text stringlengths 3 7.38M | source_data stringclasses 5 values | info stringlengths 83 12.5k |
|---|---|---|
Shaun of the Dead
Shaun of the Dead is a 2004 British horror comedy film directed by Edgar Wright and written by Wright and Simon Pegg, and starring Pegg and Nick Frost. Pegg plays Shaun, a man attempting to get some kind of focus in his life as he deals with his girlfriend, his mother and stepfather. At the same time, he has to cope with an apocalyptic zombie uprising. ... more on Wikipedia | mini_pile | {'original_id': 'db5b0ef584990bbd81f8fb7d9265449b71926bed599f7fa5277f6ffbd5b2545b'} |
in reply to Re: PerlMonks Survivor would be won this season by:
in thread PerlMonks Survivor would be won this season by:
Paco was one of the earliest public (i.e., not a friend or aquaintance of Tim Vroom) users to join up and ask a legitimate question on Perlmonks. The question pertained to visiting a directory structure recursively.
The answer back in those days was to use File::Find. These days, the answer would probably tend more towards File::Find::Rule or File::Finder, depending on what you wanted to do. They certainly have nicer interfaces. Funny what a difference a few years makes.
Paco sprang to prominence a few years later when Ovid ran a "Vote for Paco!" sig for a while. After the Paco node threatened to take the lead in the Best Nodes thread, demerphq rewrote the best nodes stuff to present a random selection of culled best nodes. We never saw Paco again.
Antivroom. Back in the old days, we made a big fuss about when the site hit 1e5, or 100 000 nodes. Bets were laid. Fortunes were made and lost. I had a question I wanted to ask at about the time of the 99999 rollover, about installing Math::Pari. In my youthful foolishness, I tried to claim the spot.
Of course, I should have known better. Antivroom scored node 100000. I had to settle for node 100001. I suppose this means that I am crunchy and taste good with ketchup.
Which is why it pleases me no end that at the time I write these lines, I am the only voter for antivroom. It makes for a certain sense of closure.
- another intruder with the mooring in the heart of the Perl | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.9674890637397766}", 'metadata': "{'Content-Length': '3372', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:VCGDHPCNCNVXLRZHMW7424A4UBEQDQCT', 'WARC-Concurrent-To': '<urn:uuid:8323857b-53cf-4610-b7e0-82db1de49ab0>', 'WARC-Date': datetime.datetime(2019, 2, 16, 20, 29, 6), 'WARC-IP-Address': '216.92.34.251', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:BNTSQKJAEPUBU5WZCJGGG5QHHMTV6LCN', 'WARC-Record-ID': '<urn:uuid:6c5434e8-4d78-4bdc-97a3-cf1e40ba227d>', 'WARC-Target-URI': 'https://www.perlmonks.org/?displaytype=print;node_id=477376', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4f410764-1dab-49cf-9230-aa11ba16fde4>', 'WARC-Truncated': None}", 'previous_word_count': '281', 'url': 'https://www.perlmonks.org/?displaytype=print;node_id=477376', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-142-55-37.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02244746685028076', 'original_id': '0e90922cf44f64abe245fef64ae1bded29475510470ab8fa9528e31512b4633b'} |
How did you sleep last night? Revisited.
"Continuous effort - not strength nor intelligence - is the key to unlocking our potential."
–Winston Churchill
Several months ago I asked you how you slept the night before. Granted, the question was rhetorical since I didn't expect an actual answer. However, I did have an answer. It went something like this,
"I slept like a baby. 9 hours." Well, that was then, this is now. For the past month, I haven't slept more than 6 hours/night. And you say, "What?? The Coach isn't sleeping?"
Here's my take on it. We all run into rough times in life. Maybe your sleep is off. Maybe you're not eating as well as you once were. Maybe you just don't have the drive to exercise like you used to. Whatever it happens. Where we run into trouble is when we stop caring, stop trying and sink down deeper. As Winston Churchill says above, continuous effort is the key to unlocking your potential.
For me, that means I'm not satisfied with my sleep and I'm making every effort to correct it. Doing nothing just isn't an option. In other words, I'm not going to take this lying down (pun intended!). As I stand back and look at my sleep habits over the past month I realize the following:
I have been going to bed later.
I have been going to bed hungry.
I have been watching TV before bed.
Continuous effort means that I see these things and I do something about them. Moving forward, I will be in bed between 9-9:30 pm, I'll eat a larger dinner and the TV goes off at 8 pm.
Where do you need to apply continuous effort? Good health doesn't just happen. Take a look at your life, make a plan and set it into motion one small step at a time.
Not sure where to start? Summer is a great time to set up your Free Health Consultation with me. Visit my website at, give me a call, 309-825-0424 or send me an email, I'll find a spot for you!
In the ring! Renee | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9779404401779176}", 'metadata': "{'Content-Length': '34178', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BB25P43IPHJKQ7FLNGFFSE76RPQVOX43', 'WARC-Concurrent-To': '<urn:uuid:305e1745-d6af-4a4c-b791-fdbb99c00f11>', 'WARC-Date': datetime.datetime(2019, 3, 23, 0, 12, 58), 'WARC-IP-Address': '198.185.159.145', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:CEM6DYKXJOOV7Y4LGXWXSZSV5EJ5ZMBO', 'WARC-Record-ID': '<urn:uuid:1210094f-b189-4576-be97-0c6c308f92c4>', 'WARC-Target-URI': 'http://www.yourfoodfight.com/blog/2018/7/10/how-did-you-sleep-last-night-revisited', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ab686526-42a2-4e44-a3e5-8e37f77c95fb>', 'WARC-Truncated': None}", 'previous_word_count': '348', 'url': 'http://www.yourfoodfight.com/blog/2018/7/10/how-did-you-sleep-last-night-revisited', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-13-253-122.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.21916544437408447', 'original_id': 'f2f39b4066d4b27b1feb61cc7b558384d0cac4fbc59408a5692c07ec21acead6'} |
Hawai'i Pineapple Co. operates a farm on the Big Island, but most of its production comes from a partnership with Aloun Farm, in Kunia.
Aloun Farms
Pineapple pickers on Lana'i, once the world's largest pineapple plantation operated by Dole Food.
ADVERTISER LIBRARY PHOTO | Sept. 5, 1990
2006: Del Monte Fresh Produce left the Hawai‘i market in 2006.
1993: Dole tears down its pineapple water tower after closing the cannery in '92.
1983: Del Monte ceases Hawai'i pineapple canning operations.
1968: Canning on Lana'i. Pineapple production starting to slow.
Pineapple farming in Hawai'i declined sharply in the past few years at the hands of two agribusiness industry giants, but increasing numbers of small farmers see sweet opportunity in the crop long associated with the Isles.
"Call us crazy, but let's hope we're crazy like a fox — not crazy crazy," said Craig Bowden, a farm industry veteran who partnered to start two local pineapple farm ventures three years ago and has rapidly expanded.
Bowden was one of 42 pineapple growers in the state in 2007, up from 34 in 2002 and 27 in 1997, according to the three most recent farm census reports from the U.S. Department of Agriculture.
The rise in pineapple farming involves mostly small farms, so the crop isn't about to reclaim its crown as king of Hawai'i agriculture — a title lost in 2006 to seed crops.
But the niche growth for pineapple is helping maintain agriculture's roots in Hawai'i and counters a perception for some that pineapple farming is dying out in the state.
"It's part of Hawai'i," said Mark Hudson, statistician for the state Department of Agriculture.
Plantation-scale pineapple farming in Hawai'i has suffered over several decades from competition largely from Central America and Asia where land and labor costs are cheaper. Hawai'i's pineapple production by acreage actually peaked in 1955, though the value of annual pineapple sales topped out in 1991 at $108 million.
CUTBACKS SEEN
The most recent pullbacks involved Del Monte Fresh Produce leaving the local market in 2006, and a cutback last year by Maui Land & Pineapple Co. from roughly 2,000 acres to 1,000 acres. Dole Food Co. reduced its local pineapple business in 2006 from 3,100 acres to 2,700, and remains the biggest grower in the state.
Matthew Loke, agriculture development division administrator with the state Department of Agriculture, said Hawai'i farms still supply 100 percent of pineapple for local consumption, but the changes by big producers have created opportunity for more small farmers, especially organic producers and growers of special varieties.
New growth in local pineapple farming has mostly involved very small farms, according to census figures. On the Big Island, 19 pineapple farms averaged one acre in size. On Kaua'i, 16 acres of pineapple were spread over 13 farms.
Those in the industry suspect that some of the small farms counted in the census don't produce fresh fruit for commercial sale, or may only sell at farmers markets.
Bowden is one of the biggest, if not the biggest, among the new crop of Hawai'i pineapple farmers. A graduate of Kalani High School and former manager with Del Monte who worked in the Philippines, Hawai'i and Florida, Bowden partnered with fellow Kalani alumnus and crop research specialist Tom Menezes to start Hawai'i Pineapple Co. LLC in 2006 and produce fruit under a brand named Hawaiian Crown.
The company started with a few acres of its own pineapple variety sold in Times Super Market, and has since dramatically expanded by tens of acres and added more retail outlets including Foodland Super Market, KTA Super Stores and military commissaries.
GROWTH ON BIG ISLAND
Hawai'i Pineapple Co. operates a farm on the Big Island, but most of its production comes from a partnership with large diversified crop grower Aloun Farm in Kunia on O'ahu.
Bowden said 99 percent of Hawaiian Crown pineapple is sold locally in stores typically for $1.59 to $1.79 a pound, with a few exports to places such as California, Las Vegas and even Dubai.
Bowden said plans are in the works to partner with two more existing farms on O'ahu and the Big Island that would double the size of the business.
On a smaller scale, Sweet Spirit Farms on the Big Island incorporated pineapple farming with a Kona coffee farm started in 2004 by Deb and Paul Sims after they moved to Hawai'i from the Mainland in 2003.
Deb Sims said they started planting crowns from white pineapple they bought to eat, and two years ago had accumulated enough plants to begin selling regularly at the local farmers market where the fruit typically sells for $3 a pound.
"They're easy to grow," she said. "They don't need a lot of care."
Sweet Spirit, which has about 3,600 coffee trees, has about 250 pineapple plants on one-fourth an acre, and Sims said she and her husband intend to plant more. "The supply I don't think meets the demand," she said.
Other small pineapple farmers include Phil Green, who grows organic pineapples on Kaua'i at Kaua'i Organic Farms, and James Bunten and Sharon Umbaugh of Bunten Farms who grow white pineapples on the Big Island.
The growth among small pineapple farmers, however, doesn't mean the business is easy or a sure thing. Small farmers have left the business in recent years, a reminder that farming is inherently tough with its exposure to inclement weather, pests and other factors that are hard to control.
PERSONAL PRODUCTION
On Lana'i — once the world's largest pineapple plantation operated by Dole Food — only one commercial farmer is believed to be growing pineapple, but the plants aren't for commercial production.
Alberta De Jetley farms 18 acres planted in a variety of crops, including lettuce and bananas, sold to the island's two resorts and other local businesses. De Jetley said she first planted pineapple for fun about 18 months ago with about 20 plants, and has since more than doubled plantings of crowns she receives from a hotel bakery.
Still, De Jetley, who once contemplated asking Dole for propagation material for 200 plants, intends to keep her pineapple harvests small for sharing with friends and making what she said is a fantastic fruit salad. | mini_pile | {'original_id': 'dcce3fda199606a0ca94b5e8644e23948cc33326daf01f2dcf955d619f8510b3'} |
Now that the solenoids are mounted to the action, it's time to actually attach them to the keys.
Sounds simple? Well it really isn't... we have to attach the solenoids to the keys so there isn't any play between the keys and the solenoid. Any play will result in noise from metal clinking on metal, as well as inconsistency between keys in terms of how them feel when manually played. Remember, we want to reduce our impact on the action as much as possible.
I devised a good way of attaching the keys. Look at the pictures; they will describe how I did this better than I can with words.
White Keys:
First, you drill two holes in each key: one up around halfway into the key, and another from the left side of the key around halfway into the key. These two holes result in an internal L shape inside the key. See above image.
Now you can bend pieces of wire into an L to attach to the keys. Just bend an L and stick it in! Note that you may have to widen the holes to get the wire in place.
Next you cut a short piece of wire (around 1/2") for each solenoid and insert it through the clevis as a pin. Then wrap it around to make an L, and you now have a pin in that solenoid's clevis.
Now put the key back on the key frame, and line it up so the wire is where it should be (going straight down to the solenoid with the pin through it). Mark where the wire coming down from the solenoid passes by the pin. Bend the wire just slightly below that point so it points out from the front of the keyboard.
Now place it so the wire is in the solenoid's clevis and its bend is directly under the "pin" we made with the piece of wire. Pull the key off again. While holding the solenoid plunger so it points around 30º back from straight down, bend the solenoid wire down over the front of the loop of wire we made that goes through the solenoid's clevis.
Pull the solenoid forward so it faces straight down. If you pull it too far, though, you will create play in this mechanism. This is something we want to avoid. If you don't pull it far enough, the solenoid plunger will have too much friction inside the solenoid and that key will get stuck. We also want to avoid this. So you need to bend the solenoid plunger such that it is in this sweet spot.
Black Keys
The process is essentially the same for the black keys, except the piece of wire is longer and attaches to the popsicle stick different than to the white keys. Look at the photos above to see how it is attached to the popsicle sticks. They are very self-explanatory.
One thing to point out for the black keys is that you can adjust how tight the solenoid plunger fits by bending the key pulling wire forward or back. This is nice because you can do this without taking the plunger out, unlike the white keys. | mini_pile | {'original_id': '860467d8db80a14016868c209a5be3a9dd0d3e73126097101e9a8cee17ca887c'} |
Do you see the wind?
When it is windy, Honorable Shamans and Fellow Pagans, do you see it? What do you experience, when it is windy? If I’m indoors, I see the effects of wind: I see the flags flapping, and I see the tree branches and leaves whipping. A leaf or two may roll by, like a small tumbleweed. But that is not the wind, itself, just a manifestation of the wind.20160321_102639
If I go outside, I can hear the wind, whistling through the tree branches or leaves. (Am I hearing the wind, or the tree, reacting to the wind?) While outside, I can feel the wind hitting my face, my arms, and wherever it hits.
And, while outside, I notice that which direction the wind is coming from. And I note, this is a cold wind, bringing cold air and temperatures down from other parts of the country.
When I talk about the local seasons, our local wheel of the year, I must remember that a marker of Fire Season, is Wind.
How do you see the wind?
Share your Peace with Our Earth.
(c) 2016 Whale Maiden | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9125986695289612}", 'metadata': "{'Content-Length': '64555', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6YYDC7BHJ3GDDPEQ2B7EQXB7GDLE6E2E', 'WARC-Concurrent-To': '<urn:uuid:482bc07c-ecf1-4773-8106-073877b84a74>', 'WARC-Date': datetime.datetime(2018, 9, 23, 6, 22), 'WARC-IP-Address': '192.0.78.13', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DMSMIRZ2VZRDCFMWUCJGCRRV7U5IOTFT', 'WARC-Record-ID': '<urn:uuid:7db3e29d-9560-49f7-b936-04315f32c326>', 'WARC-Target-URI': 'https://whalemaidensuburbanshaman.wordpress.com/tag/wind/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:26e658a5-3416-4843-8406-8ceeb753af93>', 'WARC-Truncated': None}", 'previous_word_count': '188', 'url': 'https://whalemaidensuburbanshaman.wordpress.com/tag/wind/', 'warcinfo': 'isPartOf: CC-MAIN-2018-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-111-168-72.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0404355525970459', 'original_id': '008231b6c38684ba5f1a02c11e12b7410c265123c2adb84ed075c4e806547e78'} |
Why You Need a Paved Driveway for Your Residence
Why You Need a Paved Driveway for Your Residence
Why You Need a Paved Driveway for Your Residence
Are you wondering whether it's time for you to pave your driveway at your home? When you are tired of parking your car on gravel or stone, you will likely be craving a chance to have a nice, sleeked paved surface. Paved driveways come in a range of styles using different materials to meet your budget, but they all offer the same benefits. As experts in paving in Orlando, we provide consultations and installation to residences in the community. There are a few reasons why you should pave your driveway with asphalt this year.
Increase the Value of Your Home
When you pave the exterior surfaces around your home, you also add value to the residence. If you ever choose to sell your home, this equity will be factored in when your home is appraised for resale value. Not only is paving something that you can enjoy, but it is also a worthwhile investment.
Provides a Sleek Look
Asphalt driveways are a rich and deep black coloring that never fades away. This makes it a great choice for Texas homes because it will never fade no matter how much sun exposure it has. Asphalt driveways typically match any home color or style, which makes it a great addition to any outdoor space. It also helps to add curb appeal and add value to the home.
Offers Low Maintenace
Asphalt is a very popular choice with our homeowners simply because it is easy to clean and maintain throughout its lifespan. Asphalt can simply be hosed off or swept off when it is dirty. Driveways often see lots of exposure to the elements, especially if you leave your cars parked outside on its surface. When chemicals spill or dirt and debris clutter your driveway, you can easily hose or sweep the surface.
Has Flexible Options
Asphalt is a very flexible but also durable substance. This means that it requires a lot of wear and tear to ever crack. It will also hold a lot of weight, which is critical for a driveway surface. Concrete, on the other hand, may crack easily or see damage from exposure to the elements when it is not properly treated.
Lasts a Long Time
Asphalt driveways typically at least fifteen years. They can even last as long as twenty years with the proper maintenance and care. Just like anything else, when you take better care of it, it will last even longer. Even though concrete driveways can last even longer, they will frequently require repairs to keep up their appearance. Asphalt will continue looking deep rich in color throughout its entire life.
Meets a Range of Budgets
Asphalt driveways are cheaper to install than a concrete driveway. They are also easy to install. Although it is more expensive than a gravel driveway, it is half the cost of a concrete driveway. When you are looking to have your driveway paved in order to create a smooth surface for your home, you should consider the more affordable option of asphalt.
These are just a few of the benefits of having an asphalt driveway when you live in Orlando. Contact our experts in paving in Orlando to get your free estimate today. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '6', 'language_id_whole_page_fasttext': "{'en': 0.9275063276290894}", 'metadata': "{'Content-Length': '14345', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CTF72UGYUTLQUM7EJNXVZJT6OME75HAH', 'WARC-Concurrent-To': '<urn:uuid:f33fa667-4bb3-4864-ac48-620315b5585f>', 'WARC-Date': datetime.datetime(2021, 4, 21, 2, 46, 46), 'WARC-IP-Address': '64.202.190.196', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:YHDCJKLFCMGOPHKRQGHMRTZFWPBDU4S2', 'WARC-Record-ID': '<urn:uuid:c5a86d7b-8677-481d-99df-ca4e69d580b8>', 'WARC-Target-URI': 'https://www.floridasealcoating.com/blog/2020/why-you-need-a-paved-driveway-for-your-residence.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:5fed5ade-62ba-455b-b817-f2a5f325e4c2>', 'WARC-Truncated': None}", 'previous_word_count': '573', 'url': 'https://www.floridasealcoating.com/blog/2020/why-you-need-a-paved-driveway-for-your-residence.html', 'warcinfo': 'isPartOf: CC-MAIN-2021-17\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-190.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.026943087577819824', 'original_id': '2958cd523dc4f940d23b499fcc3b5978ce4f5775af128b0acf5a7a93e9b797cf'} |
Alps imagines the car dashboard of the future
Alps dashboard (1)
Martyn Williams
When you sit in the car of the future, you won't need to worry about keys or adjusting your seat and you'll even get a quick health check when you sit in the driver's seat.
At least, that's the dream of Japan's Alps Electric. The company has built a futuristic dashboard and a driver cabin that's packed with the company's sensor technology and realizes these features. It's on show this week at the Ceatec expo in Japan.
Alps dashboard (3)Martyn Williams
The keys are gone because the car features a facial recognition system. If the driver isn't registered to use the car it won't start. And don't think about drinking while sick. A line of sensors checks basic vital signs, such as heart rate, and won't let the car start if it judges the driver isn't fit enough to drive safely.
An NFC (near-field communication) sensor in the dashboard provides a path between the car's IT system and a smartphone, which in turn connects to the Internet. If the driver needs to adjust any controls on the cell phone while driving, all that's required is a wave of the hand. A gesture recognition system means drivers don't have to use the phone's screen while driving -- something that's illegal in many countries.
Alps dashboard (4)Martyn Williams
Face recognition.
When in motion, the same facial recognition system keeps watch on drivers to ensure they remain looking ahead while in control of the vehicle.
The demonstration is designed to highlight Alps' sensors, but many of the same technologies are already being developed by automobile makers. Cars have gotten much more high-tech in the last few years as safety and entertainment systems become an increasingly important part of vehicles.
Shop Tech Products at Amazon | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9539307951927184}", 'metadata': "{'Content-Length': '111723', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:S3A2LNHKEBQG67GEWYRB54ELFAXY5JEP', 'WARC-Concurrent-To': '<urn:uuid:e01d346d-9c30-462a-89d2-ed22448edab9>', 'WARC-Date': datetime.datetime(2018, 10, 17, 1, 22, 41), 'WARC-IP-Address': '151.101.202.165', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:T7J7U62KRHKINWQYENTQR2SNXH5GDKV5', 'WARC-Record-ID': '<urn:uuid:7af4a7c9-29c5-47c5-9f69-b824a1a1f1b5>', 'WARC-Target-URI': 'https://www.pcworld.com/article/2050980/alps-imagines-the-car-dashboard-of-the-future.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4054a149-2ae9-464c-b17f-368fc98854e8>', 'WARC-Truncated': None}", 'previous_word_count': '317', 'url': 'https://www.pcworld.com/article/2050980/alps-imagines-the-car-dashboard-of-the-future.html', 'warcinfo': 'isPartOf: CC-MAIN-2018-43\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for October 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-69-127-157.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.1530798077583313', 'original_id': 'e390ab46634e8e65cafa9f1f4f3f85e321da3c05e9cf35154295c40b699695a7'} |
Illinois Population 2013
December, 6th 2013
Illinois is one of the slowest growing states in the US. Between 2000 and 2010, the population of Illinois grew by a mere 3.3%, compared to a national average US population growth of 9.7%.
Illinois Population 2013
Did you know?
Illinois is only the 24th largest state, but it has the 5th largest population in the US with the 3rd largest city.
The population of Illinois in 2013 is 12,897,625, making Illinois the fifth largest state in the USA. This is based on a growth rate of 0.17%, which ranks 44th. You can explore more about the latest Illinois population data using the interactive tool below, or scroll down for more information.
Illinois Population Growth
In Illinois' cities, population growth has stalled. Chicago was, for much of its early history, one of America's fastest growing cities. Between 1850 and 1930, the city grew by at least 25% each decade, and in some decades it doubled or even tripled in size. However, from the 1960s onwards, Chicago has been steadily shrinking and a city which was home to 3.5 million people in 1960 is home to just 2.7 million today.
The problem is widespread throughout Illinois, and if you look at the interactive map at the top of this article, you'll see that the number of people living in in most of the State's counties fell between 2000 and 2010 (the slightly peachy colour). Despite this, some counties (marked in dark blue) have seen rapid growth, sometimes upwards of 25% in the past decade, and it's this that has resulted in the state's overall growth figures.
Chicago, Largest City in Illinois
As you can see from the map above, most of the Illinois population is based in the North East of the state. Chicago, home to 2,695,598 people, remains the largest city in Illinois. It dwarfs the state's other cities – the next largest is Aurora, with 197,899 people.
This marks one of Illinois’ defining features – although it has a large urban population, it is spread through a number of smaller cities. Including Chicago, there are twelve cities with more than 75,000 people.
Many of these smaller cities make up a part of the Chicago Metropolitan Area (prosaically also known as Chicagoland), which holds between 8.3 and 9.8 million people, depending on how you classify its boundaries.
Cook County is the largest county in Illinois. It holds 5,194,675 people. The next largest county is neighboring Dupage, with 916,924 people. Almost half of the Illinois Population 2012 can be found in just those two counties.
Illinois Population by Race
In responding to the 2010 Census, 71.5% of the people of Illinois declared themselves to be white alone. 14.5% were black or African American, and 4.6% Asian. 83.7% declared themselves to be non-Hispanic or Latino and 16.3% declared that they were Hispanic or Latino.
Illinois Population Chart | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9614160656929016}", 'metadata': "{'Content-Length': '16031', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:73FDVTIFGQJEFRAE3JZPXNSP24SJAR72', 'WARC-Concurrent-To': '<urn:uuid:8add51b4-7ce9-491a-b697-e13707d3157b>', 'WARC-Date': datetime.datetime(2013, 12, 12, 7, 47, 25), 'WARC-IP-Address': '176.32.100.193', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:T3GXMZ3N5UGMTACFGURKKAH2KTG7S56C', 'WARC-Record-ID': '<urn:uuid:9546c6b2-b36d-47fb-9f37-8819207afeb7>', 'WARC-Target-URI': 'http://worldpopulationreview.com/states/illinois-population/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1fc764f1-049a-48f3-8b66-6fbdcb92817b>', 'WARC-Truncated': None}", 'previous_word_count': '476', 'url': 'http://worldpopulationreview.com/states/illinois-population/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.048142075538635254', 'original_id': 'c5691c391ae57b11685b95c441411901e05bcb524c1b51e5796258e6ff4b6c89'} |
Coding Standards
Submissions to the James project must follow the coding conventions outlined in this document. James developers are asked to follow coding conventions already present in the code. (For example, if the existing code has the bracket on the same line as the if statement, then all subsequent code should also follow that convention.) Anything not explicitly mentioned in this document should adhere to the official Sun Java Coding Conventions.
Developers who commit code that does not follow the coding conventions outlined in this document will be responsible for fixing their own code.
1. Spaces between parentheses are optional. The preference is to exclude extra spaces. Both of these conventions are acceptable:
if (foo)
if ( foo )
2. Four spaces. NO tabs. Period. The James mailing list receives cvs commit messages that are almost impossible to read if tabs are used.
In Emacs-speak, this translates to the following command: (setq-default tab-width 4 indent-tabs-mode nil)
3. Use Unix linefeeds for all .java source code files. Only platform-specific files (e.g. .bat files for Windows) should contain non-Unix linefeeds.
4. Javadoc must exist on all methods. Contributing a missing javadoc for any method, class, variable, etc., will be GREATLY appreciated as this will help to improve the James project.
5. The Jakarta Apache/James License MUST be placed at the top of every file. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '3', 'language_id_whole_page_fasttext': "{'en': 0.8376257419586182}", 'metadata': "{'Content-Length': '7016', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:XVZQEOG4XMJXTTBB7NI75CW22HSNOFTW', 'WARC-Concurrent-To': '<urn:uuid:1d408701-0a09-42a9-bd8c-d1416b5b7795>', 'WARC-Date': datetime.datetime(2014, 4, 18, 0, 48, 13), 'WARC-IP-Address': '140.211.11.131', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:2IV5NDY3X5QJKKMQOPC5477CNHGCIBKM', 'WARC-Record-ID': '<urn:uuid:2fbec535-3200-4e21-8ff7-b4df28da92f8>', 'WARC-Target-URI': 'http://james.apache.org/code-standards.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2efbc610-8a8a-43b5-a9cd-e8503010b892>', 'WARC-Truncated': None}", 'previous_word_count': '215', 'url': 'http://james.apache.org/code-standards.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-147-4-33.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-15\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for April 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0888446569442749', 'original_id': 'ad93fc399d763742a7aeb7be333d2d918cda39bf243a2742ca56dfcf86972909'} |
Computer and Web Ethics
Only available on StudyMode
• Download(s) : 264
• Published : August 15, 2011
Open Document
Text Preview
With the freedom of the computer has come a multitude of new ethical issues. Computer ethics is a set of moral principles that systematize the use of computers and supervise the behavior of a group or individual. This essay will tell how computer ethics came about. We will discuss the “Ten Commandments of Computer Ethics.” Having the use of a computer for business, academic, or just for social reasons entitles you to know and follow these ethics. Do you apply computer ethics when spending time on the internet? At the end of this essay ask yourself this question again and give an honest answer. If your answer is no then correct the issue and apply them now. Ethics in computing are social-justice issues, commerce, computer abuse, speech issues, intellectual property, basics, privacy, and risks. We will discuss each of these issues in this essay. By the end of this essay you will have the knowledge of computer and web ethics to apply to your daily use of a computer. The Ten Commandments of Computer Ethics were created in 1992 by the Computer Ethics Institute. The commandments were introduced in the paper "In Pursuit of a 'Ten Commandments' for Computer Ethics" by Ramon C. Barquin as a means to create "a set of standards to guide and instruct people in the ethical use of computers (Fitzpatrick, Carolyn Bronstein 2006)." The Ten Commandments of Computer Ethics
2. Thou shalt not interfere with other people's computer work. 3. Thou shalt not snoop around in other people's computer files. 4. Thou shalt not use a computer to steal.
6. Thou shalt not copy or use proprietary software for which you have not paid. 7. Thou shalt not use other people's computer resources without authorization or proper compensation. 8. Thou shalt not appropriate other people's intellectual output. 9. Thou shalt think about the social consequences of the program you are writing or the system you are designing. 10. Thou shalt always use a computer in ways that ensure consideration and respect for your fellow humans.
The “Ten Commandments of Computer Ethics” cover many concerns of ethics in the technology world today. It covers plagiarism, hacking, identity theft, and social standards. These issues are in the work place, academic areas, and the social network. If people would follow the “Ten Commandments of Computer Ethics” it would be a start in the fight against ethical problems in the world of computer technology.
Computer ethics begin long ago with the invention of computers. MIT professor Norbert Wiener, during WWII in the early 1940s, recognized the consideration of computer ethics. Wiener helped to develop an anti-aircraft cannon with the capability of shooting down fast warplanes. Cybernetics, the science of information feedback systems, was soon created by Wiener and his colleagues. In 1950, Wiener published The Human Use of Human Beings, which described a comprehensive foundation that is still the basis for computer ethics research and analysis (Rebecca Harold, 2006). Donn B. Parker published “Rules of Ethics in Information Processing” in Communications of the ACM in 1968. Parker headed the first code of Professional Conduct for the Association for Computing Machinery which was adopted by the ACM in 1973 (Rebecca Harold, 2006). In 1978, Maner published the Starter Kit in Computer Ethics, which contained curriculum materials and advice for developing computer ethics courses. Many university courses were put in place because of Maner's work (Rebecca Harold, 2006). These were just the beginning of the concept of computer ethics. Today the field has grown in different ways and has developed over time. Growing up parents taught their children at a young age morals and ethics at the top of this list is manors. Manors consist of being polite to others and using appropriate language. Ethics were taught as the children...
tracking img | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '30', 'language_id_whole_page_fasttext': "{'en': 0.935888946056366}", 'metadata': "{'Content-Length': '77547', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5YEUOCARQ54CKL3FCPHQLYSDC47F3NXJ', 'WARC-Concurrent-To': '<urn:uuid:3a907260-5c88-424b-b344-8adce73bff34>', 'WARC-Date': datetime.datetime(2017, 9, 20, 6, 6, 39), 'WARC-IP-Address': '64.30.136.226', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:EGUFYGUHGWCTVM2HV3MBKSWSAYGVGJXF', 'WARC-Record-ID': '<urn:uuid:9ed812f9-990f-4e9b-b3d4-e500731a8f49>', 'WARC-Target-URI': 'http://www.studymode.com/essays/Computer-And-Web-Ethics-758008.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ea7a1619-e48a-4a82-a0dc-de3b68eaf7a1>', 'WARC-Truncated': None}", 'previous_word_count': '660', 'url': 'http://www.studymode.com/essays/Computer-And-Web-Ethics-758008.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-181-87-197.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03366267681121826', 'original_id': '62d292d95e96134ffe9bf95591c8b1d05cec62fe0329f535468f610a46a88a8e'} |
Tom Ramcigam (magicmarmot) wrote,
Tom Ramcigam
1. convergence score: 9
2. algorithms score: 8
3. lisp score: 7
4. casting score: 6
5. neural networks score: 6
6. compilers score: 6
7. prolog score: 6
8. free software score: 6
9. science fiction conventions score: 5
10. graph theory score: 5
11. machine learning score: 5
12. complexity theory score: 5
13. programming languages score: 5
14. rick baker score: 4
15. creative people score: 4
16. creature effects score: 4
17. autobiographies score: 4
18. distributed computing score: 4
19. memetics score: 4
20. fetish clothing score: 4
Popularity Ceiling: (Please be patient!)
changed by ouwiyaru based on code by ixwin
Find out more
Really, I find this tremendously interesting.
Convergence is easy. But I'm a bit surprised at all of the CompSci oriented ones-- it's pretty dang accurate. And fetish clothing... not on me particularly, but sure...
• Post a new comment
default userpic
Your reply will be screened
Your IP address will be recorded
You must follow the Privacy Policy and Google Terms of use. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '16', 'language_id_whole_page_fasttext': "{'en': 0.8244311213493347}", 'metadata': "{'Content-Length': '344926', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6SPOCUMUXC6MJQHQ2JPFT4D5HAY55ML3', 'WARC-Concurrent-To': '<urn:uuid:e039cd01-7e04-473e-8167-bc8b4a9a1249>', 'WARC-Date': datetime.datetime(2020, 10, 21, 2, 34, 21), 'WARC-IP-Address': '13.88.179.33', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:Y7TJL6UXBPYINF2Z3Z2UDIWK4JL7KGHN', 'WARC-Record-ID': '<urn:uuid:8116b35e-b555-4c18-911b-138742fcd705>', 'WARC-Target-URI': 'https://magicmarmot.livejournal.com/625617.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8034dd60-07fd-41a1-8cbb-9a111790fd5e>', 'WARC-Truncated': None}", 'previous_word_count': '229', 'url': 'https://magicmarmot.livejournal.com/625617.html', 'warcinfo': 'isPartOf: CC-MAIN-2020-45\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for October 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-32.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.34771209955215454', 'original_id': '7aa5f9ecc947bc2bd7bde96309862bbf11a2fbb97d6c433cdeed2b596cd58958'} |
Newborn Reflexes for the NCLEX
When you sit your NCLEX, a large part of the Health and Promotion category will involve questions on Labor and delivery, and the newborn child. For the most part, this isn’t too bad. The principals of infection, hemorrhage, pain and diabetes, for example, are the same for every client.
However, there are always some specialty specific questions, and newborn reflexes is one of them. You’re almost guaranteed at least one question on reflexes in the neonate when you sit your test, so put aside half an hour or more of your study time to review these, and refresh what you’ve already learnt.
Root reflex
reflexrootWhat happens – when the corner of a baby’s mouth is touched, the baby’s reflex is to turn his head towards it, and open his mouth.
The purpose – this reflex helps the baby to find the breast or bottle to begin feeding.
It disappears – at about 2 or 3 months old, although for some infants, this reflex may stay until as old as 12 months old.
Suck reflex
reflexsuckWhat happens – this reflex is stimulated once the roof of a baby’s mouth is touched, prompting the baby to begin sucking.
The purpose – in combination with the rooting reflex, the sucking reflex ensures a baby instinctually knows how to feed. It is coordinated with breathing and swallowing, and this coordination improves over time.
It disappears – by 4 months old sucking becomes a voluntary activity rather than a reflex.
Moro reflex
reflexmoroWhat happens – when a baby is startled by a loud sound, he will throw back his head, and extend his arms and legs.
The purpose – the Moro reflex is also known as the startle reflex, but it doesn’t have a clear explanation as a survival tactic.
It disappears – at around 6 months old.
Tonic neck reflex
reflextonicneckWhat happens – when a baby’s head turns to one side, the arm on that side extends while the opposite arm bends.
The purpose – researchers believe this reflex to be a precursor to the hand-eye coordination
It disappears – by six months old. If this reflex doesn’t disappear or worsens after 6 months old, it’s often a sign of developmental delays such as, for example, cerebral palsy.
Grasp reflex
reflexgraspWhat happens – touching or stroking the palm of a baby’s hand causes the baby to close his fingers in a tight grasp.
The purpose – the pressure stimulation of the palmar tendons ensured that a baby could ‘hold on’ to its mother at an earlier time when newborns were carried everywhere with their mother.
It disappears – by about 5 or 6 months old, becoming a voluntary action instead.
Babinski reflex
reflexbabinskyWhat happens – similar to the grasp reflex, Babinski reflex, also known as the plantar reflex, occurs when the sole of a baby’s foot is stroked firmly from the heel to the toes. This causes dorsiflexion of the foot with the big toe bending up and back while the other toes fan out.
The purpose – this reflex prepares the infant for walking and protecting the foot from damage (such as stepping on a sharp object).
It disappears – by 2 years old. A positive plantar reflex in older children or adults is a sign of neurological damage or abnormality.
Step reflex
reflexstepWhat happens – when the baby is held upright with feet on a solid surface, he will attempt to walk, placing one foot in front of the other.
The purpose – to prepare a child for walking
It disappears – at about six weeks old, reappearing again as a voluntary action at 8 – 12 months old.
Related Posts | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8920831680297852}", 'metadata': "{'Content-Length': '53074', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BTLREHQOSFAX7XOPKEZ6UUIIXMOMKOE3', 'WARC-Concurrent-To': '<urn:uuid:a57d4abf-4b41-4384-82ce-74ca00ada688>', 'WARC-Date': datetime.datetime(2022, 11, 28, 22, 19, 27), 'WARC-IP-Address': '104.21.93.239', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:NBURTTXATCDXONMBHBEATQPGUXS7QCX3', 'WARC-Record-ID': '<urn:uuid:a0178cd6-18ca-4085-bd13-729025561e0e>', 'WARC-Target-URI': 'https://freenclexapp.com/newborn-reflexes-for-the-nclex/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:fe5cd381-8dad-4d3b-a62b-303772e14dae>', 'WARC-Truncated': None}", 'previous_word_count': '569', 'url': 'https://freenclexapp.com/newborn-reflexes-for-the-nclex/', 'warcinfo': 'isPartOf: CC-MAIN-2022-49\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November/December 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-125\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.16689550876617432', 'original_id': '2797a778e03845f468c0f745c3ec1943f090c921a8521da611e5ac6681d065ec'} |
Re: Nuisance Calls From Virgin Media
There is the option to send Virgin Media aSection 11 DPA Noticewhich gives you the right to make a request to an organisation to stop processing your data for the purposes of direct marketing.
If you send this notice to an organisation it means they must stop, or not begin, sending you marketing material or contacting you for marketing purposes.
You need to give the organisation enough information to identify you. This may be your full name, address, email address or other information, such as your account number. Your notice needs to be in writing, an email is acceptable for this purpose.
Your letter should be sent to Virgin Media's Data Protection Officer at
MEDIA HOUSE BARTLEY WOOD BUSINESS PARK HOOK HAMPSHIRE RG27 9UP
TEMPLATE LETTER
[Your full name]
[Your full address]
[Today's date]
Data Controller / Company Secretary
[Organisation's full address]
Dear Sir or Madam,
Notice under the Data Protection Act 1998 not to use my personal information for direct marketing
I,[your full name]of[your full address]require you to[stop / not to begin]processing personal information relating to me for direct marketing as soon as possible and in any event within 28 days of the date of this[letter / e-mail].
If you do not normally handle these requests for your organisation, please pass this[letter / e-mail]to your Data Protection Officer or the person who does.
Please note that if you do not comply with this notice, I can apply to the court for an order against you under Section 11 of the Data Protection Act.
Yours faithfully,
[Your name]
In normal circumstances you should expect them to stop contacting you by email within 28 days of receiving your notice, and post to stop within two months. Telephone contact should also stop within this time period.
Re: Nuisance Calls From Virgin Media
on 20-12-201720:25
Hi Pamdor,
Thanks for your post and apologies to hear you are receiving unwanted calls from us.
I've gone into your account and changed your marketing preferences to No Contact so this will stop any calls you are getting from us. It will also stop any emails, addressed marketing and texts from us too.
It can take up to 6 weeks for things to completely stop but you should see it reduce as time goes on. | mini_pile | {'original_id': 'dfb1a546afa75dbc415b889d9644b51982f6938cf58c527b23a6eafbca0cf191'} |
4K60Hz HDR Hyperion Setup
Discussion in 'Hyperion Hardware' started by nasdas-dev, 24 September 2017.
1. nasdas-dev
nasdas-dev New Member
Hi everyone, I've just recently stumbled upon the hyperion project.
I am very interested to build my own ambilight setup but I couldn't really gather enough information for what I was trying to do.
Essentially, I'd like my setup to work with any HDMI signal and as stated in the title, I want to have full 4K 60Hz HDR experience on compatible devices (e.g. Watching Netflix with an Xbox One S).
So far I've gathered the following parts list:
- 4K HDMI, HDR compatible Splitter (https://nl.aliexpress.com/item/VOXL...-HDR-Splitter-Extender-1X2-1-in-2/32694337706.
- APA 102 led strips + power supply
- Video grabber (utv007 chipset)
- Raspberry Pi 3 + power supply
As you can see I'm still missing a 4K to RCA signal converter/downscaler.
The only one I could find is the super expensive HDfury Linker (http://hdfury.com/product/linker-4k60-444-600mhz-scaler/) but I am not ready to spent that money on a signal converter.
Are there any other options to get my setup to work? Would it work, if I would buy 2 separate signal converters, 4K -> 1080P and 1080P -> RCA?
Any help would be much appreciated! | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '14', 'language_id_whole_page_fasttext': "{'en': 0.9155693650245668}", 'metadata': "{'Content-Length': '35138', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FSOXKW7FMERQP6JFVUJ6HNTQ53TYF5A7', 'WARC-Concurrent-To': '<urn:uuid:d1ac0ca1-403e-4922-b0ed-3787b58eeed5>', 'WARC-Date': datetime.datetime(2018, 10, 17, 0, 45, 25), 'WARC-IP-Address': '104.31.75.1', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2D5FS4DMOLQFCJBGTTRI3MLF6R4BBCRS', 'WARC-Record-ID': '<urn:uuid:1388251d-2f51-4bad-83a3-c9ad6207b5cd>', 'WARC-Target-URI': 'http://forum.hyperion-project.org/threads/4k60hz-hdr-hyperion-setup.1021/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:909ed258-b36d-4171-b0fd-0d4f9f40f398>', 'WARC-Truncated': None}", 'previous_word_count': '211', 'url': 'http://forum.hyperion-project.org/threads/4k60hz-hdr-hyperion-setup.1021/', 'warcinfo': 'isPartOf: CC-MAIN-2018-43\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for October 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-102-177-5.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9256628155708313', 'original_id': '5ec26ab59cc63094d5bcf2a3fd6486423c4c436a6671fd12495b020bd3a73100'} |
Nursing And Allied Journey Jobs
Travel affiliate programs are designed to earn money doing easy issues that you simply enjoy. Low-Price Assure – The positioning presents a low-price assure. All the web sites reviewed allow prospective clients to search for available resorts in a selected metropolis or town throughout a chosen time frame. In general, these sorts of sites provide invited members unique entry to deep discounts for a restricted time, and so they work greatest should you’re flexible about where you wish to travel.
Most often, this means limitless access to journey itineraries and emails of any worth alerts or final-minute deals. 23) Hotwire does provide some good pay as you go rental car deals in certain worldwide cities, but such bargains are AutoEurope ‘s specialty. Of course, there’s nonetheless a catch: Hotwire offers you half-hour to mull over the purchase, and solely after you enter your bank card info does it reveal the airline, route, and flight times.
Convenience fees: Some journey websites earn cash by charging convenience fees when visitors e-book or pay for companies on-line. Sometimes it’s the resort, airline or automotive rental agency that assesses the charges, and the reserving firm simply passes it on. Other occasions it is the journey service that prices these fees. That’s why many travel sites provide worth ensures.
In our seek for six home journeys (the location would not yet provide international fares), it always discovered the lowest price, typically by a big margin. Although many services let you modify your search options, Google Flights is particularly good at it. Although you’ll be able to ebook flights and automotive leases utilizing Hotwire, this online travel company excels at finding the most cost effective lodge prices by way of its search engine.
The most effective travel websites also have offers on cruises, vacation properties, and widespread actions. Many travel sites have developed cell apps that give vacationers safe entry to their online accounts. For those who’re eager on hotel residing, package deal excursions normally provide a better worth than if you booked the flight and (same) hotel separately, due to tour operators’ capacity to buy rooms in bulk. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '40', 'language_id_whole_page_fasttext': "{'en': 0.9301994442939758}", 'metadata': "{'Content-Length': '27571', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6PSQ7RROMDCDUERS42TRYRWYFJTFW4CB', 'WARC-Concurrent-To': '<urn:uuid:561bf041-68ff-40e5-95d6-254cb9da151b>', 'WARC-Date': datetime.datetime(2019, 1, 18, 12, 44, 56), 'WARC-IP-Address': '198.54.115.55', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:P2BEVBDWRHWULWAOZ63NHO3BVMTDW5PX', 'WARC-Record-ID': '<urn:uuid:3996a9b2-b6a7-4ba4-b2d2-77118af0f639>', 'WARC-Target-URI': 'http://www.thefootempress.com/nursing-and-allied-journey-jobs.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6ec57e36-1d63-4944-9162-e01a210acb78>', 'WARC-Truncated': None}", 'previous_word_count': '354', 'url': 'http://www.thefootempress.com/nursing-and-allied-journey-jobs.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-159-152-254.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02344822883605957', 'original_id': 'fdd8fad7e994adc0954adc3621e05906f593a9bf524f88006b1933a87a680eeb'} |
Well, sate, sate, sate! Meliodas, and the Seven Deadly Sins gang are all together in this brand new gacha game that was released back at the beginning of March globally thanks to its HUGE success in Japan and Korea since it was rank number one game on Google Play in 2019. So what are my thoughts on this shounen anime based gacha game after playing it for over a month? Well, let’s get into it! FULL COUNTER!
Wait you sure this game isn’t for console?
Woah, hold up, a shounen anime gacha mobile game that actually looks like it could be on a console! When I first laid eyes on the screenshots and videos, it was hard to believe that it was for mobile. This game has fantastically animated, well-made, 3-D models of characters in the game. Heck just watching the 3-D models when they are just standing still you see that they are giving off a feeling that these characters are alive. Oh, and let’s not forget the attack animations! So satisfying to watch that health bar go down as my team gives a show, slashing on the enemy. I will admit, I was never really a big fan of Slader, but watching him go at my enemies with his huge sword doing moves like Cloud Strife from Final Fantasy 7 never felt so pleasing to the eye. Now those are just little animations of models, let’s move on to full-on animations like the ultimate attacks and cutscenes. These scenes are beautifully animated to look as epic as possible. Fully voiced with the voice cast from the Seven Deadly Sins anime, with background music that encourages me to want to listen to while being at the gym trying to break my record for weight lifting. Music comes from both the anime and originals made for the game. Camera angles and animated movements show the grand composition of an enjoyable ultimate move. Again I ask myself, how is this a mobile game?! Honestly, this was the Seven Deadly Sins video game I have wanted based on all the hard work put into the animations, visuals, and sound. (Check out some the Ultimates in the playlist below)
Now there is a lot of graphics for this game and sometimes that does come with a price. There were times my game did glitch some visuals and some of the sounds. But it would only happen for a second before the game fixed itself. So really it wasn’t that big of a deal to worry about.
Another thing is that this game really heated up my systems and ate the battery of whatever device that I play the game on. Just so you get a picture on devices, I have played it on my Samsung Galaxy 9, Ipad Pro, and my new Mac Pro 2020. Even at the lowest graphic setting and highest battery saving setting, so be prepared.
Still, though even with these two minor problems, I still was able to see beautiful work that was put into this game to make it look visually amazing in a 3-D setting of Seven Deadly Sins.
NOW HOLD UP! What about the user-interface?!
I am going to stop myself from fantasying for minute cause video games aren’t all about the visuals. There is a user-interface! Your home base is the Boar Tavern that Meliodas owns in the show. It’s a full-on 3-D rendered setting where you control Meliodas and can walk around the bar and interact with characters and things in the bar. Other deadly sins members like Ban, Diane, and King contribute to the party by giving the functions of cooking, material exchange, and salvaging equipment. Finally, with the help of Sir Hawk, you can take care of the Boar Tavern by serving drinks to the customer, cleaning, and serving food. Got to earn that gold as though it’s an actual job. All types of mechanics you would see in an RPG-type game
For a mobile game user-interface, honestly, it’s a little much. There were a lot of times where I had to move Meliodas a couple of times just to get him in the right position just so then I can get to Ban and click on his cooking icon. Luckily the game knows this and has shortcut icons to each of the functions the tavern offers. But then why does the game have the big fully render setting to roam in if it’s a difficult function to use in the game I wonder?
The only reason I could think of is for visuals. Ah but wait! There is a function that the tavern plays for ya other than being a hub. The more you upgrade your tavern the better percentage in benefits in-game you will receive. Now these upgrades as of now, cost Diamonds, gacha roll currency. Some might think they would prefer to not use their diamonds on other things except for gacha rolls. I personally will admit, this game loves to give diamonds to players daily. From personal experience after one banner I rolled for, I was able to save up over 100 diamonds (One ten roll is 30 diamonds) from free to play while at the same time spend some to upgrade my tavern and pay for more storage cause this game has VERY LIMITED storage. DEAD SERIOUS! This was also before I got the PVP mode which rewards gacha currency weekly.
Other interfaces you will be using is Britannia’s Map where you will journey throughout the story of Seven Deadly Sins Manga/Anime. In-game, there are all the towns you visit in the country. They are where you will receive side-quests and shop for materials. Depending on your relationship with the town, it will give you a higher rarity of items in-store as well as more difficult missions. Honestly, just like the home page, having a 3-D rendered setting is really not necessary but it’s there to look pretty. Overall the interface looks pretty but function wise can be kind of pointless to use since they already give you shortcuts and movement in the 3-D plain can be difficult to maneuver.
Another to consider is the gameplay mechanics!
As for the gameplay of the game, the battle system gameplay is overall pretty average really. You have a turn-based system where you are given randomly a hand of cards that each represent an action each character on your team can do. If two of the same card with the same star level are next to each other they fuse to upgrade to the higher ranking of star card. From your hand, you would play three action cards. Depending on the cards you play for that turn, those cards will cause the character to charge their ultimate gauge. Once charge you will be given an ultimate card in your hand to play. Simple strategy but adding the passives and abilities that each of the characters in the game has makes the game more complicated.
After starting the game at launch, I got to say that I spent a whole week trying to defeat the final form Hendrickson, the final boss of the available story in the game. Between grinding, upgrading characters, and trial and error, I have never spent so long on a gacha game to try and defeat a story boss. Especially one that you have to battle over 5 times in a row! Honestly, sometimes the gameplay doesn’t feel like its strategy but a game of luck ’cause the chances of getting the one card you need in your hand to stop Hendrickson from using his ultimate can be very slim and then if you don’t get that card, it’s game over. This is unfair for someone who has grinded hard for the fight and doesn’t finish the story until they have a combat level of 90,000 while others are only at 84,000 just cause they got the right cards at the right time. So honestly this gameplay is a bit unbalanced since we don’t know what the next cards we are getting are, but at the same time, I can not remember feeling so dedicated to grinding and upgrading just so I can defeat the one boss in any video game. The last time I remember doing something like that was when I played Kingdom Hearts Chain of Memories back when I was a kid. It is some tediousness but the results, in the end, are satisfying ’cause you will then get to join guilds and of course, get diamonds for finishing the story. Got to get those diamonds for the gacha rolls! So yea the gameplay needs some work, but still feels like a fun system to play.
The fun thing is you will be using this battle system for a LOT of things you can do in the game. So honestly, you should never get bored and have to wait the next day for dailies. You got story, missions, upgrading, pvp, events, etc. Luckily there is even an auto system to help out in situations where you can’t be near your device.
Got to say a luster looking game
So overall, after playing the game now for over a month, I must say the game looks beautiful visually with some kinks. Sure, this game has its hiccups, but I am still giving this game a try cause unlike many others based on shounen anime, I have seen this one as one of the best ones yet. For sure I am not putting this one down any time soon.
Seven Deadly Sins Grand Cross is on Google Play and Apple Store. You can also visit their website here for more info and news for what is to come. So now you heard my thoughts, what about yours? Leave a comment! What characters did you get and who are your favorites? | mini_pile | {'original_id': '9864985b51d9ae1b071f39d2cb1c5fcb9c6b494c40f2a9ab6d933a29b2331f2d'} |
Why me? Responds to Mail on Sunday article, “Khan’s £1.3 million social justice plan helps just ten victims meet offenders.”
Published: Friday, April 5th, 2019
On Sunday, the Mail on Sunday published an article about the Mayor of London’s two-year restorative justice programme, run by Catch 22, called Restore:London. Writing for the Mail on Sunday, Martin Beckford criticised Sadiq Khan, Mayor of London, for what he saw as being profligate with £1.3 million of taxpayers’ money. He noted that just ten face-to-face Restorative Justice meetings had taken place between victims of crime and offenders over a two-year period, as a result of the programme.
What we must remember is that Restorative Justice is a process that is overwhelmingly victim-led, and our own in-house service at Why me? is geared to reflect that. In over ten years’ experience of working with victims, we have found that they are more likely to ask for restorative justice than the offender. Why? Because they feel let down by the traditional justice system, they seek answers to questions relating to the crime committed against them, and are keen for the offender to make reparations. These reparations do not just take the form of letters of apology or “saying sorry,” as the Mail on Sunday article put it. In addition to meeting the victims’ needs through providing explanations for their actions, we have seen offenders completing successful stints in rehab, improved engagements with education and direct action to repair damages.
The best outcome of all? A good number of offenders – having seen the true impact of their actions upon the victim – actually desist from a life of crime altogether, after taking part in a successful restorative justice process. This includes Why me’s patron, Peter Woolf, who in his own estimation had committed “20,000 crimes” before he attacked Islington businessman Will Riley in a burglary at his home. The two took part in a restorative justice conference. It was so successful that Peter Woolf never re-offended, the two became friends, and Will Riley went on to set up the Why me? Charity in 2009.
The article also quoted Susan Hall, a Conservative member of the London Assembly: “We shouldn’t underestimate the amount of cash that the Mayor has spent on this white elephant – £1.3 million of taxpayers’ money could have put 22 more police officers on our streets to catch crooks and keep Londoners safe.”
Unfortunately, this approach by the GLA member paints an inaccurate picture of what victims want and restorative justice as a whole.
Academic research supports the case for using Restorative Justice. Government research found that 80% of offenders who take part in a restorative justice conference think it will lessen their likelihood of reoffending and that it reduces the frequency of reoffending by 14%. Research in New Zealand found that offenders who had been through restorative justice committed 23% fewer offences over the following 12 months than those who had not.
In March 2015, the RJC commissioned Ipsos MORI to conduct research on restorative justice. A nationally representative sample of 1,782 adults was interviewed throughout England and Wales, and it was found that 77% of the public think that victims should have the right to meet their offender. Among victims of crime the figure was even higher, at 83%. 69% of the public think that offenders need to see the real impact of their crimes and face their victims.
The government funded a £7 million, seven-year research programme into restorative justice (2202-7), which found that in a randomised control trial 85% of victims who take part in a restorative justice conference are satisfied with the process and 78% of victims who take part in restorative justice conferences would recommend the experience to others. 90% of victims who take part in a restorative justice conference receive an apology from the offender in their case, compared with only 19% of those who just go through the conventional justice system. Victims who go through restorative justice are 49% less likely to suffer from posttraumatic stress.
Restorative justice can hardly therefore be described as a “white elephant.” It is therefore a false dichotomy to pit funding for restorative justice against the (crucial) priority of putting more police officers on our streets.
While it may be true that only ten face-to-face meetings have taken place between victims and offenders over a two-year period during the Restore: London programme, face-to-face meetings are only one aspect of the benefits of restorative justice for victims of crime. Victims report great satisfaction from talking about the crime and its impact on them, their families and their communities. Other restorative justice procedures include shuttling (an exchange of letters between victim and offender), and even the use of surrogate offenders in place of the actual offender. All of this is geared towards the victim’s wishes, comfort and safety – and it goes without saying that the victim’s safety needs are thoroughly risk-assessed by experienced restorative justice facilitators.
Further, the statistics on restorative justice in London do not reflect the qualitative benefits it has for victims. At Why me?, we have a number of testimonies from victim ambassadors which describe these benefits in detail (Why me? Victim ambassadors’ stories).
We also know that there are a number of practical barriers to delivering restorative justice successfully and at scale. These include short contracts, problems around giving victims an informed choice, and excessive time taken to establish information sharing agreements and referral routes.
If restorative justice is done well, it is certainly not the “soft option” that it has been portrayed as. Nor is it a waste of resources. This is borne out in statistics: a comprehensive Ministry of Justice study (2002-7) found that restorative justice reduced the frequency of offending by 14%, and led to £8 in savings to the criminal justice system for every £1 spent on restorative justice.
While there are undoubtedly things that restorative justice providers could learn from the Restore: London experience, we must be mindful of the difference between legitimate criticism and baseless scaremongering. The latter does absolutely nothing to help victims of crime or reduce re-offending.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '3', 'language_id_whole_page_fasttext': "{'en': 0.966507077217102}", 'metadata': "{'Content-Length': '24860', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7MBFRHJMXNQXLG2Y6RK647K325Z44W6X', 'WARC-Concurrent-To': '<urn:uuid:40947259-31d3-48b1-840f-2249a70fa673>', 'WARC-Date': datetime.datetime(2019, 4, 24, 6, 37, 47), 'WARC-IP-Address': '193.200.81.171', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:CWVWY6JGY6JI7DDN5QIYQ46QRSB45X3U', 'WARC-Record-ID': '<urn:uuid:55a30aac-dbd9-4a24-9560-d6266cd1949a>', 'WARC-Target-URI': 'https://why-me.org/2019/%EF%BB%BFwhy-me-responds-to-mail-on-sunday-article-khans-1-3-million-social-justice-plan-helps-just-ten-victims-meet-offenders/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:23e08bc2-a111-4ee2-afa1-29e23c6e768b>', 'WARC-Truncated': None}", 'previous_word_count': '995', 'url': 'https://why-me.org/2019/%EF%BB%BFwhy-me-responds-to-mail-on-sunday-article-khans-1-3-million-social-justice-plan-helps-just-ten-victims-meet-offenders/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-230-181-38.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018576204776763916', 'original_id': '0f17755ad6bdc1e61ea70a8f50587f6e50920fc81ad783f802884280c1b65643'} |
Search Results (EC1N 2LL) 0,0
We have found 1 items matching your search query.
Diversity travel business travel
0161 235 5407
Diversity Travel
We are an award-winning specialist Travel Management Company providing a unique and comprehensive travel service to charity, academic and not-for-profit organisations globally. As a specialist in char | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.8355596661567688}", 'metadata': "{'Content-Length': '33229', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QHLSLGGMVSWT5YALFQXPXKLAHR4KN3LT', 'WARC-Concurrent-To': '<urn:uuid:91902198-058c-4f73-a94a-b10b5631d3b2>', 'WARC-Date': datetime.datetime(2017, 4, 27, 3, 17, 42), 'WARC-IP-Address': '23.229.152.38', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:X63DID5EOOAQG3LWJOSPXVAGEUJBCING', 'WARC-Record-ID': '<urn:uuid:71e8d2f2-caf4-4f56-b504-8fe1e325461f>', 'WARC-Target-URI': 'http://tmcfinder.com/?s=&zipcode=EC1N%202LL&radius=50&showmap=1&orderby=distance&order=desc', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:bb0844dc-64dd-4ac6-94e3-442fb4bedcd0>', 'WARC-Truncated': None}", 'previous_word_count': '51', 'url': 'http://tmcfinder.com/?s=&zipcode=EC1N%202LL&radius=50&showmap=1&orderby=distance&order=desc', 'warcinfo': 'robots: classic\r\nhostname: ip-10-145-167-34.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-17\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for April 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.058389127254486084', 'original_id': 'b45de9149917c1929f078073169c8548cad6f265bb011f473a046614eb2a022d'} |
Russell's teapot
From Conservapedia
This is the current revision of Russell's teapot as edited by Jpatt (Talk | contribs) at 13:44, 2 March 2012. This URL is a permanent link to this version of this page.
Jump to: navigation, search
Russell's Teapot is an argument first formulated by the philosopher Bertrand Russell as a reductio ad absurdum of the notion that in an argument about the possible existence of an unseen entity, the burden of proof is upon the skeptic.
The fallacy in the argument is that there is in fact nothing absurd about believing the teapot to be there, if those "ancient books" were written by an ancient astronaut or other being who placed the teapot there. The argument presumes that such is not the case, so it presumes what it sets out to prove, and is thus a circular argument.
That is, the argument is based on the presumption that there is no valid reason, beyond widespread belief, to believe that the teapot exists. But if the validity of those ancient books could be established, there is indeed reason to believe that the teapot exists, and thus the presumption in the argument is false.
Charles Darwin postulated that species adapt over time to the environment around them. Since Darwin makes the claim, the burden of proof rests on his shoulders. However, supporters of Darwin often claim that evolution is correct because it is unfalsifiable.[Who says?]
1. Is There A God? | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '168', 'language_id_whole_page_fasttext': "{'en': 0.9678449034690856}", 'metadata': '{\'Content-Length\': \'20724\', \'Content-Type\': \'application/http; msgtype=response\', \'WARC-Block-Digest\': \'sha1:BYTRKH4X6KAWBLORJVR6QKATWDBUQVBO\', \'WARC-Concurrent-To\': \'<urn:uuid:20ebd598-c606-4a57-b3e2-d6b9a76f0932>\', \'WARC-Date\': datetime.datetime(2017, 9, 22, 3, 14, 20), \'WARC-IP-Address\': \'65.60.9.250\', \'WARC-Identified-Payload-Type\': \'text/html\', \'WARC-Payload-Digest\': \'sha1:TTONBBJ37JYLIZDDDF7HQNHCFG7F77D3\', \'WARC-Record-ID\': \'<urn:uuid:7192e3f2-f287-4fc2-9261-c139a8346ce7>\', \'WARC-Target-URI\': "http://www.conservapedia.com/index.php?title=Russell\'s_teapot&oldid=965342", \'WARC-Type\': \'response\', \'WARC-Warcinfo-ID\': \'<urn:uuid:85cb34b1-3222-4599-9ceb-3893c1c0ca06>\', \'WARC-Truncated\': \'length\'}', 'previous_word_count': '402', 'url': "http://www.conservapedia.com/index.php?title=Russell's_teapot&oldid=965342", 'warcinfo': 'robots: classic\r\nhostname: ip-10-37-236-142.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.8118008971214294', 'original_id': '853e355882b39b43892b53509260df409085e33606e1d50544c8ecd93785d801'} |
Slideshows Images Quizzes
Last reviewed on RxList: 3/29/2021
Radicava Patient Information Including Side Effects
Brand Names: Radicava
Generic Name: edaravone
What is edaravone (Radicava)?
Edaravone works by relieving the effects of oxidative stress, which may be related to the death of motor neurons (nerve cells) in people with Amyotrophic Lateral Sclerosis (ALS). Keeping motor neurons healthy may help to preserve muscle function.
Edaravone is used to treat amyotrophic lateral sclerosis.
Edaravone may also be used for purposes not listed in this medication guide.
What are the possible side effects of edaravone (Radicava)?
Edaravone can cause serious allergic reactions. The symptoms may not appear until after your IV infusion is finished.
Get emergency medical help if you have signs of an allergic reaction: hives, itching; wheezing, difficult breathing; feeling light-headed; swelling of your face, lips, tongue, or throat.
Call your doctor at once if you have:
Common side effects may include:
• bruising;
• headache; or
• trouble walking.
What is the most important information I should know about edaravone (Radicava)?
Edaravone can cause serious allergic reactions. Get emergency medical help if you have hives, itching, trouble breathing, swelling in your face or throat, or if you feel light-headed.
Radicava Patient Information including How Should I Take
What should I discuss with my healthcare provider before receiving edaravone (Radicava)?
You should not be treated with edaravone if you are allergic to it.
To make sure edaravone is safe for you, tell your doctor if you have ever had:
It is not known whether edaravone passes into breast milk or if it could affect the nursing baby. Tell your doctor if you are breast-feeding.
How is edaravone given (Radicava)?
Edaravone is usually given in a 28-day treatment cycle. You may need to use the medicine only during the first 2 weeks of each cycle. Your doctor will determine how long to treat you with edaravone.
This medicine must be given slowly and the IV infusion can take at least 60 minutes to complete.
Brain Food Pictures: What to Eat to Boost Focus See Slideshow
Radicava Patient Information including If I Miss a Dose
What happens if I miss a dose (Radicava)?
Call your doctor for instructions if you miss an appointment for your edaravone injection.
What happens if I overdose (Radicava)?
What should I avoid while receiving edaravone (Radicava)?
What other drugs will affect edaravone (Radicava)?
Other drugs may interact with edaravone, including prescription and over-the-counter medicines, vitamins, and herbal products. Tell your doctor about all your current medicines and any medicine you start or stop using.
Where can I get more information (Radicava)?
Your pharmacist can provide more information about edaravone.
Health Solutions From Our Sponsors | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '180', 'language_id_whole_page_fasttext': "{'en': 0.8674846291542053}", 'metadata': "{'Content-Length': '158271', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:Z7KUCNZFVLXC2TQQ2MTYJBFQTUFFCHK6', 'WARC-Concurrent-To': '<urn:uuid:7dead5b3-4fd2-49b4-90a6-52b42966c857>', 'WARC-Date': datetime.datetime(2021, 5, 18, 5, 0, 53), 'WARC-IP-Address': '104.18.25.195', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:SGDQMH63TFBEEWAL56O7A3XCC6BIUXCB', 'WARC-Record-ID': '<urn:uuid:9731795e-18c4-403f-a7ba-cd05ffece5b0>', 'WARC-Target-URI': 'https://www.rxlist.com/radicava-drug/patient-images-side-effects.htm', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3d638b62-03b5-41ba-81bf-409e92c7ba77>', 'WARC-Truncated': None}", 'previous_word_count': '607', 'url': 'https://www.rxlist.com/radicava-drug/patient-images-side-effects.htm', 'warcinfo': 'isPartOf: CC-MAIN-2021-21\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-101.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04046553373336792', 'original_id': '87441cf879752b00c295ca6fa6335348154ad63638fdd35a5b7167d29ae000eb'} |
Pneumatic Tire
ABSTRACT
The pneumatic tire includes a carcass layer, a belt layer disposed outward of the carcass layer in the tire radial direction, and a tread rubber disposed outward of the belt layer in the tire radial direction. Moreover, the belt layer is formed by laminating a pair of cross belts having a belt angle with an absolute value from 10° to 45° both inclusive and mutually opposite signs, and the circumferential reinforcing layer having a belt angle within a range of ±5° relative to the tire circumferential direction. Moreover, the distance (Gcc) from the tread profile to the tire inner circumferential surface along the tire equatorial plane and the distance (Gsh) from the tread edge to the tire inner circumferential surface have a relationship satisfying 1.10≦Gsh/Gcc.
TECHNICAL FIELD
The present technology relates to a pneumatic tire, and more particularly relates to a pneumatic tire with improved belt-edge-separation resistance performance.
BACKGROUND
Recent heavy duty tires mounted on trucks, buses, and the like maintain their tread shape due to the tires having a low aspect ratio while having a circumferential reinforcing layer disposed in the belt layer. The circumferential reinforcing layer is a belt ply having a belt angle that is substantially 0° with respect to the tire circumferential direction, and is disposed laminated upon a pair of cross belts. The technology disclosed in Japanese Patent Nos. 4642760B, 4663638B and 4663639B includes conventional pneumatic tires that are configured in this manner. There is a problem that it is necessary to suppress separation of peripheral rubber at an end portion of a belt ply
SUMMARY
Thus, the present technology provides a pneumatic tire with improved belt-edge-separation resistance performance.
A pneumatic tire according to the present technology has: a carcass layer, a belt layer disposed outward of the carcass layer in a tire radial direction, and a tread rubber disposed outward of the belt layer in the tire radial direction. The belt layer is formed by laminating a pair of cross belts having a belt angle with an absolute value from 10° to 45° both inclusive and mutually opposite signs, and a circumferential reinforcing layer having a belt angle within a range of ±5° relative to a tire circumferential direction. A distance Gcc from a tread profile to a tire inner circumferential surface along a tire equatorial plane and a distance Gsh from a tread edge to the tire inner circumferential surface have a relationship satisfying 1.10≦Gsh/Gcc.
In the pneumatic tire according to the present technology, because the ratio Gsh/Gcc is set to a high value, the tread face as a whole has a flat (substantially parallel to the tire rotational axis) shape, and further, the volume of tread rubber (the distance Gsh) in a shoulder portion is assured. Thus, due to the fact that strain of each belt ply is reduced when the tire contacts the ground, there is an advantage that the belt-edge-separation resistance performance is improved.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a cross-sectional view in a tire meridian direction illustrating a pneumatic tire 1 according to an embodiment of the present technology.
FIG. 2 is an explanatory view illustrating a belt layer of the pneumatic tire depicted in FIG. 1.
FIG. 3 is an explanatory view illustrating a belt layer of the pneumatic tire depicted in FIG. 1.
FIGS. 4A and 4B are explanatory views illustrating the effect of the pneumatic tire depicted in FIG. 1.
FIG. 5 is an explanatory view illustrating the effect of the pneumatic tire depicted in FIG. 1.
FIG. 6 is an explanatory view illustrating a modified example of the pneumatic tire depicted in FIG. 1.
FIG. 7 is an explanatory view illustrating a modified example of the pneumatic tire depicted in FIG. 1.
FIGS. 8A-8B include a table showing results of performance testing of pneumatic tires according to embodiments of the present technology.
FIGS. 9A-9B include a table showing results of performance testing of pneumatic tires according to embodiments of the present technology.
DETAILED DESCRIPTION
The present technology is described below in detail with reference to the accompanying drawings. However, the present technology is not limited to these embodiments. Moreover, constituents which can possibly or obviously be substituted while maintaining consistency with the present technology are included in constitutions of the embodiments. Furthermore, a plurality of modified examples that are described in the embodiment can be freely combined within a scope of obviousness for a person skilled in the art.
Pneumatic Tire
FIG. 1 is a cross-sectional view in a tire meridian direction illustrating a pneumatic tire 1 according to an embodiment of the present technology. In this drawing, a radial tire for heavy loads that is mounted on trucks, buses, and the like for long-distance transport is illustrated as an example of the pneumatic tire 1. Note that the symbol CL refers to a tire equator plane. Moreover, a tread edge P and a tire ground contact edge T are in accord with each other in FIG. 1. The circumferential reinforcing layer 145 in FIG. 1 is indicated by hatching.
A pneumatic tire 1 includes a pair of bead cores 11, 11, a pair of bead fillers 12, 12, a carcass layer 13, a belt layer 14, tread rubber 15, and a pair of side wall rubbers 16, 16 (see FIG. 1).
The pair of bead cores 11, 11 have annular structures and constitute cores of left and right bead portions. The pair of bead fillers 12, 12 are formed from a lower filler 121 and an upper filler 122, and are disposed on a periphery of the pair of bead cores 11, 11 in the tire radial direction so as to reinforce the bead portions.
The carcass layer 13 stretches between the left and right side bead cores 11 and 11 in toroidal form, forming a framework for the tire. Additionally, both end portions of the carcass layer 13 are folded from an inner side in a tire width direction toward an outer side in the tire width direction and fixed so as to wrap around the bead cores 11 and the bead fillers 12. Also, the carcass layer 13 is constituted by a plurality of carcass cords formed from steel or organic fibers (e.g. nylon, polyester, rayon, or the like) covered by a coating rubber and subjected to a rolling process, and has a carcass angle (inclination angle of the carcass cord in a fiber direction with respect to the tire circumferential direction) with an absolute value from 85° to 95° both inclusive.
The belt layer 14 is formed by laminating a plurality of belt plies 141 to 145, and disposed to extend over a periphery of the carcass layer 13. A detailed configuration of the belt layer 14 is described below.
The tread rubber 15 is disposed on an outer circumference in the tire radial direction of the carcass layer 13 and the belt layer 14, and forms a tread portion of the tire. The pair of side wall rubbers 16, 16 is disposed on both outer sides of the carcass layer 13 in the tire width direction, so as to form left and right sidewall portions of the tire.
In the configuration illustrated in FIG. 1, the pneumatic tire 1 includes seven circumferential main grooves 2 that extend in a tire circumferential direction, and eight land portions 3 partitioned and formed by the circumferential main grooves 2. The land portions 3 are formed of blocks that are segmented in the circumferential direction by ribs or lug grooves (not illustrated on the drawings) that continue in the tire circumferential direction.
Here, “circumferential main grooves” refers to circumferential grooves having a groove width of 5.0 mm or greater. The groove width of the circumferential main grooves is measured excluding the notched portions and/or the chamfered portions formed at the groove opening portion.
Additionally, in the pneumatic tire 1, the left and right outermost circumferential main grooves 2, 2 in the tire width direction are referred to as outermost circumferential main grooves. Moreover, the left and right land portions 3, 3 outward in the tire width direction that are defined by the left and right outermost circumferential main grooves 2, 2 are referred to as shoulder land portions.
[Belt Layer]
FIGS. 2 and 3 are explanatory views illustrating a belt layer of the pneumatic tire depicted in FIG. 1. Among these drawings, FIG. 2 illustrates an area on one side of a tread portion demarcated by the tire equatorial plane CL, and FIG. 3 illustrates a laminated structure of the belt layer 14. Furthermore, the thin lines in the belt plies 141 to 145 in FIG. 3 schematically represent the respective belt cords of the belt plies 141 to 145.
The belt layer 14 is formed by laminating a large angle belt 141, a pair of cross belts 142, 143, a belt cover 144, and a circumferential reinforcing layer 145, and is disposed by being wound and mounted onto the periphery of the carcass layer 13 (see FIG. 2).
The large angle belt 141 is configured by a plurality of belt cords formed from steel or organic fibers, covered by coating rubber, and subjected to a rolling process, having a belt angle (angle of inclination of the fiber direction of the belt cords with respect to the tire circumferential direction) with an absolute value from 45° to 70° both inclusive. Moreover, the large angle belt 141 is disposed laminated outward in the tire radial direction of the carcass layer 13.
The pair of cross belts 142, 143 is configured by a plurality of belt cords formed from steel or organic fibers, covered by coating rubber, and subjected to a rolling process, having a belt angle with an absolute value from 10° to 45° both inclusive. Additionally, the pair of cross belts 142, 143 has belt angles that are of mutually opposite signs, and are laminated such that the fiber directions of the belt cords intersect each other (a crossply structure). In the following description, the cross belt 142 positioned inward in the tire radial direction is referred to as “inner-side cross belt”, and the cross belt 143 positioned outward in the tire radial direction is referred to as “outer-side cross belt”. Three or more cross belts may be disposed laminated (not illustrated on the drawings). Moreover, in this embodiment, the pair of cross belts 142, 143 are disposed laminated outward in the tire radial direction of the large angle belt 141.
Also, the belt cover 144 is configured by a plurality of belt cords formed from steel or organic fibers, covered by coating rubber, and subjected to a rolling process, having a belt angle with an absolute value from 10° to 45° both inclusive. Moreover, the belt cover 144 is disposed laminated outward in the tire radial direction of the cross belts 142, 143. In this embodiment, the belt cover 144 has the same belt angle as the outer-side cross belt 143, and is disposed in the outermost layer of the belt layer 14.
The circumferential reinforcing layer 145 is configured by belt cords formed from steel, and covered by coating rubber that are wound in a spiral manner with an inclination within a range of ±5° relative to the tire circumferential direction. Moreover, in this embodiment, the circumferential reinforcing layer 145 is disposed interposed between the pair of cross belts 142, 143. Additionally, the circumferential reinforcing layer 145 is disposed inward of left and right edges of the pair of cross belts 142, 143 in the tire width direction. Specifically, the circumferential reinforcing layer 145 is formed by winding one or a plurality of wires in a spiral manner around the periphery of the inner-side cross belt 142. This circumferential reinforcing layer 145 reinforces the stiffness in the tire circumferential direction. As a result, the tire durability is improved.
In the pneumatic tire 1, the belt layer 14 may have an edge cover (not illustrated on the drawings). Generally, the edge cover is configured by a plurality of belt cords formed from steel or organic fibers covered by coating rubber and subjected to a rolling process, having a belt angle with an absolute value from 0° to 5° both inclusive. Additionally, edge covers are disposed outward of the left and right edges of the outer-side cross belt 143 (or the inner-side cross belt 142) in the tire radial direction. The edge covers improve the uneven wear resistance performance of the tire by reducing the difference in radial growth between the center area and the shoulder area of the tread portion, by exhibiting a hoop effect.
[Belt-Edge Separation Suppressing Structure]
Recent heavy duty tires mounted on trucks, buses, and the like maintain their tread shape due to the tires having a low aspect ratio while having a circumferential reinforcing layer disposed in the belt layer. Specifically, by disposing the circumferential reinforcing layer at the tread center region, and exploiting the hoop effect thereof, radial growth of the tread is suppressed and the tread shape is maintained.
In such a configuration, as the rigidity of the belt layer in the tire circumferential direction is increased due to the circumferential reinforcing layer, there is a problem that separation of the peripheral rubber at the edge portion of the belt ply occurs easily. Such a problem clearly appears, in particular, under high inner pressure and heavy load long-term service conditions.
Here, in the pneumatic tire 1, the configuration described below is adopted in order to improve tire durability performance by suppressing the occurrence of the above-described separation (see FIG. 1 to FIG. 3).
As illustrated in FIG. 2, in the pneumatic tire 1, a distance Gcc from the tread profile to the tire inner circumferential surface along the tire equatorial plane CL and a distance Gsh from the tread edge P to the tire inner circumferential surface have a relationship satisfying 1.10≦Gsh/Gcc. In particular, as shown by the results of a performance test to be described later (see FIGS. 8A-8B), this ratio Gsh/Gcc preferably satisfies 1.20≦Gsh/Gcc. This results in effective improvement of the belt-edge-separation resistance performance of the tire.
On the other hand, the upper limit of the ratio Gsh/Gcc is not particularly limited, but when the tire is assembled on a specified rim, filled with specified internal pressure, and in an unloaded state, the radius along the tread edge P of the tread profile is preferably less than or equal to the radius along the tire equatorial plane CL. That is, the tread profile has a linear shape or an arc shape having a center inward in the tire radial direction, and is configured so as not to have a reverse R shape (arc shape having a center outward in the tire radial direction). For example, in a configuration having a square shoulder portion as in FIG. 2, the upper limit of the ratio Gsh/Gcc is approximately from 1.4 to 1.5. On the other hand, in a configuration having a round shoulder portion as in FIG. 6, the upper limit of the ratio Gsh/Gcc is approximately from 1.3 to 1.4.
The distance Gcc is measured as the distance from the intersection of the tire equatorial plane CL and the tread profile to the intersection of the tire equatorial plane CL and the tire inner circumferential surface when viewed as a cross-section from the tire meridian direction. Therefore, in a configuration having a circumferential main groove 2 at the tire equatorial plane CL such as the configuration illustrated in FIG. 1 and FIG. 2, the distance Gcc is measured omitting the circumferential main groove 2. The distance Gsh is measured as the length of a perpendicular line from the tread edge P to the tire inner circumferential surface when viewed as a cross-section from the tire meridian direction.
In the configuration illustrated in FIG. 2, the pneumatic tire 1 includes an inner liner 18 on the inner circumferential surface of the carcass layer 13, and the inner liner 18 is disposed across the entire region of the tire inner circumferential surface. In such a configuration, the distance Gcc and the distance Gsh are measured on the basis of the outer surface of the inner liner 18 (tire inner circumferential surface).
The tread edge P (1) refers to a point of the tread edge portion in a configuration having a square shaped shoulder portion. For example, in the configuration illustrated in FIG. 2, the tread edge P and a tire ground contact edge T coincide with each other due to the shoulder portion having a square shape. Conversely, (2) in a configuration in which the shoulder portion has a round shape, as illustrated in the modification example of FIG. 6 to be described later, taking an intersection P′ between the tread portion profile and the side wall portion profile when viewed as a cross-section from the tire meridian direction, the tread edge P is taken as the bottom of a perpendicular line drawn from the intersection P′ to the shoulder portion.
Additionally, the “tire ground contact edge T” refers to the maximum width position in a tire axial direction of a contact surface between the tire and a flat plate in a configuration in which the tire is assembled on a specified rim, filled with specified internal pressure, placed perpendicularly to the flat plate in a static state, and loaded with a load corresponding to a specified load.
Herein, “specified rim” refers to an “applicable rim” defined by the Japan Automobile Tyre Manufacturers Association (JATMA), a “design rim” defined by the Tire and Rim Association (TRA), or a “measuring rim” defined by the European Tyre and Rim Technical Organisation (ETRTO). “Specified internal pressure” refers to “maximum air pressure” stipulated by JATMA, a maximum value in “tire load limits at various cold inflation pressures” defined by TRA, and “inflation pressures” stipulated by ETRTO. Note that “specified load” refers to “maximum load capacity” stipulated by JATMA, a maximum value in “tire load limits at various cold inflation pressures” defined by TRA, and “load capacity” stipulated by ETRTO. However, with JATMA, in the case of passenger car tires, the specified internal pressure is an air pressure of 180 kPa, and the specified load is 88% of the maximum load capacity.
FIGS. 4A, 4B, and 5 are explanatory views illustrating the operation of the pneumatic tire depicted in FIG. 1. In these diagrams, FIGS. 4A and 4B illustrates the states of ground contact of tires having mutually different ratios Gsh/Gcc, and FIG. 5 illustrates strain at the end portions of belt cords of the circumferential reinforcing layer 145 at the time of ground contact of each of the tires of FIGS. 4A and 4B.
In the tire of a comparative example of FIG. 4A, in the configurations of FIGS. 1 to 3, the ratio Gsh/Gcc is set to a small value (Gsh/Gcc=1.06). For this reason, when the tire does not contact the ground, the tread profile has a counterbore shape in which the outside diameter decreases from the tire equatorial plane CL toward the tread edge P (not illustrated). Thus, when the tire contacts the ground, as depicted in FIG. 4A, the tread rubber 15 on the shoulder portion deforms greatly on the road surface side (outward in the tire radial direction), and each of the belt plies 141 to 145 of the belt layer 14 curves greatly on the road surface side (outward in the tire radial direction) toward the outer side in the tire width direction (see FIG. 4A). As a result, as the strain of each of the belt plies 141 to 145 becomes large, (1) it is easy for separation to occur in the peripheral rubber at the end portion of each of the belt plies 141 to 145, and (2) it is easy for separation to occur in the coating rubber between the adjacent belt plies 141 to 145. In particular, separation of the peripheral rubber at the end portion of the circumferential reinforcing layer 145 and separation of the coating rubber between the circumferential reinforcing layer 145 and the pair of cross belts 142, 143 that sandwich the circumferential reinforcing layer 145 occur easily.
In contrast, in the tire of a comparative example of FIG. 4B, in the configurations of FIGS. 1 to 3, the ratio Gsh/Gcc is set to a large value (Gsh/Gcc=1.20). For this reason, when the tire does not contact the ground, the difference in diameter between the outside diameter of the tread profile at the tire equatorial plane CL and the outside diameter at the tread edge P is small, and as a whole, the tread face has a flat (substantially parallel to the tire rotational axis) shape (see FIGS. 1 and 2). Furthermore, the volume (distance Gsh) of the tread rubber 15 at the shoulder portion is assured, and rigidity of the shoulder land portion 3 is assured. Thus, deformation of the shoulder portion is suppressed when the tire contacts the ground, and the strain of each of the belt plies 141 to 145 is reduced (see FIG. 4B). As a result, (1) the occurrence of separation of the peripheral rubber of the end portions of each of the belt plies 141 to 145 and (2) the occurrence of separation of the coating rubber between the adjacent belt plies 141 to 145 are suppressed.
Additionally, in the pneumatic tire 1, in FIG. 1, a tread width TW and a width Ws of the circumferential reinforcing layer 145 have a relationship satisfying 0.70≦Ws/TW≦0.90.
The tread width TW is the distance in the direction of the tire rotational axis between the left and right tread edges P, P, measured when the tire is assembled on a specified rim, inflated to a specified internal pressure and is in an unloaded state.
The width Ws of the circumferential reinforcing layer 145 is the distance measured between the left and right end portions of the circumferential reinforcing layer 145 in the tire rotation direction when the tire is assembled on a specified rim, is inflated to a specified internal pressure, and is in an unloaded state. The width Ws of the circumferential reinforcing layer 145 is the distance between the outermost end portions of the divided portions when the circumferential reinforcing layer 145 has a structure that is divided in the tire width direction (not illustrated in the drawings).
Moreover, a typical pneumatic tire has a left-right symmetrical structure centered on the tire equatorial plane CL, as illustrated in FIG. 1. As a result, the distance from the tire equatorial plane CL to the tread edge P is TW/2, and the distance from the tire equatorial plane CL to the circumferential reinforcing layer 145 is Ws/2.
In contrast, in a pneumatic tire having a left-right asymmetrical structure (not illustrated), the range of the ratio Ws/TW between the width Ws of the circumferential reinforcing layer 145 and the tread width TW is stipulated by conversion to half width based on the tire equatorial plane CL. Specifically, a distance TW′ (not illustrated) from the tire equatorial plane CL to the tread edge P and the distance Ws′ from the tire equatorial plane CL to the end portion of the circumferential reinforcing layer 145 are set so as to have the relationship satisfying 0.70≦Ws′/TW′≦0.90.
Further, in FIG. 2, a difference Dr between a radius R1 of the circumferential reinforcing layer 145 along the tire equatorial plane CL and a radius R2 at the end portion outward in the tire width direction (=R1−R2), and the width Ws of the circumferential reinforcing layer 145 have a relationship satisfying −0.010≦Dr/Ws≦0.010. When the sign of the difference Dr is positive, the radius R1 of the circumferential reinforcing layer 145 along the tire equatorial plane CL is larger than the radius R2 at the end portion, and, in a state illustrated in FIG. 2, the circumferential reinforcing layer 145 corresponds to a downward curve to the right. In contrast, when the sign of the difference Dr is negative, in the state illustrated in FIG. 2, the circumferential reinforcing layer 145 corresponds to an upward curve to the right.
The radii R1, R2 of the circumferential reinforcing layer 145 are measured as a distance from a tire rotational axis to a center line of the circumferential reinforcing layer 145, when viewed as a cross-section from the tire meridian direction, when the tire is assembled on a specified rim, inflated to a specified internal pressure, and no load is applied.
Further, in FIG. 2, a distance Dcc along the tire equatorial plane CL from the circumferential reinforcing layer 145 to the tread profile, and a distance De from the end portion of the circumferential reinforcing layer 145 to the tread profile have a relationship satisfying 0.95≦De/Dcc≦1.05. As a result, the circumferential reinforcing layer 145 is disposed substantially parallel to the tire rotational axis.
The distance Dcc and the distance De are respectively measured as distances, when viewed as a cross-section from the tire meridian direction, between a virtual line, which links an outer side surface in the tire radial direction of the group of belt cords disposed at respective positions of the circumferential reinforcing layer 145, and the tread profile, when the tire is assembled on a specified rim, inflated to a specified internal pressure, and no load is applied.
Furthermore, in the pneumatic tire 1, the width Wb1 of the large angle belt 141 and the width Wb3 of the narrower cross belt 143 of the pair of cross belts 142, 143 preferably have a relationship satisfying 0.85≦Wb1/Wb3≦1.05 (see FIG. 3). As a result, the ratio Wb1/Wb3 is made appropriate.
The width Wb1 of the large angle belt 141 and the width Wb3 of the cross belt 143 are measured as the distance in the tire width direction when the tire is assembled on a specified rim, inflated to a specified internal pressure, and no load is applied.
In the configuration in FIG. 1, the belt layer 14 has a structure with left-right symmetry around the tire equatorial plane CL as illustrated in FIG. 3, and the width Wb1 of the large angle belt 141 and the width Wb3 of the narrower cross belt 143 have a relationship satisfying Wb1<Wb3. As a result, an edge portion of the large angle belt 141 is disposed inward of the edge portion of the narrower cross belt 143 in the tire width direction in a region on either side of the tire equatorial plane CL. However, the configuration is not limited thereto, and the width Wb1 of the large angle belt 141 and the width Wb3 of the narrower cross belt 143 may have a relationship satisfying Wb1≧Wb3 (not illustrated in the drawings).
Moreover, the belt cords of the large angle belt 141 are preferably steel wire, and the large angle belt 141 preferably has the number of ends from 15 ends/50 mm to 25 ends/50 mm both inclusive (see FIGS. 4A and 4B).
Moreover, the belt cords of the pair of cross belts 142, 143 are preferably steel wire, and the pair of cross belts 142, 143 preferably have the number of ends from 18 ends/50 mm to 28 ends/50 mm both inclusive. Also, the belt cords that constitute the circumferential reinforcing layer 145 are steel wire, and the circumferential reinforcing layer 145 preferably has the number of ends from 17 ends/50 mm to 30 ends/50 mm both inclusive. As a result, the strengths of the belt plies 141, 142, 143, 145 are properly assured.
Moreover, a modulus E1 at 100% elongation of the coating rubber of the large angle belt 141 and a modulus Es at 100% elongation of the coating rubber of the circumferential reinforcing layer 145 preferably have a relationship satisfying 0.90≦Es/E1≦1.10 (see FIGS. 4A and 4B). Moreover, moduli E2, E3 at 100% elongation of the coating rubbers of the pair of cross belts 142, 143, and the modulus Es at 100% elongation of the coating rubber of the circumferential reinforcing layer 145 preferably have a relationship satisfying 0.90≦Es/E2≦1.10 and 0.90≦Es/E3≦1.10. Moreover, the modulus Es at 100% elongation of the coating rubber of the circumferential reinforcing layer 145 preferably is in a range of 4.5 MPa≦Es≦7.5 MPa. As a result, the moduli of the belt plies 141, 142, 143, 145 are made appropriate.
The modulus at 100% elongation is measured in a tensile test at ambient temperature in conformance with JIS K6251 (using dumbbell no. 3).
Moreover, a breaking elongation λ1 of the coating rubber of the large angle belt 141 is preferably equal to or greater than 200% (see FIGS. 4A and 4B). Moreover, breaking elongations λ2, λ3 of the coating rubbers of the pair of cross belts 142, 143 are both preferably equal to or greater than 200%. Furthermore, a breaking elongation Xs of the coating rubber of the circumferential reinforcing layer 145 is preferably equal to or greater than 200%. As a result, the durability of the belt plies 141 142, 143, 145 is properly assured.
Breaking elongation is measured by performing a tensile test on a test sample of the JIS-K7162 specification 1B shape (dumb bell shape with a thickness of 3 mm) using a tensile tester (INSTRON5585H manufactured by Instron Corp.) conforming to JIS-K7161 at a pulling speed of 2 mm/min.
Elongation of the belt cords that configure the circumferential reinforcing layer 145, when the belt cords are components, is preferably from 1.0% to 2.5% both inclusive when the tensile load is from 100 N to 300 N, and when the belt cords are of a tire (when removed from the tire), the elongation is preferably from 0.5% to 2.0% both inclusive when the tensile load is from 500 N to 1000 N. The belt cords (high elongation steel wire) have good elongation ratio when a low load is applied compared with normal steel wire, so they can withstand the loads that are applied to the circumferential reinforcing layer 145 during the time from manufacture until the tire is used, so it is possible to suppress damage to the circumferential reinforcing layer 145, which is desirable.
The elongation of the belt cord is measured in accordance with JIS G3510.
Also, as illustrated in FIG. 3, the circumferential reinforcing layer 145 is preferably disposed inward of the left and right edge portions of the narrower cross belt 143 of the pair of cross belts 142, 143 in the tire width direction. Also, preferably the width Wb3 of the narrower cross belt 143 and the distance S from the edge portion of the circumferential reinforcing layer 145 to the edge portion of the narrower cross belt 143 have the relationship 0.03≦S/Wb3≦0.12. As a result, the distance between the end portions of the width Wb3 of the cross belt 143 and the end portions of the circumferential reinforcing layer 145 are properly assured. This point is the same even if the circumferential reinforcing layer 145 has a divided structure (not illustrated on the drawings).
The distance S of the circumferential reinforcing layer 145 is measured as a distance in the tire width direction when the tire is assembled on a specified rim, inflated to a specified internal pressure, and no load is applied.
Further, in the configuration in FIG. 1, the circumferential reinforcing layer 145 is constituted by a single steel wire wound in a spiral manner, as illustrated in FIG. 3. However, the configuration is not limited thereto, and the circumferential reinforcing layer 145 may also be configured by a plurality of wires wound spirally around side-by-side to each other (multiple winding structure). In this case, preferably, the number of wires is 5 or less. Additionally, the width of winding per unit when five wires are wound in multiple layers is preferably not greater than 12 mm. As a result, a plurality of wires (from 2 to 5 wires both inclusive) can be wound properly at a slant within a range of ±5° relative to the tire circumferential direction.
Additionally, in the configuration in FIG. 2, the circumferential reinforcing layer 145 is disposed interposed between the pair of cross belts 142, 143 (see FIG. 2). However, the circumferential reinforcing layer 145 is not limited as such, and may also disposed outward of the pair of cross belts 142, 143 (not illustrated on the drawings) in the tire radial direction. Additionally, the circumferential reinforcing layer 145 may also be disposed inward of the pair of cross belts 142, 143. For example, the circumferential reinforcing layer 145 may be (1) disposed between the large angle belt 141 and the inner-side cross belt 142, or (2) disposed between the carcass layer 13 and the large angle belt 141 (not illustrated on the drawings).
Additionally, in the pneumatic tire 1, the breaking elongation of the tread rubber 15 is preferably not less than 350%. As a result, the strength of the tread rubber 15 is assured and the occurrence of tears in the outermost circumferential main groove 2 is suppressed. Further, the maximum breaking elongation of the tread rubber 15 is not specifically limited, but is constrained by the type of rubber compound of the tread rubber 15.
Furthermore, in the pneumatic tire 1, the hardness of the tread rubber 15 is preferably within a range of not greater than 70. As a result, the strength of the tread rubber 15 is assured and the occurrence of tears in the outermost circumferential main groove 2 is suppressed. Further, the maximum hardness of the tread rubber 15 is not specifically limited, but is constrained by the type of rubber compound of the tread rubber 15.
Here, “rubber hardness” refers to JIS-A hardness in accordance with JIS-K6263.
[Round Shaped Shoulder Portion]
FIG. 6 is an explanatory view of a modified example of the pneumatic tire depicted in FIG. 1. FIG. 6 illustrates a configuration having a shoulder portion with a round shape.
In the configuration in FIG. 1, the shoulder portion has a square shape, in which the tire ground contact edge T and tread edge P are in accord, as illustrated in FIG. 2.
However, the shoulder portion is not limited as such, and may also have a round shape, as illustrated in FIG. 6. In such a case, an intersection P′ is taken from the tread portion profile and the side wall portion profile when viewed as a cross-section from the tire meridian direction, and the tread edge P is taken as the bottom of a perpendicular line drawn from the intersection P′ to the shoulder portion. Therefore, the tire ground contact edge T and the tread edge P normally are in mutually different locations.
[Belt Edge Cushion Two-Color Structure]
FIG. 7 is an explanatory view of a modified example of the pneumatic tire depicted in FIG. 1. FIG. 7 is an enlarged view of an end portion of the belt layer 14 outward in the tire width direction. The circumferential reinforcing layer 145 and the belt edge cushion 19 in FIG. 6 are indicated by hatching.
In the configuration illustrated in FIG. 1, the circumferential reinforcing layer 145 is disposed inward of the left and right edges of the narrower cross belt 143 of the pair of cross belts 142, 143 in the tire width direction. The belt edge cushion 19 is disposed sandwiched between the pair of cross belts 142, 143 at a position corresponding to the edge portion of the pair of cross belts 142, 143. Specifically, the belt edge cushion 19 is disposed outward of the circumferential reinforcing layer 145 in the tire width direction so as to be adjacent to the circumferential reinforcing layer 145, and extends from the end portion outward of the circumferential reinforcing layer 145 in the tire width direction to the end portion outward of the pair of cross belts 142, 143 in the tire width direction.
In the configuration illustrated in FIG. 1, the belt edge cushion 19 has a structure that is thicker as a whole than the circumferential reinforcing layer 145 due to the thickness increasing toward the outer side in the tire width direction. The belt edge cushion 19 has a modulus E at 100% elongation that is lower than the coating rubber of the cross belts 142, 143. Specifically, the modulus E at 100% elongation of the belt edge cushion 19 and a modulus Eco of the coating rubber have a relationship satisfying 0.60≦E/Eco≦0.95. As a result, there is an advantage that the occurrence of separation of rubber materials between the pair of cross belts 142, 143 and in a region outward in the tire width direction of the circumferential reinforcing layer 145 is suppressed.
Conversely, according to the configuration illustrated in FIG. 7, the belt edge cushion 19 in the configuration illustrated in FIG. 1 has a two-color structure composed of a stress relief rubber 191 and an edge portion relief rubber 192. The stress relief rubber 191 is disposed between the pair of cross belts 142, 143 outward of the circumferential reinforcing layer 145 in the tire width direction so as to be adjacent to the circumferential reinforcing layer 145. The edge portion relief rubber 192 is disposed between the pair of cross belts 142, 143 outward of the stress relief rubber 191 in the tire width direction at a position corresponding to the edge portion of the pair of cross belts 142, 143 so as to be adjacent to the stress relief rubber 191. Therefore, when viewed as a cross-section from the tire meridian direction, the belt edge cushion 19 has a structure composed by disposing the stress relief rubber 191 and the edge portion relief rubber 192 side to side in the tire width direction to fill a region from the end portion of the circumferential reinforcing layer 145 outward in the tire width direction to the edge portion of the pair of cross belts 142, 143.
Additionally, a modulus Ein at 100% elongation of the stress relief rubber 191 and the modulus Es at 100% elongation of the coating rubber of the circumferential reinforcing layer 145 have a relationship satisfying Ein<Es in the configuration in FIG. 7. Specifically, the modulus Ein of the stress relief rubber 191 and the modulus Es of the circumferential reinforcing layer 145 preferably have a relationship satisfying 0.6≦Ein/Es≦0.9.
Moreover, in the configuration illustrated in FIG. 7, a modulus Ein at 100% elongation of the stress relief rubber 191 and the modulus Eco at 100% elongation of the coating rubber of the cross belts 142, 143 have a relationship satisfying Ein<Eco. Specifically, the modulus Ein of the stress relief rubber 191 and the modulus Eco of the coating rubber preferably have a relationship satisfying 0.6≦Ein/Eco≦0.9.
Additionally a modulus Eout at 100% elongation of the end portion relief rubber 192 and the modulus Ein at 100% elongation of the stress relief rubber 191 preferably have a relationship satisfying Eout<Ein in the configuration in FIG. 5. Additionally, the modulus Ein at 100% elongation of the stress relief rubber 191 preferably is within a range of 4.0 MPa≦Ein≦5.5 MPa.
Since the stress relief rubber 191 is disposed outward of the circumferential reinforcing layer 145 in the tire width direction in the configuration illustrated in FIG. 7, shearing strain of the peripheral rubbers between the edge portion of the circumferential reinforcing layer 145 and the cross belts 142, 143 is alleviated. Moreover, since the end portion relief rubber 192 is disposed at a position corresponding to the edge portions of the cross belts 142, 143, shearing strain of the periphery rubbers at the edge portions of the cross belts 142, 143 is alleviated. Accordingly, separation of the periphery rubber of the circumferential reinforcing layer 145 is suppressed.
Effect
As described above, the pneumatic tire 1 includes a carcass layer 13, a belt layer 14 disposed outward of the carcass layer 13 in the tire radial direction, and a tread rubber 15 disposed outward of the belt layer 14 in the tire radial direction (see FIG. 1). Moreover, the belt layer 14 is formed by laminating the pair of cross belts 142, 143 having a belt angle with an absolute value from 10° to 45° both inclusive and mutually opposite signs, and the circumferential reinforcing layer 145 having a belt angle within a range of ±5° relative to the tire circumferential direction (see FIG. 3). Moreover, the distance Gcc from the tread profile to the tire inner circumferential surface along the tire equatorial plane CL and the distance Gsh from the tread edge P to the tire inner circumferential surface have a relationship satisfying 1.10≦Gsh/Gcc (see FIG. 2).
In such a configuration, because the ratio Gsh/Gcc is set to a high value, the tread face as a whole has a flat (substantially parallel to the tire rotational axis) shape, and further, the volume of the tread rubber 15 (distance Gsh) at the shoulder portion is assured (see FIGS. 1 and 2). As a result, due to the fact that the strain of each of the belt plies 141 to 145 is reduced when the tire contacts the ground (see FIG. 4B and FIG. 5), there is an advantage that the belt-edge-separation resistance performance of the tire is improved.
Additionally, in this pneumatic tire 1, the tread width TW and the width Ws of the circumferential reinforcing layer 145 have the relationship satisfying 0.70≦Ws/TW≦0.90 (see FIG. 1). In such a configuration, due to the fact that the ratio Ws/TW between the tread width TW and the width Ws of the circumferential reinforcing layer 145 is made appropriate, there is an advantage that separation of the edge portion of the circumferential reinforcing layer 145 is suppressed. Specifically, by satisfying the relationship 0.70≦Ws/TW, the width Ws of the circumferential reinforcing layer 145 is appropriately assured, and the strain of the end portions of the surrounding belt plies 142, 143 is appropriately suppressed. Also, by satisfying the relationship Ws/TW≦0.90, due to the fact that the deformation of the end portions of each of the belt plies when the tire contacts the ground is suppressed, the strain of the end portions of each of the belt plies is reduced.
Further, in the pneumatic tire 1, the difference Dr (=R1−R2) between the radius R1 of the circumferential reinforcing layer 145 in the tire equatorial plane CL and the radius R2 at the end portion outward in the tire width direction, and the width Ws of the circumferential reinforcing layer 145 have a relationship satisfying −0.010≦Dr/Ws≦0.010 (see FIG. 2). In such a configuration, the ratio Dr/Ws between the shoulder rounding amount (the difference Dr) of the circumferential reinforcing layer 145 and the width Ws is made appropriate. Specifically, due to the fact that the ratio Dr/Ws is set within the above-described range, there is no curving of the circumferential reinforcing layer 145 and it is disposed in a flat manner in the tire width direction. In this manner, the strain of the end portion of the circumferential reinforcing layer 145 is reduced when the tire contacts the ground. As a result, there is an advantage that the belt-edge-separation resistance performance of the tire is improved.
Furthermore, in the pneumatic tire 1, the belt layer 14 includes the large angle belt 141 having a belt angle with an absolute value from 45° to 70° both inclusive (see FIGS. 1 and 3). As a result, due to the fact that the belt layer 14 is reinforced, there is an advantage that strain of the end portions of the belt layer 14 when the tire contacts the ground is suppressed.
Also, in the pneumatic tire 1, the belt cords of the large angle belt 141 are steel wire, and the large angle belt 141 has the number of ends from 15 ends/50 mm to 25 ends/50 mm both inclusive. As a result, there is an advantage that the number of ends of the belt cords of the large angle belt 141 is made appropriate. Specifically, the strength of the large angle belt 141 is appropriately assured due to the large angle belt 141 having at least 15 ends/50 mm. Moreover, due to the fact that the number of ends of the belt cords is not greater than 25 ends/50 mm, the rubber amount of the coating rubber of the large angle belt 141 is appropriately assured, and separation of the rubber materials between the adjacent belt plies (the cross belt 142 in FIG. 2) is suppressed.
Furthermore, in the pneumatic tire 1, the width Wb1 of the large angle belt 141 and the width Wb3 of the narrower cross belt 143 of the pair of cross belts 142, 143 have a relationship satisfying 0.85≦Wb1/Wb3≦1.05 (see FIG. 3). With such a configuration, the ratio Wb1/Wb3 between the width Wb1 of the large angle belt 141 and the width Wb3 of the narrower cross belt 143 is made appropriate. As a result, there is an advantage that the strain of the end portions of the belt layer 14 when the tire contacts the ground is suppressed.
| common_corpus | {'identifier': 'US-201214435145-A_1', 'collection': 'USPTO', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '2012.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '7483', 'token_count': '9528', '__index_level_0__': '1346', 'original_id': '1ff6c1878f7a4efafd36b310d7e6fba624b00127ffde52cb887747dc3b6eaf21'} |
• Playlist
• Download
• Embed
• Transcript
Meet Adam Wolf*, your asset protection adviser. (*Not his real name.) via Global Wealth Protection hide caption
itoggle caption via Global Wealth Protection
"That's always a big concern," says Bobby Casey, managing director at a company called Global Wealth Protection.
Bobby Casey lives in Latvia. The director of operations at his company goes by "Adam Wolf," but that's not his name. There's a photo of Adam Wolf on the website, but you can't see his face. He's riding a motorcycle, dressed in black, wearing a helmet and sunglasses.
Asset protection is one of those professions where you can make enemies. Bobby Casey says he's simply trying to help people build a fortress around wealth they've earned.
Say you own a piece of property with a few rental units, and you're worried about a lawsuit from a tenant who claims to have slipped on the stairs.
First step, place the property into a legal entity into a trust. Then, when a lawyer looks for who owns the building, all he finds is the trust. The lawyer has to go get a court order to get the trust document, which is when he encounters the second layer of your financial fortress. The trust is owned not by you, but by some company in Delaware. That company also doesn't have your name attached to it.
"It's kind of like Alice in Wonderland down the rabbit hole," Casey says. "It makes it very complicated to chase down owners."
The whole point is to put up barriers to discourage people from suing you. Casey recommends all his clients keep some money out of the country entirely — perhaps by setting up a shell company on the Caribbean island of Nevis with a bank account in Latvia.
Now a lawyer trying to penetrate your fortress might have to fly to Nevis. And then, even if the gets what he wants there, he would have to go to Latvia.
Bobby Casey paints a picture of a world with two kinds of people in it: People with money, and people who sue the people with money.
But, I asked Casey, isn't the point of the court system to sort that out? Isn't he helping people hide assets that actually should go to other people?
"I would say there is way more frivolous, unjustified litigation in the U.S. than there is justified litigation," he said.
That's debatable. What's not debatable: All these tricks are within the law. "It's legal," one lawyer said to me. "Is it moral? That's a question for the bishop."
Correction: Due to an editing error, an earlier version of this story incorrectly said that Bobby Casey is not Bobby Casey's real name. It is his real name.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '139', 'language_id_whole_page_fasttext': "{'en': 0.9691336750984192}", 'metadata': "{'Content-Length': '65214', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:B6MEUVK5Y4ZPCQJXZFBCLQILLUPU46SZ', 'WARC-Concurrent-To': '<urn:uuid:7f9447a7-13c8-4ef1-bcc0-fb289e189dec>', 'WARC-Date': datetime.datetime(2015, 6, 3, 10, 6, 8), 'WARC-IP-Address': '72.247.9.89', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:GK3SE2HWGDJYDK4Z7QO2FGOGOH6I33FR', 'WARC-Record-ID': '<urn:uuid:7ec41ccc-a83b-44bc-bec9-e81a43ce9216>', 'WARC-Target-URI': 'http://www.npr.org/sections/money/2012/09/28/161913466/they-wont-tell-you-their-names-but-theyll-help-you-hide-your-money', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:86475a0c-b8ec-4b0c-b823-10e1fa749aca>', 'WARC-Truncated': None}", 'previous_word_count': '598', 'url': 'http://www.npr.org/sections/money/2012/09/28/161913466/they-wont-tell-you-their-names-but-theyll-help-you-hide-your-money', 'warcinfo': 'robots: classic\r\nhostname: ip-10-180-206-219.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-22\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for May 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03872275352478027', 'original_id': '6f0ed11e4420a01f8ebe9edd81907076662efd1f5486c4a614ae017f271cd7ae'} |
Church bulletin:
I am writing this devotional having had several late nights and then broken sleep once I dozed off. This morning I felt so tried it was almost like being ill. Dr Kelly Bulkelley on the Psychology Today website makes this observation:
There is some natural variability and flexibility in the sleep cycle, hence people can go 24 or more hours without sleep in the right circumstances, without any lasting harm other than additional “rebound” sleep the next time they are able to sleep normally. However, if a person is deprived of sleep for longer than that, several mental and physical problems begin to develop. The first signs of sleep deprivation are unpleasant feelings of fatigue, irritability, and difficulties concentrating. Then come problems with reading and speaking clearly, poor judgment, lower body temperature, and a considerable increase in appetite. If the deprivation continues, the worsening effects include disorientation, visual misperceptions, apathy, severe lethargy, and social withdrawal.
To sleep well and feel rested is a wonderful blessing which can easily be taken for granted. The Bible indicates that rest is God’s gift. Psalm 127:2, “……He gives His beloved sleep” God provides for us physically and emotionally in many ways, including granting rest to our minds and bodies. At the same time we also have a part to play in this. Just as we are to work in order to receive our daily bread so we have a responsibility to ensure that we get necessary rest. Here are a few exhortations in this regard:
* Don’t continually stay up too late. How many times do we burn the midnight oil doing nothing in particular or doing things which we could have done earlier. Psalm 127:2, “It is vain for you to rise up early, to sit up late, to eat the bread of sorrows; for so He gives His beloved sleep.”
* Pray that God would refresh you and invigorate you as you sleep. We are to pray for our daily needs, one of which is to have the physical strength and mental alertness to take up our responsibilities. Psalm 23:2-3, “He makes me to lie down in green pastures; He leads me beside the still waters. He restores my soul……….”
* Learn to cast your cares upon the Lord before retiring to bed. A mind churning over with worry or burdened by the busyness of life will rob us of a peaceful night’s sleep. Psalm 55:22, “Cast your burden on the Lord, and He shall sustain you; He shall never permit the righteous to be moved.”
Tiredness makes spiritual disciplines difficult; furthermore, when we are tired we are more susceptible to the schemes of the evil one. Temptation often comes calling when we are at our weakest. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '119', 'language_id_whole_page_fasttext': "{'en': 0.9579269289970398}", 'metadata': "{'Content-Length': '27452', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:CTEGJZ4F7VH4HE2STMIZVHGJGWBAU3MI', 'WARC-Concurrent-To': '<urn:uuid:77233cf5-d30c-42e9-863d-3539e9d22bb3>', 'WARC-Date': datetime.datetime(2018, 12, 13, 13, 47, 51), 'WARC-IP-Address': '192.186.216.229', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:4R6RWGJQP7XWM7MRHQ7D3JQAVHH6VZOP', 'WARC-Record-ID': '<urn:uuid:cbfaaf73-ece5-4ed2-ac81-d391600f4eea>', 'WARC-Target-URI': 'http://sdreformedbaptist.org.au/?p=2497', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:702e91ca-7e1e-4a5e-8bc3-2e620a16cdac>', 'WARC-Truncated': None}", 'previous_word_count': '450', 'url': 'http://sdreformedbaptist.org.au/?p=2497', 'warcinfo': 'isPartOf: CC-MAIN-2018-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-179-113-199.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.024422764778137207', 'original_id': '4db9451a6c346f67eb1c05d2b5cee42e8eb5e9a77b617ca263c2f4672c554e7e'} |
87th Annual Academy Awards - ShowThere may have been few surprises among the winners at Sunday night's Academy Awards, but one surprise was how political their speeches were. After all, in recent years, political statements have largely been unwelcome guests at the Dolby Theater.
In past years, artists from Vanessa Redgrave to Richard Gere to Michael Moore have been criticized for using their time at the Oscar podium to raise controversial issues before a worldwide audience. In an evening of glitz, glamour, and self-congratulation, mentioning the sometimes cruel realities of life beyond Hollywood Boulevard makes winners seem like party poopers. Mentioning God, your cast and crew, your spouse and kids, and Harvey Weinstein is fine, but mentioning the plight of migrant farm workers is a little too much reality for the dream factory.
Nonetheless, several winners at the 87th annual Oscar ceremony used their victory speeches to mention causes important to them. Some of those causes were at least relevant to the movies they were being recognized for, and some were not. But in a year when the Academy was taken to task for its dearth of minority nominees, and when actresses used the #AskHerMore hashtag to prompt red-carpet interviewers to ask them about their achievements instead of treating them as walking fashion mannequins, it's understandable that winners would feel encouraged to be more vocal about their politics. Here's what the issue-minded winners had to say; judge for yourself if they did their causes a favor by touting them at the Oscars.
1. Patricia Arquette
The "Boyhood" Best Supporting Actress winner ended her speech with calls for wage equality and equal rights for women. Many viewers probably wondered what these issues had to do with her role as a mom in "Boyhood." She did imply a connection between motherhood and her pet issues: "To every woman who gave birth, to every taxpayer and citizen of this nation, we have fought for everybody else's equal rights," she said. "It's our time to have wage equality once and for all and equal rights for women in the United States of America."
2. Mat Kirkby and James Lucas
The Oscar-winning live-action short "The Phone Call" is about a suicide hotline, a topic close to the hearts of filmmakers Kirkby and Lucas. Though Kirkby started his speech with a joke that his Oscar entitled him to a free donut at his favorite bakery, he turned serious, saying, "We'd like to thank all the volunteers around the world in crisis centers who give their time for nothing, including our mums."
3. Ellen Goosenberg Kent and Dana Perry
Kent and Perry won the Best Documentary Short prize for "Crisis Hotline: Veterans Press 1." Director Kent said that the honor "really goes to the veterans and their families who are brave enough to seek help." The topic of suicide is one producer Perry knows all too well; her son Evan killed himself at 15, an event that was the subject of her 2009 film "Boy Interrupted." In her brief remarks on behalf of "Crisis Hotline," Perry said, "We should talk about suicide out loud."
4. Laura Poitras
Poitras won the Best Documentary Feature prize for "Citizenfour," chronicling her interview with fugitive National Security Agency leaker Edward Snowden. "The disclosures that Edward Snowden reveals don't only expose a threat to our privacy but to our democracy itself," she said. "When the most important decisions being made affecting all of us are made in secret, we lose our ability to check the powers that control. Thank you to Edward Snowden for his courage and for the many other whistleblowers. And I share this with Glenn Greenwald and other journalists who are exposing truth."
5. Common and John Legend
When they won Best Original Song for "Glory," their tune from "Selma," both men emphasized that the movie about the civil rights protest in Alabama 50 years ago remains relevant today. Common said that the Edmund Pettus Bridge, where the bloody confrontation depicted in "Selma" took place, is now a symbol of hope. "The spirit of this bridge connects the kid from the South Side of Chicago dreaming of a better life to those in France standing up for their freedom of expression, to the people in Hong Kong protesting for democracy." Legend noted that the Voting Rights Act -- the legislation passed as a result of the Selma march -- was now being weakened (thanks to a 2013 Supreme Court decision that all but overturned the 1965 law). He also observed that America is "the most incarcerated country in the world. There are more black men under correctional control today than were under slavery in 1850." The musicians' speeches echoed the theme of the movie and the song, that the battle for human rights continues.
6. Graham Moore
Moore, who won Best Adapted Screenplay for "The Imitation Game," noted that his film's subject, World War II codebreaker and computing pioneer Alan Turing, never got to bask in adulation at a podium like the one at the Dolby Theater; instead, he was persecuted by the British legal system and hounded to suicide because he was gay. In perhaps the night's most moving speech, Moore noted just how personal Turing's story was for him because "when I was 16 years old, I tried to kill myself because I felt weird, and I felt different, and I felt like I did not belong. And now I'm standing here." He encouraged kids who feel like he did to stick around and do something great so that they, too, can be recognized for their achievement and pass the message of hope on to a new generation. "Stay weird," he advised. "Stay different."
7. Julianne Moore
Moore won Best Actress for playing an early-onset Alzheimer's patient in "Still Alice." Said Moore, "I'm thrilled that we were able to shine a light on Alzheimer's disease, So many people who have this disease feel marginalized. People who have Alzheimer's disease deserve to be seen so we can find a cure."
8. Eddie Redmayne
Like Julianne Moore, "The Theory of Everything" star Redmayne won his lead acting prize for playing someone with a debilitating ailment -- Amyotrophic Lateral Sclerosis-afflicted physicist Stephen Hawking. "This Oscar belongs to all of those people around the world suffering with ALS," Redmayne said. "It belongs to one exceptional family -- Stephen, Jane and the Hawking children," Of the Oscar trophy, he said. "I will be his custodian."
9. Alejandro Gonzalez Iñarritu
The "Birdman" filmmaker, who took home three trophies (for Best Original Screenplay, Best Directing, and Best Picture), noted that he was the second Mexican in a row to win the Directing prize. (Last year, his pal Alfonso Cuaron won for "Gravity.") In his Best Picture speech, Iñarritu called for justice for Mexicans, both at home and in the United States. He expressed a wish that his countrymen in Mexico could "find and build a government that we deserve." As for Mexicans in America, he said, "I just pray they can be treated with the same dignity and respect of the ones that came before and built this incredible, immigrant nation." | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '166', 'language_id_whole_page_fasttext': "{'en': 0.9794102311134338}", 'metadata': "{'Content-Length': '114006', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QJZBP6MCAGELMO6S5KYKKG6VRZ54JI4H', 'WARC-Concurrent-To': '<urn:uuid:ce246d8a-c9de-4666-912d-07a4d62fc847>', 'WARC-Date': datetime.datetime(2018, 10, 17, 0, 44, 6), 'WARC-IP-Address': '52.14.209.190', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:I5R2AFZS6LLX2K4JEYDFO7XYI34LK2D5', 'WARC-Record-ID': '<urn:uuid:82df2326-f3cd-4bb2-9d02-17a7d73e488d>', 'WARC-Target-URI': 'https://www.moviefone.com/2015/02/23/oscars-2015-politically-charged-acceptance-speeches/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f323e8dd-b21a-4ef1-b1b4-5c92628222f0>', 'WARC-Truncated': None}", 'previous_word_count': '1145', 'url': 'https://www.moviefone.com/2015/02/23/oscars-2015-politically-charged-acceptance-speeches/', 'warcinfo': 'isPartOf: CC-MAIN-2018-43\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for October 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-69-127-157.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.036712646484375', 'original_id': 'abb281d09412b1d5963dee40287e38516a9fbe3745fc57d2f041edf17f38213b'} |
Q:
c:\...\source\repos\HelloWorld\Debug\HelloWorld.exe (process 3764) exited with code 0
I have a little issue with my first time programming.
I get that message
is that ok to get "c:\users\amittler\source\repos\HelloWorld..."?
thanks for your help
A:
Yes, it's OK to get this.
Your IDE is just telling you that the program finished running. And I presume that all your program does is printing "Hello World!", so it's finishing a split second after that.
"c:\users\amittler\source\repos\HelloWorld..."?
This is the location of your program. When your IDE is done building it, it has to put it somewhere before it can run it, and that's where it went.
(process 3764)
Your computer can do many things (seemingly) at once, and all these things running at the same time get a process number. It's basically an identification. It's telling you the process number that your program run had. Most of the time, you won't be needing this information.
exited with code 0
This means that your program has ran successfully. Actually, it's dependent on what you return in your main function. The convention is that 0 stands for success and everything else denotes an error. For instance, if a different program was calling your program and got a 0 back it knows it went well, otherwise it might react accordingly.
| mini_pile | {'original_id': '3b752e158a5671fb63c07e4228131cf7e1edb780f29f3c5da4f966fa011c41bd'} |
MEMORANDUM OPINION AND ORDER GRANTING IN PART AND DENYING IN PART THE TRUSTEE'S MOTION FOR SUMMARY JUDGMENT
DALE L. SOMERS, Bankruptcy Judge.
This adversary proceeding is brought by Christopher J. Redmond, in his capacity as the Trustee of the bankruptcy estate of Alexico Corporation (hereafter "Trustee"), against Debtor John William Karr (hereafter "Karr" or "Debtor"), the sole director, shareholder, and officer of Alexico Corporation (hereafter "Alexico"). The Trustee objects to Karr's discharge under two subsections of 11 U.S.C. § 727 and, in the alternative, to the dischargeability of Karr's debts to Alexico under two subsections of 11 U.S.C. § 523.
The Trustee has moved for summary judgment as to discharge under § 727(a)(7) (which incorporates § 727(a)(2)(A)) and § 727(a)(5), and as to dischargeability under § 523(a)(4) and § 523(a)(6). The Debtor opposed the motion, and also filed a motion to strike more than half of the Trustee's statements of uncontroverted facts for alleged noncompliance with Local Bankruptcy Rule 7056.1. By separate order, the Court has denied the motion to strike. The Trustee filed a reply brief. The Debtor, without seeking the Court's approval, then filed a sur-reply brief, which the Trustee moved to strike. By separate order, the Court has sustained the motion to strike. The Court will disregard the Debtor's sur-reply brief.
FINDINGS OF UNCONTROVERTED FACTS.
A. THE TRUSTEE'S MOTION IS BASED UPON THE FOLLOWING UNCONTROVERTED FACTS.
From December 2, 2004, when a suit by a former stockholder of Alexico against Karr and Alexico was settled, Karr was the sole director, shareholder and officer of Alexico. Karr was the ultimate decision maker. On January 5, 2009, Karr filed a voluntary petition for relief under Chapter 7. On February 16, 2009, Alexico filed a voluntary petition under Chapter 7. Plaintiff Christopher J. Redmond was appointed trustee in the Alexico ease.
Alexico's primary business was the sale of certain automotive-related insurance, warranties, and service contract products to automobile purchasers, through auto dealerships. As an administrative office for after-market warranties, Alexico issued various policies, including an anti-theft policy known as ThefMJard and Premium Care; a paint, fabric, and vinyl protection package known as Signature Finish; GAP coverage, which was Guaranteed Auto Protection; Travel-Gard, which was Tire and Wheel Protection; and Lease Edge and Executive Edge.
On October 8, 2003, Robert B. Sparks ("Sparks"), a former minority shareholder of the predecessor of Alexico, brought suit in Johnson County District Court against Alexico and Karr. Sparks's petition sought damages and equitable relief for breach of fiduciary duty, fraud, breach of contract, an accounting, unpaid dividends, conversion, promissory estoppel, and breach of the implied covenant of good faith and fair dealing, and sought to impose liability on Karr personally through an alter-ego or pierce-the-corporate-veil theory. The petition alleged that "Karr used Alexico as his personal piggy bank, drawing large sums of money from the company for personal expenditures and causing the company to purchase items and services intended only to benefit Karr and/or members of his family." Count II of Sparks's petition asserted a claim of fraud against Karr personally and alleged that in Alexico financial statements Karr presented to Sparks, he: (a) omitted the use of Alexico's assets to pay personal expenses of Karr; (b) omitted the extension of interest-free personal loans or advances by Alexico to Karr from corporate assets; (c) characterized and paid non-reimbursable personal expenses of Karr as reimbursable business expenses; (d) acquired assets through Alexico for the principal or sole purpose of benefitting Karr and his family personally, including but not limited to motor vehicles and an airplane; and (e) engaged in self-dealing in the assets and income of Alexico. Count II did not allege a claim against Alexico. On December 3, 2004, the District Court of Johnson County, Kansas, entered a final judgment in favor of Sparks on Count II of Sparks's petition, in the amount of $2,400,000.
Pursuant to an agreement between the parties, the Sparks judgment was kept under seal and was subject to the terms of a Mutual Release and Settlement Agreement ("Settlement") dated December 2, 2004. Among other things, the Settlement provided that the judgment in the amount of $2,400,000 would be entered "against both John W. Karr and Alexico Corporation . on Count II . [and] Sparks will voluntarily dismiss with prejudice the other claims in his First Amended Complaint." The agreement further provided the Judgment could be satisfied by Karr, defined to mean John W. Karr and Alexico Corporation, paying Sparks $1,650,000 in the form of a lump sum payment of $950,000 on December 15, 2004, plus 48 monthly installments of $19,791.67 on the fifteenth day of each month thereafter. If there was a material default and failure to cure, Sparks would be entitled to immediately execute on the entire judgment amount of $2,400,000. However, if all the payments required in the Settlement were made, the judgment would be deemed fully satisfied. Karr testified that he agreed to have a judgment against him for fraud to eliminate Sparks's concern that Karr could file bankruptcy after the settlement and thereby eliminate the debt. Karr's Statement of Financial Affairs states that nothing is still owing to Sparks.
Possibly as early as 2006, Alexico experienced apparent cash flow problems. Be ginning in 2005 and continuing into 2006, there were instances when checks prepared by Alexico's in-house accountant on a weekly basis needed to be held rather than sent immediately because there was not sufficient money in the Alexico operating account. Alexico's in-house balance sheets for June 30, 2005, September 30, 2005, and December 31, 2005, show negative cash balances in the operating account. This condition was also present in 2006 and 2007; for example, the negative balance in the operating account as of February 28, 2007, was $228,827.75. Alexico's 2005 tax return showed a negative equity position of $1,201,006, which increased to a negative $2,529,245 by year end 2006 and a negative $2,629,704 by year end 2007. Alexico's audited financial statement as of December 31, 2006, prepared by outside accountants, identified the total stockholder's deficit to be $5,199,274. The notes to the audited financial statement include the following:
As of the report date the Company continues its business operations despite difficulties with cash flow and a general downward movement in the automotive market.... The viability of continuing business operations is contingent upon the Company's ability to mange its relationships with reinsurers and agents under payment terms that will allow the Company to extend obligations until such time as cash flow allows repayment.
Karr admits that Alexico had cash flow problems and that he became aware of a serious cash flow problem by the summer of 2007. When insufficient cash was available to pay all creditors, Karr directed the in-house accountant which creditors to pay and when.
One of the reinsurers of Alexico's warranty products, Allstate, performed an internal audit of Alexico in September 2007. The report described Alexico's financial condition as "seriously impaired" and questioned whether Alexico could "continue as a going concern." The report stated that Alexico was delinquent on two invoices to Allstate amounting to over $600,000, and new invoices were about to be billed. In March 2008, Allstate re quired that commissions paid to Alexieo for the sale of products that Allstate insured be sent to a lockbox. This had a big adverse effect on Alexico's cash flow problems. At this time, another large reinsurer creditor was communicating with Karr about substantial outstanding obligations owed to it by Alexieo. During 2008, Alexi-co's accountant would have to hold back automatically-generated checks for so long that, by the time cash was available, the dates on the checks became an issue, and new checks were created before payment was sent.
Karr admits that he did not distinguish between himself and Alexico. From 2001 forward, Alexico's accountant paid Karr's personal expenses and the expenses of some of Karr's family members. Initially, the accountant had signatory authority for Karr's personal account at First National Bank, to which his salary was deposited and from which his bills were paid. An Advance to Officer Account was established in Alexico's books to show advances made to Karr in excess of his salary when Karr directed the cutting of a check for deposit to his personal account because its balance was not sufficient to cover his expenses. After Karr's personal checking account was garnished by the State of Kansas prior to December 2005, Karr directed the accountant to make his salary deposits as credits to the Advance to Officer Account and to pay his expenses through the Alexieo bank account, with appropriate debits to the Advance to Officer Account. At Karr's direction, Alexieo also made some deposits to the bank accounts and savings accounts of some of Karr's family members. The deposits were considered to be advances to Karr and were recorded in the Advance to Officer Account. For the period from July 2007 to June 2008, disbursements from the Advance to Officer Account exceeded credits for salary and capital distributions by an amount in excess of $450,000.
Karr was married at least three times to three different women, Sherry, Dawn, and Crystal Karr, and divorced from each of them. Maintenance payments to Sherry Karr of $7,500 per month were paid by Alexieo through 2008. Maintenance payments to Crystal Karr of $5,000 per month for 20 months commenced April 1, 2008, and some payments were made. Karr has two children, Austin and Alexis. In 2008, Karr continued to have Alexieo make payments for his daughter's BMW, auto insurance, and cable service, and deposits to her savings account. In 2008, Karr also continued to have Alexieo make payments on his own country club membership and for maintenance of his swimming pool.
Over the years of Alexico's operation, Alexieo acquired vehicles for Karr's personal use, including a Ferrari F430, a Ferrari Stradali, a Mercedes CLK63, an Aston Martin, and a Porsche, among others. Karr continued the purchase of luxury automobiles through August 2007. In 2008, Karr conveyed a corporate automobile to his latest ex-wife in their divorce settlement. The Mercedes SUV was worth $103,738.76 as shown on Alexico's July 2008 balance sheet, but was "awarded" to Karr's ex-wife sometime between that date and the September 30, 2008, balance sheet.
Karr received salary compensation from Alexieo that was in excess of $1 million each year from 2005 through 2007. He continued to take a salary until February 2008. Karr received capital distributions from Alexico in the amounts of $2,700,000 in 2005 and $1,500,000 in 2006.
The Allstate internal audit report from September 2007 included the following as a Critical Audit Finding: "Alexico also pays the owner['s] personal expenses. It was determined that insurance company funds are utilized to pay approximately $150,000 each month of the owner['s] personal expenses. The company only generates approximately $50,000 in operating profit from the business. Consequently, the advances paid to the stockholder approximate $76,000 per month plus a $20,000 per month legal settlement with an ex-employee causing the negative cash flow situation."
Starting in the fall of 2007, a portion of the premiums due to Old United, a rein-surer, were held back and those funds were used to pay other expenses, including Karr's divorce payments, the Sparks Settlement, and the IRS. Alexico continued to sell Travel-Gard warranties until it filed for bankruptcy on October 31, 2008. At that time, it was holding back checks for payments of Travel-Gard claims because it had insufficient cash.
Karr provided a personal financial statement to an individual and corporate creditor, Great Western Bank, as of July 12, 2007. The financial statement reported that Alexico was worth $5,000,000, and that Karr had personal property valued at $500,000 and artwork valued at $70,000.
B. DEFENDANT KARR'S STATEMENT OF FACTS SUBMITTED IN RESPONSE TO THE TRUSTEE'S MOTION.
Karr, when opposing the Trustee's motion, sets forth 30 paragraphs of statements of fact. The majority of these statements are nearly identical to those submitted in attempting to controvert the facts submitted by the Trustee in support of his motion for summary judgment. The Trustee controverts all but a few of Karr's statements.
Karr begins his statement of uncontro-verted facts with several statements about the December 2, 2004, settlement of the Sparks litigation, which the Court finds are not proper for inclusion in the statement of facts portion of a memorandum in opposition to a motion for summary judgment because they are in essence legal conclusions. The uncontroverted facts about the settlement are stated above. Karr's statement of facts includes the following: "Alexico and Karr were both responsible for making payments under the Settlement Agreement.... Because Alexi-co was liable under the Settlement Agreement, Sparks could have enforced the Settlement Agreement against Alexico if there was a default under the Settlement Agreement. . The lawsuit with Robert Sparks was a shareholder lawsuit." The Trustee controverts these statements, asserting that the Settlement Agreement and the payments are examples of Karr's use of corporate assets to satisfy his personal obligations, since the corporation was not a defendant in Count II, the count allegedly settled with Sparks. The Trustee also asserts that the complaint, although brought by a shareholder, involved more than a "shareholder suit." As to the additional "facts" provided by Karr, the Court finds that they evidence a legal dispute as to the legal impact of the Settlement, not additional uncontroverted facts.
Karr states as uncontroverted that he "does not recall when Alexico began experiencing cash flow issues; however, he believes that he first became aware of Alexi-co's cash flow issues in late 2007." This statement is controverted. As previously found, it is uncontroverted that Karr became aware of Alexico's cash flow problems by the summer of 2007. Karr further states that when he "became aware of Alexico's cash flow issues, he reduced his monthly salary from $80,000 to $33,000," and that he did not take a salary in May 2008. This statement is controverted. The Trustee, relying on the Advance to Officer Account transaction records, responds that Karr's salary was not reduced until February 2008, several months after he states he became aware of the cash flow issues, and that he took his salary as scheduled on May 15, 2008, and May 31, 2008.
Karr's statements about his attempt to sell the company are controverted. Karr states as follows:
After he was unable to secure the loan, Defendant Karr attempted to sell Alexi-co. In fact, Defendant Karr reached an agreement in principle with a company to purchase Alexico. However, the agreement fell through and Defendant Karr was unable to sell the business to the prospective purchaser. Mr. Karr believed that he could sell the business for between $8,000,000.00 and $10,000,000.00. Based upon this evaluation, Defendant Karr remained confident that he could sell Alexico and pay off its liabilities, including the Advance to Officer Account.
The Trustee asserts that these statements are controverted because they are supported only by self-serving, conclusory statements provided by Karr's affidavit, without any supporting details. The Trustee specifically controverts Karr's statement of the value of the business. As to the value of the business, Karr cites the Allstate audit, which in a box on the right margin of the document labeled "deleted" states: "The company is in dire need of a potential equity partner to secure additional funding, since it is estimated that the market value of Alexico's business is anywhere from $8 million to $10 million." As the Trustee points out, in the body of the audit, as opposed to the box labeled "deleted," the report states: "Currently, Alexico's financial condition is seriously impaired and there is a question as to whether [it] can continue as a going concern." The body of the report also states: "The most significant asset on Alexico's books is a $2.6 million Advance to Stockholder. It is not known if the owner of this Subchapter S-Corporation has any other assets to contribute as a capital infusion. The company requires an infusion of cash and is presently in a negative equity position of $2.8 million as per [its] June 30, 2007 balance sheet." The Court finds, as urged by the Trustee, that the Allstate audit does not provide a basis for a reasonable belief that Alexico could be sold for $8,000,000 to $10,000,000.
As to Karr's July 2002 financial statement presented to Great Western Bank, Karr submits the following as uncontro-verted facts. "The $500,000 figure listed on the July, 2007 financial statement he provided to Great West[ern] Bank was an estimation of the value of [his] personal property." The Trustee does not controvert this statement. Karr further states: "In the above referenced financial statement, Defendant Karr did not list any specific items of personal property." The Trustee responds, correctly, that the financial statement identified several items of personal property, including two automobiles, a 401k balance of $125,000, and artwork valued at $70,000. Karr further states: (1) "Any items of artwork listed on the financial statement were included in his bankruptcy schedules," (2) "Defendant Karr still has the artwork which he valued at $70,000.00 on the Great West[ern] Bank statement, except for two pieces which were sold," and (3) "The value of the artwork is currently significantly less than $70,000.00." As the Trustee points out, the foregoing are supported only by Karr's affidavit, with no specifics concerning valuations or past sales.
Karr's statement of uncontroverted facts includes the following regarding the Advance to Officer Account:
When Alexico did not have sufficient cash flow to pay all its creditors, Alexico had to decide which creditors to pay. Defendant Karr, rather than Alexico[,] paid his personal expenses. Defendant Karr[] directed Ms. Heermann to pay his personal expenses out of his Advance to Officer Account. Any salary owed Defendant Karr was credited to his [A]dvance to [O]fficer [A]ccount, and any personal expenses paid out of Defendant Karr's Advance to Officer Account in excess of his salary would remain in the Advance to Officer Account. Any dividend distributions listed on Alexico's Federal Income Tax Returns were not paid to Defendant Karr. Rather, they were used to pay down [his] Advance to Officer Account. Moreover, every single penny that entered into and exited the Advance to Officer Account was accounted for and its whereabouts explained.
These statements, when viewed simply as facts about Alexico's accounting procedures relating to the payment of Karr's personal expenses by the corporation, are the same as the uncontroverted facts found in the preceding section. As stated by Karr and not disputed by the Trustee, the Advance to Officer Account properly identifies and documents the transactions that flowed through the account. To the extent Karr's statements of fact vary from the uncontroverted facts found above, they are arguments as to the legal implications of the procedures and are not proper for inclusion in statements of fact submitted in response to a motion for summary judgment.
Karr's statement of uncontroverted facts includes several statements of his belief and intent. Karr states:
All actions in deciding which creditors to pay were made with the intent of continuing the business of Alexico with the ultimate goal of selling Alexico. I never took an action that I believed would harm Alexico or its value. Because I was the sole shareholder of Alexico, any harm to Alexico would have diminished the value of my stock in Alexico and directly harmed me.
The Trustee responds that these statements, which are supported only by Karr's affidavit, are contrary to the manner in which Karr operated Alexico, which in the Trustee's view harmed Alexico to the benefit of Karr personally. Whether they are sufficient to create a material fact in controversy will be discussed in the analysis section of this opinion.
ANALYSIS AND CONCLUSIONS OF LAW.
A. SUMMARY JUDGMENT AND BURDEN OF PROOF.
Rule 56 of the Federal Rules of Civil Procedure applies in adversary proceedings. Pursuant to that rule, a judgment sought by a properly filed and supported motion for summary judgment "should be rendered if the pleadings, the discovery and disclosure materials on file and any affidavits show that there is no genuine issue as to any material fact and that the movant is entitled to judgment as a matter of law." The provisions for denial of discharge of all debts under § 727 are "generally construed in favor of the debtor and strictly against the creditor." The same rule applies to determining whether a particular debt falls within one of the exceptions to discharge of § 523. As to both objections to the discharge of all debts and the excepting of specific debts from discharge, the objecting party has the burden of proving the objection by a preponderance of the evidence.
B. DENIAL OF DISCHARGE UNDER § 727(a)(7) AND § 727(a)(2)(A).
"Section 727(a)(7) extends the basis for denial of discharge [from misconduct in the debtor's own case] to the debtor's misconduct in a substantially contemporaneous related bankruptcy case." It provides:
(a) The court shall grant a debtor a discharge, unless—
(7) the debtor has committed any act specified in paragraph (2), (3), (4), (5), or (6) of this subsection, on or within one year before the date of the fifing of the petition, or during the case, in connection with another case, under this title or under the Bankruptcy Act, concerning an insider.
A commentator explains the operation of the exception as follows, "Thus, if the debtor engages in objectionable conduct in a case involving . a corporation of which the debtor is an officer, director or controlling person, the debtor may be denied a discharge in the debtor's own case."
Two requirements must be satisfied. The debtor must be an insider of the debtor in another case, and the debtor must have engaged in an act proscribed by § 727(a)(2), (3), (4), (5), or (6). For purposes of § 727(a)(7), "insider" is defined by § 101(31). Since Karr was the president, sole director, and sole stockholder of Alexico and controlled its business, this element is satisfied. To satisfy the second require ment for denial of discharge under § 727(a)(7), the Trustee alleges that Karr's conduct was objectionable under § 727(a)(2)(A), which provides:
(a) The court shall grant the debtor a discharge, unless—
(2) the debtor, with intent to hinder, delay, or defraud a creditor or an officer of the estate charged with custody of property under this title, has transferred, removed, destroyed, mutilated, or concealed, or has permitted to be transferred, removed, destroyed, mutilated, or concealed—
(A) property of the debtor, within one year before the date of the filing of the petition.
In this case, it is uncontroverted that Karr was an insider of Alexico. Thus, if, within one year before the date of the filing of the Alexico petition, Karr transferred property of Alexico in violation of § 727(a)(2)(A), Karr may be denied a discharge in his own Chapter 7 case. The elements of a § 727(a)(2)(A) claim are: (1) The debtor or his duly authorized agent transferred, removed, destroyed, mutilated, or concealed (2) property of the debtor, (3) within one year prior to the bankruptcy filing, (4) with the intent to hinder, delay, or defraud a creditor. To deny a discharge under this subsection, the court must find " 'actual intent to defraud creditors.' " "Fraudulent intent of course may be established by circumstantial evidence, or by inferences drawn from a course of conduct." "The initial burden is upon the objecting creditor to establish reasonable grounds for believing the bankrupt has committed acts which will prevent his discharge.... [T]he bankrupt must then assume the burden of showing that the transfer was justified under all the circumstances."
Since Karr was an insider of Alexico, the elements required for denial of Karr's discharge under § 727(a)(7) are: (1) that Karr transferred substantial assets of Alexico to himself or to others for his benefit; (2) that such transfers occurred at Karr's direction; (3) that such transfers occurred within one year of Alexico's bankruptcy filing on February 16, 2009, and (4) that such transfers were made with intent to hinder, delay, or defraud creditors of Alexico.
Here, the uncontroverted facts clearly establish that within one year prior to Alexico's filing, under Karr's direction, substantial funds from Alexico's operating account in excess of Karr's salary were transferred for Karr's benefit. During this time period, as previously found, Karr admits that he did not distinguish between himself and Alexico, and all of his personal expenses were paid from Alexico's operating account, with appropriate entries to Alexico's Advance to Officer Account. The charges to the Advance to Officer Account exceeded the credits by more than $450,000 from July 2007 to June 2008. Karr's personal obligations paid by the corporation during 2008 included maintenance payments to two ex-wives, his country club membership and pool maintenance expenses, payments for Karr's daughter's BMW, auto insurance, and cable service, and deposits to her savings account. In 2008, Karr conveyed a corporate Mercedes SUV, valued at $103,738.76, to his latest ex-wife in their divorce settlement.
The Court does not include payments on the Sparks Settlement in the transfers for Karr's benefit which satisfy the elements of § 727(a)(2)(A). The Court finds that there are controverted issues of fact concerning Alexico's liability under the Settlement. It is true that Alexico was not a defendant in Count II of the Sparks complaint under which the Settlement states liability was agreed to, but Alexico was a defendant in other counts which were dismissed. These additional counts may have had value which for convenience was wrapped into the settlement of Count II against Karr. Without further evidence concerning the merits of Sparks's lawsuit and the intent of the Settlement, the Court can not determine whether Alexico's alleged liability to Sparks was based upon corporate wrongdoing, or whether the inclusion of Alexico as a liable party under the Settlement is further evidence of Karr's fraudulent conduct. There are disputed issues of material fact as to whether payments on the Sparks Settlement were payments to a creditor of Alexico rather than fraudulent transfers for the benefit of Karr.
The circumstantial evidence establishes that the transfers for the benefit of Karr were made with intent to hinder, delay, or defraud Alexico's creditors. From at least late 2005 forward, Alexico, at Karr's direction, paid all of Karr's personal expenses. Alexico began experiencing cash flow problems as early as 2006, yet Karr was credited with a salary in excess of $1,000,000 each year from 2005 to 2007. The practice of Alexico paying all of Karr's expenses continued after the summer of 2007, when Karr admits that he was aware of Alexico's cash flow problems. In September 2007, when Alexico was delinquent on two invoices to Allstate amounting to over $600,000, Allstate, a reinsurer of Alexico, conducted an audit of Alexico. The audit described Alexico's financial situation as "seriously impaired." It noted that the payment of Karr's personal expenses using insurance company funds was occurring, and that the excess of these expenses over the company's operating profit was causing a negative cash flow situation. After the audit, in March 2008, Allstate required that commissions paid to Alexico be forwarded to Allstate through a lockbox arrangement. This change made the cash flow situation worse. During 2008, Alexico's accountant would have to hold back automatically-generated checks for so long that by the time cash was available to pay them, the dates on the checks became an issue and new checks were created before payment was sent. Another large insurer, in addition to Allstate, began communicating with Alexico regarding a substantial outstanding obligation. However, despite all of these events indicating that Alexico had insufficient funds to pay both its creditors and Karr's personal expenses, Karr did not stop the practice of having Alexico pay his personal expenses.
For the foregoing reasons, the Court concludes that the Trustee has made out a prima facie case that Karr should be denied a discharge under § 727(a)(7) because as an insider of Alexico, within the year preceding Alexico's bankruptcy, Karr, with the intent to delay payment of Alexico's creditors, directed the transfer of Alexico's assets for his own benefit and the benefit of his family, within the meaning of § 727(a)(2)(A).
Karr has not satisfied his burden to justify the transfers. Karr does not contest the fact that he was an insider or that substantial transfers from the Alexico operating account were made for his benefit when Alexico had cash flow issues and was not paying all of its creditors. His first defense is a legal one, the argument that there is no § 727(a)(2)(A) violation since the property in issue was not his own property. The Court rejects this position since it totally ignores the fact that the Trustee is proceeding under § 727(a)(7), which provides that if a debtor engages in objectionable conduct in a case concerning a corporation of which the debtor is an insider, the debtor may be denied a discharge in the debtor's own case. Under this theory, the relevant transfers are transfers of Debtor Alexico's property, not Debtor Karr's property.
Karr's second defense is also legal. Karr argues that he "was not using Alexico funds for these personal expenses," since they were charged to the Alexico Advance to Officer Account. The Court denies this defense. It is uncontroverted that the personal expenses were paid from the Alexico operating account; there was a transfer of Alexieo's property. The fact that the payments were fully accounted for by entries to Alexico's Advance to Officer Account does not change their nature.
As to Karr's third defense, the Court finds no issues of material fact exist concerning Karr's intent to hinder, delay, or defraud Alexico's creditors. The evidence of substantial payments from Alexico's assets for Karr's benefit is uncontroverted. The only evidence offered by Karr of actions, taken after he became aware of the cash flow issues in the summer of 2007, that allegedly negate an intent to hinder, delay, or defraud Alexico's creditors is that Karr reduced his salary in March 2008 and allegedly received no salary in May 2008. However, Karr has admitted that he knew of the cash flow problems since at least the summer of 2007, so that response was significantly delayed. Further, assuming that his salary was reduced in response to Karr's learning of the cash flow problems, since there is no evidence that the reduction was accompanied by a termination of Alexico's practice of paying all of Karr's expenses, even in excess of his salary, the reduction of the salary had no impact on the availability of funds to pay Alexico's creditors. Karr offers no evidence that payments to creditors of Alexico were ever favored over payment of his personal expenses. Therefore, to the extent there are controverted facts about Karr's salary, those controversies are not material to the finding of a violation of § 727(a)(2)(A).
As to Karr's fourth defense, the Court finds no issue of material fact arising from Karr's argument that he was obligated to and fully intended to repay the advances. Although legally Karr was obligated to repay the advances, Karr offers no evidence that he ever repaid any of the advances made by the corporation, even in part, or that he acknowledged his obligation to do so before Alexico filed for bankruptcy relief. There are no contemporaneous promissory notes or minutes of corporate meetings evidencing that the advances were considered loans. The only evidence which Karr offers to show his acknowledgement of his duty to repay the corporation are statements in his affidavit that he attempted unsuccessfully to get a loan and that even though one sale of Alexico fell through, he "fully anticipated that he could sell Alexico and pay off its existing liabilities, including the Advance to Officer Account." This defense is unsuccessful. It does not address the prima facie case that the advances were fraudulent when taken; at most it indicates after-the-fact acknowledgment of an obligation to restore the corporation for his wrongful prior acts. Any controversies concerning the alleged intent to obtain a loan and then to sell the company are not material to finding a violation of § 727(a)(2)(A).
For the foregoing reasons, the Court finds that the Trustee is entitled to summary judgment on his objection to Karr's discharge under § 727(a)(7) because of the fraudulent transfers of Alexico's property, made at Karr's direction, within one year of Alexico's petition date with intent to hinder and delay Alexico's creditors, within the meaning of § 727(a)(2)(A). Karr has failed to justify the transfers.
C. DENIAL OF DISCHARGE UNDER § 727(a)(5).
Subsection 727(a)(5) provides that a debtor shall be granted a discharge unless "the debtor has failed to explain satisfactorily, before determination of denial of discharge under this paragraph, any loss of assets or deficiency of assets to meet the debtor's liabilities." "[Noticeably lacking from § 727(a)(5) is any element of wrongful intent, or, for that matter, any affirmative defenses — § 727(a)(5) simply imposes strict liability." "A party objecting to a debtor's discharge under § 727(a)(5) has the burden of proving facts establishing that a loss or shrinkage of assets actually occurred. However, once the objecting party meets its initial burden of proof, the burden then shifts to the debtor to explain the loss or deficiency of assets in a satisfactory manner." The explanation must be more than a "vague explanation" unsupported by "documentation or some other corroboration." The explanation should be "sufficient to enable either the trustee or a creditor to properly investigate the circumstances surrounding the loss or deficiency."
In this case, the Trustee asserts that Debtor should be denied a discharge under § 727(a)(5) because he has failed to satisfactorily explain the discrepancy between the report of his ownership of personal property valued at $500,000, plus artwork valued at $70,000, in his financial statement as of July 12, 2007, and the disclosure of personal property totaling only $132,925.42 on his bankruptcy schedules filed on January 5, 2009, including "CD's; Art; Collectibles" valued at $500.
Karr responds that the Trustee has not made an essential element of his case since he has not identified "a specific fund or an identifiable piece of property" as the basis for his objection. The Court disagrees. First, the Trustee's objection is based in part on a very specific asset, artwork, which was valued at $70,000 on the financial statement and at less than $500 on Debtor's schedules. Second, the financial statement sufficiently identifies specific assets, since it included $500,000 of personal property in addition to other assets of $25,000 in cash, $5,000,000 in securities, a $1,4000,000 homestead, $100,000 worth of other real estate, and two specific automobiles. The $500,000 value was therefore attributable to personal property other than cash, securities, artwork, and automobiles. The Court finds this description sufficiently specific.
Since the Trustee has identified specific assets which were present approximately 18 months before filing and are not included in Debtor's schedules, the burden shifts to Debtor to adequately explain the loss. This Debtor has failed to do. As to the artwork, Debtor states by affidavit that "[a]ny items of artwork listed on the financial statement were included in his bankruptcy schedules," "Defendant Karr still has the artwork which he valued at $70,000.00 on the Great West[ern] Bank statement, except for two pieces which were sold," and "[t]he value of the artwork is currently significantly less than $70,000.00." He provides no other details, such as what artwork was included in the $70,000 valuation and what artwork has been sold, to whom, and for what amount. Karr provides no details as to the artwork remaining, or any evidence other than his general statement as to its value. Further, Karr makes no attempt whatsoever to explain the apparent loss of almost $500,000 of other personal property. Debtor's response does not satisfy the minimum requirements to avoid denial of discharge under § 727(a)(5).
D. EXCEPTION TO DISCHARGE-ABILITY FOR DEBTOR'S DEBT TO ALEXICO UNDER § 523(a)(4).
The Trustee also moves for summary judgment under § 523(a)(4), which provides that a Chapter 7 discharge does not discharge any debt "for fraud or defalcation while acting in a fiduciary capacity." "Although the question of fiduciary status under this provision is one of federal law, state law is an important factor in determining when a trust relationship exists." Alexico is a Nevada corporation. Under Nevada common law, an officer or director serves as a fiduciary to the corporation. The Nevada Supreme Court has recognized that " 'A director is a fiduciary.... So is a dominant or controlling stockholder or group of stockholders.... Their powers are powers in trust.' "
Commentators agree that for purposes of § 523(a)(4), the relationship of a corporate officer to the corporation commonly imposes a fiduciary relationship. Officers of corporations "are fiduciaries as to corporate stockholders as well as to the corporation itself with respect to funds controlled by them." "Corporate officers and directors are widely viewed as acting as fiduciaries with respect to their corporation," and the "[n]ondischargeable liability of corporate officers to the corporation, or its trustee in bankruptcy,. is well established."
As stated by a former judge of this Court in 1983, "it has long been settled that a corporate officer is a 'fiduciary' of the corporation, within the meaning of § 523(a)(4) and § 17(a)(4), its predecessor section under the Bankruptcy Act of 1898." Application of this rule to facts similar to this case is illustrated by In re Decker. Debtor Decker was the president and principal manager, as well as a shareholder and director, of Black's, Inc. Despite Black's poor financial condition, Decker withdrew substantial funds from Black's for his personal use and for his purchase of Black's stock. Although the debts were fully and accurately reflected upon the books, records, and accounts of Black's, which were available for inspection by interested persons, Decker did not specifically disclose the transfers to the other directors or sign promissory notes for the money. In Decker's subsequent bankruptcy, Black's objected to discharge of Decker's debt to it. The Court rejects Karr's defense that "fiduciary" for purposes of § 523(a)(4) is so narrowly construed as to exclude Karr's relationship to Alexico. The primary case Karr relies upon is In re Cantrell, a Ninth Circuit case where judgment creditors objected to the discharge of a debtor-corporate-officer's debt arising from misappropriation of corporate assets. The court found no fiduciary relationship for purposes of § 523(a)(4) because under California law, while corporate officers "possess the fiduciary duties of an agent, they are not trustees with respect to corporate assets." Of course, this case is not controlled by California law.
The Court also rejects Karr's further argument that a § 523(a)(4) fiduciary relationship exists only when there is an express or technical trust, an argument derived from the Supreme Court's decision in Davis. This requirement has been applied by the Tenth Circuit to find that there was no fiduciary relationship between a corporate officer of a construction company and the owner of four-plexes with whom the corporation contracted. The Tenth Circuit has also found no fiduciary duty between a corporate officer and a minority stockholder. But this rule requiring an express or technical trust does not apply when a corporation, rather than a corporate creditor or individual shareholder, objects to the discharge of a corporate officer's debt to it. "[W]hen the [Supreme] Court interpreted the meaning of the term 'fiduciary capacity' to require a technical or express trust, . the Court did not mean to say that an officer of a corporation was not a fiduciary." Such an interpretation would be contrary to the settled rule that a corporate officer is a fiduciary of the corporation, within the meaning of § 523(a)(4) and its predecessor under the Bankruptcy Act of 1898.
The second element of the Trustee's objection to the discharge of Karr's debt to Alexico is whether there was a defalcation. The Tenth Circuit BAP has held that " 'defalcation' under section 523(a)(4) is a fiduciary-debtor's failure to account for funds which have been entrusted to it [sic] due to any breach of fiduciary duty, whether intentional, wil[l]ful, reckless, or negligent." This standard requires no "mental culpability on the part of the debtor-fiduciary." "Any failure to maintain the standard of care attributable to a fiduciary is a bad act that is nondischargeable under section 523(a)(4)."
There is no question that the actions of Karr creating his liability to Alexico were defalcations. Karr converted corporate assets to his own and his family's use while corporate creditors went unpaid, thereby breaching his duty of care, loyalty and good faith to Alexico. He continued this conduct while he knew that his personal expenditures were causing a severe financial burden. The fact that the corporation kept records of the funds advanced in breach of Karr's fiduciary duty does not mean that there was no defalcation. Even assuming, as contended by Karr, that the excess payments were loans, there is no evidence of notes or an agreement as to the terms of repayment. As a fiduciary, Karr had a duty not to loan corporate assets on a less than arm's-length basis.
The Trustee is entitled to summary judgment on his claim of exception to discharge under § 523(a)(4). The uncontro-verted facts establish that Karr's debts to the Alexico estate were incurred by defalcations committed when Karr was acting as a fiduciary to Alexico.
E. DISCHARGEABILITY OF KARR'S DEBTS TO ALEXICO PURSUANT TO § 523(a)(6).
| common_corpus | {'identifier': '3787301_1', 'collection': 'Caselaw Access Project', 'open_type': 'Open Government', 'license': 'Public Domain', 'date': '2011.0', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '6868', 'token_count': '9416', '__index_level_0__': '50653', 'original_id': 'baaa7b178c0d996804bc440e8d491745126356a34cd54e5a3be7735c0d7bcca7'} |
Billy Madison
Revealing mistake: On Billy's first day of school when he is outside waiting for the bus and it just passes him you hear the noise of kids on a bus, but when it passes no one is in it.
Continuity mistake: In the scene when Billy and the bad guy are facing off in the "learning decathalon" and they are doing some science stuff, Billy pulls a shoe out of the boiling pot - it is his right shoe but he has his right shoe on his foot too.
Continuity mistake: When Billy is in first grade, Miss Lippy sits all the kids down in a circle for story time. One little girl goes up to Billy and says, "You have a mis-shaped head.", while she stands in front of Billy. In the very next shot, you see her stepping over Billy's leg to sit in front of him. (00:18:50)
Continuity mistake: When Billy is on the bus and the kid dares him to touch Ms. Vaughn, when the camera is looking at the back of Billy's head, you can see in the background that Ms. Vaughn is 3 seats in front of him. Then after he tries to grab her and goes back to sit back down his seat is only 2 seats back.
Continuity mistake: When Billy and Veronica are singing when Billy decides to go back to school, Veronica is on the left side. While standing in front of the fountain, they turn to see the kids who are singing, but Billy and Veronica have switched positions. They are standing in the same spot, but since they've turned around, Billy should now be on the left and Veronica on the right.
Continuity mistake: After chasing the penguin, his shirt is unbuttoned and he falls. When Juanita pulls him off the ground and tells him to get dressed, his shirt is buttoned.
Continuity mistake: When Billy is chasing the penguin, he chases the penguin from the front yard and goes around to the back yard, but when he falls down attempting to grab the penguin, he appears at the front door and you can see when the limos stop, there's the gate where he ran over the flowers and the maintenance guy threw down the hoe.
Visible crew/equipment: When Billy shows that he stole the shirt from Frank and lifts it up, you can see the microphone wire on the side of his stomach.
Continuity mistake: In the scene where Veronica comes to Billy's house, tosses him in the pool and starts beating him up, watch the people on the side of the pool. First, the chubby guy and Frank are sitting in lounge chairs and you see a third person's legs on one of the chairs. Then the next time they cut to them, the third set of legs is gone, and Frank is lying on the chair where the legs were. When they cut back again, Frank is back in the first chair and there is no third pair of legs.
Revealing mistake: When the car is falling off the cliff you can clearly see that there is 1 person in the car, it's not packed with the whole family like before.
Visible crew/equipment: When the students go to Principal Anderson's house, you can see the shadow of a crew member in a room behind the principal.
Continuity mistake: When Billy puts a suntan lotion smiley on his chest it changes. One time it is running down and then not. (00:01:00)
Revealing mistake: When Eric gets mad at Max, chucks his stapler, and hits his secretary, the stapler is already on the floor when she gets hit. (01:04:45)
Continuity mistake: When Billy gets out of the pool he grabs his shirt twice between the shots. (00:01:30)
Mortug Premium member
Continuity mistake: When Billy is in 3rd grade, and Ms.Vaughn is sick and the class is going crazy, the kid dancing on the desk is on the left desk, and when the scene changes back to him he is on the right desk. (00:36:10)
Continuity mistake: When Billy opens the mailbox he place his hand on the lid. When it cuts his hand is under the lid. (00:02:15)
Mortug Premium member
Continuity mistake: When Ms.Vaughn goes to beat up Billy and he is sleeping on the ground he has the lobster float on his chest, but in the next shot it is around his neck, and then it isn't. (01:05:20)
Continuity mistake: When Billy is at the mailbox and he spots the penguin we can see a white can on the ground in front of the penguin. When it cuts to Billy starting to pursue the penguin, the can is gone. (00:03:10)
Mortug Premium member
Continuity mistake: Field trip scene, the bus driver throws the banana peel out the window of the school bus, you can see that there are no vehicles behind the bus. In all of the shots from inside the bus there is an entire line of cars behind the bus. (00:42:10)
Timothy Conard
Continuity mistake: When Billy, Frank, and that other guy throw pickles at the fast-food restaurant window to see which one will slide down the fastest, the pickles' respective positions on the window change significantly from when they're thrown to when the actual "race" is occurring. The position then changes again after the race is over and the pickles are still visible in the background. (00:08:50)
Join the mailing list
Add something
Buy the booksMost popular pagesBest movie mistakesBest mistake picturesBest comedy movie quotesMovies with the most mistakesNew this monthForrest Gump mistakesPirates of the Caribbean: The Curse of the Black Pearl mistake pictureM*A*S*H mistakesThe Game endingLilo & Stitch questionsDeadpool 2 triviaShrek quotesAvatar plotJim Carrey movies & TV shows50 mistakes in The SimpsonsStar Wars mistake video
More for Billy Madison
High School Principal: Mr. Madison, what you've just said, is one of the most insanely idiotic things I have ever heard. At no point in your rambling, incoherent response, were you even close to anything that could be considered a rational thought. Everyone in this room is now dumber for having listen to it. I award you no points, and may God have mercy on your soul.
Billy Madison: Ok, a simple "wrong" would have done just fine.
The picture of Billy that Eric is using to monitor Billy's progress from grade to grade is the same headshot photo that was used in Happy Gilmore for the signboards some people were carrying in the crowds. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '87', 'language_id_whole_page_fasttext': "{'en': 0.9587122201919556}", 'metadata': "{'Content-Length': '76471', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:S5D3XMF4D6VG4XUU6D2YXQHHPNRD2VYP', 'WARC-Concurrent-To': '<urn:uuid:892bf27e-8741-4635-89fc-bbc2fbed646a>', 'WARC-Date': datetime.datetime(2018, 9, 23, 2, 37, 39), 'WARC-IP-Address': '209.68.14.195', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:PR47U6TNEP4KAONFWOCOI4JZUFKTLO6M', 'WARC-Record-ID': '<urn:uuid:10b2c31b-1214-4531-b751-89ff39437b2e>', 'WARC-Target-URI': 'https://www.moviemistakes.com/film169', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ca1707ed-1548-4455-a53b-e5f630af89df>', 'WARC-Truncated': None}", 'previous_word_count': '1097', 'url': 'https://www.moviemistakes.com/film169', 'warcinfo': 'isPartOf: CC-MAIN-2018-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-47-244-60.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.029154479503631592', 'original_id': '8c430cdf6c44a6296e11a9423946ae513fbbe7f5871ecf7069f95b4db2fff65c'} |
Wednesday, July 29, 2009
Day 1 Nears End
Rub. I'll admit that upon first glance, I wasn't thrilled to be eating BBQ. Obviously had there been an "N Tug" appended to the name, I'd have sprinted to get there. I wasn't too far removed from my lunch, so I intended to eat light. Ha. Eat light. At Rub. The portions are pretty damned big. I ordered the smoked turkey, coleslaw and shredded onion rings because that's what people trying to get shredded do. If I were a connoisseur (did I just use that word?) of BBQ food, my opinion on the meal may have carried more weight. However, even still, based on what everyone else ordered, and the quality of the meat, I'll give it a thumbs up. Price tag was about $30 per person, give or take.
Interesting side note. AlCantHang turned down prop-bet money to eat the remaining 9 pieces of bacon he ordered. Yeah, I just outed you.
After dinner, the gang from media row went back to work, thinking there'd be another six or seven hours of play until the Noviembre Nueve were established. Sick bilingualism right there. Especially with the French word used 2 paragraphs ago. I'll pause here so you can digest it sufficiently. There.
I went back to the Rio poker room and sat my outclassed self at the 1-3 game. Even though I was outmatched at the 2-5 game that was still running, I nonetheless found that the 1-3 game continued to be easy and boring. I cashed out because when I looked at the LCD showing the available games, I saw something pretty inspiring. PLO. I bolted for the open seat.
I didn't win or lose much, but I had a ton of fun. It was the first B&M PLO experience for me, having only played it live at local home games. There was, and I kid you not, a blonde guy named Lars from Sweden raising every pot. Just like online. Unfortunately for him, he wasn't very good. At showdown, when his opponent tabled top two pair, he showed his 4 hole cards thinking he'd win the pot. AAJJ, with neither of those ranks on board. "I have a higher two-pair," he said. When he finally went bust (he had about $900 in front when I sat down), and I didn't get any of it, the game lost some of its flair.
Then, to pretty much every one's surprise, the Main Event was over before 11pm local time. That only meant one thing, off to the Hooker Bar and -EV games at the Gold Coast.
Monday, July 27, 2009
More Day 1
If you've ever listened to Bart Hanson's "Cash Plays" poker podcast, you'd be aware of one of his common themes while talking about playing no-limit hold 'em. Value. Every action you take, every bet, should be designed to earn you some value. I happen to agree with this concept and think that nowhere in the course of a hand is value more important than on the river.
The pots are bigger on the river. The decisions are therefore more important, especially when you are playing deep stacked. When I sat down at the 2/5 table at the Rio and bought in for $500, I committed mistake number one. While I certainly covered most players, there were two others with nearly $2000 in chips and $100 bills positioned in front of them. Both players were extremely aggressive, but the play of one of them stood out to me for the reason mentioned above. He was the best player I'd ever played with when extracting value on the river against his opponents.
He raised very frequently, opening for $20 if folded to him. Continuation bets were the norm and even when his opponents played back at him post flop or on the turn, he seemed to know exactly where he was in relation to their holdings. He must have made over $1000 on river bets alone in the time I sat there. Nearly each time he'd fire out a river bet, I was praying for his opponent to call because I was sure he was effectively bluffing. But each time he'd get called, flip up middle pair, 9-kicker, his opponent would simply muck. It was amazing, and I'll admit, a bit inspiring.
Meanwhile, I was sitting there making more mistakes.
I lost half my stack with AQ suited all-in preflop against a short stack who I felt was shoving out of frustration. Turns out he had Queens and I failed to suck out. The rest of my stack went away when I flopped top two pair against middle set. No 2-outer for me and I reloaded. I then just watched and learned since I was card dead and couldn't do much against the two aggressive players without putting my entire newly reloaded stack at risk.
Thankfully, I got the text from Otis that they were going on dinner break and eating at a place called Rub. Rather than dwell further on my miscues, I took the opportunity to join them. Missing out on eating with friends is one mistake I didn't want to make.
Friday, July 24, 2009
Preamble - Day 1
Day 1 as it were. The travel began early, I was up at 4:30 am to catch a 6:00 am flight out of friendly GSP. Thankfully, by the time I'd reach Las Vegas, absolutely nothing of note happened. I like that. No complications. I was travelling alone with a backpack and a carry-on and figured my free room hookup, otherwise known as Otis, would not yet be awake. After all, it was about 11:00am and when I boarded the plane back in Greenville, I was reading tweets from Pokerati and Pauly about some late night/early morning bowling. Surprisingly, Otis was awake and managed to beat me to the check-in line at Harrah's. With the room all taken care of, we ventured back to the Rio wherein the final day of the Main Event was progressing from 27 to 9 players.
Media row was pretty far removed from the action, but due to flat panel displays and relays from those close to the action, they could still keep tabs on the action. They were all there. Pauly, Al, Otis and his co-workers Stephen and Howard, Mean Gene, F-Train, Change100 and Jen. I hung out for a bit with no real rush to do anything. With the past year that I've gone through at work, just sitting around and relaxing was something I wasn't used to doing. What a welcome change that was.
Sensing that most everyone needed to get back to work at some point, I slithered away with plans to meet up later. I made a quick phone call to my grandmother who turned 97 that day. It's the small things that people appreciate and she certainly did enjoy talking to me from back in Florida. She wished me luck, I accepted it, and then I went to grab some grub at the All American Bar and Grille. First gambling of the trip was the video poker machine at the bar. Down a quick $20 with a steady drain of nothing cards. I sighed inside, but not too loudly. I did earn two free Heinekens. Like I said. The small things.
I found my way to the Rio poker room, a room I'd actually never played in. My only Rio poker play prior to this trip had been in the Amazon room. However, with just the Main Event going on, all poker action was relegated back to the normal, year-round location. I put my name on the 1/2 and 2/5 lists and waited.
I truly hate waiting. I am the worst at being patient when I have a pocket full of bills and a head full of monster pot daydreams. I couldn't sit down fast enough. And then when I did finally grab a seat at the 1/2 table, my anxiousness didn't go away. You see, the players at the 1/2 table I sat at were horrible. I can't describe to you how bad, but if you'll trust me enough, just understand that there was really no poker being played at the table. Mistake after mistake after mistake. I just sat there, not doing much of anything, except watching all the players make bet size and positional mistakes that would make you cringe.
Within the first orbit I was already up over $100. "That was easy," I thought, envisioning me pressing G-Rob's tilt-inducing Staples button. In fact, it might have been too easy. It bored me. I gazed over to the corner where the 2/5 game was playing and saw a seat open. My name got called, and I decided to rack up from the "boring" and "easy" game and sit at the 2/5 game.
Did I mention word mistake yet? Oh yes, just a few sentences ago. Luckily, I'm a pretty self-observant type of guy. I see myself making mistakes all the time. Even when I don't make mistakes, I over compensate and attribute them to myself anyway. Switching tables was a mistake. A big one. Word to the wise: Never play in the biggest game a poker room has to offer during mid-afternoon on a Wednesday. I failed miserably at table selection.
More to come...
Wednesday, July 22, 2009
I have a trip report to write. Suffice to say, it was an "ultimate" good time.
Wednesday, July 08, 2009
Spock's Brain
It's a conundrum of sorts. If you're out to make the best decisions, you need access to the correct data and a process to filter it, manipulate it, and correctly choose from a well-defined set of options. You don't want to guess. Guessing involves hope. Guessing is a conscious effort to ignore some of the data. Why would you ignore valid data? Because it leads you to a conclusion you simply don't want to be true.
Spock would be a great limit poker player. Decision after decision based purely on his logic-driven conclusions. No-limit? He might be pretty good at that as well. He wouldn't tilt, that's certain. His success would be based on his ability to read other players and their emotions while hiding his own. We know he can do the latter, but only the true Trekkie would know about the former. After all, he's no Troi.
I battle with myself each poker session. I make an attempt to train myself to ignore emotionally-driven feelings at the poker table. The lament of a crushing bad beat. The disappointment of a 5th straight losing session. The martyrdom of inevitably getting it in bad and not sucking out like your luckbox opponents seem to always do. All of those things, if they occupy any of your mental energy, detract from your ability to make the best decision.
Lately, I sure as hell know what the worst decision is.
It's horrible. In theory, I want a smooth call by yours truly to frighten my opponents. But lately I've been calling too much and you can't scare everyone with a call when your frequency is so high.
Back to the conundrum. When can you take emotion completely out of your game? For one, by lowering the stakes. If you play at stakes far below your norm, your interest in the results go down. You've eliminated the negative emotions associated with losing when the magnitude is irrelevent.
But unfortunately, you've also eliminated the positive emotions of winning. And there's the catch. Why do you play? Do you play to win, or simply be right? Because you can be right and lose. A lot. So if you get no satisfaction from being right, then you're going to run into situations where the reason you're playing gets lost and the negativity of the results has no positive counterbalance.
Each action at the poker table is like a question on a test. What's the right answer? Can you figure it out? Why are you taking the test? To get a good score, or because it's an opportunity to learn?
Poker for me is a dichotomy of searching for that satisfaction of being right which requires me playing at stakes that mean something and the quelling of emotions that cloud my ability to make the best decision.
I need risk to feel the reward, but I don't want the feel of the risk to effect my ability to earn that reward.
Crazy game. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9857627749443054}", 'metadata': "{'Content-Length': '83099', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:BR3IL6LFPYZMMBGPOAQOUUFGJX4ZWK5K', 'WARC-Concurrent-To': '<urn:uuid:792b6789-9548-4016-bcb7-cd4bb3702989>', 'WARC-Date': datetime.datetime(2014, 12, 22, 2, 44, 12), 'WARC-IP-Address': '74.125.228.108', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:2TPIU6SQRYNS6P2PGCBUAE7XKKIAPFFW', 'WARC-Record-ID': '<urn:uuid:2e23180a-281c-4b0c-84d4-20ddad2bc81d>', 'WARC-Target-URI': 'http://badbloodonpoker.blogspot.com/2009_07_01_archive.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:04e76361-8859-42e7-ae52-c1f15e05addc>', 'WARC-Truncated': 'length'}", 'previous_word_count': '2062', 'url': 'http://badbloodonpoker.blogspot.com/2009_07_01_archive.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-231-17-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-52\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for December 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03196471929550171', 'original_id': 'd419a4772b8f9dec1bfe4eaab2fc36359b52f4e565857d7c576fc9695d1d9551'} |
Monday, February 15, 2016
Happy (late) Chinese New Year!
Chinese New Year was last Monday, and Biscuit's class at school had a parade, sang a song in Chinese and learned how to say, "Gong Hey Fat Choy," which is what people say to each other on that day. I've seen different translations of it, and best I can tell, it's a wish for a prosperous year.
All the other students were allowed to step out of their classrooms and line the walls while the first-graders brought their parade through. And parents were invited, too.
The kindergartners seemed amazed by the whole thing, and it was hard to imagine that Biscuit was that little just last year. The first-graders seem so much more mature this year. And the older kids, make a big fuss over the little ones, which is really nice.
Here they come. No chance of seeing Biscuit here. His class was last.
They wore dragon hats and carried instruments they made. The glued
together two paper plates with beads and strings on the side. When they
twisted them back and forth, the beads banged on the plates like drums.
I liked the little curls on the back of their hats.
We were able to take him home with us after the parade.
I thought he would be excited, but he was disappointed because
he wouldn't get to see his friends in his afterschool group.
Since it was a Monday, Biscuit had a piano lesson, then we went to one of our favorite restaurants where they were celebrating, too.
You might remember from last year, but this guy with a large full-head mask came walking into the restaurant with a big staff. After him, a couple of guys with traditional drums and cymbals came in. Then a dragon/lion creature that danced around the restaurant.
The lion costume had two people in it. The front guy was able to stand up. He operated the head, complete with blinking eyes and a mouth that opened and closed. The guy in the back had to walk stooped over as the back part of the animal. Every once in a while, a different couple of guys would trade places with them, and I was impressed about how seamless it was.
The performers were from a local kung fu business, and they were doing a lot of fancy moves. It was fun to watch them.
The guy with the mask on came around and stirred up trouble. He would use his staff and lift little kids' jackets off their chairs. He lifted a woman's pocketbook off her chair. It was fun to watch him.
And the lion played with the kids, too. It was moving, moving, moving, but when they saw someone trying to take a picture, they would stand perfectly still and tilt the head. It was a cute little pose. When it got to our table, it propped its head on the back of the booth and acted very coy while I took a couple of pictures.
And speaking of pictures, here are a few:
This guy was a troublemaker. He
went around messin' with people!
This boy was waiting quite impatiently for the lion to head our way.
We got little red envelopes we could use for a tip for the lion.
Then it would come around and take it out of your hand.
Biscuit was a little tentative and kept pulling his hand back.
It nodded its head and blinked in thanks for the envelope.
This is not a great picture, but can you see how long this thing is?
Dancing, bobbing, swooping and generally getting down.
Hello, lion. It's posing for a picture.
A little blink for me. Very sweet.
No comments: | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9900344610214232}", 'metadata': "{'Content-Length': '87838', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:IZ5LB4PQ65NHUZWNVVNESSZI56HURNCB', 'WARC-Concurrent-To': '<urn:uuid:863649ff-d8e5-4751-accd-29f090dfaf07>', 'WARC-Date': datetime.datetime(2017, 2, 24, 21, 49, 24), 'WARC-IP-Address': '172.217.2.193', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:LMTKDVK3ASHSESXKXWOZ2ODYTNGFRSXB', 'WARC-Record-ID': '<urn:uuid:5b17228f-9485-4bef-9224-7e7cd364df10>', 'WARC-Target-URI': 'http://bringingupbiscuit.blogspot.com/2016/02/happy-late-chinese-new-year.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:19b51d4b-aaa3-4cf5-85bd-4c687b430f16>', 'WARC-Truncated': None}", 'previous_word_count': '621', 'url': 'http://bringingupbiscuit.blogspot.com/2016/02/happy-late-chinese-new-year.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-171-10-108.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-09\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web for February 2017\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.024909555912017822', 'original_id': '4c5c57985566b0df456a8044b0d20c6b514ae04ceffc3bedf13d59aa9bb7f53f'} |
Lag: What Causes It- A treatise j
We all know what lag is- and we often blame Funcom servers-
But, I have been researching (and catching up) on today’s computers (rigs) and have learned much so far-
I have even learned my rig is more powerful than I had believed, after checking some things I found I am running a 6 gig Ram, Dual Core AMD and Ratheon 7310 graphics.
I had thought, in my noob-ness, that my ram was low, which caused lag- but now, I think different. My lag is worse with the World Boss, sometimes a large raid or Raid Finder- but mostly WB (even all the tricks, particles off, names off, so on). And disconnects (the Bane of Unconqueored) are somewhat common- (which may be due to my ISP more than hardware)
To the Point- What Causes Lag?
1. Ram
2. ISP
3. Graphics Card
4. Funcom Servers
5. Single/Dual/Multi-Core
Any advice is appreciated, and my heartfelt thanks to those that already have helped my on my quest for a more current understanding of computers.
Graphics is Radeon not ratheon.
In my experience from different games I’ve played lag is usually due to:
#2 ISP & the route and the nodes along the route your packages take to the server.
#3 The WB lag is probably a combination of package routing due to many players in same instance and also extra heavy on the Graphics Card, due to having many players on screen at the same time.
In large raids the mobs creates the extra load to the GC. Tho this is usually more an issue of low FPS than real lag.
I haven’t reached the Bane of Unconqueored, so I can’t say anything about that particular issue.
Edit: I know there is a graphics booster program for AoC, my friend uses it and it apparently reduces load times and gives better graphics even on low settings. Can’t reach him atm, but I’ll add the name of the program as soon as I get in touch with him.
1. Ram: 6GB should be plenty ! it is easy to check : play then alt-tab to windows task manager, check the performance tab -> memory : if it’s almost completely used, you probably miss some.
2. ISP: this is the most reasonable explanation. the previous post by @Gleb_Reawer gives a good explanation.
3. Graphics Card: easy to test and fix by lowering graphics options
4. Funcom Servers: that happens, when EVERYONE in the instance freeze and when you can play again, the fight didn’t evolve at all (look at health bars, if the opponents and allies didn’t take any damages for exemple).
5. Single/Dual/Multi-Core: low single thread performance is bad for many (if not all) games of that generation
1 Like
There are really 2 different lag situations: 1) The server lags (the mods stop hitting, everyone in the raid/6 man instance red bars.) 2) You connection lags (mobs continue to beat on you).
There is also low FPS which looks like lag, but is really totally different.
Lag can be caused my many things. I dont want to burst your bubble but the specs you listed are far from powerful. I’m guessing you are running a laptop from the look of the spec. Dual core APU(cpu+gpu in one), you have E1-1200 or E1-1500 APU which runs a whopping 1.40ghz or 1.48ghz and it’s below both minimum and recommended specs from 2008, and this is 100% the cause of the lag you have when doing world boss or raids. You have a low speed dual core with an intergrated gpu, a quick google reveals the hd 7310 is “good” for 720p. You are probably running a very slow harddrive as well and this is another cause of lags because you need to load resources from the harddrive and it can only do that by the speed of your harddrive unless it’s stored in memory.
In your case I will rate the lag you experience is from
APU (3 & 5) - You are running ancient hardware
Funcom Servers (Unpredictable)
ISP (Your isp is most certainly running newer technology than funcom servers)
Ram (You got enough ram)
I saw your other thread asking for recommendations for building a new computer and most of your lags will be gone but you will still have a few that most of us encounter, aka the funcom servers.
1 Like
Thanks for the info! I know my rig is not powerful, but I think I said it was more powerful than I had thought or believed. No bubbles burst. It’s quite old by today’s standards, especially gaming.
I am catching up on knowledge from all the replies and now balancing budget v performance. Thanks to all for helping me move into the 21st century!I
I’ve been lucky enough to not have experienced server freeze yet.
I noticed the FPS drops first time entering Old Tarantia Tradepost and then turning my character around in circles on the stairs and reduced my graphics settings in order to try to have 40 FPS at minimum, while running around there.
I have had and still do have some places where the ping meter goes to 4800ms+, most of them disappeared by themselves but f.ex. the Sailor’s Den in the Docks still lags. Not sure why, but I suspect my HDD and will re-install game to a SSD, in hopes of getting rid of them.
Here is the link to the archived old forums that has the links to the graphics booster I told you about in my first reply. Hope it helps, my friend says it was as simple as copying the files to the right folder, no installation. But he might have used a different site to get the ReSahder.
I’m going to use it too when I finally get my lazy butt to re-install AoC to my SSD | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9520514607429504}", 'metadata': "{'Content-Length': '27293', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:F5FVDQWKTPQYGELYZ7FWF3JIGGYTYAFC', 'WARC-Concurrent-To': '<urn:uuid:aaa94e9b-dd42-426d-a7c9-e1a71aa1e323>', 'WARC-Date': datetime.datetime(2019, 12, 16, 10, 18, 54), 'WARC-IP-Address': '104.20.154.108', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:XDBPADPHDD3A3DM75KXJKZMY27TU3VMZ', 'WARC-Record-ID': '<urn:uuid:ab1e08dd-7ef6-4f87-8505-423459fffc54>', 'WARC-Target-URI': 'https://forums.funcom.com/t/lag-what-causes-it-a-treatise-j/94799', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:5f1691e4-abb4-4417-92c0-8e1123409d44>', 'WARC-Truncated': None}", 'previous_word_count': '964', 'url': 'https://forums.funcom.com/t/lag-what-causes-it-a-treatise-j/94799', 'warcinfo': 'isPartOf: CC-MAIN-2019-51\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for December 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-9.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04271697998046875', 'original_id': '2e2fd3eb2c14669fc53fa9798d7f247c1338393073263164551b435006cce2f7'} |
Driver in fatal wrong-way accident sentenced to 10 years
SEATTLE — A man who had gotten drunk, drove the wrong way on the SR 520 Bridge and plowed head-on into another car, killing the driver, tearfully apologized Friday before he was sentenced to 10 years in prison.
wrongwayMichael Robertson, 25, had pleaded guilty to the DUI vehicular homicide charge.
He was drunk and driving the wrong way on the SR 520 Bridge in April when he slammed head-on into another car, killing Morgan Williams, 58.
Robertson, who was still in a wheelchair from the accident, cried throughout his sentencing hearing Friday and apologized to the victim’s friends and family.
But Williams’ life partner, Jerry Esterly, told Robertson, “I generally start to cry at 3:30 in the afternoon when she’d come home from work, and the dog waits by the door. I cry and then nighttime comes and that’s when things get kind of tough.”
Last year, a new law was enacted that doubled the standard range for vehicular homicide, making it equal to manslaughter. That added two years to Robertson’s sentence.
• Guest
I agree with esco. The apology was good but too little too late. I hope he learns from this and never touches so much as a drop of alcohol again. Personally I don't think he got nearly enough time in prison but the judge did the best he could under the law as it now stands.
Yet another slap on the wrist courtesy of our so-called 'justice' system. If the actual penalty was life in prison, with no exceptions, we just might see far fewer of these drunken wrong-way fatalities.
• Wynne
10 years is too long. Deliberate homicide killers often get not much more than that–even less time.
This case is tragic. Tragic. Tragic. Tragic. It is obviously tragic for the victim and the victim’s loved ones. But the eagerness–the wanton desire to compound this tragedy further is astounding and heartbreaking. It is even worse than the tragic accident itself. Why? Because the other victim, the young man in the wheel chair who will also spend he next 10 years in prison, was reckless and thoughtless, sure, failing to calculate the risk. However, he did not willfully set out to throw away another human being’s life. He didn’t wake up and say, “Hey, I think I’ll go out and end Morgan William’s life today.” No, he was a young man, a product of our society, that drank alcohol our society values so highly–including the government for it’s money–and he drove, unfortunately as many young men his age do. Society’s value: alcohol. cars. And with these values held high in esteem, society also failed to impress upon this young man the risk he posed to himself and others in subscribing to society’s alcohol and vehicle values.
But what the posters who’ve posted here thus far, and the victim’s partner have done wrong is they have willingly made a choice to diminish this young man’s life and not recognize he is also a victim, being the impetus of this tragedy notwithstanding.
The better road, the better way to honor Morgan Williams is to partner with this young man to make a difference in society that this might not happen again. Recognize that he also has tremendous value and that his life along with Morgan’s is lost–but in a much different way. Anger, hatred, want of revenge will not bring Morgan back, but partnering with this young man can make a difference so that other Morgan’s aren’t lost, neither are other Michael Robinson’s.
I am truly truly sorry that Morgan’s life was lost. My heart goes out to her family and loved ones. Please honor her life in good. In kindness and in benevolence forward. Please stop the next tragedy from happening.
Also, please, please don’t wait too long to reach out to the grieving and heartbroken ever sorrowful young man in the wheelchair in prison.
• SickOfThis
By drinking alcohol and getting behind the wheel of a vehicle, he became a "deliberate homicide killer." There is NO excuse to drink and drive. Ever.
• mike walker
Kid will do 5 yrs max. They give each day you behave your self in there a day off sentence. Thing is whos gonna hire a convicted felon who killed some chick. No one…., so he'll most likely become a proffesional criminal
• Edith Hall
Thank you for your kind words, Wynne. I have reached out to this young man that I never knew before the accident and I am the same age as Morgan. He is truly sorry for what he has done and wants to donate money to Morgan's charity when he is released.
• ab weston
I just got sick reading your post. You are what is wrong with society. There is only 1 victim here and that is Morgan. I wish they would have a 1 year mandatory in prison for a DUI. Death Penalty for killing someone. Life for harming someone.
• Stephanie
Very sad, and yes, inexcuseable. At least he just plead guilty and got it over with. I hate it when peple plead not guilty to shit they actually did do! Prayers to all families.
• mydogismyheart
Why is it that the offenders always survive and the victims die? Every time it seems like. It's so sad. I wish it was the other way around, this guy should be dead and Morgan should be alive. Not fair. Not fair that he can do something so incredibly stupid and an innocent person has to die. Sorry, but he should have LIFE in prison. He voluntarily chose to drink and drive, that is manslaughter all the way!!!
• bluemalak
Drunks have slow reflexes, which in an accident, keeps them from sustaining the mortal injuries that their victims die from. I have nothing against drinking, I do it, but I do not go out to a bar, get drunk, then think it's okay to drive. It's never okay to drive if you've been drinking. It's not rocket science, any idiot should be able to figure that out. If you get drunk then get behind the wheel of a vehicle, you're taking a chance on murdering someone, it's that simple.
• Anonymous
There is so much going on to protect drunk drivers, I’m guessing the reason they are so lenient with these kinds of “killers” is so that their chances of re-offending will create fatter wallets, SOMEONE or some companies can’t deny this. When will the thinking change into courteous, safe driving habits, where every person gets home safe to their loved ones? Well, I’m sorry, but this guy should have been given life in prison. I for one always keep an eye out on the road for ANY kind of bad drivers, and if I see any, I’ll either get the hell as far from them as I can or alert my driver to do the same. Since our Justice System fails here, personal safety has to be #1 priority now, guys……
Leave a Reply
You are commenting using your account. Log Out / Change )
Twitter picture
Facebook photo
Google+ photo
Connecting to %s | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9588841795921326}", 'metadata': "{'Content-Length': '95115', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:AKUCLV7VNX5MIYLOOVNW7ESVPX5L7CV5', 'WARC-Concurrent-To': '<urn:uuid:8b5ed51f-fcb4-43a5-a2ab-d66429aa22ca>', 'WARC-Date': datetime.datetime(2014, 7, 24, 14, 40, 42), 'WARC-IP-Address': '192.0.83.250', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:CTS6LTXEXIV2MOSDSDLWNJKBLJ5EI5CK', 'WARC-Record-ID': '<urn:uuid:af02edfa-bb13-4a42-93c2-075d59427c99>', 'WARC-Target-URI': 'http://q13fox.com/2013/07/26/driver-of-fatal-wrong-way-accident-sentenced-to-10-years/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:17e29019-6a8b-482f-94c7-f05e071520da>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1214', 'url': 'http://q13fox.com/2013/07/26/driver-of-fatal-wrong-way-accident-sentenced-to-10-years/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-131-23.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.034332454204559326', 'original_id': 'fe70d0c75e2f01356ec3d1e070e5c622e4ad87c4f2f2d323538f14337ee7eb3b'} |
Hubble Sees a Huge Dust Cloud Around a Newly Forming Star
Younger stars have a cloud of dusty debris encircling them, called a circumstellar disk. This disk is material left over from the star’s formation, and it’s out of this material that planets form. But scientists using the Hubble have been studying an enormous dust structure some 150 billion miles across. Called an exo-ring, this newly imaged structure is much larger than a circumstellar disk, and the vast structure envelops the young star HR 4796A and its inner circumstellar disk.
Discovering a dust structure around a young star is not new, and the star in this new paper from Glenn Schneider of the University of Arizona is probably our most (and best) studied exoplanetary debris system. But Schneider’s paper, along with capturing this new enormous dust structure, seems to have uncovered some of the interplay between the bodies in the system that has previously been hidden.
Schneider used the Space Telescope Imaging Spectrograph (STIS) on the Hubble to study the system. The system’s inner disk was already well-known, but studying the larger structure has revealed more complexity.
The Hubble Space Telescope has imaged a vast, complex dust structure surrounding the star HR 4769A. The bright, inner ring is well-known to astronomers, but the huge dust structure surrounding the whole system is a new discovery. Image: NASA/ESA/G. Schneider (Univ. of Arizona)
The origin of this vast structure of dusty debris is likely collisions between newly forming planets within the smaller inner ring. Outward pressure from the star HR 4769A then propelled the dust outward into space. The star is 23 times more luminous than our Sun, so it has the necessary energy to send the dust such a great distance.
A press release from NASA describes this vast exo-ring structure as a “donut-shaped inner tube that got hit by a truck.” It extends much further in one direction than the other, and looks squashed on one side. The paper presents a couple possible causes for this asymmetric extension.
It could be a bow wave caused by the host star travelling through the interstellar medium. Or it could be under the gravitational influence of the star’s binary companion (HR 4796B), a red dwarf star located 54 billion miles from the primary star.
“The dust distribution is a telltale sign of how dynamically interactive the inner system containing the ring is'” – Glenn Schneider, University of Arizona, Tucson.
The asymmetrical nature of the vast exo-structure points to complex interactions between all of the stars and planets in the system. We’re accustomed to seeing the radiation pressure from the host star shape the gas and dust in a circumstellar disk, but this study presents us with a new level of complexity to account for. And studying this system may open a new window into how solar systems form over time.
Artist’s impression of circumstellar disk of debris around a distant star. These disk are common around younger stars, but the star in this study has a massive dust cloud that envelops and dwarfs the smaller, inner ring. Credit: NASA/JPL
The paper suggests that the location and brightness of smaller rings within the larger dust structure places constraints on the masses and orbits of planets within the system, even when the planets themselves can’t be seen. But that will require more work to determine with any specificity.
This paper represents a refinement and advancement of the Hubble’s imaging capabilities. The paper’s author is hopeful that the same methods using in this study can be used on other similar systems to better understand these larger dust structures, how they form, and what role they play.
As he says in the paper’s conclusion, “With many, if not most, technical challenges now understood and addressed, this capability should be used to its fullest, prior to the end of the HST mission, to establish a legacy of the most robust images of high-priority exoplanetary debris systems as an enabling foundation for future investigations in exoplanetary systems science.” | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '107', 'language_id_whole_page_fasttext': "{'en': 0.9170783162117004}", 'metadata': "{'Content-Length': '145231', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:RFMRG2SAIUHSS4BT6YRAYOZQBJX33A7Z', 'WARC-Concurrent-To': '<urn:uuid:127d264f-5fdc-4ef4-9679-621590080cf1>', 'WARC-Date': datetime.datetime(2019, 4, 24, 6, 44, 33), 'WARC-IP-Address': '104.18.45.62', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:I3F7BB44P5LP5DFY2POQMMNE4LXAWNAU', 'WARC-Record-ID': '<urn:uuid:64648b1a-be2e-4a8a-b1cb-f2c216bba002>', 'WARC-Target-URI': 'https://www.universetoday.com/138753/hubble-sees-huge-dust-cloud-around-newly-forming-star/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8a251a3f-b8e3-495f-89fc-4e6da7cd1e1e>', 'WARC-Truncated': None}", 'previous_word_count': '752', 'url': 'https://www.universetoday.com/138753/hubble-sees-huge-dust-cloud-around-newly-forming-star/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-229-41-121.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06299519538879395', 'original_id': '730e36389fe4093c4c509f8b2f4ec09d80ead8c1383b9aaaef5b9452d2e8ed8b'} |
ArtsAutosBooksBusinessEducationEntertainmentFamilyFashionFoodGamesGenderHealthHolidaysHomeHubPagesPersonal FinancePetsPoliticsReligionSportsTechnologyTravel
Concrete - Beautify your Home
Updated on June 23, 2012
Driveway with proper joints
Joints and sealer
Joints and sealer | Source
Decorative Concrete
The Beautiful World of Concrete
Have you ever looked at sidewalks, driveways, or walkways and thought how beautiful or why didn't they add a design etc...? I never did until I married someone who is a Master Concrete Construction Manager, now everywhere I go I see concrete I know what the joints are for and why they used a certain material and how they added the design. I also know the difference between decorative concrete, stamp concrete, and real stone. It's amazing what you can do with concrete. If you drive along the coast of Florida or any beach side property you will notice that most of the homes that are situated along side the beach or in their communities have a decorative driveway.
Have you ever wondered what's the difference between concrete and cement? The cement is an ingredient of the concrete along with water and other ingredients. The concrete is the actual product that you are seeing when you drive on or by a home or business. It's amazing the designs and components that goes into have a driveway that will last and one that won't. Did you know that if you have a long driveway or walkway that you must have joints in a certain place so that when it settles the driveway or walkway will still look flawless? If you look at an older driveway and you see cracks that are in the middle of the driveway, there could be two reasons why this happens: 1) the natural settling of the earth below and 2) the joints were not positioned correctly to reinforce the driveway so that the natural movement would not cause the crack in the wrong place. So how do you correct the crack down the middle of the drive way? Again there are two ways to correct this as well 1) depending on the dept of the crack you can repair it by filling the crack with a concrete filler or 2) If the crack is deep or causing the concrete to break up; such as what tree roots may cause, you will need to replace that section.
Why is concrete so important? There is concrete everywhere, it is stable and helps us to build on solid ground. I can house things such as pipes and poles for stability and it can also be use to decorate walkways, as well as homes. If you use cement its actually concrete without the rocks so if you are adding tile or brick to your home then cement/mortar is what you use as the grout.
Have you driven down the expressway and saw these designed stone or cement walls along each side? They actually create these in molds, when they get ready to set them in place they are placed like a beautiful puzzle connecting to each one, side by side and on top. There are some instances where concrete is used to build or construct a wall or barrier. This product is so versatile that there are some people that use it as a floor inside their home as well as patios and decks. There are beautiful designs that you can use for your driveway, walkway and even your kitchen floor. Have you watched HGTV lately? On the Holmes on Homes show, Mike used cement to construct a tile floor that look like stone in a kitchen for one home owner. The engineer actually laid down tape on top of the dried cement then they colored the cement as though it was stone and added a gloss or sealer on top it was beautiful, it looked just like tile. In cases like that you don't have to worry about replacing the tile if broken, you can change the color if you want and you have a sturdy floor.
There are so many ways to use concrete to make your home beautiful. If you want to add a concrete patio, make sure the ground is level, have it formed up with some 2x4 depending on how think you want it. If you go to the home improvement stores you can buy the ingredients to mix and add water and start pouring. But wait if you don't smooth it out or put the joints in the correct areas or don't make a drain for water you may find yourself in a world of trouble later on. The best thing to do is contact a licensed professional and ask them either for a free estimate or ask them for someone that you can trust to do the job. It is really not that expense to make sure it is done properly and looks great.
Decorative Concrete
0 of 8192 characters used
Post Comment
No comments yet.
Click to Rate This Article | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9673680067062378}", 'metadata': "{'Content-Length': '49734', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZAXA3W56EJ4E4FEZDFVT7UF3S3PBUA2U', 'WARC-Concurrent-To': '<urn:uuid:81436711-f889-4fad-93ff-b54dd374ad68>', 'WARC-Date': datetime.datetime(2017, 5, 23, 19, 4, 26), 'WARC-IP-Address': '52.72.174.208', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:QBBHMDEJ465ZDWIBX7GEO2QC5R7JZLPI', 'WARC-Record-ID': '<urn:uuid:d34f99b6-f5b6-4046-a6e7-24099bcfe62a>', 'WARC-Target-URI': 'https://hubpages.com/living/Concrete-Is-versitale', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e79bac0e-530c-4299-93b8-f40636adac2d>', 'WARC-Truncated': None}", 'previous_word_count': '820', 'url': 'https://hubpages.com/living/Concrete-Is-versitale', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-224-210.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-22\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for May 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.05982774496078491', 'original_id': '8231e64d7f3aeb9bf3b40c6d16c74a2cea93281c0e78d3a4c034b1c19c066a45'} |
Online College Courses for Credit
2 Tutorials that teach Identifying Sentence Fragments
Take your pick:
Identifying Sentence Fragments
Identifying Sentence Fragments
Author: Martina Shabram
Identify or correct sentence fragments.
See More
Fast, Free College Credit
Developing Effective Teams
Let's Ride
37 Sophia partners guarantee credit transfer.
Sentence Fragments
Source: [image of bridge, public domain,] [image of ice warning, public domain,] [image of cow jumping over the moon, public domain,] [image of cow in field, public domain,] [image of soup, public domain,]
Video Transcription
Download PDF
Hello students. My name is Doctor Martina Shabram. And I will be your instructor for today's lesson. I am genuinely excited to teach you these concepts. So let's get started.
What's on the schedule for this lesson? Well, we're going to learn about sentence fragments. We'll learn what they are, how to identify them, and finally, how to correct them when we see them.
If you recall, a sentence is made up of a subject plus a verb plus a full thought. So a sentence fragment is just a fragment, a scrap of a sentence. It's a phrase or a clause that does not meet all the criteria of a sentence.
Most of the time these fragments are missing the subject. But sometimes they'll be missing the verb instead.
So what does this all look like? Well, here's an example. See how there's a verb and a part of a thought, but we're missing the subject? We don't know who wanted to cross the bridge.
A common fragment sentence will be a dependent clause punctuated as if it were a full sentence. That might look like this. Here we have a subject and a verb, but we're missing the complete thought. That because is our clue, that not everything is here. These sentence fragments are important to spot in your writing. Because they can confuse your reader with unclear, half-formed ideas.
So how do we identify a sentence fragment then? The best thing to do is to ask yourself questions about a suspect sentence. These questions will help you sort out if a sentence is a fragment or complete.
Does this sentence have a subject? Does the sentence have a verb? Does this sentence form a complete thought? Since all complete sentences will include a subject, a verb, and a full thought, if you find yourself answering no to any of those questions, well, then you've got a fragment sentence.
So what if you've asked yourself all three questions and you still aren't sure? Then you can use this trick. When you read your sentence, tack the phrase, it is true that, to the beginning of that sentence. If the sentence still makes sense, then it's complete. If it doesn't, then you know you have a fragment. Let's practice.
Does this sentence have a subject? Yes, the cow. Does it have a verb? Again, yes, jumped. And is this a full thought? Yes. So if we add, it is true that, to the beginning it's still going to make sense. And that means that all signs are pointing to a complete sentence.
Let's try a different one. All we've changed is that we've added, when. So we know that we have a subject and a verb. But do we have a full thought? No. And we can see that when we try our trick out. It is true that when the cow jumped over the moon. Well, that doesn't make any sense.
So you know how to spot a fragment now. But how are you going to fix it? Well, if your sentence is missing a subject or a verb, then all you have to do is add one in. Let's try a sentence like that and see if we can fix it.
What are we missing? Well, do, we see a subject? Yes, the cow. And wow, there's a lot of information in the sentence. But do you see any action? No. We're missing the verb. So we can make this sentence complete by adding in a verb. How about sat?
OK. Here's another. We've got that verb. And I see a noun, which that could be the subject. But is that noun doing the action? Is the spoon doing the eating? No. So we're missing the subject. Let's add that in.
OK. And here's another kind of fragment. Here we have what? A dependent clause. We have a subject and a verb. But that because tells us that this is meant to complete a thought that isn't all here. When we have a dependent clause punctuated like a sentence, it's a fragment.
You'll see this often happen when the independent clause either follows or leads the dependent sentence fragment in a paragraph. So it's easy to make this mistake. And fortunately it's also easy to fix. We just need to pair this fragment sentence, this dependent clause, with an independent clause to make it complete-- like this.
And if we really wanted to, we could also take off that subordinating conjunction, that because. And then the dependent clause will be complete. She was hungry, independent clause, full sentence.
Easy, right? So what did we do today? Well, we learned the various ways a sentence can be fragmented. And we learned how to spot these fragments by asking ourselves questions or using the it is true trick.
Then we practiced completing fragments by adding in missing subjects or verbs, connecting dependent clauses with independent clauses, or removing subordinating conjunctions from dependent clauses.
Well students, I hope you had as much fun as I did. Thank you.
Notes on "Sentence Fragments"
(00:00 – 00:09) Introduction
(00:22 – 01:14) What is a sentence fragment?
(01:15 – 01:45) Identifying Sentence Fragments
(01:46 – 02:05) The “It is true that…” Trick
(02:06 – 02:46) Practice: is this a fragment?
(02:47 – 04:30) How To Fix Fragment Sentences
(04:31 – 05:01) Recap and Goodbye
Terms to Know
Sentence Fragment
A phrase or clause that does not meet all the criteria of a sentence. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '58', 'language_id_whole_page_fasttext': "{'en': 0.9439430236816406}", 'metadata': "{'Content-Length': '53437', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LJP3TMHKHDICJM2ULQBPHSD7USYEID5K', 'WARC-Concurrent-To': '<urn:uuid:4cca5086-1de0-4e14-9f30-1908fc1a7f5d>', 'WARC-Date': datetime.datetime(2021, 1, 21, 5, 20, 3), 'WARC-IP-Address': '3.227.212.59', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:OQHVVPIHQLEDGOU6FD4MWKX2BVISNDM6', 'WARC-Record-ID': '<urn:uuid:80a36c14-1e36-4a48-b204-68df92952b62>', 'WARC-Target-URI': 'https://www.sophia.org/tutorials/identifying-sentence-fragments?pathway=write-effective-sentences-and-paragraphs', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:c7d34d09-8382-47cb-9a7f-ad0dab89fe61>', 'WARC-Truncated': None}", 'previous_word_count': '1059', 'url': 'https://www.sophia.org/tutorials/identifying-sentence-fragments?pathway=write-effective-sentences-and-paragraphs', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-12.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9691646695137024', 'original_id': '832b0068b8fc9189d33e444419eaf9b826bda1ad4503265178caaf54b35ca21a'} |
@FAKE0005 Original version has PHRED scores from 0 to 62 inclusive (in that order)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG
+
@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
@FAKE0006 Original version has PHRED scores from 62 to 0 inclusive (in that order)
GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
+
~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@
| mini_pile | {'original_id': 'dc2cbaea780de049b285d2b13c0f9a7cb270f7e493a2233b9846060b56ca3e77'} |
This invention relates to the production and display of interlaced video images. A method and apparatus for scaling interlaced video images is disclosed.
Most known display devices, including cathode ray tubes (`CRTs`) and liquid crystal displays (`LCDs`), have picture elements which must be refreshed every few moments to prevent image flickering and the consequent loss of the image. A common method to prevent this flickering and loss of picture, which has been in use for many decades, is to interlace the video data. As shown in FIG. 1, video data is stored and/or transmitted sequentially in two fields, the first field containing all the data for the even display lines and the second field containing all the data for the odd display lines. For purposes of this description, the first line of the display will be line 0 and it is even. This designation is arbitrary and can be changed without in any way altering the substance of the invention. In operation, all the data for the even numbered lines contained in the first field is displayed first, followed by all the data for the odd-numbered lines contained in the second field. Using this alternation of even and odd fields results in adjacent picture elements being refreshed often enough to prevent or to minimize the effects of the fading or "flickering" of the individual picture elements. This technique is commonly called interlacing.
Although interlacing video data produces acceptable picture quality with relatively inexpensive components, it is not without problems. In particular, scaling the video data to produce scaled video images presents several difficulties. In this description, scaling includes both the enlargement or shrinkage of the image. In order to scale down or reduce the image, a certain number of input pixels must be mapped to a smaller number of output pixels. This can be done by either discarding some pixels according to the difference in the size of the input image and the desired output image or performing a weighted arithmetic averaging to reduce the total number of pixels. Obviously, using either technique requires the knowledge of which pixels are to be dropped or combined by averaging.
As the shape of the output image can be any rectangular shape (with or without the same aspect ratio as the input window), the scaling factor must be applied independently in both the vertical (`Y`) and horizontal (`X`) direction. Also, it is desirable to be able to scale the image independently in both the X and Y directions.
A simple way of shrinking an image is to drop some pixels. To improve the quality of the image so produced, the pixels should be dropped uniformly across the input image. For example, the determination as to whether a pixel in the X-direction is to be dropped can be made by having a simple counter that generates a periodic pulse by dividing the input pixel rate (pixel clock) by a variable scaling factor. With a programmable divider, the image can be scaled in the X-direction by any desired factor.
To scale the image in a vertical direction, some lines of the image will have to be skipped entirely. This can be done by dividing the line rate by the vertical scale factor and using the output of the division operation to determine if the next line should be dropped. Circuits to perform both the horizontal and vertical divisions have been known and used for many years.
The scaling process can be done at several different times. In one method, the entire image is stored in a frame buffer. The image is then selectively copied, using the horizontal and vertical divisions, into a second frame buffer. Although this process works, it is slow. Also, as parts of the image which will not be displayed are stored, albeit temporarily, a system using this process requires extra memory and is more expensive. A better method is to perform the scaling process as the image is placed in the frame buffer. This method is particularly attractive as almost: all images are generated by a raster scan process.
In a raster scan process, the image is broken down horizontally and vertically and transmitted to the buffer in serial fashion. To scale the image, each pixel as it reaches the frame buffer is either stored and the frame buffer address pointer incremented, or the pixel is ignored and the frame buffex address pointer remains the same.
As discussed, many images are produced using an interlaced data format. The simple scaling techniques mentioned previously, when used on interlaced video data, can result in either the dropping of adjacent lines or the display of lines in an inappropriate order.
FIG. 2 shows how the 50% scaling of an interlaced image having two fields can result in an undesired granularity in the final image. With 50% scaling, every other line in each field is discarded. When the beginning of the second odd field is detected, the scaling counter is reset and the first and successive, alternating lines from that field are displayed. The result is that lines 0,1,4,5,8 and 9 are displayed. Thus, lines 2 and 3 and lines 6 and 7 are discarded. With two successive lines missing, the output image appears to have annoying discontinuities.
In the special case of reducing the image by 50%, a known technique which works well is to discard all the information contained in either the first or second field. Although the technique works well in the special case of 50% reduction, it obviously cannot be used with other scaling factors. Consequently, the machine performing the scaling will need to store at least two algorithms: a first for the special case of 50% reduction and a second for other scaling requirements.
One attempt to correct the noted discontinuities requires that the scaling counter not be reset when moving from the first to second field. As shown in FIG. 3, when a two field image of 16 total lines is scaled by 2/3, this technique results in three pairs of lines (3/2, 9/8, 15/14) being displayed in the wrong order. Output of this type is also undesirable.
In general, known scaling methods for interlaced data only function well when the scaling factor is a binary factor (e.g. 50%, 25%, 12.5%, etc.) of the original image. The use of non-binary scaling factors with known scaling methods results in discontinuities and misplaced display lines. | mini_pile | {'original_id': '29ea734591474daf9db0c56c4cb3197ad10e6b80b9d2aaa3ccd39bcc3a96d8cb'} |
Coming to a School Near You: Swine Flu
This morning I was reading a column in the Sunday Herald by radio talkshow host Kerre Woodham saying that SwineFlu is a load of hogwash. Half an hour ago I was at the checkout at my local Foodtown and overheard a girl saying that she was told not to go to school next week at Westlake College (On Auckland’s North Shore) as there had been a confirmed case of SwineFlu at the school. She said that initially only year 12 girls were told to stay away, but that she since been told that the whole school is to be closed for a week. The fact that she was working at a checkout at the supermarket suggests that as well as spreading the news, she could also of course be spreading the virus.
I have said all along that, the people who are saying that because bird flu turned out to be a non event, this one will too, are going to get a rude awakening. This thing is spreading quickly, with a rise of 65% in the last 24 hours to 71 confirmed cases, while many more are expected to be confirmed in coming days as the NZ Police College has closed for a week and 41 tourists in the South Island town of Hokitika have also been confirmed.
One question being asked is whether employers should pay their staff if the company closes its doors during a quarantine. The answer appears to be no, other than normal holiday pay conditions. If it turns out to be as serious as is suggested, this could be a major concern. The biggest concern though is people who are sick but go to work anyway, because they can’t financially afford to miss work.
Perhaps the answer is obvious, but what should you do if one of your family members with whom you live is ill and could have Swine Flu?Does the whole family have to stay home, or do they only stay home if the person is confirmed to have the virus, which takes 72 hours after the swab. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.989766538143158}", 'metadata': "{'Content-Length': '82548', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6L6NYYP6KU4BGRJUU53IY6OF4XDINYGY', 'WARC-Concurrent-To': '<urn:uuid:fe105751-b684-41b9-8093-7f8b2b6f164e>', 'WARC-Date': datetime.datetime(2021, 3, 8, 22, 24, 17), 'WARC-IP-Address': '192.0.78.13', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:VSIF623UBXQPCDLWASJHE2S2BONBETCX', 'WARC-Record-ID': '<urn:uuid:0f152307-df29-4fa6-900c-e243b9fbedcf>', 'WARC-Target-URI': 'https://luigicappel.wordpress.com/tag/westlake-girls/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b12db64b-192a-4b19-bdb0-99a86043476a>', 'WARC-Truncated': None}", 'previous_word_count': '350', 'url': 'https://luigicappel.wordpress.com/tag/westlake-girls/', 'warcinfo': 'isPartOf: CC-MAIN-2021-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February/March 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-127.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03234213590621948', 'original_id': 'e37a4ab43577cfe4f58bd8c249316d4d394b95b76a18c434dcf3e2870fd9a519'} |
Have you ever bought anything online? Millions of people do it around the globe every day. e-commerce is an essential part of business for many retailers and it continues to gain more and more supporters.
It is not only the way of buying things but of selling them as well. One cannot even count how many online-shops there are on the Internet. Some of them are very poorly made, but you can also see eye-catching ones. Guess which ones are more likely to attract a new customer?
E-commerсe sites have no geographical limits so the number of people who would like to do this kind of business is constantly growing.
Our developers work with Ruby on Rails to provide back-end solutions for projects. It is not easy to “cook” up a project like this, especially for those without much experience. But don’t worry, we have prepared a detailed “recipe” for beginners on how to create an API for an e-commerce website. Just follow our detailed instructions and you will succeed.
Today we will present the first part of our “e-commerce API recipe” that deals with creating products. It is going to be very informative so get ready and start the “development cooking”.
1. First of all, you need to install Ruby 2.2.3 and Ruby on Rails 4.2.4. You can read about the installation process here.
2. Create a new app and name it “Shop” for example. Write the command in the console to do that:
rails new Shop --skip-sprockets --skip-spring --skip-javascript --skip-turbolinks --skip-test-unit --database=postgresql
To learn more about the keys used in the command:
rails new --help
3. Do a preliminary application setup. Set up Ruby on Rails generators first by placing this code into the file config/initializers/generators.rb.
Rails.application.configure do config.generators do |g| g.orm :active_record, migration: true g.test_framework :rspec, fixtures: false g.helper false g.decorator false g.controller assets: false end end
The next step is testing environment setup. We will use RSpec for the app testing. Not a big deal, just add the following to the Gemfile:
... group :development, :test do gem 'rspec-rails' end group :test do gem 'shoulda-matchers' gem 'rspec-activemodel-mocks' gem 'rspec-its' end
To install new gems write the command in the console:
bundle install # (or just bundle)
Then set up RSpec for the project by running this command in the terminal:
rails generate rspec:install # (or use a shortcut: rails g rspec:install)
A newly generated spec/ directory will be the result of all previous instructions completed successfully. This is where we are going to write tests.
4. As we create only API for an e-commerce website we need to write the following code in the file config/routes.rb:
namespace :api do end
config/routes.rb is the file where we will set up the routes to the resources.
For the the next step let’s plan the API's architecture. Since all controllers are inherited from ApplicationController we will arrange there such methods as new, create, update, destroy:
class ApplicationController < ActionController::Base ... def new initialize_resource end def create build_resource resource.save! end def update resource.update! resource_params end def destroy resource.destroy! end end
Thus, when we create controllers for our online-shop API we will be able to redefine private methods initialize_resource, build_resource, resource. This will help us to keep the controllers lightweight.
5. It is the right time to add something every shop needs - the products. Create the model “Product”, that will contain such fields for example: name, price, description. Let’s type the command in the console:
rails generate model Product name:string price:integer description:text
This command will generate the model product.rb in the folder app/models/ with the fields name(type string), price(type integer), description(type text) and the migration to the database db/migrate/(timestamp)_create_products.rb. The file where we will write tests for the model spec/models/product_spec.rb. will be generated too.
Then write the command in the console to create a database:
rake db:create
After that write the command to conduct the created migration to the database:
rake db:migrate
The next step is to create an API controller ProductsController where we will process requests to API of the products. Let’s start with writing tests for the controller. Create the file spec/controllers/api/products_controller_spec.rb and add the following code:
require 'rails_helper' describe Api::ProductsController do end
We will write tests for routes first:
require 'rails_helper' describe Api::ProductsController do it { should route(:get, '/api/products').to(action: :index) } it { should route(:get, '/api/products/1').to(action: :show, id: 1) } end
Go to the console and type the command rake, you will see that tests do not work and there are two errors on the screen.
What's next? Has everything been done in vain? Don’t panic, we just need to fix that. Go to config/routes.rb and write:
namespace :api do resources :products, only: [:index, :show] end
Let’s check if the tests run this time. Drumroll… Voila, there are two green dots!
We also need to write tests for actions. Let’s add them to other tests.
RSpec.describe Api::ProductsController, type: :controller do ... describe ' #index.json' do before { get :index, format: :json } it { should render_template :index } end describe ' #show.json' do before { get :show, id: 1, format: :json } it { should render_template :show } end describe ' #collection' do before { expect(Product).to receive(:all) } it { expect { subject.send :collection }.to_not raise_error } end describe ' #resource' do before { expect(subject).to receive(:params).and_return({ id: 1 }) } before { expect(Product).to receive(:find).with(1) } it { expect { subject.send :resource }.to_not raise_error } end end
Not a surprise they don’t run now. Create a file app/controllers/api/products_controller.rb. and write a code there:
class Api::ProductsController < ApplicationController private def collection @products ||= Product.all end def resource @product ||= Product.find params[:id] end end
Add one line of code to ApplicationController from which our new controller is inherited.
class ApplicationController < ActionController::Base ... helper_method :resource, :collection ... end
Having done this we can call methods resource and collection directly from views. No need to write action methods index and show. They are kept in the ActionController::Base from which all other controllers are inherited. They render templates with their names by default and this is exactly what we need.
Now we have to create templates and this is where the most interesting part begins. All the templates (views) will be the same, even when we add a shopping cart and orders. They will look like those for the products. That is why we need to learn about the inheritance of views in Ruby on Rails.
All of them are inherited from the application, which means in our case that Ruby on Rails will look for templates in the directory app/views/application if it doesn’t find them in the directory app/views/api/products. If it doesn’t find them in the latter one as well, you will see an error.
So let’s place the templates in the views/application directory. Create two files index.json.erb and show.json.erb. They should be in the json format because the API of the shop will transfer data in it. Add this code to index.json.erb:
<%= sanitize collection.to_json %>
And to show.json.erb:
<%= sanitize resource.to_json %>
Done. Let’s check the performance of the newly written API for the products. Launch the tests first and make sure they have run smoothly, if not - you have done something wrong.
Now we have to check the API performance with the help of the curl command in the console. Let’s add a few products to the database. Run the console command rails console and write, for example:
Product.create!([{ name: 'apple', price: 5, description: 'green' }, { name: 'beer', price: 10, description: 'cold' }])
The create! method will show an error if you do something wrong.
This code will enter two products in the database. Let’s make a request to the API with the curl command (don’t forget to launch a local server in the console with the rails server command). Write the following command in the console:
curl -H "Accept: application/json" "http://localhost:3000/api/products"
This should show the data of the products we have worked on. Let’s check the show action.
curl -H "Accept: application/json" "http://localhost:3000/api/products/1"
It shows information about the product with id = 1.
Great! The products API works fine but it displays unnecessary information such as time when the product was created (created_at) or when it was updated (updated_at).
Let’s think how we can change it without transferring the parameter (only: [:id, :name, :price, :description]) to the to_json method. We should keep in mind that all templates are the same for the whole app and there will be no such fields in another model. So what should we do? Connect the gem 'draper'. You can read about it here: https://github.com/drapergem/draper. Let’s create a new decorator app/decorators/product_decorator.rb and write the code there:
class ProductDecorator < Draper::Decorator delegate_all def as_json *args { id: id, name: name, price: price, description: description } end end
You could probably ask why the method is named as_json if we call to_json in a template. Everything is very simple if you take a closer look at how the to_json method works in the original code: as_json is called within it. If you redefine this method with the necessary hash you will get the data needed. Don’t forget to call the decorate method in templates:
In index.json.erb:
<%= sanitize collection.decorate.to_json %>
In show.json.erb:
<%= sanitize resource.decorate.to_json %>
You should also remember to write tests for the decorator in the file spec/decorators/product_decorator.rb.
require 'rails_helper' describe ProductDecorator do describe ' #as_json' do let(:product) { stub_model Product, id: 1, name: 'apple', price: 10.0, description: 'green' } subject { product.decorate.as_json } its([:id]) { should eq 1 } its([:name]) { should eq 'apple' } its([:price]) { should eq 10.0 } its([:description]) { should eq 'green' } end end
Check if the tests have run properly and make requests again with the curl command (don’t forget to restart the server as we have just added new files to the app). You should see the data you need on the screen. What if a request to show action will be with an id that does not exist in the database? Then type the following in the code line in the app/controllers/api/products_controller.rb file:
@product ||= Product.find params[:id]
The find method will raise ActiveRecord::RecordNotFound exception and it will render the 404 error. To display this error in the json format add it to the ApplicationController that will handle this exception and render the exception.json.erb. template.
class ApplicationController < ActionController::Base ... rescue_from ActiveRecord::RecordNotFound do |exception| @exception = exception render :exception end ... end
Let’s create views/application/exception.json.erb and write the code there:
<%= sanitize({ errors: { @exception.class.name => [@exception.to_s] } }.to_json) %>
Try to use the curl command to make a request to API for a product with an id that does not exist in the database. Let it be 4 for example:
curl -H "Content-Type: application/json" "http://localhost:3000/api/products/4"
You will see the following error description on the screen:
{ "errors": { "ActiveRecord::RecordNotFound": [ "Couldn't find Product with 'id'=4" ] } }
API for the e-commerce product is successfully completed. Well done! Not bad as for a beginner but this is all for today only. Next time we will unveil the second part of the ‘recipe’ that will deal with searching products using Full Text Search in PostgreSQL. Don’t miss it!
Links:
Ruby on Rails e-commerce API on GitHub
This part of the series has been republished with permission from MLSDev. The original article can be seen here. | mini_pile | {'original_id': '092466c4c70c285f80fb880dcc0063ee9a753c7c2703cea74e09b63ce3097125'} |
The Government Doesn’t Care About You
Would you ever expect a gang of crooks to care about their victims? Do you think the neighborhood thief would ever look after you? Do you trust the mafia to keep you safe? If you answered no to these questions, then why would you ever expect the government to care about you? You are not the government’s customer, you are not a citizen they represent, nor are you a person they care to help. You are their victim, and they wish to extort you.
Before diving any further, it is important to note that the state receives its wealth through violent coercion. If you are the rightful owner of your body and the rightful owner of your goods acquired through original appropriation or voluntary means, then no man or woman has the right to dictate what you must do with your person or property. Therefore individuals that call themselves the government have no rightful authority over your person or property. We can rationally deduce that taxation is theft because these individuals have no right to threaten you with violence if you don’t give them your money.
If taxation is theft, then the state serves no meaningful purpose except to satiate the desires of the individuals who reap the benefits of this extortion. Politicians don’t serve you, they serve themselves. If they represented you in any meaningful way, they wouldn’t steal from you. They get away with this egregious crime by maintaining a monopoly over very important services, such as defense, courts, and roads. Since they are the sole provider of these services, they are able to easily maintain the illusion that they represent your best interest, when we can empirically discern that they instead represent themselves.
Recognizing this truth is imperative in understanding the context surrounding current events. In light of the most recent mass shootings in Paris and San Bernardino, there have been calls to enhance the powers of governments around the world so they may effectively combat violence and keep their citizenry protected. Immediately following the terror in Paris, French citizens had no problem letting their government institute martial law and go door-to-door without any warrants. Here in the US, calls for gun control intensified after the shooting in San Bernardino. However if history is an indicator of anything, giving governments greater power in an effort to keep us safe in actuality makes us less safe.
As we have concluded, government is inherently criminal, since it compels us to pay their salaries and abide by their whims under the constant threat of violence. The larger their power grows, the larger their crimes against us grow. It is an oxymoron and logically inconsistent to say that we are protected by an entity that threatens violence against us if we don’t pay them.
With this said, government does not protect you, nor do they have any incentive to do so. As economist, historian, and political theorist Tom Woods once said, “The government’s incentive is to fail, because the more it fails, the more money it gets.” Although the government has expansive surveillance programs and the most superior technology in the world, they still failed to stop these attacks, despite having prior knowledge that they would occur. If the government acted as a private entity and faced the risk of losing money if they were not accountable to their consumers, they would have a real incentive to protect you. But since the government obtains its wealth through coercion and always has a steady stream of revenue into their pockets regardless of their performance, they do not have any incentive to protect you. Their only incentive is to keep the stable flow of money and power coming into their hands.
The easiest way for governments to accomplish this is by failing, that way they have an excuse to grow their powers and their ability to tax you. They have a greater incentive to make sure you are as vulnerable as possible than they do to actually protect you, this way you come crawling to their feet demanding they grow their powers. For a historical analysis of this, I recommend reading the book Suicide Pact by Judge Andrew Napolitano, in which he details how the federal government has been able to vastly expand its powers every time it jumped into war.
In spite of this truth, Americans continue to ask the government to take away their individual rights under the false guise that they will be protected. Liberals want the government to take away our right to self-defense in hopes that this will somehow stop violent crime, despite the fact that gun control increases violent crime. And conservatives want the government to increase its efforts in the War on Terror (which will necessarily require tax hikes and violations of our right to due process) in hopes that this will somehow stop terrorism, despite the fact that the War on Terror has created more terrorism.
The government does not care about you. It cares about itself. When you demand they increase their powers in order to keep you secure, they win, you lose, and you are now neither free nor secure. If you wouldn’t ask the mafia to keep you safe, then for the very same reasons, you should not expect the government to keep you safe. You are their victims and their tax slaves. They care only that you continue to believe the illusion that their authority is necessary and just.
It is time to wake up and realize that there is no such thing as government, for there are only individuals. As basic economics shows us, men are naturally self-interested and will always seek to improve their living conditions in the most expedient way possible. The individuals that call themselves government are just as susceptible to this as the rest of us, and they operate on extortion in order to improve their wellbeing. For you and I, we must work hard, become skilled individuals, and have a fruitful number of voluntary interactions in order to improve our standards of living. For the individuals that call themselves the state, all they must do is grow their power. It is for this reason that they do not care about you and why you should not let yourself continue to fall prey to their masterful trickery. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.976525068283081}", 'metadata': "{'Content-Length': '107812', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:FG2NFT6CFNFE6D4MQV2UWLUQAXQKGD7Y', 'WARC-Concurrent-To': '<urn:uuid:6e675e1b-69e7-4cc0-aabb-cd8fea0c2153>', 'WARC-Date': datetime.datetime(2019, 1, 19, 4, 30, 7), 'WARC-IP-Address': '104.27.190.3', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:OU2ITHZX4MFZXSGYIONEO7JL57WGLXGB', 'WARC-Record-ID': '<urn:uuid:e4c12737-a250-4f60-92c3-bf00ee15abfe>', 'WARC-Target-URI': 'http://libertyhangout.org/2015/12/the-government-doesnt-care-about-you/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:159efae8-70ef-41f2-a8e7-e78a4cd8280f>', 'WARC-Truncated': None}", 'previous_word_count': '1054', 'url': 'http://libertyhangout.org/2015/12/the-government-doesnt-care-about-you/', 'warcinfo': 'isPartOf: CC-MAIN-2019-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-101-220-24.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.5538426041603088', 'original_id': 'c0851f553bdec27438feebae6f76eb1f4eaa8391ccb8326639e97af1a35a4f65'} |
Marko Kanala, also known as Mulletronic, has been producing electronic music since 1991. Mulletronic's musical style is a mixture of several styles such as electro, disco and synth pop. His tracks have influences from artists like Kraftwerk, Anthony Rother and Legowelt.
Mulletronic's producing style is very live-oriented and in studio he uses a mixture of old classics and newer technology. He prefers instruments with hands-on pattern sequencing capabilities such as Roland's famous TR and SH series. His skills in electronics have also helped him to include some homebrew synthesizers and rhythm boxes in his studio gear.
His first 12" release is "Sexual" from a new label Sewer Leak. Earlier his works have been heard on Anthony Rother's "Electro Commando 1 - Welcome To Psicity" compilation, on which "Eeyore" was a stand-out track.
Sexual 12" (EP) - leak 001 - Sewer Leak
Reviews: atome.com | de-bug.de
Eeyore (track) on "Electro Commando 1 - Welcome To Psicity" - Psi49net
contact: raato [ at ] mulletronic.com | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9492080211639404}", 'metadata': "{'Content-Length': '3450', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:AHBN3MNTIRWSLG32XUTK4XXSQJUDE2FZ', 'WARC-Concurrent-To': '<urn:uuid:3711ceb1-756c-41a4-94b0-e3ed9c599ee8>', 'WARC-Date': datetime.datetime(2022, 9, 30, 3, 26, 22), 'WARC-IP-Address': '172.67.144.95', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:KTOC4JGGNMSOMKLMZXKBORN25J2TV47O', 'WARC-Record-ID': '<urn:uuid:9743d7ec-1503-4f0a-a533-b175f3d5bf62>', 'WARC-Target-URI': 'https://www.mulletronic.com/home.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f2ed7da5-def8-4ac9-8684-8167cdcedb31>', 'WARC-Truncated': None}", 'previous_word_count': '147', 'url': 'https://www.mulletronic.com/home.html', 'warcinfo': 'isPartOf: CC-MAIN-2022-40\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September/October 2022\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-142\r\nsoftware: Apache Nutch 1.19 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.4-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.08149200677871704', 'original_id': 'e306f204025f80781e3705bbe0ec63198b941a0dfbb881d3d6004ebc401b0b12'} |
<!doctype html>
<html lang="en" data-ng-app="buildrModule">
<head>
<meta charset="utf-8">
<title>Build Tracker</title>
<link href="css/style.css" rel="stylesheet" />
<link href="css/bootstrap.min.css" rel="stylesheet" />
<link href="css/bootstrap-responsive.min.css" rel="stylesheet" />
</head>
<body>
<div class="navbar navbar-inverse navbar-fixed-top">
<div class="navbar-inner">
<div class="container">
<button type="button" class="btn btn-navbar" data-toggle="collapse" data-target=".nav-collapse">
<span class="icon-bar"></span>
<span class="icon-bar"></span>
<span class="icon-bar"></span>
</button>
<a class="brand" href="#">Build Tracker</a>
<div class="nav-collapse collapse">
<ul class="nav">
<li><a href="#/builds">Builds</a></li>
<li><a href="#/builds/add">Add Build</a></li>
</ul>
</div><!--/.nav-collapse -->
</div>
</div>
</div>
<div class="container">
<div ng-view></div>
</div> <!-- /container -->
<!-- In production use:
<script src="//ajax.googleapis.com/ajax/libs/angularjs/1.0.6/angular.min.js"></script>
-->
<script src="lib/jquery/jquery.min.js"></script>
<script src="lib/angular/angular.min.js"></script>
<script src="lib/angular/angular-resource.min.js"></script>
<!-- UI Libs -->
<script src="lib//twitter/bootstrap.js"></script>
<script src="js/app.js"></script>
<script src="js/controllers.js"></script>
<script src="js/services.js"></script>
</body>
</html>
| the_stack | {'hexsha': '6754b5d8acaec92b957f541a11e326524e9136f5', 'size': '1615', 'ext': 'html', 'lang': 'HTML', 'max_stars_repo_path': 'src/front_end/app/index.html', 'max_stars_repo_name': 'vollov/build-tracker', 'max_stars_repo_head_hexsha': '1d21a8bef51bc003e68759e7731d91a6b0e1ba01', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '', 'max_stars_repo_stars_event_min_datetime': '', 'max_stars_repo_stars_event_max_datetime': '', 'max_issues_repo_path': 'src/front_end/app/index.html', 'max_issues_repo_name': 'vollov/build-tracker', 'max_issues_repo_head_hexsha': '1d21a8bef51bc003e68759e7731d91a6b0e1ba01', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '', 'max_issues_repo_issues_event_min_datetime': '', 'max_issues_repo_issues_event_max_datetime': '', 'max_forks_repo_path': 'src/front_end/app/index.html', 'max_forks_repo_name': 'vollov/build-tracker', 'max_forks_repo_head_hexsha': '1d21a8bef51bc003e68759e7731d91a6b0e1ba01', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '', 'max_forks_repo_forks_event_min_datetime': '', 'max_forks_repo_forks_event_max_datetime': '', 'avg_line_length': '31.0576923077', 'max_line_length': '106', 'alphanum_fraction': '0.5764705882', 'original_id': 'd514ce76a35282acb0b2f46b879d5f26207e52d4731ef72ac78a3f73615f75c9'} |
Use of study days to develop the healthcare assistant role.
The Department of Health's strategies to combat staff shortages and an ageing workforce have now turned their focus to the delivery of patient care by HCAs. This article describes how a trust redesigned the role of HCAs and implemented a study day in order to enhance both theoretical knowledge and clinical practice for this role. | mini_pile | {'original_id': 'ce9f8e185e363f9c94ab0ef0942f6aeb8c8dd29a7d7e95249e0b9164bc12020f'} |
Q:
ExtJs: How to validate editible Grid and prevent empty cells
I need to validate a grid using this link. But I can't use getByCellPosition function and it returns false because of its input parameters {row: idx, column: i} .
How can I get cell from the grid and call this function?
store = grid.getStore();
view = grid.getView();
error = false;
columnLength = grid.columns.length;
store.each(function(record,idx){
for (var i = 0; i < columnLength; i++) {
cell = view.getCellByPosition({row: idx, column: i});
cell.removeCls("x-form-invalid-field");
cell.set({'data-errorqtip': ''});
fieldName = grid.columns[i].dataIndex;
if (fieldName === 'WHATEVER') {
//Do your validation here
if(failed) {
cell.addCls("x-form-invalid-field");
cell.set({'data-errorqtip': 'Your error message qtip'});
error = true;
}
}
}
});
A:
I think using 'renderer' is easy and efficient way. If its suitable with your code, you can try this: https://fiddle.sencha.com/#fiddle/tl3
var validRenderer = function (val, meta, rec, rowIndex, colIndex, store) {
if (val == isNotValid) {
meta.tdAttr = 'data-qtip=" '+val+' is not right person"';
meta.style = "background-color:red;";
}
return val;
}
var grid = Ext.create('Ext.grid.Panel', {
store: store1,
columns: [
{
text: 'Name',
dataIndex: 'name',
renderer: validRenderer
}
],
renderTo: Ext.getBody()
});
| mini_pile | {'original_id': '750d12e6a8e25de20d012cff1aa1e64d23d5782b32b0de9908c8184c2e7b1ddf'} |
Wednesday, October 10, 2012
Joining the Revolution
I’ve joined the electronic revolution and purchased an iPhone. Having been resistant for some time, I could no longer avoid the temptation of having the social networks at my fingertips, cool apps to explore, email at the tap of a button, and a personal calendar on hand. Now I can relieve my purse of my pocket-sized appointment book and my emergency Sudoku pad. No longer will I have to fumble for someone’s phone number or wish I could send a photo directly to Facebook. I can do all of these things and more.
And therein rests the problem. The iPhone, like its larger cousin the iPad, is in itself a complete source of entertainment. Miss a favorite TV show? Watch it on your device. Need to look up the nearest pizza palace? Ask Siri. Need to kill time at the doctor’s office? Read a book on iBooks. Or better yet, play a game of Solitaire.
No wonder people’s attention spans are decreasing. It makes me worry for the future of reading. Who will be able to concentrate on finishing an entire novel when so many other activities require less effort?
Thank goodness for teen fiction that captures the interest of our youth and perhaps spurs them on to develop a lifelong reading habit. Because once the older generation who gobbles up our stories in print form dies off, who will be left? Consumers who expect their reading material to arrive in the form of daily excerpts? Will the art of storytelling devolve into single page entries? How can we make reading more attractive to the younger set to compete with iTunes?
Storytelling will always be part of our psyche even if the means of delivery evolves. But as a novelist, I am concerned for the future of our art. Can those of us trained to write lengthy works adapt to the changing marketplace? What if we have no choice? Do we want to write shorter, compelling, quicker prose? Can we compete with smartphones and tablets, or must we join the revolution and change our techniques to suit them?
1. I think it's both/and Nancy. As I wrote on Sunday, there is a whole new market for shorter work, just like in the pulp days (which also had people wondering about the future of reading). But a good long novel will sell IF the parts read compellingly....the way Dickens used to do it.
2. For me, smartphones, tablets, ereaders mean an expansion of reading possibilities.
Yes, I even read (and finish) novels on my smartphone.
I have found myself wasting so much time WAITING for things (waiting for my boyfriend in the car, waiting for appointments at doctors' offices, being stuck in a traffic jam...) that all those devices seem like salvation.
Carrying my kindle or smartphone with me is so much easier than taking the 750-page-book with you.
I don't care whether I'm reading longer or shorter stuff. I'm just glad I can read wherever I go. :)
3. Nancy, I must be the last holdout. My sons keep bugging me to get an iPhone, or any smartphone. I still use a cell phone that allows me to do one thing: call other phones. If and when I finally exit the old-school cellphone room, I'll be sure to turn out the lights. Until then, maybe I'll just call someone. Or not.
4. I can't wait until the whole deal can be implanted in my head.
5. Implanted in the head..that's a good one, and maybe not so far off! As readers, we have access to more devices and more ways to get our reading material delivered. As writers, we do have more markets for short fiction as James says. My concern is if the readers of the future will have the patience to slog through a novel or if we'll have to feed it to them page by page. This will change the way we write.
6. I have been an assumer of technology from the beginning. As far as cell phones, I started off with a 'bag-phone' in the 80s. Couldn't afford a $200 battery for it so it had to stay in my car plugged into the lighter. I'm not an Apple fan, but have used both Blackberry and Android since they came out and couldn't live comfortably without them.
I have tried the implant thing Jim, while it worked great for reading emails in my head, watching streaming movies caused the back of my eyeballs to itch..way back where you can't reach without surgical instruments. And ever since the 2.74e "BrainPan" OS upgrade was automatically pushed anytime someone uses a microwave near me I involuntarily squawk like a raven and pee my pants.
7. Oh, and to answer the actual question: Serialized Fiction will rise again, both in written and audiobook form. And we will make more money on subscriptions than on people buying individual books. That's my prediction.
8. Serialized fiction...yes, and it's already being done. I believe the so-called "Cell phone novels" are popular in Japan. But who will make the money--the company that delivers these daily excerpts, or the author who writes them? I sense another middleman here. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.95800518989563}", 'metadata': "{'Content-Length': '121637', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:N4QYIO37SNBIUSYY7JSP7HU5WUNXBGD5', 'WARC-Concurrent-To': '<urn:uuid:3963af65-f936-4fcf-9473-ce4f1fa2859e>', 'WARC-Date': datetime.datetime(2014, 8, 2, 4, 31, 2), 'WARC-IP-Address': '74.125.228.12', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:PCV5QPZNRJKQSE4A4EBYFLNSRNLAKSSA', 'WARC-Record-ID': '<urn:uuid:342842c1-af46-4518-a7dc-1281f450b641>', 'WARC-Target-URI': 'http://killzoneauthors.blogspot.com/2012/10/joining-revolution.html?showComment=1349901974408', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:75adbcf4-79e2-406b-a285-f9e68219e3e5>', 'WARC-Truncated': 'length'}", 'previous_word_count': '872', 'url': 'http://killzoneauthors.blogspot.com/2012/10/joining-revolution.html?showComment=1349901974408', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02048259973526001', 'original_id': '70a9b7b09f5f5425b4044deac52505cb4717e8215e815da573db08b900f800b7'} |
"Saturn's Titan: Surface Change, Ammonia, and Implications for Atmospheric and Tectonic Activity."
Before the Cassini-Huygens mission began bringing back crucial data about Saturn and its largest moon, Titan, scientists knew very little about the nature of Titan or its hazy atmosphere. It was thought of as a "pre-biotic Earth, frozen in time."
But now, Cassini instruments have provided tantalizing evidence that Titan is currently geologically active, recording what could be a large area where icy ammonia fog vents from the interior and falls to the local surface. The finding indicates that Titan continues to replenish its atmosphere today by outgassing ammonia, which serves as a source for the satellite's nitrogen-dominated atmosphere.
Scientists who recently authored the paper "Saturn's Titan: Surface Change, Ammonia, and Implications for Atmospheric and Tectonic Activity," conclude that distinct changes have occurred on or near the ground over a 73,000 square kilometer-area viewed by Cassini's Visual Infrared Mapping Spectrometer (VIMS) several times over a two-year period. The area in question - twice as large as Hawaii's Big Island -- was found to repeatedly grow and diminish in brightness from 2004-2006.
The region in question is also comparable to the large volcano, Loki, on Jupiter's Io. "If the entire reflective region is part of the activity, its size is of Krakatoan proportions," says lead author Robert M. Nelson of NASA's Jet Propulsion Laboratory (JPL). "This may be the largest active surface region in the solar system."
VIMS image of Titan from the T9 data set.
VIMS image of Titan from the T9 data set. Here, unlike Fig. 1, the image is shown without projection to the observational perspective of the T0 observations. The region of changing brightness is indicated with yellow fiducial marks; the tropospheric cloud is indicated by red fiducial marks.
Earlier studies provide evidence for ammonia mixed with water in a liquid layer below Titan's water-ice surface. Given such a layer, it is possible that ammonia, alone or mixed with water, may be vented through deep-seated volcanism, or via a diapir that taps the liquid layer, or by more localized geysering of ammonia-rich deposits in the crust. Ammonia decomposes into nitrogen. Ongoing episodes of ammonia venting from the interior could be feeding nitrogen into Titan's atmosphere now and in the future. Titan now joins Earth, Io, Triton, Enceladus, probably Venus, and possibly Europa as the small community of planetary objects in the solar system that exhibit active volcanic processes. Most significantly, these findings could shed light on how Earth's nitrogen-rich atmosphere evolved. In summary, the results also cause the scientists to ask 'Are the chemical processes happening on Titan today the best approximation among the planets to the processes under which life evolved on Earth?'
Reference: "Saturn's Titan: Surface Change, Ammonia, and Implications for Atmospheric and Tectonic Activity." Icarus, August 4, 2008
Scientists: R..M. Nelson, L.W. Kamp, D.L.Matson (JPL); PG.J. Irwin (Clarendon Lab, U.K.); K.H. Baines (JPL); M.D. Boryta Mt. San Antonio Coll.); F.E. Leader (JPL); R. Jaumann (Inst. for Planetary Exploration, Germany); W.D. Smythe (JPL) C. Sotin (U. Nantes); R. N. Clark (USGS Denver); D.P. Cruikshank (NASA Ames);P. Drossart (Obs. de Paris-Meudon); J.C. Pearl (NASA Goddard); B.W. Hapke (U of Pittsburgh); J. Lunine (U of AZ); M. Combes (Obs. de Paris); G. Bellucci (Inst. di Astrofisica Spaziale, Rome); J.-P. Bibring (Univ. de Paris Sud-Orsay); f. Capaccioni, P. Cerroni, A. Coradini, V. Formisano, G. Filacchione (Instit. Di Astrofisica Spaziale); R. Y. Langevin (Univ. de Paris Sud-Orsay); T. B McCord (U of WA); V. Mennella (Oservatorio Astronomico di Capodimonte); P.D. Nicholson (Cornell U.); B. Sicardy (Obs. de Paris-Meudon)
You Might Also Like | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '12', 'language_id_whole_page_fasttext': "{'en': 0.8797036409378052}", 'metadata': "{'Content-Length': '62590', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:UPWW7HFPH4PI4UBJGEB4ILJT6SQQRSIZ', 'WARC-Concurrent-To': '<urn:uuid:73331b4b-e49e-4b6d-801c-34a9bcea0177>', 'WARC-Date': datetime.datetime(2019, 5, 19, 23, 6, 22), 'WARC-IP-Address': '99.84.181.45', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:HBCQYGP7XH3IX6OYJANYGBRDXC4T45LU', 'WARC-Record-ID': '<urn:uuid:32bce72b-5053-481b-8528-ba535270e5cb>', 'WARC-Target-URI': 'https://solarsystem.nasa.gov/news/12614/titan-frozen-in-time-or-constantly-evolving/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f13860ae-b32e-4620-9417-53cdc7d9eb2e>', 'WARC-Truncated': None}", 'previous_word_count': '562', 'url': 'https://solarsystem.nasa.gov/news/12614/titan-frozen-in-time-or-constantly-evolving/', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-7-214-88.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.05616849660873413', 'original_id': '2b77a1de066c621de497f371f8a36c981944ef76c131a0eb3d05e2e8f3a5572f'} |
<node>
<interface name='org.gtk.Application'>
<method name='Activate'>
<arg type='a{sv}' name='platform_data' direction='in'/>
</method>
<method name='Open'>
<arg type='as' name='uris' direction='in'/>
<arg type='s' name='hint' direction='in'/>
<arg type='a{sv}' name='platform_data' direction='in'/>
</method>
<method name='CommandLine'>
<arg type='o' name='path' direction='in'/>
<arg type='aay' name='arguments' direction='in'/>
<arg type='a{sv}' name='platform_data' direction='in'/>
<arg type='i' name='exit_status' direction='out'/>
</method>
<property name='Busy' type='b' access='read'/>
</interface>
</node>
| mini_pile | {'original_id': '1e63c1632efc1d424804a65e1b7edbb6b8fb0e309d6ce9ff2cd4504fb12099f3'} |
Take the 2-minute tour ×
Let $f(x)$ be a polynomial function.
It is known that for every $x$:
$$ f'(x) \leq f(x) $$
For every $x$:
$$ f(x) \geq 0 $$
Suppose by contradiction that $f(z)<0$ for some $z$. Then $f'(z)<0$ too, so $f$ must go down and down to $-\infty$.
Moreover, the rate of decrease must by at least exponential because:
$$ |f'(x) \geq f(x)| $$
and we know that equality holds for the exponential function.
This contradict the fact that $f(x)$ is polynomial.
MY QUESTIONS: Is my intuition true? If so, how to formalize it? If not, then what is the correct answer?
share|improve this question
Yes, your intuition is correct. However, I don't see a really easy way to formalize it and prove the assertion from there. I find it easier to argue with the degree of the polynomials, which disallows $\lvert f'(x)\rvert \geqslant \lvert f(x)\rvert$ for $\lvert x\rvert$ large. – Daniel Fischer Dec 2 '13 at 12:06
3 Answers 3
up vote 1 down vote accepted
Your intuition seems quite good. Here are a couple notes on some ways to make it rigorous:
1) Since $f$ is a polynomial, $\displaystyle \lim_{x \to \pm \infty} |f'(x)|/|f(x)| = 0$ (unless $f \equiv 0$, but in that case you're already done.)
2) If for some $x_0$, $f(x_0)<0$, then since $f$ is continuous, there is a certain interval $(a,b)$ containing $x_0$ such that $f(x) < 0$ for all $x \in (a,b)$. This means that $f'(x)<0$ for every $x \in (a,b)$ implying that $f$ is strictly decreasing on $(a,b)$. In particular, you can deduce that $f(b) < f(x_0)<0$. Now, let $$A = \sup\{ y \geq b \mid f(x)<0 \text{ for every } x \in (a,y) \}$$ If $A \neq \infty$ then by the same work as before you get that $f(A) < f(x_0) < 0$, implying there is some $\delta > 0$ such that for all $x \in (a, A+\delta)$, $f(x)<0$ contradicting the choice of $A$, hence $A = \infty$.
3) From the previous mark, if $f(x_0)<0$, then $\forall x \geq x_0$, $f(x) < 0$ and hence $f'(x) \leq f(x) < 0$. Now, as you pointed out, this means $\forall x \geq x_0$, $|f'(x)|/|f(x)| \geq 1$. But this contradicts the first point.
share|improve this answer
Just to make sure I understand: point 2 is the formalization of "If $f(x_0)<0$ for some $x_0$ then $f'(x_0)<0$ too so $f$ must decrease to $-\infty$"? – Erel Segal Halevi Dec 3 '13 at 15:53
In point 3, shouldn't it be "$\forall x \geq x_0$"? – Erel Segal Halevi Dec 3 '13 at 15:55
@ErelSegalHalevi Sorry, I was working from right to left, not left to right.. a strange bout of dyslexia I suppose.. I've edited for the fix. – Tom Dec 3 '13 at 16:19
In point 2, shouldn't it be "$A=sup\{y≥a...\}$"? – Erel Segal Halevi Dec 4 '13 at 7:42
@ErelSegalHalevi $(a,b)$ was chosen so that $f(x) < 0$ for every $x \in (a,b)$, so $y \geq b$ is "$A$"-ok. – Tom Dec 4 '13 at 13:20
Assume that $f<0$ somewhere. There are only two cases: (i) $f$ attains a critical point with a strictly negative value. But then, if $x^*$ is this point, $f(x^*) \geq f'(x^*) =0$, a contradiction. The other case is that $f<0$ definitely. As you noticed, considering either $f(x)e^{-x}$ or $f(x)e^x$, you can prove that $f$ goes to $-\infty$ exponentially fast, and this is impossible since $f$ is a polynomial. I think this approach can be made completely rigorous.
share|improve this answer
I don't understand why there are only these two cases? – Erel Segal Halevi Dec 3 '13 at 15:42
$f(x)$ from your assumptions is a polynomial, not just a function with polynomial growth.
From your conditions, on all critical points, the function is non-negative. after its last critical point, it must be decreasing, but $\deg f'=\deg(f) - 1$ so $\lim_{x\to\infty}\frac{f}{f'} > 0$.
share|improve this answer
Yes, I mean that. I will correct the answer, thank you very much for pointing it out. – rewritten Dec 3 '13 at 15:46
"after its last critical point, it must be decreasing" - I didn't understand, why is this? Also, why must the limit be positive? (I didn't understand which fact is generally true and which fact is true only because of the question conditions). – Erel Segal Halevi Dec 3 '13 at 15:50
Your Answer
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '48', 'language_id_whole_page_fasttext': "{'en': 0.871150016784668}", 'metadata': "{'Content-Length': '86375', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:5MJV2UZ6JHG6NNB5BIL4JWAC76NX6BIY', 'WARC-Concurrent-To': '<urn:uuid:43198f7e-ba19-4570-959c-f49f0fc47ba5>', 'WARC-Date': datetime.datetime(2014, 12, 20, 12, 3, 39), 'WARC-IP-Address': '198.252.206.140', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:3UU6E43MLMNXKP4JW6XJIYCGIUJHEEN4', 'WARC-Record-ID': '<urn:uuid:cfc77f64-7769-4e5c-8c0d-11acf74850cb>', 'WARC-Target-URI': 'http://math.stackexchange.com/questions/589478/polynomial-or-exponential', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e8eec635-b52b-4158-880d-5b6e2f18a741>', 'WARC-Truncated': None}", 'previous_word_count': '636', 'url': 'http://math.stackexchange.com/questions/589478/polynomial-or-exponential', 'warcinfo': 'robots: classic\r\nhostname: ip-10-231-17-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-52\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for December 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.8921638131141663', 'original_id': 'aa66b3b0358ccc61d158d8d81895388dde188115bc458afabb85eefc9d85ed5f'} |
Summertime calls for relaxing afternoons chilling in your backyard pool. We spend countless hours maintaining it, but often forget that everything is weathering with time.
Owning a pool is an expensive affair, to say the least. You most likely installed one in your home a few years back, or perhaps it was packaged along with the house you purchased. In that case, remodeling it would be a smarter choice than spending on repairs at a later date.
There are several upgrades that you can give to your pool like installing energy-efficient heat pumps and filters or remodel the deck to match your patio. Renovating your swimming pool makes it safer and more enjoyable.
Our contemporary Calabasas pool remodeling services in will ensure that all your wishes come true.
Do I need pool remodeling?
Over time your backyard pool develops cracks. The water pump system is susceptible to wear and tear. It degrades after many years of pumping water, or there might be a leak. While you give your 100 percent in maintaining the pool, time takes its toll, and the expensive repairs follow.
Remodeling your pool makes it run like it’s brand new. Instead of repairing the same one over and again, you could replace the tiling, plaster, and deck or install more power efficient and state-of-the-art equipment for lesser operational costs. A pool remodeling and pool replastering service near you can give more personalized recommendations.
How long does a swimming pool remodel take from start to finish?
The time for completing your swimming pool project will depend on the extent of the work to be performed. While pool plastering service and re-tiling typically take around two weeks, remodeling your pool along with the entire backyard would take several weeks at best. A contractor will be able to provide better estimates as well as a quotation after a quick survey.
pool remodeling process
Is it OK to remodel my pool during the winter?
There are several benefits of remodeling your pool during the winter season. Firstly, since winters aren’t the most favored time for a dive and splash, you won’t miss out on the fun during the peak summer season.
Pool reconstruction and remodeling can take from a few days to a couple of weeks depending on the changes. Moreover, since it’s the offseason, it’s easier to get multiple consultations from different contractors and get the renovation done as per your desired scheduling.
What do I have to do during my pool renovation?
The only thing you do is to turn off the water. All professional Swimming Pool or Spa Repair companies in Calabasas, CA will take care of your beloved pool. You can sit back and relax, while the pros get onto work and remodel your pool into a picturesque sight.
Choosing the best pool remodeling services in Calabasas
The key is to hire a pool renovation and remodeling contractor after careful thought and consideration if you want the job done to perfection within your budget, but it’s easier said than done.
There are a ton of factors one needs to consider while hiring an agency. To facilitate the process, we’ve curated an extensive list of tips and tricks on how to find the best Calabasas pool remodeling services.
Selecting the best pool remodeling service in Calabasas can be a daunting task. While some may claim that they are the best, your mileage will vary. Following the above set of advice while selecting the right pool renovation contractor will give you peace of mind and a sparkling new pool. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9510149955749512}", 'metadata': "{'Content-Length': '55386', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:SUKZNHTBSIQEPBXPDHYK22WLNSGLXBSN', 'WARC-Concurrent-To': '<urn:uuid:d077ebe4-aa2a-4080-b596-9cf70c915978>', 'WARC-Date': datetime.datetime(2021, 5, 16, 21, 3, 26), 'WARC-IP-Address': '69.163.246.176', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:H4HMG3JTACDVTQCIGVPBSWHBBXU5KLM5', 'WARC-Record-ID': '<urn:uuid:f2757a76-48d3-4082-b635-9aecb71d0dd1>', 'WARC-Target-URI': 'https://valleypoolplaster.com/how-to-choose-the-best-pool-remodeling-services/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:528ae1fb-ab0e-4949-929b-8ce53616efa0>', 'WARC-Truncated': None}", 'previous_word_count': '591', 'url': 'https://valleypoolplaster.com/how-to-choose-the-best-pool-remodeling-services/', 'warcinfo': 'isPartOf: CC-MAIN-2021-21\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-223.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.0446319580078125', 'original_id': 'd72aef62c816f7ce889367fabc04af13cee720f315e0238f45ab0d9310700f0f'} |
FYP Midterm Authors 3
Random Literature or novel Quiz
Can you name the FYP Midterm Authors 3?
Quiz not verified by Sporcle
How to Play
Score 0/14 Timer 07:00
A dialogue between Salvaiti and Simplico
Believes that magic is the power of the word over nature
Faculty for judgement is not infinite (error is not a negativity but a privation for knowledge)
Imagination is the application of knowing to a body present in the knowing faculty
We can only know what we ourselves have made
We can difform refrangible rays of light
We do not have a unified soul but it is simply matter in motion
Differentiates between impressions, ideas, and imagination
Believes that the idea of faith is false
Believes that the government is the intermediate body between subject and sovereign
Civil liberty is limited to the general will
Writes about a statue arriving at dinner
Moral worth for actions is gained only through acting in accordance with duty
the dignity of man is his ability to legislate and be subject to self determined laws
Friend Scores
Player Best Score Plays Last Played
You You haven't played this game yet.
You Might Also Like... | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9300304651260376}", 'metadata': "{'Content-Length': '50670', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:35RX5FNIABZNS6LXUHJXE7R7U3HAADU7', 'WARC-Concurrent-To': '<urn:uuid:593079b8-c1be-4f90-8963-24c6a0c2f224>', 'WARC-Date': datetime.datetime(2014, 4, 18, 1, 49, 55), 'WARC-IP-Address': '50.17.215.113', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:YJQYAK3ITR2B6IEZTWBYO34YIOCAQ5LW', 'WARC-Record-ID': '<urn:uuid:cecabcba-e914-4373-b63a-5499c2af90e9>', 'WARC-Target-URI': 'http://www.sporcle.com/games/LHLS/fypmidtermideasandconcepts', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2efbc610-8a8a-43b5-a9cd-e8503010b892>', 'WARC-Truncated': None}", 'previous_word_count': '197', 'url': 'http://www.sporcle.com/games/LHLS/fypmidtermideasandconcepts', 'warcinfo': 'robots: classic\r\nhostname: ip-10-147-4-33.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-15\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for April 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.12704986333847046', 'original_id': 'dd6ea8e5adab4f55f8407a5ead2abf3ef52affe7339760956f805d70a0f6095d'} |
Don't Miss: The Last T-Shirt Sale of the Year
What Is It? game 289
The question is: what is it? It's time for our collaboration with the fascinating What Is It? Blog! Do you know what the object in this picture is? You can win even if you don't know! We don't know what the item is, but serious guesses will be investigated, and if yours check out, you can win a t-shirt from the NeatoShop! Read what we know about the object, and see more pictures at the What Is It? Blog.
Please write your T-shirt selection alongside your guess. If you don't include a selection, you forfeit the prize, okay? May we suggest a Science T-Shirt, Funny T-Shirt, or Artist-Designed T-Shirts?
So let's recap: this is a true mystery item, but if you figure it out before anyone else, you win the shirt you designate with your guess. There are more clues at the What Is It? Blog. If you have the funniest wrong guess, you'll win a shirt, as long as you select one and include it in your comment. Good luck!
Update: the mystery object …is still a mystery object. We don't know what it is! But we have a t-shirt from the NeatoShop for Paul Bryant 2, who gave us this funny answer: "It's a primitive bowling ball. Scores were marked on the side, meaning that not only was it hard to control, but only good for one game. It was quickly decided that round would be better." Yes, that that way progress is made. See the answers to the other mystery items of the week at the What Is It? blog.
Newest 5
Newest 5 Comments
It's a post to tie your boat on, they pulled the beam from a very busy dock, there any numbered slots so the harbormaster knows where each boats rented spot is at.
Timey Wimey Sweater xl
Abusive comment hidden. (Show it anyway.)
Commenting is closed.
Email This Post to a Friend
"What Is It? game 289"
Separate multiple emails with a comma. Limit 5.
Success! Your email has been sent!
close window | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '117', 'language_id_whole_page_fasttext': "{'en': 0.957033634185791}", 'metadata': "{'Content-Length': '62454', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7N4XKE4QOWRBPD2EKNATLNEV7SMVRRCF', 'WARC-Concurrent-To': '<urn:uuid:0969a5e8-2ae2-46ff-b69d-7218ea1ad5cc>', 'WARC-Date': datetime.datetime(2013, 12, 13, 13, 43, 43), 'WARC-IP-Address': '173.231.35.2', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:4RU4DPVDIOZIQPCTW2MPNPF2NNKGVIY7', 'WARC-Record-ID': '<urn:uuid:d7fcba81-b931-479f-b40c-b326959e17ae>', 'WARC-Target-URI': 'http://www.neatorama.com/2013/08/22/What-Is-It-game-289/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e32ba125-27df-4113-9a11-03a8182e04eb>', 'WARC-Truncated': 'length'}", 'previous_word_count': '427', 'url': 'http://www.neatorama.com/2013/08/22/What-Is-It-game-289/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-33-133-15.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2013-48\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for Winter 2013\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.18736809492111206', 'original_id': 'ff18322cc1fa0af4d8d4ba1d87e032b711875a20419e72f7104223b8f1016c19'} |
There are TWO Types of Pain
“There are two types of pain, one that hurts you and the other that changes you.”
The mechanism that exists to get the body stronger is very unusual. In simplest terms, to get in better shape, you must exert the body so much that it becomes stressed enough to produce microtears in the muscle. The adaptation to those microtears is what builds stronger muscles. Exercise scientist have labeled this response “super-compensation.” In this instance, this pain to the body has a productive value. It changes the shape of the body for the good.
On the other hand, if a client is running 100m repeats and after the third set complains that they may have hurt their hamstring I immediately have them stop what they are doing and have them describe the event. “I was in the middle of the sprint when I felt my hamstring pop,” he said. A red flag goes up in my head; this individual has hurt/injured their hamstring. If they continue on it will only make matters worse.
For our newest members, the concept of pain is very foreign to them. As trainers, it is essential that we teach them the difference. For example, after a tough training session the day before, a client may walk into the gym and describe their legs as “hurting.” I immediately respond, “do you mean sore?” Most often than not, they confuse hurt with being sore. I’m okay with soreness, if not happy about it. This hurt will eventually lead to a positive change in body composition.
For one type of athlete, hurt provides a mechanism to become stronger while the other only causes physical pain beyond immediate repair.
The same is true about life situations. There is pain that makes us stronger, and there’s pain that causes harm. The art and science of pain is knowing the difference.
Sign up for my FREE Daily Email Newsletter:
Related Articles | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '1', 'language_id_whole_page_fasttext': "{'en': 0.9527843594551086}", 'metadata': "{'Content-Length': '168368', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:SEKJPXI2HF2IT3VU32J6BKVHFTIVNNUS', 'WARC-Concurrent-To': '<urn:uuid:439955f8-b4d8-4f44-ab0a-2af11c28eebc>', 'WARC-Date': datetime.datetime(2019, 2, 16, 15, 56, 9), 'WARC-IP-Address': '162.214.23.231', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:I6PTUP34WHSSPRGNK6KO7U4VMM4DUUPI', 'WARC-Record-ID': '<urn:uuid:df9ced46-dce8-4097-830e-a2cc0771e391>', 'WARC-Target-URI': 'http://www.marioashley.com/there-are-two-types-of-pain/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:108c3ab7-9147-4fa0-b345-0007a25fea66>', 'WARC-Truncated': None}", 'previous_word_count': '315', 'url': 'http://www.marioashley.com/there-are-two-types-of-pain/', 'warcinfo': 'isPartOf: CC-MAIN-2019-09\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-166-118-163.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03461718559265137', 'original_id': '6e004b8d8ea934866003456466abd12eb10a8d2b386cbf60aba0f043241c43e9'} |
World Class Spas
Many hotels these days advertise themselves as having a spa - but there is a world of difference between basic facilities such as a steam room, sauna and a couple of beauty rooms and the kind of spa that is worth traveling the world for.
The former category are increasingly common - the latter stand out in people's minds as places synonymous with health, relaxation, rejuvenation and a real retreat from the stresses and strains of life generally - or even after a particular upset such as a divorce or bereavement.
Why visit a spa?
In the 19th century, spas were viewed as destinations for the wealthy, who went there for the restorative effects of "taking the waters." Water treatments are still considered the heart of the spa experience in Europe while in America massages and facials are by far the most popular. Whereas the reason for a spa break used to be mainly medicinal, these days there are far more varied reasons why people go.
They may want a place to properly unwind from stress - not just the type that might keep them awake at night but the kind that is so serious it is affecting their long term health. They may want to change a toxic lifestyle, give up using caffeine, nicotine or alcohol, lose weight or kick start a healthy eating or exercise regime. Increasingly today the best spas are offering specialist programmes aimed at people who want to see specific results after a stay - whether that be detoxing, anti aging, a clearer mind or more defined body.
Spas Directory
In this category of the Search and Go Directory you will find the latest information and quality listings featuring spas and wellness resorts worldwide. If You Need Info.... then Search and Go... | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9509138464927672}", 'metadata': "{'Content-Length': '8147', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:PMG3XPH4LQ622HREBZPGE7YF2CKSYPR2', 'WARC-Concurrent-To': '<urn:uuid:49b867fa-5a78-48d2-b5d3-b533cff5b225>', 'WARC-Date': datetime.datetime(2020, 5, 29, 17, 10, 56), 'WARC-IP-Address': '67.222.150.101', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:JNOSSUGJ3LVA4SINL4UPKOITYM42JS7M', 'WARC-Record-ID': '<urn:uuid:7275e68a-75e7-4405-8faf-162b173abfcf>', 'WARC-Target-URI': 'http://www.searchandgo.com/directory/health_nutrition/spas/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4cc5ce7f-e25c-47d1-8a54-72adf23aa046>', 'WARC-Truncated': None}", 'previous_word_count': '295', 'url': 'http://www.searchandgo.com/directory/health_nutrition/spas/', 'warcinfo': 'isPartOf: CC-MAIN-2020-24\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May/June 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-60.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2543623447418213', 'original_id': 'f9b87db0ee16bf69a7030222cac0ca80aea8f471f441efeefacf355850845c72'} |
Patching Up Potholes With Cold Mix Asphalt
Temperature fluctuations, snowfall, and plowing are all hard on asphalt paving. Over time these extreme temperature swings coupled with the everyday wear-and-tear from vehicles can cause asphalt to develop fissures or even dangerous potholes.
These potholes are bad enough in their own right, but when left untreated they can create even larger vulnerabilities. So, when are potholes most likely to develop and worsen?
You tend to notice a lot of potholes in the latter part of winter as well as the beginning of the spring season as this is the time of the year in which asphalt is combating the heaviest amounts of excess water and thawing.
Too much water and extreme temperature fluctuations don’t do any favors to asphalt, yet there is something you can do about damage that’s already occurred.
Cold Mix Asphalt for Potholes
Cold mix asphalt is made in pug mills by combining asphalt emulsions with aggregates designed to increase the integrity of your asphalt.
Because cold mix asphalt can be made to provide a coarser, stonier asphalt binder with a very high load factor or be used as a base or leveler, cold mix asphalt makes a great all-purpose material to work with. Cold mix is also extremely ego-friendly.
• Proven track record
For this reason, cold mix asphalt is also ideal for filling in potholes. Cold mix asphalt is actually quite flexible yet, because of how it’s constructed, also extremely durable and resistant to damage from the freeze-thaw cycle that can ravage your property in the late winter and early spring.
Cold mix asphalt already has a long track record of being used for temporary patching, even in the winter time. One of the reasons that many engineers and paving services actually prefer cold mix to hot mix asphalt is that cold mix can be used at lower temperatures and stored for later use if needed.
Whenever hot mix asphalt is hard to come by, or when conditions drop below a certain temperature, cold mix asphalt is the go-to material for maintaining roads and filling in potholes, especially from November to February.
• How it works
Because cold mix asphalt combines bitumen emulsion, cold aggregates designed for tough conditions, and even anti-stripping materials, it can be used in a wider range of weather conditions.
Not only that – cold mix asphalt is seen as easier to work with and more flexible than its hot mix counterpart due to the fact that cold mix asphalt has a longer cure time.
Although cold mix asphalt is already lab designed and tested to provide the best combination of flexibility and durability, different additives can be combined to the mix in order to render cold mix asphalt the perfect solution for your next project.
Cold mix asphalt can even be formulated to provide a long-term solution to improving the integrity of rural roads and parking lots to their original condition. In short, cold mix asphalt is very ease to work with, durable and can even be stored for months until you need another pothole filled.
• Cold mix exceeds expectations
Some people might be wondering about how cold mix asphalt holds up against hot mix asphalt in terms of meeting design guidelines.
Know that cold mix asphalt is resilient to cracking and fatigue and even has the capacity to self-heal. In addition, cold mix asphalt can be formulated to match the high AASHTO standards established for hot mix asphalt.
Make sure to regularly check your parking lot or home driveway for fissures and potholes. Too many potholes can even be a sign that your asphalt needs a sealcoating or routine spring maintenance. Contact us today to make sure your free of potholes and you have a grade A driveway or parking lot. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9257229566574096}", 'metadata': "{'Content-Length': '37008', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ONFUXAY5K232OI667ZYLLK7BAH5GF77G', 'WARC-Concurrent-To': '<urn:uuid:f7e6ba84-9498-499e-8dba-218a690eb145>', 'WARC-Date': datetime.datetime(2021, 1, 21, 23, 31, 47), 'WARC-IP-Address': '67.227.145.248', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:EYPQ5UG2QSKYEXZCB64S3NL3L53WDRQH', 'WARC-Record-ID': '<urn:uuid:9beccc86-3a31-406c-8735-dbb8922233b3>', 'WARC-Target-URI': 'http://www.dykespaving.com/blog/patching-up-potholes-with-cold-mix-asphalt/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:e4cad596-c700-4aed-9e8d-0b21be1b976c>', 'WARC-Truncated': None}", 'previous_word_count': '621', 'url': 'http://www.dykespaving.com/blog/patching-up-potholes-with-cold-mix-asphalt/', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-103.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018472611904144287', 'original_id': '9420f4adbef4019157cc95d68dd0a6cc7d651db82a2eb5be9e1bd14eab32ec40'} |
import Global = NodeJS.Global;
import { Container } from "inversify";
export default interface TestGlobal extends Global {
container: Container
}
| common_corpus | {'identifier': 'https://github.com/wand2016/twitch_host_prototype/blob/master/__tests__/global.d.ts', 'collection': 'Github Open Source', 'open_type': 'Open Source', 'license': 'MIT', 'date': '', 'title': 'twitch_host_prototype', 'creator': 'wand2016', 'language': 'TypeScript', 'language_type': 'Code', 'word_count': '20', 'token_count': '38', '__index_level_0__': '2551', 'original_id': '1d14b10de64af176a4cfa57dadce53dd9ee3b4f95eacd3b4f912b9509c16c7b0'} |
Why Shouldn’t I Call My Son Clint?
No Preview
Why Shouldn’t I Call My Son Clint?
electronic: $9.99paperback: $29.95
Using secret sounds of names as a predictor of personality
2. You work with an idiot and you wonder how they became an idiot.
3. Your parents didn’t have access to this book and they mysteriously called you Nigel, Colleen, Sharon or Kingston. And you wonder why people seem to treat you differently.
Clear selection | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '76', 'language_id_whole_page_fasttext': "{'en': 0.9223520755767822}", 'metadata': "{'Content-Length': '30957', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZN4YK4F3ROL6I7SXZ2DCAINNCZFIZUNZ', 'WARC-Concurrent-To': '<urn:uuid:a9681651-9c29-44cc-9fa3-2e880f048c0e>', 'WARC-Date': datetime.datetime(2020, 3, 30, 4, 41), 'WARC-IP-Address': '116.90.61.189', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:SOIUCIWAHQIQWMCWTSN2O6W2DKDUCKGY', 'WARC-Record-ID': '<urn:uuid:2f64c384-1dd6-4b4c-91f6-460e2e649624>', 'WARC-Target-URI': 'http://airbooks.com.au/book/why-shouldnt-i-call-my-son-clint/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:1780225b-6948-4ce9-8199-fbbd183ee7c2>', 'WARC-Truncated': None}", 'previous_word_count': '158', 'url': 'http://airbooks.com.au/book/why-shouldnt-i-call-my-son-clint/', 'warcinfo': 'isPartOf: CC-MAIN-2020-16\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March/April 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-100.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.9980387091636658', 'original_id': '0ad93ea6a72a330f0e12581f585db88b85fb0413c5df7841ccf00f6e020c38b5'} |
Why is the Nigerian Army obstructing Commercial Avenue?
Opposite Silverbird’s E-Center at Sabo, there is a compound owned by the Ordnance Ancilliary Service of the Nigerian Army. On both sides of the road, there is a clearly designated parking zone that runs throughout Commercial Avenue.
For the longest time, the parking zone in front of the Ordnance HQ has been obstructed, preventing motorists from parking. As if that is not enough, part of the other side of the road has also been obstructed.
When I asked why this was so, I was threatened with violence, and asked the typical Nigerian question: ‘Who are you?’
Obviously, there is a clear problem here: why is a parking zone being blocked? If there is any law – no matter how archaic and irrelevant – that forbids vehicles being parked in front of run-down military compounds, then why did the state government put them there? If there is no such law, then is this not a very blatant abuse of power by men of the Nigerian military?
Leave a Reply
WordPress.com Logo
Twitter picture
Facebook photo
Google+ photo
Connecting to %s | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '6', 'language_id_whole_page_fasttext': "{'en': 0.9528681635856628}", 'metadata': "{'Content-Length': '54091', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:XDENKXFRHEP6LVGC6ZZZGMGF4O3U4HUK', 'WARC-Concurrent-To': '<urn:uuid:876a52b2-647d-48ab-9c30-9ec7833038f4>', 'WARC-Date': datetime.datetime(2017, 9, 21, 14, 12, 19), 'WARC-IP-Address': '192.0.78.12', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2KYMMKUKOAWGFF4YGRCYFXGJRRWCEIUU', 'WARC-Record-ID': '<urn:uuid:ec654197-0f89-41de-9770-421c4aa082b9>', 'WARC-Target-URI': 'https://jmacebong.wordpress.com/2012/05/28/why-is-the-nigerian-army-obstructing-commercial-avenue/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a345b23d-e3e7-4112-a48e-4b7be6b6692b>', 'WARC-Truncated': 'length'}", 'previous_word_count': '228', 'url': 'https://jmacebong.wordpress.com/2012/05/28/why-is-the-nigerian-army-obstructing-commercial-avenue/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-236-49-209.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.4510354995727539', 'original_id': 'a0e18c144bf4b726cc80200fc78ea729a2aebfafc4914aea2c3038a90480f14c'} |
Could painkillers cause pain?
07 June 2016
Interview with
Dr Peter Grace, University of Boulder
Could painkillers actually make the pain worse? Opioid drugs, like morphine and Pills_painkillerscodeine, are extremely powerful but new research shows that they appear to cause chronic pain, as Chris Smith found out from researcher Peter Grace...
Peter - So the opioids do work exceptionally well for acute pain when they're initially being administered. Their effect actually diminishes over time so it means you need to take more drug to get the same pain relief. What we're also showing now is that, over a longer period of time, the effect not only wears off but they actually start to paradoxically induce pain in their own right.
Chris - So what did you actually do and how did you stumble on this discover?
Peter - We did an initial study where we looked at rats. We gave them a peripheral nerve injury and waited ten days and then gave them morphine for a five day period. Once that morphine treatment had conclude, we looked at their pain levels and we saw that those rats that had received the injury, but no morphine, recovered after about four to five weeks. But those rats that had received morphine for just that five day period took double the time to recover; their pain only resolved ten or eleven weeks afterwards.
Chris - So what you're saying is that they continue to show a heightened evidence of being in pain for twice as long if they'd had morphine than animals that didn't have any morphine?
Peter - That's exactly right. So we're looking at the sensitivity of the rats paws to touch. A normal healthy rat will just feel a tickle on the paw that won't bother them, a rat that is in pain will violently withdraw their paw.
Chris - How did you pursue that then Peter? So you have these animals which, if they've been given painkillers, paradoxically seem to then experience more pain for twice as long as if they hadn't had opioid painkillers - how did you investigate what was actually causing that?
Peter - Our first port of call was looking at these immune cells in the spinal cord called 'glial cells.' They are there to surround and support neurons but what we've shown is that these cells are really sensitive to any sort of injury or foreign substance. So these cells are activated, that means they start producing these inflammatory mediators that activate pain sensing neurons, and they're activated after peripheral nerve injury, but they're also activated by morphine and that then leads to these paradoxical effects on pain.
Chris - So, you injure the nerve and that winds up these glial cells and they start to become more active. At the same time you give morphine to quench the pain that you're experiencing but that also winds up these glial cells and makes them even more active. How do you then end up with this chronic pain, this pain that relentlessly goes on even after the original has subsided - how does that get entrenched?
Peter - Yes, the combined challenge of the peripheral nerve injury and the morphine sends these glial cells into overdrive. So they're far more reactive, and they're spewing out far more of these inflammatory signals, with the combined challenge then had either one of them the opioids or the peripheral nerve injury in isolation. So, because this immune response is so great, it leads to perhaps some extra cell damage in the spinal cord as well as enhanced signalling at these pain sensing neurons.
Chris - Could a person, therefore, end up in a sort of feedback loop where they initially have an injury, they get given opioids because they had severe pain and they needed to control it, but the damage to their nervous system, coupled with the exposure to the opioid drug, means they then end up with pain produced by having taken the opioid, so they then take even more opioid to control the pain and it just feeds back on itself and they end up in this loop they can't get out of?
Peter - Yeah, that's exactly right, and that's precisely what our study suggests. Importantly, I think, the silver lining here is that the cycle can be broken if the immune system, specifically within the spinal cord, is blocked and we've been able to do that in our rat study here. And we're currently focused on developing a couple of drugs that will, hopefully, get out to patients to help break that cycle.
Chris - So, what would your advice be then to someone who has an injury, should they not take the morphine if they can avoid it or minimise their exposure? What's the best way not to end up with one of these chronic pain states?
Peter - Opioids really aren't a long term solution for chronic pain. I think that for an initial acute injury they're fantastic and they do an excellent job of managing that pain, but if the pain starts to persists, I think it's best to have a conversation with your doctor to see whether there are any other alternatives that might work for you, and there are some other drugs out there that are really excellent for chronic pain.
Add a comment | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9782204627990724}", 'metadata': "{'Content-Length': '104228', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:PDGZLYQTIIFHAG2YFRATY4YBAYCPFBGA', 'WARC-Concurrent-To': '<urn:uuid:143b6915-d0d5-4796-85ac-5daa835e2e32>', 'WARC-Date': datetime.datetime(2019, 5, 19, 18, 56, 42), 'WARC-IP-Address': '81.201.132.39', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2VQF3ZP7UAH2M7DRP3XXRD6R4MXI2NRM', 'WARC-Record-ID': '<urn:uuid:818da418-5cf3-4ab7-ba32-afb488d7f2eb>', 'WARC-Target-URI': 'https://www.thenakedscientists.com/articles/interviews/could-painkillers-cause-pain', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7de7497e-ff48-428e-b617-f13cf7a4ff97>', 'WARC-Truncated': None}", 'previous_word_count': '882', 'url': 'https://www.thenakedscientists.com/articles/interviews/could-painkillers-cause-pain', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-171-192-21.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.8576438426971436', 'original_id': '548c068f66bbd7725f59e579c06b82f84d1dc9604b04560bb8109a8bce44d907'} |
jieba
numpy
scipy
pandas
networkx
pypinyin
pyhanlp
rdflib
python-louvain
tqdm
w3lib
nltk | the_stack | {'hexsha': '1fce81f30f3ddfe7649149bc023ea60e5fccfd8d', 'size': '88', 'ext': 'txt', 'lang': 'Text', 'max_stars_repo_path': 'requirements.txt', 'max_stars_repo_name': 'zgw540/HarvestText', 'max_stars_repo_head_hexsha': '6d3a1e31af9ad9752e78ca7d4b00ed20be63f1c1', 'max_stars_repo_licenses': "['MIT']", 'max_stars_count': '', 'max_stars_repo_stars_event_min_datetime': '', 'max_stars_repo_stars_event_max_datetime': '', 'max_issues_repo_path': 'requirements.txt', 'max_issues_repo_name': 'zgw540/HarvestText', 'max_issues_repo_head_hexsha': '6d3a1e31af9ad9752e78ca7d4b00ed20be63f1c1', 'max_issues_repo_licenses': "['MIT']", 'max_issues_count': '', 'max_issues_repo_issues_event_min_datetime': '', 'max_issues_repo_issues_event_max_datetime': '', 'max_forks_repo_path': 'requirements.txt', 'max_forks_repo_name': 'zgw540/HarvestText', 'max_forks_repo_head_hexsha': '6d3a1e31af9ad9752e78ca7d4b00ed20be63f1c1', 'max_forks_repo_licenses': "['MIT']", 'max_forks_count': '1', 'max_forks_repo_forks_event_min_datetime': '2021-11-14T01:17:11.000Z', 'max_forks_repo_forks_event_max_datetime': '2021-11-14T01:17:11.000Z', 'avg_line_length': '7.3333333333', 'max_line_length': '14', 'alphanum_fraction': '0.8636363636', 'original_id': 'b954303da35ef989380628f2944890a5ce291b9bfd92d4a14fc5d96bb7db0e3a'} |
Tuesday, 25 August 2015
Abolition of Slave Trade in Nigeria
Abolition of Slave Trade
In 1807 the Houses of Parliament in London enacted legislation prohibiting British subjects from participating in the slave trade. Britain withdrew from the slave trade while it was the major transporter of slaves to the Americas.
Furthermore, the French had been knocked out of the trade during the French Revolution beginning in 1789 and by the Napoleonic wars of the first fifteen years of the nineteenth century. Between them, the French and the British had purchased a majority of the slaves sold from the ports of Oyo.
British legislation forbade ships under British registry to engage in the slave trade, but the restriction was applied generally to all flags and was intended to shut down all traffic in slaves coming out of West African ports. Other countries more or less hesitantly followed the British lead. The United States, for example, also prohibited the slave trade in 1807 (Denmark actually was the first country to declare the trade illegal in 1792). Attitudes changed slowly, however, and not all countries cooperated in controlling the activity of their merchant ships. American ships, for instance, were notorious for evading the prohibition and going unpunished under United States law. It should be noted, moreover, that the abolition movement concentrated on the transatlantic trade for more than five decades before eventually becoming a full-fledged attack on slave trading within Africa itself.
The Royal Navy maintained a prevention squadron to blockade the coast, and a permanent station was established at the Spanish colony of Fernando Po, off the Nigerian coast, with responsibility for patrolling the West African coast. For several decades, as much as one-sixth of all British warships were assigned to this mission, and a squadron was maintained at Fernando Po from 1827 until 1844. Slaves rescued at sea were usually taken to Sierra Leone, where they were released. British naval crews were permitted to divide prize money from the sale of captured slave ships. Apprehended slave runners were tried by naval courts and were liable to capital punishment if found guilty.
Still, a lively slave trade to the Americas continued into the 1860s. The demands of Cuba and Brazil were met by a flood of captives taken in wars among the Yoruba and shipped from Lagos, while the Aro continued to supply the delta ports with slave exports through the 1830s. Despite the British blockade, almost 1 million slaves were exported from Nigeria in the nineteenth century. The risk involved in running the British blockade obviously made profits all the greater on delivery.
The campaign to eradicate the slave trade and substitute for it trade in other commodities increasingly resulted in British intervention in the internal affairs of the Nigerian region during the nineteenth century and ultimately led to the decision to assume jurisdiction over the coastal area. Suppression of the slave trade and issues related to slavery remained at the forefront of British dealings with local states and societies for the rest of the nineteenth century and even into the twentieth century.
Lagos, where the British concentrated activities after 1851, had been founded as a colony of Benin in about 1700. A long dynastic struggle, which became entwined with the struggle against the slave trade, resulted in the overthrow of the reigning oba and the renunciation of a treaty with Britain to curtail the slave trade. Britain was determined to halt the traffic in slaves fed by the Yoruba wars, and responded to this frustration by annexing the port of Lagos in 1861. Thereafter, Britain gradually extended its control along the coast. British intervention became more insistent in the 1870s and 1880s as a result of pressure from missionaries and liberated slaves returning from Sierra Leone. There was also the necessity of protecting commerce disrupted by the fighting. The method of dealing with these problems was to dictate treaties that inevitably led to further annexations.
Credit: Country Studies
No comments:
Post a Comment | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '36', 'language_id_whole_page_fasttext': "{'en': 0.9746002554893494}", 'metadata': "{'Content-Length': '82113', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:4T76HDMFGZGFF4X4Y6UEEKC7TAFBAJUO', 'WARC-Concurrent-To': '<urn:uuid:8404688b-2c79-4838-82f0-cc1081cd0bb1>', 'WARC-Date': datetime.datetime(2017, 9, 21, 10, 23, 39), 'WARC-IP-Address': '172.217.7.179', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:T5H53MELVQ5XCZFHO6TEGC4OGKFMFAI2', 'WARC-Record-ID': '<urn:uuid:47896c0f-3441-4ccb-b9dc-b43c719eb157>', 'WARC-Target-URI': 'http://www.nigeriagists.com/2015/08/abolition-of-slave-trade-in-nigeria.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ff55554f-3805-4d19-a8ed-9e2f35cc7378>', 'WARC-Truncated': None}", 'previous_word_count': '662', 'url': 'http://www.nigeriagists.com/2015/08/abolition-of-slave-trade-in-nigeria.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-186-163-226.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-39\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for September 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.029577910900115967', 'original_id': '0b1b15fa33e8f7655dbcda6e18fdb51a4cf4ee2bbf9bb70fc1da5e49c80c34f4'} |
How to keep up your physical wellbeing with the demands of modern working life
Like the employer wants employees to perform at a high level, it is in the interest of each individual. We want to be good in what we are doing and achieve good results. Unfortunately, the modern business environment isn't always enabling us to do so. And more often, limitations in our physical wellbeing aren't either.
Increasing demands from employers and the modern lifestyle are putting more stress on employees and their wellbeing. As a result we are seeing low energy levels, lowered performance, more stress related sick-days, and lowered employee engagement.
In an optimal situation the employer takes a bigger responsibility of the wellbeing and development of employees, and provides resources and support to handle the challenges of modern work life. However, not everyone is fortunate enough to receive the help and support.
Good physical wellbeing enables you to perform at your highest potential and be energetic after work
What to do?
By taking proactively care of your physical wellbeing and by reducing sitting hours, you can increase your energy levels, performance, alertness, creativity, and decision making. More importantly, you decrease the chances of getting modern lifestyle diseases (e.g. obesity, heart diseases, type II diabetes) significantly and have more energy outside the work. Here is how:
1. Add more physical activity into your day
So far it is quite clear that evolution is not keeping up with the requirements of sitting 9 hours staring at screens. It's been suggested that too much sitting might be even more dangerous for your health than smoking!
The importance of daily physical activity is becoming ever greater while we are doing less physical work. It provides the necessary movement for our body and reduces the pressure on our spine and blood vessels caused by sitting.
Try following methods to add activity into your day:
• Walking longer distance to and from work by parking your car on a further parking place
• Taking/leaving the public transport a stop or two further/earlier + standing in the transport
• Cycling to work (or part of the trip)
• Taking stairs instead of an elevator
• Walking or standing meetings
• Walking or standing while you are on the phone
• Standing desk
• Lunch break walks
• Standing up regularly to stretch
• Force yourself with conscious choices to move more (e.g. printer in another room, switching work station between tasks)
• Regular muscle movement (squats, push-ups etc.)
• Use activity tracker or other technology to remind and motivate you move regularly
• Ask your colleagues to take part to get support
By making physical activity a habit or a part of another habit, you have a higher probability of doing it regularly and gaining the benefits. Use your imagination how you could add activity into your usual working day habits.
2. Exercise regularly but not too often
Physical activity helps you to keep your body functioning normally but it isn't alone effective enough to improve your physical fitness.
The health benefits of exercise are so significant, that you should make time for it no matter how busy you are, it will pay back. In addition to decreasing the risk of getting the modern lifestyle diseases, helping in weight control, preventing depression, better fitness also improves your performance and concentration, and gives you the strength to get through the day with higher energy. Try following methods:
• 1-3 times of exercise per week is often enough in addition to your daily activity. If you do more, make sure you leave enough time for recovery and program easier weeks on your training plan
• Do diverse range of exercise including low pace/long distance training, muscle and strength work, high intensity interval training (HIIT), and mobility and stability exercises
• Vary exercises regularly to give your body new stimulus. Don't forget to give your body some easier weeks to recover
• Concentrate mainly on activities you enjoy doing and plan other training to support you getting better in your favourite activity
• Set goals and make plans how to get there
• Start slowly and increase the amount of workouts and intensity step by step to avoid killing your motivation in the beginning
• To make sure you are doing things correctly and efficiently, ask for help from a professional trainer
Remember exercise is also added stress for your body. Always balance the amount and intensity of exercise with other stressors in your life. For weight control exercise alone is not very efficient.
3. Eat nutrient rich food to energize your body
Bad diet choices have a direct impact on your health and performance, whereas healthy diet provides the necessary nutrients to keep your body healthy and your brain alert.
There is no one and only right diet for everyone but some guidelines are often helpful for most of us:
• Try out different food timing and different portion sizes to find out how much, and how often, you should eat to keep your blood sugar level even, and which is the best rhythm to energize your day
• Take care that you get enough energy during the workday
• Have a snack in the late afternoon to avoid the monster hunger on the way home and at home, which often leads to bad choices and binge eating
• If you eat often in a restaurant, remember the hidden calories you get with the tasty food. Pick the healthier choice from the list. If you know you will be having a large restaurant dinner, balance the days intake by eating a lighter breakfast and lunch
• Balance your food intake to match the changes in your activity level
• Eat most of the carbs (carbohydrates) around your exercise to improve performance and recovery
• Try a breakfast with more protein and fat instead of classic carb breakfast
• Make sure you get enough vitamins and minerals from nutrition rich foods. Include vegetables, berries and/or fruits into each meal
• Drink water regularly during the day. Avoid sodas or other energy rich drinks
• Prefer preparing food yourself to know what you are actually eating
• Cook a larger dinner to have leftover for next days lunch
• Be honest to yourself about your eating. Keep a food diary for some days to see the truth
Forget seasonal weight loss diet thinking and aim to find a balanced diet, which you can follow throughout your life. Instead of restricting yourself from something, use more allowing approach and aim to moderateness. Base your diet on foods you enjoy to eat and learn to make them nutrition rich and tasty.
If you are struggling to improve in activity, exercise and nutrition, even if you try your best, the reason might be in your nights.
4. Take care of your sleep and recovery
Sleep is the "hottest wellbeing topic of 2017" and for a reason. Lack of sleep has been connected to stress, weight gain, lifestyle diseases, attentiveness, depression, flu, heart diseases etc. Very often, good sleep is the defining factor for better wellbeing and performance, and it can change your life. Once sleep is at a good level, everything else will fall in place.
To recover from the stress the work is causing for our body and mind we must take care of proper recovery
To recover from the days stimulus body needs 7-9 hours of sleep regularly. Unfortunately it is not enough that you sleep well 2 nights/week on weekends. If you recognize yourself sleeping continuously less and claiming it has no impact on you, try for two weeks sleeping enough and see the difference in your health, energy, performance, decision making, and creativity. I bet you don't want to go back to old. It is all about choices and enough sleep should be very high on your priority list.
To secure a good night sleep try following methods:
• Reserve minimum 8 hours in bed to secure enough sleep
• Do some light activity or meditation in the evening to relax your body and mind
• Exercise improves sleep quality. Do it in the morning, during the day or after work but avoid late evening exercise (can prolong falling asleep)
• Secure getting enough daylight during the day to signal your body its natural rhythm
• Get an ergonomic bed and pillow
• Minimize distractions in your bedroom and lower the room temperature
• Keep a notebook next to bed to write stressing thoughts down, this way you remember to handle it in the morning and can let the thought go
• Turn of electronic devices 2-3 hours before sleeping to avoid blue light
• Darken lights in the evening
• Eat a late, carb rich dinner
Caffeine has been shown to improve performance and memory when used moderately. If you use it continuously to make up bad sleep, you are on wrong track and facing even a bigger problem very soon.
Even if your work is highly meaningful and enjoyable, it creates stress on your body and mind.
Methods for adding recovery inside the working day:
• Schedule breaks for your day to let your body and mind recover
• Close your eyes for 30-60 seconds and take 10 deep breaths and concentrate only to the breathing movement to forget everything else
• Do mindfulness or meditation practice. Even very short stopping and concentration into the moment can help
• Take a 1-3 minute quiet moment before each meeting or task to forget the previous task and be ready for the next
Take action
Don't start next week or next month or when it's getting easier at work, the right time to start is now, there won't ever be "a better time".
Need help in improving your fitness and wellbeing?
If you are insecure what you should do and would like to get clear instructions to start on a correct path right away, I am happy to help you. Contact me through and I will advice you how to proceed. The first coaching session is for free!
- Petri | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9445356726646424}", 'metadata': "{'Content-Length': '60149', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:V4N3ABRVX6FJTRFJZGYVLGDJODCNKIK2', 'WARC-Concurrent-To': '<urn:uuid:3fd79988-27e5-4b46-b936-9f2ce8ea3fe7>', 'WARC-Date': datetime.datetime(2019, 3, 19, 19, 47, 49), 'WARC-IP-Address': '217.16.182.131', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:7VGKD4JWNZ4GDKXKZZ3QW5QAEROETMRU', 'WARC-Record-ID': '<urn:uuid:0088b613-144c-4feb-b4f5-88a15ad4505d>', 'WARC-Target-URI': 'https://www.wellbc.de/l/keep-up-your-wellbeing-with-the-demands-of-modern-working-life/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4985e695-d50a-42fd-bece-063ad2c27d60>', 'WARC-Truncated': None}", 'previous_word_count': '1626', 'url': 'https://www.wellbc.de/l/keep-up-your-wellbeing-with-the-demands-of-modern-working-life/', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-146-23-210.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018934965133666992', 'original_id': 'd1857447d0980f0f3bd566a52c42160d300f76e995450488f191e648261b55c3'} |
Project Description
Life is strange.
There are events that have happened during my career that seem to be WOW moments. Like when I sold my first piece, getting into a magnet program for the arts, getting into art college. These are some of those milestones that made me sit back and think, WOW I might be getting better at this whole art career. Well I happened had one of those moments over the weekend.
A few months back I had a piece purchased, for the direct intent of being put up for auction to raise money for a good cause. To be honest I had forgotten about it until I opened my email the other day. I received an email from someone who purchased the piece, and was asking if it was mine, and if I could tell her a little bit more about the piece. So, we began a conversation with a little bit more about the piece. She then responded the next day about how much she enjoyed it and how everybody likes it when they walk into her house It just brightens their whole attitude and the atmosphere of the home. If you had told me a couple years ago that I would get an email from someone in California who purchased my work, I would’ve said, “No.” But it did happen and it’s a WOW.
These are the moments that push you to develop your career and to become even better. It is a moment of validation; it says that you are on the right path. You should always be mindful of those things that happen for the first time to be appreciative that you have that WOW moment. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9869198203086852}", 'metadata': "{'Content-Length': '250821', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:3HDG3ZREXEUP7FQHYROAWVH4OIINW3YF', 'WARC-Concurrent-To': '<urn:uuid:0cd1ef67-c4cf-4231-a173-13007b16e986>', 'WARC-Date': datetime.datetime(2020, 8, 10, 18, 10, 20), 'WARC-IP-Address': '35.215.113.54', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:VJHV6IWXALBW2OWKF4YH3OPHZEREHFU2', 'WARC-Record-ID': '<urn:uuid:1e150a67-67f0-46dc-b55a-6d1f76fbc930>', 'WARC-Target-URI': 'https://creativepinellas.org/magazine-items/life-is-strange/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:7f4d97c2-9c3c-419f-8775-ddf33ebc4ddb>', 'WARC-Truncated': None}", 'previous_word_count': '282', 'url': 'https://creativepinellas.org/magazine-items/life-is-strange/', 'warcinfo': 'isPartOf: CC-MAIN-2020-34\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-230.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02087271213531494', 'original_id': '8b2fa6d024c57610b717137d11e85f8684ecd04d78f8406cd1673c9006d520b7'} |
This page has been archived and commenting is disabled.
If Greece Was California...
Tyler Durden's picture
For all its rhetoric, the current situation in the Eurozone should be very familiar to most Americans: after all it is merely a Federalist organization just missing one key feature: Federalism. At least for now. Whether Europe will succeed in reversing 20 centuries of nationalist pride, a multitude of languages, religions, cultures, histories, and superficial solidarity and friendliness covering generations of broad-based enmity, blood feuds and hatred, which is precisely what will be required (because the monetary union was merely half of the game) remains to be seen. It is likely that the stock market will force this resolution sooner than most expect. Then the question becomes: will Europe truly become the United States of Europe. And if so, what would the current Greek travails look like if they were transplanted to the state of California: another place which may soon be in dire need of a bailout. Luckily Jefferies' David Zervos has performed just the thought experiment: "let's assume the European monetary system structure was in place in the US. And then imagine that a US "member state" were to head towards a bankruptcy or a restructuring of its debts - for example California." The results are below.
Separation of Bank and State
The Euro monetary system is flawed. It is a system that was cobbled together for political purposes; and sadly it was set up in such a way that each member state retained significant sovereign powers - most importantly the ability to exit the system and default on debts in times of stress. There is virtually NO federal power in the Union, as witnessed by the complete breakdown of the Maastrict and Lisbon treaties. In fact, what we are seeing today is that the structure of the monetary system is so poorly designed, it actually creates perverse fiscal linkages across member states that incentivize strategic default and exit. Our new leader of the Greek revolt - Mr CHEpras - has figured this one out. And in turn he is holding Angie hostage as we head into June 17th!
To better understand these flaws in the Eurosystem let's assume the European monetary system structure was in place in the US. And then imagine that a US "member state" were to head towards a bankruptcy or a restructuring of its debts - for example California.
So let's suppose California promised its citizens huge pensions, free health care, all you can eat baklava at beachside state parks, subsidized education, retirement at age 45, all you can drink ouzo in town squares and paid 2 week vacations during retirement. And then assume the authorities never came after anyone who didn't pay property, sales or income taxes.
Now it's probably safe to further assume that the suckers who had bought California municipal debt in the past (because it had a zero risk weight), would quickly figure out that the state finances were unsustainable. In turn, these investors would dump the debt and crash the system into crisis.
So what would happen next in our US member state financial crisis? Well, the California governor would head to the US Congress to ask for money - a bailout. Although there is a "no bailout" clause in the US constitution, it would be over run by political forces as California would be deemed systemically important. The bailout would be granted and future reforms would be exhanged for current cash. The other states would not want to pay unless California reformed its profligate policies. But the prospect of no free baklava and ouzo then sends the Californians to the streets - rioting, looting and protesting ensue.
The agreed reforms by the Governor then fail to pass the state legislature. And as the bailout money slows to a trickle. The fed up Californians finally elect a militant left wing radical, Alexis (aka Alec) Baldwin, to lead them out of this mess!
When Alexis gets into office, the US officials in DC worry. They cut off all the Californian banks from funding at the Fed. But luckily, the "Central Bank of California" has an Emergency Liquidity Assistance program. This gives the member state central bank access to uncollaterized lending from the Fed - the dollars and the ouzo keep flowing. But the Central Bank of California starts to run a huge deficit with the other US regional central banks in the Fed's Target2 system. As the crisis deepens, retail depositors start to question the credit quality of the California banks; and everyone starts to worry that the Fed might turn off the ELA for the Central Bank of California. In turn they worry that California banks will not be able to access dollars. The depositors in California banks then start to pull their funds, and send them to internet banks based in "safe" shale gas towns up in North Dakota. Because in this imaginary world there is no FDIC insurance and resolution authority (just like in Europe), the California banks can only go to the Central Bank of California for dollars, who in turn continue to lend dollars to an insolvent banking system to pay out depositors. In order to reassure depositors, California might announce a deposit guarantee program - but with the state's credit rating is at CCC, the guarantee does nothing to stem the deposit outflow.
In this nightmare monetary structure, with regional central banks, ELA, Target2 and no FDIC, the prospect of a state default FORCES a bank default. The banks automatically fall when the state goes into financial turmoil because of the financial structure. A bank run is the only equilibrium in this system.
There is sadly no separation of member state financials state and bank financials in the European financial system. So what's the end game in our little US example above? Well, after the Californians take all the their dollars out of the California banks, Alexis realizes that if the central bank of California, along with the state and the banks default, the citizens will still have their dollar wealth preserved and the state could start all over again by issuing new dollars with Mr Baldwin's picture on them (or maybe Che's picture). This California competitive devaluation/default would then leave a multi-trillion dollar hole in the Fed balance sheet and the rest of the more responsible US states would have to pick up the tab. So Alexis goes back to Washington to threaten exit unless the ouzo and baklava keep coming. And here we sit in the current battle in Europe!
Can anyone in the US imagine ever designing a system so fundamentally flawed? Its insane! Without some form of FDIC insurance and national banking resolution authority, the European Monetary System will surely tear itself to shreds. In fact, as the Target2 imbalances rise, it is clear that Germany is already being placed on the hook for Greek deposits and other peripheral deposits. The system has de facto insurance and no one in the south is even paying a fee for it. Crazy!
In the last couple days I have spent a bit of time trying to find any legal construct which would allow the ELA to be turned off for a member country. I can't. It doesn't mean it won't be done (as the Irish were threatened with this 18 months ago), but we are entering the twilight zone of the ECB legal department. Who knows what happens next?
- advertisements -
Comment viewing options
Sun, 05/27/2012 - 18:44 | 2467854 devo
devo's picture
It should be if Greece were California.
Sun, 05/27/2012 - 18:45 | 2467856 Colombian Gringo
Colombian Gringo's picture
Sun, 05/27/2012 - 18:47 | 2467863 SilverTree
SilverTree's picture
If I wanted America to fail...
Sun, 05/27/2012 - 19:08 | 2467908 nmewn
nmewn's picture
...what would I do different?
Sun, 05/27/2012 - 19:12 | 2467918 Hulk
Hulk's picture
Absolutely nothing...
Sun, 05/27/2012 - 21:14 | 2468202 markmotive
markmotive's picture
Greece is Cali and Cali is America.
Welcome to the land where nothing's free.
Cue Niall Ferguson: Austerity vs. Stimulus
Mon, 05/28/2012 - 02:32 | 2468593 Oh regional Indian
Oh regional Indian's picture
Every truth-seeker here should study this web-site in and out.
Then sit-back and re-examine all of the foundation stones of your belief-systems.
The ensuing cog-diss will be the darkest before dawn, I assure you.
good luck. Seriously, it's all a scam.
Key Word CAFR
Mon, 05/28/2012 - 03:34 | 2468617 The Big Ching-aso
The Big Ching-aso's picture
All I know is that it's getting so bad in California San Francisco is issuing I.O.U.B.J.'s.
Sun, 05/27/2012 - 19:13 | 2467920 knukles
knukles's picture
Fuck all nothing.
Sun, 05/27/2012 - 20:21 | 2468085 Spitzer
Spitzer's picture
The auther is a fuckin fool
Sun, 05/27/2012 - 20:44 | 2468133 Troll Magnet
Troll Magnet's picture
obamney would never allow california to fail. too much money...holy shit, is teh gays gettin' married?!
Sun, 05/27/2012 - 20:57 | 2468159 sessinpo
sessinpo's picture
That could have been said about Greece and it was by certain Europeans. At some point, entities become to big to bail out as Greece is. The truth is, there was little to gain by keeping Greece in the game. It became a politican and economic headache not worth the billions. To much money. Not much money in a bankrupt state.
Sun, 05/27/2012 - 23:41 | 2468433 Augustus
Augustus's picture
The married Gay Life is so much simpler. They have no worries about the future of their children. Spend it Now or Never has so much more appeal.
Sun, 05/27/2012 - 21:55 | 2468262 BlueCollaredOne
BlueCollaredOne's picture
Don't know if you're trying to be ironic or not. Author is spelled this way. Spitzer is the man though, it's a shame the public can't accept the fact that some men just like hookers. I'm sure some bankers would be in jail if they could.
Sun, 05/27/2012 - 22:21 | 2468302 Ahmeexnal
Ahmeexnal's picture
Even Jesus Christ surrounded himself with hookers.
Many say he married one.
Sun, 05/27/2012 - 23:11 | 2468376 Ahmeexnal
Ahmeexnal's picture
T.J. Hooker.
How could a cop series with a name like that become the most succesful role for James Tiberius Kirk?
Mon, 05/28/2012 - 04:57 | 2468651 The Alarmist
The Alarmist's picture
You are really giving short-shrift to Denny Crane! IMHO, that was his finest role, and he looked like he enjoyed doing it.
Mon, 05/28/2012 - 00:20 | 2468490 prole
prole's picture
Show me the ZHer who complained of Spritzer's dalliance with his courtesan?
I believe our scorn is earned by the fact that the POS hypocrite jailed and ruined other men and women for participating in the same flesh trade as the fake lying two-faced politician himself.
Spritzer is the epitome of government: "Rules for thee, not for me" I condemn him to the lowest circle of the inferno
Mon, 05/28/2012 - 05:00 | 2468525 Harlequin001
Harlequin001's picture
Shouldn't you be dead by now?
What happened to the 'if I can't live free I'd rather die' bullshit you were complaining about?
yeah, suuure you would... evidently you're full of it, hypocrite.
So you condemn him to 'the lowest circle of the inferno' for.... wait for it... paying for sex, the oldest game in the history of mankind.
Do me a fucking favour... Prole, that's obviously an anagram of thick fucking twat.
Mon, 05/28/2012 - 11:01 | 2469257 prole
prole's picture
You are the hypocrite and the proof is you are an open liar and defending the hypocrite Spritzer.
I did not complain of his whoring at all, yet you straw man me as such? You are a liar and you use lies to score small talking point hits on me. Go ahead and lie your character shows.
And why should I be dead? Maybe I'll live for a thousand years.
Read my post liar, and you will note I condemn him to Hell for hypocricy, and for lying and bearing false witness against his ZH neighbor I'll toss you in with him.
Go back and read all my posts on ZH and see if I ever comdemn anyone for whoring, or even mildly complain? I think it should be legal you dolt, but Statists like you and Spritzer lock men and women up for the flesh trade. Probably just another hobby you share with your co-religionist Spritzer
Mon, 05/28/2012 - 12:14 | 2469427 Harlequin001
Harlequin001's picture
Woah there hoss. Spitzer, his name is Spitzer. If you're going to have a go at someone you should at least be able to get some basic facts right, and his name would be a good start that way at least we know we're both singing from the same fucking song sheet eh. What you're referring to is a soft drink.
'why should I be dead? you said if you can't be free, which you clearly feel you aren't that you'd die, yet here you are gobbing off at a good man with your I'm-holier-than-thou-attitude for doing nothing more than what is clearly legal in most parts of the civilised world' Stop point scoring, it just makes you look like what you are, a prick. You make up these statements as you go along without any intention of justifying or keeping to any of them. You said if you can't be free, you'd die, and we can all tell from your incessent fucking whining that you aren't, yet here you still are, ever the hypocrite.
Every time you type a word I know you just reneged on a deal. Now if you wouldn't mind going doing what you said you'd do and topping yourself for us, slave boy I'm sure the world will be a much better, and much quieter place. and we won't all need to wade waist deep through your bullshit anymore either. You lied, pure and simple, you make false statements on a daily basis to whatever suits your whim, and it's no good denying it now. You lied. You're still here therefore you lied. Clearly you have a problem with the English language but maybe I can help. '...for participating in the same flesh trade as the fake lying two-faced politician himself" - sounds pretty clear to me.
This bit, however, does not ...'lying and bearing false witness against his ZH neighbor' honestly, what the fuck are you talking about? I only restate back to you the bullshit you said to me and everyone else.
And as for this, 'Maybe I'll live for a thousand years.' you truly are a fucking nut job. I give up!
Mon, 05/28/2012 - 02:27 | 2468584 BlueCollaredOne
BlueCollaredOne's picture
This isn't a forum for people to try and display spectacular vernicular (It rhymed) They are missing you here.
Spitzer vindicated himself when he appeared in the documentary "The Inside Job"
Fuck you
Sun, 05/27/2012 - 21:24 | 2468220 Freddie
Freddie's picture
Callie-PORN-ia is Greece.
Sun, 05/27/2012 - 19:13 | 2467919 WmMcK
WmMcK's picture
Greece:California::Germany:________ NH?
Sun, 05/27/2012 - 19:23 | 2467945 Manthong
Manthong's picture
It's just a good thing for us that the people in Texas don't mind picking up the tab for the Governor Moonbeam and Mexifornia.
Sun, 05/27/2012 - 22:36 | 2468221 AssFire
AssFire's picture
Oh, we mind...In fact; we feel Germany's pain.
Mon, 05/28/2012 - 02:11 | 2468580 Manthong
Manthong's picture
Comparatively, the good news for Texas is that while Spain will cost Germany more than Greece, Illinois will cost Texas less than California.
So cheer up! : )
Sun, 05/27/2012 - 19:24 | 2467946 TJ00
TJ00's picture
New SAT question
Greece is to the EU what California is to the _______.
Sun, 05/27/2012 - 20:02 | 2468055 dougngen
dougngen's picture
Sun, 05/27/2012 - 20:15 | 2468074 jekyll island
jekyll island's picture
California is MUCH larger than Greece, much more important economically. And just as screwed, faceplant IPO aside.
Sun, 05/27/2012 - 20:23 | 2468095 Spitzer
Spitzer's picture
California is the biggest state in the dollar bloc and Greece is the smallest state in the Euro bloc. There you go...
Sun, 05/27/2012 - 20:59 | 2468166 sessinpo
sessinpo's picture
And if TPTB can't and aren't willing to continue playing with Greece, how long will they throw money in a bigger hole?
Sun, 05/27/2012 - 21:07 | 2468184 goldfish1
goldfish1's picture
Answer: Diebold bails them out.
Polls: Greek's pro-austerity parties gaining sure sure
Sun, 05/27/2012 - 21:34 | 2468236 Spitzer
Spitzer's picture
Eventually they go bankrupt like Iceland and greek bond holders get shafted. That doesn't mean the Euro currency is doomed.
Sun, 05/27/2012 - 22:25 | 2468304 Ahmeexnal
Ahmeexnal's picture
Greek bond holders have already been shafted.
And the euro was doomed from it's inception.
Only a matter of days until fraulein Merkel's charred remains are found near the entrance of her bunker.
Mon, 05/28/2012 - 00:36 | 2468516 Spitzer
Spitzer's picture
And the euro was doomed from it's inception.
Its no coincidence that the US lost control of the gold market months after the Euro was introduced. Notice what the price of oil has done since the Euro came out ?
Bond holders are shafted and the Euro is still worth more then the USD.
Mon, 05/28/2012 - 02:06 | 2468572 Tom Green Swedish
Tom Green Swedish's picture
Markets are retarded. All stock basically move in lock step (besides ones with low volume, and dividends), because the bankers commditized stocks and they all move the same way except for higher and lower prices from the mean (beta). Its really quite dull. How is the Euro worth more than the USD? Can you get more from a Euro than a dollar? Who gives a crap about money besides women? You all act like a bunch of little whores crying over money.
Sun, 05/27/2012 - 23:23 | 2468404 jekyll island
jekyll island's picture
That is baked in all ready. No fiat currency is ever doomed, until it is. California going the way of Greece would capsize the economy. It would be 2008-2009 on steroids.
Mon, 05/28/2012 - 00:04 | 2468465 Weimin
Weimin's picture
Exactly! and worst case eurozone would just let Greece go and live with the (manageable) consequences and Greece will suffer big time. the US on the other hand is very unlikely to kick Cali out for the right reasons.
Mon, 05/28/2012 - 02:40 | 2468598 ChickenTikka
ChickenTikka's picture
Istanbul was Constantinople.
Greece was never California.
If I were Tyler Durden then I wouldnt care about grammar.
Sun, 05/27/2012 - 18:48 | 2467858 Tom Green Swedish
Tom Green Swedish's picture
Greece, Facebook, Politicians and Bankers suck. Gold, Silver and Oil are cool. I'm a Zerohedger.
Sun, 05/27/2012 - 18:47 | 2467860 Colombian Gringo
Colombian Gringo's picture
If greece were california, instead of lubricants, they would use Tziki sauce before performing backside sodomy.
Mon, 05/28/2012 - 00:01 | 2468462 Augustus
Augustus's picture
Tziki sauce with jalapenos if used in California sodomy.
Sun, 05/27/2012 - 18:47 | 2467862 ThisIsBob
ThisIsBob's picture
Actually Greece is Dallas-Ft. Worth (economy size) with a stock market capitalization smaller than Facebook.
Sun, 05/27/2012 - 18:49 | 2467867 Mark123
Mark123's picture
You seem to suggest that deposit insurance is a great thing? All it has done in USA is to lull the public into ignoring the problems in their banking system and making the problem all that bigger.
I think in the long run Europe will be in better shape that the USA because they will have to fess up sooner and deal with REAL issues.
Sun, 05/27/2012 - 19:13 | 2467921 narnia
narnia's picture
These clowns are doubling down on big government. They aren't close to facing the music. Neither are Americans. The people controlling the guns are no where near giving up either. I don't see any winners here.
Sun, 05/27/2012 - 19:15 | 2467924 Joe The Plumber
Joe The Plumber's picture
In the long run european demographics are worse than the usa
Europe will not be recognizable in 200 years as it becomes the Western Caliphate
Sun, 05/27/2012 - 19:19 | 2467938 Joe The Plumber
Joe The Plumber's picture
As one example Spain was populated by eastern european visigoths among other early roman peoples and the original native populations now are small isolated and live mostly in mountainous rwgions.
Huge population transfers abound in european history. Nothing more to say
Sun, 05/27/2012 - 23:20 | 2468395 takinthehighway
takinthehighway's picture
Anyone who has ever played Risk knows the truth of your statement.
Mon, 05/28/2012 - 02:06 | 2468574 Ghordius
Ghordius's picture
+1 Spain was already once part of the Western Caliphates. Visit the great mosques that where converted to cathedrals after the "Reconquista".
Mon, 05/28/2012 - 04:59 | 2468653 falak pema
falak pema's picture
what we call blacks and browns and whites will be as relevant to the world in two centuries and being a Marylander or Californian in the USA of the 50s. Don't look at pigment look at the awesome evolution of human culture, good and bad, that is in the pipeline. Tipping times means big changes ahead. Our yardsticks are outdated just as newspapers don't make sense to the Internet generation. Just as Gutenberg and Columbus changed the world then.
Mon, 05/28/2012 - 05:34 | 2468675 Psyman
Psyman's picture
Yes, the future of humanity is one ugly mess of mud people ruled by the Jews from their seat of power in Greater Israel. Global genocide via the destruction of all unique cultures and peoples. All while claiming to embrace diversity and multi-culturalism.
Mon, 05/28/2012 - 08:59 | 2468925 hornster
hornster's picture
Europe does seem to reinvent itself every 50 years.
Mon, 05/28/2012 - 05:06 | 2468658 Psyman
Psyman's picture
The Jewish genocide of whites is going exactly according to plan. Western Europe and North America will be devoid of white power blocs well before the 200 year time frame you speak of. Seems whites are just a little too smart, and much too rebellious for the Jews to let them live. Thus the past century has seen a genocidal war against whites by the Jews.
Luckily for the Jews, whites are very obedient to authority, so long as it is not heavy handed. So the environmentalism/birth control propaganda has effectively gutted white birth rates. And mass immigration from the third world combined with "Democracy" ensures that whites will be powerless and victimized by the new majorites in their own lands within just a few decades.
Russia and Eastern Europe are the only long term hope for survival that the white race has. Short term, Australia is still 93% white, but that will be rapidly altered as the Anglosphere is under the iron heel of the Jews (just look at immigration policies and demographic shifts in the U.S., U.K. and Canada).
Sun, 05/27/2012 - 20:22 | 2468088 Whiner
Whiner's picture
And their private sector, non-bank debt is just a smidgin of ours! Still, it's gonna hurt, hurt bad for a long time.
Sun, 05/27/2012 - 20:28 | 2468111 natty light
natty light's picture
+1 mark123
Sun, 05/27/2012 - 21:03 | 2468178 sessinpo
sessinpo's picture
No one knows at this point. It's to early to tell what will develop on the other side. For all we know, we could have Europe implode and Russia and China picking up the pieces. It's all conjecture at this point. Maybe they bleed themselves slowly like Japan or maybe they make real reforms.
Sun, 05/27/2012 - 21:08 | 2468186 miro1a
miro1a's picture
I love it when sheep quote the fact that something is FDIC insured as an end all argument to the safety of an account. Things really "don't compute" when you tell them FDIC is broker and can't evin begin to cover losses.
Sun, 05/27/2012 - 18:53 | 2467875 lolmao500
lolmao500's picture
Who cares, zombies have invaded Miami... Long ammo!
Naked Man Eating Victim's Face Shot And Killed By Miami Police: Report
The officer, who has not been identified, approached and saw that the naked man was actually chewing the other man's head, according to witnesses. The officer ordered the naked man to back away, and when he continued the assault, the officer shot him. The attacker continued to eat the man, despite being shot, forcing the officer to continue firing. Witnesses said they heard at least a half dozen shots.
Sun, 05/27/2012 - 19:04 | 2467897 Uncle Remus
Uncle Remus's picture
Wait - does Miami PD use .40 cal? 'Cause, you know, I be connecting the dots...
Sun, 05/27/2012 - 19:16 | 2467929 knukles
knukles's picture
Ha ha ha ha ha ha
The epitome of Conspiracy Theories.
Sun, 05/27/2012 - 19:14 | 2467911 Disenchanted
Disenchanted's picture
Someone emailed me that and when I saw it a little bit ago that's the first thing I said to my wife...fucking zombies.
I'm a stranger in a strange land.
btw didn't that cop watch the walking dead...ya gotta shoot em in the head. /sarc
Sun, 05/27/2012 - 19:42 | 2467952 Joe The Plumber
Joe The Plumber's picture
I saw a guy eat his own shit and smear it all over the seclusion room walls for around 30 hours or so. Family was mad that we didnt stop him. Yet it took six family members holding him down to get him to the hospital and i had three dainty little nurses on the unit
He later told us it was ecstacy. He was probably mildly hyperpyretic too like the miami zombie was theorized to be. Any of the stimulating hallucinogens, or even cocaine and amphetamine, , that act on dopamine or serotonin can do it
Mon, 05/28/2012 - 00:10 | 2468474 Calmyourself
Calmyourself's picture
Okay, fess up what the hell kind of plumber are you? Urologist maybe?? You know a bit more than payday is Friday and shit runs down hill at 7% grade..
Sun, 05/27/2012 - 19:21 | 2467941 nmewn
nmewn's picture
From all appearances this looks like a "pro-wrestler" on the skids, down on his luck, crying out for help.
Won't someone help?
For just a dollar a day you can sponser a retired pro-wrestler suffering the ravages of steroid withdrawl and popularity neglect.
Please call 1-800-88nmewn and make the most generous contribution you can...operators are standing by.
Thank you.
Sun, 05/27/2012 - 19:47 | 2468001 Uncle Remus
Uncle Remus's picture
Only if I can score an unused barf bag autographed by Mickey Rourke.
Sun, 05/27/2012 - 20:00 | 2468052 nmewn
nmewn's picture
lol...would you settle for a faked robo-signed Dusty Rhodes coffee mug?
Sun, 05/27/2012 - 23:14 | 2468384 Ahmeexnal
Ahmeexnal's picture
Why unused? A barfed one would implicitly be autographed.
Sun, 05/27/2012 - 21:01 | 2468174 dbomb12
Mon, 05/28/2012 - 07:39 | 2468747 Disenchanted
Disenchanted's picture
excerpt from that...LOL!
Why a zombie apocalypse may be more real than you think
The average American consumer is already a half-zombie right now. They eat prion-infected meat; they drink fluoride in the water; they get vaccinated every year with neurological irritants (adjuvants); they watch network television news for "programming" and they take psychiatric medications that alter their brain chemistry. That pushes quite a large number of them into the "functioning zombie" realm of cognitive dysfunction.
In other words, they still manage to dress themselves, eat some food, use the toilet and punch a time card working some government job, but behind the apparent human face, they are already 50% zombie.
It won't take much to push these near-zombies over the edge into total zombiehood. A bit of radiation, a couple more winter flu shots, or even a series of neurologically-engineered red flashes broadcast on the evening news could activate the zombie brains of the American masses, causing them to spill out into the streets in their underwear, with Doritos crumbling down the front of their wife beater T-shirts, mouths gaping wide open as they stumble down the sidewalks of America's suburbs looking for fresh flesh to feed upon.
This part is not fiction, by the way. I'm serious about this. The zombie mind of the masses has already been prepped by mercury poisoning, pesticides, fluoride, aspartame and other chemical exposures. It will only take the right trigger to unleash the zombie masses, at which point you will definitely wish you went beyond the CDC's silly advice and got yourself a 12 gauge (or a really good pair of sneakers with which to flee).
The real question is: Do you have enough zombie ammo? And how fast can you reload? Sadly, the CDC did not address these questions. The truth is that most people do not have much zombie ammo at all, so after a few rounds, it's going to be like click... pause... gobble, gobble, slurp. And then suddenly you're a zombie and you'll be roaming the streets of a large American city looking for fresh flesh, much like a Congressman or the head of the IMF.
Learn more:
Sun, 05/27/2012 - 18:53 | 2467876 TrainWreck1
TrainWreck1's picture
It would call for something colossal, like a giant Yanni concert, to bring all fiscal parties together in harmony.
Sun, 05/27/2012 - 18:54 | 2467879 CPL
CPL's picture
It's the worst position to be in. Broke and printing IOU's on political motivations that were demented to begin with.
Only parallel insane idea in the past century of history was the League of Nations, which is as useless as its more modern counter party the ECB/EU. I would point out the UN but it's about to collapse on itself for an entirely different set of reasons along with the security counsel.
Sun, 05/27/2012 - 19:03 | 2467880 SgtSchultz
SgtSchultz's picture
Here is a potential theme song for the Eurozone........."Doomed"
Sun, 05/27/2012 - 18:57 | 2467881 tim73
tim73's picture
That is just laughable bullshit. You visited Europe last time in the 1950's? The only time there is somekind of nationalist pride is during some sport event, football or ice hockey or during Eurovision maybe.
European youngsters used Interrail pass to visit other European countries via trains already in the 1960's. Today there are EVERY DAY 30000 flights inside EU, so it is quite interconnected, similar to US eastern seaboard. Both Baltic Sea and Mediterranean sea are filled with so many ships of all kinds that in some places they had to install air traffic like ship traffic control to avoid collisions! Just go look at
Sun, 05/27/2012 - 19:05 | 2467902 The Alarmist
The Alarmist's picture
Funny thing ... we were watching Eurovision last night, and when the Shakira-looking Greek hottie came on, my better half said, "I hope Greece don't win, because if they do, they won't be able to afford to host next year's contest."
Sun, 05/27/2012 - 19:09 | 2467910 Uchtdorf
Uchtdorf's picture
Sorry, for your short-sightedness, that is. Ever heard of The Marshall Plan? US taxpayers financed that nonsense. The Western European nations effectively castrated their military strength because Uncle Sap was guarding them and giving them cash. Now the debt-financed, non-productive spending buzz is wearing off. Sobriety sucks and the old rivalries will again find themselves at war.
Sun, 05/27/2012 - 19:26 | 2467951 tim73
tim73's picture
Germany was bombed pretty much all to hell during WWII. München, Berlin, Köln...all almost totally levelled. How many US cities were firebombed? Not one.
Yes, Marshall plan was helpful but it did not even begin to cover the damages caused by the war. Europeans had to work 10 hard years before cities started to look somewhat normal again. Still, there are bombs in Berlin that sometimes require an evacuation of 5000 citizens, whole city blocks.
It is also a myth that Americans alone somehow guarded Europe during Cold War while we were just singing and dancing. Bullshit, most European men (also in the other side), today in their 30-70s, had to go to army unlike Americans, when they were about 20 year olds. Some liked it, some thought it was just a year wasted. Tens of millions of men. Except for Vietnam, YOU WERE the ones singing and dancing, behind your big de facto mercenary army.
Sun, 05/27/2012 - 19:47 | 2468002 Joe The Plumber
Joe The Plumber's picture
Yeah we all have our crosses to bear on either side of the pond
Its time to pull all the usa bases out of europe. Why does the usa need to finance 140 bases in germany?
Mon, 05/28/2012 - 05:13 | 2468666 Psyman
Psyman's picture
Because the Anglo-Zionist empire currently enjoys global hegemony. We aren't there to "protect" Germany, we are there to occupy Germany. Let's them know who's STILL boss (America and its Jewish masters).
Sun, 05/27/2012 - 19:53 | 2468030 SgtSchultz
SgtSchultz's picture
Myth that America guarded Europe during the cold war?
Let’s not forget the development, deployment, and maintenance of a highly credible nuclear deterrent against the Soviet Union and its Warsaw Pact allies; it can be argued that America offered Europe the stability to rebuild during the post war era and beyond.
Sun, 05/27/2012 - 20:12 | 2468066 Uncle Remus
Uncle Remus's picture
It might be argued that since the US taxpayers footed the bill for all the nuclear deterrence, we in effect subsidized European socialism.
Sun, 05/27/2012 - 20:24 | 2468098 knukles
knukles's picture
Sun, 05/27/2012 - 20:38 | 2468122 nmewn
nmewn's picture
Pretty much.
Maybe plant some trees as a parting gift.
Mon, 05/28/2012 - 01:26 | 2468558 e-recep
e-recep's picture
what usa did back then was for his own good. what usa is doing today is still for his own good.
go to europe and ask people if they are thankful to usa. i bet you'll be very surprised.
capitalism is greed no matter what. read marx, he predicted that things would come to this point. you think big capital cares about the middle class or the politicians can stop them? ridicilous.
capitalism is not free market, it actually hates it. wake up america, you are still daydreaming.
Mon, 05/28/2012 - 05:21 | 2468655 Rynak
Rynak's picture
Do people always have to throw in terms like "capitalism" or "communism" or "socialism" or whatever, to make their point, even though none of the premises of either one's proponents were ever implemented, yet all of the defects that every proponent of those ideologies despises about his/her enemy ideology?
What's my point? You had a pretty good argument based on simple facts, up to questioning how germans felt back then about the USA, and how they feel now about it..... and then you torpedoed yourself by hijacking that argument yourself, for the sake of another ideological fanboy rant.
Here's what someone living in germany, and who pretty much thinks that all those ideologues (no matter which camp) are idiots.... experienced in this regard:
Up to about 9/11, pretty much everyone in germany, and i suspect other european nations as well - was an USA-fanboy.... we looked up to the USA, saw them as "the ideal", and were thankful for what they did do, and were doing.... pretty much regardless of the dirty truths behind MSM TV education. USA == Hero .... HELL YEAH!
That was the state of populist opinion up to at least the middle of the 90s. Beginning in the 90s, the undisputed glorification of the USA, in germany (and i suspect europe) began to show first signs of significant dissent. It first was provoked, by globalist-style corporatism and massmedia aggressively (force-fed style) conquering europe. Up to that point, corporate culture, product brands and media still mainly had a strong local cultural stamp (even if that stamp was pro-usa)... but in the 90's this local corporate and media culture began to be full-frontally REPLACED by USA corps, as opposed to local corps glorifying the USA.
This created first significant counter-opinion.... not as a majority opinion of the country, but the sentiment was strong enough, for every citizen knowing of it's existence.
Phrased another way: up to that point, we were germans glorifying the USA. But then, it seemed as if we quite suddenly were made americans chanting "USA yeah!", which provoked quite a bit of uncomfortable feelings (You can deduct from this, that "local pride" never was abolished... just made a slave to a master).
Then 9/11 happened, and from there in just a handful of years, the whole "USA-yeah!" went to the toilet. In a matter of years, the majority of the population, which for half a century glorified the USA, thought of it as "arrogant imperialist assholes, who's style now strangely reminds us about a shameful part of our own history".
Mon, 05/28/2012 - 08:10 | 2468790 THX 1178
THX 1178's picture
Bravo! +1
Mon, 05/28/2012 - 07:37 | 2468743 Tarfeather
Tarfeather's picture
Yes, I'm sure that if Russia had started a nuclear strike, all of Europe would have been spared. Taking and fortifying west-germany was done out of pure concern for its inhabitants, and the fact that it was the only thing standing between Russia and the US' european allies at the time had nothing to do with it. The germans should be so very thankful they hadn't been turned into a folk of peasants, because then they would have had no chance to be the US' bitches in the upcoming military conflicts. Oh wait.
Sun, 05/27/2012 - 20:02 | 2468056 joe6px
joe6px's picture
Your first argument is true, except for Hawaii, but unrelated to anything. Your second argument is also true, however, without the military ability of the US, Europe would have fallen in a conventional assault. As to your whining about compulsory service, an all volunteer force has proven to be very effective.
Mon, 05/28/2012 - 01:27 | 2468495 oldman
oldman's picture
The real "helpful' was the fact that US companies 'investments' were loans or loan guaranteed and we made a ton of money with this corporate wealfare 'backstopped' by the US taxpayer.
More importantly, we got the global market shares of the formerly two most productive economies in the world and owned those markets for 40 years.
This was big stuff, and I am glad we had the Marshall plan. My generation was the one that owned the world for most of its lifetime and benefitted enormously; and, even though we paid close to fifty per cent of our income for various taxes, we managed to acquire, through savings, a modicum of what now is considered wealth.
That's all history. Now, we have had to give up market share---give it back, I might say because it was only a borrowed asset----and learn to live on less, Actually, this is one the key reasons I left the US 20 years ago--I had made enough ($100,000) and thought someone else might like a chance. This is not a joke because even though I am not neccessarily so generous----sharing is the real deal if we are going to live in peace.
Mon, 05/28/2012 - 05:15 | 2468662 Psyman
Psyman's picture
Most Americans do not have passports.
Most Americans have never left the country.
Thier laughable knowledge of history and geopolitics comes largely from the history channel.
That's who you're dealing with here on Zero Hedge. I see it in their comments about "Germany gonna invade France!" And similarly stupid bull shit. They have no clue just how cosmopolitan European youths are in their political outlook. These people disagree with you about modern Europe are 60 year old imbeciles burying silver coins under the crawl space of their shitty house in some shitty part of America, pay them no heed.
Mon, 05/28/2012 - 09:59 | 2469089 BernankeHasHemo...
BernankeHasHemorrhoids's picture
You are SO right. Imagine the state of ignorance that a presidential candidate (Romney) was criticized for his ability to speak French by other candidates. Americans are the stupidest people on the planet. They do not travel so they continue in their ignorance to blindly insist "USA #1" even though the country is becoming a Third World shit hole.
Mon, 05/28/2012 - 12:39 | 2469511 BooMushroom
BooMushroom's picture
Ooh, lookit me! I'm WORLDLY! I woke up in Germany, and visited Liechtenstein and Switzerland on my way to Milan for supper. I've traveled, and am far superior to a boorish American!
Fuck you. I live in Central California, and do that much driving just to get to L.A. My state is bigger than most Euro countries. We're bordered by exactly two countries, and can fit most of your continent inside our one country.
I've traveled 7800 kilometers east to west, and never left the country. Hawaii>California>Maryland. That's further than Lisbon to Tehran.
Sun, 05/27/2012 - 18:59 | 2467888 carbonmutant
carbonmutant's picture
...they'd be building a high speed rail line from Athens to Mt Olympus
Sun, 05/27/2012 - 19:47 | 2468003 LeBalance
LeBalance's picture
would that be one way for the virgins and the other way for boons of the Gods?
how is MtO different from Berlin, in the present circumcision?
Sun, 05/27/2012 - 20:25 | 2468102 carbonmutant
carbonmutant's picture
It take a true visionary to propose building a High Speed Rail to Heaven when you can't afford to repair your roads...
Sun, 05/27/2012 - 21:09 | 2468188 Jena
Jena's picture
Are you back talking California again, carbonm?
Sun, 05/27/2012 - 23:29 | 2468417 carbonmutant
carbonmutant's picture
Sun, 05/27/2012 - 21:04 | 2468180 stocktivity
stocktivity's picture
If I am a really good boy, can I be the virgin inspector?
Sun, 05/27/2012 - 19:02 | 2467892 The Alarmist
The Alarmist's picture
I kind of get the impression that California is Greece on steroids. I hope Guv Brown has been taking good notes, because unlike the Eurozone, it is taken as settled law that CA's exit from the Union is out of the question, i.e. bailout is a certainty if and when the day of reckoning comes.
Sun, 05/27/2012 - 19:49 | 2468007 LeBalance
LeBalance's picture
I am Governor Jerry Brown...
CaliPORNia Uber Alles.
Oh Jello you SEER!
Sun, 05/27/2012 - 19:05 | 2467901 Bill D. Cat
Bill D. Cat's picture
All is well , futures are green .
Sun, 05/27/2012 - 19:11 | 2467904 tim73
tim73's picture
The difference between USA and EU is that EU is still quite loose FREE TRADING union. EU yearly budget is about 135 billion euros while US Federal budget is whopping 3800 BILLION DOLLARS!
US States are obedient little bitches to Washington DC, crying for new pork projects and federal money all the time. Eurozone nations are quite independent, despite having common currency. They still have many more tools available unlike US States in this crisis.
US States cannot tax independently so much because federal government is already taking most of the money to itself and where that federal money go? One trillion goes to finance idiotic wars and bloated military while even the basic US infrastucture (road, rails, bridges) is already in dire need of repairs.
Sun, 05/27/2012 - 20:13 | 2468068 Day_Of_The_Tentacle
Day_Of_The_Tentacle's picture
Why do you have to turn every post into a pissing contest? You seem to have many good points. Don't kill your message by being such an angry, insulting and perpetual fog horn.
Sun, 05/27/2012 - 20:56 | 2468158 natty light
natty light's picture
Good analysis; hope he hears it because he has as you say good points.
Sun, 05/27/2012 - 20:49 | 2468147 nmewn
nmewn's picture
Just as most Americans aren't up on Euro countries tax schemes, euros aren't up on ours.
Several of our states have income taxes to go along with federal income taxes. Then heap on property taxes, sales taxes, gas taxes, fees, excise etc. etc.
The cummulative effect is...for many...become a parasite, the initiative to earn a wage & be independent of anything or anyone is design or circumstance...take your pick.
Sun, 05/27/2012 - 22:30 | 2468314 Joe The Plumber
Joe The Plumber's picture
I kinda like a loose federation but they made a mistake and lost regional flexibility with a commOn currency
Mon, 05/28/2012 - 00:43 | 2468519 jekyll island
jekyll island's picture
You make some good points, but the bottom line is that both have a central bank and central planning. Neither will be free until the charters for the central banks are canceled and we go back to using real money, not fiat.
Sun, 05/27/2012 - 19:11 | 2467914 knukles
knukles's picture
Son, I'm from California. The land of milk and honey. The American Promised Land. Land of Governor Moonbeam and Linda Ronstadt. Home of Drugs, Sex and Rock & Roll. Home of Hollywood and good solid clean Uber-Liberal Thinking. I'm from the Land of Opportunity. I'm from the land of Where America's Going and I can tell ya', it ain't pretty. The land of free love and trendy thinkin'. The land that mastered the 8 lane expressway perpetually trudging at 3 mph 24/7/365. The Land of Eric Estrada and CHIPS, Batman, the Gong Show, the Real Housewives of Beverly Hills and Storage Wars.
Alas, we can take no credit for Jersey Shore.
That's where I'm from, son.
The land where spectators are beat to death at baseball games and people are shot for wearing the wrong color hoodie. The land where all the radioactive shit from Fukushima is gonna wash ashore and pollute the whole of America thereafter. No son, it don't stop at the California border, just gets there, first..
The land where John Denver died. They never found his head in Monterey Bay BTW, but to this day dive, still searching, looking. Find his head, open a shrine on Cannery Row, Make a Million.
Goddammit, the land of drive through churches and Sunday liquor sales. The land of Disney, Callaway and hot rods. The land where almost all America's green shit is grown. Lots a cows, too.
Land of wine and populated by immature egotistical people taking themselves way the fuck too seriously and can't even take a joke.
Land of the consumer movement, feminism and plastic surgery. The Land where 18 y/o birthday girls are gifted with breast enhancements from their loving fathers.
That's right son, I'm from the Real America.
And if this is where America's going, then spend all you got while you got it, live for the moment, pretend there is no God but yourself, vote for the Democratic party state super-majority thereby raining taxes with impunity, handing all your personal responsibilities over to the state thereby absolving yourself of any and all responsibility and party like it's fucking Armageddon.
Almost nobody has a sense of humor here anymore except those of us in Recovery, graduating from Fight Club.
Good luck grasshopper, as if being from any other place makes you any different.
And remember: "You are not special. You are not a beautiful or unique snowflake."(h/t Fight Club) "You're the same decaying organic matter as everything else".
Welcome to America.
America the Beautiful, Land of the Free and Home of the Brave. Land of Eddie Bernays and most under-informed, over-entertained egocentric, spoiled, childish, immature people on earth.
Welcome to the Credibility, Liquidity and Dialectic Traps
Yes, welcome home, America.
Sun, 05/27/2012 - 19:16 | 2467930 Hulk
Hulk's picture
Holy shit !!! I had no idea John Denver's dead head is missing...
Rocky Mountain High, Pacific Ocean Low. Children, always practice switching to your reserve fuel tank before actually needing to do so. Hulk is over and out...
Sun, 05/27/2012 - 19:19 | 2467936 knukles
knukles's picture
He panicked ....
I know, that's just wrong...
Mon, 05/28/2012 - 00:24 | 2468498 Calmyourself
Calmyourself's picture
I thought a seagull killed him, through the windshield... Great just great, even my green jokes get f'ed up around here...
Mon, 05/28/2012 - 02:24 | 2468586 jekyll island
jekyll island's picture
They found his head, but I think it was a closed casket funeral:
On October 12, 1997, Denver was killed at the age of 53 when his experimental Rutan Long-EZ plane, aircraft registration number N555JD, crashed into the Pacific Ocean near Pacific Grove, California, while making a series of touch-and-go landings at the nearby Monterey Peninsula Airport.[33] National Transportation Safety Board]] (NTSB) accident ID is LAX98FA008.[34] As the crash badly disfigured Denver's head and body, making identification by dental records impossible, records of his fingerprints taken from his arrests for intoxicated driving were used to confirm that the fallen pilot was indeed the singer
Sun, 05/27/2012 - 19:20 | 2467939 Everyman
Everyman's picture
I think we ALL should drink a toast to knukles. Well said, man, well said!
Sun, 05/27/2012 - 19:39 | 2467986 Bollixed
Bollixed's picture
Yes, as someone who spent 30 years in Lost Angelus I think Knukles nailed it. If God is ever going to give the world an enema she's going to stick it in California.
Sun, 05/27/2012 - 19:48 | 2468005 Amish Hacker
Amish Hacker's picture
Hear, hear! I'm from California too, and I think you about nailed it, knukles. I would add only the Summer of Love (and the Autumn of Antibiotics).
Sun, 05/27/2012 - 19:30 | 2467968 Rubbish
Rubbish's picture
I really do hate this place, but the money is good.
Sun, 05/27/2012 - 19:40 | 2467989 Mox E
Mox E's picture
What do you mean we can't take credit for Jersey Shore? It's an LA based production company and one of my clients.
Sun, 05/27/2012 - 19:50 | 2468014 knukles
knukles's picture
Is da Joisee culshur, uddah wize zid be Val goils
Sun, 05/27/2012 - 19:46 | 2468000 foxmuldar
foxmuldar's picture
Have you considered moving? Why would anyone want to live in California except perhaps Illegal aliens.
Sun, 05/27/2012 - 21:11 | 2468193 stocktivity
stocktivity's picture
....and don't forget....OJ was found not guilty.
Sun, 05/27/2012 - 22:55 | 2468350 Let The Wurlitz...
Let The Wurlitzer Play's picture
Also, the land of fruits and nuts.
Mon, 05/28/2012 - 00:29 | 2468505 Calmyourself
Calmyourself's picture
Like my grandfather used to say, "the country tipped all the nuts rolled to California."
Mon, 05/28/2012 - 00:16 | 2468484 guinea
guinea's picture
The burning question is when is Mexifornia going to declare independence?
Mon, 05/28/2012 - 00:35 | 2468515 oldman
oldman's picture
Goddammit, Knuckles,
You make me home sick with all those great memories of the 60's, 70's and early 80's!!!!
The leading edge of the planet----where nothing was ever impossible, and everyone was doing sooooo well.
All over---all gone---But that is not to say that it didn't happen----and we were a part of it!!!
Long live California!!!!!!!!!!!!!!
I would go back to THAT place rather than anyplace else in the world---- thanks om
Mon, 05/28/2012 - 02:09 | 2468576 Raymond Reason
Raymond Reason's picture
Drive through churches? Shit, i had to google that. Incredible. And land of the immigrants too. But the immigrants that migrated to Cali aren't representative of the cultures they came from. They are the fruits and nuts of their respective homelands, embracing the Cali culture, buying breast implants for their daughters and sons, joining the frontrunners of the human stampede to Hell.
Mon, 05/28/2012 - 03:57 | 2468627 oldman
oldman's picture
I left florida in 1959 where mom and dad both had to work seven days a week just to pay rent and put food on the table. When I got to LA I found truck drivers working 60 hours in five days making enough money to buy a house, a car, a pick-up truck w/ camper and whatever else the family required while mom watched the kids and cooked and cleaned the house and was happier than any of the blue collar moms in florida.
One word was the difference: union---solidarity between workers to demand a fair price for their labor. Now, most here at ZH have little idea of that difference because 'solidarity' is just a word and they have been brainwashed(although, I don't know how this is possible) against a union, so it is a dog-eat-dog world---just like it was in good old right to work florida in 1959.
Also, it was OK to live next to people of other colors and beliefs-----and college was free----
and then reagan became governor and the later became president and California was completely fucked.
just a little history for you to put in your story---maybe you were too late to enjoy it, but THOSE were the good ol' days I was lucky enough to have been one of the fruits and nuts om
Sun, 05/27/2012 - 19:25 | 2467948 Joebloinvestor
Joebloinvestor's picture
California, where the Obama administration fucks Nancy and the MJ dispenseries and says he can't do a thing about it.
Calif, where they pass a lottery with a fucking lie about how it is going to add to the schools budget.
Calif, where you get to meet the US equivelent of Tepco.
Sun, 05/27/2012 - 19:26 | 2467958 misled
misled's picture
i rarely comment, but damn knukles... you made your point. +1
Sun, 05/27/2012 - 19:33 | 2467972 engineertheeconomy
engineertheeconomy's picture
Invalid comparison, Greece is subject to unpayable usury in a Ponzi scheme, unpayable because there's no reciprocal exchange. California is subject to payable usury because it's a welfare state, a reciprocal exchange.
For those of you that didn't get that... in Greece money goes out in insanely high interest payments to terrorist loanshark bankers, but no money comes in to Greece, so the money does not riciprocate and is unpayable unless they go back to those very same loanshark bankers to borrow even more money to pay it with.
In California, money goes out to pay the terrorist loanshark bankers, and is replenished by welfare, foodstamps, emplyment insurance, medi-caid, medi-cal, etc, etc, etc. This completes the cycle and therefore is reciprocal.
This article compares Apples to Oranges.
Dissapointing, I expected more from you Tyler.
Sun, 05/27/2012 - 20:02 | 2468053 Uncle Remus
Uncle Remus's picture
Macht nichts. Fuck California.
Mon, 05/28/2012 - 02:10 | 2468578 jekyll island
jekyll island's picture
You have captured the essence of how the financial elite confiscate wealth. I'm sure there will be a lot of vampire squid with seaside Mediterranean mansions.
Sun, 05/27/2012 - 19:33 | 2467973 Piranhanoia
Piranhanoia's picture
Shorter story; We have managed to take everything of worth that isn't nailed down in our decades long attempt to loot your state, and now your assets and your asses are ours. We have your gold, you have our railroads. We have managed to purchase your legislators so that they do our bidding and they assisted in the gang rape of your beautiful state. We installed all our own banks, insurance companies, energy companies, finance companies in an attempt to control your every discovery and find a way to buy or steal it.
Now it's your turn California, we have taken all the hopes and dreams, you get the potholes, and they need fixing. Please get out of our offices and don't come back.
Jeffries, honestly.
Sun, 05/27/2012 - 19:37 | 2467985 Arnold Ziffel
Arnold Ziffel's picture
Just keep the free Baklava, Booze and Babes coming and everythng 'll be ok.
Sun, 05/27/2012 - 19:42 | 2467992 Danielvr
Danielvr's picture
ZeroHedge really is the 4chan of finance isn't it?
The entire article is based on the premise that EU nations do not offer deposit insurance. That premise is wrong. See
Sun, 05/27/2012 - 22:30 | 2468315 css1971
css1971's picture
The premise is that the national deposit insurance from an insolvent nation doesn't mean diddly.
Mon, 05/28/2012 - 00:14 | 2468481 Augustus
Augustus's picture
that is the point, isn't it? getting an insurance payment for the euro account at a Greek bank, paid in drachmas, will not be very satisfying. One of the EU pols was honest enough to comment that when the bank run starts, getting the money out of that bank is only the only rational thing to do.
Sun, 05/27/2012 - 23:07 | 2468371 jomama
jomama's picture
dafuq did i just read?
Sun, 05/27/2012 - 20:21 | 2468083 natty light
natty light's picture
Why imagine it it is for all intents and purposes happening.
Sun, 05/27/2012 - 20:24 | 2468087 virgilcaine
virgilcaine's picture
where would cali be without porn, drug and pros related industries.?. they account for most of their Gdp.
Sun, 05/27/2012 - 20:25 | 2468103 surf0766
surf0766's picture
No EU contry/ financial institution thinks the Euro Union will collapse but the are all dam sure prepping for it. The can is no just foil.
Sun, 05/27/2012 - 20:27 | 2468110 Downtoolong
Downtoolong's picture
I’ve been having exactly the same comparative thoughts between the U.S. and Europe for the last year or so. I mostly agree with the post. In summary, the Euro is more in jeopardy than the dollar primarily because Europe is attempting to overlay a central monetary system on a decentralized government system. You can’t have it both ways. It is fundamentally flawed. It seems to fly in the face of the old adage, money follows power. In the U.S. , the central monetary system is aligned with the central government. But, is it better, or just different than a decentralized government and monetary system. That’s the tough question to answer. I’m sure it depends in part on how much the central government feels a need to manipulate it’s money and currency; you know, like we do in the U.S.
Sun, 05/27/2012 - 20:57 | 2468161 spekulatn
spekulatn's picture
Sun, 05/27/2012 - 21:13 | 2468199 Stimulati
Stimulati's picture
The California hate on this site is odd in its intensity. Long story short, California equals Germany if Germany decided to bail out Greece. California gets back 86 cents for every dollar it pays into the federal government. Small, poor red states are surviving on the largesse of California federal transfer payments. Think about what those poor red states finances would look like if they didn't get federal transfer payments from wealthier states like California, New York, and Texas.
Sun, 05/27/2012 - 22:16 | 2468295 Jena
Jena's picture
While that is true, the continued state political incompetence is well-publicized and therefore California is held up for great mockery. (Maybe other states are equally poorly run, I don't know. I only watch this tragedy/comedy.) Nothing is done to solve the budget problems, the educational system is going from awful to dismal and the legislature seems more interested in the perks of the job than doing anything substantive. Tax dollars are funneled to public union pension systems and any of the tax increases proposed in the upcoming referenda will go there too, despite what the political ads say.
There are some inland pockets that are still pretty sane and not much like LA if one must live in the state for one reason or another.
Mon, 05/28/2012 - 00:24 | 2468496 Augustus
Augustus's picture
California receives a fee from everyone in the whole country. All of the Import/Export offshore trade moves through the state. There is nothing superior about California, except the location allows for the handeling charges to be imposed there. The rules and regulation imposed have made it almost impossible for there to be actual goods production in the state. They provide some unavoidable services and call it a superior contribution. It is simply more Moonbeam Economics. Somewhat akin to the Arabian Gulf countries including oil sales in GDP numbers and claiming that they have a productive population, highest in the world.
Sun, 05/27/2012 - 21:25 | 2468224 world_debt_slave
world_debt_slave's picture
live free and die, bitchez!
Sun, 05/27/2012 - 21:38 | 2468239 OC Money Man
OC Money Man's picture
In May 2009, I testified in front of Barney Frank as the only voice opposing the U.S. Government from guaranteeing all debts of the states. There were seven "experts" giving testimony. Four were Republicans and three were Democrats. I was the only person testifying against the bailout. Essentially, I said guarantees would break the AAA credit of the United States. Here is the YouTube clip:
Sun, 05/27/2012 - 22:32 | 2468316 Milestones
Milestones's picture
Knuckles--really got into to your narative post on California. I was one of the true fortunate ones into Cal. Move there from Pittsburgh in 1945 and stayed around for all the great music from Miles, Bruebeck, Mulligan to Big Jay McNeeley, Brazil 66 and had the good luck to move out in 1966 and see other places.
Ya nailed it my man--right to the the 8 lane freeway. Thanks Milestones
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '289', 'language_id_whole_page_fasttext': "{'en': 0.9328069686889648}", 'metadata': "{'Content-Length': '206624', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:WNO5DNEUKQFHTZ36U7RK5COHF37RCNLU', 'WARC-Concurrent-To': '<urn:uuid:6a4b15ab-ef78-4f4d-b476-81594958e6d8>', 'WARC-Date': datetime.datetime(2015, 2, 28, 19, 16, 52), 'WARC-IP-Address': '185.32.215.119', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:5ZDZZQDRPDZDZOMTSBBPXXTKP3RQP7TX', 'WARC-Record-ID': '<urn:uuid:7046fbde-da5c-4fc0-a9a3-2916c547c010>', 'WARC-Target-URI': 'http://www.zerohedge.com/news/if-greece-was-california', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8c1ab035-316f-4667-b4af-629f4eab4469>', 'WARC-Truncated': None}", 'previous_word_count': '9748', 'url': 'http://www.zerohedge.com/news/if-greece-was-california', 'warcinfo': 'robots: classic\r\nhostname: ip-10-28-5-156.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2015-11\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for February 2015\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.2171306610107422', 'original_id': 'd651b539db7d9f06ac5bf12262d544d94613c9c37a74128ef916a523aeded387'} |
Massachusetts Trust
Massachusetts Trust is the trust formed by shareholders of a business entity by transferring their right in the business to the trust in lieu of a certificate form the trust, authorizing the trust so formed to participate in the management of the business on behalf of them . A massachusetts trust is similar to a limited partnership such that the maximum liability of the trust certificate holders are limited to the extend of shares already transferred to the trust
Close Bitnami banner | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9339024424552916}", 'metadata': "{'Content-Length': '60048', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:EUAFI7Y2COUSFJP2XF4GCQ37TYXVRO5F', 'WARC-Concurrent-To': '<urn:uuid:d4dc15ed-d4f0-47e6-bf7d-30bca5824ff0>', 'WARC-Date': datetime.datetime(2021, 1, 23, 14, 43, 17), 'WARC-IP-Address': '18.144.119.97', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:7PI3MHCIAEWAZ62HQX5R7AL2WIVJUYPU', 'WARC-Record-ID': '<urn:uuid:89f94f1b-24dd-4686-868c-eed7285fecba>', 'WARC-Target-URI': 'https://www.legal-explanations.com/massachusetts-trust/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:86539fcd-ec74-4f97-a487-3b3aa3f0dd59>', 'WARC-Truncated': None}", 'previous_word_count': '84', 'url': 'https://www.legal-explanations.com/massachusetts-trust/', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-90.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.025067567825317383', 'original_id': '03fb38937229e250ce49ee3c13ad5c98f8b8c398018ec3e9dd3cccfc64d36834'} |
The present invention generally relates to the field of displaying video data and particularly to the magnification of a display of video data.
Users have access to information from a wide range of sources on a diverse group of systems. For example, a user utilizing a digital information appliance, such as an Internet appliance, information handling systems, convergence systems, televisions, and the like may access information from the Internet, television networks, and contained in tangible media, such as compact disc read only memory (CD-ROM) and digital versatile disc (DVD). However, these systems typically do not support the same resolution for which the data was originally formatted, due to the wide range of sources and systems. For example, the monitor of a personal computer system may support resolutions of 640xc3x97480, 1024xc3x97768 and higher, but a typical National Television Standards Committee (NTSC) standard television may support only lower resolutions, such as 320xc3x97200. Presently, to display video data formatted for a higher resolution on a device supporting lower resolutions, the data must be reformatted to reduce its resolution.
One such method of reformatting data includes removing pixels from the original format so that the remaining number of pixels corresponds to the number of pixels capable of being displayed on the low-resolution display device. Another method involves reducing and interpolating the pixels with the use of different shades of color so as to attain an image that corresponds somewhat to the original image. However, by reducing the number of pixels displayed, detailed portions of the image are often rendered illegible. For example, a user viewing a Web page from the World Wide Web on a National Television Standards Committee (NTSC) standard television may not be able to comprehend portions of the reduced image. For instance, portions of the reduced image may include text originally formatted for display in a smaller font and meant to be read on a high-resolution display device, such as a monitor of an information handling system or high-definition television.
To enable a user to view the smaller text involved enlarging the reduced image. However, the reduced video data often produces translation errors once enlarged. For example, one method of enlarging an image adds pixels to the image so that the resulting number of pixels corresponds to the number of pixels capable of being displayed on the display device. Thus, if an original image contained one-half the number of pixels capable of being displayed on a device, the rows and columns of the original image were doubled, and a portion of the image was displayed. Consequently, the resolution of the image was not changed even though the size of the image was increased. Another method involved adding and interpolating the added rows so as to correspond to the rows in the reduced image. However, this method also resulted in an imprecise translation of the data since data was lost as the original image was reduced.
Therefore, there is a need for a system and method for magnifying a display of data thereby enabling a user to view high-resolution data on a low-resolution display device.
Accordingly, the present invention is directed to a system and method for magnifying a display of video data. By utilizing the present invention, a user may view an overall display of video data formatted for display in a high resolution on a low resolution display device, yet still view portions of the video data in detail on the low resolution device. In accordance with a first aspect of the invention, a system for magnifying a display of data includes a receiver for receiving a first set of video data including video data formatted for display in a first resolution. A translator is also included for translating the first set of video data formatted for display in the first resolution to a second set of video data formatted for display in a second resolution, the second resolution is a lower resolution than the first resolution. A magnifier is also included for magnifying a display of video data by formatting the first set of video into a third set of video data. The third set of video data is capable of display on a display device suitable for displaying video data in the second resolution and incapable of displaying video data in the first resolution, wherein the third set of video data being in an enlarged format with respect to the second set of video data.
In accordance with a second aspect of the invention, a method for magnifying a display of data, a first set of video data formatted for display in a first resolution is translated to a second set of video data formatted for display in a second resolution. The second resolution is a lower resolution than the first resolution. The second set of video data is capable of being displayed on a display device capable of displaying data in the second resolution and incapable of displaying data in the first resolution. The display of video data is magnified by formatting the first set of video into a third set of video data so that the third set of video data is capable of display on the display device. The third set of video data is in an enlarged format with respect to the second set of video data.
It is to be understood that both the forgoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate an embodiment of the invention and together with the general description, serve to explain the principles of the invention. | mini_pile | {'original_id': '052f13ddcb9dad27a1fc1562bf724c374c51c6e7b0c7062e3eef130e014bfe98'} |
Picking the best road hub
Best for value
When it comes to value, the best road hub option is generally something from our own brand components. These hubs provide the best value for money and most, but not all of them, are based upon Bitex hubs. Bitex hubs are made in Taiwan and are the finest example of a performance focused value hub. They have very good bearings and a reliable. Their precisely machined and carefully optimised hub shells are an excellent foundation for a wheelset. They use a strong, durable and easily serviced ratchet system. The range is extensive so there is a hub for every occasion. They are the ideal choice for alloy sets between £250 and £600 or carbon wheelsets from £700-1200. If what you want to treat your wheels to a more exotic hub choice; either higher performance or higher finish quality, there are a number of other, premium options worth considering.
Best for other reasons
With such a choice of hubs, it is easy to become confused. Each hub is different and they are designed for different riders and for different purposes. There are sometimes valid reasons to pay more for a heavier hubs – there are many metrics for what makes a good hub. Confusingly, manufacturers love using keywords like durable; lightweight; high performance and so forth. When reading the various descriptions of each, such phrases provide little insight into their key differences. Here we show you where each of the manufacturers excels, so you can choose which hub suits you best. One of the biggest benefits of hand built wheels is that you can customise the wheelset. You choose the components which best suit your needs and riding styles.
Is it worth spending lots on a hub(set)?
A well made hub should outlive the rest of the wheelset. With hand built wheels, these hubs can be rebuilt into new wheels. This allows you to retain much of the value of your original purchase when building up a new set. Hubs have a profound impact upon the performance of a wheelset, so a good hub is a good investment. Component parts of the hub may wear but can also be replaced individually.
The following hubs best suit riders who are looking at spending over £500 on a pair of wheels. All of the hubs featured cost over £350/pair, generally most high end sets start at around £700. The hubs themselves have different maintenance requirements but, however for all hubs avoid contact with degreasers/cleaning products. Degreasers clean out the bearings and ruin them once they run dry. Similar avoid the use of pressure washers. We have separate information on how to clean your bike carefully
The following article works through the different hubs in price order, extolling their various virtues. There are a number of manufacturers out there who we have not chosen to stock for a number of reasons. One of the reasons is overlap, however it may be that we have some concerns about the product. The range on offer here should be able to make a wheelset suitable for anyone.
DT Swiss 240s – £350, 314g/pairHBDT2405
Availability: 20, 24, 28 and 32h front. 24, 28 and 32h rear (Shimano/Campagnolo) made in Switzerland.
DT Swiss do also offer a 350 hub, which is an interesting, considerably more economical hub. Given the slightly limited availability on the hubs and the excessive weight of the front, I would consider this a mid-end hub and not relevant here. However it does have most of the features of the 240s, so if you like those features, want to save money and do not mind about the extra weight, they make a great choice.
All DT Swiss hubs are Shimano 11 speed compatible. They also all come with their patented Star Ratchet system. The Star Ratchet system differs from a conventional pawl system. It is similar to the clutch system used in Chris King hubs and two separate toothed rings revolve around each other and engage when twisted clockwise. It has been developed to provide very low drag, high reliability and durability and low weight. It is a system which can handle more torque and it puts less strain on the freehub/hub shell as there are no expanding/compressive forces from the design. The engagement as standard is only 18t. They do offer a 36t and 54t upgrade. The faster engaging systems are louder, have greater drag and reduce their durability. The hub is assembled/disassembled in a tool free way as end caps simply pull off. The ratchet system can only be fully removed from the hub with a proprietary tool.
While the headline weight of the pair of these hubs is good. The weight of the front is actually letting the weight of the rear down somewhat. The flanges are fairly standard in terms of size between both hubs. The flanges are slightly smaller in diameter to some of the other hubs here, although fairly standard, the holes are larger than some but the flanges are thick which is a good feature. The front being larger than you normally find on a high end hub which accounts for the extra weight. The front hub does have a 17mm axle which is good for stiffness – the rear has a 15mm axle which is slightly less good for stiffness but it does allow for larger bearings.
The bearings are fairly inbound in the hub which makes them less stiff, as does the push axle interface, however they used high quality bearings and a double shielded system providing probably the best sealing I have seen on any hub. 240s hubs are hubs you do not need to worry about, there is no preload. Assuming you do not cover them in degreaser, they should not require any attention until your rims are worn and require replacing, then a basic service should suffice. The rear flanges are a little smaller than standard which is perhaps where the weight saving has come from and will be less good for delivering torque. They come with alloy bodies and alloy axles which is another key way they have saved weight. Front hubs are suitable for radial lacing. The tension disparity between drive side and non-drive side is as good as you can expect to get really.
I think the look of the DT hubs is fairly unremarkable. A larger drive side flange would have been nice but would have added weight and not improved longevity or reliability which are the key features of the DT hubs. Overall a great hubset if all you want is a hubset that is light, strong and just works.
Royce Ultra Light/Venus pair – £423, 432g/pair
Availability, 20, 24, 28, 32h front, 24, 28, 32h rear. Shimano/Campag, high polished only – made in UK
Campagnolo bodies are possible on Royce hubs, however they are £10 extra and they require a lockring at an extra charge of £30.
You can see straight away that the Royce hubs are the heaviest in this line up. However this is for good reason and quite a deliberate decision. Royce hubs were previously lighter than this by around 30g, however the weight has gone up since they changed their rear axle and bearings to allow for bigger bearings and a stronger/stiffer axle at the back.
Royce hubs use the largest bearings listed here. They also have the heaviest axles. The axles themselves are barrel shaped to increase strength and stiffness. The front axle is made from titanium, the rear axle is made from 17/4 which is a very strong type of steel. They use NTN bearings in their hubs which are not actually bicycle wheel bearings but are designed instead for machining. They are very well sealed and very durable. However they are, particularly given their size (6001 at the rear), fairly heavy. The axles on Royce hubs come with a lifetime warranty.
The freehub bodies are made from titanium, like White Industries, however there is less machining on this version. The titanium as before helps to keep the weight down but resists bite. The titanium/steel axles have been chosen for strength and stiffness given their profile.
DCR Wheels is actually helping to design an Ultra Light rear hub from Royce. This will still use a titanium freehub body, a titanium axle again, smaller bearings and a different shell profile. They will be available in black with an engraved logo. They should weigh around 370g/pair, bringing them much more in keeping with the rest of the line up. They should be available in 2014, we are taking a list of interested parties.
Royce hubs are the only option in this list that is made in the UK. Longevity and strength is an obsession when it comes to Royce hubs and they require among the lowest maintenance of anything in the line up. Occasionally you will need to grease the pawls and it is best to do this with the lubrication system designed by Royce (available at DCR Wheels). Royce hubs are ideally suited to heavier riders, as well as riding who regularly cycle in harsh conditions and riders who do very high mileage. The drag on the NTN bearings is higher than most standard bearings, however that comes from the nature of the sealing on them. They do break in as time goes on and you can opt for non-contact seals if you wish. Inboard bearings on Royce hubs come with non-contact bearings as standard, outboard hubs come with contact bearings.
The hub shells are made from 2014 alloy. Normally shells are made from 6000 series aluminium which is a standard series. Generally 6061. 7000 series is sometimes used; this is stronger but also harder. The hardness can actually cause problems because it does not mold around the spoke as well and it is more brittle. It is often used when shells are heavily machined to keep the strength up. The 2000 series alloy used by Royce is stronger than 6000 but not as hard as the 7000 series. So it is a fair compromise to gain strength overall. The hubs themselves are not heavily machined and the profiles are quite curvacious which helps with durability.
Hubs are not suitable for radial lacing.
White Industries T11 – £435, 344g/pairt11 front
Availability: 20, 24, 28 and 32h front. 24, 28 and 32h rear (shimano/campag), black/silver – made in USA
White Industries hubs have a lovely finish to them. They have a real feel of hand craftsmanship about them. The logos are engraved into them. They come in a black finish or a high polished silver finish. They were developed as an 11 speed capable hub. The spacing on the flanges is nice and wide at the front. The flanges are significantly different sizes at the rear. A large flange on the drive side has helped keep the tensions more even at the back and help prevent wind up. The smaller flange on the non-drive side saves weight.
They come with a cro-mo axle at the back which is an unusual choice for a high end hub but steel axles are naturally stiffer than aluminium. The steel itself has been heavily machined and then capped with aluminium at the end, to keep this weight penalty to a minimum. The axle comes with a preload function. The front axle is alloy which is doubtlessly chosen for its weight saving. The freehub bodies are made from titanium but part of the body has been machined out behind the splines to save weight. Titanium is a lot harder than aluminium, so these bodies are a lot more resistant to bite. Titanium is also considerably lighter than steel, so the weight is kept down over using that as a material. Axles can be different sizes, so using a steel axle does not need to add as much weight as a freehub body does, where the external shape is already pre-determined by the cassette. The bearings are larger than some other hubs improving the stiffness and carrying capacity of the hubs, especially at the rear. Front hubs are suitable for radial lacing.
Longevity is built into the philosophy of White Industries and is taken seriously by them. However, bearings are an item that you can expect to replace more regularly than other hubs. They come with a low friction Enduro bearing. The hubs provide very little rolling resistance. As part of this low rolling system, the hubs provide only external shielding and no external sealing. So the hubs are better suited to fairer weather. The reduction in seals has reduced the drag on the hubs, making them ride very nicely, especially when couple with the wide bracing angle at the front and large flange and steel axle at the back with large bearings. They also have gentle leaf springs in the freehub, which is designed to be used only with lighter greases or perhaps even just oil. The gentle springs make a quieter sound and put less wear on the pawls, they also reduce the drag. Given that there is a preload on the hub; this does need to be adjusted periodically.
Phil Wood from £416, from 442g/pairphil
A very similar weight and price to the Royce hubs (comparing pro Phil hubs with Venus and Ultralight Royce). I am comparing these hubs generally in price order, however I have made an exception here because a Phil Wood hubset probably would cost you more than this as colour options are extra. It is also nice to be able to compare it directly after Royce. Like Royce this is a different focus for the hubset. A bit of background on Phil Wood:
They have been making hubs for a very long time. They are one of the oldest manufacturers here and over the years most of their hubs have been track of freewheel hubs. They have sold a range of touring and tandem hubs as well and lighter road hubs has been their newest venture. Campagnolo and 11 speed shimano hubs as well as alloy axles and bodies are new to 2015. So these hubs are both, in essence, very old and very new.
The traditional Phil Wood formula was essentially to use quality components, work with them to a high tolerance, over engineer them and build yourself a hubset that will last forever. Phil say themselves that their new ‘pro’ hubs have a lower rider weight and are less durable, however it is a lot lighter. They would prefer you to have a stainless steel freehub body and steel axles. Steel is stiffer for an axle and given that this is the largest steel axle used, it is fair to say that Phil Wood make the stiffest axles of all. Similarly when it comes to freehub material, steel is the most durable, it resists bite best and if you are using a pawl and ratchet system (as Phil do) then it will be the most durable there too. They use a very high quality ABEC 10 bearing. That’s right, ABEC 10! Essentially because they can and they have worked with a bearing manufacturer to do so.
So, the key question is, when would you choose Royce and when would you choose Phil Wood?
Phil Wood are made in the USA, Royce are made in the UK. That is likely to be a major factor. Phil Wood make more hubs, so you may choose Phil simply because there isn’t a Royce option that works. They make more colours for example, more axle interfaces, more drillings and more designs, they actually make more designs than any other manufacturer here. They also use steel freehubs, so if titanium is too soft for you, that may be your preferred option. Phil hubs are quieter when they freewheel. They also have 5 pawls not 3 and they are bigger pawls as well. Double row. The Phil hubs also have larger flanges for stiffer wheels.
So, what about downsides over Royce. Well, they just use a standard steel axle, whereas Royce is 17/4. They also use a steel body which is heavier than titanium, you can see that in reality, the hubset weight is comparable, however what is being compared there is the new Phil hub with the alloy axle and body. So the Phil hubs are normally heavier than Royce. Also, Royce hubs have bigger bearings with a bigger carrying capacity – in a way, that is a bit unfair, as the ultralight Royce hub has smaller bearings than Phil but the mid flange and titan hubs have larger bearings. The main concern I have about Phil over Royce is Royce use 3 coil springs on their pawls, whereas Phil use one retaining clip/spring for their pawls. That does make freehub removal and servicing easier, however it does mean that the engagement of the pawls relies on their shape being in tact and just one spring. It makes the Phil system quieter than the Royce system, however I prefer individually sprung systems like those used by Royce, Tune, Bitex to those retaining clip/spring system as used by Fulcrum, NovaTec and (on some models only) – Powerway.
If you wanted something that is tough and durable but did not want a hubset as heavy as Phil or Royce, DT and PMP are probably your best options as each of those have no real maintenance programme. Chris King is exceptionally durable and tough, however there are higher demands from maintenance.
Tune hubs – Mig70/Mag170, £440, 249g/pairMAG-170_D320029-Frei
For those of you skimming this, you will notice from the headline that these are among the lightest hubs in the lineup. You will also potentially notice that it is the rears in particular that help with this. Although the 71g front is by no means heavy. The 178g rear is achievable through a combination of a very machined shell and freehub body, small bearings, oversized and thin, unthreaded axle and a titanium engagement mechanism.
The mechanism that Tune use is probably their most unusual features, with the rest being found in a similar way in the Carbon-ti and AIVEE hubs. The titanium mechanism uses two different titanium alloys which have dissimilar molecular shape/size in order to ensure they can durably pass over one another. There are three pawls which engage simultaneously which means each of them shares an even burden of the overall load. Each component can be reduced down accordingly as the load is distributed more evenly and consistently among a great number of components. This design is now well proven and is a key part of Tune’s success.
The shells are both forged and machined out of 7075 aluminium. This ensures that the molecules are aligned fanning out of the flanges to maximise their strength. The spoke hole drillings are 2.2mm, which is the tightest fit of any hub. The tighter fit helps to improve stiffness, as does the oversized axles and flange spacing. The freehub bodies are a very special material, a blend of titanium and aluminium helping to guard as much as possible against cassette bite. Alloy carriers on cassettes are still recommended (i.e. an ultegra or dura ace cassette).
The hubs have a 0.2mm tolerance in their assembly which is absorbed when a quick release skewer is applied. This allows the hubs to run freely without risking over preloading the bearings. It is also a push fit assembly which does away with the need for a thread which adds weight as more material is required.
The hubs can be fully dismantled but it is not recommended that you do this at home. The best thing to do is look after the hubs but also leave them alone. Keep degreasers and water displacers as well as pressurised water away from all of their seals. If your drive needs degreasing, remove it from the wheel before doing so.
The front hubs have rotating flanges which ensure perfectly alignment. the 20 and 24h incarnations are specifically designed to be laced radially at a decent tension. If you are a sub 95kg rider looking for the best level of performance from your wheelset possible, Tune is probably going to be your best option. The actual limit is around 110kg.
Alto Cycling, R-symmetric hubs, £550, 315g/pair
You probably have not heard of Alto Cycling. However, these hubs are seriously special. To start with they are all made in Sarasota, USA. They use exceptionally high quality NSK bearings and weigh a humble 315g/pair.
I always think when it comes to a line up of exotic hubs it is easy to look at them and just go for the lightest. It is a nice way to flatter the wheelset weight and light-weight components always impress, at least initially. However, I like to think as weight as like a budget. You probably have a target budget overall for the weight of your bike and you can spend that budget in various different ways. I never like to see a component that is unnecessarily heavy simply by poor design, so if I see a high end hubset that is not exceptionally light, I normally question the virtues of spending the extra weight budget on the hubset. What do you get for that extra few grams? Is that a feature you may be interested in? It can go the other way, the lightest hubset design is rarely the best, often it means less material, smaller bearings, less stiffness, less practicality, lower rider weight limit, increased flex.
Alto’s brief was absolutely to build components that are suitable for elite level racing. So certainly they were looking for hubs which performed very well indeed. However their approach was a little different. They did not want to simply make the lightest wheels possible if they felt it compromised them costing their performance. They saw a few grams here and there as irrelevant in the real world and sought the performance in other areas where most manufacturers fall down. They wanted to be genuinely innovative and deliver better performance through a different approach.
If you look at the breakdown of the hubset weight, you have 85g front, 230g rear. Certainly not heavyweight – light by most peoples’ standards. However, if you compare that to Tune; 71g and 178g for f/r, you can see that the additional weight is really found at the back, not the front. Adding 52g at the rear but just 14g at the front. If you look at the design of the rear hub, you can see why. The hubs use a very high / low flange design to create a huge disparity in the flanges. This disparity helps to offset the disparity you naturally find in a rear wheel because of the dish created by the cassette.
It means that the flange diameter which on most hubs is somewhere between 48mm and 55mm on the drive side rear is actually 100mm. The design is taken even further by the lacing pattern that Alto encourage but do not insist that you use. They suggest 2x lacing on the non-drive side but radial lacing with the heads in on the drive side rear. That lacing pattern forces all of the drive side spokes even further out – as far out as they can possibly be. It also means that the spoke itself is much, much shorter than it would otherwise be. So for example on their CC56 (carbon clincher 56mm) rim, the drive side spoke length is only 218mm. If that had been one of our standard road hubs the spoke length would be 256mm. That shorter spoke reduces the spoke stretch and also reduces the spoke weight. So some of the weight you gain in the rear hub you lose again in the overall wheel.
My initial concerns were that this design would lead to flange failure, a harsh ride and loss of torsional stiffness. However, it appears my concerns were misplaced. Firstly, the hubs were comprehensively simulated prior to their production; they were designed on the basis of no rider weight limit, so the flanges are certainly engineered to be very strong indeed. In the real world and after a few years of riders putting them through their paces there have been no failures, so no need for concern there. As for a harsh ride, well that is much more easy to discover – riding these hubs myself and lots of very positive rider feedback have confirmed that actually quite the opposite is true. The hubs themselves provide a significantly enhanced ride quality. The stiffness increase is very noticeable when riding and when building and the increase in the bracing angle improves the ride comfort. In fact I would say without question, these are the stiffest hubs I have ever built with by a margin. Finally, testing done at Alto shows that where the non-drive side tensions are now significantly higher (at least 25kgf higher we have found during building). This more than offsets the torsional stiffness loss on the drive side. So rather than being torsionally less stiff, they are actually torsionally more stiff. Although the torsional stiffness increase is less pronounced than the radial stiffness increase.
They also have a 4 pawl design, each pawl has three teeth, they go inside a ratchet with 48 teeth making for a 144pt effective freehub engagement or 576pt possible contact points depending on how you look at it. The upshot of which is, however you look at it, you get very fast freehub engagement and very fast pickup as a result.
Finally they use an unusual but innovative axle design, this design allows for the minimum possible loading on radial bearings for very good bearing life, no need for regular adjustment and to allow for particularly good rolling resistance. For details on maintenance, please view here.
So, in summary, what would I say about the Alto hubs? Well, they are clearly made to a very high standard. I like that they now use radial not angular contact bearings and I think that their latest axle design which enables this is a definite improvement. Their ride quality is beyond reproach. I cannot really see any way that they can realistically save any weight in the hubset without abandoning the R-symmetric design or their unlimited rider weight limit but I appreciate that there will always be those out there looking for something lighter. The R-Symmetric design does limit their drilling to 20/24 symmetrical which means they do not work with all rim options. Finally, being the price that they are, there will always be those who question the need to spend this amount on a hubset but if it were me, I would choose Alto hubs over Chris King for ease of maintenance and improvements in stiffness/ride quality reasons and over DT Swiss simply because they are more special and they perform better. They are clearly among the very best hubs we offer and I think that anyone who has £550 to spend on a hubset should seriously consider these as an option.
Chris King R45 hubs, £550 (£580 Campag), 325g/pairr45_hubset_shim_black
Availability: 20, 24, 28, 32h front, 24, 28 and 32h rear. Campag and shimano. Many colours.
The R45 is a revision of the classic Chris King hub. Instead of having 72 points of engagement, it now only has 45. The result is lower drag and less weight. The shell has also been redesigned. All Chris King hubs come with their unique, patented Ring Drive system. This allows for faster engagement than conventional system. It also offer surprisingly low drag and it is a lot quieter than most fast engaging hubs as there are no pawls. The sound of the hub is quite different, more of a whurring sound rather than clicking.
Chris King is the only manufacturer in this line up that makes their own bearings, even the balls within the races. The bearings themselves are also different in design. They are angular contact bearings (despite being removable and replacable sealed cartridge units). They offer a very high static loading capacity. The axles are made from aluminium and so is the shell of the freehub body. All this has been done to help keep the weight down. There is machining on the non-drive side rear to keep the weight down. Chris King obviously decided against a high low profile. The sizes of the flanges on the rear are unusually large, which helps with even tensions and wind up.
The front hub again is fairly chunky and much heavier than the rear when pitched against other hubs. The front hub is suitable for radial lacing, however Chris King like this to be undertaken only by professional builders and specify a lower tension limit on this. The size of the shell is probably required given the size of the bearings and the 5 year warranty on it.
The angular contact bearings offer low drag, which is particularly noticable under loading. They are also the only bearings that come with a 5 year warranty, along with the rest of the hub. The 5 year warranty is conditional that regular checks and maintenance be carried out on the hub. The bearings themselves need to be loaded (this can be done with basic tooling) and improper loading can cause premature failure.
The capacity of the bearings and the more positive feel that you get from the ring drive combined with the low enertia of these hubs makes them among the highest performing option in the line up. You will notice this as soon as you ride them. However the downside is that they will require more regular maintenance than some other hubs. A complete strip down is recommended every 6-12 months and to do this you will need to use the R45 maintenance kit. If properly maintained, they will last a long time, so a diligent rider will have a high performing pair of hubs for years to come. To read more about maintaining your Chris King hubs, click here.
DT Swiss 180 – £730, 290g/pairhbdt1801
The 180 hubs are by far the most expensive we sell and it is fairly difficult to see how they justify such a steep price increase over the 240. The axles and freehub body are the same. They do come with ceramic bearings, which account for most of the (negligible) weight saving. They also come with a carbon fibre/alloy shell which has saved a little additional weight while making the shells themselves stiffer. However it is unlikely that much of the flex would be come from the shell itself, moreover the interface between the carbon and the alloy now itself has scope for flex.
Nevertheless they are strong, durable, light, high performance hubs. If you wanted a pair of hubs that weight towards the Alchemy end of the spectrum but was a big more rugged, this would be a sensible choice.
ENVE hubs, 20/24, £1250.
In terms of dimensions, the hubs aren’t that different to DT Swiss. That is, from a wheelbuilding perspective. They look quite different to other hubs – all lumpy. Unlike the 180, these are a genuine carbon shell, not just a sleeve or layer of carbon on them. It is in that that you can see the real gains and it is quite an undertaking that ENVE have made here. Carbon will offer better strength to weight, better corrosion resistance, fatigue life and you can control its properties more carefully as it is laid up rather than forged/machined. So, you are probably still thinking – why are they so much more than other hubs. Well, obviously aside from carbon fibre the internals are not the cheapest. They are DT Swiss star ratchet design. That is probably the most durable and reliable design that there is for engagement. It is also their 36t version, which is an upgrade on any DT Swiss hub. Then there is the bearings, you will have 6 of them in a hubset and they, being ceramic speed, would normally cost around £75 each, so that is £450 just in bearings.
So, are they worth it? Well, they will probably mean that your ENVE wheels, and in all likelihood they will be used in an ENVE wheelset will cost more like £3k rather than £2k. They will be lighter. Require little or no maintenance, roll very nicely indeed and carry a lot of natural strength/durability. Ultimately it is about buying a set of wheels without compromise. If budget is not a concern, they are a compelling option.
If you buy these hubs, as even, no degreasers or pressure washers. That is advice on any hubset I sell, but before you get out your aggressive cleaners, remember £450 to replace those bearings.
Weight saving means that a set of these hubs built up with CX-Rays onto 2.2 tubular rims would weigh approximately 1050g.
Other notable hubs
I have put these here as I do not want them in the premium lineup, but I would like to fit them into the discussion. The analysis is less detailed, just some quick points:
Hope hubs – £220/pair
Hope make a big range of hubs and are a sound UK manufacturer. We have omitted them here because they overlap with our own range of hubs but at a higher price point. There is no harm is going with Hope hubs – we respect them as a manufacturer, however if you did wish to use Hope hubs – it is worth viewing our range as well.
AIVEE – £230/pair, 287g/pair
I do like AIVEE as a company. They are made in France, use 7075 alloy shells and EZO bearings. They are light. So we are definitely off to a good start. Their bracing angle on the non-drive side rear is their most unusual feature, making for more even spoke tensions. They say it does not affect stiffness, as the tension is higher and the bracing less. I haven’t done the maths, so I cannot confirm or deny their claim, but I suspect this is not accurate given that they are on their own with the design. The bearings are fairly small and the shells quite heavily machined. The hubs are a bit on the noisy side.
PMP – £250/pair, 396g/pair
Beautifully made. Alloy axles, alloy bodies. Exceptionally durable, using a range of high end bearings including some SKF bearings. They have big shells, decent sized axles and decent sized bearings. It is more of a Phil Wood/Royce approach although it is all alloy body and axle design. If these hubs were even 50g lighter, I am sure they would be a lot more prolific. The weight is almost the same as the DT 350 which is the closest comparison in many ways. I would rather run a PMP hub than a 350 as I think they are more unusual and more interesting, however the versatility of the 350 and popularity of the 240s and other DT Components means that most opt for DT. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '35', 'language_id_whole_page_fasttext': "{'en': 0.9543368816375732}", 'metadata': "{'Content-Length': '219071', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LVGMWO6ACZ6QA4KL3GSDNBTISKJHD3RR', 'WARC-Concurrent-To': '<urn:uuid:ba79ac1a-45b5-488e-8c6b-f28262257256>', 'WARC-Date': datetime.datetime(2020, 6, 3, 0, 51, 9), 'WARC-IP-Address': '23.92.22.100', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:PJ2UXHAA4E4AQGGY745R6LESMRRGWYLD', 'WARC-Record-ID': '<urn:uuid:5dd0f9f5-a03c-4852-ba17-4e00ff51784c>', 'WARC-Target-URI': 'https://dcrwheels.co.uk/custom-wheelsets/the-best-hubs-in-the-world/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:18547d04-77fb-41be-a475-3e5c438343b3>', 'WARC-Truncated': None}", 'previous_word_count': '5762', 'url': 'https://dcrwheels.co.uk/custom-wheelsets/the-best-hubs-in-the-world/', 'warcinfo': 'isPartOf: CC-MAIN-2020-24\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May/June 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-190.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.027792930603027344', 'original_id': 'b201ce60e21a5af11e39d14677dad44b1cc2dbf401bf98810e83c9215198c818'} |
MONDAY MORNING, MAY 6, 1872. NO. 109. BY TELEGRAPH. KtoliiNlTely for the Register. K, ihe Pnrlflr mad Atlantic I. In*. Office, 103 NkId Nlml. Saturday's Dispatches The Cincinnati Convention. Though the action of the Cincinnati Convention in nominating Mr. Greeley. It links the honest members of the convention, overpowered by its political principles. It further says: "I would have been something serious, if men had been opposed to most of the advanced by the distinguished men of the Convention, is a wing of places the Convention in a thorough contemptible position by the two. It has not even one chance of winning this morning by a vote of the Cincinnati Convention to nominate Adams. In nominating the situation, it never occurred to us, as Greeley, but, as a matter of fact, it is therefore much surprised if the result, as it had considered Greeley not able to get more than a complete majority vote. It supposed the Convention would nominate a prominent man." In a view to concentrate the Democratic support, and in the face of which this nomination is made, the most conspicuous opponent of the Democrats is the candidate for the Presidency. The World says if Adams had been nominated, it would have advised his endorsement by the Democratic people, but it cannot do so with Greeley. It is an advice to offer to the Democratic National Committee, which meets here next week to issue a call for the regular National Convention. It says: "We frankly say that Greeley is not our choice. Our impression is that the Democratic National Convention will ignore the candidate entirely, and nominate a new ticket. We do not see what is to be the fate of Greeley. The account of the Cincinnati Liberal Convention in the nomination of Greeley for the Presidency is the subject of general comment by the press this morning... The Herald says the nomination will excite surprise and interest. After favorably reviewing Greeley's eminent position both in journalism and politics, we ask the question, has the Convention really nominated the next President? Will the enthusiasm which we yesterday on the banks of the Ohio be swayed by a grand parade? Will the strange and the elements which gathered at Cincinnati really form the winning party? They are considered doubtful questions, as also whether the many Free Traders who took part in the Convention will submit to the nomination of a Protective Trade man?" Washington, May 4 - The Republican, an administration or the Democratic, this morning thinks that the Republicans have nothing to fear from Cincinnati nominations. The Liberal Republican, an administration or the Democratic, this morning thinks that the Republicans have nothing to fear from Cincinnati nominations. The Liberal Republican, an administration or the Democratic, this morning thinks that the Republicans have nothing to fear from Cincinnati nominations. General, in nominating Greeley and Brown, have thrown away their only chance of success. The Patriot (Democratic), is surprised by the result, but thinks that the ticket is great strength, and that it will perpetuate the work of the destruction of the Republican organization. In May, the Commercial Leader says that whether we will do it our duty to urge upon our fellow citizens the election of Horace Greeley as Presidency, depends largely upon which will be done by the regular organization of the old existing political parties. Mr. Greeley, a few weeks frankly stated that he would support the nomination of the Cincinnati Convention, provided the Democratic party, if not, will not attempt to take advantage of the Republican division; and as there was a regular Democratic convention, he would support strongly the Republican candidate, we have no further reason to believe that we have disagreed with regard to free silver's tariff notions. We have for a long time believed that the doctrines that with impartial grace and complete amnesty, we think popular faith be in him, his temperate life has with his opponents and warfare; his personal and abounding generosity have commended him to the heart and influence of the people. Of America. FOREIGN. Spanish Imminent. Madrid, May 4? Ernilio Castelar, known Republican, announces a general Republican uprising throughout the continent. It is the intention of Republican deputies in the Cortes to their seats, and openly adhere to the new movement. The insurrection is rapidly extending. Velar's declaration has been the means of adding much influence to the army who are still massed in considerable force in Navarre and Alusia. A affection has appeared in the enemy, and the Government apprehends that the event of a general rising would join in the revolt. The latest information says that Don Vas arrived at Navarre, and at once placed himself at the head of the government and commenced operations against the Government. St. Petersburg, May 4.? The Czar accepted Gortschakoff's resignation as Chancellor. Prince Vladimir, the new Prime Minister, has resigned. New York, May 4.? A fire broke out at midnight in the drying room of Palmer, Ebury & Co's manufactory of parlor furniture, in the third floor of a large building on Sixth Street; low $75,000. The Campaign Opens. The nomination of Greeley has caused the organization of several Greeley campaign clubs in this city. One was organized in the 10th Ward last night. How the Nomination Was Refused. The nomination of the Cincinnati Convention has caused considerable excitement in Brooklyn and Jersey City. At various political and reading rooms, much excitement was visible. At the Amor House, large crowds of merchants, brokers, and others congregated and discussed the situation. On Wall Street, the excitement was greater than in any part of the city. Business was partially neglected on the announcement of the nomination. A large crowd at the Fifth Avenue Hotel, composed of the leading merchants, were noisily discussing the nomination. Many were favorably impressed with the choice of the Convention. The flag was run up at the City Hall in honor of the nomination of Mr. Greeley. There was a large meeting at the Cooper Institute last night, the object being to raise funds to erect a monument to the late General George H. Thomas. General Joe Hooker acted as Chairman. Letters were received from Grant and Sherman, expressing a hope of the accomplishment of the object. CINCINNATI. The Convention. Cincinnati, May 4.? Many of the delegates are still in the city, though nearly all will have left by tonight. White law Read leaves for New York, this evening. There is considerable discussion on the nomination today. The general tone is friendly to Greeley. Pre-Representation. Among the press representation at the Convention were the following: Philadelphia Bulletin and Age, Boston Globe, Pittsburgh Leader and Mail, Wheeling Register, Chicago Mail, News and Sun. Indianapolis X The Telegraph. There was during the Convention on Tuesday night the enormous amount of one hundred and ten thousand words of press matter telegraphed over the different companies' wires from here. The Nomination Are the general topic of today. A hat called the "Greeley Hat" has been put on sale today, and is said to be in great demand. The Government Uniting. The committee appointed to select a site for the Government buildings were ordered from Washington not to do so until the arrival of Mr. Wallet, the Government Architect. Movements of Journalists. Nearly all the journalists in attendance at the Convention have gone home. R. J. Hilber and Queen of the Boston Globe left for Washington today. FIRES. Fifty buildings burned at Depos, Ohio. Fort Wayne, Ind., May 4.? Yesterday afternoon, during a prevalent heavy wind storm at Depos, Ohio, a fire broke out in the drug store of Schenck & Long. The cause is not known. The flames spread with such rapidity that most of the business part of the town, including dry goods stores, boot and shoe and millinery stores, groceries, jewelry stores, saloons, barber shops, and a large number of dwellings, in all about fifty buildings, were destroyed. The loss is estimated at a quarter of a million of dollars. Fire engines from Fort Wayne, Lima and other towns were telegraphed for and arrived in time to prevent the destruction of the town. Fire at Warren. Reid & Co.'s machine works and foundry, and John Clemens' dwelling house were destroyed by fire, at Warren, Ohio. Loss upwards of $50,000. Insured for $20,000. In the Franklin, of Philadelphia; Home, of Hartford; Imperial, of London, and $25,000 in the People's, of Worcester. MEMPHIS. Caterpillar NonpoliilDg a Railroad. Memphis, May 4.? The trains on the Mississippi and Tennessee railroad were stopped every day ten miles below this city by the caterpillars, and the track has to be scraped off before the rain can move. The nomination of Greeley and Brown by the Liberal Convention, seems to give general satisfaction in this State, and it may safely be said that Tennessee and Arkansas, as well as Mississippi, will give that ticket an overwhelming majority at the next election. Both of the leading morning papers of this city support it, and it is confidently affirmed that nearly all the journals in the South will give it dearly support. Meeting at Odd Fellows' Hall. Covington, Ky., May 4.? In answer to Schurz' call, a meeting was held at Odd Fellows' Hall this evening. The Hall was densely crowded, and the meeting was of the most enthusiastic kind. Speeches were made endorsing Greeley and Brown by Messrs. Caseins, H. Clay and Col. A. S. Beeson. PHILADELPHIA. Dau'i Ball Far felted. Philadelphia, May 4.? Dana, of the New York Sun, on trial for libel, failed to appear in Court this morning, and Judge Bartlett declared his bail of $5,000 forfeited. The case was postponed one hour to admit of a search for Dana, who was believed to be in town. DUBUQUE. Harder in the First Degree. Dubuque, May 4.? The trial of John Duncan, charged with the murder of A. E. Romilly, near Hopetown, in December, 1870, terminated today. The jury rendered a verdict of guilty of murder in the first degree. WASHINGTON. Those Alabama Claims. Washington, May 4. — The President and members of the Senate and House Foreign Affairs Committees, are at the State Department consulting with Secretary Fish on the Alabama Claims. It is expected that the final action of the Government on the question will be decided upon. CHICAGO. Aldermen Discharged from Jail. Chicago, May 4. — This morning, before Judge Porter, in the Criminal Court, on motion of the State's Attorney, the indictment of four of the scalawags Aldermen, Powell, McGreer, Robinson and Shields, were discharged on the grounds of insufficient evidence for their conviction, it is thought. Sunday's Dispatches. FOREIGN. HOLLAND. Resignation of the Cabinet. The House, May 5. — The Dutch Cabinet resigned yesterday, in consequence of an adverse vote on the income tax question. SPAIN. Hostilities Commenced. Madrid, May 5. — Information has been received in this city of the commencement of actual hostilities between the Royal and insurgent troops in Navarre. The Carlists, the main body of which is commanded by Don Carlos and the remainder by Don Alfonso and General Roda, are moving in the direction of Guelpuzcoa. The Government troops, under General Ravera, are harassing the rear of the Carlists, and several hot skirmishes have occurred. No general engagement has yet taken place, although such is momentarily expected. A Weneral Engagement - Don Carlos Reported a Prisoner. A dispatch has been received here announcing... Concerning that a general engagement has occurred between the Carlist and Royalist forces in Navarre. General Palacios, commanding a division of the Government troops, attacked the army near C'a9ias, in the Province of Navarre. variety, last evening, and after a severe battle of ten hours, gained a complete victory over the rebels. The losses on both sides during the engagement are said to have been very heavy. Dispatches containing fuller reports of the battle are pouring in. The resistance of the Carlists is said to have been most decided. General Talacous commanded the whole Carlist center, and a combat at close quarters was maintained fiercely during the most of the day, and towards evening the Carlists' force wavered and betrayed symptoms of disorganization. A most effective onset by the Government troops caused the surrender of the whole Carlist center and it is stated that Don Carlos himself is among the prisoners taken. The news has created the wildest excitement here. ENGLAND. Arrest of Internationalists. London, May 5.? A Copenhagen dispatch states that the President and Treasurer of the International Society were arrested in that city on Saturday evening and will shortly be tried on a charge of conspiracy against the government. FRANCE. Court Martial. Paris, May 6.? The government has decided to bring Generals Winishoff and Uhrich to trial by court martial on a charge against their action during the late Franco-German war. RUSSIA. Resignation of Gortschakoff's Minister St. Petersburg, May 5.? The statement recently circulated to the effect that the resignation of Chancellor Gortschakoff had been presented to and accepted by his Majesty the Emperor is denied by the best of authority. His withdrawal from his official duties. It is merely temporary, and he has received permission from the Emperor to travel for his health. The Weather Today. Washington, May 5, 7 P. M.? Probabilities. The lowest barometer over Dakota will probably move east over the upper lake region, accompanied by brisk and light winds. Increased cloudiness and possibly threatening weather will probably prevail on Monday from the lower Mississippi and the Ohio Valley to the upper lakes and extend to the lower lakes. Clear weather over the New England, Middle and Southern States with southeastern to southwestern winds. Cautionary signals have been ordered for Milwaukee, Chicago and Grand Haven. CHICAGO. The Chicago Papers in the Nomination? The Times Wants Greeley to Resign. Chicago, May 5.? The Tribune this morning says that Horace Greeley will be elected is beyond all doubt. The only hope that the present administration has of defeating him is in the Democratic party. That that party will nominate a candidate is improbable, as it will not accomplish the purpose. Though there be a Democratic candidate, the whole country, Democrats and Republicans, will understand the game, and they will know that the next President must be Grant or Greeley. Every vote given for Hancock will be a vote given for Grant, and there is no Democrat so obtuse as not to know this fact and vote accordingly. There is not a Democratic leader who does not know that in no event will a Democrat be elected. The Republicans will effectively prevent that, so that, whatever condition of affairs, the choice is Greeley or Grant, provided the latter is not set aside at Philadelphia. The Times, on the nomination, says little. Its only words this morning. are the following: The resignation of Mr. Greeley would probably tend to unite in his support all the elements of the country. It should not follow that the Cincinnati mistake cannot be corrected; that somebody else cannot be found who can do that which is impossible with Mr. Greeley, and it may be fairly presumed that when Mr. Greeley himself shall realize his inability, he will not stand in the way of another and more promising movement in the hope of such other movements. Why may we not look forward to the discretion of the Democratic National Convention with some degree of confidence? The reports from the surrounding country are conflicting. The Madison, Wisconsin, Daily (Democrat), the Springfield, Illinois, Register (Democrat), the Des Moines Dispatch and St. Paul Dispatch endorse the nominations although the latter says Greeley will carry Minnesota. Governor Palmer is reported as saying that Greeley and Brown will receive 75,000 Republican votes in Illinois. The Des Moines Courier repudiates the ticket. Newspaper Fire. The city of Marshalltown, Iowa, of about ten thousand inhabitants, on the Chicago and Northwestern railroad, was visited on Saturday by a terribly destructive fire, sweeping away most of the southeastern part of the city. The fire started in Shanley's elevator, and a high wind carried it on until five elevators filled with grain, the railroad depot, two hotels, a woolen mill, four lumber yards, five stores and several dwellings were consumed. The loss is estimated at a quarter of a million of dollars. At one time it was thought the whole town would be destroyed. The fire. Companies of an adjoining town were telegraphed for, but the flamed were subdued before they arrived. NEW YORK. The "Herald" on the Cincinnati News. New York, May 5.? The Herald again comments on Greeley's nomination this morning and points out to the Administration the importance of the Cincinnati movement and the waning popularity of General Grant. It thinks that unless he changes his course and Cabinet, he will run more risk of being defeated next November. It says that, finding his popularity declining, the Philadelphia Convention might eventually think it proper to set him aside and accept the nominee of the Cincinnati Convention, or else enter into a new movement with them to take up new men acceptable to all Republicans. Work on the New York Custom House is rapidly progressing. Thirty men have been added to the force during the past week and further additions will be made as the season advances. The second story will be completed by the end of July, and it is expected the roof will be put on in November. Congratulation. Numerous congratulatory telegrams poured in yesterday on Horace Greeley. Trumbull, Fenton, and many other prominent politicians are among the senders. Fainter's Natives. A general strike of the painters of this city for the eight hour system will take place tomorrow. The members of the different unions assembled at Demitt's Hall and appointed committees and everything necessary for carrying out the strike successfully. MEMPHIS. Democratic Convention Convention-The Delegates Returning. Memphis, May 5? The County Democratic Convention met yesterday and elected delegates to the State Convention. A motion instructing the delegation as to what course to pursue in regard to the National Convention was voted down. The State Convention meets at Nashville on the 9th, and without doubt the present Governor will be nominated by acclamation and will have no opposition. The State Convention may not decide Greeley and Brown, but will doubtless decide not to take any action with reference to a National Convention. Necrly all the Democratic and nine-tenths of the Republican papers of the South have already hoisted the names of Greeley and Brown. The West Tennessee and a portion of the Mississippi and Arkansas delegations to the Cincinnati Convention returned today. The Weather and River, Cincinnati, May 5? River 11 feet 6 inches and falling. Weather clear. Arrived? Elginburg, from Red river; J. H. Groebeck and Mollie Dean, from New Orleans; R. C. Gray, from Arkansas river; R. W. Skilinger, from Nashville. No departures. WASHINGTON. Senator Trumbull. Washington, May 5.? Senator Trumbull announces his approval of and intention to support the nomination of Greeley and Brown. Other Liberal Republicans have also announced their determination to adhere to the ticket. The Direct Claims. The expectation indulged in certain quarters here that Great Britain would propose to this government as a means of settlement of the indirect claims the principle that neutrals are not to be held response for indirect damages, and eventually have their way for a settlement of our direct claims at Geneva under the treaty of Washington, has been disapproved. The British Government has notified this. Government that they can make no such proposition for the settlement of a principle which they never did or never expected to admit. This notification substantiates places the whole question where it was when first presented at Geneva and it is thought, shuts out all hope of a satisfactory solution of the question of indirect and possibly direct damages, as the administration again announces that in view of the fact that they have incorporated in our case a claim for indirect as well as direct damages and asked that a gross sum might be awarded, therefore they cannot and will not recede from their position. The Buell Records. It is stated here that the missing Buell records, over which there has been so much discussion lately, were turned over to General Badeau to enable him to complete the second volume of his life of General Grant, since which time they have not been seen or accounted for. Testimony was given last week before the House Committee of Investigation by a prominent ex-officer of the Union army to the effect that these records were seen by him in possession of General Badeau, that the latter exhibited them to him, and that many of them were much mutilated. CINCINNATI. President of the Louisville Convention-The country will support the nominees. Cincinnati, April 5.? A careful estimate of the amount of press matter telegraphed from this city during the Convention week by all telegraph lines places the number at at seven hundred and eighty-five thousand words, the greater portion of which was sent during the three days of the Convention and the day previous. About fifty men prepared this matter. When it is taken into consideration the amount of work necessary to glean the information before preparing it and the fact that many of the correspondents in addition wrote long letters to their respective papers, some idea may be formed of the arduous tasks of the correspondents. The Louisiana delegation, 120 strong, left forborne last night, all wearing the Greeley bats which they purchased before starting home. The country Democratic papers throughout this section declare themselves willing to support Greeley, provided no Democratic nomination is a mystery. About once in four or five years the question "Was Morgan murdered by the Free Masons?" comes up in the newspapers, and is discussed with as much fervor as if the transaction itself was a matter of yesterday. It will sadden those who delight in mystery to know, on so good authority as that of Morgan's son, that the supposed victim of the brethren of the mystic tie was neither tied to a stone and sunk, had his throat cut, or was torn asunder, according to the general custom in such cases. On the contrary, he lived until nearly thirty years after his abduction, and finally ended his days in compliance and contentment at Hobartown, Van Dieman's land, where he for some years published a newspaper, the Advertiseer, which is still in existence. According to the statement of the son referred to, Morgan was released on condition of his leaving the country forever. He was accompanied to Quebec, where he entered the British navy, and was placed on a ship which left soon after for England. Later he accompanied a Government vessel to Australia, and his period of service being ended, he chose to take up his residence in that quarter of the world. His son is a resident of San Francisco, and is responsible for the statements here given. The Virginia Debt. The amount of interest paid by the accounting officers of the treasury upon the debt of the State amounted to, up to yesterday, about $200,000. It has been less than thirty days since the payment of interest commenced, and while there has been no rush of bondholders, there has been a steady and daily increasing demand for the four percent so ungraciously allowed by the last Legislature. The apprehension that there will not be more revenue raised by the present tax bill than is sufficient to pay current expenses of the Government and two percent interest next year, has induced many persons to collect the amount offered to them, and to acquiesce in the repeal of the provisions of the law making coupons receivable for taxes, that would not otherwise have done so... Counties are still applying to the Auditor for blanks to make out the new assessment, and the reductions reported vary from fifteen to fifty percent on the valuations of last year. Richmond Enquirer. A city constable of Troy, New York, returned a summons with this endorsement: "Not served, because there are three cases of smallpox in the house where the party lives." Dr. Greeley, the following account of an interview with Mr. Greeley, published in the New York Sun of Friday, is of interest in view of the action of the Liberal Convention at Cincinnati: "I don't want to interrupt you," said a Sun reporter to Dr. Horace Greeley, as the great editor was looking over some proof sheets. Dr. Greeley? I'll answer any question you want to ask. Reporter? May I ask you, Mr. Greeley, what your feeling is at present in regard to your nomination at the Convention? Dr. Greeley? I don't think it will take place. Reporter? Do you really not expect to be nominated, Doctor? Dr. Greeley? No, I do not. Reporter? But if, against your expectation, you should be nominated for the Presidency, would you decline? Dr. Greeley? I never declined an office yet, and I won't decline this one. Reporter? I know you once told me at the Union League Club that it was the duty of every man to accept any trust the people may impose upon him? Dr. Greeley? Yes. I don't think any man has any business to decline any office. Reporter? Mr. Greeley, I think you would make a good President. Dr. Greeley? Yes, possibly; but I think I shall never have the chance to make a good President. Reporter? A better one, anyhow, than Grant. Dr. Greeley (with a smile)? Maybe; but of course I could not tell anything about that. Here a gentleman came in and informed Dr. Greeley that the Convention had had no balloting so far. Dr. Greeley thanked him for the information. He became again absorbed in his proof sheets. Reporter? Mr. Greeley, I should not like to interrupt you. Dr. Greeley (with resignation)? Well, I have a living to earn; I'll answer any question you want to ask me. Reporter? Thanks. Is it true that if the Convention should adopt an anti-protection platform, you would go against the candidate of the Liberal Republicans? Dr. Greeley? I have not said that. What I say is: Let every man have his own opinions and act accordingly. Reporter? But, in that case, you would withdraw your support? Dr. Greeley? No; what I have said is simply: "The Tribune is an independent newspaper. I don't propose to be much of a politician after this, anyhow. The Back Down, The Secretary of State, it is positively stated, sent a telegram to Minister Schenck on Wednesday, in relation to the matter of indirect damages. In this dispatch, Mr. Schenck is directed to inform Her Majesty's Government that the United States never expected a money compensation for such damages. All that has ever been desired or contemplated has been a settlement of the principle. In fact, it is now alleged that it was only expected that the decision would be against the United States, and that our government would prefer it so, because with the "principle" once settled, there would be no danger that when the United States shall occupy a neutral position, it can be held responsible for vessels that might go out from our extended line of coast to be employed by a belligerent. But as has been repeatedly stated, Mr. Schenck is directed to pay that the United States will not "withdraw" the demand. It is the desire, however, that the proposition for the settlement of the principle that neutrals are not to be held responsible for indirect damages, shall come from the British side. Yet, in spite of all this, the government insists that it has not backed down. Members of the Foreign Affairs Committee are disposed to think differently, and think, too, that the backing down has been done in the most ignominious manner - a sort of back door exit. Among other things for which the New York Tribune has lately been remarkable, is a short letter concerning "Northern Settlers in Virginia," the fairness of which forms an agreeable contrast to the communications of the cowardly anonymous correspondents to whom the Tribune, at one time, so freely threw open its columns. The letter we speak of is signed with the writer's full name, and the gist of it can be gathered from the first two paragraphs. He says: "I have been in Virginia during the past winter looking for a home, and am often asked regarding the feelings of the people toward Northern settlers. I reply that I was never treated in a more friendly or hospitable manner in any part of the country, and I have traveled a good deal in the East and West." Such testimony as this, coming from a Northern man, and, in all probability, in politics a Republican, is the best answer to the multitude of scribblers who have made it their business to plunder and malign the South. A scrub-headed boy having been brought before the court as witness, the following amusing colloquy ensued: "Where do you live?" inquired the court with my mother. "Where does your mother live?" "She lives with father." "Where does he live?" "He lives with the old folks." "Where do they live?" says the judge, getting tired, as an audible titter goes round the court-room. "They live at home." "Where in thunder is their home?" "That's where I'm from," said the boy, sticking his tongue in the corner of his cheek and slowly closing one eye on the judge. "Here, Mr. Constable, take this witness out and tell him to travel; he evidently does not know the nature of an oath." BUSINESS CARDS. THUS. O'HRIS, REAL ESTATE AGENT OFFICE? CUSTOM HOUSE BUILDING Wheeling, W. Va. Buys and sells Real Estate, Stock, etc. on commission. April JOHN HOSSELL, (Successor to Jacob Hrosaclo), MANUFACTURER OF Baggies, Carriages, Rockaways, Ar., etc. NO. 79 MARKET STREET, KEEPS CONSTANTLY ON HAND AND MANUFACTURER OF ALL KINDS OF WORK IN HIS LINE OF BUSINESS. PARTICULAR ATTENTION GIVEN TO REPAIRING. SECOND-HAND CARRIAGES AND BUGGIES FOR CASH. April H. M. BISHEL, ATTORNEY AT LAW. Fourth St., 2d door Below Court House, WHEELING, W. VA. J. H. PENDLETON, O. O. DATKNPOUT PENDLETON & DA V EXPORT. At the office of the law, Fourth street, above the office of L. H. Paul. Wheeling. Practice law in all the Courts of Ohio and Marshall counties, W. Va., and in the Federal Courts and County Appeals. Also in neighboring counties in Ohio and Pennsylvania. B. H. COCURAN. V. T. HAPPAR COCURED A HILL, ATTORNEYS AT LAW Office on Fourth Street, two doors below the Court House, WHEELING, W. VA. Practice in the Courts of West Virginia, and Belmont and Jefferson counties, Ohio. GEO. E. ROYD, ATTORNEY AT LAW N. 6ft. HAIRFIELD, WHEELING, W. VA., (Opposite the Bank of Wheeling.) F. STRIPF, DYER AND CLEANER, AS REMOVED TO WEST SIDE OF Market Square, Mrs. Graham's old stand, where he is prepared to clean, dye and repair all kinds of shawls, dresses and ladies' fancy goods at the shortest notice. N. Kit ATTORNEY AT LAW. OFFICE, No. 5? MONROE STREET above Fourth, Wheeling, W. Va. aprl# C. BAY H. A. BREAD, CRACKER AND CAKE 33 A. E. ELY, MARKET STREET, OPPOSITE WASHINGTON Hall, a few doors above Monroe street, keeps constantly on hand a full assortment of the above articles. Goods delivered to all parts of the city free of charge. lys National Business College. ORN BROOKS HALL, OPEN DAY AND FEMALE. The course of study embraces Book-keeping, Commercial Arithmetic and Writing. Terms, $50. SAMUEL I. MURPHY, Principal. V. H. MIDDLETON, Dealer in books, periodicals, Stationery, Albums, Pocket Books, Toy Books, Oatmeal, Stereoscopes, and Views, Ac. All the popular Periodicals furnished by mail, year and to club. Also New York, Baltimore, Pittsburgh and Cincinnati Dailies to mail and city subscribers at publishers' prices. Market street, between Culney and John, Wheeling, W. Va. Janl DR. E. E. WORTHEN. DENTIST, McLAUGHLIN BLOCK, Monroe Street, between Market and Main, aug25 HARKNESS, H. VA. HARKNESS & CO Steam Engines, Boilers, Shafting, MILL WORK, Ac., aprtO WHEELING, W VA J. t. FAIRFAX, Architect and Superintendent, Office? Cranberry's Block, Market St., WHEELING, And 42 N. Second street, Zanesville, O. Special attention given to Public West Virginia University, 1371- 72. THE LIGHT CATALOGUE HOWARD AND A ATTENDANT OF 171 Students at this Institution. Five distinct Departments of instruction, with a full corps of competent Professors. The Ancient and Modern languages; Mathematics, pure and applied; Psyc history, Ethics, Political Economy, Logic, Rhetoric, the Science, etc., carefully and thoroughly taught. Practical Chemistry and Physics, Illustrated by appropriate apparatus. Special advantages for the study of Geology. A good Library. Extensive Cottages of Mineralogy, Geology and Geology, together with many other departments of Natural History. Fine buildings, beautiful and healthy location, good society. Fall Term begins September 6th. Winter, December 5th. Spring, March 4th. Commencement, June 11th. Boarding from $10 per week. Tuition $16 to $20 per year. For further particulars, inquire of ALEX. MARTIN, President. Morgantown, W. Va. 100 Notch like Lime. BARRELS JUST RECEIVED. EXCHANGE, DAVENPORT & PAUL WILLIAM HAKE, Practical Plumber & Gas Fitter, No. 5 SOUTH STREET, WHEELING, W. VA. Orders from the country attended to short notice. "Sugar Cured Beef." THEREO. O. D. DAVIS CO., sugar cured canned beef Just received and for sale by M. REILLY. Floor. 20 BBL. FALCON MILK (SPRING) CO. Bbl. Silver Spray (Choice white.) M Baltic (vincerines, Ind.) Ly White, (Spring wheat.) 3 lb. LL, Davenport & Park's Bait (choice.) 10 lb. Cottage Mills, Red. 50 lb. Choice Extras, for sale by LIGHT, DAVENPORT & PARK. Nondrletu BOXES CHOCOLATE A LAVA . nllla. 10 boxes Chocolate De Hance. 10 " Family Chocolate, sweet. 10 " Baker - Premium Chocolate. 10 " Pore Cakes. Also, Italian Dried Pears, choice new Dates and Figs, selected French Prunes, Paper Shell Almonds. Nuts of all kinds, Ac? Ac., last arrived and for sale low by HECHUZA NICHOLAS, mar 14 86 Market street. Dried Peaches. BAUH HALVES AND QUARTERS apfl2 LL5T, DAVENPORT & PARK 100 TRANSPORTATION Cleveland & Pittsburgh B. B. ON and after ho. i|W VEMBKR IS, Uf71, Trains I will ran as follow* : lsat> ?mm axpaaaa Bridgeport ? fciinu. *10 p. ui Steuben villa? ? 7:00 a. m. 115 p. m WelUvtlla. . *15 a- m. 4:40 p. m Alliance 1U6 a. m. #30 p. m AAJUTB ; Cleveland 110 p. m. 8:45 p. m. CreaUlna .. 5.1 ? p. m. lOtlO p. ur Kort W*yne ?__..._1H> a. m. tMa.ni* ! Chicago 8:50 a. m. a. lu. Puuimrgh lo:*) a. m. 140 p. at. Harrlsburg 10:15 p. m. 145 a. n?. ! Baltimore *00 p. m. 7:* a. m. i W?u?liin(ft<>n...??_...... 5.-06 p. tu. KhOOa. ni. Philadelphia.. 140 p. m. M5 a. m. j New York kJO p. iu. 11:50 a. n?. Tickets to all principal pointa In Um Ma?l I and went can be procured at the Unlou i Ticket Offloe, In McLure House, and al lit* ; Station at Bridgeport. F. R. MYKKS, ' no21 Oen'l Passengw and Ticket Ageu BALTIMORE &0HI0B. R.CO. PAHSKNQIB TKAlNs will run by the following ?ch while on aud alter November JO I, M71 - Wheeling time : ST. LOUIS KXPRRHH. CAST ? LXA V 101 WWt- LUVB. Wheeling Wheeling dally at ft * dalljr at. ..-11 JO A, a. AKKlVDt AT AHK1VBM AT Cumberland.:?:.'* r. V. Zanenvllle....^ ? P. M i Baltimore. *50 " Newark ?_4:.10 " Waah'u Cltyll:l0 " Sandusky ...Jfcio " Philadelphia^**) a. m. Columbus A40 " i New York b io " t'l net u nail -.101M " ICUloago 7 JO A. M FAST LINK. XAMT ? LIAYCI , WHT-L1AVH i ?Wheeling *Wheellug ? dally at 4A) P. M. daily al.... 7:00 A. M. AHHIVBt AT AKaiVBaAT ParkersauraJStt a. m. Zanesvllle^ilJJ A. H. I Cuiulierlaud.'J <>i " Newark 1145 r. a. iUltiiuore " (X>lumbus......liO ** Wash. City ..lOtt) " Sandusky KW " j Philadelphia 1:JU r. M. Chicago. ~.?U0 " New York 4:40 " ?Sundays excepted. ?tiuudays excepted. MA1LTKAIN. CAST I.EA V EH , WKST -LBAVIS ?Wheeling 'Wheellug | dully hi... .10: r> r. a. daily st 1:?) a. a. AKiuvth at aaaivasAT j Cnmberlsnd.hMO a. a. Mnesville... 8:i5 a.m. . PurSer*burg_7:i5 ?? Newark 7:40 " llnlllmore 5A5P.1I iVilumbus.... 0:10 A.M. Philadelp'a.ll: o " {Cincinnati.. 1 ?Saturday* excepted. Iiloago | 'Sundays excepted. ACCOM MoDATlON. KAST-I.KAVKM I WOTT-LSAVH ; ?Wheeling i* Wheeling dally Hi 10:30 a. M. dally st...._4:lo p. M | AHKIVKH AT I A KKI V KH AT Parker?l>uriilO*o p. a Zanesville.... 110 " ! Cumberland 10:15 " NewarkmmIO:|U " i ?Sundays excepted. Columbus. ...lU.OO " (Cincinnati.. I. ?Huudaya excepted. Central Ohio | Arrivals. | Ksit.MsIn Hiem st.loiuixKx I irio P. M. Kasl Liiio... I ?>:<aj A. M. Acromion [ ? >:*) P. M. Msll .... 2x6 A.M. H:lri A. M ti:W P. M_._ IlrJO A. M_... 10:kJ P. M W., P. A B. MV. Leave Wheeling 7.10 a. in. S.2S p. m K.?nt bound trsinsmsae connection* at Baltimore with trslus far Philadsl* phis, New York and Boston. At Itelsy Hou.-e, via Washlngtou City, for all polnla South. West liound trains make direct ennue* tlon at Columbus for all polnta Wast and North went. Tickets to sll principal points can be pro cured al the office. JOHN L. W11J40M, Master ol Transportation. Baltimore. H. T. I>EVRIKk INSURANCE. JIHTN fire and Marine Insurance Ce. Or WHKELLNtf. CAPITAL, .... ?!?#,???. The company has been instrumental in ensuring the safety and security of its clients. The company has been instrumental in ensuring that all its clients' needs are met. The company's office is located in the heart of the city, offering a wide range of services and services. The company's office is located in the heart of the city, offering a wide range of services and services. Whether you're looking for a new building or a more modern office, the company has something for you. The company's office is located in the heart of the city, offering a wide range of services and services. Whether you're looking for a new office, a new office, or a more modern office, the company has something for you. In addition to the office, the company also offers a range of services and services. Whether you're in need of a new office, a new office, or a more modern office, the company has something for you. For those interested in learning more about the company's offerings, the company offers a range of services and services. Whether you're in need of a new office, a new office, or a more modern office, the company has something for you. The company's office is located in the heart of the city, offering a wide range of services and services. Whether you're in need of a new office, a new office, or a more modern office, the company has something for you. K. J. Mtona. Win. A. Wilson. Alfred Caldwell, In the "Inman Building," next door to the Mercantile National bank. A. WILKINS, President. JOHN KELLY, Vice President. C. H. COLLINS, Secretary, J. L. National Insurance Co., OF WHEELING. Capital - $200,000 DIRECTORS: George K. Wheat, Thos. Hornbrook, John M'Huney, John K. Wilson, Morgan L. Oll, Joseph J. Paall, A. W. Campbell, George Adams. A. J. Clark. UEO. K WHEAT. President J. AH. McCLELLAN, Vice President, John H. Haskins, Secretary. OF OFFICE: Hanker and Merchant, Office: No. HANKER STREET. West Virginia Insurance Co. Market and under the McLure House. CAPITAL, $100,000. TAKER RICKS AT THE LOWEST rates on Building of all kinds, Furniture, Household Goods, Merchandise and Wood In Transit. DIRECTORS: Jacob Hornbrook, Jacob M. Makei, Henry Hartman, Dr. J. C. Hops. Jonathan Rowley, Edmund Hack Inc. R. J. Hmyth, T. J. Campbell, J. H. Brtofor, K Pragar. Wm. B. OiOert, Tlujmia Bokml D.b.T. Farnawortk, Wm. R Crane. Darld Blllmyer, Joaepb MbMda, Wm. R. W hit*, S.JotT, Jr. L H. Duval. D. H. lAx. Wm. E. Htevenaon, ?vOffleeorer Hartmac "a CVrtblna Btcra, ?oath klde Monroe etreel Wbeellng/W. Va. JACOB HORXBfUXjK, PreSdrat JACOB M. BICKEL, Vta* PraaX L H. WILLLAMR Secretary. H. R MeCOLLOCH. Aa't Heeretary mart C. WELTY & BRO., IMstillcm aad Iaiparter* an pbaxjb* n foreign and Domestic Wines LIQUOB AID BBAHDI mi. niriiiii. | common_corpus | {'identifier': 'sn84026847_1872-05-06_1_1_1', 'collection': 'US-PD-Newspapers', 'open_type': 'Open Culture', 'license': 'Public Domain', 'date': '', 'title': 'None', 'creator': 'None', 'language': 'English', 'language_type': 'Spoken', 'word_count': '6692', 'token_count': '9632', '__index_level_0__': '9837', 'original_id': '16f53774aee5e14dfd19126545718af8ec97e1db4cb580684decc55ca758bceb'} |
Ask A Scientist
Where could people go if the Earth became uninhabitable...?
Asked by: Morgan Rafferty
School: Maine Endwell Middle School
Grade: 6
Teacher: Kevin Wagstaff
Hobbies/Interests: Volleyball, lacrosse and shopping.
Career Interest: Cosmetologist or pediatrics nurse or a criminal lawyer
Answer from E. Jay Sarton Jr.
Adjunct faculty member/grants consultant at Bingha
Research area:
K-12 Science, education in physical science and earth science Interests/hobbies: Coaching youth soccer and softball, nature photography and astronomy.
If Earth became uninhabitable in the next fifty years, it would be possible, in theory, to relocate perhaps five to ten thousand people to Mars over that period. The red planet is the best site in the solar system because it is relatively nearby (as close as 40,000,000 miles away) and because it is the most earth-like planet. Mars has ice caps for water, carbon dioxide for plants, a reasonable amount of sunlight, and useful raw materials in the rocks. Mars has frozen water in the soil, a thin non-poisonous atmosphere, seasons, and 24-hour days. Martian colonists could build extensive greenhouses to grow plants, which could provide food and oxygen for life support. The key to human survival on Mars, however, would be a reliable energy source. Since there is no coal, oil, or natural gas on Mars, sunlight would have to be that source. Because it is farther from the sun, Mars receives only half as much sunlight as Earth. Since it does have fewer clouds, Mars actually absorbs about the same amount of sunlight at its surface as Earth. This solar energy could be used to heat greenhouses, fabricate glass and steel, and make fuel from the Martian soil. There is even a remote chance that some geothermal heat source might be found near one of the huge Martian volcanoes. If this all sounds too easy, don't be fooled: moving a few thousand people to Mars would be the greatest human endeavor of all time. Astronomers know that Mars is very cold with an average temperature of -90oF and that deadly ultraviolet radiation reaches the surface. Also, every pound you send to Mars will cost over $1 million in travel expenses. At that rate it would $150,000,000 to send me! The plan would be to send robots first to find the best site for the colony and then to mine the resources and build the shelters. The few dozen astronauts would arrive a year later and they would set up the life support systems and test their safety shelters. After about a decade of testing, the first colonists, probably engineers and technicians, would be sent to expand the Mars base to receive several hundred more people. Once the colony was fully operational, plans would go into effect for recycling all materials and for minimizing pollution. New energy and agricultural technologies would be necessary to insure the survival of the colony over the long term. If successful, the colony could then expand to handle thousands of new colonists. Only a small percentage of the Earth's population could be sent to Mars over the first hundred years. So for the time being, we all need to do our part to protect Earth and its ecosystems. No matter what scientists could do to develop a Mars base, no place in our solar system will ever duplicate the rivers, forests, oceans, and beautiful clouds of Earth. It is your planet: treat it kindly.
Last Updated: 9/18/13 | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '3', 'language_id_whole_page_fasttext': "{'en': 0.9596337080001832}", 'metadata': "{'Content-Length': '61612', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LD72XXSYTQ5YGKDUX2AXCTNMTIO67Y6O', 'WARC-Concurrent-To': '<urn:uuid:c7d982de-40d9-4e87-8af3-ebf2cd7ee670>', 'WARC-Date': datetime.datetime(2014, 12, 20, 8, 5, 30), 'WARC-IP-Address': '128.226.6.62', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:3POG2NHJBRWOIREUCEUMQNBJVMED2KPA', 'WARC-Record-ID': '<urn:uuid:65a53c1e-3648-4c5a-afdc-6d784f237b0a>', 'WARC-Target-URI': 'http://www.binghamton.edu/mpr/ask-a-scientist/entry.html?id=56', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6e11aa8f-26a7-4e60-9684-49d3e503e979>', 'WARC-Truncated': None}", 'previous_word_count': '574', 'url': 'http://www.binghamton.edu/mpr/ask-a-scientist/entry.html?id=56', 'warcinfo': 'robots: classic\r\nhostname: ip-10-231-17-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-52\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for December 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.6650548577308655', 'original_id': '70b9d2bb645291147030252a0471993256d8458ab211377c5473fdce87a2e2b2'} |
Tuesday, January 30, 2007
What I'm up to
I misread an announcement. I thought that my after-sixth-term exam on everything is a month later than it really is, meaning that I have plenty of time to write my seminar papers (which I've been procrastinating for up to three years) and to pass a few exams and to do some paperwork that requires catching the responsible persons. Just plenty of time.
As I found out today, the notice read that I should apply until February 5, not from February 5.
Since it's January 30, I'm in deep shit, because the next date for this exam is in May,after my expected finals and graduation and stuff.
Yes, at this point you're totally right, dear reader. I'm an irresponsible chaotic idiot.
I admit it. I even admit that the energy I spend on solving problems I caused myself could replace a nuclear power plant.... but, it just happened.
So now the plan is:
1] lots of coffee
2] a paper on medieval stuff so that I can submit it tomorrow to the head of the department. That's the paper I owe for three years. The notes for it are in my stolen comp, for that matter, so I wasn't totally lazying around but who cares now. The head of department owes me a favor or two so and he's pretty chaotic himself so I guess he might be understanding and helpful (he was helpful enough when I still didn't have my papers after returning from Italy and needed some credits so that I wouldn't get kicked from school) and give me a credential for the dean's office to permit me to apply for the damn exam on behalf of all things done by now, not the things required only - I did stuff that wasn't required for the first three years of study so I'm not a total lazyass and I can prove it.
3] seminar paper on st. Birgitta. This seminar is run by my thesis consultant,no problem, only to find her and make her sign my papers. Owes me a favor, too. Nice and helpful person.
4]possibly morning coffee and off to the uni.
If you know something about Bridget Riley, let me know. I need a seminar paper on her. I left my library card at parents', for that matter. Deep shit comes, dear reader, in large amounts.
Yes, some nice yarn arrived today. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9754652976989746}", 'metadata': "{'Content-Length': '17257', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:OVBF4CLU4CKFN3D5QS5LTCTX66PH7SF4', 'WARC-Concurrent-To': '<urn:uuid:b095419f-ebc6-4388-bfc0-8b498dceb8d0>', 'WARC-Date': datetime.datetime(2017, 5, 23, 8, 38, 58), 'WARC-IP-Address': '172.217.7.129', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:FBI6RF4XRGTCWWCGG5FGITCCYRNWJQVD', 'WARC-Record-ID': '<urn:uuid:17bb1de5-bb1f-409b-951e-f44dad1a091e>', 'WARC-Target-URI': 'http://my-paperback-life.blogspot.com/2007/01/what-im-up-to.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:a6e66b36-3062-4844-b302-76d53e287e81>', 'WARC-Truncated': None}", 'previous_word_count': '401', 'url': 'http://my-paperback-life.blogspot.com/2007/01/what-im-up-to.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-224-210.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-22\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for May 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.053907811641693115', 'original_id': 'b7fc9e93affa732a91ac633ba09ee6cfa128b6b8be8fa855f11c2a5547a9c135'} |
Should we evaluate for cardiovascular disease in patients with Cushing's syndrome?
Current evidence indicates a strong association between Cushing's syndrome, characterized by a cluster of systemic complications and increased cardiovascular risk. The biological link is cortisol overproduction, which influences various pathogenetic processes leading to cardiovascular damage, a main cause of increased mortality. Anthropometric and biochemical profile (including fasting glucose, lipids, potassium and coagulation parameters), clinical blood pressure measurement and electrocardiogram should be routinely carried out. Oral glucose tolerance test, 24-h ambulatory blood pressure monitoring, echocardiography and carotid ultrasound are recommended for further evaluation. Search for cardiac and vascular damage, according to specialist's advice, is mandatory in complicated hypertension or diabetes, as part of a comprehensive assessment. A combination of treatments directed against the aetiology of hypercortisolism and aimed at controlling cardiovascular risk factors, is required in this complex condition. | mini_pile | {'original_id': '5a1a25d365c32eb52a25a09080ee1872742a07449c2c81b37feaea4c1d2842fd'} |
Paid By The Mouse Click? Compensated By Page Views? The Death Of Modern Journalism?
By Gene Mueller. CREATED Mar 28, 2014
Jaws might've dropped and a collective "tsk tsk" might've been heard the other day when a story appeared detailing how a new dynamic might soon be coming to a digital web page near you, one that will have web reporters recompensed based on how many people read their stuff.
"Journalists who were paid to write when the muse or events beckoned," writes New York Times media columnist David Carr, "are now held accountable for the amount of work they produce and the volume of traffic it attracts. Gee, it's almost like news is supposed to be a business or something."
Carr wonders if this new trend will change how news organizations pay employees and if it'll have an effect on content itself. I'm sure the world of journalists-with-a-capitol-J is probably in a tizzy over these very same points.
Too late. It already has and the dynamic pre-dates the mouse and keyboard, at least when it comes to making the meter move among listeners/viewers/readers.
Contesting is an old radio trick used to manipulate the Arbitron diary system that had folks at home writing down what stations they listened to and when, an imperfect setup that was open to industry abuse. That's why WKTI did things like "The Birthday Game" back in the day, offering obscene amounts of money to the right caller who happened to have been born on the day we'd announce at a set time. It's not that our radio station was overtly generous with an unquenchable desire to toss money out the window. We were gaming the system, and it worked.
This dynamic works on television, where the juiciest, rawest, sexiest stories get trotted out not when they break or are in the news climate but rather for "sweeps" when ratings are used to set advertising rates. And now, our TV buds are contesting ala KTI during newscasts, offering swag and cash if you watch at a certain time. Those ad rates push revenue which helps set up budgets which contain salaries paid to station personnel, reporters included. We all live by the numbers.
The Internet isn't ruled by Arbitron or Nielsen. Revenue is culled based on how many eyeballs you draw to your website. Is it any wonder, then, that digital management would come up with a model in which those who bring the most readers make the most cash? The Chicago Tribune and Sun-Times fought back and forth for the stylings of columnist Mike Royko back in the day because his stuff helped empty newspaper boxes scattered all over the Windy City. And, every major town had it's Royko, the stud columnist who's printed word was the water cooler chat of the day. Their stuff was good of and by itself, and it got readers. Now, with so many digital information sources the question is being asked--to stand out, is being good good enough? What gets mouse clicks, unique visitors and page views?
Ask anyone who dabbles in new media and they'll tell you what brings folks in: porn (in all forms), pets/animals, lists, and video of men getting hit in the nards. These aren't scientific, but you get my drift.
I've told the story a million times about my former radio partner John Jagler: he and I both had morning show blogs, and he'd routinely kick my butt in terms of readership. I stuck with my usual Cold Filtered fare--long form takes on things I had a thought about but didn't have time to fully discuss on the air. John often went with video, links to stories that had gone viral and other shorter fare. He killed, and would kid me about all the time and effort I put into what I did with little response. No one's right or wrong here--he knew what worked and went with it. I ended up writing consistently for a global audience of about, um, six.
CNN is getting grief for it's wall-to-wall, round-the-clock, this-is-the-only-story-on-the-planet coverage of the missing Malaysian airliner. The apparent loss of 239 souls is nothing to be ignored, for sure, but the cable channel's devotion to the saga even when there isn't anything even remotely there in the way of "new" information isn't a service but an obvious pander to a ratings system that shows CNN getting its best numbers in recent memory because they're showing the audience what it WANTS to see instead of the news that it claims is part of its mission. News, in fact, was CNN's middle name.
They aren't alone. Local electronic media provide a public service with severe weather coverage, saving lives with cutting edge technology that warns views/listeners of pending electrical storms and tornadoes, extreme cold and life-altering blizzards. Noticing how the numbers jumped amid such events, the bar got lowered to the point where it's not usual to see the mere mention of the word "flurries" pushing weather to lead-story status, with reporters out in the field describing what a half-inch of snow looks like while poised in front of a plow/salt pile. It may not be the most pressing issue of the day, but it moves the meter.
Media folks get paid based by the number of people who read our stuff, watch our stories, listen to our prattle. No numbers? No job. The worry is that, because of the internet, what qualifies as news may change, that journalism may suffer in a head-long rush to numbers. That worry should already be here. A Marquette student media type got torched by Deadspin.com this week for being one of the sources of an erroneous report about Shaka Smart becoming the new MU head basketball coach. Let's hope the school uses the incident as a learning experience to teach its kids that there's more to journalism than posting a story first--there has to be a story in the first place, one that is generated by picking up a phone, turning rumor to fact through legwork, sources and multiple confirmation. I'm sure the kid's social media hits shot through the roof.
Carr writes, "Now that metrics are part of the news agenda, all of the sticks are in the air. Just because something is popular does not make it worthy, but ignoring audience engagement is a sure route to irrelevance." He ends his column with a very cute picture of a kitty. Far be it from me to submit to such an obvious device to curry favor and page views.
Gene Mueller
Gene Mueller
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '29', 'language_id_whole_page_fasttext': "{'en': 0.9497936964035034}", 'metadata': "{'Content-Length': '159474', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:NLODORRXI24E3W4JH5PAM2FCPXDKTMYU', 'WARC-Concurrent-To': '<urn:uuid:4e3b8785-d7a5-4137-b2c0-b68dbf18b334>', 'WARC-Date': datetime.datetime(2014, 12, 23, 3, 46, 52), 'WARC-IP-Address': '68.142.108.128', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:V4SE7FVBH3RFPSCVG7I23XP6SGAD55LL', 'WARC-Record-ID': '<urn:uuid:3f0c80ba-d842-490f-9880-7bc3cb423d32>', 'WARC-Target-URI': 'http://www.jrn.com/wtmj/shows/wisconsins-morning-news/Paid-By-The-Mouse-Click-Compensated-By-Page-Views-The-Death-Of-Modern-Journalism-252951731.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:5aba68eb-f337-4ca4-96ee-510db16f8ffe>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1112', 'url': 'http://www.jrn.com/wtmj/shows/wisconsins-morning-news/Paid-By-The-Mouse-Click-Compensated-By-Page-Views-The-Death-Of-Modern-Journalism-252951731.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-231-17-201.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-52\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for December 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.12734752893447876', 'original_id': 'bdba6cf43b8913ec30099b6d8032dbd2b2c4f10d73ef6200d654938b553eb459'} |
In a data center in which a cloud is implemented, operation of resources is performed by virtualizing physical servers and then activating and operating plural virtual machines (VM) on physical machines.
Requests to deploy virtual machines, remove virtual machines or change the configuration of virtual machines are occasionally outputted from users to this kind of data center, and the timing of such requests and the contents of the change of the configuration cannot be predicted in advance by an administrator of the data center. The main role of the data center is to fulfill user requirements, while at the same time, improve utilization efficiency of the infrastructure used to fulfill the user requirements, and reduce offering costs such as power costs and software license fees.
The operating requirements of the data center and the operating requirements of VMs include various operating requirements such as energy-saving operation and improvement operation of fault tolerance (improvement of availability), and these operating requirements change over time to correspond to the business environment.
In a conventional technique, the operating requirements of the data center are fixedly set before development completion of the operation management system, or before starting the system operation, and dedicated programs are prepared in advance for the plural operating requirements. When a user sends a request to deploy a VM or add a VM, the VM relating to that request is additionally activated on a physical server based on the processing result of those programs.
However, due to environmental or societal demands, the priority of individual operating requirements may change, new operating requirements may be added or some existing operating requirements may be eliminated, so it may not be possible for the dedicated programs to correspond to a specific operating requirement. Therefore, a new program, which is dedicated for plural operating requirements that are changed entirely each time when changing the operating requirements, would be prepared. As the number of operating requirements increases, it becomes more difficult to find judgment conditions for those requirements, and the program itself becomes more complex. Therefore, changing the operating policy in accordance to environmental changes is not easy.
There exists a distributed computing control apparatus that is capable of improving the computational processing performance in an environment in which the system virtualization technique is used. More specifically, the distributed computing control apparatus that distributes plural second computation processes included in a first computation process among plural virtual machines that operate on one or plural physical machines has: an allocation pattern detection unit that detects various allocation patterns for distributing the plural second computation processes among the plural virtual machines, a cost computation unit that computes the cost for each allocation pattern; and an allocation unit that selects an allocation pattern that has the lowest cost based on computation results of the cost computation unit, and distributes the plural second computation processes among the plural virtual machines according to the selected allocation pattern. This technique is a technique for distributing processes among virtual machines, and changing a method for computing the cost according to the first computation process or the requesting source of that process is not disclosed. Patent Document 1: Japanese Laid-open Patent Publication No. 2010-218307 | mini_pile | {'original_id': '3434ce674cde13a935c580833f5b2aeb146c3cf73383957b53bdce31ac21384d'} |
Combined Section Requests
Instructors teaching multiple sections of the same course can combine the courses into one shell. This may simplify developing the course as the content needs to be placed only once into the course. However, there may be instances where combining courses is not recommended such as where exams need to be given to the various sections at different times or if students are to be put into groups and risk being in a group with students from different sections. Any of your sections can be combined, regardless of whether the course titles match.
Please remember that the process of combining sections automatically deletes all content from those sections. So make this request BEFORE you start building your course(s).
To request your sections be combined, send an email to | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9314965009689332}", 'metadata': "{'Content-Length': '8406', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:XIZQPDSDE4TW6O7EZQBFN4MXCJE5Y2FJ', 'WARC-Concurrent-To': '<urn:uuid:52fe4b57-dee9-4ff5-8df2-dea8124cf14b>', 'WARC-Date': datetime.datetime(2014, 8, 2, 0, 25, 12), 'WARC-IP-Address': '149.152.64.45', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:LV2FBU3HXC2F5BVGQQ4XUVEWFSTOCNSG', 'WARC-Record-ID': '<urn:uuid:998f971b-f807-4cca-aa04-781f5f7d2757>', 'WARC-Target-URI': 'http://southernct.edu/faculty-staff/teaching-learning/combined.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:b9d630d8-6c48-4c23-bd7e-351649e1cc22>', 'WARC-Truncated': 'length'}", 'previous_word_count': '131', 'url': 'http://southernct.edu/faculty-staff/teaching-learning/combined.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-146-231-18.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-23\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for July 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.17142605781555176', 'original_id': '4eea83779a64994553cf7c1e10aebd2794403a53dc9e1fe7e7c8782ca9ba7fa3'} |
2020-2021 Academic Catalog
Jan 23, 2021
2020-2021 Academic Catalog
CHEM 260 - Physical Chemistry I
CHEM 260 covers thermodynamics and kinetics. Topics include the gas law, kinetic theory of gases, the laws of thermodynamics, Gibbs and Helmholtz energies and their applications, electrolyte and nonelectrolyte solutions, phase equilibria, chemical equilibria, and chemical kinetics.
Prerequisites: CHEM 131 and MATH 121 or MATH 125
Anticipated Terms Offered: Offered every year | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.6897379755973816}", 'metadata': "{'Content-Length': '103937', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZLW4WLR67WCB6FYCCCX6YNYYFHAN4TKU', 'WARC-Concurrent-To': '<urn:uuid:687dcf6c-ff1d-40f6-9967-16c909d75b24>', 'WARC-Date': datetime.datetime(2021, 1, 23, 17, 45, 43), 'WARC-IP-Address': '18.215.95.201', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:RYENWUG74IMH4B7TEM6WPA2CRK32ZQGZ', 'WARC-Record-ID': '<urn:uuid:292bd724-e86e-4361-9fbd-817c0b2f8fac>', 'WARC-Target-URI': 'http://catalog.clarku.edu/preview_course_nopop.php?catoid=26&coid=85423', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:4226458e-c3dc-4071-bd45-0918b3a37ebf>', 'WARC-Truncated': None}", 'previous_word_count': '64', 'url': 'http://catalog.clarku.edu/preview_course_nopop.php?catoid=26&coid=85423', 'warcinfo': 'isPartOf: CC-MAIN-2021-04\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for January 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-90.ec2.internal\r\nsoftware: Apache Nutch 1.17 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.29964298009872437', 'original_id': '73c8551f06c90a9216c888f1e636629a07c93d4323705a2653ea4ae79e6bfc69'} |
We had our septic pumped and your technician mentioned risers and a filter. What are they?
Risers are lids at or above ground level that allow easier access to your septic tank without the damage of digging in your yard. An effluent filter traps solids leaving the tank and prevents them from entering your drain field. Keeping solids out of your drain field will extend its life. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9533324241638184}", 'metadata': "{'Content-Length': '19027', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7V26BI5NCPWFYNAQ4WBQPQRRWAK7SCVO', 'WARC-Concurrent-To': '<urn:uuid:30d358fd-49c4-49e7-aad0-e1fb228524a0>', 'WARC-Date': datetime.datetime(2021, 9, 20, 4, 20, 1), 'WARC-IP-Address': '206.188.192.106', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2YIQP3CSDDSAL36W3DMB4J5RKFMXC5QZ', 'WARC-Record-ID': '<urn:uuid:64946a0a-cb01-4963-9c1f-c3172e4e53ab>', 'WARC-Target-URI': 'http://cleandelaware.com/wp_super_faq/we-had-our-septic-pumped-and-your-technician-mentioned-risers-and-a-filter-what-are-they/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:697e9dd8-4d49-4e2c-a7e2-db04eca150b9>', 'WARC-Truncated': None}", 'previous_word_count': '68', 'url': 'http://cleandelaware.com/wp_super_faq/we-had-our-septic-pumped-and-your-technician-mentioned-risers-and-a-filter-what-are-they/', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-207\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.045697808265686035', 'original_id': 'd07bceef2d368967b825b5f18814e1c9d7d5ec39b471551f04d1bffbf6fc8718'} |
Direct Evidence for Bottom-fishing in Archaeological Whelks (Buccinum undatum)
Greg Campbell1 and Michael Russell2
1. The Naive Chemist. 150 Essex Road, Southsea, Portsmouth PO4 8DJ, UK. Email:
2. English Heritage, Fort Cumberland, Eastney, Portsmouth PO4 9LD, UK.
Cite this as: Campbell, G. and Russell, M. (2014). Direct Evidence for Bottom-fishing in Archaeological Whelks (Buccinum undatum). 'Human Exploitation of Aquatic Landscapes' special issue (ed. Ricardo Fernandes and John Meadows), Internet Archaeology.
A dredge-damaged and encrusted whelk (Image credit: G. Campbell)
Bottom-fishing is a major step in the increase of exploitation of marine resources, requiring specialised craft, technology, and practitioners. However, the onset and development of bottom-fishing is almost impossible to observe directly in the archaeological record, and is usually reconstructed by implication. The shells of common whelk (Buccinum undatum) from a kitchen midden at Carisbrooke Castle, Isle of Wight, southern England, showed a pattern of damage characteristic of harvesting by bottom-fishing, rather than the usual baited pots. Some whelks had survived being dredged several times. The very consistent size-shape relationship made it likely the whelks were all from a single habitat, probably in the fast tidal flows typical of the oyster-beds just north of the island. The whelks were harvested along with oysters: the whelks' shells were encrusted in a similar way to the oysters in the same midden, and the whelks even bore sub-adult oysters (spat), despite these being potential prey for whelks. This may be the first time whelks have been shown to have been harvested along with oysters and also seems the first direct evidence for a bottom-fishery for whelks.
Go to Table of Contents. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '11', 'language_id_whole_page_fasttext': "{'en': 0.9283096194267272}", 'metadata': "{'Content-Length': '8248', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:LMBPLMOU4P2QEUUDVC5FDIH2QXBYOR57', 'WARC-Concurrent-To': '<urn:uuid:01585bf3-c9c8-4067-ba5a-bf65df9d88d7>', 'WARC-Date': datetime.datetime(2019, 3, 22, 6, 0, 1), 'WARC-IP-Address': '144.32.125.236', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:J7QKRX7JIDF4FVUPPM257BBDR7CKGDNY', 'WARC-Record-ID': '<urn:uuid:fad25ed2-b6b4-4b7e-9d8f-341f85ec1d38>', 'WARC-Target-URI': 'http://intarch.ac.uk/journal/issue37/campbell_index.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2867003c-9acf-411c-a894-ba441ff8309f>', 'WARC-Truncated': None}", 'previous_word_count': '261', 'url': 'http://intarch.ac.uk/journal/issue37/campbell_index.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-13\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for March 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-167-248-25.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.018884003162384033', 'original_id': 'cfd6d6b809da1335155461f22c0395320a88d8bfc45a6dbd24186d1d0ed39443'} |
Climate measures in budget bill could cut nearly 1 billion tons of emissions per year by 2030, analysis finds
Six major climate provisions in congressional Democrats’ massive budget bill could slash US greenhouse gas emissions by nearly 1 billion tons per year by 2030, a new analysis from the nonpartisan Rhodium Group found.
It would be comparable to removing all passenger vehicles from the road, or the yearly greenhouse gas emissions of Texas and Florida combined, according to the analysis.
“This is a really big deal,” Rhodium Group President John Larsen told CNN. “It would be the single largest action the federal government’s ever taken to deal with climate change.”
Rhodium’s findings are consistent with other analyses that have showed the biggest reductions would come from a combination of Democrats’ clean electricity program and tax credits for clean energy, like wind and solar.
Out of the six measures the group analyzed, Rhodium estimated a combination of the clean electricity program, tax credits and funding for rural electric cooperatives would have the largest impact on US emissions, accounting for up to 715 million tons per year.
The House Energy and Commerce Committee structured its clean electricity program so that utilities would be eligible for federal grants if they increase the amount of clean electricity supplied to customers by 4% compared with the previous year. The grant would be $150 for each megawatt-hour of clean electricity above 1.5% of the previous year’s clean electricity.
Rhodium’s analysis found that if utilities hit that minimum increase each year, the power sector would achieve a 73% clean share in 2030, just short of President Joe Biden’s 80% goal.
“There’s no reason why any utility wouldn’t get paid to overachieve,” Larsen told CNN. “If I do better than 4% per year, you could actually get paid for even more of doing the right thing. I think between the tax credits and the [clean electricity program], it’s a no-brainer for utilities to meet these goals.”
All these programs combined could make a significant dent in US emissions, but Larsen told CNN it’s too early to say definitively whether the total budget package will hit Biden’s decarbonization target of 50% to 52% below 2005 levels by 2030.
Rhodium estimated there’s an approximately 1.7 billion- to 2.3 billion-ton gap between where greenhouse emissions will be under the current US trajectory and where they’d need to be in order to meet Biden’s 2030 goal.
“We estimate that this could close about half the gap between where the US is likely to be and where it needs to be to hit the target,” Larsen told CNN, adding that gap could shrink if Congress goes even bigger with its investments.
Climate provisions make up about one-fifth of the overall $3.5 trillion budget bill, environmental groups have estimated. The clean electricity program as written costs about $150 billion over 10 years, while clean energy tax credits account for about $253 billion over the next decade.
Rhodium’s analysis also included a $7,500 electric vehicle tax credit, a methane emissions fee and more funding for agricultural and forestry programs that help remove carbon from the atmosphere.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.9389044046401978}", 'metadata': "{'Content-Length': '55020', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:W3QFHY44HKRHZXNMC4G2ISO4NIS67TX4', 'WARC-Concurrent-To': '<urn:uuid:09e28794-7af8-44be-a5c8-de679cfb0b0c>', 'WARC-Date': datetime.datetime(2021, 9, 21, 17, 19, 40), 'WARC-IP-Address': '45.60.11.102', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:QY57HONPVJGNHYMSDW5DBTXAFVB6RIVC', 'WARC-Record-ID': '<urn:uuid:25ea0ef7-d607-4c11-9173-93e7fec65367>', 'WARC-Target-URI': 'https://www.ed.fm/news/climate-measures-in-budget-bill-could-cut-nearly-1-billion-tons-of-emissions-per-year-by-2030-analysis-finds/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8ab0d992-ce00-421d-8bcd-a1aadb102ce3>', 'WARC-Truncated': None}", 'previous_word_count': '523', 'url': 'https://www.ed.fm/news/climate-measures-in-budget-bill-could-cut-nearly-1-billion-tons-of-emissions-per-year-by-2030-analysis-finds/', 'warcinfo': 'isPartOf: CC-MAIN-2021-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-130\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.1598525047302246', 'original_id': '6df95eca4146fe995d9d3c7a86fb53954ee368da16605873b98f8d8e9ecea551'} |
[Evaluation of the colonic endoscopic polypectomy in patients of the National Carlos Alberto Seguín Escobedo Hospital ESSALUD of Arequipa (1999-2004)].
The investigation was performed in the Carlos Alberto Seguín Escobedo National Hospital of Essalud-Arequipa, in 194 patients that were submitted to Colonic Endoscopic Polypectomy from January of 1999 to December of 2004. This study is observational, retrospective and transverse. The clinical histories, endoscopies reports and pathological anatomy reports were reviewed, taking the personal data, clinical symptoms, endoscopic and pathologic characteristics of the polyps; colonoscopies associate findings; surgical technique of polypectomies, complications and complementary treatment of post-polypectomy. The colonic endoscopic polypectomy was performed in 194 patients from 1380 colonoscopies (14.05 %), with more frequency in the sixth decade of life, and corresponding most to the masculine sex. Most of the patients did not have previous symptoms, and of those who had clinical manifestations the more frequent were the bleeding lost and changes in the intestinal rhythm. The polyps endoscopic characteristics found that the sessile were the more frequent and were located in rectum--sigmoid zone. The preponderant size was from 5 to 10mm, and mostly unique. The histopathology type of the polyps was adenoma, frequently with some grade of dysplasia. The surgical techniques for the colonic endoscopy polypectomy were with cold pincer and electric cut. The complications were rare. The complementary treatment after polypectomy was injectotherapy and surgery. Finally, our results were discussed and compared with other similar studies, and then we elaborated the conclusions and recommendations, with whom we expect to contribute to a better knowledge of the Colonic Endoscopy Polypectomy in our country. | mini_pile | {'original_id': '315d2a2d27509e8fe8f771ce55c51fdeb2ba8b5866264974e02e1c0049d70995'} |
Friday, March 7, 2014
My coursera essay for 'Human Evolution: Past and Future'
Dualisms's dysgenic disruption of endocranial displacement,
or: Dude, where's the rest of my brain?
by A philosophical Doggerlander
"I would be willing to wager that if an average citizen from Athens of 1000 BC were to appear suddenly among us, he or she would be among the brightest and most intellectually alive of our colleagues and companions." Gerald R. Crabtree from 'Our fragile intellect'
This is a disturbing idea at odds with the standard narrative of humankind becoming steadily more intelligent and I shall address one of the many possibilities for a cause of this phenomenon - the rise of dualism as concomitant with the appearance of consciousness. I shall produce data in the form of endocranial displacement trends, and my own "research" into the fecundity of the acknowledged geniuses of history.
The subject is enormously complex and hotly debated, in order to narrow the scope to fit in the confines of this essay, I shall make a number of assumptions which I shall declare at the beginning; each is in itself a topic for discussion some aspects of which I shall mention; for the interested reader I point to a paper supporting each respective assumption. I consider a mainly eurocentric (local) viewpoint though I believe a global argument could be made.
A1. That there is a correlation between the size of the brain (measured through endocranial volume) and intelligence.
This is at least partially the case, complications arise through modern brains having a different structure as well as the effects of better education, also a diminishing body mass. We may wish to ask how we would be today with these advantages AND a bigger brain.
From 'Decrease of human skull size in the Holecene' Henneberg, Maciej 1988.
The decline as seen above is in sharp contrast to the steady increase seen in the last 2,000,000 years. The start of decline slightly predates the agricultural revolution indicating a cause other than natural selection due to domestication, though this probably is a major contributor post neolithic (limited food and unsanitary birthing conditions compared to the wild).
I postulate that the decline is marked by the replacement of sexual selection on an animal basis to a system of cultural mate allocation - through complex language and the idea of ownership.
Property prior to this time simply did not exist, stone tools were disposable, but now we see various objets d'art (statues; flutes; pottery), dogs, dwellings, and particularly grave goods. It is probably at this point that the patriarchy is established and the female role is reduced to dutiful daughter - note how much more marked the female reduction is - a sign of stronger selection pressure on the female. Whilst female selection appears to have favoured big brains, males were clearly focusing their attention elsewhere - towards neoteny; body fat in other areas and possibly docility, clearly there is a story to be told here - but not now.
When man put in place (albeit unwittingly) the parameters for cultural sexual selection what were the chances that he would have hit upon a better method than nature (A4) had already provided? Given that he based his method on a number of erroneous assumptions, not least of which involved ignoring half the population's wshes, the chance must be vanishingly small. But it is those early 'methods' that set us upon our way to 'civilisation'. Probably male mates were allocated that were considered fit for a particular culture and the various niches that such a society has to offer (chief, henchman, soldier, labourer etc..).
Rather than speculate on the exact forms of primitive beliefs in prehistory, it could be instructive to work backwards from our early written history. Firstly in early classical times we find Pythagoreans extolling the virtue of celibacy for mystic reasons, moving backwards from there there appear to be a mix of cults and beliefs, some of which deny the pleasures of the flesh to priests and shamen - in particular 'Earth mother' cults may expect the shaman to be available to the goddess and none other. The shaman moves in the spirit world at a remove from the body, not to see the sun not to touch the earth, his person is different from others.
Joseph Campbell in 'Primitve Mythologies' shows this to be the beginning of the schism between sex and intellect - quoting Hamlet:
....thy commandment all alone shall live
Within the book and volume of my brain,
Unmixed with baser matter. Yes, by heaven!
O most pernicious woman!...
Chris Stringer in his book 'The origin of our species' claims that sects which do not allow the shaman to reproduce or even castrate their priests are doomed to die out, but clearly if a society can give up just a few individuals for this purpose it can still thrive and benefit from their wisdom - but with a reduction in genetic variety. It is the cerebral who become the shamen and wise men and it is their genes removed from the pool (A3). The trade-off for the shaman is reward in the spirit-realm (pre/post-mortem).
“The most spiritual men, as the strongest, find their happiness where others would find their destruction...Their joy is self-conquest: asceticism becomes in them nature, need, and instinct" Nietzsche 'The Anti-Christ'
These two streams merge in the christian religion which dominated European culture for perhaps 50 generations. The first written mandate requiring priests to be chaste came in AD 304. Canon 33 of the Council of Elvira stated that all "bishops, presbyters, and deacons and all other clerics" were to"abstain completely from their wives and not to have children." The less venal clerics and more serious thinkers have been honour-bound by this. Around 1 in 50 men were clerical during the middle ages. This seems about the level we might expect for a shaman in the mesolithic - perhaps one plus an acolyte in a clan of 200?
With its monopoly on education and its providing the only chance of social mobility in a single generation (prime examplehttp://en.wikipedia.org/wiki/Thomas_Wolsey ), the church was able to select the best and brightest..
Here are some figures for reproductive success of some of the best known thinkers. There are many 'toptens' on the internet, but they seem to have some names in common (Goethe is invariably #1), I have chosen one at random so not to be guilty of cherry-picking, but I maintain that a similar result will crop up on any list.
Table 2: We are standing on the shoulders of giants, but are they our ancestors?
Philosophers (Chapters from B.Russell 'History of Western Philosophy', chosen because this is my field)
Plato------------->0
Aristotle---------->2
Aquinas---------->0
Macchiaveli------>0
Erasmus---------->0
Bacon------------->0
Hobbes------------>0
Descartes--------->0-----daughter died age 5
Spinoza----------->0
Berkeley---------->1
Hume-------------->0
Locke-------------->0
Rousseau--------->0----all 5 abandoned to die
Byron-------------->3---(my ancestor)
Schopenhauer--->0
Kant--------------->0
Hegel-------------->3
Nietzsche--------->0
Kierkegaard------>0---in honesty missing form Russell but a prime example
Marx--------------->3
ConclusionClearly this hypothesis requires more work, especially the maths, but I think it points towards a recognisable trend in our recent evolution. We should avoid making the assumption that we are steadily improving with time and accept that we may have taken a wrong turning somewhere.
If mankind aspires to longer more fulfilling life it may need bigger brains with space to preserve individual histories and identities. Current trends showing an inverse relation between intelligence and fecundity.
We can stop self harming by:1. Respect for diversity2. Education - history;science;philosophy, not divinity;dogma;devotion3. Equality of the sexes | mini_pile | {'original_id': '0e38a8383ab211d374e5e2bad47a929b69f5c409ba416bf2f5854b79eea85598'} |
How To Get A Body Like Captain Marvel
5 Ways You Can Transform Your Body To Show Off Your Inner Captain Marvel Just Like Brie Larson
Your going to have to put down that ice-cream and pick up some carrot sticks.
Brie Larson trained for nine months with celebrity trainer Jason Walsh for her lead role in Captain Marvel. Since she knew she would be doing her own stunts, she wanted to be strong enough mentally and physically to give it her all in the role. She worked out five days a week and up to four and a half hours a day at most, to get into shape for the movie and it clearly shows. She went from not being able to do a pull-up to hip-thrusting 275 pounds and box jumping higher than her waist.
"I sobbed in the gym many times," she said.
Wash recently launched a 2-week training app based on the Captain Marvel workouts. It's filled with strength training, resistance bands, stability balls, and barbells. The app has a series of six 45-minute routines which can easily be accessed on the tablet or iPhone.
Despite the challenges of getting fit and going through rigorous exercises, Larson loved how it made her feel afterward. She told Hollywood Reporter that, "Although the primary focus might be about looking good, it's the feeling of confidence you get when you know the body can do what the mind wants it to that makes you feel like a superhero. The aesthetics are almost secondary…I started to fall in love with training and the way my body was changing and transforming. It was the first time I felt like I was making my body work for me."
If that isn't inspiration to get off the couch and go find a trainer, then I don't know what is. However, if you can't get yourself a personal trainer, here are some tips of achieving the Captain Marvel confidence that we have always dreamed of.
1. The hardest part about working out is getting started.
Brie said that she would sometimes sob in the gym because of her vigorous workouts. While we definitely don't want that to happen to us, we do want to push ourselves in a way that is mentally and physically exhausting. It's crazy to see what our body is able to do and what we can transform it over time.
While it can be awkward and uncomfortable when you first get into the gym, once you get in a routine and start to learn how to navigate the gym world, you will enjoy going. The first step is getting off the couch and getting yourself there. If you don't know how to use a certain machine, ask a worker. I promise you that they won't laugh if anything they will go above and beyond and show you how to do a workout that will kick your butt.
2. High rep, low-weight.
According to a workout Brie Larson posted on her Instagram, one of the best ways to shed fat and get good muscle definition is high repetitions of low weight. This basically means get a low-enough weight that you can do about 10-15 repetitions before stopping. A great workout for this is a resistance band pull-apart move. This helps build back muscle and defines your body. It also improves posture, which, let's be honest, we all need help with.
3. Sacrifice culinary-wise.
If you want a healthy body, sadly, you will have to put down the Oreos and shop on the outside aisles of produce. This is easier said than done, and won't come without its trials, but as long as you try, you will get in the habit of eating healthy. Once you get the processed sugars detoxed from your body, the healthier food will taste better and you will crave it more.
Some other daily sacrifices include: no alcohol, don't eat anything after 7 pm, eat more fruits and veggies, and go to sleep before midnight.
*of course, have the occasional celebratory donut when you hit a huge milestone*
4. Try different types of workouts.
Not only can doing the same few vigorous exercises be boring and annoying, but it will also make you less motivated to go to the gym. Mix it up a little and take some classes. Larson tried boxing as another way to shred fat and boost her cardio. She also had different dance routines that were all demanding in their own way. It helped test her balance and movements that you normally can't work on the treadmill or with weights. Make it fun and exciting to get up and go to the gym.
5. It takes time.
Brie Larson didn't get fit overnight. She had the determination and patience to work hard every day to become the Captain Marvel that we see on the big screen. She built her body up day-by-day and showed up, no matter how she was feeling.
Don't expect to work out once and immediately get abs. As much as I wish that's how it works, it doesn't. So get up, get out of bed, and go to the gym. Even if you want to cry, quit, and sleep. Every day is a step towards being Captain Marvel and feeling physically and mentally well.
Popular Right Now
These Are 4 Proven Ways That Vaccines Cause Autism
Stock up on those essential oils.
Let's just start with the first (and main) point.
1. They don't.
2. But in case you still believe Susan...
4. But here's what you should know...
Related Content
Connect with a generation
of new voices.
Learn more Start Creating
The Life Of A Curvy Girl Is Very Exciting
To every curvy girl out there, share your curves as a positive outcome to your circumstances
Have you ever noticed in all the magazines, blogs, and TV it shows a thin size woman? In all the entertainment I take in, there was always a skinny woman. It brought down my self-esteem, and I would try to starve myself, yet it doesn't help. However, what if I was meant to be a curvy girl?
Before I go any further, I know that God gave me this body to take of it. But what if I was meant to be this size so, I can touch others who feel negative towards their bodies? For every curvy woman, you are so beautiful!!
Throughout my life, I wasn't thin. I had a gut. I had thighs. I was very unhappy with myself. Yet, I look at the expectations and what people will be happy with. But if there is one thing I realized, its that people are temporary. The naysayers in your life are not set in gold. They will push you to make sure that you're happy with yourself. I truly believe if people look at me weird, that means I'm doing an amazing job with not conforming in the world but transforming in the renewing of the mind. By the way, that's Romans 12:2 in the bible!
When it comes to the curves, I'm truly grateful for them. There are some positives to having a curvy body. For one, when it comes to wearing jeans, it shapes you well. The curves pop and the haters bow down! Other than that, I truly love how I look in jeans! Another positive thing about curves, its that there are amazing clothes for us! I was on Facebook the other day, and I saw a company called Dia&Co.; Dia&Co; is a customized clothing company for plus sized women which has all the styles. When I saw the clothes, I was truly amazed. The colors and the material of the clothes were truly special.
What defines beauty? Is it makeup or having a model's body? Is it buying the most expensive clothes as a statement? I'm here to tell you those are not the definitions of beauty. The true definition of beauty is acceptance. Accepting the circumstances, even if other people say so. True beauty is waking up with a smile on your face for living another day and finding your purpose in life. Beauty is being you!
To all of you curvy women out there in the world, you are truly a blessing. Thank you for standing out of the normal and taking a step to give others the courage to becoming their selves. I learned to treat my body with the utmost respect. I must learn to take care of it and embrace it at the same time. Psalms 139:14 says, "I praise you because I am fearfully and wonderfully made, your works are wonderful, I know that full well." So, Instead of me being a worried progress, God made me a working progress, because all things work together for good.
Related Content
Facebook Comments | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '246', 'language_id_whole_page_fasttext': "{'en': 0.973946213722229}", 'metadata': "{'Content-Length': '841827', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:QV25ZZ4RCVP7RQLKPFWAKLHZ2MMS5TBR', 'WARC-Concurrent-To': '<urn:uuid:54ea874f-a0ed-4b4b-b02b-5549fbf0af49>', 'WARC-Date': datetime.datetime(2019, 4, 20, 12, 16, 7), 'WARC-IP-Address': '151.101.201.68', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DDYXFI2GDZNVP3FT45B6WNKSMC4J5PCW', 'WARC-Record-ID': '<urn:uuid:46b33725-5967-4a69-bb40-49833fd11cca>', 'WARC-Target-URI': 'https://www.theodysseyonline.com/how-to-have-captain-marvel-body', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:8c0d867e-30ca-4c89-a5e1-523d76c9489b>', 'WARC-Truncated': None}", 'previous_word_count': '1762', 'url': 'https://www.theodysseyonline.com/how-to-have-captain-marvel-body', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-166-27-36.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.06946742534637451', 'original_id': 'd51b2d40a26e16c448e0d2702e8d1aebb414b0c7ee7585b328ee9d928aff1231'} |
Towards the end of the nineteenth century, the Australian colonies enjoyed a considerable increase in prosperity. Before 1890, national wealth was increasing at rates similar to those of the United States and twice those of Britain. The population was growing at an annual rate of around 3 per cent. The economy was largely agricultural based with the sheep industry becoming ever more dominant.
Flocks of sheep penetrated further and further inland as investments in buildings fences, transporation and water-storage facilities further increased the land's capacity. Much of this capital was re-invested profits, but an increasing share came from loans raised in Britain. British investment increased sixfold in the two decades following 1860. Britain was also the major destination for Australian agricultural output. This dependence on the British economy meant that if anything effected Britain then it would have serious consequences for the Australian colonies. In the 1870s, the American and Canadian prairies came on stream as the railroads could deliver their goods to the ports. This glut of produce depressed the prices for all agricultural commodities.
Australian farmers were extremely vulnerable and small farmers had even more to be concerned about. While certain areas, such as the Yorke Peninsula in South Australia, remained prosperous, there was failure in most other areas and many farms were abandoned in despair.
It was hoped that the various discoveries of gold would help revive the flagging fortunes of the colony. However, they never quite lived up to expectations with only the workings in Victoria lasting more than a few years. Fortunately, other mineral discoveries would produce more longer lasting. The most spectacular being Broken Hill which was a mound of pure silver, lead and zinc. Copper was discovered at Mount Lyell. Coal would also be discovered.
There was some diversification of the economy as food processing plants, clothing factories and metal goods were produced. House building would also need resources and expertise as suburbs sprawled out from the administrative centres. By 1911, 50 per cent of houses were owner occupied. This was five times the rate of Britain.
In the nineteenth century, most of the colonies developed similar political systems. They possessed two houses, with the lower house being elected by manhood suffrage and the upper house being appointed by the governor or chosen by the landed gentry. However, there were no political parties of note. This meant that governments formed and dissolved with amazing rapidity. As there was little of ideological consequence to keep them together, alliances were formed on personal or single issue bases. In forty years, South Australia had 41 governments, New South Wales had 29 and Victoria 28.
Growth of Australian Nationalism
Although many Australians were quick to articulate their country's interests, they strove to protect them by emphasizing their Britishness rather than rejecting it. Consequently, they would emulate and import many facets of life from the mother country: Cricket, Rugby, Fish and Chips would all take their place in the transplanted colonies. Queen Victoria's Golden and Diamond jubilees were celebrated as vigorously in Australia as they were back in Britain.
One national cause that united most politicians throughout the six colonies was the issue of the Pacific Islands. They were nervous at the movements of the Germans, French and Americans island hopping across the Pacific. They were particularly concerned at German moves in the North of New Guinea in the 1880s and demanded that the British Government occupy the Southern portion as a buffer. At the Imperial conference, Australian politicians angered their hosts by their continued insistence on yet further annexations.
These imperial concerns meant that Australians were often the most vehement in supporting British imperial actions. Thus, in 1885, one of the people most in favour of the 1885 intervention in Sudan was a Victorian politician James Service. He had been one of those had criticized British sluggishness over New Guinea.
Of course, there was an element of self-preservation in the enthusiastic embrace of ties with Britain. After all, the Royal Navy was the ultimate defender of the island of Australia. There were local militias formed, but it would be the regular British Army that would be called on to deter German, French or American incursions. It must also be remembered that the 1890s and early 1900s was a period of rising international tension with power blocks dangerously emerging.
There was a strong current of racism involved. This was the hey day of Social Darwinism and eugenics. The Sydney Bulletin was proud to proclaim 'Australia for the white man'. There was unease at the use of Chinese and Melanesian labourers in the sugar plantations of Queensland. They were thought to be uncouth and slovenly. The desire to colonise the Pacific Islands was partly based on the idea that the Polynesians were lazy and inefficient and not making the most of the bountiful land that lived on. There was also the inconvenient presence of Aborigines in a land that had legally been declared 'Terra Nullis'. It was easier to justify this empty island theory if the aborigines were not considered as humans at all. Social Darwinism allowed them to be considered as some kind of missing link between humans and gorillas. It was indicative that the colonial parliaments showed less concern for the treatment of non-whites than Westminster had done in the past.
Britain was considered to be the source of white civilisation and therefore settlers from the mother country found it much easier to settle in to the nascent colonies. There was also unease at the geographical isolation of this outpost of European civilisation. Hundreds of millions of Asians lay between it and Europe. This was yet another source of anxiety.
The 1890 Slump
Australia's economic bubble fully burst in the 1890s. Australians had borrowed greatly from Britain to finance their expansion of farms and industries. America and Canada pumped out greater and greater quantities of foodstuffs and they would be joined by Argentina and South Africa. The technological advantages that had allowed the Australian economies to take advantage of the world economy was not allowing other economies to join in. Ships and trains were making the world every smaller and more producers were producing for the same quantity of consumers.
In 1890 the Baring Brothers bank in Britain would collapse. The loss of confidence that this created would turn the teetering world economy into depression. The Australian colonies would find themselves particularly hard hit due to the quantity of British loans that they held and the dependence they had on the British market. Highly developed Victoria would be particularly hard hit. The relatively undeveloped Western Australia would escape most of the excesses.
With the onset of depression came the sharpening of class tensions. Skilled labourers had always been in high demand meaning that they had been able to set high prices for their services. Trade Unionism had been well developed thanks partly to this shortage of labour. Therefore when employers responded to the downturn in the economy by reducing wages and laying people off the Trade Unions were going to respond. Strikes became commonplace. In the docks the situation grew so inflammatory that cargoes were set ablaze.
Trade Unions sponsored their own Labour Party candidates to try and promote their interests. They had some success in Queensland and in New South Wales. Indeed, Andrew Dawson in in Queensland probably led the world's first socialist ministry - even if it was just for a few days in 1899. The employers would sponsor their own candidates. The polarisation of Australian politics had begun.
There were a number of reasons why the 1890s would see Federation become more palatable to more Australian colonialists. A rudimentary 'federal council of Australia' (which included Fiji for a while) had already begun meeting in 1885 and they held a conference in 1890. Some politicians like Alfred Deakin and Edmund Barton realised that there might be votes in advocating just such a federation as the Australian Native Association found an ideology that might bind together political groupings more effectively.
Some conservatives were convinced that a stronger union would preserve their economic base more effectively. The worldwide slump convinced many smaller farmers and workers that their might be something in the colonies working together rather than competing amongst themselves. Britain was still a Free Trade Empire but voices were beginning to discuss alternatives.
The international tensions were also a deciding factor - it was hoped that a federation would be more able to fund its own defence more effectively. Initially the idea was to share the burden with the British - but later it would be used to allow their own prioritisation for defence. The Royal Navy might not always be able to put Australian defence at the top of their priorities.
1867 had seen the Canadians develop an effective federation within the Empire. Three decades was enough time to show Australians that federation could work and a model was available for them to copy.
For all of these reasons made the 1890s an appropriate time to advance the idea of federation. 1897 and 1898 saw a conference of state representatives draw up a constitution. This was put to a referendum which passed convincingly in all states by New South Wales. A rerun resulted in a more convincing majority the following year. The representatives travelled to Britain in 1900 to find that the mother country was more than happy to share the burdens of running a colony the size of Australia and promptly granted permission for federation.
The Early Commonwealth
The new Australian governments (Liberal and Labour) wasted no time appealing to the nationalist and racist tendencies of much of the electorate. Asian immigration was promptly prohibited. 'White Australia Policy' was promoted in its place. Melanesian and Asian workers were repatriated - sometimes against their will.
An expansionist Australian nationalism was demonstrated by assuming responsibility for the Papua New Guinea colony in 1905. They volunteered to help the British run the Pacific colonies. They even sponsored an expedition to the Antarctic as that continent's future had yet to have been decided.
In 1908 the Royal Australian Navy was established. This was partly in response to concerns at the growth of Japanese power as a result of their destruction of a Russian fleet in 1905. The Germans were also still too close for comfort in the north of New Guinea.
The Australians had not hesitated in supporting Britain in imperial and defensive matters. Australians enthusiastically joined the Boer War and the First World War. There was no question from either of the two main parties. It was still considered that Australian culture and defence was dependent upon Britain. Although the seemingly callous disregard for the lives of so many Australian soldiers did begin the first mutterings against this unquestioning loyalty to British defence policy. The Gallipoli and the Western Front campaigns also brought together Australians from all over their country for the first time for many of the participants.
flag of Australia
Flag of Australia
map of Australia
Maps of Australia
1901 -
1901 -
Historical australia
Images of Australia
Art and Culture
Portraying Australia
Colonies joining Federation
New South Wales
South Australia
Western Australia
40,000 BC Aborigines started to arrive
1606 Torres sails between Australia and New Guinea
1636 Anthony van Diemen arrives in Dutch East Indies to explore region
1642 Tasman discovers Tasmania
1644 Tasman maps Tasmanian North Coast
1699 Dampier lands in the West of Tasmania
1770 Captain Cook lands at Botany Bay. He calims New South Wales
1788 First convict fleet arrives - founds Sydney
1790 Second fleet arrives
1798 Bass and Flinders establish Tasmania as an island
1801 Flinders circumnavigates continent
1803 Tasmania settled under Collins
1804 Irish revolt suppressed
1808 Rum Rebellion
1813 Blue Mountains crossed
1825 Tasmania separates from New South Wales
1827 Hume and Hovel reach site of Melbourne
1828 Sturt's first journey, discovers River Darling
1829 Sturt's second journey. Western Australia founded
1834 Southern Australia founded
1838 Myall Creek massacre
1840 Transportation to New South Wales ends
1841 Eyre and Wylie cross Nullarbor plain
1842 Representative government in New South Wales
1848 Leichhardt vanishes whilst crossing continent
1849 Convicts are transported to Western Australia
1851 Gold Rush in New South Wales and Victoria
1853 Transportation to Tasmania stops
1854 Eureka stockade
1855 Parliamentary government for New South Wales, Tasmania, Victoria and South Australia
1859 Queensland founded
1860 Death of Burke, Wills and Gray. Riots against Chinese
1862 McDuall Stuart crosses continent
1867 Duke of Edinburgh visits
1872 Intercontinental cable link
1883 Death of Ned Kelly. Queensland occupies New Guinea
1891 Labour party emerges
1893 Gold discovered in Western Australia
1899 Australian troops serve in Boer War
1901 Federation
1907 Fair wage established
1915 Gallipoli
1916 Conscription row
1922 'Men, Money and Markets' policy
1939 Second World War
1941 Curtin replaces Menzies as PM
1942 Fall of Singapore. Darwin bombed. US troops arrive.
1943 Victory in New Guinea
1944 ANZAC pact
1949 Menzies PM
1951 Australian troops enter Korean War. ANZUS pact
1952 Atomic bombs tested
1954 Petrov affair
1956 Melbourne Olympics
1965 Aborinial freedom rides. Australian troops to Vietnam.
1966 Menzies resigns
1972 Labor Party returns to power
1975 Sir John Kerr sacks Gough Whitlam
1978 Northern Territories become self governing
1982 Racial trouble in Moree
1988 Bicentenary celebrations
A History of the World: Aboriginal Bark Shield (BBC)
The Gallipoli Campaign
Australia's Foreign Wars: Origins, Costs, Future?!
The Proposition
The Sundowners
Rabbit Proof Fence
The Lighthorsemen
The Man from Snowy River
Return to Snowy River
Suggested Reading
Fatal Shore
by Robert Hughes
The Road to Botany Bay
by Paul Carter
Online Videos
For Colonial Australian Items | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9727475047111512}", 'metadata': "{'Content-Length': '34954', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:ZBBVTOGLFLR4FXKSRTYYEKJAL25RCYWY', 'WARC-Concurrent-To': '<urn:uuid:b1c67470-b89a-4028-957b-aab3a7cc846b>', 'WARC-Date': datetime.datetime(2014, 10, 31, 9, 1, 33), 'WARC-IP-Address': '109.123.77.12', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:5JLSWKWAQR6QKT5QWZMDUPKESUS2VEDU', 'WARC-Record-ID': '<urn:uuid:111bdfd9-ddc1-4843-8f31-4c7cde5a0a75>', 'WARC-Target-URI': 'http://www.britishempire.co.uk/maproom/australia.htm', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:2a6e64d8-9d87-4d55-85be-a094e00437a1>', 'WARC-Truncated': None}", 'previous_word_count': '2276', 'url': 'http://www.britishempire.co.uk/maproom/australia.htm', 'warcinfo': 'robots: classic\r\nhostname: ip-10-16-133-185.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-42\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for October 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.12271231412887573', 'original_id': 'c87af8578f1c3cbce5d3c1431da96aa1bbf9208e739a51158a55c4489ceb78a3'} |
CONFIGURATION_BUILD_DIR = $PODS_CONFIGURATION_BUILD_DIR/ZYLocationManager
GCC_PREPROCESSOR_DEFINITIONS = $(inherited) COCOAPODS=1
HEADER_SEARCH_PATHS = "${PODS_ROOT}/Headers/Private" "${PODS_ROOT}/Headers/Private/ZYLocationManager" "${PODS_ROOT}/Headers/Public" "${PODS_ROOT}/Headers/Public/AFNetworking" "${PODS_ROOT}/Headers/Public/MJRefresh" "${PODS_ROOT}/Headers/Public/Masonry" "${PODS_ROOT}/Headers/Public/SDWebImage" "${PODS_ROOT}/Headers/Public/SVProgressHUD" "${PODS_ROOT}/Headers/Public/UITableView+FDTemplateLayoutCell" "${PODS_ROOT}/Headers/Public/ZYLocationManager"
OTHER_LDFLAGS = -framework "MapKit" -framework "UIKit"
PODS_BUILD_DIR = $BUILD_DIR
PODS_CONFIGURATION_BUILD_DIR = $PODS_BUILD_DIR/$(CONFIGURATION)$(EFFECTIVE_PLATFORM_NAME)
PODS_ROOT = ${SRCROOT}
PRODUCT_BUNDLE_IDENTIFIER = org.cocoapods.${PRODUCT_NAME:rfc1034identifier}
SKIP_INSTALL = YES
| mini_pile | {'original_id': '9a23517b7e154e9706c96afc07703250546e3d014aa4c02960ca1a975199928f'} |
\section{Linearity of Expectation Function/Discrete}
Tags: Linearity of Expectation Function
\begin{theorem}
Let $\struct {\Omega, \Sigma, \Pr}$ be a probability space.
Let $X$ and $Y$ be random variables on $\struct {\Omega, \Sigma, \Pr}$.
Let $\expect X$ denote the expectation of $X$.
Then:
:$\forall \alpha, \beta \in \R: \expect {\alpha X + \beta Y} = \alpha \, \expect X + \beta \, \expect Y$
\end{theorem}
\begin{proof}
Follows directly from Expectation of Function of Joint Probability Mass Distribution, thus:
{{begin-eqn}}
{{eqn | l = \expect {\alpha X + \beta Y}
| r = \sum_x \sum_y \paren {\alpha x + \beta y} \, \map \Pr {X = x, Y = y}
| c = Expectation of Function of Joint Probability Mass Distribution
}}
{{eqn | r = \alpha \sum_x x \sum_y \map \Pr {X = x, Y = y}
| c =
}}
{{eqn | o = +
| r = \beta \sum_y y \sum_x \map \Pr {X = x, Y = y}
| c =
}}
{{eqn | r = \alpha \sum_x x \, \map \Pr {X = x} + \beta \sum_y y \, \map \Pr {Y = y}
| c = {{Defof|Marginal Probability Mass Function}}
}}
{{eqn | r = \alpha \, \expect X + \beta \, \expect Y
| c = {{Defof|Expectation}}
}}
{{end-eqn}}
{{qed}}
Category:Linearity of Expectation Function
\end{proof}
| math_pile | {'subset': 'ProofWiki', 'meta': "{'type': 'Theorem_Proof'}", 'original_id': '912f1f63194fbd1e2792b610c800352a3785eff52fcc4358b9461feb4fda8de0'} |
Skip to main content Skip to footer site map
Serious Medicine. Extraordinary Care.
Sports Injuries and Children
Obviously, some sports are more dangerous than others. For example, contact sports such as football can be expected to result in a higher number of injuries than a noncontact sport such as swimming. However, all types of sports have a potential for injury, whether from the trauma of contact with other players or from overuse or misuse of a body part. Listed below are some sports injuries that are common in the growing child, for which we have provided a brief overview.
Overuse Conditions
Sprains and Strains
Tennis Elbow
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '56', 'language_id_whole_page_fasttext': "{'en': 0.9337902069091796}", 'metadata': "{'Content-Length': '66660', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:SNOX2NUCBUVF6KNCOMWED2P52W4UAKCH', 'WARC-Concurrent-To': '<urn:uuid:7d81c48f-5b67-482e-bbaf-9f7aec5bb35c>', 'WARC-Date': datetime.datetime(2014, 10, 31, 8, 31, 18), 'WARC-IP-Address': '192.198.54.12', 'WARC-Identified-Payload-Type': None, 'WARC-Payload-Digest': 'sha1:7PV3VGFJXTYDXJVWZWVLWIFE66DXQBFH', 'WARC-Record-ID': '<urn:uuid:78570c52-9855-40bd-b4ac-6e9ed0704d45>', 'WARC-Target-URI': 'http://www.nebraskamed.com/health-library/adult/pediatrics/35704/sports-injuries-and-children', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:f98be011-12c8-4c9b-b208-234bcbe71853>', 'WARC-Truncated': None}", 'previous_word_count': '116', 'url': 'http://www.nebraskamed.com/health-library/adult/pediatrics/35704/sports-injuries-and-children', 'warcinfo': 'robots: classic\r\nhostname: ip-10-16-133-185.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2014-42\r\noperator: CommonCrawl Admin\r\ndescription: Wide crawl of the web with URLs provided by Blekko for October 2014\r\npublisher: CommonCrawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03879237174987793', 'original_id': '724631e131820294902564d135384911bf0814bccc3c2cfa43371a834b2cae93'} |
What your employees really think about AI
Expert | Featured | Leadership | Workplace
By Loren Webb
Recently, Dynamic Business attended the 2-day Gartner ReImagine HR event to hear the new trends, reports and insights from HR industry leaders and share them with our readers.
HR leaders from all over Australia came together to uncover and discuss the latest HR and leadership trends, best practice, challenges and opportunities.
One of those discussions was from Jonathan Tabah, Director at Gartner, about what employees really think about AI, and we’ve got all the best bits wrapped up for you below.
Artificial Intelligence (AI) can evoke fear in a lot of people, and this fear is definitely not helped by media headlines suggesting every single Australian will be losing their jobs to a robot within the next year…
The reality is, whether you or your employees are aware of it or not, we are already using lots of examples of AI in our everyday lives.
Do you use Google Maps to figure out how to get somewhere? Ever said “Hey Siri?” to your iPhone? Used a snapchat filter to make yourself look like a dog?
All of those things are AI. So we can see that not only is AI already immersed and actually a tangible entity (not just some idea of robots, automation and the cloud), but that it is also highly beneficial to the end user.
Jonathan Tablah spoke about how this beneficial factor is the key to getting workers on board in implementing AI and a lot of successful integrations of new systems come down to the simple communication strategy about that integration.
The recent Gartner research reveals that most CIOs are in fact planning to invest in AI soon, with only 9% not having any interest at all. Most visualise deployment from anytime now to within the next 3 years.
So what actually do the employees think about AI?
Well Jonathan summarised the answer pretty easily, by saying overall that they feel ‘OK’ about it, which is supported by the 2019 Gartner survey results.
When interviewed, most employees said they agreed with the positive benefits of AI, namely that it would:
• Create new roles for them to work in
• Allow them to do new high-value activities
• Allow them to do work they’ve never done before
• Make work easier and enjoyable
• Taker over a repetitive part of their job
Only 25% of employees believe AI will replace them at their organisation in the next 5 years, with the large majority having a more positive outlook.
In the hypothetical case that new technology emerged which could save the organisation money and potentially replace their job, survey participants were asked what they thought their organisation would do.
Nearly 6 out of 10 employees (57%) believed that their organisation would actually retrain or redeploy them, as opposed to a 22% group that thought they’d just be fired. The remaining 21% simply thought that, in that hypothetical situation, their company wouldn’t even invest in the tech in the first place.
Going back to how we then communicate deploying new tech, and how we speak about the benefits… it’s not quite as simple as that.
Jonathan’s advice is to stop selling employees on the good things about AI and to start helping employees with understanding AI and exactly how it will affect their jobs. In other words, make those benefits personal to them. Make a point of saying AI will benefit, not replace them.
We are social beings and as such leaders should be enabling discussion; natural conversation that is two way between leaders and their teams, without a pre-determined narrative or script provided by HR.
Jonathan recommended change reaction workshops as part of this process and emphasised the importance of acknowledging employee’s natural emotional response.
Rather than simply thinking “who has already authority over this?”, ask questions such as “who would be surprised by this?” and “who is likely to reject this?” instead. To establish the right communication system when introducing your employees to new tech and AI, you can start with Gartner’s recommended sample AI discussion questions below.
• What scares or worries you the most about AI and why?
• In what ways do you think about AI at work and AI in your personal life differently?
• If a new technology were to become available that could replace parts of your job, how would you hope your organization would respond?
• In what ways can you see AI having a positive impact on your work?
• How might you change your day-to-day habits to fully take advantage of AI’s positive attributes?
Related Articles | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.963010311126709}", 'metadata': "{'Content-Length': '167602', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:MNC63MOGSBYJYYY6R65WKXEUNS3JTV2O', 'WARC-Concurrent-To': '<urn:uuid:546a0d14-c87a-47fd-8eed-59f865b1f5e2>', 'WARC-Date': datetime.datetime(2019, 11, 16, 20, 57, 5), 'WARC-IP-Address': '13.237.123.142', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:DVUREGJUUVPMFQW3T23JAAK5YDX74IQX', 'WARC-Record-ID': '<urn:uuid:6c19826d-aabf-466f-a6e6-8c1809aacd97>', 'WARC-Target-URI': 'https://dynamicbusiness.com.au/leadership-2/what-your-employees-really-think-about-ai.html?utm_source=rss&utm_medium=rss&utm_campaign=what-your-employees-really-think-about-ai', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:5d09bd1c-9708-46e0-9594-d8f47458c70b>', 'WARC-Truncated': None}", 'previous_word_count': '754', 'url': 'https://dynamicbusiness.com.au/leadership-2/what-your-employees-really-think-about-ai.html?utm_source=rss&utm_medium=rss&utm_campaign=what-your-employees-really-think-about-ai', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-188.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.33838385343551636', 'original_id': 'f97cfd0ace2e07b3bc5298cd4202615e6fb53d5c280d0daea72b74c0c90fbd06'} |
Resetting the SyncServices folder
Dealing with SyncServices issues is one of the most frustrating, and frequent, parts of my job.
Apple's released a new article on resetting Sync Services. Memorize it.
How to Reformat a New External Hard Disk
TidBITS has a good short article on how to reformat an external drive.
As expected, the instructions that come with hard drives are geared towards PC users. I can never figure out whether manufacturers really don't know that things are that complicated for the Mac, or they just can't bring themselves to admit we don't need their help, but Mac instructions on these things are usually multi-step and include installing un-needed software.
All you need to do is wipe the drive. Instructions below:
How to Reformat a New External Hard Disk | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.953278124332428}", 'metadata': "{'Content-Length': '47786', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:DOQVF3RFPAJT3SMPA3CKTXDRKWP7OFIW', 'WARC-Concurrent-To': '<urn:uuid:5e357a44-e3f9-44cd-a788-2ea67d3556d5>', 'WARC-Date': datetime.datetime(2017, 5, 23, 8, 44, 27), 'WARC-IP-Address': '172.217.7.179', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:WAY5DFSUEGH4RIQOORLYEGHWWUUIJH7R', 'WARC-Record-ID': '<urn:uuid:34428f96-1aeb-4a1f-88f7-1c4c8d37b539>', 'WARC-Target-URI': 'http://www.macgirldc.com/2009_09_01_archive.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:99a29800-e8da-4893-9720-33c05faedee2>', 'WARC-Truncated': None}", 'previous_word_count': '132', 'url': 'http://www.macgirldc.com/2009_09_01_archive.html', 'warcinfo': 'robots: classic\r\nhostname: ip-10-185-224-210.ec2.internal\r\nsoftware: Nutch 1.6 (CC)/CC WarcExport 1.0\r\nisPartOf: CC-MAIN-2017-22\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for May 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.08718651533126831', 'original_id': 'dcb5b7b84746ba1f7de5d5db3322d8b050f131e9790b430b3c56708d0d4f0a63'} |
Tags Finance
Piggy bank vector with spending icons
5 tried-and-true money saving tips for students
Rate this article and enter to winGet used to hearing this one—higher education is expensive. You’re either feeling the effects now (oh hey, side hustle to your side hustle and attending lots of irrelevant...
Two women placing money in a piggy bank
Fight the urge to splurge: 7 ways to avoid monster spending
Rate this article and enter to winIn December, many events and celebrations take place, and this can make spending seem attractive, even necessary. Plus, for some, shopping is a way to escape the grind... | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9030694365501404}", 'metadata': "{'Content-Length': '142456', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:3LZRZ44QSIKTPIHDD3XL6P63ONQY7UVB', 'WARC-Concurrent-To': '<urn:uuid:5e298656-ebd5-4499-b318-a92981dba479>', 'WARC-Date': datetime.datetime(2017, 10, 23, 7, 50, 42), 'WARC-IP-Address': '104.27.160.104', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:76ZBTOVMXX52JBPHSGTMPQQ7CVLIPVNI', 'WARC-Record-ID': '<urn:uuid:bbe21558-95a1-4a79-9f93-0eef15d8ad29>', 'WARC-Target-URI': 'http://csi.readsh101.com/tag/finance/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3dcc0747-a6cf-4251-9d23-72f46db3757d>', 'WARC-Truncated': 'length'}", 'previous_word_count': '102', 'url': 'http://csi.readsh101.com/tag/finance/', 'warcinfo': 'robots: classic\r\nhostname: ip-10-230-39-145.ec2.internal\r\nsoftware: Nutch 1.6 (CC)\r\nisPartOf: CC-MAIN-2017-43\r\noperator: Common Crawl Admin\r\ndescription: Wide crawl of the web for October 2017\r\npublisher: Common Crawl\r\nformat: WARC File Format 1.0\r\nconformsTo: http://bibnum.bnf.fr/WARC/WARC_ISO_28500_version1_latestdraft.pdf', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.13796865940093994', 'original_id': 'ddafc7616e8429f7da0acd3348ccff7b9ee5e6ce1254bd4186d8f468a58855ac'} |
August 10, 2017
Please reload
Recent Posts
This Ancient Wonder Oil!
July 1, 2017
Please reload
Featured Posts
Help Out Your Hardworking Adrenals
Our stress-fighting adrenal glands, which sit atop the kidneys, are actually two different glands in one. The center of the gland (adrenal medulla) manufactures adrenaline (epinephrine). The outer part of the gland (adrenal cortex) makes several hormones called corticosteroids. They include:
• Cortisol. Pumped out in response to stress, cortisol regulates blood sugar and blood pressure, two key parts of our stress response, and also helps control immune function.
• DHEA-S (dehydroepiandrosterone sulfate … a great word for Scrabble players). The most abundant hormone produced by the adrenal gland, its function isn't clearly understood. But one fact is well-known: DHEA-S declines with age, and many people feel better when levels are brought up to the normal range for a 29-year-old.
• Aldosterone. This regulates the balance of salt and water levels.
• Testosterone. The adrenal glands produce 1/2 of a woman's testosterone, maintaining libido and decreasing the volume in our pain system.
Adrenal Fatigue
Chronic stress can exhaust your adrenals, leading to reduced levels of adrenal hormones. They can also impact many of your body's systems, including:
• Energy levels. You're tired first thing in the morning — and maybe all day, every day.
• Immune function. You seem to have recurrent infections that take a long time to clear up.
• Response to stress. You feel overwhelmed and unable to deal with stress, and "crash" under too much stress.
• Blood sugar levels. You have dropping blood sugars and intense irritability when hungry (i.e., "Feed me now — or I'll kill you!" is a thought you might be having).
• Blood pressure. You may have a drop in blood pressure and dizziness when you stand up.
Another sign of diminished adrenal function is that one or more of the above symptoms started suddenly after a viral infection.
Unfortunately, adrenal exhaustion doesn't show up on standard blood tests until you're practically dead. But if you have one or more of the above concerns, here's what you can do about it.
There are several easy and natural ways to help promote healthy adrenal function. They include:
1. Adrenal glandulars. This type of supplement supplies the raw materials your adrenal glands need for optimal functioning. My patients typically take 200-450 mg daily.
2. Vitamin C. The body's highest levels of vitamin C are found in the adrenal glands (and the brain), and this nutrient is a must for healthy adrenal function. Get at least 100 mg a day (an optimal intake is 500-750 mg daily).
3. Pantothenic acid, or vitamin B5. This nutrient also supports adrenal function. The optimum amount to take is 100-150 mg daily.
4. Licorice. This herb slows down the breakdown of adrenal hormones in your body, helping to maintain healthy levels. An excellent way to get licorice is to take 200-400 mg a day of licorice extract standardized to contain 5% glycyrrhizic acid, the active ingredient. (Caution: Don't take licorice if you have high blood pressure.)
All 4 of the nutrients above, along with other adrenal supporters like tyrosine, can be found in Adrenal Stress End. I recommend 1-2 each morning. You can add an extra one at lunch if needed. To make an outstanding combination, also take the Energy Revitalization System vitamin powder, which also adds chromium and about 50 other key nutrients.
1. Chromium. This mineral helps keep blood sugar levels within a healthy normal range, a challenge when adrenal hormones are low. I recommend you take 200 micrograms (mcg) daily.
2. Cut out sugar. Sugary sweets first skyrocket and then crash your blood sugar levels, contributing to you feeling awful while exhausting your glucose-controlling adrenal glands.
Special tip:When blood sugar levels are low (where you feel irritable and need to eat NOW) try eating just a little bit of sugar to help bring your blood sugar levels back up to normal. Have one-half packet (half a teaspoon) of table sugar, or the amount in one Life Saver or other hard candy. Place the sugar under your tongue for fast absorption. This little bit is enough to break the irritability caused by a drop in blood sugar levels without a ride on the roller coaster of glucose spikes and dips.
1. Cut caffeine. Like sugar, caffeine forces the adrenal glands into action and amplifies the irritability from fluctuating blood sugars. Limit yourself to one or two cups of coffee or tea a day, and then switch to decaf.
2. Have frequent, small meals. To stabilize blood sugar levels and rest your adrenals, eat five (or even six) smaller, high-protein, low-carbohydrate meals — a style of eating known as grazing. Good sources of protein include meat, poultry, fish, eggs, cheese, beans and nuts.
3. Drink more water and eat more salt. Your adrenal glands are responsible for regulating blood volume and blood pressure, tasks that require plenty of water and salt. But if your adrenals aren't functioning up to par, your body doesn't adequately retain either water or salt, and you may need more. How much is enough? If you're thirsty, drink. If you crave salt, add a dash of it to your foods. Generally, salt restriction is a really bad idea for those with exhausted adrenals. Listen to your body to see what feels best to you!
4. Control stress by asking yourself this one question! Ask yourself "Am I in imminent danger?" The answer will almost always be no. So you can relax.
Other easy ways to decrease stress include:
• Gratitude. Switch your mental channel to the positive by remembering what you're grateful for, such as a sunny day or someone you love.
• Skip the daily news. Do you unusually feel good while watching the news? Inspired, uplifted, energized, or refreshed? I doubt it. In fact, most of us feel anywhere from irritated to powerless and overwhelmed. Sure, watch the news every now and then to stay informed. Or entertained. But there's no need for a daily dose of war, crime, disasters, and economic downturn. Basically, turn it off (or switch to a comedy channel) when it starts feeling bad.
Think twice. If you have a thought that leaves you feeling badly, choose to focus instead on a thought that feels good, like a thought of a cute baby or pet. Our thoughts are a lot like a massive buffet table. Choose which thoughts you "put on your plate" by what you decide to pay attention to!
Share on Facebook
Share on Twitter
Please reload
Follow Us | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '7', 'language_id_whole_page_fasttext': "{'en': 0.8962770104408264}", 'metadata': "{'Content-Length': '1051728', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:PB4LBQ5UXLFXDTZ46NIJDSKCRB3PS3MQ', 'WARC-Concurrent-To': '<urn:uuid:0a01fb03-46c0-4723-bba3-8ad88f1a7d22>', 'WARC-Date': datetime.datetime(2020, 2, 20, 13, 58, 43), 'WARC-IP-Address': '185.230.60.211', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:QB4UA4YVSSBU5LHCL3GCLD3YANOKVRLF', 'WARC-Record-ID': '<urn:uuid:3df8b360-ad2c-4894-9b80-7e48d1a57c96>', 'WARC-Target-URI': 'https://www.naturalwaystl.com/single-post/2017/06/29/Help-Out-Your-Hardworking-Adrenals', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:0ba4ad1d-6501-462c-a7fa-591b473aaf5f>', 'WARC-Truncated': 'length'}", 'previous_word_count': '1039', 'url': 'https://www.naturalwaystl.com/single-post/2017/06/29/Help-Out-Your-Hardworking-Adrenals', 'warcinfo': 'isPartOf: CC-MAIN-2020-10\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for February 2020\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-77.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.10685622692108154', 'original_id': 'bbfdff2929fdd7d567f326ebb827e9eaae21267fb02cc2607f60a38919e6e017'} |
INTERVIEW: M. Rickert, Author of “Evidence of Love in a Case of Abandonment”
Tell us a bit about your story. What’s it about?
The actual inspiration came from the quote by Randall Terry. I wanted to write a story where the world imagined by Terry had come to pass. Though it’s been broadly read as science fiction, I consider it a fantasy, an imagined reality formed by the genesis of a particular desire rather than by the logical manifestations of an idea, which, in my mind, could not be contained by logical structure as the desire itself is based in a distressed foundation, which, upon extrapolation, reveals its internal flaws. It was also meant to take a sort of sideways look at what has already happened to women in countries where their freedom is denied. At the same time as I came across this quote, there was a good deal of discussion about the feminist voice in genre and its ability to find publication. I set about to write a feminist story in response to that concern.
What is the appeal of dystopian fiction? Why do so many writers–or you yourself–write about it? Why do readers love it so much?
I do not feel qualified to speak to the broad appeal of dystopian fiction, as I have never been good at measuring the common quality, but I can speak to its personal appeal for me as a literature of the ultimate fear of what the worst aspect of being human can wrought if not balanced by the best aspect. The big struggle with good and evil, as it turns out, is not with a force outside ourselves, but a force within, which I think makes for frightening material, worthy of consideration within fiction, too often forgotten as a force in itself.
What are some of your favorite examples of dystopian fiction, and what makes them your favorites?
One of my favorite works of dystopian fiction is Carolyn See’s Golden Days. See’s story, more fantasy than science fiction, works for me because of its emotional resonance. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.978276550769806}", 'metadata': "{'Content-Length': '24281', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YA4ZWJJ6CEFYQ6FENVZZCX5W4A466O2J', 'WARC-Concurrent-To': '<urn:uuid:e4359d99-aafb-410c-aa3d-9f922728a690>', 'WARC-Date': datetime.datetime(2019, 11, 14, 7, 42, 28), 'WARC-IP-Address': '66.33.202.38', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:ONZNEDPXGFNGOJQIPOM7QHMNLQ7UFVNO', 'WARC-Record-ID': '<urn:uuid:3c37bbd8-d8e6-430a-bb81-3cc9f9960c61>', 'WARC-Target-URI': 'http://www.johnjosephadams.com/brave-new-worlds/2010/12/01/interview-m-rickert-author-of-evidence-of-love-in-a-case-of-abandonment/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:cce9fd48-7277-4431-bce1-cce5e989eccd>', 'WARC-Truncated': None}", 'previous_word_count': '343', 'url': 'http://www.johnjosephadams.com/brave-new-worlds/2010/12/01/interview-m-rickert-author-of-evidence-of-love-in-a-case-of-abandonment/', 'warcinfo': 'isPartOf: CC-MAIN-2019-47\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for November 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-168.ec2.internal\r\nsoftware: Apache Nutch 1.16 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.4379085302352905', 'original_id': '7bc3a89383b4ab2405795c22cfd0019c7742ac7c00263ff66b754d4a3cfbca3c'} |
Tuesday, April 1, 2014
Thinking about using an Online Service to prepare your Estate Planning?
Considering the accessibility and inundation of online services recently, many people have turned to the internet to prepare their estate planning documents. The cost and ease of using the service however does not mean a better value or a better plan. Usually, using this type of service will give you a false sense of security because your loved ones will only realize the failure of your planning after you have passed away.
Do your documents comply with local law?
Each State has it’s own set of laws regarding the process of executing legal documents and what is actually required within the document to make it valid. Generally the online service creating your estate planning documents does not take each individual jurisdiction’s requirements into consideration and a failure to properly execute the documents will result in their invalidity for administration purposes. This could mean that the money spent to procure these documents is wasted and instead the State laws where you live will determine who inherits under the intestacy (passing away without a Will) laws.
Does your planning minimize your taxes and expenses?
In addition to execution considerations, each State has specific laws regarding taxes including inheritance taxes and estate taxes and a failure to take these specific laws into consideration could cost your loved ones more in taxes than what you saved by preparing your own plan. Again, this type of misstep would only be discovered after you have passed away when it would be to late to change the documents and provide any kind of tax relief.
Do your documents accurately reflect your specific family circumstances?
Finally, the online process is "cookie cutter" and does not take into consideration your specific goals and needs with regard to your family. Meeting with an estate planning attorney will help to create a set of documents that are specific and tailored exactly to your needs and family situation. For example, do you have a child who is in the process of a divorce or bankruptcy or who is currently receiving state and/or federal benefits? Leaving money to that child without any further planning could result in that child’s inheritance ending up in the hands of an ex-spouse or creditor or could disqualify him from the state and/or federal benefits he is receiving. Without a consultation with an estate planning attorney, there is a much greater chance that your wishes for the inheritance left to your loved ones will not be carried out. There is no way an online service could contemplate your individual concerns and provide you with the necessary vehicles to protect your assets after you pass away.
Are there steps necessary beyond creating your documents?
Another issue to consider is what happens with your documents after you have signed them. Often, the creation of a revocable trust is just the beginning of the estate planning process, a trust must be "funded" by re-titling assets in the name of the trust in order to provide any benefit. An online service cannot properly advise you as to funding matters since it is necessary to know exactly where your assets are and how they are titled to complete this process.
There is a varying level of uncertainty that your planning will save time and money for your loved ones after you pass away when you use an online service. An estate planning attorney can assist with documents that are customized to your family’s specific situation while saving taxes and the expense and time associated with the probate process.
© 2019 Snyder & Snyder P.A. | Disclaimer
7931 S.W. 45th St., Davie, FL 33328
| Phone: 954-475-1139
777 Brickell Avenue, Ste. 500, Miami, FL 33131
| Phone: (305) 563-9436
1946 Tyler Street, Hollywood, FL 33020
| Phone: (754) 260-5394
Attorney Website Design by
Zola Creative
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '114', 'language_id_whole_page_fasttext': "{'en': 0.937504231929779}", 'metadata': "{'Content-Length': '67010', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:I4S6AZEG5ZXNBPFDMNJOYMP7FI7SPGD3', 'WARC-Concurrent-To': '<urn:uuid:c470deb6-1846-4b35-8a18-7c25c5015d48>', 'WARC-Date': datetime.datetime(2019, 4, 24, 6, 26, 43), 'WARC-IP-Address': '52.6.30.22', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:LR4X3VRY7EEVARVJCH7YPCJ3ZGL73NVO', 'WARC-Record-ID': '<urn:uuid:4b2e19bb-eabb-446d-b03a-8704c5ac4aba>', 'WARC-Target-URI': 'https://www.snyderlawpa.com/lawyer/2014/04/01/Estate-Planning/Thinking-about-using-an-Online-Service-to-prepare-your-Estate-Planning_bl12469.htm', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6d836fd4-64ee-4b05-8a8c-3a5be508ed05>', 'WARC-Truncated': None}", 'previous_word_count': '747', 'url': 'https://www.snyderlawpa.com/lawyer/2014/04/01/Estate-Planning/Thinking-about-using-an-Online-Service-to-prepare-your-Estate-Planning_bl12469.htm', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-143-100-67.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.038547396659851074', 'original_id': '26dc57c4f1d37ebcaa9a28a6032014446477b3917829afe46bf9ed4d87de4351'} |
Log in
No account? Create an account
Subsidies aren't sticky - Søren Ragsdale [entries|archive|friends|userinfo]
Søren Ragsdale
[ website | Søren Ragsdale ]
[ userinfo | livejournal userinfo ]
[ archive | journal archive ]
Subsidies aren't sticky [Mar. 2nd, 2011|11:07 am]
Søren Ragsdale
Most subsidy programs are expected to be temporary. The government gives a nascent industry a chance to blossom, which they see as an investment. Once the industry is established, there are jobs for locals and taxable revenues for the state. But the film industry is not normal industry. Traditionally, film production companies start up to produce a film, after which the film is released and crew goes its separate ways to either join an existing production or start up a new company to produce a new film. Individual productions are also highly mobile. If crews will move thousands of miles for light or scenery they'll definitely keep moving to follow the money.
I started thinking about this after reading that World War Z is pulling out of Philadelpha after the city's film tax credits were suspended. In most other industries who see their subsidies cut they'd grumble about it, then look at their equipment and warehouses and sunk costs and home mortgages and suck it up. But film production is fundamentally ephemeral. You do it till it's done. If you're lucky you can re-use some of what you've built for your new project, but every project is different.
There are other reasons to subsidize film production. Bringing attention to your area, for example, seems perfectly reasonable. New Zealand has attracted lots of tourism with its "perfect slice of Middle Earth". But spending tax money to "establish" a mobile project-to-project industry seems like a fool's errand.
From: tajestub
2011-04-10 01:44 pm (UTC)
I don’t bookmark sites but i will bookmark this! LOL!
(Reply) (Thread)
From: tajestub
2011-04-12 09:36 am (UTC)
(Reply) (Thread)
From: hepablip
2011-04-15 06:12 am (UTC)
Couldnt agree more with that, very attractive article
(Reply) (Thread) | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '4', 'language_id_whole_page_fasttext': "{'en': 0.945610284805298}", 'metadata': "{'Content-Length': '175258', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:VQUL4OCC2LWTFSWPHHAV462YHIJVIVDD', 'WARC-Concurrent-To': '<urn:uuid:444fbea2-2b6f-48cd-8d39-7e20dcf13489>', 'WARC-Date': datetime.datetime(2019, 6, 18, 4, 53, 24), 'WARC-IP-Address': '13.88.179.33', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:MIIRF7G2BH6CLON2W5UTMY624GAPW7MP', 'WARC-Record-ID': '<urn:uuid:4d2199ff-7d88-4997-8305-dca589830f9a>', 'WARC-Target-URI': 'https://sorenragsdale.livejournal.com/25029.html', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:eb9525ed-5bb8-499d-a2e4-3d5e437c665a>', 'WARC-Truncated': None}", 'previous_word_count': '323', 'url': 'https://sorenragsdale.livejournal.com/25029.html', 'warcinfo': 'isPartOf: CC-MAIN-2019-26\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for June 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-149-156-229.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.037724077701568604', 'original_id': '1295db1401003856e0eccd0f6f4dbabe34621eb6335a1292cbe95efeb38a03c0'} |
Dispersion forces between ultracold atoms and a carbon nanotube.
Dispersion forces are long-range interactions between polarizable objects that arise from fluctuations in the electromagnetic field between them. Dispersion forces have been observed between microscopic objects such as atoms and molecules (the van der Waals interaction), between macroscopic objects (the Casimir interaction) and between an atom and a macroscopic object (the Casimir-Polder interaction). Dispersion forces are known to increase the attractive forces between the components in nanomechanical devices, to influence adsorption rates onto nanostructures, and to influence the interactions between biomolecules in biological systems. In recent years, there has been growing interest in studying dispersion forces in nanoscale systems and in exploring the interactions between carbon nanotubes and cold atoms. However, there are considerable difficulties in developing dispersion force theories for general, finite geometries such as nanostructures. Thus, there is a need for new experimental methods that are able to go beyond measurements of planar surfaces and nanoscale gratings and make measurements on isolated nanostructures. Here, we measure the dispersion force between a rubidium atom and a multiwalled carbon nanotube by inserting the nanotube into a cloud of ultracold rubidium atoms and monitoring the loss of atoms from the cloud as a function of time. We perform these experiments with both thermal clouds of ultracold atoms and with Bose-Einstein condensates. The results obtained with this approach will aid the development of theories describing quantum fields near nanostructures, and hybrid cold-atom/solid-state devices may also prove useful for applications in quantum sensing and quantum information. | mini_pile | {'original_id': 'c121c3494b5dc61a105e6676df9fd1b0601c0e6ad110d6681a3b00684ebcda5c'} |
KD diving camp - Haapasaari, Finland
Every year, at the start of July, Kotka Divers organices diving camp in the island Sauluoto at Haapasaaristo. This is outer archipelago of Kotka and pelongs Eastern Gulf of Finland National Park. Divers, their families, rookies and pros meets in open fire and tent sauna of Sauluoto. Divesites what you can see in these pictures include: Järvenkari wreck, Luppi, Kaide, Kilpisaari and Ristisaari. In the underwater images you can find Lari, Kimmo and Tero. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.7584683299064636}", 'metadata': "{'Content-Length': '34956', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:MCM4XWF735QQUOKU4W4UA37Q4RZKZKKF', 'WARC-Concurrent-To': '<urn:uuid:3891acac-03a2-445c-ab8a-a1d334186ee5>', 'WARC-Date': datetime.datetime(2019, 4, 20, 15, 9, 20), 'WARC-IP-Address': '188.117.28.147', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:B6APNVDNLPITKZ5PP3W3WBNJ24STPB6E', 'WARC-Record-ID': '<urn:uuid:c531ab55-e624-48b2-ae79-178169024832>', 'WARC-Target-URI': 'http://uwg.fi/galleries/Baltic/Haapasaari/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:3c49c003-6578-49b3-8bdc-b2a2b6b7f47b>', 'WARC-Truncated': None}", 'previous_word_count': '80', 'url': 'http://uwg.fi/galleries/Baltic/Haapasaari/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-165-178-231.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.034923255443573', 'original_id': 'bcb6e84de50824db6529ce1f1cf46563f24147c49ff334c9dd90fad203d82112'} |
5 Easter Eggs in ‘Chilling Adventures of Sabrina’
Warning: Contains spoilers for the first season of Chilling Adventures of Sabrina.
Chilling Adventures of Sabrina is just what it claims to be. It’s a throwback to the supernatural television shows marketed to teens that were proliferate in the late 90’s/early 2000’s, like Buffy the Vampire Slayer and Charmed, which could revel in the kitschy and absurd, but also tackle dark subject matter and serious issues. It’s already stirred up controversy for multiple reasons, and not for the reasons you’d probably expect. However, those heavier themes are to be tackled here at a later time. For now, let’s set those topics aside, and get into the things every true nerd hungers for — EASTER EGGS!
1- The Names
There are many names with significance in Sabrina. Besides more obvious ones like “Spellman” and “Salem,” here are some names with more remarkable meanings:
• “Puttnam” and “Hawthorne” were the names of families involved in the Salem Witch Trials.
• Ironically, the name “Wardwell” is probably a reference to warding spells, which are used to repel evil spirits.
• “Faustus” is taken from the play Faust by Johann Wolfgang von Goethe, wherein the main character sells his soul to the Devil.
• “Scratch,” as in “Old Scratch” or “Mr. Scratch,” is a nickname for the Devil.
• The mentioned-but-never-seen “Doc Phibes” gets his name from the titular character of the 1971 horror flick The Abominable Dr. Phibes.
2- “Criminal”
Of course you noticed the inclusion of Fiona Apple’s 90’s hit “Criminal” in Chapter 7: Feast of Feasts. However, if you’ve never seen the music video for the song, you might not get the connection. The video portrays the then-18-year-old Apple in her underwear, and lounging around with other teens on the floor, in what looks to be the aftermath of a party. The images are highly suggestive of some risque stuff going on, a lot like what’s taking place in Prudence’s room at the time.
3- The Weird Sisters
The term “Weird Sisters” has its origins in the Norns of Norse mythology. They were three prophetic witches who were the daughters of a seer named “Wyrd.” The term was later anglicized to “Weird” and used in Shakespeare’s MacBeth. It just goes to show, trios have always been powerful in witchcraft. The number can represent past, present, and future; the maiden, the mother, and the crone; the Rule of 3; father, mother, and child; the Furies; the Fates; and too many other examples of the power of the number three to recite here.
4- Other horror references
Besides names of characters, Sabrina contains some homages to the horror genre. Some include:
• On a couple of occasions, characters refer to the blessings of Satan as “delicious.” This most likely is pulled from a famous line in the 2015 horror film The Witch, in which (SPOILERS – highlight to read) the Devil asks the protagonist, “Wouldst thou like to live deliciously?” The scene in Chapter 10 where the Devil coaxes Sabrina to sign the Book of the Beast, he whispers in a way reminiscent of the Devil in The Witch.
• Chapter Five is titled “Dreams in a Witch House,” a slight variant on the title of the H. P. Lovecraft story Dreams in the Witch House.
• Chapter Six shows Harvey wearing the same outfit as Johnny Depp’s character during his death scene in Nightmare on Elm Street.
• The Spellman house has the same stained glass skylight as the ballet school in 1977’s witchsploitation film Suspiria.
5- The exorcism
The incantation for the exorcism in Chapter Six contains references to many significant figures in Witch/Wiccan culture. Apart from the mythological characters, there are several historical figures, including:
• Anne Boleyn, the wife of Henry VIII, who was accused of bewitching Henry to make him marry her. Her being a witch was also said to be the reason for her later miscarriage.
• Hildegard of Bingen was a German Benedictine abbess, but became respected by modern Pagans as a healer and mystic.
• Mary Bradbury and Tituba, both women who were accused during the Salem Witch Trials, but manage to avoid execution.
• Moll Dyer, a witch said to have lived in Maryland in the 1600s. Her spirit is still said to haunt the area where she was killed.
• Sybil Leek, one of the most prolific writers on the subject of modern Witchcraft.
That’s it for now, but I will certainly, in the future, dive deeper into the themes of Sabrina and possibly put a couple theories out there. So stay tuned!
The Simpsons: Lisa is the Villain in ‘Bart Sells His Soul’
The Golden Age of The Simpsons still holds up to this day, despite various modern controversies and some outdated stereotypes. The concepts and lessons contained within remain both compelling and hilarious. Lisa is one of my absolute favorite characters within the prodigious cast of the show. However, there is one episode I re-watched recently that made me re-think my opinions of the character.
In the Season 7 episode ‘Bart Sells His Soul,’ Bart and Milhouse get into a theological discussion (rather advanced for a pair of 10-year-olds) about the nature of the soul. Milhouse whole-heartedly believes in the concept of the soul as presented by organized religion, while Bart maintains that the soul is fake, made up by religion to manipulate the masses and make a profit off of tax-free donations. And he’s entitled to that opinion.
You know who’s not okay with that? Lisa.
While Lisa is generally portrayed as a liberal free-thinker, supporting the rights of the oppressed, her actions in this episode greatly contrast those character traits. Once she finds out that Bart sold his soul to Milhouse (it was actually just words written on a piece of paper), she is clearly disturbed by the fact that Bart doesn’t take the concept of the soul seriously. She presses her own agenda upon him repeatedly, and mocks him in front of their family for his beliefs.
Because she disagrees with Bart’s opinion, she ostracizes him, and uses a series of arbitrary coincidences to convince Bart that he has lost his soul. She even buys his soul when she finds it in the Android’s Dungeon comic book store, and then proceeds to withhold it from him. It is only after he goes through Hell, is missing all night, and comes home in a clearly broken state, that she concedes and returns his soul to him.
She takes advantage of his emotionally vulnerable state, and convinces him that all the trouble he endured was actually good, and was necessary for him to deserve his soul. She is basically using psychological torture to imprint Bart with her own beliefs, as many cults do in real life.This is very disturbing behavior for one of the most progressive characters in The Simpsons. Granted, the early days of the series have their problematic moments, and, whether or not you agree with these criticisms, it’s undeniable that society has come a long way in how we view women and minorities, putting these issues more under the microscope than ever. However, atheists and those with atheistic ideas (those who don’t believe in angels, heaven, or the soul, but may still believe in a higher power) are still one of the most distrusted groups in the United States. If this episode was made today, I’m sorry to say, I think Bart’s opinions would still be treated with scorn.
If you like my content and would like to support, consider making a donation on ko-fi. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '12', 'language_id_whole_page_fasttext': "{'en': 0.9577816724777222}", 'metadata': "{'Content-Length': '75426', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:26XQF63QPP57IWLDMNODQX6KQRGWF7ZO', 'WARC-Concurrent-To': '<urn:uuid:ecab14e2-ed7e-4965-8bb9-cf3156b9d43f>', 'WARC-Date': datetime.datetime(2019, 4, 20, 15, 6, 5), 'WARC-IP-Address': '192.0.78.13', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:2VZZXTY5N4M5NSVAC2ZBINFLOZGRNYQG', 'WARC-Record-ID': '<urn:uuid:acddfc3e-fa9c-49d5-b73f-5c780d2e01c6>', 'WARC-Target-URI': 'https://theunfamousedenh.wordpress.com/tag/religion/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:34a4340b-1b66-43d7-9fb2-917f57ab1a88>', 'WARC-Truncated': None}", 'previous_word_count': '1226', 'url': 'https://theunfamousedenh.wordpress.com/tag/religion/', 'warcinfo': 'isPartOf: CC-MAIN-2019-18\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-143-100-67.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.025738656520843506', 'original_id': '3bed00ae23bcc795474c8dcaa4c5a3161defe956108ad864a71ac9265870740e'} |
Paraguay dengue outbreak tops 100K, Three dengue serotypes circulating now
By NewsDesk @infectiousdiseasenews
During a press conference today, Health Minister Julio Mazzoleni announced the latest information on the dengue fever outbreak in Paraguay. “We want to start the conference with good news: the epidemic has slowed in the area of Asunción and Central, at this time we have not reached peak and we are currently on a plateau and we even have a tendency of a decline in most of the hospitals, stating this will be corroborated next week”.
To date, 106,127 total dengue fever cases have been reported, including 5,766 confirmed cases and 20 deaths. The deaths have been reported from Central (11), Concepción (3), Asunción (2), San Pedro Sur (1), Pdte. Hayes (1), Alto Paraná (1) and Paraguarí (1).
Nearly 20,000 cases have been reported weekly during recent weeks.
In addition, officials report serotype DEN-1 is circulating, bringing it to three dengue serotypes circulating in the national territory: DEN-1, DEN-2 and DEN-4, with a predominance of the latter. Likewise, co-circulation of DEN-2 and DEN-4 is verified in 12 health regions of the country, and co-circulation of the three serotypes in Itapúa.
In the last four weeks, all neighborhoods in Asunción register dengue notifications. About 28% of neighborhoods have confirmed cases of the disease. The DEN-4 serotype is located in 18 neighborhoods of the Capital: in Ciudad Nueva, Bernardino Caballero, Jara, Yukyty, Las Mercedes, Madame Lynch, Mbocayaty, Murucuyá, Obrero, Pinozá, San Antonio, San Cayetano, San Vicente, Santa Rosa , Holy Trinity, Tablada, Virgin of the Assumption, Vista Alegre and Zeballos Cué; and DEN-2 in Tablada Nueva.
The Central department reflects the same epidemiological behavior, reporting cases in all its districts. DEN-4 circulates in Limpio, MRA, Luque, Areguá, Itauguá, Ypacaraí, Itá, Nueva Italia, Villeta, Guarambaré, Ypané, JA Saldívar, San Antonio, Ñemby, Capiatá, San Lorenzo, Villa Elisa, Lambaré; and co-circulation of DEN-4 and DEN-2 in the Fernando de la Mora district.
Costa Rica: Child who contracted ‘brain-eating amoeba’ ‘progressing satisfactorily’
Brazil: Melioidosis cases in Piauí state prompt instruction for providers
Brazil reports 28 percent increase in syphilis cases in 2018
Peru: MOH declares dengue health emergency in Loreto, Madre de Dios and San Martín regions
Brazil Carnival 2020: MOH distributes millions of condoms in attempt to prevent sexually transmitted infections | mini_pile | {'original_id': '578d148cf9173724ba2c33421ddf171b8899af81ab8ab1603dd92f4a331ef346'} |
Estonian operations centralised in two plants
In order to improve its productivity and competitiveness, Atria Baltic concentrates its Estonian operations in two plants instead of three: Valga and Vastse-Kuuste in Southern Estonia. Atria also owns large piggeries in Estonia.
| dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '12', 'language_id_whole_page_fasttext': "{'en': 0.912585437297821}", 'metadata': "{'Content-Length': '77959', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:YT5UEW3UGZSJ2SENNKPYCS4Q6V3X75ND', 'WARC-Concurrent-To': '<urn:uuid:e970a4d1-e1ed-42ba-b90a-5028f593b5dd>', 'WARC-Date': datetime.datetime(2018, 9, 23, 7, 26, 29), 'WARC-IP-Address': '217.114.93.77', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:RGBXUQNCDTLK7JNJFDJ7OVMQAMZ4PGO3', 'WARC-Record-ID': '<urn:uuid:26bf77d7-ea3c-4c74-8650-c2407a904ad4>', 'WARC-Target-URI': 'https://www.atria.fi/en/group/company/history/years-of-atria/2010/estonian-operations-centralised-in-two-plants/', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:26e658a5-3416-4843-8406-8ceeb753af93>', 'WARC-Truncated': None}", 'previous_word_count': '62', 'url': 'https://www.atria.fi/en/group/company/history/years-of-atria/2010/estonian-operations-centralised-in-two-plants/', 'warcinfo': 'isPartOf: CC-MAIN-2018-39\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for September 2018\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-111-168-72.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 0.11-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.03410309553146362', 'original_id': '527f28c5d23f79152300fea96b812cfd0293e0c5817470e365616d18d5c0c71e'} |
Circulating the Facts of Slavery
How the American Anti-Slavery Almanac became an influential best seller.
By Teresa A. Goddu
Tuesday, July 28, 2020
From The American Anti-Slavery Almanac for 1842. Smithsonian National Museum of African American History and Culture.
From its outset, the American Anti-Slavery Society (AASS) worked to establish the facts of slavery. Antislavery lecturers were instructed to make themselves “familiar with FACTS, for they chiefly influence reflecting minds” and to “make no random statements, prove all things.” Periodicals regularly offered facts or statistics about slavery: the headlines of Human Rights declared facts! facts!! facts!!! and still more facts while the Quarterly Anti-Slavery Magazine published statistics of the U.S. slave population.
By ceaselessly creating facts and linking them together within a reinforcing print system, the AASS forged a factual foundation upon which to build its arguments. Throughout the 1830s, the AASS was an information-gathering, knowledge-producing enterprise. Its most prominent genre—the documentary compendium—was the principal print form through which it compiled, constructed, and dispersed facts about slavery. Its most popular factual compendium in the 1830s was the antislavery almanac. Driven by data, the antislavery almanac deployed the genre’s modes of information analysis to produce antislavery knowledge in a legible and familiar form. Framing its facts through the genre’s customary conventions, it trained its audience to calculate slavery’s immorality. It was also a key node in the AASS’ consolidated print system and the primary pamphlet in many of its distributional plans. Crucial to the formulation of the society’s factual argument, it was essential to its institutional credibility and organizational growth.
Through the almanac, the AASS established its knowledge system as sound and its movement as legitimate.
As historian Patricia Cline Cohen argues, a cultural shift toward numeracy occurred in the 1820s and 1830s. Arising in conjunction with the market revolution and the emergence of mass society, this shift was marked by the explosion of numbers, the popularity of statistics, “a mania for quantification,” and the invention of what historian and literary critic Mary Poovey terms “the modern fact.” Numeracy was a crucial tool of U.S. nation building in the nineteenth century. The state solidified its power through what Oz Frankel calls “print statism”—the unprecedented production, accumulation, and diffusion of facts in and through official reports and policy documents. Through the authority of statistics and the uniformity of print, the federal government sought to manage a rapidly expanding nation and represent its own identity as commanding. Reform movements similarly turned to numeracy to quantify and enumerate social ills—and thereby make them visible and comprehensible.
In the 1830s the AASS turned to the almanac—the informational genre of its day—to authenticate its argument. A miscellany of diverse information, statistical tables, charts, and computations, the nineteenth-century almanac was constituted as a collection of facts. Associated with prediction and superstition in the seventeenth century, by the late eighteenth century almanacs had become more rational, serving as vehicles for Enlightenment thought. Their statistical role—collecting, organizing, and analyzing data—expanded rapidly in the nineteenth century as the genre responded to the market economy and an increased demand for useful knowledge.
Cover of The American Anti-Slavery Almanac for 1842.
The antebellum almanac managed and made comprehensible its mass of information by presenting it in a standardized form. Almanacs typically opened with a preface, followed by celestial phenomena: astronomical calculations, eclipses, phases of the moon, tide tables, signs of the zodiac. Calendar pages for each month, which included sunrise and sunset, location of the planets, tide times, useful information, important historical and religious dates, followed. Back matter included statistics, essays, moralistic or entertaining stories, anecdotes, and verse. Almanacs’ uniform and repetitive structures habituated readers in finding certain types of information in certain places.
Since everyone read—and knew how to read—an almanac, it was an ideal vehicle for propagandizing. “If you want to make converts,” The Emancipator advises, “circulate the Almanac.”
The American Anti-Slavery Almanac had two editors. The almanacs for 1836–38 were edited by the Boston minister Nathaniel Southard; the editor for the 1839–41 editions was Theodore Weld, a member of the executive committee and editor of the society’s publications. Southard’s almanacs were more religious in nature, focusing on slavery as a sin, while Weld’s were more political, calculating slavery’s criminality, but both used the almanac’s standard format to produce and disseminate antislavery knowledge.
A forty-eight-page pamphlet, The AAS Almanac included a neat, printed cover, an “elegant frontispiece on the title page,” front matter (a preface, astronomical calculations, tide tables, eclipses for the year), monthly calendar pages (tables of planetary positions, tides, and day length as well as historical dates and engravings), and miscellaneous back matter (census and demographic data, essays, testimonies, and stories related to slavery). It was advertised in The Emancipator as “rich in statistical facts and tables, bearing on the subject of slavery” and in The Liberator as “crowded with fine ‘pictorials,’ startling facts, valuable statistics, convincing arguments, and stirring appeals to the hearts and consciences of the people.”
The AAS Almanac made slavery’s influence strikingly visible. It trained readers in how to read statistically to decipher slavery’s growing power. The AAS Almanac for 1839, published under Weld’s editorship, provides a table of “Statistics of the United States”—“carefully prepared from the best sources”—that includes the populations for “free whites,” “slaves,” and “free colored” people alongside the number of congressional representatives for different time periods. Read horizontally, the table registers the nation’s population explosion. Read vertically—the chart groups Northern and Southern states separately so that their numbers can be added into sectional sums—the table encourages comparison of regional differences. A detailed analysis of the table follows. Titled “Statistics,” it tells the reader how to compare the table’s columns and calculate percentages and the rate of change in order “to see the comparative progress” of free and slave states. It also translates the table’s complex numerical data into simpler takeaways, such as the facts that the slave population has “increased faster since the slave trade was abolished” and that “slave states have nearly TWICE as much territory as the free.” Moreover, by comparing columns that “contrast the present apportionment of representatives with what it would be, if the present number were apportioned on the basis of the FREE population only,” the analysis compels readers to “see how large a part of [their] own JUST RIGHTS in the U.S. H.R. [they] have given to slavery.” Drawing a connection between population numbers and political power, the essay explicates for its Northern readers how the data affect them directly.
The AAS Almanac’s adaptation of the almanac’s knowledge systems extended to its calendar pages. The AAS Almanac for 1839 showed the weather’s impact on the enslaved and on antislavery activity. “Clear and cold” is followed by “Slaves suffer much”; “blustering weather” leads to “squalls in congress” and an “immense No. of petitions.” This predictive function is extended to the antislavery cause as the data in the almanac verify the calendar’s assessments that “abolitionism [is] spreading” and “the jubilee is at hand.”
Besides connecting antislavery principles to natural systems, The AAS Almanac also used the genre’s conventions to insert antislavery events into national history. In some editions, the daily calendar records antislavery occasions, such as the Monthly Concert for the Slave and the May Anniversary, to establish the rhythm of the antislavery year. In others, the list of important dates on the upper left-hand side of the page situates antislavery events in a national framework and asserts the movement’s inevitable progress: the dates of Columbus’ landing in America and the Pilgrims’ arrival at Plymouth Rock are side by side with those of William Wilberforce’s birth and the publication of the AASS’ Declaration of Sentiments. Juxtaposing the historical calendar to the daily calendar, which was often situated below it, underscored how everyday activism could produce noteworthy events. By integrating antislavery into historical systems, The AAS Almanac constructed its cause as significant and its success as certain.
The AAS Almanac was the society’s most widely distributed and consistently circulated text throughout the 1830s and crucial to many of its distributional plans. The Liberator calls it “one of the most valuable productions in the antislavery cause.” It was the movement’s best seller in the 1830s, steadily increasing its sales numbers each year. Its first two editions, The AAS Almanac for 1836 and 1837, sold a total of 70,000 copies; The AAS Almanac for 1839 sold 130,000. Printed by stereotype as early as the edition for 1838, it was the only text in the AASS’ catalogue of publications advertised as available by the thousands as well as the hundreds. It was promoted as “the cheapest Almanac in the United States” and marketed at a low price to ensure extensive circulation. Selling at 6 cents per single, 50 cents per dozen, $3.50 per hundred, and $30 per thousand, it was inexpensive enough, other advertisements noted, to be “purchased in large quantities for gratuitous distribution; and scattered like the leaves of the forest over the land.” Slated to be put in “every household in the free states,” it was also distributed in the West and carried abroad.
Cover of The American Anti-Slavery Almanac for 1843. Wikimedia Commons.
The AAS Almanac’s broad dissemination depended on systematic as well as ample supply. As a renewable resource—each year’s almanac was distributed until the next year’s took its place—it stayed in constant circulation. Readers are instructed to “be in season with [their] orders for the Anti-Slavery Almanac,” procuring supplies and furnishing the country before other almanacs glutted the market. “Now is the time, the seed-time for sowing Almanacs,” The Emancipator proclaims, “and a little effort now will be producing effects through the year.”
Local agents were urged to place an almanac in every household and to supply it for free to those who could not afford to buy it. The AASS’ “Plan of Labor” calculated that it would cost between five and eight dollars to flood a town with The Almanac, given its low price. The AAS Almanac was also available at bookstores and hawked on the street: The Emancipator asks “every merchant and bookseller [to] order a large package for their counters,” and Lewis Tappan wrote of New York newsboys crying “Anti-Slavery Almanac,” selling “ten thousand copies” in “two days!”
The AAS Almanac’s distribution supported the society’s growth. As agents disposed of the almanac, they propelled its other parts: they circulated the AASS constitution and its petitions, located subscribers for the Quarterly Subscription Plan and The Emancipator, and sold books. “Work for Abolitionists” on the inside back cover of The AAS Almanac for 1840 urges readers to plant libraries: “Reader! Will you not see that an Anti-Slavery Library is established and put into circulation in your district, and a copy of this Almanac put into every family without delay?” Just as the AAS Almanac’s intertextual form publicized the society’s larger print system, its circulation served as the catalyst for the society’s other initiatives.
Marking the commencement of the new society, The AAS Almanac formally began a second volume with its “for 1842” edition (published in 1841). Its first volume, composed of the for 1836–41 editions, was published as a bound set, underscoring the separate identity of the original AASS. The AAS Almanacs of the 1840s became less cohesive, often separating calendar pages from antislavery matter and compressing the numerical information on twelve successive calendar pages at the front in order to gain space for antislavery articles in the back. The later almanacs also contained fewer pictures (with none on the calendar pages) and were less spatially organized and thematically structured. The AAS Almanac developed unevenly in the 1840s. While the editions for 1843 and 1844, edited by Lydia Maria Child and David L. Child respectively, resembled the 1830s almanacs’ format more closely, The AAS Almanac never again achieved the internal coherence of the 1830s version. Disconnected from the regulated distribution system of the 1830s AASS, its circulation also decreased. Only thirty thousand copies of The AAS Almanac for 1844 were issued, because of the “state of the treasury.”
The appearance of competing antislavery almanacs in the 1840s replicated the split within the movement, while the dissolution of the pamphlets themselves into miscellaneous parts reflected the loosening of numeracy’s hold over the antislavery argument. Although facts remained central to antislavery’s case throughout the antebellum period, the years after 1840 witnessed the rise of more narrative-driven works, such as the antislavery novel and the slave narrative. Significantly, The Liberty Almanac for 1852, which marked the end of the antislavery almanac’s fifteen-year run, was advertised side by side with Uncle Tom’s Cabin in the National Era.
Excerpted from Selling Antislavery: Abolition and Mass Media in Antebellum America by Teresa A. Goddu. Copyright © 2020 by University of Pennsylvania Press. Reprinted by permission. | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '96', 'language_id_whole_page_fasttext': "{'en': 0.9436845779418944}", 'metadata': "{'Content-Length': '43826', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:DZP6HLDCFJOOYCEC2E4AQAH4YORDHSDR', 'WARC-Concurrent-To': '<urn:uuid:ae7ece8d-0c4c-472f-9e45-8d0e79438c70>', 'WARC-Date': datetime.datetime(2021, 4, 12, 21, 26, 29), 'WARC-IP-Address': '54.148.138.28', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:NGWS4GPNXO4AUJOSYZH7QOFGAEASZ66H', 'WARC-Record-ID': '<urn:uuid:7d160ccb-a89b-49cf-a11b-2c6152cba888>', 'WARC-Target-URI': 'https://www.laphamsquarterly.org/roundtable/circulating-facts-slavery', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:6d128cd1-f7b6-4cf8-86b1-467f4b37ee86>', 'WARC-Truncated': None}", 'previous_word_count': '2152', 'url': 'https://www.laphamsquarterly.org/roundtable/circulating-facts-slavery', 'warcinfo': 'isPartOf: CC-MAIN-2021-17\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for April 2021\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-199.ec2.internal\r\nsoftware: Apache Nutch 1.18 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.2-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: https://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.04177969694137573', 'original_id': 'a3f0e14d4293b3b8e71e23dccbac648ec37b7c58a066cb81003538557bdf2534'} |
Family Jokes
• Funny Jokes
Attorney and Two Men
Hot 1 year agoby Tats
His driver went to the two men and asked, sirs why are you eating grass? The first man replied, I have no money and must eat grass. The driver told the Attorney. The attorney would not hear of it and said come to my house and I will feed you. The man stated, sir I have a wife and three children, and then the second man spoke up and said I have a wife and six children. The Attorney says it is ok bring them all, there is enough for everyone.
It takes about twenty minutes to get everyone into the car and they are on their way.Shortly after the two men are totally overtaken and are saying to the Attorney, sir I do not know how to thank you and we are not able to repay you, thank you for your kindness. The Attorney says to them do not worry about it, it is fine and plenty for everyone. You will love my house, the grass is more...
Hot 1 year agoby justincider
"Such a tragic accident they were the perfect family."
Kind of makes me immortal.
Email and Internet
Hot 1 year ago
Taken back, the man protests that he is poor and has neither a computer nor an e-mail address. To this the manager replies, "You must understand that to a company like ours that means that you virtually do not exist. Without an e-mail address or internet access you can hardly expect to be employed by a high-tech firm. Good day."
Stunned, the man leaves. Not knowing where to turn and having $10 in his wallet, he walks past a farmers' market and sees a stand selling 25 lb. crates of beautiful red tomatoes. He buys a more...
Special Family
Hot 1 year ago
guy is in the market for a used motorcycle. He always
wanted a big Harley. He shops around, answering ads
in the newspaper, and is not having much luck. One day
he comes across a beautiful classic Harley with a for
sale" sign on it. Upon inspection, he is amazed
to find the bike in mint condition. He inquires about
it with the owner.
"This bike is beautiful! I'll take it. But you
gotta tell me how you keep it in such good shape.
"Well," says the seller, "it's pretty
simple. Just make sure that if the bike is outside
and it's going to rain, rub Vaseline on the chrome.
It protects it from the rain. In
fact, since you're buying the bike I won't need my
tube of Vaseline anymore. Here, you can have it."
and he hands the buyer a tube of Vaseline.
The guy buys the bike and off he goes, a happy biker.
He takes the bike over to show his girlfriend. She's
ecstatic (being a Harley more...
In a small town some where in Illinois lies a family. It consisted of a husband, wife, three sons, and a daughter. One of the sons had a terrible secret.
"Dad, I don't know how to tell you this, but I'm gay," said the son.
The Dad was furious he couldn't believe that one of his sons was gay.
A year had passed and his second son approached him and told a very bad secret.
"Dad, I'm sorry to disappoint you but I'm gay."
The Dad went crazy again, he couldn't believe that two out of three sons were gays.
Another year had passed and the third son came forward. "Dad I know you're not going to want to hear this but, I'm gay.
The Dad was enraged he started shouting "DOESN'T ANYONE IN THIS FAMILY LIKE GIRLS ANYMORE?!!"
The daughter said, "I do, I do!"
• Recent Activity | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '233', 'language_id_whole_page_fasttext': "{'en': 0.9865543246269226}", 'metadata': "{'Content-Length': '26635', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:7IVDCZ2LZCGM74NSVU7ISSK3UODPB3HT', 'WARC-Concurrent-To': '<urn:uuid:dbe81b70-066a-481f-8415-5383c96d106a>', 'WARC-Date': datetime.datetime(2019, 8, 25, 23, 31, 33), 'WARC-IP-Address': '173.203.84.57', 'WARC-Identified-Payload-Type': 'application/xhtml+xml', 'WARC-Payload-Digest': 'sha1:QGW3CKXVVTK4SLEKR4EDCJPWH3OT7URJ', 'WARC-Record-ID': '<urn:uuid:14c20a90-0b8d-4561-b7d5-ba88aaa3304e>', 'WARC-Target-URI': 'http://www.jokebuddha.com/Family', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:ff216863-2269-411a-aa01-220d59282e08>', 'WARC-Truncated': None}", 'previous_word_count': '779', 'url': 'http://www.jokebuddha.com/Family', 'warcinfo': 'isPartOf: CC-MAIN-2019-35\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for August 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-67-67-36.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.019837021827697754', 'original_id': '6833aa0c455b8b7e45f6efb60705c714967b530e5ae0cbd4f414f618e8387af8'} |
\section{Indiscrete Topology is Coarsest Topology}
Tags: Indiscrete Topology, Discrete Topology
\begin{theorem}
Let $T = \struct {S, \tau}$ be an indiscrete topological space.
:$\tau$ is the coarsest topology on $S$.
Hence it is comparable with all other topologies on $S$.
\end{theorem}
\begin{proof}
Let $\phi$ be any topology on $S$.
Then by definition of topology, $\O \in \phi$ and $S \in \phi$
Hence by definition of subset, $\tau \subseteq \phi$.
Hence by definition of coarser topology, $\tau$ is coarser than $\phi$.
{{qed}}
\end{proof}
| math_pile | {'subset': 'ProofWiki', 'meta': "{'type': 'Theorem_Proof'}", 'original_id': 'ec888d2a6d4dae192dd8a163a77209f2ea66126ba70c09ef7d7e32f931cbf0c1'} |
How Much Should an Australian Shepherd Eat?
By September 21 | See Comments
Published by:
How Much Should an Australian Shepherd Eat?
Australian Shepherds are high energy dogs with high nutrient needs. Learn how to feed your Aussie here.
Originally bred as smart, capable herding dogs, Australian Shepherds are active, medium-sized pets who are usually happiest when they get plenty of time to run and play. Their activity level is an important consideration when deciding how much to feed them, along with other factors such as the dog’s age and size. It is essential for owners to stay alert when it comes to their dogs’ physical condition to ensure their pets are getting the right amount of food.
Dry Food
Dry dog food has the advantage of being easy to store and convenient to feed. It also helps keep your Aussie’s teeth clean by scraping off any accumulation of plaque. Most dry dog foods are fed based on the weight of the dog. Adult Australian Shepherds typically weigh between 35 and 60 pounds, with about 45 to 55 pounds being the most common weight range for both males and females. They need anywhere from three to four cups of dry food per day.
Frozen Diet
Aussie owners who want to give their dogs a raw, natural diet often choose to feed them a commercially made, frozen diet. These diet foods typically contain a combination of raw meat and vegetables, and are sold as patties, cubes or in cylindrical chubs. In general, a 50-pound Australian Shepherd needs about a pound of frozen food each day. It is essential to handle raw dog food safely, in the same manner as you would handle any kind of raw meat. Defrost the food in the refrigerator, discard any food that your dog doesn’t eat within 30 minutes after serving, and wash your hands, utensils, work surfaces, and your dog’s dish in hot, soapy water after use to avoid contaminating bacteria. Check with a veterinarian before feeding your dog raw meat.
Canned Food
Canned dog food can be used as a complete diet for your Australian Shepherd, but dogs fed only soft foods may need extra help with their teeth and gums. Dog biscuits and hard rubber toys help to remove plaque before it causes problems; brushing your dog’s teeth will also help. Choose food tailored to your dog’s needs, selecting either an all-purpose food or one designed specifically for various health problems, for puppies or for older dogs. Start by feeding about one-half a can per day for every 10 pounds of the dog’s body weight if your dog is not very active. Active or pregnant dogs need about twice that much, for a total of up to five cans a day or more. Many owners prefer to feed their Australian shepherd a single can each day, replacing some of the kibble and mixing the two together to make a semi-moist meal.
Older dogs and puppies have different needs than the average adult Australian Shepherd. Aussie puppies generally need more food than adult dogs of the same size. As dogs age, they tend to slow down, though many Australian Shepherds remain active well into their senior years. Aussies who don’t run and play a lot don’t need as much food, and their intake should be cut back to help them maintain a healthy weight. Pregnant and nursing females need extra food, typically in increasing amounts from the time the pups begin to develop during pregnancy until weaning.
• Medium Breed
• Raw
• Weight Control
• Anatolian Shepherd Dog
comments powered by Disqus
Was this article helpful? | dclm_baseline | {'bff_contained_ngram_count_before_dedupe': '0', 'language_id_whole_page_fasttext': "{'en': 0.9592403769493104}", 'metadata': "{'Content-Length': '126584', 'Content-Type': 'application/http; msgtype=response', 'WARC-Block-Digest': 'sha1:6QYNKQNVEEKZWTJQCGNSAT3PVYRMD3KY', 'WARC-Concurrent-To': '<urn:uuid:954ed973-3e9e-4af7-aa75-ccf40cac79ef>', 'WARC-Date': datetime.datetime(2019, 5, 24, 7, 23, 31), 'WARC-IP-Address': '104.16.60.49', 'WARC-Identified-Payload-Type': 'text/html', 'WARC-Payload-Digest': 'sha1:REDR2366PW6NMUL74GERXBUTBZGEBNDS', 'WARC-Record-ID': '<urn:uuid:f50d4e3c-7cdf-45c6-b996-6c0cdc119cff>', 'WARC-Target-URI': 'https://www.petcarerx.com/article/how-much-should-an-australian-shepherd-eat/522', 'WARC-Type': 'response', 'WARC-Warcinfo-ID': '<urn:uuid:5cc3b2ed-0a6d-474f-ac60-9551b8e164d8>', 'WARC-Truncated': None}", 'previous_word_count': '601', 'url': 'https://www.petcarerx.com/article/how-much-should-an-australian-shepherd-eat/522', 'warcinfo': 'isPartOf: CC-MAIN-2019-22\r\npublisher: Common Crawl\r\ndescription: Wide crawl of the web for May 2019\r\noperator: Common Crawl Admin (info@commoncrawl.org)\r\nhostname: ip-10-186-87-179.ec2.internal\r\nsoftware: Apache Nutch 1.15 (modified, https://github.com/commoncrawl/nutch/)\r\nrobots: checked via crawler-commons 1.1-SNAPSHOT (https://github.com/crawler-commons/crawler-commons)\r\nformat: WARC File Format 1.1\r\nconformsTo: http://iipc.github.io/warc-specifications/specifications/warc-format/warc-1.1/', 'fasttext_openhermes_reddit_eli5_vs_rw_v2_bigram_200k_train_prob': '0.02618110179901123', 'original_id': '55fd4081059ee117087885c1a0fa4adcdee8f77255a171cbd253f3c100390b05'} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.