.w_yaxis.set_pane_color((1.0, 1.0, 1.0, 1.0)) ax2.w_zaxis.set_pane_color((1.0, 1.0, 1.0, 1.0)) ax2.set_axis_off() ax2.grid(False) arrprop=dict(mutation_scale=20, lw=1,arrowstyle='-|>,head_length=1.4,head_width=0.6',color="k") ax2.add_artist(Arrow3D([-2,4],[0,0],[0,0], **arrprop)) ax2.add_artist(Arrow3D([0,0],[-2,3.3],[0,0], **arrprop)) ax2.add_artist(Arrow3D([0,0],[0,0],[-1,2], **arrprop)) ftsz2=30 ax2.text(4.4, -1, 0, r'$d_x$', None,fontsize=ftsz2) ax2.text(0.3, 3.0, 0, r'$d_y$', None,fontsize=ftsz2) ax2.text(0, 0.6, 2.0, r'$d_z$', None,fontsize=ftsz2) ax2.plot([0],[0],[0],'ko',markersize=8) ax2.view_init(elev=21., azim=-45) ax2.set_aspect(1.0) ax2.set_zlim3d(-0.5, 2) ax2.set_ylim3d(-0.5, 2) ax2.set_xlim3d(-0.5, 2) tight_layout() interact(seq_and_d,funcs=fixed('uvwCF'),ti=(0,len(tran[:,0])-1)); def H_RM_reals(L,u,v,w,**kwargs): ''' A function to bulid a finite RM chain. The number of unitcells is L. As usual v is intracell and w ins intercell hopping. We also have now an asymmetric sublattice potential u. ''' idL=eye(L); # identity matrix of dimension L odL=diag(ones(L-1),1);# upper off diagonal matrix with ones of size L odc=matrix(diag([1],-L+1));#lower corner for periodic boundary condition U=matrix([[u,v],[v,-u]]) # intracell T=matrix([[0,0],[1,0]]) # intercell p=0 if kwargs.get('periodic',False): p=1 H=(kron(idL,U)+ kron(odL,w*T)+ kron(odL,w*T).H+ p*(kron(odc,w*T)+kron(odc,w*T).H)) return H class pumpdata: ''' A class that holds information on spectrum and wavefunctions of a pump sequence performed on a finite lattice model. Default values are tailored to the control freak sequence. ''' def __init__(self,L=10,numLoc=1,norm_treshold=0.99,func=uvwCF,**kwargs): ''' Initialization function. The default values are set in such a way that they correspond to the control freak sequence. ''' self.L=L self.dat=[] # We will collect the data to be self.vecdat=[] # plotted in these arrays. self.lefty=[] self.righty=[] self.lefty=[] self.righty=[] tlim=kwargs.get('edge_tlim',(0,1)) # We can use this to restrict classification # of left and right localized states in time for t in tran[:,0]: u,v,w=func(t) # obtain u(t),v(t) and w(t) H=H_RM_reals(L,u,v,w) # eigdat=eigh(H); # for a given t here we calculate the eigensystem (values and vectors) if tlim[0]<t<tlim[1]: # for the interesting time intervall we look for states localized to the edge for i in range(2*L): if sum((array(eigdat[1][0::2,i])**2+array(eigdat[1][1::2,i])**2)[0:2*numLoc:2])>norm_treshold: self.lefty=append(self.lefty,[[t,eigdat[0][i]]]); if sum((array(eigdat[1][0::2,i])**2+array(eigdat[1][1::2,i])**2)[:L-2*numLoc:-2])>norm_treshold: self.righty=append(self.righty,[[t,eigdat[0][i]]]); self.dat=append(self.dat,eigdat[0]); self.vecdat=append(self.vecdat,eigdat[1]); self.dat=reshape(self.dat,[len(tran[:,0]),2*L]); # rewraping the data self.vecdat=reshape(self.vecdat,[len(tran[:,0]),2*L,2*L]) # to be more digestable # Filling up data for the control freak sequence CFdata=pumpdata(edge_tlim=(0.26,0.74)) def enpsi(PD,ti=10,n=10): figsize(14,5) subplot(121) lcol='#53a4d7' rcol='#d7191c' # Plotting the eigenvalues and # a marker showing for which state # we are exploring the wavefunction plot(tran[:,0],PD.dat,'k-'); (lambda x:plot(x[:,0],x[:,1],'o',mec=lcol,mfc=lcol, markersize=10))(reshape(PD.lefty,(PD.lefty.size/2,2))) (lambda x:plot(x[:,0],x[:,1],'o',mec=rcol,mfc=rcol, markersize=10))(reshape(PD.righty,(PD.righty.size/2,2))) plot(tran[ti,0],PD.dat[ti,n],'o',markersize=13,mec='k',mfc='w') # Make it look like the book xlabel(r'$t/T$',fontsize=25); xticks(linspace(0,1,5),fontsize=25) ylabel(r'energy $E$',fontsize=25); yticks(fontsize=25) ylim(-2.99,2.99) grid() subplot(122) # Plotting the sublattice resolved wavefunction bar(array(range(0,2*PD.L,2)), real(array(PD.vecdat[ti][0::2,n].T)),0.9,color='grey',label='A') # sublattice A bar(array(range(0,2*PD.L,2))+1,real(array(PD.vecdat[ti][1::2,n].T)),0.9,color='white',label='B') # sublattice B # Make it look like the book xticks(2*(array(range(10))),[' '+str(i) for i in array(range(11))[1:]],fontsize=25) ylim(-1.2,1.2) yticks(linspace(-1,1,5),fontsize=25,x=1.2) ylabel('Wavefunction',fontsize=25,labelpad=-460,rotation=-90) grid() legend(loc='lower right') xlabel(r'cell index $m$',fontsize=25); tight_layout() interact(enpsi,PD=fixed(CFdata),ti=(0,len(tran[:,0])-1),n=(0,19)); class wannierflow: ''' A class that holds information on Wannier center flow. ''' def __init__(self,L=6,func=uvwCF,periodic=True,tspan=linspace(0,1,200),**kwargs): self.L=L self.func=func self.periodic=periodic self.tspan=tspan # get position operator if self.periodic: POS=matrix(kron(diag(exp(2.0j*pi*arange(L)/(L))),eye(2))) else: POS=matrix(kron(diag(arange(1,L+1)),eye(2))) Lwanflow=[] Hwanflow=[] Lwane=[] Hwane=[] for t in tspan: u,v,w=self.func(t) H=H_RM_reals(L,u,v,w,periodic=periodic) sys=eigh(H) Lval=sys[0][sys[0]<0] Lvec=matrix(sys[1][:,sys[0]<0]) LP=Lvec*Lvec.H LW=LP*POS*LP LWval,LWvec=eig(LW) LWvec=LWvec[:,abs(LWval)>1e-10] LWe=real(diag(LWvec.H*H*LWvec)) Hval=sys[0][sys[0]>0] Hvec=matrix(sys[1][:,sys[0]>0]) HP=Hvec*Hvec.H HW=HP*POS*HP HWval,HWvec=eig(HW) HWvec=HWvec[:,abs(HWval)>1e-10] HWe=real(diag(HWvec.H*H*HWvec)) Lwane=append(Lwane,LWe) Hwane=append(Hwane,HWe) if periodic: Lwanflow=append(Lwanflow,L/(2*pi)*sort(angle(LWval[abs(LWval)>1e-10]))) Hwanflow=append(Hwanflow,L/(2*pi)*sort(angle(HWval[abs(HWval)>1e-10]))) else: Lwanflow=append(Lwanflow,sort(LWval[abs(LWval)>1e-10])) Hwanflow=append(Hwanflow,sort(HWval[abs(HWval)>1e-10])) self.Lwanflow=Lwanflow self.Hwanflow=Hwanflow self.Lwane=Lwane self.Hwane=Hwane def plot_w_vs_t(self,LorH='Lower band',*args,**kwargs): ''' A function for plotting the Wannier flow. The Wannier centers against time are plotted. ''' #figsize(7,5) data=eval('self.'+(LorH[0] if (LorH[0] in ['L','H']) else 'L')+'wanflow') for i in range(self.L): descr=(LorH if i==0 else '') plot(real(data[i::self.L]),self.tspan,*args,label=descr,**kwargs) if self.periodic: xticks(arange(self.L)-self.L/2+0.5*mod(self.L,2),fontsize=25) else: xticks(arange(self.L)+1,fontsize=25) yticks(linspace(0,1,5),fontsize=25) xlabel(r'position $\langle \hat{x}\rangle$',fontsize=25); ylabel(r"time $t/T$",fontsize=25); grid() def plot_w_vs_e(self,LorH='Lower band',*args,**kwargs): ''' A function for plotting the Wannier flow. The Wannier centers against energy are plotted. ''' #figsize(7,5) dataw=eval('self.'+(LorH[0] if (LorH[0] in ['L','H']) else 'L')+'wanflow') datae=eval('self.'+(LorH[0] if (LorH[0] in ['L','H']) else 'L')+'wane') for i in range(self.L): descr=(LorH if i==0 else '') plot(dataw[i::self.L],datae[i::self.L],*args,label=descr,**kwargs) pos=100 vx=real(dataw[i::self.L][pos:(pos+2)]) vy=real(datae[i::self.L][pos:(pos+2)]) #plot(vx[0],vy[0],'bo') arrow(vx[0],vy[0], (vx[1]-vx[0])/2, (vy[1]-vy[0])/2,fc='k',zorder=1000, head_width=0.3, head_length=0.1) if self.periodic: xticks(arange(self.L)-self.L/2+0.5*mod(self.L,2),fontsize=25) else: xticks(arange(self.L)+1,fontsize=25) yticks(fontsize=25) xlabel(r'position $\langle \hat{x}\rangle$',fontsize=25); ylabel(r'energy $\langle \hat{H}\rangle$',fontsize=25); grid() def polar_w_vs_t(self,LorH='Lower band',*args,**kwargs): ''' A function for plotting the Wannier flow. A figure in polar coordinates is produced. ''' if self.periodic==False: print('This feature is only supported for periodic boundary conditions') return #figsize(7,7) data=eval('self.'+(LorH[0] if (LorH[0] in ['L','H']) else 'L')+'wanflow') for i in range(self.L): descr=(LorH if i==0 else '') plot((self.tspan+0.5)*cos((2*pi)/self.L*data[i::self.L]), (self.tspan+0.5)*sin((2*pi)/self.L*data[i::self.L]), *args,label=descr,**kwargs) phi=linspace(0,2*pi,100); plot(0.5*sin(phi),0.5*cos(phi),'k-',linewidth=2); plot(1.5*sin(phi),1.5*cos(phi),'k-',linewidth=2); xlim(-1.5,1.5); ylim(-1.5,1.5); phiran=linspace(-pi,pi,self.L+1) for i in range(len(phiran)-1): phi0=0 plot([0.5*sin(phiran[i]+phi0),1.5*sin(phiran[i]+phi0)], [0.5*cos(phiran[i]+phi0),1.5*cos(phiran[i]+phi0)],'k--') text(1.3*cos(phiran[i]+pi/self.L/2),1.3*sin(phiran[i]+pi/self.L/2),i+1,fontsize=20) axis('off') text(-0.45,-0.1,r'$t/T=0$',fontsize=20) text(1.1,-1.1,r'$t/T=1$',fontsize=20) CFwan=wannierflow() figsize(12,4) subplot(121) CFwan.plot_w_vs_t('Lower band','ko',ms=10) CFwan.plot_w_vs_t('Higher band','o',mec='grey',mfc='grey') legend(fontsize=15,numpoints=100); subplot(122) CFwan.plot_w_vs_e('Lower band','k.') CFwan.plot_w_vs_e('Higher band','.',mec='grey',mfc='grey') #legend(fontsize=15,numpoints=100); tight_layout() figsize(6,6) CFwan.polar_w_vs_t('Lower band','ko',ms=10) CFwan.polar_w_vs_t('Higher band','o',mec='grey',mfc='grey') legend(numpoints=100,fontsize=15,ncol=2,bbox_to_anchor=(1,0)); CFwan_finite=wannierflow(periodic=False) figsize(6,4) CFwan_finite.plot_w_vs_t('Lower band','ko',ms=10) CFwan_finite.plot_w_vs_t('Higher band','o',mec='grey',mfc='grey') legend(fontsize=15,numpoints=100); xlim(0,7); def uvwNSCF(t): ''' The u,v and w functions of the not so control freak sequence. For the time beeing we assume vbar to be fixed. ''' vbar=1 return array([sin(t*(2*pi)),vbar+cos(t*(2*pi)),1*t**0]) interact(seq_and_d,funcs=fixed('uvwNSCF'),ti=(0,len(tran[:,0])-1)); # Generating the not-so control freak data NSCFdata=pumpdata(numLoc=2,norm_treshold=0.6,func=uvwNSCF) interact(enpsi,PD=fixed(NSCFdata),ti=(0,len(tran[:,0])-1),n=(0,19)); NSCFwan=wannierflow(periodic=True,func=uvwNSCF) figsize(12,4) subplot(121) NSCFwan.plot_w_vs_t('Lower band','ko',ms=10) NSCFwan.plot_w_vs_t('Higher band','o',mec='grey',mfc='grey') legend(fontsize=15,numpoints=100); subplot(122) NSCFwan.plot_w_vs_e('Lower band','k.') NSCFwan.plot_w_vs_e('Higher band','.',mec='grey',mfc='grey') #legend(fontsize=15,numpoints=100); tight_layout() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Model Inputs Step2: Generator network Step3: Discriminator Step4: Hyperparameters Step5: Build network Step6: Discriminator and Generator Losses Step7: Optimizers Step8: Training Step9: Training loss Step10: Generator samples from training Step11: These are samples from the final training epoch. You can see the generator is able to reproduce numbers like 1, 7, 3, 2. Since this is just a sample, it isn't representative of the full range of images this generator can make. Step12: Below I'm showing the generated images as the network was training, every 10 epochs. With bonus optical illusion! Step13: It starts out as all noise. Then it learns to make only the center white and the rest black. You can start to see some number like structures appear out of the noise like 1s and 9s.
<ASSISTANT_TASK:> Python Code: %matplotlib inline import pickle as pkl import numpy as np import tensorflow as tf import matplotlib.pyplot as plt from tensorflow.examples.tutorials.mnist import input_data mnist = input_data.read_data_sets('MNIST_data') def model_inputs(real_dim, z_dim): inputs_real = tf.placeholder(tf.float32, (None, real_dim), name='input_real') inputs_z = tf.placeholder(tf.float32, (None, z_dim), name='input_z') return inputs_real, inputs_z def generator(z, out_dim, n_units=128, reuse=False, alpha=0.01): with tf.variable_scope('generator', reuse=reuse): # Hidden layer h1 = tf.layers.dense(z, n_units, activation=None) # Leaky ReLU h1 = tf.maximum(alpha * h1, h1) # Logits and tanh output logits = tf.layers.dense(h1, out_dim, activation=None) out = tf.tanh(logits) return out def discriminator(x, n_units=128, reuse=False, alpha=0.01): with tf.variable_scope('discriminator', reuse=reuse): # Hidden layer h1 = tf.layers.dense(x, n_units, activation=None) # Leaky ReLU h1 = tf.maximum(alpha * h1, h1) logits = tf.layers.dense(h1, 1, activation=None) out = tf.sigmoid(logits) return out, logits # Size of input image to discriminator input_size = 784 # Size of latent vector to generator z_size = 100 # Sizes of hidden layers in generator and discriminator g_hidden_size = 128 d_hidden_size = 128 # Leak factor for leaky ReLU alpha = 0.01 # Smoothing smooth = 0.1 tf.reset_default_graph() # Create our input placeholders input_real, input_z = model_inputs(input_size, z_size) # Build the model g_model = generator(input_z, input_size) # g_model is the generator output d_model_real, d_logits_real = discriminator(input_real) d_model_fake, d_logits_fake = discriminator(g_model, reuse=True) # Calculate losses d_loss_real = tf.reduce_mean( tf.nn.sigmoid_cross_entropy_with_logits(logits=d_logits_real, labels=tf.ones_like(d_logits_real) * (1 - smooth))) d_loss_fake = tf.reduce_mean( tf.nn.sigmoid_cross_entropy_with_logits(logits=d_logits_fake, labels=tf.zeros_like(d_logits_real))) d_loss = d_loss_real + d_loss_fake g_loss = tf.reduce_mean( tf.nn.sigmoid_cross_entropy_with_logits(logits=d_logits_fake, labels=tf.ones_like(d_logits_fake))) # Optimizers learning_rate = 0.002 # Get the trainable_variables, split into G and D parts t_vars = tf.trainable_variables() g_vars = [var for var in t_vars if var.name.startswith('generator')] d_vars = [var for var in t_vars if var.name.startswith('discriminator')] d_train_opt = tf.train.AdamOptimizer(learning_rate).minimize(d_loss, var_list=d_vars) g_train_opt = tf.train.AdamOptimizer(learning_rate).minimize(g_loss, var_list=g_vars) !mkdir checkpoints batch_size = 100 epochs = 100 samples = [] losses = [] # Only save generator variables saver = tf.train.Saver(var_list=g_vars) with tf.Session() as sess: sess.run(tf.global_variables_initializer()) for e in range(epochs): for ii in range(mnist.train.num_examples//batch_size): batch = mnist.train.next_batch(batch_size) # Get images, reshape and rescale to pass to D batch_images = batch[0].reshape((batch_size, 784)) batch_images = batch_images*2 - 1 # Sample random noise for G batch_z = np.random.uniform(-1, 1, size=(batch_size, z_size)) # Run optimizers _ = sess.run(d_train_opt, feed_dict={input_real: batch_images, input_z: batch_z}) _ = sess.run(g_train_opt, feed_dict={input_z: batch_z}) # At the end of each epoch, get the losses and print them out train_loss_d = sess.run(d_loss, {input_z: batch_z, input_real: batch_images}) train_loss_g = g_loss.eval({input_z: batch_z}) print("Epoch {}/{}...".format(e+1, epochs), "Discriminator Loss: {:.4f}...".format(train_loss_d), "Generator Loss: {:.4f}".format(train_loss_g)) # Save losses to view after training losses.append((train_loss_d, train_loss_g)) # Sample from generator as we're training for viewing afterwards sample_z = np.random.uniform(-1, 1, size=(16, z_size)) gen_samples = sess.run( generator(input_z, input_size, reuse=True), feed_dict={input_z: sample_z}) samples.append(gen_samples) saver.save(sess, './checkpoints/generator.ckpt') # Save training generator samples with open('train_samples.pkl', 'wb') as f: pkl.dump(samples, f) fig, ax = plt.subplots() losses = np.array(losses) plt.plot(losses.T[0], label='Discriminator') plt.plot(losses.T[1], label='Generator') plt.title("Training Losses") plt.legend() def view_samples(epoch, samples): fig, axes = plt.subplots(figsize=(7,7), nrows=4, ncols=4, sharey=True, sharex=True) for ax, img in zip(axes.flatten(), samples[epoch]): ax.xaxis.set_visible(False) ax.yaxis.set_visible(False) im = ax.imshow(img.reshape((28,28)), cmap='Greys_r') return fig, axes # Load samples from generator taken while training with open('train_samples.pkl', 'rb') as f: samples = pkl.load(f) _ = view_samples(-1, samples) rows, cols = 10, 6 fig, axes = plt.subplots(figsize=(7,12), nrows=rows, ncols=cols, sharex=True, sharey=True) for sample, ax_row in zip(samples[::int(len(samples)/rows)], axes): for img, ax in zip(sample[::int(len(sample)/cols)], ax_row): ax.imshow(img.reshape((28,28)), cmap='Greys_r') ax.xaxis.set_visible(False) ax.yaxis.set_visible(False) saver = tf.train.Saver(var_list=g_vars) with tf.Session() as sess: saver.restore(sess, tf.train.latest_checkpoint('checkpoints')) sample_z = np.random.uniform(-1, 1, size=(16, z_size)) gen_samples = sess.run( generator(input_z, input_size, reuse=True), feed_dict={input_z: sample_z}) _ = view_samples(0, [gen_samples]) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: A quoi ça ressemble Step2: C'est gros. Step3: Idée de la compétation Step4: Le code qui suit est construit après plusieurs essais en fonction des warnings retournés par le module dask. Step5: On ajoute la colonne à prédire, booleénne, qui indique la présence d'additif commençant par 'e Step6: On se limite au produit pour lesquels on a quelques informations sur le contenu. Step7: Bon la suite prend un peu de temps et ça n'est pas hyper efficace. Il faudrait un dask qui n'utilise pas dask mais uniquement les dataframes pour que ça aille plus vite. Café. Step8: Bon je crois que je vais vraiment développer une truc comme dask juste avec pandas. Step9: Split... Step10: Ah j'allais oublié, il faut bidouiller la colonne additives pour retirer éviter un memory leak et on recalcule la colonne hasE pour être sûr. Step11: On recompose le tout. Step12: Il y aura probablement un ou deux data leak dans les autres colonnes.. Step13: Premier modèle Step14: ROC
<ASSISTANT_TASK:> Python Code: from jyquickhelper import add_notebook_menu add_notebook_menu() import os os.stat("c:/temp/fr.openfoodfacts.org.products.csv").st_size / 2**30, 'Go' import pyensae %load_ext pyensae %head -n 2 c:/temp/fr.openfoodfacts.org.products.csv import pandas df = pandas.read_csv("c:/temp/fr.openfoodfacts.org.products.csv", sep="\t", encoding="utf-8", nrows=10000, low_memory=False) df.head().T.to_excel("e.xlsx") df[df.additives.notnull() & df.additives.str.contains("E4")].head().T import dask import dask.dataframe as dd ddf = dd.read_csv("c:/temp/fr.openfoodfacts.org.products.csv", sep="\t", encoding="utf-8", low_memory=False, dtype={'allergens': 'object', 'cities_tags': 'object', 'emb_codes': 'object', 'emb_codes_tags': 'object', 'first_packaging_code_geo': 'object', 'generic_name': 'object', 'ingredients_from_palm_oil_tags': 'object', 'labels': 'object', 'labels_fr': 'object', 'labels_tags': 'object', 'manufacturing_places': 'object', 'manufacturing_places_tags': 'object', 'origins': 'object', 'origins_tags': 'object', 'stores': 'object', 'code': 'object','allergens_fr': 'object', 'cities': 'object', 'created_t': 'object', 'last_modified_t': 'object'}) ddf.head() print(type(ddf)) ddfe = ddf.assign(hasE=ddf.apply(lambda row: isinstance(row.additives, str) and "en:e" in row.additives, axis=1, meta=bool)) ddfe.head() g100 = [_ for _ in ddf.columns if '100g' in _] g100 ddfe.compute().shape import numpy ddfe100 = ddfe.assign(s100=ddf.apply(lambda row: sum(0 if numpy.isnan(row[g]) else 1 for g in g100), axis=1, meta=float)) ddfe100 = ddfe100[ddfe100.s100 > 0] ddfe100.head() ddfe100.to_csv("ddfe100*.csv", sep="\t", encoding="utf-8", index=False) dffefiles = [_ for _ in os.listdir(".") if "ddfe" in _] dffefiles types = {k:v for k, v in zip(ddfe100.columns, ddfe100.dtypes)} from sklearn.model_selection import train_test_split for i, name in enumerate(dffefiles): print("name", name) df = pandas.read_csv(name, sep="\t", encoding="utf-8", dtype=types) df_train, df_test = train_test_split(df, test_size =0.5) df_test, df_eval = train_test_split(df_test, test_size =0.5) df_train.to_csv("off_train{0}.txt".format(i), sep="\t", index=False, encoding="utf-8") df_test.to_csv("off_test{0}.txt".format(i), sep="\t", index=False, encoding="utf-8") df_eval.to_csv("off_eval{0}.txt".format(i), sep="\t", index=False, encoding="utf-8") df[["additives", "hasE"]].head() import re reg = re.compile("[[](.*?)[]]") addi = re.compile("(en[:]e[0-9])") def has_emachine(v): if isinstance(v, (list, pandas.core.series.Series)): rem = [] add = [] for _ in v: if isinstance(_, str): fd = reg.findall(_) for __ in fd: if " en:e" in __ and addi.search(__): add.append(__)#.split("->")[-1].strip()) elif " en:" not in __: continue else: rem.append(__.split("->")[-1].strip()) else: continue return add, list(sorted(set(rem))) elif isinstance(v, float) and numpy.isnan(v): return [], [] elif isinstance(v, str): if "," in v: raise Exception('{0}\n{1}'.format(type(v), v)) return has_emachine([v]) else: # ??? raise Exception('{0}\n{1}'.format(type(v), v)) hasE, clean = has_emachine(df.loc[1,"additives"]) hasE, clean off = [_ for _ in os.listdir(".") if "off" in _ and "all" not in _] for cont in ['train', 'test', 'eval']: sub = [_ for _ in off if cont in _] dfs = [] for name in sub: df = pandas.read_csv(name, sep="\t", encoding="utf-8", dtype=types) print("name", name, df.shape) df["hasE"] = df["additives"].apply(lambda x: len(has_emachine(x)[0]) > 0) df["additives"] = df["additives"].apply(lambda x: ";".join(has_emachine(x)[1])) dfs.append(df) df = pandas.concat(dfs, axis=0) print("merged", df.shape) df.to_csv("off_{0}_all.txt".format(cont), sep="\t", index=False, encoding="utf-8") len(types) df_eval = pandas.read_csv("off_eval_all.txt", sep="\t", dtype=types, encoding="utf-8") df_eval_X = df_eval.drop("hasE", axis=1) df_eval_X.to_csv("off_eval_all_X.txt") df_eval[["hasE"]].to_csv("off_eval_all_Y.txt") df_train = pandas.read_csv("off_train_all.txt", sep="\t", dtype=types, encoding="utf-8") df_train.shape X = df_train[g100].fillna(0) Y = df_train['hasE'] from sklearn.linear_model import LogisticRegression clf = LogisticRegression() clf.fit(X, Y) pred = clf.predict(X) from sklearn.metrics import confusion_matrix confusion_matrix(Y, pred) df_test = pandas.read_csv("off_test_all.txt", sep="\t", dtype=types, encoding="utf-8") X_test = df_test[g100].fillna(0) Y_test = df_test['hasE'] pred = clf.predict(X_test) confusion_matrix(Y_test, pred) y_proba = clf.predict_proba(X_test) y_pred = clf.predict(X_test) print(y_proba[:3]) print(y_pred[:3]) y_test = Y_test.values type(y_pred), type(Y_test), type(y_test) import numpy prob_pred = numpy.array([(y_proba[i, 1] if c else y_proba[i, 0]) for i, c in enumerate(y_pred)]) prob_pred[:3] from sklearn.metrics import roc_curve fpr, tpr, th = roc_curve(y_pred == y_test, prob_pred) %matplotlib inline import matplotlib.pyplot as plt plt.figure() lw = 2 plt.plot(fpr, tpr, color='darkorange', lw=lw, label='Courbe ROC') plt.plot([0, 1], [0, 1], color='navy', lw=lw, linestyle='--') plt.xlim([0.0, 1.0]) plt.ylim([0.0, 1.05]) plt.xlabel("Proportion mal classée") plt.ylabel("Proportion bien classée") plt.title('ROC') plt.legend(loc="lower right") <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Load the data from *.csv file Step2: Explore the correct data Step3: Prepare the Data for CNN Step4: Prepare the data for CNN Step5: Model 1 - Overfitting the data TODO not overfitting with 35k data Step6: As it is possible to see from this result, the model overfits the training data already at iteration 400, while getting a test accuracy of only 28%. Step7: Model 2 - 4 x Convolutional Layers, 1x Fully Connected Step8: Computational graph - 6 Layers, Conv-Relu-Maxpool, 1 Fully Connected L. Step9: saving the trained graph in TF file Step10: Feeding the CNN with some data (camera/file)
<ASSISTANT_TASK:> Python Code: import random import numpy as np import tensorflow as tf import matplotlib.pyplot as plt import csv import scipy.misc import time import collections import os import utils as ut import importlib import copy importlib.reload(ut) # This is a bit of magic to make matplotlib figures appear inline in the notebook # rather than in a new window. %matplotlib inline plt.rcParams['figure.figsize'] = (20.0, 20.0) # set default size of plots plt.rcParams['image.interpolation'] = 'nearest' plt.rcParams['image.cmap'] = 'gray' #Data Visualization # Load the shortened raw CSV data, it contains only 300 pictures with labels emotions_dataset_dir = 'fer2013_full.csv' #obtaining the number of line of the csv file file = open(emotions_dataset_dir) numline = len(file.readlines()) print ('Number of data in the dataset:',numline) #Load the file in csv ifile = open(emotions_dataset_dir, "rt") reader = csv.reader(ifile) hist_threshold = 350 # images above this threshold will be removed hist_div = 100 #parameter of the histogram print('Loading Images. It may take a while, depending on the database size.') images, emotions, strange_im, num_strange, num_skipped = ut.load_dataset(reader, numline, hist_div, hist_threshold) ifile.close() print('Skipped', num_skipped, 'happy class images.') print(str( len(images) ) + ' are left after \'strange images\' removal.') print('Deleted ' + str( num_strange ) + ' strange images. Images are shown below') # showing strange images plt.rcParams['figure.figsize'] = (5.0, 5.0) # set default size of plots idxs = np.random.choice(range(1,num_strange ), 6, replace=False) for i, idx in enumerate(idxs): plt_idx = i plt.subplot(1, 6, plt_idx+1) plt.imshow(strange_im[idx]) plt.axis('off') if(i == 0): plt.title('Some of the images removed from dataset (max(histogram) thresholded)') plt.show() classes = [0,1,2,3,4,5] str_emotions = ['angry','scared','happy','sad','surprised','normal'] num_classes = len(classes) samples_per_class = 6 plt.rcParams['figure.figsize'] = (10.0, 10.0) # set default size of plots for y, cls in enumerate(classes): idxs = np.flatnonzero(emotions == y) idxs = np.random.choice(idxs, samples_per_class, replace=False) for i, idx in enumerate(idxs): plt_idx = i * num_classes + y + 1 plt.subplot(samples_per_class, num_classes, plt_idx) plt.imshow(images[idx]) y_h, x_h = np.histogram( images[idx], hist_div ); plt.axis('off') if(i == 0): plt.title(str_emotions[y] ) plt.show() print('number of clean data:' + str(images.shape[0]) + ' 48x48 pix , 0-255 greyscale images') n_all = images.shape[0]; n_train = 64; # number of data for training and for batch # dividing the input data train_data_orig = images[0:n_all-n_train,:,:] train_labels = emotions[0:n_all-n_train] test_data_orig = images[n_all-n_train:n_all,:,:] test_labels = emotions[n_all-n_train:n_all] # Convert to float train_data_orig = train_data_orig.astype('float32') y_train = train_labels.astype('float32') test_data_orig = test_data_orig.astype('float32') y_test = test_labels.astype('float32') print('orig train data ' + str(train_data_orig.shape)) print('orig train labels ' + str(train_labels.shape) + 'from ' + str(train_labels.min()) + ' to ' + str(train_labels.max()) ) print('orig test data ' + str(test_data_orig.shape)) print('orig test labels ' + str(test_labels.shape)+ 'from ' + str(test_labels.min()) + ' to ' + str(test_labels.max()) ) for i in range (0, 5): print('TRAIN: number of' , i, 'labels',len(train_labels[train_labels == i])) for i in range (0, 5): print('TEST: number of', i, 'labels',len(test_labels[test_labels == i])) # Data pre-processing n = train_data_orig.shape[0]; train_data = np.zeros([n,48**2]) for i in range(n): xx = train_data_orig[i,:,:] xx -= np.mean(xx) xx /= np.linalg.norm(xx) train_data[i,:] = xx.reshape(2304); #np.reshape(xx,[-1]) n = test_data_orig.shape[0] test_data = np.zeros([n,48**2]) for i in range(n): xx = test_data_orig[i,:,:] xx -= np.mean(xx) xx /= np.linalg.norm(xx) test_data[i] = np.reshape(xx,[-1]) #print(train_data.shape) #print(test_data.shape) #print(train_data_orig[0][2][2]) #print(test_data[0][2]) plt.rcParams['figure.figsize'] = (2.0, 2.0) # set default size of plots plt.imshow(train_data[4].reshape([48,48])); plt.title('example image after processing'); # Convert label values to one_hot vector train_labels = ut.convert_to_one_hot(train_labels,num_classes) test_labels = ut.convert_to_one_hot(test_labels,num_classes) print('train labels shape',train_labels.shape) print('test labels shape',test_labels.shape) # Define computational graph (CG) batch_size = n_train # batch size d = train_data.shape[1] # data dimensionality nc = 6 # number of classes # CG inputs xin = tf.placeholder(tf.float32,[batch_size,d]); #print('xin=',xin,xin.get_shape()) y_label = tf.placeholder(tf.float32,[batch_size,nc]); #print('y_label=',y_label,y_label.get_shape()) #d = tf.placeholder(tf.float32); # Convolutional layer K0 = 8 # size of the patch F0 = 64 # number of filters ncl0 = K0*K0*F0 Wcl0 = tf.Variable(tf.truncated_normal([K0,K0,1,F0], stddev=tf.sqrt(2./tf.to_float(ncl0)) )); print('Wcl=',Wcl0.get_shape()) #bcl0 = tf.Variable(tf.zeros([F0])); print('bcl=',bcl0.get_shape()) bcl0 = bias_variable([F0]); print('bcl0=',bcl0.get_shape()) #in ReLu case, small positive bias added to prevent killing of gradient when input is negative. x_2d0 = tf.reshape(xin, [-1,48,48,1]); print('x_2d=',x_2d0.get_shape()) x = tf.nn.conv2d(x_2d0, Wcl0, strides=[1, 1, 1, 1], padding='SAME') x += bcl0; print('x2=',x.get_shape()) # ReLU activation x = tf.nn.relu(x) # Dropout #x = tf.nn.dropout(x, 0.25) # Fully Connected layer nfc = 48*48*F0 x = tf.reshape(x, [batch_size,-1]); print('x3=',x.get_shape()) Wfc = tf.Variable(tf.truncated_normal([nfc,nc], stddev=tf.sqrt(2./tf.to_float(nfc+nc)) )); print('Wfc=',Wfc.get_shape()) bfc = tf.Variable(tf.zeros([nc])); print('bfc=',bfc.get_shape()) y = tf.matmul(x, Wfc); print('y1=',y.get_shape()) y += bfc; print('y2=',y.get_shape()) # Softmax y = tf.nn.softmax(y); print('y3(SOFTMAX)=',y.get_shape()) # Loss cross_entropy = tf.reduce_mean(-tf.reduce_sum(y_label * tf.log(y), 1)) total_loss = cross_entropy # Optimization scheme #train_step = tf.train.GradientDescentOptimizer(0.02).minimize(total_loss) train_step = tf.train.AdamOptimizer(0.004).minimize(total_loss) # Accuracy correct_prediction = tf.equal(tf.argmax(y,1), tf.argmax(y_label,1)) accuracy = tf.reduce_mean(tf.cast(correct_prediction, tf.float32)) # Run Computational Graph n = train_data.shape[0] indices = collections.deque() init = tf.initialize_all_variables() sess = tf.Session() sess.run(init) for i in range(1001): # Batch extraction if len(indices) < batch_size: indices.extend(np.random.permutation(n)) idx = [indices.popleft() for i in range(batch_size)] batch_x, batch_y = train_data[idx,:], train_labels[idx] #print(batch_x.shape,batch_y.shape) # Run CG for vao to increase the test acriable training _,acc_train,total_loss_o = sess.run([train_step,accuracy,total_loss], feed_dict={xin: batch_x, y_label: batch_y}) # Run CG for test set if not i%100: print('\nIteration i=',i,', train accuracy=',acc_train,', loss=',total_loss_o) acc_test = sess.run(accuracy, feed_dict={xin: test_data, y_label: test_labels}) print('test accuracy=',acc_test) d = train_data.shape[1] #Défining network def weight_variable2(shape, nc10): initial2 = tf.random_normal(shape, stddev=tf.sqrt(2./tf.to_float(ncl0)) ) return tf.Variable(initial2) def conv2dstride2(x,W): return tf.nn.conv2d(x,W,strides=[1, 2, 2, 1], padding='SAME') def conv2d(x,W): return tf.nn.conv2d(x,W,strides=[1, 1, 1, 1], padding='SAME') def max_pool_2x2(x): return tf.nn.max_pool(x, ksize=[1, 2, 2, 1], strides=[1, 2, 2, 1], padding='SAME') def weight_variable(shape): initial = tf.truncated_normal(shape, stddev=1/np.sqrt(d/2) ) return tf.Variable(initial) def bias_variable(shape): initial = tf.constant(0.01,shape=shape) return tf.Variable(initial) tf.reset_default_graph() # Define computational graph (CG) batch_size = n_train # batch size d = train_data.shape[1] # data dimensionality nc = 6 # number of classes # CG inputs xin = tf.placeholder(tf.float32,[batch_size,d]); #print('xin=',xin,xin.get_shape()) y_label = tf.placeholder(tf.float32,[batch_size,nc]); #print('y_label=',y_label,y_label.get_shape()) #d = tf.placeholder(tf.float32); # Convolutional layer K0 = 7 # size of the patch F0 = 16 # number of filters ncl0 = K0*K0*F0 K1 = 5 # size of the patch F1 = 16 # number of filters ncl0 = K1*K1*F1 K2 = 3 # size of the patch F2 = 2 # number of filters ncl0 = K2*K2*F2 nfc = int(48*48*F0/4) nfc1 = int(48*48*F1/4) nfc2 = int(48*48*F2/4) keep_prob_input=tf.placeholder(tf.float32) #First set of conv followed by conv stride 2 operation and dropout 0.5 W_conv1=weight_variable([K0,K0,1,F0]); print('W_conv1=',W_conv1.get_shape()) b_conv1=bias_variable([F0]); print('b_conv1=',b_conv1.get_shape()) x_2d0 = tf.reshape(xin, [-1,48,48,1]); print('x_2d0=',x_2d0.get_shape()) h_conv1=tf.nn.relu(conv2d(x_2d0,W_conv1)+b_conv1); print('h_conv1=',h_conv1.get_shape()) h_conv1= tf.nn.dropout(h_conv1,keep_prob_input); # 2nd convolutional layer W_conv2=weight_variable([K0,K0,F0,F0]); print('W_conv2=',W_conv2.get_shape()) b_conv2=bias_variable([F0]); print('b_conv2=',b_conv2.get_shape()) h_conv2 = tf.nn.relu(conv2d(h_conv1,W_conv2)+b_conv2); print('h_conv2=',h_conv2.get_shape()) h_conv2_pooled = max_pool_2x2(h_conv2); print('h_conv2_pooled=',h_conv2_pooled.get_shape()) # reshaping for fully connected h_conv2_pooled_rs = tf.reshape(h_conv2_pooled, [batch_size,-1]); print('x_rs',h_conv2_pooled_rs.get_shape()); W_norm3 = weight_variable([nfc1, nfc]); print('W_norm3=',W_norm3.get_shape()) b_conv3 = bias_variable([nfc1]); print('b_conv3=',b_conv3.get_shape()) # fully connected layer h_full3 = tf.matmul( W_norm3, tf.transpose(h_conv2_pooled_rs) ); print('h_full3=',h_full3.get_shape()) h_full3 = tf.transpose(h_full3); print('h_full3=',h_full3.get_shape()) h_full3 += b_conv3; print('h_full3=',h_full3.get_shape()) h_full3=tf.nn.relu(h_full3); print('h_full3=',h_full3.get_shape()) h_full3=tf.nn.dropout(h_full3,keep_prob_input); print('h_full3_dropout=',h_full3.get_shape()) #reshaping back to conv h_full3_rs = tf.reshape(h_full3, [batch_size, 24,24,-1]); print('h_full3_rs=',h_full3_rs.get_shape()) #Second set of conv followed by conv stride 2 operation W_conv4=weight_variable([K1,K1,F1,F1]); print('W_conv4=',W_conv4.get_shape()) b_conv4=bias_variable([F1]); print('b_conv4=',b_conv4.get_shape()) h_conv4=tf.nn.relu(conv2d(h_full3_rs,W_conv4)+b_conv4); print('h_conv4=',h_conv4.get_shape()) h_conv4 = max_pool_2x2(h_conv4); print('h_conv4_pooled=',h_conv4.get_shape()) # reshaping for fully connected h_conv4_pooled_rs = tf.reshape(h_conv4, [batch_size,-1]); print('x2_rs',h_conv4_pooled_rs.get_shape()); W_norm4 = weight_variable([ 2304, nc]); print('W_norm4=',W_norm4.get_shape()) b_conv4 = tf.Variable(tf.zeros([nc])); print('b_conv4=',b_conv4.get_shape()) # fully connected layer h_full4 = tf.matmul( h_conv4_pooled_rs, W_norm4 ); print('h_full4=',h_full4.get_shape()) h_full4 += b_conv4; print('h_full4=',h_full4.get_shape()) y = h_full4; ## Softmax y = tf.nn.softmax(y); print('y(SOFTMAX)=',y.get_shape()) # Loss cross_entropy = tf.reduce_mean(-tf.reduce_sum(y_label * tf.log(y), 1)) total_loss = cross_entropy # Optimization scheme #train_step = tf.train.GradientDescentOptimizer(0.02).minimize(total_loss) train_step = tf.train.AdamOptimizer(0.001).minimize(total_loss) # Accuracy correct_prediction = tf.equal(tf.argmax(y,1), tf.argmax(y_label,1)) accuracy = tf.reduce_mean(tf.cast(correct_prediction, tf.float32)) # Run Computational Graph n = train_data.shape[0] indices = collections.deque() init = tf.initialize_all_variables() sess = tf.Session() sess.run(init) for i in range(15001): # Batch extraction if len(indices) < batch_size: indices.extend(np.random.permutation(n)) idx = [indices.popleft() for i in range(batch_size)] batch_x, batch_y = train_data[idx,:], train_labels[idx] #print(batch_x.shape,batch_y.shape) # Run CG for vao to increase the test acriable training _,acc_train,total_loss_o = sess.run([train_step,accuracy,total_loss], feed_dict={xin: batch_x, y_label: batch_y, keep_prob_input: 0.2}) # Run CG for test set if not i%50: print('\nIteration i=',i,', train accuracy=',acc_train,', loss=',total_loss_o) acc_test = sess.run(accuracy, feed_dict = {xin: test_data, y_label: test_labels, keep_prob_input: 1.0}) print('test accuracy=',acc_test) tf.reset_default_graph() # implementation of Conv-Relu-COVN-RELU - pool # based on : http://cs231n.github.io/convolutional-networks/ # Define computational graph (CG) batch_size = n_train # batch size d = train_data.shape[1] # data dimensionality nc = 6 # number of classes # CG inputs xin = tf.placeholder(tf.float32,[batch_size,d]); #print('xin=',xin,xin.get_shape()) y_label = tf.placeholder(tf.float32,[batch_size,nc]); #print('y_label=',y_label,y_label.get_shape()) #d = tf.placeholder(tf.float32); #for the first conc-conv # Convolutional layer K0 = 8 # size of the patch F0 = 22 # number of filters ncl0 = K0*K0*F0 #for the second conc-conv K1 = 4 # size of the patch F1 = F0 # number of filters ncl1 = K1*K1*F1 #drouput probability keep_prob_input=tf.placeholder(tf.float32) #1st set of conv followed by conv2d operation and dropout 0.5 W_conv1=weight_variable([K0,K0,1,F0]); print('W_conv1=',W_conv1.get_shape()) b_conv1=bias_variable([F0]); print('b_conv1=',b_conv1.get_shape()) x_2d1 = tf.reshape(xin, [-1,48,48,1]); print('x_2d1=',x_2d1.get_shape()) #conv2d h_conv1=tf.nn.relu(conv2d(x_2d1, W_conv1) + b_conv1); print('h_conv1=',h_conv1.get_shape()) #h_conv1= tf.nn.dropout(h_conv1,keep_prob_input); # 2nd convolutional layer + max pooling W_conv2=weight_variable([K0,K0,F0,F0]); print('W_conv2=',W_conv2.get_shape()) b_conv2=bias_variable([F0]); print('b_conv2=',b_conv2.get_shape()) # conv2d + max pool h_conv2 = tf.nn.relu(conv2d(h_conv1,W_conv2)+b_conv2); print('h_conv2=',h_conv2.get_shape()) h_conv2_pooled = max_pool_2x2(h_conv2); print('h_conv2_pooled=',h_conv2_pooled.get_shape()) #3rd set of conv W_conv3=weight_variable([K0,K0,F0,F0]); print('W_conv3=',W_conv3.get_shape()) b_conv3=bias_variable([F1]); print('b_conv3=',b_conv3.get_shape()) x_2d3 = tf.reshape(h_conv2_pooled, [-1,24,24,F0]); print('x_2d3=',x_2d3.get_shape()) #conv2d h_conv3=tf.nn.relu(conv2d(x_2d3, W_conv3) + b_conv3); print('h_conv3=',h_conv3.get_shape()) # 4th convolutional layer W_conv4=weight_variable([K1,K1,F1,F1]); print('W_conv4=',W_conv4.get_shape()) b_conv4=bias_variable([F1]); print('b_conv4=',b_conv4.get_shape()) #conv2d + max pool 4x4 h_conv4 = tf.nn.relu(conv2d(h_conv3,W_conv4)+b_conv4); print('h_conv4=',h_conv4.get_shape()) h_conv4_pooled = max_pool_2x2(h_conv4); print('h_conv4_pooled=',h_conv4_pooled.get_shape()) h_conv4_pooled = max_pool_2x2(h_conv4_pooled); print('h_conv4_pooled=',h_conv4_pooled.get_shape()) #5th set of conv W_conv5=weight_variable([K1,K1,F1,F1]); print('W_conv5=',W_conv5.get_shape()) b_conv5=bias_variable([F1]); print('b_conv5=',b_conv5.get_shape()) x_2d5 = tf.reshape(h_conv4_pooled, [-1,6,6,F1]); print('x_2d5=',x_2d5.get_shape()) #conv2d h_conv5=tf.nn.relu(conv2d(x_2d5, W_conv5) + b_conv5); print('h_conv5=',h_conv5.get_shape()) # 6th convolutional layer W_conv6=weight_variable([K1,K1,F1,F1]); print('W_con6=',W_conv6.get_shape()) b_conv6=bias_variable([F1]); print('b_conv6=',b_conv6.get_shape()) b_conv6= tf.nn.dropout(b_conv6,keep_prob_input); #conv2d + max pool 4x4 h_conv6 = tf.nn.relu(conv2d(h_conv5,W_conv6)+b_conv6); print('h_conv6=',h_conv6.get_shape()) h_conv6_pooled = max_pool_2x2(h_conv6); print('h_conv6_pooled=',h_conv6_pooled.get_shape()) # reshaping for fully connected h_conv6_pooled_rs = tf.reshape(h_conv6, [batch_size,-1]); print('x2_rs',h_conv6_pooled_rs.get_shape()); W_norm6 = weight_variable([ 6*6*F1, nc]); print('W_norm6=',W_norm6.get_shape()) b_norm6 = bias_variable([nc]); print('b_conv6=',b_norm6.get_shape()) # fully connected layer h_full6 = tf.matmul( h_conv6_pooled_rs, W_norm6 ); print('h_full6=',h_full6.get_shape()) h_full6 += b_norm6; print('h_full6=',h_full6.get_shape()) y = h_full6; ## Softmax y = tf.nn.softmax(y); print('y3(SOFTMAX)=',y.get_shape()) # Loss cross_entropy = tf.reduce_mean(-tf.reduce_sum(y_label * tf.log(y), 1)) total_loss = cross_entropy # Optimization scheme #train_step = tf.train.GradientDescentOptimizer(0.02).minimize(total_loss) train_step = tf.train.AdamOptimizer(0.001).minimize(total_loss) # Accuracy correct_prediction = tf.equal(tf.argmax(y,1), tf.argmax(y_label,1)) accuracy = tf.reduce_mean(tf.cast(correct_prediction, tf.float32)) # Run Computational Graph n = train_data.shape[0] indices = collections.deque() init = tf.initialize_all_variables() sess = tf.Session() sess.run(init) for i in range(20001): # Batch extraction if len(indices) < batch_size: indices.extend(np.random.permutation(n)) idx = [indices.popleft() for i in range(batch_size)] batch_x, batch_y = train_data[idx,:], train_labels[idx] #print(batch_x.shape,batch_y.shape) # Run CG for vao to increase the test acriable training _,acc_train,total_loss_o = sess.run([train_step,accuracy,total_loss], feed_dict={xin: batch_x, y_label: batch_y, keep_prob_input: 0.5}) # Run CG for test set if not i%100: print('\nIteration i=',i,', train accuracy=',acc_train,', loss=',total_loss_o) acc_test = sess.run(accuracy, feed_dict = {xin: test_data, y_label: test_labels, keep_prob_input: 1.0}) print('test accuracy=',acc_test) # Add ops to save and restore all the variables. saver = tf.train.Saver() # Save the variables to disk. save_path = saver.save(sess, "model_6layers.ckpt") print("Model saved in file: %s" % save_path) # calculating accuracy for each class separately for the test set result_cnn = sess.run([y], feed_dict = {xin: test_data, keep_prob_input: 1.0}) #result = sess.run(y, feed_dict={xin: test_data, keep_prob_input: 1.0}) tset = test_labels.argmax(1); result = np.asarray(result_cnn[:][0]).argmax(1); for i in range (0,nc): print('accuracy',str_emotions[i]+str(' '), '\t',ut.calc_partial_accuracy(tset, result, i)) faces, marked_img = ut.get_faces_from_img('diff_emotions.jpg'); #faces, marked_img = ut.get_faces_from_img('big_bang.png'); #faces, marked_img = ut.get_faces_from_img('camera'); # if some face was found in the image if(len(faces)): #creating the blank test vector data_orig = np.zeros([n_train, 48,48]) #putting face data into the vector (only first few) for i in range(0, len(faces)): data_orig[i,:,:] = ut.contrast_stretch(faces[i,:,:]); #preparing image and putting it into the batch n = data_orig.shape[0]; data = np.zeros([n,48**2]) for i in range(n): xx = data_orig[i,:,:] xx -= np.mean(xx) xx /= np.linalg.norm(xx) data[i,:] = xx.reshape(2304); #np.reshape(xx,[-1]) result = sess.run([y], feed_dict={xin: data, keep_prob_input: 1.0}) plt.rcParams['figure.figsize'] = (10.0, 10.0) # set default size of plots for i in range(0, len(faces)): emotion_nr = np.argmax(result[0][i]); plt_idx = (2*i)+1; plt.subplot( 5, 2*len(faces)/5+1, plt_idx) plt.imshow(np.reshape(data[i,:], (48,48))) plt.axis('off') plt.title(str_emotions[emotion_nr]) ax = plt.subplot(5, 2*len(faces)/5+1, plt_idx +1) ax.bar(np.arange(nc) , result[0][i]) ax.set_xticklabels(str_emotions, rotation=45, rotation_mode="anchor") ax.set_yticks([]) plt.show() <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Data Exploration Step2: Implementation Step3: Question 1 Step4: Answer Step5: The heatmap above shows the percentile ranks of samples' category spending. It further helps visualize the amount of spending in each category. This helps us further understand the key categories of spending for each sample. It also confirms that the initial analysis of comparision with the descriptive statistics of the data is correct. Step6: Question 2 Step7: Question 3 Step8: Answer Step9: Observation Step10: Implementation Step11: Question 4 Step12: Question 5 Step13: Implementation Step14: Observation Step15: Question 6 Step16: Question 7 Step17: Implementation Step18: Question 8 Step19: Answer Step20: The heatmap above helps visualize the segments alongside the samples. This helps better understand that the sample 1 exhibits characteristics of segment 1 while sample 2 and 3 look like they belong to segment 0. Step21: Answer
<ASSISTANT_TASK:> Python Code: # Show matplotlib plots inline (nicely formatted in the notebook) %matplotlib inline # Import libraries necessary for this project import numpy as np import pandas as pd import renders as rs import seaborn as sns from matplotlib import pylab as plt from IPython.display import display # Allows the use of display() for DataFrames # Load the wholesale customers dataset try: data = pd.read_csv("customers.csv") data.drop(['Region', 'Channel'], axis = 1, inplace = True) print "Wholesale customers dataset has {} samples with {} features each.".format(*data.shape) except: print "Dataset could not be loaded. Is the dataset missing?" # Display a description of the dataset display(data.describe()) # TODO: Select three indices of your choice you wish to sample from the dataset indices = [13,120,390] # Create a DataFrame of the chosen samples samples = pd.DataFrame(data.loc[indices], columns = data.keys()).reset_index(drop = True) print "Chosen samples of wholesale customers dataset:" display(samples) print "Mean Differences" display(samples - np.round(data.mean())) print "Median Differences" display(samples - np.round(data.median())) # look at percentile ranks pcts = 100. * data.rank(axis=0, pct=True).iloc[indices].round(decimals=3) # visualize percentiles with heatmap sns.heatmap(pcts.reset_index(drop=True), annot=True, vmin=1, vmax=99, fmt='.1f', cmap='YlGnBu') plt.title('Percentile ranks of\nsamples\' category spending') plt.xticks(rotation=45, ha='center'); # TODO: Make a copy of the DataFrame, using the 'drop' function to drop the given feature new_data = data.drop('Fresh',axis=1) # TODO: Split the data into training and testing sets using the given feature as the target from sklearn.cross_validation import train_test_split X_train, X_test, y_train, y_test = train_test_split(new_data,data['Fresh'],test_size=0.25,random_state=42) # TODO: Create a decision tree regressor and fit it to the training set from sklearn.tree import DecisionTreeRegressor regressor = DecisionTreeRegressor(random_state=42) # TODO: Report the score of the prediction using the testing set regressor.fit(X_train,y_train) score = regressor.score(X_test,y_test) print score # Produce a scatter matrix for each pair of features in the data pd.scatter_matrix(data, alpha = 0.3, figsize = (14,8), diagonal = 'kde'); import seaborn as sns import pylab as plt corr = data.corr() mask = np.zeros_like(corr) mask[np.triu_indices_from(mask, 1)] = True with sns.axes_style("white"): ax = sns.heatmap(corr, mask=mask, square=True, annot=True, cmap='RdBu_r') plt.xticks(rotation=45, ha='center'); # TODO: Scale the data using the natural logarithm log_data = np.log(data) # TODO: Scale the sample data using the natural logarithm log_samples = np.log(samples) # Produce a scatter matrix for each pair of newly-transformed features idx_reorder = ['Detergents_Paper', 'Grocery', 'Milk', 'Fresh', 'Frozen', 'Delicatessen'] axes = pd.scatter_matrix(log_data[idx_reorder], alpha = 0.3, figsize = (14,8), diagonal = 'kde') corr = log_data[idx_reorder].corr().as_matrix() for i, j in zip(*plt.np.triu_indices_from(axes, k=1)): axes[i, j].annotate("%+.3f" %corr[i,j], (0.8, 0.2), xycoords='axes fraction', ha='center', va='center',color="red", fontsize=14) # Display the log-transformed sample data display(log_samples) # For each feature find the data points with extreme high or low values for feature in log_data.keys(): # TODO: Calculate Q1 (25th percentile of the data) for the given feature Q1 = np.percentile(log_data[feature],q=25) # TODO: Calculate Q3 (75th percentile of the data) for the given feature Q3 = np.percentile(log_data[feature],q=75) # TODO: Use the interquartile range to calculate an outlier step (1.5 times the interquartile range) step = (Q3-Q1)*1.5 # Display the outliers #print "Data points considered outliers for the feature '{}':".format(feature) #display(log_data[~((log_data[feature] >= Q1 - step) & (log_data[feature] <= Q3 + step))]) # OPTIONAL: Select the indices for data points you wish to remove [66,95,75,109,128,142,187,218,338] outliers = [val for sublist in [log_data[~((log_data[feature] >= np.percentile(log_data[feature],q=25) - ((np.percentile(log_data[feature],q=75) - np.percentile(log_data[feature],q=25))*1.5)) & (log_data[feature] <= np.percentile(log_data[feature],q=75) + ((np.percentile(log_data[feature],q=75) - np.percentile(log_data[feature],q=25))*1.5)))].index.values for feature in log_data.keys()] for val in sublist] outliers = list(set([x for x in outliers if outliers.count(x)>1])) # Remove the outliers, if any were specified good_data = log_data.drop(log_data.index[outliers]).reset_index(drop = True) #visualizing the outliers removed with box-plots. ax = sns.boxplot(data=log_data) ax = sns.swarmplot(data=log_data.iloc[outliers], color="red", size=8) # TODO: Apply PCA to the good data with the same number of dimensions as features from sklearn.decomposition import PCA pca = PCA() pca.fit(good_data) # TODO: Apply a PCA transformation to the sample log-data pca_samples = pca.transform(log_samples) # Generate PCA results plot pca_results = rs.pca_results(good_data, pca) # Display sample log-data after having a PCA transformation applied display(pd.DataFrame(np.round(pca_samples, 4), columns = pca_results.index.values)) # TODO: Fit PCA to the good data using only two dimensions pca = PCA(n_components=2) pca.fit(good_data) # TODO: Apply a PCA transformation the good data reduced_data = pca.transform(good_data) # TODO: Apply a PCA transformation to the sample log-data pca_samples = pca.transform(log_samples) # Create a DataFrame for the reduced data reduced_data = pd.DataFrame(reduced_data, columns = ['Dimension 1', 'Dimension 2']) #implement joint Grid to further understand the categories in the two dimensions g = sns.JointGrid("Dimension 1", "Dimension 2", reduced_data, xlim=(-6,6), ylim=(-5,5)) g = g.plot_joint(sns.kdeplot, cmap="Blues_d") g = g.plot_marginals(sns.kdeplot, shade=True) # Display sample log-data after applying PCA transformation in two dimensions display(pd.DataFrame(np.round(pca_samples, 4), columns = ['Dimension 1', 'Dimension 2'])) # TODO: Apply your clustering algorithm of choice to the reduced data from sklearn.mixture import GMM from sklearn.cluster import KMeans from sklearn.metrics import silhouette_score for i in range (6,1,-1): clusterer = GMM(n_components = i,random_state=42) clusterer.fit(reduced_data) # TODO: Predict the cluster for each data point preds = clusterer.predict(reduced_data) # TODO: Find the cluster centers centers = clusterer.means_ # TODO: Predict the cluster for each transformed sample data point sample_preds = clusterer.predict(pca_samples) # TODO: Calculate the mean silhouette coefficient for the number of clusters chosen score = silhouette_score(reduced_data,preds) print "clusters = {} : score = {:.3f}\n".format(i,score), # Display the results of the clustering from implementation rs.cluster_results(reduced_data, preds, centers, pca_samples) # TODO: Inverse transform the centers log_centers = pca.inverse_transform(centers) # TODO: Exponentiate the centers true_centers = np.exp(log_centers) # Display the true centers segments = ['Segment {}'.format(i) for i in range(0,len(centers))] true_centers = pd.DataFrame(np.round(true_centers), columns = data.keys()) true_centers.index = segments display(true_centers) print "Mean Difference" display(true_centers - np.round(data.mean())) print "Median Differences" display((true_centers - np.round(data.median()))) print "N-stds" display((true_centers - np.round(data.mean()))/data.std()) # add the true centers as rows to our original data newdata = data.append(true_centers) # show the percentiles of the centers ctr_pcts = 100. * newdata.rank(axis=0, pct=True).loc[['Segment 0', 'Segment 1']].round(decimals=3) #print ctr_pcts # visualize percentiles with heatmap and compare to samples (as kept in `pcts` variable) pcts = 100. * data.rank(axis=0, pct=True).iloc[indices].round(decimals=3) _ = sns.heatmap(pcts.append(ctr_pcts), annot=True, cmap='Greens', fmt='.1f') plt.xticks(rotation=45, ha='center') plt.title('Percentile ranks of spending by\nsamples & segment centers'); # Display the predictions for i, pred in enumerate(sample_preds): print "Sample point", i, "predicted to be in Cluster", pred # Display the clustering results based on 'Channel' data rs.channel_results(reduced_data, outliers, pca_samples) <END_TASK>
<SYSTEM_TASK:> Given the following text description, write Python code to implement the functionality described below step by step <END_TASK> <USER_TASK:> Description: Step1: Tools Step2: Reading the instances Step3: Statistical difficulty and average multiplicity Step4: The dispersion of the pagination sizes could have been measured in several other ways, for instance with the standard deviation (below). Step5: Number of instances by statistical difficulty Step6: [Sec. 4.3] Predicting the statistical difficulty of a given instance Step7: [Fig. 5] Number of instances by average multiplicity Step8: [Sec. 4.4] Discussion Step9: [Sec. 4.4.2] Comparison of the heuristic methods Step10: [Fig. 7] Relative quality of the five main heuristics Step11: Exact algorithms vs. heuristics Step12: Hence, the optimal value found by CPLEX may be lesser than this one Step13: It may happen that the upper bound found by CPLEX is less than the best page count found by the heuristics. In this case, we know that there exists a better pagination (although CPLEX cannot prove its optimality) Step14: The column best gives the minimum pagination sizes found by the heuristics and CPLEX (including the upper bound) Step15: Grouping GA vs. the other heuristics
<ASSISTANT_TASK:> Python Code: from collections import OrderedDict INPUT_PATH = "gauss/" (MIN_PREFIX, MAX_PREFIX) = ("C015", "C055") # for instance filenames OUTPUT_PATH = "plots/" WINDOW = 150 # size of the subsets of instances used as a moving window SOLVER_NAMES = OrderedDict([ ("GeneticGroup", "Grouping GA"), ("GeneticStandard", "Standard GA"), ("OverloadAndRemove", "Overload-and-Remove"), ("OverloadAndRemovePresort", "Overload-and-Remove (with presort)"), ("BestFusion", "Best Fusion"), ("FirstFit", "First Fit"), ]) EXCLUDED_SOLVER_NAMES = {"OverloadAndRemovePresort"} # excluded from certain plots solvers = ["solvers" + name for name in SOLVER_NAMES.keys()] times = ["times" + name for name in SOLVER_NAMES.keys()] %matplotlib inline import numpy as np import pandas as pd import matplotlib.pyplot as plt from matplotlib.ticker import Locator np.warnings.filterwarnings("ignore", category=RuntimeWarning) np.warnings.filterwarnings("ignore", category=UserWarning) !pip install seaborn import seaborn as sns sns.set_style("white") sns.set_context("paper", font_scale=2) sns.set_palette(sns.color_palette("Set1", 5)) def plot_linear_regression(x, y): fit = np.polyfit(x, y, deg=1) plt.plot(x, fit[0] * x + fit[1]) correlation = round(x.corr(y), 3) print("Pearson:", correlation) return correlation !pip install pandas --upgrade import os, json df = [] indexes = [] for filename in os.listdir(INPUT_PATH): if not filename.endswith("json") or not MIN_PREFIX <= filename <= MAX_PREFIX: continue with open(os.path.join(INPUT_PATH, filename)) as f: instances = json.loads(f.read()) indexes.extend([(filename, discriminant) for discriminant in range(len(instances))]) for instance in instances: for (k, v) in list(instance.items()): if isinstance(v, dict): # flatten any sub-dict with dot notation for (sub_key, sub_value) in v.items(): instance[k + sub_key] = sub_value del instance[k] df.extend(instances) df = pd.DataFrame(df, index=pd.MultiIndex.from_tuples(indexes, names=("filename", "i"))) df["best"] = df[["pageCount", "cplexOpt", "cplexUB"]].min(axis = 1) # add a column for the best known pagination size df["cardinality"] = df["tiles"].apply(lambda tiles: sum(len(tile) for tile in tiles)) df_sorted_by_multiplicity = df.sort_values(by="avgMultiplicity") # for use with a moving window print(df.info()) df.describe() print("There are a %s instances." % len(df)) x = df[solvers].mean(axis=1) - df["best"] y = df["best"] plt.xlabel("Statistical difficulty") plt.ylabel("Best pagination size") plt.scatter(x, y, marker="o", s=1) _ = plot_linear_regression(x, y) x = df["avgMultiplicity"] y = df[solvers].std(axis=1) axes = plt.gca() axes.set_xlim([0, 70]) plot_linear_regression(x, y) plt.scatter(x, y, marker="o", s=1) plt.xlabel("Average multiplicity") plt.ylabel("Average standard deviation") plt.grid() plt.show() result = df.groupby(round(2 * (df[solvers].mean(axis=1) - df["best"]))/2).size() result.plot(kind="bar") plt.yscale("symlog") plt.xlabel("Statistical difficulty") plt.ylabel("Number of instances (sym-log scale)") plt.show() print("Number of instances per statistical difficulty:\n", result) print("Average statistical difficulty: %.02f" % (df[solvers].mean(axis=1) - df["best"]).mean()) print("Median statistical difficulty: %.02f" % (df[solvers].mean(axis=1) - df["best"]).median()) plt.figure(figsize=(10,5)) x = df["avgMultiplicity"] y = df[solvers].mean(axis=1) - df["best"] axes = plt.gca() axes.set_xlim([0, 70]) axes.set_ylim([-1, 9.5]) plot_linear_regression(x, y) plt.scatter(x, y, marker="o", s=1) plt.xlabel("Average multiplicity") plt.ylabel("Average range (statistical difficulty)") plt.grid() plt.savefig(os.path.join(OUTPUT_PATH, "difficulty_by_multiplicity.pdf"), bbox_inches='tight') plt.figure(figsize=(20, 10)) df["bitSize"] = df["symbolCount"] * df["tileCount"] for (i, column) in enumerate(["symbolCount", "bitSize", "tileCount", "cardinality"], 1): plt.subplot(2, 2, i) x = df[column] y = df[solvers].mean(axis=1) - df["best"] if i in [1, 3]: plt.ylabel("Average range (statistical difficulty)") plt.scatter(x, y, marker="o", s=1) correlation = plot_linear_regression(x, y) plt.xlabel("%s (r = %s)" % (column, correlation)) plt.show() plt.figure(figsize=(10,6)) range_width = 2 ranges = np.arange(1, df["avgMultiplicity"].max() + range_width, range_width) slices = pd.cut(df["avgMultiplicity"], ranges) instances_per_slice = df.groupby(slices).size() instances_per_slice.plot(kind="bar", width=0.9, color="#ffffbf") cplex_instances = df[df["cplexOpt"].notnull() | df["cplexLB"].notnull() | df["cplexUB"].notnull()] cplex_slices = pd.cut(cplex_instances["avgMultiplicity"], ranges) cplex_instances.groupby(cplex_slices).size().plot(kind="bar", width=0.7, color='#abdda4') cplex_solved_instances = df[df["cplexOpt"].notnull()] cplex_solved_slices = pd.cut(cplex_solved_instances["avgMultiplicity"], ranges) cplex_solved_instances.groupby(cplex_solved_slices).size().plot(kind="bar", width=0.5, color="#2b83ba") plt.xlabel("Ranges of average multiplicity") plt.ylabel("Number of instances (sym-log scale)") plt.yscale('symlog') axes = plt.gca() axes.set_ylim(0, 3000) plt.tick_params(axis='x', which='both', bottom='off', top='off') axes.yaxis.grid(True) plt.legend(["All instances", "Submitted to CPLEX", "Solved to optimality by CPLEX"]) plt.savefig(os.path.join(OUTPUT_PATH, "count_by_multiplicity.pdf"), bbox_inches='tight') range_width = 1 ranges = np.arange(1, df["avgMultiplicity"].max() + range_width, range_width) slices = pd.cut(df["avgMultiplicity"], ranges) instances_per_slice = df.groupby(slices).size() for start in (4, 23, 53): n = instances_per_slice[range_width * (start - 1)] print("There are %d instances whose average multiplicity lies between %s and %s." % (n, start, start + range_width)) (a, b) = (1, 9) rate = 100.0 * sum(instances_per_slice[a-1:b-1]) / len(df) print("%0.2f %% of the instances concentrate between average multiplicities %s and %s." % (rate, a, b)) cplex_instances = df[df["cplexOpt"].notnull() | df["cplexLB"].notnull() | df["cplexUB"].notnull()] print("%s instances (%.2f %%) submitted to CPLEX." % (len(cplex_instances), 100.0 * len(cplex_instances)/len(df))) print("CPLEX's success in less than one hour: %s instances (%.1f %%)." % (df["cplexOpt"].count(), 100.0 * df["cplexOpt"].count() / len(cplex_instances))) for above in (13, 20): cplex_instances_above = cplex_instances[df["avgMultiplicity"] > above] print("CPLEX's success in less than one hour above an average multiplicity of %s: %.1f %%." % (above, 100.0 * cplex_instances_above["cplexOpt"].count() / len(cplex_instances_above))) cplex_results = df[df["cplexOpt"].notnull() | df["cplexUB"].notnull()][["cplexOpt","cplexUB","pageCount"]] print("All the %s instances for which CPLEX has found either a solution, either an upper bound:" % len(cplex_results)) cplex_results x = pd.Series.rolling(df_sorted_by_multiplicity["avgMultiplicity"], WINDOW, center=True).mean() plt.figure(figsize=(10,5)) axes = plt.gca() axes.set_xlim([2, 52]) for time in times: solver_name = time[len("times"):] if solver_name in EXCLUDED_SOLVER_NAMES: continue y = pd.Series.rolling(df_sorted_by_multiplicity[time], WINDOW, center=True).mean() plt.plot(x, y, label=SOLVER_NAMES[solver_name]) plt.yscale('log') plt.xlabel("Average multiplicity (rolling mean on %s instances)" % WINDOW) plt.ylabel("Execution time (seconds, log scale)") plt.grid() plt.savefig(os.path.join(OUTPUT_PATH, "speed_by_multiplicity.pdf"), bbox_inches='tight') plt.legend(loc=7) # legend not plotted for the paper version plt.show() contents = [ df[times].min().map('{:,.2f}'.format), df[times].max().map('{:,.2f}'.format), df[times].mean().map('{:,.2f}'.format), df[times].std().map('{:,.2f}'.format) ] digest = pd.DataFrame(contents, index = ["min", "max", "mean", "std"]) digest.columns = SOLVER_NAMES.values() print("Basic aggregations on execution times (in seconds):") digest x = pd.Series.rolling(df_sorted_by_multiplicity["avgMultiplicity"], WINDOW, center=True).mean() plt.figure(figsize=(10,7)) axes = plt.gca() axes.set_xlim([2, 52]) axes.set_ylim([0.74, 1.01]) axes.spines['right'].set_visible(False) axes.spines['top'].set_visible(False) for solver in solvers: solver_name = solver[len("solvers"):] if solver_name in EXCLUDED_SOLVER_NAMES: continue ratio = df_sorted_by_multiplicity["best"] / df_sorted_by_multiplicity[solver] y = pd.Series.rolling(ratio, WINDOW, center=True).mean() plt.plot(x, y, label=SOLVER_NAMES[solver_name]) plt.xlabel("Average multiplicity (rolling mean on %s instances)" % WINDOW) plt.ylabel("Average pagination size vs. best known result") plt.grid() # move the legend to an empty place legend = plt.legend(loc=7) plt.draw() bb = legend.legendPatch.get_bbox().inverse_transformed(axes.transAxes) bb.set_points([[bb.x0 - 0.02, bb.y0 + 0.2], [bb.x1 - 0.02, bb.y1 + 0.2]]) legend.set_bbox_to_anchor(bb) plt.savefig(os.path.join(OUTPUT_PATH, "relative_size_by_multiplicity.pdf"), bbox_inches='tight') assert len(df[df["pageCount"] != df[solvers].min(axis=1)]) == 0 suboptimal_instances_1 = df[df["cplexOpt"] < df["pageCount"]][["cplexOpt", "pageCount"] + solvers] suboptimal_instances_1.columns = ["cplexOpt", "pageCount"] + list(SOLVER_NAMES.values()) print("The optimal solution is better than the best approximation for these %s instances:" % len(suboptimal_instances_1)) suboptimal_instances_1 suboptimal_instances_2 = df[df["cplexUB"] < df["pageCount"]][["cplexUB", "pageCount"] + solvers] suboptimal_instances_2.columns = ["cplexOpt", "pageCount"] + list(SOLVER_NAMES.values()) print("For %s more instances, we know that the best approximation is not optimal:" % len(suboptimal_instances_2)) suboptimal_instances_2 df[df["best"] < df["pageCount"]][["best", "pageCount"]] count = len(suboptimal_instances_1) + len(suboptimal_instances_2) print("All in all, ILP improved on the heuristics in %s cases" % count, end=" ") print("(%.02f %% of the %s selected instances)." % (100.0 * count / len(cplex_instances), len(cplex_instances))) prefix = ["avgMultiplicity", "pageCount"] columns = [ "solversGeneticGroup", "solversGeneticStandard", "solversOverloadAndRemove", "solversOverloadAndRemovePresort" ] bad_gga = df[df["pageCount"] < df["solversGeneticGroup"]][prefix + columns] for column in columns[1:]: bad_gga[column] = bad_gga[column][bad_gga[column] < bad_gga["solversGeneticGroup"]] bad_gga.columns = prefix + [SOLVER_NAMES[column[len("solvers"):]] for column in columns] print("In %.02f %% of the cases," % (100.0 - 100.0 * len(bad_gga) / len(df)),) print("Grouping GA was the best heuristics, except on these %s instances" % len(bad_gga), end=" ") print("(greater values erased for clarity, sorted by increasing average multiplicity).") bad_gga.sort_values(by="avgMultiplicity").fillna("") for column in bad_gga.columns[len(prefix) + 1:]: count = bad_gga[column].count() print("%s produced a better pagination than Grouping GA on %s instances (%.03f %%)." % (column, count, (100.0 * count / len(df)))) <END_TASK>