text
stringlengths 1
2.31M
| meta
dict |
|---|---|
SHC asks ministry, Pemra, cable operators to submit reply
KARACHI: The Sindh High Court (SHC) on Monday directed the Ministry of Information, Pakistan Electronic Media Regulatory Authority (Pemra) and the cable operators to file comments on applications of Jang, Geo and The News employees against non-restoration of Geo News, Geo Tez, Geo Kahani and Geo Entertainment transmission by the cable operators.
The applicants submitted that thousands of Jang and Geo TV employees were facing hardships due to closure of Geo News, Geo Entertainment, Geo Tez and Geo Kahani by the cable operators and prayed the court to allow them to become interveners in the petitions. The Pemra and cable operators counsel Kashif Hanif and S Amir Ali waived notices on the applications and undertook to file comments on the applications.
Petitioner counsel Behazad Haider submitted that private cable operators did not comply with the orders of the Pemra and broadcast of the Geo News, Geo Entertainment, Geo Tez and Geo Kahani remained suspended till filing of the petition. He submitted that blocking the transmission of the Geo TV channels was the violation of the Supreme Court and High Court’s orders that restrained the Pemra and cable operators from blocking or interfering in the smooth transmission of the Geo News, Geo Entertainment, Geo Kahani and Geo Tez.
SHC’s division bench headed by Justice Aqeel Ahmed Abbasi granting the applications of interveners for hearing and directed the Ministry of Information and Broadcasting, Pemra and cable operators to file comments on the applications by September 2 and observed that court would pass appropriate order after hearing the counsel of respondents.
|
{
"pile_set_name": "Pile-CC"
}
|
If you wish to do gardening, plant or insect and pest research on your own, TheGardenLady wants to suggest a few ways to get the best, most up to date information on line.
The first is to check out what the extension offices have written on your subject of interest. When Googling up your topic, add the word extension at the end of the word/s you type in the search space and you will get a list of papers put out by various Agricultural extensions at different universities. For example, do you have skunks making a nest in your basement window wells? A friend did and contacted me about what she should do. I told her to call small animal control in her town. However, if you want to see what else might be recommended or if skunks don’t interest you but you are interested in rose care, type in Skunk extension or rose care extension and a list of papers from university researchers on the topic of your interest will appear.
The government offers excellent source material. You can type government at the end of the word you are searching. For example, invasive plants government
Garden and plant societies have good information online. If you are interested in azaleas or perhaps African violets, type in azalea society or African violet society to see what information these organizations have to offer.
Then consider nurseries for information about plants or seeds. Many nurseries will provided excellent information about the plants they sell. They want repeat business, so it is in their best interest to give you the information about what they sell. For example, if you want to know about herbs, Richters herbs has been in business for a long time. They not only have information on line, but they have the added service of allowing you to contact their specialists about any herb questions you might have. This service is free.
There are some excellent blogs about gardens on line. Some of my favorite nurseries, that I have recommended on TheGardenLady, I am proud to say have started their own informative blogs where you can get information and have your questions answered. New blogs are Carolyn’s Shade Gardens and Georgia Vines. If you contact them, let them know that you heard about their blogs on TheGardenLady blog.
TheGardenLady has received some notices of events that might be of interest to readers of TheGardenLady.org blog. As they are received, I will try to let you know what is happening so that you can mark your calendar and plan ahead.
Carolyn’s Shade Garden is having an open house this October 9th at her nursery at 325 South Roberts Rd, Bryn Mawr, PA Telephone: 610-525-4664 She has some lovely plants for sale. Contact her for more information. Her garden alone is worth the visit.
Central Ohio is having their 56th Annual Home and Garden Show on Feb. 26th. If you are interested check out this site.
Stonecrop Gardens in Cold Springs, NY (see here) will have their 4th annual Alpine plant sale in the spring- probably early April. If you are interested in Rock Gardens and plants for the rock garden or just love alpine plants, it seems that Stonecrop Gardens is one of the foremost gardens in the US for these plants so that the Rock Garden Society of America has their alpine sale there. And the Stonecrop Gardens are wonderful to visit even if you don’t buy plants. More information will come about the date when TheGardenLady learns which weekend is chosen for this event.
TheGardenLady recently wrote a post answering a question about the the types of plants she would recommend planting near a graveside. You can read it here. She then received the following letter from Carolyn Walker of the famous Carolyn’s Shade Gardens in Bryn Mawr, Pennsylvania, which was about the same topic. Here’s Carolyn’s letter.
Hello Garden Lady
It is very coincidental that you should have this question about planting around graves. One of my customers referred an elderly woman to me who was interested in planting around her husband’s gravestone. The cemetery, which was in the woods, allowed live planting. She sought my advice on what would be elegant, simple, easy to maintain, and most importantly, deer proof.
My son and I went to the graveyard and transformed the site. First we removed the sod in a rough oval extending around the sides of the grave to soften its stark outline (see before photo). Then we planted ten shade perennials for maximum year round impact and deer resistance. We chose three Helleborus niger ‘Jacob’, one of the new Christmas roses that is not only evergreen but also blooms from November to April. We surrounded it with five Lamium maculatum ‘Shell Pink’, the only lamium that blooms from April to November. It is also evergreen. We now had flowers and foliage year round. Finally, we added two Brunnera macrophylla ‘Jack Frost’, a perennial forget-me-not with huge, silver leaves and long-blooming blue flowers in spring. To me the heart-shaped leaves of this plant symbolize the husband and wife. The two after pictures show the completed job. The plants will fill in quickly so that no bare earth remains.
I have never done this type of planting before, but it was immensely satisfying.
TheGardenLady is a big fan of hostas in the garden. They add such pizazz to any garden landscape. Mine are planted around trees to decorate the feet of the trees for a finishing touch. So in my garden, instead of just seeing a mound of mulch at the bottom of the trees, you see a sort of wreath of hostas that have pushed through the mulch. I think this adds such a pretty touch to the garden picture. If you want to buy hostas for your garden and are in the Philadelphia area on Saturday, May 15th, you should definitely visit Carolyn’s Shade Garden in Bryn Mawr.
Carolyns Shade Garden is having the third open house this Saturday, May 15, from 10 to 3, rain or shine, directions attached (checks and cash only). The display gardens are beautiful and full of great ideas, and the nursery has a huge selection of plants.
Appointment: Feel free to schedule an appointment during this week or next week if you can’t make it on Saturday. There seems to be a misconception that appointments are unusual. In fact, Carolyn does over half her business by appointment. Of course, if you only want a small amount of plants, the open houses are recommended.
Parking: For the convenience of my neighbors, please observe the no parking signs on Robinhood Rd and do not block mailboxes or turn around in driveways.
As promised, this is the best open house for hosta, ferns (10 varieties), and hardy geraniums, including hard-to-find and extremely desirable ‘Rozanne’.
There is also a great selection of phlox, foamflowers, bleeding-hearts, columbines, corydalis, lamium, pulmonaria, and, of course, hellebores (including the Lady Series, the Immanence Collection, and Christmas Rose ‘Jacob’). Japanese primroses and yellow corydalis are also ready.
A Word about Hostas: Carolyn has a great selection of hostas this year, including several varieties that she developed herself. She highly recommends that you walk around the gardens and look at the hostas in the landscape before choosing the type you want. Big-leaf hostas look totally different in a pot and often don’t develop their true leaf shape and gorgeous colors until they have been in the ground for a year. Smaller hostas cannot adequately portray their distinct habits in a pot.
When selecting hostas for your garden, you can’t go wrong by selecting a winner of the coveted Hosta of the Year Award from the American Hosta Growers Association. This award means a lot–only 15 hostas have received it out of the over 6,000 cultivars out there. I offer 1998 ‘Fragrant Bouquet’, 1999 ‘Paul’s Glory’, 2000 ‘Sagae’, 2001 ‘June’, 2002 ‘Guacamole’, 2008 ‘Blue Mouse Ears’, 2009 ‘Earth Angel’, and 2011 ‘Praying Hands’. Click here for gorgeous photographs:
Carolyn is totally infatuated with miniature and dwarf hostas and is offering 11 varieties at the open house.
New hostas for this year include:
‘Baby Bunting’: 6” tall by 12” wide; considered by many to be one of the best dwarf hostas, it has round, heavily textured, blue-green leaves and bell-shaped white flowers.
‘Cherry Berry’: 10” tall by 14” wide; wavy leaves with central white area surrounded by dark green bleeding back into the center and establishing a lighter green “bridge” between the two areas; leaf stems are deep cherry colored and prominently displayed.
‘Earth Angel’: 30” tall by 5’ wide; 2009 Hosta of the Year; a phenomenal variegated version of ‘Blue Angel’ with large heart-shaped blue leaves and a wide creamy-white border–the first giant blue hosta to have a border; specimen plant.
‘Fantasy Island’: 7” tall by 12” wide; rippled, wide green margin with a speckled center that changes from yellow to creamy white; vigorous, sun-tolerant, and a good multiplier.
‘X-ray’: 8” tall by 15” wide; low, dense mound of narrow, heavily rippled and misted foliage that is beautifully variegated early in the growing season.
Questions: Carolyn’s catalogue is an excellent resource for information about the ornamental characteristics and cultural requirements of the plants she offers. Carolyn often finds incorrect information on the preprinted plastic plant tags and recommend that you go to her catalogue first. Printed copies will be available at the open house. If your question is not covered in the catalogue, please feel free to consult one of the knowledgeable open house “volunteers” in the blue aprons.
Email Issues: If you wish to be on the customer email list, please click on this address carolynsshadegardens@verizon.net and request this.
On Monday’s post, TheGardenLady answered a question about using compost for potting soil, in which she suggested that this was fine to do. Recently, she received a response to her answer from Carolyn of the famous Carolyn Shade Gardens in Bryn Mawr, a garden which TheGardenLady has written about in the past (see here). Here’s Carolyn’s response and some photos of her beautiful flowers.
I would not recommend using straight compost as potting soil in a container. It will become too hard, impede root growth, and not drain well. I use my own compost in my containers, but I mix it approximately one part composted cow manure, one part compost, three parts Pro-mix. The compost improves the quality and fertility of the soil mix. However, container plants need a lot more fertilizer because water is running through them all the time. I add the cow manure for long-term fertility and also fertilize once every two weeks with a weak mixture of organic liquid fertilizer. The Pro-mix keeps the soil light and draining well and allows good root growth. I have attached some pictures of my containers.
Thanks Carolyn for your view on this question. TheGardenLady is always open to different viewpoints, so if you disagree with TheGardenLady feel free to express your thoughts.
Carolyn of Carolyn’s Shade Gardens says that her unusual bulbs and wildflowers seem to peak between her first two open houses, so she is scheduling her fifth annual “bulb and wildflower day”. Anyone who is interested in purchasing the plants listed below is invited to stop by without an appointment on Saturday, April 10, from 9 to 3 pm, rain or shine (checks and cash only).
If you can’t come Saturday, feel free to schedule an appointment at carolynsshadegardens@verizon.net to stop by during the preceding week (daylight hours April 5 through 9) or Sunday, April 11.
Parking: Please park on the right side of Robinhood Road, avoiding turning around in or blocking the neighbors’ driveways or mailboxes. Directions are attached.
Arum italicum ‘Pictum’/Italian Arum
Arum italicum ‘Tiny Tot’/Miniature Italian Arum
Asarum canadense/Wild-ginger (native)
Asarum splendens/Chinese Wild-ginger
Camassia ‘Coerulea’/Blue Camassia (native to U.S.)
Camassia ‘Semiplena’/Double White Camassia (native to U.S.)
Chionodoxa forbesii/Glory-of-the-Snow
Chionodoxa forbesii ‘Pink Giant’/Pink Glory-of-the-Snow
Corydalis solida ‘Beth Evans’/Corydalis
Corydalis solida ‘George P. Baker’/Corydalis (rare)
Cyclamen hederifolium/Fall-blooming Hardy Cyclamen
Erythronium ‘Pagoda’/Dog-tooth Violet (native to U.S.)
Fritillaria meleagris/Checkered-lily
Galanthus ‘Atkinsii’/Snowdrop
Galanthus elwesii/Giant Snowdrop
Galanthus ‘Magnet’/Snowdrop
Galanthus nivalis/Common Snowdrop
Galanthus nivalis ‘Flore Pleno’/Double-flowered Snowdrop
Galanthus ‘Potter’s Prelude’/Fall-blooming Snowdrop
Galanthus ‘S. Arnott’/Snowdrop
Galanthus woronowii/Species Snowdrop
Hepatica acutiloba/Sharp-lobed Hepatica (native)
Hepatica americana/Round-lobed Hepatica (native)
Jeffersonia diphylla/Twinleaf (native)
Mertensia virginica/Virginia Bluebells (native)
Muscari armeniacum/Grape-hyacinth
Muscari latifolium/Grape-hyacinth
Muscari ‘Mt. Hood’/Snow-capped Grape-hyacinth
Puschkinia scilloides/Striped-squill
Sanguinaria canadensis ‘Multiplex’/Double-flowered Bloodroot (native)
Scilla campanulata ‘Excelsior’/Spanish Bluebells
Scilla campanulata ‘Queen of Pinks’/Pink Spanish Bluebells
Scilla campanulata ‘White City’/White Spanish Bluebells
Scilla mischtschenkoana/Tubergen Squill
Scilla siberica/Siberian Squill
Scilla siberica ‘Alba’/White Siberian Squill
Trillium grandiflorum/Large-flowered Trillium (native)
Trillium luteum/Yellow Trillium (native)
Trillium recurvatum/Bloody Noses (native)
Also available: incredibly beautiful selection of hellebores if you couldn’t make it to the March open house and many other native plants.
Carolyn’s Shade Gardens Nursery is having its first spring open house on Saturday, March 27, from 10 to 3, rain or shine (checks and cash only). Directions are attached. For the convenience of her neighbors, please park on the right side of Robinhood Rd only and do not block mailboxes and driveways.
Feel free to schedule an appointment if you can’t make it on Saturday—you won’t want to miss all the exciting plants described below! Carolyn is available days and evenings this week. Just send her an email with a suggested time.
Carolyn Walker has an excellent assortment of top quality shade plants available right now, and her gardens are beautiful. Here are descriptions of some of the exciting offerings:
Hellebores: For hybrids, the Immanence Collection bred for outward facing flowers; the lovely and vigorous Lady Series with blooming plants of ‘Blue, Red, Yellow, and White Lady’; my own flowering “Carolyn’s Select” hybrids; and ‘Double Vision’ and ‘Double Integrity’ with double flowers. For hellebore lovers, I offer the green-flowered Helleborus viridis; exquisite, plum-colored H. purpurascens; rose dusted ‘Silvermoon’; and unusual ‘Honeyhill Joy’; in addition to the ever popular Bearsfoot, Corsican, and Christmas Roses ‘Josef’ and ‘Praecox’, which bloom from November to May.
Snowdrops: If you didn’t order snowdrops, all is not lost. She has potted up almost all the varieties, including ‘Atkinsii’, the giant snowdrop (G. elwesii), ‘Magnet’, the common snowdrop (G. nivalis), the double-flowered snowdrop ‘Flore Pleno’, fall-blooming ‘Potter’s Prelude’, ‘S. Arnott’, ‘Virdi-apice’, and G. woronowii.
Pulmonarias: Carolyn is excited to have her best ever selection of pulmonarias for this open house—hard-to-find ‘Majeste’ with heart-shaped silver leaves and pink and blue flowers, ‘Blue Ensign’ with cobalt blue flowers and dark green leaves, ‘Dora Bielefeld’ with all pink flowers, ‘Roy Davidson’ with pale blue flowers and spotted leaves, ‘Samurai’ with narrow all silver leaves, and ‘Silver Bouquet’ with rounded silver leaves.
Native Coral Bells: The new coral bells with our native Heuchera villosa as a parent are head and shoulders above the competition. Their eye-catching leaves remain attractive all winter, and the plants are extremely vigorous. She has available the beautifully colored ‘Miracle’, ‘Mocha’, and ‘Caramel’.
Questions: Her catalog is an excellent resource for information about the ornamental characteristics and cultural requirements of the plants she offers. She often finds incorrect information on the pre-printed plastic plant tags and recommend that you go to my catalog first. Printed copies will be available at the open house. If your question is not covered in the catalogue, please feel free to consult one of my knowledgeable open house “volunteers” in the blue aprons.
Reusable Plant Crates, Boxes, and Pots: If you took a plastic plant crate at a previous open house, don’t forget to reuse it on Saturday. Additional crates will be available for those who don’t have them. Carolyn would also love to have any cardboard boxes that are suitable for holding potted plants. You have been great about dropping off pots for reuse. She currently needs 4” and 5” square pots and nursery pots in sizes 400, 200, and 100 (if the number is not on the bottom, she can’t use it).
Email Issues: Please add Carolyn’s email address to your “safe sender’s list”—in Outlook this is found in Actions, Junk Email. If you wish to be removed from my customer email list, please click on this address carolynsshadegardens@verizon.net and put “delete from customer list” in the subject line.
Content: Using examples from my own gardens, I will cover everything and anything you ever wanted to know about hellebores, including:
+ How to grow and maintain them
+ How to propagate them by division and seedlings
+ How to pick the best plants
+ The difference between “species” and. “hybrid” hellebores
+ What makes a superior hybrid hellebore
+ What is special about the 15 or so species of hellebores
+ Some of the interesting new species crosses available
+ A special selection of hellebores will be available for purchase, including rare plants potted just for the seminars
The seminars are suitable for any level gardener as long as you can listen to discussions of the most esoteric qualities of hellebores without your eyes glazing over. Questions and observations from the group are encouraged. Feel free to bring samples for identification and discussion.
Registration: To register, please click on this address carolynsshadegardens@verizon.net and send me an email listing the seminar date, your name, and phone number. You will receive a reply confirming your registration and containing further details.
A Hellebore.....The Lenten Rose by keithhull
]]>http://www.thegardenlady.org/hellebore-seminars-for-the-totally-obsessed-2/feed/0Galanthus and Other Winter Plants To Buy From Carolyn Walker’s Shade Gardenhttp://www.thegardenlady.org/galanthus-and-other-winter-plants-to-buy-from-carolyn-walkers-shade-garden/
http://www.thegardenlady.org/galanthus-and-other-winter-plants-to-buy-from-carolyn-walkers-shade-garden/#commentsFri, 12 Feb 2010 15:10:39 +0000http://www.thegardenlady.org/?p=1960More Galanthus and other winter interest plants that you can buy from Carolyn Walker’s Shade Garden
Potter’s Prelude
Charles Cresson’s Heirloom Snowdrop Collection
New G. ‘Atkinsii’: In Snowdrops, Matt Bishop says that ‘Atkinsii’ has “elegant elongated flowers that suggest the drop-pearl earrings of Elizabeth I”—if that description doesn’t portray a true English classic, I don’t know what does. It is a large-flowered cultivar (the largest I am offering) valued for its early bloom and particularly sweet fragrance. Selected in the 1860s by James Atkins of Gloucestershire, Charles got his bulbs from the famous Swarthmore bulb authority Mrs. Wister. She bought her bulbs in the 1960s from the Dutch bulb nursery, Van Tubergen, renowned for their well documented bulb collections. The authenticity of Charles’s stock has since been reconfirmed by Michael Hoog, the grandson of Van Tubergen’s founder. Charles’s plants have the appearance and documented lineage of true ‘Atkinsii’, a snowdrop almost impossible to obtain today outside of England. $25 (1 plant per pot).
G. elwesii var. monostictus ‘Potter’s Prelude’: This is a free-flowering and vigorous snowdrop with wide recurving blue-green leaves and large flowers similar to the best of the species except that it blooms from November to January. It was selected by Jack Potter in the 1960s, former gardener to Mrs. Wister and Curator of the Scott Arboretum. In 2004, Charles registered it with the KAVB (the international registration authority for bulb cultivars) in the Netherlands. Matt Bishop declared ‘Potter’s Prelude’ the best of its type and will include it in the revised edition of Snowdrops. I am honored to be the only source for this cultivar. $40 (1 plant per pot) (photo above).
New G. ‘Magnet’: The descriptions of this snowdrop are a joy to read, and I can see why after having it in my garden. The stem (or pedicel) of the substantial flower is long and thin causing it to sway in the slightest breeze and setting ‘Magnet’ apart from all other snowdrops (no magnifying glass needed). Selected in the 1880s, it may have been named ‘Magnet’ after the child’s fishing game with magnets and sticks, we can’t be sure. I do know that Matt Bishop says it defines garden-worthiness and is a mainstay of snowdrop collections throughout the world. $25 (1 plant per pot).
Helleborus niger ‘Josef’ (Helleborus Gold Collection Christmas Rose), 12”, one of the earliest to flower of my Christmas roses, ‘Josef’ sends up its white, outward-facing blooms in November and blooms on and on, last year into May; large plants in full bloom now, $20 (gallon pots)(photo below).
G. elwesii, giant, early-blooming, beautifully scented, white flowers with the inner segments marked with green at both the top and bottom (or merged into a single large green mark) and broad, glaucous leaves, naturalized throughout Winterthur, $12 (3 plants per pot) (photo above).
G. nivalis ‘Viridi-apice’ (‘Viridapice’), white flowers unusual for having prominent green tips on the outer segments as well as the inner ones, vigorous, originally acquired from the “old” Heronswood, $10 (1 plant per pot).
New ‘S. Arnott’ (syn. ‘Sam Arnott’), large rounded flowers with heart-shaped green marking on the tip of the inner segment, considered one of the classic snowdrops of all time, $12 (1 plant per pot)
|
{
"pile_set_name": "Pile-CC"
}
|
1. Field of the Invention
This invention relates to belt buckles, and more particularly to seat belt buckles; but, as the name implies, is not limited to these uses and is applicable wherever a catch of the nature described below is needed.
An object of this invention is the provision of a catch which will allow instant escape from a vehicle if used as a seat belt buckle, or instant release of cargo if used as a carge buckle. When used as a seat belt, this catch can be adjusted to release with the slap of a hand or the push of an arm struggling to be freed. The advantages of this characteristic can be easily seen--in many accidents survival depends in escaping the vehicle instantly, i.e., if it is burning or about to fall from an escarpment. This adjustment is determined by the producer in advance of fabrication in the preferred embodiment, but the concept includes an adjustment in the produced article. By elevating the stud further from the bottom of the male member, more tilt is required to depress the dog and spring and thereby release the male member; also by shortening the stud the same objective is accomplished. Whether the mechanism is adjusted for hair trigger release or for deliberate release, it is a faster release than that available in conventional button release seat belts.
2. Description of the Prior Art
The prior art is replete with buckles having housings, snaps, and levers of one type or another--i.e. C. J. Schumann's Snap Lock Buckle (U.S. Pat. No. 2,110,684)--and many safety belt buckles have been cited in the prosecution of the prior and pending application.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Q:
Using Javas System.out.format to align integer values
I am trying to produce right aligned numbers looking a bit like this:
12345
2345
but I clearly does not understand the syntax. I have been trying to follow these instructions. and Come up with the following attempt (it is integers so d and I want width 7 and 0 decimals):
public class test {
public static void main( String[] args ) {
System.out.format("%7.0d%n", 12345);
System.out.format("%7.0d%n", 2345);
}
}
but no matter what I do I seem to end up with IllegalFormatPrecisionException. Is there a way to do this using this tool? If not how else would you do it?
A:
You can do something like this:
public class Test {
public static void main( String[] args ) {
System.out.format("%7d%n", 12345);
System.out.format("%7d%n", 2345);
}
}
Essentially this code asks Java to pad the string with spaces so that the output is exactly 7 characters.
|
{
"pile_set_name": "StackExchange"
}
|
13 October 2014
gradini
New things are so wonderful.
I love to adapt, I love to find a way with new things.
A melody, a space, a season.
I'm currently working on a playlist which I really try to do as often as possible, however I like to wait for the songs to come to me. I can't go searching for new music of songs that work well together. They always come and become part of a current feeling or experience in my life.
I'm feeling happy with how my mind has been wandering recently. Vivid dreams and concrete ideas.
I've been dreaming of Rovinj, Croatia -- my aunt just came back from a weekend there and told me it reminded her of Mykonos! Dita incrociate!
No comments:
Post a Comment
I'm fifi -- a young artist currently living in Italy, I work primarily with the simple mediums of graphite and paper. This is where most of my first and second thoughts live - my public dreams, ideas, and whereabouts.
|
{
"pile_set_name": "Pile-CC"
}
|
Diabetes prevalence among American Indians and Alaska Natives and the overall population--United States, 1994-2002.
Diabetes affects American Indians/Alaska Natives (AI/ANs) disproportionately compared with other racial/ethnic populations and has been increasing in prevalence in AI/AN populations during the past 16 years. To examine trends in diabetes prevalence among AI/ANs and the overall U.S. population and to describe disparities among these two populations, CDC analyzed data from the Indian Health Service (IHS) and the Behavioral Risk Factor Surveillance System (BRFSS). This report summarizes the results of that analysis, which indicate that diabetes continues to affect AI/ANs disproportionately and is becoming more common among younger populations. To combat this epidemic, knowledge and interventions from clinical trials and best-practice models should be translated to community-based prevention programs within AI/AN communities.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
How to finish() the Activity on home button click in android?
I want to finish the Activity on Home Button Click .
I have below code but not get its click event . but still not get clickevent
public boolean onKeyDown(int keyCode, KeyEvent event) {
if (event.getAction() == KeyEvent.ACTION_DOWN) {
switch (keyCode) {
case KeyEvent.KEYCODE_HOME:
System.out.println("Home clicked....");
return true;
}
}
return super.onKeyDown(keyCode, event);
}
A:
When Home button is pressed, onStop method is called in your activity. So what you may do is to add finish(); in onStop method to destroy your activity. Eventually onDestroy method will be raised to confirm that your activity is finished.
A:
You can't handle "Home" button.
You could try overriding some of these methods though: onStop, onUserLeaveHint
Are you sure you need to do this though?
If you could save your current state through the onPause/onSaveInstanceState and recover it later the OS should be able to handle the Activity's life cycle and finish it if needed.
Can you tell us what is preventing you from doing it that way? :)
|
{
"pile_set_name": "StackExchange"
}
|
{
"pile_set_name": "PubMed Central"
}
|
|
Sexy and I know it - fixed
|
{
"pile_set_name": "OpenWebText2"
}
|
Following the release of a 2005 tape in which Donald Trump bragged about how he could sexually assault women thanks to his celebrity status, several Republican politicians have announced that instead of voting for Trump they will write in his running mate, Indiana Gov. Mike Pence, on Election Day. Others have even gone so far as to call on Pence to replace Trump at the top of the ticket.
While Trump has pledged to stay in the race, the attempt to paint Pence as an acceptable alternative to Trump belies the fact that Pence is anything but mainstream.
Here are 12 reasons why Pence, a self-described Rush Limbaugh acolyte, is hardly a better option than Trump:
1) Abortion Rights
A fervent opponent of abortion rights, Pence frequently declares that he wants to “send Roe v. Wade to the ash heap of history where it belongs,” comparing the ruling to the Dred Scott decision. Earlier this year he told the far-right Values Voter Summit that a Trump administration would begin its fight against abortion rights on “the first day we take office.”
His record as a congressman and governor shows that he is deeply committed to the anti-choice cause.
He backed two “personhood” bills to grant legal status to zygotes, an effort that, if successful, would outlaw abortion and could curtail certain types of birth control, and in 2000 called for Congress to “enact a human life amendment to the constitution” and pass “legislation that makes clear that the 14th Amendment’s protections apply to unborn children.”
Furthermore, as Huffington Post has reported, “Pence cosponsored the Ultrasound Informed Consent Act, a bill that would have required abortion providers to perform an ultrasound on a woman seeking abortion, regardless of whether it was medically necessary, and then describe the embryo in detail to her. He also cosponsored a bill that would have essentially redefined rape, prohibiting federal funds from paying for abortion except in cases of ‘forcible rape,’ and a bill that would allow hospitals to deny abortions to pregnant women who would die without the care.”
As governor, he signed a law “banning abortions motivated by the race, gender, ancestry, or disability status of the fetus” that “also required that all fetal remains be buried or cremated” and “mandated that abortion providers have admitting privileges at local hospital,” a targeted regulation used by anti-choice groups to shut down abortion providers. A federal judge blocked the law as unconstitutional and many Hoosier women joined a “Periods for Pence” campaign to call the governor’s office to “report our periods” since “any period could potentially be a miscarriage without knowledge,” putting women “at risk of penalty if they do not ‘properly dispose’ of this or report it.”
Indiana’s abortion laws are so restrictive that one woman was incarcerated for what prosecutors said was a self-induced abortion.
2) Planned Parenthood
In Congress, Pence was behind the 2011 push for a shutdown of the federal government unless Planned Parenthood was prohibited from receiving federal aid, even though such funding didn’t go towards the group’s abortion services, promising that he would “be after” Planned Parenthood until they stopped “providing abortions.” As governor, Pence steered money from the Temporary Assistance for Needy Families (TANF) program to anti-abortion “crisis pregnancy centers.”
“The days of public funding for Planned Parenthood are over when a Trump-Pence administration arrives in Washington, D.C.,” he said in a speech to the Values Voter Summit last month.
3) Ex-Gay Therapy
During his 2000 run for Congress, Pence came up with a proposal to divert funds from organizations working to prevent the spread of HIV/AIDS to groups involved in discredited ex-gay therapy.
On his campaign website, Pence said that gays and lesbians should not receive equal recognition or legal protections from discrimination, before urging the government to direct taxpayer dollars “toward those institutions which provide assistance to those seeking to change their sexual behavior” instead of those “that celebrate and encourage the types of behaviors that facilitate the spreading of the HIV virus.”
Congress should oppose any effort to put gay and lesbian relationships on an equal legal status with heterosexual marriage.
Congress should oppose any effort to recognize homosexual’s as a “discreet and insular minority” entitled to the protection of anti-discrimination laws similar to those extended to women and ethnic minorities.
Congress should support the reauthorization of the Ryan White Care Act only after completion of an audit to ensure that federal dollars were no longer being given to organizations that celebrate and encourage the types of behaviors that facilitate the spreading of the HIV virus. Resources should be directed toward those institutions which provide assistance to those seeking to change their sexual behavior.
The fact-checking group PolitiFact “found no evidence Pence has walked back his stance on public funding for conversion therapy.” Indeed, the Republican National Committee adopted a plank opposing laws that try to limit unsafe and discredited sexual orientation conversion therapies as part of its party platform this year.
4) HIV/AIDS
While Pence never achieved his plan of transferring money meant for HIV groups to ex-gay therapists, as governor he did slash funding for public health programs, continued attacks against Planned Parenthood, which provides testing services, and was a staunch opponent of needle exchange programs.
In recent years, an HIV epidemic emerged in Scott County, Indiana, mostly stemming from intravenous drug use. A Planned Parenthood clinic in the county, the county’s only HIV testing center, closed in 2013 when the state drastically cut funding to the group, even though that particular clinic didn’t offer abortion services. Pence was a leading voice in the movement to defund Planned Parenthood.
In 2015, there were clear signs of an emerging HIV epidemic in Pence’s state, but the governor “dragged his feet,” taking months to approve a needle exchange program, citing moral qualms about such an undertaking. “It was disappointing that it took so much effort to bring the governor on board,” a Republican state lawmaker said at the time, while another commented: “He doesn’t recognize this as a crisis?”
Back in 1996, Pence criticized the Republican National Convention in San Diego for including “AIDS activists” as speakers, suggesting that their inclusion was a slap in the face to “pro-family conservatives.” The “AIDS activists” in question were Mary Fisher, an HIV-positive woman who was a former staffer for President Ford and had led the National Commission on AIDS, and Hydeia Broadbent, an HIV-positive minor.
5) LGBT Rights
One month after Arizona’s governor vetoed a measure that would have permitted businesses to deny services to LGBT customers, Pence signed a similar bill in Indiana, calling it “a measure that frankly, Indiana should have enacted many years ago.” He only signed a revised version of the law after a national outcry against it.
Pence has also been involved in an anti-LGBT organization in his state: “In the early 1990s, Pence was a board member for the Indiana Family Institute, a conservative advocacy group that has long opposed gay rights. At the time, the organization was led by Bill Smith, who would later become Pence’s chief of staff in Congress and during his first two years as governor. Smith is now a Pence campaign consultant.”
In the 1990s, as an editor of a conservative journal, he published works on “gaydom” and phony ties between homosexuality and pedophilia.
In Congress, Pence opposed a 2007 “bill to protect gays and lesbians from workplace discrimination,” the Employment Non-Discrimination Act, and the 2009 Shepard-Byrd legislation “to expand the definition of a hate crime to include the victim’s sexual orientation.”
He has also called for both a federal constitutional amendment to ban same-sex marriage and a similar state constitutional amendment. In 2006, he urged Congress to “say ‘no’ to activist courts bent on redefining” marriage, arguing that the Constitution should prevent same-sex couples from marrying because “societal collapse was always brought about following an advent of the deterioration of marriage and family.”
6) Don’t Ask Don’t Tell
In 2000, Pence said he wanted to scrap Don’t Ask Don’t Tell and replace it with a sweeping ban on gay service members, saying that he supported “bringing an end to the ‘don’t ask/don’t tell’ policy of permitting homosexuals to serve in the armed forces.” “Homosexuality is incompatible with military service because the presence of homosexuals in the ranks weakens unit cohesion,” he said.
Pence took to the House floor in 2010 to denounce the repeal of Don’t Ask Don’t Tell as an attempt to use the military “as a vehicle to advance a liberal political agenda” and “break faith with our men and women in uniform,” warning that it would harm military cohesion, morale and recruitment. He also told CNN that the open service of gay members amounts to “social experimentation.”
7) Refugees
Trump has made opposition to the resettlement of Syrian refugees a key fixture of his campaign, suggesting that they are terrorists and vowing to deport legally settled refugees.
As governor, Pence tried to prevent Syrian refugees from settling in Indiana, “forcing the local Indianapolis resettlement agency to scramble to look for another placement” for one family from Syria. “How could that be the freedoms that we hear about?” the family’s father commented. Pence suggested that such refugees might be terrorists and tried to prevent refugee agencies working in the state from receiving federal aid.
A federal district court judge prohibited Pence’s action and called it “national origin discrimination,” and an appeals court agreed, finding that it was “the equivalent of his saying (not that he does say) that he wants to forbid black people to settle in Indiana not because they’re black but because he’s afraid of them.”
8) Race
On the campaign trail, Pence criticized those who want to address issues about racial disparities and bias within law enforcement, accusing them of using “the rhetoric of division.”
“Donald Trump and I believe that there’s been far too much talk of institutional bias or racism within law enforcement,” he said, adding that “we ought to set aside this talk, this talk about institutional racism and institutional bias.”
9) Science
In a 2002 speech on the House floor, then-congressman Pence mocked evolution and said that schools should “consider teaching other theories of the origin of species,” praising Creationism as a legitimate scientific theory because it is based in the Bible and “was believed in by every signer of the Declaration of Independence.”
He is also a climate science denialist, stating that “global warming is a myth” and opposing regulations on greenhouse gas emissions.
10) Media
Pence must have appreciated Trump’s call to “open up the libel laws” against journalists, as the Indiana governor has already taken the conservative movement’s contempt against the media to a whole new level by attempting to create a state-run news agency.
He sought to create a taxpayer-funded state news outlet called “Just IN” that would have its own editorial and news teams, in hopes of creating a news service “overseen by political staff” that “could write stories that would be picked up by smaller newspapers that don’t have big newsrooms.”
Pence eventually abandoned the plan after it was widely mocked as an attempt to create a Pravda-style propaganda outlet.
11) Smoking
The “pro-life” leader has been an ardent defender of the tobacco industry:
Over his political career Gov. Mike Pence (R-IN) has consistently carried the tobacco industry’s water, denying the dangers of cigarettes, opposing government regulation, and slashing smoking cessation efforts. In return, they rewarded him with more than $100,000 in campaign donations. In 2000, Gov. Mike Pence (R-IN), then running for an open U.S. House seat, came out against a proposed settlement between government and the tobacco industry, calling it “big government.” In a shocking editorial, he wrote: “Time for a quick reality check. Despite the hysteria from the political class and the media, smoking doesn’t kill.” Pence acknowledged that smoking is not “good for you,” but claimed that two-thirds of smokers do not die from smoking related illness and “9 out of ten smokers do not contract lung cancer.” He warned of a slippery-slope in which government would soon seek to discourage fatty foods, caffeine, and SUVs. … In 2009, Pence was one of just 97 people in the U.S. House of Representatives to vote against the bipartisan Family Smoking Prevention and Tobacco Control Act, which gave the Food and Drug Administration the power to regulate cigarettes and blasted a 2009 bill to expand healthcare for kids as “a tax increase on smokers to pay for a new middle-class entitlement.”
He mocked talk “about the scourge of tobacco and the resultant premature deaths” as “the worst kind of Washington-speak” and warned that a “government big enough to go after smokers is big enough to go after you.”
12) Mulan
Back in 1999, Pence criticized the Disney movie “Mulan” as the creation of a “mischievous liberal” who was trying to influence “the cultural debate over the role of women in the military.”
And yet, he said that “Mulan” actually justifies bans on women in combat since “young Ms. Mulan falls in love with her superior officer!”
“You see, now stay with me on this, many young men find many young women to be attractive sexually,” he wrote. “Many young women find many young men to be attractive sexually. Put them together, in close quarters, for long periods of time, and things will get interesting. Just like they eventually did for young Mulan. Moral of story: women in military, bad idea.”
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Getting the ID's of div tags
I have the following HTML snippet
<div id="column_1">
<div id="portlet_1">
<div id="portlet-header_1"> <input type="button" class="close_button"> </div>
<div id="portlet-sub-header_1"> sub header goes here </div>
<div id="portlet-content_1"> content goes here </div>
<div id="portlet-footer_1"> footer goes here </div>
</div>
<div id="portlet_2">
<div id="portlet-header_2"> <input type="button" class="close_button"> </div>
<div id="portlet-sub-header_2"> sub header goes here </div>
<div id="portlet-content_2"> content goes here </div>
<div id="portlet-footer_2"> footer goes here </div>
</div>
</div>
<div id="column_2">
<div id="portlet_3">
<div id="portlet-header_3"> <input type="button" class="close_button"> </div>
<div id="portlet-sub-header_3"> sub header goes here </div>
<div id="portlet-content_3"> content goes here </div>
<div id="portlet-footer_3"> footer goes here </div>
</div>
<div id="portlet_4">
<div id="portlet-header_4"> <input type="button" class="close_button"> </div>
<div id="portlet-sub-header_4"> sub header goes here </div>
<div id="portlet-content_4"> content goes here </div>
<div id="portlet-footer_4"> footer goes here </div>
</div>
</div>
How do I:
get the column id depending on which close button is clicked? So if close_button is clicked which is in portlet-header_3, it should return column_2
get the portlet id depending on which close button is clicked? So if close_button is clicked which is in portlet-header_1, it should return portlet_1
I have the following, but this returns the closest div, portlet-header_*, which is not what I am after:
$(".close_button").live('click', function(event) {
event.preventDefault();
var that = this;
alert( $(that).closest("div").attr("id") )
});
A:
Try this (using jQuery .parents()):
$(".close_button").live('click', function(event) {
event.preventDefault();
var that = this;
alert( $(that).parents("[id^=column_]").attr("id") )
});
Fiddle: http://jsfiddle.net/maniator/3EJBC/
|
{
"pile_set_name": "StackExchange"
}
|
Pages
Start the year with a haul!
1:22 AM
Hello everyone! Happy new year! I know it's late and I also know that the phrase that I'm going to say rn is so overused but yeah.. "it's better late than never" XD I'm really really sorry for neglecting this blog.. again. D: I've been extremely busy (AGAIN lol) with school stuffs. Actually as long as I'm in school I will never be not busy. OTL Summer vacation please come soon! ;__;
Anyway.. I bought a few stuffs this January and I wanted to show it to you guys. This mini beauty haul is consists of Korean and Japanese stuffs. Mostly Korean though. lol
I actually bought other Dolly Wink products but it hasn't arrived yet. I'm going to post it as soon as it arrived to my doorstep. :P
The Dolly Wink falsies and the Tsubaki Water are the most expensive in this haul but.. I regret nothing! :D I'm so happy I finally get to try Dolly Wink falsies! Well, I haven't really tried it yet but soon I will. :D
As for the other one, I've been using the Tsubaki water for quite a while and so far I'm loving it! Will post a review about it asap. Moving on to the Korean stuffs, I decided to repurchase Skin79 Prestige BB Cream instead of trying a new bb cream because whenever I use it people at school are always telling me that I have baby face and that i have this certain glow. (LMAO) They would always ask me what products I use. LOLOL and of course if I'm going to buy Korean cosmetics, Etude House will never be out of the list. I love Etude House so much and I'm sure you guys already know that. :D I was actually supposed to get the Fresh Cherry Tint in PK001 but I made I mistake (I'm such a fail =_=) so I received the PK002 instead. When I took it out of the box I was shocked because the packaging super hot pink so I thought it's not suitable for school but when i tried it, it turned out to be okay. I still love the PK001 though because it gives your lips a nice touch of pink so it looks very natural. The other product that i adore in this haul is the tear eye liner, also from Etude. It is just so pretty!
Aside from cosmetics I also bought 2 jeans from Jag and wedges from Primadonna. Each of these are over $32 if I'm not mistaken.
I have good news! my brother sent me chocolates! Yay! of course that's
good news. chocolates makes me happy. :D There was actually a lot of
chocolates because my eldest brother went home from the states I just
forgot to take a photo. FACT: My favorite cholate is Hersheys Cookies
and Cream.
I'm going to make this post a little bit longer because I haven't posted for more than a month.. I'm just going to blab things that I need to get out of my chest. lol
Do you guys watch Running Man? I've been watching Running Man since 2010 and I absolutely love each member. They never fail to make me laugh in each episode. Actually the reason why I brought this up is because i miss seeing Song Joongki on Running Man. LOL I rewatched a lot of episodes during the holidays and I miss SongSong couple so much I can't even begin to describe how much I miss them! They look so good together and they look comfortable with each other and skinship comes out naturally. I really miss them!! ;___; Hopefully Joongki will be back on Running Man, if not then please let him and Jihyo be in a drama or movie together as a couple! I ship SongSong couple so hard. lol
"I’m
actually a coward. When I watch horror movies, I don’t have the courage
to open my eyes. If I go to a high place, my legs will shake. But for
me, the most scariest thing is not being able to see you.”
— Song Joong Ki to Song Jihyo (Running Man Ep. 18)
Have you guys heard SNSD's new single? I'm not gonna lie that I got really excited when SMent released the teasers but when the full song was released I swear.. I didn't like I Got A Boy when I first listened to it but after a couple of time of listening to it I eventually learned to like it. My favorite song in their album is Baby Maybe. It's a cute song and I recommend you guys to listen to it. :D
ALSO, listen to Infinite H "Special Girl" I love that song! Hopefully, Woohyun, Myungsoo, Sungyeol and Sungjong will also form a sub unit. Or Woohyun will go solo just like Sunggyu and then we have the Maknae line! I can imaging the maknae line doing a cutie song. *cough*orange caramel*cough*:D
Who is excited for CN Blue's comeback? MEEEEEEEEEE!
Btw, I'm currently watching Flower Boy Next Door (KDRAMA) So far so good. The girl protagonist, Go Dok Mi (Park Shin Hye) is interesting. Episode 3 will air on Monday.
Please look forward to my circle lens review sponsored by UNIQSO. I accidentally deleted the photos so I need to retake it again the problem is it's been raining here for the past 3 days resulting my lighting to be extremely horrible. OTL
I loooooove Ferrero Rocher. You never told me who the girl is in your profile photo by the way, is she a famous Korean singer? We should do an international swap one day as we don't get brands like Etude House and Dolly Wink here!
Hey! It's because I think I accidentally deleted your message.. I can't see it anywhere in my inbox. OTL She's not Korean, she's actually Thai. Her name is Baifern. :D We should! but we don't have Dolly Wink here either. I bought mine from ebay. :D
oh my!! i also love rochero ferrero.. I always have that on my bedroom. I love to eat those during the night haha! i think etude products are nice.. after reading your post i'm going to try that soon :) where have you buy your dolly wink eyelashes? i badly want one haha!
|
{
"pile_set_name": "Pile-CC"
}
|
Well,
now we have some more Coalition-related results from our latest survey to share
with you – specifically on its duration. Here’s the first, on the question of
when the Tories and Lib Dems should
split up. As you’ll see, the most popular choice was “shortly before the 2015
general election”, although the other three options each received around 20 per
cent of the vote:
Then
the question of when the Tories and Lib Dems will split up. Again, “shortly before the 2015 general election”
came out on top, but by a larger margin this time. Only one per cent of party
members believe that the divorce will happen this year, well below the proportion
that wants it to:
And,
to finish, a question about the possibility of another Con-Lib Coalition after
the election. Reversing
the positivity of earlier in the week, it turns out that almost 59 per cent of
party members are either “broadly” or “completely” opposed to such a union:
>Just over 1550 people responded to the
survey, of whom over 700 were Conservative Party members. The figures above are
taken from the latter's views.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Can't create an instance of an array type not listed by suds
i am making a client to access a wsdl and print the response..later on print the response on a web page..however right now I am stuck in the initial code itself....i believe that suds is generating the wrong client methods signature for the wsdl give...the following is my code and the error i get:
print client
Suds ( https://fedorahosted.org/suds/ ) version: 0.4 GA build: R699-20100913
Service ( IWS_GeocodeService_GB ) tns="http://www.g1.com/"
Prefixes (1)
ns0 = "http://www.g1.com/services/IWS_GeocodeService_GB"
Ports (1):
(IWS_GeocodeService_GBPort)
Methods (1):
IWS_GeocodeService_GB(ns0:context context, ns0:options options, ns0:rows rows, )
Types (7):
ns0:IWS_GeocodeService_GBRequest
ns0:IWS_GeocodeService_GBResponse
ns0:context
ns0:options
ns0:requestRow
ns0:responseRow
ns0:user_field
>>> print context1
(context){
account.id = "spectrumd3v"
account.password = "spectrumd3v"
}
>>> rows = client.factory.create('ns0:rows')
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/local/lib/python2.7/dist-packages/suds-0.4-py2.7.egg/suds/client.py", line 234, in create
raise TypeNotFound(name)
suds.TypeNotFound: Type not found: 'ns0:rows'
i am not sure y its finding nso:rows in the first place. Because the type is a responseRow object in the WSDL def but its expecting a row object...so I can't send in the msg request! I need to send in the details in the requestRow object. Help! I am new at this...
EDIT: i tried sending in a Request object instead of the rows...that didn't work and i got the following error
>>> resp = client.service.IWS_GeocodeService_GB(context,options,Request)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/local/lib/python2.7/dist-packages/suds-0.4-py2.7.egg/suds/client.py", line 542, in __call__
return client.invoke(args, kwargs)
File "/usr/local/lib/python2.7/dist-packages/suds-0.4-py2.7.egg/suds/client.py", line 602, in invoke
result = self.send(soapenv)
File "/usr/local/lib/python2.7/dist-packages/suds-0.4-py2.7.egg/suds/client.py", line 649, in send
result = self.failed(binding, e)
File "/usr/local/lib/python2.7/dist-packages/suds-0.4-py2.7.egg/suds/client.py", line 702, in failed
r, p = binding.get_fault(reply)
File "/usr/local/lib/python2.7/dist-packages/suds-0.4-py2.7.egg/suds/bindings/binding.py", line 265, in get_fault
raise WebFault(p, faultroot)
suds.WebFault: Server raised fault: 'Unmarshalling Error: unexpected element (uri:"http://www.g1.com/services/IWS_GeocodeService_GB", local:"context"). Expected elements are <{http://www.g1.com/services/IWS_GeocodeService_GB}row> '
I am attaching the xml for this as well
<wsdl:definitions name="IWS_GeocodeService_GB" targetNamespace="http://www.g1.com/">
<wsdl:types>
<xs:schema attributeFormDefault="unqualified" elementFormDefault="unqualified" targetNamespace="http://www.g1.com/services/IWS_GeocodeService_GB">
<xs:element name="requestRow" type="tns:requestRow"/>
<xs:element name="responseRow" type="tns:responseRow"/>
<xs:complexType name="IWS_GeocodeService_GBRequest">
<xs:sequence>
<xs:element form="qualified" name="context" type="tns:context"/>
<xs:element form="qualified" minOccurs="0" name="options" type="tns:options"/>
<xs:element form="qualified" name="rows">
<xs:complexType>
<xs:sequence>
<xs:element form="qualified" maxOccurs="unbounded" name="row" type="tns:requestRow"/>
</xs:sequence>
</xs:complexType>
</xs:element>
</xs:sequence>
</xs:complexType>
<xs:complexType name="context">
<xs:sequence>
<xs:element form="qualified" name="account.id" type="xs:string"/>
<xs:element form="qualified" minOccurs="0" name="account.password" type="xs:string"/>
</xs:sequence>
</xs:complexType>
<xs:complexType name="options">
<xs:sequence/>
</xs:complexType>
<xs:complexType name="requestRow">
<xs:all>
<xs:element form="qualified" minOccurs="0" name="AddressLine1" type="xs:string"/>
<xs:element form="qualified" minOccurs="0" name="AddressLine2" type="xs:string"/>
<xs:element form="qualified" minOccurs="0" name="City" type="xs:string"/>
<xs:element form="qualified" minOccurs="0" name="PostalCode" type="xs:string"/>
<xs:element form="qualified" minOccurs="0" name="Country" type="xs:string"/>
<xs:element form="qualified" minOccurs="0" name="user_fields"><xs:complexType>
A:
its solved! ideally rows here was just a python list..all i needed to do was add a row object in it of type requestRow which solved my problem... !
|
{
"pile_set_name": "StackExchange"
}
|
/*M///////////////////////////////////////////////////////////////////////////////////////
//
// IMPORTANT: READ BEFORE DOWNLOADING, COPYING, INSTALLING OR USING.
//
// By downloading, copying, installing or using the software you agree to this license.
// If you do not agree to this license, do not download, install,
// copy or use the software.
//
//
// License Agreement
// For Open Source Computer Vision Library
//
// Copyright (C) 2015, Baisheng Lai (laibaisheng@gmail.com), Zhejiang University,
// all rights reserved.
//
// Redistribution and use in source and binary forms, with or without modification,
// are permitted provided that the following conditions are met:
//
// * Redistribution's of source code must retain the above copyright notice,
// this list of conditions and the following disclaimer.
//
// * Redistribution's in binary form must reproduce the above copyright notice,
// this list of conditions and the following disclaimer in the documentation
// and/or other materials provided with the distribution.
//
// * The name of the copyright holders may not be used to endorse or promote products
// derived from this software without specific prior written permission.
//
// This software is provided by the copyright holders and contributors "as is" and
// any express or implied warranties, including, but not limited to, the implied
// warranties of merchantability and fitness for a particular purpose are disclaimed.
// In no event shall the Intel Corporation or contributors be liable for any direct,
// indirect, incidental, special, exemplary, or consequential damages
// (including, but not limited to, procurement of substitute goods or services;
// loss of use, data, or profits; or business interruption) however caused
// and on any theory of liability, whether in contract, strict liability,
// or tort (including negligence or otherwise) arising in any way out of
// the use of this software, even if advised of the possibility of such damage.
//
//M*/
#ifndef __OPENCV_MULTICAMERACALIBRATION_HPP__
#define __OPENCV_MULTICAMERACALIBRATION_HPP__
#include "opencv2/ccalib/randpattern.hpp"
#include "opencv2/ccalib/omnidir.hpp"
#include <string>
#include <iostream>
namespace cv { namespace multicalib {
//! @addtogroup ccalib
//! @{
#define HEAD -1
#define INVALID -2
/** @brief Class for multiple camera calibration that supports pinhole camera and omnidirection camera.
For omnidirectional camera model, please refer to omnidir.hpp in ccalib module.
It first calibrate each camera individually, then a bundle adjustment like optimization is applied to
refine extrinsic parameters. So far, it only support "random" pattern for calibration,
see randomPattern.hpp in ccalib module for details.
Images that are used should be named by "cameraIdx-timestamp.*", several images with the same timestamp
means that they are the same pattern that are photographed. cameraIdx should start from 0.
For more details, please refer to paper
B. Li, L. Heng, K. Kevin and M. Pollefeys, "A Multiple-Camera System
Calibration Toolbox Using A Feature Descriptor-Based Calibration
Pattern", in IROS 2013.
*/
class CV_EXPORTS MultiCameraCalibration
{
public:
enum {
PINHOLE,
OMNIDIRECTIONAL
//FISHEYE
};
// an edge connects a camera and pattern
struct edge
{
int cameraVertex; // vertex index for camera in this edge
int photoVertex; // vertex index for pattern in this edge
int photoIndex; // photo index among photos for this camera
Mat transform; // transform from pattern to camera
edge(int cv, int pv, int pi, Mat trans)
{
cameraVertex = cv;
photoVertex = pv;
photoIndex = pi;
transform = trans;
}
};
struct vertex
{
Mat pose; // relative pose to the first camera. For camera vertex, it is the
// transform from the first camera to this camera, for pattern vertex,
// it is the transform from pattern to the first camera
int timestamp; // timestamp of photo, only available for photo vertex
vertex(Mat po, int ts)
{
pose = po;
timestamp = ts;
}
vertex()
{
pose = Mat::eye(4, 4, CV_32F);
timestamp = -1;
}
};
/* @brief Constructor
@param cameraType camera type, PINHOLE or OMNIDIRECTIONAL
@param nCameras number of cameras
@fileName filename of string list that are used for calibration, the file is generated
by imagelist_creator from OpenCv samples. The first one in the list is the pattern filename.
@patternWidth the physical width of pattern, in user defined unit.
@patternHeight the physical height of pattern, in user defined unit.
@showExtration whether show extracted features and feature filtering.
@nMiniMatches minimal number of matched features for a frame.
@flags Calibration flags
@criteria optimization stopping criteria.
@detector feature detector that detect feature points in pattern and images.
@descriptor feature descriptor.
@matcher feature matcher.
*/
MultiCameraCalibration(int cameraType, int nCameras, const std::string& fileName, float patternWidth,
float patternHeight, int verbose = 0, int showExtration = 0, int nMiniMatches = 20, int flags = 0,
TermCriteria criteria = TermCriteria(TermCriteria::COUNT + TermCriteria::EPS, 200, 1e-7),
Ptr<FeatureDetector> detector = AKAZE::create(AKAZE::DESCRIPTOR_MLDB, 0, 3, 0.006f),
Ptr<DescriptorExtractor> descriptor = AKAZE::create(AKAZE::DESCRIPTOR_MLDB,0, 3, 0.006f),
Ptr<DescriptorMatcher> matcher = DescriptorMatcher::create("BruteForce-L1"));
/* @brief load images
*/
void loadImages();
/* @brief initialize multiple camera calibration. It calibrates each camera individually.
*/
void initialize();
/* @brief optimization extrinsic parameters
*/
double optimizeExtrinsics();
/* @brief run multi-camera camera calibration, it runs loadImage(), initialize() and optimizeExtrinsics()
*/
double run();
/* @brief write camera parameters to file.
*/
void writeParameters(const std::string& filename);
private:
std::vector<std::string> readStringList();
int getPhotoVertex(int timestamp);
void graphTraverse(const Mat& G, int begin, std::vector<int>& order, std::vector<int>& pre);
void findRowNonZero(const Mat& row, Mat& idx);
void computeJacobianExtrinsic(const Mat& extrinsicParams, Mat& JTJ_inv, Mat& JTE);
void computePhotoCameraJacobian(const Mat& rvecPhoto, const Mat& tvecPhoto, const Mat& rvecCamera,
const Mat& tvecCamera, Mat& rvecTran, Mat& tvecTran, const Mat& objectPoints, const Mat& imagePoints, const Mat& K,
const Mat& distort, const Mat& xi, Mat& jacobianPhoto, Mat& jacobianCamera, Mat& E);
void compose_motion(InputArray _om1, InputArray _T1, InputArray _om2, InputArray _T2, Mat& om3, Mat& T3, Mat& dom3dom1,
Mat& dom3dT1, Mat& dom3dom2, Mat& dom3dT2, Mat& dT3dom1, Mat& dT3dT1, Mat& dT3dom2, Mat& dT3dT2);
void JRodriguesMatlab(const Mat& src, Mat& dst);
void dAB(InputArray A, InputArray B, OutputArray dABdA, OutputArray dABdB);
double computeProjectError(Mat& parameters);
void vector2parameters(const Mat& parameters, std::vector<Vec3f>& rvecVertex, std::vector<Vec3f>& tvecVertexs);
void parameters2vector(const std::vector<Vec3f>& rvecVertex, const std::vector<Vec3f>& tvecVertex, Mat& parameters);
int _camType; //PINHOLE, FISHEYE or OMNIDIRECTIONAL
int _nCamera;
int _nMiniMatches;
int _flags;
int _verbose;
double _error;
float _patternWidth, _patternHeight;
TermCriteria _criteria;
std::string _filename;
int _showExtraction;
Ptr<FeatureDetector> _detector;
Ptr<DescriptorExtractor> _descriptor;
Ptr<DescriptorMatcher> _matcher;
std::vector<edge> _edgeList;
std::vector<vertex> _vertexList;
std::vector<std::vector<cv::Mat> > _objectPointsForEachCamera;
std::vector<std::vector<cv::Mat> > _imagePointsForEachCamera;
std::vector<cv::Mat> _cameraMatrix;
std::vector<cv::Mat> _distortCoeffs;
std::vector<cv::Mat> _xi;
std::vector<std::vector<Mat> > _omEachCamera, _tEachCamera;
};
//! @}
}} // namespace multicalib, cv
#endif
|
{
"pile_set_name": "Github"
}
|
Downloadable Media
Hoopla is a collection of movies, television programs, music, and audiobooks available to Wilmette and Kenilworth cardholders. Media is either streamed through a PC or Mac computer or downloaded to a smartphone or tablet using the Hoopla app. Limit: Ten items per month.
Kanopy is a collection of movies and television programs including content from PBS, The Criterion Collection, The Great Courses, Music Box Films, and many more. Media is streamed through a web browsers or the (coming soon!) Kanopy app for your smartphone or tablet. Limit: 10 items per month.
Smartphone/Tablet Instructions
1. Download the Kanopy app from your device's app store.
2. New users: Sign up with an e-mail address, password, and WPL library card number and password. Returning users: Log in with your e-mail address and password.
3. Browse through titles by category or search using the box at the top of the page.
|
{
"pile_set_name": "Pile-CC"
}
|
2012 - 2017 Travel Map - Now in East Glacier Park MT
October 26 – 31, 2016: Our last new camping state for this season will be Oklahoma. We added Georgia, South Carolina, Connecticut, Massachusetts, Vermont, New Hampshire, Maine, and now Oklahoma this year. We have just 6 states left to complete all 50 states now!
Before adding the three new states
and after adding. This time next year this should be completely full.
We stopped in 2 places in Oklahoma, Oak Lake Trail Campground in Depew and then on to the Council Road RV Park in Oklahoma City. Our first stop in Depew was to visit with friends Dave and Alice. Dave and Alice winter at the same place we do in the Rio Grande Valley of South Texas.
Our site at Oak Lake Campground in Depew OK.
Dinner out with Dave and Alice.
Great hosts and good friends, Dave and Alice.
The Oak Lake Park just outside Depew is Dave and Alice’s summer residence. They are in the process of building a beautiful new stick built house that overlooks a vast valley. The view from their new back porch will be wonderful! We spent 2 nights with Dave and Alice to see their park and their new home there. We topped it off with a nice dinner out in the town of Depew. Many thanks to Dave and Alice for your hospitality!Now we are off to visit Oklahoma City.The Oklahoma City campground was just 45 miles southwest of where we were in Depew OK. So this was just about an hour and a half drive to the Council Road RV Park. Since we have such a short drive today we didn’t leave Dave and Alice’s place until about 1:30pm. It was great weather in the low 70s with full on sun. It is absolutely great to travel and to just be outside.
Oklahoma City skyline as we whizzed by.
We passed under the SkyDance Pedestrian Bridge over I40.
The Council Road RV Park is in Oklahoma City’s west side just off of I 40. Council Road RV Park gets its name from, wait for it, it’s actually on Council Road! Not sure if was ever called anything else but is just seems some people just don’t have any imagination! This RV Park is located right beside a bunch of trucker places like Travel America, truck and trailer repair places, and storage yards. Yea, this is not a destination park, it’s a place to park and go somewhere else, perfect for us!
Our site at the Council Road Park.
We have 2 full days or 3 nights to visit Oklahoma City. The only thing we wanted to really see was the bombing memorial downtown. As it is with most places, we may have just a thing or 2 we want to see which turns into more after we are actually there. Oklahoma City didn’t turn out have more for us to see but we did see more than we thought we would see.
We passed this on our way to lunch before the memorial so we stopped to check it out first.
Loads of stuff inside!
Patty trying on hats. None were purchased!
Oklahoma City (OKC) is really a large small city. With its population of about 650,000 it is not really a very big city but it is the largest city in Oklahoma and its capital city. Because OKC is the largest city in Oklahoma and the state capital it has a feel of a city much larger. OKC, like many US cities, is trying to bring back the downtown area. And by the looks of things, it is well on its way! One of OKCs old city areas known as Bricktown has become very trendy. We decided to visit Bricktown as well as the OKC bombing memorial for our 2 day visit.
Bricktown now has a canal area that is trying to fashion its self after San Antonio’s River Walk. They have a long way to go as the canal is very small at this time, but they have ambitions of making it larger. Unlike San Antonio who needed the canals for flood protection, OKC made there canal solely for tourism. They took a couple of streets and dug them out, filled them with water, and they have a canal!
One of many Bricktown murals.
On our first full day in OKC we went to the bombing memorial in downtown. But before getting to the memorial, we went for lunch. We found out that the Oklahoma sandwich to have is the onion burger. The sandwich was developed during the depression when beef was hard to get. To make the beef go farther onion was added to the beef while it cooked. Basically smashing the onion into the beef patty while it was grilling. The taste was something similar to a large White Castle burger.
Several restaurants sell the onion burger. Tucker's specializes in the onion burger though.
Local humor on the walls in Tucker's.
Our beer choice for today with the burgers
The memorial is on the grounds of what was the Murrah Federal building that was destroyed in the bombing. We went on a Saturday afternoon in mid-October and the city was pretty much empty. We could cross a street with no cars and could hear our echo as we walked. So there wasn’t any problem finding a place to park right on the street. We paid $3 for 4 hours which we thought was way too long, we ended up being wrong about that! Interesting is that there are many, many, parking lots with very few cars asking $10-15 for the day to park near the memorial. We are thinking that maybe during the summer months these are needed but they certainly not needed in October on a Saturday though!
Downtown OKC on a Saturday just after noon.
Where the Alfred R. Murrah building one stood.
The memorial is mostly free! The memorial consists of a reflection pool with permanently mounted chairs on one side. The chairs have the name of the person who was killed inscribed on them. The chairs are on a small slope that rises above the reflective pool. The chairs are located in a manner that represents where they were in the building when bomb went off. Also, the chairs of the many children who were killed are smaller than the adult chairs. This area is free and is very moving.
People put notes and memorabilia on the fence outside the memorial.
Pictures of the reflection pool and monuments.
The survivor tree. This tree survived the bombing.
This was the daycare play ground that survived the bombing
The other part of the memorial is the museum next to the free part. The museum is not free but is not costly at just $15 per adult. Usually we don’t like museums too much but we decided to visit this one to learn more about it and we are glad we did! The museum is made up of three floors with the start on the third floor. The museum takes you through the day of the bombing and ends with the memorial being built. One of the most moving parts for me was the recording play back of a meeting being held across the street when the bomb went off. The museum is very well done!
Entrance to the museum.
Kids sent tiles from around the country and some are placed here.
The chairs and reflection pool as seen from the museum.
On our next and last day in OKC we went to the Bricktown area for a ride on a water taxi in the new canal and dinner. Since the canal is sort of new and below street level is was sort of hard to find. Also, unknown to us, it is sort of small at just a mile long. We finally got place to park for $5 in a large parking lot near the canal behind the Bricktown baseball field.
Horse carriage ride in front of the ball field.
After using our phone GPS to locate a cross street to the canal we found it! Next we needed to find the water taxi and figure out how to purchase a ticket. After a few starts, stops, and reverse moves, we found the taxi loading area and where to purchase tickets. The ticket cost was $10 per person and you could use the system all day. The only problem we learned is that it really doesn’t go to many places. A ride from one end of the 1 mile canal to the other 2 times took about an hour.
The canal with the water taxi in the background.
The ride starts in the middle so it goes to one end, turns around, and then back to the other end and then back again to where you started. There are shops and restaurants along the canal sort of like in San Antonio, but mostly they are above you at street level. There is a start to put some shops and restaurants below the street but that is still a work in progress. The canal still has a long way to go to be a destination instead of just a curiosity as it is now.
Views from the water taxi
Our guide on the water taxi
A statue depiction of the land rush here in Oklahoma.
Learned a trivia history lesson on the taxi. The federal government originally owned most of the Oklahoma land to be used for railroad use. After the Railroads were built the land was given away. You just had to show up on a piece of land and claim it on a certain date, hence the land rush. The trivia piece is that some people arrived early, who would know, to get the land. These people were called Sooners. Now it is the state nickname. I thought it was interesting!
After the canal ride we found a nice restaurant in one of the old meat packing buildings called the Bricktown Brewery.
Our dinner choice
The Sky Dance at night on our way back to our RV.
That pretty much sums up our OKC visit! We are glad we visited OKC because we probably won’t be back in our lifetimes. OKC is just on in our travel path to anywhere for us. So going to and stopping in OKC just won’t be on our future itinerary.Next up, Texas for the winter!Stay Tuned!
|
{
"pile_set_name": "Pile-CC"
}
|
Dopexamine increases internal mammary artery blood flow following coronary artery bypass grafting.
Vasoactive agents and inotropes influence conduit-coronary blood flow following coronary artery bypass grafting (CABG). It was hypothesized that dopexamine hydrochloride, a dopamine A-1 (DA-1) and beta(2) agonist would increase conduit-coronary blood flow. A prospective randomized double blind clinical trial was carried out to test this hypothesis. DA-1 receptors have previously been localized to human left ventricle. Twenty-six American Society of Anaesthesiology class 2-3 elective coronary artery bypass graft patients who did not require inotropic support on separation from cardiopulmonary bypass (CPB) were studied. According to a randomized allocation patients received either dopexamine (1 microg/kg per min) or placebo (saline) by intravenous infusion for 15 min. Immediately prior to and at 5,10 and 15 min of infusion, blood flow through the internal mammary and vein grafts (Transit time flow probes, Transonic Ltd.), heart rate, cardiac index, mean arterial pressure and pulmonary haemodynamics were noted. The data were analysed using multivariate analysis of variance. Low-dose dopexamine (1 microg/kg per min) caused a significant increase in mammary graft blood flow compared to placebo at 15 min of infusion (P=0.028, dopexamine group left internal mammary artery (LIMA) flow of 43.3+/-14.2 ml/min, placebo group LIMA flow at 26.1+/-16.3 ml/min). Dopexamine recipients demonstrated a non-significant trend to increased saphenous vein graft flow (P=0.059). Increased heart rate was the only haemodynamic change induced by dopexamine (P=0.004, dopexamine group at 85.2+/-9.6 beats/min and placebo group at 71.1+/-7.6 beats/min after 15 min of infusion). This study demonstrates that administration of dopexamine (1 microg/kg per min) was associated with a significant increase in internal mammary artery graft blood flow with mild increase in heart rate being the only haemodynamic change. Low-dose dopexamine may improve graft flow in the early post CABG period with minimal haemodynamic changes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
A federal grand jury on Friday indicted 12 Russian military intelligence officers with conspiracy to hack into Democrat computers during the 2016 presidential election, the latest charges brought against Russian nationals by the special counsel investigating Moscow's interference.
The indictment charges the operatives with carrying out one of two kinds of the Russian meddling in the contentious election: hacking the email accounts of volunteers and employees of the Hillary Clinton presidential campaign, including its chairman, and releasing the emails and other documents to the public.
The other aspect of the Russian interference involved a massive influence operation on social media orchestrated by a St. Petersburg-based troll farm known as the Internet Research Agency.
In February, a grand jury indicted 12 of the company's employees and its financial backer.
Special Counsel Robert Mueller and Deputy Attorney General Rod Rosenstein announced the latest charges Friday.
"The blame for election interference belongs to the criminals who committed election interference," Rosenstein said at a press conference. "We need to work together to hold the perpetrators accountable, and keep moving forward to preserve our values, protest against future interference, and defend America."
The Russian operatives worked for two special units of Russia's military intelligence agency known as GRU and used a variety of techniques to gain access to the Democratic computers, according to the 29-page indictment.
WATCH: 12 Russians Accused of Hacking Democrats in 2016 Campaign
"The units engaged in active cyberoperations to interfere in the 2016 presidential election," Rosenstein said. "One GRU unit worked to steal information, while another unit worked to disseminate stolen information."
Starting as early as March 2016, the Russians hacked into Clinton campaign accounts, according to the indictment. By April, the operatives also had intruded into the computer networks of the Democratic Congressional Campaign Committee and the Democratic National Committee.
"The Conspirators covertly monitored the computers of dozens of DCCC and DNC employees, implanted hundreds of files containing malicious computer code ["malware"], and stole emails and other documents from the DCCC and DNC," the indictment says.
By July, the Russians, using fictitious online personas, including DCLeaks and Guccifer 2.0, released tens of thousands of the stolen emails and documents from the Clinton campaign and the two Democratic committees, according to the indictment.
FILE - A man walks past the building of the headqu FILE - A man walks past the building of the headquarters of the Russian General Staff's Main Intelligence Department (GRU) in Moscow, Dec. 30, 2016. FILE - A man walks past the building of the headquarters of the Russian General Staff's Main Intelligence Department (GRU) in Moscow, Dec. 30, 2016.
The charges come on the eve of a highly-anticipated summit Monday between U.S. President Donald Trump and Russian President Vladimir Putin in Helsinki, Finland. Trump said at a news conference Friday that he'll "absolutely ask" Putin about the Russian interference in the U.S. election.
Rosenstein said he briefed Trump on the allegations earlier this week.
"The president is fully aware of today's actions by the Department," he said.
Rosenstein said that while the Russian aim was to influence the elections, "there is no allegation that the conspiracy altered the vote count or changed any election result."
The indictment names all 12 agents engaged in the conspiracy, including Viktor Borisovich Netyksho, who headed the GRU unit responsible for hacking the Democratic accounts. The commanding officer of the second unit, which helped release the stolen documents through DCLeaks and Guccifer 2.0, is identified as Aleksandr Vladimirovich Osadchuk.
Eleven agents are charged with conspiring to hack computers, steal documents and release them in an effort to influence the election.
The 12th is charged with "conspiring to infiltrate computers of organizations responsible for administering elections, including state boards of election, secretaries of state, and companies that supply software and other technology used to administer elections," Rosenstein said.
|
{
"pile_set_name": "OpenWebText2"
}
|
[Non septic, surgical complications and their treatment of acute necrotizing pancreatitis in 131 cases].
The authors analyse non septic, surgical complications and their treatment in 131 patients with acute necrotizing pancreatitis. Bleeding occurred in 13 patients 16 times. There were 3 cases with large intestine perforation, small intestine perforation twice in one patient and hydrothorax in 12 patients. The patients APACHE-II score was in the range of 15, 5, which was quite high. They experienced complications such as bleeding and bowel perforations mostly in those who underwent several reoperations. For the bleeding from acute duodenal ulcer conservative and surgical therapy (suturing) was executed. In the cases of intraabdominal bleeding they used several options such as, ligature, collagen mesh, Surgicell net and tamponation. Large intestine perforations were surgically treated with Hartmann's procedure or loop colostomy. The small intestine perforation was simply sutured. From the 12 patients with hydrothorax 8 underwent thoracic drainage. We lost 7 patients with bleeding, 3 with bowel perforations and 2 with hydrothorax. The authors believe that complications during therapy of acute necrotizing pancreatitis are high risk factor, but their treatment is not hopeless.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Compare these two tales of corruption that illustrate how the opportunity to turn a profit distorts our supposedly impartial judicial system.
In 2008, a scandal rocked Wilkes-Barre, Pennsylvania, when the FBI charged two judges, Mark Ciavarella and Michael Conahan, with taking kickbacks from a private juvenile detention facility in exchange for handing down lengthy prison terms to young offenders. Robert Mericle, who had built two for-profit detention centers, and a businessman named Robert Powell paid the judges almost $3 million over a three-year period to help smooth the way for the construction of the facilities and to keep their beds full.
According to an appeals court ruling, “over the course of several years, Ciavarella committed hundreds of juveniles to detention centers co-owned by Powell, including many who were not represented by counsel.” Hundreds of young lives were ruined. Kids, including first-time offenders, were sentenced to juvenile facilities for “offenses” like mocking an assistant principal on Myspace, taking loose change from unlocked cars and trespassing in an abandoned building. In one tragic incident, a star high-school wrestler who had never been in trouble before was sentenced to months behind bars for a minor charge of possessing drug paraphernalia. He missed his senior year of high-school, and became bitter and depressed. His mother would blame his suicide several years later on the corrupt judges.
“By the summer of 2008,” reads the appeals court ruling, “Ciavarella and Conahan, aware that they were under criminal investigation, met with Mericle and Powell to collaborate on their stories, discuss how to mitigate the effects of damaging witnesses, and encourage the destruction of records.” What the others didn’t know is that Powell was cooperating with authorities and wore a wire during the discussion. Judge Ciavarella was sentenced to 28 years in federal prison. Judge Conahan got over 17 years. Robert Powell received a sentence of 18 months as a result of a plea bargain. Robert Mericle pled guilty and awaits sentencing.
When you deliver boxes full of cash to judges in exchange for keeping your private prison profitable and your beds full – when there’s a clear quid-pro-quo – then the FBI will investigate and the perpetrators will likely end up in prison. But a new report issued this week by In the Public Interest, a government watchdog group, shows that you can achieve a similar result through less direct means – lobbying and campaign financing – and it’s perfectly legal.
The report found that 2/3 of a sample of state contracts with private prison companies have “occupancy clauses” that guarantee the companies’ facilities will remain full. The minimum occupancy requirements varied from 80 to 100 percent, with 90 percent being the most common threshold.
With crime rates dropping nationwide, taxpayers are forced to pay the companies compensation if their prison populations fall below the minimum. In some cases, state-owned prisons are now under-populated as detainees have been shifted to for-profit facilities in order to meet these quotas.
According to the report:
These clauses can force corrections departments to pay thousands, sometimes millions, for unused beds — a “low-crime tax” that penalizes taxpayers when they achieve what should be a desired goal of lower incarceration rates. The private prison industry often claims that prison privatization saves states money. Numerous studies and audits have shown these claims of cost savings to be illusory, and bed occupancy requirements are one way that private prison companies lock in inflated costs after the contract is signed. By contractually requiring states to guarantee payment for a large percentage of prison beds, the prison companies are able to protect themselves against fluctuations in the prison population. These provisions guarantee prison companies a consistent and regular revenue stream, insulating them from ordinary business risks. The financial risks are borne by the public, while the private corporations are guaranteed profits from taxpayer dollars.
The report offers examples of some nightmarish results of the cost-cutting measures these private facilities often impose – including housing prisoners in deplorable living conditions, overcrowding, violence, mismanagement and escapes.
There are no boxes of cash involved. But as the report notes, “the for-profit prison industry works hard to ensure harsh criminal laws and elect policymakers that support its agenda.”
The Center for Responsive Politics reports that [Corrections Corporation of America] spent $17.4 million in lobbying expenditures from 2002 through 2012, while GEO Group spent $2.5 million from 2004 to 2012. Similarly, CCA spent $1.9 million in political contributions from 2003 to 2012, and Geo Group spent $2.9 million during the same time period.
A 2011 report by the Justice Policy Institute also found that private prison companies lobbied hard for harsher sentencing laws. Steve Owen, a spokesman for CCA, the nation’s largest private prison company, admitted to the Shreveport Times that the occupancy requirements “are necessary for a feasible business model.”
But government shouldn’t be in the business of keeping an unsustainable industry afloat. And yet that’s just what they’ve done in the past. In 2008, Leslie Berestein reported for the San Diego Union-Tribune that the country’s leading private prison firms – CCA, Geo Group, Halliburton and Management and Training Corp. – lobbied lawmakers to pass harsh new immigration laws, including changes “in the way that immigrant detainees – illegal immigrants, asylum-seekers, legal residents appealing deportation and others – are held.”
“The private prison industry was on the verge of bankruptcy in the late 1990s, until the feds bailed them out with the immigration-detention contracts,” said Michele Deitch, an expert on prison privatization with the Lyndon B. Johnson School of Public Affairs at the University of Texas in Austin. As increasingly tough immigration laws have called for the detention and deportation of ever more immigrants, the demand for bed space by immigration authorities has helped turn what was once a dying business into a multibillion-dollar industry with record revenue and stock prices several times higher than they were eight years ago.
According to Aviva Shen at Think Progress, the private prison industry spent $45 million on immigration lobbying alone. They now enjoy a $5.1 billion industry, with virtually no risk – the risk instead is borne by American taxpayers and those more likely to end up behind bars to fill quotas.
|
{
"pile_set_name": "OpenWebText2"
}
|
BoxParser.stshBox.prototype.write = function(stream) {
var i;
this.version = 0;
this.flags = 0;
this.size = 4+8*this.shadowed_sample_numbers.length;
this.writeHeader(stream);
stream.writeUint32(this.shadowed_sample_numbers.length);
for(i=0; i<this.shadowed_sample_numbers.length; i++) {
stream.writeUint32(this.shadowed_sample_numbers[i]);
stream.writeUint32(this.sync_sample_numbers[i]);
}
}
|
{
"pile_set_name": "Github"
}
|
The goal of plant breeding is to combine, in a single variety or hybrid, various desirable traits. For field crops, these traits may include resistance to diseases and insects, resistance to heat and drought, reducing the time to crop maturity, greater yield, and better agronomic quality. With mechanical harvesting of many crops, uniformity of plant characteristics such as germination, stand establishment, growth rate, maturity, plant height and ear height, is important. Traditional plant breeding is an important tool in developing new and improved commercial crops.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
News and research tips for finding out about ancestors that lived in Hendricks County, Indiana.
Friday, July 12, 2013
Doctor Sanders PORTER Adopted (1896)
As mentioned in Hendricks County Civil Order Book Volume 39 (May 1895 - April 1896), in February 1896, Reason R. Reader petitioned the circuit court to adopt Doctor Sanders Porter as his heir-at-law, noting that Porter's mother was dead and the whereabouts of his father were unknown. The court granted his petition, noting that Porter's name would not be changed.
NOTE: The 1900 Hendricks County census (enumeration of the town of Danville) shows Reason R. Reader born April 1838 and among those listed in his household is "grandson" Doc Porter born January 1890.
|
{
"pile_set_name": "Pile-CC"
}
|
This portrait of the Elector of Saxony (1468 - 1532) is joined as a diptych with the portrait of his son, 'Johann Friedrich the Magnanimous', who succeeded him as elector in 1532. Both portraits are in the original frames.
The pairing of portraits of father and son is unusual, and may have arisen because the six-year-old Johann Friedrich's mother, Sophia of Mecklenburg, died giving birth to him.
On the back is the family coat of arms. The frame is probably original.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Python - JSON to CSV converter explanation
I am doing a data analysis project and I need to convert the files from JSON to CSV. I have discovered this code but as I have not studied Python yet I'm unsure what to do. I'm not sure where I put the file directory or the column names.
If someone would be able to explain where I do this I'd appreciate it!
import argparse
import collections
import csv
import simplejson as json
def read_and_write_file(json_file_path, csv_file_path, column_names):
"""Read in the json dataset file and write it out to a csv file,given the column names."""
with open(csv_file_path, 'wb+') as fout:
csv_file = csv.writer(fout)
csv_file.writerow(list(column_names))
with open(json_file_path) as fin:
for line in fin:
line_contents = json.loads(line)
csv_file.writerow(get_row(line_contents, column_names))
def get_superset_of_column_names_from_file(json_file_path):
"""Read in the json dataset file and return the superset of column names."""
column_names = set()
with open(json_file_path) as fin:
for line in fin:
line_contents = json.loads(line)
column_names.update(
set(get_column_names(line_contents).keys())
)
return column_names
def get_column_names(line_contents, parent_key=''):
"""Return a list of flattened key names given a dict.
Example:
line_contents = {
'a': {
'b': 2,
'c': 3,
},
}
will return: ['a.b', 'a.c']
These will be the column names for the eventual csv file.
"""
column_names = []
for k, v in line_contents.iteritems():
column_name = "{0}.{1}".format(parent_key, k) if parent_key else k
if isinstance(v, collections.MutableMapping):
column_names.extend(
get_column_names(v, column_name).items()
)
else:
column_names.append((column_name, v))
return dict(column_names)
def get_nested_value(d, key):
"""Return a dictionary item given a dictionary `d` and a flattened key from `get_column_names`.
Example:
d = {
'a': {
'b': 2,
'c': 3,
},
}
key = 'a.b'
will return: 2
"""
if '.' not in key:
if key not in d:
return None
return d[key]
base_key, sub_key = key.split('.', 1)
if base_key not in d:
return None
sub_dict = d[base_key]
return get_nested_value(sub_dict, sub_key)
def get_row(line_contents, column_names):
"""Return a csv compatible row given column names and a dict."""
row = []
for column_name in column_names:
line_value = get_nested_value(
line_contents,
column_name,
)
if isinstance(line_value, unicode):
row.append('{0}'.format(line_value.encode('utf-8')))
elif line_value is not None:
row.append('{0}'.format(line_value))
else:
row.append('')
return row
if __name__ == '__main__':
"""Convert a yelp dataset file from json to csv."""
parser = argparse.ArgumentParser(
description='Convert Yelp Dataset Challenge data from JSON format to CSV.',
)
parser.add_argument(
'json_file',
type=str,
help='The json file to convert.',
)
args = parser.parse_args()
json_file = args.json_file
csv_file = '{0}.csv'.format(json_file.split('.json')[0])
column_names = get_superset_of_column_names_from_file(json_file)
read_and_write_file(json_file, csv_file, column_names)
A:
As far as I can see, the json file is one of the arguments when you run the script and the column names are mapped from the json file.
So it should work if you run this script like this:
python script.py json_file.json
|
{
"pile_set_name": "StackExchange"
}
|
Seongsu-dong
Seongsu-dong is a dong, neighbourhood of Seongdong-gu in Seoul, South Korea.
See also
Administrative divisions of South Korea
References
External links
Seongdong-gu Official site in English
Seongdong-gu Official website
Map of Seongdong-gu
Seongsu 1ga-dong Resident office
Category:Neighbourhoods of Seongdong District
|
{
"pile_set_name": "Wikipedia (en)"
}
|
485 F.3d 1351
Keith Lamont JORDAN, Petitioner-Appellant,v.SECRETARY, DEPARTMENT OF CORRECTIONS, Attorney General, State of Florida, Respondents-Appellees.
No. 05-14736.
United States Court of Appeals, Eleventh Circuit.
May 14, 2007.
George Allen Couture, Rosemary T. Cakmis, Fed. Pub. Defenders, Orlando, FL, Maurice C. Grant, II, Fed. Pub Def., Jacksonville, FL, for Jordan.
Edward C. Hill, Jr., Trisha Meggs Pate, Sheron L. Wells, Tallahassee, FL, for Respondents-Appellees.
Appeal from the United States District Court for the Middle District of Florida.
Before CARNES, WILSON and HILL, Circuit Judges.
CARNES, Circuit Judge:
1
Keith Lamont Jordan is serving sentences of life imprisonment and twenty-two years following his conviction in Florida state court for first degree murder, attempted first degree murder, and armed robbery. After the First District Court of Appeal affirmed his conviction, Jordan v. State, 696 So.2d 344 (Fla. 1st DCA 1997) (table), Jordan filed a habeas corpus petition in that same appellate court, which was denied, and then filed in the state trial court a collateral attack on his conviction under Florida Rule of Criminal Procedure 3.850, which was also denied.
2
Thereafter, in September of 2000, Jordan filed his first petition in federal court pursuant to 28 U.S.C. § 2254. The district court dismissed it with prejudice as untimely. He then filed another Rule 3.850 motion for collateral relief in the state trial court. After that motion was denied, Jordan in October of 2003 filed pro se an application in this Court seeking an order permitting him to file a second or successive § 2254 petition in the district court. His application said that he wanted to raise in the petition a claim of actual innocence based on newly discovered evidence.
3
Jordan's actual innocence claim was based on the declaration of two convicted felons he met in prison who said that they had seen someone else commit the crime and on Jordan's own declaration that he did not do it. Jordan sought to explain away his confession as the product of coercion by declaring that he had confessed only because the detectives had threatened to prosecute his mother if he didn't. A panel of this Court found that Jordan had made out a prima facie case under 28 U.S.C. § 2244(b)(2)(B) for filing a second or successive petition in the district court and entered an order permitting him to do so. (Order, Nov. 17, 2003.)
4
Jordan then filed his second § 2254 petition in the district court, which asserted a claim of actual innocence. He also asked for the assistance of counsel, and the district court appointed the Federal Public Defender to represent him. Acting as Jordan's counsel, an Assistant Federal Public Defender filed in the district court a memorandum of law in support of the petition for writ of habeas corpus. That memorandum conceded, on behalf of Jordan, that a freestanding claim of actual innocence did not provide a basis for federal habeas relief. This is that concession:
5
A bare claim of actual innocence based upon newly discovered evidence, without "an independent constitutional violation" does not establish a basis for federal habeas relief. Herrera v. Collins, 506 U.S. 390, 400, 113 S.Ct. 853, 122 L.Ed.2d 203 (1993). While "the federal court must grant an evidentiary hearing" in the presence of newly discovered evidence, the "evidence must bear upon the constitutionality of the applicant's detention." Id., quoting Townsend v. Sain, 372 U.S. 293, 317, 83 S.Ct. 745, 9 L.Ed.2d 770. "[T]he existence merely of newly discovered evidence relevant to the guilt of a state prisoner is not a ground for relief on federal habeas corpus." Id.
6
(Petr.'s Mem. of Law in Supp. of Pet. for Writ of Habeas Corpus 2, Feb. 23, 2004.)
7
Immediately after making that concession, the memorandum argued that Jordan's petition did assert a constitutional claim, which it identified as the allegations that his confession had been coerced and, as a result, its use against him at trial had violated the Fifth and Fourteenth Amendments to the Constitution. This is how the memorandum explained that theory:
8
In Mr. Jordan's case, the petition states the grounds for habeas relief as being "newly discovered evidence supporting claim of actual innocence." At first blush, looking simply at the title of the claim, one might prematurely determine that Herrera and Townsend preclude relief. However, upon review of the facts supporting the claim, Mr. Jordan identifies "an independent constitutional violation." Mr. Jordan claims that his confession was [in]voluntary. Within a declaration attached to the petition, Mr. Jordan states the reason for making the statement was the result of the detectives telling him that his "mother could be charged for criminal negligence since he was a minor." Exhibit C of the Petition. Mr. Jordan further states in the declaration that he "did not provide any written or verbal details" about the incident to the detectives. In short, Mr. Jordan claims that his adoption of the statement drafted by detectives was coerced and not a true statement of his involvement in the incident. As such, Mr. Jordan claims that the detectives violated his rights against self-incrimination as guaranteed by the Fifth Amendment and his due process rights as guaranteed by the Fourteenth Amendment.
9
Mr. Jordan's "claim of innocence is thus `not itself a constitutional claim, but instead a gateway through which a habeas petitioner must pass to have his otherwise barred constitutional claim considered on the merits.'" Schlup v. Delo, 513 U.S. 298, 315, 115 S.Ct. 851, 130 L.Ed.2d 808 (1995), quoting Herrera, 506 U.S. at 404, 113 S.Ct. 853. By alleging the detectives coerced him into adopting a false confession, Mr. Jordan has set forth a claim of "an independent constitutional violation."
10
(Id. at 2-3.) After explaining that Jordan's substantive claim was not actual innocence but coerced confession, the remainder of the memorandum argued that Jordan's confession actually had been coerced. (Id. at 3-8.)
11
Sometime later, the district court issued an order instructing the parties to brief the question whether "there is a federal and/or state claim of substantive actual innocence available to Petitioner in either this Court or in the state courts." (Order, Jan. 13, 2005.) The brief that Jordan's counsel filed in response stated that Jordan no longer had available to him in state court a substantive claim of actual innocence, because when he had attempted to file that claim the state courts had held it was barred as untimely, successive, and not based on newly discovered evidence. (Pet'r Jordan's Br. in Resp. to Ct. Order of Jan. 13, 2005 at 2-5, Feb. 2, 2005.)
12
On the question of whether Jordan could obtain relief in federal court on a substantive claim of actual innocence, his brief was ambivalent. (Id. at 5-7.) It conceded on one hand that language in the majority opinion in Herrera v. Collins, 506 U.S. 390, 113 S.Ct. 853, 122 L.Ed.2d 203 (1993), "appears to bar habeas claims based solely on free-standing assertions of actual innocence," but asserted on the other hand that "the concurring opinion of Justices O'Connor and Kennedy makes clear that a majority of justices agree that habeas relief would be warranted upon a truly persuasive showing of actual innocence, at least in a capital case." (Id. at 5.) The brief noted that other courts were divided on the issue, (id. at 5-6), and suggested that this Court's action in granting Jordan permission to file a successive petition "would seem to indicate" that it "believes that his claim is adequate to deserve encouragement to proceed further," (id. at 7). The brief argued that the district court should, in any event, also construe Jordan's actual innocence claim as a Schlup v. Delo, 513 U.S. 298, 325, 115 S.Ct. 851, 866, 130 L.Ed.2d 808 (1995), gateway claim of innocence and that doing so would permit Jordan to litigate his otherwise procedurally defaulted coerced confession claim. (Id. at 7.) The district court dismissed with prejudice Jordan's petition for a writ of habeas corpus. In doing so, it pointed out that although Jordan had attacked the admissibility of his confession on at least four occasions in state court, and had even testified in a pretrial hearing in an attempt to have the confession suppressed, he never suggested to the state courts that the detectives had threatened to prosecute his mother. (Order 14-16, July 22, 2005.) Jordan had failed to raise this specific claim in state court even though he obviously knew all along whatever it was that the detectives had said to him. For that reason, the district court held that this coerced confession claim was procedurally barred. (Id. at 15-16.)
13
The district court held that the claim was also barred by the second or successive petition rules contained in § 2244(b)(2), because Jordan had known at the time he filed his first § 2254 petition everything the detectives had said to him before he confessed. That fact prevented him from fitting any claim based on those allegations into the § 2244(b)(2)(B)(i) exception. (Id. at 24-25.)
14
To the extent that Jordan was pursuing an actual innocence claim in his second § 2254 petition, the district court ruled that claim was barred because Jordan could have discovered through the exercise of due diligence the two allegedly new witnesses before he filed the first petition. (Id. at 20-24.)
15
After the district court dismissed Jordan's second or successive § 2254 petition with prejudice, he applied for a COA to permit him to appeal, see § 2253(c). The district court denied the application, (Order, Sept. 12, 2005), but a judge of this Court granted a COA, specifying however, that it was granted "on the following issues only":
16
1. Whether a petitioner can bring a new claim in his second or successive 28 U.S.C. § 2254 habeas petition when that claim was not before us in our order granting him leave to file a successive § 2254 petition?
17
2. Assuming that a petitioner can bring a new claim in his successive § 2254 petition that was not raised in his application for a second or successive § 2254, whether the new claim must also meet the newly discovered evidence requirements in § 2244(b)?
18
3. Assuming that a petitioner can raise a new claim in his second or successive 28 U.S.C. § 2254 habeas petition that was not raised in his application for a second or successive § 2254 petition, and assuming that the new claim did not have to meet the newly discovered evidence requirement set forth in 28 U.S.C. § 2244(b), did the district court err in failing to consider whether the petitioner demonstrated a fundamental miscarriage of justice in order to overcome the procedural default in his involuntary confession claim?
19
4. After we granted a petitioner authorization to file a second or successive 28 U.S.C. § 2254 petition, whether a district court can revisit our grant of authority and determine that the petitioner's claim does not meet the threshold requirements for filing a second or successive § 2254 habeas petition under 28 U.S.C. § 2244(b)(2)?
20
5. Assuming that the district court can revisit our grant of authority on a second or successive 28 U.S.C. § 2254 habeas petition, whether the district court properly determined that petitioner's second witness, Theodis Hagans, was not newly discovered as required to meet the requirements for filing a second or successive § 2254 habeas petition as set forth in 28 U.S.C. § 2244(b), and whether the district court should have held an evidentiary hearing to determine if Hagans was newly discovered?
21
(Order 1-2, Nov. 3, 2005 (Wilson, J.) (issue enumerations added)). After setting out those five issues, the COA order stated: "The parties are instructed to brief only the issues above." (Id. at 2.)
22
The first issue stated in the COA order asks if Jordan could bring "a new claim" in the second or successive petition that he did not raise in the § 2243(b)(3)(A) application that we granted permitting him to file the petition. That "new claim" is the coerced confession claim; the actual innocence claim is the only one Jordan raised in his application to us and the only one mentioned in our § 2244(b)(3)(C) order.
23
Recognizing that the COA we granted does not cover the actual innocence claim, Jordan filed a motion in this Court seeking to expand the COA to include that claim. (Mot., Feb. 22, 2006.) The motion, which came in three-and-a-half months after our limited COA order had issued, was treated as a motion for reconsideration. See 11th Cir. R. 22-1(d). Two judges of this Court entered an order denying the motion. This is what their order said:
24
Appellant has filed a motion to expand the certificate of appealability. This motion is in fact a motion for reconsideration because this Court already has considered the question of whether the appellant could bring a freestanding claim of actual innocence and concluded that a certificate of appealability was not warranted in that regard. Therefore, because (1) the original certificate of appealability was granted on November 3, 2005, and appellant did not file the reconsideration motion until February 22, 2006, and (2) appellant has provided no good cause for the untimely filing, appellant's motion for reconsideration is DENIED as untimely. See 11th Cir. R. 27-2. Even if this motion was timely filed, it would be denied because appellant abandoned the freestanding claim of actual innocence in the district court. Appellant is also informed that this Court will not further reconsider this matter. See 11th Cir. R. 27-3.
25
(Order 1-2, Apr. 18, 2006 (Marcus & Wilson, JJ.)).
26
Our refusal to permit Jordan to raise a free standing claim of actual innocence in this appeal could not have been clearer, but it was still not clear enough to prevent counsel for Jordan from attempting to argue that claim at oral argument. As we instructed him then, we will not decide any issues involving the actual innocence claim because the law of this circuit prohibits consideration of any issue that was not specified in the COA order. Murray v. United States, 145 F.3d 1249, 1251 (11th Cir.1998) ("[W]e hold that in an appeal brought by an unsuccessful habeas petitioner, appellate review is limited to the issues specified in the COA."); see also Harrell v. Butterworth, 251 F.3d 926, 928 n. 1 (11th Cir.2001) (declining to address an issue the COA did not cover); McIntyre v. Williams, 216 F.3d 1254, 1256 n. 2 (11th Cir.2000) (same).
27
For what it is worth, our precedent forbids granting habeas relief based upon a claim of actual innocence, anyway, at least in non-capital cases. Brownlee v. Haley, 306 F.3d 1043, 1065 (11th Cir.2002) (alternative holding); see generally Johnson v. DeSoto County Bd. Comm'rs, 72 F.3d 1556, 1562 (11th Cir.1996) ("we are bound by alternative holdings"); McLellan v. Miss. Power & Light Co., 545 F.2d 919, 925 n. 21 (5th Cir.1977) ("It has long been settled that all alternative rationales for a given result have precedential value.").
28
Turning now to the issues properly before us, all of which center around the coerced confession claim, we believe that the most efficient way to proceed is to assume that the answer to the first issue is "yes." For present purposes, we will take as a given that a petitioner may raise in a second or successive petition an issue in addition to the one that the court of appeals granted him permission to raise in its § 2244(b)(3)(A) order.
29
Assuming that is so, the second question framed by the COA is whether that additional issue must also meet "the newly discovered evidence requirements in § 2244(b)[(2)(B)(i)]." The answer to that question is easy. Section 2244(b)(2) plainly states that "[a] claim presented in a second or successive habeas corpus application under section 2254 that was not presented in a prior application shall be dismissed unless" it falls within one of two exceptions. The first exception, which is contained in § 2244(b)(2)(A), speaks to claims based on new rules of constitutional law, and Jordan's coerced confession claim is based on old rules of constitutional law. The other exception applies only where each of two requirements are met, and one of them is that "the factual predicate for the claim could not have been discovered previously through the exercise of due diligence." § 2244(b)(2)(B)(i).
30
In cases where the petitioner is not claiming the benefit of a new rule of constitutional law, if he does not meet the newly discovered evidence requirement his claim "shall be dismissed." § 2244(b)(2). Another provision in the same section makes clear that the district court "shall dismiss any claim" that fails to satisfy the requirements of the section even if the court of appeals authorized the filing of the claim. § 2244(b)(4). The question, then, is whether Jordan has met the newly discovered evidence requirements of § 2244(b)(2)(B)(i) as to his coerced confession claim. That is essentially the fifth COA issue, but before we get to it we need to discuss the third and fourth ones.
31
The third COA issue comes into play only "assuming that the new claim did not have to meet the newly discovered evidence requirement set forth in 28 U.S.C. § 2244(b)." Our answer to the second question forecloses that assumption.
32
The fourth COA question asks whether, after we have granted an order under § 2244(b)(3)(A) authorizing a district court to consider a second or successive petition, the district court can determine if the petitioner's claim meets the § 2244(b)(2) requirements for filing such a petition. The answer is that the district court not only can, but must, determine for itself whether those requirements are met. The statute instructs the court to do so. It provides that: "A district court shall dismiss any claim presented in a second or successive application that the court of appeals has authorized to be filed unless the applicant shows that the claim satisfies the requirements of this section." § 2244(b)(4).
33
Jordan recognizes the meaning of those words but would have us dilute them with a requirement that the district court give some deference to a court of appeals' prima facie finding that the requirements have been met. He argues that "the district court should not be allowed to review the same evidence as this Court and make the exact opposite factual determinations." (Appellant's Br. 29, 28-30.) But the relevant statutory provisions say nothing about deference, and in issuing a § 2244(b)(3)(A) order authorizing the filing of a second or successive petition in the district court, we do not make any factual determinations. We make only a prima facie decision for § 2244(b)(3)(A) purposes.
34
When we make that prima facie decision we do so based only on the petitioner's submission. We do not hear from the government. We usually do not have access to the whole record. And we often do not have the time necessary to decide anything beyond the prima facie question because we must comply with the statutory deadline. See § 2244(b)(3)(D) (requiring a decision within 30 days after the motion is filed). Even if we had submissions from both sides, had the whole record before us, and had time to examine it and reach a considered decision on whether the new claim actually can be squeezed within the narrow exceptions of § 2244(b)(2), the statute does not allow us to make that decision at the permission to proceed stage. It restricts us to deciding whether the petitioner has made out a prima facie case of compliance with the § 2244(b) requirements.
35
Things are different in the district court. That court has the benefit of submissions from both sides, has access to the record, has an opportunity to inquire into the evidence, and usually has time to make and explain a decision about whether the petitioner's claim truly does meet the § 2244(b) requirements. The statute puts on the district court the duty to make the initial decision about whether the petitioner meets the § 2244(b) requirements — not whether he has made out a prima facie case for meeting them, but whether he actually meets them.
36
Given these circumstances, it would make no sense for the district court to treat our prima facie decision as something more than it is or to mine our order for factual ore to be assayed. The district court is to decide the § 2244(b)(1) & (2) issues fresh, or in the legal vernacular, de novo. See In re Johnson, 322 F.3d 881, 883 (5th Cir.2003) (court of appeals' grant of permission to file a second or successive petition is only tentative and the district court must dismiss the petition if it finds that the statutory requirements for filing one have not been met); Bennett v. United States, 119 F.3d 468, 469-70 (7th Cir.1997) (recognizing that the court of appeals' determination of a prima facie case means "simply a sufficient showing of possible merit to warrant a fuller exploration by the district court" and it gets the petitioner through one of the two gates he must pass through before the merits of his petition may be considered). Our first hard look at whether the § 2244(b) requirements actually have been met will come, if at all, on appeal from the district court's decision, and we are taking that hard look now.
37
We can now resolve the fifth issue stated in the COA order, which asks whether the expected testimony of Jordan's second witness, Theodis Hagans, was newly discovered for purposes of meeting the requirements of § 2244(b)(2)(B)(i), and whether the district court should have held an evidentiary hearing to decide if was. The answer to both questions is that it does not matter whether Hagans' testimony was newly discovered and for that reason no evidentiary hearing was necessary. It does not matter whether Hagans' testimony was newly discovered because even if it were, the testimony is not part of "the factual predicate for the claim" as § 2244(b)(2)(B)(i) also requires.
38
Hagans is one of the two witnesses Jordan proffered to prove that he was actually innocent; Hagans was willing to testify that he saw someone other than Jordan commit the crime. Actual innocence, however, is not an element of a coerced confession claim. A defendant's Fifth and Fourteenth Amendment right not to be forced to confess or forced "to be a witness against himself," U.S. Const. Amend. V, is not a prerogative of the innocent. It is a privilege available even to the guiltiest of the guilty. To put it in § 2244(b)(2)(B)(i) terms, innocence is not part of "the factual predicate for the claim" of coerced confession.
39
The factual predicate for the claim consists of the facts describing the coercion that produced the confession. Those facts — if Jordan's allegations be true — are that the detectives threatened to prosecute his mother if he did not confess. What matters under § 2244(b)(2)(B)(i) is whether Jordan, with the exercise of due diligence, could have discovered those facts at the time he filed his first federal habeas petition. He not only could have discovered those facts, he actually did know them. Because he knew all along what the detectives had said to him, Jordan's confession claim is not based on new evidence at all.
40
Jordan does not really argue that he meets the requirements of § 2244(b)(2)(B)(i). Instead, he argues that he does not have to meet them because his attempt to file a second or successive petition ought to be judged by the standard set out in Schlup, 513 U.S. at 325, 115 S.Ct. at 866, which is more lenient than the one the statute imposes, Cooper v. Woodford, 358 F.3d 1117, 1119 (9th Cir.2004) (en banc) ("The AEDPA requirements for a second or successive application are stricter than the Schlup standard in two ways."). The Schlup decision provided the standard for filing a second or successive petition, at least in capital cases, before the Antiterrorism and Effective Death Penalty Act took effect. That Act, including the provisions now found in § 2244(b), became effective in April of 1996, which was seven years before Jordan sought permission in October of 2003 to file his second or successive petition. We have neither the power nor the inclination to turn back the clock and pretend that the AEDPA was not enacted. See Felker v. Turpin, 518 U.S. 651, 664, 116 S.Ct. 2333, 2340, 135 L.Ed.2d 827 (1996) (the added restrictions which AEDPA places on second and successive petitions fall well within Congress' authority). It was enacted, and its provisions govern second or successive petitions.
41
Because Jordan's coerced confession claim is not based on a factual predicate which could not have been discovered previously through the exercise of due diligence, as required by § 2244(b)(2)(B)(i), the district court properly dismissed it, as it was obligated to do by § 2244(b)(4).
42
AFFIRMED.
|
{
"pile_set_name": "FreeLaw"
}
|
4)) + -18?
-21
What is -8 + 29 + 5 + -11 + -6 + 15?
24
Calculate (-9 - 22) + 11 + (9 - 8).
-19
What is -5 + 1 + 10 + (0 - 1)?
5
Calculate -420 + 396 - (-32 + -2).
10
Evaluate (14 - -1) + (-14 - 0).
1
Calculate 11 + -3 - (6 + (-11 - -14)).
-1
What is 3 + -3 + 4 + 1 + -4 + -3?
-2
Evaluate (14 - -1 - -13) + -23.
5
What is -5 - (-1 - (-17 + (9 - 1) - -7))?
-6
Calculate 1 + -2 + 1 - (-15 + 28 + -14).
1
(11 - -1) + -13 + 16 + -9 - -7
13
-2 - (40 + -37 + 3 + 1 + -15)
6
Calculate -11 + 11 - 8 - 4.
-12
What is the value of -8 + (-1 - 0 - -2) - -21?
14
Calculate 3 + 0 - (11 + (10 + 2 - -1)).
-21
Calculate -10 - (-38 - -45 - (3 - 0) - -4).
-18
Evaluate -36 + 9 - (-17 - 7).
-3
What is (-17 - 6) + (16 + -20 - -11)?
-16
Calculate (-30 - 0) + 116 + -61.
25
Calculate (-1 - -11 - (56 + -34)) + 7.
-5
Calculate -2 + ((6 - 0) + -4 + -3 - -4).
1
Calculate (-34 - -66 - 62) + 63.
33
(5 - 1 - 29) + 3
-22
15 + -2 + (3 + -10 - 2 - -2)
6
What is (-1 - 13 - -15) + -12 + 3?
-8
Evaluate -5 + (18 - (6 - 2)) - 2.
7
-13 + 15 + -1 - (-18 + 2)
17
Calculate (-9 - -23) + (48 - 32) + 1 + -9.
22
(-22 - -20 - 4) + -10
-16
Calculate -10 + -1 + (23 - 20) + 5 + -8.
-11
Evaluate -14 + 19 + -8 + -2.
-5
Evaluate 8 - (-8 - -12 - (-2 + 4) - 10).
16
What is the value of (3 - 1) + 6 + 6?
14
What is the value of 3 + -9 + -11 + 24 + -1 + -17?
-11
What is -1 + 14 + -20 + -2 + 17?
8
What is (60 - 64 - (-12 - -3)) + -29?
-24
Evaluate 10 + 4 + -9 + (24 - 13).
16
What is 1379 + -1393 + 1 + 16?
3
Calculate (-68 - -67) + (-15 - (-3 - -2)).
-15
What is the value of (-42 - -37) + (4 - 9)?
-10
What is the value of (-4 - 8) + (134 - 138)?
-16
15 - (-5 + 11 + -6)
15
Evaluate -37 - (-103 + 47) - (-1 + -5 - 0).
25
What is the value of -4 + 24 - (-12 + 21 + -1)?
12
Evaluate (0 - (-24 + -5)) + -15.
14
Evaluate 13 + -9 - 0 - (49 + -38).
-7
What is (-9 + 16 - -2) + 4 + -41?
-28
What is -2 + 0 + 37 + 11 + -52?
-6
-8 + -1 - (25 - 10 - 21)
-3
Calculate (-8 - 0) + (-21 - -5 - -20).
-4
Evaluate 0 + 2 + 3 + 0 - -5.
10
What is -11 - (-4 + -1 + -2 + (21 - 15))?
-10
Evaluate 46 + (33 - 55 - 18).
6
Evaluate 1 - -13 - (-16 + 38).
-8
10 + (-5 - (1 - 6 - -4)) - 2
4
What is the value of (-29 + -1 - (-153 - -142)) + 8?
-11
Calculate 127 + -141 + (0 - -10) - (-1 + 3).
-6
Calculate 30 + -25 + (7 - 3) + -23.
-14
(-5 + (-6 - (-8 + 3)) - -10) + -19
-15
What is the value of (-25 - (-8 - 15)) + -12?
-14
Calculate (-242 - -267 - (-1 + -7)) + -9.
24
What is 2 - (-18 - (9 - 28))?
1
17 - 11 - -9 - 2
13
What is (12 - 6) + -4 - -3?
5
Evaluate -13 + 1 - (-57 + (6 - -22)).
17
What is the value of -39 - (-8 - 36) - ((-1 - -2) + -21)?
25
Evaluate -4 + 3 + 2 - (17 - 13).
-3
0 + (-17 + 9 - -8) - 12
-12
What is the value of 6 + (-7 - 12) + 3 + (3 - 1)?
-8
Evaluate -12 - (3 - (13 - (7 + -3))) - -1.
-5
-6 + -2 - (46 + -51)
-3
Evaluate 21 - (-18 + (-9 - 2 - -38)).
12
Evaluate (-36 - -34) + 17 + -10.
5
Calculate (-1 - -1) + 2 + -5 + -6 + 6.
-3
What is 6 + 0 + -19 + 9 - (2 + 1)?
-7
Evaluate (-4 - 0) + 8 + -3 + 455 + -451.
5
What is (2 + -4 - -2 - 6) + 1220 + -1208?
6
What is (3 + 6 - 1) + -31 + 29?
6
What is the value of -11 + 0 + (84 - 63) + -31?
-21
Calculate 12 - 2 - (518 - 523).
15
What is the value of (1 - (-1 - (-7 + 4))) + 78 + -75?
2
Calculate (-28 - 0 - (33 + -48)) + 1.
-12
Evaluate 24 - (4 + -15 + 2 - -4).
29
What is the value of (0 - -4 - (3 + -10) - -2) + -3?
10
Calculate 10 + (-3 + 8 + -1 - 7).
7
Evaluate -1 - ((-8 + 6 - -13) + -17) - 38.
-33
What is 16 + (23 - 16 - 35) + -5?
-17
Calculate 4 + 8 - -2 - -2 - 9.
7
Evaluate -58 - -66 - (4 - -1).
3
What is -13 - ((2 - 3 - -4) + 3)?
-19
(39 - -1) + -26 + -3 + 1
12
Evaluate 17 + (-24 - 5) + (1 - 13).
-24
What is (12 - 13 - -14) + -7 + 0?
6
Calculate -14 - (-6 + -3 + 8).
-13
Evaluate -33 - (-7 + 5 + -4 + 12 + -2).
-37
What is 4 + (5 - (4 - -4) - 2)?
-1
Calculate -2 - (8 + (8 - 1) + -25 + 8).
0
Calculate 10 - -5 - (15 - 8).
8
Calculate -44 + (2 - -28) + (-2 - (1 + -5)).
-12
Calculate -23 + 36 - 12 - 2.
-1
2 + (-2 - 8) + (-1 - -1 - -2)
-6
What is the value of -16 + (-5 - -15) + -3 + 3 + -3?
-9
Calculate -27 + -1 + 14 + -3.
-17
Calculate 3 + 1 + 16 + -19.
1
Calculate 10 + -14 + (-13 + 18 - -15).
16
-45 + (23 + 47 - 17)
8
What is the value of -18 + (-15 - -10 - -15) + -3?
-11
Evaluate 15 - 8 - (13 - 0) - (14 - -2).
-22
What is -1 + 5 + (-68 - -80) - 0?
16
Evaluate 7 + 7 + -8 + -4 + -5.
-3
What is -4 + (0 - 0) + (-12 - -30)?
14
-5 + (45 - (-2 + 8))
34
What is the value of -54 - -56 - (0 - -1) - (-13 - -1)?
13
What is 8 - (-2 - -11 - 0 - 10)?
9
What is the value of 0 + (-5 - (-4 - (1 - -4))) + 6?
10
What is the value of 0 + 12 + -4 + (3 - 13)?
-2
Evaluate (13 - (-1 + 0)) + (18 + -22 - -2).
12
Evaluate -1 + (-2 + 0 - (3 - 4 - 2)).
0
-7 - ((-23 - -13) + -3 + 0)
6
Calculate -123 + 149 + (-14 - -3).
15
Calculate (-26 - -6 - -27) + -2.
5
Calculate (-22 - -13) + 6 + -1.
-4
Calculate (22 - 0) + (-116 - -87) - (0 + -10).
3
What is 9 - (16 + -15 + 20)?
-12
2 + 3 - (112 + -113)
6
What is 12 + -5 + (-165 - -178)?
20
7 + -18 + 15 + -5 + 1 + -8
-8
What is the value of -16 - (2 - (-1 - (-6 + 0 + 9)))?
-22
Evaluate 22 + (0 - 1 - 6) - (-1 - -3).
13
Evaluate -117 + 137 - ((3 - (1 - 1)) + 0).
17
What is the value of -4 + -6 + 19 + (-4 - -1) + 5?
11
9 + (-23 + (12 - 1) - -17)
14
What is 15 + (11 - 11 - (5 - -8))?
2
What is the value of -14 + 10 + 20 + -32?
-16
What is the value of 19 + (-3 + 9 - 1) + 7 + -2?
29
Evaluate 229 + -254 + -7 + -5.
-37
(22 + -20 - (-6 + 7)) + (1 - 7)
-5
(441 - 438) + (17 - (0 - 1 - -1))
20
What is (-20 - -18) + -1 + -6 - -6 - -10?
7
What is 9 - (1 - 1) - (-198 + 204)?
3
-21 - (3 - (6 - -5 - 7) - -5)
-25
What is the value of -9 - -1 - -19 - 3?
8
What is the value of -7 - (-14 + 23 - 12)?
-4
What is the value of (46 - 1) + 346 + -397?
-6
Calculate 7 + 1 + -6 + 0 + (-90 - -92).
4
What is the value of 3 + 2 + (-6 + 17 - 3) - 3?
10
Calculate 9 - 4 - (2 - (-8 + (4 - 3))).
-4
What is the value of 3 - ((-1 + -2 - -4) + (60 - 51))?
-7
What is 34 + -4 + -9 + (14 + -4 - 4)?
27
434 - 434 - (2 - (1 + -16))
-17
What is -2 + -37 + (-2 - -21)?
-20
Evaluate -48 - (-5 - -8 - 5) - -16.
-30
What is 16 + (-13 + 11 - 2)?
12
515 - 493 - (-2 + 7)
17
What is (1 - 0 - -21) + 20 + -17 + -7?
18
Evaluate -2 + (1 - 4) - ((41 - 19) + -17).
-10
What is 28 + (-1 - (11 - 1)) - 8?
9
What is (1 - 0) + 12 + -21 + (-4 - 0)?
-12
What is -4 + 3 + 19 - (35 + -28)?
11
What is the value of 1 - (7 + -5 - 12)?
11
Calculate -5 + (1 - -11) + (-12 - -10) - 4.
1
Evaluate -9 - (-2 - -8) - -18.
3
What is the value of 2 + 5 + -1 + -5?
1
-6 - (9 + 0 - 6 - 9)
0
Calculate (5 - 38) + (-16 - -11 - -15) + -3.
-26
What is the value of (-21 - (-1 + 2 + (-17 - -24))) + -2?
-31
Calculate 132 - 155 - (-4 - (-2 - (-4 - -2))).
-19
Evaluate (1 - 3) + 2 + -1 - (-1935 - -1950).
-16
Evaluate 0 - 10 - (12 - ((24 - 33) + 22)).
-9
Calculate 6 + (-2 - -10) + (3 - 3).
14
What is (-15 - (9 - (12 - 4))) + 8?
-8
What is the value of 31 - (27 - 26) - 10?
20
What is -2 + (15 - (-5 - -15) - (20 - 3))?
-14
Calculate 5 - (-17 + 10 + (-19 - -2)).
29
Evaluate 2 + (13 - 22) + -1 + 8.
0
Evaluate 4 + -4 + -5 - (-3 + (-4 - -4)).
-2
What is the value of 12 + (1 - (-4 + 4 + (-4 - 1)))?
18
Evaluate 8 - (-33 + 29 - (1 - 2 - -1)).
12
What is (19 - (1 + 13)) + 5?
10
What is the value of (5 + -3 - -5) + -6 + 0 + 2?
3
Evaluate (-3 - (-16 + 18 + 4)) + (0 - 0).
-9
-9 - ((-13 - -11) + -11)
4
What is -21 + 15 + -17 + -11 + 13?
-21
What is the value of (-1 - 7 - -2) + -20 + 15?
-11
Calculate 8 + (0 - 12 - (35 - (-2 - -23))).
-18
Evaluate -8 + -18 + -1 + 27.
0
What is the value of -24 + 24 - 18 - -14?
-4
Evaluate (6 - -6 - (3 + -2)) + 4.
15
What is the value of -11 + 1 + 12 + 34 + -3 + -14?
19
What is the value of 13 - (-1 + 1) - (-1031 - -1023)?
21
What is (54 + -68 - -26) + (-10 - -3)?
5
(-3 + 1 - -6) + (1 - (20 + -4))
-11
Evaluate -2 - (-6 - (-3 + -11 + 15)).
5
What is -11 - (-20 + (33 - 31))?
7
Evaluate (14 - 57) + 37 + 7 + (-2 - -1).
0
What is the value of 12 + -11 + -14 - -4?
-9
Calculate -1 - 3 - (-13 - 9 - -3).
15
What is the value of 16 + 3 + -10 + (-16 - -15) + -3?
5
What is the value of 1320 + -1329 - (-22 - -1)?
12
Evaluate 1 - (-3 - -4 - (-14 - -22)).
8
What is the value of 5 - (-3 + -2 + 5 - -25 - 2)?
-18
What is (-12 - -37) + -8 + -15?
2
Calculate 45 - (20 + 2 - -1).
22
Cal
|
{
"pile_set_name": "DM Mathematics"
}
|
University of North Carolina Wilmington
The University of North Carolina Wilmington (UNCW or UNC Wilmington) is a public research university in Wilmington, North Carolina. It is part of the University of North Carolina System and enrolls 16,747 undergraduate and graduate students each year.
History
UNCW opened its doors on September 4, 1947 as Wilmington College. At the time the school operated as a junior college, offering freshman-level courses to 238 students during the first school year, 75% of whom were veterans returning from military service following World War II. Under the control of the New Hanover County Board of Education, Wilmington College earned accreditation from the North Carolina College Conference in 1948 and became a member of the American Association of Junior Colleges. Further accreditation came in 1952 from the Southern Association of Colleges and Schools.
In 1958, Wilmington College was placed under the Community College Act of North Carolina, passing control from the New Hanover County Board of Education to a board of trustees as a state-supported college under the supervision of the North Carolina Board of Higher Education.
Wilmington College became a four-year liberal arts college on July 1, 1963, when the North Carolina General Assembly passed legislation allowing the school to award bachelor's degrees. Six years later, July 1, 1969, the school was elevated to university status under its present name, becoming the fifth campus of the University of North Carolina system. On August 22, 1977, UNCW was authorized to offer its first graduate programs at the master's level.
The school offers 55 bachelor's degrees, 35 master's degrees and four doctoral degrees: Ed.D. Educational Leadership; Ph.D. Marine Biology and Psychology and a Doctorate in Nursing Practice.
Academics
The university is organized into seven colleges:
College of Arts and Sciences
Cameron School of Business
College of Health and Human Services
Watson College of Education
Graduate School
Honors College
University College
The university has 55 undergraduate degree programs, 35 master's degree programs and four doctoral programs.
Rankings
Randall Library
William Madison Randall Library supports the mission of UNCW through the provision of information resources, services and programs relevant to the needs of its students, faculty and staff. To accomplish this mission, the library provides diverse collections of informational resources in multiple formats, including assistance and instruction in identifying, evaluating and interpreting these resources.
Randall Library has two floors. The first floor features computer banks, group work areas, the Technology Assistance Center, and a coffee shop for students. The floor has a very social atmosphere, and is commonly used to complete group assignments. The second floor has a strictly enforced quiet policy.
Most recently added to the library are charging kiosks. The kiosk located near TAC in the back of the library "provides six secure lockers to store your [iPhone, Android, iPad or other tablets] while it charges."
Centers, institutes, and extensions
Center for Support of Undergraduate Research and Fellowships
Center for Teaching Excellence
Center for Marine Science
Center for Innovation and Entrepreneurship
ETEAL
Osher Lifelong Learning Institute
Swain Center for Professional and Continuing Education
Student life
Campus life
The university offers degrees in humanities, sciences, health, business and professional fields. The university's highly ranked marine science program draws a variety of undergraduate and graduate students from across the United States. The proximity to the Atlantic Ocean is a draw for incoming freshmen.
Teal is the official school color of UNCW, with navy and gold as alternate colors.
The average high school GPA was 4.13 for incoming freshmen in 2018, and the SAT average score was 1251.
Student facilities
In 2000, the Student Recreation Center was opened to students, staff, and faculty members. It houses three basketball courts, exercise machines, a weight training area, an indoor running track, and an indoor climbing wall. It also includes a group exercise room which supports multiple clubs and activities, including Yoga, Pilates, and an Aikido club. In 2012, the Student Recreation Center completed an expansion of facilities, as well as construction on a new nadatorium. This construction doubled the size of the existing Recreation Center.
Lumina Theater, named after the boardwalk theater that was once found on Wrightsville Beach features 333 stadium seats, a 15.5' x 30' screen, Dolby Digital surround sound, 35mm capabilities and a digital projection system. Lumina screens blockbusters, independents, cult classics, art films, international films and student films throughout the academic year, four or more days a week, except during University holidays and breaks. Some notable Lumina events included a multi-part, high-definition screening of BBC's Planet Earth series over the span of several weekends, and a yearly 24-hour movie marathon called Hawk-In.
Residential accommodation
Galloway Hall is UNCW's first residence facility on campus, and has a standard hall-style double room arrangement with shared bathrooms for the entire hall. Housing 400 students, predominately Freshman, Galloway has a very social atmosphere. It was the first dorm in the UNC system to be built with air condition and was originally called "Dorm '71".
Graham-Hewlett and Belk residence halls are configured in suite-style hall arrangements with up to eight individuals sharing a bathroom. Graham-Hewlett houses 384 residents and Belk houses 192 residents, and both facilities consist of predominately first-year students. Originally a co-ed facility, Belk Hall was all female for quite some years before returning co-ed beginning in the 2016-2017 academic year.
Schwartz Hall houses 160 residents, and is home to mostly first-year students. A double room layout features shared bathrooms but is distinguished by its "pod" layout in contrast with the typical hall style areas.
Newer residence halls on campus include Honors (100 Honors Scholar residents), Innovation (100 residents) and Cornerstone Hall (265 residents) and are arranged with a courtyard between them to form what is referred to as "Tri-House". These residence halls were constructed in the late 1990s and early 2000s and are home to the living and learning communities and the Honors college.
University Suites, built in the late 1980s, include seven suite buildings which can also house 400 students. Two floor plans consist of six bedroom units housing 12 students and 10 bedroom units housing ten students. All residents of the Suites share bathrooms, living rooms, and kitchens. University Suites are home to various sororities who have personalized suites in the area.
Seahawk Village is an apartment complex of housing 524 students in 2- 3- or 4 bedroom apartments and houses upperclassmen students. Seahawk Village features a club house with swimming pool. The apartments are fully furnished and feature a full-service kitchen and washer and dryer in each apartment.
Seahawk Landing features living arrangements similar to that found in the Seahawk Village facility, with expanded amenities including a sandwich shop, convenience market, and an on-site mail center. Seahawk Landing houses 603 students in seven apartment buildings, predominately upperclassmen.
Seahawk Crossing is the most recent addition to residential facilities on campus. Seahawk Crossing's four apartment buildings comprise four, six, and eight bedroom apartments and house 662 students. Apartment-pod style rooms are fully furnished, and residents are allowed access to the Seahawk Crossing parking deck.
There are currently four new residence halls under construction, in the proximity of Galloway and Graham-Hewlett. Two of those buildings are expected to be completed by the Fall of 2020, while the other two will be completed in the Fall of 2021.
Campus dining
UNCW has several options for campus dining. The primary venue for dining on campus is Wagoner Hall, commonly referred to as Wag by students and staff. Wagoner Hall serves as a standard dining hall setup, with various stations offering a variety of foods, including a salad bar and assorted desserts. Wagoner Hall is also host to "Wagsgiving", thanksgiving for students. Students have termed the sick feeling or upset stomach that sometimes results from eating at Wagoner Hall as getting "the Waggles."
The newly renovated Dub's Café, located in Warwick Hall, offers fewer options than Wagoner Hall, but is modeled in a similar cafeteria style.
The Fisher University Union houses Hawk's Nest, a dining center where students can choose from a wide assortment of available options. Hawk's Nest offers Mexican food, Mediterranean food, pizza, Asian cuisine, hamburgers and fries, sushi, Chick-fil-A and Subway. Also in Hawk's Nest there is a green and locally inspired grab and go restaurant.
Other on-campus dining options include Einstein Bros. Bagels, Courtside Bagel Shop, Dunkin Donuts, Port City Java, Landing Sandwich Shop and multiple convenience stores.
Greek life
Greek-letter societies became an early part of student life at UNCW when the first social fraternity was formed in January 1964, just six months after Wilmington College became a four-year institution. Fraternities and Sororities have continued to grow at UNCW with membership now above 12 percent of the overall student population, exceeding the national average. There are 15 social fraternities and 11 social sororities. The National Pan-Hellenic Council has 6 historically black organizations, three fraternities and three sororities. UNCW also has one Christian sorority. Several fraternities and sororities have on-campus housing in University Suites and University Apartments. More recently, Alpha Psi Lambda, a coeducational Latino-based fraternity, has established a colony at UNCW.
Fraternities
There are currently 15 national fraternities at UNCW:
Alpha Sigma Phi
Alpha Psi Lambda
Alpha Tau Omega
Chi Phi
Delta Chi
Delta Kappa Epsilon
Delta Sigma Phi
Delta Tau Delta
Kappa Alpha Order
Kappa Sigma
Lambda Chi Alpha
Phi Gamma Delta
Pi Kappa Alpha
Pi Kappa Phi
Sigma Alpha Epsilon
Tau Kappa Epsilon
Sororities
There are currently 11 national sororities at UNCW:
Alpha Chi Omega
Alpha Delta Pi
Alpha Gamma Delta
Alpha Phi
Alpha Xi Delta
Chi Omega
Delta Zeta
Delta Gamma
Kappa Delta
Phi Mu
Sigma Sigma Sigma
National Pan-Hellenic Council, Inc.
The 4 historically black fraternities include:
Alpha Phi Alpha
Kappa Alpha Psi
Omega Psi Phi
Phi Beta Sigma
The 3 historically black sororities include:
Alpha Kappa Alpha
Delta Sigma Theta
Zeta Phi Beta
Christian sorority
Sigma Alpha Omega
Honors fraternity
Phi Sigma Pi
Athletics
The UNCW athletic teams are known as the Seahawks. They are NCAA's Division I members fielding 18 teams, 8 varsity athletic teams for men (baseball, basketball, cross country, golf, soccer, swimming, tennis, track & field) and 10 for women (basketball, cross country, golf, soccer, softball, swimming, tennis, track & field, volleyball, beach volleyball). UNCW is a member of the Colonial Athletic Association. The men's and women's basketball teams play at Trask Coliseum and the baseball team plays at Brooks Field. The teams' colors include navy blue, teal, and gold. The baseball team has made eight appearances in the NCAA tournament (2003, 2004, 2006, 2008, 2012, 2013, 2015, 2016) while the men's basketball team postseason accolades include six NCAA tournament appearances (2000, 2002, 2003, 2006, 2016, 2017), two trips to the NIT (1998, 2001) and one invitation to the Collegeinsider.com tournament in 2015.
Notable people
Alumni
Faculty
Mike Adams, Criminology
Herbert Berg, Philosophy and Religion
Clyde Edgerton, Creative Writing
Philip Furia, Creative Writing
David Gessner, Creative Writing
Peter Jurasik, Acting for the Camera
Joseph R. Pawlik, Frank Hawkins Kenan Distinguished Professor of Marine Biology
Jarrod Tanny, Charles and Hannah Block Distinguished Scholar in Jewish History
References
External links
UNCW Athletics website
Category:Educational institutions established in 1947
*
Category:University of North Carolina
Category:Universities and colleges in North Carolina
Category:Buildings and structures in Wilmington, North Carolina
Category:Universities and colleges accredited by the Southern Association of Colleges and Schools
Category:Education in New Hanover County, North Carolina
Category:1947 establishments in North Carolina
Category:Liberal arts colleges in North Carolina
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Answers : (1)
SAGAR SINGH - IIT DELHI
879
Points
Dear student,
For a perfect (ideal) gas, Cp = CV + R , where Cp and CV are the molar heat capacities at constant pressure and volume, respectively. For an arbitrary real gas a slightly more complicated relationship between these heat capacities may be derived from the equation of state. Essentially, however, the difference between heating a gas at constant volume and constant pressure is expansion work. Thus, the ratio Cp / CV is related to the capacity of the system to do work upon expansion. This ratio is usually given the symbol [lower case greek gamma].
Please feel free to ask your queries here. We are all IITians and here to help you in your IIT JEE preparation.
All the best.
Win exciting gifts by answering the questions on Discussion Forum. So help discuss any query on askiitians forum and become an Elite Expert League askiitian.
Now you score 5+15 POINTS by uploading your Pic and Downloading the Askiitians Toolbar respectively : Click here to download the toolbar..
|
{
"pile_set_name": "Pile-CC"
}
|
Laverne Cox has slammed men who who feel ashamed about dating trans women. The Orange Is The New Black star opened up about dating in Attitude's Award Issue, revealing that she's found that men are often intimidated by her. "I still meet men. I'm on apps. I think you have to be on apps to be in the game, so I do it that way. I think a lot of guys are intimidated by me, but guys were intimidated by me before I was famous." However, the actress has no time for the men who feel ashamed about dating trans women."Men who are into trans women who want to keep us a secret and are afraid if someone thinks they are gay, they're insecure as fuck. If someone thinks you're gay, gay is fabulous. Gay is amazing. There's nothing wrong with that. Toxic masculinity is bullshit." Cox also spoke to Attitude about a toxic relationship that could have killed her , saying: “I thought that if I could be perfect and great in bed, prepare him food and take care of him that I would be worthy." "If I could turn someone who was emotionally abusive and unavailable and manipulative in someways into someone who was available and unabusive because I was so amazing, it would heal of of the childhood trauma that I had taken into the relationship." Read Laverne’s full interview in the Attitude Awards Issue, where the star opens up about battling for trans rights and her role in Orange is the New Black – out now featuring six special edition collectable covers. Buy in print subscribe or download
|
{
"pile_set_name": "OpenWebText2"
}
|
Instigate sex and be rough/playful about it....you start the vibe in that direction...see where he takes it.....maybe grab his hand and slap it on your ass....and react accordingly so he can see you enjoy it.
Click to expand...
That might work. I told him I can handle it, but I guess I need to show him.
i got rough and nasty (really nasty) with my ex and it never changed my opinion of her
you do some crazy shit when you're horny, being able to keep that separate from the other parts of your relationship is key
i think that rough sex is portrayed most dominantly in our society by porn and college whores being slutty, but that's not the only place for it, it can be part of a loving, respectful relationship and I think it's healthy
In the TS's case however, even a little spice might be fun if the guy just allowed it to happen. She doesn't have to pull out chains and gags and demand he "rape" her to subscribe to a "rough" night of sex.
I love that rough stuff (as from reading so do a lot of people) I found it pretty hard to slap my ex also but once she showed me how I kind of just jumped into it. I think if you lead by example he'll follow you where ever you want to go with it.
I used to be like that. What changed me was a woman pushing me to cross that boundary. You tell him it's okay to be rough, then get rough enough with him that he either has to let himself be abused or be rough back. If he's half a man, he'll push back.
I used to be like that. What changed me was a woman pushing me to cross that boundary. You tell him it's okay to be rough, then get rough enough with him that he either has to let himself be abused or be rough back. If he's half a man, he'll push back.
Click to expand...
This is what I was thinking. If you taint his ego he should come back twice as strong. At least that is what I would do. And let me tell you that would be one of my better sexual nights if it happened.
Maybe your mindset entering the room is giving him the vibe it's wrong or not right. Act a little dirty or whorish so he see it fits the role for him to abuse you more so than normal. IE dont have scented candles going with flowers on the bed. Maybe start making fun of him for small playful things till you start "rough housing" with each other. And then take that to the bedroom. Where he just wants to pin you down and fuck you till you come?
This is what I was thinking. If you taint his ego he should come back twice as strong. At least that is what I would do. And let me tell you that would be one of my better sexual nights if it happened.
Maybe your mindset entering the room is giving him the vibe it's wrong or not right. Act a little dirty or whorish so he see it fits the role for him to abuse you more so than normal. IE dont have scented candles going with flowers on the bed. Maybe start making fun of him for small playful things till you start "rough housing" with each other. And then take that to the bedroom. Where he just wants to pin you down and fuck you till you come?
Click to expand...
I tried to be playful yesterday in a rough way, and he just told me to stop and moved away...
Ok he gets home from work you make a decent dinner then relax on the couch for a nice movie or tv show and let him sit infront of you so you can message his back a little. After about 20 or so minutes lightly run you fingers through his hair (most guys like that, I know I do) then once and a while pull lightly and slowly increase it till he really notices. He might get the whole your doing it to hard, then call him a sissy and get up and challenge him to wrestle or pillow fight. If he truely wants some rough sex this will all be amazing fore-play that should have his train moving. During the fight magically either rip some clothes off or just say it is getting hot and take some off. Well if you don't know what to do from he failure is always an option.
He has a Madonna complex with you, that would drive me insane. Then again every guy I've ever been with has viewed me as the sultry vixen so it's bever been a problem. You're going to have to step up the kink to show him you mean it.
Oh and how fragile are you? I had one gf who wanted me to be rougher with her, but she bruised/got hurt so easily. If you want your guy to be rough and you say things like "ow my hair" or "careful" EVER in the bedroom, then odds are you're sending mixed messages and he feels its better to be safe than sorry. Might not be the case, but I figured I'd mention it just on the off chance.
I'm with babylon on this one. It's hard to do certain things with your SO that you would do with a random hook-up. as previously stated initiate it. If he doesn't react positively the first couple of times maybe he was lying about it...
Oh and how fragile are you? I had one gf who wanted me to be rougher with her, but she bruised/got hurt so easily. If you want your guy to be rough and you say things like "ow my hair" or "careful" EVER in the bedroom, then odds are you're sending mixed messages and he feels its better to be safe than sorry. Might not be the case, but I figured I'd mention it just on the off chance.
Click to expand...
I'm really careful not to say those things, however last night we were getting a little rough, and he left a mark on me and now feels bad. I told him it was ok and that it didn't hurt, and that I liked it. I dunno how to stop him from feeling bad.
I'm really careful not to say those things, however last night we were getting a little rough, and he left a mark on me and now feels bad. I told him it was ok and that it didn't hurt, and that I liked it. I dunno how to stop him from feeling bad.
Click to expand...
Eh, you might be stuck with him the way he is now. I used to be all gentle with my ex and even though she mentioned a few times she wanted me to be less gentle, I never got over it with her. Good luck though. He doesn't know what he's missing.
I'm really careful not to say those things, however last night we were getting a little rough, and he left a mark on me and now feels bad. I told him it was ok and that it didn't hurt, and that I liked it. I dunno how to stop him from feeling bad.
Click to expand...
Next time during sex insult him, in a hot/erotic kind of way. "Are you afraid to slap me, you little pussy" "Choke me you bitch"
Ok, so that might be a little to much, haha, but anything along those lines would get me going instantly.
Next time during sex insult him, in a hot/erotic kind of way. "Are you afraid to slap me, you little pussy" "Choke me you bitch"
Ok, so that might be a little to much, haha, but anything along those lines would get me going instantly.
Click to expand...
I've been happy to give a slap or pull some hair when requested, but if a girl ever said "slap me you pussy" or called me a bitch or something i'd probably kick her ass out. I just don't see how that would work or is necessary.
|
{
"pile_set_name": "Pile-CC"
}
|
Wednesday, November 12, 2008
By Patrick Goodenough, International Editor
Images from a Saudi flag on a soccer ball are drawing complaints from Muslims in South Africa, host of the 2010 World Cup.(CNSNews.com) – An Islamic clerics’ group in South Africa is protesting the appearance of Koranic text in advertising and promotional merchandise for the soccer World Cup, which the country is hosting in 2010.
At issue are soccer balls featuring images of flags of the world, including those of Saudi Arabia, Iran and Iraq. All three flags include words from the Koran.
The Council of Muslim Theologians, based in Johannesburg, said in a statement that the use of text which Muslims consider sacred “has the potential of offending adherents of the Islamic faith.”
“We would therefore like to bring to the attention of publishers, advertisers, printers, publicists and all concerned about the sensitivities the Muslim community has about the use of any type of media with sacred Islamic text,” it said.
Although Muslims comprise less than two percent of South Africa’s population, the community is an influential one, with activists frequently protesting against Israeli and American policies.
(snip)
Allah everywhere
Muslim groups have on numerous occasions complained about images or words being used in ways they consider blasphemous, and Western business interests invariably back down.
In 2005, Burger King restaurants in Britain withdrew an ice cream product after Muslim customers said a label design – a stylized swirl of soft serve – looked like the Arabic script for “Allah,” when viewed sideways. The Muslim Council of Britain commended the company for “sensitive and prompt action.”
Pamphlets have circulated in Muslim countries alleging that the famous swirly-scripted Coca Cola symbol, if viewed in a mirror, resembles the Arabic words, “No Mohammed, no Mecca.”
In a “myths and rumors” section on its Web site, the Coca Cola Co. dismisses the charge, noting that “the trademark was created in 1886 in Atlanta, Georgia, at a time and place where there was little knowledge of Arabic.”
“The allegation has been brought before a number of senior Muslim clerics in the Middle East who researched it in detail and refuted the rumor outright,” the company says, and its Web site links to a ruling in 2000 by the top cleric in Sunni Islam, the grand mufti of Al-Azhar, Egypt.
Two years earlier, the owner of Walls ice cream, Unilever, was forced to scrap a new logo for use in the Middle East after Muslims in Gulf states said the symbol – a pair of intertwining red and yellow hearts – looked like the word “Allah” in Arabic, when viewed upside down and backwards.
In 1997, Nike pulled more than 38,000 pairs of basketball shoes after the Council on American-Islamic Relations said the logo – the word “air” in flame-like lettering – looked like “Allah” in Arabic, again, when viewed from a certain angle.
Nike also launched a program of “sensitivity training on Islam” and donated a children’s playground to an Islamic center in Falls Church, Va. In return, CAIR pledged to urge Islamic organizations and governments worldwide to cancel any planned boycotts of Nike.
And in 1994, Chanel designer Karl Lagerfeld designed a dress incorporating an embroidered pattern copied from Arabic lettering on India’s Taj Mahal monument. He was unaware that the lettering included the phrase “They are the ones who found guidance,” which appears a number of times in the Koran.
After wearing the dress on a Paris catwalk, German model Claudia Schiffer received death threats, prompting her mother to make a public plea for her safety. An Indonesian clerics’ body also called for a boycott of Chanel.
Lagerfeld apologized, burned the garments, and said he would destroy all photographs and negatives of the dress.
Muslims already damage private property, intimidate business people, and blow themselves and countless innocents up over various issues. How much more could they do if someone decided to blow them off over the soccer balls?
CNS (http://www.cnsnews.com/public/content/article.aspx?RsrcID=39210)
noonwitch
11-12-2008, 11:56 AM
The irony is that the manufacturer of the soccer balls was trying to show the international appeal of the sport by displaying various national flags on the merchandise. They were trying to be inclusive of all.
Gingersnap
11-12-2008, 12:01 PM
The irony is that the manufacturer of the soccer balls was trying to show the international appeal of the sport by displaying various national flags on the merchandise. They were trying to be inclusive of all.
I don't think Islam thinks very highly of all that inclusivity stuff. They just got through stoning a 13 year old rape victim to death. :(
enslaved1
11-12-2008, 12:44 PM
Allah everywhere
snip
Wow. Looks like we have a tinfoil turban crowd going there. Conspiracies to disgrace Allah are everywhere!!!1111!!!!!!
Gingersnap
11-12-2008, 12:59 PM
Wow. Looks like we have a tinfoil turban crowd going there. Conspiracies to disgrace Allah are everywhere!!!1111!!!!!!
From their perspective, that's true. This issue comes up over and over again which is part of the point the article makes. It isn't Baptists or Buddhists forcing businesses to conform to religious notions. The Amish aren't protesting sporting goods or advertising logos.
Islam is the only religion that currently has a theocracy and the only one that is actively working to create more. Every time a non-Islamic business or enterprise caters to these protests, it makes it harder to draw a line between secular and religious interests.
PoliCon
11-12-2008, 01:31 PM
The irony is that the manufacturer of the soccer balls was trying to show the international appeal of the sport by displaying various national flags on the merchandise. They were trying to be inclusive of all.which just goes to show how STUPID that idea really is.
noonwitch
11-12-2008, 04:55 PM
I don't think Islam thinks very highly of all that inclusivity stuff. They just got through stoning a 13 year old rape victim to death. :(
I know, that is so disgusting. Poor girl. I read some of the details, that they buried her in the ground and put a sheet over her head, while she begged for her life. I hope all the men who participated get testicular cancer, or that the women of Somalia get hold of weapons and start gunning the bastards down who do this kind of thing.
I read where this punishment exceeded that prescribed in Sharia law-allegedly, Sharia law does not consider a 13 year old unmarried girl to be capable of adultry.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Changing the header of the response on NodeJS using request
I have the following problem:
I want to get a static file from another server, and give it back to the user with another content-type header.
The following code works just fine, but I can't figure out a way to change the response header, though.
const request = require('request');
app.get('video', function (req, res) {
request.get('http://anotherurl.com/video-sample.mp4').pipe(res);
});
I tried to do this thing more manually, but the response was very slow.
app.get('video', function (req, res) {
request.get('http://anotherurl.com/video-sample.mp4', function(error, response, body) {
// ...
res.setHeader('content-type', 'image/png');
res.send(new Buffer(body));
});
});
Can you guys help me with that?
Thanks
A:
Just set the response header when the 'response' event fires.
app.get('video', (req, res) => {
request.get('http://anotherurl.com/video-sample.mp4')
.on('response', response => {
res.setHeader('Content-Type', 'image/png');
// pipe response to res
// since response is an http.IncomingMessage
response.pipe(res);
});
});
|
{
"pile_set_name": "StackExchange"
}
|
Background {#Sec1}
==========
Accounting for 45% of all brain malignancies and 54% of all human gliomas, glioblastoma (GBM) is the most aggressive and lethal type of brain tumor \[[@CR1],[@CR2]\]. Despite multimodality therapies including maximal resection and adjuvant chemotherapy and radiotherapy, the overall outcome of patients with newly diagnosed GBM remains dismal. According to the most recent report of The Central Brain Tumor Registry of the United States (CBTRUS), less than 5% of GBM patients survive five years post diagnosis \[[@CR1]\]. Clearly more effective therapies are urgently needed and identification of valuable prognostic biomarkers and potential molecular targets is one key strategy to achieve this goal.
There are several different genetic alterations of important genes that may contribute to the pathogenesis of GBM, and these aberrations may differ from patient to patient. Therefore, treatment regimens for patients with GBM may be more effective if they are tailored toward the particular pathogenesis of patients' neoplasm. In recent years, substantial efforts have been made to explore molecular profiles to better understand the pathogenesis of GBM and biomarkers associated with patients' survival. There also have been several public resources that have provided insight into the pathogenesis of GBM through allowing researchers to correlate levels of gene expression with clinical features, including The Cancer Genome Atlas (TCGA) network \[[@CR3]\] and Repository of Molecular Brain Neoplasia Data (REMBRANDT) database \[[@CR4]\]. Gene expression studies of TCGA GBM tissues have identified several distinct GBM molecular subtypes, namely classical, mesenchymal, proneural and neural \[[@CR5]\]. Thus, uncovering new prognostic factors and molecular targets altered in GBM, and revealing the association of their expression profile with genetic alterations and molecular subtypes of GBM, may provide opportunities to improve the clinical outcome of GBM patients.
Tectonic family member 1 (TCTN1), was first identified in 2006 as a potential regulator of the Hedgehog pathway in patterning of the neural tube of mice, downstream of smoothened and Rab23, and named tectonic after the Greek word for builder due to its apparent involvement in a diverse range of developmental processes \[[@CR6]\]. In addition, a recent study showed that TCTN1 was part of a ciliopathy-associated protein complex and interacted with several other proteins associated with ciliopathies \[[@CR7]\]. Over the past several years, the primary cilium was found to be a complex signalling center where Hedgehog signalling was regulated \[[@CR8]-[@CR10]\], and its disregulation was associated closely to tumorigenesis \[[@CR11]-[@CR13]\]. Furthermore, Hedgehog pathway was involved in the regulation of embryonic development, cancer formation and maintenance, cancer stem cells \[[@CR14]-[@CR16]\], and particularly development and progression of human gliomas \[[@CR17],[@CR18]\]. However, the function and prognostic value of TCTN1 in human glioma have never been characterized.
In this study, we sought to investigate levels of TCTN1 expression in human GBMs using a tissue microarray (TMA) of a Chinese GBM cohort and estimate its prognostic value. We then validated the differential expression and prognostic significance of *TCTN1* in another two independent datasets, namely the TCGA cohort and the REMBRANDT cohort. For the TCGA cohort, we also analysed the expression profile of *TCTN1* according to subtypes and genetic alterations of GBM. Finally, we performed cell proliferation assays to explore the functions of TCTN1 in GBM cells.
Methods {#Sec2}
=======
Patients and tissue samples {#Sec3}
---------------------------
For the Chinese cohort of human glioblastoma (GBM) patients in this study, 110 specimens were obtained at the time of surgery at the Department of Neurosurgery in Changzheng Hospital, Second Military Medical University (SMMU), between January 2000 and December 2010. Tissues of 16 normal brain samples were taken from trauma outpatients. Clinicopathological information (age, gender, clinical manifestations and extent of resection) was obtained from medical records of the patients. Tumor histology was confirmed independently by two neuropathologists. Written informed consent was provided by all participants. The study protocol and acquisition of tissue specimens were approved by the Specialty Committee on Ethics of Biomedical Research, SMMU, Shanghai, China.
Tissue microarray construction and immunohistochemistry {#Sec4}
-------------------------------------------------------
Formalin-fixed, paraffin-embedded tissues were used to construct an tissue microarray (TMA) as described previously \[[@CR19],[@CR20]\] (Shanghai Biochip Company). Briefly, after verification with hematoxylin and eosin (H&E) staining, 1.5 mm core punch sample was taken from each specimen and cut as 4-μm-thick sections, which were then deparaffinized. Endogenous HRP activity was blocked with 3% H~2~O~2~, and antigen retrieval was achieved by boiling in sodium citrate buffer (pH 6.0). After blocking in 10% normal goat serum, immunostaining was performed using a rabbit anti-TCTN1 antibody (ab105381; Abcam) at 1: 50 dilution. Finally, the visualization signal was developed with 3,3'-diaminobenzidine (DAB), and the slides were then counterstained in hematoxylin. As negative controls, the sections were incubated with normal mouse serum instead of the primary antibody. The scores of immunohistochemical staining were evaluated by two independent pathologists in a blinded manner as described previously \[[@CR21]-[@CR23]\]. Briefly, the expression of TCTN1 was scored by estimating the proportion of tumor cells with positive staining. High TCTN1 expression was defined as \>10% positive staining, while low expression was defined as a proportion of \< = 10% positive staining, as described in previous studies \[[@CR22],[@CR24]-[@CR31]\].
RNA extraction, cDNA synthesis, and quantitative real-time PCR {#Sec5}
--------------------------------------------------------------
Fresh-frozen tissues from 8 human GBM patients and 8 normal brain samples were used for total RNA extraction using the Trizol reagent (Invitrogen) according to the manufacturer's instructions. Reverse transcription of total RNA was conducted using ReverTra Ace qPCR RT Master Mix (Toyobo), and quantitative real-time PCR was performed using THUNDERBIRD SYBR qPCR Mix (Toyobo) on ABI PRISM 7900HT instruments (Applied Biosystems). The primers used for amplification of TCTN1 were as follows: sense, 5'-CTGGATATTCCTACTGCTGCTAAAT-3'; antisense, 5'-CGAAGGAAATCTCAGAAACGA-3'. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control, using primers: sense, 5'-AGCCACATCGCTCAGACAC-3'; antisense, 5'-GCCCAATACGACCAAATCC-3'. The amplification was done in a total volume of 10 μl with the following conditions: an initial denaturation step (95°C for 5 minutes), followed by 40 cycles of denaturation (95°C for 15 seconds) and elongation (60°C for 45 seconds), and a melting curve analysis of each sample was used to check the specificity of amplification. Each sample was assayed in triplicate, and the 2^-ΔΔCt^ method \[[@CR32]\] was used to determine relative gene expression.
*In silico* analyses of TCGA and REMBRANDT data {#Sec6}
-----------------------------------------------
Another two independent datasets of GBMs, The Cancer Genome Atlas (TCGA) \[[@CR3]\] cohort (n = 528) and the Repository of Molecular Brain Neoplasia Data (REMBRANDT) \[[@CR4]\] cohort (n = 228), were also included in the present study. Expression data of *TCTN1* and clinical information of patients were obtained to validate the differential expression of *TCTN1* and its prognostic value. For the TCGA cohort, we also obtained common mutations, copy number alterations and molecular subtypes data, which were available for part of the patients, to analyze the expression profile of *TCTN1* and its relationship with these items. In the analysis of TCGA cohort, TCTN1 levels were dichotomized to high and low at the median expression as previously described \[[@CR33]-[@CR35]\]. For the REMBRANDT cohort, analyses were performed on the website interface using the default parameters \[[@CR23],[@CR36]\].
Cell culture {#Sec7}
------------
U251 and U87 human GBM cell lines, and 293 T human embryonic kidney cell line were purchased from Cell Bank of Chinese Academy of Sciences (Shanghai, China), and cultured in Dulbecco's modified Eagle's medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Life Technologies) and penicillin/streptomycin (100 units/ml and 100 μg/ml, respectively; Life Technologies) and maintained at 37°C in an atmosphere of humidified air containing 5% CO~2~.
Gene overexpression and silencing {#Sec8}
---------------------------------
To overexpress TCTN1, coding sequence of *TCTN1* gene was cloned into a lentiviral vector pCDH-CMV-EF1-copGFP (pCDH; System Biosciences) at the *Xho*I and *Eco*RI restriction sites using primers: sense, 5'-CCGCTCGAGACTCCCTGGGAGATGAGGC-3'; antisense, 5'-GGAATTCTCAAACAAACGGGAAGAAGAAG-3'. To interfere TCTN1 expression, the 21-nucleotide target sequence was selected from the Public TRC Portal \[[@CR37]\]: shTCTN1(clone ID, TRCN0000297995), 5'-CTTCAGATTCGTTTCTGAGAT-3'. Sequence against LacZ gene served as a control designated shControl: 5'-GGATCAGTCGCTGATTAAA-3' \[[@CR38]\]. Corresponding sense and antisense oligonucleotides were synthesized, annealed and cloned into the *Hpa*I - *Xho*I sites of pLL3.7 lentiviral vector \[[@CR39]\]. Lentiviral production and transduction was conducted as previously described \[[@CR40]\]. Briefly, 293 T cells were co-transfected with the lentiviral expression vector pCDH-TCTN1 (pCDH empty vector as a control) together with packaging plasmids pLP/VSVG, pLP1 and pLP2 for overexpression, and with lentiviral vector pLL3.7-shTCTN1 (or shControl) and corresponding packaging vectors psPAX2 and pMD2.G for gene silencing, using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The supernatants of lentiviral particles were collected 48 hours post transfection and filtered through 0.45-μm syringe filters (Millipore). U251 and U87 cells were infected with the lentiviruses carrying the expression vector or shRNA against TCTN1 along with corresponding controls.
Cell proliferation assay {#Sec9}
------------------------
Cell proliferation assay was performed as previously described \[[@CR41]\]. Briefly, different cell lines were seeded in 96-well plates (1500--2000 cells/well) in six replicates. Cells were allowed to grow for 4 days and cell proliferation analysis was performed by Cell Counting Kit-8 (CCK-8; Dojindo Laboratories) assay at different time points according to the manufacturer's instructions. After an incubation of 2 hours at 37°C, absorbance was measured at 450 nm using a microplate reader iMark (Bio-Rad).
Western blot {#Sec10}
------------
Western blot was performed as previously described \[[@CR42]\]. Briefly, cells were lysed in the radioimmunoprecipitation assay (RIPA) buffer \[50 mM Tris--HCl pH 8.0, 150 mM NaCl, 1% (v/v) NP-40, 0.5% (w/v) Sodium deoxycholate, 0.1% (w/v) SDS\] with protease inhibitors cocktail (Sigma) added freshly. The lysates were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore), which were blocked in 5% milk for 1 hour and then probed with antibody against TCTN1(1:200; ab105381; Abcam), or actin (1:4000; M20010; Abmart) as a loading control. Blots were developed with Immobilon Western Chemiluminescent HRP Substrate (Millipore) and visualized on G: Box Chemi XR5 (Syngene).
Statistical analysis {#Sec11}
--------------------
Differences between two groups were analyzed by two-tailed student's t-test. The Fisher's exact test (two-sided) was conducted to analyze the correlation between *TCTN1* expression and clinical characteristics. Pearson correlation test was performed to analyze the correlation between expression of *TCTN1* and other genes. Overall survival (OS) was defined as the elapsed time between diagnosis and death or the last follow-up, and progression-free survival (PFS) was defined as the time from diagnosis to the date of tumor recurrence or further growth of residual tumor or the date of death. Survival curves were plotted by the Kaplan-Meier method and compared by the log-rank test. To construct a model for the prediction of survival, univariate and multivariate Cox proportional-hazards regression analysis was performed, in which clinical variables with log-rank *P* \<0.05 in univariate analysis were pooled into multivariate analysis. Values presented are expressed as mean ± SD. SPSS (15.0) software (SPSS Inc.) was used for all statistical analysis and *P* \<0.05 was considered statistically significant.
Results {#Sec12}
=======
GBM tissues exhibited increased protein and mRNA expression of *TCTN1* gene {#Sec13}
---------------------------------------------------------------------------
In total, 110 cases of GBM patients were enrolled in the Chinese GBM cohort. The median age at diagnosis was 53 years. Of the subjects, 74 (67.3%) were males. Details of clinical characteristics were presented in Table [1](#Tab1){ref-type="table"}. The patients' median overall survival (OS) was 12 months, with 5 year survival rate of 4.3%. We assessed the protein expression of TCTN1 in 110 GBMs and 16 normal brain tissues by immunohistochemistry assay using a tissue microarray (TMA). We found that TCTN1 was mainly expressed in nucleus (Figure [1](#Fig1){ref-type="fig"}A), and was significantly increased in GBM tissues compared to normal controls (*P* =0.042, Additional file [1](#MOESM1){ref-type="media"}: Figure S1), with no significant correlation with gender, age and other clinicopathologic characteristics. We further addressed whether *TCTN1* gene was also up-regulated at the transcriptional level. Total RNA was extracted from a subset of 8 GBMs and 8 controls randomly selected from this cohort and subjected to real-time quantitative RT-PCR assay. The mRNA expression of *TCTN1* was considerably elevated in GBMs compared to normal controls (Figure [1](#Fig1){ref-type="fig"}B, *P* =0.004).Table 1**Correlation between TCTN1 expression and clinicopathologic characteristics of 110 GBM patients in the Chinese cohortCharacteristicsNo. patientsTCTN1 expression*P*** **\*LowHigh**Gender0.378 Male74(67.3%)20(27.0%)54(73.0%) Female36(32.7%)13(36.1%)23(63.9%)Age (year)0.211 ≥5352(47.3%)19(36.5%)33(63.5%) \<5358(52.7%)14(24.1%)44(75.9%)Tumor origin0.670 Primary95(86.4%)28(29.5%)67(70.5%) Secondary15(13.6%)5(33.3%)10(66.7%)Seizure0.349 No96(87.3%)27(28.1%)69(71.9%) Yes14(12.7%)6(42.9%)8(57.1%)IICP0.836 No59(53.6%)17(28.8%)42(71.2%) Yes51(46.4%)16(31.4%)35(68.6%)Cystic degeneration0.799 No82(74.5%)25(30.5%)57(69.5%) Yes23(20.9%)6(26.1%)17(73.9%)Necrosis0.419 No90(81.8%)25(27.8%)65(72.2%) Yes20(18.2%)8(40.0%)12(60.0%)Edge0.762 Not clear52(47.3%)15(28.8%)37(71.2%) Clear17(15.5%)6(35.3%)11(64.7%)MTD (cm)0.093 \< 546(41.8%)18(39.1%)28(60.9%) ≥564(58.2%)15(23.4%)49(76.6%)Resection1.000 ≥98%84(76.4%)25(29.8%)59(70.2%) \< 98%26(23.6%)8(30.8%)18(69.2%)*\*P* value was evaluated by Fisher\'s Exact Test (2-sided).*Abbreviations*: IICP, increased intracranial pressure; MTD, mean tumor diameter.Figure 1**Expression and prognostic value of TCTN1 in a Chinese glioblastoma (GBM) cohort. (A)** TCTN1 protein expression was analysed by immunohistochemistry staining in human GBM specimens and normal brain samples, and representative images show high nuclear expression of TCTN1 in GBMs. Magnification: ×50, left; ×200, right. Scale bars: 100 μm, left; 25 μm, right. **(B)** *TCTN1* mRNA expression was analysed by real time RT-PCR assay in human GBM samples, and *GAPDH* was used as an internal control. *P* value was determined by Student's t test. **(C-D)** Kaplan-Meier plots were estimated according to different TCTN1 immunoreactivity level for overall survival **(C)** and progression-free survival **(D)** of GBM patients. *P* values were obtained from log-rank test, and hazard ratio (HR) and 95% confidence interval (CI) were calculated by univariate Cox regression model.
TCTN1 served as an independent prognostic factor for GBM patients {#Sec14}
-----------------------------------------------------------------
To investigate the correlation between TCTN1 expression and clinical outcome, we first analysed the prognostic significance of TCTN1 using Kaplan-Meier method. As shown in Figure [1](#Fig1){ref-type="fig"}C and D, high TCTN1 expressers had significantly shorter overall survival (OS) and progression-free survival (PFS) than those with low TCTN1 expression (Log rank *P* =0.027 and 0.029 for OS and PFS respectively). Moreover, the subsequent univariate Cox regression indicated that, besides TCTN1 expression (HR =1.70, 95% CI =1.04-2.78, *P* = 0.033 for OS; HR = 1.63, 95% CI =1.03-2.56, *P* =0.036 for PFS), age at diagnosis was also a significant prognostic factor. As shown in Table [2](#Tab2){ref-type="table"}, multivariate Cox regression revealed that, after correction for patient age, elevated expression of TCTN1 protein was an independent risk predictor of both OS (HR =1.69, 95% CI =1.03-2.76, *P* =0.037) and PFS (HR =1.60, 95% CI =1.01-2.52, *P* =0.044) for GBM patients in the Chinese cohort.Table 2**Multivariate Cox regression analysis of** ***TCTN1*** **expression in GBM patients of 3 independent cohortsCohortCharacteristicsMultivariate cox regressionHR (95% CI)*P***Chinese GBM (OS)*TCTN1* (high vs. low)1.69 (1.03-2.76)0.037Age (≥53 vs. \<53)1.54 (1.02-2.33)0.038(PFS)*TCTN1* (high vs. low)1.60 (1.01-2.52)0.044Age (≥53 vs. \<53)1.46 (0.98-2.18)0.061TCGA (OS)*TCTN1* (high vs. low)1.26 (1.03-1.54)0.026Age (≥60 vs. \<60)1.90 (1.55-2.33)\<0.001REMBRANDT (OS)*TCTN1* (high vs. low)1.58 (1.09-2.29)0.017Age (≥60 vs. \<60)2.23 (1.57-3.16)\<0.001*Abbreviations*: OS, overall survival; PFS, progression-free survival; CI, confidence interval; HR, hazard ratio.
*TCTN1* gene was overexpressed in GBMs and correlated with several clinical features in the TCGA cohort {#Sec15}
-------------------------------------------------------------------------------------------------------
We next examined the expression profile and clinical significance of *TCTN1* in an independent cohort, i.e. the TCGA cohort. Consequently, mRNA expression of *TCTN1* was found to be increased in 98.86% (522/528) of the GBMs compared to the normal brain controls (Figure [2](#Fig2){ref-type="fig"}A). TCGA network described a robust gene expression-based molecular classification of GBM into 4 different subtypes, namely classical, mesenchymal, neural, and proneural \[[@CR5]\]. Thus, we further screened *TCTN1* expression in different molecular subtypes of GBMs and found that *TCTN1* expression was dramatically decreased in proneural subtype compared with other three subtypes, although still significantly elevated as compared to normal controls (*P* \<0.0001; Figure [2](#Fig2){ref-type="fig"}B).Figure 2**Expression of** ***TCTN1*** **mRNA in GBM specimens of the TCGA cohort. (A)** *TCTN1* mRNA expression levels were detected in 528 clinical GBM specimens and 10 cases of normal control tissue obtained by TCGA. The value represents log 2 of gene expression value of GBM to the average mRNA of 10 normal samples. The red samples (\>0) indicate that the mRNA levels of these GBM tissues were higher than the average of normal brain tissues while the green bars (\<0) represent GBM sample with lower *TCTN1* mRNA expression compared to normal tissues. **(B-H)** *TCTN1* mRNA expression was significantly different in subgroups of GBM according to subtypes and/or status of common mutations or copy number alterations (CNA) as indicated. "NC", no change; "Del", deletion; "Amp", amplification; "Wt", wild-type; "Mut", mutation. A single spot represents the *TCTN1* expression value (log 2 scale) of an individual patient, with a line in the middle representing the mean expression value. The difference in *TCTN1* expression was determined by Student's t-test.
In TCGA analysis of GBM, several genes were identified to be significantly mutated or have significant copy number alterations (CNAs) \[[@CR3],[@CR43]\]. To further explore the expression profile of *TCTN1* gene, we examined associations between its expression and common genetic alterations in GBM, including mutations in *TP53*, *PTEN*, *NF1*, *EGFR*, *RB1*, *PIK3R1*, *IDH1*, *PIK3CA*, *SPTA1*, *ATRX*, *KEL*, *GABRA6*, *LZTR1*, *CTNND2*, *BRAF*, amplifications of *EGFR*, *CDK4*, *PDGFRA*, *MDM2*, *MET*, *MDM4*, *CDK6*, *MYCN*, *CCND2*, *PIK3CA*, *AKT3*, and deletions of *CDKN2A*, *CDKN2B*, *PTEN*, *CDKN2C*, *RB1*, *PARK2* and *NF1*. Consequently, we found that *TCTN1* expression was significantly associated with mutations of *TP53*, *IDH1* and *ATRX*, amplifications of *EGFR*, *PDGFRA* and *MYCN*, and deletions of *CDKN2A*, *CDKN2B*, *PTEN* and *PARK2* (Figure [2](#Fig2){ref-type="fig"}C-H, Additional file [1](#MOESM1){ref-type="media"}: Figure S2), but not other aberrations.
Given that *TCTN1* expression was also correlated with transcriptional subtypes, we next addressed whether the differential expression of *TCTN1* according to abovementioned genetic alterations was dependent on specific subtypes. As a result, *CDKN2A* or *CDKN2B* deleted cases had significantly higher expression of TCTN1 in both non-proneural (*P* \<0.0001) and proneural (*P* =0.001) subtypes compared with cases with no corresponding changes (Figure [2](#Fig2){ref-type="fig"}C-D). Cases with *TP53* mutation had lower levels of *TCTN1* expression than wild-type (*P* =0.004) in non-proneural subtypes, while there was no significant difference in proneural subtype (Figure [2](#Fig2){ref-type="fig"}E). In contrast, cases with amplification of *EGFR* or deletion of *PTEN* or *PARK2* had higher levels of *TCTN1* expression than cases with no corresponding changes only in proneural subtype (*P* =0.045, 0.003, 0.014, respectively; Figure [2](#Fig2){ref-type="fig"}F-H). However, the differential expression of *TCTN1* according to mutations of *IDH1*, *ATRX* or amplification of *MYCN* and *PDGFRA* (Additional file [1](#MOESM1){ref-type="media"}: Figure S1A-D) lost any statistical significance when we classified all cases into non-proneural and proneural subgroups.
Given that previous studies linked TCTN1 to Hedgehog pathway in mouse embryonic development \[[@CR6]\], we investigated the associations between the expression level of *TCTN1* and common targets of Hedgehog pathway, *GLI1* and *PTCH1*, and found no significantly correlation (Additional file [1](#MOESM1){ref-type="media"}: Figure S3).
*TCTN1* was associated with prognosis of GBM patients in the TCGA cohort {#Sec16}
------------------------------------------------------------------------
We further investigated the relationship between *TCTN1* expression and patients' clinical outcome in the TCGA cohort. We compared the survival of all GBM patients with *TCTN1* expression above or below the median expression and found a statistically significant disadvantage in overall survival for patients with higher *TCTN1* expression (Log-rank *P* =0.006; Cox regression HR =1.32, 95% CI 1.08-1.61; Figure [3](#Fig3){ref-type="fig"}A). Multivariate Cox regression further confirmed the prognostic value of *TCTN1* as an independent predictor (HR =1.60, 95% CI =1.01-2.52, *P* =0.044; Table [2](#Tab2){ref-type="table"}).Figure 3**The prognostic value of** ***TCTN1*** **in GBM specimens of the TCGA cohort.** Kaplan-Meier plots were estimated according to different *TCTN1* gene expression for overall survival of all GBM patients **(A)** or the 4 different subtypes of GBM patients **(B-E)**, or considering the copy number alteration status of *PTEN* simultaneously **(F)**. *P* values were obtained from log-rank test, while hazard ratio (HR) and 95% confidence interval (CI) were determined by univariate Cox regression model.
In addition, we also carried out survival analyses for each molecular subtype and found that only the proneural (Log-rank *P* =0.006; Cox regression HR =1.84, 95% CI 1.18-2.85) and mesenchymal (Log-rank *P* =0.037; Cox regression HR =1.47, 95% CI 1.02-2.13) subtypes retained statistical significance (Figure [3](#Fig3){ref-type="fig"}B-E).
Furthermore, we performed survival analysis stratified by the genetic alteration status of abovementioned 10 genes with which *TCTN1* expression was significantly associated. As a consequence, *TCTN1* expression was associated with patients' prognosis only in one specific subgroup classified by the status of 7 genes (*PTEN*, *EGFR*, *PDGFRA*, *MYCN*, *PARK2*, *CDKN2A*, *CDKN2B*; Figure [3](#Fig3){ref-type="fig"}F and Additional file [1](#MOESM1){ref-type="media"}: Figure S4). A representative example shown in Figure [3](#Fig3){ref-type="fig"}F indicated that prognostic significance of *TCTN1* was highly pronounced in individuals with no *PTEN* change (Log-rank *P* \<0.001; Cox regression HR =2.84, 95% CI 1.58-5.14), but not significant in *PTEN* deleted individuals. However, for the other 3 genes, namely *TP53*, *IDH1* and *ATRX*, *TCTN1* expression could not predict patients' outcome in any subgroup stratified by the genetic status of these genes.
The differential expression and prognostic value of *TCTN1* was further validated in the REMBRANDT cohort {#Sec17}
---------------------------------------------------------------------------------------------------------
We further validated the differential expression and prognostic significance of *TCTN1* in GBMs of another independent cohort, namely the REMBRANDT cohort. Consistent with above mentioned TMA and TCGA analysis, *TCTN1* gene expression was remarkably increased in GBMs (n = 228) than in normal controls (n = 28; *P* \<0.0001; Figure [4](#Fig4){ref-type="fig"}A). Moreover, high *TCTN1* mRNA expression (n =132) could significantly predict a worse overall survival for GBM patients in comparison with low *TCTN1* expression (n =49; Log-rank *P* =0.013; HR =1.54, 95% CI 1.09-2.17; Figure [4](#Fig4){ref-type="fig"}B), which could also serve as an independent prognostic factor in a multivariate Cox regression model (HR =1.58, 95% CI =1.09-2.29, *P* =0.017; Table [2](#Tab2){ref-type="table"}).Figure 4**Expression and prognostic value of** ***TCTN1*** **in GBMs of the Rembrandt cohort. (A)** *TCTN1* gene has significantly higher expression in GBM samples in comparison to non-tumor controls. *P* value was calculated by Student's t-test. **(B)** Kaplan-Meier curve was plotted according to different *TCTN1* gene expression for overall survival of GBM patients. *P* values were obtained from log-rank test, while hazard ratio (HR) and 95% confidence interval (CI) were determined by univariate Cox regression model.
Ectopic TCTN1 expression affected GBM cell proliferation {#Sec18}
--------------------------------------------------------
To explore the biological significance of TCTN1 in glioma, we investigated whether it could affect cell proliferation. TCTN1 was stably overexpressed or silenced in U251 and U87 cells by lentiviruses infection, while the efficiency of ectopic expression of TCTN1 was validated by real-time PCR (Figure [5](#Fig5){ref-type="fig"}A) and western blot (Figure [5](#Fig5){ref-type="fig"}B) analysis. We then studied the impact of TCTN1 on GBM cell proliferation by CCK-8 assay within a 4-day period monitoring. The results showed that in both U251 and U87 GBM cell lines, upregulation of TCTN1 significantly promoted the proliferation compared with the control groups, whereas the blockade of endogenous TCTN1 expression markedly inhibited cell growth in comparison with the controls (Figure [5](#Fig5){ref-type="fig"}C).Figure 5**Overexpression and knock-down of** ***TCTN1*** **regulate GBM cell growth. (A)** Overexpression and knock-down of *TCTN1* gene in U251 and U87 human GBM cell lines were validated at mRNA level by real-time RT-PCR assays and GAPDH was used as an internal control. **(B)** Protein level of TCTN1 was analysed by western blot assays and actin served as a loading control. **(C)** The cell growth curve of *TCTN1* overexpression and knockdown cells was assessed by CCK-8 assay. Each experiment was performed three times. Statistical analysis was performed using two tailed Student's t-test. \*, *P* \< 0.05.
Discussion {#Sec19}
==========
Glioblastoma (GBM) is the most malignant brain tumor with dismal prognosis despite multimodal therapies, and its pathogenesis is still far from elucidation. Molecular targeted therapy represents promising avenue for the future of effective treatment strategies for GBMs. Hence, more valuable prognostic biomarkers and potential molecular targets for gliomas are urgently needed to combat this devastating disease. The present study identified TCTN1 as a novel prognostic factor for GBM, which was overexpressed in GBM tissues and could also regulate the proliferation of GBM cells.
*TCTN1* was a newly identified gene reported to be involved in developmental processes, Hedgehog pathway transduction and functions of primary cilium \[[@CR6],[@CR7]\]. Given that potent regulators of developmental processes are frequently disrupted in tumorigenesis \[[@CR44]\], and the primary cilium and Hedgehog pathway also play important roles in tumorigenesis \[[@CR11],[@CR16]\], it is to be expected that TCTN1 also contributes to tumor development yet there have been no reports on it. Hence, our study aimed to unveil the indispensable role of TCTN1 in GBM progression. Our TMA analysis and real-time PCR validation of a Chinese GBM cohort revealed that TCTN1 was up-regulated in GBMs compared to normal controls, and high TCTN1 expression could predict shorter overall and progression-free survival for GBM patients, as an independent prognostic factor. Due to differences of genetic background between populations \[[@CR45]\], we further validated these findings in another two independent international cohorts, namely the TCGA cohort and the REMBRANDT cohort.
It was noteworthy that our immunohistochemical staining experiments in GBM tissues found a nuclear localisation of TCTN1, which was beyond our expectation more or less, given the two important reports that linked TCTN1 to Hedgehog pathway and primary cilia by Dr. Jeremy F. Reiter' group \[[@CR6],[@CR7]\]. Actually, there were several limitations of these studies. The former revealed the involvement of Tctn1 (the mouse homolog of human TCTN1) in Hedgehog signaling mediated patterning of the neural tube of mice. Epistasis analyses further indicated that Tctn1 modulated Hedgehog signal transduction downstream of Ptch, Smo and Rab23. However, the findings were merely restricted in a mouse embryonic development context and lacked direct evidences using biochemical methods. The latter report found that Tctn1 was essential for ciliogenesis in some embryonic tissues such as the node and neural tube, and was required to localize some proteins to the cilium in several other tissues containing perineural and limb bud mesenchyme. They further discovered Tctn1 as part of a transition zone complex that controlled the organization of the transition zone and ciliary membrane composition using some mouse cell lines. However, the mechanisms underlying the tissue specificity of Tctn1 complex function remain unclear and the findings were also context dependent. Thus, whether TCTN1 regulate Hedgehog pathway still remains unclear, particularly in the context of human cancer biology.
Hedgehog signaling pathway was linked to tumorigenesis in recent years. The most typical examples were basal cell carcinoma (BCC) \[[@CR46]\] and medulloblastoma (MB) \[[@CR47]\], in which mutations were identified in the regulatory components of Hedgehog pathway. Although there were a few reports regarding the regulation of Hedgehog signaling on cancer stem cells in human gliomas \[[@CR48],[@CR49]\], the role of Hedgehog pathway in glioma remains in question.
To further investigate the relationship of *TCTN1* and Hedgehog pathway, we examined the transcriptional level of *GLI1*, which is widely used to reflect Hedgehog pathway activity \[[@CR50]\], in TCGA database, and found it comparable between GBMs and normal controls (data not shown). In addition, we analyzed the relationship of *TCTN1* and two common target genes of Hedgehog pathway, *GLI1* and *PTCH1*, and found no significant correlation (Additional file [1](#MOESM1){ref-type="media"}: Figure S3), indicating a rather weak link (if any) between TCTN1 and Hedgehog pathway in GBMs.
The signal transduction of Hedgehog pathway was regulated in the primary cilium, where TCTN1 was found to be a component of a protein complex. In the mammalian body, primary cilia were found on most epithelial and stromal cells, and interestingly, transformed cells commonly lack cilia \[[@CR51]\]. The role of primary cilia in cancer progression were still controversial, maybe according to the genetic background, as found in BCC \[[@CR13]\] and MB \[[@CR12]\]. In addition, the prevalence and role of cilia on glioma cells were poorly studied. It was reported that primary cilia were deficient in several established GBM cell lines compared to normal astrocytes \[[@CR52]\]. Consistently, in recently derived primary GBM cell lines and tumor biopsies, the majority of cells were unable to grow cilia \[[@CR53]\]. Furthermore, it seems that the observed cilia of a small portion of U251 GBM cells had no effect on cell proliferation, since depletion of Kif3a, a key component of ciliogenesis, did not significantly affect cell growth \[[@CR54]\].
A remarkable feature of ciliogenesis is its cell cycle-dependence \[[@CR51],[@CR55]-[@CR57]\]. In a system to study ciliary dynamics in the hTERT-RPE1 cell lines, most of the cells were ciliated following serum starvation \[[@CR56]\], which was widely used to induce ciliogenesis in cultured cells \[[@CR54],[@CR58],[@CR59]\]. However, it is a remarkable fact that ciliogenesis was enhanced by serum starvation in neither established nor recently derived primary GBM cell lines \[[@CR52],[@CR53]\], although that was the case in normal primary astrocytes \[[@CR52]\]. Recently, it was reported that a cell-cycle-related kinase (CCRK) may modulate ciliogenesis, and its regulation of cell cycle was dependent on cilia in NIH3T3 cells \[[@CR54]\]. In addition, they found that depletion of CCRK could restore cilia for a small fraction of U251 glioma cells, and inhibit cell growth in part dependent on cilia. However, it is interesting to note that depletion of CCRK did not block cells in G0/G1 phase, suggesting other underlying mechanisms.
Our immunohistochemical staining experiments showed primary expression of TCTN1 in cell nucleus through a scan of more than one hundred GBM patients, suggesting a weak link (if any) of TCTN1 and cilia in human gliomas. Functions and molecular mechanisms of TCTN1 in glioma warrant more investigations.
Characterized by dramatic molecular and histologic heterogeneity, GBM has recently been classified into distinct subtypes with clinical relevance, opening the way for treatments to be directed at subtype-specific mechanisms \[[@CR5],[@CR60]\]. In addition, for each molecular subtype, genetic alterations in several key genes were significantly different. The TCGA dataset offers an opportunity to investigate the relationship between gene expression, molecular subtypes and genetic alterations \[[@CR61]-[@CR64]\]. Therefore, we studied the expression preference of *TCTN1* in different subtypes and its association with genetic aberrations in the TCGA cohort. We found that *TCTN1* was dramatically decreased in the proneural subtype compared to other three subtypes, which is in concordance with the previous finding that the proneural subtype has a trend toward longer survival compared with other subtypes \[[@CR5]\]. For common genetic alterations of GBM, *TCTN1* was expressed in correlation with 10 of them, i.e. mutations of *TP53*, *IDH1* and *ATRX*, amplifications of *EGFR*, *PDGFRA* and *MYCN*, deletions of *CDKN2A*, *CDKN2B*, *PTEN* and *PARK2*. Interestingly, for several of them (*TP53* mutation, *EGFR* amplification, *PTEN* deletion and *PARK2* deletion), the association was restricted in non-proneural or proneural subtype. For instance, within non-proneural subgroups, the status of *PTEN* deletion did not influence the levels of *TCTN1* expression. However, within the proneural subtype, patients with no CNA of *PTEN* had dramatically lower *TCTN1* expression compared to *PTEN* deleted patients. These findings provided a clue for further research of the regulation of *TCTN1* expression in GBMs.
We also investigated the relationship of *TCTN1* expression and patients' clinical outcome stratified by different molecular subtypes and status of key genetic alterations. As a consequence, when we looked at *TCTN1* impact on survival based on molecular subtype, only the proneural and mesenchymal subtype retained significance. This analysis showed that the influence of *TCTN1* expression on survival outcome shows high subtype specificity with very strong effect in the proneural and mesenchymal subtypes and almost no effect in the other subtypes, thus the full sample analysis effectively showed a dilution of the effect in these two subtypes. In particular, patients within the proneural subtype are expected to have a slightly better prognosis compared to other subtypes \[[@CR5]\]. However, we noted that within the proneural subgroup patients with high *TCTN1* expression suffer from especially poor prognosis than those with low *TCTN1* expression. Moreover, we also investigated status of genetic alterations in TCGA dataset and stratified the patients with GBM into two subgroups by these molecular features. Our results showed that the effect of *TCTN1* expression on patients' survival rely on genetic background. It should be noted that, *TCTN1* could divide patients with no *PTEN* copy number change into two subsets with totally distinct outcome, although there was no difference for survival of *PTEN* deleted patients with different *TCTN1* expression, suggesting distinct effect of *TCTN1* on clinical outcome dependent on status of *PTEN* deletion. Similar results could also be observed for other several alterations, in detail, high expression of *TCTN1* could predict poor prognosis for patients with no *EGFR* change, no *PDGFRA* change, no *MYCN* change, *PARK2* deletion, *CDKN2A* deletion or *CDKN2B* deletion. However, further perspective studies are still warranted to unveil the underlying mechanisms.
Our analyses in these independent cohorts suggested a key role of *TCTN1* gene in tumorigenesis and progression of GBM, yet there has been no direct report on its function in cancer biology. Thus we performed *in vitro* experiments in two GBM cell lines through enforced expression or depletion of TCTN1. Consequently, we observed that TCTN1 overexpression evidently promoted cell proliferation, whereas TCTN1 depletion dramatically hampered cell growth. These results were consistent with the augmented expression and prognostic value of TCTN1 in GBM clinical tissues, suggesting that its survival detriment role may be in part due to the ability of the TCTN1 protein to regulate proliferation of GBM cells. Functional study in cell lines further highlighted potential therapeutic value of TCTN1 in treatment of patients with GBM, albeit the molecular mechanisms were still far from elucidation.
Conclusions {#Sec20}
===========
In summary, TCTN1 was significantly elevated in human GBMs, and predicted poorer prognosis of GBM patients as a novel prognostic factor, which was found in a TMA analysis of a Chinese cohort and confirmed in two independent international cohorts. Furthermore, the expression profile and prognostic value of TNTN1 were associated with different molecular subtype and genetic alterations of GBM in analyses of the TCGA dataset. Moreover, TCTN1 played an important role in proliferation of GBM cells, suggesting its potential application as a therapeutic target for future GBM treatment.
Additional file {#Sec21}
===============
Additional file 1: Figure S1.TCTN1 protein expression was analysed by immunohistochemistry staining and positive staining rate of TCTN1 in normal brain samples and GBMs was indicated as a scatter plot. *P* value was determined by Student's t-test. **Figure S2.** *TCTN1* mRNA expression was significantly different in subgroups of GBMs in the TCGA cohort according to status of *IDH1* mutation (A), *ATRX* mutation (B), *MYCN* amplification (C) or *PDGFRA* amplification (D) as indicated. A single spot represents the *TCTN1* expression value (in log 2 scale) of an individual patient, with a line in the middle representing the mean expression value. *P* values were determined by Student's t-test. **Figure S3.** Correlations between *TCTN1* with *GLI1*(A) and *PTCH1*(B) levels in TCGA cohort. **Figure S4.** Kaplan-Meier curves were plotted according to different *TCTN1* gene expression for overall survival of GBM patients in the TCGA cohort stratified by the status of EGFR amplification (A, B), PDGFRA amplification (C, D), MYCN amplification (E, F), PARK2 deletion (G, H), CDKN2A deletion (I, J) and CDKN2B deletion (K, L) as indicated. *P* values were obtained from log-rank test.
Delong Meng and Yuanyuan Chen contributed equally to this work.
**Competing interests**
The authors declare that they have no competing interests.
**Authors' contributions**
DM designed the study, performed data analysis, carried out experiments and drafted the manuscript. DM and YC revised the manuscript. YZ, SY and HC assisted with statistical analyses. YC, JW and DY participated in experimental studies. JC contributed to patient collection and clinical data interpretation. DL conceived of the study, participated in its design and coordination, and revised the manuscript critically. All authors read and approved the final manuscript.
This study was supported by the National Natural Science Foundation of China (grants 81170786, 81372706, 81372235, and 81071739) and Shanghai Education Committee (grant SOH1322002). We thank staff of the Department of Neurosurgery of Changzheng Hospital for their help of sample and clinical information collection.
|
{
"pile_set_name": "PubMed Central"
}
|
Address
Directors Name
Mahatme Eye Bank & Eye Hospital Nagpur is run by S. M. M. Eye welfare charitable trust. The S. Mahatme Memorial Eye welfare charitable trust was formulated in the year 1986, registered under the Public trust Act, 1950 (Year 1950, Rule No. 29) at the office of Registrar of Public Trust, Nagpur bearing registration number E/1183/Nagpur.
The trust is a secular body with the aim of making world beautiful for the curable blindness. The Trust is envisaged on the vision of Dr. Vikas Mahatme, an ophthalmologist of great charitable fervor and a highly sensitive and motivated individual for the cause of the acute and unattended eye care needs in this part of the country.
|
{
"pile_set_name": "Pile-CC"
}
|
Innovative Arpeggio Guitar Phrasing for Advancing Metal Players
Do you want to create your OWN killer solos and phrases using arpeggios and express yourself more fully? Do you want to be able to apply what you have practiced for so long and be more creative with your OWN music?
Many players think of arpeggios only in terms of pure technique. How to combine all that technique with essential melodic concepts that will create highly expressive solos is very rarely taught.
As a result, many guitarists struggle with applying their arpeggio playing in creative ways. Having the ability to rip through this skill at high speeds will only be useful if you know WHEN and HOW to apply this expressive tool in your music.
Fortunately, you CAN learn to be very musical and original with this technique.
To help you develop great guitar phrasing skills, using arpeggios, and take your musical self expression to a higher level, we have created the INNOVATIVE ARPEGGIO GUITAR PHRASING FOR ADVANCING METAL PLAYERS. In this unique course you will learn the essential concepts behind using arpeggios to create your own killer solos and phrases. It will show you how to express yourself more fully and be more creative with your OWN music.
This course is perfect for you if:
You are an intermediate or advanced metal guitar player looking to inject some new ideas and FIRE into your solos.
You want to vastly increase your ability to express yourself in meaningful and musical ways.
You want to improve your soloing technique, vocabulary and ability to create impressive and expressive solos!
You want to learn the “secrets” the pros use to create amazing solos using arpeggios.
Discover how guitar masters like Eddie Van Halen, Randy Rhoads, Yngwie Malmsteen, John Petrucci and many others have used arpeggios in their own soloing to create killer phrases!
This is what the course will teach and explain to you:
How to phrase with tapping arpeggios ala Van Halen, Randy Rhoads and George Lynch.
Soloing like the neo-classical metal gods including Yngwie, Symphony X and many others using the sweeping technique!
How to improve your guitar phrasing with string skipping arpeggios.
Unique ways of playing 7th arpeggios like Satriani, Vai and Vinnie Moore!
How to combine arpeggios and scales to create your own killer phrases.
The essential concepts and theory that will enable you to create your OWN awesome solos in any key!
Much more!
Included with this exciting new guitar phrasing course are:
Audio examples played at both normal and slow speeds that are fully explained via text, tab and notation.
Rocking backing tracks that will help you apply and use what you have learned.
Text available as PDF download AND as mp3’s so you can study anywhere—in your car, at the gym, etc.
Listen and watch some examples of great guitar phrasing:
Innovative Arpeggio Guitar Phrasing for Advancing Metal Players will give you the tools necessary to take your playing to new levels of self-expression and confidence! We have put several years of experience as professional musicians and teachers into the creation of this “one-of-a-kind” course. We want you to avoid the trial and error route, and help you reach your goals in much less time than it took us.
Invest into your musical goals now!
"Innovative Arpeggio Guitar Phrasing for Advancing Metal Players is a great course for those that may have learned some arpeggio's but not really sure of how to apply them.”
It's not just a bunch of mindless arpeggio shapes. They are arranged into tasty phrases that you can use right from the start. You learn to apply them in many different ways like tapping, sweep picking, string skipping etc... You also learn how to mix the arpeggios with other techniques and ideas you may have already learned to create more interesting and exciting phrases.
I highly recommend this course for anyone that wants to learn how to connect their lead phrases to the progressions being played underneath.
Don Parkhurst, Connecticut, USA
"Phrasing Concepts for Rock Lead Guitar Soloing and Innovative Arpeggio Phrasing for Advancing Metal Players are in the top 10% of what is available anywhere.”
Why? Because they don’t teach you licks, They teach you strategies based on a compilation of easy-to-understand methods.
These two great guides give you a much greater understanding of the fretboard and how to make it come alive through your OWN applications of these concepts.
|
{
"pile_set_name": "Pile-CC"
}
|
COURT OF APPEALS
SECOND DISTRICT OF TEXAS
FORT WORTH
NO. 2-09-023-CR
JOEMAR JACKSON APPELLANT
V.
THE STATE OF TEXAS STATE
------------
FROM CRIMINAL DISTRICT COURT NO. 3 OF TARRANT COUNTY
------------
MEMORANDUM OPINION
(footnote: 1)
------------
I. Introduction
Appellant Joemar Jackson appeals his conviction for capital murder. In six issues, Jackson argues that the trial court erred by denying his
Batson
challenge, by overruling his objections to the State’s closing argument, by refusing to grant a mistrial based on inadmissible hearsay, by overruling his objection to later hearsay, and by not including an accomplice-witness instruction in the jury charge. We will affirm.
II. Factual and Procedural Background
Eric Witt was a drug dealer in the Como area of Fort Worth. He was at his home one evening with his friend Kretearria Porter when Jackson came over, purchased some drugs from Witt, and left. Another man showed up to buy drugs after Jackson left. As the man was leaving Witt’s house, two men carrying guns forced their way inside. The first man carried a black gun, and the second man carried a silver gun; both men had bandanas covering their faces below their eyes. The first man shot Witt in the hand as he was trying to shut the door on the men, and Witt fell to the ground.
One of the men ordered Porter to lay on the floor. The man with the silver gun asked Witt, “E, where’s the dope at?” Witt told him it was in a cracker box in the kitchen. One of the men searched Witt’s pockets as he lay on the floor. The man with the black gun stood over Witt and shot Witt in the back of the head as they were leaving. The two men left, and the man who had just purchased drugs fled out the front door after them. Witt died from the gunshot wound to his head.
Police eventually arrested James Phillips, Kenneth Francis, Nathaniel Baldwin, and Jackson in connection with Witt’s murder. Francis admitted to participating in the robbery, and he told detectives that Jackson was the robber who shot Witt. Phillips also admitted to participating in the robbery and told detectives that Jackson was the shooter.
At Jackson’s trial, Francis testified that Phillips, Baldwin, and Jackson had planned to rob Witt and that Francis’s role was to go to Witt’s house to buy drugs so that he could determine how many people were inside Witt’s house. By the time Francis got to Witt’s house, Phillips and Jackson were already inside; Francis saw Witt and Porter laying on the floor, Phillips standing over Witt with a chrome gun, and Jackson in the kitchen with a black gun. Witt was pleading for them not to kill him and was saying, “It’s in the box. It’s in the box.” Francis ran back to his car and heard a gunshot. Sometime after the robbery, Francis saw Jackson and asked him why he had shot Witt. Jackson told him, “When I shot E, [Phillips] threw up.” Francis testified that he had agreed to testify for the State in exchange for an eight-year sentence for conspiracy to commit robbery.
Phillips testified that on the day of Witt’s murder, Baldwin had showed up at his house and had told him, “Let’s go get this money.” Phillips did not know exactly what he was talking about, but he knew that Baldwin was asking if he wanted to go rob someone. Phillips got in the car with Baldwin, Jackson, and Francis and learned that they planned to rob Witt. Phillips testified that Baldwin’s role in the robbery was “[j]ust getting the door open.” According to Phillips, Baldwin approached Witt’s house first under the guise of purchasing drugs, and while Baldwin was inside, Jackson “bust[ed] up in there.” Phillips said that he and Francis were still outside when they heard a gunshot. Phillips went inside and saw that Witt had been shot in the hand. Phillips started grabbing money and drugs. He was carrying a chrome-plated revolver. He testified that he ran to his mother’s house after the robbery and threw up at her house from running so hard. Phillips explained that he had agreed to testify for the State in exchange for a twenty-five-year sentence for capital murder.
LaTonia Clark testified that Francis was her boyfriend when Witt was murdered. On the night of Witt’s murder, Clark heard Phillips tell Francis that he wanted to rob Witt because he and Jackson had seen “a lot of money or drugs” at Witt’s house. Later that night, Francis was taking a bath when he told Clark about the robbery. He was crying, and he told Clark that Jackson had shot Witt in the back of the head and that Phillips had thrown up in Witt’s house.
Lee Hall testified that he lives in Como and knows Jackson, Phillips, Francis, and Baldwin. After Witt’s murder, Hall overheard a conversation between Jackson and a man who lives next door to Hall’s grandmother. Jackson was talking about Phillips and said, “I hope the boy can hold water. I ain’t never did no crime. I ain’t never did no dirt with him. I just hope he don’t snitch on me.” Hall explained that when Jackson said he “ain’t never did no dirt with [Phillips],” Jackson meant that he had never committed a crime with Phillips. Hall also overheard Jackson tell the man, “Man, I should have murked [Phillips],” which is a street term for murder.
Donald Coleman testified that he had a sexual relationship with Phillips at the time of Witt’s murder and that Phillips had told him that Phillips, Jackson, and Francis robbed “the dope man.” Coleman testified that Phillips had told him that Jackson shot Witt during the robbery.
Marquies Amos testified that he knows Phillips, Francis, Baldwin, and Jackson and that he had known Witt. Amos said that Phillips had told him that Jackson shot Witt during the robbery. Amos also testified that Jackson confessed to him that he had shot Witt because, during the robbery, Phillips was calling Jackson by his name in front of Witt and because Witt was telling Jackson, “I know where y’all live.” Amos agreed to testify for the State in exchange for a plea agreement with his brother regarding unrelated charges.
The jury convicted Jackson of capital murder. Acknowledging that the State had waived the death penalty, the trial court sentenced Jackson to life in prison.
III.
Batson
Challenge
In his first issue, Jackson argues that the trial court erred by overruling his
Batson
challenge regarding the State’s use of a peremptory strike on veniremember 3, who was African-American. Jackson asserts that the State’s proffered race-neutral reason for striking veniremember 3 was a pretext for racial discrimination. Jackson is African-American.
A. Law on
Batson
Challenges
The Equal Protection Clause of the Fourteenth Amendment to the United States Constitution prohibits race-based jury selection. U.S. Const. amend. XIV;
Batson v. Kentucky
, 476 U.S. 79, 89, 106 S. Ct. 1712, 1719 (1986);
Jasper v. State
, 61 S.W.3d 413, 421 (Tex. Crim. App. 2001);
see
Tex. Code Crim. Proc. Ann. art. 35.261(a) (Vernon 2006). In the face of perceived purposeful discrimination, the defendant may request a
Batson
hearing to address the challenge.
See
Tex. Code Crim. Proc. Ann. art. 35.261(a).
Trial courts follow a three-step process when resolving
Batson
challenges.
Snyder v. Louisiana
, 552 U.S. 472, 476, 128 S. Ct. 1203, 1207 (2008);
Young v. State
, 283 S.W.3d 854, 866 (Tex. Crim. App.),
cert. denied
, 130 S. Ct. 1015 (2009). First, the defense must make a prima facie case of racial discrimination.
Snyder
, 552 U.S. at 476, 128 S. Ct. at 1207;
Watkins v. State
, 245 S.W.3d 444, 447 (Tex. Crim. App. 2008),
cert. denied
, 129 S. Ct. 92 (2008). Second, if the prima facie showing has been made, the burden of production shifts to the State to articulate a race-neutral reason for its strike.
Snyder
, 552 U.S. at 476, 128 S. Ct. at 1207;
Watkins
, 245 S.W.3d at 447. Third, if the State tenders a race-neutral explanation, the trial court must then decide whether the defendant has proved purposeful racial discrimination.
Snyder
, 552 U.S. at 476, 128 S. Ct. at 1207;
Watkins
, 245 S.W.3d at 447.
The step-two explanation need only be race neutral on its face.
Purkett v. Elem
, 514 U.S. 765, 767–68, 115 S. Ct. 1769, 1771 (1995);
Watkins
, 245 S.W.3d at 447. The ultimate plausibility of that race-neutral explanation is to be considered as part of the third step of the analysis, in which the trial court determines whether the defendant has satisfied his burden of persuasion to prove that the strike was indeed the product of the State’s purposeful discrimination.
Purkett
, 514 U.S. at 768, 115 S. Ct. at 1771;
Watkins
, 245 S.W.3d at 447. Throughout the challenge, the burden of persuasion remains with the defendant.
Purkett
, 514 U.S. at 768, 115 S. Ct. at 1771;
Ford v. State
, 1 S.W.3d 691, 693 (Tex. Crim. App. 1999). The defendant must prove by a preponderance of the evidence that the allegations of purposeful discrimination were true in fact and that the prosecutor’s reasons were merely a sham or pretext.
Watkins
, 245 S.W.3d at 451–52.
B. Standard of Review
On appeal, a trial court’s ruling on the issue of discriminatory intent must be sustained unless it is clearly erroneous.
Snyder
, 552 U.S. at 477, 128 S. Ct. at 1207;
Watkins
, 245 S.W.3d at 448. Appellate courts must give great deference to credibility and demeanor determinations made by the trial court in connection with a
Batson
inquiry.
Snyder
, 552 U.S. at 477, 128 S. Ct. at 1208. The court of criminal appeals has explained our review of a
Batson
ruling as follows,
In assaying the record for clear error,
vel non
, the reviewing court should consider the entire record of voir dire; it need not limit itself to arguments or considerations that the parties specifically called to the trial court’s attention so long as those arguments or considerations are manifestly grounded in the appellate record. But a reviewing court should examine a trial court’s conclusion that a facially race-neutral explanation for a peremptory challenge is genuine, rather than a pretext, with great deference, reversing only when that conclusion is, in view of the record as a whole, clearly erroneous.
Watkins
, 245 S.W.3d at 448 (citations omitted).
When determining whether a race-neutral explanation was a pretext for purposeful discrimination, we examine whether comparative evidence demonstrates disparate treatment of minority veniremembers.
See
Miller-El v. Dretke
, 545 U.S. 231, 241, 125 S. Ct. 2317, 2325 (2005). If a prosecutor’s race-neutral reason for striking a minority veniremember applies equally to an otherwise similar non-minority veniremember whom the prosecutor does not challenge, this may be evidence that the race-neutral reason is a pretext for purposeful discrimination.
See id.
We cannot, however, automatically impute disparate treatment in every case in which a reason for striking a minority veniremember also technically applies to a non-minority veniremember whom the prosecutor found acceptable.
See Cantu v. State
, 842 S.W.2d 667, 689 (Tex. Crim. App. 1992),
cert. denied
, 509 U.S. 926 (1993). The decision to strike a particular potential juror is not susceptible to rigid qualification.
Id.
We must also look to the entire record to determine if, despite a similarity, there are any significant differences between the characteristics and responses of the veniremembers that would, under the facts of the case, justify the prosecutor treating them differently as potential members of the jury.
See Miller-El
, 545 U.S. at 247, 125 S. Ct. at 2329.
In
Miller-El
, the Supreme Court “considered the combined impact of a number of factors in concluding that, by clear and convincing evidence, the prosecutors exercised two peremptory challenges on a racially discriminatory basis, notwithstanding the race-neutral explanations they offered at the
Batson
hearing.”
Watkins
, 245 S.W.3d at 448 (citing
Miller-El
, 545 U.S. at 266, 125 S. Ct. at 2317). Those factors included (1) that the State had struck a higher percentage of African-Americans than non-African-Americans, (2) that the State’s reasons for striking African-American jurors appeared to apply equally to non-African-American jurors whom the State did not strike, (3) that the State had used jury shuffles in a manner that supported an inference of racial discrimination, (4) that the State had questioned African-American and non-African-American jurors differently and in a way designed to obtain answers justifying strikes of African-American jurors, and (5) that the county in which Miller-El was prosecuted had a formal policy of excluding minority jurors from service.
Miller-El
, 545 U.S. at 240–64, 125 S. Ct. at 2325–39;
see Watkins
, 245 S.W.3d at 448–49.
C.
Batson
Hearing
After the State exercised its strikes to the venire panel, Jackson’s trial counsel raised a
Batson
challenge, arguing that the State had stricken the remaining three African-Americans from the venire panel. Although the record does not demonstrate the race of the veniremembers, we glean from the parties’ arguments in the record and on appeal that five veniremembers were African-American; one was stricken for cause by agreement, one was stricken by Jackson because he was a Fort Worth police officer, and the remaining three—veniremembers 3, 4, and 14—were stricken by the State.
(footnote: 2) The trial court asked for the State’s reasons for striking veniremembers 3, 4, and 14.
The State explained that it struck veniremember 3 because “she did not like the law of parties with regard to the non-shooter in a capital murder case, and that’s very possibly an issue in this case.” The State explained that it struck veniremember 4 because she had written on her juror questionnaire that her brother is a drug dealer and because, during voir dire, she had agreed that the justice system is “sometimes” flawed and unfair and that she has felt isolated in the past.
(footnote: 3) Finally, the State said it struck veniremember 14 because he had failed to disclose his prior arrest for credit card abuse and because he had stated in his jury questionnaire that he had several children but also that he was single.
The trial court found that the State had provided race-neutral reasons for striking veniremembers 3, 4, and 14, and it denied Jackson’s
Batson
challenge. On appeal, Jackson challenges only the trial court’s denial of his
Batson
challenge regarding veniremember 3, claiming that the State did not strike another veniremember who was not African-American and who also expressed a similar opinion about the law of parties. Jackson does not complain of the State’s peremptory strikes of veniremembers 4 and 14 other than to assert that those strikes show that the State exercised peremptory strikes disproportionally against African-American veniremembers.
(footnote: 4)
D. Disproportionate Strikes Analysis
We initially note that the State used a disproportionate number of its peremptory strikes to exclude three of the four remaining African-American veniremembers the jury. Of the thirty-two veniremembers within the strike zone, four, or 12.5%, were African-Americans. The State used three, or 30%, of its ten peremptory challenges to strike 75% of the African-Americans on the venire panel.
See
Tex. Code Crim. Proc. Ann. art. 35.15(b) (providing for ten peremptory challenges in non-death penalty capital cases). Thus, the State used a statistically-disproportionate number of strikes on African-American veniremembers.
See Watkins
, 245 S.W.3d at 451 (noting that use of 55% of peremptory strikes to exclude 88% of black veniremembers was clearly disproportionate);
Leadon v. State
, Nos. 01-08-00839-CR, 01-08-00840-CR, 2010 WL 143467, at *11 (Tex. App.—Houston [1st Dist.] Jan. 14, 2010, no pet. h.) (holding State’s use of 36.36% of strikes on 80% of black veniremembers was statistically disproportionate).
The disproportionality in the use of strikes may “support the appellant’s ultimate burden of persuasion that the State’s proffered race-neutral explanations are a sham.”
Watkins
, 245 S.W.3d at 452. But, as the United States Supreme Court in
Miller-El
noted, a comparative analysis is “more powerful” than “bare statistics,” and thus, we consider the State’s proffered reason for striking veniremember 3.
See Miller-El
, 545 U.S. at 241, 125 S. Ct. at 2325.
E. Comparative Juror Analysis of
Veniremember 3
During voir dire, as the State was questioning the venire panel about the law of parties, the following exchange took place between the State and veniremember 3:
[State]: Okay. You think it would be unfair to charge Bill with capital murder if I’m the shooter at the bank, right?
[Veniremember 3]: Yes.
[State]: And just like I asked Mr. Hess the same question, would you have trouble following that part of the law if you’re on the jury?
[Veniremember 3]: No, I don’t have no trouble following.
[State]: But you disagree with it?
[Veniremember 3]: Yeah, I disagree with it, but I ain’t heard the case.
[State]: Okay. Well, sure you haven’t heard the facts, and I’m just talking about the hypothetical I told you about, okay?
[Veniremember 3]: Uh-huh.
[State]: And that is the law. Someone who’s not the shooter in a capital murder, they can certainly be charged and found guilty, under the law, of capital murder, okay?
So you’re—but you’re saying . . . you disagree with that law, right?
[Veniremember 3]: Yeah, I do.
[State]: So you would have trouble following it if you were on the jury, right?
[Veniremember 3]: Yeah, I guess I would.
[State]: Well, let me ask you—I’ve got to pin you down—would you or would you not?
[Veniremember 3]: I would.
Jackson argues that the State treated veniremember 3 differently than a non-African-American on the panel, veniremember 21, because she also indicated that she could not agree with the law of parties but was ultimately seated on the jury. Jackson argues that the State “talked [veniremember 3] into saying she would have trouble” following the law but “had no trouble” accepting veniremember 21's assurance that she could follow the law. But unlike veniremember 3, veniremember 21 never indicated that she did not agree with the law of parties.
(footnote: 5) Thus, the State’s reason for striking veniremember 3 did not apply to veniremember 21, and we cannot say that the State’s persistent questioning of veniremember 3—after she had stated that she disagreed with the law of parties—was designed to evoke a certain response not elicited from veniremember 21.
See Watkins
, 245 S.W.3d at 449, 453–54 (citing
Miller-El
, 545 U.S. at 255–63, 125 S. Ct. at 2317).
Moreover, the State’s explanation for striking veniremember 3 went unchallenged during the
Batson
hearing. Once the State proffered its race-neutral reason for striking veniremember 3, Jackson bore the burden to convince the trial court that the State’s reason was not race-neutral.
See Ford
, 1 S.W.3d at 693;
see also Johnson v. State
, 68 S.W.3d 644, 649 (Tex. Crim. App. 2002) (“[A] party’s failure to offer any real rebuttal to a proffered race neutral explanation can be fatal to his claim.”). Jackson did not cross-examine the State about the strike or offer any rebuttal or impeachment evidence tending to show that the State’s reason was pretextual.
(footnote: 6)
For these reasons, we cannot say that the State’s reason for striking veniremember 3 applied equally to veniremember 21 or was pretextual.
See Watkins
, 245 S.W.3d at 453–54;
Leadon
, 2010 WL 143467, at *14–15.
F. Remaining Strikes on African-Americans
We will also examine the State’s reasons for striking veniremembers 4 and 14 to determine whether those reasons provide evidence of the State’s discriminatory intent.
See Watkins
, 245 S.W.3d at 448–49 (citing
Miller-El
, 545 U.S. at 241–52, 125 S. Ct. at 2317).
The State said that it had struck veniremember 4 because her brother is a drug dealer, and her jury questionnaire shows that she in fact indicated that her brother had been arrested for selling drugs. Having a family member who has been arrested or convicted is a race-neutral reason for striking a veniremember, and consequently, the State provided a race-neutral reason for striking veniremember 4.
See Simpson v. State
, 119 S.W.3d 262, 267–68 (Tex. Crim. App. 2003),
cert. denied
, 542 U.S. 905 (2004).
Jackson argues that the State did not strike other veniremembers who had family or close friends with prior convictions for driving while intoxicated, but drugs and dealing drugs were at issue in this case, not driving while intoxicated, and the State noted in its reasoning that Jackson’s case involved many drug dealers.
See Beasley v. State
, 838 S.W.2d 695, 700 (Tex. App.—Dallas 1992, pet. ref’d) (holding prosecutor’s reasons for striking potential jurors who had family members involved with drugs was race-neutral where appellant’s case was drug-related),
cert. denied
, 114 S. Ct. 451 (1993). The State also reasoned that it struck veniremember 4 because she believed that the justice system is flawed; specifically, veniremember 4 commented, “[P]eople have done some things and gotten off.” Jackson argues on appeal that veniremember 4's statement was actually a bias in favor of the State, but “the State may legitimately strike prospective jurors who appear to be unfavorable to the defense in ways that call into question their impartiality.”
Johnson
, 68 S.W.3d at 650. Thus, the trial court could have reasonably found that the State did not have a discriminatory intent when it struck veniremember 4.
See Snyder
, 552 U.S. at 477, 128 S. Ct. at 1207;
Watkins
, 245 S.W.3d at 448.
Regarding veniremember 14, Jackson admits that veniremember 14’s failure to disclose his prior criminal history “may well be a race neutral reason for striking him” but argues that the State’s second reason—that veniremember 14 has children but is single—is not an appropriate reason to strike him. Regardless of the State’s second reason, failure to disclose information during voir dire and personal involvement with the criminal justice system are race-neutral reasons to challenge a potential juror.
See Perry v. State
, 770 S.W.2d 950, 952–53 (Tex. App.—Fort Worth 1989, no pet.);
see also Holman v. State
, 772 S.W.2d 530, 533 (Tex. App.—Beaumont 1989, no pet.) (dismissing appellant’s argument regarding one of State’s reasons to strike potential jurors because failure to reveal criminal histories was State’s “main or central reason” for exercising strikes). Thus, the trial court could have reasonably found that the State did not have a discriminatory intent when it struck veniremember 14.
See Snyder
, 552 U.S. at 477, 128 S. Ct. at 1207;
Watkins
, 245 S.W.3d at 448.
G. Trial Court Not Clearly Erroneous
Reviewing the record as a whole and applying, as we must, great deference to the trial court’s ruling, we cannot say that the trial court was clearly erroneous in overruling Jackson’s
Batson
challenge.
See Watkins
, 245 S.W.3d at 448. Although the statistical analysis demonstrates that the State used a disproportionate number of peremptory strikes on African-Americans, our comparative analysis of veniremember 3 demonstrates that the State’s reason for striking her was not pretexual, and our analysis of the State’s remaining strikes on African-American veniremembers does not demonstrate discriminatory intent.
See id.
at 448, 453–54. Accordingly, we overrule Jackson’s first issue.
IV. Jury Argument
In his second and third issues, Jackson argues
that
the State twice commented on his failure to testify during its closing argument at the guilt-innocence stage of trial and that the trial court erred by overruling both of his objections to the comments. Jackson claims that this error violated his state and federal constitutional rights against self-incrimination and article 38.08 of the code of criminal procedure.
See
U.S. Const. amend V; Tex. Const. art. I, § 10; Tex. Code Crim. Proc. Ann. art. 38.08 (Vernon 2005).
A. The Complained-Of Comments
During its closing arguments, the State argued that Jackson’s alibi witnesses had lied on the witness stand. The State then stated,
And [Jackson’s alibi witnesses] testified that [Jackson] was with them after [six] o’clock all night long. That’s what the testimony was.
But the defendant didn’t know that we knew he went back to the scene, so he had to shift gears a little bit. And now all of a sudden, he went back to the scene. Yes, he admits he was there. “I was there, but if I was there”—
Jackson objected that this was an improper comment on his failure to testify, to which the State replied, “Defense counsel, Your Honor, is who I’m referring to.” The trial court overruled the objection. The State continued, “This is what it comes down to. You heard the testimony on Friday. You know they were lying, okay? And if he’s going to get them to come here and lie to you, it’s because he is guilty of the offense.”
Later in its closing argument, the State argued,
And their defense theory about Como turning [Jackson] in was shot out of the water on day two. And now Friday afternoon to Monday morning, the alibi witnesses that we called up here were shot out of the water. That is not true.
If he was going to lie to you about that, then he’s guilty of capital murder.
Jackson again objected that this was a comment on his failure to testify, and the trial court overruled his objection.
B. Law on Comment on Failure to Testify
A comment on an accused’s failure to testify violates the accused’s state and federal constitutional privileges against self-incrimination.
Moore v. State
, 849 S.W.2d 350, 351 (Tex. Crim. App. 1993);
Smith v. State
, 65 S.W.3d 332, 339 (Tex. App.—Waco 2001, no pet.). In addition, the code of criminal procedure provides that a defendant’s failure to testify on his own behalf may not be held against him and that counsel may not allude to the defendant’s failure to testify. Tex. Code Crim. Proc. Ann. art. 38.08.
To determine whether a comment violates a defendant’s right against self-incrimination or article 38.08
, we must decide whether the language used was manifestly intended or was of such a character that the jury naturally and necessarily would have considered it to be a comment on the defendant’s failure to testify.
See Bustamante v. State
, 48 S.W.3d 761, 765 (Tex. Crim. App. 2001);
Fuentes v. State
, 991 S.W.2d 267, 275 (Tex. Crim. App.),
cert. denied
, 528 U.S. 1026 (1999). The offending language must be viewed from the jury’s standpoint, and the implication that the comment referred to the accused’s failure to testify must be clear.
Bustamante
, 48 S.W.3d at 765;
Swallow v. State
, 829 S.W.2d 223, 225 (Tex. Crim. App. 1992). A mere indirect or implied allusion to the defendant’s failure to testify does not violate the accused’s right to remain silent.
Wead v. State
, 129 S.W.3d 126, 130 (Tex. Crim. App. 2004);
Patrick v. State
, 906 S.W.2d 481, 490–91 (Tex. Crim. App. 1995),
cert. denied
, 517 U.S. 1106 (1996). A statement referencing evidence that can come only from the defendant is, however, a direct comment on the defendant’s failure to testify.
Goff v. State
, 931 S.W.2d 537, 548 (Tex. Crim. App. 1996),
cert. denied
, 520 U.S. 1171 (1997);
Madden v. State
, 799 S.W.2d 683, 700 (Tex. Crim. App. 1990),
cert. denied
, 499 U.S. 954 (1991).
C. State Did Not Comment on Jackson’s Failure to Testify
In the instant case, a review of Jackson’s defensive theory and closing argument provides some insight into the complained-of comments made by the State in its closing argument. At trial, Jackson called Brandi Hawkins and Andre Hawkins to testify on his behalf. Brandi is the mother of Jackson’s girlfriend, and Andre is the brother of Jackson’s girlfriend. Both testified that Jackson was at their house the entire evening of Witt’s murder and that Jackson had slept there that night. On cross-examination, Brandi admitted that Jackson had sent her a handwritten affidavit to sign, stating that Jackson was at her house on the night of Witt’s murder. In rebuttal, the State called two witnesses to testify that they had seen Jackson in the crowd of bystanders at Witt’s house after Witt’s murder, contradicting Brandi’s and Andre’s testimony. During defense counsel’s closing argument, he addressed the State’s rebuttal and said that Brandi Hawkins’s testimony was discredited. He argued,
But I’m not going to stand in front of you and argue that Joemar Jackson didn’t go to [Witt’s] house. I believe he did.
But if he went to the house, his interest in this is no different than the interest of everybody else at the house about what happened.
When the State commented later in its closing argument that Jackson “admits he was there [at Witt’s house after the murder]. ‘I was there, but if I was there,’” the State was clearly addressing defense counsel’s closing argument, not any failure to testify on Jackson’s part.
(footnote: 7)
The State’s comment was also addressing Jackson’s defensive theory and the impeachment of his alibi witnesses. This same reasoning applies to the second complained-of argument—that Jackson had lied about his alibi defense. The State was summarizing the evidence and addressing testimony from Jackson’s alibi witnesses and the fact that Jackson had written affidavits for them to sign, stating that he was with them on the night of Witt’s murder.
See Felder v. State
, 848 S.W.2d 85, 94–95 (Tex. Crim. App. 1992) (noting that proper jury argument includes
summations of evidence
, reasonable deductions from evidence, and
answers to argument of opposing counsel)
,
cert. denied
, 510 U.S. 829 (1993).
Viewing the State’s comments from the jury’s standpoint,
we hold that the complained-of comments
did not naturally and necessarily refer to Jackson’s failure to testify; rather,
they were proper comments on Jackson’s defensive theory and testimony from his alibi witnesses and were answers to defense counsel’s arguments.
See Bustamante
, 48 S.W.3d at 765;
Smith
, 65 S.W.3d at 339 (holding that State’s comments were critiques of the amount of evidence defendant put forth on his defensive theory, not comments on failure to testify);
see also McKay v. State
, 707 S.W.2d 23, 37 (Tex. Crim. App. 1985) (concluding prosecutor’s statement that “there is no evidence to that effect” and “there is no evidence of any phantom [killer]” was not improper reference to defendant’s failure to testify but was invited by counsel’s argument that someone else had committed the murder),
cert. denied
, 479 U.S. 871 (1986);
Edmond v. State
, 566 S.W.2d 609, 611 (Tex. Crim. App. [Panel Op.] 1978) (construing prosecutor’s closing argument as proper comment on appellant’s defensive theory). The complained-of comments were not manifestly intended or of such a character that the jury naturally and necessarily would have considered them to be comments on Jackson’s failure to testify.
See Bustamante
, 48 S.W.3d at 765;
Fuentes
, 991 S.W.2d at 275.
D. Alternatively, Any Error Was Harmless
Alternatively, even assuming the State’s arguments were comments on Jackson’s failure to testify, we conclude any error in the trial court’s overruling Jackson’s objections was harmless.
See
Tex. R. App. P. 44.2(a);
see
Wimbrey v. State
, 106 S.W.3d 190, 192 (Tex. App.—Fort Worth 2003, pet. ref’d)
. Under Texas Rule of Appellate Procedure 44.2(a), upon determining constitutional error exists, we should reverse unless we determine beyond a reasonable doubt that the error did not contribute to the defendant’s conviction or punishment.
Tex. R. App. P. 44.2(a). Our primary inquiry is what effect the error had, or reasonably may have had, on the jury’s decision.
Wimbrey
, 106 S.W.3d at 193. “We consider the source and nature of the error, the extent that it was emphasized by the State, its probable collateral implications, the weight a juror would probably place on the error, and whether declaring it harmless would likely encourage the State to repeat it with impunity.”
Harris v. State
, 790 S.W.2d 568, 587 (Tex. Crim. App. 1989).
As we explained above, a review of the State’s entire argument, Jackson’s closing argument, and Jackson’s defensive theories reveals that the State was referring to testimony elicited from Jackson’s alibi witnesses and defense counsel’s closing argument.
Our neutral, impartial review of the record further demonstrates that the comment was a small part of the State’s argument and was not emphasized or mentioned again and that the jury likely did not attribute much, if any, weight to the error.
See id.
Although the trial court overruled Jackson’s objections, the court read its charge to the jury prior to closing arguments. The charge included an instruction not to consider Jackson’s failure to testify, and the jury is presumed to follow this instruction.
See
Colburn v. State
, 966 S.W.2d 511, 520 (Tex. Crim. App. 1998).
After carefully reviewing the record and performing the harm analysis required under rule 44.2(a), we alternatively hold that if the trial court erred by overruling Jackson’s objection to the State’s comments at issue, then beyond a reasonable doubt, such error did not contribute to Jackson’s conviction or punishment.
See
Tex. R. App. P. 44.2(a). We overrule Jackson’s second and third issues.
V. Hearsay Statements
In his fourth and fifth issues, Jackson complains of hearsay statements made by Clark at trial. We will address each of his complaints separately below.
A. Clark’s Testimony
Clark testified that, on the night of Witt’s murder, she and Francis were in a car together, that she could tell something was wrong with him, and that she had asked Francis what had happened. The State then asked Clark, “What did he tell you?” Defense counsel raised a hearsay objection, and after a discussion off the record, defense counsel withdrew his objection. Clark then testified, “He said, ‘I didn’t do it. [Jackson] did it.’” Outside the jury’s presence, defense counsel explained that he had withdrawn the objection because the State had told him that Clark’s answer would be that Francis did not tell her anything. The State agreed to withdraw the question. When the jury returned, the trial court instructed it to disregard the State’s last question and Clark’s answer. The trial court denied Jackson’s request for a mistrial.
The State then asked Clark about a conversation she had with Francis while he was taking a bath the night of Witt’s murder. She testified, over Jackson’s running hearsay objection, that Francis had told her that after he, Phillips, Baldwin, and Jackson robbed Witt, Jackson shot Witt in the back of the head. Clark explained that Francis was crying “[a] lot” while telling her about the robbery.
B. Motion for Mistrial
In his fourth issue, Jackson argues that the trial court erred by refusing to grant a mistrial after Clark testified that Francis “said, ‘I didn’t do it. [Jackson] did it.’”
We review whether the trial court erred in denying a motion for mistrial under an abuse of discretion standard.
Ladd v. State
, 3 S.W.3d 547, 567 (Tex. Crim. App. 1999),
cert. denied
, 529 U.S. 1070 (2000). A trial court does not abuse its discretion when its decision is within the zone of reasonable disagreement.
Montgomery v. State
, 810 S.W.2d 372, 391 (Tex. Crim. App. 1990) (op. on reh’g). Absent an abuse of discretion, we do not reverse a trial court’s denial of a mistrial.
Ladd
, 3 S.W.3d at 567.
Granting a mistrial is an extreme remedy for curing prejudice that occurs during a trial.
Ocon v. State
, 284 S.W.3d 880, 884 (Tex. Crim. App. 2009). A mistrial is required only when the improper evidence or testimony is “clearly calculated to inflame the minds of the jury and is of such a character as to suggest the impossibility of withdrawing the impression produced on the minds of the jury.”
Hinojosa v. State
, 4 S.W.3d 240, 253 (Tex. Crim. App. 1999). A trial court should grant a mistrial only when it is apparent that an objectionable event at trial is so emotionally inflammatory that curative instructions are not likely to prevent the jury from being unfairly prejudiced against the defendant.
Bauder v. State
, 921 S.W.2d 696, 698 (Tex. Crim. App. 1996),
overruled on other grounds by Ex parte Lewis
, 219 S.W.3d 335 (Tex. Crim. App. 2007). Ordinarily, a prompt instruction to disregard will cure any prejudicial effect associated with improper testimony.
Ovalle v. State
, 13 S.W.3d 774, 783 (Tex. Crim. App. 2000). A reviewing court should presume the jury followed the trial court’s instructions to disregard improper testimony.
Colburn
, 966 S.W.2d at 520.
In this case, by the time that Clark testified about what Francis had said in the car, the jury had already heard Francis testify that Jackson was the shooter and that Francis had told Clark what had happened, as well as Hall’s testimony that Jackson had admitted to shooting Witt. Thus, the harm from Clark’s testimony was attenuated by the fact that the jury had already twice heard essentially the same evidence.
See Anderson v. State
, 717 S.W.2d 622, 628 (Tex. Crim. App. 1986) (“Inadmissible evidence can be rendered harmless if other evidence at trial . . . proves the same fact that the inadmissible evidence sought to prove.”);
Couchman v. State
, 3 S.W.3d 155, 160–61 (Tex. App.—Fort Worth 1999, pet. ref’d). Moreover, in the absence of evidence to the contrary, we presume that the jury followed the trial court’s instructions to disregard Clark’s testimony.
See Colburn
, 966 S.W.2d at 520. The testimony at issue was not so emotionally inflammatory that the trial court’s curative instruction did not prevent the jury from being unfairly prejudiced against Jackson.
See Bauder
, 921 S.W.2d at 698. Thus, we hold that the trial court did not abuse its discretion when it denied Jackson’s motion for mistrial, and we overrule Jackson’s fourth issue.
See Ladd
, 3 S.W.3d at 567;
Montgomery
, 810 S.W.2d at 391.
C. Objection to Further Hearsay
In his fifth issue, Jackson argues that the trial court erred by overruling his hearsay objection after Clark testified that, while Francis was taking a bath, he had told her that Jackson had shot Witt. The State argues that the statement was admissible as an excited utterance and that, alternatively, any error was harmless.
We need not decide whether this testimony was admissible as an excited utterance because, even assuming error, any error was harmless. Erroneously admitted evidence is a violation of evidentiary rules and thus non-constitutional error.
See King v. State
, 953 S.W.2d 266, 271 (Tex. Crim. App. 1997). We apply rule 44.2(b) and disregard the alleged error if it did not affect Jackson’s substantial rights. Tex. R. App. P. 44.2(b);
see Mosley v. State
, 983 S.W.2d 249, 259 (Tex. Crim. App. 1998) (op. on reh’g),
cert. denied
, 526 U.S. 1070 (1999);
Coggeshall v. State
, 961 S.W.2d 639, 642–43 (Tex. App.—Fort Worth 1998, pet. ref’d). In applying the “harmless error” test, our primary question is whether there is a “reasonable possibility” that the error might have contributed to the conviction.
Mosley
, 983 S.W.2d at 259.
As we noted above, an error in the admission of a hearsay statement is harmless if other unobjected-to evidence is admitted at trial that proves the same fact.
Mayes v. State
, 816 S.W.2d 79, 88 (Tex. Crim. App. 1991);
Anderson
, 717 S.W.2d at 628;
Franks v. State
, 90 S.W.3d 771, 805 (Tex. App.—Fort Worth 2002, no pet.);
Matz v. State
, 21 S.W.3d 911, 912–13 (Tex. App.—Fort Worth 2000, pet. ref’d);
Couchman
, 3 S.W.3d at 160–61. Thus, Francis’s unobjected-to testimony that Jackson was the shooter and that Francis had told Clark what had happened, Phillips’s unobjected-to testimony that Jackson was the shooter, and Hall’s and Amos’s unobjected-to testimony that Jackson had admitted to being the shooter rendered harmless any error in admitting Clark’s testimony.
See
Tex. R. App. P. 44.2(b);
see Mosley
, 983 S.W.2d at 259. We overrule Jackson’s fifth issue.
VI. Jury Charge
In his sixth issue, Jackson argues that the trial court erred by failing to include an accomplice-witness instruction in the jury charge. Jackson acknowledges that his defense counsel did not object to the exclusion of the accomplice-witness instruction, but he argues that he suffered egregious harm as a result of the trial court’s error.
A. Standard of Review
Appellate review of error in a jury charge involves a two-step process.
Abdnor v. State
, 871 S.W.2d 726, 731 (Tex. Crim. App. 1994);
see Sakil v. State
, 287 S.W.3d 23, 25–26 (Tex. Crim. App. 2009). Initially, we must determine whether error occurred. If it did, we must then evaluate whether sufficient harm resulted from the error to require reversal.
Abdnor
, 871 S.W.2d
at 731–32.
If there is error in the court’s charge but the appellant did not preserve it at trial, we must decide whether the error was so egregious and created such harm that the appellant did not have a fair and impartial trial—in short, that “egregious harm” has occurred.
Almanza v. State
, 686 S.W.2d 157, 171 (Tex. Crim. App. 1985) (op. on reh’g);
see
Tex. Code Crim. Proc. Ann. art. 36.19 (Vernon 2006);
Allen v. State
, 253 S.W.3d 260, 264 (Tex. Crim. App. 2008);
Hutch v. State
, 922 S.W.2d 166, 171 (Tex. Crim. App. 1996). Egregious harm is the type and level of harm that affects the very basis of the case, deprives the defendant of a valuable right, or vitally affects a defensive theory.
Allen
, 253 S.W.3d at 264 & n.15;
Olivas v. State
, 202 S.W.3d 137, 144, 149 (Tex. Crim. App. 2006)
;
Almanza
, 686 S.W.2d at 172.
In making an egregious harm determination, “the actual degree of harm must be assayed in light of the entire jury charge, the state of the evidence, including the contested issues and weight of probative evidence, the argument of counsel and any other relevant information revealed by the record of the trial as a whole.”
Almanza
, 686 S.W.2d at 171;
see generally Hutch
, 922 S.W.2d at 172–74. The purpose of this review is to illuminate the actual, not just theoretical, harm to the accused.
Almanza
, 686 S.W.2d at 174. Egregious harm is a difficult standard to prove and must be determined on a case-by-case basis.
Ellison v. State
, 86 S.W.3d 226, 227 (Tex. Crim. App. 2002);
Hutch
, 922 S.W.2d at 171.
B. Accomplice-Witness Instruction
Article 38.14 of the code of criminal of procedure provides, “A conviction cannot be had upon the testimony of an accomplice unless corroborated by other evidence tending to connect the defendant with the offense committed; and the corroboration is not sufficient if it merely shows the commission of the offense.” Tex. Code Crim. Proc. Ann. art. 38.14 (Vernon 2005). A prosecution witness “who is indicted for a lesser included offense based upon alleged participation in commission of the greater offense is also an accomplice as a matter of law.”
Ex parte Zepeda
, 819 S.W.2d 874, 876 (Tex. Crim. App. 1991). If a prosecution witness is an accomplice as a matter of law, the trial court is under a duty to instruct the jury accordingly, and failure to do so is error.
Herron v. State
, 86 S.W.3d 621, 631 (Tex. Crim. App. 2002).
The instruction does not require the jury to be skeptical of accomplice-witness testimony or to give less weight to such testimony than to other evidence.
Id.
The instruction merely informs the jury that it cannot use the accomplice-witness testimony unless some non-accomplice evidence connects the defendant to the offense.
Id.
The test for sufficient corroboration is whether, after excluding the accomplice’s testimony, other evidence of an incriminating character tends to connect the defendant with the commission of the offense.
Burks v. State
, 876 S.W.2d 877, 887 (Tex. Crim. App. 1994),
cert. denied
, 513 U.S. 1114 (1995);
Munoz v. State
, 853 S.W.2d 558, 559 (Tex. Crim. App. 1993). Corroborating evidence need not directly connect the defendant to the crime or be sufficient by itself to establish guilt; instead, the combined weight of the corroborating evidence need only tend to connect the defendant to the offense.
Cathey v. State
, 992 S.W.2d 460, 462 (Tex. Crim. App. 1999),
cert. denied
, 528 U.S. 1082 (2000);
McDuff v. State
, 939 S.W.2d 607, 613 (Tex. Crim. App.),
cert. denied
, 522 U.S. 844 (1997). Additionally, the corroborative evidence may be circumstantial or direct, and the accomplice testimony need not be corroborated on every element of the offense.
Brosky v. State
, 915 S.W.2d 120, 138 (Tex. App.—Fort Worth, pet. ref’d),
cert. denied
, 519 U.S. 1020 (1996).
Non-accomplice evidence can render harmless a failure to submit an accomplice-witness instruction by fulfilling the purpose an accomplice-witness instruction is designed to serve.
Herron
, 86 S.W.3d at 632. The omission of an accomplice-witness instruction is generally harmless under the egregious harm standard unless the corroborating non-accomplice evidence is “‘so unconvincing in fact as to render the State’s overall case for conviction clearly and significantly less persuasive.’”
Id.
(quoting
Saunders v. State
, 817 S.W.2d 688, 692 (Tex. Crim. App. 1991)).
C. No Egregious Harm
Here, Jackson was indicted for and convicted of capital murder for killing Witt in the course of committing or attempting to commit robbery.
See
Tex. Penal Code Ann. § 19.03(a)(2) (Vernon Supp. 2009). Francis testified that he had been charged with consipiracy to commit robbery for his participation in this crime, and Phillips testified that he had been charged with capital murder for his participation in the crime; consequently, they were accomplices as a matter of law, and the trial court erred by not including the accomplice-witness instruction in the jury charge.
See Zepeda
, 819 S.W.2d at 876. We must consider whether Jackson suffered egregious harm as a result of this error.
See Herron
, 86 S.W.3d at 631.
The non-accomplice evidence in this case consisted of (1) Hall’s testimony that he had overheard Jackson telling a neighbor that he hoped Phillips could “hold water” and would not “snitch” on him and saying that he should have “murked” Phillips; (2) Coleman’s testimony that Phillips had told him about the robbery and that Jackson was the shooter; (3) Amos’s testimony that both Phillips and Jackson had told him that Jackson was the shooter; (4) Clark’s testimony that she had heard Phillips tell Francis that he and Jackson saw a lot of drugs and money at Witt’s house and wanted to rob Witt and that Francis had told her about the robbery and that Jackson shot Witt during the robbery; and (5) Porter’s and Witt’s cousin’s testimony that they had seen Jackson at the crime scene after Witt’s murder, contradicting the testimony of Jackson’s alibi witnesses.
Jackson argues that Clark’s and Coleman’s only knowledge of Jackson’s involvement in the crime came from his accomplices, Phillips and Francis. Jackson admits that Hall and Amos offered corroborating testimony, but he argues that they are “individuals of questionable veracity” and that Jackson’s alleged admissions to Hall and Amos were ambiguous.
Nevertheless, we cannot say that the corroborating (non-accomplice) evidence was not “so unconvincing in fact as to render the State’s overall case for conviction clearly and significantly less persuasive.”
Herron
, 86 S.W.3d at 632 (quoting
Saunders
, 817 S.W.2d at 692). The non-accomplice evidence need not prove all the elements of the alleged offense or directly link Jackson to the commission of the offense; rather, it is sufficient if it tends to connect him to the offense.
See Cathey
, 992 S.W.2d at 462;
Brosky
, 915 S.W.2d at 138. After excluding the accomplice testimony, we find that the combined weight of the corroborating evidence—even absent Clark’s and Coleman’s testimony—sufficiently tends to connect Jackson to the robbery and Witt’s murder.
See Cathey
, 992 S.W.2d at 462;
Brosky
, 915 S.W.2d at 138.
Accordingly, we hold that the trial court’s error in failing to include an accomplice-witness instruction in the jury charge did not result in egregious harm to Jackson such that he did not have a fair and impartial trial.
See
Tex. Code Crim. Proc. Ann. art. 36.19;
Allen
, 253 S.W.3d at 264;
Hutch
, 922 S.W.2d at 171;
Almanza
, 686 S.W.2d at 171. We overrule Jackson’s sixth issue.
VII. Conclusion
Having overruled Jackson’s six issues, we affirm the trial court’s judgment.
PER CURIAM
PANEL: WALKER, LIVINGSTON, and GARDNER, JJ.
DO NOT PUBLISH
Tex. R. App. P. 47.2(b)
DELIVERED: April 15, 2010
FOOTNOTES
1:See
Tex. R. App. P. 47.4.
2:There is some dispute in the record about whether a fourth veniremember, who ultimately sat on the jury, was Hispanic or African-American.
3:The State noted its belief that one of Jackson’s defense theories at trial would be his isolation from the Como community.
4:Jackson’s attorney explained during oral argument that he was not challenging the State’s reasons for striking veniremembers 4 and 14, but he included in his brief an analysis of the State’s stated reasoning for striking them to show discriminatory intent in striking veniremember 3.
5:Jackson appears to argue that veniremember 21 raised her hand when the State asked the entire panel if anyone disagreed with the law of parties, but the record shows only that veniremembers 3, 13, 46, and 60 raised their hands. Veniremembers 46 and 60 were not within the strike zone and did not sit on the jury. The only other veniremember who expressed disagreement with the law of parties and who was within the strike zone was questioned extensively on his opinion, ultimately agreed that he could follow the law, but did not sit on the jury for reasons not revealed by the record.
6:When the trial court asked if defense counsel had any comment to the State’s proffered reasons, defense counsel responded only that he was concerned with the State’s reasoning for veniremember 4.
7:Jackson emphasizes the State’s use of the word “I,” but “[w]hat determines the impermissibility of a reference to the defendant’s failure to testify is not the use of ‘I’ or ‘he’ or ‘she’ or any other word, but rather the entirety of the prosecutor’s statements, taken in the context in which the words were used and heard by the jury.”
Cruz v. State
, 225 S.W.3d 546, 549 (Tex. Crim. App. 2007);
but see Cherry v. State
, 507 S.W.2d 549, 550 (Tex. Crim. App. 1974) (“[W]hen the word ‘I’ is used in reference to something the defendant might have testified to, but did not, it is illogical to think that the jury is not reminded of the defendant’s failure to testify.”)
.
|
{
"pile_set_name": "FreeLaw"
}
|
Origin of the thoracic duct and pancreaticoduodenal lymphatic pathways to the para-aortic lymph nodes.
We investigated the afferent and efferent connections of the para-aortic lymph nodes (group 16 nodes) relative to the origin of the thoracic duct in 85 postmortem cadavers. The origin was usually restricted to groups 16b1-inter and -latero nodes (type I; 90.6%), regardless of whether the union of their efferents occurred at the abdominal or thoracic level. We also occasionally observed thick collecting vessels originating from the dorsal aspect of the pancreaticoduodenal region, running along the right side of and superficial to the celiac plexus and emptying into group 16b1 nodes. The thoracic duct originated occasionally not only from group 16b1 nodes but also from group 16a2 nodes (type II; 9.4%). Moreover, in all 85 specimens, the group 16a2-inter node often received afferents from the celiac plexus itself or the tight connective tissue between the plexus and diaphragmatic crus, or both. The results support the reliability of the extended D2 lymphadenectomy (D2 + group 16b1 nodes + group 16a2-inter node) for curative cancer surgery in the pancreaticoduodenal region.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Varenicline for smoking cessation.
Varenicline (pronounced va-re-nik-leen) (Champix - Pfizer), a nicotinic receptor partial agonist, is the first medicine of this type licensed for smoking cessation in adults. Launched in the UK in December 2006, the drug accounted for 14% of all prescription items and 22% of total expenditure, for smoking cessation products dispensed in the community in 2007. Marketing materials claim that it has a "unique dual action", a "significantly higher quit rate" than bupropion, and a "favourable safety and tolerability profile". Here we discuss the evidence for varenicline and consider its role in smoking cessation.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Help me, Obi-Wan Kenobi. You're my only hope. This article or section is in need of referencing per Wookieepedia's sourcing guidelines.
"And one of the great things about doing the Special Editions was we were able to go back and do the original Star Wars: A New Hope exactly the way George wanted it. The way he had written it. Whether people liked it, it didn't matter, it was his movie and he couldn't make it when he first made it because there were so many compromises he had to go through." ―Rick McCallum at the Episode I DVD press conference in 2001
The Star Wars Trilogy Special Edition was a theatrical anniversary edition of the original trilogy, in order to celebrate the 20th anniversary of the release of Star Wars: Episode IV A New Hope.
The three movies were shown in the U.S. from January through March at a monthly interval. A New Hope was released on January 31, 1997, followed by The Empire Strikes Back on February 21, 1997.[1] Return of the Jedi was scheduled to premiere on March 7, 1997, but due to the box-office success of the first two (mostly A New Hope, which grossed the most of the three re-releases), it was pushed a week, to March 14. Coverage on CNN in 1997 notes that George Lucas spent $10 million to rework his original 1977 film, which was roughly what it cost to film it originally. $3 million of that was spent on the audio track for the Special Edition. Lucas also spent $2.5 million each on Episodes V and VI.
The trilogy aimed to renew the movies in the minds of both the older and the younger audience, and to prepare the way for the upcoming release of Star Wars: Episode I The Phantom Menace.
"You know, I was fine with doing it, I didn't feel at all that we were hurting anything. My feeling always was that the original version was always gonna be there, and I don't know if that's necessarily happened. George hasn't put the effort into doing an HD, super good HD version of the original versions and I don't know if that will ever happen. But at the time my feeling was that we could finally make these shots better, you know. He went through and picked a bunch of shots, and I picked a bunch of shots and we redid them so they just looked a lot better. I was fine with it, and I think it's gone overboard, I think it's been done too many times and too many shots, but I just feel as long as the original version is always there that it's fine to be able to work on it later on, and sort of like 'so what', you know?" ―Dennis Muren
The renewal was done by digitally remastering the image and sound with extensive clean-up and restoration work, Lucas also made a number of changes to the films in order to "finish the film the way it was meant to be" (as Lucas said in a September 2004 interview with the Associated Press) so that someone who started watching the saga from the prequel trilogy wouldn't notice the aesthetic difference between the 20 years.
The most significant alterations were cosmetic, generally adding special effects which weren't originally possible, like the addition of some originally filmed but cut scenes (like Han Solo's confrontation with Jabba the Hutt), the addition of new digitally made sequences (like the arrival at Mos Eisley) which sometimes included the replacement of older scenes altogether (like the flight to the Death Star).
Other changes, however, are considered to have affected plot or character development. These changes, such as the change often referred to with the phrase "Han shot first," have been controversial, inciting considerable criticism of George Lucas by fans. This was one of the first causes of the Lucas Bashing phenomenon.
Contents show]
Covers Edit
Theatrical poster Edit
Box set release Edit
Special Edition box set
2000 VHS cover Edit
Star Wars Episode IV: A New Hope Star Wars Episode V: The Empire Strikes Back Star Wars Episode VI: Return of the Jedi
Add a photo to this gallery
Bibliography Edit
I find your lack of sources disturbing. This article needs to be provided with more sources and/or appearances to conform to a higher standard of article quality.
Notes and references Edit
|
{
"pile_set_name": "OpenWebText2"
}
|
Disgraced ex-congressman Jesse Jackson Jr. reportedly at N.C. prison
Jesse Jackson Jr. was first elected to Congress in 1995. Sandi Jackson was a Chicago alderman until she resigned her post in January 2013. They have two children. On Feb. 15, 2013, federal prosecutors charged the couple, alleging he misused $750,000 in campaign funds and she understated their income on tax returns for six years. On Feb. 20, Jackson Jr. pleaded guilty.
WASHINGTON — A case filled with strange twists and turns took a detour into confusion Monday night when a spokeswoman linked to former Rep. Jesse Jackson Jr. announced that the ex-congressman had reported to federal prison but prison officials said he was not in custody.
Bunnie Jackson-Ransom, an Atlanta publicist for Jackson lawyer C.K. Hoffler, said Jackson arrived at the Butner Federal Correctional Complex in North Carolina sometime after 2p.m. Chicago time Monday.
But Chris McConnell, Butner's executive assistant and public information officer, was contacted after Jackson's announced arrival time and denied that Jackson was there. And Ed Ross, a Bureau of Prisons spokesman in Washington, noted that the "inmate locator" on the prison system's website listed Jackson as "not in BOP custody" late Monday.
The contradiction could not immediately be reconciled. But WLS-TV reported that Rep. G.K. Butterfield, a North Carolina Democrat who was said to have accompanied Jackson, explained that a paperwork problem at Butner was being worked out. At sentencing, Jackson had been ordered to report to prison for his 30-month sentence no earlier than this coming Friday.
Jackson's defense lawyers did not respond to Tribune requests for comment.
Jackson, 48, who was convicted of looting his campaign fund of $750,000, had already been given a number as Inmate 32451-016.
The federal complex at Butner is not far from Durham.
Jackson is expected to join other high-profile felons there. It is home to rogue financier Bernard Madoff; spy Jonathan Pollard; Omar Ahmad Rahman, the "blind sheik" convicted for plotting to blow up New York City landmarks; and Jon Burge, the former Chicago police commander under whose watch African-American suspects were tortured into making false confessions to rape and murder, records show.
A former congressman from California, Republican Randy "Duke" Cunningham, who was convicted of bribery, served time at Butner before his release. And Frank Calabrese Sr., a Chicago mobster responsible for several gangland slayings in the 1970s and '80s, died last Christmas in Butner's Federal Medical Center.
Jackson, the son of civil rights leader the Rev. Jesse Jackson, reportedly has depression and bipolar disorder. Jackson Jr. pleaded guilty to stealing $750,000 from his campaign from 2005 to 2012 to pay for vacations, furs, celebrity memorabilia and even two elk heads.
He was ordered to pay $750,000 in restitution. According to a court filing last week, the ex-congressman will pay $200,000 by Friday and then sell his Washington home. By May 15, attorneys will give the judge a report on how much he has paid.
|
{
"pile_set_name": "Pile-CC"
}
|
Photosynthetic characteristics of a multicellular green alga Volvox carteri in response to external CO2 levels possibly regulated by CCM1/CIA5 ortholog.
When CO(2) supply is limited, aquatic photosynthetic organisms induce a CO(2)-concentrating mechanism (CCM) and acclimate to the CO(2)-limiting environment. Although the CCM is well studied in unicellular green algae such as Chlamydomonas reinhardtii, physiological aspects of the CCM and its associated genes in multicellular algae are poorly understood. In this study, by measuring photosynthetic affinity for CO(2), we present physiological data in support of a CCM in a multicellular green alga, Volvox carteri. The low-CO(2)-grown Volvox cells showed much higher affinity for inorganic carbon compared with high-CO(2)-grown cells. Addition of ethoxyzolamide, a membrane-permeable carbonic anhydrase inhibitor, to the culture remarkably reduced the photosynthetic affinity of low-CO(2) grown Volvox cells, indicating that an intracellular carbonic anhydrase contributed to the Volvox CCM. We also isolated a gene encoding a protein orthologous to CCM1/CIA5, a master regulator of the CCM in Chlamydomonas, from Volvox carteri. Volvox CCM1 encoded a protein with 701 amino acid residues showing 51.1% sequence identity with Chlamydomonas CCM1. Comparison of Volvox and Chlamydomonas CCM1 revealed a highly conserved N-terminal region containing zinc-binding amino acid residues, putative nuclear localization and export signals, and a C-terminal region containing a putative LXXLL protein-protein interaction motif. Based on these results, we discuss the physiological and genetic aspects of the CCM in Chlamydomonas and Volvox.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
SALT LAKE CITY — Utah better come up with new revenue sources for transportation, a legislative task force was warned Thursday, because the gas tax is on the way out, like “a rock star playing a final concert” on a farewell tour.
"The current funding system is not sustainable," Baruch Feigenbaum, assistant director of transportation policy for the Reason Foundation, a libertarian think tank, told members of the Transportation Governance and Funding Task Force.
Feigenbaum, who compared the gas tax to a rock star at the end of his career, said even with the complicated indexing formula passed in 2015 and recalibrated this year to boost revenues, Utah's gas tax likely will sputter out around 2030.
In a presentation made over the phone, he offered a number of alternative revenue sources, such as toll roads along I-15 and taxing drivers based on miles driven, with higher rates applicable in urban areas and during rush hours.
The potential moneymakers could be tested through demonstration projects authorized by the Legislature, Feigenbaum said.
No action was taken on his proposals by the task force, which is expected to make recommendations to the 2018 Legislature on funding as well as if the state should shake up control of transportation agencies, particularly the Utah Transit Authority.
The task force's House chairman, Rep. Mike Schultz, R-Hooper, said after the meeting that no revenue source is off the table at this point.
"We're looking at all sources right now. I think we're taking everything seriously," Schultz said. "We know that the gas tax is going to be less and less and go away eventually."
Feigenbaum also said all users should pay an equitable share of the costs of maintaining Utah's transportation system, including those driving alternative fuel vehicles and even bicyclists.
He suggested Utah consider a separate tax for electric cars, and when it comes to ensuring bicyclists pay their way, look at imposing a tax on bicycle tires that he said has been accepted in Oregon and other states.
Public transit, funded largely through sales taxes, could see additional funds by tapping a “significantly underused tool” known as value capture, Feigenbaum said, that includes assessing new property taxes near transit lines and impact fees.
Concerns about UTA's transit-oriented development projects around several TRAX and FrontRunner stations have been raised in critical legislative audits and are part of an ongoing federal investigation. UTA has signed a nonprosecution agreement with the U.S. Attorney's Office that requires the agency cooperate with the investigation and submit to up to three years of federal monitoring.
So far, the investigation has resulted in the indictment of a former UTA board member, Terry Diehl, on charges related to allegedly misrepresenting earnings from a Draper transit deal in bankruptcy court.
After the meeting, UTA President and CEO Jerry Benson said what he took from the presentation on value capture was that transit-oriented development "was a legitimate strategy and we probably need to be looking more at that concept."
Schultz said the controversy about transit-oriented development isn't necessarily about the program that was approved by lawmakers, but about how UTA officials were involved in the projects.
He said UTA does need additional funding, but for that to come from the state would require more control. The agency is now overseen by a board appointed by state and local entities.
"I don't think there is the political will to give UTA state dollars under the current structure," Schultz said. But with a change in governance, he said some existing transportation funds could be shifted.
"Maybe there's the possibility of taking some of the money that we're putting toward roads and putting it toward transit projects," Schultz said. "I think that's something we need to look at."
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
xpages design elements not shown
I;m using IBM Notes 9 - social edition and I saw that some design elements are missing: for example, paragraph and script editor.
Should I import them or they are just hidden?
Thanks for your time!
A:
You just need to change your IBM Domino Designer preferences to show them in the palette. In Domino Designer go to File - Preferences and then go to Domino Designer - XPages - Palette.
Paragraph is in the Other Controls palette category while Output script is in the Core Controls palette category.
|
{
"pile_set_name": "StackExchange"
}
|
Synthesis of fructooligosaccharides from Aspergillus niger commercial inulinase immobilized in montmorillonite pretreated in pressurized propane and LPG.
Commercial inulinase from Aspergillus niger was immobilized in montmorillonite and then treated in pressurized propane and liquefied petroleum gas (LPG). Firstly, the effects of system pressure, exposure time, and depressurization rate, using propane and LPG, on enzymatic activity were evaluated through central composite design 2³. Residual activities of 145.1 and 148.5% were observed for LPG (30 bar, 6 h, and depressurization rate of 20 bar min⁻¹) and propane (270 bar, 1 h, and depressurization rate of 100 bar min⁻¹), respectively. The catalysts treated at these conditions in both fluids were then used for the production of fructooligosaccharides (FOS) using sucrose and inulin as substrates in aqueous and organic systems. The main objective of this step was to evaluate the yield and productivity in FOS, using alternatives for enhancing enzyme activity by means of pressurized fluids and also using low-cost supports for enzyme immobilization, aiming at obtaining a stable biocatalyst to be used for synthesis reactions. Yields of 18% were achieved using sucrose as substrate in aqueous medium, showing the potential of this procedure, hence suggesting a further optimization step to increase the process yield.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Developing the channel training strategy supporting the business plan for the channel,Ensuring execution of training initiatives as per the curriculum and learning needs leading to desired increase in productivity.Responsible for leading a team of TM...
|
{
"pile_set_name": "Pile-CC"
}
|
Human and ovine amniotic fluid composition differences: implications for fluid dynamics.
The ovine model is frequently utilized to extrapolate data regarding fetal and amniotic fluid dynamics to human pregnancy. The ovine amnion is highly vascularized, facilitating intramembranous exchange of water and solutes between the amniotic fluid and fetal plasma. In comparison, the relatively avascular human amniotic membrane may have a reduced potential for intramembranous absorption. In view of these anatomical differences, we hypothesized that comparison of human and ovine amniotic fluid composition would provide insight into differences in the mechanisms of amniotic fluid exchange. Amniotic fluid was sampled from 43 patients upon hospital admission, and from 27 ovine ewes at five days following amniotic fluid catheter placement. Both human (32 to 39 weeks' gestation) and ovine pregnancies (125 to 136 days' gestation) were sampled during the last 20% of gestation. Samples were analyzed for osmolality and sodium, potassium and chloride concentrations. The contribution of electrolytes to amniotic fluid osmolality and changes in osmolality and electrolyte composition versus gestational age were assessed by regression and covariance analysis. Mean (+/-SEM) amniotic fluid sodium concentration (134.6+/-1.9 vs. 127.1+/-2.0 mEq/1) was greater and potassium (4.6+/-0.1 vs. 6.1+/-0.6 mEq/l) and osmolality (263.9+/-3.7 vs. 285.1+/-1.6 mOsm/kg) less in human than sheep. The range of amniotic fluid osmolality was greater in human (223 to 336 mOsm/kg) than in sheep (274 to 298 mOsm/kg). Human amniotic fluid osmolality was highly correlated with amniotic fluid sodium (r = 0.97) and chloride (r = 0.96) while ovine amniotic fluid osmolality was only weakly correlated with amniotic fluid sodium (r = 0.75) and chloride (r = 0.51). The slope of the regression line of amniotic fluid sodium and osmolality was greater for human than for sheep amniotic fluid (P < 0.0001). The percent of amniotic fluid osmolality accounted for by sodium, chloride and potassium concentrations was greater for human (97%) than for sheep (86%; P < 0.0001). The results suggest that human amniotic fluid osmolality is comprised almost entirely of the major electrolytes while alternative solutes (e.g., fructose) contribute to ovine amniotic fluid osmolality. Extrapolation of fetal and amniotic fluid dynamics from ovine models to humans should incorporate differences in amniotic fluid osmolality and electrolyte composition.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
I Feel I Must Apologize…
Harry Enfield has done some interesting stereotypes in his comedy sketches in the past (though not without controversy), including Jurgen, the profusely and masochistically apologetic German, and the Dutch policemen, who are attentative gay lovers and have more than a passing interest in pot smoking. Well, I spotted this PARANOIA auction, and I couldn’t help but apply one of Enfield’s Northern European accents to it…
It is forbidden to disobey the Computer. Now as a lowly, Infra-red troubleshooter who is a traitor to Alpha Complex and the Computer; how will you survive?
More books than just the box set…
[snip… snip…]
The Paranoia Sourcebook – The Return of the Computer; its back and badder than ever. Gives subdivisions of Alpha: Alpha Complex, Alpha Base, and Alpha City. Explains Treason, Commies, Mutants, and Clones in Reboot Alpha. New equiptment from R&D (Oh No!)
Too Hilarious! Paranoia is a Dark Comedy set in the futuristic underground complex of Alpha.
Batteries and dice not included. Bid Now and Win!
Possibly it’s just me. In fact, it definitely is just me; but, it amuses me no end, like an R&D experiment gone wrong (Oh No!)
Like translating humour in stand-up comedy, just how easy is it to translate some aspects of a setting like PARANOIA, especially considering so many of the foundations of the back story come from English literature and Western film.
|
{
"pile_set_name": "Pile-CC"
}
|
777 F.2d 699
*Kitchensv.Villard
85-4372
United States Court of Appeals,Fifth Circuit.
11/19/85
1
N.D.Miss.
AFFIRMED
2
---------------
* Fed.R.App.P. 34(a); 5th Cir.R. 34.2.
|
{
"pile_set_name": "FreeLaw"
}
|
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
Social housing is essential to the welfare of some captive animals e.g. \[[@pone.0160029.ref001]--[@pone.0160029.ref003]\]. Wild chimpanzees form multi-male and multi-female groups \[[@pone.0160029.ref004]--[@pone.0160029.ref006]\], and evidence suggests that chimpanzees who are separated from their conspecifics show diverse abnormal behaviors, including self-injurious and stereotypic behaviors, and fail to show certain appropriate, normal social and reproductive behaviors e.g. \[[@pone.0160029.ref007]--[@pone.0160029.ref011]\]. Therefore, providing social stimulation in the form of interaction with conspecifics is one of the most important parts of the care of captive chimpanzees. However, social management is one of the most difficult parts of captive management \[[@pone.0160029.ref002],[@pone.0160029.ref012],[@pone.0160029.ref013]\]. Although the formation of complex social groups comparable to that of wild groups is recommended, it can sometimes result in negative consequences. For example, male chimpanzees are aggressive in nature \[[@pone.0160029.ref014]\]; keeping several adult males in a captive environment with females often results in escalated aggression. As a result, surplus males emerge, and unnatural social compositions, such as all-male groups, are sometimes formed to solve the problem of surplus animals \[[@pone.0160029.ref015]\]. In addition, only adolescent females normally migrate from their natal groups in the wild, whereas both females and males in captivity are relocated between institutions---on artificial schedules---due to breeding programs, retirement from research, closure of institutions, etc. \[[@pone.0160029.ref016],[@pone.0160029.ref017]\] and integrated into new social groups. These factors may lead to long-term stress in captive chimpanzees. Furthermore, in human and non-human animals, social interaction can have both positive and negative consequences, depending on the circumstances and the quality of the relationship e.g. \[[@pone.0160029.ref018],[@pone.0160029.ref019]\]. As social relationships are unpredictable and can affect animal welfare for over long period of time, social management plays a role in maximizing the positive effects of these social relationships while reducing the stress derived from them.
Understanding the factors associated with long-term stress is particularly important, as it can have profound effects on animal welfare. Glucocorticoids (GCs), steroid hormones secreted by the adrenal glands of vertebrates, are frequently used as an indicator of physiological and psychological stress, because they often increased when organisms face stressors \[[@pone.0160029.ref020],[@pone.0160029.ref021]\]. GCs generally increase available energy, and their acute increases are generally considered adaptive in stressful situations. However, prolonged exposure to GCs can result in a number of maladaptive consequences, such as neuronal cell death, insulin resistance, muscle and bone atrophy, poor wound healing, hypertension, and even collapse of the immune system to the point of death \[[@pone.0160029.ref022]\]. Prolonged exposure can also affect their reproduction \[[@pone.0160029.ref023]\] and accelerate or increase the likelihood of acquiring certain illnesses, such as cardiovascular disease, which is one of the common causes of death in captive great apes \[[@pone.0160029.ref020],[@pone.0160029.ref023]--[@pone.0160029.ref026]\]. Cortisol is the primary GC released in primates and has historically been measured in the blood, saliva, urine, and feces of many primate species e.g. \[[@pone.0160029.ref027]--[@pone.0160029.ref035]\]. Although these samples offer advantages in the measurement of relatively short-term stress, they are difficult to use to monitor long-term stress. Bahr et al. \[[@pone.0160029.ref036]\] compared the temporal excretion of cortisol metabolites in the urine and feces of a chimpanzee. They reported that the peak of excretion in urine was found 4.8 h after labeled cortisol was administered intravenously; in feces, it was recovered 22.2 h after administration. Even fecal samples can change within 24 h of cortisol secretion, rendering repeated sampling necessary. Additionally, the cortisol concentration often changes with storage method and duration \[[@pone.0160029.ref037],[@pone.0160029.ref038]\] and can also be affected by diurnal rhythms \[[@pone.0160029.ref039]\]. Such issues make it difficult to investigate long-term stress in captive wild animals.
Hair cortisol (HC) has been shown to be a useful measure of long-term hypothalamic--pituitary--adrenal (HPA) axis activation in several species including humans \[[@pone.0160029.ref040]--[@pone.0160029.ref048]\] and has attracted attention as a way to overcome the aforementioned problems. Substances from blood are absorbed by growing hair follicles and accumulate as hair grows \[[@pone.0160029.ref049]\]. Therefore, HC can reflect the accumulation of cortisol in the hair shaft over several months.It was reported that HC levels increase after relocation \[[@pone.0160029.ref041]\] and are associated with behavioral phonotype \[[@pone.0160029.ref050],[@pone.0160029.ref051]\], population density \[[@pone.0160029.ref052]\], and ecological disturbance caused by humans \[[@pone.0160029.ref046],[@pone.0160029.ref053]\]. Recently, we developed an HC assay to monitor cortisol accumulation for several months in captive chimpanzees and found a link between HC levels and aggression \[[@pone.0160029.ref054]\]. Although body regions can affect the HC analysis \[[@pone.0160029.ref054]--[@pone.0160029.ref056]\], we found a similar trend in the change in HC levels between the proximal and distal parts of hair segments obtained from different body regions \[[@pone.0160029.ref057]\]. Hair color and other methodological factors can also influence the HC results, but HC is stable over time \[[@pone.0160029.ref057],[@pone.0160029.ref058]\] and is advantageous for long-term monitoring of cortisol in various captive settings, provided these methodological pitfalls are avoided. This new methodology enables the long-term stress levels of captive chimpanzees to be assessed more efficiently. However, few studies have used this novel technique to assess the effects of the husbandry and management of captive animals.
Our goal was to investigate the relationship between factors relevant to social management and long-term stress levels in captive chimpanzees via two specific approaches. First, we investigated the effects of the relocation and acclimation of chimpanzees by monitoring behaviors and HC in a group of chimpanzees over a 3-year period. We first focused on relocation as it is a challenging event that requires animals to adapt to a new physical and social environment and thus requires particular care and consideration from the animal caretakers. Understanding how relocation affects long-term stress is useful for creating strategies to mitigate the stress derived from relocation and to maintain the physical and mental health of the animals. However, despite the fact that chimpanzees are one of the most common great ape species in captivity and that the animals are frequently relocated between institutions, little is known about the relationship between long-term stress and the relocation of chimpanzees living in social housing \[[@pone.0160029.ref059]--[@pone.0160029.ref061]\]. Previously, Schapiro et al. \[[@pone.0160029.ref016]\] reported the effects of the relocation of 72 chimpanzees on physiological parameters obtained from blood. They found that hematological, clinical chemistry, and immunological parameters changed significantly immediately after relocation and reported that the immunological parameters of some of the chimpanzees had not returned to their baseline levels 12 weeks after relocation, indicating that chimpanzees may need long periods of acclimation after being moved to a new environment. Another chimpanzee study suggested that the effects of relocation depend on rearing history \[[@pone.0160029.ref062]\]. Reimers et al. \[[@pone.0160029.ref062]\] measured changes in fecal GC metabolites after the transportation and resocialization of ex-laboratory chimpanzees and found that chimpanzees who had experienced early deprivation showed more prolonged cortisol increases than those who had experienced late deprivation. Recent studies in rhesus macaques found similar results. Devenport et al. \[[@pone.0160029.ref041]\] reported that the HC levels of rhesus macaques increased 14 weeks after relocation and decreased 35 weeks after relocation. Furthermore, Dettmer and Novak \[[@pone.0160029.ref063]\] suggested that mother-reared rhesus macaques showed a weaker response to relocation. Therefore, relocation can influence many welfare indicators for the long-term and rearing history, and other factors, such as age, sex, group formation, and aggressive interactions, may modify stress reactions to relocation. We hypothesized that relocation can lead to long-term stress in captive chimpanzees. Specifically, we predicted that the HC level of chimpanzees would increase after relocation and decrease 1 year after relocation, as observed in Davenport et al. (40). We also predicted that there might be sex differences in the response to relocation, because female wild chimpanzees migrate into other social groups after puberty, whereas male chimpanzees do not \[[@pone.0160029.ref004]\].
Second, we investigated the factors underlying individual differences in HC levels among 58 captive chimpanzees. As noted above, there can be individual differences in reactions to relocation, and this might be important when considering a specific strategy to mitigate the long-term stress of chimpanzees. However, it is difficult to test these hypotheses with the first approach mentioned above due to the impracticality of obtaining sufficient numbers of relocated chimpanzees. Additionally, various individual (e.g., age, sex, and early-rearing conditions) and environmental factors can influence the HC levels at the same time. Therefore, we focused on individual differences in HC levels and investigate the factors influencing the average HC levels of captive chimpanzees using statistical approach sometimes used in the previous studies of animal welfare. For example, Shepherdson et al. \[[@pone.0160029.ref064]\] compared individual fecal GC metabolites (FGM) of 55 polar bears living in 20 zoological institutions to investigate individual and facility level factors affecting FGM levels. They found that temperament, stereotypic behaviors and some facility characteristics were related to FGM levels. This approach based on epidemiological studies has proven to be a powerful tool for elucidating the risk factors that decrease animal welfare \[[@pone.0160029.ref064],[@pone.0160029.ref065]\]. In this regard, we test four specific hypotheses. First, we hypothesized that relocation can influence average HC levels. We predicted that immigrant or relocated chimpanzees who came from other institutions would have higher HC levels than native chimpanzees who did not experience changes in their physical and social environment. Second, we hypothesized that social situation can influence the HC responses. Previously, we found a positive correlation between HC and the rate of receiving aggression, whereas the rate of initiating aggression was not related to HC levels in six male chimpanzees \[[@pone.0160029.ref054]\]. We predict that similar results would be obtained with a larger sample size, but, as males and females have different social characteristics, we hypothesized that the relationship between HC and aggression might be sex-dependent. We also predicted that social composition influences HC levels. As noted previously, all-male groups sometimes form to solve the problem of surplus male chimpanzees \[[@pone.0160029.ref012],[@pone.0160029.ref013]\], and such social groups might constitute a feasible management strategy for captive chimpanzees. However, no study has investigated differences in stress responses between the males in all-male groups and those in mixed-sex groups males, despite the fact that all-male group formation is not observed in wild chimpanzees, which differs from the case in gorillas \[[@pone.0160029.ref066]\]. If all-male group formation poses excessive physiological challenges, the HC levels could be higher in individuals living in such groups. Third, early-rearing experience can also influence HC levels. Studies have shown that animals who have experienced maternal separation early in life have altered HPA responses e.g. \[[@pone.0160029.ref067]--[@pone.0160029.ref069]\]. Because impaired social abilities were observed in individuals who were separated from their mother early in life e.g. \[[@pone.0160029.ref011],[@pone.0160029.ref070]\], such individuals might be suffering from such a deficiency. In that case, we would expect them to have higher HC levels than other individuals.
Materials and Methods {#sec002}
=====================
Subjects {#sec003}
--------
The subjects were 58 chimpanzees (35 males, 23 females; age range: 5--44 years) living in Kumamoto Sanctuary (KS), Kyoto University, Japan. Eight were relocated from the Great Ape Research Institute (GARI) in January 2013. Established in 2007, KS was the first chimpanzee sanctuary in Japan (it was renamed from Chimpanzee Sanctuary Uto (CSU) in 2011 when the institution was passed onto Kyoto University from Sanwa Kagaku Research Institute. For more information see \[[@pone.0160029.ref012]\]. KS accommodates ex-laboratory chimpanzees and chimpanzees considered surplus in Japanese zoos. KS accepted 15 chimpanzees from other institutions between 2008 and 2012. It promotes the social life of chimpanzees, and three types of social groups have formed: all-male groups; one-male and multi-female groups; and multi-male, multi-female groups. The members of the all-male groups are changed periodically to provide social stimulation and prevent escalated aggression, directed especially toward immigrant individuals. Decisions regarding social group formation were also based on the chimpanzees' choices. The chimpanzees sometimes refused to move or moved to near the door connected to different enclosures voluntarily. Such behaviors were considered when making the decisions. All individuals had access to both indoor and outdoor enclosures, most of which are cage style (*i*.*e*., a building with a roof), although one outdoor enclosure (about 270 m^2^ in area) has no roof. The outdoor cages range in size from about 70 m^2^ in area and 5.4 m in height to about 120 m^2^ in area and 12 m in height. All these outdoor cages are connected to other cages. Most of the chimpanzees used multiple cages, and some of them used different enclosures from day to day. Passages totaling 150 m in length that connect several cages within KS were introduced, and groups of chimpanzees could access the passages in turn for exploration. They had free access to water at any time, and regular meals (consisting mainly of fruits, vegetables, and monkey pellets) were provided three times per day. Additionally, routine feeding enrichment (e.g., juice feeders, puzzle feeders, browsing opportunities, and foods concealed in boxes or newspapers) were changed daily. Other types of environmental enrichment were also provided. For example, fire hoses, ropes, hammocks, climbing structures, and substrate materials were installed, and natural vegetation was planted to increase the complexity of the physical environment. Spaces were also available for the chimpanzees to escape from rain, strong sunlight, and cold, and they were provided with comfortable bedding materials for day- and night-time sleep. Materials that they could manipulate freely were also provided, such as toys, buoys, and sacks. For additional details on environmental enrichment, please see \[[@pone.0160029.ref071]\]. In addition to the lifelong care of these chimpanzees and bonobos, non-invasive research (cognitive, behavioral, endocrinological, and genetic) is conducted at KS.
General Methods {#sec004}
===============
Hair cortisol (HC) assessment {#sec005}
-----------------------------
Basic methods to quantify HC levels were based on our previous study \[[@pone.0160029.ref054]\]. Briefly, samples were collected from chimpanzees by cutting arm hair with scissors. Samples were collected from similar parts of the arms. Samples were cut with scissors by keepers or researchers at each institute (KS: MT, NM, SH, and other keepers; GARI: keepers) who were familiar with the individual animals. We were able to obtain hair samples from all chimpanzees. There was some small variation in the sampling procedures across individuals. Hair samples were collected by asking the subject chimpanzees to show their arm parts through the cage mesh or to extend their arms through a small window in their home cages or enclosures, or when people were together with the subject chimpanzees in the same room. In two cases, we collected hair samples when chimpanzees were anesthetized for their health check. Although we tried to cut the hair at the skin surface in all the cases, about 5 mm of hair was often left. To check whether we were able to obtain stable results with this methodology, we compared the HC levels obtained from similar body parts on the same day in our previous study \[[@pone.0160029.ref057]\]. We found that the samples were significantly correlated and the absolute values did not differ significantly. Therefore, although small intra- and inter-individual variation exists in terms of hair sample collection, the previous study showed that the procedures can produce consistent results \[[@pone.0160029.ref057]\]. We also collected multiple hair samples from each individual to use average HC levels for comparisons, to minimize the effects of such sampling errors and possible inter-individual variation in the hair growth rate. Samples were stored at ambient temperature until analysis. Samples were washed with 5 mL isopropanol and dried. Samples were then ground into a fine powder using a Precellys 24 tissue homogenizer (Bertin Technologies, Orléans, France). The powdered samples were weighed and placed in 2-mL tubes, and 1-mL methanol was added. Cortisol was extracted by shaking the tubes for 24 h at ambient temperature. Following extraction, the samples were centrifuged, and 0.6 mL of supernatant was aliquoted into different tubes and evaporated by vacuum oven at 80°C. Samples were reconstituted using phosphate buffer, and cortisol concentrations were measured using a salivary cortisol enzyme immunoassay (EIA) kit (Salimetrics, Philadelphia, PA, USA). The intra-assay variability was 4.85%, and inter-assay variabilities for high and low controls were 4.0 and 9.16%, respectively (mean of nine plates). In our previous study, we reported the stability of this method of HC measurement regardless of storage duration \[[@pone.0160029.ref057]\].
Behavioral monitoring {#sec006}
---------------------
Aggressive interactions were monitored using daily behavior monitoring sheets developed for this study. Aggressive interactions were defined as behaviors that included chasing, hitting, biting, kicking, and charging displays directed toward group members; individuals who were targets of such behavior showed screaming, escaping, or counterattacking behaviors(6). Each day, keepers or researchers in charge of taking care of the chimpanzees recorded the names of the individuals who initiated, and were the targets of, aggression when they observed any such behaviors during their husbandry routine. They also recorded whether the aggressive interactions resulted in injury to any individual involved. Because this is a simple way of behavior monitoring, we checked the validity of behavior monitoring sheets by comparing the sociogram generated by these sheets with that generated by direct observation. For that purpose, YY collected the behavioral data of 11 male chimpanzees living in two social groups for 6 months, in total, in 2014 and 2015 (from June to July 2014 and from December 2014 to March 2015). The daily checks of the behaviors using the daily behavior monitoring sheets by researchers and keepers continued during the same 6-month period. YY completed 230.5 hours of observation and collected data on aggressive interactions. Direct observations were made in the two adjacent groups of chimpanzees between 11 am and 3 pm. During the observation, YY collected data on aggressive interactions using all-occurrence sampling methods. YY conducted 30 min of focal observation in a randomly assigned order and recorded behaviors (e.g., foraging, resting, and grooming, which were not used for this study). During the observations, YY recorded all of the aggressive interactions that occurred in the groups. YY stopped making focal observations and recorded aggressive interactions when a scream was heard or when there were any other signs of aggression. We applied the same definition of aggressive interactions given above. We created sociograms based on these two types of observation. Pearson's correlation tests were performed using UCINET \[[@pone.0160029.ref072]\]. The two observation methods yielded significant positive correlations in the two groups (r = 0.496--0.623, p \< 0.01). We also tested the inter-rater reliability among the observers using video clips and found more than 90% agreement with the behaviors coded by the first author.
Study 1: Monitoring HC level before and after relocation {#sec007}
--------------------------------------------------------
For the first experiment, we collected hair from eight chimpanzees moved from the GARI to KS at the end of January 2013 ([Table 1](#pone.0160029.t001){ref-type="table"}). They were divided into two groups: the main group, consisting of six chimpanzees (Group A), and another group, with a mother--offspring pair (Group B). We collected hair from these chimpanzees twice before relocation (August and December 2012) and seven times (first year: April, June, September, December, 2013 and March, 2014; second year: September 2014 and March 2015) after relocation. We collected hair more frequently (once every three months) for the first year after their move to the new environment. In September 2015, two individuals, Loi and Tsubaki, were moved to another zoo in Japan as part of a breeding program. Therefore, we collected hair from these two chimpanzees eight times, and we collected hair from the other six individuals nine times. We analyzed HC levels as described in the previous section. We divided the proximal and distal segments of the hair samples by cutting the hairs into two parts at the middle and processed these separately whenever possible. For comparison, we collected hair from 24 chimpanzees that remained in KS during this period (the control group); hair was collected seven times (once between July and December, 2012; in June, September, and December, 2013; in March and September, 2014; and in March, 2015).
10.1371/journal.pone.0160029.t001
###### Profile of chimpanzees in Study 1.
{#pone.0160029.t001g}
Name Year born Sex Rearing history Group
--------- ----------- ----- -------------------- -------
Loi 1995 M Artificial (late) A
Zamba 1995 M Artificial (late) A
Mizuki 1996 F Artificial (early) A
Tsubaki 1996 F Artificial (late) A
Misaki 1999 F Artificial (late) B
Natsuki 2005 F Mother-reared A
Iroha 2008 F Mother-reared A
Hatsuka 2008 F Artificial (early) B
Aggressive interactions were recorded using behavior monitoring sheets from January 2013 to March 2014 by keepers and researchers during their husbandry routine. We categorized aggressive interactions into two categories: injurious (resulting in injury) and moderate (without injury).
There were various differences between the two institutions (GARI and KS) with respect to their physical environments and husbandry routines. For example, the GARI facility consisted of a large outdoor compound covering approximately 7,400 m^2^ in area and containing natural vegetation, enrichment items, and a 13-m high climbing structure attached to indoor rooms \[[@pone.0160029.ref073]\]. For the first 9 months after moving to KS, the eight chimpanzees (January 2012 to October 2013) lived in a facility consisting of two outdoor cages, each of which was approximately 100 m^2^ in area and 5.6 m in height, and attached to indoor rooms. Both the indoor and outdoor cages were enriched with items such as substrate materials, branches, fire hoses, and feeders. In October 2013, the chimpanzees were moved into a different facility within KS. This second facility consisted of three connected outdoor cages of approximately 70, 80, and 150 m^2^ in area and 5.4 m in height, containing natural vegetation and climbing frames attached to indoor rooms. The two facilities also differed with respect to food varieties and keepers. For more information regarding these two institutions, please see \[[@pone.0160029.ref012],[@pone.0160029.ref074]\].
Study 2: Relationship between HC level and environmental and individual factors {#sec008}
-------------------------------------------------------------------------------
The subjects were 58 chimpanzees living in KS. We collected hair samples from the arm four times from 56 individuals and three times from two individuals between June 2013 and April 2014. We checked the effects of age, sex, relocation status, group type, rearing history and aggressive interactions on the average HC levels. The chimpanzees were divided according to relocation status: eight chimpanzees had been relocated (relocated from another institution as a group), seven chimpanzees were immigrants (relocated from other institutions and integrated into new social groups within 5 years), and 44 chimpanzees were residents (housed at KS for more than 5 years). Rearing history included four categories of chimpanzees: wild-born, mother-reared in captivity, and artificially reared (divided into early- or late-separation according to the timing of maternal separation). These categories are listed in [Table 2](#pone.0160029.t002){ref-type="table"}. We used the rate of aggressive interactions calculated from behavior monitoring sheets recorded between April 2013 and March 2014 by keepers and researchers during their husbandry routine.
10.1371/journal.pone.0160029.t002
###### Categories of individuals.
We divided the artificially reared chimpanzees into two categories: early-deprived and late-deprived, as determined by median number of days of maternal separation.
{#pone.0160029.t002g}
Category Definition No. of males No. of females
------------------- ---------------------------------------------------------------------------------------- -------------- ----------------
Group type
All-male group Group consists only of males 28 0
Mixed-sex group Group consists of male(s) and females 7 23
Relocation status
Relocation group Relocated from another institution as a group 2 6
Immigrant group Relocated from other institutions and integrated into new social groups within 5 years 5 2
Resident group Housed at KS for more than 5 years 28 15
Rearing history
Mother-reared Reared by their biological mothers until weaning 7 2
Early-deprived Separated from their biological mothers before 205 days and reared by humans 10 7
Late-deprived Separated from their biological mothers after 333 days and reared by humans 5 4
Wild-born Born in the wild 12 10
Unknown 1 0
Statistical analysis {#sec009}
--------------------
We used Generalized Linear Model (GLM) and Generalized Linear Mixed Model (GLMM) to analyze the results. For Study 1, we used GLMM to investigate the effects of relocation on eight chimpanzees. To this end, we used the function 'glmer' with a gamma distribution and the identity link function. We treated sampling year (three categories: before relocation, first year after relocation, and second year after relocation) as an explanatory variable and individual ID as a random factor. Due to convergence errors, we used changes in the HC level from 2012 as a response variable for constructing the model (the HC level for each year was divided by the HC level in 2012). We first constructed the model using sampling year, relocation-status group, and their interaction. Then, we separately analyzed changes in HC levels for each relocation-status group, and we compared Akaike Information Criteria (AIC) between models with and without the factor of sampling year as we found the interaction effects. Furthermore, to check the differences in the HC levels between two relocation-status groups for each sampling year, we constructed a model with relocation status group for each year and compared the AIC between models with and without the relocation-status group factor. For Study 2, we used the glm function with a gamma distribution and the linear function (identity) to examine the relationship between average HC levels and environmental and individual factors. We first constructed models including age, sex, relocation status, group type, rearing history, and aggressive interactions as explanatory variables. The rate of receiving and initiating aggression was calculated by summing the number of episodes involving the receiving of or initiation of aggression over an entire year; the rate was standardized for each social group. Standardization involved subtracting the average rate of receiving/initiating aggression within each social group from the individual rate of receiving/initiating aggression, and then dividing this number by the standard deviation for each group. As initiating aggression and receiving aggression can be related to each other, we constructed models including one of the factors to separately analyze these two factors. We also constructed models for each sex, because group type and aggressive interactions were confounded with sex. We included age, relocation status, group type, rearing history, and aggressive interactions as explanatory variables. In total, we constructed six models from sex (3 categories: all, male, and female)\* and aggressive interactions (2 categories: receive and initiate aggression) and conducted a model simplification process \[[@pone.0160029.ref075]\]. We compared AIC among models comprised of various combinations of the aforementioned factors to identify the models that produced the lowest AIC value. We considered models with ΔAIC (difference in AIC from the smallest AIC models) \< 2 as valid models \[[@pone.0160029.ref076]\]. We also used Spearman's rank correlation test to examine the relationship between HC level and the number of months after relocation in immigrant chimpanzees. The alpha level was set at 0.05. R 3.1.2 was used for the statistical analysis \[[@pone.0160029.ref077]\].
Ethics statement {#sec010}
----------------
This study was carried out in accordance with the recommendations in the \"Guide for the Care and Use of Laboratory Primates 3rd Edition\" of the Primate Research Institute, Kyoto University and the \"Guide for Animal Research Ethics\" of the Wildlife Research Center, Kyoto University. The samples were collected by people who were familiar with each of the chimpanzee subjects. No invasive procedures, such as anesthesia, were used in this study, and the care of chimpanzees is described in the Method section. The study protocol was approved by the institutional committee of the Wildlife Research Center (No. WRC-2014KS001A).
Results {#sec011}
=======
Study 1--1: Changes in HC level before and after relocation {#sec012}
-----------------------------------------------------------
The model with sampling year, relocation-status group, and their interaction resulted in a lower AIC than the model without the interaction ([Table 3](#pone.0160029.t003){ref-type="table"}: AIC with interaction -54.2; AIC without interaction -34.0). As we found interaction effects, we analyzed the effects of sampling year for each group separately. The model with sampling year produced a lower AIC than the null model for both the relocation group (AIC with sampling year 1.3, AIC without sampling year 27.6) and the control group (AIC with sampling year --50.2, AIC without sampling year -23.7.). Overall, HC level increased in the first year (2013) after relocation and decreased again in the second year (2014) after relocation compared with that in the former institution (2012) ([Fig 1A](#pone.0160029.g001){ref-type="fig"}; Year 2012: mean = 14.5 pg/mg hair; Year 2013: mean = 22.2 pg / mg hair, est. = 0.496, SE = 0.104, t = 4.77, p \< 0.001; Year 2014: mean = 11.7 pg / mg hair, est. = -0.227, SE = 0.0716, t = -3.17, p = 0.00153). The control group also showed changes in the HC levels ([Fig 1A](#pone.0160029.g001){ref-type="fig"}; Year 2012: mean = 21.7 pg / mg hair; Year 2013: mean = 23.1 pg / mg hair, est. = 0.103, SE = 0.0427, t = 2.39, p = 0.0164; Year 2014: mean = 18.5 pg / mg hair, est. = -0.144, SE = 0.0373, t = -3.86, p \< 0.001). Although both the relocation and control groups showed changes in HC levels, the HC levels of the two groups differed significantly for 2013 (AIC with relocation-status group 18.4; AIC without relocation-status group 25.0; est. = -0.406, SE = 0.150, t = -2.70, p = 0.0112), whereas it was not different in 2014 (AIC with relocation-status group 14.1; AIC without relocation-status group 15.1; est. = -0.109, SE = 0.068, t = -1.60, p = 0.113) Together with the aforementioned interaction effects, this result indicates that the range of fluctuation was wider in relocation-group chimpanzees. Six of eight individuals in the relocation group showed a similar tendency, but two individuals (one of whom was the alpha male of the group) did not show any change in HC level over the 3-year period ([Fig 1B](#pone.0160029.g001){ref-type="fig"}).
{#pone.0160029.g001}
10.1371/journal.pone.0160029.t003
###### Parameter estimates of the model with interaction.
{#pone.0160029.t003g}
Factor Estimate SE T P
----------------- ---------- -------- -------- --------------
Sampling year
2013 0.495 0.0928 5.34 \< 0.001\*\*
2014 -0.227 0.0642 -3.55 \< 0.001\*\*
Group
KS -0.00138 0.0907 -0.015 0.988
Interaction
2013 × Group KS -0.393 0.0103 -3.83 \<0.001\*\*
2014 × Group KS 0.0838 0.0749 1.12 0.263
Study 1--2: Changes in aggressive interactions after relocation {#sec013}
---------------------------------------------------------------
As we found clear individual differences in the reaction toward relocation, even among males, we checked the changes in aggressive interactions and HC levels. Aggressive interactions between males were recorded sporadically during the early period after relocation. Most of the aggressive interactions were directed by the alpha male toward a subordinate male, and these sometimes resulted in injury. Aggression between males ceased after November 2013 ([Fig 2](#pone.0160029.g002){ref-type="fig"}). The strongest cortisol response of the subordinate male was observed in the hair sample obtained in September 2013, which corresponds to the heightened period of aggression.
{#pone.0160029.g002}
Study 2: Relationship between HC level and individual and environmental factors {#sec014}
-------------------------------------------------------------------------------
When we compared the models including both sexes and the rate of receiving aggression, we found that sex, rate of receiving aggression, group type, and rearing history significantly influenced average HC level ([Fig 3](#pone.0160029.g003){ref-type="fig"} and [Table 4](#pone.0160029.t004){ref-type="table"}). In terms of the models that included initiating aggression, we excluded one obvious outlier individual shown in [Fig 3C](#pone.0160029.g003){ref-type="fig"}. There were three competing models, with ΔAIC \< 2 ([Table 4](#pone.0160029.t004){ref-type="table"}). All models contained the factor of sex and group type, and two models contained the factors of initiating aggression, and rearing history. According to the parameter estimates of the best-fit models ([Table 5](#pone.0160029.t005){ref-type="table"}), males showed higher levels of HC concentration than females. In terms of rearing history, late-deprived individuals showed lower levels of HC than other groups of chimpanzees. Receiving aggression and initiating aggression followed opposite trends, as individuals receiving higher levels of aggression had higher levels of HC, and those initiating higher levels of aggression had lower levels. Relocation status and age were excluded from the models. Spearman's rank correlation test was performed to examine the relationship between number of months after relocation and HC level in immigrant chimpanzees, but no significant relationship was identified (Spearman's rank correlation, rho = -0.0561, n = 7, p = 0.905).
{#pone.0160029.g003}
10.1371/journal.pone.0160029.t004
###### AIC tables of the models to explain variation in the average HC levels of KS chimpanzees in 2013.
{#pone.0160029.t004g}
Model with receiving aggression Model with initiating aggression
---------------- ----------------------------------------------------------- -------- -------------------------------------------------------------------------------- --------
Best-fit model Receiving aggression + Rearing history+ Group Type 188.27 Initiating aggression + Rearing history + Group Type + Relocation status 184.7
Initiating aggression + Rearing history + Group Type + Relocation status + Age 185.11
Female
Best-fit model Null 118.75 Initiating aggression 113.75
Relocation status 120.27 Initiating aggression + Relocation status 114.06
Both sexes
Best-fit model Sex + Receiving aggression + Rearing history + Group Type 317.59 Sex + Initiating aggression + Group Type 313.55
Sex + Initiating aggression + Group Type + Rearing history 314.4
Sex + Rearing history + Group Type 315.37
10.1371/journal.pone.0160029.t005
###### Parameter estimates from the models used to explain variation in the average HC levels of KS chimpanzees in 2013.
{#pone.0160029.t005g}
Male Model with receiving aggression Male Model with initiating aggression
------------------------ --------------------------------- ------- ---------------------------------- -------- -------------- ------------------------ ------- -------- -------- --------------
(Intercept) 24.05 1.10 22.0 \<0.001\*\* (Intercept) 22.3 3.59 6.19 \<0.001 \*\*
Group type Group type
All-male 22.3±3.89 All-male
Mixed-sex (male) 26.6±6.85 3.98 1.10 2.58 0.0155\*\* Mixed-sex (male) 4.85 2.12 2.29 0.0308 \*
Rearing Rearing
Artificial (Early) 24.7±3.03 Artificial (Early)
Artificial (Late) 20.7±5.92 -6.31 1.64 -3.85 \<0.001\*\* Artificial (Late) -4.43 1.93 -2.294 0.0304 \*
Mother-reared 26.1±6.03 0.85 1.82 0.468 0.643 Mother-reared -1.78 1.84 -0.966 0.343
Wild-born 22.3±3.49 -1.75 1.42 -1.23 0.227 Wild-born -3.14 1.4704 -2.134 0.0429
Aggressive interaction Aggressive interaction
Receive 2.27 0.625 3.63 0.0013\*\* Initiate -1.56 0.596 -2.62 0.0148 \*
Relocation status Relocation status
Relocation 21.9±10.4 Relocation
Immigrant 26.4±3.96 Immigrant 5.69 3.91 1.46 0.157
Resident 23.2±4.82 Resident 1.61 3.29 0.491 0.628
Female Female
(Intercept) 21 0.634 33.2 \<0.001 \*\* (Intercept) 23.1 1.01 22.8 \<0.001\*\*
Null Aggressive interaction
Initiate 6.35 2.44 2.6 0.0166\*
Both sexes Both sexes
(Intercept) 17.9 1.96 9.17 \<0.001\*\* (Intercept) 17.5 1.99 8.78 \<0.001 \*\*
Sex Sex
Female 21.0±3.04 Female
Male 23.16±4.82 5.02 1.76 2.86 0.00622\*\* Male 4.87 1.91 2.55 0.0137 \*
Group type Group type
All-male 22.3±3.89 All-male
Mixed-sex (male) 26.6±6.85 3.71 1.74 2.13 0.0381 \* Mixed-sex (male) 3.07 1.81 1.69 0.0965 +
Mixed-sex (female) 21.0±3.04 Mixed-sex (female)
Rearing
Artificial (Early) 22.9±3.34
Artificial (Late) 20.1±5.50 -3.02 1.39 -2.18 0.0339 \*
Mother-reared 25.1±5.63 1.3 1.63 0.8 0.428
Wild-born 21.8±3.10 -0.91 1.16 -0.795 0.431
Aggressive interaction Aggressive interaction
Receive 1.53 0.53 2.88 0.00585 \*\* Initiate -1.56 0.599 -2.61 0.0119 \*
As sex differences were observed in terms of average HC level, aggressive interactions, and group type, we constructed and selected models for each sex. The models for the male data with explanatory variables that were similar to those in models for both sexes (group type, rearing history, and aggressive interactions) produced the lowest AIC. Although the factor relocation status remained in the final model with initiating aggression, relatively smaller parameter estimates, with relatively high standard errors, were observed for this factor compared with the other variables. However, only initiating aggression remained in the final model for female data. In addition, according to the parameter estimates, females with a higher level of aggression had higher HC concentrations, which was opposite to the pattern for males.
Discussion {#sec015}
==========
This study showed that HC level increased during the first year after relocation to the new environment and that it decreased during the second year. Although chimpanzees in both the control and relocation groups showed changes in HC levels, the most pronounced change in HC was observed in the relocation-group chimpanzees, which might suggest the operation of relocation stress in the first year and acclimation effects in the second year after relocation, as predicted. As there were many differences between the two institutions, it is difficult to determine the specific factors influencing the changes in HC and aggressive behaviors. Although we did not find clear sex differences, social factors represent one possible type of mediator, given that there were individual differences in reactions to relocation. The alpha male did not show changes in HC levels, whereas the other male, who received aggressive interactions, showed the highest increase in HC levels. The timing of the increase in HC levels in the subordinate male corresponded to the periods of heightened aggression. Thus, not only relocation but also social factors might influence changes in HC concentration.
Study 2 revealed that the standardized rate of receiving and initiating aggression had a significant effect on HC levels, whereas relocation status alone did not. Indeed, data from newly arrived chimpanzees (including both immigrant and relocation-group chimpanzees) varied widely and were not related to the number of months since relocation. Combining studies 1 and 2, the most important factor affecting long-term stress levels after moving to a new environment might be whether the new chimpanzees received aggression.
However, there were sex differences, as males showed higher HC concentrations than females, and the association with aggressive interactions was stronger in males. The direction of the relationship between HC and the rate of initiating aggression was opposite in males and females, although this should be treated with caution considering the limited range of variations in aggressiveness among females. These associations between aggressive behaviors and sex were consistent with our previous study in male chimpanzees \[[@pone.0160029.ref054]\] and previous findings in female ring-tailed lemurs \[[@pone.0160029.ref078],[@pone.0160029.ref079]\] showing that higher ranked females had higher fecal GC levels than did lower ranked individuals, and that GC level was positively associated with the rate of initiating aggression \[[@pone.0160029.ref078]\]. Males and females may be affected by their social environment in different ways; this tendency should be considered when planning the relocation of captive chimpanzees. In the wild, female chimpanzees migrate from their natal groups after puberty, whereas males generally remain in their original groups \[[@pone.0160029.ref004]\]. Although the small sample size of female immigrant chimpanzees limits our discussion of relocation and sex differences, two female immigrant chimpanzees showed low HC levels and low rates of receiving aggression. Kahlenberg et al. \[[@pone.0160029.ref017]\] reported that immigrant females among the wild chimpanzees of Kibale National Park received higher levels of aggression from female residents and exhibited higher urinary cortisol levels than did resident females. They also reported that immigrant chimpanzees received less aggression in the presence of male chimpanzees. In the current study, males were present most of time due to the spatial limitations of the environment, which may have influenced our results.
In this study, the relationship between receiving and initiating aggression and HC followed opposite patterns among males, although the previous study in wild chimpanzees reported that single aggressive interactions in both directions can increase urinary cortisol metabolite levels \[[@pone.0160029.ref080]\]. These differences might be related to the fact that HC reflects long-term rather than short-term stress and to the possibility that initiating aggression might increase cortisol in the short-term but not the long-term. Muller and Wrangham \[[@pone.0160029.ref081]\] reported that dominant individuals in Kibale National Park showed higher levels of fecal GC metabolites. In their study, dominance rank was decided based on a model that took into consideration the number of opponents that an individual successfully defeated. The present study found patterns that were in the opposite direction to those observed in their study. We also used the relative level of aggressiveness within the group as a measure, although methodological differences exist between the two studies. However, variations in results have often been reported in previous research involving rats, human and non-human primates; the possible explanations offered were social stability, physical environment, and controllability \[[@pone.0160029.ref018],[@pone.0160029.ref026],[@pone.0160029.ref082]\]. In fact, the alpha male who showed the highest level of aggression in a mixed-sex group also showed the highest average HC concentration in the present study (one outlier male in [Fig 3C](#pone.0160029.g003){ref-type="fig"}). Although the aforementioned factors probably contributed to the variations in this study, the current study did not have a large enough sample size to elucidate the factors underlying this type of variation. As long-term elevation of cortisol levels may be detrimental to health and behavior \[[@pone.0160029.ref026]\], such high-HC individuals should be closely monitored; a detailed study of the factors affecting stress levels is also important for the maintenance of the good health of such exceptionally high-cortisol individuals.
There was no evidence that an all-male grouping leads to higher levels of HC. This is an important result, because all-male groups do not exist in wild chimpanzees, which is unlike the case for wild gorillas, which sometimes form groups of this kind \[[@pone.0160029.ref066],[@pone.0160029.ref083]\]. Due to the aggressiveness of male chimpanzees, multi-male and multi-female social groupings are often difficult to form \[[@pone.0160029.ref002],[@pone.0160029.ref013]\], and social groups with one male and several females are more widespread. As a result, surplus males emerge and, in the worst cases, can be isolated. All-male groups can be an alternative to reducing the number of isolated males in captivity without imposing excessive stress, as long as we minimize the incidents of escalated aggression. However, there were only a limited number of social groups in this study, and we should note that the keepers were careful to avoid escalated aggression, monitoring and adjusting the membership of groups, especially when new males were introduced. Future studies of all-male groups of captive chimpanzees should use larger samples and include other welfare-related parameters, such as behaviors and other physiological variables.
The results related to rearing history were unexpected, because late-deprived individuals showed lower HC concentrations than wild-born, early-deprived, and mother-reared individuals, especially among males. Dettmer et al. \[[@pone.0160029.ref063]\] reported that rhesus macaques who were reared by their mother showed less pronounced responses to relocation and that the HC levels of mother-reared individuals were lower than those of peer-reared and nursery-reared individuals when assessed at 6 and 18 months. However, opposite patterns were also reported in many earlier studies on the effects of maternal separation \[[@pone.0160029.ref068]\]. Studies of rodents and primates indicated that early adverse experiences decrease basal cortisol levels (hypocortisolism) later in life \[[@pone.0160029.ref067],[@pone.0160029.ref084],[@pone.0160029.ref085]\]. For example, Feng et al. \[[@pone.0160029.ref086]\] reported that rhesus macaques who experienced maternal separation in early life had lower basal HC levels and delays in their response to stressors (capture and restraint), assessed by plasma cortisol responses, compared with mother-reared conspecifics. Researchers have reviewed the effects of maternal separation on infant development and discussed factors, such as species differences, type of stress, sex, timing of maternal separation and differences in the details of \"maternal separation\" as potential explanations for these inconsistent results \[[@pone.0160029.ref087]\]. This study showed that the sex and timing of maternal separation had different effects on basal cortisol levels. In terms of the timing of maternal separation, hypocortisolism was observed only in late-deprived individuals and not in early-deprived individuals. It is difficult to attribute the results to maternal separation based only on alterations in the HPA axis. Indeed, the fact that these two groups of chimpanzees might differ in their social abilities may have influenced the results. For example, many late-deprived individuals in this study occupied higher-ranking positions, although there was no direct relationship between rearing history and aggressive behaviors. Reimers et al. \[[@pone.0160029.ref062]\] found that late-deprived resocialized captive chimpanzees showed lower levels of fecal GC metabolites than early-deprived ones. At the same time, the late-deprived individuals were more highly ranked than the early-deprived individuals in their study. Thus, rearing history might influence stress response partly because rearing history can be related to how individuals form social relationships. However, there is an alternative hypothesis for explaining the results. As some studies have reported the possible salutary effects of later experiences on the sequelae of maternal separation\[[@pone.0160029.ref088]\], social experiences later in life might buffer the effects of early-life experiences. Unlike subjects in the earlier experimental studies, all subjects in this study spent many years in social environments. Thus, the current environment of the animals may have had more pronounced effects on the HC levels of the chimpanzees than the early one. In the current study, we could not dissociate the contribution of early rearing conditions from that of current social environment to HC levels, partly due to the fact that the detailed rearing histories of wild-born individuals and some captive-born individuals were unclear. Additional studies including a larger sample are needed to understand how the combination of early rearing conditions and current environment affects the stress response of animals.
Age was not a significant contributor to either average HC level. This was consistent with our previous study \[[@pone.0160029.ref054]\], although the age range was expanded to between 5 and 44. Studies have found age-related declines in HC levels from infancy in rhesus macaques, baboons, and vervet monkeys \[[@pone.0160029.ref045],[@pone.0160029.ref063],[@pone.0160029.ref089]\]. The fact that our study did not include infants might be why we did not find any association with age.
There were some limitations to this study, pertaining to our understanding of the specific factors contributing to HC levels. Although the daily behavior monitoring sheets provided valuable information, we included aggressive interactions as only a social index due to methodological limitations, as our methodology rendered it impossible to record quantitatively frequent but less evident social behaviors, such as social grooming. There is some evidence that affiliative social interaction, such as grooming, can be related to stress alleviation in primate species \[[@pone.0160029.ref090]--[@pone.0160029.ref093]\]. Furthermore, the size of enclosures was reduced after the move to KS; such a change may have influenced the social behavior of the chimpanzees. The intense aggression by the alpha male to subordinate males ceased 9 months after relocation, which coincided with the timing of changes to the facility inside the new institution; however, this did not result in large differences in the size of enclosures. The decrease in aggression may have been due to the simple passage of time, although we cannot rule out the possibility that the intense aggression was influenced by properties of the physical environment. If aggressive interactions strongly influence the long-term stress level after relocation and if it, in turn, is influenced by physical environment, then it may be possible to alleviate long-term stress by modifying certain properties of the physical environment. Future research investigating other social parameters is needed to achieve a detailed understanding of the effects of the social environment on chimpanzee welfare and to evaluate the role of physical environmental parameters in the alleviation of the stress experienced by these chimpanzees.
In conclusion, relocation can affect long-term stress, but the issue of whether individuals receive aggression might be a more important contributor to long-term stress than relocation alone. Group type, rearing history, and sex were also related to HC levels in captive chimpanzees. Male and female chimpanzees might be affected by the social environment differently, which might be related to social characteristics in the wild. These sex differences should be considered more carefully when planning the relocation and formation of captive social groups. This study further strengthened the usefulness of HC analysis as a means of monitoring long-term stress, especially in the context of social management. Future studies should focus more on the consequences of higher HC levels in terms of other welfare parameters to ensure the physical and mental health of chimpanzees and to contribute to efforts to alleviate their stress.
Supporting Information {#sec016}
======================
###### Changes in hair cortisol levels before and after the relocation.
Data used for investigating the effects of relocation on hair cortisol levels (Study 1). Changes of HC levels from the year 2012 were used. Age information was at year 2013.
(DOCX)
######
Click here for additional data file.
###### Average hair cortisol levels in 2013 and relevant information.
Data used for investigating the effects of individual and environmental factors affecting hair cortisol levels (Study 2).
(DOCX)
######
Click here for additional data file.
We are grateful to the following people and institutions for their support of our study: Tetsuro Matsuzawa, Masaki Tomonaga, Misato Hayashi, Ikuma Adachi, Juri Suzuki and members of the Primate Research Institute and the Wildlife Research Center of Kyoto University. We also thank Etsuko Nogami, Yusuke Mori, Toshifumi Udono, Koki Fuwa, and the staff at the Kumamoto Sanctuary and the Great Ape Research Institute for their help in sample collection. We also thank Yusuke Hori for his help with the statistical analysis.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: YY MT NM. Performed the experiments: YY MT NM SH. Analyzed the data: YY. Contributed reagents/materials/analysis tools: YY MT NM SH MIM. Wrote the paper: YY MT NM SH MIM GI.
|
{
"pile_set_name": "PubMed Central"
}
|
<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd">
<html xmlns="http://www.w3.org/1999/xhtml"><head><title>Patents</title><meta name="generator" content="DocBook XSL Stylesheets V1.76.1"/></head><body><div class="sect1" title="Patents"><div class="titlepage"><div><div><h1 class="title"><a id="patents"/>Patents</h1></div></div></div><p>Software patents are the lightning rod issue of the moment in
free software, because they pose the only real threat against which
the free software community cannot defend itself. Copyright and
trademark problems can always be gotten around. If part of your code
looks like it may infringe on someone else's copyright, you can just
rewrite that part. If it turns out someone has a trademark on your
project's name, at the very worst you can just rename the project.
Although changing names would be a temporary inconvenience, it
wouldn't matter in the long run, since the code itself would still do
what it always did.</p><p>But a patent is a blanket injunction against implementing a
certain idea. It doesn't matter who writes the code, nor even what
programming language is used. Once someone has accused a free
software project of infringing a patent, the project must either stop
implementing that particular feature, or face an expensive and
time-consuming lawsuit. Since the instigators of such lawsuits are
usually corporations with deep pockets—that's who has the
resources and inclination to acquire patents in the first
place—most free software projects cannot afford the latter
possibility, and must capitulate immediately even if they think it
highly likely that the patent would be unenforceable in court. To
avoid getting into such a situation in the first place, free software
projects are starting to code defensively, avoiding patented
algorithms in advance even when they are the best or only available
solution to a programming problem.<sup>[<a id="idp8720592" href="#ftn.idp8720592" class="footnote">34</a>]</sup></p><p>Surveys and anecdotal evidence show that not only the vast
majority of open source programmers, but a majority
of <span class="emphasis"><em>all</em></span> programmers, think that software patents
should be abolished entirely.<sup>[<a id="idp8893504" href="#ftn.idp8893504" class="footnote">35</a>]</sup> Open source programmers tend to feel
particularly strongly about it, and may refuse to work on projects
that are too closely associated with the collection or enforcement of
software patents. If your organization collects software patents,
then make it clear, in a public and irrevocable way, that the patents
would never be enforced on open source projects, and that they are
only to be used as a defense in case some other party initiates an
infringement suit against your organization. This is not only the
right thing to do, it's also good open source public relations.<sup>[<a id="idp8895104" href="#ftn.idp8895104" class="footnote">36</a>]</sup></p><p>Unfortunately, collecting patents for defensive purposes is a
rational action. The current patent system, at least in the United
States, is by its nature an arms race: if your competitors have
acquired a lot of patents, then your best defense is to acquire a lot
of patents yourself, so that if you're ever hit with a patent
infringement suit you can respond with a similar threat—then the
two parties usually sit down and work out a cross-licensing deal so
that neither of them has to pay anything, except to their intellectual
property lawyers of course.</p><p>The harm done to free software by software patents is more
insidious than just direct threats to code development, however.
Software patents encourage an atmosphere of secrecy among firmware
designers, who justifiably worry that by publishing details of their
interfaces they will be giving technical help to competitors seeking
to slap them with patent infringement suits. This is not just a
theoretical danger; it has apparently been happening for a long time
in the video card industry, for example. Many video card
manufacturers are reluctant to release the detailed programming
specifications needed to produce high-performance open source drivers
for their cards, thus making it impossible for free operating systems
to support those cards to their full potential. Why would the
manufacturers do this? It doesn't make sense for them to
work <span class="emphasis"><em>against</em></span> software support; after all,
compatibility with more operating systems can only mean more card
sales. But it turns out that, behind the design room door, these
shops are all violating one another's patents, sometimes knowingly and
sometimes accidentally. The patents are so unpredictable and so
potentially broad that no card manufacturer can ever be certain it's
safe, even after doing a patent search. Thus, manufacturers dare not
publish their full interface specifications, since that would make it
much easier for competitors to figure out whether any patents are
being infringed. (Of course, the nature of this situation is such
that you will not find a written admission from a primary source that
it is going on; I learned it through a personal communication.)</p><p>Some free software licenses have special clauses to combat, or at
least discourage, software patents. The GNU GPL, for example, contains
this language:</p><pre class="screen">
7. If, as a consequence of a court judgment or allegation of patent
infringement or for any other reason (not limited to patent issues),
conditions are imposed on you (whether by court order, agreement or
otherwise) that contradict the conditions of this License, they do not
excuse you from the conditions of this License. If you cannot
distribute so as to satisfy simultaneously your obligations under this
License and any other pertinent obligations, then as a consequence you
may not distribute the Program at all. For example, if a patent
license would not permit royalty-free redistribution of the Program by
all those who receive copies directly or indirectly through you, then
the only way you could satisfy both it and this License would be to
refrain entirely from distribution of the Program.
[...]
It is not the purpose of this section to induce you to infringe any
patents or other property right claims or to contest validity of any
such claims; this section has the sole purpose of protecting the
integrity of the free software distribution system, which is
implemented by public license practices. Many people have made
generous contributions to the wide range of software distributed
through that system in reliance on consistent application of that
system; it is up to the author/donor to decide if he or she is willing
to distribute software through any other system and a licensee cannot
impose that choice.
</pre><p>The Apache License, Version 2.0
(<a class="ulink" href="http://www.apache.org/licenses/LICENSE-2.0">http://www.apache.org/licenses/LICENSE-2.0</a>) also
contains anti-patent requirements. First, it stipulates that anyone
distributing code under the license must implicitly include a
royalty-free patent license for any patents they might hold that could
apply to the code. Second, and most ingeniously, it punishes anyone
who initiates a patent infringement claim on the covered work, by
automatically terminating their implicit patent license the moment
such a claim is made:</p><pre class="screen">
3. Grant of Patent License. Subject to the terms and conditions of
this License, each Contributor hereby grants to You a perpetual,
worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except
as stated in this section) patent license to make, have made, use,
offer to sell, sell, import, and otherwise transfer the Work, where
such license applies only to those patent claims licensable by such
Contributor that are necessarily infringed by their Contribution(s)
alone or by combination of their Contribution(s) with the Work to
which such Contribution(s) was submitted. If You institute patent
litigation against any entity (including a cross-claim or counterclaim
in a lawsuit) alleging that the Work or a Contribution incorporated
within the Work constitutes direct or contributory patent
infringement, then any patent licenses granted to You under this
License for that Work shall terminate as of the date such litigation
is filed.
</pre><p>Although it is useful, both legally and politically, to build
patent defenses into free software licenses this way, in the end these
steps will not be enough to dispel the chilling effect that the threat
of patent lawsuits has on free software. Only changes in the
substance or interpretation of international patent law will do that.
To learn more about the problem, and how it's being fought, go to
<a class="ulink" href="http://www.nosoftwarepatents.com/">http://www.nosoftwarepatents.com/</a>. The Wikipedia
article <a class="ulink" href="http://en.wikipedia.org/wiki/Software_patent">http://en.wikipedia.org/wiki/Software_patent</a>
also has a lot of useful information on software patents. I've also
written a blog post summarizing the arguments against software
patents, at
<a class="ulink" href="http://www.rants.org/2007/05/01/how-to-tell-that-software-patents-are-a-bad-idea/">http://www.rants.org/2007/05/01/how-to-tell-that-software-patents-are-a-bad-idea/</a>.</p><div class="footnotes"><br/><hr/><div class="footnote"><p><sup>[<a id="ftn.idp8720592" href="#idp8720592" class="para">34</a>] </sup>Sun Microsystems and
IBM have also made at least a gesture at the problem from the other
direction, by freeing large numbers of software patents—1600 and
500 respectively—for use by the open source community. I am not
a lawyer and thus can't evaluate the real utility of these grants, but
even if they are all important patents, and the terms of the grants
make them truly free for use by any open source project, it would
still be only a drop in the bucket.</p></div><div class="footnote"><p><sup>[<a id="ftn.idp8893504" href="#idp8893504" class="para">35</a>] </sup>See
<a class="ulink" href="http://groups.csail.mit.edu/mac/projects/lpf/Whatsnew/survey.html">http://groups.csail.mit.edu/mac/projects/lpf/Whatsnew/survey.html</a> for one such
survey.</p></div><div class="footnote"><p><sup>[<a id="ftn.idp8895104" href="#idp8895104" class="para">36</a>] </sup>For example, RedHat has pledged that open source projects are
safe from its patents, see
<a class="ulink" href="http://www.redhat.com/legal/patent_policy.html">http://www.redhat.com/legal/patent_policy.html</a>.</p></div></div></div></body></html>
|
{
"pile_set_name": "Github"
}
|
DOJ advises that Net Neutrality could hamper development of the Internet - youngnh
http://news.yahoo.com/s/ap/20070906/ap_on_hi_te/internet_fees_justice_department;_ylt=AlDVAzEP6zj3FCeqjPcXCsWs0NUE
Bad news and the flawed analogies still persist. This time instead of tubes, the internet is likened to the Post Office charging more for express mail.
======
brlewis
Talk about spin.
They use the example of the post office, saying you can pay different amounts
for different speeds. That's not what net neutrality prevents. Net neutrality
would prevent the situation where you send off two order forms at the same
postal rate, but one company gets their order form faster because they're a
subsidiary of the post office, or have paid a big fee.
|
{
"pile_set_name": "HackerNews"
}
|
Game Deep Balls online
Game Deep Balls online.
Seeing these bright balls you can not break away, reaching new goals and heights. Just move one of them with your cursor to attach it to another. Only should hurry, because objects very quickly reduced in size and you can not manage to fulfill its purpose. Each level will delight you with new tasks.
|
{
"pile_set_name": "Pile-CC"
}
|
Halloween is one of my favourite holidays! I love everything about it, the costumes, jack-o-lanterns, ghoulish food, parties, trick-or-treating and best of all an excuse to watch as many horror movies as you want! It’s probably because I’m a massive horror movie fan – it’s pretty much how I was brought up and slightly inevitable with two older brothers (and the fact that my mother also loves a good horror/thriller). Movies of my childhood include: Chucky, It, Gremlins, Nightmare on Elm Street, Friday the 13th and Psycho, to name but a few. From there it’s extended to many many more.
Anyway, I encouraged the office to do something vaguely Halloween-y and unfortunately, despite originating in England, Halloween is not so big here, but some brought in treats and have some form of head decoration, so I’m happy with any effort! I’m dressed as a sort of modern witch in a wool grey-black dress with burgundy polk-dot tights, green eye shadow and of course a witches hat!
I brought it graveyard chocolate cupcakes, complete with little R.I.P tombstones, cheesy ghoul fingers, swamp guacamole, and vampire-proof dip (onion & garlic). I can’t say everything is home-made because I didn’t have enough hours in the day to make it all from scratch. The ghoul fingers are ‘home-made’… I bought the pastry but assembled & baked them myself.
Tombstones ready for icing! I used melted white chocolate.
I used green food colouring to give the almond nails a creepy ages look.
I currently have a lot of time for being a little bit creative with food, especially with different breakfast options. When I’m working I usually don’t allow myself much time for a ‘proper’ breakfast which means I tend to grab a banana or eat something from work. I work in the catering industry so it’s easy for me to pick up a scone or similar. At the weekends, however, I like to cook up a nice late breakfast or brunch – this tends to be eggs, pancakes or french toast. This weekend I decided on a mixture of Huevos Rancheros and a Southern American country-fried potato recipe. I used leftover potatoes from the dinner before (baby new potatoes). If you don’t have leftovers, I’m sure you can fry them from raw – otherwise boil them and wait for them to cool slightly before using them in this recipe.
I haven’t thought of a name for this yet, but I do have a recipe.
You will need:
2 tablespoons butter
8-10 small potatoes, chopped into small pieces
5 chestnut mushrooms, diced
3 spring onions, thinly sliced
4 large eggs
1 tablespoon oregano
1 teaspoon paprika (optional)
1 teaspoon dried chilli flakes (optional)
salt and pepper to taste
50g grated cheese (e.g. cheddar, also optional)
In a large frying pan over a medium-high heat melt the butter and sauté the potatoes and mushrooms for about 10 minutes – until the mushrooms are soft and the potatoes start to become crispy.
Add in the spring onions and seasoning, allow to fry for 5 minutes Crack in the 4 eggs and allow to cook for a further 5 minutes.
You can either put a lid on your pan or place your pan under the grill until the eggs are fully cooked through. Lastly, top with the grated cheese, making sure it fully melts.
I served this with baguette toast and homemade guacamole (also a leftover from dinner the night before) and enjoyed eating this al fresco outside in the garden.
What are some of your favourite breakfast options? And your favourite way of cooking eggs? Let me know 🙂
Follow Blog via Email
Enter your email address to follow this blog and receive notifications of new posts by email.
|
{
"pile_set_name": "Pile-CC"
}
|
{
"pile_set_name": "PubMed Central"
}
|
|
The family of a terrified Chinese factory worker who jumped to his death after being interrogated over a missing iPhone prototype has been paid US$44,000 (NZ$67,000), while the factory in which he worked continues to smear his reputation.
Sun Danyong, 25, committed suicide this month after one of the 16 prototype iPhones he ordered from the Foxconn factory assembly line went missing.
Family and friends say Sun told them he was beaten and humiliated by his superiors while being interrogated over the missing phone, claims that Foxconn has denied.
The incident has whipped up controversy in China and abroad and has helped shine a light on questionable working conditions in Chinese factories.
It has also highlighted the pressure Apple puts on staff and supply chain workers to keep its upcoming products secret.
In an interview with The New York Times, Sun's brother, Sun Danxiong, 28, said Foxconn paid his family US$44,000 compensation and gave Sun's girlfriend a free Apple laptop computer.
The paper also spoke to Foxconn's general manager of China operations, James Lee, who defended the company's working conditions and continued to attack Sun's credibility.
''Several times he had some products missing, then he got them back. We don't know who took the product, but it was at his stop,'' Lee said.
Foxconn has suspended one of its security staff members over the incident pending a police investigation.
The man, Gu Qinming, told Chinese media last week that he did not beat Sun and only grabbed his right shoulder after becoming ''a little angry''.
Gu's personal details were published on the internet by angry Chinese citizens, and he now claims he is unable to return to his home.
It has also been revealed that, just after being interrogated, Sun, a shy graduate who had finished university only a year earlier, sent a distressed SMS to his girlfriend, who later published the message online.
The message read: ''Dear, I'm sorry. Go back home tomorrow. I ran into some problems. Don't tell my family. Don't contact me. I'm begging you for the first time. Please do it! I'm sorry.''
Sun jumped to his death from the 12th floor of an apartment building hours later.
Foxconn and Apple have both expressed their sadness at Sun's death, but neither has released any further details about the investigation into it. Local police have so far refused to comment.
In a press release issued after Sun's death, China Labor Watch lambasted Foxconn's ''inhumane and militant management system, which lacks fundamental respect for workers' rights''.
CLW published a detailed investigation into working conditions at Foxconn last year but claims the company failed to address the issues it raised.
They include ''serious labour violations including excessive working hours, unpaid wages for up to 30 minutes of work each day, compulsory overtime and extremely poor dormitory conditions''.
The organisation alleges Sun's death was not the first suicide at a Foxconn factory and that other workers have reported being beaten with ''iron bars and whips''.
It also claims that only workers producing Apple products are given stools, and the rest must stand.
CLW said workers were housed in ''converted workshops with hundreds of workers per room'', which is similar to conditions that Britain's Daily Mail found when it published photographs and details of the harsh working conditions at Foxconn's iPod factories in 2006.
Foxconn has still not recovered the missing iPhone, but Sun's brother is confident Sun had nothing to do with it.
Biographies of Sun published in Chinese media have said he grew up in an isolated mountain village in the south-western province of Yunnan and his family was so poor that he would erase the old pencil notes from his school books and reuse them.
He had only just graduated with a business degree from one of China's best schools, the Harbin Institute of Technology.
When he started work at Foxconn he told his parents ''from now on you don't have to work so hard, you should enjoy a little'', China's Southern Metropolis Daily reported .
''He was honest and modest. He would never steal anything,'' Sun's brother told The New York Times.
|
{
"pile_set_name": "OpenWebText2"
}
|
Dieta mediterránea (debate)
Presidente
El siguiente punto es la pregunta oral a la Comisión presentada por el Sr. Parish, en nombre de la Comisión de Agricultura y Desarrollo Rural, sobre la dieta mediterránea, dieta que, por cierto, quien preside este Pleno sigue de manera razonablemente rigurosa y con resultados más que aceptables.
Neil Parish
autor. - Señor Presidente, ¡me alegro mucho de que siga la dieta mediterránea y de ver que le funciona muy bien!
Lo que he aprendido aquí esta mañana como Presidente de la Comisión de Agricultura y Desarrollo Rural es que tenemos un espectro muy variado de asuntos de los que hablar. En un minuto estamos hablando acerca del transporte de animales -un tema muy importante- y ahora estamos hablando de otro tema muy importante: la dieta mediterránea.
Uno de los encargos que me ha llegado como Presidente de la Comisión de Agricultura y con el que tenemos que tomar rápido contacto es que, con motivo del Consejo de Ministros celebrado en Bruselas el 16 de julio de 2007, la Comisión reiteró su total apoyo para la candidatura de la dieta mediterránea como Patrimonio Cultural Inmaterial de la Humanidad por la Unesco. Esta candidatura se estudiará en 2009 -de hecho, se está haciendo ahora- por parte del comité de la Unesco responsable. ¿Se plantea la Comisión establecer una estrategia coordinada y específica para apoyar esta candidatura, ya que ahora avanzamos muy rápido?
Represento, como dije, a la Comisión de Agricultura y Desarrollo Rural aquí, pero probablemente represente a todos los diputados cuando hable sobre la dieta, porque una de las grandes cosas que tiene Europa es la diversidad y la cultura, y parte de esa diversidad y cultura reside, naturalmente, en nuestra comida.
La dieta mediterránea es una dieta muy buena. ¿En qué consiste la dieta mediterránea? Estoy seguro de que podríamos hablar mucho sobre ello esta mañana, pero en general es una dieta rica en pescado azul, aceites de oliva, fruta y verduras. Se trata sin duda de una dieta muy sabrosa y pueden deducir por mi tamaño que soy un gran seguidor de ella. También es una dieta saludable: supone una fuente rica en ácidos grasos esenciales y antioxidantes, una combinación que puede ayudar a mejorar los niveles de colesterol y proteger la salud del corazón. Investigaciones científicas recientes también han sugerido que puede ayudar a frenar el riesgo de afecciones como la demencia.
Cuando se viaja a los países mediterráneos, puede apreciarse que la gente la disfruta, y no solo los que viven allí sino también muchos de nosotros, que viajamos a los países mediterráneos especialmente cuando buscamos algo de sol y también muy buena comida.
Se trata de algo que debemos plantearnos muy seriamente en un mundo en el que todo parece ser uniforme. Asistimos a cómo las nuevas generaciones se ven bombardeadas por las cadenas de comida rápida -no las nombraré a todas aquí hoy- que se están extendiendo por toda la Unión Europea. Deberíamos recordar que, sí, la cadena de comida rápida cumple su función, pero sería algo terrible que en los años venideros todo lo que encontráramos al viajar por Europa fuera comida rápida. Al viajar por algunas partes de América -especialmente en la costa oeste- no parece haber nada más que cadenas de comida rápida y eso es lo último que queremos aquí en Europa.
Como he comentado, necesitamos apoyar la comida mediterránea y es una muy buena idea para la cultura y la diversidad. Creo que, en el futuro, tendremos que explorar otras formas de dieta en la Unión Europea, porque lo que deseo transmitirles claramente esta mañana es que, a pesar de que soy un gran partidario de la dieta mediterránea, no vengo aquí en calidad de Presidente de la Comisión de Agricultura únicamente para apoyar la dieta mediterránea, sino porque hay otras dietas en Europa que son igual de buenas pero tienen cualidades diferentes y distintos alimentos.
Así pues, éste es el comienzo de muchas cosas aún por venir y, como he dicho, realmente deseo saber cómo pretende la Comisión apoyar de forma activa esta apuesta a lo largo de este año, porque estamos deseando obtener un premio por la dieta mediterránea y también estamos deseando disponer de muy buenos alimentos mediterráneos en el futuro.
Vladimír Špidla
Señor Presidente, Señorías, me gustaría comenzar por enfatizar la importancia de una dieta saludable para la prevención de enfermedades. Como diputados, sabrán que el Libro Blanco llamado "Estrategia europea sobre problemas de salud relacionados con la alimentación, el sobrepeso y la obesidad", que fue aprobado por la Comisión Europea el 30 de mayo de 2007, recoge todas las políticas comunitarias que pueden contribuir a mejorar los hábitos de alimentación y a prevenir la obesidad. Abarca principalmente medidas en áreas de la salud pública, catering, transporte, política regional, deporte, educación y estadísticas, así como medidas de política agrícola.
Uno de los mejores ejemplos es la iniciativa de la Comisión que constituye un programa paneuropeo para suministrar fruta y vegetales a las escuelas. El objetivo del programa es ayudar a facilitar a nuestros niños un comienzo saludable en la vida. Se pondrá en marcha a comienzos del año escolar 2009/2010 con un presupuesto anual de 90 millones EUR para comprar y suministrar a los colegios fruta y verduras frescas.
En relación con la pregunta específica formulada por uno de los diputados acerca de la solicitud de incluir la dieta mediterránea en la lista del patrimonio cultural mundial de la Unesco, el predecesor del señor Comisario, D. Markos Kyprianou, presentó este tema en una reunión del Consejo sobre agricultura en julio de 2007. La Comisión acoge esta iniciativa, dado que puede ayudar a fomentar hábitos alimenticios saludables en la UE.
La Comisión Europea naturalmente no dispone de poderes formales para apoyar tal petición dentro del marco de la Unesco, dado que no es un miembro de la Unesco y, en consecuencia, no puede participar en el proceso de toma de decisión. Sin embargo, espero que los estados participantes tengan éxito en su solicitud ante la Unesco y que reciban el apoyo apropiado para ello por parte de los otros Estados miembros de la UE.
Rosa Miguélez Ramos
Señor Presidente, quisiera, en primer lugar, agradecer a la Comisión el apoyo expreso que, de nuevo, ha manifestado en relación con esta candidatura de la dieta mediterránea como patrimonio cultural de la humanidad ante la Unesco.
Una vez escuchada la respuesta del señor Comisario, es importante recordar que nos encontramos ante un bien cultural y que el concepto de dieta es mucho más amplio que el de modelo alimentario. Es cierto, como ha dicho mi colega el señor Parish, que la dieta mediterránea, en su faceta de modelo alimentario, tiene un papel muy importante en los hábitos de vida sana e incluso en la prevención de enfermedades vinculadas a una alimentación incorrecta o a la falta de ejercicio físico.
Pero el concepto de dieta mediterránea -y en este sentido mi intervención complementa a la suya- va más allá. Incluye un modo de vida característico, una forma de compartir los alimentos, de disfrutarlos en compañía, está vinculada con un determinado tipo de paisaje y de territorio, y con unas sociedades que a lo largo de siglos han desarrollado una cultura, un arte, unas tradiciones y unas festividades alrededor de este concepto de dieta mediterránea.
Una vez aclarado lo que, para mí y para la mayor parte de las personas que se mueven en este ámbito, es la dieta mediterránea y el porqué de esta candidatura y, comprobada la buena disposición de la Comisión para colaborar, consideramos -y así se lo digo, señor Comisario que, aunque la Comisión no sea miembro de la Unesco -cosa que ya sabíamos- ni participe en sus procesos de decisión -cosa que sabíamos, también-, la Comisión sí que puede apoyar esta candidatura con acciones indirectas que tendrían, a no dudar, una repercusión positiva en la percepción de quienes están involucrados en el proceso de votación.
Y mencionaría, entre estas posibilidades, una declaración formal de apoyo de la Comisión Europea a la candidatura presentada, porque hay otros organismos internacionales como la FAO, la Organización Mundial de la Salud, la comunidad científica y académica, que vienen haciendo estas declaraciones de apoyo.
En relación con el futuro plan de gestión, desde luego entendemos que la Comisión debería involucrarse, apoyar o adherirse a las acciones transnacionales concretas que se propongan. Estamos en el año del diálogo intercultural y uno de los Estados que forman parte de esta candidatura es, precisamente, nuestro vecino del Mediterráneo, el Reino de Marruecos. Especialmente, teniendo en cuenta, como usted ha dicho, el interés de la Comisión por promover dietas y hábitos de vida saludables para los europeos.
La Comisión podría colaborar, también, en la búsqueda de apoyos y adhesiones, podría realizar una labor diplomática, teniendo en cuenta el respeto que se tiene a la Comisión, especialmente en los países mediterráneos extracomunitarios y, también, fuera del ámbito mediterráneo y de la Unión Europea. Y, desde luego, señor Comisario, la Comisión podría mostrar su disponibilidad para organizar o colaborar en posibles acciones que vayan surgiendo estos meses en algunos de los ámbitos de trabajo.
Jorgo Chatzimarkakis
Señor Presidente, muchas gracias al Sr. Parish por su pregunta y gracias también al señor Comisario por su respuesta. Europa posee muchas cosas que son envidiadas en el resto del mundo: nuestra moda, nuestro estilo de vida, nuestros sistemas de seguridad social y, cada vez más, nuestra dieta. Haríamos bien en Europa si prestáramos atención a la dieta más saludable de todas, en concreto, la mediterránea.
Para aclarar la definición: la dieta mediterránea data de los modelos dietarios típicos de amplias zonas de Grecia, incluyendo la isla de Creta, y del sur de Italia -de ahí su nombre-. Su componente principal -como ya dijo el señor Comisario- es el aceite de oliva. Esto supone otra razón más -y dirijo esta observación no solo al Comisario Špidla, sino también a toda la Comisión- para concederle a este producto original europeo una protección aún mayor.
La dieta mediterránea también consiste en pan de alto contenido en fibra, buenas cantidades de fruta y verduras -por eso damos nuestra acogida al Plan de consumo de fruta en las escuelas de la Comisión- pescado, productos lácteos con moderación y vino también. Se ha probado científicamente -esta conclusión fue publicada en la edición de septiembre de 2008 del British Medical Journal- que la dieta mediterránea ayuda a reducir la incidencia de enfermedades cardiovasculares, diabetes del tipo 2 -la epidemia contemporánea europea- y cáncer, y minimiza los efectos del Alzheimer y el Parkinson. Esto se ilustra con una visita a cementerios de Creta, la isla desde la que mi padre saluda: ver la edad que alcanza la gente allí, realmente hace que uno se dé cuenta.
Así pues, debemos esforzarnos al máximo para aumentar el número de adeptos de la dieta mediterránea en Europa y más allá y, en este sentido, supone un paso importante su inclusión en la Lista del Patrimonio Mundial. Deseo dar las gracias a la Comisión por sus esfuerzos.
Sin embargo, debemos percatarnos de que, si China e India adoptaran la dieta americana, como ya hacen cada vez más, los efectos adversos se triplicarán. En primer lugar, la salud de la población se deteriorará. En segundo lugar, habrá un aumento de la ganadería intensiva con todos sus efectos adversos en el medioambiente, y la tercera consecuencia afectará a la producción de metano, dado que la mayoría de la carne será de vacuno. El ganado produce metano y es perjudicial para el clima global. Por este motivo es tan importante dar este paso en concreto. Gracias de nuevo, Sr. Parish.
Sebastiano Musumeci
en nombre del Grupo UEN. - (IT) Señor Presidente, señor Comisario, Señorías, la decisión de la Unión Europea de apoyar el reconocimiento de la dieta mediterránea como Patrimonio Cultural de la Humanidad de la Unesco, nos recuerda, sobre todo, el derecho a la protección de las identidades de los pueblos en su estrecha relación con sus tierras. Sin embargo, el compromiso institucional desplegado por Italia, España, Grecia y Marruecos no puede limitarse exclusivamente a lograr este prestigioso reconocimiento.
Creo que debemos reconstruir el lazo, hoy en día cada vez más débil y frágil, que une el producto alimenticio agrícola y el alimento de consumo diario, es decir, debemos animar a los consumidores a estar informados acerca de los principios de una dieta saludable y la estacionalidad del producto. El producto alimenticio debe volver a ser natural y libre de aditivos y conservantes químicos. La comunidad científica internacional nos asegura que el consumo de tales productos reduce significativamente las tasas de mortalidad. Estoy pensando, por ejemplo, en aceite de oliva extra virgen, vino y fruta y, en concreto, las naranjas de sangre de Sicilia, únicas en el mundo por su pigmentación, que es rica en antioxidantes.
En conclusión, espero que este objetivo pueda compartirse con otros países mediterráneos y, como se requiere una estrategia específica, solo la Comisión puede llevar la voz cantante y actuar como tenor en esto.
Pedro Guerreiro
Las iniciativas que procuran promover y salvaguardar las culturas de los pueblos, especialmente en relación con la comida, han de ser bienvenidas. Un ejemplo es la candidatura de la dieta mediterránea como Patrimonio Cultural Inmaterial de la Humanidad, que será valorada por el comité responsable de la Unesco en 2009.
La realización de tal objetivo puede contribuir a preservar, despertar conciencias y promover una dieta que predomina en los países mediterráneos y que ha demostrado ser saludable por varios nutricionistas y otros especialistas. Esta dieta se basa, como ya se ha mencionado aquí, en productos tradicionales de la región mediterránea, como fruta y verduras, aceite de oliva, pescado, cereales, frutos secos, hierbas aromáticas, productos lácteos, carne de cordero y cabra, y vino.
A pesar de ello, el número de personas que mantiene esta saludable dieta ha descendido.
Por lo tanto, entre otras iniciativas políticas necesarias y consecuentes, consideramos que se deben adoptar medidas efectivas para apoyar la producción mediterránea tradicional, en especial dentro del marco de política agrícola común y la política común pesquera. Dichas medidas deberían estar dirigidas a la agricultura a pequeña escala y la agricultura familiar, así como a los pescadores de estas regiones, para garantizar su producción. Las medidas deberían aportar un valor añadido a los productos artesanales y tradicionales y estimular el desarrollo de los mercados locales.
Fundamentalmente, se necesitan medidas para contrarrestar el continuado descenso de la actividad agrícola y su reducción en una población que, con sus conocimientos, mantiene y salvaguarda estos productos tradicionales de calidad.
Todos estos asuntos y medidas entran dentro de la competencia de la Comisión Europea.
Luis Manuel Capoulas Santos
(PT) Señor Presidente, Señorías, no es habitual que un único tema combine al mismo tiempo y de forma positiva tres asuntos tan importantes como la salud, la cultura y la economía. La dieta mediterránea lo consigue por completo.
Desde la perspectiva de la salud, no parecen quedar dudas acerca de los avances para la salud humana de una dieta basada en alimentos naturales y frescos. Como ya se ha mencionado, incluye cereales, arroz, legumbres, frutos secos, fruta y verduras, un consumo frecuente de pescado, aceite de oliva como principal aporte de grasa y un moderado consumo de vino.
Desde un punto de vista cultural, los sistemas de producción y el procesamiento y consumo de estos productos están asociados con técnicas ancestrales y tradiciones que datan más allá de la cultura grecorromana y que, en muchos sentidos, aún siguen presentes en las prácticas, costumbres y técnicas de las comunidades de la cuenca mediterránea.
Desde la perspectiva de la economía, aún siguen teniendo un considerable impacto socioeconómico las actividades vinculadas, en especial, a la agricultura, la pesca y los sectores de turismo rural, que son tan importantes para impedir la despoblación y mantener la vitalidad de las zonas rurales y costeras. Al mismo tiempo, y curiosamente en el caso de la agricultura, estas actividades representan las formas más competitivas de producción de la Unión Europea y siempre se han beneficiado del mínimo apoyo financiero en lo que respecta a la política agrícola común.
Por todas estas razones, la iniciativa de las autoridades españolas para que la dieta mediterránea sea reconocida por la Unesco como Patrimonio Cultural de la Humanidad, merece ser calurosamente acogida y pienso que es el deber y la obligación de la Unión Europea realizar los esfuerzos necesarios para influenciar esta decisión porque no se trata de los intereses específicos de un país o grupo de países, se trata de los intereses de toda la Unión.
Salvatore Tatarella
(IT) Señor Presidente, señor Comisario, Señorías, la obesidad se está convirtiendo en un problema serio y diría que de fundamental importancia en Europa, especialmente entre los jóvenes. Según los expertos, si queremos cuidar la salud de nuestros niños, la mejor manera de lograrlo es volver a las tradiciones de la cocina mediterránea de un modo cotidiano, pues es el único seguro de vida al que nunca puede afectar la crisis financiera.
La propuesta de Alfonso Iaccarino, un reconocido chef italiano y miembro del comité experto para el reconocimiento de la dieta mediterránea como Patrimonio Cultural Inmaterial de la Humanidad, es volver a los alimentos naturales y sencillos y a la tradición, diversidad y calidad en la cocina. La dieta mediterránea no consiste tan solo en mucho pan y pasta, también implica un movimiento, actividad física y un estilo de vida. La dieta mediterránea, basada en el aceite de oliva extra virgen y el buen vino, tiene un efecto excelente en la salud: el aceite de oliva reduce los niveles de colesterol en la sangre y el vino, con moderación, posee un efecto antioxidante.
La dieta mediterránea ha ayudado a los italianos a alcanzar el récord de longevidad en Europa. Italia también lidera el ranking de mejor índice de masa corporal, que es la relación entre la altura y el peso. En conclusión: el senado italiano recientemente ha aprobado por unanimidad un documento base a favor del reconocimiento de la dieta mediterránea como patrimonio de la humanidad. Espero que el Parlamento Europeo sea de la misma opinión y que la Comisión actúe en consecuencia.
(El Presidente interrumpe al orador)
Vincenzo Lavarra
(IT) Señor Presidente, señor Comisario, Señorías, antes de nada me gustaría expresar mi agradecimiento al Presidente de la Comisión de Agricultura y Desarrollo Rural del Parlamento, el Sr. Parish, por haber propuesto esta cuestión tras la valiosa explicación experta de la Comisión.
Es innegable que la comida mediterránea es parte del patrimonio histórico y cultural de nuestro continente. Asimismo, la base saludable de la dieta es innegable. El Libro Blanco de la Comisión sobre la obesidad identificaba la dieta mediterránea como una excelente medicina natural.
Los beneficios sobre la salud han sido científicamente demostrados y poseen una excelente reputación en el extranjero, en especial, en los Estados Unidos. Como resultado, el concepto se ha ampliado hasta el punto de distorsionar su naturaleza original. El reconocimiento de la Unesco ayudaría a crear una definición que protegiera esta particular dieta. Le diría al Sr. Parish, en relación con las dietas específicas de la cultura gastronómica europea, que estamos hablando en este momento de la comida mediterránea, pero que ciertamente ésta no es la única dieta específica dentro de la muy rica gastronomía europea.
Señor Comisario, usted ha mantenido el compromiso de su predecesor de reconocer la importancia de esta iniciativa y le doy las gracias por ello. Ha hecho Su Señoría hincapié en que no posee poderes de toma de decisión con respecto al procedimiento de la Unesco. Sin embargo, considero que podría elaborar una declaración y realizar esfuerzos diplomáticos...
(El Presidente interrumpe al orador)
Alessandro Battilocchio
(IT) Señor Presidente, señor Comisario, Señorías, todos somos conscientes del concepto de que la dieta mediterránea, como confirman muchos estudios, puede ayudar en la batalla contra la obesidad y la enfermedad cardiovascular y, en general, es muy positiva para la salud humana de muchas maneras distintas.
No obstante, el punto aquí no reside en tratar de imponer la dieta mediterránea en la UE o intentar que prevalezca sobre otras dietas que están mejor adaptadas a climas o regiones no mediterráneas. Por eso tenemos el deber de proteger esta dieta y definir su contenido y características para defenderla de la imitación y contaminación externas que podrían dañar su imagen y valor.
Así pues, la dieta debería valorarse de la misma forma que el resto de expresiones de la cultura europea que merecen ser protegidas y promovidas globalmente. Se han realizado intentos por todo el mundo de imitar el modelo y, por este motivo, es importante definir la naturaleza particular de la dieta y protegerla para impedir que un patrimonio europeo completo se pierda en el mar de la globalización.
Czesław Adam Siekierski
(PL) La dieta mediterránea también merece que la protejan y promuevan por otras razones. Hoy día, en un mundo que está dominado por comida rápida y de supermercado, la cocina mediterránea representa una excepción encomiable, ya que es popular y sana. No la inventaron los nutricionistas, sino que es el producto de muchos siglos de tradición que se ha transmitido a través de generaciones.
Más de la mitad de la población de la Unión Europea tiene sobrepeso. Un 15 % son obesos. A mí también me afecta este problema. Estas estadísticas son alarmantes. Deberíamos actuar para combatir esta tendencia negativa. Una de las formas de abordar el problema es fomentando hábitos alimenticios saludables y la dieta mediterránea desde luego entra en esta categoría. La investigación científica ha demostrado que contribuye a disminuir el riesgo de enfermedad cardiovascular, especialmente la cardiopatía isquémica y varios tipos de cáncer, aparte de poseer un impacto positivo en el promedio de vida.
Marios Matsakis
Señor Presidente, se sabe que la dieta contribuye de forma esencial a tener una buena salud. Ahora existe una indiscutible evidencia científica que prueba que la dieta mediterránea -basada en el consumo alimenticio tradicional de los ciudadanos de las zonas del sur de Europa, como Creta y Chipre- conduce a una vida más larga y sana, mientras que la dieta de comida basura influenciada por Estados Unidos -compuesta de hamburguesas procesadas industrialmente, patatas fritas y dulces- lleva a una vida más corta y más afectada por la enfermedad. Una buena dieta es muy importante para los niños. Entonces, ¿va la Comisión a hacer más -mucho más- para garantizar que los Estados miembros promuevan eficazmente la dieta mediterránea en escuelas e incluso prohibir el empleo de dietas que han demostrado ser perjudiciales para los niños en dichas instituciones?
Por cierto, señor Comisario, no he acabado de entender por qué la UE no es miembro de la Unesco. ¿No debería serlo?
(El Presidente interrumpe al orador)
Ewa Tomaszewska
(PL) Señor Presidente, es preferible seguir una dieta sana y evitar enfermedades que pasar por incluso el más efectivo tratamiento médico moderno, incluyendo la complicada cirugía que requieren los pacientes con niveles de colesterol excesivamente elevados. También es más caro que los alimentos sencillos y tradicionales. Esta propuesta es acertada, dado que se basa en buenas tradiciones, probadas y testadas. La dieta mediterránea nos aporta salud y alegría de vivir, y también impide ganar peso excesivo. Acojo con agrado el hecho de que la Unesco haya colocado la dieta mediterránea en su lista de patrimonio mundial.
Jean-Claude Martinez
(FR) Señor Presidente, me complace que sea un británico, el Sr. Parish, el que ha presentado este texto. Esto simplemente nos viene a demostrar que hace dos mil años, aquellos soldados romanos hicieron lo correcto al ir a Gran Bretaña con su ánfora de aceite de oliva y vino. Pues bien, de esto se derivan dos consecuencias. Una de ellas es que es bastante raro desde un punto de vista simbólico que se establezca una Autoridad Alimentaria en Helsinki, y otra es que es poco razonable para la Comisión Europea no volver sobre los siguientes asuntos: primero, restablecer la ayuda para los almendros, después frenar los ataques a los olivos, especialmente en Andalucía y por toda Europa, también frenar los ataques a los pescadores de atún de aleta azul en el Mediterráneo y los ataques a los viñedos europeos, donde se están arrancando las viñas. Yo mismo querría sugerir al Comisario y al Sr. Barroso que organizaran un enorme banquete en Portugal y sirvieran queso de leche de oveja y vino de Samos.
(El Presidente interrumpe al orador)
Vladimír Špidla
Señorías, basándose en la estrategia establecida en el Libro Blanco, la Comisión apoya todas las propuestas y todos los procesos que estimulen hábitos de alimentación saludables. La Comisión respalda estas iniciativas. Sin embargo, no puede apoyar simplemente un conjunto de hábitos alimenticios apenas definidos dado que existen diferencias importantes entre los Estados miembros individuales y entre las regiones individuales, así como existen diferencias, por ejemplo, entre cada uno de los países mediterráneos. Por supuesto, esto no invalida lo que he dicho en mi introducción acerca del apoyo de la Comisión a la propuesta para el reconocimiento de la dieta mediterránea como parte del Patrimonio Cultural de la Humanidad. Estamos realizando progresos en esta dirección y, por supuesto, queda claro que, aunque no seamos miembros de la Unesco, seguro que hay maneras de apoyar esta propuesta.
Señorías, me gustaría responder a una intervención en particular con la que estoy profundamente en desacuerdo. No veo ninguna razón por la que debiéramos reconsiderar la ubicación de la agencia en Finlandia. No tengo ninguna duda de que las personas reunidas en torno a la agencia son perfectamente capaces de defender y cumplir con el mandato asignado a la agencia. En mi opinión, la ubicación se decidió correcta y razonablemente.
Presidente
No sé si hay grandes discrepancias entre Estados miembros o grupos, lo cierto es que, en el debate que hemos mantenido aquí, no se ha apreciado discrepancia; en el debate no ha habido discrepancia y de Alemania a Polonia, del Reino Unido a Portugal, España o Chipre se ha apreciado -creo yo- una unanimidad muy grande en el apoyo que se da a la iniciativa.
Muchas gracias a todos. Vamos a suspender la sesión por unos minutos. Hemos podido terminar el debate a tiempo y, sobre todo, con la tranquila atmósfera necesaria para que todos nos escuchemos, lo cual es un buen inicio del año en nuestro Pleno. La sesión se reanudará a las 12.00 horas para las votaciones.
(La sesión, suspendida a las 11.50 horas, se reanuda a las 12.00 horas)
Francis Wurtz
(FR) Señor Presidente, Señorías, desgraciadamente debo informarles de que acabamos de enterarnos de que la sede de la agencia de las Naciones Unidas responsable de ayudar a los refugiados en Gaza acaba de ser alcanzada por bombas procedentes de tanques israelíes. Tres personas han resultado heridas y la ONU ha decidido suspender todas sus operaciones.
Teniendo en cuenta la votación que va a tener lugar en breve, considero que es importante que todos ustedes queden informados de este suceso.
(Aplausos)
Presidente
Muchas gracias por esa información, Sr. Wurtz. Si es cierto, esto hace aún más apremiante la votación que estamos a punto de realizar.
|
{
"pile_set_name": "EuroParl"
}
|
#Generated by Maven Integration for Eclipse
#Mon Aug 19 21:06:29 CST 2019
version=0.0.1-SNAPSHOT
groupId=com.mashibing.springboot
m2e.projectName=oa-provider
m2e.projectLocation=C\:\\dev\\dubbows\\dubbo01\\oa-provider
artifactId=oa-provider
|
{
"pile_set_name": "Github"
}
|
THE SECRET SPIES IN THE SKY - Imagery, Data Analysis, and Discussions relating to Military Space
SatTrackCam Leiden (Cospar 4353) is a satellite tracking station located at Leiden, the Netherlands. The tracking focus is on classified objects - i.e. "spy satellites". With a camera, accurate positional measurements on satellites of interest are obtained in order to determine their orbits. Orbital behaviour is analysed.
Saturday, 23 July 2016
In January, I posted an analysis of images provided by the Russian MoD during a press conference in July 2014, a few days after the shootdown of Malaysian Airlines flight MH17 over the Ukraine. These images purport to show Ukrainian BUK installations in a field near Zaroshchens’ke.
In my investigation of these images, I showed that the images are suspect because the satellite-to-ground geometry of the satellite and target area on the moment the images were purportedly taken, do not appear to match.
In short: the satellite could only image these targets with clearly obligue angles with the horizontal at the target location, angles between 45 and 57.5 degrees. The Russian imagery however, appears to show these purported "BUK's" as if taken from a much higher angle,almost from straight above. There also appear to be inconsistencies in the shadow directions.
I noted this in the context of checking which satelite made the purported imagery (the only candidate is the Resurs P-1 satellite). For more details, read my earlier post with the original analysis.
The authenticity of these same Russian satellite images had already come under fire from the side of the Bellingcat collective earlier, based on an analysis with the photoforensic tool FotoForensics. More recently (15 July 2016) the authenticity of the images in question again came under fire, this time by the people from the Arms Control Wonk blog, using another photoforensic package, Tungstène.
Both of these photoforensic analysis are not without criticasters (most notably Neal Krawetz, the author of the FotoForensics photoforensic tools). There are however other reasons as well to be cautious with respect to this Russian imagery.
My own analysis, approached the issue from (pun intended) another angle, and came (predictably) under fire from a number of Twitter trolls, the most persistent of which was and is an anonymous Twitter known under the nickname 'Masami Kuramoto' (they always are anonymous, and that itself tells you something). I earlier replied to his criticism in a blog post in February.
'Masami Kuramoto' initially seemed to have given up after my rebuttal, but more recently has stepped up his antics again. He has posted an analysis on his brand new blog, called "Facts versus Truthers", in which he purports to show that my model is incorrect, claiming that I published a model that was "misaligned and pointing downhill". He also tried to smear me by suggesting I am a "truther" (really a very odd insult given the positions I take).
The truth is that Masami Kuramoto's own points of view have very little to do with "facts". As I was tired of arguing with trolls I have ignored him for a while (I have better, more useful things to do), but as the antics are stepped up in the debates in the aftermath of the appearance of the Arms Control Wonkstudy, and Masami publicly purports he has rebutted me and proven my reconstruction "false", I will briefly discuss Masami Kuramoto's fabrications and show the malicious manipulative perversity of it all.
It is immediately clear that he superimposed his block model on a severely distorted version of my reconstruction.
In fact, when we project Masami Kuramoto's block model (red) over my undistorted model, with both being rotated so that the Y-axis is north-south in order to match the North-South oriented Russian satellite image and the north-south alignments of the purported BUK on that image, we get the image below.
click to enlarge
As you can see, the two models actually match very well. There is no significant difference between my model and Masami Kuramoto's model, contra Masami Kuramoto's insistence. In fact, it only appeared that way because Masami Kuaramoto provided a distorted version of my model and compared his model to that, rather than my original.
Hence why I use the word "fabrication" to refer to Masami Kuramoto's attempt to rebut me. Masami Kuramoto's argument that my model is "misaligned and pointing downhill" is simply not true, the argument is fabricated.
Looking at the reconstructions above, it is also very clear that the BUKs in the Russian MoD image do not match both Masami's own model and my model in terms of what is visible of the west sides of the launch vehicles (the slanted look of the models due to the oblique viewing angle).
This of course was the original point of my analysis: the two BUK's seem to be shown too much from directly above these machines, whereas the image should show a clearly oblique angle (as the model reconstructions show)
I want to emphatically point out, that no amount of orthorectifications applied to the Russian image can make the exposed west sides that should have been imaged (but are not), somehow automagically disappear. Nor will it result in incompatible shadow directions.
So, I think my point is clear. And it is also clear that Masami Kuramoto is a malicious, insincere troll of the kind that is abundant in the MH17 debate.
I know enough of troll behaviour by now to have no illusion that this will stop Masami Kuramoto's attempts to discredit my findings by provided fabricated counter-arguments. He will try again, and in that sense, this will be a perpetual discussion. Remember however, the history of this discussion so far, in judging the veracity of any new bollocks he might come up with.
It is interesting to look at how this whole argument developed, as it contains several clues on how to identify a troll. Masami Kuramoto tried from the start to tear my analysis apart by any handle he could perceive. When several of these attempts failed, he went on to the next one, and then yet another one. This is the hallmark of someone with a strong bias, a bias with an origin in ideology. In brief order (see also the summary and discussion in my earlier post):
1) He tried to argue that the orbital elements for the satellite in question I used were incorrect, and hence my geometry reconstruction was incorrect. He argued that the US MoD had post-altered the orbital elements for this satellite, but was taken aback when I informed him that I (and several other satellite trackers) maintain a private archive of elements. I regularly save copies of the latest orbital elements released by JSpOC to a hard drive and have an archive of these going back many years, and that analysis of that archive showed no sign of post-MH17 fiddling with the orbital elements;
2) Then he tried to use a part of the Space-Track User Agreement, taken completely out of context, to (falsely) imply that the elements would not be accurate enough (the matter of fact is that the accuracy of JSpOC elements for the question at hand is not in dispute, see my earlier post);
3) He then tried that argument again by referring to a publication, without (wanting to) realize the inaccuracies pointed out in that paper were very small scale and completely neglicable for the discussion at hand;
4) He then came with the fabricated counter-evidence currently under discussion in this blog post.
In all cases, he insisted on maintaining his position even after being corrected on the matter. It was (and is) very clear he is desperately looking for handles to tackle my analysis because he wants to prove it wrong. Masami Kuramoto is pro-Russian and promotes a worldview where Russia is never wrong, so I must be. As we have seen, he is willing to fabricate arguments to sustain his point. All this, from the comfort of his anonimity.
There are a lot of people out there like Masami Kuramoto (and, to be clear, not just pro-Russian ones). They are annoying, and poisoning the debate. Around last week's 2-year anniversary of the MH17 tragedy, we have seen a lot of it again, both anonymous and not so anonymous, coming out of the woodwork. Most of these people are "useful idiots" blinded by ideology. Some are more sinister, as they deliberately fabricate disinformation on behalf of an involved party.
Wednesday, 20 July 2016
Last night was a clear and very warm, moonlit night (21 deg C). It was warm enough to observe in shirt and shorts. I observed MUOS 5 and USA 224, but the highlight of the night came in early morning twilight: a splendid pass of the ISS being chased by SpaceX's Dragon CRS-9 cargo vehiclelaunched July 18 and berthing to the ISS at the moment of writing.
The image above shows them, crossing Aquila at 1:32:42 UT (3:32 local time): ISS is the brighter object in top, the Dragon is chasing it, some 20-25 seconds behind it.
It was a splendid view, seeing the two objects majestically sailing across te sky. The Dragon was very bright an easy to see: mag +2 when clearing the rooftop in the southwest, and briefly attaining magnitude 0 while decsending in the southeast.
The image was made with my Canon EOS 60D and an EF 2.0/35mm lens set at F2.2, 5 seconds exposure at 800 ISO. This was 9.5 hours before the Dragon was captured by the ISS's robotic arm for berthing.
Tuesday, 19 July 2016
On July 19, 2016, near ~6:30 UT (~18:30 local time), a bright very slow and long-lasting fireball was reported by many people from New Zealand's South Island. Several images are available, e.g. here and here and here. The fine video below is from YouTube user Ralph Pfister:
Perhaps the most accurate time given for the event is 6:26 UT as given by amateur astronomer Paul Stewart from Timaru on New Zealand's South Island. Stewart captured the fireball on several all-sky images. A fine animation of his images is on his weblog.
From the video's it is immediately clear that this is not a meteoric fireball, but the re-entry of an artificial object (i.e. artificial Space Junk).
Time, direction of movement and geographical position moreover match well with an obvious decay candidate: the Russian Soyuz upper stage (2016-045B, NORAD #41671) from the July 16 launch of Progress MS-03 to the International Space Station. In other words: this was a Space Junk re-entry.
At the moment of writing, the elements that are available for the Soyuz
rocket stage are almost a day old and not unproblematic. For unknown
reasons the B* drag value of the elsets is zero and the NDOT/2 value unrealistic.
This hampers analysis slightly, but using the almost a day old elements face-value,
the upper stage would have passed over New Zealand's Southern Island
near ~6:33 UT (~18:33 local time). This is within minutes of the time of
the New Zealand event. The direction of movement of the rocket stage
also matches that in Paul Stewart's imagery.
The maps below show the predicted position and track of the Soyuz upper stage for 19 July 2016, 16:30 UT (18:30 local time in New Zealand). They are based on the almost a day old element set 16200.42841345.
click map to enlarge
click map to enlarge
The few minutes discrepancy between predictions and actual sighting from New Zealand is not unusual for a re-entering object. The last available elements (at the moment of writing) for the Soyuz stage are actually from many hours before the reentry, and during the last moments of its life the orbital altitude drops quickly (i.e. the orbit alters).
Old elements hence will place it in a too high orbit compared to the reality of that moment. As it drops lower in orbital altitude, the rocket stage will get a shorter orbital period and hence appear somewhat earlier, "in front" of predictions made using the old element set. Discrepancies of a few minutes are therefore normal in cases like these.
When it is "early" on the ephemerids, the orbital plane will be slightly more to the east as seen from a locality. In this case, the nominal pass predicted for Paul Stewart's locality would have been a zenith pass: but the a few minutes earlier pass time compared to the predicted time and the lower actual orbital altitude at the time of the re-entry would result in a sky track that is shifted eastwards and lower in the sky. This matches Paul Stewart's all-sky imagery.
Friday, 8 July 2016
The website Spaceflight.com has broken the news that something has gone wrong with the orbit raising manoeuvres of MUOS 5. They have therefore been halted for the moment. A formal statement by the US Navy on this all is here.
So MUOS 5 at this moment appears to be stuck in the aproximately 15240 x 35700 km Geostationary Transfer Orbit (GTO) in which Paul Camilleri and me observed it between July 3 and 5 (see my previous post).
It is the white orbit in the plots below (replaced with new versions July 9):
Thursday, 7 July 2016
Over the past days, Paul Camilleri in Australia and me in the Netherlands have been tracking an object in GTO with a Mean Motion of 1.5 revolutions per day. It produces brief bright (mag +8) flashes each ~5 minutes. We are certain this is MUOS 5 (2016-041A) launched June 24 (see my earlier post here, about Paul's orbit insertion and Centaur fuel vent imagery).
The image below was shot by me from Leiden, the Netherlands, during the night of 4-5 July 2016. The object was at an elevation of only 16 degrees above the horizon:
click image to enlarge
Paul first imaged it from Australia on June July 3, when it passed a few degrees from the position where we expect MUOS 5 to be placed in GEO. I next imaged it from the Netherlands during the night of June July 4-5, low at my southeast horizon not far from Mentor 6. A few hours later, Paul observed it again from Australia. All these observations can be fitted to yield this GTO orbit:
Comparing this orbit to the initial GTO insertion orbit from June 24-25 provides a clear link. The RAAN values of both orbits agree to within a few degrees, and the apogee direction is also very similar, as can be see in the plot below:
click to enlarge
In the plot above, the red orbit is the June 24 initial GTO insertion orbit. Somewhere after June 25, the satellite manoeuvered (multiple times probably) to increase its perigee from 3900 km to 15240 km. The white orbit is the resulting "current" GTO orbit from the July 3-5 observations.
[ UPDATE 7 Jul 2016 17:25 UT: I have since done an analysis that suggests that a perigee-raising manoevre from the initial 3903 km to 15242 km could have happened on July 3, near 14:33 UT, in apogee. I suspect however that it was in reality a series of smaller manoeuvres [update July 8: series of manoeuvres confirmed here]]
The grey orbit is the eventual geosynchronous orbit in which MUOS 5 will be inserted a few days from now (probably with a position near longitude 172 W). It will probably make more manoeuvres for that purpose the coming days. [update: there is a possibility it actually did so only a few hours after our last observation on July 5]
UPDATE July 8 17:00 UT: News has come in that something went wrong and MUOS 5 is snagged in GTO for now. More on the Spaceflight.com website and a brief follow-up post here].
The plot below shows how during this manoeuvering, the orbital inclination has been lowered, from 19.0 degrees initially, to 9.8 degrees currently. It will be further lowered to ~5.0 degrees upon GEO insertion:
click to enlarge
The object shows a clear brightness variation, from mag +8 to invisible, with a peak-to-peak period of ~5.0 minutes, indicating the satellite is spin-stabilized. [update: Ted Molczan has noted that this 5-minute periodicity seems to be typical for the Lockheed A-2100 bus in GTO].The bright peaks are of short, specular and somewhat variable duration: lasting ~0.5 to 1 minute. During the lows, the object was not visible for my equipment.
The image sequence below, from my June July 4-5 imagery, shows a part of the described brightness behaviour:
click image to enlarge
As I have written earlier, MUOS 5 will likely be placed in a geosynchronous, 5-degree inclined orbit near longitude 172 W, probably within a few days from now or perhaps even on July 5th already [see the update already mentioned above: MUOS 5 has got stuck in GTO! See also the brief follow-up post here]. This is an initial check-out position. It will stay there for 4 to 6 months, and then be moved to longitude 72 E where it will be placed as an on-orbit spare. In 2015, we observed this with MUOS 4 (see previous posts here and here).
About the Author
Dutch, 47, PhD, stone age archaeologist, meteoriticist, satellite tracker, meteor observer, asteroid discoverer. Consultant in a Space Situational Awareness project with the Space Security Center of the Royal Dutch Air Force and Leiden Observatory. As an invited expert I advised members of Dutch Parliament about military satellite systems and their locations during a 2016 foreign affairs committee hearing about the MH17 disaster.
Asteroid (183294) Langbroek was named after me. In 2012, I received the Dr. J. van der Bilt Prize of the Royal Dutch Astronomy Association (KNVWS) for my work on meteors, asteroids and satellites.
Opinions expressed on this blog are entirely my own.
You can find me on Twitter via @Marco_Langbroek
Use of images
Use of photographs and video from this blog for scientific or educational purposes, or by news agencies in news items is allowed, provided that the source is acknowledged. Images are released under a Creative Commons BY-NC license, except for those released on Wikicommons under the license stated there, and with the addition that news media may freely use them with source acknowledgement. Note that this only concerns my own imagery posted here, not imagery by others which I post with permission!
Excerpt from United Nations resolution 2222 (XXI)
Treaty on Principles Governing the Activities of States in the Exploration and Use of Outer Space, including the Moon and Other Celestial Bodies
In order to promote international co-operation in the peaceful exploration and use of outer space, States Parties to the Treaty conducting activities in outer space, including the moon and other celestial bodies, agree to inform the Secretary-General of the United Nations as well as the public and the international scientific community, to the greatest extent feasible and practicable, of the nature, conduct, locations and results of such activities. On receiving the said information, the Secretary-General of the United Nations should be prepared to disseminate it immediately and effectively.
|
{
"pile_set_name": "Pile-CC"
}
|
s digit of q?
1
Let y be (-2)/14 + (-15804)/14. What is the tens digit of y/(-13) + 3 + 4/26?
9
Let k(i) = -i**3 + 13*i**2 - 11*i - 14. Let d be k(12). Let o(g) = -2*g - 3*g - 3*g**3 + g - 4*g**2 - 3. What is the tens digit of o(d)?
1
Let k be (2 - -4) + -9 + 1 + -165. Let b = -33 - k. What is the hundreds digit of b?
1
Let o = -69 + 74. What is the tens digit of (-3 - -4)/o + 856/20?
4
Let m be ((-8)/10)/(4/(-20)). Suppose -4*i - 3*j = -146, -181 + 43 = -m*i + j. What is the tens digit of i?
3
Suppose -5 + 93 = -4*g. Let u = g + 53. What is the units digit of u?
1
Let g(n) = -n**3 - 25*n**2 - 36*n - 102. What is the units digit of g(-26)?
0
Let l(u) = -u. Let g be l(-7). Suppose g*n - 3*n = 16. What is the units digit of n?
4
Let y = -102 + 166. Let n = y + -27. What is the tens digit of n?
3
Let n(s) = 7*s**3 - 3*s**2 + 2*s - 3. Let p be n(2). Suppose -191 = -2*i - u, -3*u = -i + 40 + p. What is the tens digit of i?
9
Let p be (7 - 2) + 2 + 7. Suppose p*a + 273 = 15*a. What is the units digit of a?
3
Let x = 2211 + 759. What is the tens digit of x?
7
Let d(q) = q**2 + 2*q - 10. Let v be d(-5). Suppose 5*w + 133 = 5*m - 2*m, -4*m + v*w + 169 = 0. What is the units digit of m?
6
Suppose 2*l + 27 - 76 = j, 0 = 3*j + l + 147. Let i = j + 90. What is the tens digit of i?
4
Suppose 0 = z - 4*h - 2522, -2558 = 15*z - 16*z - 5*h. What is the thousands digit of z?
2
Suppose 0 = -5*v + 1485 + 2485. What is the tens digit of v?
9
Suppose -1 - 2 = -x. Let d be -10 - (-1 + x + -4). Let m = d + 12. What is the units digit of m?
4
Let v(t) = 5*t**2 - 27. What is the units digit of v(9)?
8
Suppose 79*w + 8040 = 87*w. What is the tens digit of w?
0
Suppose -2*s + 2234 = 4*c - 154, s = 4*c - 2382. What is the hundreds digit of c?
5
Suppose 87 + 83 = r + 2*z, 3*r - 500 = -4*z. What is the hundreds digit of r?
1
Let r(u) = -u**2 + 16*u - 1. Let s(a) = -13*a + 88. Let t(p) = 3*p - 22. Let d(k) = -2*s(k) - 9*t(k). Let x be d(9). What is the tens digit of r(x)?
3
Let q(o) = -o**3 - 10*o**2 - 7*o + 9. Let s be q(-10). Let l = s + -114. What is the units digit of l/(-2) - 5/10?
7
Let h(p) = -38*p + 3. Let g be h(-1). Suppose -19 = -2*v + g. Let n = v - 10. What is the tens digit of n?
2
What is the units digit of 68573/19 + (-304)/2888?
9
Suppose 2*i + 2 = 0, -196 - 595 = -5*m + i. What is the hundreds digit of m?
1
Suppose 0*b + b = -g + 52, 2*g = -b + 53. Suppose -b = 5*q + 4. Let x = q - -12. What is the units digit of x?
1
Suppose 27 = -3*h - 6*h. What is the units digit of (-1)/h + 276/36?
8
Let u(w) = -4*w**2 - 1 + 0 - 1 + w**3 - 4*w. Let d be u(5). Suppose 3*v - 34 = 4*j, -d*v + 5*j + 55 = 2*v. What is the units digit of v?
0
Let q(x) = -5*x**2 + 1. Let g be q(-4). Let z = g + 118. What is the units digit of z?
9
Let g be 268 + 2 - (10 + -12 + 6). Let r = -33 + g. What is the hundreds digit of r?
2
Suppose -4*f - 37 + 21 = 0. Let r(w) = -2*w**3 - 5*w**2 - 4*w - 4. Let g be r(f). Suppose -g = 2*c - 6*c. What is the tens digit of c?
1
What is the tens digit of 40/32*-4 - -1543?
3
Suppose 13 = 6*t + 73. Let p be (-9828)/30 - 6/t. What is the units digit of p/(-12) - 12/(-16)?
8
Let g be (-1 - 2)/(3/(-2)). Let r be g/(-7) + 108/(-14). What is the units digit of (-1)/(3/9)*r?
4
Let p be (5/(-5) - 2) + 3. Suppose 10*w - 7*w - 234 = p. What is the tens digit of w?
7
Let k = -52 - -51. What is the units digit of k*6243/(-33) + 6/(-33)?
9
Let n(c) = -4*c**2 + 3*c + 2*c**2 + 3*c**2 + 4. What is the units digit of n(-3)?
4
Let n(s) = -23*s**3 - 7*s**2 - 10*s - 2. Suppose 6*h - 2 = 7*h. What is the hundreds digit of n(h)?
1
Let l = 393 - 29. What is the tens digit of l?
6
Let n(c) = 3*c + 6 + 4 - 10 + 40*c**2. What is the hundreds digit of n(-2)?
1
What is the thousands digit of (6/(-10) + (-72)/180)*-1823?
1
Let d(l) = -14*l + 8. Let k be d(-4). Suppose 2*i + 2*i = k. What is the units digit of i?
6
Let i(k) = k**3 - 11*k**2 - k + 15. Let v be (-44)/6*6/(-4). Let n be i(v). Suppose n*x + 0*x + 147 = 3*z, -5*z + 2*x = -231. What is the units digit of z?
5
What is the tens digit of ((-4)/6)/(30/(-2745))*5?
0
Let k(g) = -6*g**3 - 9*g**2 - 4*g - 9. Let b(h) = h**3 - h. Let a(y) = -5*b(y) - k(y). Let i be a(-9). What is the units digit of (i/30)/(1/(-20))?
8
Let t(y) = -8*y - 7. Let o be t(-3). Let m = 22 - o. Suppose 5*v - 35 = m. What is the units digit of v?
8
Let z(i) = 2*i - 10 + 7*i**2 + i**3 - 25*i**2 + 9*i - 6*i. What is the units digit of z(18)?
0
Let w be (-15)/((-2)/(-10)*-1). Suppose 7*d = 2*d + w. What is the tens digit of d?
1
Let r(i) = 4*i**2 + 1. Suppose -7*f = -3*f + 4. Let b be r(f). Suppose 0 = c + 5*z + 19, -c = -4*c - 2*z - b. What is the units digit of c?
1
Let y be 1/(-3) - ((-140)/6)/(-5). What is the units digit of (-2)/y*(-20 + 590)?
8
Let c(a) = a**3 - 5*a**2 + 5*a + 1. Let i be c(4). Let n = i + 28. What is the tens digit of n?
3
Suppose -z - 43 = -48. Suppose z*p = t + 635, 53 = -2*p - 4*t + 285. What is the units digit of p?
6
Suppose 4*i + 6 = 22. Suppose -w = -0*j + 2*j + 15, -5*w - 131 = -i*j. Let z = -4 - w. What is the tens digit of z?
1
Let u(s) = -45*s + 34. What is the units digit of u(-12)?
4
Let p = -1002 + 1761. What is the tens digit of p?
5
Let u(m) = -3*m**2 - 6*m - 3. Let g = 3 - 9. Let b be u(g). What is the units digit of (b/6 - -2)*-2?
1
Suppose -r = 2*l - 218, 0*l = 3*r - 2*l - 678. What is the hundreds digit of r?
2
Let y be -1 - 1/((-1)/8). Suppose 2*j - 70 = y*j. Let g = 30 + j. What is the tens digit of g?
1
Let f(u) = 2*u + 2*u**2 + 11*u**2 + 36*u**2 - 105 + 106. What is the tens digit of f(-1)?
4
Let w be 1/(-4) - 4/((-16)/1). What is the units digit of 2346/15 - w - 10/25?
6
Let t = 29 - 38. Let c(u) = -u**3 - 9*u**2 - u - 9. Let n be c(t). Suppose n = 11*i - 8*i - 27. What is the units digit of i?
9
Suppose 3*a = -4*o + 1230, -3*a - 3*o - 2*o = -1233. What is the hundreds digit of a?
4
Let j(c) = -c**2 + 2*c + 537. What is the units digit of j(0)?
7
What is the tens digit of ((-884)/52)/((-2)/142)?
0
Let i = -1451 - -2095. What is the hundreds digit of i?
6
Let m(q) = -2*q**2 - 12*q + 1. Suppose 17 - 42 = 5*f. What is the units digit of m(f)?
1
Let v be 66/4*48/(-36). Let l = v + 29. Let s = 14 + l. What is the tens digit of s?
2
Suppose 5*b - 4*v - 18649 = 0, -2*b = 2*b + v - 14915. Suppose 663 = -14*h + b. What is the units digit of h?
9
Suppose 7533 = 5*w + 2*b, -8*w - 2*b = -5*w - 4519. What is the units digit of w?
7
What is the tens digit of 51967/17 + (-158)/(-1343)?
5
Suppose -d - 3 = -3*f - 4, -d = -f - 1. Suppose 2*j - 14*j + 2628 = f. What is the hundreds digit of j?
2
Let n = -930 + 1347. What is the hundreds digit of n?
4
Let s(o) = -4*o + 1. Let r(l) = 21*l - 5. Let i(b) = 2*r(b) + 11*s(b). Let g be i(-5). What is the units digit of (g - (2 - 2))*1?
1
Suppose -2*l - 3*m - 11 = 0, 2*l + 4*m + 2 = -14. Let y be l/(-6)*0/1. Suppose -f + 2 - 1 = y. What is the units digit of f?
1
Let h = 59 - 27. Suppose -h = -a + 40. What is the units digit of a?
2
Let r be 24/(-32) + (-774)/(-8). Let u = 1 + 2. Suppose m - r = -u*m. What is the tens digit of m?
2
Suppose 4*n - 7*s + 4*s - 3753 = 0, -2*n + s = -1877. What is the tens digit of n?
3
What is the tens digit of (-484043)/(-189) + (-6)/81?
6
Suppose 2880 = -3*x - 15*x. What is the units digit of -3*(3 + x/3)?
1
Let s(t) = -t**2 + 2*t + 1. Let k(y) = y + 1. Let v(z) = -2*k(z) - s(z). What is the units digit of v(7)?
8
Let t(r) = 9*r - 1. Let i be -4*(-3)/4 + 3. Let x be (-3)/i*(-7 - -1). What is the tens digit of t(x)?
2
Let y(s) = -s + 11. Let v(k) = -4. Let g(h) = 17*v(h) + 6*y(h). Let d be g(-1). Suppose 2*q - 66 = -0*q - d*i, -3 = -i. What is the units digit of q?
7
Let c = -241 + 631. What is the units digit of c?
0
Let g be ((-2)/3 + -2)*-3. Suppose 0 = 12*j - 7*j - 1020. What is the units digit of (j/(-16))/((-3)/g)?
4
What is the units digit of ((-7812)/(-18))/(2/11)?
7
Let o = -14 - -9. Let k(g) = -2*g + 11. What is the units digit of k(o)?
1
Let l(i) = i**3 - 7*i**2 - 2*i + 14. Let x be l(7). Suppose x = 3*r - 2*r - 5*m + 17, r = 3*m - 9. Suppose 0 = b - r*b + 84. What is the tens digit of b?
4
Let p = -49 - -54. Let q(c) = -2*c**3 + 5*c**2 + 6*c - 14. Let v(d) = d**3 - 3*d**2 - 3*d + 7. Let i(x) = -2*q(x) - 5*v(x). What is the units digit of i(p)?
|
{
"pile_set_name": "DM Mathematics"
}
|
[Surgical treatment of benign lesions and strictures of the bile ducts].
Benign strictures of the biliary ducts are treated surgically in 90% of cases. Usually they are caused by trauma to the choledochous duct during gallbladder operations. Younger patients are frequently affected and, particularly if the strictures go untreated, can suffer from secondary complications such as cholangitis or secondary biliary cirrhosis with the serious dangers of portal hypertension and even hepatic failure and death. Although immediate treatment by end-to-end anastomosis has sometimes been described, this method is reasonable only for smooth cuts to the choledochous duct. Good long-term results have been achieved in 86% of cases with Roux-en-Y hepaticojejunostomy. In general, the best way to avoid complications is the all-important surgical maxim of correct indication for the primary operation. The best course is to limit the decision for surgery to symptomatic gallstones.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Of his next broadcast, host Dick Flacks writes, ”This week’s ‘Culture of Protest’ will feature albums of recent release that might make nice gifts for the protest musically inclined. And we will include a couple of the Henry Wallace campaign songs we couldn’t play last week.”
|
{
"pile_set_name": "Pile-CC"
}
|
Polish Financial Watchdog To Fund Anti-Crypto Social Media Campaign
Poland’s Financial Supervision Authority (KNF) is conducting a social media campaign about the risks of investing in cryptocurrency, according to a May 10 post on the KNF’s website. KNF has placed a tender order of 615,000 zloty (around $173,000) to plan and conduct the campaign, which focuses on the risks associated with cryptocurrencies, pyramid schemes, and forex trading.
The KNF’s recent initiative is evidently part of a larger anti-cryptocurrency campaign led by the country’s authorities. In mid-February, the Central Bank of Poland admitted to funding a $27,000 anti-cryptocurrency campaign that specifically consisted of a YouTube video – with no indication that it was sponsored content – about a man who lost all his money in crypto trading.
The Central Bank of Poland and the KNF have also partnered to make an anti-crypto educational website that explains why “virtual currency is not money” and “cryptocurrencies are not currency.”
Also in February, as a response to the government’s efforts, a small film studio released a documentary about cryptocurrency in Poland, called Krypto, with the declared goal of educating the Polish public facts about crypto and blockchain technology.
The KNF’s official post says it will be accepting applications and proposals for the campaign until May 18, and the campaign will begin in June 2018 and last for 30 days. The KNF’s description of the initiative also mentions the promotion of an app referred to as “KNF Alert”. According to local news outlet Bitcoin.pl, the campaign will include two 30 second video spots, presumably on television.
Poland’s previous anti-cryptocurrency education campaign was received mainly negatively in the country, particularly due to the lack of transparency around the YouTube video’s sponsorship. Poland’s central bank responded in depth to the criticisms, mentioning the volatility of crypto markets and the use of crypto for cyber crimes as impetus for the video. However, the bank did note that they are not opposed to the development of blockchain technology.
Earlier today, Cointelegraph reported that the Polish Credit Office, the largest credit bureau in Central and Eastern Europe, has partnered with a UK fintech firm to implement blockchain for customer data storage.
|
{
"pile_set_name": "Pile-CC"
}
|
/* AUTO-GENERATED FILE. DO NOT MODIFY.
*
* This class was automatically generated by the
* gradle plugin from the resource data it found. It
* should not be modified by hand.
*/
package org.chromium.base;
public final class R {
}
|
{
"pile_set_name": "Github"
}
|
On sufficiently smart compilers - YAFZ
http://osa1.net/posts/2015-08-09-sufficiently-smart-compiler.html
======
username223
> Unreliable optimizations and performance-critical software
This is why we will not have, and should not want, a "sufficiently smart
compiler," but instead a "sufficiently predictable compiler." If the compiler
is an enormously complex inference system, then tiny language-level changes
can result in huge performance changes (see "space leaks" in Haskell, or
"auto-vectorization" in basically anything). The solution isn't adding more
knobs to the compiler; it's adding easier inter-language communication.
Scripting languages like Matlab, Perl, Python, and R have been doing this
right for decades: make a good effort at a specific domain (math, text,
statistics), and make it easy to call into lower-level code for the key
pieces.
~~~
codygman
Space leaks are a bad example imo since they happen in other languages as
well.
~~~
Tyr42
Yeah, but having a chain of functions failing to fuse properly can be quite
surprising.
~~~
codygman
There seemed to be an implication that Hindley Milner type inference leads to
unpredictable performance, you can see that is untrue with ml and ocaml.
------
nhaehnle
Compiler optimizations as part of libraries is definitely something I would
like to see more languages explore. I think this is something that could fit
quite well into Rust, actually, with its philosophy of allowing compiler
plugins.
A simple example: Most high-level array implementations have a _reserve_
method that allows you to specify the expected number of items added to the
array. This allows allocating all required memory up front and hence avoids
re-allocs and the associated copies.
In many cases, it would be trivial for a compiler to automatically determine
the size of the array and add a reserve call automatically (because the
entries are added in a loop with an easily-determined iteration count). Yet
compilers cannot be allowed to do that, because doing so changes the visible
behaviour of the program.
However, _the library in which the array is implemented_ is free to define the
semantics of the array. So that library could provide some hint to the
compiler, in essence a library-provided optimization pass, which allows such
reserve calls to be added automatically.
I'm not saying that coming up with a good DSL to describe such optimization is
easy, but it may well be worthwhile in the long run.
~~~
dbaupp
Haskell's GHC offers optimisations-in-libraries via its RULES pragma[1], which
allows specifying rewrite rules. These are an important part of the
deforestation[2] that makes, for instance, lists and vectors fast.
[1]:
[https://wiki.haskell.org/Playing_by_the_rules](https://wiki.haskell.org/Playing_by_the_rules)
[2]:
[http://hackage.haskell.org/package/vector-0.7.1/docs/src/Dat...](http://hackage.haskell.org/package/vector-0.7.1/docs/src/Data-
Vector-Generic.html#line-212)
~~~
nhaehnle
Yeah, that's actually mentioned in the article ;)
------
com2kid
Tools already exist for doing run time traces of compiled programs and then
optimizing accordingly. A lot of what they focus on is improving locality,
moving portions of the executable that are run together near each other so
improve the instruction cache hit rate. They also much more aggressively
inline, to the point that the overall code size increases but hopefully so
does performance.
You actually get a huge amount of perf gains just from improving locality, a
lot of in-depth optimizations are possible but I am not sure what compilers
now days actually do, it has been a long time since I worked on a compiler
team!
~~~
haldean
Got any links? I'd love to check out the tools you're talking about.
~~~
vilya
Profile Guided Optimisation is the search term you're looking for. For one
example: GCC does it (you may need to use gprof as well, can't really
remember).
------
stcredzero
I'd like to see projects that can integrate the runtime information provided
by a JIT VM. What if such a project used this information from the start?
Then, the programmers might be able to use information like: This variable has
only ever had an int in it, ever, over the entire lifetime of the app.
Such information might be problematic to integrate into a legacy project, but
in a language which allowed for optional type annotation, such information
could be fed into programmer tools and more easily analyzed. (Example: So,
this code here where it's not an int -- do we really need to have this, or
could we move the error checking elsewhere, so we can just say that's an int?)
~~~
douche
Or you could use a language with static typing. It might be the line of work
that I'm in, but I've never encountered a case where dynamic typing has really
been helpful - more often it's been a source of errors, where non-obvious type
coercion has been performed by the interpreter/runtime. I can only think of
one case where dynamic typing was necessary, but I'll chalk that up to a
really poorly designed COM API that I had to work with.
~~~
jcranmer
The problems most people have with static typing are related to explicit
typing, not static typing per se. (And somewhat inane conversions tend to give
dynamic typing a bad name as well).
There are two cases I can think of where the static typing in the most common
languages are insufficient. The first is union types--you can't easily express
a data structure like JSON in Java (although one could argue this is a
feature, not a bug). The second case is where you need to map types to
instances of those types, something akin to a Map<Class<T>, T> in Java syntax.
While you can generally specify the latter at a method syntax (e.g., public
<T> T get(Class<T> clazz)), there's no way to write that method without having
to resort to subverting the type system.
Dynamic typing can be beneficial if you would otherwise be stuck subverting
the type system more often than following it, although that's as much of an
argument for more powerful static type system as it is one for dynamic typing.
------
caf
It seems like errors in the rewrite rules themselves would potentially create
very hard-to-debug problems with the runtime code.
|
{
"pile_set_name": "HackerNews"
}
|
10 Essential Films For 2016
Planning for the year ahead in film is admittedly a dicey business. A great trailer does not necessarily make a good film, of course. As with previous preview lists, I’ve tried to avoid the big studio superhero films – of which there are several coming – and focus instead on the films that I suspect may have greater resonance with Uncut readers.
So, we welcome back some familiar faces – John Hillcoat, the Coens bothers, Ben Wheatley, Richard Linklater – and look forward, too, to the directorial debut of Don Cheadle, who has also found time to star in a much-anticipated Miles Davies biopic. There’s comedy, sci-fi, thrillers and also gripping political reportage (or, well, that’s perhaps stretching it: Liz Lemon in Kabul, anyone?).
Of course, as this is restricted to films with trailers, sadly I can’t include Martin Scorsese‘s Silence, Todd Solondz‘ Wiener-Dog or Kenneth Lonergan’s Manchester By The Sea. Looking through the forthcoming listings, though, I notice this curious inclusion to the November 2016 schedule: Untitled WB Event Film 1. Now what on earth could it be?
|
{
"pile_set_name": "Pile-CC"
}
|
Samsung this week announced that it had started mass production of its new 8 TB NF1 SSDs. Samsung has been demonstrating prototype NF1 SSDs for slightly less than a year now, so it is not surprising that some of its customers are now ready to adopt them. The larger NF1 form factor allows for drives with double the capacity of M.2 SSDs, and they are aimed primarily at data-intensive analytics and virtualization applications that require higher performance and capacity than what M.2 can provide.
Update 6/22: Samsung made an update to its statements regarding the NF1 SSDs. The drives are based on the Phoenix controller, they do not use a PCIe 4.0 interface, but rely on a more traditional PCIe Gen 3 x4 interface.
Samsung’s NF1 SSDs are based on the company’s 512 GB packages comprising of 16 layers of 256 Gb TLC V-NAND memory devices, as well as the company’s proprietary controller accompanied by 12 GB of LPDDR4 memory. Prototype NF1 drives used Samsung’s Phoenix controllers already used for client SSDs, early on Friday the company confirmed that the commercial NF1 SSDs are indeed the PM983 SSDs powered by the Phoenix controller. From performance point of view, the NF1 drives deliver sequential read speeds of 3100 MB/s and write speeds of 2000 MB/s. When it comes to random performance, the drives are capable of up to 500K read IOPS as well as 50K write IOPS. As for endurance, Samsung rates the drives for 1.3 DWPD.
Samsung NF1 (PM983) SSD Specification Capacity 8 TB Controller Phoenix NAND Flash 256 Gb TLC V-NAND Form-Factor, Interface NF1, PCIe 3.0 x4 Sequential Read 3100 MB/s Sequential Write 2000 MB/s Random Read IOPS 500K IOPS Random Write IOPS 50K IOPS Pseudo-SLC Caching unknown, likely not DRAM Buffer 12 GB LPDDR4 TCG Opal Encryption No Power Consumption Active Read ? W Write ? W Idle ? mW Warranty 3 years MTBF 2 million hours TBW 11388 TB Price ?
Two interesting points that Samsung mentioned in its press release was the fact that its NF1 SSDs enabled an undisclosed maker of servers to install 72 of such drives in a 2U rack for a 576 TB capacity and the fact that the drives used a PCIe 4 interface, a claim that was later retracted. All previous public demonstrations of NF1 SSDs were carried out on 1U servers based on Intel’s Xeon processors and there is also an NF1-compatible server from AIC based on AMD’s EPYC CPU. Samsung’s customer who uses the NF1 drives will likely identify itself in the coming months. In the meantime, the only shipping processor supporting PCIe 4 is the IBM POWER9, whereas the only PCIe 4-supporting switches are available from Microsemi. As for the 2U machine featuring 72 NF1 bays, it has not been publically announced yet.
Samsung promises to start producing higher-capacity NF1 SSDs later this year. The company also says that JEDEC is expected to formally standardize the NF1 (aka NGSFF) spec this October .
Update 07/05: Samsung has sent out an oddly timed correction some 2 weeks after the initial announcement, essentially disowning their comments on when NF1 is expected to be standardized. However their new statement also doesn't state that their estimate was incorrect, merely that they shouldn't have made it.
"Samsung in a footnote to its NF1 announcement unintentionally exceeded its jurisdiction in estimating a possible time frame for completion of the JEDEC Next-generation Small Form Factor (NGSFF) standard. We regret the oversight."
Related Reading:
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Tag wiki description cropped
The tag wiki "excerpt" for soteriology reads:
How salvation is understood across different faiths
But the first three words are missing from the description as displayed on the Tags page:
A:
Apparently, if you include "is" in the description, it will chop that word and everything before it.
This can be seen in the bible tag, exegesis tag, jesus tag, etc.
I've changed the description to show correctly now.
|
{
"pile_set_name": "StackExchange"
}
|
Xinhua District, Shijiazhuang
Xinhua District () is one of eight districts of the prefecture-level city of Shijiazhuang, the capital of Hebei Province, North China, located in the northwest of the urban core of Shijiazhuang.
Sanlu, when it existed, had its headquarters in Xinhua.
Administrative divisions
There are 11 subdistricts, 2 towns, and 2 townships.
Subdistricts:
Gexin Subdistrict (革新街道), Xinhua Road Subdistrict (新华路街道), Ning'an Subdistrict (宁安街道), Dongjiao Subdistrict (东焦街道), Xiyuan Subdistrict (西苑街道), Hezuo Road Subdistrict (合作路街道), Lianmeng Subdistrict (联盟街道), Shigang Subdistrict (石岗街道), Wuqi Subdistrict (五七街道), Tianyuan Subdistrict (天苑街道), Beiyuan Subdistrict (北苑街道)
Towns:
Daguo (大郭镇), Zhaolingpuxi (赵陵铺西镇)
Townships:
Sanzhuang Township (三庄乡), Dubei Township (杜北乡)
References
External links
Category:County-level divisions of Hebei
Category:Shijiazhuang
|
{
"pile_set_name": "Wikipedia (en)"
}
|
1. Field of the Invention
The present invention generally relates to ricin toxin. In particular, the present invention relates to ricin vaccines, compositions and therapeutics as well as methods of making and using thereof.
2. Description of the Related Art
Ricin is a very toxic protein obtained from the castor bean, Ricinus communis, Euphorbiaceae. Ricin is a heterodimer comprising an A chain and a B chain joined by a disulfide bond. Ricin A chain (RTA) is an N-glycosidase enzyme that irreversibly damages a specific adenine base from 28S rRNA. Once the rRNA has been damaged, the cell cannot make protein and will inevitably die (cytotoxicity). As RTA exhibits this type of destructive catalytic activity, RTA is commonly referred to as a type II ribosome inactivating protein (RIP). See Lord, et al. (1991) Semin. Cell Biol. 2(1):15–22. RTA has been coupled with a targeting moiety to selectively destroy target cells such as tumor cells. See U.S. Pat. Nos. 4,980,457; 4,962,188; and 4,689,401; see also Vitetta et al. (1993) Trends Pharmacol. Sci. 14:148–154 and Ghetie & Vitetta (1994) Cancer Drug Delivery 2:191–198.
The toxic consequences of ricin are due to the biological activity of RTA. Ricin B chain (RTB) binds the toxin to cell surface receptors and then RTA is transferred inside the cell where inhibition of ribosome activity occurs. The human lethal dose of ricin toxin is about 1 μg/kg. As highly purified ricin is readily available using methods known in the art, the use of ricin toxin in biological warfare and terrorism is highly possible and probable.
Ricin toxin (RT) or Ricin communis agglutinin II (RCA 60), a glycoprotein produced by the castor bean plant, Ricin communis, is composed of two subunits, about a 30 kDa enzymatically active A subunit (RTA) and about a 32 kDa B subunit (RTB). See Lord & Roberts (1994) Faseb J. 8(2):201–208. The B-chain mediates receptor binding of the toxin to eukaryotic cells via its high affinity for galactose. See Alami & Taupiac (1997) Cell Biol. Int. 21(3): 145–150. Once internalized within the cell, the A chain causes catalytic depurination of the 28S ribosomal RNA that results in inhibition of protein synthesis. See Chen & Link (1998) Biochemistry 37(33):11605–11613. Ricin is highly toxic and can cause death when given in sufficient quantities by either systemic or inhalational routes of exposure. See Wilhelmsen & Pitt (1996) Vet. Pathol. 33(3):296–302.
Ricin is a Category B Agent on the Centers for Disease Control (CDC) Select Agent List and thus there is a strong interest in developing diagnostic tests for toxin identification in clinical and environmental samples. See Thomas, M. (2002) “Possession, use, and transfer of select agents and toxins; interim final rule.” Federal Register 240(67). In addition, because there is no vaccine for ricin and no therapeutic agents available for treatment, there is a serious need to develop prophylactic and therapeutic countermeasures for ricin intoxication.
Development of antibodies recognizing determinants on the ricin molecule may be able to address several of these needs. Not only can antibodies be used for diagnostic reagents, but they can also neutralize the toxin by either preventing binding to cells or inhibiting enzymatic activity. There is evidence to suggest that antibodies can protect against ricin intoxication as animals were protected from lethality by administration of polyclonal antibody prior to exposure to ricin. See Hewetson & Rivera (1993) Vaccine 11(7):743–746; and Houston (1982) J. Clin. Toxicol. 19(4):385–9. Anti-ricin IgG has also been shown to protect against inhalational challenge in animals, demonstrating the feasibility of using antibody to protect against this route of exposure as well. See Griffiths & Lindsay (1995) Hum. Exp. Toxicol. 14(2):155–164; and Poli & Rivera (1996) Toxicon. 34(9):1037–1044.
Although polyclonal antibody can be used for these purposes, monoclonal antibodies offer several potential advantages, including consistency and reproducibility of product and the ability to humanize the antibody molecule to reduce adverse reactions caused such as serum sickness when animal antibodies are used therapeutically. Several monoclonal antibodies (Mab) previously developed have been shown to confer protection against ricin intoxication in vitro. See Colombatti & Johnson (1987) J. Immunol. 138(10):3339–33344; Colombatti & Pezzini (1986) Hybridoma 5(1):9–19; and Columbatti (1997) Personal communication to M. Dertzbaugh. However these Mabs were lost several years ago and to date only one Mab that still exists which has been shown to protect against ricin intoxication in vivo and this Mab is directed towards the A chain of the holotoxin. See Lemley & Amanatides (1994) Hybridoma 13(5):417–421.
Thus, a need exists for Mabs against ricin toxin.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Developmental competence of bovine oocytes after specific inhibition of MPF kinase activity: effect of estradiol supplementation and follicle size.
In the bovine, the concentration of 17beta-estradiol (E2) in the follicular fluid of the dominant follicle is high, indicating a possible role of E2 on the cytoplasmic maturation that occurs before the LH surge. The aim of this study was to investigate the role of E2 on the developmental competence of bovine oocytes originating from different sized follicles and temporarily maintained at the germinal vesicle stage with roscovitine (ROS). First, the efficiency of ROS to inhibit germinal vesicle breakdown (GVBD) in oocytes harvested from small (3-4 mm diameter) and medium (5-8 mm diameter) sized follicles was demonstrated. Next, the effect of E2 during temporary inhibition of GVBD by ROS on the subsequent nuclear maturation was evaluated. Oocytes from small and medium sized follicles were cultured in the presence of ROS, FSH and with or without E2 for 24 h. After this period, oocytes were cultured for another 24 h with FSH but without ROS and E2, after which the nuclear stages and the developmental competence of oocytes were assessed. In conclusion, it is demonstrated that exposure to E2, during temporary inhibition of the GVBD with ROS, affected neither nuclear nor cytoplasmic maturation of oocytes originating from small and medium sized follicles. It might be that in vivo, the increase of E2 during follicle growth is more related to selection of the dominant follicle than to the cytoplamsic maturation of the oocyte as such.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Company to establish a new cloud service
Sony has announced the acquisition of cloud gaming firm Gaikai.
The deal was concluded on June 30 for $380 million. Sony will now "establish a cloud service and expand its network business by taking full advantage of Gaikai's revolutionary technology and infrastructure including data centers servicing dozens of countries and key partners around the world."
While he didn't give any specifics as to what kind of services the purchase could spark, president of Sony Computer Entertainment Andrew House teased:
"By combining Gaikai’s resources including its technological strength and engineering talent with SCE’s extensive game platform knowledge and experience, SCE will provide users with unparalleled cloud entertainment experiences. SCE will deliver a world-class cloud-streaming service that allows users to instantly enjoy a broad array of content ranging from immersive core games with rich graphics to casual content anytime, anywhere on a variety of internet-connected devices.”
Gaikai CEO David Perry had denied a recent buyout of his firm, but, with the deal by Sony now finally announced, he said:
"SCE has built an incredible brand with PlayStation and has earned the respect of countless millions of gamers worldwide. We’re honored to be able to help SCE rapidly harness the power of the interactive cloud and to continue to grow their ecosystem, to empower developers with new capabilities, to dramatically improve the reach of exciting content and to bring breathtaking new experiences to users worldwide."
Before E3, it was heavily speculated that Sony would confirm their buyout of Gaikai. The online cloud gaming company were rumored to be bringing back backward compatibility for the PlayStation 2 back to the newer (slimline) PlayStation 3 models.
With Microsoft apparently open to an acquisition of Gaikai's direct competitor OnLive for the Xbox 720, it'll be intriguing to see what Sony does in regards to implementing the former into the PlayStation 4. As for the PlayStation 3, expect integration with the PlayStation Network and perhaps even the PlayStation Vita.
|
{
"pile_set_name": "OpenWebText2"
}
|
For Admin
Posts Tagged ‘hindi vowels’
For students interested in scheduling a 1:many on-line/in-person classes .
Small Class Size: 6 students per class.
Duration: Basic Conversational course is for 12 weeks consisting of 1.5hr. on-line learning as well as H.W and quizzes for students to work on during the week.
Intermediate Conversational course is for 14 weeks consisting of 1.5 hr. on-line learning as well as H.W and quizzes for students to work on during the week.
When: Each session starts after receiving 6 requests. e-mail me and I will let you know approx. when your group starts.
Time: I schedule classes at mutually convenient time for my students. On-line classes are mostly held Friday and Sunday evenings between 6.00 and 10.00pm. Few weekday evening classes are also available.
Price: You get 18 hrs. of teaching with H.W and quizzes with each class to hone your newly learnt conversational skills as well as to practice new vocabulary. Price $200 for 12 week course. This is promotional New Year price.
|
{
"pile_set_name": "Pile-CC"
}
|
Canal + propose ce soir une soirée spéciale Karim Benzema. L'attaquant du Real Madrid sera l'invité en direct du « Canal Football Club » à 19 h 10 avant la diffusion à 21 heures d'un long documentaire d'une durée de deux heures consacré à celui qui est désormais le 7e buteur de toute l'histoire des Merengue.
LIRE AUSSI
« Le K Benzema » raconte le Karim Benzema que le grand public ne connaît pas forcément. Grâce aux témoignages, entre autres, de Zidane, Cristiano Ronaldo, Ancelotti, du rappeur Booba, de son agent ou encore de son père, le film bascule sans cesse entre le Benzema footballeur et le Karim intime. Chez lui à Madrid ou à Bron, dans la banlieue de Lyon, où il a grandi, le joueur se livre sans retenue. Dans sa voix, on entend alors un garçon libéré, décontracté, heureux de donner sa version des faits.
«Le K Benzema» : «Des petits jeunes de quartier qui gagnent des millions...»
L'épisode de la sex-tape, aussi, occupe une large partie du documentaire et revient sur la drôle d'enquête menée par certains policiers (toute la procédure est en passe d'être annulée par la justice). A propos de son ex-partenaire en bleu Mathieu Valbuena, qui a refusé de s'exprimer face caméra, tout comme Noël Le Graët, le président de la Fédération française, Benzema dit : « Il est tombé sur la tête. »
|
{
"pile_set_name": "OpenWebText2"
}
|
An outbreak of leptospirosis on a single farm in east Otago.
To present an outbreak of leptospirosis on a dairy farm which had an unvaccinated herd. Nine people working or living on the farm were tested for the presence of leptospira antibody by the microscopic agglutination test. Nineteen cows randomly selected, were also tested. Three human cases and one suspected case were detected over a one month period (December 1992-January 1993). Seventy-nine percent of the dairy herd tested had serological evidence of infection with L hardjo. Leptospirosis continues to be a major occupational problem in New Zealand. The importance of herd vaccination and the use of protective clothing during milking is emphasised.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Michael Keane is reportedly a summer transfer target for Liverpool and Manchester United
Would Burnley defender Michael Keane be a good fit for Liverpool? Jamie Carragher and Gary Neville have their say…
The question was posed on the Monday Night Football Twitter Q&A following Chelsea's 3-0 win over Middlesbrough.
Recent reports in the English media have claimed Liverpool and Manchester United want to sign Keane this summer.
Former Reds defender Carragher said he rates the England international but is unsure he's worth the reported £25m price tag.
"I like him, I think he's had a really good season," Carra told Sky Sports. "It's a big jump to go from Burnley to Liverpool and a completely different way of playing.
Jamie Carragher and Gary Neville answer your Twitter questions on Monday Night Football Jamie Carragher and Gary Neville answer your Twitter questions on Monday Night Football
"That 4-4-2 at Burnley, it's a lot of protection, and maybe a similar thing to what we're seeing with Mamadou Sakho at Crystal Palace.
"He looks a completely different player there but he's playing a completely different game.
"Jurgen Klopp was talking about centre-backs at top clubs a couple of weeks ago. The questions asked of you are completely different.
"If you are going to buy Michael Keane, it's going to be £25m. He's a young English player.
"Is he better than Lovren and Matip? He's maybe the same level.
"If you're spending £25m on a centre-back he has to go straight in your team and make a massive difference. I don't think he is quite at that level to come in and make a massive difference."
Carragher then brought in Neville, who played at Manchester United when Keane was at the club's academy.
Speaking to Neville, Carra added: "You know he has been at Manchester United, maybe he has come on in terms of being on the ball at the back, being left exposed.
Paul Pogba of Manchester United (L) and Michael Keane of Burnley (R) battle for possession
"I'm still yet to see that because he's been at Burnley. I always think it's a big jump to go from a team at the bottom to a team at the top."
And Neville said: "I agree. He gets cuddled at Burnley. The two full-backs come tight, it's a tight midfield four, very compact, so you very rarely get exposed.
"I think that goal he conceded against Lukaku, I wouldn't expect him to make that kind of mistake. But he's still young. To make his England debut is a great achievement.
Keane made his England debut this season
"He's a great type, a great lad. He will be the type that's a student. He will watch videos of himself in the week, he will want feedback, he will look after himself, he will be professional. Everything you want from a football player.
"Liverpool need that defence sorting out. They have conceded 50-plus goals for three, four, five years.
"They have not had a defensive lynchpin since he [Carra] retired. They have been changing around centre-back pairings and never really had a settled duo. It's not right."
Sky Customers can now upgrade to Sky Sports for the Premier League run-in and an unmissable summer of sport. Upgrade now!
|
{
"pile_set_name": "OpenWebText2"
}
|
Mattie Miracle Cancer Foundation Promotional Video
Thank you for keeping Mattie's memory alive!
Dear Mattie Blog Readers,
It means a great deal to us that you take the time to write to us and to share your thoughts, feelings, and reflections on Mattie's battle and death. Your messages are very meaningful to us and help support us through very challenging times. To you we are forever grateful. As my readers know, I promised to write the blog for a year after Mattie's death, which would mean that I could technically stop writing on September 9, 2010. However, at the moment, I feel like our journey with grief still needs to be processed and fortunately I have a willing support network still committed to reading. Therefore, the blog continues on. If I should find the need to stop writing, I assure you I will give you advanced notice. In the mean time, thank you for reading, thank you for having the courage to share this journey with us, and most importantly thank you for keeping Mattie's memory alive.
As Mattie would say, Ooga Booga (meaning, I LOVE YOU)! Vicki and Peter
The Mattie Miracle Cancer Foundation celebrates its 7th anniversary!
The Mattie Miracle Cancer Foundationwas created in the honor of Mattie.
We are a 501(c)(3) Public Charity. We are dedicated to increasing childhood cancer awareness, education, advocacy, research and psychosocial support services to children, their families and medical personnel. Children and their families will be supported throughout the cancer treatment journey, to ensure access to quality psychosocial and mental health care, and to enable children to cope with cancer so they can lead happy and productive lives. Please visit the website at: www.mattiemiracle.com and take some time to explore the site.
We have only gotten this far because of people like yourself, who have supported us through thick and thin. So thank you for your continued support and caring, and remember:
.... Let's Make the Miracle Happen and Stomp Out Childhood Cancer!
A Remembrance Video of Mattie
Random Shots of Mattie, Family and Friends
August 26, 2016
Friday, August 26, 2016Tonight's picture was taken in August of 2004. We took Mattie to an outdoor fair in Los Angeles. Literally several streets were closed down and all sorts of child friendly activities were taking place from pony rides to miniature trains. Mattie did both that day and had a great time.... as was evident with the smile and excitement captured in this photo!Quote of the day: To know how to say what others only know how to think is what makes men poets or sages; and to dare to say what others only dare to think makes men martyrs or reformers - or both. ~ Elizabeth CharlesAs a child, I can recall my maternal grandmother watching Days of Our Lives, the soap opera, while ironing clothes! Though I could hear it, it meant nothing to me until I entered high school and started watching it myself. Not unlike most things, there were years I tuned into the program and then several years when life took over and I tuned out. Yet, as a Days of Our Lives fan, and having history with the show, it is quite easy to pick it back up even if it is years later. While raising Mattie, I never watched the show. It was only recently that I tuned back in and of course was immediately glued and absorbed back into the lives of the Bradys, Hortons, and DiMeras! These are families in a way that I feel I have grown up with. One thing I have to say is that Days is a wonderful diversion for me and when I watch it I forget about my own issues and worries for the day. So I consider it my mental health break from reality! Days of Our Lives is one of the longest-running scripted television programs in the world, airing nearly every weekday since November 8, 1965. Due to the series' success, it was expanded from 30 minutes to 60 minutes on April 21, 1975. The series focuses on its core families, the Hortons and the Bradys. Several other families have been added to the cast, and many of them still appear on the show. Frances Reid, the matriarch of the series' Horton family remained with the show from its inception to her death on February 3, 2010 (at 96 years of age!). Susan Seaforth Hayes is the only cast member to appear on Days of Our Lives in all five decades it has been on air. Days of Our Lives has been able to celebrate its 50th anniversary, because it typically covers cutting edge issues that so many of us can relate to.
My mom and I entered a clothing store to browse around today and as we were entering the store, I saw a woman who looked familiar to me leaving the store. We literally passed each other. As she began to get closer to me, I knew immediate who it was.... Susan Seaforth Hayes, who plays Julie Williams for over 40 years on Days of Our Lives.
Naturally I could have let her just walk by. But I didn't. I actually smiled at her, which caught her attention and then I said "hi." But I said it in a way that my mom assumed I knew her. Then I started chatting with her, and my mom was further perplexed because she did not recognize in any context the woman I was talking to! Then I explained to my mom that Ms. Hayes is on Days of Our Lives. Pictured here are Susan and her husband Bill. They are married in real life and on the set of Days of Our Lives.
I am sure Ms. Hayes is used to people approaching her because soap opera fans are passionate and intense about their shows. But I think what intrigued me is I felt like I knew her, and talked to her as such. Yet naturally I don't know her! I only know the character she plays, but since she has played it for almost 40 years, I wonder if there is a distinction?!
This was Susan Seaforth Hayes and her husband Bill Hayes on Days of Our Lives in 1973, when they got married. Imagine working on the set of Days of Our Lives for over 40 years? The ironic part to me is people age on the set but the magic captured in their character is timeless. Ms. Hayes is 73 years old, her husband is 91 years old, and Frances Reid (the Horton family matriarch) played on the show up until age 96! Totally impressive, which is why I feel the show appeals to a wide demographic.
August 25, 2016
Thursday, August 25, 2016Tonight's picture was taken in August of 2004. We took Mattie to Los Angeles and on our adventures we went to Griffith Park. Another Mattie favorite. The irony is I went to high school in Los Angeles and passed Griffith Park all the time, but never ventured in, until we had Mattie. Mattie loved the pony rides, the carousel, and of course the train rides! I can't tell you how many times we all rode this miniature train!Quote of the day: It is not necessarily the size of the dog in the fight - it's the size of the fight in the dog. ~ Dwight D. Eisenhower
Today my parents and I went out to lunch together. While dining at the restaurant, this is the scene I saw outside the window. For the entire time we were at the restaurant Warner Bros was shooting a scene from their new Lethal Weapon movie. Movies seem glamourous, however, the entire time we were at the restaurant they filmed the same scene OVER and OVER again. It was literally just extras walking down the street, for hours. Same people, doing the same motion.
In a way it felt like we were also on set for this movie, since we could see the camera man, the lighting folks, the person directing the scene and so forth.
After lunch, MIND YOU THEY WERE STILL AT IT, I decided to take close up photos of this scene. Notice two of the extras.... one was smiling at me and the other waving. Which was down right hysterical because I watched both of them walking up and down the street over the course of our entire lunch! But they were good sports! The lady in the blue shirt, seemed to be the lead extra... notice her silvery shoes which don't seem to go with the rest of her outfit!
They were also filming inside this clothing store. The store's real name is Rosemary and Sage. Yet while filming, they changed the window on the front door to a different name altogether! The real store was closed for the day so filming could take place! Things are never boring in Southern California, especially when you are so close to major movie studios.
Later on in the afternoon, my mom and I went on a 3.5 mile walk. Along the way, I found "Miss Puss." She was in someone's front yard and she came trotting on over to greet us. I clearly have an LA friend!
Along our journey today, we saw a sign up by a realtor's office for the famous Bob and Delores Hope Estate. Bob Hope made Toluca Lake famous and I was stunned to see that after 13 years since his death, his home is now on the market. The house is 15,000 square feet, on 5.2 acres of land, with an indoor and outdoor pool, and has its own putting green. The house is on the market for $22 million. I really wish there was an open house to tour this 1930s classic. To see a video tour go to..............https://www.youtube.com/watch?v=ly62SgZZ_Mc
August 24, 2016
Wednesday, August 24, 2016Tonight's picture was taken in August of 2004. We took Mattie to Travel Town, one of his favorite places to visit in Los Angeles. Why? Because it was a museum filled with trains that children could climb, run around in, blow their whistles, play with gears and walk on the tracks. A real find for anyone enamored with trains. LIKE MATTIE! Notice what else came along for the trip... Mr. Sippy Cup! That cup came everywhere, as Mattie loved drinking milk. I always had a cooler bag with me, so when sippy cup was needed..... there it was. Our joke was Mattie was going to have the strongest bones around..... we never imagined it would be possible for him to instead develop bone cancer. Quote of the day: Every great work, every big achievement, has been brought into manifestation through holding to the vision, and often just before the big achievement, comes apparent failure and discouragement. ~ Florence Scovel Shinn
In 2013, Animal Planet aired a TV program called, "A Wild Affair" featuring the only sign language trained orangutan in the world named Chantex. Chantex (which means lovely and beautiful) was born December 17, 1977, at the Yerkes Regional Primate Research Center in Atlanta, Georgia. He mastered the use of a number of intellectual skills, including sign language, and was taught by American anthropologists Lyn Miles and Ann Southcombe. My parents and I happened to watch this documentary last night. It is definitely worth seeing and truly as you are watching this you are fascinated by Chantex's bright and sensitive nature. Dr. Miles hypothesis was that nurture in a way could supersede nature. Meaning that if you raised an orangutan with humans, he would develop human communication patterns and also live life more like a human child than an ape. Remember this was the 1970s, a time where social science research was fascinated with communication, how humans communicate with each other, language acquisition skills and identifying critical periods during which humans learn to understand and use language. All great, but what was lacking in 1970s research was the ethical implications of conducting such studies on the lives of human/animal subjects. In Chantex's situation, Dr. Miles didn't consider the long term ramifications on Chantex. After all, an ape of this size couldn't possibly live with humans all his life, and yet, how do you transition such an animal back into the wild after teaching him sign language and raising him with humans? Complex questions that would need to be evaluated today before any institutional review board would allow such a study! Yet in all fairness to Dr. Miles, such review boards did not exist back then.
Chantek is now 36-year-old and lives at the Zoo Atlanta since 1997. In the years prior to his arrival at Zoo Atlanta, Chantek had a very unconventional upbringing in that he was reared by humans in a human setting (pictured with Dr. Miles). As part of a language research project, he was taught American Sign Language (ASL) as a juvenile. Chantex lived with Dr. Miles for almost 9 years and then after several incidents (breaking out of his home, scaring students, destruction of property) living on a college campus in Tennessee, the university insisted that the research stop and Chantex be sent back to Yerkes Regional Primate Research Center in Atlanta, Georgia. Chantex was there for 11 years, locked in a cage and dealing with depression and other issues. Imagine living freely and amongst humans, to then living in cage and isolated.
Chantek has a vocabulary of over 150 modified ESL signs, and he also understands spoken English. Chantek makes and uses tools and even understands the concepts of money and work-exchange. While at the University of Tennessee, he possessed the spatial comprehension to direct a driving-route from the university to the closest Dairy Queen, and the mental comprehension to refer to events that happened years ago. He enjoys creative projects and makes paintings, necklaces, crafts and music. The photo shows Chantex with Ann, purchasing a cheeseburger at a local drive thru.
Chantex growing up and playing at the University of Tennessee. He quickly understood that if he complied with chores, he got positive feedback and rewards such as play time and all sorts of tasty treats.
Chantex grew to be 500 pounds when he was transferred to the Atlanta Zoo. No surprise since he had been eating people food consisting of ice cream, candy, soda, and so forth! As a result of living at the zoo and eating a more orangutan friendly diet, he is now 295 pounds.
I honestly think that Dr. Miles was heart broken that her research came to an end. She literally was bonded with Chantex and treated almost like her child. She still visits him today at the zoo and through his cage communicates to him by signing. This is a very deeply meaningful documentary that leaves you with many thoughts, feelings, and questions. I naturally view this from a 2016 lens, but need to remember how cutting edge research this was for the 1970s, and despite the challenges Chantex faced, I do believe Dr. Miles really loves Chantex and wants what is best for him and his life.To me this bond she had with Chantex was almost as fascinating as her language research!
Tuesday, August 23, 2016 -- Mattie died 362 weeks ago today.Tonight's picture was taken in August of 2004. We took Mattie to another favorite place that he liked to visit.... Travel Town. Travel Town is located in Griffith Park, in Burbank, CA. The beauty of this park is it is a museum that has historic trains of the West. Yet it is a very child friendly museum because kids can walk the tracks, climb on the trains, ring the bells, and so forth. This was right up Mattie's alley since he loved trains. Quote of the day: No great thing is created suddenly. ~ Epictetus
We drove today to Santa Ana, to see an exhibit at the Bowers Museum. A museum we have never visited before. In theory it should take under an hour to get to the museum, however, with traffic it took about 90 minutes each way. But the drive to the museum was a total adventure. I plugged in the address to our GPS, but given the fact that we were directed onto six different freeways along the journey, I was worried and concluded that something was wrong. It definitely looked wrong. So I had my mom call Peter..... all the way in DC to help us. I am sure that sounds hysterical to most people, but Peter is VERY used to my "I'm lost" phone calls over the years, that it probably doesn't faze him anymore. In any case, within minutes Peter deduced where we were, and told us that we were on the right track and almost there. We concluded that the GPS rerouted us to avoid traffic on the main freeway, however, I can assure you that when we saw the museum and got out of the car, it felt like we won the lottery. If you haven't driven freeways in Southern California, then it is hard to describe. But they are six lanes typically and traffic moves FAST. You have to have your wits about you and know where you are going, because there is no wiggly room to make decisions.
A photo of my parents outside the entrance to the Bowers Museum!"Mummies of the World" highlight the stories of the people behind the mummies through scientific methods used to study mummies, including Computed Tomography (CT), ancient DNA analysis and radiocarbon dating, all of which allow researchers to learn about the lives, history, and cultures of the mummies. Who were they? Where did they come from? And what can they teach us?
Mummies of the World portrays a once-in-a-lifetime collection of real mummies and artifacts from across the globe. This compelling collection, presented with reverence and dignity, includes ancient mummies dating back as far as 4,500 years. A fascinating mix of old and new, this captivating collection bridges the gap between past and present with contributions from 10 world-renowned Institutions and two private collectors.
Security detail when the mummies were transported to the Bowers Museum.
Because of the nature of this exhibit, each of the rooms was dark and quiet. Not unlike entering a church, or a library. People were quiet and reserved. After all we were reminded that the objects on display were REAL PEOPLE, who had REAL LIVES. When you go to a cemetery, you aren't running around and conversing. Well the same behavior occurs at this exhibit! For the most part, people were quiet and on good behavior. But there was a somber feeling about walking through these catacomb like rooms. The Museum personnel reminded attendees that when they produced this exhibition, they were very careful to be very respectful and deferential to the cultures in which these mummies (and) artifacts originate.
One that stands (or lies) apart from the rest is MUMAB. His name stands for Mummy of the University of Maryland at Baltimore and he’s only been a mummy for 22 years.In 1994, two researchers, Egyptologist Bob Brier and anatomist Ronn Wade, recreated ancient Egyptian mummification techniques at the University of Maryland, Baltimore to preserve the remains of a man who donated his body to science.
They made replicas of ancient tools and even gatheredkey ingredients from Egypt to make the process as close as possible to original practice.Did ancient Egyptians drain blood from the bodies? Brier has studied many Egyptian mummies but hasn’t seen major incisions over arteries that would be used to drain the blood. What about the brain? Any kid can tell you ancient Egyptians used a hook to pull it through the nose, but Brier and Wade found out how it was likely done. “I realized the only way I’m going to answer these questions is I’m going to mummify a cadaver in the ancient way.” The ancient Egyptians never recorded the details of the process, Brier said. “That was kind of a trade secret.”
The process of mummification took about a day, but the legwork took a year. Brier traveled to Egypt for 600 pounds of natron from Wadi Natrun, the same place ancient Egyptians got their natron to preserve bodies. Natron is a naturally occuring compound of what we know as table salt and baking soda. Getting untreated linen, used to wrap the body, in today’s markets was a challenge, but Brier found some in Ireland. As for the draining of the blood, Brier said he and Wade opted not to do that. Instead, putting the body in natron was enough to dry it out, and shrink its weight from 180 pounds to 35.
Johannes Vac, from Hungary. Thought to have died at age one from Tuberculosis. Because infectious diseases may evolve over time, scientists do not know whether strains of tuberculosis or TB from the past (including those appearing in Europe when it was most deadly) are related to the strains we see today. A new study suggests mixed and therefore more dangerous infections may have been common during a time when TB was near peak prevalence in Europe. Mummified bodies found in an 18th century crypt in Hungary yielded 14 separate genomic sequences of M. tuberculosis. By studying mummies, scientists can study tuberculosis in more depth and also understand if some people were immune to developing tuberculosis, and if so, whether such a gene can be scientifically engineered.
Also in this exhibit were accounts of children being sacrificed in the name of their religion. I try not to put my lens on this, but the senseless death of a child, was heard to swallow. In any case, under biochemical analysis, the children's hair yield a record of what they ate and drank during the last two years of their lives. This evidence seems to support historical accounts of a few selected children taking part in a year of sacred ceremonies—marked in their hair by changes in food, coca, and alcohol consumption—that would ultimately lead to their sacrifice. In Inca religious ideology, coca and alcohol could induce altered states associated with the sacred. But the substances likely played a more pragmatic role as well, disorienting and sedating the young victims on the high mountainside to make them more accepting of their own grim fates.
An Egyptian priest named Nes-Hor, who was determined to have arthritis and a broken left hip.
A beloved cat, mummified to accompany his owner to the next world. The process used on people was just as meticulous for pets.
August 22, 2016
Monday, August 22, 2016Tonight's picture was taken in August of 2004. We took Mattie to the arboretum in Arcadia, CA that day. This was one of Mattie's favorite places to go for many reasons. First Mattie thrived in big outdoor spaces, and second Mattie loved all the wildlife at the park. Especially the peacocks. Peacocks roam freely at the park and Mattie got a kick out of watching them walk, fly into the trees, and of course the dance they used to do when fluffing out their tail feathers. Quote of the day: Victory belongs to the most persevering. ~ Napoleon Bonaparte
Some times I search through Google to see what turns up regarding Mattie Miracle. I do this for multiple reasons. For example, I want to make sure no one is posting things representing the Foundation without our permission and at other times I am just searching to see different photos of Mattie. Like taking a walk down memory lane. Naturally I have these photos on my computer, but it is special to see them on line. I found this series of photos taken by the Washington Post. These photos were taken shortly after Mattie died. As you can see this photo featured some of Mattie's Lego creations. Legos were very important to us because they served as our main form of therapy while Mattie was battling cancer. The ironic part about this is all of these Lego structures remain assembled and on display in our living room.
I am so glad the newspaper captured some of the chaos we were living in. Our home honestly looked like an episode of Hoarders. Not something I was proud of, given that prior to cancer I kept things neat and organized. Yet Mattie was given many gifts of all sorts while battling cancer. Some were handed directly to him and others were mailed to him. Not WEEKLY, but daily. Imagine taking in MANY things each and year day for over a year and NOT having the time to organize it or remove certain items to make room for the new ones. The intake was greater than I knew how to process and naturally given that Mattie was so ill, clean up was NOT important. As a results, there were PILES, upon PILES everywhere in our home. Mattie's room became UNUSABLE after he died because there was stuff everywhere. You couldn't see the floor! It took me a long time to contend with this hoard of items. Let's try years!
From this angle, you can see how high some of the piles were. I neither had the energy or the where with all to contend with any of Mattie's things. Therefore they just sat undisturbed for years. As if I was waiting for him to return to use them. My brain just couldn't process he wasn't coming back.
Then in 2013, only three years ago, I started slowly cleaning out the room (this is what it began to look like once cleaned). I just felt as if I had to because the room wasn't representing Mattie's memory well. If I had a huge home, I honestly think I would have left things like they were probably indefinitely. But given our limited space, I felt that I had to deal with this room, the piles and hoard every where, and finally transform the space back to being useable and a space that honored Mattie. I can assure you that this process was very painful, labor intensive, and I did it alone. People were not lining up at my doorstep to help with this! Not like after the first year after Mattie died. That first year is hard, but frankly you are too numb and in a daze to know what is really happening. It is all the years after the first where emotional support is greatly needed.
Literally as I was cleaning out Mattie's room, the number of garbage bags just piled up. That Fall I donated over 60 garbage bags full of items to Goodwill.
Once the room was cleaned out, Peter and I began painting Mattie's room. We transformed it from an ivory color to a sunny orangey peach color. In line with Mattie Miracle colors, because Mattie's room was being transformed into my Foundation office.
At one time, Mattie had books on these shelves. I donated many of Mattie's books, except for his very favorite ones. Then I got bins for each of his shelves and now use them to store Foundation paperwork and of course to highlight Mattie's artistic creations.
In December 2015, the Washington Post came back into our home to interview us. The room LOOKED very different from the hoard they saw years before. Now the room is filled with all sorts of visual memories of Mattie.
I found this photo through Google tonight. It features many of the items from our VERY first Foundation Walk in May of 2010. The beautiful cards in the upper left hand corner feature Mattie's Mr. Sun painting on the cover. I still have some of these cards and LOVE them. Mattie created his Mr. Sun painting with his art teacher in school. This painting served as our model for our Foundation's logo.
Our teenager friend (at the time), Isabel, made these wonderful Foundation magnets for us and she sold them at our Walk and gave us 100% of the proceeds.
T-shirts from our Walks through the years. This is when we used to have themed walks..... Love of Family, Faces of Hope, etc.
I found this photo on Google tonight and it featured Mattie Miracle's Whole Foods Day in Alexandria. I will never forget that day in 2012 because so many of our supporters came to visit us and the store gave Mattie Miracle 5% of all sale proceeds that day!
Sunday, August 21, 2016Tonight's picture was taken in March of 2008. My parents and I took Mattie to the LA Arboretum and you can see Mattie selected this beautiful yellow tree to pose by. I haven't seen this photo in a very long time, but when I see it, it makes me smile. I am so glad I recently found it.
Quote of the day: If the cat sits long enough at the hole, it will catch the mouse. ~ Irish Proverb
My mom and I took a walk today through Toluca Lake. The history of Toluca Lake can be traced back to the days of the Tongva Indians, followed by Spanish and Mexican occupation and development. It was part of the early rancho system and then it was later divided, with the neighborhood being known as Forman Toluca Ranch. After an almost four mile walk through this historic and beautiful neighborhood, we came across an open house. So we ventured into this 7,000 square foot beauty. I honestly never knew this was Henry Winkler's home in the 1980s, until I did a little research. But this 1938 house was like taking a walk through time (and I am so happy the integrity and charm of this house hasn't been gutted out and modernized)! I should note that this house is selling for 8 million dollars!A Virtual Tour of this house:http://9956tolucalake.aaroe.site/#/
This house was designed by Paul Williams, a famous architect who was known to be the architect of the Hollywood stars! Like many of Williams' residences, this 1938 Tudor revival has a celebrity-studded history. His homes captivated the entertainment elite starting in the late 1920s and have come to signify glamorous Southern California to the world.
The estate was built for American screenwriter Gladys Lehman, one of the founders of both the Screenwriters Guild and the Motion Picture Relief Fund. It was featured in Architectural Digest twice, in 1937 and again in 1982 when it was owned by actor Henry Winkler. It also appears in Paul R. Williams: Classic Hollywood Style, a book by the architect's granddaughter, Karen E. Hudson (Rizzoli, 2012). It is one of Hudson's favorites among her grandfather's homes.
Among its regal spaces are a formal entry, a majestic paneled library with beamed ceiling, a wine cellar, and a dramatic coffered-ceilinged office with a wraparound view of the lake and pool area. The sleekly modern kitchen supports entertaining on any scale.
A curving staircase, a Williams signature, leads to the second-story master suite, featuring a private balcony and a raised seating area with fireplace. A fountain and outdoor fireplace add to the enchanting ambience of the expansive covered brick patio. Highlights on the grounds include a gazebo, a canopied private area with built-in seating nook and fireplace, and a private dock.
Pool
Backyard over looking the lake
The beauty of Toluca Lake
View from backyard
Toluca Lake--- private natural lake which is fed by the Los Angeles River and maintained by neighboring property owners.
Number of Visitors Since October 12th, 2008
The Mattie Miracle Logo!!
Contact Information
GuideStar PLATINUM
We're On Amazon Smiles!
Mattie Passed Away
With heavy hearts, Peter and I said goodbye to our precious Mattie when he died on September 8, 2009 at 7:15am. He fought death for five hours, but after being given propofol, he finally fell into a deep sleep. My hunch is he did not want to say good-bye to Peter and I, and it took massive amounts of drugs to end his suffering.
Mattie in Summary
Diagnosis timetable: July 23, 2008 - tumor in the right humerus; August 1, 2008 - tumor in the left humerus; August 6, 2008 - tumors in the right femur and left radius. On August 6, Mattie was officially diagnosed with Multifocal Synchronous Osteosarcoma.Tumor Resection and Limb salvage surgeries (repiphysis): on October 20, 2008 and November 12, 2008.Percentage of Necrosis: 60% in right humerus; 80% in left humerus; 100% in left radius; 2% in right femur.Chemo began on August 8, 2008: High Dose Methotrexate, Cisplatin, Doxorubicin; Ifosfamide, and Etoposide were added to the treatment protocol on December 1, 2008; MTP-PE was added to the treatment protocol on January 12, 2009.Chest CT scans post surgery:December 5, 2008 – four 3mm lung lesions; January 8, 2009 – CT scans reveal no change in the lung lesions; March 19, 2009 - CT scans reveal slight changes in two of the lesions. With potential increases in size of up to 1-2 mm per lesion. On June 5, 2009, CT scans at 1.5mm cuts (so very refined cuts) revealed that Mattie's lung lesions doubled in size since January. The four lesions are now 8-9mm in size, indicating that Chemotherapy is not working.Median Sternotomy: June 15th, 2009, removed 9 lesions, four in the left lung and five in the right lung. We do know that two of the lesions had calcified indicating bone material was present. This confirms that the bone cancer has metastasized to the lungs and that Mattie's chemotherapy was not effective at fighting the cancer in his lungs.PET Scan: There appears to be a possible variant (i.e something abnormal) in the lower left femur, but as of now it is too small to determine what it really is. Normally, one would biopsy this, but the location is difficult as it involves the growth plate, and with lung surgery imminent, and Mattie just being off of chemo, the advice we're getting is to wait and watch, and to see what it looks like during the next scan.Echocardiogram: Mattie has a reduced LVEF (Left Ventricle Ejection Fraction), which in layman terms means that his heart is not pumping with its normal level of pressure. Although it is not at a dangerous level, the doctors do want to monitor it with a follow-up echo in a few months to determine if this is a temporary impairment or if long term damage has been done.
Washington Post Article on The Mattie Miracle Cancer Foundation!!
An article on Vicki and Pete and the Mattie Miracle Cancer Foundation ran on July 24, 2010, in the Washington Post's Metro section.
Many thanks to Post Reporter Rick Rojas, for doing a great story on us! To read the article on the Post's website, click HERE
Washington Post Article on Reach the Day and Mattie's Blog
In the July 2nd, 2009 edition of the Washington Post, our story and our blog were briefly mentioned in an article regarding CureSearch's Reach The Day event, held June 22-23, 2009 on Capitol Hill.
Click HERE for a link to read the article on the Washington Post's web site.
H.R. 2109: CHILDHOOD CANCER SURVIVORSHIP RESEACH AND QUALITY OF LIFE ACT OF 2009
This video highlights some advocacy efforts to provide more effective drugs for childhood cancer patients and access to better care for survivors. This link also provides information on how to contact your representatives to urge them to support this bill.http://www.youtube.com/watch?v=fQY8vxO_quU
Mattie's Channel 9 Story
To watch the YouTube version of Mattie's video, click Mattie's News Story
or
to Read the actual story on the 9NewsNow site, click HERE
Mattie's Situation
Mattie Had Bone CancerMattie had a bone cancer called Osteosarcoma. The diagnosis was: multi-focal, synchronous osteosarcoma. He had four tumors in his extremities: the upper portions of the right and left Humerus, which is the bone that connects the shoulder to the two lower arm bones (the radius and ulna), the lower (distal) left radius (right near the wrist) and the lower (distal) right femur (just above the knee joint). Although commonly found in adults, this type of bone cancer is very, very rare when found in six year old children. Mattie started chemotherapy on Thursday, August 7, 2008, consisting of several five week cycles containing five types of drugs (Doxorubicin, Cisplatin, high dose Methotrexate, Ifosfamide and Etopicide). After the second cycle Mattie underwent a surgery (Oct. 20) to remove the tumor in his right humerus, and then a second surgery (Nov. 12) to remove the other three tumors. Mattie had three prostheses (both arms and the leg) that use the Repiphysis technology. We also tried an experimental drug called L-MTP-PE in the effort to give Mattie the best fighting chance of survival. It's a shame it wasn't enough.
All of our Family and Friends have done so many wonderful and amazing things for us to help Mattie. For that we are forever grateful. We want you all to know that we cannot thank you enough for these things and your selfless acts of kindness. We cannot adequately express how much your love, caring and devoted attention to Mattie meant to us. God Bless each and every one of you.
We made a deal from the beginning with Mattie to never lie to him about his situation, and we talked him through each step of the way. Mattie knew he had "some bad bugs" in some of his bones, and he knew that the drugs he was given were to kill the bugs, and the surgeries were meant to remove the bugs from his body. Mattie even requested from Dr. Bob Henshaw (who performed the surgery) "to let me keep a bone" once the procedures were over. Mattie did get several pictures of the procedures which he always thought were really neat.
This kind of statement only furthered our immense respect and astonishment that we had for Mattie and his emotional intellect, intelligence, and maturity. It was amazing that a six year-old could so quickly rationalize and embrace a situation and keep such a strong and positive attitude going, when his parents were a pair of emotional and physical trainwrecks. The irony is that Mattie gave us our strength to go on at a time when we should have been giving him his strength to fight.
Mattie's life during the 13 months of fighting cancer was not a normal one, even though we did whatever was humanly possible to make it as normal as possible. Fortunately, we have good friends who helped us get to the right doctors and to the program at the Lombardi Center in what everyone says was record-breaking time, who embraced us and helped us with what was unquestionably the greatest challenge of our lives. Of course, without our family and good friends, life would be a whole lot tougher than it is right now, so for those of you who are reading this, all we can say is Thank You and We Love You. God Bless.
|
{
"pile_set_name": "Pile-CC"
}
|
This vegan lime orzo with sauteed bell peppers and onions makes for a simple, clean dinner or brown bag lunch. Mint, cayenne and lime add layers of flavor.
Gorging on all that sweet stuff around the holidays makes me really hungry for some good, clean, simple food. Like this Lime Orzo with Green Peppers which I put together in a few minutes one recent night.
Orzo is a popular pasta around our house, partly, I imagine, because it reminds the rice-loving Desi of his favorite grain. I almost always have some in the pantry. My only peeve is that I can never find a wholegrain version where I shop.
You could add almost any veggie to this dish-- zucchini, broccoli, cauliflower or even some greens would be great in here. Next time I will also add some cooked chickpeas or white beans to give the orzo a protein boost.
This is a really simple recipe but the mint and the lime and the peppers add layer upon layer of flavor, making it quite special. Try it. You will be hooked.
Lime Orzo with Bell Peppers Vaishali · Holy Cow! Vegan Recipes This vegan lime orzo with sauteed bell peppers and onions makes for a simple, clean dinner or brown bag lunch. Mint, cayenne and lime add layers of flavor. Nut-free, soy-free, can be made gluten-free with gf pasta. 5 from 1 vote Print Recipe Pin Recipe Prep Time 10 mins Cook Time 20 mins Total Time 30 mins Course Pasta Cuisine Italian, Vegan Servings 6 Servings Calories 255 kcal Ingredients 1x 2x 3x 2 cups orzo
5 cups water
Salt and ground black pepper to taste
2 tsp dried mint
1/2 tsp cayenne pepper
3 green bell peppers, cut into a small dice
1 medium onion, thinly sliced
4 cloves garlic, minced
Juice of half a lime. Add more if you like your orzo tangier.
2 tsp extra virgin olive oil Instructions Heat the water along with 1 tsp of olive oil, cayenne, salt, black pepper, mint and orzo. Cook for about 15 minutes until the orzo is al dente and has absorbed almost all of the water.
While the orzo is cooking, heat a saucepan with the remaining olive oil. Add the onions and green peppers and saute until the onions are softened, about 5 minutes.
Add the garlic and saute for a minute. Now add the cooked pasta and mix.
Stir in the lime juice and add salt and ground pepper if needed.
Serve hot. Nutrition Calories: 255 kcal Carbohydrates: 48.5 g Protein: 8 g Fat: 2.8 g Fiber: 3.7 g Sugar: 6.3 g Tried this recipe? Let us know ! Or post a photo on Instagram and tag @HolyCowVegan
**
More quick, easy and tasty pasta favorites:
Linguine with vegan olive oil pesto
Pasta with no-cook tomato sauce
Vegan lentil and pasta salad
|
{
"pile_set_name": "OpenWebText2"
}
|
Toward optimizing dental implant performance: Surface characterization of Ti and TiZr implant materials.
Targeting understanding enhanced osseointegration kinetics, the goal of this study was to characterize the surface morphology and composition of Ti and TiZr dental implant substrates subjected to one of two surface treatments developed by Straumann. These two treatments are typically known as SLA and SLActive, with the latter resulting in more rapid osseointegration. A range of techniques was applied to characterize four different substrate/surface treatment combinations (TiSLA, TiSLActive, TiZrSLA, and TiZrSLActive). Contact angle measurements established their hydrophilic/hydrophobic nature. Surface morphology was probed with scanning electron microscopy. X-ray diffraction, Raman μ-spectroscopy, and X-ray photoelectron spectroscopy were used to elucidate the composition of the near-surface region. Consistent with previous work, surface morphology was found to differ only at the nanoscale, with both SLActive substrates displaying nano-protrusions. Spectroscopic data indicate that all substrates exhibit surface films of titanium oxide displaying near TiO2 stoichiometry. Raman μ-spectroscopy reveals that amorphous TiO2 is most likely the only phase present on TiSLA, whilst rutile-TiO2 is also evidenced on TiSLActive, TiZrSLA, and TiZrSLActive. For TiZr alloy substrates, there is no evidence of discrete phases of oxidized Zr. X-ray photoelectron spectra demonstrate that all samples are terminated by adventitious carbon, with it being somewhat thicker (∼1nm) on TiSLA and TiZrSLA. Given previous in vivo studies, acquired data suggest that both nanoscale protrusions, and a thinner layer of adventitious carbon contribute to the more rapid osseointegration of SLActive dental implants. Composition of the surface oxide layer is apparently less important in determining osseointegration kinetics.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Would you like to know what Fraiture (Vielsalm) really looks like? Have a look at the pictures of Fraiture (Vielsalm) on this page. If you also have holiday pictures of Fraiture (Vielsalm), make sure to add them here.
Would you like to know what Fraiture (Vielsalm) really looks like? Have a look at the pictures of Fraiture (Vielsalm) on this page. If you also have holiday pictures of Fraiture (Vielsalm), make sure to add them here. - - - -
|
{
"pile_set_name": "Pile-CC"
}
|
Pedro de Mena
Pedro de Mena y Medrano (August 1628 - 13 October 1688) was a Spanish sculptor.
Biography
He was born at Granada, in Andalusia. He was a pupil of his father Alonso de Mena as well as of Alonzo Cano. His first conspicuous success was achieved in work for the convent of St. Anthony Granada, including figures of St Joseph, St Antony of Padua, St Diego, St Pedro Mentara, St Franciscus and Santa Clara.
In 1658 he signed a contract for sculptural, work on the choir stalls of the cathedral of Málaga, this work extending over four years. Other works are, statues of the Madonna and child and of St Joseph in Madrid, the polychromatic figures in the church of St Isodoro, the Magdalena and the Gertrudlis in the church of St Martin (Madrid), the crucifixion in the Nuestra Señora de Gracia (Madrid), the statuette of St Francis of Assisi in Toledo, and of St Joseph in the St Nicholas church in Murcia. Mena traveled to Madrid in 1662.
Between 1673 and 1679 Mena worked at Córdoba. About 1680 he was in Granada, where he executed a half-length Madonna and child (seated) for the church of St. Dominic.
Mena died in Málaga, city where he spent most of his life, and where he had a sculpture studio for thirty years until his death in 1688.
He and José Mora may be regarded as artistic descendants of Juan Martínez Montañés and Cano, but in technical skill and the expression of religious motive his statues are unsurpassed in the sculpture of Spain. His feeling for the nude was remarkable. Like his immediate predecessors he excelled in the portrayal of contemplative figures and scenes; Mena's drawing of Santiago leaping upon his charger is good, and the carving admirable, but the necessary movement for so spirited an action is lacking.
References
Category:1628 births
Category:1693 deaths
Category:People from Granada
Category:Spanish Baroque sculptors
Category:17th-century Spanish sculptors
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Northwest Hawai'i Times
The Northwest Hawaiʻi Times was a monthly newspaper based in Seattle, Washington that served the Hawaiian community in the Pacific Northwest. It was founded in April 2004, and ceased publication five years later, in March 2009.
External links
http://www.northwesthawaiitimes.com
Category:Newspapers published in Seattle
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Functional way to reduce object into a string
I'm looking for a good functional way to convert this object:
var globals = {
foo: "bar",
foo2: "bar2"
};
...into this string:
'window.foo = "bar"; window.foo2 = "bar2";'
Something almost similar to Array.prototype.reduce().
Use of libs like Lodash is okay.
What I'm not looking for are non-functional approaches like:
var string = "";
// Pseudo code
_.forOwn(...) {
string += key
}
A:
Use map and join
var globals = {
foo: "bar",
foo2: "bar2"
};
var result = Object.keys(globals).map(function(key) {
return 'window.' + key + ' = "' + this[key] + '";';
}, globals).join(' ');
console.log(result);
|
{
"pile_set_name": "StackExchange"
}
|
// Boost.Geometry (aka GGL, Generic Geometry Library)
// Copyright (c) 2007-2012 Barend Gehrels, Amsterdam, the Netherlands.
// Copyright (c) 2008-2012 Bruno Lalande, Paris, France.
// Copyright (c) 2009-2012 Mateusz Loskot, London, UK.
// Parts of Boost.Geometry are redesigned from Geodan's Geographic Library
// (geolib/GGL), copyright (c) 1995-2010 Geodan, Amsterdam, the Netherlands.
// Use, modification and distribution is subject to the Boost Software License,
// Version 1.0. (See accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
#ifndef BOOST_GEOMETRY_STRATEGIES_SIDE_INFO_HPP
#define BOOST_GEOMETRY_STRATEGIES_SIDE_INFO_HPP
#include <utility>
namespace boost { namespace geometry
{
/*!
\brief Class side_info: small class wrapping for sides (-1,0,1)
*/
class side_info
{
public :
inline side_info(int side_a1 = 0, int side_a2 = 0,
int side_b1 = 0, int side_b2 = 0)
{
sides[0].first = side_a1;
sides[0].second = side_a2;
sides[1].first = side_b1;
sides[1].second = side_b2;
}
template <int Which>
inline void set(int first, int second)
{
sides[Which].first = first;
sides[Which].second = second;
}
template <int Which, int Index>
inline void correct_to_zero()
{
if (Index == 0)
{
sides[Which].first = 0;
}
else
{
sides[Which].second = 0;
}
}
template <int Which, int Index>
inline int get() const
{
return Index == 0 ? sides[Which].first : sides[Which].second;
}
// Returns true if both lying on the same side WRT the other
// (so either 1,1 or -1-1)
template <int Which>
inline bool same() const
{
return sides[Which].first * sides[Which].second == 1;
}
inline bool collinear() const
{
return sides[0].first == 0
&& sides[0].second == 0
&& sides[1].first == 0
&& sides[1].second == 0;
}
inline bool crossing() const
{
return sides[0].first * sides[0].second == -1
&& sides[1].first * sides[1].second == -1;
}
inline bool touching() const
{
return (sides[0].first * sides[1].first == -1
&& sides[0].second == 0 && sides[1].second == 0)
|| (sides[1].first * sides[0].first == -1
&& sides[1].second == 0 && sides[0].second == 0);
}
template <int Which>
inline bool one_touching() const
{
// This is normally a situation which can't occur:
// If one is completely left or right, the other cannot touch
return one_zero<Which>()
&& sides[1 - Which].first * sides[1 - Which].second == 1;
}
inline bool meeting() const
{
// Two of them (in each segment) zero, two not
return one_zero<0>() && one_zero<1>();
}
template <int Which>
inline bool zero() const
{
return sides[Which].first == 0 && sides[Which].second == 0;
}
template <int Which>
inline bool one_zero() const
{
return (sides[Which].first == 0 && sides[Which].second != 0)
|| (sides[Which].first != 0 && sides[Which].second == 0);
}
inline bool one_of_all_zero() const
{
int const sum = std::abs(sides[0].first)
+ std::abs(sides[0].second)
+ std::abs(sides[1].first)
+ std::abs(sides[1].second);
return sum == 3;
}
template <int Which>
inline int zero_index() const
{
return sides[Which].first == 0 ? 0 : 1;
}
inline void debug() const
{
std::cout << sides[0].first << " "
<< sides[0].second << " "
<< sides[1].first << " "
<< sides[1].second
<< std::endl;
}
inline void reverse()
{
std::swap(sides[0], sides[1]);
}
//private :
std::pair<int, int> sides[2];
};
}} // namespace boost::geometry
#endif // BOOST_GEOMETRY_STRATEGIES_SIDE_INFO_HPP
|
{
"pile_set_name": "Github"
}
|
Free radical-triggered hepatic injury of experimental obstructive jaundice of rats involves overproduction of proinflammatory cytokines and enhanced activation of nuclear factor kappaB.
Excessive production of hydroxyl radicals in blood and liver has previously been demonstrated by us in rats with obstructive jaundice induced by common bile duct ligation (CBDL). In this study, we demonstrate overproduction of superoxide radicals in circulating blood of CBDL rats by the lucigenin-amplified chemiluminescence technique. To pinpoint the molecular agents that mediate these processes, we measured circulating proinflammatory cytokines, such as tumor necrosis factor-alpha (TNF-alpha), interleukin-1beta ( IL-1beta), and interleukin-6 (IL-6) in controls and CBDL rats. Concentrations of these cytokines in blood of CBDL rats were markedly elevated when compared to the controls (TNF-alpha: 36.7 +/- 5.0 vs 13.8 +/- 0.5 pg/mL; IL-6: 2,814 +/- 1,740 vs 0 pg/mL; IL-1beta: 11.9 +/- 2.6 vs 0 pg/mL). The overproduction of free radicals triggered by elevated cytokines in CBDL rats was correlated with the activation of NF-kappaB in hepatic tissue. Using the TdT-mediated dUTP nick-end label staining technique, we showed that hepatic tissue sections from CBDL rats had an increase in the apoptotic index (AI). Based on these findings, we propose that the severe hepatic injury in CBDL rats is mediated by a cycle that involves the activation of NF-kappaB by combined action of proinflammatory cytokines and reactive oxygen species (ROS). NF-KB, in turn, initiates the transcription of cytokine genes (eg, IL-6, IL-8, TNF-alpha), which triggers hepatic injury, at least in part, by a free radical-mediated apoptotic mechanism. Elevated ROS may be as a positive-feedback signal that triggers NF-KB reactivation; the severe hepatic injury of CBDL rats may result from perpetuation of this vicious cycle.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
The No Child Left Behind Act of 2002 (NCLB) was initially legislated for 5 years, and has been since temporarily extended, but not officially reauthorized.
Senate Democrats were divided were divided on reauthorization, while most Senate Republicans heartily despise NCLB. In May 2008, Senate reauthorization was put on the back-burner while legislators pondered hundreds of reform ideas.
In early 2010 and again on March 14, 2011, President Obama said he will seek to reauthorize NCLB, but modified to be similar to his $4.35 billion Race to the Top initiative, which requires five major education reforms for K-12 public education, and pushes states to compete for education funding, rather than automatically receiving it based on a formula.
At Race to the Top, Obama's 2010 Education Grant Initiative, read a summary of Obama's controversial five reforms which are a model for his planned reform of NCLB.
NCLB is a federal law that mandates a number of programs aimed at improving U.S. education in elementary, middle and high schools by increasing accountability standards.
The approach is based on outcome-based theories education that high expectations goal-setting will result in greater educational achievement for most students.
Supporters of NCLB
Supporters of NCLB agree with the mandate for accountability to educational standards, and believe emphasis on test results will improve the quality of public education for all students.
Proponents also believe that NCLB initiatives will further democratize U.S. education, by setting standards and providing resources to schools, regardless of wealth, ethnicity, disabilities or language spoken.
Opponents of NCLB
Opponents of NCLB, which includes all major teachers' unions, allege that the act hasn't been effective in improving education in public education, especially high schools, as evidenced by mixed results in standardized tests since NCLB's 2002 inception.
Opponents also claim that standardized testing, which is the heart of NCLB accountability, is deeply flawed and biased for many reasons, and that stricter teacher qualifications have exacerbated the nationwide teacher shortage, not provided a stronger teaching force.
Some critics believe that the federal government has no constitutional authority in the education arena, and that federal involvement erodes state and local control over education of their children.
Current Status
In January 2007, Education Secretary Margaret Spellings published "Building on Results: A Blue print for Strengthening the No Child Left Behind Act," in which the Bush Administration:
Asserts that the Act "is challenging our students to succeed and our schools to improve."
Claims that "90% of teachers have met NCLB's highly qualified teacher requirements... At-risk students are getting help earlier... children with disabilities are receiving more classroom time and attention... "
Spellings' report admitted problems that NCLB has identified and not cured, including:
Between 1999 and 2004, reading scores for 17-year-olds fell 3 points, and math scores fell 1 point.
U.S. 15-year-olds ranked 24th out of 29 developed nations in math literacy and problem-solving, in 2003.
1 million students annually drop out of high school before graduation.
Changes Proposed by Bush Administration
To strengthen the No Child Left Behind Act, the Bush Administration proposes:
* "A stronger effort must be made to close the achievement gap through the high school standards and accountability." TRANSLATED: More testing, and tougher tests.
* "Middle and high schools must offer more rigorous coursework that better prepares students for postsecondary education or the workforce." TRANSLATED: Tougher and more basics-focused courses in middle and high school. Also, clearer differentiation between college bound and non- college bound students.
* "States much be given the flexibilities and new tools to restructure chronically underperforming schools, and families must be given more options." TRANSLATED: The most controversial new proposal would enable students at failing schools to receive a voucher to transfer to a private school.
Thus, the Bush Administration is proposing that public school funds would be used to pay private and religious schools. Until now, students at perennially failing schools had the options to either transfer to another public school or receive extended tutoring at the school's expense.
Background
The 670-page No Child Left Behind Act of 2001 (NCLB) was passed with strong bipartisan backing by the House of Representatives on December 13, 2001 by a vote of 381-41, and by the Senate on December 18, 2001 by a vote of 87-10. President George W. Bush signed it into law on January 8, 2002.
The primary sponsors of NCLB were President George W. Bush and Sen. Ted Kennedy of Massachusetts, a decades-long advocate for raising the quality of public education for all American children.
NCLB was partially based on education reform strategies instituted by President Bush during his tenure as Texas governor. Those Texas education reforms were reputed to result in improved standardized test scores. Subsequent inquiry revealed test-rigging by some educators and administrators.
Margaret Spellings, Former Secretary of Education
One of the principal authors of NCLB was Margaret Spellings, who was nominated to Secretary of Education in late 2004.
Spellings, who holds a B.A. in political science from University of Houston, was the political director for Bush's first gubernatorial campaign in 1994, and later served as a senior advisor to Texas Gov. Bush during his term as 1995 to 2000.
Before her association with George W. Bush, Spellings worked on an education reform commission under Texas Governor William P. Clements and as associate executive director for the Texas Association of School Boards. Prior to her nomination to be Education Secretary, Margaret Spellings worked for the Bush Administration as Assistant to the President for Domestic Policy.
Margaret Spellings has never worked in a school system, and has no formal training in education.
She is married to Robert Spellings, former Chief of Staff to the Speaker of the Texas House, now a prominent attorney in Austin, Texas and Washington D.C., who has actively lobbied for the adoption of school vouchers.
Pros
The primary positives of the No Child Left Behind Act include:
Accountability standards are set and measured annually by each state to foster educational growth and achievement. All results are also annually reported to parents.
Standards are set for teacher qualifications.
NCLB links state academic content with student educational outcomes, and requires school improvement be implemented using "scientific-based research" methods in the classroom, parent programs, and teacher development courses.
NCLB emphasizes reading, writing and math.
NCLB measures educational status and growth by ethnicity, and helps to close the achievement gap between white and minority students.
NCLB requires schools to focus on providing quality education to students who are often underserved, including children with disabilities, from low-income families, non-English speakers, as well as African-Americans and Latinos.
Parents are provided annually with a detailed report of student achievement, and explanations are provided of achievement levels.
Cons
Major drawbacks of the No Child Left Behind Actinclude:
Federal Underfunding
The Bush Administration has significantly underfunded NCLB at the state level, and yet, has required states to comply with all provisions of NCLB or risk losing federal funds.
Said Sen. Ted Kennedy, a sponsor of NCLB and Senate Education Committee Chair, "The tragedy is that these long overdue reforms are finally in place, but the funds are not."
As a result, most states have been forced to make budget cuts in non-tested school subjects such as science, foreign languages, social studies and arts programs, and for books, field trips and school supplies.
Teaching to the Test
Teachers and parents charge that NCLB encourages, and rewards, teaching children to score well on the test, rather than teaching with a primary goal of learning. As a result, teachers are pressured to teach a narrow set of test-taking skills and a test-limited range of knowledge.
NCLB ignores many vital subjects, including science, history and foreign languages.
Problems with NCLB Standardized Tests
Since states set their own standards and write their own standardized NCLB tests, states can compensate for inadequate student performance by setting very low standards and making tests unusually easy.
Many contend that testing requirements for disabled and limited-English proficient students are unfair and unworkable.
Critics allege that standardized tests contain cultural biases, and that educational quality can't necessarily be evaluated by objective testing.
Teacher Qualification Standards
NCLB sets very high teacher qualifications by requiring new teachers to possess one (or often more) college degrees in specific subjects and to pass a battery of proficiency tests. Existing teachers must also pass proficiency tests.
These new requirements have caused major problems in obtaining qualified teachers in subjects (special education, science, math) and areas (rural, inner cities) where schools districts already have teacher shortages.
Teachers especially object to the Bush 2007 proposal to allow districts to circumvent teacher contracts to transfer teachers to failing and poorly-performing schools.
Failure to Address Reasons for Lack of Achievement
At its core, NCLB faults schools and curriculum for student failure, but critics claim that other factors are also to blame, including: class size, old and damaged school buildings, hunger and homelessness, and lack of health care.
Where It Stands
There's little doubt that the No Child Left Behind Act will be reauthorized by Congress in 2007. The open question is: How will Congress change the Act?
White House Kicks-Off Reauthorization Discussions
A meeting was held on January 8, 2007 at the White House to mark the 5th anniversary of the No Child Left Behind Act, and to kick-off Bush Administration discussons with Congress regarding reauthorization of the act.
Attendees at the meeting with President Bush and Education Secreatary Margaret Spellings were Sen. Ted Kennedy (D-MA), Chair of the Senate Education Committee; Sen. Mike Enzi (R-WY), ranking Republican on that committee; Rep. George Miller (D-CA), Chair of the House Education Committee; and Rep. Howard McKeon (R-CA), ranking Republican on that committee.
According to Sen. Enzi, "There was agreement we should proceed, and an agreement in principal on what needs to be done."
Religious, Civil Liberties Groups Propose NCLB Changes
More than 100 religious denominations and civil rights, education and disability advocacy groups have signed on to the "Joint Organizational Statement on NCLB", calling for changes to NCLB, and stating that:
"We endorse the use of an accountability system that helps ensure all children, including children of color, from low-income families, with disabilities, and of limited English proficiency, are prepared to be successful, participating members of our democracy...
... we believe the following significant, constructive corrections are among those necessary to make the Act fair and effective. Among these concerns are:
* over-emphasizing standardized testing, narrowing curriculum and instruction to focus on test preparation rather than richer academic learning;
* over-identifying schools in need of improvement; using sanctions that do not help improve schools;
* inappropriately excluding low-scoring children in order to boost test results;
* and inadequate funding.
Overall, the law's emphasis needs to shift from applying sanctions for failing to raise test scores to holding states and localities accountable for making the systemic changes that improve student achievement."
|
{
"pile_set_name": "OpenWebText2"
}
|
FERDINANDO
ARGENTI , Boston-based pianist/keyboardist/ vocalist / composer / arranger , was born in Pisa , Italy , in 1954 .At age 7 , this multi-faceted artist began studying piano until he entered high school, during which time he gained experience playing with Italian rock bands ( although in the meantime listening to his fatherís American swing records ), and even won a national musical contest and appeared on Italian television.
He continued to play music while a student of languages at the University of Pisa . At age 20 , Ferdinando began working as a full-time professional musician, touring most of Europe for 10 years as a pianist , keyboardist , vocalist and small group arranger in clubs , hotels and on cruise ships. During this time he developed a more comprehensive understanding of jazz and fusion music and wished to learn more about it at the ďsource.Ē
In 1984 , he left Europe for the United States , where he furtherly developed his jazz piano with Ray Santisi and graduated Summa Cum Laude from Berklee College of Music. During this period , Argenti returned to his native Italy to perform in many
jazz concerts with both Italian and American jazz musicians , most notably
Chet Baker , Lee Konitz and Kenny Wheeler . Among the Italian jazz musicians he played with, we should mention Massimo Urbani, Paolo Fresu, Marcello Rosa, Gianni Basso, Flavio Boltro, among others.
Ferdinando Argentiís brilliant jazz piano sound and improvisational style are a composite of Charlie Parkerís be-bop , Oscar Petersonís blend of bop and swing, the lyrical approach of Bill Evans and Chet Baker, and some of the harmonic innovations and rhythmic feel of Herbie Hancock and Chick Corea . Argentiís sensitive vocal phrasing and delivery can be largely attributed to his admiration for Frank Sinatra and Chet Baker .
After a period of music engagements that again involved traveling - this time
to places as diverse as Japan, Scandinavia, the Caribbean and Russia - in 1994 Ferdinando got married in USA and established himself in New England. Here he ran all the gamut of gigs as a solo artist, tasteful accompanist, active member of many small groups and big bands, most notably the Artie Shaw big band directed by Dick Johnson .
Throughout this varied forms of entertainment in clubs and concerts , Argentiís ultimate goal has long been to lead his own ensemble playing his own compositions and arrangements . This has now become a reality with the release of his own compact disc entitled ARGENTI, not only his name, but the name of his musical group and his music. ďARGENTIĒ CD is a captivating and well blended collection of Ferdinandoís own jazz compositions and his arrangements of American and Italian standards.
|
{
"pile_set_name": "Pile-CC"
}
|
Australian Outback Spectacular
The Australian Outback Spectacular is an Australiana dinner and show package featuring many Australian animals, songs and bush tucker. The show is located between Warner Bros. Movie World and Wet'n'Wild Water World at Oxenford on the Gold Coast.
See also
Village Roadshow Theme Parks
References
External links
Category:Village Roadshow Theme Parks
Category:Tourist attractions on the Gold Coast, Queensland
Category:Dinner theatre
Category:Australian-themed retailers
Category:Theme restaurants
Category:Restaurants in Queensland
Category:Horse showing and exhibition
Category:Australian outback
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Jan 30, Show Me Your Genitals Lyrics: Women are stupid and I respect them right, I just.. Album You Want Some of This? 1. K.
Lyrics to VAGINA" song by Jon Lajoie: (Aahhh yeah, are equal and they.. If you wanna be with me it goes one of two ways.
Lyrics to "Show Me Your Genitals" song by Jon Lajoie: Women are stupid and I respect them right, I just have sex with them Show me your genit.
A list of lyrics, artists and songs that contain the term "vagina" - from the.. Pussy shit but lips and clits x 4 Verse 1: One vagina, two vagina just like a.
Julia from Fairfield Age: 30. Looking for a sexy stud for a fun weekend.
Jun 2, Lyric video for "Pussy Pussy Pussy Marijuana" by Andy Milonakis. Lyrics on and in description. Official music video..
Ana from Fairfield Age: 34. Charming young lady with an unrealistically beautiful body, I know what men like.
Aug 10, One of the lyrics on Nicki new album has everyone.. always buying me But I know if the pussy wet or if crying and shit". Table 1. Examples of popular music lyrics describing degrading and.. if sexual for this analysis as sex.
Lauren from Fairfield Age: 28. Looking for a man who is willing to spend time not only in bed.
From "Three Point One Four" by Bloodhound Gang: hard to rhyme a word like Calvin Klein kind of.. hard for a man with access to one vagina. 1 Tags. "Moist Vagina" as written by and Kurt Cobain.. Read Edit Wiki. She had a moist vagina. been tickling the circumference.
Description:Down this vagina mine.. This vagina mine, one track, tunnel vision now. This mine, one track, tunnel vision now. Edit Lyrics Edit Wiki Add Video. Mar 27, Many artists have equated themselves to Pacquiao for the way they "beat" the " up. Juelz goes one step further by saying that a. Sep 26, We rounded up the weirdest, grossest song lyrics One thing we can agree on is that the dude puts a lot of weird shit in his lyrics. In honor of Lil (born.. the pussy up, call me Larry.
|
{
"pile_set_name": "Pile-CC"
}
|
Is a nonstented duct-to-mucosa anastomosis using the modified Kakita method a safe procedure?
After standardization of the perioperative management of pancreaticoduodenectomy, we retrospectively compared results in nonstented pancreaticojejunostomy with external-stented pancreaticojejunostomy. The study population included 129 consecutive patients who underwent pancreaticoduodenectomy between 2004 and 2008. The postoperative mortality and morbidity were compared between 51 patients with restrictive use of external stenting (group A) and 78 patients without external stenting (group B). The patient with a pancreatic duct of less than 3 mm in diameter was 31% in group A and 46% in group B. There were no differences in postoperative morbidity and mortality between the 2 groups. Although the frequency of overall postoperative pancreatic fistula development was significantly higher in group B than in group A (44% vs 27%, P = 0.0004), there was no difference in grade B/C postoperative pancreatic fistula rate (group A: 5.9% vs group B: 14.1%). The length of in-hospital stay in group B was significantly shorter than group A (13 vs 24 days, P < 0.0001). There were no differences in postoperative morbidity and mortality between subgroups that were consisted of patients with small pancreatic duct diameter. This retrospective single-center study showed that nonstented duct-to-mucosa anastomosis was a safe procedure and was associated with a shortened in-hospital stay.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
// Copyright 2017 Jeff Foley. All rights reserved.
// Use of this source code is governed by Apache 2 LICENSE that can be found in the LICENSE file.
package main
import (
"bytes"
"flag"
"fmt"
"io"
"log"
"math/rand"
"os"
"os/signal"
"path/filepath"
"syscall"
"time"
"github.com/OWASP/Amass/v3/config"
"github.com/OWASP/Amass/v3/datasrcs"
"github.com/OWASP/Amass/v3/format"
"github.com/OWASP/Amass/v3/intel"
"github.com/OWASP/Amass/v3/stringset"
"github.com/OWASP/Amass/v3/systems"
"github.com/fatih/color"
)
const (
intelUsageMsg = "intel [options] [-whois -d DOMAIN] [-addr ADDR -asn ASN -cidr CIDR]"
)
type intelArgs struct {
Addresses format.ParseIPs
ASNs format.ParseInts
CIDRs format.ParseCIDRs
OrganizationName string
Domains stringset.Set
Excluded stringset.Set
Included stringset.Set
MaxDNSQueries int
Ports format.ParseInts
Resolvers stringset.Set
Timeout int
Options struct {
Active bool
DemoMode bool
IPs bool
IPv4 bool
IPv6 bool
ListSources bool
ReverseWhois bool
Sources bool
MonitorResolverRate bool
Verbose bool
}
Filepaths struct {
ConfigFile string
Directory string
Domains format.ParseStrings
ExcludedSrcs string
IncludedSrcs string
LogFile string
Resolvers format.ParseStrings
TermOut string
}
}
func defineIntelArgumentFlags(intelFlags *flag.FlagSet, args *intelArgs) {
intelFlags.Var(&args.Addresses, "addr", "IPs and ranges (192.168.1.1-254) separated by commas")
intelFlags.Var(&args.ASNs, "asn", "ASNs separated by commas (can be used multiple times)")
intelFlags.Var(&args.CIDRs, "cidr", "CIDRs separated by commas (can be used multiple times)")
intelFlags.StringVar(&args.OrganizationName, "org", "", "Search string provided against AS description information")
intelFlags.Var(&args.Domains, "d", "Domain names separated by commas (can be used multiple times)")
intelFlags.Var(&args.Excluded, "exclude", "Data source names separated by commas to be excluded")
intelFlags.Var(&args.Included, "include", "Data source names separated by commas to be included")
intelFlags.IntVar(&args.MaxDNSQueries, "max-dns-queries", 0, "Maximum number of concurrent DNS queries")
intelFlags.Var(&args.Ports, "p", "Ports separated by commas (default: 443)")
intelFlags.Var(&args.Resolvers, "r", "IP addresses of preferred DNS resolvers (can be used multiple times)")
intelFlags.IntVar(&args.Timeout, "timeout", 0, "Number of minutes to let enumeration run before quitting")
}
func defineIntelOptionFlags(intelFlags *flag.FlagSet, args *intelArgs) {
intelFlags.BoolVar(&args.Options.Active, "active", false, "Attempt certificate name grabs")
intelFlags.BoolVar(&args.Options.DemoMode, "demo", false, "Censor output to make it suitable for demonstrations")
intelFlags.BoolVar(&args.Options.IPs, "ip", false, "Show the IP addresses for discovered names")
intelFlags.BoolVar(&args.Options.IPv4, "ipv4", false, "Show the IPv4 addresses for discovered names")
intelFlags.BoolVar(&args.Options.IPv6, "ipv6", false, "Show the IPv6 addresses for discovered names")
intelFlags.BoolVar(&args.Options.ListSources, "list", false, "Print the names of all available data sources")
intelFlags.BoolVar(&args.Options.MonitorResolverRate, "noresolvrate", true, "Disable resolver rate monitoring")
intelFlags.BoolVar(&args.Options.ReverseWhois, "whois", false, "All provided domains are run through reverse whois")
intelFlags.BoolVar(&args.Options.Sources, "src", false, "Print data sources for the discovered names")
intelFlags.BoolVar(&args.Options.Verbose, "v", false, "Output status / debug / troubleshooting info")
}
func defineIntelFilepathFlags(intelFlags *flag.FlagSet, args *intelArgs) {
intelFlags.StringVar(&args.Filepaths.ConfigFile, "config", "", "Path to the INI configuration file. Additional details below")
intelFlags.StringVar(&args.Filepaths.Directory, "dir", "", "Path to the directory containing the output files")
intelFlags.Var(&args.Filepaths.Domains, "df", "Path to a file providing root domain names")
intelFlags.StringVar(&args.Filepaths.ExcludedSrcs, "ef", "", "Path to a file providing data sources to exclude")
intelFlags.StringVar(&args.Filepaths.IncludedSrcs, "if", "", "Path to a file providing data sources to include")
intelFlags.StringVar(&args.Filepaths.LogFile, "log", "", "Path to the log file where errors will be written")
intelFlags.Var(&args.Filepaths.Resolvers, "rf", "Path to a file providing preferred DNS resolvers")
intelFlags.StringVar(&args.Filepaths.TermOut, "o", "", "Path to the text file containing terminal stdout/stderr")
}
func runIntelCommand(clArgs []string) {
args := intelArgs{
Domains: stringset.New(),
Excluded: stringset.New(),
Included: stringset.New(),
Resolvers: stringset.New(),
}
var help1, help2 bool
intelCommand := flag.NewFlagSet("intel", flag.ContinueOnError)
intelBuf := new(bytes.Buffer)
intelCommand.SetOutput(intelBuf)
intelCommand.BoolVar(&help1, "h", false, "Show the program usage message")
intelCommand.BoolVar(&help2, "help", false, "Show the program usage message")
defineIntelArgumentFlags(intelCommand, &args)
defineIntelOptionFlags(intelCommand, &args)
defineIntelFilepathFlags(intelCommand, &args)
if len(clArgs) < 1 {
commandUsage(intelUsageMsg, intelCommand, intelBuf)
return
}
if err := intelCommand.Parse(clArgs); err != nil {
r.Fprintf(color.Error, "%v\n", err)
os.Exit(1)
}
if help1 || help2 {
commandUsage(intelUsageMsg, intelCommand, intelBuf)
return
}
if (len(args.Excluded) > 0 || args.Filepaths.ExcludedSrcs != "") &&
(len(args.Included) > 0 || args.Filepaths.IncludedSrcs != "") {
commandUsage(intelUsageMsg, intelCommand, intelBuf)
os.Exit(1)
}
// Seed the default pseudo-random number generator
rand.Seed(time.Now().UTC().UnixNano())
if args.OrganizationName != "" {
asns, descs, err := config.LookupASNsByName(args.OrganizationName)
if err == nil {
for i, a := range asns {
fmt.Printf("%d, %s\n", a, descs[i])
}
} else {
fmt.Printf("%v\n", err)
}
return
}
if err := processIntelInputFiles(&args); err != nil {
fmt.Fprintf(color.Error, "%v\n", err)
os.Exit(1)
}
cfg := config.NewConfig()
// Check if a configuration file was provided, and if so, load the settings
if err := config.AcquireConfig(args.Filepaths.Directory, args.Filepaths.ConfigFile, cfg); err == nil {
// Check if a config file was provided that has DNS resolvers specified
if len(cfg.Resolvers) > 0 && len(args.Resolvers) == 0 {
args.Resolvers = stringset.New(cfg.Resolvers...)
}
} else if args.Filepaths.ConfigFile != "" {
r.Fprintf(color.Error, "Failed to load the configuration file: %v\n", err)
os.Exit(1)
}
// Override configuration file settings with command-line arguments
if err := cfg.UpdateConfig(args); err != nil {
r.Fprintf(color.Error, "Configuration error: %v\n", err)
os.Exit(1)
}
// Check if the user has requested the data source names
if args.Options.ListSources {
for _, info := range GetAllSourceInfo(cfg) {
g.Println(info)
}
return
}
// Some input validation
if !args.Options.ReverseWhois && args.OrganizationName == "" &&
len(args.Addresses) == 0 && len(args.CIDRs) == 0 && len(args.ASNs) == 0 {
commandUsage(intelUsageMsg, intelCommand, intelBuf)
os.Exit(1)
}
rLog, wLog := io.Pipe()
cfg.Log = log.New(wLog, "", log.Lmicroseconds)
logfile := filepath.Join(config.OutputDirectory(cfg.Dir), "amass.log")
if args.Filepaths.LogFile != "" {
logfile = args.Filepaths.LogFile
}
createOutputDirectory(cfg)
go writeLogsAndMessages(rLog, logfile, args.Options.Verbose)
sys, err := systems.NewLocalSystem(cfg)
if err != nil {
return
}
sys.SetDataSources(datasrcs.GetAllSources(sys, true))
ic := intel.NewCollection(sys)
if ic == nil {
r.Fprintf(color.Error, "%s\n", "No DNS resolvers passed the sanity check")
os.Exit(1)
}
ic.Config = cfg
if args.Options.ReverseWhois {
if len(ic.Config.Domains()) == 0 {
r.Fprintln(color.Error, "No root domain names were provided")
os.Exit(1)
}
args.Options.IPs = false
args.Options.IPv4 = false
args.Options.IPv6 = false
go ic.ReverseWhois()
} else {
go ic.HostedDomains()
}
go intelSignalHandler(ic)
processIntelOutput(ic, &args)
}
func processIntelOutput(ic *intel.Collection, args *intelArgs) {
var err error
dir := config.OutputDirectory(ic.Config.Dir)
txtfile := filepath.Join(dir, "amass.txt")
if args.Filepaths.TermOut != "" {
txtfile = args.Filepaths.TermOut
}
var outptr *os.File
if txtfile != "" {
outptr, err = os.OpenFile(txtfile, os.O_WRONLY|os.O_CREATE, 0644)
if err != nil {
r.Fprintf(color.Error, "Failed to open the text output file: %v\n", err)
os.Exit(1)
}
defer func() {
outptr.Sync()
outptr.Close()
}()
outptr.Truncate(0)
outptr.Seek(0, 0)
}
// Collect all the names returned by the intelligence collection
for out := range ic.Output {
source, name, ips := format.OutputLineParts(out, args.Options.Sources,
args.Options.IPs || args.Options.IPv4 || args.Options.IPv6, args.Options.DemoMode)
if ips != "" {
ips = " " + ips
}
fmt.Fprintf(color.Output, "%s%s%s\n", blue(source), green(name), yellow(ips))
// Handle writing the line to a specified output file
if outptr != nil {
fmt.Fprintf(outptr, "%s%s%s\n", source, name, ips)
}
}
}
// If the user interrupts the program, print the summary information
func intelSignalHandler(ic *intel.Collection) {
quit := make(chan os.Signal, 1)
signal.Notify(quit, os.Interrupt, syscall.SIGTERM)
<-quit
ic.Done()
}
// Obtain parameters from provided input files
func processIntelInputFiles(args *intelArgs) error {
if args.Filepaths.ExcludedSrcs != "" {
list, err := config.GetListFromFile(args.Filepaths.ExcludedSrcs)
if err != nil {
return fmt.Errorf("Failed to parse the exclude file: %v", err)
}
args.Excluded.InsertMany(list...)
}
if args.Filepaths.IncludedSrcs != "" {
list, err := config.GetListFromFile(args.Filepaths.IncludedSrcs)
if err != nil {
return fmt.Errorf("Failed to parse the include file: %v", err)
}
args.Included.InsertMany(list...)
}
if len(args.Filepaths.Domains) > 0 {
for _, f := range args.Filepaths.Domains {
list, err := config.GetListFromFile(f)
if err != nil {
return fmt.Errorf("Failed to parse the domain names file: %v", err)
}
args.Domains.InsertMany(list...)
}
}
if len(args.Filepaths.Resolvers) > 0 {
for _, f := range args.Filepaths.Resolvers {
list, err := config.GetListFromFile(f)
if err != nil {
return fmt.Errorf("Failed to parse the resolver file: %v", err)
}
args.Resolvers.InsertMany(list...)
}
}
return nil
}
// Setup the amass intelligence collection settings
func (i intelArgs) OverrideConfig(conf *config.Config) error {
if i.Options.Active {
conf.Active = true
}
if len(i.Addresses) > 0 {
conf.Addresses = i.Addresses
}
if len(i.ASNs) > 0 {
conf.ASNs = i.ASNs
}
if len(i.CIDRs) > 0 {
conf.CIDRs = i.CIDRs
}
if len(i.Ports) > 0 {
conf.Ports = i.Ports
}
if i.Filepaths.Directory != "" {
conf.Dir = i.Filepaths.Directory
}
if i.Timeout > 0 {
conf.Timeout = i.Timeout
}
if i.Options.Verbose {
conf.Verbose = true
}
if i.Resolvers.Len() > 0 {
conf.SetResolvers(i.Resolvers.Slice()...)
}
if i.MaxDNSQueries > 0 {
conf.MaxDNSQueries = i.MaxDNSQueries
}
if !i.Options.MonitorResolverRate {
conf.MonitorResolverRate = false
}
if len(i.Included) > 0 {
conf.SourceFilter.Include = true
conf.SourceFilter.Sources = i.Included.Slice()
} else if len(i.Excluded) > 0 {
conf.SourceFilter.Include = false
conf.SourceFilter.Sources = i.Excluded.Slice()
}
// Attempt to add the provided domains to the configuration
conf.AddDomains(i.Domains.Slice()...)
return nil
}
|
{
"pile_set_name": "Github"
}
|
Introduction {#s01}
============
Pancreatic ductal adenocarcinoma (PDA) has one of the worst outcomes among all cancers, with a median survival of ∼6 mo and a 5-yr survival rate of \<8% ([@bib43]). Patients are often diagnosed late during disease progression, when curative surgical approaches are not feasible. Indeed, the current systemic therapies for patients with advanced PDA provide only temporary benefits, highlighting the need for new therapeutic strategies.
PDA is characterized by abundant desmoplasia that constitutes up to 90% of the total tumor volume and contains extracellular matrix (ECM), immune cells, vasculature, and cancer-associated fibroblasts (CAFs; [@bib31]). CAFs secrete ECM and soluble factors that stimulate cancer progression, and are believed to be derived from mesenchymal cells of different origins that are resident or recruited to the pancreas by neoplastic cells ([@bib33]; [@bib30]; [@bib24]). A major source of CAFs in PDA is pancreatic stellate cells (PSCs), which are resident mesenchymal cells of the pancreas that store lipid droplets and express fibroblast-activation protein α (FAP; [@bib6]; [@bib13]; [@bib4]; [@bib31]). Upon activation, PSCs express the myofibroblast protein α-smooth muscle actin (αSMA, gene name *Acta2*) and secrete factors that stimulate tumor growth, cell survival, and metastasis ([@bib6]; [@bib21]; [@bib53]; [@bib55]). PSCs are also reported to produce the majority of ECM in PDA ([@bib3]), which acts as a physical barrier that impairs drug delivery ([@bib34]; [@bib22]; [@bib36]), and may also biochemically contribute to drug resistance ([@bib17]; [@bib46]).
Attempts to target the stroma, either by directly targeting CAFs ([@bib34]; [@bib16]; [@bib41]), or by enzymatically digesting the ECM ([@bib22]; [@bib36]), have resulted in reduced tumor growth and improved response to chemotherapy in mouse models and patients ([@bib19]). These preclinical and clinical findings have nominated the PDA stroma, particularly CAFs, as attractive targets for drug development. However, several recent reports have questioned the role of CAFs in PDA maintenance ([@bib7]). Genetic disruption or prolonged pharmacological inhibition of sonic hedgehog, a ligand that stimulates CAFs ([@bib50]; [@bib26]; [@bib40]), or depletion of αSMA-expressing cells ([@bib35]), resulted in undifferentiated PDA tumors and decreased survival in mice. Furthermore, clinical trials of Smoothened inhibitors, which targeted the G protein--coupled receptor downstream of hedgehog signaling, have failed to demonstrate benefits for PDA patients ([@bib25]), with one randomized trial reporting adverse effects ([@bib58]). Although these findings demonstrate the need to use caution when targeting CAFs, they also highlight the need to systematically determine the composition and function of the PDA stroma to improve the development of effective stroma-targeting drugs. Indeed, based on the expression patterns of various fibroblast markers in vivo, evidence is emerging on the existence of different subtypes of CAFs ([@bib47]; [@bib33]; [@bib24]). However, no precise characterization of CAF subtypes has been performed. Here, we investigate CAF heterogeneity in a novel three-dimensional co-culture system that recapitulates the in vivo symbiotic interactions of CAFs and cancer cells. Our study reveals two spatially separated, mutually exclusive, dynamic, and phenotypically distinct CAF subtypes, underscoring the stromal heterogeneity in PDA and providing an opportunity to develop agents that target specific CAF populations.
Results and discussion {#s02}
======================
Heterogeneous distribution of myofibroblastic CAFs in PDA {#s03}
---------------------------------------------------------
To investigate the inherent heterogeneity of fibroblasts in pancreatic cancer, we evaluated the spatial distribution of αSMA, a hallmark of myofibroblasts ([@bib11]), in human pancreatic tumors. Immunofluorescence analysis of FAP, a PSC marker, and αSMA expression in human PDA tissues revealed that the majority of fibroblasts expressed FAP and low levels of αSMA, whereas a subpopulation of FAP^+^ cells showed substantially elevated expression levels of αSMA ([Fig. 1 A](#fig1){ref-type="fig"}). These FAP^+^ αSMA^high^ cells could also be delineated by RNA in situ hybridization (ISH), and were located in direct proximity to neoplastic cells, forming a periglandular ring surrounding cancer cell clusters ([Fig. 1 B](#fig1){ref-type="fig"}). A gradient of αSMA expression was similarly observed in tumors from KPC (*Kras^LSL-G12D/+^; Trp53^LSL-R172H/+^; Pdx-1-Cre*) mice ([Fig. 1, C and D](#fig1){ref-type="fig"}), a mouse model that recapitulates the human disease ([@bib18]). As a result of the selective high expression of αSMA, we refer to these periglandular FAP^+^ αSMA^high^ fibroblasts as myofibroblastic CAFs (myCAFs).
{#fig1}
To exclude the possibility that myCAFs are neoplastic cells that have undergone epithelial-to-mesenchymal transition (EMT), we analyzed tissues of a KPCY mouse model, in which all neoplastic pancreatic cells express yellow fluorescent protein (YFP; [@bib39]). Periglandular cells expressing high αSMA levels did not coexpress YFP, confirming that myCAFs are of a nonneoplastic origin ([Fig. 1 E](#fig1){ref-type="fig"}). These findings identify myCAFs as a distinct subpopulation of CAFs with a unique spatial distribution pattern in PDA.
A novel three-dimensional co-culture platform recapitulates in vivo CAF heterogeneity {#s04}
-------------------------------------------------------------------------------------
To further characterize CAFs in PDA, we studied PSCs, which are believed to be a major source of FAP^+^ CAFs in PDA stroma ([@bib3]; [@bib13]). Quiescent and lipid-storing PSCs were isolated from WT C57BL/6J mice pancreata (Fig. S1, A and B), and cultured as primary cells or after immortalization with the SV40 large T Antigen. When PSCs are grown in monolayers, they lose their lipid droplets and assume a myofibroblastic phenotype indicated by αSMA expression, but can be reversed back to a quiescence and lipid-storing phenotype if embedded in Matrigel ([@bib23]). To verify that the characteristic phenotypes of PSCs remained after isolation and immortalization, we cultured PSCs in Matrigel and used Oil Red-O staining to confirm that they reacquired lipid droplets (Fig. S1 C). Additionally, we found that the PSCs, when cultured as a monolayer, showed an adequate response to the vitamin D analogue Calcipotriol ([@bib41]; Fig. S1 D). Moreover, addition of recombinant TGFβ to quiescent PSCs cultured in Matrigel induced the expression of TGFβ target genes, such as *Ctgf* and *Col1a1* (Fig. S1 E), demonstrating that the isolated PSCs still respond to common stromal cues.
To investigate the interactions between cancer cells and PSCs, we established a three-dimensional organotypic co-culture system that combined GFP-labeled tumor-derived murine pancreatic organoids ([@bib20]; [@bib8]) and mCherry-labeled murine PSCs ([Fig. 2 A](#fig2){ref-type="fig"}). Pancreatic organoids are routinely cultured in a defined, mitogen-rich media. However, many factors that are present in this organoid media, including Noggin, B27 supplement, and TGBβ inhibitor, are known to be potent inhibitors of fibroblast proliferation. To avoid inhibition of PSC proliferation in co-cultures, we used a reduced media without these components, based on DMEM supplemented with 5% FBS. Although cancer-naive PSCs embedded alone in Matrigel remained quiescent, PSCs in co-culture with tumor organoids acquired a CAF phenotype, demonstrated by morphological activation with cellular extensions in close contact with tumor organoids ([Fig. 2 B](#fig2){ref-type="fig"}). Importantly, freshly isolated and nonimmortalized PSCs seeded directly in Matrigel showed similar morphological changes when co-cultured with organoids ([Fig. 2 C](#fig2){ref-type="fig"}), demonstrating that the activated phenotype in co-culture is an inherent feature of PSCs. Electron microscopy of co-cultures revealed the close relationship between cancer cells and PSCs, with only a thin gap filled with matrix separating the two cell types ([Fig. 2 D](#fig2){ref-type="fig"}). Activated PSCs deposited ECM ([Fig. 2 E](#fig2){ref-type="fig"}) containing collagen I ([Fig. 2 F](#fig2){ref-type="fig"}) that was organized into collagen fibrils ([Fig. 2 G](#fig2){ref-type="fig"}). Thus, our co-culture system is the first to recapitulate the desmoplastic reaction of PDA in vitro, with PSCs converting from a resting quiescent state to activated, stroma-producing CAFs.
{#fig2}
PSCs were nonproliferative until organoids were included in co-culture ([Fig. 2 H](#fig2){ref-type="fig"}), and the co-cultures also promoted the proliferation of organoids ([Fig. 2 I](#fig2){ref-type="fig"}). Moreover, whereas organoid monocultures could be passaged indefinitely in complete media ([@bib8]), reduced media conditions precluded prolonged passaging of organoids unless PSCs were present in co-culture ([Fig. 2 J](#fig2){ref-type="fig"}). The mutual proliferative benefits for both epithelial cells and PSCs are consistent with prior reports of similar symbiotic interactions that promote PDA ([@bib6]; [@bib21]; [@bib53]; [@bib44]).
Analysis by ISH identified a clear distribution of αSMA^high^ PSCs surrounding the organoids in co-culture ([Fig. 2 K](#fig2){ref-type="fig"}), recapitulating the in vivo finding of a subpopulation of fibroblasts expressing high levels of αSMA (myCAFs) in close proximity to neoplastic cells ([Fig. 1, A--D](#fig1){ref-type="fig"}). This result also supports the premise that PSCs are a source of myofibroblastic CAFs in addition to BM-derived mesenchymal stem cells (BM-MSCs), which have previously been reported to give rise to myofibroblasts in cancer ([@bib38]). Moreover, this novel co-culture platform confirms the existence of cooperative interactions between cancer cells and PSCs, and provides a way for their systematic characterization.
A population of CAFs secretes inflammatory cytokines and loses myofibroblastic features {#s05}
---------------------------------------------------------------------------------------
To identify soluble factors that may mediate the symbiosis observed in co-culture, we analyzed the secretome of PSC and organoid co-cultures. We found that several secreted proteins, including inflammatory cytokines and chemokines, matrix remodeling proteins, and growth factors, were elevated specifically in co-culture ([Fig. 3 A](#fig3){ref-type="fig"}). One of the induced cytokines was interleukin 6 (IL-6), which has been reported to be up-regulated in PDA ([@bib49]) and to promote cancer progression ([@bib27]; [@bib57]; [@bib32]), cachexia, and immune suppression ([@bib15]).
{#fig3}
The increased cytokine production observed when tumor organoids and PSCs are co-cultured could be the result of a direct physical contact between these populations or alternatively, it could be caused by paracrine signaling between them. To disentangle these two possibilities and to determine which cell type was responsible for the increased cytokine production, we made use of a Transwell system, which allows paracrine interactions between tumor organoids and PSCs, but prevents direct contact between the two cell types ([Fig. 3 B](#fig3){ref-type="fig"}). IL-6 acts by binding to the IL-6 receptor subunit α (IL6RA), which in turn facilitates the dimerization and signaling of the GP130 signaling complex ([@bib48]). Because GP130 is known to interact with other ligand-receptor pairs, we measured the expression of additional GP130 signaling partners in both organoids and PSCs in trans-well cultures. Of the GP130 ligands found to be expressed in PSCs, *Il6*, *Il11*, and *leukemia inhibitory factor* (*Lif*) were the most highly up-regulated in trans-well cultures when compared with PSC monocultures ([Fig. 3 C](#fig3){ref-type="fig"}). Both IL-11 and LIF are reported to have roles in cancer progression ([@bib37]; [@bib29]), and LIF expression has been shown to be elevated in human PDA ([@bib10]). In trans-well cultures, organoids did not express detectable levels of *Il6* but expressed *Il6ra*, *Il11ra1*, *Lifr*, and *Gp130* ([Fig. 3 D](#fig3){ref-type="fig"}), indicating that activated PSCs are the sole source of IL-6 in co-culture and that tumor organoids express the receptors needed to respond to PSC-secreted ligands. These results also confirm that direct contact with neoplastic cells is not required for PSCs to initiate cytokine secretion. Enzyme-linked immunosorbent assay (ELISA) was performed to confirm and quantify the elevated secretion of IL-6, IL-11, and LIF in co-culture ([Fig. 3 E](#fig3){ref-type="fig"}).
To evaluate these findings in human PDA fibroblasts, we isolated CAFs from primary (hT1) and metastatic (hM1) tumors of two PDA patients ([@bib8]; Fig. S1, F--J). We then performed secretome analysis of conditioned media from co-cultures of human PDA CAFs with patient-matched tumor organoids. Secretion of IL-6 was induced in both primary tumor and metastatic co-cultures, whereas secretion of IL-11 and LIF was only induced in the co-culture derived from the primary tumor (hT1; [Fig. 3 F](#fig3){ref-type="fig"}).
Once dimerized with IL6RA, GP130 is phosphorylated and forms a complex with tyrosine kinases such as Janus kinases (JAKs). JAKs in turn phosphorylate and activate signal transducer and activator of transcription (STAT) factors, most notably STAT3, which plays key roles in cell growth and proliferation ([@bib48]). Immunofluorescence staining revealed detectable activation of STAT3 in KPC tumors, both in cancer cells and the surrounding stroma ([Fig. 3 G](#fig3){ref-type="fig"}). To confirm that tumor organoids activate STAT3 in response to paracrine stimuli, we measured STAT3 phosphorylation in organoids after the addition of recombinant IL-6, IL-11, and LIF to the media. All three ligands robustly activated STAT3 in organoids, and this effect was prevented when neutralizing antibodies against each ligand were added ([Fig. 3 H](#fig3){ref-type="fig"}). Interestingly, IL-6 was able to strongly activate STAT3 in tumor organoids, in contrast to studies using acinar cells isolated from *Kras^G12D^* mice that concluded that IL-6 trans-signaling is necessary to mediate robust STAT3 activation in pancreatic tumor cells ([@bib27]). STAT3 was also activated by the addition of co-culture conditioned media to tumor organoids in monoculture, and this activation was again blocked by addition of neutralizing antibodies, with the anti--IL-6 neutralizing antibody having the most prominent effect ([Fig. 3 I](#fig3){ref-type="fig"}).
As STAT3 activation is known to control cell survival and proliferation, we investigated its role in co-culture by using CRISPR/Cas9 gene editing to knockout IL-6 in two PSC lines. We confirmed loss of IL-6 secretion in PSCs by ELISA of conditioned media from trans-well cultures (Fig. S1 K). Interestingly, whereas organoids co-cultured with WT PSCs showed, as expected, prolonged passaging ability in reduced media conditions compared with monocultured organoids, continued passaging of organoids was impaired in co-cultures with IL-6--deficient PSCs ([Fig. 3 J](#fig3){ref-type="fig"}). These results demonstrate that tumor organoids in co-culture activate PSCs to secrete multiple factors, which in turn activate signaling pathways in organoids that sustain survival.
To further investigate the secretory phenotype of organoid-activated PSCs, we exposed quiescent PSCs to organoid-conditioned media (Fig. S2 A). In these conditions, PSCs acquired a CAF phenotype, indicated by morphological activation (Fig. S2 B), proliferation (Fig. S2 C), and up-regulation of *Il6*, *Il11*, and *Lif* mRNA levels ([Fig. 3 K](#fig3){ref-type="fig"}). Unexpectedly, we detected a simultaneous reduction in *Acta2* transcript and αSMA protein levels ([Fig. 3, K and L](#fig3){ref-type="fig"}). Although αSMA expression dropped in PSCs activated by tumor organoid-conditioned media, additional fibroblast surface markers, such as FAP and platelet-derived growth factor receptors (PDGFRs; [@bib56]) remained unchanged (Fig. S2, D and E), suggesting a specific loss of myofibroblastic features in cytokine-secreting PSCs. This result was reproduced in three mouse primary PSC lines ([Fig. 3 M](#fig3){ref-type="fig"}). Conditioned media from KPC cancer cells cultured in monolayer also induced this αSMA^low^ IL-6^high^ phenotype in PSCs, whereas conditioned media of NIH-3T3 fibroblasts did not (Fig. S2 F), suggesting that the ability to induce this secretory phenotype in PSCs is absent in cells of mesenchymal origin.
To extend our finding to mouse and human CAFs that already have been reprogrammed in vivo and not necessarily derived from PSCs, we isolated CAF lines from KPC mouse tumors, and validated their mesenchymal origin (Fig. S2, G--I). Mouse CAFs cultured with tumor organoid-conditioned media also increased *Il6* and concomitantly lost *Acta2* expression ([Fig. 3 N](#fig3){ref-type="fig"}). Although to a lesser extent, this pattern was also present in primary CAFs isolated from human primary and metastatic PDA samples when cultured with conditioned media from patient-matched tumor organoids ([Fig. 3 O](#fig3){ref-type="fig"}).
Previous studies have shown that pancreatic cancer cells induce IL-6 secretion in fibroblasts and PSCs ([@bib12]; [@bib14]; [@bib57]; [@bib54]), and that PSCs are a major source of IL-6 in PDA ([@bib14]; [@bib28]). Our data confirm this trait in cancer-naive PSCs that are allowed to interact with cancer cells, as well as in mouse and human PDA-derived CAFs. Importantly, for the first time we couple this phenotype with loss of myofibroblastic features. Such heterogeneity has previously been unappreciated, likely due to the fact that monolayers of fibroblasts uniformly express high levels of αSMA in culture.
Notably, the marked drop in bulk αSMA expression induced by organoid-conditioned media ([Fig. 3 K](#fig3){ref-type="fig"}) contrasted with the presence of CAFs expressing high levels of αSMA in proximity to neoplastic cells observed in co-cultures ([Fig. 2 K](#fig2){ref-type="fig"}) and in vivo ([Fig. 1, A--D](#fig1){ref-type="fig"}). We therefore hypothesized the coexistence of two distinct subtypes of CAFs in co-culture and PDA tissue, one being αSMA^high^ IL-6^low^ and proximal to the neoplastic cells (myCAFs), and the other being αSMA^low^ IL-6^high^ induced by paracrine signaling from the tumor compartment and more distantly distributed throughout the tumor. We termed these αSMA^low^ IL-6^high^ CAFs inflammatory CAFs (iCAFs) for their cytokine-secreting properties.
CAFs coexist as two mutually exclusive and reversible subtypes {#s06}
--------------------------------------------------------------
To determine whether distinct CAF subtypes coexist in co-culture, flow cytometry was used to detect αSMA and IL-6 expression in PSCs co-cultured with tumor organoids (Fig. S2 J). As our hypothesis predicted, co-culture triggered high αSMA expression only in a subset of PSCs (myCAFs), whereas a separate population showed low αSMA expression and concomitantly elevated IL-6 expression (iCAFs; [Fig. 4 A](#fig4){ref-type="fig"}). Moreover, we found that trans-well cultures of PSCs and organoids ([Fig. 3 B](#fig3){ref-type="fig"}) markedly induced iCAF formation, but did not cause an increase in myCAFs ([Fig. 4 B](#fig4){ref-type="fig"}). This demonstrates that the formation of myCAFs is contact-dependent, whereas iCAFs may be enriched in the absence of contact with PDA cells. The presence of iCAFs in co-culture was evident by ISH of *Il6* ([Fig. 4 C](#fig4){ref-type="fig"}), which also confirmed that these CAFs were spatially separated from organoids.
{#fig4}
To evaluate whether CAFs produce interleukins in vivo, we dissociated KPC mouse tumors into single cells, isolated CAFs by flow cytometry, and characterized their gene expression. We sorted CAFs based on PDGFRα expression because it has been shown to be a specific surface marker for CAFs ([@bib12]). As a comparison, epithelial and immune cells were isolated, using the EpCAM and CD45 surface markers, respectively (Fig. S2 K). No overlap was detected between the CD45^+^ population and the PDGFRα^+^ population (Fig. S2 L), demonstrating the mutual exclusivity of these two markers. We further confirmed the purity of the three sorted cell populations by qPCR for additional fibroblast, epithelial and immune markers, and demonstrated that PDGFRα**^+^** CAFs contain the majority of IL-6 transcripts in PDA ([Fig. 4 D](#fig4){ref-type="fig"}). Additionally, we found that IL-11 mRNA is also predominantly present in CAFs, further supporting the presence of an inflammatory CAF phenotype ([Fig. 4 D](#fig4){ref-type="fig"}).
To investigate the spatial distribution of IL-6^high^ CAFs in vivo, immunohistochemical analysis of KPC tumor tissue was performed. Consistent with the co-cultures, we detected IL-6 expression in cells that were located further away from neoplastic cells in the desmoplastic stroma ([Fig. 4 E](#fig4){ref-type="fig"}). We confirmed that these were iCAFs by co-staining for PDGFRβ, another fibroblast marker ([@bib56]; [Fig. 4 E](#fig4){ref-type="fig"}). Importantly, a fraction of these iCAFs proliferate in vivo, as indicated by Ki67 coexpression ([Fig. 4 F](#fig4){ref-type="fig"}), demonstrating the lack of a senescence-associated secretory phenotype ([@bib9]). Furthermore, we could identify IL-6--expressing CAFs in human PDA by co-staining human tumor tissues for IL-6 and PDGFRβ, confirming that iCAFs are also an inherent trait of human PDA ([Fig. 4 G](#fig4){ref-type="fig"}). To confirm the spatial distribution of myCAFs and iCAFs in KPC tumors, we used ISH and immunofluorescence staining, and demonstrated that periglandular αSMA^high^ cells were spatially separated from the more distant IL-6^high^ cells ([Fig. 4, H and I](#fig4){ref-type="fig"}), further supporting our observation of two distinct CAF populations in vivo.
To determine if the iCAF phenotype was permanent or transient, we plated myofibroblastic PSCs from monolayers into Matrigel to obtain quiescent PSCs, and then induced the iCAF phenotype by culturing these cells in trans-well with PDA organoids. As PSCs grown in monolayers are known to obtain myofibroblastic features, we subsequently plated the iCAFs in monolayer, and found that iCAFs rapidly reverted to a myofibroblastic state, down-regulating *Il6*, *Il11*, and *Lif*, and simultaneously up-regulating *Acta2* expression levels ([Fig. 4 J](#fig4){ref-type="fig"}). This observation suggests that CAFs are dynamic and can assume different phenotypes based on their spatial and biochemical niche within the PDA microenvironment.
Overall, our results, both in vivo and in co-culture, show a spatial separation between iCAFs and myCAFs. MyCAFs are located in the periglandular region, suggesting that direct juxtacrine interactions with cancer cells are required for myCAF formation. iCAFs, on the other hand, are induced by secreted factors from cancer cells and are located more distantly from neoplastic cells and myCAFs in PDA. Although we have demonstrated the existence and spatial separation of these two CAF populations, other CAF populations with unique genetic signatures may exist. The existence of these diverse populations and their functions in tumors remain to be elucidated.
Inflammatory CAFs and myofibroblasts show distinct transcriptional profiles {#s07}
---------------------------------------------------------------------------
To better understand the differences between these subtypes, we compared the transcriptomes of quiescent PSCs (PSCs embedded alone in Matrigel), iCAFs (SMA^low^ IL-6^high^ PSCs cultured in trans-well with tumor organoids), and myofibroblastic PSCs (SMA^high^ IL-6^low^ PSCs grown in monolayer) as a proxy for myCAFs, because obtaining myCAFs from tumors or co-cultures presents a technical challenge (Fig. S2 M). By RNA sequencing, we found clusters of genes uniquely up-regulated in either myofibroblasts or iCAFs ([Fig. 5, A and B](#fig5){ref-type="fig"}; Fig. S2 N; and Table S1). In particular, *Acta2* and TGFβ response genes, such as *Ctgf* and *Col1a1*, were up-regulated in myofibroblasts compared with quiescent PSCs and iCAFs. On the other hand, cytokines, such as *Il6*, *Il11*, and *Lif*, and chemokines, such as *Cxcl1* and *Cxcl2*, were uniquely up-regulated in iCAFs ([Fig. 5, A and B](#fig5){ref-type="fig"}; and Table S1). Furthermore, Gene Set Enrichment Analysis (GSEA) of iCAFs compared with quiescent PSCs confirmed the up-regulation of cytokine signaling pathways, and identified JAK/STAT signaling as one of the most significantly up-regulated pathways in iCAFs ([Fig. 5 C](#fig5){ref-type="fig"}). Additionally, as expected, basement membranes and smooth muscle contraction pathways were the most significantly down-regulated ones in iCAFs ([Fig. 5 C](#fig5){ref-type="fig"}). The identification of unique transcriptional signatures of myofibroblasts and iCAFs further supports the model that CAFs within the PDA microenvironment acquire distinct phenotypes. In particular, the transcriptomic profiling implies that myofibroblasts are contractile and stroma remodeling, whereas iCAFs are characterized by a secretory phenotype, with the ability to modulate in a paracrine manner cancer cells and other cell types present in the tumor. Importantly, secreted factors from iCAFs, such as IL-6, likely contribute to systemic effects in PDA patients, such as cachexia and immune suppression ([@bib14]; [@bib15]; [@bib28]).
{#fig5}
In summary, we have identified two spatially separated, reversible, and mutually exclusive subtypes of CAFs ([Fig. 5 D](#fig5){ref-type="fig"}). iCAFs, which are activated by paracrine factors secreted from cancer cells, are located more distantly from neoplastic cells within the dense tumor stroma. Although iCAFs still retain expression of αSMA, they are characterized by significantly lower αSMA levels compared with myCAFs, and instead intensely elevate expression of cytokines and chemokines with known roles in cancer progression and disease pathophysiology. Indeed, iCAFs are a significant source of IL-6 and IL-11 in the PDA microenvironment ([Fig. 4 D](#fig4){ref-type="fig"}), with the ability to stimulate the STAT3 pathway in cancer cells ([Fig. 3 I](#fig3){ref-type="fig"}). However, myCAFs are defined by high αSMA expression and periglandular location ([Fig. 1, A--D](#fig1){ref-type="fig"}), and their formation appears dependent on juxtacrine interactions with cancer cells ([Fig. 4 B](#fig4){ref-type="fig"}). Furthermore, myCAFs lack the expression of inflammatory cytokines, distinguishing them from iCAFs. Importantly, both inflammatory and myofibroblastic CAFs can be generated from PSCs, and can dynamically reverse from one cell state to the other ([Fig. 4 J](#fig4){ref-type="fig"}). The detailed mechanisms that govern the formation and transition of these cell states will require further investigation.
Although we have identified two subtypes of PSC-derived CAFs in PDA, it is likely that additional CAF subtypes with distinct roles in the pathophysiology of this disease exist. Indeed, our data already reveal a large population of CAFs with low expression of both αSMA and IL-6 ([Fig. 4, A and B](#fig4){ref-type="fig"}). Furthermore, a more thorough definition of stromal subtypes may involve additional factors and more complex genetic signatures. Importantly, although other groups have identified different subtypes of stroma in PDA across patients ([@bib30]), our work is the first to characterize the intratumoral CAF heterogeneity in PDA.
The concept of intratumoral CAF heterogeneity may address the conflicting reports that have emerged in the field in regard to CAF functions. Indeed, in recent years, different approaches to target the stroma have given contradicting results and, at times, promoted worse outcomes ([@bib26]; [@bib35]; [@bib40]). For instance, attempts to deplete CAFs based on their αSMA expression have led to decreased survival in tumor-bearing mice ([@bib35]). However, given our results, this approach may have preferentially eliminated myCAFs, while leaving other CAF populations intact. Therefore, the traditional view of the tumor stroma as a uniformly protumorigenic niche calls for reconsideration, as certain CAF subtypes might have protumorigenic properties, whereas others might have antitumorigenic features. Therapeutic development must consider this possibility to provide optimal benefits to PDA patients.
Materials and methods {#s08}
=====================
PSC isolation {#s09}
-------------
PSCs were isolated from WT C57BL/6J mice as previously described ([@bib2]) with minor modifications. In brief, pancreata were minced and digested for 30 min at 37°C in a dissociation buffer containing 0.05% collagenase P (Sigma-Aldrich) and 0.1% DNase I (Sigma-Aldrich) in Grey's balanced salt solution (GBSS; Sigma-Aldrich). Digested pancreata were filtered through a 100-µm nylon mesh and washed in GBSS with 0.3% BSA and 0.1% DNase I. After spinning, the cell pellet was resuspended in 9.5 ml GBSS with 0.3% BSA and 43.75% Histodenz (Sigma-Aldrich). 6 ml of GBSS with 0.3% BSA was layered on top of the cell suspension, and the gradient was centrifuged for 20 min at 1,400 RCF (with break switched off). The cells in the fuzzy band just above the interface between the Histodenz and GBSS were harvested, washed in PBS, and plated.
Mouse models {#s10}
------------
KPC mice (*Kras^LSL-G12D/+^; Trp53^LSL-R172H/+^; Pdx-1-Cre*) have previously been described ([@bib18]). Each of the three alleles in the KPC mouse strain (Kras; Trp53 and Pdx1-Cre) were backcrossed individually onto the C57BL/6J mouse strain obtained from The Jackson Laboratory (stock number 000664) for at least 20 generations. To generate the KPC mouse model, mice carrying single alleles were crossed onto each other. The Rosa26-LSL-YFP allele ([@bib45]) was backcrossed onto the C57BL/6J mouse strain obtained from The Jackson Laboratory and introduced into the KPC C57BL/6J strain for a total of at least 20 generations to generate KPC; *Rosa26^LSL-YFP/+^* (KPCY). NOD *scid* gamma (NSG) mice were purchased from The Jackson Laboratory (stock number 005557). All animal procedures and studies were conducted in accordance with the Institutional Animal Care and Use Committee (IACUC) at CSHL.
Mouse organoid isolation and culture {#s11}
------------------------------------
Mouse tumor organoids were isolated from KPC mice with histologically verified PDA. Tumor tissue was minced and digested at 37°C for 12 h in a dissociation buffer containing 0.012% (wt/vol) collagenase XI (Sigma-Aldrich) and 0.012% (wt/vol) dispase (Gibco) in DMEM (Gibco) containing 1% FBS (Gibco). The tissue debris was allowed to settle, and the dissociated cells were pelleted and washed in Advanced DMEM/F12 (Invitrogen) and seeded in growth factor-reduced Matrigel (BD). Organoids were cultured in complete organoid media ([@bib8]); Advanced DMEM/F12 supplemented with 1x GlutaMAX (Gibco), 1x Hepes (Gibco), 1x B27 (Invitrogen), 1.25 mM N-Acetylcysteine (Sigma-Aldrich), 10 nM gastrin (Sigma-Aldrich), 50 ng/ml EGF (PeproTech), 10% RSPO1-conditioned media, 100 ng/ml Noggin (PeproTech), 100 ng/ml FGF10 (PeproTech), and 10 mM Nicotinamide (Sigma-Aldrich).
To passage, organoids were washed out from the Matrigel using cold Advanced DMEM/F12 supplemented with 1x GlutaMAX (Gibco) and 1x Hepes (Gibco), and mechanically dissociated into small fragments using fire-polished glass pipettes, and then seeded into fresh Matrigel. Passaging was performed at a 1:8 split ratio roughly twice per week. To create frozen stocks, organoids were passaged and mixed with Recovery Cell Culture Freezing Medium (Gibco) and cryopreserved using standard procedures. Cultures were thawed using standard thawing procedures, washed once with Advanced DMEM/F12 supplemented with 1x GlutaMAX (Gibco) and 1x HEPES (Gibco), and seeded in Matrigel with organoid media supplemented with 10.5 µM Y-27632 (Sigma-Aldrich) for the first passage.
Mouse CAF isolation {#s12}
-------------------
Mouse CAFs were isolated from KPC mice with histologically verified PDA. CAFs were isolated from tumors using a combination of outgrowth and clonal isolation. The edge of the tumor mass was minced and dissociated in DMEM containing 1% FBS, 0.125 mg/ml collagenase (Sigma-Aldrich), and 0.125 mg/ml dispase (Life Technologies) for 1.5 h at 37°C in a thermomixer. The sample was trypsinized for 10 min then quenched in 10% FBS/DMEM. The pellet containing tumor pieces was plated on a 6-cm dish, and fibroblasts were allowed to grow out and attach to the plastic. To avoid cancer cell contamination, after the cell culture was established and passaged at least 10 times, cells were plated in high dilution in a 96-well plate to obtain one cell per well, and single clones were expanded. Validation of fibroblast identity was performed at the protein level by flow cytometry analysis for fibroblast surface markers, and at the genomic level by PCR to verify presence of WT and mutant *Kras* alleles. The primers used are: 5\': GGGTAGGTGTTGGGATAGCTG, and 3\': TCCGAATTCAGTGACTACAGATGTACAGAG, giving a 285-bp band for WT and 325-bp band for mutant Kras.
Human organoid and CAF isolation {#s13}
--------------------------------
All human organoid experiments were approved by the IRBs of MSKCC, MDACC, and CSHL, and all subjects taking part in the study provided written informed consent. Tumor tissue was minced and digested in a rotating shaker with collagenase II (5 mg/ml; Gibco) for 12 h at 37°C in human complete media, i.e., complete media ([@bib8]), supplemented with 50% Wnt3a-conditioned media and 1 µM Prostaglandin E2 (Tocris; [@bib8]). The tissue was further digested for 15 min at 37°C in TrypLE (Gibco) in a rotating shaker. The digested tissue was washed repeatedly after digestion. 10% of the tissue suspension, including larger undigested pieces, was plated in 10% FBS/RPMI on 10-cm dishes to allow fibroblast outgrowth. The remaining tissue suspension was seeded in Matrigel and cultured in human complete medium for establishment of organoids. Fibroblast outgrowth was observed in the 10-cm dishes within 48 h. Fibroblast identity was confirmed at the DNA level by Sanger sequencing to verify the WT status of *KRAS* at codon 12 (forward primer; 5′-CTGGTGGAGTATTTGATAGTG-3′, reverse primer; 5′-CTGTATCAAAGAATGGTCCTG-3′). To confirm that the established CAF lines had not become transformed in the isolation process, CAFs (2.0--2.5 × 10^5^ cells) were resuspended in 100 µl Matrigel and injected subcutaneously in flanks of 6--8-wk-old NOD SCID gamma mice (The Jackson Laboratory).
Mouse KPC tumor cell isolation for monolayer cultures {#s14}
-----------------------------------------------------
The primary tumor cells used in monolayer experiments were isolated from KPC tumors by an outgrowth method. In brief, 30--50 mg pieces of tumors were minced in DMEM. The minced tissue was then transferred into 5 ml of DMEM with 2 mg/ml Collagenase V (Sigma-Aldrich) and incubated for 45 min at 37°C in a thermomixer, with vortexing every 5--10 min. After digestion, 10 ml of 10% FBS/DMEM was added, and samples were pelleted, resuspended in 10% FBS/DMEM, and plated on a 10 cm dish. Cultures were passaged at a high split ratio (1:80) for several passages to favor for the growth of neoplastic cells.
Cell culture conditions for monolayer cultures {#s15}
----------------------------------------------
KPC mouse CAFs, mouse PSCs, and KPC primary tumor cells were cultured in DMEM containing 5% FBS, 1% [l]{.smallcaps}-glutamine, and 1% Penicillin/Streptomycin. NIH-3T3 fibroblasts were cultured in DMEM containing 10% FBS, 1% [l]{.smallcaps}-glutamine, and 1% Penicillin/Streptomycin. Human CAFs were cultured in RPMI 1640 (Gibco) containing 10% FBS, 1% [l]{.smallcaps}-glutamine, and 1% Penicillin/Streptomycin. All cells were cultured at 37°C with 5% CO~2~.
Transfection of fluorophores and immortalization {#s16}
------------------------------------------------
To immortalize primary PSCs and human CAFs, the SV40 large T-antigen was cloned from pBABE-puro SV40 LT (Addgene) into pLVX-IRES-tdTomato (Takara Bio Inc.) using the BamHI site. 293T cells were transfected with the pLVX-SV40 LT-IRES-tdTomato plasmid together with psPAX2 and pMD2.G packaging plasmids using X-treme GENE 9 DNA Transfection Reagent (Roche). Media was changed 24 h later, and lentivirus supernatant was collected after an additional 24 h. The supernatant was filtered through a 0.45-µm filter and aliquots were kept at --80°C. Primary PSCs and human CAFs were grown to 70% confluency, and infected with the virus supernatant for 24 h. Virus was aspirated and fresh media was added. After passaging, tdTomato was visualized by fluorescent microscopy to verify infection efficiency.
To obtain GFP-labeled organoids, PGK-Neo-IRES-EGFP retrovirus was produced in ecotropic Phoenix cells, concentrated with RetroX concentrator (Takara Bio Inc.), and resuspended in Advanced DMEM/F12 supplemented with 10 µM Y-27632 (Sigma-Aldrich). 5 × 10^4^ cells were resuspended in concentrated retrovirus and spinoculated at 600 RCF for 1 h at room temperature, washed, and then seeded into Matrigel. To obtain mCherry-labeled PSCs or PGK-Neo-IRES-mCherry, retrovirus was produced in ecotropic Phoenix cells and incubated with PSCs grown in monolayer for 24 h. 2 d after infection, cells were treated with 1 mg/ml G418 (Gibco) for selection.
IL-6 CRISPR/Cas9-mediated knockout {#s17}
----------------------------------
To knock out IL-6, lenti-Cas9-Blast plasmids (Addgene Plasmid \#52962) were transfected into 293T cells to produce lentivirus. The virus was concentrated using Lenti-X Concentrator (Takara Bio Inc.), and resuspended in DMEM with 5% FBS. Immortalized PSCs were infected with the resuspended virus and selected using 2 µg/ml blasticidin (Thermo Fisher Scientific) to create PSC lines stably expressing Cas9. Short guide RNAs (sgRNAs) against IL-6 (5′-CACCTATACCACTTCACAAGTCGG-3′ and 5′-CACCTAAGCCTCCGACTTGTGAAG-3′) were designed using the CRISPR GRNA Design Tool (Atum) and cloned into the LRG plasmid (Lenti-sgRNA-EFS-GFP; Addgene; [@bib42]). Next, LRG lentivirus was produced in 293T cells, concentrated using Lenti-X Concentrator (Takara Bio Inc.), and resuspended in DMEM with 5% FBS. Cas9-expressing PSCs were infected with resuspended LRG virus and efficient cleavage by the sgRNAs was confirmed using the SURVEYOR assay (Transgenomic), following the manufacturer\'s protocol using a PCR primer set specific to the sgRNA targeted region of IL-6 (forward primer; 5′-CCTCTGGCGGAGCTATTGAG-3′, reverse primer; 5′-CCAGACAGGAAAGGAACCCC-3′). PSCs were then plated as single clones in 96-well plates, and the clones were allowed to expand. Clones that were found to be GFP positive were then analyzed for loss of IL-6. Deletion of IL-6 was confirmed by Sanger sequencing, and by IL-6 ELISA (R&D Systems) of conditioned media from PSCs grown in trans-well cultures with mouse tumor organoids. IL-6--negative clones were combined into IL-6 KO lines, and clones positive for IL-6 secretion were combined into control lines. In total, two IL-6 KO lines and two control lines were made from two parental PSC lines.
Co-culture and passaging of tumor organoids and CAFs {#s18}
----------------------------------------------------
For co-cultures, mouse or human organoids were split at a 1:6 ratio and mixed with 1x10^4^ PSCs or CAFs, seeded in Matrigel, and cultured in DMEM containing 5% FBS and 1% Penicillin/Streptomycin. For passaging experiments, established co-cultures and monocultures were split every 7 d at a 1:4 ratio and fresh medium was added. For trans-well cultures, 2 × 10^4^ PSCs or human CAFs were seeded in Matrigel on top of the trans-well membrane (1 µm pore size, Greiner Bio-One) with organoids growing in the lower compartment in 24-well plates.
Conditioned media experiments {#s19}
-----------------------------
For conditioned media experiments, organoids or monolayer cells were cultured for 3--4 d in DMEM containing 5% FBS, 1% [l]{.smallcaps}-glutamine, and 1% Penicillin/Streptomycin. Media was collected, spun down to remove debris, and added to PSCs plated in Matrigel.
Flow cytometry and cell sorting {#s20}
-------------------------------
For flow cytometric analysis of mouse CAF and PSC lines, cells were grown in DMEM containing 5% FBS, trypsinized, and subjected to surface staining with anti-FAP (R&D Systems; 1:40 for PSCs; Abcam; 1:50 for mouse CAFs) or anti--mouse CD326 (EpCAM) APC (eBioscience clone G8.8; 1:160). Subsequent antibodies used for FAP staining are anti--goat/sheep IgG--biotin (Sigma-Aldrich; 1:50) and streptavidin APC-Cy7 (BD; 1:200), Goat anti--rabbit Alexa Fluor 488 and goat anti--rabbit Alexa Fluor 568 (Thermo Fisher Scientific; 1:500). Human CAFs were grown in RPMI containing 10% FBS, and stained and analyzed similarly, using the FAP antibody obtained from R&D Systems.
For intracellular flow cytometric staining, 5 × 10^5^ cells were treated with GolgiPlug (BD) for 6 h before fixation and permeabilization with Cytofix/Cytoperm kit (BD) according to the manufacturer's instructions. Cells were stained with the appropriate antibodies in FACS buffer (PBS containing 0.2% BSA, 2 mM EDTA, and 0.02% sodium azide) at 4°C for 30 min in the dark. The following conjugated antibodies were used: APC-Cy7-anti-αSMA (1A4; Abcore) and PE-anti--IL-6 (MP5-20F3; BioLegend). Fixable viability dye eFluor450 (eBioscience) was used to differentiate between dead and live cells. The stained populations were analyzed using an LSR-II flow cytometer (BD) and FlowJo software (Tree Star; Version 10). At least 20,000 events were recorded per condition.
For sorting of CAFs from KPC tumors, tumors (\>8 × 8 mm in diam) were minced and digested in DMEM containing 10% FBS, 2.5 mg/ml Collagenase D (Roche), 0.5 mg/ml Liberase (Roche), and 0.2 mg/ml DNase I (Sigma-Aldrich), for 45 min at 37°C in a rotating shaker. Tumor pieces were then strained through a 40-µm cell strainer, and red blood cells were lysed using ACK lysis buffer for 4 min on ice. After neutralization with flow buffer (5% FBS/PBS), cells were blocked with rat anti--mouse CD16/CD32 (Fc Block; BD; 1:100 for 20 min), and then subjected to staining with anti--mouse CD45-BV510 (BioLegend; clone 30-F11; 1:100), anti--mouse CD326 (Ep-CAM)-Alexa Fluor 488 (BioLegend; clone G8.8; 1:100), anti-mouse CD31-PE/Vio770 (Miltenyi Biotec; clone 390; 1:10), and anti--mouse CD140a (PDGFRα)-APC (BioLegend; clone APA5; 1:100) for 30 min on ice. Cells were sorted on the FACSAria cell sorter (BD) for CD45^+^, EpCAM^+^, and PDGFRα^+^ populations.
qPCR {#s21}
----
1 µg RNA was used to reverse transcribe cDNA using the TaqMan reverse transcription reagents (Thermo Fisher Scientific). qPCR was performed using gene-specific TaqMan probes (Applied Biosystems) and master mix (Thermo Fisher Scientific), following the manufacturer's instructions. Gene expression was normalized to Hprt. The following TaqMan Probes were used (Mm, mouse probes; Hs, Human probes): Acta2, Mm01546133_m1 and Hs00426835_g1; Cd11b, Mm00434455_m1; Clcf1, Mm01236492_m1; Cntf, Mm04213924_s1; Cntfr, Mm00516693_m1; Col1a1, Mm00801666_g1; Crlf1, Mm00517026_m1; Ctf1, Mm00432772_m1; Ctgf, Mm01192932_g1; Fap, Mm01329177_m1; Gp130, Mm00439665_m1; Has2, Mm00515089_m1; Hprt, Mm00446968_m1, Hs02800695_m1; Il11, Mm00434162_m1; Il11ra1, Mm01218402_m1; Il6, Mm00446190_m1, Hs00985639_m1; Il6ra, Mm00439653_m1; Il27, Mm00461162_m1; Il27ra, Mm00497259_m1; Krt19, Mm00492980_m1; Lif, Mm00434761_m1; Lifr, Mm00442942_m1; Mmp2, Mm00439498_m1; Osm, Mm01193966_m1; Osmr, Mm01307326_m1; Pdgfra, Mm00440701_m1; Pdgfrb, Mm00435546_m1; Vdr, Mm00437297_m1.
Oil Red-O staining {#s22}
------------------
Immortalized PSCs were cultured on plastic or embedded in Matrigel for 4 d and fixed in 10% formalin for 10 min at room temperature, followed by 5-min incubation in 60% isopropanol. After drying, the cells were incubated with filtered Oil Red-O working solution for 10 min. The working solution was prepared by dissolving 0.35 g Oil Red-O (Sigma-Aldrich) in 100 ml isopropanol, which was then diluted in water at a 3:2 ratio. After staining, the cells were washed four times with water and imaged.
TGFβ stimulation {#s23}
----------------
Cells were treated with 20 ng/ml of recombinant human TGFβ1 (Sigma-Aldrich) for 4--5 d before RNA isolation and qPCR analysis.
Immunofluorescence staining of monocultures and co-cultures {#s24}
-----------------------------------------------------------
Cultures were fixed with 2% PFA for 20 min at room temperature, and washed three times for 10 min in 1x PBS/Glycine solution (10× stock: 38.0 g NaCl, 9.38 g Na~2~HPO~4~, 2.07 g NaH~2~PO~4~, and 37.5 g glycine, in 500 ml PBS). Three washes in 1× wash solution were performed (10× stock: 38.0 g NaCl, 9.38 g Na~2~HPO~4~, 2.07 g NaH~2~PO~4~, 2.5 g NaN~3~, 5.0 g BSA, 10 ml Triton X-100, and 2.5 ml Tween-20, in 500 ml PBS), followed by 1 h of blocking in 1× wash solution with 10% horse serum. The cultures were then incubated over night at 4°C with rabbit anti-collagen I antibody (ab34710, Abcam) diluted 1:200 in 1x blocking solution. After three washes, the cells were incubated for 1 h with Alexa-568 Goat anti-Rabbit IgG antibody (Invitrogen) diluted 1:1000 in 1× blocking solution. Counterstain, DAPI (Sigma-Aldrich). After three washes, the slides were mounted and imaged.
ISH {#s25}
---
RNA ISH was performed on freshly prepared formalin-fixed paraffin-embedded (FFPE) tissue sections (6 µm thickness) using the ViewRNA ISH Tissue 2-Plex Assay (Affymetrix), according to the manufacturer\'s instructions using 10-min pretreatment and protease treatment incubation times. ISH probes used were as follows: mouse αSMA, VB1-16010-01; human αSMA, VA1-10300; mouse FAP, VB1-16010-01; mouse IL-6, VB1-10012; mouse Krt18, VB6-11059; human Krt18, VA6-11561.
Immunohistochemical/immunofluorescent staining of tissues {#s26}
---------------------------------------------------------
All stainings were performed on 5-µm sections of mouse and human tissues. Hematoxylin and Eosin (H&E) staining was performed according to standard protocols. For immunohistochemistry (IHC), sections were deparaffinized, and antigen retrieval was performed in a pressure cooker in 10 mM sodium citrate buffer, pH 6.0. 3% H~2~O~2~ was used to block endogenous peroxidases. Primary antibodies used for IHC were as follows: IL-6 (1:50 for mouse; Cell Signaling Technology; 1:100 for human; Abcam), GFP (to detect YFP; 1:1,000; Abcam), Ki67 (1:250; Thermo Fisher Scientific), PDGFRβ (1:400 for mouse and 1:200 for human; Abcam), and αSMA (1:200; Abcam). Hematoxylin was used as nuclear counterstain. For double and triple IHC on mouse tissue, a sequential IHC protocol was applied (Vector Laboratories) and the substrates used were as follows: ImmPACT DAB peroxidase (brown), ImmPACT VIP peroxidase (purple), and ImmPACT SG peroxidase (gray). The same protocol was used for double IHC staining of IL-6 and PDGFRβ on human tissue, using an automated Ventana Benchmark staining machine (Ventana Medical Systems).
For IF of pSTAT3 in KPC tumors, frozen sections were first fixed in 3% formaldehyde for 15 min at room temperature, and then fixed in methanol for 10 min at --20°C. Slides were immediately washed in PBST (1% Tween-20, PBS) after fixation and blocked with 10% goat serum in PBST and 0.3% Triton X-100 for 30 min at room temperature. Slides were then stained with Phospho-Stat3 (1:200; Cell Signaling Technology) and Krt19 (1:200; DSHB TROMA-III) antibodies for 1 h at room temperature. Slides were washed in PBST, and then stained with anti--rabbit Alexa Fluor 488 (1:500; Thermo Fisher Scientific), and anti--rat Alexa Fluor 568 (1:500; Thermo Fisher Scientific) secondary antibodies for 45 min at room temperature. After washing in PBST, sections were stained with DAPI for 5 min at room temperature and coverslipped with Histomount Mounting Solution (Thermo Fisher Scientific).
For IF of αSMA and IL-6, FFPE slides were used, and deparaffinization and antigen retrieval were performed according to the IHC protocol. Slides were incubated with primary antibodies for αSMA (1:100; Dako) and IL-6 (1:50; Cell Signaling Technology) overnight at 4°C. Slides were washed with TBS (Tris-buffered saline) and stained with anti--mouse Alexa Fluor 488 and anti--rabbit Alexa Fluor 568 (1:1,000; Invitrogen) secondary antibodies for 1 h at room temperature. DAPI was used as counterstain.
For IF on human tissue, frozen tissue sections were fixed in acetone for 10 min. Slides were blocked for 1 h in 3% BSA/PBS at room temperature, and incubated overnight at 4°C with primary antibodies for FAP (1:50; R&D Systems) and αSMA (1:200; Sigma-Aldrich). After washes, the slides were incubated for 1 h at room temperature with anti--mouse Alexa Fluor 488 (1:500; Invitrogen) and anti--sheep Alexa Fluor 555 (1:500; Invitrogen) secondary antibodies, then washed and mounted with Vectashield Hardset containing DAPI (Vector Laboratories). The use of human tissues in this study was approved by The Ethics Review Board (EPN) of Northern Sweden.
Imaging {#s27}
-------
Live cell and immunofluorescence imaging of monocultures and co-cultures was done on a Perkin Elmer Ultraview Vox spinning disc confocal system (Waltham MA) using the Velocity 6.3 software. The system consisted of a Nikon Ti Eclipse inverted microscope (Morrell Instruments Melville NY), Yokogawa CSU-Xi spinning disk, Perkin Elmer laser module 2.0 (6 lines), Hamamatsu R2 CCD, motorized peizo Z stage from Applied Scientific Imaging (Eugene OR), environmental chamber from In Vivo Scientific, temperature regulation with the Smart Air-Therm heater from World Precision Instruments (Sarasota FL), atmosphere was provided using premixed hematology gas with 5% CO~2~.
Fluorescence imaging of fixed tissue was done with a Leica TCS SP8 laser scanning confocal (Boulder Grove Il), controlled by the LAS AF 3.3.10134 software. This confocal was mounted on a DMI 6000 CS inverted microscope, equipped with 4 laser lines and 2 PMTs. Bright field imaging of tissue slides were obtained with an Axio Imager.A2 (ZEISS).
Quantification of fluorescence intensity was performed with the Velocity 6.3 software.
Electron microscopy {#s28}
-------------------
Co-cultures were processed for electron microscopy as previously described ([@bib5]). In brief, co-cultures were fixed overnight with 2% glutaraldehyde and 2% PFA in PBS, rinsed in distilled water and post-fixed with 1% osmium tetroxide in 1.5% potassium ferrocyanide for 1 h. After dehydration, samples were resin infiltrated and polymerized overnight at 60°C. 100 nm thin sections were collected on 100 mesh grids with and without a supporting film. Following counterstaining with lead citrate, sections were examined in a Hitachi H-7000 transmission electron microscope operated at 75 kV. Images were recorded on Kodak 4489 film and scanned at 2400 dpi.
Western blot {#s29}
------------
PSCs or organoids were harvested in Cell Recovery Solution (Corning) and incubated rotating for 1 h at 4°C. Cells were then pelleted, and lysed in 0.1% Triton X-100, 15 mM NaCl, 0.5 mM EDTA, 5 mM Tris, pH 7.5 supplemented with protease Mini-complete protease inhibitors (Roche) and a phosphatase inhibitor cocktail (PhosSTOP; Roche). Cells were incubated on ice for 30 min before clarification. Standard procedures were used for Western blot. In brief, protein lysates were separated by SDS-PAGE, transferred to a polyvinylidene difluoride (PVDF) membrane, blocked with 5% BSA in TBST (1% Tween 20, tris-buffered saline), and incubated with primary antibodies overnight at 4°C. Proteins were detected using HRP-conjugated secondary antibodies. Primary antibodies used were: PDGFRα (Cell Signaling Technology), PDGFRβ (Cell Signaling Technology), αSMA (Dako), Hsp90α (EMD Millipore), Actin (Cell Signaling Technology), Phospho-STAT3 (Cell Signaling Technology), STAT3 (Cell Signaling Technology), Pan-Actin (Cell Signaling Technology).
Secretome analysis {#s30}
------------------
Conditioned media was collected after incubation with monocultures of PSCs, CAFs, mouse or human organoids, co-cultures, or Matrigel-only controls for 3--4 d, filtered through a 0.45-µm filter to remove cell debris, and frozen at --20°C. Frozen conditioned media was then thawed and used for cytokine dot blots (R&D Systems) according to the manufacturer\'s instructions.
ELISA {#s31}
-----
For ELISA of conditioned media of co-cultures or monocultures of PSCs, human CAFs, and mouse and human tumor organoids, cultures were grown in DMEM containing 5% FBS for 3--5 d. Media was then collected, filtered through a 0.45-µm filter to remove cell debris, aliquoted, and frozen at --20°C. Thawed media was assayed using the manufacturer\'s protocol. The following ELISA assays used were: IL-6 (R&D Systems), IL-11 (R&D Systems), and LIF (R&D Systems).
Dot blot and Western blot quantification {#s32}
----------------------------------------
Dot blots and Western blot films were scanned at 600 dpi and then quantified in ImageJ (National Institutes of Health). Scanned blots were background subtracted using a rolling ball radius of 50 pixels, and then inverted before being quantified using the integrated pixel density function. For Western blots, a rectangular region was used to quantify each band. Quantification is presented as pixel intensity of pSTAT3 normalized to total STAT3, loading control, and the control condition. For dot blots, a circular region was used to quantify each pair of dots, which was then averaged.
Proliferation assays {#s33}
--------------------
GFP-expressing organoids and mCherry-expressing PSCs were dissociated into single cells and counted. Both cell types were mixed in a 1:1 ratio in 50% Matrigel and 50% media (DMEM with 5% FBS). 70 µl of a cell suspension containing 7,000 cells of each cell type was plated per well on black 96-well plates with clear bottoms (Corning) on ice. After 30-min incubation in a cell incubator, 200 µl prewarmed media containing 10.5 µM RhoK-inhibitor (Sigma-Aldrich) was added on top of the cells. Fluorescence intensity was measured for both GFP and mCherry once a day for up to 7 consecutive days, on a SpectaMax I3 (Molecular Devices) by scanning each well at 52 points and averaging the intensity.
When proliferation of nonfluorescent PSCs was measured, 5,000 cells were seeded in 96-well plates in 50% Matrigel/PBS and cultured in 150 µl control media or conditioned media. Cell proliferation was followed for 5 d with CellTiter-Glo (Promega), with measurements every 24 h.
RNA seq {#s34}
-------
Samples were collected in 1 ml of TRIzol Reagent (Thermo Fisher Scientific) and stored at −80°C. RNA was extracted using the PureLink RNA mini kit (Thermo Fisher Scientific). RNA quality was assessed on a bioanalyzer using the Agilent RNA 600 Nano kit. We used poly-A pull-down to enrich for mRNAs from total RNA samples (0.2--1 µg per sample, RIN \> 8) and proceeded to library preparation using Illumina TruSeq RNA prep kit. Libraries were then sequenced using Illumina HiSeq2000 at the Columbia Genome Center. We multiplexed samples in each lane, which yielded targeted number of single-end 100-bp reads for each sample, as a fraction of 180 million reads for the whole lane. We used RTA (Illumina) for base calling and bcl2fastq (version 1.8.4) for converting BCL to fastq format, coupled with adaptor trimming. We mapped the reads to a reference genome (Human, NCBI/build37.2; Mouse, UCSC/mm9) using Tophat ([@bib51]; version 2.0.4) with 4 mismatches (--read-mismatches = 4) and 10 maximum multiple hits (--max-multihits = 10). To tackle the mapping issue of reads that are from exon--exon junctions, Tophat infers novel exon--exon junctions ab initio, and combined them with junctions from known mRNA sequences (refgenes) as the reference annotation. We estimated the relative abundance (i.e., expression level) of genes and splice isoforms using cufflinks ([@bib52]; version 2.0.2) with default settings. All RNA-seq data are available at Gene Expression Omnibus (GEO) under the accession no. [GSE93313](GSE93313).
Differential expression analysis and GSEA {#s35}
-----------------------------------------
Genes expressed in fewer than two libraries were filtered out before differential expression testing. The principle component analysis was calculated using the prcomp function available in R and plotted using a customized R script. Expression normalization and differential expression testing were performed using DESeq ([@bib1]), with dispersion estimation parameters set as: 'method = "per-condition", sharingMode = "maximum", fitType = "parametric."' Genes with adjusted P \< 0.01 were selected as significantly differentially expressed between conditions. All plots were produced using customized R scripts.
GSEA on the RNA-seq data were performed by entering fold change data from the differential expression analysis into the GSEA software (Broad Institute) using the Gene sets database c2.cp.v5.1.symbols.
Statistics {#s36}
----------
For graphical representation of data and statistical analysis, GraphPad Prism was used. Statistical analysis was performed using Student's *t* test. If multiple *t* tests of the same dataset were performed, correction for multiple comparisons was made using the Sidak-Bonferroni method. Data are presented as mean of biological replicates ± SD unless otherwise indicated.
Online supplemental material {#s37}
----------------------------
Fig. S1 shows the isolation process and validation data for the PSCs and human CAFs used in this study. Fig. S2 shows supplementary data from investigating fibroblast heterogeneity in the co-culture model system and the isolation process and validation data for the mouse KPC CAFs used in this study. Table S1, provided as an Excel file, contains the RNA expression analysis (DeSEQ) and pathway analysis (GSEA) comparing quiescent PSCs, iCAFs, and myofibroblasts.
The authors would like to thank the Cold Spring Harbor Cancer Center Support Grant (CCSG) shared resources: Bioinformatics Shared Resource, Flow Cytometry Facility, the St. Giles Foundation Microscopy Center, Animal & tissue imaging, and the Animal Facility. The CCSG is funded by the National Cancer Institute. We also thank Anette Berglund for technical assistance, and Maya Ridinger, Marina Pasca di Magliano, Yaqing Zhang, Greg Beatty, Anil Rustgi, and Valerie Weaver for constructive advice and discussion.
This work was supported by the Lustgarten Foundation, where D.A. Tuveson is a distinguished scholar and Director of the Lustgarten Foundation--designated Laboratory of Pancreatic Cancer Research. D.A. Tuveson is also supported by the Cold Spring Harbor Laboratory Association, the National Institutes of Health (NIH; 5P30CA45508-26, 5P50CA101955-07, 1U10CA180944-02, 5U01CA168409-5, 1R01CA188134, and 1R01CA190092-03). In addition, we are grateful for support from the following: Stand Up to Cancer/KWF (D.A. Tuveson), the STARR Foundation (I7-A718 for D.A. Tuveson), DOD (W81XWH-13-PRCRP-IA for D.A. Tuveson), the Precision Medicine Research Associates (PMRA; H. Tiriac and D.A. Tuveson), the Swedish Research Council (537-2013-7277 for D. Öhlund), the Kempe Foundations (JCK-1301 for D. Öhlund) and the Swedish Society of Medicine (SLS-326921, SLS-250831, SLS-175991, and SLS-591551 for D. Öhlund), federal funds through the county council of Västerbotten (ALFVLL269081, VLL242121, VLL322391, VLL400421, VLL493371, and VLL582681 for D. Öhlund), the Cancer Research Foundation in Northern Sweden (AMP15-793 and LP11-1927 for D. Öhlund), the Human Frontiers Science Program (LT000403/2014 for E. Elyada; LT000195/2015-L for G. Biffi; LT000190/2013 for I.I.C. Chio), The Weizmann Institute of Science Women in Science award (for E. Elyada), EMBO (ALTF 1203-2014 for G. Biffi), the Italian Ministry of Health (FIRB - RBAP10AHJ for V. Corbo), Associazione Italiana Ricerca Cancro (AIRC n. 18718 for V. Corbo), NIH (R50CA311506-01 for Y. Park), NIH awards (CA101955 UAB/UMN SPORE, 5T32CA148056, and F32CA192904 for L.A. Baker), the Damon Runyon Cancer Research Foundation (Shirley Stein fellow, DRG-2165-13, for I.I.C. Chio), the National Cancer Institute (NCI 1K99CA204725-01A1 for D.D. Engle), and Nancy Gay fellowship (for A.S. Almeida).
The authors declare no competing financial interests.
Abbreviations used:αSMAα-smooth muscle actinBM-MSCBM-derived mesenchymal stem cellCAFcancer-associated fibroblastECMextracellular matrixELISAenzyme-linked immunosorbent assayEMTepithelial-to-mesenchymal transitionFAPfibroblast-activation proteinGSEAGene Set Enrichment AnalysisiCAFinflammatory CAFIFimmunofluorescenceIHCimmunohistochemistryISHin situ hybridizationmyCAFmyofibroblastic CAFPDApancreatic ductal adenocarcinomaPSCpancreatic stellate cell
[^1]: D. Öhlund, A. Handly-Santana, G. Biffi, and E. Elyada contributed equally to this paper.
|
{
"pile_set_name": "PubMed Central"
}
|
Master's Degree Programs
Advance your career with a master’s degree from Wilkes. We offer a variety of affordable
master’s degrees for working professionals, providing an education you can put to
work immediately. Programs are conveniently offered on campus, online or at a site
near you.
Terminal Degree Programs
Take your education to the highest level - earn a terminal degree in a specialized
field. Many of our terminal degree are offered in convenient low-residency or hybrid
formats for the convenience of busy adults.
Admissions
Graduate admission requirements vary based upon program of study. For all programs,
an applicant must have received a baccalaureate degree from a regionally accredited
institution and must have satisfactorily completed a minimum of coursework in designated
areas, specific prerequisite courses dependent upon the field of advanced study. Please
see desired graduate or doctoral program page for specific admission requirements.
Information Session
Attend an information session to learn more about pursuing a graduate degree from
Wilkes. Meet program faculty and admissions staff to learn more about our academic
programs, financial aid and the admissions process.
|
{
"pile_set_name": "Pile-CC"
}
|
Chronic nicotine in utero selectively suppresses hypoxic sensitivity in neonatal rat adrenal chromaffin cells.
Nicotine in cigarette smoke has been linked to several deleterious side effects on the offspring of smoking mothers, including impaired development of the sympathoadrenal system, abnormal arousal reflexes, and sudden infant death syndrome. Catecholamine (CA) release from adrenomedullary chromaffin cells (AMCs) in response to asphyxial stressors, e.g., low O(2) (hypoxia) and elevated CO(2) (hypercapnia), is critical for adaptation to extrauterine life and occurs before splanchnic innervation. Here, we investigated the effects of prenatal nicotine bitartrate exposure on the ability of neonatal (P0) rat AMCs to respond appropriately to asphyxial stressors. Control AMCs isolated from pups born to saline-treated dams displayed typical responses to hypoxia and hypercapnia, including inhibition of outward K(+) current, membrane depolarization, increased cytosolic calcium, and CA secretion. In contrast, P0 AMCs from pups born to nicotine-treated dams showed a marked suppression or loss of hypoxic sensitivity, although hypercapnic sensitivity and the expression of CO(2) markers (i.e., carbonic anhydrase I and II) appeared normal. Moreover, isolated saline-treated P0 AMCs lost their hypoxic sensitivity when grown in culture for approximately 1 wk in the presence of a subsaturating concentration of nicotine base (50 microM), and this effect was abolished by the nicotinic acetylcholine receptor (nAChR) blocker mecamylamine (100 microM). Taken together, these data suggest that the adverse effects of maternal smoking on sympathoadrenal function in the offspring are due in part to a loss or suppression of acute hypoxic sensitivity in adrenal chromaffin cells, triggered by the direct action of nicotine on endogenous nicotinic acetylcholine receptors.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Find girl for sex tonight in your city
Teen girls are totally watch online
Hey Lulu. I said as I walked towards her. But best of all, it was lovely waking up with her in my arms every morning. He struggled not to sound so out of breath. In the end, the poachers built a simple travois frame to put her on so that they could drag her along. It was a job well done. I squint at you and huff. I would stand in there, smell of them, and then jerk off into them so as not to make a mess on the floor. The last few nights she had cummed so fast after beginning that she did it a few times more.
Bromas telefonicas a prostitutas prostitutas rotondas
Meanwhile both Su and Tierah were breathing hard from the impending climax about to rock their bodies as Tierah let a guttural shriek,his seed spewing into the hot snatch that lay splayed on the bed. I don't know what we are. This really did happen in Baton Rouge in the 1985. As she faced away from him she stopped and bent at the waist to check something on the shoes. Robin giggled and said, Neither could we.
We finally fell asleep in a sixty-nine. Whose call were you expecting. She mockingly asked. You say you will obey yet just by speaking and not choosing you were disobedient. Thrusting his cock deep inside me, he stopped for a moment to unbutton my blouse and then he reached up to pull my bra straps exposing my huge tits to him.
Italian milf gang bang
This is all about showing off and strutting your stuff. She pressed her face against mine, and I felt her hot breath in my ear as she whispered. Ready to suck your own ass, whore. Gabrielle shivered, and Zack could feel her nervousness picking up. Samantha's overpowering ministrations forced me over the edge very soon.
Angel wrapped her arms around her father and hugged him, giving him a kiss on the cheek. More or less, hes not as big as some. Your pierced bejeweled belly-button. Jack began fingering her with two fingers licking the sweet tasting juices that flowed. Whoever it was that dared attack Selene, he would make them suffer the tortures of Hell a thousand times over.
Kb sleeping teen get fucked
Out. the nurse yelled back. It was a short black leather whip, only one strand, but looked very hard. Chrissy pouted as B joined us in the room. Just looking at Tiffany made me very happy. See if this fish from her first ever cast will win the catch of the day.
It felt like I just entered a furnace, she was so hot.
24 minutes big black cocks
Well if you want to come you know what you have to say, I prompted. Now he increased his thrusting, grunting more and more, oh yeah Katie take my cock. You slutty secretary, Im gonna fuck you every chance I get. The instant burning sensation of being slapped cause Justins mouth to fly open. Why else would I be out of school.
Gigi s pussy pink pussy shots
Sure he said he felt more for her but that didnt mean declarations of love were part of that more. Anne almost embraced it though, thought it as being neat or cool.
Charles shook the mans hand as he stuck it out towards him. I continued with the fingering of her ass. I set the crop aside and used the Hitachi on her pussy and clit making her orgasm three times. They ended up with her dragging him down to the floor, spreading her legs, and him taking her in the usual man-on-top position.
They were soon naked as the day they were born, There is nothing finer than a bed full of women sucking pussy Ben says. Even if I got between her legs I'd be liable to freeze off my. The three of them were drop dead gorgeous in there own way.
SO BEAUTIFUL TO MAKE RAW LOVE ! I ADORE DO IT ON PUBLIC PLACES TO BE SEEN IN ACTIONS ! I'm very hot bitch bi-sexual exhibitionist and that excite me to know others persons over the world can see me, masturbate and ejaculate a lot of sperm as me by seeing my hot videos. Know me better, on net: hairless-penis-cock hom-total-epilation hairlesspenisbal on tube8, villacon31, xhamster. You can see hundreds very hot videos(+130 and over 3000 photos in 13 galleries. Eveest the sensual bitch bi
pillepale6 months ago
I used to do this with my girlfriend. Mom was in the room as well.
loverine6 months ago
from greenland
love2f_heels6 months ago
Pechos de esta embarazada mmm exquisito cuerpo mmmmm
hornysailor8836 months ago
I'm willing to show mine in DM
macydog6 months ago
precum or pee?
bustygirl376 months ago
I hope she invited him to fuck her tight little ass-cunt after he'd rested a bit from her sucking mouth! She's a cutie!
|
{
"pile_set_name": "Pile-CC"
}
|
[Numerical study on inspiratory flows in two and three generation bronchi of human lung airways].
The main physiological function of respiratory system is exchange of oxygen and carbon dioxide between atmosphere and blood. Its physiological process is closely related with air flow and transport in respiratory airway. This paper studies numerically the inspiratory flows in a two generation and a three generation bronchial airway. The numerical results of the two generation bronchi show that the present computations fit the available experiments very well. For three generation bronchi, no separation appears within the whole airway under normal breathing rate, which is contrary to the occurrence of separation at even low Reynolds number by the previous two dimensional models. Strong secondary flow phenomenon, skew and m-shaped main flow velocity profiles are found in the airways due to geometrical curvature and bifurcation. These increase shear stress acting on the inner wall as well as on the anterior and posterior wall in the bifurcating airways. In the end bronchi of the three generation airway, the mass flow rates in medial and lateral bronchi are unequal, and the mass flow ratio between the medial and the lateral bronchi is 1.2 at the flow conditions considered.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
perform calculation on all combinations of columns of a matrix
I am trying to apply a function to a very large matrix I want to eventually create a (40,000 by 40,000) matrix (where only one side of the diagonal is completed) or create a list of the results.
The matrix looks like:
obs 1 obs 2 obs 3 obs 4 obs 5 obs 6 obs 7 obs 8 obs 9
words 1 0.2875775 0.5999890 0.2875775 0.5999890 0.2875775 0.5999890 0.2875775 0.5999890 0.2875775
words 2 0.7883051 0.3328235 0.7883051 0.3328235 0.7883051 0.3328235 0.7883051 0.3328235 0.7883051
words 3 0.4089769 0.4886130 0.4089769 0.4886130 0.4089769 0.4886130 0.4089769 0.4886130 0.4089769
words 4 0.8830174 0.9544738 0.8830174 0.9544738 0.8830174 0.9544738 0.8830174 0.9544738 0.8830174
words 5 0.9404673 0.4829024 0.9404673 0.4829024 0.9404673 0.4829024 0.9404673 0.4829024 0.9404673
words 6 0.0455565 0.8903502 0.0455565 0.8903502 0.0455565 0.8903502 0.0455565 0.8903502 0.0455565
I use the function using cosine(mat[, 3], mat[, 4]) which gives me a single number.
[,1]
[1,] 0.7546113
I can do this for all of the columns but I want to be able to know which columns they came from, i.e. the calculation above came from columns 3 and 4 which is "obs 3" and "obs 4".
Expected output might be the results in a list or a matrix like:
[,1] [,1] [,1]
[1,] 1 . .
[1,] 0.75 1 .
[1,] 0.23 0.87 1
(Where the numbers here are made up)
So the dimensions will be the size of the ncol(mat) by ncol(mat) (if I go the matrix method).
Data/Code:
#generate some data
mat <- matrix(data = runif(200), nrow = 100, ncol = 20, dimnames = list(paste("words", 1:100),
paste("obs", 1:20)))
mat
#calculate the following function
library(lsa)
cosine(mat[, 3], mat[, 4])
cosine(mat[, 4], mat[, 5])
cosine(mat[, 5], mat[, 6])
Additional
I thought about doing the following:
- Creating an empty matrix and calculating the function in a forloop but its not working as expected and creating a 40,000 by 40,000 matrix of 0's brings up memory issues.
co <- matrix(0L, nrow = ncol(mat), ncol = ncol(mat), dimnames = list(colnames(mat), colnames(mat)))
co
for (i in 2:ncol(mat)) {
for (j in 1:(i - 1)) {
co[i, j] = cosine(mat[, i], mat[, j])
}
}
co
I also tried putting the results into a list:
List <- list()
for(i in 1:ncol(mat))
{
temp <- List[[i]] <- mat
}
res <- List[1][[1]]
res
Which is also wrong.
So I am trying to create a function which will column by column calculate the function and store the results.
A:
1) Using mat shown in the question, the first line creates a 20x20 matrix with all 20*20 cosines filled in. The second line zeros out the values on and above the diagonal. Use lower.tri instead if you prefer that the values on and below the diagonal be zero'd out.
comat <- cosine(mat)
comat[upper.tri(comat, diag = TRUE)] <- 0
2) Alternately to create a named numeric vector of the results:
covec <- c(combn(as.data.frame(mat), 2, function(x) c(cosine(x[, 1], x[, 2]))))
names(covec) <- combn(colnames(mat), 2, paste, collapse = "-")
3) We can use the fact that the off-diagonal cosines are the same as correlations up to a factor, mult.
mult <- c(cosine(mat[, 1], mat[, 2]) / cor(mat[, 1], mat[, 2]))
co3 <- mult * cor(mat)
co3[upper.tri(co3, diag = TRUE)] <- 0
3a) This opens up using any of several correlation functions available in R. For example, using mult just calculated:
library(HiClimR)
co4 <- mult * fastCor(mat)
co4[upper.tri(co4, diag = TRUE)] <- 0
3b)
library(propagate)
co5 <- mult * bigcor(mat)
co5[upper.tri(co5, diag = TRUE)] <- 0
3c)
co6 <- crossprod(scale(mat)) / (nrow(mat) - 1)
co6[upper.tri(co6, diag = TRUE)] <- 0
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Nigrification of references for double-blind refereeing
I really love biblatex, the only disadvantage is that it is not so simple any more to mess with the bibitems manually any more.
Here is a problem that caused me grief: I was asked to blacken out (nigrify) the identifying parts of self-references in a paper to maintain double-blind refereeing. When I used regular bib, I just define
\def\blackbox#1{\setbox0=\hbox{#1}\rule{\wd0}{\ht0}}
and put around the text
after every \newblock. Not very elegant, but doable. (note that there are better ways of nigrification, see
Efficient ways to anonymize a document but that is not the point)
In biblatex, I can do the same, but things are much more tedious since the data is organized in a much more granular way.... very very tedious (I just did it for two papers and it took me more than an hour).
Ideally, I would like to just specify the authors whose citations I would like to nigrify and then in these bib entries the author names, the title, URL, and page ranges are nigrified e.g. by \blackbox. But I would also be willing to do some editing e.g. by replacing \entry and \endentry by \blackentry and \endblackentry. This \blackentry could call things like
\renewbibmacro*{url}{\blackbox....}
locally for nigrification. In principle biblatex should be uniquely suited for this; I just do not understand the code deeply enough to do it myself.
A:
The apa6 class works with biblatex and defines \maskcite macros that remove the citation from the text and reference list:
\documentclass[biblatex,mask]{apa6}
\addbibresource{xampl.bib}
\begin{document}
You can cite with \verb-\cite- and get: \cite{book-full}\par
You can maskcite with \verb-\maskcite- and get: \maskcite{article-full}
\end{document}
If you are willing to replace \cite with \maskcite, then the way apa6 works is pretty universal. Essentially the class checks for the mask flag. If it is not there it does \let\maskcite\cite otherwise it defines \maskcite to print some text (handling pre- and post-notes nicely). You could easily make it print a black box. It would take some work to make the black box be exactly the size of the reference with the identical line breaks.
A:
I think you can do this by redefining two macros that appear in biblatex.def and are used for name formatting. (I haven't checked this with all styles, of course, and some might use different macros, in which case there would need to be different redefinition.)
This tests for a coincidence of initials and lastname (or lastname but no initials). If your lastname is not common it could possibly be simplified.
\documentclass{article}
\usepackage[backend=biber,style=numeric]{biblatex}
\usepackage{filecontents}
\begin{filecontents}{my.bib}
@book{me01,
author = {Me Myself},
title = {This Should Be Blackened},
publisher = {August House},
date = {2012},
}
@article{me02,
author = {Me Myself},
title = {This Should be Blackened Too},
journaltitle = {Worty Journal},
volume = {100},
pages = {103--145},
date = {2011},
}
@article{notme01,
author = {Brother of Myself},
title = {This Should be Patent},
journaltitle = {Marginal Quarterly},
volume = {10},
pages = {23--24},
date = {2010},
}
\end{filecontents}
\renewcommand\mkbibnamelast[1]{%
\ifauthorisme
{\setbox0=\hbox{#1}\rule{\wd0}{\ht0}}
{#1}}
\renewcommand\mkbibnamefirst[1]{%
\ifauthorisme
{\setbox0=\hbox{#1}\rule{\wd0}{\ht0}}
{#1}}
\newtoggle{iamauthor}
\def\ifauthorisme#1#2{%
\togglefalse{iamauthor}%
\printnames[setiamauthor]{author}%
\iftoggle{iamauthor}{#1}{#2}}
\DeclareNameFormat{setiamauthor}{%
\ifboolexpr{ test {\ifstrequal{#1}{Myself}}
and ( test {\ifstrequal{#4}{M\bibinitperiod}}
or test {\ifblank{#4}} )}
{\global\toggletrue{iamauthor}}
{}}
\addbibresource{my.bib}
\begin{document}
Test \cite{me01} and \cite{notme01} and \cite{me02}
\printbibliography
\end{document}
A:
The tricky part here is ensuring that raw bibliographic data are always passed to \blackbox/\anonymize. You can do this by aliasing the innermost format applied to the fields you want to censor.
\documentclass{article}
\usepackage[T1]{fontenc}
\usepackage[american]{babel}
\usepackage{csquotes}
\usepackage{biblatex}
\makeatletter
\def\anonymize#1{\setbox0=\hbox{#1}\rule{\wd0}{\ht0}}
\makeatother
% Define anonymized formats
\DeclareFieldFormat{anonfield}{\anonymize{#1}}
\DeclareNameFormat{anonnames}{\anonymize{#3#5#1}}
\DeclareFieldFormat{anontitle}{\anonymize{#1}}
\DeclareFieldFormat
[article,inbook,incollection,inproceedings,patent,thesis,unpublished]
{anontitle}{\mkbibquote{\anonymize{#1}\isdot}}
\DeclareFieldFormat[suppbook,suppcollection,suppperiodical]
{anontitle}{\anonymize{#1}}
\DeclareFieldFormat{anontitlecase}{%
\ifboolexpr{ test {\ifcurrentfield{title}}
or test {\ifcurrentfield{subtitle}} }
{\anonymize{#1}}
{#1}}
% Define category of entries to anonymize
\DeclareBibliographyCategory{byname}
% Specify entries in category via comma-separated list of author names
\newcommand*{\anonlist}{}
\DeclareIndexNameFormat{byname}{%
\xifinlist{\detokenize{#4#5#1}}{\anonlist}
{\addtocategory{byname}{\thefield{entrykey}}}
{}}
\newrobustcmd*{\anonlistadd}[1]{\listxadd{\anonlist}{\detokenize{#1}}}
% Hook in anonymized formats
\newrobustcmd*{\anonalias}{%
\ifcategory{byname}
{\DeclareNameAlias{author}{anonnames}%
\DeclareNameAlias{labelname}{anonnames}%
\DeclareFieldAlias{pages}{anonfield}%
\DeclareFieldAlias{url}{anonfield}%
\DeclareFieldAlias{doi}{anonfield}%
\DeclareFieldAlias{citetitle}{anontitle}%
\DeclareFieldAlias[article]{citetitle}[article]{anontitle}%
\DeclareFieldAlias{titlecase}{anontitlecase}}
{}}
\newtoggle{anonymize}
\AtDataInput{\iftoggle{anonymize}{\indexnames[byname][1-99]{author}}{}}
\AtEveryBibitem{\iftoggle{anonymize}{\anonalias}{}}
\AtEveryCitekey{\iftoggle{anonymize}{\anonalias}{}}
% Example
\toggletrue{anonymize}
\forcsvlist{\anonlistadd}
{Aristotle, L.V{\'a}zques{ de }Parga, A.vanGennep, N.Markey, M.~A.Kastenholz}
\forcsvlist{\anonlistadd}
{L\bibinitperiod V{\'a}zques{\bibnamedelimb de\bibnamedelimb }Parga,
A\bibinitperiodvanGennep, N\bibinitperiod Markey,
M\bibinitperiod \bibinitdelim A\bibinitperiod Kastenholz}
\addbibresource{biblatex-examples.bib}
\begin{document}
Filler text \parencite{companion,aristotle:anima,markey,vazques-de-parga}.
\Textcite{companion,aristotle:anima,kastenholz} showed that...
The results from \citetitle{companion,aristotle:anima,vangennep} showed that...
\printbibliography
\end{document}
Commenting out \toggletrue{anonymize} gives:
A few notes:
The censored text won't break across lines. To resolve this, use gablin's \anonymize command. Even with this improvement, the anonymized formats only give an approximation to the original document layout; some bibliographic data (particularly names) are heavily formatted.
Some of these entries need additional fields censored to make their authors non-identifiable; they were simply chosen to give some variety in the name list.
The name list under biber needs to make use of delimiter commands (\bibinitperiod and friends). If you find this tedious, you could categorize entries with biber's sourcemap option. It supports regular expressions.
|
{
"pile_set_name": "StackExchange"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.